U.S. patent application number 17/000590 was filed with the patent office on 2020-12-31 for immunogenic compositions for use in pneumococcal vaccines.
The applicant listed for this patent is Pfizer Inc.. Invention is credited to Fiona Laichu Lin, Viliam Pavliak, Michael William Pride, Shite Sebastian.
Application Number | 20200405837 17/000590 |
Document ID | / |
Family ID | 1000005076681 |
Filed Date | 2020-12-31 |
United States Patent
Application |
20200405837 |
Kind Code |
A1 |
Lin; Fiona Laichu ; et
al. |
December 31, 2020 |
IMMUNOGENIC COMPOSITIONS FOR USE IN PNEUMOCOCCAL VACCINES
Abstract
An object of the present invention is to provide immunogenic
compositions for protection against S. pneumoniae, in particular
against S. pneumoniae serogroup 10A and 39, while limiting the
number of conjugates. The present invention therefore relates to
new immunogenic compositions for use in pneumococcal vaccines and
to vaccination of human subjects, in particular infants and
elderly, against pneumococcal infections using said immunogenic
compositions.
Inventors: |
Lin; Fiona Laichu; (Fanwood,
NJ) ; Pavliak; Viliam; (Montebello, NY) ;
Pride; Michael William; (Staten Island, NY) ;
Sebastian; Shite; (Monroe, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Pfizer Inc. |
New York |
NY |
US |
|
|
Family ID: |
1000005076681 |
Appl. No.: |
17/000590 |
Filed: |
August 24, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15775485 |
May 11, 2018 |
10786561 |
|
|
PCT/IB2016/056693 |
Nov 7, 2016 |
|
|
|
17000590 |
|
|
|
|
62257798 |
Nov 20, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 2039/6037 20130101;
A61K 2039/70 20130101; A61K 39/092 20130101; A61K 2039/58
20130101 |
International
Class: |
A61K 39/09 20060101
A61K039/09 |
Claims
1. An immunogenic composition comprising at least one
glycoconjugate from Streptococcus pneumoniae serotype 10A and a
carrier protein, wherein said immunogenic composition is able to
elicit IgG antibodies in a human at a concentration of at least
0.35 ug/mL as determined by ELISA assay, and wherein said anti-IgG
antibodies are able to bind S. pneumoniae serotype 39
polysaccharides.
2. The immunogenic composition of claim 1, further comprising
glycoconjugates from S. pneumoniae serotypes 4, 6B, 14, 18C, 19F
and 23F.
3. The immunogenic composition of claim 2, further comprising at
least one glycoconjugate from S. pneumoniae serotype 1, 5 and
7F.
4. The immunogenic composition of claim 3, further comprising
glycoconjugates from S. pneumoniae serotypes 3, 6A and 19A.
5. The immunogenic composition of claim 3, further comprising
glycoconjugates from S. pneumoniae serotypes 22F and 33F.
6. The immunogenic composition of claim 3, further comprising
glycoconjugates from S. pneumoniae serotypes 8, 11A, 12F, and
15B.
7. The immunogenic composition of claim 1 which is a 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25 or 26-valent pneumococcal conjugate composition.
8. The immunogenic composition of claim 1, wherein said immunogenic
composition further comprises at least one adjuvant.
9. The immunogenic composition of claim 1 which is able to elicit a
titer of at least 1:8 against S. pneumoniae serotype 10A in at
least 50% of the subjects as determined by in vitro
opsonophagocytic killing assay (OPA).
10. The immunogenic composition of claim 1, wherein said carrier
protein is selected from the group consisting of Diphtheria toxin
(DT), tetanus toxoid (TT), CRM.sub.197, the A chain of diphtheria
toxin mutant CRM.sub.197, CRM.sub.176, CRM.sub.228, CRM.sub.4S,
CRM.sub.9, CRM.sub.102, CRM.sub.103, CRM.sub.107, and Haemophilus
influenzae protein D (PD).
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is Continuation of U.S. patent application
Ser. No. 15/775,485, filed May 11, 2018 (allowed), which is a U.S.
National Stage Application of International Application No.
PCT/11B2016/056693, filed Nov. 7, 2016, which claims the benefit of
U.S. Provisional Application No. 62/257,798, filed Nov. 20, 2015
(expired), each of which is hereby incorporated in its entirety by
reference herein.
REFERENCE TO SEQUENCE LISTING
[0002] This application is being filed electronically via EFS-Web
and includes an electronically submitted sequence listing in .txt
format. The .txt file contains a sequence listing entitled
"PC72239A_Sequence_Listing_ST25.txt" created on May 10, 2018 and
having a size of 3 kb. The sequence listing contained in this .txt
file is part of the specification and is herein incorporated by
reference in its entirety.
FIELD OF THE INVENTION
[0003] The present invention relates to new immunogenic
compositions for use in pneumococcal vaccines. Immunogenic
compositions of the present invention will typically comprise
conjugated capsular saccharide antigens (glycoconjugates), wherein
the saccharides are derived from serotypes of Streptococcus
pneumoniae. An object of the present invention is to provide
immunogenic compositions for protection against S. pneumoniae
serogroups 10A and 39.
BACKGROUND OF THE INVENTION
[0004] Infections caused by pneumococci are a major cause of
morbidity and mortality all over the world. Pneumonia, febrile
bacteraemia and meningitis are the most common manifestations of
invasive pneumococcal disease, whereas bacterial spread within the
respiratory tract may result in middle-ear infection, sinusitis or
recurrent bronchitis. Compared with invasive disease, the
non-invasive manifestations are usually less severe, but
considerably more common.
[0005] The etiological agent of pneumococcal diseases,
Streptococcus pneumoniae (pneumococcus), is a Gram-positive
encapsulated coccus, surrounded by a polysaccharide capsule. The
capsular polysaccharides (CPs) are key antigenic determinants of
this bacterium and protective immune responses to pneumococci in
humans are typically directed against the capsular polysaccharides.
Differences in the composition of this capsule permit serological
differentiation between about 91 capsular types, some of which are
frequently associated with pneumococcal disease, others rarely.
Invasive pneumococcal infections include pneumonia, meningitis and
febrile bacteremia; among the common non-invasive manifestations
are otitis media, sinusitis and bronchitis.
[0006] Protection against a high number of serotypes, while
limiting the number of conjugates in the composition, maybe very
difficult to obtain despite of the significant value.
[0007] An object of the present invention is to provide immunogenic
compositions for appropriate protection against S. pneumoniae, in
particular against S. pneumoniae serogroup 10A and 39, while
limiting the number of conjugates.
SUMMARY OF THE INVENTION
[0008] The present invention relates to an immunogenic composition
comprising at least one glycoconjugate from S. pneumoniae serotype
39.
[0009] In one aspect the present invention further relates to an
immunogenic composition comprising at least one glycoconjugate from
S. pneumoniae serotype 39 for use in a method of immunizing a
subject against infection by S. pneumoniae serotype 10A. Preferably
said composition does not comprise capsular saccharide from S.
pneumoniae serotypes 10A. The present invention also relates to an
immunogenic composition comprising at least one glycoconjugate from
S. pneumoniae serotype 10A for use in a method of immunizing a
subject against infection by S. pneumoniae serotype 39. Preferably
said composition does not comprise capsular saccharide from S.
pneumoniae serotypes 39.
[0010] In one aspect the present invention relates to the use of an
immunogenic composition comprising at least one glycoconjugate from
S. pneumoniae serotype 10A for the manufacture of a medicament for
immunizing a subject against infection by S. pneumoniae serotype
39. Preferably said composition does not comprise capsular
saccharide from S. pneumoniae serotypes 39.
[0011] In one aspect the present invention relates to the use of an
immunogenic composition comprising at least one glycoconjugate from
S. pneumoniae serotype 39 for the manufacture of a medicament for
immunizing a subject against infection by S. pneumoniae serotype
10A. Preferably said composition does not comprise capsular
saccharide from S. pneumoniae serotypes 10A.
[0012] In one aspect, the above immunogenic compositions further
comprise at least one glycoconjugate from S. pneumoniae serotypes
4, 6B, 9V, 14, 18C, 19F and/or 23F.
