U.S. patent application number 16/896682 was filed with the patent office on 2020-12-31 for identification of resistance genes from wild relatives of banana and their uses in controlling panama disease.
The applicant listed for this patent is EG Crop Science, Inc.. Invention is credited to Walter MESSIER.
Application Number | 20200407743 16/896682 |
Document ID | / |
Family ID | 1000005117996 |
Filed Date | 2020-12-31 |
United States Patent
Application |
20200407743 |
Kind Code |
A1 |
MESSIER; Walter |
December 31, 2020 |
IDENTIFICATION OF RESISTANCE GENES FROM WILD RELATIVES OF BANANA
AND THEIR USES IN CONTROLLING PANAMA DISEASE
Abstract
The present disclosure provides compositions and methods for
providing broad-based resistance to fungal pathogens, such as a
Fusarium fungi, and plants derived therefrom.
Inventors: |
MESSIER; Walter; (Longmont,
CO) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
EG Crop Science, Inc. |
Longmont |
CO |
US |
|
|
Family ID: |
1000005117996 |
Appl. No.: |
16/896682 |
Filed: |
June 9, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62912010 |
Oct 7, 2019 |
|
|
|
62866872 |
Jun 26, 2019 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/8282
20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82 |
Claims
1.-38. (canceled)
39. A nucleic acid construct comprising a nucleic acid sequence
coding for resistance to Fusarium oxysporum race 4 when expressed
in a plant, wherein said nucleic acid sequence is selected from the
group consisting of a nucleic acid sequence having at least 95% a
sequence identity to SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 9, SEQ
ID NO: 11, SEQ ID NO: 18, SEQ ID NO: 21, and SEQ ID NO: 24, and
wherein the nucleic acid sequence is operably linked to a promoter
capable of driving expression of the nucleic acid sequence.
40. The nucleic acid construct of claim 39, wherein the promoter is
a plant promoter.
41. The nucleic acid construct of claim 39, wherein the promoter is
a 35S promoter.
42. The nucleic acid construct of claim 39, wherein the promoter is
coded by SEQ ID NO: 31.
43. A transgenic plant, plant part, plant cell, or a plant tissue
culture comprising a nucleic acid construct comprising a nucleic
acid sequence coding for resistance to Fusarium oxysporum race 4
when expressed in a plant, wherein said nucleic acid sequence is
selected from the group consisting of a NO: 5, SEQ ID NO: 9, SEQ ID
NO: 11, SEQ ID NO: 18, SEQ ID NO: 21, and SEQ ID No: 24, and
wherein the nucleic acid sequence is operably linked to a promoter
capable of driving expression of the nucleic acid sequence.
44. A method of transforming a plant cell comprising introducing
the nucleic acid construct of claim 39 into a plant cell, whereby
the transformed plant cell expresses the nucleic acid sequence
coding for resistance to Fusarium oxysporum race 4.
45. The method of claim 44, wherein the plant cell is a Musa plant
cell.
46. The method of claim 44, wherein the plant cell is a Musa
acuminata plant cell.
47. The method of claim 44, further comprising producing a
transformed plant tissue from the transformed plant cell.
48. The method of claim 47, further comprising producing a
transformed plantlet from the transformed plant tissue.
49. The method of claim 48, further comprising producing a clone of
the transformed plantlet.
50. The method of claim 48, further comprising growing the
transformed plantlet of the transformed plantlet into a mature
transformed plant.
51. The method of claim 50, wherein the mature transformed plant is
a Musa plant and the mature transformed Musa plant is capable of
producing fruit.
52. The method of claim 51, further comprising producing clones of
the mature transformed Musa plant.
53. The method of claim 51, further comprising using the mature
transformed Musa plant of the mature transformed Musa plant in a
breeding method.
54.-77. (canceled)
78. The transgenic plant of claim 43, wherein the promoter is a
plant promoter.
79. The transgenic plant of claim 43, wherein the promoter is a 35S
promoter.
80. The transgenic plant of claim 43, wherein the promoter is coded
by SEQ ID NO: 31.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Patent Application No. 62/866,872, filed on Jun. 26, 2019, and of
U.S. Provisional Patent Application No. 62/912,010, filed on Oct.
7, 2019, the entire contents of each of which are herein
incorporated by reference.
FIELD
[0002] The present disclosure generally relates to the field of
agricultural industry, especially production of consumer crops with
pathogenic resistance. More particularly, the present disclosure
relates to compositions and methods for generating plants that
possess traits resistant to fungal pathogens such as the soil-born
Fusarium fungi and/or that show resistance to diseases caused by
said fungal pathogens.
DESCRIPTION OF THE TEXT FILE SUBMITTED ELECTRONICALLY
[0003] The Sequence Listing associated with this application is
provided in text format in lieu of a paper copy. The contents of
the text file submitted electronically herewith are incorporated
herein by reference in their entirety: A computer readable format
copy of the Sequence Listing (filename:
EVOL_009_02US_SubSeqList_ST25.txt, date recorded: Jul. 22, 2020;
file size: 27.0 kilobytes).
BACKGROUND OF THE DISCLOSURE
[0004] Bananas are one of the world's biggest fruit crops, totaling
over 100 million metric tons. Bananas are the most popular fruit in
developed countries, and are an important food and income source
for a large percentage of the world, providing food security in
many tropical and subtropical nations. In fact, bananas are the
fourth most important food crop in developing nations where the
vast majority of bananas are produced and consumed locally. The
major producing countries are India, China, Ecuador, Brazil, and
some African countries.
[0005] About 15 percent of banana production is traded on the
global market, generating about $8 Billion annually. The top
exporting countries are Ecuador, Philippines, Costa Rica, and
Columbia.
[0006] However, this important crop is now severely threatened by
Fusarium Wilt, also known as Panama Disease, caused by the fungus
Fusarium oxysporum f sp. cubense (Foc).
[0007] Half of the commercial banana crop world-wide and even up to
90% of banana exports in some countries consist of a single group
of cultivars, the Cavendish genotypes, which are propagated
clonally. Also, most of the commercially traded bananas and many of
the locally consumed bananas are clonally cultivated with a single
crop in a given area, known as `monoculture.` The monoculture has
been widely practiced by farmers to mass-produce highly demanded
crops such as banana, which is easily affected by a range of
fungal, viral, bacterial and nematode diseases. Clearly, the
current expansion of the Panama disease epidemic is particularly
destructive due to the massive monoculture of susceptible Cavendish
bananas.
[0008] Cavendish bananas are the fruits of one of a number of
banana cultivars belonging to the Cavendish subgroup of the AAA
banana cultivar group. The same term is also used to describe the
plants on which the bananas grow. They include commercially
important cultivars like `Dwarf Cavendish` (1888) and `Grand Nain`
(the "Chiquita banana"). `Williams` is a cultivar of the `Giant
Cavendish` type in the Cavendish subgroup. It is one of the most
widely grown cultivars in commercial plantations. `Formosana` is
another name for the somaclonal variant `GCTCV-218,` which has some
resistance to Fusarium wilt TR4. Other representative commercial
cultivars include `Masak Hijau` and `Robusta.` Since the 1950s,
these cultivars have been the most internationally traded bananas.
They replaced the Gros Michel banana (commonly known as Kampala
banana in Kenya and Bogoya in Uganda) after it was devastated by
Panama disease.
[0009] Thus, there is an urgent need in the art for bananas that
are resistant to Fusarium Wilt or Panama Disease.
SUMMARY OF THE DISCLOSURE
[0010] The present disclosure solves the aforementioned Panama
Disease problem by identifying the underlying genetic architecture
giving rise to resistance. Furthermore, the disclosure teaches
methodology by which this resistance genetic architecture can be
imported into disease susceptible bananas and thus render these
bananas disease resistant. The importation of this genetic
architecture can take many forms, as elaborated upon herein,
including: traditional plant breeding, transgenic genetic
engineering, next generation plant breeding (CRISPR, base editing,
MAS, etc.), and other methods.
[0011] In some embodiments as provided herein are isolated nucleic
acid molecules comprising nucleic acid sequence SEQ ID NO: 14
coding for susceptibility to Fusarium oxysporum race 4 when
expressed in a plant, wherein SEQ ID NO: 14 is modified by one,
two, three or four nucleic acid substitutions so that the resulting
nucleic acid sequence codes for resistance to Fusarium oxysporum
race 4 when expressed in a plant. In some embodiments, the isolated
nucleic acid molecule includes nucleic acid substitutions
comprising replacing a T corresponding to position 148 of SEQ ID
NO: 14 with a G (148T>G). In some embodiments, the isolated
nucleic acid molecule includes nucleic acid substitutions
comprising replacing a T corresponding to position 323 of SEQ ID
NO: 14 with an A (323T>A). In some embodiments, the isolated
nucleic acid molecule includes nucleic acid substitutions
comprising replacing a G corresponding to position 344 of SEQ ID
NO: 14 with a C (344G>C). In some embodiments, the isolated
nucleic acid molecule includes nucleic acid substitutions
comprising replacing an A corresponding to position 347 of SEQ ID
NO: 14 with a T (347A>T). In some embodiments, the isolated
nucleic acid molecule includes nucleic acid substitutions
comprising replacing a T corresponding to position 323 with an A
(323T>A), replacing a G corresponding to position 344 with a C
(344G>C), and replacing an A corresponding to position 347 with
a T (347A>T), and wherein all positions are based on SEQ ID NO:
14. In some embodiments the isolated nucleic acid molecule of SEQ
ID NO: 14 codes for an amino acid sequence of SEQ ID NO: 15 and
wherein the nucleic acid substitutions result in replacing a
Leucine corresponding to position 50 of SEQ ID NO: 15 with a Valine
(50L>V). In some embodiments, the isolated nucleic acid molecule
includes SEQ ID NO: 14 which codes for an amino acid sequence of
SEQ ID NO: 15 and wherein the nucleic acid substitutions result in
replacing a Valine corresponding to position 108 of SEQ ID NO: 15
with a Glutamic Acid (108V>E). In some embodiments, the isolated
nucleic acid includes a SEQ ID NO: 14 which codes for an amino acid
sequence of SEQ ID NO: 15 and wherein the nucleic acid
substitutions result in replacing an Arginine corresponding to
position 115 of SEQ ID NO: 15 with a Proline (115R>P). In some
embodiments, the isolated nucleic acid molecule includes a SEQ ID
NO: 14 which codes for an amino acid sequence of SEQ ID NO: 15 and
wherein the nucleic acid substitutions result in replacing an
Aspartic Acid corresponding to position 116 of SEQ ID NO: 15 with a
Valine (116D>V). In some embodiments, the isolated nucleic acid
molecule includes a SEQ ID NO: 14 which codes for an amino acid
sequence of SEQ ID NO: 15 and wherein the nucleic acid
substitutions result in replacing a Valine corresponding to
position 108 of SEQ ID NO: 15 with a Glutamic Acid (108V>E), an
Arginine corresponding to position 115 of SEQ ID NO: 15 with a
Proline (115R>P), and an Aspartic Acid corresponding to position
116 of SEQ ID NO: 15 with a Valine (116D>V).
[0012] In some embodiments, the expression occurs in a plant cell,
plant tissue, plant cell culture, plant tissue culture, or whole
plant. In some embodiments the expression occurs in a Musa cell,
tissue, cell culture, tissue culture, or whole plant. In some
embodiments, the expression occurs in a Musa acuminata cell,
tissue, cell culture, tissue culture or whole plant.
[0013] In some embodiments, a nucleic acid construct comprises the
nucleic acid sequences of the present invention which are operably
linked to a promoter capable of driving expression of the nucleic
acid sequence. In some embodiments, the promoter is a plant
promoter. In some embodiments, the promoter is a 35S promoter. In
some embodiments, the promoter is coded by SEQ ID NO: 31.
[0014] In some embodiments, a transformation vector comprises the
nucleic acid constructs of the present invention.
[0015] In some embodiments, provided herein is a method of
transforming a plant cell comprising introducing the transformation
vectors of the present invention into a plant cell, whereby the
transformed plant cell expresses the nucleic acid sequence coding
for resistance to Fusarium oxysporum race 4. In some embodiments,
the method uses a plant cell which is aMusa plant cell. In some
embodiments, the method uses a plant cell which is aMusa acuminata
plant cell.
[0016] In some embodiments, the transformed plant tissue is
produced from the transformed plant cell. In some embodiments, a
transformed plantlet is produced from the transformed plant tissue.
In some embodiments, a clone is produced from the transformed
plantlet. In some embodiments, the method comprises growing the
transformed plantlet or clone of the transformed plantlet into a
mature transformed plant. In some embodiments, the mature
transformed plant is a Musa plant and the mature transformed Musa
plant is capable of producing fruit. In some embodiments, the
methods of the present invention include further producing clones
of the mature transformed Musa plant. In some embodiments, the
mature transformed Musa plant or clone of the mature transformed
Musa plant are used in breeding methods.
[0017] In some embodiments, the present invention provides an
isolated amino acid molecule comprising an amino acid sequence of
SEQ ID NO: 15 coding for a protein that when produced in a plant
results in susceptibility to Fusarium oxysporum race 4, wherein SEQ
ID NO: 15 is modified by one, two, three or four amino acid
substitutions so that it codes for a protein which when produced in
a plant results in resistance to Fusarium oxysporum race 4. In some
embodiments, the amino acid substitutions comprise replacing a
Leucine corresponding to position 50 of SEQ ID NO: 15 with a Valine
(50L>V). In some embodiments, the amino acid substitutions
comprise replacing a Valine corresponding to position 108 of SEQ ID
NO: 15 with a Glutamic Acid (108V>E). In some embodiments, the
amino acid substitutions comprise replacing an Arginine
corresponding to position 115 of SEQ ID NO: 15 with a Proline
(115R>P). In some embodiments, the amino acid substitutions
comprise replacing an Aspartic Acid corresponding to position 116
of SEQ ID NO: 15 with a Valine (116D>V). In some embodiments,
the amino acid substitutions comprise replacing a Valine
corresponding to position 108 of SEQ ID NO: 15 with a Glutamic Acid
(108V>E), an Arginine corresponding to position 115 of SEQ ID
NO: 15 with a Proline (115R>P), and an Aspartic Acid
corresponding to position 116 of SEQ ID NO: 15 with a Valine
(116D>V). In some embodiments, the protein production occurs in
a plant cell, plant tissue, plant cell culture, plant tissue
culture, or whole plant. In some embodiments, the protein
production occurs in a Musa cell, tissue, cell culture, tissue
culture, or whole plant. In some embodiments, the protein
production occurs in a Musa acuminata cell, tissue, cell culture,
tissue culture or whole plant.
[0018] In some embodiments, the nucleic acid constructs of the
present invention comprise a nucleic acid sequence coding for
resistance to Fusarium oxysporum race 4 when expressed in a plant,
wherein said nucleic acid sequence is selected from the group
consisting of SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO:
11, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 24 and SEQ ID NO: 29,
and wherein the nucleic acid sequence is operably linked to a
promoter capable of driving expression of the nucleic acid
sequence. In some embodiments, the promoter is a plant promoter. In
some embodiments, the promoter is a 35S promoter. In some
embodiments, the promoter is coded by SEQ ID NO: 31. In some
embodiments, a transformation vector comprises the nucleic acid
constructs of the present invention. In some embodiments, the
present invention provides methods of transforming a plant cell
comprising introducing the transformation vector into a plant cell,
whereby the transformed plant cell expresses the nucleic acid
sequence coding for resistance to Fusarium oxysporum race 4. In
some embodiments, the plant cell is a Musa plant cell. In some
embodiments, the plant cell is a Musa acuminata plant cell. In some
embodiments, the methods further comprise producing transformed
plant tissue from the transformed plant cell. In some embodiments,
a transformed plantlet is produced from the transformed plant
tissue. In some embodiments, the methods further comprise producing
a clone of the transformed plantlet. In some embodiments, the
methods further comprise growing the transformed plantlet or clone
of the transformed plantlet into a mature transformed plant. In
some embodiments, the mature transformed plant is a Musa plant and
the mature transformed Musa plant is capable of producing fruit. In
some embodiments, the methods further comprise producing clones of
the mature transformed Musa plant. In some embodiments, the mature
transformed Musa plant or clone of the mature transformed Musa
plant is used in a breeding method.
[0019] In some embodiments, the invention provides a banana
breeding method comprising crossing a first Musa plant comprising a
nucleic acid sequence coding for resistance to Fusarium oxysporum
race 4 with a second Musa plant that is susceptible to Fusarium
oxysporum race 4 and selecting resultant progeny of the cross based
on their resistance to Fusarium oxysporum race 4, wherein said
nucleic acid sequence coding for resistance to Fusarium oxysporum
race 4 is selected from the group consisting of SEQ ID NO: 2, SEQ
ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 18, SEQ ID NO:
21, SEQ ID NO: 24 and SEQ ID NO: 29. In some embodiments, the
banana breeding methods further comprise producing clones of the
resultant progeny of the cross wherein the clones are selected
based on their resistance to Fusarium oxysporum race 4. In some
embodiments, the first and second Musa plants are from different
Musa species. In some embodiments, the first and second Musa plants
are from the same Musa species. In some embodiments, the first
and/or second Musa plant is a Musa acuminata plant. In some
embodiments, the progeny of the cross that display resistance to
Fusarium oxysporum race 4 are selected using molecular markers that
are designed based on the nucleic acid sequence coding for
resistance to Fusarium oxysporum race 4 that is present in the
first Musa plant used in the cross.
[0020] In some embodiments, the present invention provides methods
for obtaining a Musa acuminata plant cell with a silenced
endogenous gene coding for susceptibility to Fusarium oxysporum
race 4, the method comprising introducing a double-strand break to
at least one site in an endogenous gene coded by SEQ ID NO: 14 to
produce a Musa acuminata plant cell with a silenced endogenous gene
coding for susceptibility to Fusarium oxysporum race 4. In some
embodiments, the methods further comprise generating a Musa
acuminata plant from the Musa acuminata plant cell with a silenced
endogenous gene coding for susceptibility to Fusarium oxysporum
race 4 to produce a Musa acuminata plant with a silenced endogenous
gene coding for susceptibility to Fusarium oxysporum race 4. In
some embodiments, the methods further comprise using the Musa
acuminata plant with a silenced endogenous gene coding for
susceptibility to Fusarium oxysporum race 4 in a banana breeding
program. In some embodiments, the methods of the present invention
utilize a plant cell that is the Musa acuminata plant cell with a
silenced endogenous gene coding for susceptibility to Fusarium
oxysporum race 4. In some embodiments, the double-strand break is
induced by a nuclease selected from the group consisting of a
TALEN, a meganuclease, a zinc finger nuclease, and a
CRISPR-associated nuclease. In some embodiments, the double-strand
break is induced by a CRISPR-associated nuclease and where a guide
RNA is provided.
[0021] In some embodiments, the present invention provides methods
for producing a plant cell resistant to Fusarium oxysporum race 4
comprising introducing at least one genetic modification into one
or more endogenous nucleic acid sequences coding for susceptibility
to Fusarium oxysporum race 4, wherein the genetic modification
confers resistance to Fusarium oxysporum race 4 to the plant cell.
In some embodiments, at least one genetic modification is
introduced by a TALEN, a meganuclease, a zinc finger nuclease or a
CRISPR-associated nuclease. In some embodiments, the at least one
genetic modification is introduced by a CRISPR-associated nuclease
and an associated guide RNA. In some embodiments, the at least one
genetic modification is selected from the list consisting of
replacing a T corresponding to position 148 of SEQ ID NO: 14 with a
G (148T>G), replacing a T corresponding to position 323 of SEQ
ID NO: 14 with an A (323T>A), replacing a G corresponding to
position 344 of SEQ ID NO: 14 with a C (344G>C), and replacing
an A corresponding to position 347 of SEQ ID NO: 14 with a T
(347A>T). In some embodiments, the at least one genetic
modification results in a change in an amino acid selected from the
group consisting of replacing a Leucine corresponding to position
50 of SEQ ID NO: 15 with a Valine (50L>V), replacing a Valine
corresponding to position 108 of SEQ ID NO: 15 with a Glutamic Acid
(108V>E), replacing an Arginine corresponding to position 115 of
SEQ ID NO: 15 with a Proline (115R>P), and replacing an Aspartic
Acid corresponding to position 116 of SEQ ID NO: 15 with a Valine
(116D>V). In some embodiments, the plant cell is a Musa plant
cell. In some embodiments, the plant cell is a Musa acuminata plant
cell. In some embodiments, the methods further comprise producing
transformed plant tissue from the transformed plant cell. In some
embodiments, the methods further comprise producing a transformed
plantlet from the transformed plant tissue. In some embodiments,
the methods further comprise producing a clone of the transformed
plantlet. In some embodiments, the methods further comprise growing
the transformed plantlet or clone of the transformed plantlet into
a mature transformed plant. In some embodiments, the mature
transformed plant is a Musa plant and the mature transformed Musa
plant is capable of producing fruit. In some embodiments, the
methods further comprise producing clones of the mature transformed
Musa plant. In some embodiments, the methods further comprise using
the mature transformed Musa plant or clone of the mature
transformed Musa plant in a breeding method.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1 illustrates banana FusR1 coding sequences aligned.
Initiation (start) and termination (stop) codons are
underlined.
[0023] FusR1 nucleotide base substitutions between Musa species are
bolded. Substitutions that code for replacement amino acid residues
(i.e., are nonsynonymous) are shown in bolded font with an asterisk
(*); silent substitutions are shown in bolded font with a dot ( ).
The first 96 bases code for a leader peptide (shown in lower case)
that is cleaved from the mature protein. This is known to be common
for Bowman-Birk proteins (Barbosa et al., 2007). Inventor confirmed
the extent of the leader sequence using two different
bioinformatics tools, SignalP-5.0 (Armenteros et al, 2019), and
PrediSi (Hiller et al., 2004), which both identified the same
leader peptide. Using the bioinformatics tool DeepLoc-1.0
(Armenteros et al., 2017), inventor then established that the
mature FUSR1 protein is localized to the cell cytoplasm (likelihood
of 0.9732).
[0024] Bases shown in UPPER CASE code for the mature protein.
[0025] A missing base, shown as a dash (-), in the M. balbisiana
FusR1 sequence results in a premature stop codon (shown in
italicized, underlined lower case), relative to the other FusR1
sequences. As described in the text, FusR1 mRNAs from all M.
balbisiana accessions inventor examined have an unspliced (i.e.,
expressed) intron; for clarity in the Figure and to focus on
sequence similarities/differences in FusR1 coding sequences from
different banana species, the intron sequence has been removed here
from M. balbisiana, even though inventor has not seen that happen.
Thus SEQ ID NO: 27 is a `hypothetical" coding sequence.
[0026] The M. itinerans FusR1 sequence was obtained from multiple
accessions (ITC1526, ITC1571, and PT-BA-00223), all of which are
FW-resistant. The M. acuminata FusR1 sequence labeled
`FW-resistant` was obtained from multiple FW-resistant accessions,
including ITC0896 (M. a. subspecies banksii) and PT-BA-00281
(Pisang Bangkahulu). The M. acuminata sequence labeled `sensitive`
is from FW-sensitive accessions ITC0507, ITC0685, PT-BA-00304,
PT-BA-00310, and PT-BA-00315. These accessions include multiple
samples from banana cultivars such as Pisang Madu, Pisang Pipit,
and Pisang Rojo Uter, all of which have been well-characterized as
FW-sensitive (Chen et al, 2019). The M. balbisiana sequence
included here was obtained from ITC1016. FusR1 from M. basjoo is
from FW-resistant accessions (ITC0061 and PD #3064).
[0027] Examination of FIG. 1 reveals that our FusR1 banana
sequences are well-conserved in the region that codes for the
leader peptide, as is expected. However, the FusR1 sequence that
codes for the mature FUSR1 protein shows an unusually high number
of nonsynonymous substitutions. This is the result of severe
selective pressure on these proteins, which is reflected in the
elevated Ka/Ks ratios seen for these genes. (See below.) Inventor
found 2 FW-resistant alleles for FusR1 from M. itinerans. These
differ very slightly and for simplicity, only Allele 1 (SEQ ID NO:
2) from M. itinerans is shown in FIG. 1. The Allele 2 coding
sequence from M. itinerans is included in the Sequence Listing as
SEQ ID NO: 5. Similarly, inventor found 2 FusR1 FW-resistant
alleles in M. acuminata. These differ only by a single silent base
substitution. Again, for simplicity, FIG. 1 shows only one of these
alleles (SEQ ID NO: 9). The second allele, not shown in FIG. 1, is
recorded in the Sequence Listing as SEQ ID NO: 11.
[0028] FIG. 2 illustrates banana FUSR1 protein sequences aligned.
Amino acid residues that differ between the banana FUSR1 protein
sequences are underlined. The first 32 residues constitute a leader
peptide which is cleaved from the mature protein. Leader sequence
residues are shown in lower case, and mature protein residues in
UPPER CASE.
[0029] The functional folded banana FUSR1 protein consists of two
subdomains: Subdomain 1 is indicated by light grey shading;
Subdomain 2 is indicated by dark grey shading. As in other
Bowman-Birk proteins, banana FUSR1 structure is maintained by 14
disulfide bonds. The cysteine residues that form these disulfide
bonds are shown in bold. Each subdomain contains a reactive site,
shown in italics. Residues that are specific for trypsin (Subdomain
1) and chymotrypsin (Subdomain 2) are indicated by an asterisk (*).
For M. acuminata, residues that differ between the Foc4-sensitive
FusR1 allele and the Foc-4 resistant alleles are shown by a dot (
), with the arginine residue (number 115) that explains Foc4
sensitivity shown in bold font with a dot ( ).
[0030] FIG. 3 provides a phylogenetic tree for several banana
species, based on nucleotide sequences of the C2H2 gene.
[0031] The tree topology shown here was recovered from analysis of
our banana C2H2 nucleotide sequences. This topology is identical to
that recovered from analysis of the C2H2 protein sequence. The same
tree was recovered from our TOPO6 nucleotide and protein sequences.
The topology shown here is also similar to that in references.
[0032] It is important note that in contrast, topologies recovered
from the FusR1 protein sequences and the protein-coding regions of
the FusR1 gene give a different topology, which is clearly the
result of the selective pressures imposed on FusR1 during
adaptation due to challenge by Fusarium. The non-coding regions of
FusR1 have the same topology as the phylogenetic trees for C2H2 and
TOPO6.
[0033] The evolutionary history was inferred using the Maximum
Parsimony method. The single most parsimonious tree is shown. The
consistency index is 1.000000, the retention index is 1.000000, and
the composite index is 1.000000 for all sites. The MP tree was
obtained using the Subtree-Pruning-Regrafting (SPR) algorithm with
search level 0 in which the initial trees were obtained by the
random addition of sequences (10 replicates). This analysis
involved 5 nucleotide sequences. Codon positions included were
1st+2nd+3rd+Noncoding. All positions with less than 95% site
coverage were eliminated, i.e., fewer than 5% alignment gaps,
missing data, and ambiguous bases were allowed at any position
(partial deletion option). There were a total of 218 positions in
the final dataset. Evolutionary analyses were conducted in MEGA X
(Kumar et al. 2018).
[0034] FIG. 4 provides a phylogenetic tree for several banana
species, based on FUSR1 protein sequences. Note that this tree
unites Musa acuminata and M. basjoo, in contrast to their actual
phylogenetic relationship. M. acuminata is most closely related to
M. balbisiana, with M. basjoo as a sister taxon to these 2 species.
However, because of the severe effects of positive selection, the
FusR1 protein sequence of M. acuminata and M. basjoo cluster
together. (In fact, these protein sequences are identical.)
[0035] The evolutionary history was inferred using the Maximum
Parsimony method. The single most parsimonious tree with length=55
is shown. The consistency index is 0.963636, the retention index is
0.875000, and the composite index is 0.843182 for all sites. The MP
tree was obtained using the Subtree-Pruning-Regrafting (SPR)
algorithm with search level 0 in which the initial trees were
obtained by the random addition of sequences (10 replicates).
Evolutionary analyses were conducted in MEGA X.
[0036] FIG. 5 provides the alignment of FusR1 mRNA sequences from
FW-sensitive Musa balbisiana accessions. The sequences included
here were obtained from many M. balbisiana accessions, including
ITC1016, ITC0545, ITC0080, ITC1527, ITC0565, ITC1781, ITC1580, and
several others.
[0037] FusR1 nucleotide base substitutions between Musa balbisiana
accessions are in italics. Start and termination (stop) codons are
shown in lower case. Insertions, relative to other M. balbisiana
accessions (as well as to FusR1 sequences from all other plants
inventor analyzed), are bolded. Nucleotide deletions are shown by
the colon symbol (:). The 85 base pair deletion in FusR1 from
accessions ITC0545 and ITC1781 is unique to M. balbisiana. As the
sequence of FusR1 from ITC1781 is identical to that from ITC0545,
ITC1781 is not presented in FIG. 5. Similarly, the single base pair
deletion found in these FW-sensitive M. balbisiana accessions has
not been found in any other FusR1 sequence. However it exists in
all M. balbisiana accessions inventor analyzed. This single base
pair deletion results in a premature termination codon relative to
the FusR1 sequences from FW-resistant banana accessions.
[0038] All M. balbisiana accessions inventor examined had one of
the 4 allele types shown here. Several accessions shared identical
FusR1 alleles. Thus, for simplicity, only 4 accessions are shown in
this figure. These 4 FusR1 alleles are all very similar in
nucleotide sequence. There are transcriptional variants between
accessions but all these variants have the expressed, non-spliced
intron. All accessions also have the single base pair base pair
deletion. Three accessions also have an 85 base pair deletion, and
several have a 4 base pair insertion.
[0039] Thus all these FusR1 sequences are `broken` and they all
code for non-functional FusR1 proteins. Significantly, all these M.
balbisiana accessions are FW-sensitive.
DETAILED DESCRIPTION OF THE DISCLOSURE
[0040] The present disclosure provides a solution of fungal, viral,
bacterial and/or nematode diseases by inducing a defense response
to many invading pathogens. The present disclosure provides methods
of identifying genetic materials that can drive disease resistance
and/or fungal resistance in plants including banana and in plants
and plant parts. Also, the present disclosure provides methods of
transferring genetic materials to susceptible banana cultivars in
order to give rise to traits of disease and/or fungal resistance.
Furthermore, the present disclosure teaches newly-identified
genetic components and methods of generating genetically modified
plants, plant cells, tissues and seeds, having modified disease
resistance.
I. Definitions
[0041] Unless stated otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by those
of ordinary skill in the art to which the disclosure belongs. While
the following terms are believed to be well understood by one of
ordinary skill in the art, the following definitions are set forth
to facilitate explanation of the presently disclosed subject
matter. Although any methods and materials similar or equivalent to
those described herein can be used in the practice or testing of
the present disclosure, preferred methods and materials are
described. The following terms are defined below. These definitions
are for illustrative purposes and are not intended to limit the
common meaning in the art of the defined terms.
[0042] The term "a" or "an" refers to one or more of that entity,
i.e., can refer to a plural referent. As such, the terms "a" or
"an", "one or more" and "at least one" are used interchangeably
herein. In addition, reference to "an element" by the indefinite
article "a" or "an" does not exclude the possibility that more than
one of the elements is present, unless the context clearly requires
that there is one and only one of the elements.
[0043] As used in this specification, the term "and/or" is used in
this disclosure to mean either "and" or "or" unless indicated
otherwise.
[0044] Throughout this specification, unless the context requires
otherwise, the words "comprise", or variations such as "comprises"
or "comprising", will be understood to imply the inclusion of a
stated element or integer or group of elements or integers but not
the exclusion of any other element or integer or group of elements
or integers.
[0045] As used in this application, the terms "about" and
"approximately" are used as equivalents. Any numerals used in this
application with or without about/approximately are meant to cover
any normal fluctuations appreciated by one of ordinary skill in the
relevant art. In certain embodiments, the term "approximately" or
"about" refers to a range of values that fall within 25%, 20%, 19%,
18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%,
4%, 3%, 2%, 1%, or less in either direction (greater than or less
than) of the stated reference value unless otherwise stated or
otherwise evident from the context (except where such number would
exceed 100% of a possible value).
[0046] As used herein, the term "at least a portion" or "fragment"
of a nucleic acid or polypeptide means a portion having the minimal
size characteristics of such sequences, or any larger fragment of
the full length molecule, up to and including the full length
molecule. A fragment of a polynucleotide of the disclosure may
encode a biologically active portion of a genetic regulatory
element. A biologically active portion of a genetic regulatory
element can be prepared by isolating a portion of one of the
polynucleotides of the disclosure that comprises the genetic
regulatory element and assessing activity as described herein.
Similarly, a portion of a polypeptide may be 4 amino acids, 5 amino
acids, 6 amino acids, 7 amino acids, and so on, going up to the
full length polypeptide. The length of the portion to be used will
depend on the particular application. A portion of a nucleic acid
useful as a hybridization probe may be as short as 12 nucleotides;
in some embodiments, it is 20 nucleotides. A portion of a
polypeptide useful as an epitope may be as short as 4 amino acids.
A portion of a polypeptide that performs the function of the
full-length polypeptide would generally be longer than 4 amino
acids. In some embodiments, a fragment of a polypeptide or
polynucleotide comprises at least 10%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% of the entire length of
the reference polypeptide or polynucleotide. In some embodiments, a
polypeptide or polynucleotide fragment may contain 5, 10, 15, 20,
25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500,
600, 700, 800, 900, 1000, 2000 or more nucleotides or amino
acids.
[0047] As used herein, the term "codon optimization" implies that
the codon usage of a DNA or RNA is adapted to that of a cell or
organism of interest to improve the transcription rate of said
recombinant nucleic acid in the cell or organism of interest. The
skilled person is well aware of the fact that a target nucleic acid
can be modified at one position due to the codon degeneracy,
whereas this modification will still lead to the same amino acid
sequence at that position after translation, which is achieved by
codon optimization to take into consideration the species-specific
codon usage of a target cell or organism.
[0048] As used herein, the term "endogenous" or "endogenous gene,"
refers to the naturally occurring gene, in the location in which it
is naturally found within the host cell genome. "Endogenous gene"
is synonymous with "native gene" as used herein. An endogenous gene
as described herein can include alleles of naturally occurring
genes that have been mutated according to any of the methods of the
present disclosure, i.e. an endogenous gene could have been
modified at some point by traditional plant breeding methods and/or
next generation plant breeding methods.
[0049] As used herein, the term "exogenous" refers to a substance
coming from some source other than its native source. For example,
the terms "exogenous protein," or "exogenous gene" refer to a
protein or gene from a non-native source, and that has been
artificially supplied to a biological system. As used herein, the
term "exogenous" is used interchangeably with the term
"heterologous," and refers to a substance coming from some source
other than its native source.
[0050] The terms "genetically engineered host cell," "recombinant
host cell," and "recombinant strain" are used interchangeably
herein and refer to host cells that have been genetically
engineered by the methods of the present disclosure. Thus, the
terms include a host cell (e.g., bacteria, yeast cell, fungal cell,
CHO, human cell, plant cell, protoplast derived from plant, callus,
etc.) that has been genetically altered, modified, or engineered,
such that it exhibits an altered, modified, or different genotype
and/or phenotype (e.g., when the genetic modification affects
coding nucleic acid sequences), as compared to the
naturally-occurring host cell from which it was derived. It is
understood that the terms refer not only to the particular
recombinant host cell in question, but also to the progeny or
potential progeny of such a host cell.
[0051] As used herein, the term "heterologous" refers to a
substance coming from some source or location other than its native
source or location. In some embodiments, the term "heterologous
nucleic acid" refers to a nucleic acid sequence that is not
naturally found in the particular organism. For example, the term
"heterologous promoter" may refer to a promoter that has been taken
from one source organism and utilized in another organism, in which
the promoter is not naturally found. However, the term
"heterologous promoter" may also refer to a promoter that is from
within the same source organism, but has merely been moved to a
novel location, in which said promoter is not normally located.
[0052] Heterologous gene sequences can be introduced into a target
cell by using an "expression vector," which can be a eukaryotic
expression vector, for example a plant expression vector. Methods
used to construct vectors are well known to a person skilled in the
art and described in various publications. In particular,
techniques for constructing suitable vectors, including a
description of the functional components such as promoters,
enhancers, termination and polyadenylation signals, selection
markers, origins of replication, and splicing signals, are reviewed
in the prior art. Vectors may include but are not limited to
plasmid vectors, phagemids, cosmids, artificial/mini-chromosomes
(e.g. ACE), or viral vectors such as baculovirus, retrovirus,
adenovirus, adeno-associated virus, herpes simplex virus,
retroviruses, bacteriophages. The eukaryotic expression vectors
will typically contain also prokaryotic sequences that facilitate
the propagation of the vector in bacteria such as an origin of
replication and antibiotic resistance genes for selection in
bacteria. A variety of eukaryotic expression vectors, containing a
cloning site into which a polynucleotide can be operatively linked,
are well known in the art and some are commercially available from
companies such as Stratagene, La Jolla, Calif.; Invitrogen,
Carlsbad, Calif.; Promega, Madison, Wis. or BD Biosciences
Clontech, Palo Alto, Calif. In one embodiment the expression vector
comprises at least one nucleic acid sequence which is a regulatory
sequence necessary for transcription and translation of nucleotide
sequences that encode for a peptide/polypeptide/protein of
interest.
[0053] As used herein, the term "naturally occurring" as applied to
a nucleic acid, a polypeptide, a cell, or an organism, refers to a
nucleic acid, polypeptide, cell, or organism that is found in
nature. The term "naturally occurring" may refer to a gene or
sequence derived from a naturally occurring source. Thus, for the
purposes of this disclosure, a "non-naturally occurring" sequence
is a sequence that has been synthesized, mutated, engineered,
edited, or otherwise modified to have a different sequence from
known natural sequences. In some embodiments, the modification may
be at the protein level (e.g., amino acid substitutions). In other
embodiments, the modification may be at the DNA level (e.g.,
nucleotide substitutions).
[0054] As used herein, the term "nucleotide change" or "nucleotide
modification" refers to, e.g., nucleotide substitution, deletion,
and/or insertion, as is well understood in the art. For example,
such nucleotide changes/modifications include mutations containing
alterations that produce silent substitutions, additions, or
deletions, but do not alter the properties or activities of the
encoded protein or how the proteins are made. As another example,
such nucleotide changes/modifications include mutations containing
alterations that produce replacement substitutions, additions, or
deletions, that alter the properties or activities of the encoded
protein or how the proteins are made.
[0055] As used herein, the term "protein modification" refers to,
e.g., amino acid substitution, amino acid modification, deletion,
and/or insertion, as is well understood in the art.
[0056] The term "next generation plant breeding" refers to a host
of plant breeding tools and methodologies that are available to
today's breeder. A key distinguishing feature of next generation
plant breeding is that the breeder is no longer confined to relying
upon observed phenotypic variation, in order to infer underlying
genetic causes for a given trait. Rather, next generation plant
breeding may include the utilization of molecular markers and
marker assisted selection (MAS), such that the breeder can directly
observe movement of alleles and genetic elements of interest from
one plant in the breeding population to another, and is not
confined to merely observing phenotype. Further, next generation
plant breeding methods are not confined to utilizing natural
genetic variation found within a plant population. Rather, the
breeder utilizing next generation plant breeding methodology can
access a host of modern genetic engineering tools that directly
alter/change/edit the plant's underlying genetic architecture in a
targeted manner, in order to bring about a phenotypic trait of
interest. In aspects, the plants bred with a next generation plant
breeding methodology are indistinguishable from a plant that was
bred in a traditional manner, as the resulting end product plant
could theoretically be developed by either method. In particular
aspects, a next generation plant breeding methodology may result in
a plant that comprises: a genetic modification that is a deletion
or insertion of any size; a genetic modification that is one or
more base pair substitution; a genetic modification that is an
introduction of nucleic acid sequences from within the plant's
natural gene pool (e.g. any plant that could be crossed or bred
with a plant of interest) or from editing of nucleic acid sequences
in a plant to correspond to a sequence known to occur in the
plant's natural gene pool; and offspring of said plants.
[0057] As used herein, the term "operably linked" refers to the
association of nucleic acid sequences on a single nucleic acid
fragment so that the function of one is regulated by the other. For
example, a promoter is operably linked with a coding sequence when
it is capable of regulating the expression of that coding sequence
(i.e., that the coding sequence is under the transcriptional
control of the promoter). Coding sequences can be operably linked
to regulatory sequences in a sense or antisense orientation. In
another example, the complementary RNA regions of the disclosure
can be operably linked, either directly or indirectly, 5' to the
target mRNA, or 3' to the target mRNA, or within the target mRNA,
or a first complementary region is 5' and its complement is 3' to
the target mRNA.
[0058] The terms "polynucleotide," "nucleic acid," and "nucleotide
sequence," used interchangeably herein, refers to a polymeric form
of nucleotides of any length, either ribonucleotides or
deoxyribonucleotides, or analogs thereof. This term refers to the
primary structure of the molecule, and thus includes double- and
single-stranded DNA, as well as double- and single-stranded RNA.
This term includes, but is not limited to, single-, double-, or
multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a
polymer comprising purine and pyrimidine bases or other natural,
chemically or biochemically modified, non-natural, or derivatized
nucleotide bases. It also includes modified nucleic acids such as
methylated and/or capped nucleic acids, nucleic acids containing
modified bases, backbone modifications, and the like.
"Oligonucleotide" generally refers to polynucleotides of between
about 5 and about 100 nucleotides of single- or double-stranded
DNA. However, for the purposes of this disclosure, there is no
upper limit to the length of an oligonucleotide. Oligonucleotides
are also known as "oligomers" or "oligos" and may be isolated from
genes, or chemically synthesized by methods known in the art. The
terms "polynucleotide" "nucleic acid," and "nucleotide sequence"
should be understood to include, as applicable to the embodiments
being described, single-stranded (such as sense or antisense) and
double-stranded polynucleotides.
[0059] The terms "peptide," "polypeptide," and "protein" are used
interchangeably herein, and refer to a polymeric form of amino
acids of any length, which can include coded and non-coded amino
acids, chemically or biochemically modified or derivatized amino
acids, and polypeptides having modified peptide backbones.
[0060] As used herein, the phrases "recombinant construct",
"expression construct", "chimeric construct", "construct", and
"recombinant DNA construct" are used interchangeably herein. A
recombinant construct comprises an artificial combination of
nucleic acid fragments, e.g., regulatory and coding sequences that
are not found together in nature. For example, a chimeric construct
may comprise regulatory sequences and coding sequences that are
derived from different sources, or regulatory sequences and coding
sequences derived from the same source, but arranged in a manner
different than that found in nature. Such construct may be used by
itself or may be used in conjunction with a vector. If a vector is
used then the choice of vector is dependent upon the method that
will be used to transform host cells as is well known to those
skilled in the art. For example, a plasmid vector can be used. The
skilled artisan is well aware of the genetic elements that must be
present on the vector in order to successfully transform, select
and propagate host cells comprising any of the isolated nucleic
acid fragments of the disclosure. The skilled artisan will also
recognize that different independent transformation events will
result in different levels and patterns of expression (Jones et
al., (1985) EMBO J. 4:2411-2418; De Almeida et al., (1989) Mol.
Gen. Genetics 218:78-86), and thus that multiple events must be
screened in order to obtain lines displaying the desired expression
level and pattern. Such screening may be accomplished by Southern
analysis of DNA, Northern analysis of mRNA expression,
immunoblotting analysis of protein expression, or phenotypic
analysis, among others. Vectors can be plasmids, viruses,
bacteriophages, pro-viruses, phagemids, transposons, artificial
chromosomes, and the like, that replicate autonomously or can
integrate into a chromosome of a host cell. A vector can also be a
naked RNA polynucleotide, a naked DNA polynucleotide, a
polynucleotide composed of both DNA and RNA within the same strand,
a poly-lysine-conjugated DNA or RNA, a peptide-conjugated DNA or
RNA, a liposome-conjugated DNA, or the like, that is not
autonomously replicating. As used herein, the term "expression"
refers to the production of a functional end-product e.g., an mRNA
or a protein (precursor or mature).
[0061] The term "traditional plant breeding" refers to the
utilization of natural variation found within a plant population as
a source for alleles and genetic variants that impart a trait of
interest to a given plant. Traditional breeding methods make use of
crossing procedures that rely largely upon observed phenotypic
variation to infer causative allele association. That is,
traditional plant breeding relies upon observations of expressed
phenotype of a given plant to infer underlying genetic cause. These
observations are utilized to inform the breeding procedure in order
to move allelic variation into germplasm of interest. Further,
traditional plant breeding has also been characterized as
comprising random mutagenesis techniques, which can be used to
introduce genetic variation into a given germplasm. These random
mutagenesis techniques may include chemical and/or radiation-based
mutagenesis procedures. Consequently, one key feature of
traditional plant breeding, is that the breeder does not utilize a
genetic engineering tool that directly alters/changes/edits the
plant's underlying genetic architecture in a targeted manner, in
order to introduce genetic diversity and bring about a phenotypic
trait of interest.
[0062] A "CRISPR-associated effector" as used herein can thus be
defined as any nuclease, nickase, or recombinase associated with
the CRISPR (Clustered Regularly Interspaced Short Palindromic
Repeats), having the capacity to introduce a single- or
double-strand cleavage into a genomic target site, or having the
capacity to introduce a targeted modification, including a point
mutation, an insertion, or a deletion, into a genomic target site
of interest. At least one CRISPR-associated effector can act on its
own, or in combination with other molecules as part of a molecular
complex. The CRISPR-associated effector can be present as fusion
molecule, or as individual molecules associating by or being
associated by at least one of a covalent or non-covalent
interaction with gRNA and/or target site so that the components of
the CRISPR-associated complex are brought into close physical
proximity.
[0063] A "base editor" as used herein refers to a protein or a
fragment thereof having the same catalytic activity as the protein
it is derived from, which protein or fragment thereof, alone or
when provided as molecular complex, referred to as base editing
complex herein, has the capacity to mediate a targeted base
modification, i.e., the conversion of a base of interest resulting
in a point mutation of interest, which in turn can result in a
targeted mutation, if the base conversion does not cause a silent
mutation, but rather a conversion of an amino acid encoded by the
codon comprising the position to be converted with the base editor.
At least one base editor according to the present disclosure
temporarily or permanently linked to at least one CRISPR-associated
effector, or optionally to a component of at least one
CRISPR-associated effector complex.
[0064] The term "Cas9 nuclease" and "Cas9" can be used
interchangeably herein, which refer to a RNA-guided DNA
endonuclease enzyme associated with the CRISPR (Clustered Regularly
Interspaced Short Palindromic Repeats), including the Cas9 protein
or fragments thereof (such as a protein comprising an active DNA
cleavage domain of Cas9 and/or a gRNA binding domain of Cas9). Cas9
is a component of the CRISPR/Cas genome editing system, which
targets and cleaves a DNA target sequence to form a DNA double
strand breaks (DSB) under the guidance of a guide RNA.
[0065] The term "CRISPR RNA" or "crRNA" refers to the RNA strand
responsible for hybridizing with target DNA sequences, and
recruiting CRISPR endonucleases and/or CRISPR-associated effectors.
crRNAs may be naturally occurring, or may be synthesized according
to any known method of producing RNA.
[0066] The term "tracrRNA" refers to a small trans-encoded RNA.
TracrRNA is complementary to and base pairs with crRNA to form a
crRNA/tracrRNA hybrid, capable of recruiting CRISPR endonucleases
and/or CRISPR-associated effectors to target sequences.
[0067] The term "Guide RNA" or "gRNA" as used herein refers to an
RNA sequence or combination of sequences capable of recruiting a
CRISPR endonuclease and/or CRISPR-associated effectors to a target
sequence. Typically gRNA is composed of crRNA and tracrRNA
molecules forming complexes through partial complement, wherein
crRNA comprises a sequence that is sufficiently complementary to a
target sequence for hybridization and directs the CRISPR complex
(i.e. Cas9-crRNA/tracrRNA hybrid) to specifically bind to the
target sequence. Also, single guide RNA (sgRNA) can be designed,
which comprises the characteristics of both crRNA and tracrRNA.
Therefore, as used herein, a guide RNA can be a natural or
synthetic crRNA (e.g., for Cpf1), a natural or synthetic
crRNA/tracrRNA hybrid (e.g., for Cas9), or a single-guide RNA
(sgRNA).
[0068] The term "guide sequence" or "spacer sequence" refers to the
portion of a crRNA or guide RNA (gRNA) that is responsible for
hybridizing with the target DNA.
[0069] The term "protospacer" refers to the DNA sequence targeted
by a guide sequence of crRNA or gRNA. In some embodiments, the
protospacer sequence hybridizes with the crRNA or gRNA guide
(spacer) sequence of a CRISPR complex.
[0070] The term "CRISPR landing site" as used herein, refers to a
DNA sequence capable of being targeted by a CRISPR-Cas complex. In
some embodiments, a CRISPR landing site comprises a proximately
placed protospacer/Protopacer Adjacent Motif combination sequence
that is capable of being cleaved by a CRISPR complex.
[0071] The term "CRISPR complex", "CRISPR endonuclease complex",
"CRISPR Cas complex", or "CRISPR-gRNA complex" are used
interchangeably herein. "CRISPR complex" refers to a Cas9 nuclease
and/or a CRISPR-associated effectors complexed with a guide RNA
(gRNA). The term "CRISPR complex" thus refers to a combination of
CRISPR endonuclease and guide RNA capable of inducing a double
stranded break at a CRISPR landing site. In some embodiments,
"CRISPR complex" of the present disclosure refers to a combination
of catalytically dead Cas9 protein and guide RNA capable of
targeting a target sequence, but not capable of inducing a double
stranded break at a CRISPR landing site because it loses a nuclease
activity. In other embodiments, "CRISPR complex" of the present
disclosure refers to a combination of Cas9 nickase and guide RNA
capable of introducing gRNA-targeted single-strand breaks in DNA
instead of the double-strand breaks created by wild type Cas
enzymes.
[0072] As used herein, the term "directing sequence-specific
binding" in the context of CRISPR complexes refers to a guide RNA's
ability to recruit a CRISPR endonuclease and/or a CRISPR-associated
effectors to a CRISPR landing site.
[0073] As used herein, the term "deaminase" refers to an enzyme
that catalyzes the deamination reaction. In some embodiments of the
present disclosure, the deaminase refers to a cytidine deaminase,
which catalyzes the deamination of a cytidine or a deoxycytidine to
a uracil or a deoxyuridine, respectively. In other embodiments of
the present disclosure, the deaminase refers to an adenosine
deaminase, which catalyzes the deamination of an adenine to form
hypoxanthine (in the form of its nucleoside inosine), which is read
as guanine by DNA polymerase.
[0074] As used herein, the term "glycosylase" refers to a family of
enzymes involved in base excision repair, classified under EC
number EC 3.2.2. Base excision repair is the mechanism by which
damaged bases in DNA are removed and replaced. DNA glycosylases
catalyze the first step of this process. They remove the damaged
nitrogenous base while leaving the sugar-phosphate backbone intact,
creating an apurinic/apyrimidinic site, commonly referred to as an
AP site. This is accomplished by flipping the damaged base out of
the double helix followed by cleavage of the N-glycosidic bond. In
some embodiments of the present disclosure, in an expectation of
affording a mutation introduction tendency different from that of
deaminase and the like, a base excision reaction by hydrolysis of
N-glycosidic bond of DNA, and then inducing mutation introduction
in a repair process of cells is used. In aspects, an enzyme having
cytosine-DNA glycosylase (CDG) activity or thymine-DNA glycosylase
(TDG) activity is used. In aspects, a mutant of yeast mitochondrial
uracil-DNA glycosylase (UNG 1), is used as an enzyme that performs
such base excision reaction. Nishida et al., US 2017/0321210 A1,
published on Nov. 9, 2017, is incorporated by reference herein.
[0075] As used herein the term "targeted" refers to the expectation
that one item or molecule will interact with another item or
molecule with a degree of specificity, so as to exclude
non-targeted items or molecules. For example, a first
polynucleotide that is targeted to a second polynucleotide,
according to the present disclosure has been designed to hybridize
with the second polynucleotide in a sequence specific manner (e.g.,
via Watson-Crick base pairing). In some embodiments, the selected
region of hybridization is designed so as to render the
hybridization unique to the one, or more targeted regions. A second
polynucleotide can cease to be a target of a first targeting
polynucleotide, if its targeting sequence (region of hybridization)
is mutated, or is otherwise removed/separated from the second
polynucleotide. Furthermore, "targeted" can be interchangeably used
with "site-specific" or "site-directed," which refers to an action
of molecular biology which uses information on the sequence of a
genomic region of interest to be modified, and which further relies
on information of the mechanism of action of molecular tools, e.g.,
nucleases, including CRISPR nucleases and variants thereof, TALENs,
ZFNs, meganucleases or recombinases, DNA-modifying enzymes,
including base modifying enzymes like cytidine deaminase enzymes,
histone modifying enzymes and the like, DNA-binding proteins,
cr/tracr RNAs, guide RNAs and the like.
[0076] The term "seed region" refers to the critical portion of a
crRNA's or guide RNA's guide sequence that is most susceptible to
mismatches with their targets. In some embodiments, a single
mismatch in the seed region of a crRNA/gRNA can render a CRISPR
complex inactive at that binding site. In some embodiments, the
seed regions for Cas9 endonucleases are located along the last
.about.12 nts of the 3' portion of the guide sequence, which
correspond (hybridize) to the portion of the protospacer target
sequence that is adjacent to the PAM. In some embodiments, the seed
regions for Cpf1 endonucleases are located along the first .about.5
nts of the 5' portion of the guide sequence, which correspond
(hybridize) to the portion of the protospacer target sequence
adjacent to the PAM.
[0077] The term "sequence identity" refers to the percentage of
bases or amino acids between two polynucleotide or polypeptide
sequences that are the same, and in the same relative position. As
such one polynucleotide or polypeptide sequence has a certain
percentage of sequence identity compared to another polynucleotide
or polypeptide sequence. For sequence comparison, typically one
sequence acts as a reference sequence, to which test sequences are
compared. The term "reference sequence" refers to a molecule to
which a test sequence is compared. When percentage of sequence
identity is used in reference to proteins it is recognized that
residue positions which are not identical often differ by
conservative amino acid substitutions, where amino acid residues
are substituted for other amino acid residues with similar chemical
properties (e.g., charge or hydrophobicity) and therefore do not
change the functional properties of the molecule. Where sequences
differ in conservative substitutions, the percent sequence identity
may be adjusted upwards to correct for the conservative nature of
the substitution. Sequences which differ by such conservative
substitutions are said to have "sequence similarity" or
"similarity." Means for making this adjustment are well-known to
those of skill in the art. Typically this involves scoring a
conservative substitution as a partial rather than a full mismatch,
thereby increasing the percentage sequence identity. Thus, for
example, where an identical amino acid is given a score of 1 and a
non-conservative substitution is given a score of zero, a
conservative substitution is given a score between zero and 1. The
scoring of conservative substitutions is calculated, e.g.,
according to the algorithm of Meyers and Miller, Computer Applic.
Biol. Sci., 4:11-17 (1988).
[0078] "Complementary" refers to the capacity for pairing, through
base stacking and specific hydrogen bonding, between two sequences
comprising naturally or non-naturally occurring bases or analogs
thereof. For example, if a base at one position of a nucleic acid
is capable of hydrogen bonding with a base at the corresponding
position of a target, then the bases are considered to be
complementary to each other at that position. Nucleic acids can
comprise universal bases, or inert abasic spacers that provide no
positive or negative contribution to hydrogen bonding. Base
pairings may include both canonical Watson-Crick base pairing and
non-Watson-Crick base pairing (e.g., Wobble base pairing and
Hoogsteen base pairing). It is understood that for complementary
base pairings, adenosine-type bases (A) are complementary to
thymidine-type bases (T) or uracil-type bases (U), that
cytosine-type bases (C) are complementary to guanosine-type bases
(G), and that universal bases such as such as 3-nitropyrrole or
5-nitroindole can hybridize to and are considered complementary to
any A, C, U, or T. Nichols et al., Nature, 1994; 369:492-493 and
Loakes et al., Nucleic Acids Res., 1994; 22:4039-4043. Inosine (I)
has also been considered in the art to be a universal base and is
considered complementary to any A, C, U, or T. See Watkins and
Santa Lucia, Nucl. Acids Research, 2005; 33 (19): 6258-6267.
[0079] As referred to herein, a "complementary nucleic acid
sequence" is a nucleic acid sequence comprising a sequence of
nucleotides that enables it to non-covalently bind to another
nucleic acid in a sequence-specific, antiparallel, manner (i.e., a
nucleic acid specifically binds to a complementary nucleic acid)
under the appropriate in vitro and/or in vivo conditions of
temperature and solution ionic strength.
[0080] Methods of sequence alignment for comparison and
determination of percent sequence identity and percent
complementarity are well known in the art. Optimal alignment of
sequences for comparison can be conducted, e.g., by the homology
alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol.
48:443, by the search for similarity method of Pearson and Lipman,
(1988) Proc. Nat'l. Acad. Sci. USA 85:2444, by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package, Genetics
Computer Group, 575 Science Dr., Madison, Wis.), by manual
alignment and visual inspection (see, e.g., Brent et al., (2003)
Current Protocols in Molecular Biology), by use of algorithms know
in the art including the BLAST and BLAST 2.0 algorithms, which are
described in Altschul et al., (1977) Nuc. Acids Res. 25:3389-3402;
and Altschul et al., (1990) J. Mol. Biol. 215:403-410,
respectively. Software for performing BLAST analyses is publicly
available through the National Center for Biotechnology
Information. Some alignment programs are MacVector (Oxford
Molecular Ltd, Oxford, U.K.), ALIGN Plus (Scientific and
Educational Software, Pennsylvania) and AlignX (Vector NTI,
Invitrogen, Carlsbad, Calif.). Another alignment program is
Sequencher (Gene Codes, Ann Arbor, Mich.), using default
parameters, and MUSCLE (Multiple Sequence Comparison by
Log-Expection; a computer software licensed as public domain).
[0081] Herein, the term "hybridize" refers to pairing between
complementary nucleotide bases (e.g., adenine (A) forms a base pair
with thymine (T) in a DNA molecule and with uracil (U) in an RNA
molecule, and guanine (G) forms a base pair with cytosine (C) in
both DNA and RNA molecules) to form a double-stranded nucleic acid
molecule. (See, e.g., Wahl and Berger (1987) Methods Enzymol.
152:399; Kimmel, (1987) Methods Enzymol. 152:507). In addition, it
is also known in the art that for hybridization between two RNA
molecules (e.g., dsRNA), guanine (G) base pairs with uracil (U).
For example, G/U base-pairing is partially responsible for the
degeneracy (i.e., redundancy) of the genetic code in the context of
tRNA anti-codon base-pairing with codons in mRNA. In the context of
this disclosure, a guanine (G) of a protein-binding segment (dsRNA
duplex) of a guide RNA molecule is considered complementary to a
uracil (U), and vice versa. As such, when a G/U base-pair can be
made at a given nucleotide position a protein-binding segment
(dsRNA duplex) of a guide RNA molecule, the position is not
considered to be non-complementary, but is instead considered to be
complementary. It is understood in the art that the sequence of
polynucleotide need not be 100% complementary to that of its target
nucleic acid to be specifically hybridizable. Moreover, a
polynucleotide may hybridize over one or more segments such that
intervening or adjacent segments are not involved in the
hybridization event (e.g., a loop structure or hairpin structure).
A polynucleotide can comprise at least 70%, at least 80%, at least
90%, at least 95%, at least 99%, or 100% sequence complementarity
to a target region within the target nucleic acid sequence to which
they are targeted.
[0082] The term "modified" refers to a substance or compound (e.g.,
a cell, a polynucleotide sequence, and/or a polypeptide sequence)
that has been altered or changed as compared to the corresponding
unmodified substance or compound.
[0083] "Isolated" refers to a material that is free to varying
degrees from components which normally accompany it as found in its
native state.
[0084] The term "gene edited plant, part or cell" as used herein
refers to a plant, part or cell that comprises one or more
endogenous genes that are edited by a gene editing system. The gene
editing system of the present disclosure comprises a targeting
element and/or an editing element. The targeting element is capable
of recognizing a target genomic sequence. The editing element is
capable of modifying the target genomic sequence, e.g., by
substitution or insertion of one or more nucleotides in the genomic
sequence, deletion of one or more nucleotides in the genomic
sequence, alteration of genomic sequences to include regulatory
sequences, insertion of transgenes at a safe harbor genomic site or
other specific location in the genome, or any combination thereof.
The targeting element and the editing element can be on the same
nucleic acid molecule or different nucleic acid molecules. In some
embodiments, the editing element is capable of precise genome
editing by substitution of a single nucleotide using a base editor,
such cytosine base editor (CBE) and/or adenine base editor (ABE),
which is directly or indirectly fused to a CRISPR-associated
effector protein.
[0085] The term "plant" refers to whole plants. The term "plant
part" include differentiated and undifferentiated tissues
including, but not limited to: plant organs, plant tissues, roots,
stems, shoots, rootstocks, scions, stipules, petals, leaves,
flowers, ovules, pollens, bracts, petioles, internodes, bark,
pubescence, tillers, rhizomes, fronds, blades, stamens, fruits,
seeds, tumor tissue and plant cells (e.g., single cells,
protoplasts, embryos, and callus tissue). Plant cells include,
without limitation, cells from seeds, suspension cultures, embryos,
meristematic regions, callus tissue, leaves, roots, shoots,
gametophytes, sporophytes, pollen and microspores. The plant tissue
may be in a plant or in a plant organ, tissue or cell culture.
[0086] As used herein when discussing plants, the term "ovule"
refers to the female gametophyte, whereas the term "pollen" means
the male gametophyte.
[0087] As used herein, the term "plant tissue" refers to any part
of a plant. Examples of plant organs include, but are not limited
to the leaf, stem, root, tuber, seed, branch, pubescence, nodule,
leaf axil, flower, pollen, stamen, pistil, petal, peduncle, stalk,
stigma, style, bract, fruit, trunk, carpel, sepal, anther, ovule,
pedicel, needle, cone, rhizome, stolon, shoot, pericarp, endosperm,
placenta, berry, stamen, and leaf sheath.
[0088] As used herein, the term "phenotype" refers to the
observable characters of an individual cell, cell culture, organism
(e.g., a plant), or group of organisms which results from the
interaction between that individual's genetic makeup (i.e.,
genotype) and the environment.
[0089] The terms "transgene" or "transgenic" as used herein refer
to at least one nucleic acid sequence that is taken from the genome
of one organism, or produced synthetically, and which is then
introduced into a host cell or organism or tissue of interest and
which is subsequently integrated into the host's genome by means of
"stable" transformation or transfection approaches. In contrast,
the term "transient" transformation or transfection or introduction
refers to a way of introducing molecular tools including at least
one nucleic acid (DNA, RNA, single-stranded or double-stranded or a
mixture thereof) and/or at least one amino acid sequence,
optionally comprising suitable chemical or biological agents, to
achieve a transfer into at least one compartment of interest of a
cell, including, but not restricted to, the cytoplasm, an
organelle, including the nucleus, a mitochondrion, a vacuole, a
chloroplast, or into a membrane, resulting in transcription and/or
translation and/or association and/or activity of the at least one
molecule introduced without achieving a stable integration or
incorporation and thus inheritance of the respective at least one
molecule introduced into the genome of a cell. The terms
"transgene-free" refers to a condition that transgene is not
present or found in the genome of a host cell or tissue or organism
of interest.
[0090] As used herein, the term "tissue culture" indicates a
composition comprising isolated cells of the same or a different
type or a collection of such cells organized into parts of a plant.
Exemplary types of tissue cultures are protoplasts, calli, plant
clumps, and plant cells that can generate tissue culture that are
intact in plants or parts of plants, such as embryos, pollen,
flowers, seeds, leaves, stems, roots, root tips, anthers, pistils,
meristematic cells, axillary buds, ovaries, seed coat, endosperm,
hypocotyls, cotyledons and the like. The term "plant organ" refers
to plant tissue or a group of tissues that constitute a
morphologically and functionally distinct part of a plant.
"Progeny" comprises any subsequent generation of a plant.
[0091] General methods in molecular and cellular biochemistry can
be found in such standard textbooks as Molecular Cloning: A
Laboratory Manual, 3rd Ed. (Sambrook et al., HaRBor Laboratory
Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel
et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag
et al., John Wiley & Sons 1996); Nonviral Vectors for Gene
Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors
(Kaplift & Loewy eds., Academic Press 1995); Immunology Methods
Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue
Culture: Laboratory Procedures in Biotechnology (Doyle &
Griffiths, John Wiley & Sons 1998), the disclosures of which
are incorporated herein by reference.
[0092] As used herein, the term "AGAMOUS Clade Transcription
Factor" or "AG clade transcription factor" is a member of the
AGAMOUS (AG) subfamily of MIKC-type MADS-box genes. "MIKC-type"
proteins represent a class of MADS-domain transcription factors and
are defined by a unique domain structure: (1) `M`--a highly
conserved DNA-binding MADS-domain, (2) `I`--an intervening domain,
(3) `K`--a keratin-like K-domain, and (4) `C`--a C-terminal domain.
In some embodiments, "AGAMOUS Clade Transcription Factor" or "AG
clade transcription factor" further comprises an N-terminal region.
In further embodiments, "AGAMOUS Clade Transcription Factor" or "AG
clade transcription factor" comprises AG, SHP1, SHP2, and STK genes
in plants of the present disclosure, each of which has a NN motif
in the M domain, a YQQ motif in the K domain, and/or a R/Q (R or Q)
in the C domain.
[0093] By "biologically active portion" is meant a portion of a
full-length parent peptide or polypeptide which portion retains an
activity of the parent molecule. For example, a biologically active
portion of polypeptide of the disclosure will retain the ability to
confer disease resistance, especially resistance to fungal
pathogens such as Fusarium. As used herein, the term "biologically
active portion" includes deletion mutants and peptides, for example
of at least about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 30, 40, 50, 60, 70, 80, 90, 100, 120, 150, 300,
400, 500, 600, 700, 800, 900 or 1000 contiguous amino acids, which
comprise an activity of a parent molecule. Portions of this type
may be obtained through the application of standard recombinant
nucleic acid techniques or synthesized using conventional liquid or
solid phase synthesis techniques. For example, reference may be
made to solution synthesis or solid phase synthesis as described,
for example, in Chapter 9 entitled "Peptide Synthesis" by Atherton
and Shephard which is included in a publication entitled "Synthetic
Vaccines" edited by Nicholson and published by Blackwell Scientific
Publications. Alternatively, peptides can be produced by digestion
of a peptide or polypeptide of the disclosure with proteinases such
as endoLys-C, endoArg-C, endoGlu-C and staphylococcus V8-protease.
The digested fragments can be purified by, for example, high
performance liquid chromatographic (HPLC) techniques. Recombinant
nucleic acid techniques can also be used to produce such
portions.
[0094] By "corresponds to" or "corresponding to" is meant a
polynucleotide (a) having a nucleotide sequence that is
substantially identical or complementary to all or a portion of a
reference polynucleotide sequence or (b) encoding an amino acid
sequence identical to an amino acid sequence in a peptide or
protein. This phrase also includes within its scope a peptide or
polypeptide having an amino acid sequence that is substantially
identical to a sequence of amino acids in a reference peptide or
protein.
[0095] The terms "growing" or "regeneration" as used herein mean
growing a whole, differentiated plant from a plant cell, a group of
plant cells, a plant part (including seeds), or a plant piece
(e.g., from a protoplast, callus, or tissue part).
[0096] As used herein, the term "derived from" refers to the origin
or source, and may include naturally occurring, recombinant,
unpurified, or purified molecules. A nucleic acid or an amino acid
derived from an origin or source may have all kinds of nucleotide
changes or protein modification as defined elsewhere herein.
[0097] By "obtained from" is meant that a sample such as, for
example, a nucleic acid extract or polypeptide extract is isolated
from, or derived from, a particular source. For example, the
extract may be isolated directly from plants, especially
monocotyledonous plants and more especially non-graminaceous
monocotyledonous plants such as banana.
[0098] The term "pathogen" is used herein in its broadest sense to
refer to an organism or an infectious agent whose infection of
cells of viable plant tissue elicits a disease response.
[0099] By "variant" polypeptide is intended a polypeptide derived
from the native protein by deletion (so-called truncation) or
addition of one or more amino acids to the N-terminal and/or
C-terminal end of the native protein; deletion or addition of one
or more amino acids at one or more sites in the native protein; or
substitution of one or more amino acids at one or more sites in the
native protein. Variant proteins encompassed by the present
disclosure are biologically active, that is they continue to
possess the desired biological activity of the native protein, that
is, modulating or regulatory activity as described herein. Such
variants may result from, for example, genetic polymorphism or from
human manipulation. Biologically active variants of a native R
protein of the disclosure will have at least 40%, 50%, 60%, 70%,
generally at least 75%, 80%, 85%, preferably about 90% to 95% or
more, and more preferably about 98% or more sequence identity to
the amino acid sequence for the native protein as determined by
sequence alignment programs described elsewhere herein using
default parameters. A biologically active variant of a protein of
the disclosure may differ from that protein by as few as 1-15 amino
acid residues, as few as 1-10, such as 6-10, as few as 5, as few as
4, 3, 2, or even 1 amino acid residue.
[0100] The proteins of the disclosure may be altered in various
ways including amino acid substitutions, deletions, truncations,
and insertions. Methods for such manipulations are generally known
in the art. For example, amino acid sequence variants of the R
proteins can be prepared by mutations in the DNA. Methods for
mutagenesis and nucleotide sequence alterations are well known in
the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA
82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382;
U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques
in Molecular Biology (MacMillan Publishing Company, New York) and
the references cited therein. Guidance as to appropriate amino acid
substitutions that do not affect biological activity of the protein
of interest may be found in the model of Dayhoff et al. (1978)
Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found.,
Washington, D.C.), herein incorporated by reference. Conservative
substitutions, such as exchanging one amino acid with another
having similar properties, may be preferable.
[0101] Individual substitutions deletions or additions that alter,
add or delete a single amino acid or a small percentage of amino
acids (typically less than 5%, more typically less than 1%) in an
encoded sequence are "conservatively modified variations," where
the alterations result in the substitution of an amino acid with a
chemically similar amino acid. Conservative substitution tables
providing functionally similar amino acids are well known in the
art. The following five groups each contain amino acids that are
conservative substitutions for one another, Aliphatic: Glycine (G),
Alanine (A), Valine (V), Leucine (L), Isoleucine (I); Aromatic:
Phenylalanine (F), Tyrosine (Y), Tryptophan (W); Sulfur-containing:
Methionine (M), Cysteine (C); Basic: Arginine I, Lysine (K),
Histidine (H); Acidic: Aspartic acid (D), Glutamic acid (E),
Asparagine (N), Glutamine (Q). See also, Creighton, 1984. In
addition, individual substitutions, deletions or additions which
alter, add or delete a single amino acid or a small percentage of
amino acids in an encoded sequence are also "conservatively
modified variations."
[0102] "Expression cassette" as used herein means a DNA sequence
capable of directing expression of a particular nucleotide sequence
in an appropriate host cell, comprising a promoter operably linked
to the nucleotide sequence of interest which is operably linked to
termination signals. It also typically comprises sequences required
for proper translation of the nucleotide sequence. The coding
region usually codes for a protein of interest but may also code
for a functional RNA of interest, for example antisense RNA or a
nontranslated RNA, in the sense or antisense direction. The
expression cassette comprising the nucleotide sequence of interest
may be chimeric, meaning that at least one of its components is
heterologous with respect to at least one of its other components.
The expression cassette may also be one which is naturally
occurring but has been obtained in a recombinant form useful for
heterologous expression. The expression of the nucleotide sequence
in the expression cassette may be under the control of a
constitutive promoter or of an inducible promoter which initiates
transcription only when the host cell is exposed to some particular
external stimulus. In the case of a multicellular organism, the
promoter can also be specific to a particular tissue or organ or
stage of development in animal and/or plant including banana
species.
[0103] As used herein, the term "vector", "plasmid", or "construct"
refers broadly to any plasmid or virus encoding an exogenous
nucleic acid. The term should also be construed to include
non-plasmid and non-viral compounds which facilitate transfer of
nucleic acid into virions or cells, such as, for example,
polylysine compounds and the like. The vector may be a viral vector
that is suitable as a delivery vehicle for delivery of the nucleic
acid, or mutant thereof, to a cell, or the vector may be a
non-viral vector which is suitable for the same purpose. Examples
of viral and non-viral vectors for delivery of DNA to cells and
tissues are well known in the art and are described, for example,
in Ma et al. (1997, Proc. Natl. Acad. Sci. U.S.A. 94:12744-12746).
Examples of viral vectors include, but are not limited to,
recombinant plant viruses. Non-limiting examples of plant viruses
include, TMV-mediated (transient) transfection into tobacco (Tuipe,
T-H et al (1993), J. Virology Meth, 42: 227-239), ssDNA genomes
viruses (e.g., family Geminiviridae), reverse transcribing viruses
(e.g., families Caulimoviridae, Pseudoviridae, and Metaviridae),
dsNRA viruses (e.g., families Reoviridae and Partitiviridae), (-)
ssRNA viruses (e.g., families Rhabdoviridae and Bunyaviridae), (+)
ssRNA viruses (e.g., families Bromoviridae, Closteroviridae,
Comoviridae, Luteoviridae, Potyviridae, Sequiviridae and
Tombusviridae) and viroids (e.g., families Pospiviroldae and
Avsunviroidae). Detailed classification information of plant
viruses can be found in Fauquet et al (2008, "Geminivirus strain
demarcation and nomenclature". Archives of Virology 153:783-821,
incorporated herein by reference in its entirety), and Khan et al.
(Plant viruses as molecular pathogens; Publisher Routledge, 2002,
ISBN 1560228954, 9781560228950). Examples of non-viral vectors
include, but are not limited to, liposomes, polyamine derivatives
of DNA, and the like.
[0104] Also, "vector" is defined to include, inter alia, any
plasmid, cosmid, phage or Agrobacterium binary vector in double or
single stranded linear or circular form which may or may not be
self-transmissible or mobilizablez, and which can transform
prokaryotic or eukaryotic host either by integration into the
cellular genome or exist extrachromosomally (e.g. autonomous
replicating plasmid with an origin of replication).
[0105] Specifically included are shuttle vectors by which is meant
a DNA vehicle capable, naturally or by design, of replication in
two different host organisms, which may be selected from
actinomycetes and related species, bacteria and eukaryotic (e.g.
higher plant, mammalian, yeast or fungal cells).
[0106] Preferably the nucleic acid in the vector is under the
control of, and operably linked to, an appropriate promoter or
other regulatory elements for transcription in a host cell such as
a microbial, e.g. bacterial, or plant cell. The vector may be a
bi-functional expression vector which functions in multiple hosts.
In the case of genomic DNA, this may contain its own promoter or
other regulatory elements and in the case of cDNA this may be under
the control of an appropriate promoter or other regulatory elements
for expression in the host cell.
[0107] "Cloning vectors" typically contain one or a small number of
restriction endonuclease recognition sites at which foreign DNA
sequences can be inserted in a determinable fashion without loss of
essential biological function of the vector, as well as a marker
gene that is suitable for use in the identification and selection
of cells transformed with the cloning vector. Marker genes
typically include genes that provide tetracycline resistance,
hygromycin resistance or ampicillin resistance.
[0108] As used herein, the term "resistant", or "resistance",
describes a plant, line or cultivar that shows fewer or reduced
symptoms to a biotic pest or pathogen than a susceptible (or more
susceptible) plant, line or variety to that biotic pest or
pathogen. These terms are variously applied to describe plants that
show no symptoms as well as plants showing some symptoms but that
are still able to produce marketable product with an acceptable
yield. Some lines that are referred to as resistant are only so in
the sense that they may still produce a crop, even though the
plants may appear visually stunted and the yield is reduced
compared to uninfected plants. As defined by the International Seed
Federation (ISF), a non-governmental, non-profit organization
representing the seed industry (see "Definition of the Terms
Describing the Reaction of Plants to Pests or Pathogens and to
Abiotic Stresses for the Vegetable Seed Industry", May 2005), the
recognition of whether a plant is affected by or subject to a pest
or pathogen can depend on the analytical method employed.
Resistance is defined by the ISF as the ability of plant types to
restrict the growth and development of a specified pest or pathogen
and/or the damage they cause when compared to susceptible plant
varieties under similar environmental conditions and pest or
pathogen pressure. Resistant plant types may still exhibit some
disease symptoms or damage. Two levels of resistance are defined.
The term "high/standard resistance" is used for plant varieties
that highly restrict the growth and development of the specified
pest or pathogen under normal pest or pathogen pressure when
compared to susceptible varieties. "Moderate/intermediate
resistance" is applied to plant types that restrict the growth and
development of the specified pest or pathogen, but exhibit a
greater range of symptoms or damage compared to plant types with
high resistance. Plant types with intermediate resistance will show
less severe symptoms than susceptible plant varieties, when grown
under similar field conditions and pathogen pressure. Methods of
evaluating resistance are well known to one skilled in the art.
Such evaluation may be performed by visual observation of a plant
or a plant part (e.g., leaves, roots, flowers, fruits et. al) in
determining the severity of symptoms. For example, when each plant
is given a resistance score on a scale of 1 to 5 based on the
severity of the reaction or symptoms, with 1 being the resistance
score applied to the most resistant plants (e.g., no symptoms, or
with the least symptoms), and 5 the score applied to the plants
with the most severe symptoms, then a line is rated as being
resistant when at least 75% of the plants have a resistance score
at a 1, 2, or 3 level, while susceptible lines are those having
more than 25% of the plants scoring at a 4 or 5 level. If a more
detailed visual evaluation is possible, then one can use a scale
from 1 to 10 so as to broaden out the range of scores and thereby
hopefully provide a greater scoring spread among the plants being
evaluated.
[0109] Another scoring system is a root inoculation test based on
the development of the necrosis after inoculation and its position
towards the cotyledon (such as one derived from Bosland et al.,
1991), wherein 0 stands for no symptom after infection; 1 stands
for a small necrosis at the hypocotyl after infection; 2 stands a
necrosis under the cotyledons after infection; 3 stands for
necrosis above the cotyledons after infection; 4 stands for a
necrosis above the cotyledons together with a wilt of the plant
after infection, while eventually, 5 stands for a dead plant.
[0110] In addition to such visual evaluations, disease evaluations
can be performed by determining the pathogen bio-density in a plant
or plant part using electron microscopy and/or through molecular
biological methods, such as protein hybridization (e.g., ELISA,
measuring pathogen protein density) and/or nucleic acid
hybridization (e.g., RT-PCR, measuring pathogen RNA density).
Depending on the particular pathogen/plant combination, a plant may
be determined resistant to the pathogen, for example, if it has a
pathogen RNA/DNA and/or protein density that is about 50%, or about
40%, or about 30%, or about 20%, or about 10%, or about 5%, or
about 2%, or about 1%, or about 0.1%, or about 0.01%, or about
0.001%, or about 0.0001% of the RNA/DNA and/or protein density in a
susceptible plant.
[0111] Methods used in breeding plants for disease resistance are
similar to those used in breeding for other characters. It is
necessary to know as much as possible about the nature of
inheritance of the resistant characters in the host plant and the
existence of physiological races or strains of the pathogen.
[0112] As used herein, the term "full resistance" is referred to as
complete failure of the pathogen to develop after infection, and
may either be the result of failure of the pathogen to enter the
cell (no initial infection) or may be the result of failure of the
pathogen to multiply in the cell and infect subsequent cells (no
subliminal infection, no spread). The presence of full resistance
may be determined by establishing the absence of pathogen protein
or pathogen RNA in cells of the plant, as well as the absence of
any disease symptoms in said plant, upon exposure of said plant to
an infective dosage of pathogen (i.e. after `infection`). Among
breeders, this phenotype is often referred to as "immune".
"Immunity" as used herein thus refers to a form of resistance
characterized by absence of pathogen replication even when the
pathogen is actively transferred into cells by e.g.
electroporation.
[0113] As used herein, the term "partial resistance" is referred to
as reduced multiplication of the pathogen in the cell, as reduced
(systemic) movement of the pathogen, and/or as reduced symptom
development after infection. The presence of partial resistance may
be determined by establishing the systemic presence of low
concentration of pathogen protein or pathogen RNA in the plant and
the presence of decreased or delayed disease-symptoms in said plant
upon exposure of said plant to an infective dosage of pathogen.
Protein concentration may be determined by using a quantitative
detection method (e.g. an ELISA method or a quantitative reverse
transcriptase-polymerase chain reaction (RT-PCR)). Among breeders,
this phenotype is often referred to as "intermediate
resistant."
[0114] As used herein, the term "tolerant" is used herein to
indicate a phenotype of a plant wherein disease-symptoms remain
absent upon exposure of said plant to an infective dosage of
pathogen, whereby the presence of a systemic or local pathogen
infection, pathogen multiplication, at least the presence of
pathogen genomic sequences in cells of said plant and/or genomic
integration thereof can be established. Tolerant plants are
therefore resistant for symptom expression but symptomless carriers
of the pathogen. Sometimes, pathogen sequences may be present or
even multiply in plants without causing disease symptoms. This
phenomenon is also known as "latent infection". In latent
infections, the pathogen may exist in a truly latent non-infectious
occult form, possibly as an integrated genome or an episomal agent
(so that pathogen protein cannot be found in the cytoplasm, while
PCR protocols may indicate the present of pathogen nucleic acid
sequences) or as an infectious and continuously replicating agent.
A reactivated pathogen may spread and initiate an epidemic among
susceptible contacts. The presence of a "latent infection" is
indistinguishable from the presence of a "tolerant" phenotype in a
plant.
[0115] As used herein, the term "susceptible" is used herein to
refer to a plant having no or virtually no resistance to the
pathogen resulting in entry of the pathogen into the plant and
multiplication and systemic spread of the pathogen, resulting in
disease symptoms. The term "susceptible" is therefore equivalent to
"non-resistant".
[0116] As used herein, the term "offspring" refers to any plant
resulting as progeny from a vegetative or sexual reproduction from
one or more parent plants or descendants thereof. For instance an
offspring plant may be obtained by cloning or selfing of a parent
plant or by crossing two parents plants and include selfings as
well as the F1 or F2 or still further generations. An F1 is a
first-generation offspring produced from parents at least one of
which is used for the first time as donor of a trait, while
offspring of second generation (F2) or subsequent generations (F3,
F4, etc.) are specimens produced from selfings of F1's, F2's etc.
An F1 may thus be (and usually is) a hybrid resulting from a cross
between two true breeding parents (true-breeding is homozygous for
a trait), while an F2 may be (and usually is) an offspring
resulting from self-pollination of said F1 hybrids.
[0117] As used herein, the terms "dicotyledon," "dicot" and
"dicotyledonous" refer to a flowering plant having an embryo
containing two seed halves or cotyledons. Examples include tobacco;
tomato; the legumes, including peas, alfalfa, clover and soybeans;
oaks; maples; roses; mints; squashes; daisies; walnuts; cacti;
violets and buttercups.
[0118] As used herein, the term "monocotyledon," "monocot" or
"monocotyledonous" refer to any of a subclass (Monocotyledoneae) of
flowering plants having an embryo containing only one seed leaf and
usually having parallel-veined leaves, flower parts in multiples of
three, and no secondary growth in stems and roots. Examples include
banana, daffodils, sugarcane, ginger, lily, orchid, rice, corn,
grasses, such as tall fescue, goat grass, and Kentucky bluegrass;
grains, such as wheat, oats and barley, irises; onion and palm.
[0119] As used herein, the term "gene" refers to any segment of DNA
associated with a biological function. Thus, genes include, but are
not limited to, coding sequences and/or the regulatory sequences
required for their expression. Genes can also include nonexpressed
DNA segments that, for example, form recognition sequences for
other proteins. Genes can be obtained from a variety of sources,
including cloning from a source of interest or synthesizing from
known or predicted sequence information, and may include sequences
designed to have desired parameters.
[0120] As used herein, the term "genotype" refers to the genetic
makeup of an individual cell, cell culture, tissue, organism (e.g.,
a plant), or group of organisms.
[0121] As used herein, the term "allele(s)" means any of one or
more alternative forms of a gene, all of which alleles relate to at
least one trait or characteristic. In a diploid cell, the two
alleles of a given gene occupy corresponding loci on a pair of
homologous chromosomes. Since the present disclosure relates to
QTLs, i.e. genomic regions that may comprise one or more genes or
regulatory sequences, it is in some instances more accurate to
refer to "haplotype" (i.e. an allele of a chromosomal segment)
instead of "allele", however, in those instances, the term "allele"
should be understood to comprise the term "haplotype". Alleles are
considered identical when they express a similar phenotype.
Differences in sequence are possible but not important as long as
they do not influence phenotype.
[0122] As used herein, the term "locus" (plural: "loci") refers to
any site that has been defined genetically. A locus may be a gene,
or part of a gene, or a DNA sequence that has some regulatory role,
and may be occupied by different sequences.