[0013] In an aspect the above immunogenic compositions further
comprise at least one glycoconjugate from S. pneumoniae serotype 1,
5 and/or 7F.
[0014] In an aspect the above immunogenic compositions further
comprise at least one glycoconjugate from S. pneumoniae serotype 6A
and/or 19A.
[0015] In an aspect the above immunogenic compositions further
comprise at least one glycoconjugate from S. pneumoniae serotype 3,
15B, 22F, 33F, 12F, 11A and/or 8.
[0016] In a further aspect the above immunogenic compositions
further comprise at least one glycoconjugate from S. pneumoniae
serotype 2, 9N, 15C, 17F and/or 20.
[0017] In a further aspect the immunogenic compositions is a 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or
25-valent pneumococcal conjugate composition.
[0018] In a further aspect the glycoconjugates of the immunogenic
compositions are individually conjugated to CRM197.
[0019] In on aspect, the glycoconjugates from S. pneumoniae
serotypes 1, 4, 5, 6B, 7F, 9V, 14 and/or 23F of the immunogenic
compositions are individually conjugated to PD, and if present, the
glycoconjugate from S. pneumoniae serotype 18C is conjugated to TT
and the glycoconjugate from S. pneumoniae serotype 19F is
conjugated to DT.
[0020] In on aspect, the glycoconjugates are prepared using CDAP
chemistry or by reductive amination chemistry.
[0021] The immunogenic composition may further comprise antigens
from other pathogens, and/or at least one adjuvant such as aluminum
phosphate, aluminum sulphate or aluminum hydroxide.
[0022] In an aspect the immunogenic compositions are able to elicit
IgG antibodies in human which are capable of binding S. pneumoniae
serotypes 10A and/or 39 polysaccharide at a concentration of at
least 0.35 .mu.g/ml as determined by ELISA assay.
[0023] In an aspect the immunogenic compositions are able to elicit
a titer of at least 1:8 against S. pneumoniae serotype 10A and/or
39 in at least 50% of the subjects as determined by in vitro
opsonophagocytic killing assay (OPA).
[0024] In an aspect the immunogenic compositions are able to
significantly increase the proportion of responders against S.
pneumoniae serotype 10A and/or 39 as compared to the pre-immunized
population.
[0025] In an aspect the immunogenic compositions are able to
significantly increase the OPA titers of human subjects against S.
pneumoniae serotype 10A and/or 39 as compared to the pre-immunized
population.
[0026] In an aspect the immunogenic compositions are for use in a
method of immunizing a subject against infection by S. pneumoniae
serotype 10A and/or 39.
[0027] In an aspect the immunogenic compositions are for use in a
method for preventing, treating or ameliorating an infection,
disease or condition caused by S. pneumoniae serotypes 10A and/or
39 in a subject, for use to prevent serotypes 10A and/or 39 S.
pneumoniae infection in a subject or for use in a method to protect
or treat a human susceptible to S. pneumoniae serotypes 10A and/or
39 infection, by means of administering said immunogenic
compositions via a systemic or mucosal route.
[0028] In one aspect the present invention relates to the use of
the immunogenic composition disclosed in the present document for
the manufacture of a medicament for preventing, treating or
ameliorating an infection, disease or condition caused by S.
pneumoniae serotypes 10A and/or 39 in a subject. In one aspect the
present invention relates to the use of the immunogenic composition
disclosed in the present document for use to prevent serotypes 10A
and/or 39 S. pneumoniae infection in a subject or for use in a
method to protect or treat a human susceptible to S. pneumoniae
serotypes 10A and/or 39 infection, by means of administering said
immunogenic compositions via a systemic or mucosal route.
[0029] In an aspect the invention relates to a method of
preventing, treating or ameliorating an infection, disease or
condition associated with S. pneumoniae serotypes 10A and/or 39 in
a subject, comprising administering to the subject an
immunologically effective amount of the immunogenic composition of
the invention.
[0030] In an aspect the invention relates to a method of preventing
an infection by S. pneumoniae serotypes 10A and/or 39 in a subject,
comprising administering to the subject an immunologically
effective amount of the immunogenic composition of the
invention.
[0031] The invention further relates to a kit comprising an
immunogenic composition disclosed herein and an information
leaflet, wherein said information leaflet mentions the ability of
the composition to elicit functional antibodies against S.
pneumoniae serotypes 10A and/or 39 and process for producing said
kit.
[0032] It has been surprisingly found that serotype 10A
polysaccharide conjugate beyond eliciting functional reactive
antibodies to serogroup 10A, can additionally elicit functional,
cross-reactive antibodies to serotype 39.
[0033] It has also been surprisingly found that serotype 39
polysaccharide conjugate beyond eliciting functional reactive
antibodies to serogroup 39, can additionally elicit functional,
cross-reactive antibodies to serotype 10A.
FIGURES
[0034] FIG. 1: Cross-reactivity of S. pneumoniae 10A specific mAb
with S. pneumoniae 39 Bacteria by FACS
[0035] FIG. 2: Cross-reactivity of S. pneumoniae 10A specific mAb
with S. pneumoniae 39 Bacteria by multiplex urinary antigen
detection (UAD) assay (B)
[0036] FIG. 3: S. pneumoniae 10A mAb reacts with S. pneumoniae 10A
and 39 capsular polysaccharides (CPs) in UAD assay but not with
other CPs of S. pneumoniae serogroup 10: 10B, 10C and 10A
[0037] FIG. 4: OPA Killing Titers of S. pn. 10A, 11A and 39 strains
with S. pn. 10A Specific mAbs
[0038] FIG. 5: Inhibition of OPA Killing of S. pn. 10A Bacteria
with S. pn. 10A mAbs with S.pn. 39 and 10 Capsular
Polysaccharides.
[0039] FIG. 6: Inhibition of OPA Killing of S. pn. 39 Bacteria by
S. pn. 10A mAbs with S.pn. 39 and serogroup 10 Capsular
Polysaccharides.
[0040] FIG. 7: S. pn. 10A and 39 bacteria are killed by 23 v S. pn.
polysaccharide vaccine immune human sera (n=39).
[0041] FIG. 8: OPA killing of S. pn. 10A bacteria with 23 v CPs
vaccine immune human sera in the presence or absence of homologous
10A and heterologous CPs.
[0042] FIG. 9: S. pn. 39 CP-CRM.sub.197 and S. pn. 39 CP-TT
conjugates sera can mediate killing of S. pn. 39 strain in OPA
Assay.
[0043] FIG. 10: S. pn. 39 CP-CRM.sub.197 and S. pn. 39 CP-TT
conjugates sera can mediate killing of S. pn. 10A strain in OPA
Assay.
[0044] FIG. 11: S. pn. 10A CP-CRM.sub.197 conjugate sera can
mediate killing of S. pn. 39 and 10A strains in OPA Assay.
[0045] FIG. 12: 20 v PnC vaccine sera can mediate killing of S. pn.
39 strain in OPA Assay. 20 v PnC Contains S. pn. 10A CP-CRM197
Conjugate.
[0046] FIG. 13: 20 v PnC vaccine sera can mediate killing of S. pn.
10A Strains in OPA Assay. 20 v PnC Contains S. pn. 10A
CP-CRM.sub.197 Conjugate.
1 IMMUNOGENIC COMPOSITIONS OF THE INVENTION
[0047] Immunogenic compositions of the present invention will
typically comprise conjugated capsular saccharide antigens (also
named glycoconjugates), wherein the saccharides are derived from
serotypes of S. pneumoniae.
[0048] Preferably, the number of S. pneumoniae capsular saccharides
can range from 1 serotype (or "v", valences) to 26 different
serotypes (26 v). In one embodiment there is one serotype. In one
embodiment there are 2 different serotypes. In one embodiment there
are 3 different serotypes. In one embodiment there are 4 different
serotypes. In one embodiment there are different serotypes. In one
embodiment there are 6 different serotypes. In one embodiment there
are 7 different serotypes. In one embodiment there are 8 different
serotypes. In one embodiment there are 9 different serotypes. In
one embodiment there are 10 different serotypes. In one embodiment
there are 11 different serotypes. In one embodiment there are 12
different serotypes. In one embodiment there are 13 different
serotypes. In one embodiment there are 14 different serotypes. In
one embodiment there are 15 different serotypes. In one embodiment
there are 16 different serotypes. In an embodiment there are 17
different serotypes. In an embodiment there are 18 different
serotypes. In an embodiment there are 19 different serotypes. In an
embodiment there are 20 different serotypes. In an embodiment there
are 21 different serotypes. In an embodiment there are 22 different
serotypes. In an embodiment there are 23 different serotypes. In an
embodiment there are 24 different serotypes. In an embodiment there
are 25 different serotypes. In an embodiment there are 26 different
serotypes. The capsular saccharides are conjugated to a carrier
protein to form glycoconjugates as described here below.