[0123] As used herein, the term "molecular marker" or "genetic
marker" refers to an indicator that is used in methods for
visualizing differences in characteristics of nucleic acid
sequences. Examples of such indicators are restriction fragment
length polymorphism (RFLP) markers, amplified fragment length
polymorphism (AFLP) markers, single nucleotide polymorphisms
(SNPs), insertion mutations, microsatellite markers (SSRs),
sequence-characterized amplified regions (SCARs), cleaved amplified
polymorphic sequence (CAPS) markers or isozyme markers or
combinations of the markers described herein which defines a
specific genetic and chromosomal location. Mapping of molecular
markers in the vicinity of an allele is a procedure which can be
performed quite easily by the average person skilled in
molecular-biological techniques which techniques are for instance
described in Lefebvre and Chevre, 1995; Lorez and Wenzel, 2007,
Srivastava and Narula, 2004, Meksem and Kahl, 2005, Phillips and
Vasil, 2001. General information concerning AFLP technology can be
found in Vos et al. (1995, AFLP: a new technique for DNA
fingerprinting, Nucleic Acids Res. 1995 November 11; 23(21):
4407-4414).
[0124] As used herein, the term "hemizygous" refers to a cell,
tissue or organism in which a gene is present only once in a
genotype, as a gene in a haploid cell or organism, a sex-linked
gene in the heterogametic sex, or a gene in a segment of chromosome
in a diploid cell or organism where its partner segment has been
deleted.
[0125] As used herein, the term "heterozygote" refers to a diploid
or polyploid individual cell or plant having different alleles
(forms of a given gene) present at least at one locus.
[0126] As used herein, the term "heterozygous" refers to the
presence of different alleles (forms of a given gene) at a
particular gene locus.
[0127] As used herein, the term "homozygote" refers to an
individual cell or plant having the same alleles at one or more
loci.
[0128] As used herein, the term "homozygous" refers to the presence
of identical alleles at one or more loci in homologous chromosomal
segments.
[0129] As used herein, the term "homologous" or "homolog" is known
in the art and refers to related sequences that share a common
ancestor or family member and are determined based on the degree of
sequence identity. The terms "homology", "homologous",
"substantially similar" and "corresponding substantially" are used
interchangeably herein. Homologs usually control, mediate, or
influence the same or similar biochemical pathways, yet particular
homologs may give rise to differing phenotypes. It is therefore
understood, as those skilled in the art will appreciate, that the
disclosure encompasses more than the specific exemplary sequences.
These terms describe the relationship between a gene found in one
species, subspecies, variety, cultivar or strain and the
corresponding or equivalent gene in another species, subspecies,
variety, cultivar or strain. For purposes of this disclosure
homologous sequences are compared.
[0130] The term "homolog" is sometimes used to apply to the
relationship between genes separated by the event of speciation
(see "ortholog") or to the relationship between genes separated by
the event of genetic duplication (see "paralog").
[0131] The term "homeolog" refers to a homeologous gene or
chromosome, resulting from polyploidy or chromosomal duplication
events. This contrasts with the more common `homolog`, which is
defined immediately above.
[0132] The term "ortholog" refers to genes in different species
that evolved from a common ancestral gene by speciation. Normally,
orthologs retain the same function in the course of evolution.
Identification of orthologs is critical for reliable prediction of
gene function in newly sequenced genomes.
[0133] The term "paralog" refers to genes related by duplication
within a genome. While orthologs generally retain the same function
in the course of evolution, paralogs can evolve new functions, even
if these are related to the original one.
[0134] "Homologous sequences" or "homologs" or "orthologs" are
thought, believed, or known to be functionally related. A
functional relationship may be indicated in any one of a number of
ways, including, but not limited to: (a) degree of sequence
identity and/or (b) the same or similar biological function.
Preferably, both (a) and (b) are indicated. The degree of sequence
identity may vary, but in one embodiment, is at least 50% (when
using standard sequence alignment programs known in the art), at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at least 90%, at least about 91%, at least about 92%,
at least about 93%, at least about 94%, at least about 95%, at
least about 96%, at least about 97%, at least about 98%, or at
least 98.5%, or at least about 99%, or at least 99.5%, or at least
99.8%, or at least 99.9%. Homology can be determined using software
programs readily available in the art, such as those discussed in
Current Protocols in Molecular Biology (F. M. Ausubel et al., eds.,
1987) Supplement 30, section 7.718, Table 7.71. Some alignment
programs are MacVector (Oxford Molecular Ltd, Oxford, U.K.) and
ALIGN Plus (Scientific and Educational Software, Pennsylvania).
Other non-limiting alignment programs include Sequencher (Gene
Codes, Ann Arbor, Mich.), AlignX, and Vector NTI (Invitrogen,
Carlsbad, Calif.).
[0135] As used herein, the term "hybrid" refers to any individual
cell, tissue or plant resulting from a cross between parents that
differ in one or more genes.
[0136] As used herein, the term "inbred" or "inbred line" refers to
a relatively true-breeding strain.
[0137] The term "single allele converted plant" as used herein
refers to those plants which are developed by a plant breeding
technique called backcrossing wherein essentially all of the
desired morphological and physiological characteristics of an
inbred are recovered in addition to the single allele transferred
into the inbred via the backcrossing technique.
[0138] As used herein, the term "line" is used broadly to include,
but is not limited to, a group of plants vegetatively propagated
from a single parent plant, via tissue culture techniques or a
group of inbred plants which are genetically very similar due to
descent from a common parent(s). A plant is said to "belong" to a
particular line if it (a) is a primary transformant (TO) plant
regenerated from material of that line; (b) has a pedigree
comprised of a TO plant of that line; or (c) is genetically very
similar due to common ancestry (e.g., via inbreeding or selfing).
In this context, the term "pedigree" denotes the lineage of a
plant, e.g. in terms of the sexual crosses affected such that a
gene or a combination of genes, in heterozygous (hemizygous) or
homozygous condition, imparts a desired trait to the plant.
[0139] As used herein, the terms "introgression", "introgressed"
and "introgressing" refer to the process whereby genes of one
species, variety or cultivar are moved into the genome of another
species, variety or cultivar, by crossing those species. The
crossing may be natural or artificial. The process may optionally
be completed by backcrossing to the recurrent parent, in which case
introgression refers to infiltration of the genes of one species
into the gene pool of another through repeated backcrossing of an
interspecific hybrid with one of its parents. An introgression may
also be described as a heterologous genetic material stably
integrated in the genome of a recipient plant.
[0140] As used herein, the term "population" means a genetically
homogeneous or heterogeneous collection of plants sharing a common
genetic derivation.
[0141] As used herein, the term "variety" or "cultivar" means a
group of similar plants that by structural features and performance
can be identified from other varieties within the same species. The
term "variety" as used herein has identical meaning to the
corresponding definition in the International Convention for the
Protection of New Varieties of Plants (UPOV treaty), of Dec. 2,
1961, as Revised at Geneva on Nov. 10, 1972, on Oct. 23, 1978, and
on Mar. 19, 1991. Thus, "variety" means a plant grouping within a
single botanical taxon of the lowest known rank, which grouping,
irrespective of whether the conditions for the grant of a breeder's
right are fully met, can be i) defined by the expression of the
characteristics resulting from a given genotype or combination of
genotypes, ii) distinguished from any other plant grouping by the
expression of at least one of the said characteristics and iii)
considered as a unit with regard to its suitability for being
propagated unchanged.
[0142] As used herein, the term "mass selection" refers to a form
of selection in which individual plants are selected and the next
generation propagated from the aggregate of their seeds. More
details of mass selection are described herein in the
specification.
[0143] As used herein, the term "open pollination" refers to a
plant population that is freely exposed to some gene flow, as
opposed to a closed one in which there is an effective barrier to
gene flow.
[0144] As used herein, the terms "open-pollinated population" or
"open-pollinated variety" refer to plants normally capable of at
least some cross-fertilization, selected to a standard, that may
show variation but that also have one or more genotypic or
phenotypic characteristics by which the population or the variety
can be differentiated from others. A hybrid, which has no barriers
to cross-pollination, is an open-pollinated population or an
open-pollinated variety.
[0145] As used herein, the term "self-crossing", "self pollinated"
or "self-pollination" means the pollen of one flower on one plant
is applied (artificially or naturally) to the ovule (stigma) of the
same or a different flower on the same plant.
[0146] As used herein, the term "cross", "crossing", "cross
pollination" or "cross-breeding" refer to the process by which the
pollen of one flower on one plant is applied (artificially or
naturally) to the ovule (stigma) of a flower on another plant.
[0147] As used herein, the term "derived from" refers to the origin
or source, and may include naturally occurring, recombinant,
unpurified, or purified molecules. A nucleic acid or an amino acid
derived from an origin or source may have all kinds of nucleotide
changes or protein modification as defined elsewhere herein.
[0148] The term "primer" as used herein refers to an
oligonucleotide which is capable of annealing to the amplification
target allowing a DNA polymerase to attach, thereby serving as a
point of initiation of DNA synthesis when placed under conditions
in which synthesis of primer extension product is induced, i.e., in
the presence of nucleotides and an agent for polymerization such as
DNA polymerase and at a suitable temperature and pH. The
(amplification) primer is preferably single stranded for maximum
efficiency in amplification. Preferably, the primer is an
oligodeoxyribonucleotide. The primer must be sufficiently long to
prime the synthesis of extension products in the presence of the
agent for polymerization. The exact lengths of the primers will
depend on many factors, including temperature and composition (A/T
and G/C content) of primer. A pair of bi-directional primers
consists of one forward and one reverse primer as commonly used in
the art of DNA amplification such as in PCR amplification.
[0149] A probe comprises an identifiable, isolated nucleic acid
that recognizes a target nucleic acid sequence. A probe includes a
nucleic acid that is attached to an addressable location, a
detectable label or other reporter molecule and that hybridizes to
a target sequence. Typical labels include radioactive isotopes,
enzyme substrates, co-factors, ligands, chemiluminescent or
fluorescent agents, haptens, and enzymes. Methods for labelling and
guidance in the choice of labels appropriate for various purposes
are discussed, for example, in Sambrook et al. (ed.), Molecular
Cloning: A Laboratory Manual, 2.sup.nd ed., vol. 1-3, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989 and Ausubel
et al. Short Protocols in Molecular Biology, 4.sup.th ed., John
Wiley & Sons, Inc., 1999.
[0150] Methods for preparing and using nucleic acid probes and
primers are described, for example, in Sambrook et al. (ed.),
Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., vol. 1-3,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989; Ausubel et al. Short Protocols in Molecular Biology, 4.sup.th
ed., John Wiley & Sons, Inc., 1999; and Innis et al. PCR
Protocols, A Guide to Methods and Applications, Academic Press,
Inc., San Diego, Calif., 1990. Amplification primer pairs can be
derived from a known sequence, for example, by using computer
programs intended for that purpose such as PRIMER (Version 0.5,
1991, Whitehead Institute for Biomedical Research, Cambridge,
Mass.). One of ordinary skill in the art will appreciate that the
specificity of a particular probe or primer increases with its
length. Thus, in order to obtain greater specificity, probes and
primers can be selected that comprise at least 20, 25, 30, 35, 40,
45, 50 or more consecutive nucleotides of a target nucleotide
sequences.
[0151] For PCR amplifications of the polynucleotides disclosed
herein, oligonucleotide primers can be designed for use in PCR
reactions to amplify corresponding DNA sequences from cDNA or
genomic DNA extracted from any organism of interest. Methods for
designing PCR primers and PCR cloning are generally known in the
art and are disclosed in Sambrook et al. (2001) Molecular Cloning:
A Laboratory Manual (3rd ed., Cold Spring Harbor Laboratory Press,
Plainview, N.Y.). See also Innis et al., eds. (1990) PCR Protocols:
A Guide to Methods and Applications (Academic Press, New York);
Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New
York); and Innis and Gelfand, eds. (1999) PCR Methods Manual
(Academic Press, New York). Known methods of PCR include, but are
not limited to, methods using paired primers, nested primers,
single specific primers, degenerate primers, gene-specific primers,
vector-specific primers, partially-mismatched primers, and the
like.
[0152] The present disclosure provides an isolated nucleic acid
sequence comprising a sequence selected from the group consisting
of FusR1, homologs of FusR1, orthologs of FusR1, paralogs of FusR1,
and fragments and variations thereof. In one embodiment, the
present disclosure provides an isolated polynucleotide encoding a
protein produced by the nucleic acid sequence for FusR1, comprising
a nucleic acid sequence that shares at least 70%, at least 75%, at
least 80%, at least 85%, at least 90%, at least 91%, at least 92%,
at least 93%, at least 94%, at least 95%, at least 96%, at least
97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at
least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at
least 99.7%, at least 99.8%, or at least 99.9% identity to
FusR1.
[0153] Methods of alignment of sequences for comparison are well
known in the art. Various programs and alignment algorithms are
described in: Smith and Waterman (Adv. Appl. Math., 2:482, 1981);
Needleman and Wunsch (J. Mol. Biol., 48:443, 1970); Pearson and
Lipman (Proc. Natl. Acad. Sci., 85:2444, 1988); Higgins and Sharp
(Gene, 73:237-44, 1988); Higgins and Sharp (CABIOS, 5:151-53,
1989); Corpet et al. (Nuc. Acids Res., 16:10881-90, 1988); Huang et
al. (Comp. Appls Biosci., 8:155-65, 1992); and Pearson et al.
(Meth. Mol. Biol., 24:307-31, 1994). Altschul et al. (Nature
Genet., 6:119-29, 1994) presents a detailed consideration of
sequence alignment methods and homology calculations.
[0154] The present disclosure also provides a chimeric gene
comprising the isolated nucleic acid sequence of any one of the
polynucleotides described above operably linked to suitable
regulatory sequences.
[0155] The present disclosure also provides a recombinant construct
comprising the chimeric gene as described above. In one embodiment,
said recombinant construct is a gene silencing construct, such as
used in RNAi gene silencing. In another embodiment, said
recombinant construct is a gene editing construct, such as used in
CRISPR-Cas gene editing system.
[0156] The expression vectors of the present disclosure may include
at least one selectable marker. Such markers include dihydrofolate
reductase, G418 or neomycin resistance for eukaryotic cell culture
and tetracycline, kanamycin or ampicillin resistance genes for
culturing in E. coli and other bacteria.
[0157] The present disclosure also provides a transformed host cell
comprising the chimeric gene as described above. In one embodiment,
said host cell is selected from the group consisting of bacteria,
yeasts, filamentous fungi, algae, animals, and plants including,
but not limited to Musa genus.
[0158] These sequences allow the design of gene-specific primers
and probes for FusR1, homologs of FusR1, orthologs of FusR1,
homeologs of FusR1, paralogs of FusR1, and fragments and variations
thereof.
II. Modulation of Disease Resistance
[0159] The present disclosure is drawn to polynucleotides and/or
polypeptides of newly-identified FusR1 (Fusarium Resistant 1) and
methods for modulating, stimulating or enhancing disease resistance
in plants, caused by pathogens. Pathogens of the disclosure
include, but are not limited to, bacteria, fungi, viruses or
viroids, nematodes, insects, and the like.
[0160] Bacterial pathogens include but are not limited to
Pseudomonas avenae subsp. avenae, Xanthomonas campestris pv.
holcicola, Enterobacter dissolvens, Envinia dissolvens, Ervinia
carotovora subsp. carotovora, Envinia chrysanthemi pv. zeae,
Pseudomonas andropogonis, Pseudomonas syringae pv. coronafaciens,
Clavibacter michiganensis subsp., Corynebacterium michiganense pv.
nebraskense, Pseudomonas syringae pv. syringae, Herniparasitic
bacteria (see under fungi), Bacillus subtilis, Envinia stewartii,
and Spiroplasma kunkelii.
[0161] Fungal pathogens include but are not limited to
Collelotrichum graminicola, Glomerella graminicola Politis,
Glomerella lucumanensis, Aspergillus flavus, Rhizoctonia solani
Kuhn, Thanatephorus cucumeris, Acremonium strictum W. Gams,
Cephalosporium acremonium Auct. non Corda Black Lasiodiplodia
theobromae=Bolr odiplodia y theobromas Borde blanco Marasmiellus
sp., Physoderma maydis, Cephalosporium Corticium sasakii,
Curvularia clavata, C. maculans, Cochhobolus eragrostidis,
Curvularia inaequahs, C. intermedia (teleomorph Cochhobolus
intermedius), Curvularia lunata (teleomorph: Cochliobolus lunatus),
Curvularia pallescens (teleomorph Cochliobolus pallescens),
Curvularia senegalensis, C. luberculata (teleomorph: Cochliobolus
tuberculatus), Didymella exitalis Diplodiaftumenti
(teleomorph--Botryosphaeriafestucae), Diplodia maydis=Stenocarpella
maydis, Stenocarpella macrospora=Diplodia macrospora, Sclerophthora
rayssiae var. zeae, Sclerophthora macrospora=Sclerospora
macrospora, Sclerospora graminicola, Peronosclerospora
maydis=Sclerospora maydis, Peronosclerospora philippinensis,
Sclerospora philippinensis, Peronosclerospora sorghi=Sclerospora
sorghi, Peronosclerospora spontanea=Sclerospora spontanea,
Peronosclerospora sacchari=Sclerospora sacchari, Nigrospora oryzae
(teleomorph: Khuskia oryzae) A. Iternaria alternala=A. tenuis,
Aspergillus glaucus, A. niger, Aspergillus spp., Botrytis cinerea,
Cunninghamella sp., Curvulariapallescens, Doratomyces
slemonitis=Cephalotrichum slemonitis, Fusarium culmorum,
Gonatobotrys simplex, Pithomyces maydicus, Rhizopus microsporus
Tiegh., R. stolonifer=R. nigricans, Scopulariopsis brumptii,
Claviceps gigantea (anamorph: Sphacelia sp.) Aureobasidium
zeae=Kabatiella zeae, Fusarium subglutinans=F. moniliforme var.
subglutinans, Fusarium moniliforme, Fusarium avenaceum (teleomorph
Gibberella avenacea), Botryosphaeria zeae=Physalospora zeae
(anamorph: Allacrophoma zeae), Cercospora sorghi=C. sorghi var.
maydis, Helminthosporium pedicellatum (teleomorph:
Selosphaeriapedicellata), Cladosporium cladosporioides=Hormodendrum
cladosporioides, C. herbarum (teleomorph Mycosphaerella tassiana),
Cephalosporium maydis, A. Iternaria alternata, A. scochyta maydis,
A. tritici, A. zeicola, Bipolaris victoriae, Helminthosporium
victoriae (teleomorph Cochhoholus victoriae), C. sativus (anamorph:
Bipolaris sorokiniana=H. sorokinianum=H. sativum), Epicoccum
nigrum, Exserohilum prolatum=Drechslera prolata (teleomorph:
Setosphaeriaprolata), Graphium penicillioides, Leptosphaeria
maydis, Leptothyrium zeae, Ophiosphaerella herpotricha (anamorph
Scolecosporiella sp.), Pataphaeosphaeria michotii, Phoma sp.,
Septoria zeae, S. zeicola, S. zeina Setosphaeria turcica,
Exserohilzim turcicum=Helminthosporium furcicum, Cochhoholus
carbonum, Bipolaris zeicola=Helminthosporium carhonum, Penicilhum
spp., P. chrysogenum, P. expansum, P. oxalicum, Phaeocytostroma
ambiguum, Phaeocylosporella zeae, Phaeosphaeria maydis=Sphaerulina
nmaydis, Botryosphaeriafestucae=Physalospora zeicola (anamorph:
Diplodiaftumenfi), Herniparasitic bacteria and fungi Pyrenochaeta
Phoma terrestris=Pyrenochaeta terrestris, Pythiumn spp., P.
arrhenomanes, P. graminicola, Pythium aphanidermatum=P. hutleri L.,
Rhizoctonia zeae (teleomorph: Waitea circinata), Rhizoctonia
solani, minor A Iternaria alternala, Cercospora sorghi,
Dictochaetaftrtilis, Fusarium acuminatum (teleomorph Gihherella
acuminata), E. equiseti (teleomorph: G. intricans), E. oxysporum,
E. pallidoroseum, E. poae, E. roseum, G. cyanogena (anamorph: E.
sulphureum), Microdochium holleyi, Mucor sp., Periconia circinata,
Phytophthora cactorum, P. drechsleri, P. nicotianae var.
parasitica, Phytophthora spp., Rhizopus arrhizus, Setosphaeria
rostrata, Exserohilum rostratum=Helminthosporium rostratum,
Puccinia sorghi, Physopella pallescens, P. zeae, Sclerotium rofsii
Sacc. (teleomorph Athelia rotfsii), Bipolaris sorokiniana, B.
zeicola=Helminthosporium carbonum, Diplodia maydis, Exserohilum
pedicillatum, Exserohilum furcicum=Helminthosporium turcicum,
Fusarium avenaceum, E. culmorum, E. moniliforme, Gibberella zeae
(anamorph E. graminearum), Macrophominaphaseolina, Penicillium
spp., Phomopsis sp., Pythium spp., Rhizoctonia solani, R. zeae,
Sclerotium rolfsfi, Spicaria sp., Selenophoma sp., Gaeumannomyces
graminis, Myrothecium gramineum, Monascus purpureus, M ruber Smut,
Ustilago zeae=U. maydis Smut, Ustilaginoidea virens Smut,
Sphacelotheca reiliana=Sporisorium holci, Cochliobolus
heterostrophus (anamorph: Bipolaris maydis=Helminthosporium
maydis), Stenocarpella macrospora=Diplodia macrospora, Cercospora
sorghi, Fusarium episphaeria, E. merismoides, F. oxysporum
Schlechtend, Fusarium oxysporum f sp. cubense (Foc), Fusarium spp.,
E. poae, E. roseum, E. solani (teleomorph: Nectria haematococca),
F. tricincturn, Mariannaea elegans, Mucor sp., Rhopographus zeae,
Spicaria sp., Aspergillus spp., Penicillium spp., Trichoderma
viride=T. lignorum teleomorph: Hypocrea sp., Stenocarpella
maydis=Diplodia zeae, Ascochyta ischaemi, Phyllosticta maydis
(teleomorph: Mycosphaerella zeae-maydis), Mycosphaerella fijiensis,
Pseudocercospora (Paracercospora) fijiensi and Gloeocercospora
sorghi.
[0162] Virus or viroids include but are not limited to American
wheat striate mosaic virus mosaic (AWSMV), barley stripe mosaic
virus (BSMV), barley yellow dwarf virus (BYDV), banana bunchy top
virus, Brome mosaic virus (BMV), cereal chlorotic mottle virus
(CCMV), corn chlorotic vein banding virus (CCVBV), maize chlorotic
mottle virus (MCMV), maize dwarf mosaic virus (MDMV), A or B, wheat
streak mosaic virus (WSMV), cucumber mosaic virus (CMV), cynodon
chlorotic streak virus (CCSV), Johnsongrass mosaic virus (JGMV),
maize bushy stunt or mycoplasma-like organism (NILO), maize
chlorotic dwarf virus (MCDV), maize chlorotic mottle virus (MCMV),
maize dwarf mosaic virus (MDMV) strains A, D, E and F, maize leaf
fleck virus (MLFV), maize line virus (NELV), maize mosaic virus
(MMV), maize mottle and chlorotic stunt virus, maize pellucid
ringspot virus (MPRV), maize raya gruesa virus (MRGV), maize rayado
fino virus (MRFV), maize red leaf and red stripe virus (MRSV),
maize ring mottle virus (MRMV), maize rio cuarto virus (MRCV),
maize rough dwarf virus (MRDV), maize sterile stunt virus (strains
of barley yellow striate virus), maize streak virus (MSV), maize
chlorotic stripe, maize hoja Maize stripe virus blanca, maize
stunting virus, maize tassel abortion virus (MTAV), maize vein
enation virus (MVEV), maize wallaby ear virus (MAVEV), maize white
leaf virus, maize white line mosaic virus (NTVVLMV), millet red
leaf virus (NMV), viruses of the family Nanoviridae, Northern
cereal mosaic virus (NCMV), oat pseudorosette virus, oat sterile
dwarf virus (OSDV), rice black-streaked dwarf virus (RBSDV), rice
stripe virus (RSV), sorghum mosaic virus (SrMV), formerly sugarcane
mosaic virus (SCMV) stains H, I and M, sugarcane Fiji disease virus
(FDV), sugarcane mosaic virus (SCMV) strains A, B, D, E, SC, BC,
Sabi and NM vein enation virus, and wheat spot mosaic virus
(WSMV).
[0163] Parasitic nematodes include but are not limited to Awl
Dolichodorus spp., D. heterocephalus Bulb and stem (Europe),
Ditylenchus dipsaci Burrowing Radopholus similis Cyst Heterodera
avenae, H. zeae, Punctodera chalcoensis Dagger Xiphinema spp., X.
americanum, X. mediterraneum False root-knot Nacobbus dorsalis
Lance, Columbia Hoplolaimus columbus Lance Hoplolaimus spp., H.
galeatus Lesion Pratylenchus spp., P. brachyurus, P. crenalus, P.
hexincisus, P. neglectus, P. penetrans, P. scribneri, P. thornei,
P. zeae Needle Longidorus spp., L. breviannulatus Ring Criconemella
spp., C. ornata Root-knot Meloidogyne spp., M. chitwoodi, M.
incognita, M. javanica Spiral Helicotylenchus spp., Belonolaimus
spp., B. longicaudatus Stubby-root Paratrichodorus spp., P.
christiei, P. minor, Ouinisulcius aculus, and Trichodorus spp.
[0164] Insect pests include insects selected from the orders
Coleoptera, Diptera, Hymenoptera, Lepidoptera, Mallophaga,
Homoptera, Hemiptera, Orthoptera, Thysanoptera, Dermaptera,
Isoptera, Anoplura, Siphonaptera, Trichoptera, etc., particularly
Coleoptera and Lepidoptera.
[0165] In some embodiments, the plant pathogen is selected from
fungi, especially soil borne fungi such as Fusarium oxysporum,
water and air-borne viruses such as Mycosphaerella fijiensis
(Morelet), Mycosphaerella musicola (Leach ex Mulder),
Pseudocercospora (Paracercospora) fijiensi, Verticillium dahliae,
Cladosporium and Ralstona Solanaceum.
[0166] In some embodiments, said disease is Fusarium wilt, also
known as Panama disease, which is a lethal fungal disease caused by
the soil-borne fungus Fusarium oxysporum f. sp. cubense (Foc). Said
disease can also be known as Panama Disease TR4, Foc, Panama
Disease Tropical Race 4, or TR4. In some embodiments, resistance to
TR4 is combined within a single cultivar with genetic resistances
or tolerances to one or more additional diseases, such as
resistance to diseases caused by bacteria, other fungi, viruses,
nematodes, insects and the like.
[0167] Fusarium wilt is one of the most destructive and notorious
diseases of banana. It is also known as Panama disease, in
recognition of the extensive damage it caused in export plantations
in this Central American country. By 1960, Fusarium wilt had
destroyed an estimated 40,000 ha of `Gros Michel` (AAA), causing
the export industry to convert to cultivars in the Cavendish
subgroup (AAA) (Ploetz and Pegg, 2000). Fusarium wilt is caused by
the soil-borne hyphomycete, Fusarium oxysporum Schlect. f sp.
cubense. It is one of more than 120 formae speciales (special
forms) of F. oxysporum that cause vascular wilts of flowering
plants. This pathogen affects species of Musa and Heliconia, and
strains have been classified into four physiological races based on
pathogenicity to host cultivars in the field (race 1, `Gros
Michel`; race 2, `Bluggoe`; race 3, Heliconia spp.; and race 4,
Cavendish cultivars and all cultivars susceptible to race 1 and 2).
Four Fusarium oxysporum races have been named, Race 1 through Race
4. Race 1 is a critical pathogen of many banana cultivars. Race 2
attacks cooking bananas. Race 3 affects banana relatives in the
Americas, but doesn't seem to affect bananas. The current threat
stems from the expansion of Fusarium oxysporum race 4, also known
as TR4 (Tropical Race 4), which is designated as `Foc-TR4`. Race 4
has two subgroups, TR4 and SR4 (subtropical race 4). Until
recently, race 4 had only been recorded to cause serious losses in
the subtropical regions of Australia, South Africa, the Canary
Islands, and Taiwan. Banana growers and banana companies have
repeatedly stated that if this race were to become established in
the Americas, the world export industries would be severely
affected, as there is no widely accepted replacement for Cavendish
cultivars (Bentley et al., 1998).
[0168] Very recently, (Stokstad, 2019), Panama Disease Race 4
(Fusarium wilt) has now been detected in the Western Hemisphere.
The disease was found in four plantations in Columbia. These four
plantations were immediately quarantined. However, a substantial
part of the banana market consists of exports from Central and
South America to the United States. This market is now critically
imperiled, making a swift solution to the crisis even more urgent.
The recent emergence of Panama Disease TR4 in the Western
Hemisphere makes a swift solution to the crisis even more
urgent.
[0169] In some embodiments, `Fusarium Wilt" or `FW` can be used
interchangeably, which designates the disease as displayed in
infected banana plants.
[0170] In the 1950s and 1960s, a single variety, Gros Michel, was
grown widely. It was highly sensitive to the easily spread fungus
Fusarium oxysporum f sp. cubense. In particular, it was Fusarium
Tropical Race 1 (Foc-TR1) which caused a fatal wilt disease, and
the global banana industry was nearly destroyed. The Cavendish
variety was found to be highly resistant to Foc-TR1, and replaced
Gros Michel for global banana production. In the 1990s, growers
began to find banana plants infected with Foc-TR4, a newly emerging
race. Foc-TR4 is also easily spread and has been found in banana
plantations in Asia, the Middle East, and Africa, again threatening
the global banana crop. Great concern has been provoked by the
recent identification of Foc-TR4 in the Caribbean, which means that
the fungus now has a beachhead in the Western Hemisphere, thus
threatening Latin America banana production. In some embodiments,
the present disclosure provide a solution to serious problems on
bananas caused by Foc-TR4. In some embodiments, the solution is
drawn to identification of disease-resistant genetic materials
and/or architecture and importation of said genetic materials and
architecture to banana varieties that are susceptible to pathogenic
fungi (e.g. Foc-TR4).
[0171] Bananas are also susceptible to other pathogenic fungi,
particularly Mycosphaerella fijiensis (Morelet) which causes black
leaf streak disease (also known as Black Sigatoka and Black Sig)
and M. musicola, which causes Yellow Sigatoka leaf spot disease. It
is known that these fungi fijiensis and M. musicola) are controlled
with fungicides, but fungicides are ineffective against
Foc-TR4.
[0172] The present disclosure teaches method of modulating,
stimulating, or enhancing disease resistance in plants, caused by
pathogens such as Foc-TR4 using next generation plant breeding
techniques, also known as new breeding techniques.
[0173] New breeding techniques (NBTs) refer to various new
technologies developed and/or used to create new characteristics in
plants through genetic variation, the aim being targeted
mutagenesis, targeted introduction of new genes or gene silencing
(RdDM). The following breeding techniques are within the scope of
NBTs: targeted sequence changes facilitated through the use of Zinc
finger nuclease (ZFN) technology (ZFN-1, ZFN-2 and ZFN-3, see U.S.
Pat. No. 9,145,565, incorporated by reference in its entirety),
Oligonucleotide directed mutagenesis (ODM, a.k.a., site-directed
mutagenesis), Cisgenesis and intragenesis, epigenetic approaches
such as RNA-dependent DNA methylation (RdDM, which does not
necessarily change nucleotide sequence but can change the
biological activity of the sequence), Grafting (on GM rootstock),
Reverse breeding, Agro-infiltration for transient gene expression
(agro-infiltration "sensu stricto", agro-inoculation, floral dip),
Transcription Activator-Like Effector Nucleases (TALEN5, see U.S.
Pat. Nos. 8,586,363 and 9,181,535, incorporated by reference in
their entireties), the CRISPR/Cas system (see U.S. Pat. Nos.
8,697,359; 8,771,945; 8,795,965; 8,865,406; 8,871,445; 8,889,356;
8,895,308; 8,906,616; 8,932,814; 8,945,839; 8,993,233; and
8,999,641, which are all hereby incorporated by reference),
engineered meganuclease, re-engineered homing endonucleases, DNA
guided genome editing (Gao et al., Nature Biotechnology (2016),
doi: 10.1038/nbt.3547, incorporated by reference in its entirety),
and Synthetic genomics. A major part of today's targeted genome
editing, another designation for New Breeding Techniques, is the
applications to induce a DNA double strand break (DSB) at a
selected location in the genome where the modification is intended.
Directed repair of the DSB allows for targeted genome editing. Such
applications can be utilized to generate mutations (e.g., targeted
mutations or precise native gene editing) as well as precise
insertion of genes (e.g., cisgenes, intragenes, or transgenes). The
applications leading to mutations are often identified as
site-directed nuclease (SDN) technology, such as SDN1, SDN2 and
SDN3. For SDN1, the outcome is a targeted, non-specific genetic
deletion mutation: the position of the DNA DSB is precisely
selected, but the DNA repair by the host cell is random and results
in small nucleotide deletions, additions or substitutions. For
SDN2, a SDN is used to generate a targeted DSB and a DNA repair
template (a short DNA sequence identical to the targeted DSB DNA
sequence except for one or a few nucleotide changes) is used to
repair the DSB: this results in a targeted and predetermined point
mutation in the desired gene of interest. As to the SDN3, the SDN
is used along with a DNA repair template that contains new DNA
sequence (e.g. gene). The outcome of the technology would be the
integration of that DNA sequence into the plant genome. The most
likely application illustrating the use of SDN3 would be the
insertion of cisgenic, intragenic, or transgenic expression
cassettes at a selected genome location. A complete description of
each of these techniques can be found in the report made by the
Joint Research Center (JRC) Institute for Prospective Technological
Studies of the European Commission in 2011 and titled "New plant
breeding techniques--State-of-the-art and prospects for commercial
development", which is incorporated by reference in its
entirety.
[0174] In some embodiments, various approaches have been taken to
prevent or treat Foc-TR4 infection. The present disclosure teaches
that a key approach to prevent or treat Foc-TR4 is to (1) find
resistant banana cultivars, (2) to identify resistance genes and/or
traits from the selected banana cultivars, and (3) breed/introduce
the resistance genes and/or traits into sensitive banana
cultivars.
[0175] Zuo et al. (2018) evaluated 129 banana accessions and found
10 that are highly resistant to Foc-TR4--thus providing naturally
existing resistant cultivars for study.
[0176] Li et al. (2012) looked at the transcriptomes and expression
profiles of roots of a resistant mutant and compared these to
sensitive wild type Brazilian Cavendish bananas at two time points
after challenge with Foc-TR4. They found some 88,000 unigenes, with
5,000 related to defense pathways in other plants. They concluded
that some 2,600 genes were differentially expressed in the
resistant mutant, including some plant cell lignification genes
that were expressed at the same or lower levels in the resistant
mutant.
[0177] In similar fashion, Bai et al. (2013) compared root
transcriptomes from the Foc-TR4 sensitive Brazilian cultivar to the
Yueyoukangl cultivar that is known to have far lower disease
severity. Bai et al. found differential expression for 500 to 2000
different unigenes at different time points, and these could be
clustered into 11 different types of metabolic pathways. Bai et al.
found genes connected to cell wall lignification that were
differentially regulated between the sensitive and resistant
cultivars--specifically 4-coumarate: CoA ligase (4CL), glutathione
S-transferase (GST), cellulose synthase, Caffeoyl-CoA
O-methyltransferase (CCoAM), and cinnamylalcohol dehydrogenase
(CAD) were expressed at higher levels in the resistant cultivar and
concluded that cell wall lignification could be one of the
mechanisms involved in Foc-TR4 resistance. Bai et al. pointed out
that this was inconsistent with the result found in Li et al.
(2012) and concluded that different plants could have different
resistance mechanisms and that more work is required to decipher
how banana cultivars are able to resist Foc-TR4.
[0178] Wang et al. (2017) also looked at differential root gene
expression at the time of flower bud differentiation and found 107
genes differentially expressed in the roots between a susceptible
banana cultivar and a sensitive one.
[0179] Zhang et al. (2018) showed that Foc-TR4 infection proceeds
similarly in the roots of a resistant cultivar (Pahang) and a
susceptible cultivar (Brazilian) until reaching the corm, where the
fungal biomass and degree of necrosis were significantly less in
the Pahang vs. Brazilian. (The banana `corm` is an underground
stem, or rhizome, from which the roots grow.)
[0180] Van der Berg et al. (2007) used quantitative RT-PCR to
identify genes that are were up-regulated in the FW-tolerant
GCTCV-218 banana cultivar after infection with Foc-4. Their control
was the FW-sensitive Williams cultivar. They found that a number of
genes were up-regulated in FW-tolerant GCTCV-218 as compared to
FW-sensitive Williams. As expected, many of the up-regulated genes
were homologous to known defense-associated genes, including cell
wall-strengthening genes. They reported 13 genes that were
up-regulated in roots. While they state that "The results shed
light on genes involved in defence and provide a step towards
understanding Fusarium wilt of banana and thereby developing an
effective disease management strategy", the paper does not suggest
that any one of 13 that they deposited in GenBank can be used for
controlling Fusarium Wilt. No particular strategy is given for use
of these genes to control Fusarium Wilt.
[0181] Vishnevetsky et al. (2009) (U.S. Pat. No. 7,534,930)
described a method to genetically engineer banana plants to confer
exogenous disease resistance traits, including resistance to Black
and Yellow Sigatoka and Botrytis cinerea. Vishnevetsky et al.
manipulated three polynucleotides into banana plants, including
genes encoding endochitinase, stilbene synthase, and superoxide
dismutase.
[0182] Paul et al (2011) isolated a gene from the nematode C.
elegans that, when stably transformed into the `Lady finger` banana
cultivar, appeared in greenhouse trials to confer resistance to
Race 1 of Panama Disease.
[0183] Although transformation of bananas with a gene derived from
a nematode is unlikely to be accepted by consumers, follow-up work
by Dale's group with a gene derived from bananas does show promise
for achieving Fusarium resistance in GMO-transformed bananas. For
example, Peraza-Echeverria et al (2009) isolated a resistance gene
analog (RGA2) gene from a wild banana, Musa acuminata malaccensis.
This gene is a member of the large NB-LRR-type resistance gene
family. When transformed into FW-sensitive Cavendish plants (Dale
et al, 2017), the gene appears to confer resistance to Fusarium.
Dale et al (2017) conducted field trials of transgenic banana
plants for 3 years. At the trial's conclusion, some 67% to 100% of
FW-sensitive control plants were dead or infected. However, in four
lines of bananas transfected with their candidate gene, fewer than
30% of the transformed bananas showed signs of severe infection
(i.e., >70% showed some tolerance or resistance). One line
transformed with RGA2 appeared to be immune to TR4. While this is
good evidence that the gene may confer some FW-resistance, the gene
was first isolated over a decade ago and it is unclear whether the
banana growing industry will ever embrace the RGA2 gene.
[0184] It is important to note that it is believed (unpublished
communications with banana industry breeders and scientists) that
there may be up to four genes in the Musa genome that contribute
some degree of Fusarium resistance so RGA2 alone is unlikely to
solve the present crisis, even if it is accepted by growers. Even
if RGA2 finds acceptance, that the industry has a dire need for
multiple genes to control TR4.
[0185] Inventor notes that FusR1 of the present disclosure is
completely unrelated to RGA2. The two genes have completely
different nucleotide sequences (i.e., they have no sequence
identity), they lie on different chromosomes, they have different
biochemistries, and they have different mechanisms of action in the
plant.
[0186] Wu et al. (2016) sequenced a disease-resistant wild banana
relative, Musa itinerans, found in subtropical China. Ks values
were calculated in order to estimate speciation and
paleoploidization events in the Musa genus. Also Ka/Ks values were
calculated to show that as expected, most genes in the Musa
itinerans genome have undergone purifying selection. It was
suggested that M. itinerans is known to be disease resistant, thus,
its genome could be mined for disease resistance genes.
[0187] In some embodiments, the present disclosure provides methods
of finding, identifying, and selecting genes resistant to diseases,
such as Fusarium wilt from FW-resistant banana cultivars. In other
embodiments, the present disclosure provides nucleotide and
polypeptide sequences of Fusarium-resistant genes (e.g. FusR1 gene)
identified from the methods of the present disclosure. In further
embodiments, the present disclosure teaches methods of generating
and/or producing banana varieties having resistance genes and/or
traits by using next generation plant breeding technology, which
include but are not limited to CRISPR technology described in the
present disclosure.
III. Identification of FusR1 Gene from Musa Genus
[0188] Cultivated bananas are generally triploid (although a few
are diploid) as a result of their complex evolutionary and
domestication history which involved a number of interspecific and
intraspecific hybridization events, both natural and human-driven.
Edible, cultivated bananas are largely the result of hybridization
between two wild diploid species, Musa acuminata and Musa
balbisiana (Christelova et al., 2017). Human domestication of
bananas began about 7,000 years ago in Southeast Asia (D'Hont et
al, 2012). Banana genomes derived from M. acuminata are known as
"A" genomes, while bananas derived from M. balbisiana have "B"
genomes (D'Hont et al., 2012). Thus the genome structure of the
diploid M. acuminata is labeled AA, and the genomic structure of
diploid M. balbisiana is BB. Edible banana cultivars may thus have
triploid AAA genomes (like Cavendish or Gros Michel), AAB genomes
(as in many plantains), or ABB genomes (like the Cachaco landrace).
M. acuminata likely arose in Malaysia or Indonesia (Christelova et
al., 2017). In contrast, M. balbisiana is believed to have
originated in India, Thailand or the Philippines (Christelova et
al., 2017). Thus, these two species were originally allopatric and
geographic isolation provided an opportunity for each species to
develop unique traits. When humans later moved M. acuminata
cultivars to areas populated by M. balbisiana, interspecific
hybridization took place.
[0189] The economically critical Cavendish cultivar, which accounts
for at least 99% of commercial banana export production, exhibits
triploid induced sterility. This, combined with parthenocarpy,
gives rise to edible fruit without seeds, but severely hampers
breeding, so Cavendish bananas are propagated vegetatively
(clonally). The Cavendish genotype has three M. acuminata-derived
"A" genomes.
[0190] In some embodiments, inventor identified genes that
effectively control Fusarium Wilt in banana. For example, the
present disclosure teaches that a gene, which is named FusR1
(Fusarium Resistance 1) was identified by using inventor's
molecular evolutionary analysis approach. The resent disclosure
teaches that the FusR1 gene is a native gene in Musa species,
including cultivated bananas, M. itinerans, M. acuminata, M.
balbisiana, M. basjoo, as well as Musella lasiocarpa, the sole
member of a closely related genus. The ortholog (two alleles) from
the wild banana relative, Musa itinerans, is given here as SEQ ID
NO: 1 and SEQ ID NO: 4. The M. itinerans FusR1 sequences were
obtained from multiple accessions (including, but not limited to,
ITC1526, ITC1571, and PT-BA-00223). All M. itinerans accessions are
extremely FW-resistant (Li et al., 2015; Wu et al., 2016).
[0191] The present disclosure teaches that inventor identified two
alleles of FusR1 in M. itinerans. SEQ ID NO: 1 gives allele #1 of
the FusR1 mRNA sequence. SEQ ID NO: 2 gives the allele #1 coding
sequence. SEQ ID NO: 4 gives allele #2 of the FusR1 mRNA sequence.
SEQ ID NO: 5 gives the allele #2 coding sequence. Alleles 1 and 2
are very similar in sequence: they code for just four amino acid
differences.
[0192] A second transcript of FusR1 was identified (SEQ ID NO: 7)
from M. itinerans; this transcript has an expressed (i.e.,
unspliced) intron that results in disruption of the proper reading
frame. This is expressed at very low levels.
[0193] M. itinerans is naturally extremely resistant to the effects
of Fusarium Wilt (Li et al., 2015; Wu et al., 2016). In some
embodiments, the FusR1 gene from M. itinerans is responsible for
resistance to Fusarium Wilt.
[0194] The present disclosure further teaches that inventor
identified three alleles of FusR1 in M acuminata. Two of these
alleles were isolated from FW-resistant accessions of M. acuminata.
The third allele was isolated from an FW-sensitive M. acuminata
accession. The M. acuminata FusR1 FW-resistant sequences were
obtained from multiple FW-resistant accessions, including ITC0896
(M. a. subspecies banksii) and PT BA-00281 (Pisang Bangkahulu). The
M. acuminata FW-sensitive sequence is from the FW-sensitive
accessions ITC0507, ITC0685, PT-BA-00304, PT-BA-00310, and
PT-BA-00315.
[0195] SEQ ID NO: 8 gives the mRNA sequence of allele 1 of the
FW-resistant FusR1 gene from M. acuminata. SEQ ID NO: 10 gives the
mRNA sequence of allele 2 of the FW-resistant FusR1 gene from M.
acuminata. The coding sequence of FW-resistant allele 1 from M.
acuminata is given in SEQ ID 9. SEQ ID NO: 11 gives the coding
sequence of FW-resistant allele 2 from M. acuminata.
[0196] SEQ ID NO: 13 gives the mRNA sequence of the FW-sensitive
FusR1 allele from M acuminata. (The M. acuminata FW-sensitive
sequence was identified from accessions ITC0507, ITC0685,
PT-BA-00304, PT-BA-00310, and PT-BA-00315. These accessions include
multiple samples from banana cultivars such as Pisang Madu, Pisang
Pipit, and Pisang Rojo Uter, all of which have been
well-characterized as FW-sensitive (Chen et al, 2019).
[0197] Inventor identified a putative core promoter for FusR1 from
M. acuminata. Inventor used two different promoter prediction
applications in an attempt to find congruent predictions from
different algorithms/software.
[0198] As a first step, inventor amplified and sequenced a 753 bp
sequence fragment (SEQ ID NO: 31), which begins upstream of the
coding region of the FW-resistant-allele of the FusR1 gene derived
from M. acuminata. This fragment is 100% identical to
bp7868911-bp7869210 and bp7869341-bp7869743 of GenBank accession
NC_025206 (Musa acuminata subsp. malaccensis chromosome 5,
ASM31385v2, whole genome shotgun sequence), which lies on M.
acuminata Chromosome 5.
[0199] Inventor first analyzed the upstream region of FusR1 using
the "Neural Network Promoter Prediction" (NNPP), which is available
on the Berkeley Drosophila Genome Project (BDGP). BDGP is a
consortium of the Drosophila Genome Center, funded by the National
Human Genome Research Institute, the National Cancer Institute, and
the Howard Hughes Medical Institute. The NNPP software was
`trained` on human and Drosophila melanogaster promoter sequences,
but has proven to be generally effective at identifying promoter
sequences, even in plants (Reese, 2001).
[0200] NNPP analysis successfully identified a core promoter for
FusR1. Analysis results follow. The first 189 bases of SEQ ID NO:
31 (shown in lower case) are non-coding upstream sequence,
including the 5' UTR sequence of FusR1; the next 423 bases are
coding sequence (shown in UPPER CASE). This coding sequence is
identical to SEQ ID NO: 9. The last 141 bases are 3' UTR (shown in
lower case). Bases 92-141 of SEQ ID NO: 31
(atcgtggcactataaataggacaagaggagggatgaggtaaaacgcactc) are the NNPP
predicted promoter sequence, shown in lower case bold. The
transcription start site (TSS) at base pair 132 is shown in lower
case underlined bold. NNPP assigns a score of 0.88 (i.e., 88%
confidence level) to this promoter.
TABLE-US-00001 SEQ ID NO: 31:
gtagagacacttgagttgaattctgaatccattatttcttctcatgaacg
catacgtcccaccatacacaccaaatcttaatggctcaagcatcgtggca c
taggacaagaggagggatgaggtaaaacgcactccctcatact
tgcacaggtacgttgtgatagaaagttcagaggtaagcgATGGCTGGAGG
AGGCAAAAGAGGTGAAGCGTCGTCTCTTCTACTTGTGACGCTGCTCGTGA
CGTTGTTGGCTTTCTTCGCCACCAACTCCTCGGCAGCCCGTGTCACACCC
CGTCCGCAATCCCTCGCCAGAGCGGCACTGAGTGCGGTGGGGGCAAGGCA
AGATGAGCCGTGCTGCAGATGCGCGTGTCCTCTCATTTACCCACCTACTT
GGTGCATTTGCGGCGGCATATGGCAAGGCTCCTGCCCTTCCGCCTGCAAC
AACTGCCAGTGTGTCCTCAACGAGTGCACTTGCCTCGATCTTATGGACCC
CAAGGTCTGCGAGGCCAACTCCTGTCCCTGGCCTGTTGCAGCCCCCAAAG
TAGAGCCGGCGCAGCAGTGGGCTATCGAAGAAACCGGTGGGAAATTAGCG
ATGATGGTGTGAtccaattgtgtttgtgatcgcctgtcgtcttctctcgc
tccgtcctatccatctatccatccatctacttataatctatgtcgtgtac
cgtcgtgtggtgttgctttgcttcagtaataaaaataaaatgcttctgct ttt
[0201] Inventor then analyzed the upstream region of FusR1 from M.
acuminata using the "Prediction of PLANT Promoters" (TSSP)
software, which is targeted specifically at identification of plant
promoter sequences (Solovyev and Shahmuradov, 2003). This is a part
of a suite of sequence analysis software produced by Softberry,
Inc. TSSP identified the transcription start site (TSS) as position
132 in SEQ ID NO: 31, which is identical to the NNPP software
results (see above). TSSP located the FusR1 TATA box (shown above
in lower case italics) at bases 102-107 of SEQ ID NO: 31. Thus the
FusR1 TATA box lies, as expected, 25 base pairs upstream of the
TSS.
[0202] As these 2 different promoter prediction applications give
congruent results, inventor identified the correct promoter
sequence for M. acuminata.
[0203] The present disclosure teaches methods of introducing the
newly-identified FusR1 gene and its variants into cultivated
bananas, particularly the Fusarium-sensitive Cavendish cultivar in
order to make these cultivars resistant to Fusarium Wilt. In some
embodiments, the present disclosure teaches that traditional plant
breeding methods can be used to introduce FusR1 gene/trait from M.
itinerans into Cavendish and other cultivated bananas. In other
embodiments, the present disclosure teaches that next generation
plant breeding methods can be used to introduce FusR1 gene/trait
from M. itinerans into Cavendish and other cultivated bananas. In
further embodiments, the present disclosure teaches methods of
introducing FusR1 gene/trait from M itinerans into Cavendish and
other cultivated bananas using genome editing techniques such as
targeted genome editing system using zinc finger nucleases (ZFN),
transcription activator like effector nucleases (TALEN) or
CRISPR/Cas9 system technology exploiting the endonuclease activity
of CRISPR-associated (Cas) proteins with sequence specificity
directed by CRISPR RNAs (crRNAs).
[0204] Given the threat of likely extinction for Cavendish, the
present disclosure provides a rapid, efficient, and precise genome
editing approach using CRISPR/Cas9 system adapted for production of
minimally genetically-edited bananas having Fusarium-resistant
gene/trait, which will be accepted especially in developing
countries where banana provides critical economic and food
security. The present disclosure teaches that the transfer of the
native FusR1 gene from M itinerans to cultivated bananas can be
best accomplished with CRISPR technology, which allows a targeted,
clean, and efficient transfer and which, as compared to more
traditional genetic editing techniques, minimizes potential side
effects.
[0205] In some embodiments, useful alleles of FusR1 (SEQ ID NO: 8
and SEQ ID NO: 10) are identified from naturally FW-resistant M.
acuminata populations. These alleles confer FW-resistance. The
present disclosure teaches that the FusR1 allele derived from M.
acuminata can be used, in combination with FusR1 alleles derived
from M. itinerans (SEQ ID NO: 2 and SEQ ID NO: 5), to enhance
FW-resistance in cultivated bananas, particularly Cavendish.
[0206] The present disclosure teaches gene stacking with at least
two FusR1 genes identified by inventor disclosed in the present
disclosure.
[0207] Both the M. itinerans FusR1 ortholog (SEQ ID NO: 2 and SEQ
ID NO: 5) and the M acuminata FW-resistant alleles (SEQ ID NO: 8
and SEQ ID NO: 10) can be used in traditional plant breeding and/or
new generation plant breeding approaches. The new generation plant
breeding approaches include but are not limited to
marker-assisted-selection (MAS) and/or genome editing techniques in
cultivated bananas.
[0208] Some M. balbisiana accessions have been rigorously
characterized as very resistant to FW, while others are extremely
FW-sensitive. While it might be expected that the wild M balbisiana
accessions would be resistant to a pathogen like Fusarium, it has
been difficult for researchers to understand why closely related
accessions differ so significantly in terms of FW resistance.
[0209] Inventor discovered a structural difference of the
nucleotide sequences of FusR1 gene in FW-sensitive M. balbisiana
accessions as shown in FIG. 5. All the FW-sensitive M. balbisiana
accessions inventor analyzed contain a `broken` FusR1 transcript.
This analysis is restricted to the `broken` FusR1 genes found in
all FW-sensitive accessions that were examined. FusR1 mRNAs in all
M. balbisiana accessions inventor examined had an unspliced,
expressed intron that disrupts proper reading frame. In addition,
inventor found (i) a long 82 or 84 bp deletion in several FusR1
mRNAs(2) in all accessions, a smaller 1 bp deletion, or (ii), in
some accessions, a 4 bp insertion, each of which also disrupts the
open reading frame, thus coding for a mutated, non-functional FUSR1
protein. All FW-sensitive M. balbisiana accessions have one or more
of these reading frame disrupters described above, resulting in a
non-functional protein. In some embodiments, the present disclosure
teaches that some M. balbisiana accessions have all four reading
frame disrupters. See FIG. 5.
[0210] In other embodiments, inventor also discovered another
significant difference when studying FW-resistant vs. FW-sensitive
M. acuminata accessions. In some embodiments, FusR1 in M. acuminata
give resistance vs. sensitivity depending on FusR1 alleles. The
present disclosure teaches that two alleles, which turned out to be
"resistant alleles" confer FW-resistance; SEQ ID NO: 8 and SEQ ID
NO: 10. These two alleles are very similar in sequence to the FusR1
ortholog derived from the FW-resistant wild banana spaces, M.
basjoo (SEQ ID NO: 17 and SEQ ID NO: 20. The third allele, the
FW-sensitive allele, is found only in FW-sensitive M. acuminata
accessions (SEQ ID NO: 13).
[0211] The M. balbisiana FusR1 sequence (SEQ ID NO: 26 and SEQ ID
NO: 27) does not confer FW resistance, because this gene is damaged
(as it is in all the FW-sensitive M. balbisiana accessions
examined) by reading-frame disrupting indels and/or expressed
unspliced introns that cause loss of FW resistance.
[0212] In further embodiments, FusR1 sequences derived from
FW-resistant M. acuminata accessions (SEQ ID NO: 8 and SEQ ID NO:
10) have a very high sequence similarity to the FusR1 ortholog
derived from M. basjoo (SEQ ID ID: 17). M. basjoo is a wild banana
species that is very resistant to FW (Li et al., 2015). In other
embodiments, the FusR1 sequence (SEQ ID NO: 13) from FW-sensitive
M. acuminata accessions differs from the FW-resistant M. acuminata
alleles (SEQ ID NO: 8 and SEQ ID NO: 10).
[0213] The present disclosure teaches that FW-resistance in M.
acuminata depends upon having the allele found only in FW-resistant
accessions. Although M. acuminata and M. balbisiana are more
closely related to each other than either is to M. itinerans or M.
basjoo, the FusR1 sequences that control FW-resistance cluster
together in direct contrast to the way the species are actually
related. In other embodiments, the FusR1 gene has adapted (i.e.,
been positively selected) so that FusR1 fails to reflect the actual
relationships within Musa species. The present disclosure teaches
two independent adaptive events (convergent evolution) or perhaps
the FW-resistant FusR1 version has been traded between various Musa
species (gene transfer).
[0214] Inventor confirmed the true phylogenetic relationships
between these Musa species by sequencing two different, conserved,
single-copy genes, C2H2 and TOPO6, from several Musa species.
C2H2-type zinc finger proteins play important roles in plant
development and growth as well as abiotic stress resistance,
including for fruit ripening in banana (Han et al., Front. Plant
Sci., Vol. 11, Article 115:1-13, 20 Feb. 2020; Han et at,
Postharvest Biology and Technology, 1.16:8-15, June 2010. TOPO6, a
nuclear gene-marker region of subunit B of the plant homolog of
archaean topoisomerase VI, occurs as single-copy locus in the
haploid genome of most plant groups (Frank R. Blattner, Plant
Systematics and Evolution, Vol. 302: 239-244, 2016). These two
genes (whose biochemical functions are well-known) have no role in
pathogen control, making them ideal as `controls` for understanding
the adaptive changes imposed on banana FusR1 as a result of
exposure to Fusarium. Thus, the disclosure teaches that the
consensus in the literature that M. acuminata and M. balbisiana are
sister species is correct, meaning that significant changes have
occurred to our newly-identified gene, FusR1, in these banana
species, providing yet more evidence that FusR1 confers
FW-resistance. See the phylogenetic trees provided in FIGS. 3 and
4.
[0215] The present disclosure teaches the critical sequence
differences between the strongly FW-resistant FusR1 alleles from M.
itinerans, which allows the inventor to determine the exact few
nucleotides that make FusR1 capable of controlling FW. Based on the
inventor's findings, the present disclosure teaches a method of
using CRISPR/Cas system to confer FW-resistance in FW-sensitive
Cavendish (as well as all other cultivated bananas), by precisely
changing only a few critical nucleotides in FusR1. Also, the
present disclosure also teaches a method of using these critical
nucleotides to create a novel FusR1 sequence with greater
FW-resistance than the native gene.
IV. FusR1 Gene and Variants Thereof
[0216] The present disclosure is predicated, in part, on the
isolation of novel FusR1 gene from banana varieties and species.
The nucleotide sequences of this FusR1 gene and its orthologs
sequences are presented in SEQ ID NO: 1-2, 4-5, 7-11, 13-14, 16-18,
20-21, 23-24, and 26-31 respectively.
[0217] In some embodiments, SEQ ID NO: 1 is partial mRNA sequence
for allele 1 of FusR1 from Musa itinerans, the most
Fusarium-resistant wild banana species. SEQ ID NO: 4 is partial
mRNA sequence for allele 2 of FusR1 from Musa itinerans.
[0218] The aforementioned FusR1 alleles from M. itinerans (SEQ ID
NO: 1 and SEQ ID NO: 4) code for slightly different proteins, which
are SEQ ID NO: 3 and SEQ ID NO: 6, respectively. The translated
polypeptide of SEQ ID NO: 1 is presented as SEQ ID NO: 3. The
translated polypeptide of SEQ ID NO: 4 is presented as SEQ ID NO:
6. These are only slightly different, with the few differing amino
acid residues all being biochemically conservative. In some
embodiments, 5 different M. itinerans accessions were sequenced and
all accessions had these same two FusR1 alleles.
[0219] In some embodiments, SEQ ID NO: 8 and SEQ ID NO: 10 are
partial mRNAs (including the full coding sequences). These are the
FW-resistant alleles of FusR1 from Musa acuminata ssp. banksia
(Accession No. ITC0896) and PT_BA-00281(Pisang Bankahulu). These
two alleles differ at a single silent site. In other embodiments,
SEQ ID NO: 13 represents the FW-sensitive allele from M. acuminata.
In further embodiments, SEQ ID NO: 9 and SEQ ID NO: 11 represent
the coding sequence for the FW-resistant alleles from M. acuminata.
Also, SEQ ID NO: 12 represents the FW-resistant protein sequence
from M. acuminata, which is a translated polypeptide sequence of
SEQ ID NO: 8 and SEQ ID NO: 10.
[0220] In some embodiments, SEQ ID NO: 17 and SEQ ID NO: 20 are
partial mRNA FusR1 allele sequences from M. basjoo, a wild banana
species that is resistant to Fusarium. In other embodiments, SEQ ID
NO: 23 is the FusR1 sequence from another wild banana relative,
Musella lasiocarpa.
[0221] It is noted that all of the mRNA sequences inventor reports
herein are technically partial, as they lack a bit of 5'UTR and
usually a few bases of the extreme end of the 3'UTR. The vast
majority of the mRNAs reported herein are very close to being full
sequence.
[0222] In some embodiments, SEQ ID NO: 26, and SEQ ID NO: 28-30 are
the partial mRNA FusR1 sequences from several different M.
balbisiana accessions. SEQ ID NO: 27 is the FusR1 coding sequence
from M. balbisiana. In some embodiments, a large number of
FW-sensitive M balbisiana accessions were examined. In all the
FusR1 sequences from FW-sensitive M balbisiana accessions, the
structure of the FusR1 sequence is broken and/or damaged. All the
FW-sensitive M. balbisiana accessions had a FusR1 coding sequence
with a 1 bp deletion at position 340 in the coding sequence. All
FW-sensitive M. balbisiana accessions also had a long unspliced,
expressed intron in the coding sequence. Several also had a long
(82-84 bp) deletion, some had another 4 bp deletion, and in all
cases, a one base pair deletion (relative to FusR1 from other plant
species, including all other banana accessions While it is true
that 84 bp, as a multiple of three, doesn't disrupt the reading
frame, it does remove 28 amino acid residues from the protein's
primary structure, thus potentially disrupting the folded protein's
tertiary structure and thus negatively impacting function. In any
case, based on our findings, the ubiquitous 1 bp deletion always
results in reading frame disruption.
[0223] Inventor included mRNA sequences from Musa balbisiana
accessions from which inventor sequenced FusR1. These illustrate
the various ways in which FusR1 is `broken` in M balbisiana.
Inventor notes herein that EVERY M. balbisiana accession inventor
analyzed has a broken FusR1 mRNA transcript. FIG. 5 shows these M.
balbisiana FusR1 sequences aligned.
[0224] M. balbisiana accession ITC1016 (SEQ ID NO: 26) contains an
82 base pair unspliced, expressed intron. This intron disrupts the
reading frame, resulting in a premature termination codon located 8
bp into the intron, which causes a truncated 141 bp coding sequence
(as opposed to the proper 423 bp coding sequence). In addition,
this accession (and, in fact, all M. balbisiana accessions) also
has a one base pair deletion, located about 90 bp 5'-ward of the
true termination codon, which (even if the intron had been properly
spliced out) results in a premature stop codon, giving a truncated
coding sequence.
[0225] M. balbisiana accession ITC0545 (SEQ ID NO: 28) contains the
same 82 base pair unspliced, expressed intron. This intron disrupts
the reading frame, resulting in a premature stop codon located 8 bp
into the intron, causing a truncated 141 bp coding sequence (as
opposed to the proper 423 bp coding sequence). Another 27 bp
downstream of the expressed intron lies an 85 bp deletion. While
this in combination with the 84 bp expressed intron would
mathematically restore the correct reading frame, (85 bp-82 bp=3
bp), as explained above, it causes the loss of 28 amino acid
residues that lie in a functionally critical region of the folded
FusR1 protein. In addition, this accession also has the one base
pair deletion, located about 90 bp 5'-ward of the true termination
codon, which (even if the intron had been properly spliced out)
results in a premature stop codon, giving a truncated coding
sequence. Finally, the FusR1 mRNA from this accession also has a
frame-disrupting 4 bp insertion farther downstream.
[0226] M. balbisiana accession ITC0080 (SEQ ID NO: 29) contains the
same unspliced, expressed intron as the previous accessions, except
that this version of the unspliced intron is 84 bp in length. While
this expressed intron doesn't disrupt reading frame, it does
introduce 28 extra amino acid residues that lie in a functionally
critical region of the folded protein and thus very likely prevents
proper folding of the FusR1 protein. In addition, this accession
also has the one base pair deletion, located about 90 bp 5'-ward of
the true termination codon, which (even if the intron had been
properly spliced out) results in a premature stop codon, giving a
truncated coding sequence.
[0227] M. balbisiana accession ITC1527 (SEQ ID NO: 30) contains the
same unspliced, expressed intron as the previous accessions, this
time 82 bp long. Again, this intron disrupts the reading frame,
resulting in a premature stop codon located 8 bp into the intron,
causing a truncated 141 bp coding sequence (as opposed to the
proper 423 bp coding sequence). In addition, the FusR1 mRNA from
this accession has a 4 bp insertion farther downstream. In
addition, this accession also has the one base pair deletion,
located about 90 bp 5'-ward of the true termination codon, which
(even if the intron had been properly spliced out) results in a
premature stop codon, giving a truncated coding sequence.
[0228] All M. balbisiana accessions inventor analyzed have some
combination of one or more of these various flaws in their FusR1
mRNA.
[0229] Table 1 summarizes sequence information of the present
disclosure.
TABLE-US-00002 TABLE 1 Summary of Sequence Information SEQ ID NO.
Sequence Type Origin Brief Description SEQ ID Nucleotide Musa
itinerans Partial mRNA sequence for the NO: 1 FW*-resistant FusR1
transcript 1, allele 1 from Musa itinerans SEQ ID Nucleotide Musa
itinerans FusR1 allele 1 FW-resistant NO: 2 coding sequence from M.
itinerans SEQ ID Protein Musa itinerans Protein sequence of FUSR1
FW- NO: 3 resistant allele 1 from M. itinerans SEQ ID Nucleotide
Musa itinerans Partial mRNA sequence for NO: 4 FusR1transcript 1
FW-resistant allele 2 from Musa itinerans SEQ ID Nucleotide Musa
itinerans FusR1 FW-resistant allele 2 NO: 5 coding sequence from M.
itinerans SEQ ID Protein Musa itinerans Protein sequence of FUSR1
FW- NO: 6 resistant allele 2 from M. itinerans SEQ ID Nucleotide
Musa itinerans Partial mRNA sequence for NO: 7 FusR1 transcript 2
from Musa itinerans SEQ ID Nucleotide Musa acuminata ssp. Partial
mRNA sequence for FW- NO: 8 banksii resistant FusR1 allele 1 from
M. acuminata SEQ ID Nucleotide Musa acuminata ssp. Coding sequence
of FW- NO: 9 banksii resistant FusR1 allele 1 from M. acuminata SEQ
ID Nucleotide Musa acuminata ssp. Partial mRNA sequence for FW- NO:
10 banksii resistant FusR1 allele 2 from M. acuminata SEQ ID
Nucleotide Musa acuminata ssp. Coding sequence of FW- NO: 11
banksii resistant FusR1 allele 2 from M. acuminata SEQ ID Protein
Musa acuminata ssp. Protein sequence of FW- NO: 12 banksii
resistant FUSR1 from M. acuminata SEQ ID Nucleotide Musa acuminata
Partial mRNA sequence for NO: 13 FW-sensitive FusR1 allele from M.
acuminata SEQ ID Nucleotide Musa acuminata Coding sequence of FW-
NO: 14 sensitive FusR1 allele from M. acuminata SEQ ID Protein Musa
acuminata Protein sequence of FW-sensitive NO: 15 FusR1 from M.
acuminata SEQ ID Nucleotide Musa acuminata Partial mRNA sequence of
FW- NO: 16 sensitive FusR1 transcript 2 from M. acuminata SEQ ID
Nucleotide Musa basjoo Partial mRNA sequence of FusR1 NO: 17
FW-resistant allele 1 from M. basjoo SEQ ID Nucleotide Musa basjoo
Coding sequence of FusR1 FW- NO: 18 resistant allele 1 from M.
basjoo SEQ ID Protein Musa basjoo Protein sequence of FusR1 FW- NO:
19 resistant allele 1 from Musa basjoo SEQ ID Nucleotide Musa
basjoo Partial mRNA sequence of FW- NO: 20 resistant allele 2 of
FusR1 from M. basjoo SEQ ID Nucleotide M. basjoo Partial coding
sequence of FusR1 NO: 21 FW-resistant allele 2 from M. basjoo SEQ
ID Protein M. basjoo Partial protein sequence of FW- NO: 22
resistant allele 2 of FusR1 from M. basjoo SEQ ID Nucleotide
Musella lasiocarpa Partial mRNA sequence of FusR1 NO: 23 from
Musella lasiocarpa SEQ ID Nucleotide Musella lasiocarpa Coding
sequence of FusR1 from NO: 24 M. lasiocarpa SEQ ID Protein Musella
lasiocarpa Protein sequence of FUSR1 from NO: 25 M. lasiocarpa SEQ
ID Nucleotide M. balbisiana Partial mRNA sequence of FusR1 NO: 26
from M. balbisiana Accession ITC1016 SEQ ID Nucleotide M.
balbisiana "Hypothetical" coding sequence NO: 27 from M. balbisiana
Accession ITC1016 SEQ ID Nucleotide M. balbisiana Partial mRNA
sequence of FusR1 NO: 28 from M. balbisiana Accession ITC0545 SEQ
ID Nucleotide M. balbisiana Partial mRNA sequence of FusR1 NO: 29
from M. balbisiana Accession ITC0080 SEQ ID Nucleotide M.
balbisiana Partial mRNA sequence of FusR1 from NO: 30 M. balbisiana
Accession ITC1527 SEQ ID Nucleotide M. acuminata ssp. Upstream
Sequence, including NO: 31 banksii promoter sequence, of the FW-
resistant allele 1 of FusR1 from M. acuminata SEQ ID Protein M.
balbisiana Protein sequence of FUSR1 from NO: 32 M. balbisiana
*FW--Fusarium wilt
[0230] In accordance with the present disclosure, the novel FusR1
gene and its orthologs will be useful for facilitating the
construction of crop plants that are resistant to pathogenic
disease, especially disease caused by fungal pathogens, viruses,
nematodes, insects and the like. The FusR1 genes of the present
disclosure can also be used as markers in genetic mapping as well
as in assessing disease resistance in a plant of interest. Thus,
the sequences can be used in breeding programs. See, for example,
Gentzbittel et al. (1998, Theor. Appl. Genet. 96:519-523).
Additional uses for the sequences of the disclosure include using
the sequences as bait to isolate other signaling components on
defense/resistance pathways and to isolate the corresponding
promoter sequences. The sequences may also be used to modulate
plant development processes, such as pollen development, regulation
of organ shape, differentiation of aleurone and shoot epidermis,
embryogenic competence, and cell/cell interactions. See, generally,
Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd
ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.). The
sequences of the present disclosure can also be used to generate
variants (e.g., by `domain swapping`) for the generation of new
resistance specificities.
[0231] The disclosure encompasses isolated or substantially
purified nucleic acid or protein compositions. An "isolated" or
"purified" nucleic acid molecule or protein, or biologically active
portion thereof, is substantially or essentially free from
components that normally accompany or interact with the nucleic
acid molecule or protein as found in its naturally occurring
environment. Thus, an isolated or purified polynucleotide or
polypeptide is substantially free of other cellular material, or
culture medium when produced by recombinant techniques, or
substantially free of chemical precursors or other chemicals when
chemically synthesized. Suitably, an "isolated" polynucleotide is
free of sequences (especially protein encoding sequences) that
naturally flank the polynucleotide (i.e., sequences located at the
5' and 3' ends of the polynucleotide) in the genomic DNA of the
organism from which the polynucleotide was derived. For example, in
various embodiments, the isolated polynucleotide can contain less
than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of
nucleotide sequences that naturally flank the polynucleotide in
genomic DNA of the cell from which the polynucleotide was derived.
A polypeptide that is substantially free of cellular material
includes preparations of protein having less than about 30%, 20%,
10%, 5%, (by dry weight) of contaminating protein. When the protein
of the disclosure or biologically active portion thereof is
recombinantly produced, culture medium suitably represents less
than about 30%, 20%, 10%, or 5% (by dry weight) of chemical
precursors or non-protein-of-interest chemicals.
[0232] A portion of a FusR1 nucleotide sequence that encodes a
biologically active portion of a FusR1 polypeptide of the
disclosure will encode at least about 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, 50, 60,
70, 80, 90, 100, 120, 150, 300, 400, 500, 600, 700, 800, 900 or
1000 contiguous amino acid residues, or almost up to the total
number of amino acids present in a full-length FUSR1 polypeptide of
the disclosure (for example, 140 amino acid residues for SEQ ID NO:
3, 6, 12, 19, or 22, respectively). Portions of a FusR1 nucleotide
sequence that are useful as hybridization probes or PCR primers
generally need not encode a biologically active portion of a FUSR1
polypeptide.
[0233] Thus, a portion of a FusR1 nucleotide sequence may encode a
biologically active portion of a FUSR1 polypeptide, or it may be a
fragment that can be used as a hybridization probe or PCR primer
using standard methods known in the art. A biologically active
portion of a FUSR1 polypeptide can be prepared by isolating a
portion of one of the FusR1 nucleotide sequences of the disclosure,
expressing the encoded portion of the FUSR1 polypeptide (e.g., by
recombinant expression in vitro), and assessing the activity of the
encoded portion of the FUSR1 polypeptide. Nucleic acid molecules
that are portions of an FusR1 nucleotide sequence comprise at least
about 15, 16, 17, 18, 19, 20, 25, 30, 50, 75, 100, 150, 200, 250,
300, 350, 400, 450, 500, 550, 600, or 650 nucleotides, or almost up
to the number of nucleotides present in a full-length FusR1
nucleotide sequence disclosed herein (for example, about from 350
to 650 nucleotides for SEQ ID NO: 1-2, 4-5, 8-10, 17-18, or 20-21,
respectively).
[0234] The disclosure also contemplates variants of the disclosed
nucleotide sequences. Nucleic acid variants can be naturally
occurring, such as allelic variants (same locus), homologues
(different locus), and orthologues (different organism) or can be
non-naturally occurring. Naturally occurring variants such as these
can be identified with the use of well-known molecular biology
techniques, as, for example, with polymerase chain reaction (PCR)
and hybridization techniques as known in the art. Non-naturally
occurring variants can be made by mutagenesis techniques, including
those applied to polynucleotides, cells, or organisms. The variants
can contain nucleotide substitutions, deletions, inversions and
insertions. Variation can occur in either or both the coding and
non-coding regions. The variations can produce both conservative
and non-conservative amino acid substitutions (as compared in the
encoded product). For nucleotide sequences, conservative variants
include those sequences that, because of the degeneracy of the
genetic code, encode the amino acid sequence of one of the FUSR1
polypeptides of the disclosure. Variant nucleotide sequences also
include synthetically derived nucleotide sequences, such as those
generated, for example, by using site-directed mutagenesis but
which still encode a FUSR1 polypeptide of the disclosure.
Generally, variants of a particular nucleotide sequence of the
disclosure will have at least about 30%, 40% 50%, 55%, 60%, 65%,
70%, generally at least about 75%, 80%, 85%, desirably about 90% to
95% or more, and more suitably about 98% or more sequence identity
to that particular nucleotide sequence as determined by sequence
alignment programs described elsewhere herein using default
parameters.
[0235] Variant nucleotide sequences also encompass sequences
derived from a mutagenic or recombinant procedures such as `DNA
shuffling` which can be used for swapping domains in a polypeptide
of interest with domains of other polypeptides. With DNA shuffling,
one or more different FusR1 coding sequences can be manipulated to
create a new FusR1 sequence possessing desired properties. In this
procedure, libraries of recombinant polynucleotides are generated
from a population of related polynucleotides comprising sequence
regions that have substantial sequence identity and can be
homologously recombined in vitro or in vivo. For example, using
this approach, sequence motifs encoding a domain of interest may be
shuffled between the FusR1 gene of the disclosure and other known
FusR1genes to obtain a new gene coding for a protein with an
improved property of interest, such broadening spectrum of disease
resistance. Strategies for DNA shuffling are known in the art. See,
for example: Stemmer (1994, Proc. Natl. Acad. Sci. USA
91:10747-10751; 1994, Nature 370:389-391); Crameri et al. (1997,
Nature Biotech. 15:436-438); Moore et al. (1997, J. Mol. Biol.
272:336-347); Zlang et al. (1997 Proc. Natl. Acad. Sci. USA
94:450-44509); Crameri et al. (1998, Nature 391:288-291); and U.S.
Pat. Nos. 5,605,793 and 5,837,458.
[0236] The present disclosure provides nucleotide sequences
comprising at least a portion of the isolated proteins encoded by
nucleotide sequences for FusR1, homologs of FusR1, orthologs of
FusR1, paralogs of FusR1, and fragments and variations thereof.
[0237] In some embodiments, the present disclosure provides a
nucleotide sequence encoding FUSR1, and/or functional fragments and
variations thereof comprising a nucleotide sequence that shares at
least about 70%, about 75%, about 80%, about 81%, about 82%, about
83%, about 84%, about 85%, about 86%, about 87%, about 88%, about
89%, about 90%, about 91%, about 92%, about 93%, about 94%, about
95%, about 96%, about 97%, about 98%, or about 99%, about 99.1%,
about 99.2%, about 99.3%, about 99.4%, about 99.5%, about 99.6%,
about 99.7%, about 99.8%, or about 99.9% sequence identity to SEQ
ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8,
SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 17, or SEQ
ID NO: 18. In some embodiments, a nucleotide sequence encoding
FUSR1 has the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 2,
SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO:
10, SEQ ID NO: 11, SEQ ID NO: 17, or SEQ ID NO: 18.
[0238] In some embodiments, the present disclosure provides
nucleotide sequences for FusR1, homologs of FusR1, orthologs of
FusR1, paralogs of FusR1, and fragments and variations thereof
comprising nucleotide sequences that share at least about 70%,
about 75%, about 80%, about 81%, about 82%, about 83%, about 84%,
about 85%, about 86%, about 87%, about 88%, about 89%, about 90%,
about 91%, about 92%, about 93%, about 94%, about 95%, about 96%,
about 97%, about 98%, or about 99%, about 99.1%, about 99.2%, about
99.3%, about 99.4%, about 99.5%, about 99.6%, about 99.7%, about
99.8%, or about 99.9% sequence identity to SEQ ID NO: 1, SEQ ID NO:
2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID
NO: 10, SEQ ID NO: 11, SEQ ID NO: 17, or SEQ ID NO: 18. In some
embodiments, nucleotide sequences for FusR1, homologs of FusR1,
orthologs of FusR1, paralogs of FusR1, and fragments and variations
thereof have the nucleic acid sequences of SEQ ID NO: 1, SEQ ID NO:
2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID
NO: 10, SEQ ID NO: 11, SEQ ID NO: 17, or SEQ ID NO: 18.
[0239] In some embodiments, nucleotide sequences for FusR1,
homologs of FusR1, orthologs of FusR1, paralogs of FusR1, and
fragments and variations thereof can be used to be expressed in
plants. In some embodiments, said nucleotide sequences can be used
to be incorporated into an expression cassette, which is capable of
directing expression of a nucleotide sequence for FusR1, homologs
of FusR1, orthologs of FusR1, paralogs of FusR1, and fragments and
variations thereof in a plant cell, for example, banana varieties
disclosed herein. This expression cassette comprises a promoter
operably linked to the nucleotide sequence of interest (i.e. FusR1,
orthologs of FusR1, and fragments and variations thereof) which is
operably linked to termination signals. It also typically comprises
sequences required for proper translation of the nucleotide
sequence. The coding region usually codes for a protein of
interest, (i.e. FUSR1). In some embodiments, the expression
cassette comprising the nucleotide sequence for FusR1, homologs of
FusR1, orthologs of FusR1, paralogs of FusR1, and fragments and
variations thereof is chimeric so that at least one of its
components is heterologous with respect to at least one of its
other components.
[0240] In other embodiments, the expression cassette is one which
is naturally occurring but has been obtained in a recombinant form
useful for heterologous expression. The expression of the
nucleotide sequence in the expression cassette can be under the
control of a constitutive promoter or of an inducible promoter
which initiates transcription only when the host cell is exposed to
some particular external stimulus. Also, the expression of the
nucleotide sequence in the expression cassette can be under the
control of a tissue-specific promoter. In the case of a
multicellular organism, the promoter can also be specific to a
particular tissue or organ or stage of development in animal and/or
plant including banana species.
[0241] The present disclosure provides polypeptides and amino acid
sequences comprising at least a portion of the proteins encoded by
nucleotide sequences for FusR1, homologs of FusR1, orthologs of
FusR1, paralogs of FusR1, and fragments and variations thereof.
[0242] The present disclosure also provides an amino acid sequence
encoded by the nucleic acid sequences of FusR1, homologs of FusR1,
orthologs of FusR1, paralogs of FusR1, and/or fragments and
variations thereof. In some embodiments, the present disclosure
provides an isolated polypeptide comprising an amino acid sequence
that shares at least about 70%, about 75%, about 80%, about 85%, at
least about 90%, about 91%, about 92%, about 93%, about 94%, about
95%, about 96%, about 97%, about 98%, about 99%, about 99.1%, about
99.2%, about 99.3%, about 99.4%, about 99.5%, about 99.6%, about
99.7%, about 99.8%, or about 99.9% identity to an amino acid
sequence encoded by the nucleic acid sequences of FusR1, homologs
of FusR1, orthologs of FusR1, paralogs of FusR1, and/or fragments
and variations thereof. In one embodiment, the present disclosure
provides an isolated polypeptide comprising an amino acid sequence
which encodes an amino acid sequence that shares at least about
85%, about 86%, about 87%, about 88%, about 89%, about 90%, about
91%, about 92%, about 93%, about 94%, about 95%, about 96%, about
97%, about 98%, about 99%, about 99.1%, about 99.2%, about 99.3%,
about 99.4%, about 99.5%, about 99.6%, about 99.7%, about 99.8%, or
about 99.9% identity to an amino acid sequence encoded by the
nucleic acid sequences of FusR1, homologs of FusR1, orthologs of
FusR1, paralogs of FusR1, and/or fragments and variations
thereof.
[0243] The disclosure also encompasses variants and fragments of
proteins of an amino acid sequence encoded by the nucleic acid
sequences of FusR1, homologs of FusR1, orthologs of FusR1 and/or
paralogs of FusR1. The variants may contain alterations in the
amino acid sequences of the constituent proteins. The term
"variant" with respect to a polypeptide refers to an amino acid
sequence that is altered by one or more amino acids with respect to
a reference sequence. The variant can have "conservative" changes,
or "nonconservative" changes, e.g., analogous minor variations can
also include amino acid deletions or insertions, or both.
[0244] Functional fragments and variants of a polypeptide include
those fragments and variants that maintain one or more functions of
the parent polypeptide. It is recognized that the gene or cDNA
encoding a polypeptide can be considerably mutated without
materially altering one or more of the polypeptide's functions.
First, the genetic code is well-known to be degenerate, and thus
different codons encode the same amino acids. Second, even where an
amino acid substitution is introduced, the mutation can be
conservative and have no material impact on the essential
function(s) of a protein. See, e.g., Stryer Biochemistry 3rd Ed.,
1988. Third, part of a polypeptide chain can be deleted without
impairing or eliminating all of its functions. Fourth, insertions
or additions can be made in the polypeptide chain for example,
adding epitope tags, without impairing or eliminating its functions
(Ausubel et al. J. Immunol. 159(5): 2502-12, 1997). Other
modifications that can be made without materially impairing one or
more functions of a polypeptide can include, for example, in vivo
or in vitro chemical and biochemical modifications or the
incorporation of unusual amino acids. Such modifications include,
but are not limited to, for example, acetylation, carboxylation,
phosphorylation, glycosylation, ubiquination, labelling, e.g., with
radionucleotides, and various enzymatic modifications, as will be
readily appreciated by those well skilled in the art. A variety of
methods for labelling polypeptides, and labels useful for such
purposes, are well known in the art, and include radioactive
isotopes such as 32P, ligands which bind to or are bound by
labelled specific binding partners (e.g., antibodies),
fluorophores, chemiluminescent agents, enzymes, and anti-ligands.
Functional fragments and variants can be of varying length. For
example, some fragments have at least 10, 25, 50, 75, 100, 200, or
even more amino acid residues. These mutations can be natural or
purposely changed. In some embodiments, mutations containing
alterations that produce silent substitutions, additions, or
deletions, but do not alter the properties or activities of the
proteins or how the proteins are made are an embodiment of the
disclosure.
[0245] Conservative amino acid substitutions are those
substitutions that, when made, least interfere with the properties
of the original protein, that is, the structure and especially the
function of the protein is conserved and not significantly changed
by such substitutions. Conservative substitutions generally
maintain (a) the structure of the polypeptide backbone in the area
of the substitution, for example, as a sheet or helical
conformation, (b) the charge or hydrophobicity of the molecule at
the target site, or (c) the bulk of the side chain. Further
information about conservative substitutions can be found, for
instance, in Ben Bassat et al. (J. Bacteriol., 169:751 757, 1987),
O'Regan et al. (Gene, 77:237 251, 1989), Sahin Toth et al. (Protein
Sci., 3:240 247, 1994), Hochuli et al. (Bio/Technology, 6:1321
1325, 1988) and in widely used textbooks of genetics and molecular
biology. The Blosum matrices are commonly used for determining the
relatedness of polypeptide sequences. The Blosum matrices were
created using a large database of trusted alignments (the BLOCKS
database), in which pairwise sequence alignments related by less
than some threshold percentage identity were counted (Henikoff et
al., Proc. Natl. Acad. Sci. USA, 89:10915-10919, 1992). A threshold
of 90% identity was used for the highly conserved target
frequencies of the BLOSUM90 matrix. A threshold of 65% identity was
used for the BLOSUM65 matrix. Scores of zero and above in the
Blosum matrices are considered "conservative substitutions" at the
percentage identity selected. The following table 2 shows exemplary
conservative amino acid substitutions.