[0049] If the protein carrier is the same for 2 or more saccharides
in the composition, the saccharides could be conjugated to the same
molecule of the protein carrier (carrier molecules having 2 or more
different saccharides conjugated to it) [see for instance WO
2004/083251].
[0050] In a preferred embodiment though, the saccharides are each
individually conjugated to different molecules of the protein
carrier (each molecule of protein carrier only having one type of
saccharide conjugated to it). In said embodiment, the capsular
saccharides are said to be individually conjugated to the carrier
protein.
[0051] For the purposes of the invention the term `glycoconjugate`
indicates a capsular saccharide linked covalently to a carrier
protein. In one embodiment a capsular saccharide is linked directly
to a carrier protein. In a second embodiment a bacterial saccharide
is linked to a protein through a spacer/linker.
[0052] 1.1 Carrier Protein of the Invention
[0053] A component of the glycoconjugate of the invention is a
carrier protein to which the saccharide is conjugated. The terms
"protein carrier" or "carrier protein" or "carrier" may be used
interchangeably herein. Carrier proteins should be amenable to
standard conjugation procedures.
[0054] In a preferred embodiment, the carrier protein of the
glycoconjugates is selected in the group consisting of: DT
(Diphtheria toxin), TT (tetanus toxid) or fragment C of TT,
CRM.sub.197 (a nontoxic but antigenically identical variant of
diphtheria toxin), the A chain of diphtheria toxin mutant
CRM.sub.197 (CN103495161), other DT mutants (such as CRM176,
CRM228, CRM45 (Uchida et al. (1973) J. Biol. Chem. 218:3838-3844),
CRM9, CRM102, CRM103 or CRM107; and other mutations described by
Nicholls and Youle in Genetically Engineered Toxins, Ed: Frankel,
Maecel Dekker Inc. (1992); deletion or mutation of Glu-148 to Asp,
Gln or Ser and/or Ala 158 to Gly and other mutations disclosed in
U.S. Pat. Nos. 4,709,017 and 4,950,740; mutation of at least one or
more residues Lys 516, Lys 526, Phe 530 and/or Lys 534 and other
mutations disclosed in U.S. Pat. Nos. 5,917,017 and 6,455,673; or
fragment disclosed in U.S. Pat. No. 5,843,711, pneumococcal
pneumolysin (ply) (Kuo et al. (1995) Infect Immun 63:2706-2713)
including ply detoxified in some fashion, for example dPLY-GMBS (WO
2004/081515 and WO 2006/032499) or dPLY-formol, PhtX, including
PhtA, PhtB, PhtD, PhtE (sequences of PhtA, PhtB, PhtD or PhtE are
disclosed in WO 00/37105 and WO 00/39299) and fusions of Pht
proteins for example PhtDE fusions, PhtBE fusions, Pht A-E (WO
01/98334, WO 03/054007, WO 2009/000826), OMPC (meningococcal outer
membrane protein--usually extracted from Neisseria meningitidis
serogroup B (EP0372501), PorB (from N. meningitidis), PD
(Haemophilus influenzae protein D; see, e.g., EP0594610 B), or
immunologically functional equivalents thereof, synthetic peptides
(EP0378881, EP0427347), heat shock proteins (WO 93/17712, WO
94/03208), pertussis proteins (WO 98/58668, EP0471177), cytokines,
lymphokines, growth factors or hormones (WO 91/01146), artificial
proteins comprising multiple human CD4+ T cell epitopes from
various pathogen derived antigens (Falugi et al. (2001) Eur J
Immunol 31:3816-3824) such as N19 protein (Baraldoi et al. (2004)
Infect Immun 72:4884-4887) pneumococcal surface protein PspA (WO
02/091998), iron uptake proteins (WO 01/72337), toxin A or B of
Clostridium difficile (WO 00/61761), transferrin binding proteins,
pneumococcal adhesion protein (PsaA), recombinant Pseudomonas
aeruginosa exotoxin A (in particular non-toxic mutants thereof
(such as exotoxin A bearing a substitution at glutamic acid 553
(Douglas et al. (1987) J. Bacteriol. 169(11):4967-4971)). Other
proteins, such as ovalbumin, keyhole limpet hemocyanin (KLH),
bovine serum albumin (BSA) or purified protein derivative of
tuberculin (PPD) also can be used as carrier proteins. Other
suitable carrier proteins include inactivated bacterial toxins such
as cholera toxoid (e.g., as described in WO 2004/083251),
Escherichia coli LT, E. coli ST, and exotoxin A from P.
aeruginosa.
[0055] In a preferred embodiment, the carrier protein of the
glycoconjugates is independently selected from the group consisting
of TT, DT, DT mutants (such as CRM.sub.197), H. influenzae protein
D, PhtX, PhtD, PhtDE fusions (particularly those described in WO
01/98334 and WO 03/054007), detoxified pneumolysin, PorB, N19
protein, PspA, OMPC, toxin A or B of C. difficile and PsaA.
[0056] In an embodiment, the carrier protein of the glycoconjugates
of the invention is DT (Diphtheria toxoid). In another embodiment,
the carrier protein of the glycoconjugates of the invention is TT
(tetanus toxid).
[0057] In another embodiment, the carrier protein of the
glycoconjugates of the invention is PD (H. influenzae protein D;
see, e.g., EP0594610 B).
[0058] In another embodiment, the carrier protein of the
glycoconjugates of the invention is CRM.sub.197. The CRM.sub.197
protein is a nontoxic form of diphtheria toxin but is
immunologically indistinguishable from the diphtheria toxin.
CRM.sub.197 is produced by Corynebacterium diphtheriae infected by
the nontoxigenic phage .beta.197.sup.tox- created by
nitrosoguanidine mutagenesis of the toxigenic corynephage beta
(Uchida et al. (1971) Nature New Biology 233:8-11). The CRM.sub.197
protein has the same molecular weight as the diphtheria toxin but
differs therefrom by a single base change (guanine to adenine) in
the structural gene. This single base change causes an amino acid
substitution (glutamic acid for glycine) in the mature protein and
eliminates the toxic properties of diphtheria toxin. The
CRM.sub.197 protein is a safe and effective T-cell dependent
carrier for saccharides. Further details about CRM.sub.197 and
production thereof can be found, e.g., in U.S. Pat. No. 5,614,382.
In an embodiment, the capsular saccharides of the invention are
conjugated to CRM.sub.197 protein or the A chain of CRM.sub.197
(see CN103495161). In an embodiment, the capsular saccharides of
the invention are conjugated the A chain of CRM.sub.197 obtained
via expression by genetically recombinant E. coli (see
CN103495161). In an embodiment, the capsular saccharides of the
invention are all conjugated to CRM.sub.197. In an embodiment, the
capsular saccharides of the invention are all conjugated to the A
chain of CRM.sub.197.
[0059] Accordingly, in frequent embodiments, the glycoconjugates of
the invention comprise CRM.sub.197 as the carrier protein, wherein
the capsular polysaccharide is covalently linked to
CRM.sub.197.
[0060] 1.2 Capsular Saccharide of the Invention
[0061] The term "saccharide" throughout this specification may
indicate polysaccharide or oligosaccharide and includes both. In
frequent embodiments, the saccharide is a polysaccharide, in
particular a S. pneumoniae capsular polysaccharide.
[0062] Capsular polysaccharides are prepared by standard techniques
known to those of ordinary skill in the art.