TABLE-US-00003 TABLE 2 Exemplary conservative amino acid
substitutions listed Very Highly - Highly Conserved Original
Conserved Substitutions (from the Conserved Substitutions Residue
Substitutions Blosum90 Matrix) (from the Blosum65 Matrix) Ala Ser
Gly, Ser, Thr Cys, Gly, Ser, Thr, Val Arg Lys Gln, His, Lys Asn,
Gln, Glu, His, Lys Asn Gln; His Asp, Gln, His, Lys, Ser, Arg, Asp,
Gln, Glu, His, Lys, Thr Ser, Thr Asp Glu Asn, Glu Asn, Gln, Glu,
Ser Cys Ser None Ala Gln Asn Arg, Asn, Glu, His, Lys, Arg, Asn,
Asp, Glu, His, Lys, Met Met, Ser Glu Asp Asp, Gln, Lys Arg, Asn,
Asp, Gln, His, Lys, Ser Gly Pro Ala Ala, Ser His Asn; Gln Arg, Asn,
Gln, Tyr Arg, Asn, Gln, Glu, Tyr Ile Leu; Val Leu, Met, Val Leu,
Met, Phe, Val Leu Ile; Val Ile, Met, Phe, Val Ile, Met, Phe, Val
Lys Arg; Gln; Glu Arg, Asn, Gln, Glu Arg, Asn, Gln, Glu, Ser, Met
Leu; Ile Gln, Ile, Leu, Val Gln, Ile, Leu, Phe, Val Phe Met; Leu;
Tyr Leu, Trp, Tyr Ile, Leu, Met, Trp, Tyr Ser Thr Ala, Asn, Thr
Ala, Asn, Asp, Gln, Glu, Gly, Lys, Thr Thr Ser Ala, Asn, Ser Ala,
Asn, Ser, Val Trp Tyr Phe, Tyr Phe, Tyr Tyr Trp; Phe His, Phe, Trp
His, Phe, Trp Val Ile; Leu Ile, Leu, Met Ala, Ile, Leu, Met,
Thr
[0246] In some examples, variants can have no more than 3, 5, 10,
15, 20, 25, 30, 40, 50, or 100 conservative amino acid changes
(such as very highly conserved or highly conserved amino acid
substitutions). In other examples, one or several hydrophobic
residues (such as Leu, Ile, Val, Met, Phe, or Trp) in a variant
sequence can be replaced with a different hydrophobic residue (such
as Leu, Ile, Val, Met, Phe, or Trp) to create a variant
functionally similar to the disclosed an amino acid sequences
encoded by the nucleic acid sequences of FusR1, homologs of FusR1,
orthologs of FusR1 and/or paralogs of FusR1, and/or fragments and
variations thereof.
[0247] In some embodiments, variants may differ from the disclosed
sequences by alteration of the coding region to fit the codon usage
bias of the particular organism into which the molecule is to be
introduced. In other embodiments, the coding region may be altered
by taking advantage of the degeneracy of the genetic code to alter
the coding sequence such that, while the nucleotide sequence is
substantially altered, it nevertheless encodes a protein having an
amino acid sequence substantially similar to the disclosed an amino
acid sequences encoded by the nucleic acid sequences of FusR1,
homologs of FusR1, orthologs of FusR1 and/or paralogs of FusR1,
and/or fragments and variations thereof.
[0248] In some embodiments, functional fragments derived from the
FusR1 orthologs of the present disclosure are provided. The
functional fragments can still confer resistance to pathogens when
expressed in a plant. In some embodiments, the functional fragments
contain at least the conserved region or Bowman-Birk inhibitor
domain of a wild type FusR1 orthologs, or functional variants
thereof. In some embodiments, the functional fragments contain one
or more conserved region shared by two or more FusR1 orthologs,
shared by two or more FusR1 orthologs in the same plant genus,
shared by two or more dicot FUSR1 orthologs, and/or shared by two
or more monocot FusR1 orthologs. The conserved regions or
Bowman-Birk inhibitor domains can be determined by any suitable
computer program, such as NCBI protein BLAST program and NCBI
Alignment program, or equivalent programs. In some embodiments, the
functional fragments are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,
48, 49, 50 or more amino acids shorter compared to the FusR1
orthologs of the present disclosure. In some embodiments, the
functional fragments are made by deleting one or more amino acid of
the FusR1 orthologs of the present disclosure. In some embodiments,
the functional fragments share at least 80%, 85%, 90%, 95%, 96%,
97%, 98%, 99%, or more identity to the FusR1 orthologs of the
present disclosure.
[0249] In some embodiments, functional chimeric or synthetic
polypeptides derived from the FusR1 orthologs of the present
disclosure are provided. The functional chimeric or synthetic
polypeptides can still confer resistance to pathogens when
expressed in a plant. In some embodiments, the functional chimeric
or synthetic polypeptides contain at least the conserved region or
Bowman-Birk inhibitor domain of a wild type FUSR1 orthologs, or
functional variants thereof. In some embodiments, the functional
chimeric or synthetic polypeptides contain one or more conserved
region shared by two or more FUSR1 orthologs, shared by two or more
FusR1 orthologs in the same plant genus, shared by two or more
monocot FusR1 orthologs, and/or shared by two or more dicot FUSR1
orthologs. Non-limiting exemplary conserved regions are shown in
FIG. 2. The conserved regions or Bowman-Birk inhibitor domains can
be determined by any suitable computer program, such as NCBI
protein BLAST program and NCBI Alignment program, or equivalent
programs. In some embodiments, the functional chimeric or synthetic
polypeptides share at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%,
or more identity to the FusR1 orthologs of the present
disclosure.
[0250] Sequences of conserved regions unique to FW-sensitive
alleles can also be used to knock-down the level of one or more
FusR1 orthologs. In some embodiments, sequences of conserved
regions can be used to make gene silencing molecules to target one
or more FusR1 orthologs. In some embodiments, the gene silencing
molecules are selected from the group consisting of double-stranded
polynucleotides, single-stranded polynucleotides or Mixed Duplex
Oligonucleotides. In some embodiments, the gene silencing molecules
comprises a DNA/RNA fragment of about 10 bp, 15 bp, 19 bp, 20 bp,
21 bp, 25 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100
bp, 150 bp, 200 pb, 250 bp, 300 bp, 350 bp, 400 bp, 500 bp, 600 bp,
700 bp, 800 bp, 900 bp, 1000 bp, or more polynucleotides, wherein
the DNA/RNA fragment share at least 90%, 95%, 99%, or more identity
to a conserved region of the FusR1 orthologs sequences of the
present disclosure, or complementary sequences thereof.
V. Plant Transformation
[0251] The present polynucleotides coding for FUSR1, homologs of
FusR1, orthologs of FusR1 and/or paralogs of FusR1, and/or
fragments and variations thereof of the present disclosure can be
transformed into banana or other plant genera.
[0252] Methods of producing transgenic plants are well known to
those of ordinary skill in the art. Transgenic plants can now be
produced by a variety of different transformation methods
including, but not limited to, electroporation; microinjection;
microprojectile bombardment, also known as particle acceleration or
biolistic bombardment; viral-mediated transformation; and
Agrobacterium-mediated transformation. See, for example, U.S. Pat.
Nos. 5,405,765; 5,472,869; 5,538,877; 5,538,880; 5,550,318;
5,641,664; 5,736,369 and 5,736,369; International Patent
Application Publication Nos. WO2002/038779 and WO/2009/117555; Lu
et al., (Plant Cell Reports, 2008, 27:273-278); Watson et al.,
Recombinant DNA, Scientific American Books (1992); Hinchee et al.,
Bio/Tech. 6:915-922 (1988); McCabe et al., Bio/Tech. 6:923-926
(1988); Toriyama et al., Bio/Tech. 6:1072-1074 (1988); Fromm et
al., Bio/Tech. 8:833-839 (1990); Mullins et al., Bio/Tech.
8:833-839 (1990); Hiei et al., Plant Molecular Biology 35:205-218
(1997); Ishida et al., Nature Biotechnology 14:745-750 (1996);
Zhang et al., Molecular Biotechnology 8:223-231 (1997); Ku et al.,
Nature Biotechnology 17:76-80 (1999); and, Raineri et al.,
Bio/Tech. 8:33-38 (1990)), each of which is expressly incorporated
herein by reference in their entirety.
[0253] Agrobacterium tumefaciens is a naturally occurring bacterium
that is capable of inserting its DNA (genetic information) into
plants, resulting in a type of injury to the plant known as crown
gall. Most species of plants can now be transformed using this
method, including cucurbitaceous species.
[0254] Microprojectile bombardment is also known as particle
acceleration, biolistic bombardment, and the gene gun
(Biolistic.RTM. Gene Gun). The gene gun is used to shoot pellets
that are coated with genes (e.g., for desired traits) into plant
seeds or plant tissues in order to get the plant cells to then
express the new genes. The gene gun uses an actual explosive (.22
caliber blank) to propel the material. Compressed air or steam may
also be used as the propellant. The Biolistic.RTM. Gene Gun was
invented in 1983-1984 at Cornell University by John Sanford, Edward
Wolf, and Nelson Allen. It and its registered trademark are now
owned by E. I. du Pont de Nemours and Company. Most species of
plants have been transformed using this method.
[0255] The most common method for the introduction of new genetic
material into a plant genome involves the use of living cells of
the bacterial pathogen Agrobacterium tumefaciens to literally
inject a piece of DNA, called transfer or T-DNA, into individual
plant cells (usually following wounding of the tissue) where it is
targeted to the plant nucleus for chromosomal integration. There
are numerous patents governing Agrobacterium mediated
transformation and particular DNA delivery plasmids designed
specifically for use with Agrobacterium--for example, U.S. Pat. No.
4,536,475, EP0265556, EP0270822, WO8504899, WO8603516, U.S. Pat.
No. 5,591,616, EP0604662, EP0672752, WO8603776, WO9209696,
WO9419930, WO9967357, U.S. Pat. No. 4,399,216, WO8303259, U.S. Pat.
No. 5,731,179, EP068730, WO9516031, U.S. Pat. Nos. 5,693,512,
6,051,757 and EP904362A1. Agrobacterium-mediated plant
transformation involves as a first step the placement of DNA
fragments cloned on plasmids into living Agrobacterium cells, which
are then subsequently used for transformation into individual plant
cells. Agrobacterium-mediated plant transformation is thus an
indirect plant transformation method. Methods of
Agrobacterium-mediated plant transformation that involve using
vectors with no T-DNA are also well known to those skilled in the
art and can have applicability in the present disclosure. See, for
example, U.S. Pat. No. 7,250,554, which utilizes P-DNA instead of
T-DNA in the transformation vector.
[0256] A transgenic plant formed using Agrobacterium transformation
methods typically contains a single gene on one chromosome,
although multiple copies are possible. Such transgenic plants can
be referred to as being hemizygous for the added gene. A more
accurate name for such a plant is an independent segregant, because
each transformed plant represents a unique T-DNA integration event
(U.S. Pat. No. 6,156,953). A transgene locus is generally
characterized by the presence and/or absence of the transgene. A
heterozygous genotype in which one allele corresponds to the
absence of the transgene is also designated hemizygous (U.S. Pat.
No. 6,008,437).
[0257] Direct plant transformation methods using DNA have also been
reported. The first of these to be reported historically is
electroporation, which utilizes an electrical current applied to a
solution containing plant cells (M. E. Fromm et al., Nature, 319,
791 (1986); H. Jones et al., Plant Mol. Biol., 13, 501 (1989) and
H. Yang et al., Plant Cell Reports, 7, 421 (1988). Another direct
method, called "biolistic bombardment", uses ultrafine particles,
usually tungsten or gold, that are coated with DNA and then sprayed
onto the surface of a plant tissue with sufficient force to cause
the particles to penetrate plant cells, including the thick cell
wall, membrane and nuclear envelope, but without killing at least
some of them (U.S. Pat. Nos. 5,204,253, 5,015,580). A third direct
method uses fibrous forms of metal or ceramic consisting of sharp,
porous or hollow needle-like projections that literally impale the
cells, and also the nuclear envelope of cells. Both silicon carbide
and aluminum borate whiskers have been used for plant
transformation (Mizuno et al., 2004; Petolino et al., 2000; U.S.
Pat. No. 5,302,523 US Application 20040197909) and also for
bacterial and animal transformation (Kaepler et al., 1992; Raloff,
1990; Wang, 1995). There are other methods reported, and
undoubtedly, additional methods will be developed. However, the
efficiencies of each of these indirect or direct methods in
introducing foreign DNA into plant cells are invariably extremely
low, making it necessary to use some method for selection of only
those cells that have been transformed, and further, allowing
growth and regeneration into plants of only those cells that have
been transformed.
[0258] For efficient plant transformation, a selection method must
be employed such that whole plants are regenerated from a single
transformed cell and every cell of the transformed plant carries
the DNA of interest. These methods can employ positive selection,
whereby a foreign gene is supplied to a plant cell that allows it
to utilize a substrate present in the medium that it otherwise
could not use, such as mannose or xylose (for example, refer U.S.
Pat. Nos. 5,767,378; 5,994,629). More typically, however, negative
selection is used because it is more efficient, utilizing selective
agents such as herbicides or antibiotics that either kill or
inhibit the growth of non-transformed plant cells and reducing the
possibility of chimeras. Resistance genes that are effective
against negative selective agents are provided on the introduced
foreign DNA used for the plant transformation. For example, one of
the most popular selective agents used is the antibiotic kanamycin,
together with the resistance gene neomycin phosphotransferase
(nptll), which confers resistance to kanamycin and related
antibiotics (see, for example, Messing & Vierra, Gene 19:
259-268 (1982); Bevan et al., Nature 304:184-187 (1983)). However,
many different antibiotics and antibiotic resistance genes can be
used for transformation purposes (refer U.S. Pat. Nos. 5,034,322,
6,174,724 and 6,255,560). In addition, several herbicides and
herbicide resistance genes have been used for transformation
purposes, including the bar gene, which confers resistance to the
herbicide phosphinothricin (White et al., Nucl Acids Res 18: 1062
(1990), Spencer et al., Theor Appl Genet 79: 625-631(1990), U.S.
Pat. Nos. 4,795,855, 5,378,824 and 6,107,549). In addition, the
dhfr gene, which confers resistance to the anticancer agent
methotrexate, has been used for selection (Bourouis et al., EMBO J.
2(7): 1099-1104 (1983).
[0259] The expression control elements used to regulate the
expression of a given protein can either be the expression control
element that is normally found associated with the coding sequence
(homologous expression element) or can be a heterologous expression
control element. A variety of homologous and heterologous
expression control elements are known in the art and can readily be
used to make expression units for use in the present disclosure.
Transcription initiation regions, for example, can include any of
the various opine initiation regions, such as octopine, mannopine,
nopaline and the like that are found in the Ti plasmids of
Agrobacterium tumefaciens. Alternatively, plant viral promoters can
also be used, such as the cauliflower mosaic virus 19S and 35S
promoters (CaMV 19S and CaMV 35S promoters, respectively) to
control gene expression in a plant (U.S. Pat. Nos. 5,352,605;
5,530,196 and 5,858,742 for example). Enhancer sequences derived
from the CaMV can also be utilized (U.S. Pat. Nos. 5,164,316;
5,196,525; 5,322,938; 5,530,196; 5,352,605; 5,359,142; and
5,858,742 for example). Lastly, plant promoters such as prolifera
promoter, fruit specific promoters, Ap3 promoter, heat shock
promoters, seed specific promoters, etc. can also be used.
[0260] Either a gamete-specific promoter, a constitutive promoter
(such as the CaMV or Nos promoter), an organ-specific promoter
(such as the E8 promoter from tomato), or an inducible promoter is
typically ligated to the protein or antisense encoding region using
standard techniques known in the art. The expression unit may be
further optimized by employing supplemental elements such as
transcription terminators and/or enhancer elements.
[0261] Thus, for expression in plants, the expression units will
typically contain, in addition to the protein sequence, a plant
promoter region, a transcription initiation site and a
transcription termination sequence. Unique restriction enzyme sites
at the 5' and 3' ends of the expression unit are typically included
to allow for easy insertion into a pre-existing vector.
[0262] In the construction of heterologous promoter/structural gene
or antisense combinations, the promoter is preferably positioned
about the same distance from the heterologous transcription start
site as it is from the transcription start site in its natural
setting. As is known in the art, however, some variation in this
distance can be accommodated without loss of promoter function.
[0263] In addition to a promoter sequence, the expression cassette
can also contain a transcription termination region downstream of
the structural gene to provide for efficient termination. The
termination region may be obtained from the same gene as the
promoter sequence or may be obtained from different genes. If the
mRNA encoded by the structural gene is to be efficiently processed,
DNA sequences which direct polyadenylation of the RNA are also
commonly added to the vector construct. Polyadenylation sequences
include, but are not limited to the Agrobacterium octopine synthase
signal (Gielen et al., EMBO J3:835-846 (1984)) or the nopaline
synthase signal (Depicker et al., Mol. and Appl. Genet. 1:561-573
(1982)). The resulting expression unit is ligated into or otherwise
constructed to be included in a vector that is appropriate for
higher plant transformation. One or more expression units may be
included in the same vector. The vector will typically contain a
selectable marker gene expression unit by which transformed plant
cells can be identified in culture. Usually, the marker gene will
encode resistance to an antibiotic, such as G418, hygromycin,
bleomycin, kanamycin, or gentamicin or to an herbicide, such as
glyphosate (Round-Up) or glufosinate (BASTA) or atrazine.
Replication sequences, of bacterial or viral origin, are generally
also included to allow the vector to be cloned in a bacterial or
phage host; preferably a broad host range for prokaryotic origin of
replication is included. A selectable marker for bacteria may also
be included to allow selection of bacterial cells bearing the
desired construct. Suitable prokaryotic selectable markers include
resistance to antibiotics such as ampicillin, kanamycin or
tetracycline. Other DNA sequences encoding additional functions may
also be present in the vector, as is known in the art. For
instance, in the case of Agrobacterium transformations, T-DNA
sequences will also be included for subsequent transfer to plant
chromosomes.
[0264] To introduce a desired gene or set of genes by conventional
methods requires a sexual cross between two lines, and then
repeated back-crossing between hybrid offspring and one of the
parents until a plant with the desired characteristics is obtained.
This process, however, is restricted to plants that can sexually
hybridize, and genes in addition to the desired gene will be
transferred.
[0265] Recombinant DNA techniques allow plant researchers to
circumvent these limitations by enabling plant geneticists to
identify and clone specific genes for desirable traits, such as
improved fatty acid composition, and to introduce these genes into
already useful varieties of plants. Once the foreign genes have
been introduced into a plant, that plant can then be used in imp
plant breeding schemes (e.g., pedigree breeding,
single-seed-descent breeding schemes, reciprocal recurrent
selection) to produce progeny which also contain the gene of
interest.
[0266] Genes can be introduced in a site directed fashion using
homologous recombination. Homologous recombination permits
site-specific modifications in endogenous genes and thus inherited
or acquired mutations may be corrected, and/or novel alterations
may be engineered into the genome. Homologous recombination and
site-directed integration in plants are discussed in, for example,
U.S. Pat. Nos. 5,451,513; 5,501,967 and 5,527,695.
[0267] According to Ploetz (2015, Phytopathology 105:1512-1521),
"Genetic transformation of bananas has become commonplace, and
disease resistance is one of the most sought-after traits
[citations omitted]." Techniques for transforming and regenerating
banana plants are well known in the art. See, for example, U.S.
Pat. Nos. 7,534,930; 6,133,035; Sagi et al., Bio/Technology 13,
481-485, 1995; May et al., Bio/Technology 13, 485-492, 1995;
Vishnevetsky et al., Transgenic Res. 20(1):61-71, 2011; Paul et al.
(2011); Zhong et al., Plant Physiol. 110, 1097-1107, 1996; and,
Dugdale et al., Journal of General Virology 79:2301-2311, 1998,
each of which is expressly incorporated herein by reference in
their entirety. For overviews and history, see, for example, Mohan
and Swennen (editors), 2004, Banana improvement: cellular,
molecular biology, and induced mutations, Science Publishers, Inc.;
and, Remy et al., 2013, Genetically modified bananas: Past, present
and future, Acta Horticulturae 974:71-80, each of which is
expressly incorporated herein by reference in their entirety.
[0268] While reducing the present invention to practice, the
inventor can construct an expression construct which includes
nucleotide sequences encoding FUSR1, homologs of FusR1, orthologs
of FusR1 and/or paralogs of FusR1, and/or fragments and variations
thereof. The expression construct of the present invention can be
introduced into embryogenic callus of commercial banana and the
resulting transformed cells can be regenerated into plants. The
transgenic banana plants is expected to have expression of
FW-resistant FUSR1 protein and pathogen resistance.
[0269] According to one aspect of the present invention, there is
provided a method of producing a disease resistant banana plant.
The method is effected by transforming a banana cell with at least
one exogenous polynucleotide encoding a polypeptide (such as
FW-resistant FusR1) capable of conferring disease resistance to a
banana plant.
[0270] According to another aspect of the present invention, there
is provided a method of producing a disease resistant banana plant.
The method is effected by transforming a banana cell with at least
one exogenous expression cassette containing polynucleotides
encoding a CRISPR-associated effector protein and a guide RNA
capable of targeting at least one FW-sensitive FusR1 allele,
thereby conferring disease resistance to a banana plant.
[0271] The banana cell of the present invention can be any banana
variety or cultivar, including, but not limited to, commercially
important M. acuminata (Cavendish, dwarf Cavendish, Grand Nain
etc.). Preferably, the banana cell used for transformation is an
embryogenic cell which is capable of forming a whole plant. More
preferably, the banana cell is an embryogenic callus cell.
[0272] The phrase "embryogenic callus cell" used herein refers to
an embryogenic cell contained in a cell mass produced in vitro.
[0273] Banana embryogenic callus cells suitable for transformation
can be generated using well known methodology. For example,
immature male flowers (inflorescences) can be dissected and
incubated in M1 medium (see content in Table 1 herein below) under
a reduced light intensity (50-100 lux) at 25.degree. C. Following
3-5 months of incubation in M1 medium, yellow embryogenic calli are
transferred to M2 medium (see content in Table 1 below) and
incubated at 27.degree. C. in the dark for at least four months to
promote embryogenesis.
[0274] As is mentioned hereinabove, such banana embryogenic callus
cells are suitable for transformation with a nucleic acid construct
which includes at least one polynucleotide encoding a disease
resistance polypeptide.
[0275] The phrases "polypeptide capable of conferring disease
resistance" and "disease resistance polypeptide" are
interchangeably used herein to refer to any peptide, polypeptide or
protein which is capable of protecting a banana plant (expressing
the polypeptide) from pathogen infection or the harmful effects
resultant from pathogen infection.
[0276] A suitable disease resistance polypeptide can also be a
polypeptide capable of inducing or enhancing resistance in plants
such as described, for example in U.S. Pat. Nos. 6,091,004 and
6,316,697.
[0277] As is mentioned hereinabove, the method of the present
invention is effected by transforming a banana cell with at least
one polynucleotide encoding a polypeptide capable of conferring
disease resistance to a banana plant.
[0278] In some embodiments, the banana cell is transformed with a
polynucleotide sequence encoding FUSR1 protein from Musa itinerans,
an example of which is set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ
ID NO: 4, and SEQ ID NO: 5.
[0279] In some embodiments, the banana cell is transformed with a
polynucleotide sequence encoding FUSR1 protein from Musa acuminata,
an example of which is set forth in SEQ ID NO: 8, SEQ ID NO: 9, SEQ
ID NO: 10 and SEQ ID NO: 11
[0280] In some embodiments, the banana cell is transformed with a
polynucleotide sequence encoding FUSR1 protein from Musa basjoo, an
example of which is set forth in SEQ ID NO: 17, SEQ ID NO: 18, SEQ
ID NO: 20, and SEQ ID NO: 21.
[0281] In some embodiments, the banana cell is transformed with a
polynucleotide sequence encoding FUSR1 protein from Musella
lasiocarpa, an example of which is set forth in SEQ ID NO: 23.
[0282] In some embodiments, the banana cell is transformed with a
polynucleotide sequence encoding FUSR1 protein from Musa
balbisiana, an example of which is set forth in SEQ ID NO: 26.
[0283] In some embodiments, plants transformed with just a single
exogenous disease-resistance polypeptide, such as FUSR1, may
exhibit only partial and short-lasting protection (see, for
example, in Jach et al., Plant J. 8:97-108, 1995). In other
embodiments, the banana cell/plant of the present invention
preferably expresses a plurality of exogenous disease resistance
polypeptides and is thus substantially more disease resistant than
unmodified plants.
[0284] Several approaches can be utilized to transform and
co-express these polynucleotides in plant cells.
[0285] Although less preferred, each of the above described
polynucleotide sequences can be separately introduced into a banana
cell by using three separate nucleic-acid constructs. In some
embodiments, the three polynucleotide sequences can be
co-introduced and co-expressed in the banana cell using a single
nucleic acid construct. Such a construct can be designed with a
single promoter sequences co-which can transcribe a polycistronic
message including all three polynucleotide sequences. To enable
co-translation of the three polypeptides encoded by the
polycistronic message, the polynucleotide sequences can be
inter-linked via an internal ribosome entry site (IRES) sequence
which facilitates translation of polynucleotide sequences
positioned downstream of the IRES sequence. In this case, a
transcribed polycistronic RNA molecule encoding the three
polypeptides described above will be translated from both the
capped 5' end and the two internal IRES sequences of the
polycistronic RNA molecule to thereby produce in the cell all three
polypeptides.
[0286] Alternatively, the polynucleotide segments encoding the
plurality of polypeptides capable of conferring disease resistance
can be translationally fused via a protease recognition site
cleavable by a protease expressed by the cell to be transformed
with the nucleic acid construct. In this case, a chimeric
polypeptide translated will be cleaved by a cell-expressed protease
to thereby generate the plurality of polypeptides.
[0287] In other embodiments, the present invention utilizes a
nucleic acid construct which includes three promoter sequences each
capable of directing transcription of a specific polynucleotide
sequence of the polynucleotide sequences described above.
[0288] Suitable promoters which can be used with the nucleic acid
of the present invention include constitutive, inducible, or
tissue-specific promoters.
[0289] Suitable constitutive promoters include, for example, CaMV
35S promoter (Odell et al., Nature 313:810-812, 1985); maize Ubi 1
(Christensen et al., Plant Sol. Biol. 18:675-689, 1992); rice actin
(McElroy et al., Plant Cell 2:163-171, 1990); pEMU (Last et al.,
Theor. Appl. Genet. 81:581-588, 1991); and Synthetic Super MAS (Ni
et al., The Plant Journal 7: 661-76, 1995). Other constitutive
promoters include those in U.S. Pat. Nos. 5,659,026, 5,608,149;
5,608,144; 5,604,121; 5,569,597: 5,466,785; 5,399,680; 5,268,463;
and 5,608,142.
[0290] Suitable inducible promoters can be pathogen-inducible
promoters such as, for example, the alfalfa PR10 promoter
(Coutos-Thevenot et al., Journal of Experimental Botany 52:
901-910, 2001 and the promoters described by Marineau et al., Plant
Mol. Biol. 9:335-342, 1987; Matton et al. Molecular Plant-Microbe
Interactions 2:325-331, 1989; Somsisch et al., Proc. Natl. Acad.
Sci. USA 83:2427-2430, 1986: Somsisch et al., Mol. Gen. Genet.
2:93-98, 1988; and Yang, Proc. Natl. Acad. Sci. USA 93:14972-14977,
1996.
[0291] Suitable tissue-specific promoters include, but not limited
to, leaf-specific promoters such as described, for example, by
Yamamoto et al., Plant J. 12:255-265, 1997; Kwon et al., Plant
Physiol. 105:357-67, 1994; Yamamoto et al., Plant Cell Physiol.
35:773-778, 1994; Gotor et al., Plant J. 3:509-18, 1993; Orozco et
al., Plant Mol. Biol. 23:1129-1138, 1993; and Matsuoka et al.,
Proc. Natl. Acad. Sci. USA 90:9586-9590, 1993.
[0292] The nucleic acid construct of the present invention may also
include at least one selectable marker such as, for example, nptII.
Preferably, the nucleic acid construct is a shuttle vector, which
can propagate both in E. coli (wherein the construct comprises an
appropriate selectable marker and origin of replication) and be
compatible for propagation in cells. The construct according to the
present invention can be, for example, a plasmid, a bacmid, a
phagemid, a cosmid, a phage, a virus or an artificial chromosome,
preferably a plasmid.
[0293] The nucleic acid construct of the present invention can be
utilized to stably transform banana cells. The principle methods of
causing stable integration of exogenous DNA into banana genome
include two main approaches:
[0294] (i) Agrobacterium-mediated gene transfer: Klee et al. (1987)
Annu. Rev. Plant Physiol. 38:467-486; Klee and Rogers in Cell
Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular
Biology of Plant Nuclear Genes, eds. Schell, J., and Vasil, L. K.,
Academic Publishers, San Diego, Calif. (1989) p. 2-25; Gatenby, in
Plant Biotechnology, eds. Kung, S. and Arntzen, C. J., Butterworth
Publishers, Boston, Mass. (1989) p. 93-112.
[0295] (ii) Direct DNA uptake: Paszkowski et al., in Cell Culture
and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of
Plant Nuclear Genes eds. Schell, J., and Vasil, L. K., Academic
Publishers, San Diego, Calif. (1989) p. 52-68; including methods
for direct uptake of DNA into protoplasts, Toriyama, K. et al.
(1988) Bio/Technology 6:1072-1074. DNA uptake induced by brief
electric shock of plant cells: Zhang et al. Plant Cell Rep. (1988)
7:379-384. Fromm et al. Nature (1986) 319:791-793. DNA injection
into plant cells or tissues by particle bombardment, Klein et al.
Bio/Technology (1988) 6:559-563; McCabe et al. Bio/Technology
(1988) 6:923-926; Sanford, Physiol. Plant. (1990) 79:206-209; by
the use of micropipette systems: Neuhaus et al., Theor. Appl.
Genet. (1987) 75:30-36; Neuhaus and Spangenberg, Physiol. Plant.
(1990) 79:213-217; glass fibers or silicon carbide whisker
transformation of cell cultures, embryos or callus tissue, U.S.
Pat. No. 5,464,765 or by the direct incubation of DNA with
germinating pollen, DeWet et al. in Experimental Manipulation of
Ovule Tissue, eds. Chapman, G. P. and Mantell, S. H. and Daniels,
W. Longman, London, (1985) p. 197-209; and Ohta, Proc. Natl. Acad.
Sci. USA (1986) 83:715-719.
[0296] The Agrobacterium system includes the use of plasmid vectors
that contain defined DNA segments that integrate into the plant
genomic DNA. Methods of inoculation of the plant tissue vary
depending upon the plant species and the Agrobacterium delivery
system. A widely used approach is the leaf disc procedure which can
be performed with any tissue explant that provides a good source
for initiation of whole plant differentiation. Horsch et al. in
Plant Molecular Biology Manual A5, Kluwer Academic Publishers,
Dordrecht (1988) p. 1-9. A supplementary approach employs the
Agrobacterium delivery system in combination with vacuum
infiltration. Suitable Agrobacterium-mediated procedures for
introducing exogenous DNA to banana cells is described by Dougale
et al. (Journal of General Virology, 79:2301-2311, 1998) and in
U.S. Pat. No. 6,395,962.
[0297] There are various methods of direct DNA transfer into plant
cells. In electroporation, the protoplasts are briefly exposed to a
strong electric field. In microinjection, the DNA is mechanically
injected directly into the cells using very small micropipettes. In
microparticle bombardment, the DNA is adsorbed on microprojectiles
such as magnesium sulfate crystals or tungsten particles, and the
microprojectiles are physically accelerated into cells or plant
tissues.
[0298] Alternatively, the nucleic acid construct of the present
invention can be introduced into banana cells by a microprojectiles
bombardment. In this technique, tungsten or gold particles coated
with exogenous DNA are accelerated toward the target cells.
Suitable banana transformation procedures by microprojectiles
bombardment are described by Sagi et al. (Biotechnology 13:481-485,
1995) and by Dougale et al. (Journal of General Virology,
79:2301-2311, 1998). Preferably, the nucleic acid construct of the
present invention is introduced into banana cells by a
microprojectiles bombardment procedure as described in Example 4
herein below.
[0299] Following transformation, the transformed cells are
micropropagated to provide a rapid, consistent reproduction of the
transformed material.
[0300] Micropropagation is a process of growing new generation
plants from a single piece of tissue that has been excised from a
selected parent plant or cultivar. This process permits the mass
reproduction of plants having the preferred tissue expressing the
fusion protein. The new generation plants which are produced are
genetically identical to, and have all of the characteristics of,
the original plant. Micropropagation allows mass production of
quality plant material in a short period of time and offers a rapid
multiplication of selected cultivars in the preservation of the
characteristics of the original transgenic or transformed plant.
The advantages of cloning plants are the speed of plant
multiplication and the quality and uniformity of plants
produced.
[0301] Micropropagation is a multi-stage procedure that requires
alteration of culture medium or growth conditions between stages.
Thus, the micropropagation process involves four basic stages:
Stage one, initial tissue culturing; stage two, tissue culture
multiplication; stage three, differentiation and plant formation;
and stage four, greenhouse culturing and hardening. During stage
one, initial tissue culturing, the tissue culture is established
and certified contaminant-free. During stage two, the initial
tissue culture is multiplied until a sufficient number of tissue
samples are produced to meet production goals. During stage three,
the tissue samples grown in stage two are divided and grown into
individual plantlets. At stage four, the transformed plantlets are
transferred to a greenhouse for hardening where the plants'
tolerance to light is gradually increased so that it can be grown
in the natural environment.
[0302] Thus, transformed banana cells can be micropropagated and
regenerated into plants using methods known in the art such as
described, for example in U.S. Pat. No. 6,133,035 and by Novak et
al., 1989; Dhed'a et al., 1991; Cote et al., 1996; Becker et al.,
2000; Sagi et al. Plant Cell Reports 13:262-266, 1994; Grapin et
al., Cell Dev. Biol. Plant. 32:66-71, 1996; Marroquin et al., In
Vivo Cell. Div. Biol. 29P:43-46, 1993; and Escalant et al., In Vivo
Cell Dev. Biol. 30:181-186, 1994).
[0303] Stable integration of exogenous DNA sequence in the genome
of the transformed plants can be determined using standard
molecular biology techniques well known in the art such as PCR and
Southern blot hybridization.
[0304] Although stable transformation is presently preferred,
transient transformation of cultured cells, leaf cells,
meristematic cells or the whole plant is also envisaged by the
present invention.
[0305] Transient transformation can be effected by any of the
direct DNA transfer methods described above or by viral infection
using modified plant viruses.
[0306] Viral infection is preferred since is enables circumventing
micropropagation and regeneration of a whole plant from cultured
cells. Viruses that have been shown to be useful for the
transformation of plant hosts include CaMV, TMV and BV.
Transformation of plants using plant viruses is described in U.S.
Pat. No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published
Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV);
and Gluzman et al. (Communications in Molecular Biology: Viral
Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189,
1988). Pseudovirus particles for use in expressing foreign DNA in
many hosts, including plants, is described in WO 87/06261.
[0307] Construction of plant RNA viruses for the introduction and
expression of non-viral exogenous nucleic acid sequences in plants
is demonstrated by the above references as well as by Dawson et al.
(Virology 172:285-292, 1989; Takamatsu et al. EMBO J. 6:307-311,
1987; French et al. (Science 231:1294-1297, 1986); and Takamatsu et
al. (FEBS Letters 269:73-76, 1990).
[0308] When the virus is a DNA virus, suitable modifications can be
made to the virus itself. Alternatively, the virus can first be
cloned into a bacterial plasmid for ease of constructing the
desired viral vector with the foreign DNA. The virus can then be
excised from the plasmid. If the virus is a DNA virus, a bacterial
origin of replication can be attached to the viral DNA, which is
then replicated by the bacteria. Transcription and translation of
this DNA will produce the coat protein which will encapsidate the
viral DNA.
[0309] If the virus is an RNA virus, the virus is generally cloned
as a cDNA and inserted into a plasmid. The plasmid is then used to
make all of the constructions. The RNA virus is then produced by
transcribing the viral sequence of the plasmid and translation of
the viral genes to produce the coat protein(s) which encapsidate
the viral RNA.
[0310] Construction of plant RNA viruses for the introduction and
expression in plants of non-viral exogenous nucleic acid sequences
such as those included in the construct of the present invention is
demonstrated by the above references as well as in U.S. Pat. No.
5,316,931.
[0311] In one embodiment, a plant viral nucleic acid is provided in
which the native coat protein coding sequence has been deleted from
a viral nucleic acid, a non-native plant viral coat protein coding
sequence and a non-native promoter, preferably the subgenomic
promoter of the non-native coat protein coding sequence, capable of
expression in the plant host, packaging of the recombinant plant
viral nucleic acid, and ensuring a systemic infection of the host
by the recombinant plant viral nucleic acid, has been inserted.
Alternatively, the coat protein gene may be inactivated by
insertion of the non-native nucleic acid sequence within it, such
that a protein is produced. The recombinant plant viral nucleic
acid may contain one or more additional non-native subgenomic
promoters. Each non-native subgenomic promoter is capable of
transcribing or expressing adjacent genes or nucleic acid sequences
in the plant host and incapable of recombination with each other
and with native subgenomic promoters. Non-native (foreign) nucleic
acid sequences may be inserted adjacent the native plant viral
subgenomic promoter or the native and a non-native plant viral
subgenomic promoters if more than one nucleic acid sequence is
included. The non-native nucleic acid sequences are transcribed or
expressed in the host plant under control of the subgenomic
promoter to produce the desired products.
[0312] In a second embodiment, a recombinant plant viral nucleic
acid is provided as in the first embodiment except that the native
coat protein coding sequence is placed adjacent one of the
non-native coat protein subgenomic promoters instead of a
non-native coat protein coding sequence.
[0313] In a third embodiment, a recombinant plant viral nucleic
acid is provided in which the native coat protein gene is adjacent
its subgenomic promoter and one or more non-native subgenomic
promoters have been inserted into the viral nucleic acid. The
inserted non-native subgenomic promoters are capable of
transcribing or expressing adjacent genes in a plant host and are
incapable of recombination with each other and with native
subgenomic promoters. Non-native nucleic acid sequences may be
inserted adjacent the non-native subgenomic plant viral promoters
such that the sequences are transcribed or expressed in the host
plant under control of the subgenomic promoters to produce the
desired product.
[0314] In a fourth embodiment, a recombinant plant viral nucleic
acid is provided as in the third embodiment except that the native
coat protein coding sequence is replaced by a non-native coat
protein coding sequence.
[0315] The viral vectors are encapsidated by the coat proteins
encoded by the recombinant plant viral nucleic acid to produce a
recombinant plant virus. The recombinant plant viral nucleic acid
or recombinant plant virus is used to infect appropriate host
plants. The recombinant plant viral nucleic acid is capable of
replication in the host, systemic spread in the host, and
transcription or expression of foreign gene(s) (isolated nucleic
acid) in the host to produce the desired protein.
[0316] In addition to the above, the nucleic acid molecule of the
present invention can also be introduced into a chloroplast genome
thereby enabling chloroplast expression.
[0317] A technique for introducing exogenous nucleic acid sequences
to the genome of the chloroplasts is known. This technique involves
the following procedures. First, plant cells are chemically treated
so as to reduce the number of chloroplasts per cell to about one.
Then, the exogenous nucleic acid is introduced via particle
bombardment into the cells with the aim of introducing at least one
exogenous nucleic acid molecule into the chloroplasts. The
exogenous nucleic acid is selected such that it is integratable
into the chloroplast's genome via homologous recombination which is
readily effected by enzymes inherent to the chloroplast. To this
end, the exogenous nucleic acid includes, in addition to a gene of
interest, at least one nucleic acid stretch which is derived from
the chloroplast's genome. In addition, the exogenous nucleic acid
includes a selectable marker, which serves by sequential selection
procedures to ascertain that all or substantially all of the copies
of the chloroplast genomes following such selection will include
the exogenous nucleic acid. Further details relating to this
technique are found in U.S. Pat. Nos. 4,945,050; and 5,693,507
which are incorporated herein by reference. A polypeptide can thus
be produced by the protein expression system of the chloroplast and
become integrated into the chloroplast's inner membrane.
[0318] In case that the exogenous polypeptide confers disease
resistance to the plant, the expression can be determined based on
increased in resistance or tolerance to pathogens, preferably in
comparison with similar wild-type (non-transformed) plant.
Comparative evaluation of plants for their resistance or tolerance
to pathogens can be effected using in vitro or in vivo bioassays
well known in the art of plant pathology such as described, for
example by Agrios, G. N., ed. (Plant Pathology, Third Edition,
Academic Press, New York, 1988).
[0319] Evaluating plant resistance or tolerance to pathogens can be
effected by exposing a pathogen to an extract obtained from plant
tissue and determining the effect of the extract on the pathogen
growth in vitro. In some embodiments, evaluating plant resistance
or tolerance to pathogens is effected by exposing a pathogen to a
plant tissue (e.g., a leaf tissue).
[0320] In other embodiments, evaluating plant resistance or
tolerance to pathogens is effected by exposing a pathogen to a
whole plant. For example, evaluating plant resistance or tolerance
to Fusarium oxysporum f. sp. Cubense (Foc) (the causal agent of
Panama disease) can be effected by planting transformed banana
plants in an open field in a close proximity to non-transformed
plants which are infected with the pathogen (used as a source of
inoculum). The disease severity which subsequently develops in
transformed plants is evaluated comparatively to non-transformed
plants. The disease severity is preferably evaluated visually (the
damage usually appears on suckers which have at least 5-12 leaves)
and statistically analyzed to determine significant differences in
resistance or tolerance between plant lines to the Panama
disease.
[0321] Hence, the present invention provides nucleic acid
constructs including one or more polynucleotides encoding disease
resistance polypeptides, transformed banana cells and transformed
banana plants expressing exogenous disease resistance traits, and
methods of producing same.
VI. Breeding Methods
[0322] Open-Pollinated Populations. The improvement of
open-pollinated populations of such crops as rye, many maizes and
sugar beets, herbage grasses, legumes such as alfalfa and clover,
and tropical tree crops such as cacao, coconuts, oil palm and some
rubber, depends essentially upon changing gene-frequencies towards
fixation of favorable alleles while maintaining a high (but far
from maximal) degree of heterozygosity. Uniformity in such
populations is impossible and trueness-to-type in an
open-pollinated variety is a statistical feature of the population
as a whole, not a characteristic of individual plants. Thus, the
heterogeneity of open-pollinated populations contrasts with the
homogeneity (or virtually so) of inbred lines, clones and
hybrids.
[0323] Population improvement methods fall naturally into two
groups, those based on purely phenotypic selection, normally called
mass selection, and those based on selection with progeny testing.
Interpopulation improvement utilizes the concept of open breeding
populations; allowing genes for flow from one population to
another. Plants in one population (cultivar, strain, ecotype, or
any germplasm source) are crossed either naturally (e.g., by wind)
or by hand or by bees (commonly Apis mellifera L. or Megachile
rotundata F.) with plants from other populations. Selection is
applied to improve one (or sometimes both) population(s) by
isolating plants with desirable traits from both sources.
[0324] There are basically two primary methods of open-pollinated
population improvement. First, there is the situation in which a
population is changed en masse by a chosen selection procedure. The
outcome is an improved population that is indefinitely propagable
by random-mating within itself in isolation. Second, the synthetic
variety attains the same end result as population improvement but
is not itself propagable as such; it has to be reconstructed from
parental lines or clones. These plant breeding procedures for
improving open-pollinated populations are well known to those
skilled in the art and comprehensive reviews of breeding procedures
routinely used for improving cross-pollinated plants are provided
in numerous texts and articles, including: Allard, Principles of
Plant Breeding, John Wiley & Sons, Inc. (1960); Simmonds,
Principles of Crop Improvement, Longman Group Limited (1979);
Hallauer and Miranda, Quantitative Genetics in Maize Breeding, Iowa
State University Press (1981); and, Jensen, Plant Breeding
Methodology, John Wiley & Sons, Inc. (1988). For population
improvement methods specific for soybean see, e.g., J. R. Wilcox,
editor (1987) SOYBEANS: Improvement, Production, and Uses, Second
Edition, American Society of Agronomy, Inc., Crop Science Society
of America, Inc., and Soil Science Society of America, Inc.,
publishers, 888 pages.
[0325] Mass Selection. In mass selection, desirable individual
plants are chosen, harvested, and the seed composited without
progeny testing to produce the following generation. Since
selection is based on the maternal parent only, and there is no
control over pollination, mass selection amounts to a form of
random mating with selection. As stated above, the purpose of mass
selection is to increase the proportion of superior genotypes in
the population.
[0326] Synthetics. A synthetic variety is produced by crossing
inter se a number of genotypes selected for good combining ability
in all possible hybrid combinations, with subsequent maintenance of
the variety by open pollination. Whether parents are (more or less
inbred) seed-propagated lines, as in some sugar beet and beans
(Vicia) or clones, as in herbage grasses, clovers and alfalfa,
makes no difference in principle. Parents are selected on general
combining ability, sometimes by test crosses or toperosses, more
generally by polycrosses. Parental seed lines may be deliberately
inbred (e.g. by selfing or sib crossing). However, even if the
parents are not deliberately inbred, selection within lines during
line maintenance will ensure that some inbreeding occurs. Clonal
parents will, of course, remain unchanged and highly
heterozygous.
[0327] Whether a synthetic can go straight from the parental seed
production plot to the farmer or must first undergo one or two
cycles of multiplication depends on seed production and the scale
of demand for seed. In practice, grasses and clovers are generally
multiplied once or twice and are thus considerably removed from the
original synthetic.
[0328] While mass selection is sometimes used, progeny testing is
generally preferred for polycrosses, because of their operational
simplicity and obvious relevance to the objective, namely
exploitation of general combining ability in a synthetic.
[0329] The number of parental lines or clones that enters a
synthetic varies widely. In practice, numbers of parental lines
range from 10 to several hundred, with 100-200 being the average.
Broad based synthetics formed from 100 or more clones would be
expected to be more stable during seed multiplication than narrow
based synthetics.
[0330] Hybrids. As discussed above, hybrid is an individual plant
resulting from a cross between parents of differing genotypes.
Commercial hybrids are now used extensively in many crops,
including corn (maize), sorghum, sugar beet, sunflower and
broccoli. Hybrids can be formed in a number of different ways,
including by crossing two parents directly (single cross hybrids),
by crossing a single cross hybrid with another parent (three-way or
triple cross hybrids), or by crossing two different hybrids
(four-way or double cross hybrids).
[0331] Strictly speaking, most individuals in an out breeding
(i.e., open-pollinated) population are hybrids, but the term is
usually reserved for cases in which the parents are individuals
whose genomes are sufficiently distinct for them to be recognized
as different species or subspecies. Hybrids may be fertile or
sterile depending on qualitative and/or quantitative differences in
the genomes of the two parents. Heterosis, or hybrid vigor, is
usually associated with increased heterozygosity that results in
increased vigor of growth, survival, and fertility of hybrids as
compared with the parental lines that were used to form the hybrid.
Maximum heterosis is usually achieved by crossing two genetically
different, highly inbred lines.
[0332] The production of hybrids is a well-developed industry,
involving the isolated production of both the parental lines and
the hybrids which result from crossing those lines. For a detailed
discussion of the hybrid production process, see, e.g., Wright,
Commercial Hybrid Seed Production 8:161-176, In Hybridization of
Crop Plants.
[0333] Bulk Segregation Analysis (BSA). BSA, a.k.a. bulked
segregation analysis, or bulk segregant analysis, is a method
described by Michelmore et al. (Michelmore et al., 1991,
Identification of markers linked to disease-resistance genes by
bulked segregant analysis: a rapid method to detect markers in
specific genomic regions by using segregating populations.
Proceedings of the National Academy of Sciences, USA, 99:9828-9832)
and Quarrie et al. (Quarrie et al., Bulk segregant analysis with
molecular markers and its use for improving drought resistance in
maize, 1999, Journal of Experimental Botany,
50(337):1299-1306).
[0334] For BSA of a trait of interest, parental lines with certain
different phenotypes are chosen and crossed to generate F2, doubled
haploid or recombinant inbred populations with QTL analysis. The
population is then phenotyped to identify individual plants or
lines having high or low expression of the trait. Two DNA bulks are
prepared, one from the individuals having one phenotype (e.g.,
resistant to pathogen), and the other from the individuals having
reversed phenotype (e.g., susceptible to pathogen), and analyzed
for allele frequency with molecular markers. Only a few individuals
are required in each bulk (e.g., 10 plants each) if the markers are
dominant (e.g., RAPDs). More individuals are needed when markers
are co-dominant (e.g., RFLPs). Markers linked to the phenotype can
be identified and used for breeding or QTL mapping.
[0335] Gene Pyramiding. The method to combine into a single
genotype a series of target genes identified in different parents
is usually referred as gene pyramiding. The first part of a gene
pyramiding breeding is called a pedigree and is aimed at cumulating
one copy of all target genes in a single genotype (called root
genotype). The second part is called the fixation steps and is
aimed at fixing the target genes into a homozygous state, that is,
to derive the ideal genotype (ideotype) from the root genotype.
Gene pyramiding can be combined with marker assisted selection
(MAS, see Hospital et al., 1992, 1997a, and 1997b, and Moreau et
al, 1998) or marker based recurrent selection (MBRS, see Hospital
et al., 2000).
[0336] Banana breeding programs, especially for edible bananas, is
hampered by high sterility, triploidy and seedlessness. Few diploid
banana clones produce viable pollen, and the germplasm of
commercial banana clones is both male- and female-sterile. In spite
of these problems and challenges, important progress has been made
in the genetic improvement of Musa in recent years, and new
varieties are not becoming available from banana breeding programs
(Escalant and Jain, Chapter 30, Banana improvement with cellular
and molecular biology, and induced mutations: future and
perspectives, 8 pages, In Jain and Swennan, editors, Banana
Improvement: Cellular, Molecular Biology, and Induced Mutations,
2004, Food and Agriculture Organization of the United Nations,
Science Publishers, Inc.).
[0337] For information on banana breeding see, for example,
Heslop-Harrison and Schwarzacher, Annals of Botany 100:1073-1084,
2007; Bakry et al., Chapter 1, Genetic Improvement in Banana, 50
pages, In Breeding Plantation Tree Crops: Tropical Species, 2009;
Heslop-Harrison et al., Genomics, Banana Breeding and
Superdomestication, Acta Hort. 897:55-62, 2011; Jenny et al., In
Jacome et al., editors, Mycosphaerella leaf spot diseases of
banana: present status and outlook, Proceedings of the 2.sup.nd
International Workshop on Mycosphaerella leaf spot diseases held in
San Jose, Costa Rica, 20-23 May 2002, Session 4, pages 199-208;
Ortiz et al., Banana and Plantain Breeding, Chapter 10, pages
110-146, In Gowen et al., editors, Bananas and Plantains, World
Crop Series, Springer Link, 1995; Batte et al., Frontiers in Plant
Science, Volum 10, Article 81, 9 pages, February 2019.
VII. Gene Editing
[0338] As used herein, the term "gene editing system" refers to a
system comprising one or more DNA-binding domains or components and
one or more DNA-modifying domains or components, or isolated
nucleic acids, e.g., one or more vectors, encoding said DNA-binding
and DNA-modifying domains or components. Gene editing systems are
used for modifying the nucleic acid of a target gene and/or for
modulating the expression of a target gene. In known gene editing
systems, for example, the one or more DNA-binding domains or
components are associated with the one or more DNA-modifying
domains or components, such that the one or more DNA-binding
domains target the one or more DNA-modifying domains or components
to a specific nucleic acid site. Methods and compositions for
enhancing gene editing is well known in the art. See example, U.S.
Patent Application Publication No. 2018/0245065, which is
incorporated by reference in its entirety.
[0339] Certain gene editing systems are known in the art, and
include but are not limited to, zinc finger nucleases,
transcription activator-like effector nucleases (TALEN5); clustered
regularly interspaced short palindromic repeats (CRISPR)/Cas
systems, meganuclease systems, and viral vector-mediated gene
editing.
[0340] In some embodiments, the present disclosure teaches methods
for gene editing/cloning utilizing DNA nucleases. CRISPR complexes,
transcription activator-like effector nucleases (TALEN5), zinc
finger nucleases (ZFNs), and FokI restriction enzymes, which are
some of the sequence-specific nucleases that have been used as gene
editing tools. These enzymes are able to target their nuclease
activities to desired target loci through interactions with guide
regions engineered to recognize sequences of interest. In some
embodiments, the present disclosure teaches CRISPR-based gene
editing methods to genetically engineer the genome of banana
species of the present disclosure in order to stimulate, enhance,
or modulate disease resistance to pathogens.
[0341] (i) CRISPR Systems
[0342] CRISPR (Clustered Regularly Interspaced Short Palindromic
Repeats) and CRISPR-associated (cas) endonucleases were originally
discovered as adaptive immunity systems evolved by bacteria and
archaea to protect against viral and plasmid invasion. Naturally
occurring CRISPR/Cas systems in bacteria are composed of one or
more Cas genes and one or more CRISPR arrays consisting of short
palindromic repeats of base sequences separated by genome-targeting
sequences acquired from previously encountered viruses and plasmids
(called spacers). (Wiedenheft, B., et. al. Nature. 2012; 482:331;
Bhaya, D., et. al., Annu. Rev. Genet. 2011; 45:231; and Terms, M.
P. et. al., Curr. Opin. Microbiol. 2011; 14:321). Bacteria and
archaea possessing one or more CRISPR loci respond to viral or
plasmid challenge by integrating short fragments of foreign
sequence (protospacers) into the host chromosome at the proximal
end of the CRISPR array. Transcription of CRISPR loci generates a
library of CRISPR-derived RNAs (crRNAs) containing sequences
complementary to previously encountered invading nucleic acids
(Haurwitz, R. E., et. al., Science. 2012:329; 1355; Gesner, E. M.,
et. al., Nat. Struct. Mol. Biol. 2001:18; 688; Jinek, M., et. al.,
Science. 2012:337; 816-21). Target recognition by crRNAs occurs
through complementary base pairing with target DNA, which directs
cleavage of foreign sequences by means of Cas proteins. (Jinek et.
al. 2012 "A Programmable dual-RNA-guided DNA endonuclease in
adaptive bacterial immunity." Science. 2012:337; 816-821).
[0343] There are at least five main CRISPR system types (Type I,
II, III, IV and V) and at least 16 distinct subtypes (Makarova, K.
S., et al., Nat Rev Microbiol. 2015. Nat. Rev. Microbiol. 13,
722-736). CRISPR systems are also classified based on their
effector proteins. Class 1 systems possess multi-subunit
crRNA-effector complexes, whereas in Class 2 systems all functions
of the effector complex are carried out by a single protein (e.g.,
Cas9 or Cpf1). In some embodiments, the present disclosure provides
using type II and/or type V single-subunit effector systems.
[0344] As these naturally occur in many different types of
bacteria, the exact arrangements of the CRISPR and structure,
function and number of Cas genes and their product differ somewhat
from species to species. Haft et al. (2005) PLoS Comput. Biol. 1:
e60; Kunin et al. (2007) Genome Biol. 8: R61; Mojica et al. (2005)
J. Mol. Evol. 60: 174-182; Bolotin et al. (2005) Microbiol. 151:
2551-2561; Pourcel et al. (2005) Microbiol. 151: 653-663; and Stern
et al. (2010) Trends. Genet. 28: 335-340. For example, the Cse (Cas
subtype, E. coli) proteins (e.g., CasA) form a functional complex,
Cascade, which processes CRISPR RNA transcripts into spacer-repeat
units that Cascade retains. Brouns et al. (2008) Science 321:
960-964. In other prokaryotes, Cas6 processes the CRISPR
transcript. The CRISPR-based phage inactivation in E. coli requires
Cascade and Cas3, but not Cas1 or Cas2. The Cmr (Cas RAMP module)
proteins in Pyrococcus furiosus and other prokaryotes form a
functional complex with small CRISPR RNAs that recognizes and
cleaves complementary target RNAs. A simpler CRISPR system relies
on the protein Cas9, which is a nuclease with two active cutting
sites, one for each strand of the double helix. Combining Cas9 and
modified CRISPR locus RNA can be used in a system for gene editing.
Pennisi (2013) Science 341: 833-836.
[0345] (ii) CRISPR/Cas9
[0346] In some embodiments, the present disclosure provides methods
of gene editing using a Type II CRISPR system. Type II systems rely
on a i) single endonuclease protein, ii) a transactiving crRNA
(tracrRNA), and iii) a crRNA where a .about.20-nucleotide (nt)
portion of the 5' end of crRNA is complementary to a target nucleic
acid. The region of a CRISPR crRNA strand that is complementary to
its target DNA protospacer is hereby referred to as "guide
sequence."
[0347] In some embodiments, the tracrRNA and crRNA components of a
Type II system can be replaced by a single guide RNA (sgRNA), also
known as a guide RNA (gRNA). The sgRNA can include, for example, a
nucleotide sequence that comprises an at least 12-20 nucleotide
sequence complementary to the target DNA sequence (guide sequence)
and can include a common scaffold RNA sequence at its 3' end. As
used herein, "a common scaffold RNA" refers to any RNA sequence
that mimics the tracrRNA sequence or any RNA sequences that
function as a tracrRNA.
[0348] Cas9 endonucleases produce blunt end DNA breaks, and are
recruited to target DNA by a combination of a crRNA and a tracrRNA
oligos, which tether the endonuclease via complementary
hybridization of the RNA CRISPR complex.
[0349] In some embodiments, DNA recognition by the
crRNA/endonuclease complex requires additional complementary
base-pairing with a protospacer adjacent motif (PAM) (e.g.,
5'-NGG-3') located in a 3' portion of the target DNA, downstream
from the target protospacer. (Jinek, M., et. al., Science. 2012,
337:816-821). In some embodiments, the PAM motif recognized by a
Cas9 varies for different Cas9 proteins.
[0350] In some embodiments the Cas9 disclosed herein can be any
variant derived or isolated from any source. In other embodiments,
the Cas9 peptide of the present disclosure can include one or more
of the mutations described in the literature, including but not
limited to the functional mutations described in: Fonfara et al.
Nucleic Acids Res. 2014 February; 42(4):2577-90; Nishimasu H. et
al. Cell. 2014 Feb. 27, 156(5):935-49; Jinek M. et al. Science.
2012 337:816-21; and Jinek M. et al. Science. 2014 Mar. 14,
343(6176); see also U.S. patent application Ser. No. 13/842,859,
filed Mar. 15, 2013, which is hereby incorporated by reference;
further, see U.S. Pat. Nos. 8,697,359; 8,771,945; 8,795,965;
8,865,406; 8,871,445; 8,889,356; 8,895,308; 8,906,616; 8,932,814;
8,945,839; 8,993,233; and 8,999,641, which are all hereby
incorporated by reference. Thus, in some embodiments, the systems
and methods disclosed herein can be used with the wild type Cas9
protein having double-stranded nuclease activity, Cas9 mutants that
act as single stranded nickases, or other mutants with modified
nuclease activity.
[0351] According to the present disclosure, Cas9 molecules of,
derived from, or based on the Cas9 proteins of a variety of species
can be used in the methods and compositions described herein. For
example, Cas9 molecules of, derived from, or based on, e.g., S.
pyogenes, S. thermophilus, Staphylococcus aureus and/or Neisseria
meningitidis Cas9 molecules, can be used in the systems, methods
and compositions described herein. Additional Cas9 species include:
Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus
succinogenes, Actinobacillus suis, Actinomyces sp., cychphilus
denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus
smithii, Bacillus thuringiensis, Bacteroides sp., Blastopirellula
marina, Bradyrhiz obium sp., Brevibacillus latemsporus,
Campylobacter coli, Campylobacter jejuni, Campylobacter lad,
Candidatus Puniceispirillum, Clostridiu cellulolyticum, Clostridium
perfringens, Corynebacterium accolens, Corynebacterium diphtheria,
Corynebacterium matruchotii, Dinoroseobacter sliibae, Eubacterium
dolichum, gamma proteobacterium, Gluconacetobacler diazotrophicus,
Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter
canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacler
polytropus, Kingella kingae, Lactobacillus crispatus, Listeria
ivanovii, Listeria monocytogenes, Listeriaceae bacterium,
Methylocystis sp., Methylosinus trichosporium, Mobiluncus mulieris,
Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens,
Neisseria lactamica. Neisseria sp., Neisseria wadsworthii,
Nitrosomonas sp., Parvibaculum lavamentivorans, Pasteurella
multocida, Phascolarctobacterium succinatutens, Ralstonia syzygii,
Rhodopseudomonas palustris, Rhodovulum sp., Simonsiella muelleri,
Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus
lugdunensis, Streptococcus sp., Subdoligranulum sp., Tislrella
mobilis, Treponema sp., or Verminephrobacter eiseniae.
[0352] In some embodiments, the present disclosure teaches the use
of tools for genome editing techniques in plants such as crops and
methods of gene editing using CRISPR-associated (cas) endonucleases
including SpyCas9, SaCas9, St1Cas9. These powerful tools for genome
editing, which can be applied to plant genome editing are well
known in the art. See example, Song et al. (2016), CRISPR/Cas9: A
powerful tool for crop genome editing, The Crop Journal 4:75-82,
Mali et al. (2013) RNA-guided human genome engineering via cas9,
Science 339: 823-826; Ran et al. (2015) In vivo genome editing
using Staphylococcus aureus cas9, Nature 520: 186-191; Esvelt et
al. (2013) Orthogonal cas9 proteins for ma-guided gene regulation
and editing, Nature methods 10(11): 1116-1121, each of which is
hereby incorporated by reference in its entirety for all
purposes.
[0353] (iii) CRISPR/Cpf1
[0354] In other embodiments, the present disclosure provides
methods of gene editing using a Type V CRISPR system. In some
embodiments, the present disclosure provides methods of gene
editing using CRISPR from Prevotella, Francisella, Acidaminococcus,
Lachnospiraceae, and Moraxella (Cpf1).
[0355] The Cpf1 CRISPR systems of the present disclosure comprise
i) a single endonuclease protein, and ii) a crRNA, wherein a
portion of the 3' end of crRNA contains the guide sequence
complementary to a target nucleic acid. In this system, the Cpf1
nuclease is directly recruited to the target DNA by the crRNA. In
some embodiments, guide sequences for Cpf1 must be at least 12nt,
13nt, 14nt, 15nt, or 16nt in order to achieve detectable DNA
cleavage, and a minimum of 14nt, 15nt, 16nt, 17nt, or 18nt to
achieve efficient DNA cleavage.
[0356] The Cpf1 systems of the present disclosure differ from Cas9
in a variety of ways. First, unlike Cas9, Cpf1 does not require a
separate tracrRNA for cleavage. In some embodiments, Cpf1 crRNAs
can be as short as about 42-44 bases long--of which 23-25 nt is
guide sequence and 19 nt is the constitutive direct repeat
sequence. In contrast, the combined Cas9 tracrRNA and crRNA
synthetic sequences can be about 100 bases long.
[0357] Second, certain Cpf1 systems prefer a "TTN" PAM motif that
is located 5' upstream of its target. This is in contrast to the
"NGG" PAM motifs located on the 3' of the target DNA for common
Cas9 systems such as Streptococcus pyogenes Cas9. In some
embodiments, the uracil base immediately preceding the guide
sequence cannot be substituted (Zetsche, B. et al. 2015. "Cpf1 Is a
Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System" Cell
163, 759-771, which is hereby incorporated by reference in its
entirety for all purposes).
[0358] Third, the cut sites for Cpf1 are staggered by about 3-5
bases, which create "sticky ends" (Kim et al., 2016. "Genome-wide
analysis reveals specificities of Cpf1 endonucleases in human
cells" published online Jun. 6, 2016). These sticky ends with 3-5
nt overhangs are thought to facilitate NHEJ-mediated-ligation, and
improve gene editing of DNA fragments with matching ends. The cut
sites are in the 3' end of the target DNA, distal to the 5' end
where the PAM is. The cut positions usually follow the 18th base on
the non-hybridized strand and the corresponding 23rd base on the
complementary strand hybridized to the crRNA.
[0359] Fourth, in Cpf1 complexes, the "seed" region is located
within the first 5 nt of the guide sequence. Cpf1 crRNA seed
regions are highly sensitive to mutations, and even single base
substitutions in this region can drastically reduce cleavage
activity (see Zetsche B. et al. 2015 "Cpf1 Is a Single RNA-Guided
Endonuclease of a Class 2 CRISPR-Cas System" Cell 163, 759-771).
Critically, unlike the Cas9 CRISPR target, the cleavage sites and
the seed region of Cpf1 systems do not overlap. Additional guidance
on designing Cpf1 crRNA targeting oligos is available on Zetsche B.
et al. 2015. ("Cpf1 Is a Single RNA-Guided Endonuclease of a Class
2 CRISPR-Cas System" Cell 163, 759-771).
[0360] (iv) Guide RNA (gRNA)
[0361] In some embodiments, the guide RNA of the present disclosure
comprises two coding regions, encoding for crRNA and tracrRNA,
respectively. In other embodiments, the guide RNA is a single guide
RNA (sgRNA) synthetic crRNA/tracrRNA hybrid. In other embodiments,
the guide RNA is a crRNA for a Cpf1 endonuclease.
[0362] Persons having skill in the art will appreciate that, unless
otherwise noted, all references to a single guide RNA (sgRNA) in
the present disclosure can be read as referring to a guide RNA
(gRNA). Therefore, embodiments described in the present disclosure
which refer to a single guide RNA (sgRNA) will also be understood
to refer to a guide RNA (gRNA).
[0363] The guide RNA is designed so as to recruit the CRISPR
endonuclease to a target DNA region. In some embodiments, the
present disclosure teaches methods of identifying viable target
CRISPR landing sites, and designing guide RNAs for targeting the
sites. For example, in some embodiments, the present disclosure
teaches algorithms designed to facilitate the identification of
CRISPR landing sites within target DNA regions.
[0364] In some embodiments, the present disclosure teaches use of
software programs designed to identify candidate CRISPR target
sequences on both strands of an input DNA sequence based on desired
guide sequence length and a CRISPR motif sequence (PAM, protospacer
adjacent motif) for a specified CRISPR enzyme. For example, target
sites for Cpf1 from Francisella novicida U112, with PAM sequences
TTN, may be identified by searching for 5'-TTN-3' both on the input
sequence and on the reverse-complement of the input. The target
sites for Cpf1 from Lachnospiraceae bacterium and Acidaminococcus
sp., with PAM sequences TTTN, may be identified by searching for
5'-TTTN-3' both on the input sequence and on the reverse complement
of the input. Likewise, target sites for Cas9 of S. thermophilus
CRISPR, with PAM sequence NNAGAAW, may be identified by searching
for 5'-Nx-NNAGAAW-3' both on the input sequence and on the
reverse-complement of the input. The PAM sequence for Cas9 of S.
pyogenes is 5'-NGG-3'.
[0365] Since multiple occurrences in the genome of the DNA target
site may lead to nonspecific genome editing, after identifying all
potential sites, sequences may be filtered out based on the number
of times they appear in the relevant reference genome or modular
CRISPR construct. For those CRISPR enzymes for which sequence
specificity is determined by a `seed` sequence (such as the first 5
bp of the guide sequence for Cpf1-mediated cleavage) the filtering
step may also account for any seed sequence limitations.
[0366] In some embodiments, algorithmic tools can also identify
potential off target sites for a particular guide sequence. For
example, in some embodiments Cas-Offinder can be used to identify
potential off target sites for Cpf1 (see Kim et al., 2016.
"Genome-wide analysis reveals specificities of Cpf1 endonucleases
in human cells" Nature Biotechnology 34, 863-868). Any other
publicly available CRISPR design/identification tool may also be
used, including for example the Zhang lab crispr.mit.edu tool (see
Hsu, et al. 2013 "DNA targeting specificity of RNA guided Cas9
nucleases" Nature Biotech 31, 827-832).
[0367] In some embodiments, the user may be allowed to choose the
length of the seed sequence. The user may also be allowed to
specify the number of occurrences of the seed: PAM sequence in a
genome for purposes of passing the filter. The default is to screen
for unique sequences. Filtration level is altered by changing both
the length of the seed sequence and the number of occurrences of
the sequence in the genome. The program may in addition or
alternatively provide the sequence of a guide sequence
complementary to the reported target sequence(s) by providing the
reverse complement of the identified target sequence(s).
[0368] In the guide RNA, the "spacer/guide sequence" sequence is
complementary to the "proto spacer" sequence in the DNA target. The
gRNA" scaffold" for a single stranded gRNA structure is recognized
by the Cas9 protein.
[0369] In some embodiments, the transgenic plant, plant part, plant
cell, or plant tissue culture taught in the present disclosure
comprise a recombinant construct, which comprises at least one
nucleic acid sequence encoding a guide RNA. In some embodiments,
the nucleic acid is operably linked to a promoter. In other
embodiments, a recombinant construct further comprises a nucleic
acid sequence encoding a Clustered regularly interspaced short
palindromic repeats (CRISPR) endonuclease. In other embodiments,
the guide RNA is capable of forming a complex with said CRISPR
endonuclease, and said complex is capable of binding to and
creating a double strand break in a genomic target sequence of said
plant genome. In other embodiments, the CRISPR endonuclease is
Cas9.
[0370] In further embodiments, the target sequence is a nucleic
acid for FusR1, homologs of FusR1, orthologs of FusR1 and/or
paralogs of FusR1, and/or fragments and variations thereof. In some
embodiments, the present disclosure teaches the gene editing of
FusR1 in FW-sensitive banana varieties susceptible to Fusarium
pathogens using genetic engineering techniques described
herein.
[0371] The present disclosure teaches the targeted gene-editing
techniques for modulating, stimulating, and enhancing disease
resistance by turning FW-sensitive alleles to FW-resistant alleles
based on sequence information given in the present disclosure. The
present disclosure teaches sequence information of both
FW-resistant alleles and FW-sensitive alleles. Using CRISPR/Cas
system, FW-resistant traits are introduced into FW-sensitive banana
varieties.
[0372] In some embodiments, FW-sensitive FusR1 alleles are to be
targeted for knock-out. In some embodiments, sequences of conserved
regions responsible for FW sensitivity trait can be used to make
gene editing machineries (such as CRISPR-associated effector
proteins, ZFN, TALEN etc.) to target one or more FusR1
orthologs.
[0373] In some embodiments, the disrupting of expression of the
endogenous FW-sensitive alleles is carried out by a gene-editing
technology. In some embodiments, the knock-out of FW-sensitive
alleles is carried out by gene-editing technology. In some
embodiments, the base-editing of FW-sensitive alleles into
FW-resistant alleles is carried out by gene-editing technology. In
some embodiments, the gene-editing technology is a ZFN. In other
embodiments, the gene-editing technology is a TALEN. In further
embodiments, the gene-editing technology is a CRISPR/Cas system. In
further embodiments, said CRISPR system comprises a nucleic acid
molecule and an enzymatic protein, wherein the nucleic acid
molecule is a guide RNA (gRNA) molecule and the enzymatic protein
is a Cas protein or Cas ortholog. In further embodiments, at least
two expression cassettes are stacked in tandem in the expression
vector.
[0374] In some embodiments, the modified plant cells comprise one
or more modifications (e.g., insertions, deletions, or mutations of
one or more nucleic acids) in the genomic DNA sequence of an
endogenous target gene resulting in the altered function the
endogenous gene, thereby modulating, stimulating, or enhancing
disease resistance. In such embodiments, the modified plant cells
comprise a "modified endogenous target gene." In some embodiments,
the modifications in the genomic DNA sequence cause mutation,
thereby altering the function of FW-sensitive FUSR1 protein to
FW-resistant FUSR1 protein. In some embodiments, the modifications
in the genomic DNA sequence results in amino acid substitutions,
thereby altering the normal function of the encoded protein. In
some embodiments, the modifications in the genomic DNA sequence
encode a modified endogenous protein with modulated, altered,
stimulated or enhanced function of disease/pathogen resistance
compared to the unmodified (i.e., FW-sensitive) version of the
endogenous protein in the FW-sensitive banana accessions.
[0375] In some embodiments, the modified plant cells described
herein comprise one or more modified endogenous target genes,
wherein the one or more modifications result in an altered function
of a gene product (i.e., a protein) encoded by the endogenous
target gene compared to an unmodified plant cell. For example, in
some embodiments, a modified plant cell demonstrates expression of
a FW-resistant FUSR1 protein or an upregulated expression of said
protein. In some embodiments, the expression of the gene product
(such as genetically-engineered FW-resistant FusR1 from
FW-sensitive FusR1) in a modified plant cell is enhanced by at
least 0.5%, 1%, 2%, 3%, 4%, 5% or higher compared to the expression
of the gene product (such as FW-sensitive FusR1) in an unmodified
plant cell. In other embodiments, the expression of the gene
product (such as genetically-engineered FW-resistant FusR1) in a
modified plant cell is enhanced by at least 10%, 20%, 30%, 40%,
50%, 60%, 70%, 80%, 90%, or more compared to the expression of the
gene product (such as FW-sensitive FusR1) in an unmodified plant
cell. In some embodiments, the modified plant cells described
herein demonstrate enhanced expression and/or function of gene
products encoded by a plurality (e.g., two or more) of endogenous
target genes compared to the expression of the gene products in an
unmodified plant cell. For example, in some embodiments, a modified
plant cell demonstrates enhanced expression and/or function of gene
products from 2, 3, 4, 5, 6, 7, 8, 9, 10, or more endogenous target
genes compared to the expression of the gene products in an
unmodified plant cell.
[0376] In some embodiments, the modified plant cells described
herein comprise one or more modified endogenous target genes,
wherein the one or more modifications to the target DNA sequence
results in expression of a protein with reduced or altered function
(e.g., a "modified endogenous protein") compared to the function of
the corresponding protein expressed in an unmodified plant cell
(e.g., a "unmodified endogenous protein"). In some embodiments, the
modified plant cells described herein comprise 2, 3, 4, 5, 6, 7, 8,
9, 10, or more modified endogenous target genes encoding 2, 3, 4,
5, 6, 7, 8, 9, 10, or more modified endogenous proteins. In some
embodiments, the modified endogenous protein demonstrates enhanced
or altered binding affinity for another protein expressed by the
modified plant cell or expressed by another cell; enhanced or
altered signaling capacity; enhanced or altered enzymatic activity;
enhanced or altered DNA-binding activity; or reduced or altered
ability to function as a scaffolding protein.
EXAMPLES
[0377] The present invention is further illustrated by the
following examples that should not be construed as limiting. The
contents of all references, patents, and published patent
applications cited throughout this application, as well as the
Figures, are incorporated herein by reference in their entirety for
all purposes.
Example 1: Methods and Materials for Sequencing
[0378] (1) Material
[0379] Fresh and lyophilized banana leaf tissues were obtained from
Bioversity International (Leuven, Belgium), Inter-TROP CRB Plantes
Tropicales (Guadeloupe), and the IITA Genebank (Ibadan, Nigeria),
Plant Delights Nursery (Raleigh, N.C.), and The Flower Bin
(Longmont, Colo.).
[0380] (2) RNA
[0381] Total RNA was extracted from fresh, frozen, and lyophilized
banana leaves using a modified Ishihara protocol (Ishihara et al.,
2016). Approximately 100 mg of fresh or frozen banana tissue was
ground to a powder using a clean, dry-ice cooled mortar and pestle
that was treated with RNase Away.TM. (Invitrogen, Carlsbad,
Calif.). Approximately 20-30 mg of lyophilized banana tissue was
homogenized in a Lysing Matrix D Tube (MP Bio, Santa Ana, Calif.)
without liquid. One milliliter of polyphenol lysis buffer (800
.mu.l RLT buffer (Qiagen, Germantown, Md.), 200 .mu.l of Fruit-mate
(Takara, Mountain View, Calif.), and 10 .mu.l of
.beta.-mercaptoethanol) was added to each sample. Fresh and frozen
samples were homogenized for 40 seconds on the speed 6 setting of a
FastPrep 120 (ThermoFisher Scientific, Waltham, Mass.), while
lyophilized samples were vortexed on high for 1 minute. All samples
were incubated on ice for 4 minutes, then centrifuged for 2 minutes
at 8000.times.g. The supernatant was transferred to a new 2.0 ml
tube and another 1.0 ml of polyphenol lysis buffer was added to the
supernatant. Samples were vortexed on high for 1 minute, incubated
on ice for 4 minutes, and centrifuged for 2 minutes at 8000 x g.
The supernatant was split between two QIAshredder columns (Qiagen,
Germantown, Md.) and centrifuged on maximum speed for 2 minutes
until all supernatant had been processed. The remaining steps of
RNA extraction were carried out according to the Ishihara protocol.
The optional in-solution DNase digestion and RNA cleanup protocol
was also performed as detailed in the RNeasy Mini protocol (Qiagen,
Germantown, Md.). Sample concentration and purity was determined
using the NanoDrop.TM. One (ThermoFisher Scientific, Waltham,
Mass.) spectrophotometer.
[0382] (3) DNA
[0383] Total DNA was extracted from fresh, frozen, and lyophilized
banana leaves using a modified PowerPlant Pro DNA Isolation Kit
protocol (MO BIO, Carlsbad, Calif.). Approximately 40 mg of fresh
or frozen banana tissue was ground to a powder using a cleaned,
dry-ice cooled mortar and pestle that was treated with RNase
Away.TM. (Invitrogen, Carlsbad, Calif.). Approximately 10-20 mg of
lyophilized banana tissue was homogenized in a Lysing Matrix D Tube
(MP Bio, Santa Ana, Calif.) without liquid. The remaining steps of
DNA extraction were carried out according to the MO BIO protocol.
Phenolic Separation Solution was added to the lysis buffer and 250
.mu.l of PD3 buffer was used. Sample concentration and purity was
determined using the NanoDrop.TM. One (ThermoFisher Scientific,
Waltham, Mass.) spectrophotometer.
[0384] (4) cDNA
[0385] cDNA was synthesized from 1.0 .mu.g of total RNA using the
1st Strand cDNA Synthesis Kit (Epicentre, Madison, Wis.). The
adapter primer (AP) from Invitrogen's 3'-RACE kit (Invitrogen,
Carlsbad, Calif.) was used in place of the poly dT primer.
[0386] (5) Primers
[0387] Primer sequences were designed against homologous regions of
putative target genes with annealing temperatures of
57.degree.-64.degree. C. using the OligoAnalyzer Tool (IDT,
Coralville, Iowa) program. Primers were purchased from IDT.
[0388] (6) PCR
[0389] PCR reactions were performed in 25 .mu.l reactions
containing a final concentration of 1.times. Phusion.RTM. HF
buffer, 300 .mu.M each dNTP, 0.3 .mu.M each forward and reverse
primer, 0.5 Units 1.times. Phusion.RTM. High-Fidelity DNA
Polymerase (ThermoFisher Scientific, Waltham, Mass.) in a Veriti
Thermal Cycler (Applied Biosystems, Carlsbad, Calif.). General PCR
conditions were 98.degree. C. for 2 minutes, followed by 35 cycles
of 98.degree. C. for 10 seconds, 55.degree.-62.degree. C. for 30
seconds (depending on primer Ta), and 72.degree. C. for 30 seconds,
before a final extension at 72.degree. C. for 10 minutes and a hold
at 4.degree. C. PCR products were run on a 1.5% agarose gel and
visualized using GelRed.RTM. Nucleic Acid Stain (Biotium, Hayward,
Calif.) on an Alpha Imager EC (Alpha Innotech, San Leandro,
Calif.).
[0390] (7) Cloning
[0391] PCR fragments were cloned using the Zero Blunt TOPO PCR
Cloning Kit (Invitrogen, Carlsbad, Calif.) using 4 .mu.l of PCR
product, according to the manufacturer's protocol. The ligated
vector was transformed into Top10 One Shot chemically competent
cells (Invitrogen, Carlsbad, Calif.) using the chemical
transformation protocol. The transformed E. coli cells were plated
onto LB agar plates containing 50 .mu.g/ml kanamycin and the plates
were cultured overnight at 37.degree. C.
[0392] (8) Colony PCR
[0393] Colonies containing recombinant plasmids were screened using
PCR with M13 forward and reverse primers. PCR reactions were
performed in 15 .mu.l volumes containing 60 mM Tris-SO4 (pH 8.9),
18 mM Ammonium Sulfate, 2.0 mM Magnesium Sulfate, 0.2 mM each dNTP,
0.2 .mu.M each forward and reverse primer, 0.3 Units Platinum Taq
Hi Fidelity (Invitrogen, Carlsbad, Calif.) in a Veriti Thermal
Cycler (Applied Biosystems, Carlsbad, Calif.). Colonies were picked
and inoculated into the PCR reaction, followed by an inoculation of
50 .mu.l of LB-kanamycin. The colony PCR conditions were 94.degree.
C. for 2 minutes, followed by 35 cycles of 94.degree. C. for 30
seconds, 50.degree. C. for 30 seconds, and 68.degree. C. for 1
minute, before a final extension at 68.degree. C. for 10 minutes
and a hold at 4.degree. C. PCR products were run on a 1.5% agarose
gel and visualized using GelRed.RTM. Nucleic Acid Stain (Biotium,
Hayward, Calif.) on an Alpha Imager EC (Alpha Innotech, San
Leandro, Calif.). Colony PCR reactions producing products of the
expected size were sequenced.
[0394] (9) Sequencing
[0395] Five microliters of each PCR product was prepared for
sequencing by enzymatic treatment using 2 .mu.l of High-Throughput
ExoSAP-IT (Affymetrix, Santa Clara, Calif.). Reactions were
incubated at 37.degree. C. for 15 minutes, followed by 15 minutes
at 80.degree. C. Template was labeled for sequencing using the
BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems,
Carlsbad, Calif.) as follows: 2 .mu.l of the template and 2 .mu.l
of a 0.8 .mu.M sequencing primer was added to a mixture of BigDye
Terminator sequencing buffer, BigDye Terminator v3.1 Ready Reaction
Mix, and water, in a 10 .mu.l reaction. The BigDye sequencing
reaction conditions were as follows: 96.degree. C. for 1 minute,
followed by 25 cycles of 96.degree. C. for 10 seconds, 50.degree.
C. for 5 seconds, and 60.degree. C. for 75 seconds. Unincorporated
BigDye terminators were removed using the BigDye XTerminator
Purification Kit (Applied Biosystems, Carlsbad, Calif.). The
reactions were sequenced using the Applied Biosystems 3500 Genetic
Analyzer (Applied Biosystems, Carlsbad, Calif.).
[0396] (10) Sequence Alignment
[0397] Sequence files from the ABI 3500 Genetic Analyzer were
imported into Sequencher v4.8 Build 3767 (Gene Codes, Ann Arbor,
Mich.). Vector sequence was trimmed using the Trim Vector tool.
Sequences were then automatically aligned and manually edited for
sequencing artifacts.
Example 2: Identifying Structural Differences Between Fusarium Wilt
(FW)-Resistant Gene(s) and Fusarium Wilt (FW)-Sensitive Gene(s)
[0398] In this example, Fusarium Wilt resistance genes were
discovered by analysis, as described below, of DNA sequences
retrieved from GenBank. Nucleotide sequences from several banana
species (i.e. Musa itinerans, Musa acuminata, Musa basjoo, Musella
lasiocarpa, Musa balbisiana) were downloaded. The M. itinerans
FusR1 sequence was obtained from multiple accessions (ITC1526,
ITC1571, and PT-BA-00223), all of which are FW-resistant. The M.
acuminata FusR1 sequence labeled 1`FW-resistant` was obtained from
multiple FW-resistant accessions, including ITC0896 (M a.
subspecies banksii) and PT_BA-00281 (Pisang Bangkahulu). The M.
acuminata sequence labeled `sensitive` is from the FW-sensitive
accessions (ITC0507, ITC0685, PT-BA-00304, PT-BA-00310, and
PT-BA-00315). These accessions include multiple samples from banana
cultivars such as Pisang Madu, Pisang Pipit, and Pisang Rojo Uter,
all of which have been well-characterized as FW-sensitive (Chen et
al, 2019). The M. balbisiana sequence was obtained from several
FW-sensitive accessions, including ITC1016, ITC0545, ITC0080, and
ITC0565. FusR1 from M. basjoo is from FW-resistant accessions
(ITC0061 and PD #3064). Automated bioinformatics analysis was then
applied to each pairwise comparison and only those sequences that
contain a nucleotide change (or changes) that yield evolutionarily
significant change(s) were retained for further analysis. This
enabled the identification of genes that have evolved to confer
some evolutionary advantage as well as the identification of the
specific evolved changes.
[0399] Any of several different molecular evolution analyses or
Ka/Ks-type methods can be employed to evaluate quantitatively and
qualitatively the evolutionary significance of the identified
nucleotide changes between homologous gene sequences from related
species (Kreitman and Akashi, 1995; Li, 1997). For example,
positive selection on proteins (i.e., molecular-level adaptive
evolution) can be detected in protein-coding genes by pairwise
comparisons of the ratios of nonsynonymous nucleotide substitutions
per nonsynonymous site (Ka) to synonymous substitutions per
synonymous site (Ks) (Li et al., 1985; Li, 1993). Any comparison of
Ka and Ks may be used, although it is particularly convenient and
most effective to compare these two variables as a ratio. Sequences
are identified by exhibiting a statistically significant difference
between Ka and Ks using standard statistical methods.