[0063] In the present invention, capsular polysaccharides may be
prepared, e.g., from serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9N,
9V, 10A, 11A, 12F, 14, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23F,
33F and 39 of S. pneumoniae. Typically capsular polysaccharides are
produced by growing each S. pneumoniae serotype in a medium (e.g.,
in a soy-based medium), the polysaccharides are then prepared from
the bacteria culture. Bacterial strains of S. pneumoniae used to
make the respective polysaccharides that are used in the
glycoconjugates of the invention may be obtained from established
culture collections or clinical specimens.
[0064] The population of the organism (each S. pneumoniae serotype)
is often scaled up from a seed vial to seed bottles and passaged
through one or more seed fermentors of increasing volume until
production scale fermentation volumes are reached. At the end of
the growth cycle the cells are lysed and the lysate broth is then
harvested for downstream (purification) processing (see for example
WO 2006/110381, WO 2008/118752, and U.S. Patent App. Pub. Nos.
2006/0228380, 2006/0228381, 2008/0102498 and 2008/0286838).
[0065] The individual polysaccharides are typically purified
through centrifugation, precipitation, ultra-filtration, and/or
column chromatography (see for example WO 2006/110352 and WO
2008/118752).
[0066] Purified polysaccharides may be activated (e.g., chemically
activated) to make them capable of reacting (e.g., either directly
to the carrier protein of via a linker such as an eTEC spacer) and
then incorporated into glycoconjugates of the invention, as further
described herein.
[0067] S. pneumoniae capsular polysaccharides comprise repeating
oligosaccharide units which may contain up to 8 sugar residues.
[0068] In an embodiment, capsular saccharide of the invention may
be one oligosaccharide unit, or a shorter than native length
saccharide chain of repeating oligosaccharide units. In an
embodiment, capsular saccharide of the invention is one repeating
oligosaccharide unit of the relevant serotype.
[0069] In an embodiment, capsular saccharide of the invention may
be oligosaccharides. Oligosaccharides have a low number of repeat
units (typically 5-15 repeat units) and are typically derived
synthetically or by hydrolysis of polysaccharides.
[0070] Preferably though, all of the capsular saccharides of the
present invention and in the immunogenic compositions of the
present invention are polysaccharides. High molecular weight
capsular polysaccharides are able to induce certain antibody immune
responses due to the epitopes present on the antigenic surface. The
isolation and purification of high molecular weight capsular
polysaccharides is preferably contemplated for use in the
conjugates, compositions and methods of the present invention.
[0071] In some embodiments, the purified polysaccharides before
conjugation have a molecular weight of between 5 kDa and 4,000 kDa.
In other such embodiments, the polysaccharide has a molecular
weight of between 10 kDa and 4,000 kDa; between 50 kDa and 4,000
kDa; between 50 kDa and 3,000 kDa; between 50 kDa and 2,000 kDa;
between 50 kDa and 1,500 kDa; between 50 kDa and 1,000 kDa; between
50 kDa and 750 kDa; between 50 kDa and 500 kDa; between 100 kDa and
4,000 kDa; between 100 kDa and 3,000 kDa; 100 kDa and 2,000 kDa;
between 100 kDa and 1,500 kDa; between 100 kDa and 1,000 kDa;
between 100 kDa and 750 kDa; between 100 kDa and 500 kDa; between
100 and 400 kDa; between 200 kDa and 4,000 kDa; between 200 kDa and
3,000 kDa; between 200 kDa and 2,000 kDa; between 200 kDa and 1,500
kDa; between 200 kDa and 1,000 kDa; or between 200 kDa and 500
kDa.
[0072] In further embodiments, the capsular polysaccharide has a
molecular weight of between 70 kDa to 150 kDa; 80 kDa to 160 kDa;
90 kDa to 250 kDa; 100 kDa to 1,000; 100 kDa to 500 kDa; 100 kDa to
400 kDa; 100 kDa to 160 kDa; 150 kDa to 600 kDa; 200 kDa to 1,000
kDa; 200 kDa to 600 kDa; 200 kDa to 400 kDa; 300 kDa to 1,000 KDa;
300 kDa to 600 kDa; 300 kDa to 500 kDa or 500 kDa to 600 kDa. Any
whole number integer within any of the above ranges is contemplated
as an embodiment of the disclosure.
[0073] A polysaccharide can become slightly reduced in size during
normal purification procedures.
[0074] Additionally, as described herein, polysaccharide can be
subjected to sizing techniques before conjugation. Mechanical or
chemical sizing maybe employed. Chemical hydrolysis maybe conducted
using acetic acid. Mechanical sizing maybe conducted using High
Pressure Homogenization Shearing. The molecular weight ranges
mentioned above refer to purified polysaccharides before
conjugation (e.g., before activation).
[0075] In a preferred embodiment the purified polysaccharides, are
capsular polysaccharide from serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F,
8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 15C, 17F, 18C, 19A, 19F, 20,
22F, 23F, 33F or 39 of S. pneumoniae, wherein the capsular
polysaccharide has a molecular weight falling within one of the
molecular weight ranges as described here above. As used herein,
the term "molecular weight" of polysaccharide or of carrier
protein-polysaccharide conjugate refers to molecular weight
calculated by size exclusion chromatography (SEC) combined with
multiangle laser light scattering detector (MALLS). In some
embodiments, the pneumococcal saccharides from serotypes 9V, 18C,
11A, 15B, 22F and/or 33F of the invention are O-acetylated. In some
embodiments, the pneumococcal saccharides from serotypes 9V, 11A,
15B, 22F and/or 33F of the invention are O-acetylated. The degree
of O-acetylation of the polysaccharide can be determined by any
method known in the art, for example, by proton NMR (see for
example Lemercinier et al. (1996) Carbohydrate Research 296:83-96,
Jones et al. (2002) J. Pharmaceutical and Biomedical Analysis
30:1233-1247, WO 2005/033148 and WO 00/56357). Another commonly
used method is described in Hestrin (1949) J. Biol. Chem.
180:249-261. Preferably, the presence of O-acetyl groups is
determined by ion-HPLC analysis.
[0076] The purified polysaccharides described herein are chemically
activated to make the saccharides capable of reacting with the
carrier protein. These pneumococcal conjugates are prepared by
separate processes and formulated into a single dosage formulation
as described below.
[0077] 1.3 Glycoconjugates of the Invention
[0078] The purified saccharides are chemically activated to make
the saccharides (i.e., activated saccharides) capable of reacting
with the carrier protein, either directly or via a linker. Once
activated, each capsular saccharide is separately conjugated to a
carrier protein to form a glycoconjugate. In one embodiment, each
capsular saccharide is conjugated to the same carrier protein. The
chemical activation of the saccharides and subsequent conjugation
to the carrier protein can be achieved by the activation and
conjugation methods disclosed herein.
[0079] 1.3.1 Pneumococcal Polysaccharide from S. pneumoniae
Serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14,
15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23F, and 33F Capsular
polysaccharides from serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9N,
9V, 10A, 11A, 12F, 14, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23F
and/or 33F of S. pneumoniae are prepared as disclosed above.
[0080] In an embodiment, the polysaccharides are activated with
1-cyano-4-dimethylamino pyridinium tetrafluoroborate (CDAP) to form
a cyanate ester. The activated polysaccharide is then coupled
directly or via a spacer (linker) group to an amino group on the
carrier protein (preferably CRM.sub.197). For example, the spacer
could be cystamine or cysteamine to give a thiolated polysaccharide
which could be coupled to the carrier via a thioether linkage
obtained after reaction with a maleimide-activated carrier protein
(for example using N-[.gamma.-maleimidobutyrloxy]succinimide ester
(GMBS)) or a haloacetylated carrier protein (for example using
iodoacetimide, N-succinimidyl bromoacetate (SBA; SIB),
N-succinimidyl(4-iodoacetyl)aminobenzoate (SIAB),
sulfosuccinimidyl(4-iodoacetyl)aminobenzoate (sulfo-SIAB),
N-succinimidyl iodoacetate (SIA), or succinimidyl
3-[bromoacetamido]proprionate (SBAP)). Preferably, the cyanate
ester (optionally made by CDAP chemistry) is coupled with hexane
diamine or adipic acid dihydrazide (ADH) and the amino-derivatised
saccharide is conjugated to the carrier protein (e.g., CRM.sub.197)
using carbodiimide (e.g., EDAC or EDC) chemistry via a carboxyl
group on the protein carrier. Such conjugates are described for
example in WO 93/15760, WO 95/08348 and WO 96/129094.
[0081] In an embodiment of the present invention, the
glycoconjugates from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B,
7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 15C, 17F, 18C, 19A, 19F, 20,
22F, 23F and/or 33F are prepared using CDAP chemistry. In an
embodiment of the present invention, the glycoconjugates from S.
pneumoniae serotypes 1, 4, 5, 6B, 7F, 8, 9V, 14, 18C, 19F, and 23F
are prepared using CDAP chemistry. In an embodiment of the present
invention, the glycoconjugates from S. pneumoniae serotypes 1, 4,
5, 6A, 6B, 7F, 8, 9V, 14, 18C, 19F, and 23F are prepared using CDAP
chemistry. In an embodiment of the present invention, the
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 8,
9V, 14, 18C, 19A, 19F, and 23F are prepared using CDAP chemistry.
In an embodiment of the present invention, the glycoconjugates from
S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 14, 18C, 19A,
19F, and 23F are prepared using CDAP chemistry. In an embodiment of
the present invention, the glycoconjugates from S. pneumoniae
serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 14, 18C, 19A, 19F, and 23F
are prepared using CDAP chemistry.
[0082] Other suitable techniques for conjugation use carbodiimides,
hydrazides, active esters, norborane, p-nitrobenzoic acid,
N-hydroxysuccinimide, S--NHS, EDC, TSTU. Many are described in
International Patent Application Publication No. WO 98/42721.
Conjugation may involve a carbonyl linker which may be formed by
reaction of a free hydroxyl group of the saccharide with CDI (see
Bethell et al. (1979) 1. Biol. Chern. 254:2572-2574; Hearn et al.
(1981) J. Chromatogr. 218:509-518) followed by reaction with a
protein to form a carbamate linkage. This may involve reduction of
the anomeric terminus to a primary hydroxyl group, optional
protection/deprotection of the primary hydroxyl group, reaction of
the primary hydroxyl group with CDI to form a CDI carbamate
intermediate and coupling the CDI carbamate intermediate with an
amino group on a protein (CDI chemistry).
[0083] In an preferred embodiment, at least one of capsular
polysaccharides from serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9N,
9V, 10A, 11A, 12F, 14, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23F
and 33F of S. pneumoniae is conjugated to the carrier protein by
reductive amination (such as described in U.S. Patent Appl. Pub.
Nos. 2006/0228380, 2007/184072, 2007/0231340 and 2007/0184071, WO
2006/110381, WO 2008/079653, and WO 2008/143709).
[0084] In an embodiment of the present invention, the
glycoconjugate from S. pneumoniae serotype 6A is prepared by
reductive amination. In an embodiment of the present invention, the
glycoconjugate from S. pneumoniae serotype 19A is prepared by
reductive amination. In an embodiment of the present invention, the
glycoconjugate from S. pneumoniae serotype 3 is prepared by
reductive amination. In an embodiment of the present invention, the
glycoconjugates from S. pneumoniae serotypes 6A and 19A are
prepared by reductive amination. In an embodiment of the present
invention, the glycoconjugates from S. pneumoniae serotypes 3, 6A
and 19A are prepared by reductive amination.
[0085] In a preferred embodiment of the present invention, the
glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C,
19F and 23F are prepared by reductive amination. In an embodiment
of the present invention, the glycoconjugates from S. pneumoniae
serotypes 1, 4, 6B, 9V, 14, 18C, 19F and 23F are prepared by
reductive amination. In an embodiment of the present invention, the
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 9V, 14,
18C, 19F and 23F are prepared by reductive amination. In an
embodiment of the present invention, the glycoconjugates from S.
pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F are
prepared by reductive amination. In an embodiment of the present
invention, the glycoconjugates from S. pneumoniae serotypes 1, 4,
5, 6A, 6B, 7F, 9V, 14, 18C, 19F and 23F are prepared by reductive
amination. In an embodiment of the present invention, the
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F,
9V, 14, 18C, 19A, 19F and 23F are prepared by reductive amination.
In an embodiment of the present invention, the glycoconjugates from
S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A,
19F and 23F are all prepared by reductive amination.
[0086] In another preferred embodiment, the glycoconjugates from S.
pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F,
22F and 23F are all prepared by reductive amination.
[0087] In another preferred embodiment, the glycoconjugates from S.
pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A,
19F, 22F and 23F are all prepared by reductive amination.
[0088] In another preferred embodiment, the glycoconjugates from S.
pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F,
14, 15B, 18C, 19A, 19F, 22F and 23F are all prepared by reductive
amination.
[0089] In another preferred embodiment, the glycoconjugates from S.
pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A,
19F and 23F are all prepared by reductive amination.
[0090] In another preferred embodiment, the glycoconjugates from S.
pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 12F, 14, 15C, 18C,
19A, 19F, 22F, 23F and 33F are all prepared by reductive
amination.
[0091] In another preferred embodiment, the glycoconjugates from S.
pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A,
11A, 12F, 14, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F
are all prepared by reductive amination.
[0092] Reductive amination involves two steps, (1) oxidation of the
polysaccharide, (2) reduction of the activated polysaccharide and a
carrier protein to form a conjugate. Before oxidation, the
polysaccharide is optionally hydrolyzed. Mechanical or chemical
hydrolysis maybe employed. Chemical hydrolysis maybe conducted
using acetic acid.
[0093] The oxidation step may involve reaction with periodate. For
the purpose of the present invention, the term "periodate" includes
both periodate and periodic acid; the term also includes both
metaperiodate (IO.sub.4.sup.-) and orthoperiodate (IO.sub.6.sup.5-)
and includes the various salts of periodate (e.g., sodium periodate
and potassium periodate). In an embodiment the capsular
polysaccharide is oxidized in the presence of metaperiodate,
preferably in the presence of sodium periodate (NaIO.sub.4). In
another embodiment the capsular polysaccharide is oxidized in the
presence of orthoperiodate, preferably in the presence of periodic
acid. In an embodiment, the oxidizing agent is a stable nitroxyl or
nitroxide radical compound, such as piperidine-N-oxy or
pyrrolidine-N-oxy compounds, in the presence of an oxidant to
selectively oxidize primary hydroxyls (as described in WO
2014/097099). In said reaction, the actual oxidant is the
N-oxoammonium salt, in a catalytic cycle. In an aspect, said stable
nitroxyl or nitroxide radical compound are piperidine-N-oxy or
pyrrolidine-N-oxy compounds. In an aspect, said stable nitroxyl or
nitroxide radical compound bears a TEMPO
(2,2,6,6-tetramethyl-1-piperidinyloxy) or a PROXYL
(2,2,5,5-tetramethyl-1-pyrrolidinyloxy) moiety. In an aspect, said
stable nitroxyl radical compound is TEMPO or a derivative thereof.
In an aspect, said oxidant is a molecule bearing a N-halo moiety.
In an aspect, said oxidant is selected from the group consisting of
N-ChloroSuccinimide, N-Bromosuccinimide, N-Iodosuccinimide,
Dichloroisocyanuric acid,
1,3,5-trichloro-1,3,5-triazinane-2,4,6-trione, Dibromoisocyanuric
acid, 1,3,5-tribromo-1,3,5-triazinane-2,4,6-trione,
Diiodoisocyanuric acid and
1,3,5-triiodo-1,3,5-triazinane-2,4,6-trione. Preferably said
oxidant is N-Chlorosuccinimide.
[0094] Following the oxidation step of the polysaccharide, the
polysaccharide is said to be activated and is referred to an
"activated polysaccharide" here below. The activated polysaccharide
and the carrier protein may be lyophilised (freeze-dried), either
independently (discrete lyophilization) or together
(co-lyophilized). In one embodiment the activated polysaccharide
and the carrier protein are co-lyophilized. In another embodiment
the activated polysaccharide and the carrier protein are
lyophilized independently.
[0095] In one embodiment the lyophilization takes place in the
presence of a non-reducing sugar, possible non-reducing sugars
include sucrose, trehalose, raffinose, stachyose, melezitose,
dextran, mannitol, lactitol and palatinit.