[0400] In some aspects, the Ka/Ks analysis by Li et al. (1993) is
used to carry out the present disclosure, although other analysis
programs that can detect positively selected genes between species
can also be used (Li et al. 1985; Li, 1993; Messier and Stewart,
1997; Nei, 1987).
[0401] The Ka/Ks method, which comprises a comparison of the rate
of non-synonymous substitutions per non-synonymous site with the
rate of synonymous substitutions per synonymous site between
homologous protein-coding regions of genes in terms of a ratio, is
used to identify sequence substitutions that may be driven by
adaptive selection as opposed to neutral substitutions during
evolution. A synonymous (`silent`) substitution is one that, owing
to the degeneracy of the genetic code, makes no change to the amino
acid sequence encoded; a non-synonymous substitution results in an
amino acid replacement. The extent of each type of change can be
estimated as Ka and Ks, respectively, the numbers of synonymous
substitutions per synonymous site and non-synonymous substitutions
per non-synonymous site. Calculations of Ka/Ks may be performed
manually or by using software. An example of suitable programs are
Li93 (Li, 1993), or MEGA X: Molecular Evolutionary Genetics
Analysis Across Computing Platforms (Kumar et al., 2018)
[0402] For the purpose of estimating Ka and Ks, either complete or
partial protein-coding sequences are used to calculate total
numbers of synonymous and non-synonymous substitutions, as well as
non-synonymous and synonymous sites. The length of the
polynucleotide sequence analyzed can be any appropriate length.
Preferably, the entire coding sequence is compared in order to
determine any and all significant changes. Publicly available
computer programs, such as Li93 (Li, 1993), or MEGA X: Molecular
Evolutionary Genetics Analysis Across Computing Platforms (Kumar et
al., 2018) can be used to calculate the Ka and Ks values for all
pairwise comparisons.
[0403] This analysis can be further adapted to examine sequences in
a "sliding window` fashion such that small numbers of important
changes are not masked by the whole sequence. "Sliding window`
refers to examination of consecutive, over lapping subsections of
the gene (the subsections can be of any length).
[0404] The comparison of non-synonymous and synonymous substitution
rates is commonly represented by the Ka/Ks ratio. Ka/Ks has been
shown to be a reflection of the degree to which adaptive evolution
has been at work in the sequence under study. Full length or
partial segments of a coding sequence can be used for the Ka/Ks
analysis. The higher the Ka/Ks ratio, the more likely that a
sequence has undergone adaptive evolution and the non-synonymous
substitutions are evolutionarily significant. See, for example,
Messier and Stewart (1997).
[0405] Ka/Ks ratios significantly greater than one (1.0) strongly
suggest that positive selection has fixed greater numbers of amino
acid replacements than can be expected as a result of chance alone
and is in contrast to the most commonly observed pattern in which
the ratio is less than or equal to one (Nei, 1987; Hughes and Nei,
1988; Messier and Stewart, 1994; Kreitman and Akashi, 1995; Messier
and Stewart, 1997). Ratios less than one generally signify the role
of negative, or purifying selection indicating that there is strong
pressure on the primary structure of functional, effective proteins
to remain unchanged.
[0406] All methods for calculating Ka/Ks ratios are based on a
pairwise comparison of the number of nonsynonymous substitutions
per nonsynonymous site to the number of synonymous substitutions
per synonymous site for the protein-coding regions of homologous
genes from related species. Each method implements different
corrections for estimating "multiple hits" (i.e., more than one
nucleotide substitution at the same site). Each method also uses
different models for how DNA sequences change over evolutionary
time. Thus, preferably, a combination of results from different
algorithms is used to increase the level of sensitivity for
detection of positively-selected genes and confidence in the
result.
[0407] It is understood that the methods described herein could
lead to the identification of banana polynucleotide sequences that
are functionally related to banana protein coding sequences. Such
sequences may include, but are not limited to, non-coding sequences
or coding sequences that do not encode proteins. These related
sequences can be, for example, physically adjacent to the banana
protein-coding sequences in the banana genome, such as introns or
5'- and 3'-flanking sequences (including control elements such as
promoters and enhancers). These related sequences may be obtained
via searching a public genome database such as GenBank or,
alternatively, by screening and sequencing an appropriate genomic
library with a protein-coding sequence as a probe.
[0408] After candidate genes were identified, the nucleotide
sequences of the genes in each orthologous gene pair were carefully
verified by standard DNA sequencing techniques and then Ka/Ks
analysis was repeated for each carefully sequenced candidate gene
pair. More specifically, the software ran through all possible
pairwise comparisons between putative orthologs of every gene from
cultivated banana, Musa acuminata (AAA subgr. Cavendish) compared
to the orthologs from the wild species, looking for high Ka/Ks
ratios. The software BLASTed (in automated fashion) every mRNA
sequence from cultivated banana against every sequence in the
transcriptome that was sequenced from a wild relative, for example,
M. balbisiana. The software then performed Ka/Ks analysis for each
gene pair (i.e., each set of orthologs), flagging the gene pairs
with high Ka/Ks scores.
[0409] The software then compared every cultivated banana sequence
against every sequence of another wild relative, for example, M.
basjoo, again by doing a series of BLASTs and then sifting through
for high Ka/Ks scores. It thus does this for the transcriptome
sequence of all the wild species in succession. This gives a set of
candidates (see below) for subsequent analysis. The software next
compared every gene sequence in the transcriptome of M. balbisiana
against every sequence of M. basjoo, again by doing a series of
BLASTs, and then sifting through for high Ka/Ks scores. It thus
ultimately compared all of the expressed genes represented in the
utilized cDNA libraries of every banana species against all the
genes of every other banana species, both wild and cultivated, with
the goal of finding every gene that shows evidence of positive
selection.
[0410] The flagged gene pairs that emerged were then individually
and carefully re-sequenced in the lab to check the accuracy of the
original high-throughput reads to eliminate false positives.
[0411] Next, every remaining candidate gene pair with a high Ka/Ks
score was examined to determine if the comparison was truly
orthologous or just an artifactual false positive caused by a
paralogous comparison.
[0412] Using the methodology described above, banana gene sequences
available in GenBank were analyzed to identify a
positively-selected gene that has not been linked to FW-resistance
trait in banana species in the art. Inventor identified and
selected this gene to be expected to give rise to FW-resistance and
then named it as Fusarium Resistance 1 (FusR1). Remarkably,
inventor found an unusually high Ka/Ks ratio of 3.6 between the
FusR1 ortholog from the highly resistant wild banana relative M.
itinerans and FusR1 from FW-sensitive Cavendish (M. acuminata).
[0413] Inventor obtained accessions of a number of types of
bananas, including both banana cultivars and landraces, as well as
wild (undomesticated) banana species from the genera Musa, Musella,
and Ensete. These three genera comprise the banana family Musaceae.
Inventor made substantial efforts to obtain multiple samples of
both Musa acuminata ("A"-genome) and M balbisiana ("B"-genome)
accessions, in order to adequately sample both the taxonomic and
geographic diversity of bananas. Inventor obtained accessions of
most of the acuminata subspecies. In addition, for outgroup
analysis, inventor obtained plant accessions from plant families
known to be closely related to Musaceae.
[0414] It is well recognized that some B-group banana
species/varieties are highly susceptible to Foc-TR4 (Chen et al.,
2019), even while sometimes displaying desirable agronomic traits
such as drought tolerance. The bananas of the A-genome display a
range of Fusarium-resistance, tolerance, and sensitivity, depending
upon the particular species or cultivated variety. As a
consequence, many wild banana species and cultivated banana
varieties have been carefully and rigorously characterized for
resistance, tolerance, or sensitivity to TR4 (Li et al., 2012,
Ssali et al., 2013, Li et al., 2015, Wu et al., 2016, Ribeiro et
al., 2018, Niu et al., 2018, and Zuo et al. 2018).
[0415] Whenever possible inventor chose to prepare both RNA (for
conversion to cDNA) and genomic DNA (gDNA). Most accessions were
obtained as either fresh, frozen, or lyophilized samples, and this
usually permitted successful RNA extraction. For some samples,
particularly when older or partially degraded, only gDNA could be
isolated. mRNA sequences and/or coding sequence only), intron
sequence, and some sequences (see Sequence Listing) for a number of
Musa, Musella, Ensete, and outgroup species are provided herewith
as described in Table 1 and in the sequence listings. Detailed
descriptions of the methods are given in Methods and Materials
section of Example 1.
[0416] Cultivated bananas are the product of hybridization events
between B-genome bananas (the Musa balbisiana group) and A-genome
bananas (the M. acuminata group). It is well recognized that some
B-group banana species/varieties are susceptible to Foc-TR4 (Chen
et al., 2019), even while sometimes possessing desirable agronomic
traits such as drought tolerance (REF). In contrast, the bananas of
the A-genome display a range of Fusarium-resistance, tolerance, and
sensitivity, depending upon the particular species or cultivated
variety. Some A-genome group species, such as Musa itinerans and M.
basjoo, have been shown to be extremely resistant to Foc-TR4 (Li et
al., 2015; Wu et al., 2016), while some A-genome cultivars like
Cavendish are exquisitely sensitive to Fusarium.
[0417] Analysis of these sequences revealed an important result;
which is that all "A"-genome banana species (or cultivated banana
varieties) that have been characterized as Fusarium-resistant share
FusR1 sequences that fall into a common group, while
Fusarium-sensitive banana species/varieties fall into a different
group. Strikingly, every B-genome accession inventor examined is
`FW-sensitive`, and all the FusR1 sequences from B-genome
accessions are broken and/or damaged in some fashion with some
combination of coding-sequence base pair deletions. Often the
deletion is either long in size such as 82 or 85 bp, however
inventor also found a consistent single base deletion. These
deletions alter the inferred protein sequence by destroying reading
frame, usually resulting in a truncated protein. In addition, all
B-genome FusR1 coding sequences contain an unspliced 84 bp intron,
often appearing together with the 85-bp deletion.
[0418] As to A-genome bananas, inventor found that A-genome
accessions that are known to be Foc-TR4 resistant all share a
common FusR1 sequence group, while Foc-TR4-sensitive A-genome
accessions all share a different FusR1 sequence group.
[0419] This is strong evidence that FusR1 is responsible for the
observed disease-resistance patterns between Fusarium-resistant vs.
Fusarium-sensitive species. The analyses in this example suggest
that differing resistance from sensitivity to Fusarium race 4 is
strongly linked with FusR1 sequence differences.
[0420] Further support for this comes from our examination of the
few banana species that have been characterized as `Fusarium
Wilt-tolerant`. These species all have FusR1 sequences that fall
into a third sequence group, all are intermediate between the
Fusarium-resistant and Fusarium-sensitive sequence groups.
[0421] The banana industry was forced in the 1950s to convert from
its primary cultivar, Gros Michel, to the Cavendish cultivar when
Fusarium (Panama Disease) race 1 posed a critical threat to Gros
Michel. Cavendish, which is a half-sib to Gros Michel (both are "A"
genome species), was found to be resistant to race 1. Thus, the
closely related Cavendish and Gros Michel cultivars show differing
profiles of resistance to the various Fusarium races. (Both are
sensitive to Foc-TR4, the current threat to the banana
industry.)
[0422] Inventor sequenced FusR1 from a number of Musa acuminata
accessions. In each case, inventor cloned, as described in Example
1, the FusR1 gene and then sequenced multiple clones of the FusR1
gene. Some of these M. acuminata accessions have been
well-characterized for Fusarium Wilt resistance/sensitivity.
Inventor found three alleles for M. acuminata FusR1. The critical
observation is that all Fusarium Wilt-resistant accessions share
similar FusR1 sequences. The two FusR1 alleles from FW-resistant M.
acuminata accessions are the Fusarium Wilt-resistant FusR1 allele
or simply, the "Resistant Alleles" (SEQ ID NO: 8 and SEQ ID NO:
10). In contrast, all FW-sensitive M. acuminata accessions share a
different allele, named the Fusarium Wilt Sensitive FusR1 Allele
(SEQ ID NO: 13). The FW-resistant FusR1 alleles differ in just a
few critical nucleotide substitutions from the FW-sensitive allele.
(See FIG. 1). This strongly suggests that Fusarium Wilt
resistance/sensitivity is controlled by the particular FusR1 allele
that a banana plant carries.
Example 3: Resistance Breeding of Banana
[0423] Tetraploid versions of FW-sensitive Cavendish cultivars (M.
acuminata; AAAA) are available or can be developed via large
pollination/breeding programs focused on creating, identifying and
isolating the relatively low percentage of tetraploid progeny that
are produced (e.g., Aguilar Moran, J. F., 2013, Improvement of
Cavendish Banana cultivars through conventional breeding, Acta
Hortic. 986:205-208; Jenny et al., In Jacome et al., editors,
Mycosphaerella leaf spot diseases of banana: present status and
outlook, Proceedings of the 2.sup.nd International Workshop on
Mycosphaerella leaf spot diseases held in San Jose, Costa Rica,
20-23 May 2002, Session 4, pages 199-208) or by subjecting diploid
AA genotypes to in vitro polyploidization (Amah et al., November
2019, Frontiers in Plant Science, Vol. 10, Article 1450, 12
pages).
[0424] Diploid versions of FW-resistant FusR1 (AA) of M. acuminata
ssp. banksia can be identified or developed using methods known to
those skilled in the art (e.g., Bakry et al., Chapter 1, Genetic
Improvement in Banana, 50 pages, In Breeding Plantation Tree Crops:
Tropical Species, 2009). The resultant diploids are screened for
the presence of SEQ ID NO: 8 and/or SEQ ID NO: 10 (mRNA
sequences).
[0425] A tetraploid FW-sensitive Cavendish plant, such as a
tetraploid of the `Naine` or `Williams` cultivar, can be used a
male parent in crosses with a diploid FW-resistant FusR1 M
acuminata ssp. banksia plant, such as a diploid `ITC0896,` used as
the female parent.
[0426] A large number of the resultant progeny are screened for
triploid plants (AAA) comprising SEQ ID NO: 8 and/or SEQ ID NO: 10
(mRNA sequences) and subsequently evaluated for agronomic
traits.
[0427] All resulting/selected banana plants with resistance to TR4
can be maintained via asexual reproduction and used for production
or in subsequent breeding programs.
Example 4: Materials and Methods for Plant Transformation
[0428] Banana transformation systems will use sterile material of
selected banana strains. A variety of tissue culture and
transformation methodologies will be used to increase the
likelihood of success. See, for example, the transformation
protocols described in Ploetz (2015, Phytopathology 105:1512-1521),
U.S. Pat. Nos. 7,534,930; 6,133,035; Sagi et al., Bio/Technology
13, 481-485, 1995; May et al., Bio/Technology 13, 485-492, 1995;
Vishnevetsky et al., Transgenic Res. 20(1):61-71, 2011; Paul et al.
(2011); Zhong et al., Plant Physiol. 110, 1097-1107, 1996; Dugdale
et al., Journal of General Virology 79:2301-2311, 1998; Mohan and
Swennen (editors), 2004, Banana improvement: cellular, molecular
biology, and induced mutations, Science Publishers, Inc.; and, Remy
et al., 2013, Genetically modified bananas: Past, present and
future, Acta Horticulturae 974:71-80, each of which is expressly
incorporated herein by reference in their entireties.
[0429] These methodologies will focus on tissue culture conditions,
identifying different tissue types for regeneration/shooting, media
formulations, agrobacterium strains, selection cassettes,
constructing control and delivery vectors, gene delivery,
selectable markers, and target tissue/cell substrates for DNA
delivery and transformation. Initial experiments will deploy
control vectors using visual markers and selection cassettes to
rapidly optimize experimental direction and screen potential
transgenic events. Parallel experiments will be directed at
optimizing transformation efficiency and using genes of interest
(GOI).
[0430] Modifications to media formulations, vectors, and
transformation processes will be done to improve process and
transformation efficiency. Transformation vectors that contain key
genes of interest will continue to be transformed to produce
additional overexpression or knock-out events. Vectors to be used
as necessary include but are not limited to multi-gene stacked
vectors, polycistronic gene vectors, and multi gRNA CRISPR editing
vectors for testing efficacy in banana. Testing will be done on TO
events to show presence and copy number of the selectable marker
gene or the GOI. In addition, mRNA expression analysis will be used
as needed for any key GOIs. Putative transformed plant material
will be used for subsequent testing or analysis.
[0431] CRISPR technologies are described in detail elsewhere
herein, including references to the compositions and procedures for
using CRISPR to edit plant genomes, such as the banana genome.
Detailed compositions and procedures for utilizing CRISPR to
knock-out a gene in plants that gives rise to a phenotype of
interest (e.g., resistance to fungal pathogens such as Fusarium)
are provided in WO 2019/118342 (PCT/US2018/064735), WO 2018/220581
(PCT/M2018/053903) and US 2019/0032070 (U.S. Ser. No. 16/072,706),
each of which is specifically and entirely incorporated by
reference herein.
[0432] Once target sites for knocking out a candidate gene (e.g.
endogenous FW-sensitive FusR1 gene(s)) are screened in silico and
selected, CRISPR/Cas9 vectors for the targeted mutation(s) in the
candidate gene found in plants of interest will be constructed for
the transformation of the vectors into the plant of interest (i.e.
FW-sensitive banana varieties, such as the widely-grown triploid,
sterile Cavendish variety and its progeny).
[0433] The CRISPR/Cas9 vectors will be transformed into plants of
interest such as banana varieties, especially FW-sensitive bananas
using agrobacterium-mediated protocols that are known in the art
(see for example, Ma et al., 2015) and/or developed or refined by
inventor. Tissue culture and regeneration of transformed plants
will be performed accordingly.
[0434] The transformed plants with the CRISPR/Cas9 vectors will be
regenerated and tested to verify the introduction of CRISPR/Cas9
vectors into the plant cells of interest. As a control for the
induction of indels, a construct expressing wild-type Cas9 will
also be used in this experiment.
[0435] The knock-out of the candidate gene(s) will be examined in
all transformed plants. The knock-out will be studied by (1)
quantitative PCR to check suppression and/or silencing of the
candidate gene or (2) PCR amplification and subsequent Sanger
sequencing and/or high-throughput deep sequencing. Also, the amino
acid substitution(s) caused by the introduced frame-shift to the
target genome region will be analyzed by protein sequencing with
mass spectrometry.
[0436] The transformed plants obtained will be grown in the
controlled green house and/or field conditions. The transformed
plants, verified with amino acid insertion, deletion, or
substitution of interest, will be observed for enhanced resistance
to FW, Panama Disease, or infection by Fusarium oxysporum f sp.
cubense Tropical Race 4.
Example 5: Banana Transformation
[0437] Banana plants susceptible to Fusarium oxysporum race 4 (aka
Tropical Race 4 or TR4) can be transformed into TR4-resistant
plants by transforming them with a nucleotide sequence coding for
resistance using the banana transformation technologies provided in
Example 4 and the FusR1 nucleotide sequences coding for TR4
resistance as provided herein. For example, a TR4-susceptible
Cavendish banana cultivar can be transformed with one of the FusR1
alleles coding for TR4-resistance as provided herein. As a further
example, a TR4-susceptible Cavendish banana cultivar can be
transformed with one or more of the following nucleotide coding
sequences coding for TR4 resistance: SEQ ID NO: 2, SEQ ID NO: 5,
SEQ ID NO: 9 SEQ ID NO: 11, SEQ ID NO:18, SEQ ID NO: 21, and/or SEQ
ID NO:24.
[0438] For example, the Cavendish banana cultivar `Grand Nain`
(AAA) can be transformed with SEQ ID NO 2, SEQ ID NO 5, SEQ ID NO 9
and/or SEQ ID NO 11 using the transformation protocols set forth in
U.S. Pat. No. 7,534,930 (`Transgenic Disease Resistant Banana`),
which is incorporated herein in its entirety for everything it
discloses.
[0439] In summary, immature male flowers of a Cavendish banana
cultivar, such `Grand Nain` or `Williams,` are used to produce
embryogenic calli. A nucleic acid construct comprising SEQ ID NO:
2, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO 11, SEQ ID NO:18, SEQ ID
NO: 21, and/or SEQ ID NO:24, operably linked to a 35S promoter
sequence is constructed. Or, alternatively, the promoter sequence
of the FW-resistant allele 1 of FusR1 from M. acuminata (SEQ ID NO
31) could be used to drive expression of the resistance alleles.
This construct is introduced into the embryogenic calli using
microprojectile bombardment. Bombarded plantlets are regenerated
from the embryogenic calli and the plantlets undergo PCR analyses
to determine which plantlets were transformed with the
TR4-resistance gene(s). Tissue culture extracts from the resulting
plants which positively express the TR4-resistance gene(s) are
tested for their ability to suppress growth of TR4. In addition,
the putative transformed plants are tested for resistance to TR4.
TR4 resistant plants are isolated and cloned. The TR4 resistant
plants can be used in breeding programs to transfer the resistant
genes as set forth in Example 3.
[0440] Where a transformed plant expresses SEQ ID NO 2 or SEQ ID NO
5; and, also expresses SEQ ID NO: 9 or SEQ ID NO: 11, that
transformed plant would have stacked resistance genes to TR4 given
it comprises two different nucleic acids coding for TR4 resistance.
As discussed above and presented in Table 1, SEQ ID NO: 2 and SEQ
ID NO: 5 are FusR1 allele 1 and allele 2 coding sequences,
respectively, coding for resistance as obtained from M. itinerans.
In contrast, SEQ ID NO: 9 and SEQ ID NO: 11 are FusR1 allele 1 and
allele 2 coding sequences, respectively, coding for resistance
obtained from M. acuminata ssp. banksia. Thus, a transformed plant
expressing both types of resistance genes would have stacked, or
pyramidal, resistance to Panama Disease Tropical Race 4.
[0441] All resulting/selected banana plants with resistance to TR4
can be maintained via asexual reproduction and used for production
or in subsequent breeding programs.
Example 6: Banana Transformation Starting With a Cultivar
Comprising Resistance
[0442] Transformed banana plants resistant to Panama Disease
Tropical Race 4 can be produced using the procedures outlined in
Example 5 where the initial, untransformed plant also has
resistance to TR4 and/or to one or more additional diseases. In
this way the resultant transformed plant can have multiple, or
stacked, resistance genes. For example, the starting cultivar used
in the transformation procedures of Example 5 can be a Cavenish
cultivar with the resistance gene RGA2 (Dale et al., 2017). Thus, a
Cavendish cultivar comprising the RGA2 coding sequence can be
transformed to express SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 9
and/or SEQ ID NO: 11, SEQ ID NO:18, SEQ ID NO: 21, and/or SEQ ID
NO:24 and thereby have stacked resistance genes to TR4.
[0443] All resulting/selected banana plants with resistance to TR4
can be maintained via asexual reproduction and used for production
or in subsequent breeding programs.
Example 7: Knocking Out Expression of FusR1-susceptibility
Genes
[0444] In addition to or, alternatively instead of, transforming
the plants according to Example 5 or Example 6, the nucleotide
sequences of FusR1 alleles coding for susceptibility to TR4 in M
acuminata (e.g., SEQ ID NO: 14) can be knocked-out using a TALEN, a
meganuclease, a zinc finger nuclease, a CRISPR-associated nuclease
or other appropriate gene editing tools.
[0445] In one such method, a guide RNA may be utilized along with
an appropriate CRISPR-associated nuclease, including wherein the
guide RNA comprises a variable targeting domain that is
complementary to all or a partial sequence of SEQ ID NO: 14. For
example, a double-strand break can be introduced into an endogenous
sequence coding for a FW-sensitive FusR1 allele in M. acuminata
(SEQ ID NO: 14) in a banana cell using a modified SEQ ID NO: 14,
wherein the modified SEQ ID NO 14 comprises a nucleic acid
alteration that knocks out the gene function of SEQ ID NO: 14.
[0446] For details on how to construct and use such a
CRISPR-associated nuclease and Guide RNA in plants, see, for
example, U.S. Patent Application Publication No. 2019/0032070 A1
and WO 2019/118342 A1, each of which is incorporated by reference
in its entirety. For using CRISPR as a gene editing tool in banana,
including to silence disease susceptibility genes, see, for
example, WO 2018/220581 A1 (Compositions and Methods for Increasing
Shelf-Life of Banana); Tripahi et al., 2019, CRISPR/Cas9 editing of
endogenous banana streak virus in the B genome of Musa spp.
overcomes a major challenge in banana breeding, Communications
Biology 2, Article 46, 11 pages; and, Ntui et al., January 2020,
Robust CRISPR/Cas9 mediated genome editing tool for banana and
plantain (Musa spp.), Vol. 21, 10 pages.
[0447] The modified plant cell can be generated/regenerated into a
banana plant which can be maintained via asexual reproduction.
[0448] All resulting/selected banana plants with the knock out for
susceptibility to TR4 can be maintained via asexual reproduction
and used for production or in subsequent breeding programs.
Example 8: Gene Editing of Bananas Susceptible to TR4
[0449] Banana plants susceptible to Fusarium oxysporum race 4 (aka
Tropical Race 4 or TR4) can be modified into TR4-resistant plants
by using gene targeting/gene editing tools to change their
endogenous nucleic acid sequences coding for susceptibility into
nucleotide sequences coding for resistance using the banana gene
editing technologies provided in Example 4 and the FusR1 nucleotide
sequences coding for TR4 resistance as provided herein. For
example, the endogenous nucleic acid sequence coding for
TR4-susceptibility in a Cavendish banana cultivar can be altered
based on the nucleic acid sequence of one of the FusR1 alleles
coding for TR4-resistance as provided herein. As a further example,
the nucleic acid sequence coding for TR4-susceptibility in a
Cavendish banana cultivar can be altered based on one or more of
the following nucleotide coding sequences coding for TR4
resistance: SEQ ID NO 2, SEQ ID NO 5, SEQ ID NO 9, SEQ ID NO 11,
SEQ ID NO:18, SEQ ID NO: 21, and/or SEQ ID NO:24.
[0450] For example, the Cavendish banana cultivar `Grand Nain`
(AAA) can be modified based on the nucleic acid sequences coding
for resistance to TR4 as set forth herein (i.e., based upon SEQ ID
NO 2, SEQ ID NO 5, SEQ ID NO 9, SEQ ID NO 11, SEQ ID NO:18, SEQ ID
NO: 21, and/or SEQ ID NO:24) using modern gene editing tools. See
FIG. 1.
[0451] In some general examples, the endogenous FW-susceptibility
FusR1 gene of SEQ ID NO 14 is modified by one or more of the
following changes based on its alignment with FW-resistant FusR1
genes of SEQ ID NO 2, SEQ ID NO 5, SEQ ID NO, SEQ ID NO 11, SEQ ID
NO:18, SEQ ID NO: 21, and/or SEQ ID NO:24. See FIG. 1.
[0452] In some specific examples, SEQ ID NO 14 is modified by the
following changes based on its alignment with SEQ ID NO 9 (see
sequence alignment, FIG. 1): the T corresponding to position 148 is
replaced with G (148T>G); the T corresponding to position 323 is
replaced with A (323T>A); the G corresponding to position 344 is
replaced with C (344G>C); and/or, the A corresponding to
position 347 is replaced with T (347A>T). In one example, the
only substitution made is 344G>C. In one example, the following
three substitutions are made: 323T>A, 344G>C and 347A>T.
In yet another example, all four substitutions are made: 148T>G,
323T>A, 344G>C and 347A>T. See FIG. 1.
[0453] In some general examples, any and all nucleic acid
substitutions are made to the nucleic acid sequences coding for
FW-susceptible FUSR1 proteins so that the resulting, modified
nucleic acids code for FW-resistant FUSR1 proteins. See FIG. 1 and
FIG. 2.
[0454] In some specific examples, the endogenous nucleic acid
sequence coding for the FW-susceptible FUSR1 protein of SEQ ID NO:
15 is modified by one or more nucleic acid changes based on its
alignment with FW-resistant FUSR1 protein of SEQ ID NO: 12 to
produce the following protein changes: the Leucine corresponding to
position 50 is replaced with Valine (50L>V); the Valine
corresponding to position 108 is replaced with Glutamic Acid
(108V>E); the Arginine at position 115 is replaced with Proline
(115R>P); and/or, the Aspartic Acid at position 116 is replaced
with Valine (116D>V). In one example, the only protein
substitution that is made is 115R>P. In another example, the
only protein substitutions that are made are 108V>E, 115R>P
and 116D>V. In yet another example, all four protein
substitutions are made: 50L>V, 108V>E, 115R>P and
116D>V. See FIG. 2.
[0455] The banana-specific gene editing protocols from the
following publications provide the protocols for making the
necessary nucleotide base pair substitutions in banana: Shao et
al., 2020, Using CRISPR/Cas9 genome editing system to create
MaGA20ox2 gene-modified semi-dwarf banana, Plant Biotechnology
Journal, 18:17-19; Kaur et al., 2017, CRISPR/Cas9-mediated
efficient editing in phytoene desaturase (PDS) demonstrates precise
manipulation in banana cv. Rasthali genome, Functional &
Integrative Genomics, 18(1):89-99; Otang et al., 2020, Robust
CRISPR/Cas9 mediated genome editing tool for banana and plantain
(Musa spp.), Current Plant Biology, 21, 10 pages; Tripathi et al.,
2019, CRISPR/Cas9 editing of endogenous banana streak virus in the
B genome of Musa spp. Overcomes a major challenge in banana
breeding, Communications Biology, 2:46, 11 pages; and, U.S. Pat.
No. 7,381,556, each of which is entirely incorporated by reference
herein for everything it teaches.
[0456] In summary, immature male flowers of a Cavendish banana
cultivar, such `Grand Nain` or `Williams,` is used to produce
embryogenic calli and/or an embryogenic cell suspension. A
CRISPR/Cas9 construct is prepared following the procedures outline
in any one or more of the above-listed scientific and patent
publications, wherein the construct is constructed based upon the
sequence alignments provided in FIG. 1. The construct is delivered
into the embryogenic calli or embryogenic cell suspension and
well-rooted plantlets are generated. Random regenerates are
selected and screened for the presence of the Cas9 gene by PCR
using primers. The well-rooted plantlets of Cas9 PCR-positive
events and control plants are acclimatized and potted in the
greenhouse. Molecular analyses are conducted to confirm gene
editing in the endogenous FusR1 genes.
[0457] The genome edited plants and the control plants are
evaluated for agronomic traits and evaluated for TR4 resistance.
The resulting gene-edited plants which positively express the
TR4-resistance protein(s) and display resistance to TR4 are cloned.
The gene-edited TR4 resistant plants can be used in breeding
programs to transfer the resistant genes as set forth in Example
3.
[0458] All resulting/selected banana plants with resistance to TR4
can be maintained via asexual reproduction and used for production
or in subsequent breeding programs.
[0459] Further Numbered Embodiments of the Disclosure
[0460] Other subject matter contemplated by the present invention
is set out in the following numbered embodiments:
1. An isolated nucleic acid molecule comprising nucleic acid
sequence SEQ ID NO: 14 coding for susceptibility to Fusarium
oxysporum race 4 when expressed in a plant, wherein SEQ ID NO: 14
is modified by one, two, three or four nucleic acid substitutions
so that the resulting nucleic acid sequence codes for resistance to
Fusarium oxysporum race 4 when expressed in a plant. 2. The
isolated nucleic acid molecule of embodiment 1, wherein the nucleic
acid substitutions comprise replacing a T corresponding to position
148 of SEQ ID NO: 14 with a G (148T>G). 3. The isolated nucleic
acid molecule of embodiment 1, wherein the nucleic acid
substitutions comprise replacing a T corresponding to position 323
of SEQ ID NO: 14 with an A (323T>A). 4. The isolated nucleic
acid molecule of embodiment 1, wherein the nucleic acid
substitutions comprise replacing a G corresponding to position 344
of SEQ ID NO: 14 with a C (344G>C). 5. The isolated nucleic acid
molecule of embodiment 1, wherein the nucleic acid substitutions
comprise replacing an A corresponding to position 347 of SEQ ID NO:
14 with a T (347A>T). 6. The isolated nucleic acid molecule of
embodiment 1, wherein the nucleic acid substitutions comprise
replacing a T corresponding to position 323 with an A (323T>A),
replacing a G corresponding to position 344 with a C (344G>C),
and replacing an A corresponding to position 347 with a T
(347A>T), and wherein all positions are based on SEQ ID NO: 14.
7. The isolated nucleic acid molecule of embodiment 1, wherein SEQ
ID NO: 14 codes for an amino acid sequence of SEQ ID NO: 15 and
wherein the nucleic acid substitutions result in replacing a
Leucine corresponding to position 50 of SEQ ID NO: 15 with a Valine
(50L>V). 8. The isolated nucleic acid molecule of embodiment 1,
wherein SEQ ID NO: 14 codes for an amino acid sequence of SEQ ID
NO: 15 and wherein the nucleic acid substitutions result in
replacing a Valine corresponding to position 108 of SEQ ID NO: 15
with a Glutamic Acid (108V>E). 9. The isolated nucleic acid
molecule of embodiment 1, wherein SEQ ID NO: 14 codes for an amino
acid sequence of SEQ ID NO: 15 and wherein the nucleic acid
substitutions result in replacing an Arginine corresponding to
position 115 of SEQ ID NO: 15 with a Proline (115R>P). 10. The
isolated nucleic acid molecule of embodiment 1, wherein SEQ ID NO:
14 codes for an amino acid sequence of SEQ ID NO: 15 and wherein
the nucleic acid substitutions result in replacing an Aspartic Acid
corresponding to position 116 of SEQ ID NO: 15 with a Valine
(116D>V). 11. The isolated nucleic acid molecule of embodiment
1, wherein SEQ ID NO: 14 codes for an amino acid sequence of SEQ ID
NO: 15 and wherein the nucleic acid substitutions result in
replacing a Valine corresponding to position 108 of SEQ ID NO: 15
with a Glutamic Acid (108V>E), an Arginine corresponding to
position 115 of SEQ ID NO: 15 with a Proline (115R>P), and an
Aspartic Acid corresponding to position 116 of SEQ ID NO: 15 with a
Valine (116D>V). 12. The isolated nucleic acid molecule of
embodiments 1-11, wherein the expression occurs in a plant cell,
plant tissue, plant cell culture, plant tissue culture, or whole
plant. 13. The isolated nucleic acid molecule of embodiment 12,
wherein the expression occurs in aMusa cell, tissue, cell culture,
tissue culture, or whole plant. 14. The isolated nucleic acid
molecule of embodiment 13, wherein the expression occurs in aMusa
acuminata cell, tissue, cell culture, tissue culture or whole
plant. 15. A nucleic acid construct comprising the isolated nucleic
acid molecule of embodiments 1-11, wherein the nucleic acid
sequence is operably linked to a promoter capable of driving
expression of the nucleic acid sequence. 16. The nucleic acid
construct of embodiment 15, wherein the promoter is a plant
promoter. 17. The nucleic acid construct of embodiment 15, wherein
the promoter is a 35S promoter. 18. The nucleic acid construct of
embodiment 15, wherein the promoter is coded by SEQ ID NO: 31. 19.
A transformation vector comprising the nucleic acid construct of
embodiments 15-18. 20. A method of transforming a plant cell
comprising introducing the transformation vector of embodiment 19
into a plant cell, whereby the transformed plant cell expresses the
nucleic acid sequence coding for resistance to Fusarium oxysporum
race 4. 21. The method of embodiment 20, wherein the plant cell is
a Musa plant cell. 22. The method of embodiment 20, wherein the
plant cell is a Musa acuminata plant cell. 23. The method of
embodiments 20-22 further comprising producing transformed plant
tissue from the transformed plant cell. 24. The method of
embodiment 23 further comprising producing a transformed plantlet
from the transformed plant tissue. 25. The method of embodiment 24
further comprising producing a clone of the transformed plantlet.
26. The method of embodiments 24 or 25 further comprising growing
the transformed plantlet or clone of the transformed plantlet into
a mature transformed plant. 27. The method of embodiment 26,
wherein the mature transformed plant is a Musa plant and the mature
transformed Musa plant is capable of producing fruit. 28. The
method of embodiment 27 further comprising producing clones of the
mature transformed Musa plant. 29. The method of embodiment 27 or
28 further comprising using the mature transformed Musa plant or
clone of the mature transformed Musa plant in a breeding method.
30. An isolated amino acid molecule comprising an amino acid
sequence of SEQ ID NO: 15 coding for a protein that when produced
in a plant results in susceptibility to Fusarium oxysporum race 4,
wherein SEQ ID NO: 15 is modified by one, two, three or four amino
acid substitutions so that it codes for a protein which when
produced in a plant results in resistance to Fusarium oxysporum
race 4. 31. The isolated amino acid molecule of embodiment 30,
wherein the amino acid substitutions comprise replacing a Leucine
corresponding to position 50 of SEQ ID NO: 15 with a Valine
(50L>V). 32. The isolated amino acid molecule of embodiment 30,
wherein the amino acid substitutions comprise replacing a Valine
corresponding to position 108 of SEQ ID NO: 15 with a Glutamic Acid
(108V>E) 33. The isolated amino acid molecule of embodiment 30,
wherein the amino acid substitutions comprise replacing an Arginine
corresponding to position 115 of SEQ ID NO: 15 with a Proline
(115R>P). 34. The isolated amino acid molecule of embodiment 30,
wherein the amino acid substitutions comprise replacing an Aspartic
Acid corresponding to position 116 of SEQ ID NO: 15 with a Valine
(116D>V). 35. The isolated amino acid molecule of embodiment 30,
wherein the amino acid substitutions comprise replacing a Valine
corresponding to position 108 of SEQ ID NO: 15 with a Glutamic Acid
(108V>E), an Arginine corresponding to position 115 of SEQ ID
NO: 15 with a Proline (115R>P), and an Aspartic Acid
corresponding to position 116 of SEQ ID NO: 15 with a Valine
(116D>V). 36. The isolated amino acid molecule segment of
embodiments 30-35, wherein the production occurs in a plant cell,
plant tissue, plant cell culture, plant tissue culture, or whole
plant. 37. The isolated amino acid molecule segment of embodiment
36, wherein the production occurs in a Musa cell, tissue, cell
culture, tissue culture, or whole plant. 38. The isolated amino
acid molecule segment of embodiment 36, wherein the production
occurs in a Musa acuminata cell, tissue, cell culture, tissue
culture or whole plant. 39. A nucleic acid construct comprising a
nucleic acid sequence coding for resistance to Fusarium oxysporum
race 4 when expressed in a plant, wherein said nucleic acid
sequence is selected from the group consisting of SEQ ID NO: 2, SEQ
ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 18, SEQ ID NO:
21, and SEQ ID NO: 24, and wherein the nucleic acid sequence is
operably linked to a promoter capable of driving expression of the
nucleic acid sequence. 40. The nucleic acid construct of embodiment
39, wherein the promoter is a plant promoter. 41. The nucleic acid
construct of embodiment 39, wherein the promoter is a 35S promoter.
42. The nucleic acid construct of embodiment 39, wherein the
promoter is coded by SEQ ID NO: 31. 43. A transformation vector
comprising the nucleic acid construct of embodiments 39-42. 44. A
method of transforming a plant cell comprising introducing the
transformation vector of embodiment 43 into a plant cell, whereby
the transformed plant cell expresses the nucleic acid sequence
coding for resistance to Fusarium oxysporum race 4. 45. The method
of embodiment 44, wherein the plant cell is a Musa plant cell. 46.
The method of embodiment 44, wherein the plant cell is a Musa
acuminata plant cell. 47. The method of embodiments 44-46 further
comprising producing transformed plant tissue from the transformed
plant cell. 48. The method of embodiment 47 further comprising
producing a transformed plantlet from the transformed plant tissue.
49. The method of embodiment 48 further comprising producing a
clone of the transformed plantlet. 50. The method of embodiments 48
or 49 further comprising growing the transformed plantlet or clone
of the transformed plantlet into a mature transformed plant. 51.
The method of embodiment 50, wherein the mature transformed plant
is a Musa plant and the mature transformed Musa plant is capable of
producing fruit. 52. The method of embodiment 51 further comprising
producing clones of the mature transformed Musa plant. 53. The
method of embodiments 51 or 52 further comprising using the mature
transformed Musa plant or clone of the mature transformed Musa
plant in a breeding method. 54. A banana breeding method comprising
crossing a first Musa plant comprising a nucleic acid sequence
coding for resistance to Fusarium oxysporum race 4 with a second
Musa plant that is susceptible to Fusarium oxysporum race 4 and
selecting resultant progeny of the cross based on their resistance
to Fusarium oxysporum race 4, wherein said nucleic acid sequence
coding for resistance to Fusarium oxysporum race 4 is selected from
the group consisting of SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 9,
SEQ ID NO: 11, SEQ ID NO: 18, SEQ ID NO: 21, and SEQ ID NO: 24. 55.
The banana breeding method of embodiment 54 further comprising
producing clones of the resultant progeny of the cross wherein the
clones are selected based on their resistance to Fusarium oxysporum
race 4. 56. The banana breeding method of embodiment 54, wherein
the first and second Musa plants are from different Musa species.
The banana breeding method of embodiment 54, wherein the first and
second Musa plants are from the same Musa species. The banana
breeding method of embodiment 54, wherein the first and/or second
Musa plant is a Musa acuminata plant. 57. The banana breeding
method of embodiment 54, wherein the progeny of the cross that
display resistance to Fusarium oxysporum race 4 are selected using
molecular markers that are designed based on the nucleic acid
sequence coding for resistance to Fusarium oxysporum race 4 that is
present in the first Musa plant used in the cross. 58. A method for
obtaining a Musa acuminata plant cell with a silenced endogenous
gene coding for susceptibility to Fusarium oxysporum race 4, the
method comprising introducing a double-strand break to at least one
site in an exogenous gene coded by SEQ ID NO: 14 to produce a Musa
acuminata plant cell with a silenced endogenous gene coding for
susceptibility to Fusarium oxysporum race 4. 59. The method of
embodiment 58 further comprising generating a Musa acuminata plant
from the Musa acuminata plant cell with a silenced endogenous gene
coding for susceptibility to Fusarium oxysporum race 4 to produce a
Musa acuminata plant with a silenced endogenous gene coding for
susceptibility to Fusarium oxysporum race 4. 60. The method of
embodiment 59 further comprising using the Musa acuminata plant
with a silenced endogenous gene coding for susceptibility to
Fusarium oxysporum race 4 in a banana breeding program. 61. The
method of embodiment 20 or 44, wherein the plant cell is the Musa
acuminata plant cell of embodiment 59 with a silenced endogenous
gene coding for susceptibility to Fusarium oxysporum race 4. 62.