[0096] The second step of the conjugation process is the reduction
of the activated polysaccharide and a carrier protein to form a
conjugate (so-called reductive amination), using a reducing agent.
Reducing agents which are suitable include the cyanoborohydrides
(such as sodium cyanoborohydride, sodium triacetoxyborohydride or
sodium or zinc borohydride in the presence of Bronsted or Lewis
acids), amine boranes such as pyridine borane, 2-Picoline Borane,
2,6-diborane-methanol, dimethylamine-borane,
t-BuMe.sup.iPrN--BH.sub.3, benzylamine-BH.sub.3 or
5-ethyl-2-methylpyridine borane (PEMB) or borohydride exchange
resin. In one embodiment the reducing agent is sodium
cyanoborohydride.
[0097] In an embodiment, the reduction reaction is carried out in
aqueous solvent (e.g., selected from PBS, MES, HEPES, Bis-tris,
ADA, PIPES, MOPSO, BES, MOPS, DIPSO, MOBS, HEPPSO, POPSO, TEA,
EPPS, Bicine or HEPB, at a pH between 6.0 and 8.5, 7.0 and 8.0, or
7.0 and 7.5), in another embodiment the reaction is carried out in
aprotic solvent. In an embodiment, the reduction reaction is
carried out in DMSO (dimethylsulfoxide) or in DMF
(dimethylformamide) solvent. The DMSO or DMF solvent may be used to
reconstitute the activated polysaccharide and carrier protein which
has been lyophilized.
[0098] At the end of the reduction reaction, there may be unreacted
aldehyde groups remaining in the conjugates, these may be capped
using a suitable capping agent. In one embodiment this capping
agent is sodium borohydride (NaBH.sub.4). Following the conjugation
(the reduction reaction and optionally the capping), the
glycoconjugates may be purified (enriched with respect to the
amount of polysaccharide-protein conjugate) by a variety of
techniques known to the skilled person. These techniques include
dialysis, concentration/diafiltration operations, tangential flow
filtration precipitation/elution, column chromatography (DEAE or
hydrophobic interaction chromatography), and depth filtration. In
an embodiment, the glycoconjugates are purified by diafilitration
or ion exchange chromatography or size exclusion
chromatography.
[0099] In one embodiment the glycoconjugates are sterile
filtered.
[0100] In an embodiment of the present invention, the
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 8,
9V, 14, 18C, 19F, and 23F are prepared using CDAP chemistry and the
glycoconjugate from S. pneumoniae serotype 6A is prepared by
reductive amination.
[0101] In an embodiment of the present invention, the
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 8,
9V, 14, 18C, 19F, and 23F are prepared using CDAP chemistry and the
glycoconjugate from S. pneumoniae serotype 19A is prepared by
reductive amination.
[0102] In an embodiment of the present invention, the
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 8,
9V, 14, 18C, 19F, and 23F are prepared using CDAP chemistry and the
glycoconjugates from S. pneumoniae serotype 6A and 19A are prepared
by reductive amination.
[0103] In an embodiment of the present invention, the
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 8,
9V, 14, 18C, 19F, and 23F are prepared using CDAP chemistry and the
glycoconjugates from S. pneumoniae serotype 3, 6A and 19A are
prepared by reductive amination.
[0104] In an embodiment of the present invention, the
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 8,
9V, 14, 18C, 19F, 22F and 23F are prepared using CDAP chemistry and
the glycoconjugate from S. pneumoniae serotype 6A is prepared by
reductive amination.
[0105] In an embodiment of the present invention, the
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 8,
9V, 14, 18C, 19F, 22F, and 23F are prepared using CDAP chemistry
and the glycoconjugate from S. pneumoniae serotype 19A is prepared
by reductive amination.
[0106] In an embodiment of the present invention, the
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 8,
9V, 14, 18C, 19F, 22F, and 23F are prepared using CDAP chemistry
and the glycoconjugates from S. pneumoniae serotype 6A and 19A are
prepared by reductive amination.
[0107] In an embodiment of the present invention, the
glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 8,
9V, 14, 18C, 19F, 22F and 23F are prepared using CDAP chemistry and
the glycoconjugates from S. pneumoniae serotype 3, 6A and 19A are
prepared by reductive amination.
[0108] In an embodiment, the glycoconjugates of the invention are
prepared using the eTEC conjugation, such as described in WO
2014/027302. Said glycoconjugates comprise a saccharide covalently
conjugated to a carrier protein through one or more eTEC spacers,
wherein the saccharide is covalently conjugated to the eTEC spacer
through a carbamate linkage, and wherein the carrier protein is
covalently conjugated to the eTEC spacer through an amide linkage.
The eTEC linked glycoconjugates of the invention may be represented
by the general formula (I):
##STR00001##
[0109] where the atoms that comprise the eTEC spacer are contained
in the central box.
[0110] The eTEC spacer includes seven linear atoms (i.e.,
--C(O)NH(CH.sub.2).sub.2SCH.sub.2C(O)--) and provides stable
thioether and amide bonds between the saccharide and carrier
protein.
[0111] In said glycoconjugates of the invention, the saccharide may
be a polysaccharide or an oligosaccharide. The carrier protein may
be selected from any suitable carrier as described herein or known
to those of skill in the art. In frequent embodiments, the
saccharide is a polysaccharide. In some such embodiments, the
carrier protein is CRM.sub.197.
[0112] In some embodiments, the glycoconjugate from S. pneumoniae
serotypes 1, 7F, 9V, and/or 18C of the invention are O-acetylated.
In some embodiments, the glycoconjugate from S. pneumoniae
serotypes 1, 7F and 9V is O-acetylated and the glycoconjugate from
S. pneumoniae serotype 18C is de-O-acetylated.
[0113] In some embodiments, the glycoconjugate from S. pneumoniae
serotype 1 comprise a saccharide which has a degree of
O-acetylation of between 10 and 100%, between 20 and 100%, between
30 and 100%, between 40 and 100%, between 50 and 100%, between 60
and 100%, between 70 and 100%, between 75 and 100%, 80 and 100%, 90
and 100%, 50 and 90%, 60 and 90%, 70 and 90% or 80 and 90%. In
other embodiments, the degree of O-acetylation is .gtoreq.10%,
.gtoreq.20%, .gtoreq.30%, .gtoreq.40%, .gtoreq.50%, .gtoreq.60%,
.gtoreq.70%, .gtoreq.80%, .gtoreq.90%, or about 100%.
[0114] In some embodiments, the glycoconjugate from S. pneumoniae
serotype 7F comprise a saccharide which has a degree of
O-acetylation of between 10 and 100%, between 20 and 100%, between
30 and 100%, between 40 and 100%, between 50 and 100%, between 60
and 100%, between 70 and 100%, between 75 and 100%, 80 and 100%, 90
and 100%, 50 and 90%, 60 and 90%, 70 and 90% or 80 and 90%. In
other embodiments, the degree of O-acetylation is .gtoreq.10%,
.gtoreq.20%, .gtoreq.30%, .gtoreq.40%, .gtoreq.50%, .gtoreq.60%,
.gtoreq.70%, .gtoreq.80%, .gtoreq.90%, or about 100%.
[0115] In some embodiments, the glycoconjugate from S. pneumoniae
serotype 9V comprise a saccharide which has a degree of
O-acetylation of between 10 and 100%, between 20 and 100%, between
30 and 100%, between 40 and 100%, between 50 and 100%, between 60
and 100%, between 70 and 100%, between 75 and 100%, 80 and 100%, 90
and 100%, 50 and 90%, 60 and 90%, 70 and 90% or 80 and 90%. In
other embodiments, the degree of O-acetylation is .gtoreq.10%,
.gtoreq.20%, .gtoreq.30%, .gtoreq.40%, .gtoreq.50%, .gtoreq.60%,
.gtoreq.70%, .gtoreq.80%, .gtoreq.90%, or about 100%.
[0116] In some embodiments, the glycoconjugate from S. pneumoniae
serotype 18C comprise a saccharide which has a degree of
O-acetylation of between 10 and 100%, between 20 and 100%, between
30 and 100%, between 40 and 100%, between 50 and 100%, between 60
and 100%, between 70 and 100%, between 75 and 100%, 80 and 100%, 90
and 100%, 50 and 90%, 60 and 90%, 70 and 90% or 80 and 90%. In
other embodiments, the degree of O-acetylation is .gtoreq.10%,
.gtoreq.20%, .gtoreq.30%, .gtoreq.40%, .gtoreq.50%, .gtoreq.60%,
.gtoreq.70%, .gtoreq.80%, .gtoreq.90%, or about 100%. Preferably
though, the glycoconjugate from S. pneumoniae serotype 18C is
de-O-acetylated. In some said embodiments, the glycoconjugate from
S. pneumoniae serotype 18C comprise a saccharide which has a degree
of O-acetylation of between 0 and 50%, between 0 and 40%, between 0
and 30%, between 0 and 20%, between 0 and 10%, between 0 and 5%, or
between 0 and 2%. In other embodiments, the degree of O-acetylation
is .ltoreq.50%, 40%, .ltoreq.30%, .ltoreq.20%, .ltoreq.10%,
.ltoreq.5%, .ltoreq.2%, or .ltoreq.1%.
[0117] By % of O-acetylation it is meant the percentage of a given
saccharide relative to 100% (where each repeat unit is fully
acetylated relative to its acetylated structure).
[0118] In some embodiments, the glycoconjugates of the present
invention comprise a saccharide having a molecular weight of
between 10 kDa and 2,000 kDa. In other such embodiments, the
saccharide has a molecular weight of between 50 kDa and 1,000 kDa.
In other such embodiments, the saccharide has a molecular weight of
between 70 kDa and 900 kDa. In other such embodiments, the
saccharide has a molecular weight of between 100 kDa and 800 kDa.
In other such embodiments, the saccharide has a molecular weight of
between 200 kDa and 600 kDa. In further such embodiments, the
saccharide has a molecular weight of 100 kDa to 1000 kDa; 100 kDa
to 900 kDa; 100 kDa to 800 kDa; 100 kDa to 700 kDa; 100 kDa to 600
kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa;
150 kDa to 1,000 kDa; 150 kDa to 900 kDa; 150 kDa to 800 kDa; 150
kDa to 700 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to
400 kDa; 150 kDa to 300 kDa; 200 kDa to 1,000 kDa; 200 kDa to 900
kDa; 200 kDa to 800 kDa; 200 kDa to 700 kDa; 200 kDa to 600 kDa;
200 kDa to 500 kDa; 200 kDa to 400 kDa; 200 kDa to 300; 250 kDa to
1,000 kDa; 250 kDa to 900 kDa; 250 kDa to 800 kDa; 250 kDa to 700
kDa; 250 kDa to 600 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa;
250 kDa to 350 kDa; 300 kDa to 1,000 kDa; 300 kDa to 900 kDa; 300
kDa to 800 kDa; 300 kDa to 700 kDa; 300 kDa to 600 kDa; 300 kDa to
500 kDa; 300 kDa to 400 kDa; 400 kDa to 1,000 kDa; 400 kDa to 900
kDa; 400 kDa to 800 kDa; 400 kDa to 700 kDa; 400 kDa to 600 kDa;
500 kDa to 600 kDa. Any whole number integer within any of the
above ranges is contemplated as an embodiment of the disclosure. In
some such embodiments, the glycoconjugate is prepared using
reductive amination.
[0119] In some embodiments, the glycoconjugate of the invention has
a molecular weight of between 400 kDa and 15,000 kDa; between 500
kDa and 10,000 kDa; between 2,000 kDa and 10,000 kDa; between 3,000
kDa and 8,000 kDa; or between 3,000 kDa and 5,000 kDa. In other
embodiments, the glycoconjugate has a molecular weight of between
500 kDa and 10,000 kDa. In other embodiments, glycoconjugate has a
molecular weight of between 1,000 kDa and 8,000 kDa. In still other
embodiments, the glycoconjugate has a molecular weight of between
2,000 kDa and 8,000 kDa or between 3,000 kDa and 7,000 kDa. In
further embodiments, the glycoconjugate of the invention has a
molecular weight of between 200 kDa and 20,000 kDa; between 200 kDa
and 15,000 kDa; between 200 kDa and 10,000 kDa; between 200 kDa and
7,500 kDa; between 200 kDa and 5,000 kDa; between 200 kDa and 3,000
kDa; between 200 kDa and 1,000 kDa; between 500 kDa and 20,000 kDa;
between 500 kDa and 15,000 kDa; between 500 kDa and 12,500 kDa;
between 500 kDa and 10,000 kDa; between 500 kDa and 7,500 kDa;
between 500 kDa and 6,000 kDa; between 500 kDa and 5,000 kDa;
between 500 kDa and 4,000 kDa; between 500 kDa and 3,000 kDa;
between 500 kDa and 2,000 kDa; between 500 kDa and 1,500 kDa;
between 500 kDa and 1,000 kDa; between 750 kDa and 20,000 kDa;
between 750 kDa and 15,000 kDa; between 750 kDa and 12,500 kDa;
between 750 kDa and 10,000 kDa; between 750 kDa and 7,500 kDa;
between 750 kDa and 6,000 kDa; between 750 kDa and 5,000 kDa;
between 750 kDa and 4,000 kDa; between 750 kDa and 3,000 kDa;
between 750 kDa and 2,000 kDa; between 750 kDa and 1,500 kDa;
between 1,000 kDa and 15,000 kDa; between 1,000 kDa and 12,500 kDa;
between 1,000 kDa and 10,000 kDa; between 1,000 kDa and 7,500 kDa;
between 1,000 kDa and 6,000 kDa; between 1,000 kDa and 5,000 kDa;
between 1,000 kDa and 4,000 kDa; between 1,000 kDa and 2,500 kDa;
between 2,000 kDa and 15,000 kDa; between 2,000 kDa and 12,500 kDa;
between 2,000 kDa and 10,000 kDa; between 2,000 kDa and 7,500 kDa;
between 2,000 kDa and 6,000 kDa; between 2,000 kDa and 5,000 kDa;
between 2,000 kDa and 4,000 kDa; or between 2,000 kDa and 3,000
kDa.
[0120] In further embodiments, the glycoconjugate of the invention
has a molecular weight of between 3,000 kDa and 20,000 kDa; between
3,000 kDa and 15,000 kDa; between 3,000 kDa and 10,000 kDa; between
3,000 kDa and 7,500 kDa; between 3,000 kDa and 5,000 kDa; between
4,000 kDa and 20,000 kDa; between 4,000 kDa and 15,000 kDa; between
4,000 kDa and 12,500 kDa; between 4,000 kDa and 10,000 kDa; between
4,000 kDa and 7,500 kDa; between 4,000 kDa and 6,000 kDa; or
between 4,000 kDa and 5,000 kDa.
[0121] In further embodiments, the glycoconjugate of the invention
has a molecular weight of between 5,000 kDa and 20,000 kDa; between
5,000 kDa and 15,000 kDa; between 5,000 kDa and 10,000 kDa; between
5,000 kDa and 7,500 kDa; between 6,000 kDa and 20,000 kDa; between
6,000 kDa and 15,000 kDa; between 6,000 kDa and 12,500 kDa; between
6,000 kDa and 10,000 kDa or between 6,000 kDa and 7,500 kDa.
[0122] The molecular weight of the glycoconjugate is measured by
SEC-MALLS. Any whole number integer within any of the above ranges
is contemplated as an embodiment of the disclosure. In a preferred
embodiment, the serotype 22F glycoconjugate of the invention
comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6 or 0.7 or about 0.8
mM acetate per mM serotype 22F polysaccharide. In a preferred
embodiment, the glycoconjugate comprises at least 0.5, 0.6 or 0.7
mM acetate per mM serotype 22F polysaccharide. In a preferred
embodiment, the glycoconjugate comprises at least 0.6 mM acetate
per mM serotype 22F polysaccharide. In a preferred embodiment, the
glycoconjugate comprises at least 0.7 mM acetate per mM serotype
22F polysaccharide.
[0123] In a preferred embodiment, the serotype 33F glycoconjugate
of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6,
0.7 or 0.8 mM acetate per mM serotype 33F capsular polysaccharide.