The method of embodiment 58, wherein the double-strand break is
induced by a nuclease selected from the group consisting of a
TALEN, a meganuclease, a zinc finger nuclease, and a
CRISPR-associated nuclease. 63. The method of claim 62, wherein the
double-strand break is induced by a CRISPR-associated nuclease and
where a guide RNA is provided. 64. A method for producing a plant
cell resistant to Fusarium oxysporum race 4 comprising introducing
at least one genetic modification into one or more endogenous
nucleic acid sequences coding for susceptibility to Fusarium
oxysporum race 4, wherein the genetic modification confers
resistance to Fusarium oxysporum race 4 to the plant cell. 65. The
method of embodiment 64 wherein the at least one genetic
modification is introduced by a TALEN, a meganuclease, a zinc
finger nuclease or a CRISPR-associated nuclease. 66. The method of
claim 64, wherein the at least one genetic modification is
introduced by a CRISPR-associated nuclease and an associated guide
RNA. 67. The method of embodiment 64, wherein the at least one
genetic modification is selected from the list consisting of
replacing a T corresponding to position 148 of SEQ ID NO: 14 with a
G (148T>G), replacing a T corresponding to position 323 of SEQ
ID NO: 14 with an A (323T>A), replacing a G corresponding to
position 344 of SEQ ID NO: 14 with a C (344G>C), and replacing
an A corresponding to position 347 of SEQ ID NO: 14 with a T
(347A>T). 68. The method of embodiment 64, wherein the at least
one genetic modification results in a change in an amino acid
selected from the group consisting of replacing a Leucine
corresponding to position 50 of SEQ ID NO: 15 with a Valine
(50L>V), replacing a Valine corresponding to position 108 of SEQ
ID NO: 15 with a Glutamic Acid (108V>E), replacing an Arginine
corresponding to position 115 of SEQ ID NO: 15 with a Proline
(115R>P), and replacing an Aspartic Acid corresponding to
position 116 of SEQ ID NO: 15 with a Valine (116D>V). 69. The
method of embodiments 64-68, wherein the plant cell is aMusa plant
cell. 70. The method of embodiments 64-68, wherein the plant cell
is aMusa acuminata plant cell. 71. The method of embodiments 64-70
further comprising producing transformed plant tissue from the
transformed plant cell. 72. The method of embodiment 71 further
comprising producing a transformed plantlet from the transformed
plant tissue. 73. The method of embodiment 72 further comprising
producing a clone of the transformed plantlet. 74. The method of
embodiments 71 or 72 further comprising growing the transformed
plantlet or clone of the transformed plantlet into a mature
transformed plant.
75. The method of embodiment 74, wherein the mature transformed
plant is a Musa plant and the mature transformed Musa plant is
capable of producing fruit. 76. The method of embodiment 75 further
comprising producing clones of the mature transformed Musa plant.
77. The method of embodiments 75 or 76 further comprising using the
mature transformed Musa plant or clone of the mature transformed
Musa plant in a breeding method.
INCORPORATION BY REFERENCE
[0461] All references, articles, publications, patents, patent
publications, and patent applications cited herein within the above
text and/or cited below are incorporated by reference in their
entireties for all purposes. However, mention of any reference,
article, publication, patent, patent publication, and patent
application cited herein is not, and should not be taken as
acknowledgment or any form of suggestion that they constitute valid
prior art or form part of the common general knowledge in any
country in the world.
U. S. PATENT DOCUMENTS
[0462] U.S. Pat. No. 7,534,930 B2 May 2009 Vishnevetsky et al.
[0463] U.S. Pat. No. 6,274,319 August 2001 Messier and Sikela
[0464] U.S. Pat. No. 9,834,783 December 2017 Messier
OTHER PUBLICATIONS
[0464] [0465] Armenteros, J. J. A. A. 2017. DeepLoc: prediction of
protein subcellular localization using deep learning.
Bioinformatics 33(21): 3387-3395. [0466] Armenteros et al. 2019.
SignalP 5.0 improves signal peptide predictions using deep neural
networks. Nat Biotechnol 37:420-423. [0467] Bai, T-T. et al. 2013.
Transcriptome and Expression Profile Analysis of Highly Resistant
and Susceptible Banana Roots Challenged with Fusarium oxysporum f
sp. cubense Tropical Race 4. PLOS|One Published: Sep. 23, 2013.
[0468] Barbosa, J. A. R. G. et al., 2007. Crystal Structure of the
Bowman-Birk Inhibitor from Vigna unguiculata Seeds in Complex with
.beta.-Trypsin at 1.55 A Resolution and Its Structural Properties
in Association with Proteinases. Biophysical Journal. 92(5):
1638-1650. [0469] Chen, A., et al. 2019. Assessing Variations in
Host Resistance to Fusarium oxysporum f sp. cubense Race 4 in Musa
Species, With a Focus on the Subtropical Race 4. Front. Microbiol.
10. [0470] Christelova, P. et al. 2017. Molecular and cytological
characterization of the global Musa germplasm collection provides
insights into the treasure of banana diversity. Biodivers. Conserv.
26: 801. [0471] Dale, J. et al. 2017. Transgenic Cavendish bananas
with resistance to Fusarium wilt tropical race 4. Nature
Communications. 8: Article number 1496. [0472] Davey, M. W. et al.
2013. A draft Musa balbisiana genome sequence for molecular
genetics in polyploid, inter- and intra-specific Musa hybrids. BMC
Genomics 14: 683. [0473] D'Hont, A. et al. 2012. The banana (Musa
acuminata) genome and the evolution of monocotyledonous plants.
Nature 488:213-217. [0474] Dita, M. et al. 2018. Fusarium Wilt of
banana: current knowledge on epidemiology and research needs toward
sustainable disease management. Front Plant Sci. 9:1468. [0475]
Heslop-Harrison, J. S. and Schwarzacher, T. 2007. Domestication,
Genomics and the Future for Banana. Annals of Botany
100(5):1073-1084. [0476] Hiller, K, et al. 2004. PrediSi:
prediction of signal peptides and their cleavage positions. Nucleic
Acids Res. 32(Web Server issue):W375-9. [0477] Hippolyte, I. et al.
2012. Foundation characteristics of edible Musa triploids revealed
from allelic distribution of SSR markers. Annals of Botany
109(5):937-951. [0478] Hughes, A. L and Nei, M. 1988 Nature
335:167-170. [0479] Ishihara et al. 2016. An improved method for
RNA extraction from woody legume species Acacia koa A. Gray and
Leucaena leucocephala (Lam.) de Wit. Int. J. For. Wood Sci. 3(1):
31-35. [0480] Kreitman, M. and Akashi, H. 1995. Molecular evidence
for natural selection. Annu. Rev. Ecol. Syst. 26:403-422. [0481]
Kumar, S., et al. 2018. MEGA X: Molecular Evolutionary Genetics
Analysis across computing platforms. Molecular Biology and
Evolution 35:1547-1549. [0482] Li, C.-Y. et al. 2012. Transcriptome
profiling of resistant and susceptible Cavendish banana roots
following inoculation with Fusarium oxysporum f. sp. cubense
tropical race 4. BMC Genomics 13:374. [0483] Li, W.-H. et al. 1985.
A new method for estimating synonymous and nonsynonymous rates of
nucleotide substitution considering the relative likelihood of
nucleotide and codon changes. Mol. Biol. Evol. 2: 150-174. [0484]
Li, W.-H. 1993. Unbiased estimation of the rates of synonymous and
nonsynonymous substitution. J. Mol. Evol. 36: 9699. [0485] Li,
W.-H., 1997. Molecular Evolution. Sunderland, Mass.: Sinauer
Associates. [0486] Li, W. M. et al. 2015. Resistance sources to
Fusarium oxysporum f sp. cubense tropical race 4 in banana wild
relatives. Plant Pathology 64:1061-1067. [0487] Ma, X, et al. 2015
A Robust CRISPR/Cas9 System for Convenient, High-Efficiency
Multiplex Genome Editing in Monocot and Dicot Plants. Mol. Plant.
8:1274-1284. [0488] Messier, W. and Stewart, C.-B. 1994 Current
Biol. 4:911-913. [0489] Messier, W. and Stewart, C-B. 1997. Nature
385:151-154. [0490] Nei M. and Kumar S. 2000. Molecular Evolution
and Phylogenetics. Oxford University Press, New York. [0491] Paul,
J.-Y. et al. 2011. Apoptosis-related genes confer resistance to
Fusarium wilt in transgenic `Lady Finger` bananas. Plant
Biotechnology Journal. [0492] Niu, Y. et al. 2018. Comparative
digital gene expression analysis of tissue-cultured plantlets of
highly resistant and susceptible banana cultivars in response to
Fusarium oxysporum. Int. J. Mol. Sci. 19. doi:
10.3390/ijms19020350. [0493] Peraza-Echeverria, S. et al. 2009.
Molecular cloning and in silico analysis of potential Fusarium
resistance genes in banana. Mol. Breeding. 23(3): 431-443. [0494]
Ploetz, R. C. 2015. Fusarium Wilt of banana. Phytopathology Review.
[0495] Raboin, L-M. et al. 2005. Diploid Ancestors of Triploid
Export Banana Cultivars: Molecular Identification of 2n Restitution
Gamete Donors and n Gamete Donors. Mol Breeding 16:333. [0496]
Reese M. G. 2001. Application of a time-delay neural network to
promoter annotation in the Drosophila melanogaster genome. Comput.
Chem. 26(1): 51-56. [0497] Ribeiro, L. R. et al. 2018. Sources of
resistance to Fusarium oxysporum f sp. cubense in banana germplasm.
Rev. Bras. Frutic. 40:1. Epub Feb. 8, 2018. [0498] Rouard, M. et
al. 2018. Three New Genome Assemblies Support a Rapid Radiation in
Musa acuminata (Wild Banana). Genome Biology and Evolution 10(12):
3129-3140. [0499] Solovyev V. V. and Salamov A. A. 1997. The
Gene-Finder computer tools for analysis of human and model
organisms genome sequences. In Proceedings of the Fifth
International Conference on Intelligent Systems for Molecular
Biology (eds. Rawling C., Clark D., Altman R., Hunter L., Lengauer
T., Wodak S.), Halkidiki, Greece, AAAI Press, 294-302. [0500]
Solovyev V. V. 2001. Statistical approaches in Eukaryotic gene
prediction. In Handbook of Statistical Genetics (eds. Balding D. et
al.), John Wiley & Sons, Ltd., p. 83-127. [0501] Solovyev V. V.
and Shahmuradov I. A. 2003. PromH: Promoters identification using
orthologous genomic sequences. Nucleic Acids Res. 31(13):
3540-3545. [0502] Stokstad, E. 2019. Banana fungus puts Latin
America on alert. Science 365(6450): 207-208. [0503] Ssali, R. et
al. 2013. Inheritance of resistance to Fusarium oxysporum f sp.
cubense race 1 in bananas. Euphytica 194: 425. Van der Berg, N. et
al. 2007. Tolerance in banana to Fusarium wilt is associated with
early up-regulation of cell wall-strengthening genes in the roots.
Molecular Plant Pathology. 8(3): 333-341. [0504] Venkataramana, R.
K. et al. 2015. Insights into Musa balbisiana and Musa acuminata
species divergence and development of genic microsatellites by
transcriptomics approach. Plant Gene 4: 78-82. [0505] Wang, Y. et
al. 2017. Differential gene expression in banana roots in response
to Fusarium wilt. Canadian Journal of Plant Pathology 39(2):
163-175. doi.org/10.1080/07060661.2017.1342693. [0506] Wu, W. et
al. 2016. Whole genome sequencing of a banana wild relative Musa
itinerans provides insights into lineage-specific diversification
of the Musa genus. Scientific Reports 6: Article number: 31586.
[0507] Zhang, L. et al. (2018) Identification and evaluation of
resistance to Fusarium oxysporum f. sp. cubense tropical race 4 in
Musa acuminata Pahang. Euphytica 214: 106. [0508] Zuo, C. et al.
2018. Germplasm screening of Musa spp. for resistance to Fusarium
oxysporum f sp. cubense tropical race 4 (Foc-TR4). Eur J Plant
Pathol. 151:723.
Sequence CWU 1
1
321553DNAMusa itinerans 1gtaagcaatg gctggaggag gcaaaagagg
tgaagcgtcg tctcttctac ttgtgacgct 60gctcgtgatg ttgttggcct tcttcgccac
cgactcctcg gcggcccgtg tcacaccccg 120tccgcactcc ctcgccagag
cggtactgag tgcgttggag gcaagggcag atgggccgtg 180ttgcagatgc
atctgtcctc tcatttaccc acctacttgg tgcgtttgca gcggcgtatg
240gcaaggctcc tgcccttccg cctgcaccaa ctgcgagtgt ctcctcaacg
agtgcacttg 300cctcgatcac gtggactaca aggcctgcca ggccgactcc
tgtggctggc ttgatggcgt 360ccccaaacta gagccgtcgc agcagtgggc
gatcgaagaa accggtggga aattagcgat 420gatggtgtga tccaattgtg
tttgtgatcg cctgtcgtct tctctcgctc cgtcccatcc 480atctatccat
ccatctactt ataatctatg tcgtgtaccg tcgtgcggcg ttgctttgct
540tcggtaataa aat 5532423DNAMusa itinerans 2atggctggag gaggcaaaag
aggtgaagcg tcgtctcttc tacttgtgac gctgctcgtg 60atgttgttgg ccttcttcgc
caccgactcc tcggcggccc gtgtcacacc ccgtccgcac 120tccctcgcca
gagcggtact gagtgcgttg gaggcaaggg cagatgggcc gtgttgcaga
180tgcatctgtc ctctcattta cccacctact tggtgcgttt gcagcggcgt
atggcaaggc 240tcctgccctt ccgcctgcac caactgcgag tgtctcctca
acgagtgcac ttgcctcgat 300cacgtggact acaaggcctg ccaggccgac
tcctgtggct ggcttgatgg cgtccccaaa 360ctagagccgt cgcagcagtg
ggcgatcgaa gaaaccggtg ggaaattagc gatgatggtg 420tga 4233140PRTMusa
itinerans 3Met Ala Gly Gly Gly Lys Arg Gly Glu Ala Ser Ser Leu Leu
Leu Val1 5 10 15Thr Leu Leu Val Met Leu Leu Ala Phe Phe Ala Thr Asp
Ser Ser Ala 20 25 30Ala Arg Val Thr Pro Arg Pro His Ser Leu Ala Arg
Ala Val Leu Ser 35 40 45Ala Leu Glu Ala Arg Ala Asp Gly Pro Cys Cys
Arg Cys Ile Cys Pro 50 55 60Leu Ile Tyr Pro Pro Thr Trp Cys Val Cys
Ser Gly Val Trp Gln Gly65 70 75 80Ser Cys Pro Ser Ala Cys Thr Asn
Cys Glu Cys Leu Leu Asn Glu Cys 85 90 95Thr Cys Leu Asp His Val Asp
Tyr Lys Ala Cys Gln Ala Asp Ser Cys 100 105 110Gly Trp Leu Asp Gly
Val Pro Lys Leu Glu Pro Ser Gln Gln Trp Ala 115 120 125Ile Glu Glu
Thr Gly Gly Lys Leu Ala Met Met Val 130 135 1404534DNAMusa
itinerans 4ggtaagcaat ggctggagga ggcaaaagag gtgaagcgtc gtctcttcta
cttgtgacgc 60tgctcgtgat gttgttggcc ttcttcgcca ccgactcctc ggcggcccgt
gtcacacccc 120gtccgcactc cctcgccaga gcggtactga gtgcgttgga
gggaagggcc gatgggccgt 180gttgcagatg catctgtcct ctcatttacc
cacctacttg gtgcatttgc agcggcgtat 240ggcaaggctc ctgcccttcc
gcctgcacca actgcgagtg tctcctcaac gagtgcactt 300gcctcgatca
cgtggactac aaggcctgcg aggccgactc ctgtggctgg cttgatggcg
360tccccaaact agagccgtcg cagcagtggg cgatcgaaga aaccggtggg
aaattagcgg 420cgatggtgtg atccaaatgt gtttgtgttc gcctgtcgtc
ttctctcgcg ccgtcctatc 480catctatcca tccatctact tataatctat
gtcgtgtacc gtcgtgtggt gttg 5345423DNAMusa itinerans 5atggctggag
gaggcaaaag aggtgaagcg tcgtctcttc tacttgtgac gctgctcgtg 60atgttgttgg
ccttcttcgc caccgactcc tcggcggccc gtgtcacacc ccgtccgcac
120tccctcgcca gagcggtact gagtgcgttg gagggaaggg ccgatgggcc
gtgttgcaga 180tgcatctgtc ctctcattta cccacctact tggtgcattt
gcagcggcgt atggcaaggc 240tcctgccctt ccgcctgcac caactgcgag
tgtctcctca acgagtgcac ttgcctcgat 300cacgtggact acaaggcctg
cgaggccgac tcctgtggct ggcttgatgg cgtccccaaa 360ctagagccgt
cgcagcagtg ggcgatcgaa gaaaccggtg ggaaattagc ggcgatggtg 420tga
4236140PRTMusa itinerans 6Met Ala Gly Gly Gly Lys Arg Gly Glu Ala
Ser Ser Leu Leu Leu Val1 5 10 15Thr Leu Leu Val Met Leu Leu Ala Phe
Phe Ala Thr Asp Ser Ser Ala 20 25 30Ala Arg Val Thr Pro Arg Pro His
Ser Leu Ala Arg Ala Val Leu Ser 35 40 45Ala Leu Glu Gly Arg Ala Asp
Gly Pro Cys Cys Arg Cys Ile Cys Pro 50 55 60Leu Ile Tyr Pro Pro Thr
Trp Cys Ile Cys Ser Gly Val Trp Gln Gly65 70 75 80Ser Cys Pro Ser
Ala Cys Thr Asn Cys Glu Cys Leu Leu Asn Glu Cys 85 90 95Thr Cys Leu
Asp His Val Asp Tyr Lys Ala Cys Glu Ala Asp Ser Cys 100 105 110Gly
Trp Leu Asp Gly Val Pro Lys Leu Glu Pro Ser Gln Gln Trp Ala 115 120
125Ile Glu Glu Thr Gly Gly Lys Leu Ala Ala Met Val 130 135
1407398DNAMusa itinerans 7acgttgtgat agaaagttca gcggtaagca
atggctggag gaggcaaaag aggtgaagcg 60tcgtctcttc tacttgtgac gctgctcgtg
atgttgttgg ccttcttcgc caccgactcc 120tcggcggccc gtgtcacacc
ccgtccgcac tccctcgcca gagcggcgta tggcaaggct 180cctgcccttc
cgcctgcacc aactgcgagt gtctcctcaa cgagtgcact tgcctcgatc
240acgtggacta caaggcctgc caggccgact cctgtggctg gcttgatggc
gtccccaaac 300tagagccgtc gcagcagtgg gcgatcgaag aaaccggtgg
gaaattagcg atgatggtgt 360gatccaattg tgtttgtgat cgcctgtcgt cttctctc
3988616DNAMusa acuminata 8actccctcat acttgcacag gtacgttgtg
atagaaagtt cagaggtaag cgatggctgg 60aggaggcaaa agaggtgaag cgtcgtctct
tctacttgtg acgctgctcg tgacgttgtt 120ggctttcttc gccaccaact
cctcggcagc ccgtgtcaca ccccgtccgc aatccctcgc 180cagagcggca
ctgagtgcgg tgggggcaag gcaagatgag ccgtgctgca gatgcgcgtg
240tcctctcatt tacccaccta cttggtgcat ttgcggcggc atatggcaag
gctcctgccc 300ttccgcctgc aacaactgcc agtgtgtcct caacgagtgc
acttgcctcg atcttatgga 360ccccaaggtc tgcgaggcca actcctgtcc
ctggcctgtt gcagccccca aagtagagcc 420ggcgcagcag tgggctatcg
aagaaaccgg tgggaaatta gcgatgatgg tgtgatccaa 480ttgtgtttgt
gatcgcctgt cgtcttctct cgctccgtcc tatccatcta tccatccatc
540tacttataat ctatgtcgtg taccgtcgtg tggtgttgct ttgcttcagt
aataaaaata 600aaatgcttct gctttt 6169423DNAMusa acuminata
9atggctggag gaggcaaaag aggtgaagcg tcgtctcttc tacttgtgac gctgctcgtg
60acgttgttgg ctttcttcgc caccaactcc tcggcagccc gtgtcacacc ccgtccgcaa
120tccctcgcca gagcggcact gagtgcggtg ggggcaaggc aagatgagcc
gtgctgcaga 180tgcgcgtgtc ctctcattta cccacctact tggtgcattt
gcggcggcat atggcaaggc 240tcctgccctt ccgcctgcaa caactgccag
tgtgtcctca acgagtgcac ttgcctcgat 300cttatggacc ccaaggtctg
cgaggccaac tcctgtccct ggcctgttgc agcccccaaa 360gtagagccgg
cgcagcagtg ggctatcgaa gaaaccggtg ggaaattagc gatgatggtg 420tga
42310616DNAMusa acuminata 10actccctcat acttgcacag gtacgttgtg
atagaaagtt cagaggtaag cgatggctgg 60aggaggcaaa agaggtgaag cgtcgtctct
tctacttgtg acgctgctcg tgacgttgtt 120ggctttcttc gccaccaact
cctcggcagc ccgtgtcaca ccccgtccgc aatccctcgc 180cagagcggca
ctgagtgcgg tgggggcaag gcaagatgag ccgtgctgca gatgcgcgtg
240tcctctcatt tacccaccta cttggtgcat ttgcggcggc atatggcaag
gctcctgccc 300ttccgcctgc aacaactgcc agtgtgtcct gaacgagtgc
acttgcctcg atcttatgga 360ccccaaggtc tgcgaggcca actcctgtcc
ctggcctgtt gcagccccca aagtagagcc 420ggcgcagcag tgggctatcg
aagaaaccgg tgggaaatta gcgatgatgg tgtgatccaa 480ttgtgtttgt
gatcgcctgt cgtcttctct cgctccgtcc tatccatcta tccatccatc
540tacttataat ctatgtcgtg taccgtcgtg tggtgttgct ttgcttcagt
aataaaaata 600aaatgcttct gctttt 61611423DNAMusa acuminata
11atggctggag gaggcaaaag aggtgaagcg tcgtctcttc tacttgtgac gctgctcgtg
60acgttgttgg ctttcttcgc caccaactcc tcggcagccc gtgtcacacc ccgtccgcaa
120tccctcgcca gagcggcact gagtgcggtg ggggcaaggc aagatgagcc
gtgctgcaga 180tgcgcgtgtc ctctcattta cccacctact tggtgcattt
gcggcggcat atggcaaggc 240tcctgccctt ccgcctgcaa caactgccag
tgtgtcctga acgagtgcac ttgcctcgat 300cttatggacc ccaaggtctg
cgaggccaac tcctgtccct ggcctgttgc agcccccaaa 360gtagagccgg
cgcagcagtg ggctatcgaa gaaaccggtg ggaaattagc gatgatggtg 420tga
42312140PRTMusa acuminata 12Met Ala Gly Gly Gly Lys Arg Gly Glu Ala
Ser Ser Leu Leu Leu Val1 5 10 15Thr Leu Leu Val Thr Leu Leu Ala Phe
Phe Ala Thr Asn Ser Ser Ala 20 25 30Ala Arg Val Thr Pro Arg Pro Gln
Ser Leu Ala Arg Ala Ala Leu Ser 35 40 45Ala Val Gly Ala Arg Gln Asp
Glu Pro Cys Cys Arg Cys Ala Cys Pro 50 55 60Leu Ile Tyr Pro Pro Thr
Trp Cys Ile Cys Gly Gly Ile Trp Gln Gly65 70 75 80Ser Cys Pro Ser
Ala Cys Asn Asn Cys Gln Cys Val Leu Asn Glu Cys 85 90 95Thr Cys Leu
Asp Leu Met Asp Pro Lys Val Cys Glu Ala Asn Ser Cys 100 105 110Pro
Trp Pro Val Ala Ala Pro Lys Val Glu Pro Ala Gln Gln Trp Ala 115 120
125Ile Glu Glu Thr Gly Gly Lys Leu Ala Met Met Val 130 135
14013445DNAMusa acuminata 13gtaagcgatg gctggaggag gcaaaagagg
tgaagcgtcg tctcttctac ttgtgacgct 60gctcgtgacg ttgttggctt tcttcgccac
caactcctcg gcagcccgtg tcacaccccg 120tccgcaatcc ctcgccagag
cggcactgag tgcgttgggg gcaaggcaag atgagccgtg 180ctgcagatgc
gcgtgtcctc tcatttaccc acctacttgg tgcatttgcg gcggcatatg
240gcaaggctcc tgcccttccg cctgcaacaa ctgccagtgt gtcctcaacg
agtgcacttg 300cctcgatctt atggacccca aggtctgcgt ggccaactcc
tgtccctggc gtgatgcagc 360ccccaaagta gagccggcgc agcagtgggc
gatcgaagaa accggtggga aattagcgat 420gatggtgtga tccaattgtg tttgt
44514423DNAMusa acuminata 14atggctggag gaggcaaaag aggtgaagcg
tcgtctcttc tacttgtgac gctgctcgtg 60acgttgttgg ctttcttcgc caccaactcc
tcggcagccc gtgtcacacc ccgtccgcaa 120tccctcgcca gagcggcact
gagtgcgttg ggggcaaggc aagatgagcc gtgctgcaga 180tgcgcgtgtc
ctctcattta cccacctact tggtgcattt gcggcggcat atggcaaggc
240tcctgccctt ccgcctgcaa caactgccag tgtgtcctca acgagtgcac
ttgcctcgat 300cttatggacc ccaaggtctg cgtggccaac tcctgtccct
ggcgtgatgc agcccccaaa 360gtagagccgg cgcagcagtg ggcgatcgaa
gaaaccggtg ggaaattagc gatgatggtg 420tga 42315140PRTMusa acuminata
15Met Ala Gly Gly Gly Lys Arg Gly Glu Ala Ser Ser Leu Leu Leu Val1
5 10 15Thr Leu Leu Val Thr Leu Leu Ala Phe Phe Ala Thr Asn Ser Ser
Ala 20 25 30Ala Arg Val Thr Pro Arg Pro Gln Ser Leu Ala Arg Ala Ala
Leu Ser 35 40 45Ala Leu Gly Ala Arg Gln Asp Glu Pro Cys Cys Arg Cys
Ala Cys Pro 50 55 60Leu Ile Tyr Pro Pro Thr Trp Cys Ile Cys Gly Gly
Ile Trp Gln Gly65 70 75 80Ser Cys Pro Ser Ala Cys Asn Asn Cys Gln
Cys Val Leu Asn Glu Cys 85 90 95Thr Cys Leu Asp Leu Met Asp Pro Lys
Val Cys Val Ala Asn Ser Cys 100 105 110Pro Trp Arg Asp Ala Ala Pro
Lys Val Glu Pro Ala Gln Gln Trp Ala 115 120 125Ile Glu Glu Thr Gly
Gly Lys Leu Ala Met Met Val 130 135 14016525DNAMusa acuminata
16gtaagcgatg gctggaggag gcaaaagagg tgaagcgtcg tctcttctac ttgtgacgct
60gctcgtgacg ttgttggctt tcttcgccac caactcctcg gcagcccgtg tcacaccccg
120tccgcaatcc ctcgccagag gtaggttggt aaatatgcat gcgaacatct
atgattgggc 180tggagatcga ggcatcgtta attccttctt catgctgcag
cggcactgag tgcgttgggg 240gcaaggcaag atgagccgtg ctgcagatgc
gcgtgtcctc tcatttaccc acctacttgg 300tgcatttgcg gcggcatatg
gcaaggctcc tgcccttccg cctgcaacaa ctgccagtgt 360gtcctcaacg
agtgcacttg cctcgatctt atggacccca aggtctgcgt ggccaactcc
420tgtccctggc gtgatgcagc ccccaaagta gagccggcgc agcagtgggc
gatcgaagaa 480accggtggga aattagcgat gatggtgtga tccaattgtg tttgt
52517514DNAMusa basjoo 17aggtaagcga tggctggagg aggcaaaaga
ggtgaagcgt cgtctcttct acttgtgacg 60ctgctcgtga cgttgttggc tttcttcgcc
accaactcct cagcagcccg tgtcacaccc 120cgtccgcaat ccctcgccag
agcggcactg agtgcggtgg gggcaaggca agatgagccg 180tgctgcagat
gcgcgtgtcc tctcatttac ccacctactt ggtgcatttg cggcggcata
240tggcaaggct cctgcccttc cgcctgcaac aactgccagt gtgtcctcaa
cgagtgcact 300tgcctcgatc ttatggaccc caaggtctgc gaggccaact
cctgtccctg gcctgttgca 360gcccccaaag tagagccggc gcagcagtgg
gctatcgaag aaaccggtgg gaaattagcg 420atgatggtgt gatccaattg
tgtttgtgat cgcctgtcgt cttctctcgc tccgtcctat 480ccatctatcc
atccatctac ttataatcta tgtc 51418423DNAMusa basjoo 18atggctggag
gaggcaaaag aggtgaagcg tcgtctcttc tacttgtgac gctgctcgtg 60acgttgttgg
ctttcttcgc caccaactcc tcagcagccc gtgtcacacc ccgtccgcaa
120tccctcgcca gagcggcact gagtgcggtg ggggcaaggc aagatgagcc
gtgctgcaga 180tgcgcgtgtc ctctcattta cccacctact tggtgcattt
gcggcggcat atggcaaggc 240tcctgccctt ccgcctgcaa caactgccag
tgtgtcctca acgagtgcac ttgcctcgat 300cttatggacc ccaaggtctg
cgaggccaac tcctgtccct ggcctgttgc agcccccaaa 360gtagagccgg
cgcagcagtg ggctatcgaa gaaaccggtg ggaaattagc gatgatggtg 420tga
42319140PRTMusa basjoo 19Met Ala Gly Gly Gly Lys Arg Gly Glu Ala
Ser Ser Leu Leu Leu Val1 5 10 15Thr Leu Leu Val Thr Leu Leu Ala Phe
Phe Ala Thr Asn Ser Ser Ala 20 25 30Ala Arg Val Thr Pro Arg Pro Gln
Ser Leu Ala Arg Ala Ala Leu Ser 35 40 45Ala Val Gly Ala Arg Gln Asp
Glu Pro Cys Cys Arg Cys Ala Cys Pro 50 55 60Leu Ile Tyr Pro Pro Thr
Trp Cys Ile Cys Gly Gly Ile Trp Gln Gly65 70 75 80Ser Cys Pro Ser
Ala Cys Asn Asn Cys Gln Cys Val Leu Asn Glu Cys 85 90 95Thr Cys Leu
Asp Leu Met Asp Pro Lys Val Cys Glu Ala Asn Ser Cys 100 105 110Pro
Trp Pro Val Ala Ala Pro Lys Val Glu Pro Ala Gln Gln Trp Ala 115 120
125Ile Glu Glu Thr Gly Gly Lys Leu Ala Met Met Val 130 135
14020370DNAMusa basjoo 20gcactgagtg cggtgggggc aagcaaagat
gagccgtgct gcagatgcgc gtgtcctctc 60atttacccac ctacttggtg catttgcagc
ggcatatggc aaggctcctg cccttccgcc 120tgcaacaact gccagtgtgt
cctcaacgag tgcacttgcc tcgatcttat ggaccccaag 180gtctgcgagg
ccaactcctg tccctggcct gttgcagccc ccaaagtaga gccggcgcag
240cagtgggcta tcgaagaaac cggtgggaaa ttagcgatga tggtgtgatc
caattgtgtt 300tgtgatcacc tgtcgtcttc tctcgctccg tcctatccat
ctatccatcc atctacttat 360aatctatgtc 37021288DNAMusa basjoo
21gcactgagtg cggtgggggc aagcaaagat gagccgtgct gcagatgcgc gtgtcctctc
60atttacccac ctacttggtg catttgcagc ggcatatggc aaggctcctg cccttccgcc
120tgcaacaact gccagtgtgt cctcaacgag tgcacttgcc tcgatcttat
ggaccccaag 180gtctgcgagg ccaactcctg tccctggcct gttgcagccc
ccaaagtaga gccggcgcag 240cagtgggcta tcgaagaaac cggtgggaaa
ttagcgatga tggtgtga 2882295PRTMusa basjoo 22Ala Leu Ser Ala Val Gly
Ala Ser Lys Asp Glu Pro Cys Cys Arg Cys1 5 10 15Ala Cys Pro Leu Ile
Tyr Pro Pro Thr Trp Cys Ile Cys Ser Gly Ile 20 25 30Trp Gln Gly Ser
Cys Pro Ser Ala Cys Asn Asn Cys Gln Cys Val Leu 35 40 45Asn Glu Cys
Thr Cys Leu Asp Leu Met Asp Pro Lys Val Cys Glu Ala 50 55 60Asn Ser
Cys Pro Trp Pro Val Ala Ala Pro Lys Val Glu Pro Ala Gln65 70 75
80Gln Trp Ala Ile Glu Glu Thr Gly Gly Lys Leu Ala Met Met Val 85 90
9523438DNAMusella lasiocarpa 23ggtaagcaat ggctggagga ggcaaaagag
gtgaagcgtc gtctcttctg cttgtgacgc 60tgctcgtgac gttgttggcc ttcttcgcca
ccgactcctc ggcagcccgt gtcacgcccc 120gtccgcaatc cctcgccaga
gtggcactga gcgcgttggg cgtaaggcaa gatgagccgt 180gctgcagatg
catctgtcct cgcatttacc caactgcttg gtgcatttgc agcggcgcat
240ggcaaggctc ctgcccttcc gcctgcacca cctgcaagtg tgacctcaac
gagtgcactt 300gcgacgatat cgtggactac aatgcctgcc tggccgactc
ctgtccctgg cttgatgcag 360cagcccccaa ggtagagccg tcgcagcagt
gggcgatcga agaaaccggt gggaaattag 420cgacgatggt gtgatccg
43824426DNAMusella lasiocarpa 24atggctggag gaggcaaaag aggtgaagcg
tcgtctcttc tgcttgtgac gctgctcgtg 60acgttgttgg ccttcttcgc caccgactcc
tcggcagccc gtgtcacgcc ccgtccgcaa 120tccctcgcca gagtggcact
gagcgcgttg ggcgtaaggc aagatgagcc gtgctgcaga 180tgcatctgtc
ctcgcattta cccaactgct tggtgcattt gcagcggcgc atggcaaggc
240tcctgccctt ccgcctgcac cacctgcaag tgtgacctca acgagtgcac
ttgcgacgat 300atcgtggact acaatgcctg cctggccgac tcctgtccct
ggcttgatgc agcagccccc 360aaggtagagc cgtcgcagca gtgggcgatc
gaagaaaccg gtgggaaatt agcgacgatg 420gtgtga 42625141PRTMusella
lasiocarpa 25Met Ala Gly Gly Gly Lys Arg Gly Glu Ala Ser Ser Leu
Leu Leu Val1 5 10 15Thr Leu Leu Val Thr Leu Leu Ala Phe Phe Ala Thr
Asp Ser Ser Ala 20 25 30Ala Arg Val Thr Pro Arg Pro Gln Ser Leu Ala
Arg Val Ala Leu Ser 35 40 45Ala Leu Gly Val Arg Gln Asp Glu Pro Cys
Cys Arg Cys Ile Cys Pro 50 55 60Arg Ile Tyr Pro Thr Ala Trp Cys Ile
Cys Ser Gly Ala Trp Gln Gly65 70 75 80Ser Cys Pro Ser Ala Cys Thr
Thr Cys Lys Cys Asp Leu Asn Glu Cys 85 90 95Thr Cys Asp Asp Ile Val
Asp Tyr Asn Ala Cys Leu Ala Asp Ser Cys 100 105 110Pro Trp Leu Asp
Ala
Ala Ala Pro Lys Val Glu Pro Ser Gln Gln Trp 115 120 125Ala Ile Glu
Glu Thr Gly Gly Lys Leu Ala Thr Met Val 130 135 14026521DNAMusa
balbisiana 26atggctggag gaggcaaaag gggtgaagcg tcgtctcttc tacttgtgac
gctgctcgtg 60acgttgttgg ccttcttcgc caccgactcc tcggcagccc gtgtcgcacc
ccgtccgcac 120tccctcgcca gaggtaggta gataaatatg catgcgaact
tgtatatgat tgggctggag 180atcgaggcat cgttaattcc gtcttcatgc
tgcagcggca ctgagtgcgt tgggggtaag 240gcaagatgcg ccgtgctgca
catgcgtctg tcctctcatt tacccacctc ctttttgctt 300ttgcggcggc
gtatggcaag gctcctgccc gtccgcctgc accaactgcg agtgtgtcct
360caacgagtgc acttgcatcg atcgtgtgga ccccaaggcc tgcgaggccg
actcctgtgc 420cggctcgatg cagcccccaa agtagagccg tcgcagcagt
gggcgaccga agaaaccggt 480gggaaattag ggacgatggt gtgatccaat
tgtgtttgtg a 52127363DNAMusa balbisiana 27atggctggag gaggcaaaag
gggtgaagcg tcgtctcttc tacttgtgac gctgctcgtg 60acgttgttgg ccttcttcgc
caccgactcc tcggcagccc gtgtcgcacc ccgtccgcac 120tccctcgcca
gagcggcact gagtgcgttg ggggtaaggc aagatgcgcc gtgctgcaca
180tgcgtctgtc ctctcattta cccacctcct ttttgctttt gcggcggcgt
atggcaaggc 240tcctgcccgt ccgcctgcac caactgcgag tgtgtcctca
acgagtgcac ttgcatcgat 300cgtgtggacc ccaaggcctg cgaggccgac
tcctgtgccg gctcgatgca gcccccaaag 360tag 36328428DNAMusa balbisiana
28atggctggag gaggcaaaag gggtgaagcg tcgtctcttc tacttgtgac gctgctcgtg
60acgttgttgg ccttcttcgc caccgactcc tcggcagccc gtgtcgcacc ccgtccgcac
120tccctcgcca gaggtaggta gataaatatg catgcgaact tgtatatgat
tgggctggag 180atcgaggcat cgttaatccc gtcttcatgc tgcagcggca
ctgagtgcgt tgggggtaaa 240gccccttccg cctgcaccaa ctgcgagtgt
gtcctcaacg agtgcacttg catcgatcgt 300gtggacccca aggcctgcga
ggccgactcc tgtgccggct ggctcgatgc agcccccaaa 360gtagagccgt
cgcagcagtg ggcgaccgaa gaaaccggtg ggaaattagg gacgatggtg 420tgatccaa
42829523DNAMusa balbisiana 29atggctggag gaggcaaaag gggtgaagcg
tcgtctcttc tacttgtgac gctgctcgtg 60acgttgttgg ccttcttcgc caccgactcc
tcggcagccc gtgtcgcacc ccgtccgcac 120tccctcgcca gaggtaggta
gataaatatg catgcgaaca tgtatatatg attgggctgg 180agatcgaggc
atcgttaatc ccgtcttcat gctgcagcgg cactgagtgc gttgggggta
240aggcaagatg cgccgtgctg cacatgcgtc tgtcctctca tttacccacc
tcctttttgc 300ttttgcggcg gcgtatggca aggctcctgc ccgtccgcct
gcaccaactg cgagtgtgtc 360ctcaacgagt gcacttgcat cgatcgtgtg
gaccccaagg cctgcgtggc cgactcctgt 420gccggctcga tgcagccccc
aaagtagagc cgtcgcagca gtgggcgacc gaagaaaccg 480gtgggaaatt
agggacgatg gtgtgatcca attgtgtttg tga 52330523DNAMusa balbisiana
30atggctggag gaggcaaaag gggtgaagcg tcgtctcttc tacttgtgac gctgctcgtg
60acgttgttgg ccttcttcgc caccgactcc tcggcagccc gtgtcgcacc ccgtccgcac
120tccctcgcca gaggtaggta gataaatatg catgcgaact tgtatatgat
tgggctggag 180atcgaggcat cgttaatccc gtcttcatgc tgcagcggca
ctgagtgcgt tgggggtaag 240gcaagatgcg ccgtgctgca catgcgtctg
tcctctcatt tacccacctc ctttttgctt 300ttgcggcggc gtmtggcaag
gctcctgccc gtccgcctgc accaactgcg agtgtgtcct 360caacgagtgc
acttgcatcg atcgtgtgga ccccaaggcc tgcgaggccg actcctgtgc
420cggctggctc gatgcagccc ccaaagtaga gccgtcgcag cagtgggcga
ccgaagaaac 480cggtgggaaa ttagggacga tggtgtgatc caattgtgtt tgt
52331753DNAMusa acuminata 31gtagagacac ttgagttgaa ttctgaatcc
attatttctt ctcatgaacg catacgtccc 60accatacaca ccaaatctta atggctcaag
catcgtggca ctataaatag gacaagagga 120gggatgaggt aaaacgcact
ccctcatact tgcacaggta cgttgtgata gaaagttcag 180aggtaagcga
tggctggagg aggcaaaaga ggtgaagcgt cgtctcttct acttgtgacg
240ctgctcgtga cgttgttggc tttcttcgcc accaactcct cggcagcccg
tgtcacaccc 300cgtccgcaat ccctcgccag agcggcactg agtgcggtgg
gggcaaggca agatgagccg 360tgctgcagat gcgcgtgtcc tctcatttac
ccacctactt ggtgcatttg cggcggcata 420tggcaaggct cctgcccttc
cgcctgcaac aactgccagt gtgtcctcaa cgagtgcact 480tgcctcgatc
ttatggaccc caaggtctgc gaggccaact cctgtccctg gcctgttgca
540gcccccaaag tagagccggc gcagcagtgg gctatcgaag aaaccggtgg
gaaattagcg 600atgatggtgt gatccaattg tgtttgtgat cgcctgtcgt
cttctctcgc tccgtcctat 660ccatctatcc atccatctac ttataatcta
tgtcgtgtac cgtcgtgtgg tgttgctttg 720cttcagtaat aaaaataaaa
tgcttctgct ttt 75332120PRTMusa balbisiana 32Met Ala Gly Gly Gly Lys
Arg Gly Glu Ala Ser Ser Leu Leu Leu Val1 5 10 15Thr Leu Leu Val Thr
Leu Leu Ala Phe Phe Ala Thr Asp Ser Ser Ala 20 25 30Ala Arg Val Ala
Pro Arg Pro His Ser Leu Ala Arg Ala Ala Leu Ser 35 40 45Ala Leu Gly
Val Arg Gln Asp Ala Pro Cys Cys Thr Cys Val Cys Pro 50 55 60Leu Ile
Tyr Pro Pro Pro Phe Cys Phe Cys Gly Gly Val Trp Gln Gly65 70 75
80Ser Cys Pro Ser Ala Cys Thr Asn Cys Glu Cys Val Leu Asn Glu Cys
85 90 95Thr Cys Ile Asp Arg Val Asp Pro Lys Ala Cys Glu Ala Asp Ser
Cys 100 105 110Ala Gly Ser Met Gln Pro Pro Lys 115 120
* * * * *