In a preferred embodiment, the glycoconjugate comprises at least
0.5, 0.6 or 0.7 mM acetate per mM serotype 33F capsular
polysaccharide. In a preferred embodiment, the glycoconjugate
comprises at least 0.6 mM acetate per mM serotype 33F capsular
polysaccharide. In a preferred embodiment, the glycoconjugate
comprises at least 0.7 mM acetate per mM serotype 33F capsular
polysaccharide. In a preferred embodiment, the presence of O-acetyl
groups is determined by ion-HPLC analysis.
[0124] In a preferred embodiment, the serotype 15B glycoconjugate
of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6,
0.7 or 0.8 mM acetate per mM serotype 15B capsular polysaccharide.
In a preferred embodiment, the glycoconjugate comprises at least
0.5, 0.6 or 0.7 mM acetate per mM serotype 15B capsular
polysaccharide. In a preferred embodiment, the glycoconjugate
comprises at least 0.6 mM acetate per mM serotype 15B capsular
polysaccharide. In a preferred embodiment, the glycoconjugate
comprises at least 0.7 mM acetate per mM serotype 15B capsular
polysaccharide. In a preferred embodiment, the presence of O-acetyl
groups is determined by ion-HPLC analysis.
[0125] In a preferred embodiment, the serotype 15B glycoconjugate
of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6,
0.7 or 0.8 mM glycerol per mM serotype 15B capsular polysaccharide.
In a preferred embodiment, the serotype 15B glycoconjugate of the
invention comprises at least 0.5, 0.6 or 0.7 mM glycerol per mM
serotype 15B capsular polysaccharide. In a preferred embodiment,
the serotype 15B glycoconjugate of the invention comprises at least
0.6 mM glycerol per mM serotype 15B capsular polysaccharide. In a
preferred embodiment, the serotype 15B glycoconjugate of the
invention comprises at least 0.7 mM glycerol per mM serotype 15B
capsular polysaccharide.
[0126] In a preferred embodiment, the serotype 11A glycoconjugate
of the invention comprises at least 0.3, 0.5, 0.6, 1.0, 1.4, 1.8,
2.2, 2.6, 3.0, 3.4, 3.8, 4.2, 4.6 or about 5.0 mM acetate per mM
serotype 11A polysaccharide. In a preferred embodiment, the
serotype 11A glycoconjugate comprises at least 1.8, 2.2 or 2.6 mM
acetate per mM serotype 11A polysaccharide. In an embodiment, the
glycoconjugate comprises at least 0.6 mM acetate per mM serotype
11A polysaccharide. In a preferred embodiment, the serotype 11A
glycoconjugate of the invention comprises at least 0.6, 1.0, 1.4,
1.8, 2.2, 2.6, 3.0, 3.4, 3.8, 4.2 or about 4.6 mM acetate per mM
serotype 11A polysaccharide and less than about 5.0 mM acetate per
mM serotype 11A polysaccharide. In an embodiment, the serotype 11A
glycoconjugate of the invention comprises at least 0.6, 1.0, 1.4,
1.8, 2.2, 2.6, or about 3.0 mM acetate per mM serotype 11A
polysaccharide and less than about 3.4 mM acetate per mM serotype
11A polysaccharide. In an embodiment, the serotype 11A
glycoconjugate of the invention comprises at least 0.6, 1.0, 1.4,
1.8, 2.2, 2.6, or about 3.0 mM acetate per mM serotype 11A
polysaccharide and less than about 3.3 mM acetate per mM serotype
11A polysaccharide. Any of the above number is contemplated as an
embodiment of the disclosure.
[0127] In a preferred embodiment, the serotype 11A glycoconjugate
of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6,
0.7, 0.8, 0.9 or about 1.0 mM glycerol per mM serotype 11A
polysaccharide. In a preferred embodiment, the serotype 11A
glycoconjugate comprises at least 0.2, 0.3 or 0.4 mM glycerol per
mM serotype 11A polysaccharide. In a preferred embodiment, the
serotype 11A glycoconjugate of the invention comprises at least
0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8 or about 0.9 mM glycerol per
mM serotype 11A polysaccharide and less than about 1.0 mM glycerol
per mM serotype 11A polysaccharide. In a preferred embodiment, the
serotype 11A glycoconjugate of the invention comprises at least
0.3, 0.4, 0.5, 0.6, or about 0.7 mM glycerol per mM serotype 11A
polysaccharide and less than about 0.8 mM glycerol per mM serotype
11A polysaccharide. Any of the above number is contemplated as an
embodiment of the disclosure.
[0128] Another way to characterize the glycoconjugates of the
invention is by the number of lysine residues in the carrier
protein (e.g., CRM.sub.197) that become conjugated to the
saccharide which can be characterized as a range of conjugated
lysines (degree of conjugation). The evidence for lysine
modification of the carrier protein, due to covalent linkages to
the polysaccharides, can be obtained by amino acid analysis using
routine methods known to those of skill in the art. Conjugation
results in a reduction in the number of lysine residues recovered,
compared to the carrier protein starting material used to generate
the conjugate materials. In a preferred embodiment, the degree of
conjugation of the glycoconjugate of the invention is between 2 and
15, between 2 and 13, between 2 and 10, between 2 and 8, between 2
and 6, between 2 and 5, between 2 and 4, between 3 and 15, between
3 and 13, between 3 and 10, between 3 and 8, between 3 and 6,
between 3 and 5, between 3 and 4, between 5 and 15, between and 10,
between 8 and 15, between 8 and 12, between 10 and 15 or between 10
and 12.
[0129] In an embodiment, the degree of conjugation of the
glycoconjugate of the invention is about 2, about 3, about 4, about
5, about 6, about 7, about 8, about 9, about 10, about 11, about
12, about 13, about 14 or about 15. In a preferred embodiment, the
degree of conjugation of the glycoconjugate of the invention is
between 4 and 7. In some such embodiments, the carrier protein is
CRM.sub.197.
[0130] The glycoconjugates of the invention may also be
characterized by the ratio (weight/weight) of saccharide to carrier
protein. In some embodiments, the ratio of polysaccharide to
carrier protein in the glycoconjugate (w/w) is between 0.5 and 3
(e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about
1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about
1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about
2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about
2.8, about 2.9, or about 3.0). In other embodiments, the saccharide
to carrier protein ratio (w/w) is between 0.5 and 2.0, between 0.5
and 1.5, between 0.8 and 1.2, between 0.5 and 1.0, between 1.0 and
1.5 or between 1.0 and 2.0. In further embodiments, the saccharide
to carrier protein ratio (w/w) is between 0.8 and 1.2. In a
preferred embodiment, the ratio of capsular polysaccharide to
carrier protein in the conjugate is between 0.9 and 1.1. In some
such embodiments, the carrier protein is CRM.sub.197.
[0131] The glycoconjugates and immunogenic compositions of the
invention may contain free saccharide that is not covalently
conjugated to the carrier protein, but is nevertheless present in
the glycoconjugate composition. The free saccharide may be
non-covalently associated with (i.e., non-covalently bound to,
adsorbed to, or entrapped in or with) the glycoconjugate.
[0132] In a preferred embodiment, the glycoconjugate comprises less
than about 50%, 45%, 40%, 35%, 30%, 25%, 20% or 15% of free
polysaccharide compared to the total amount of polysaccharide. In a
preferred embodiment the glycoconjugate comprises less than about
25% of free polysaccharide compared to the total amount of
polysaccharide. In a preferred embodiment the glycoconjugate
comprises less than about 20% of free polysaccharide compared to
the total amount of polysaccharide. In a preferred embodiment the
glycoconjugate comprises less than about 15% of free polysaccharide
compared to the total amount of polysaccharide.
[0133] The glycoconjugates may also be characterized by their
molecular size distribution (K.sub.d). Size exclusion
chromatography media (CL-4B) can be used to determine the relative
molecular size distribution of the conjugate. Size Exclusion
Chromatography (SEC) is used in gravity fed columns to profile the
molecular size distribution of conjugates. Large molecules excluded
from the pores in the media elute more quickly than small
molecules. Fraction collectors are used to collect the column
eluate. The fractions are tested colorimetrically by saccharide
assay. For the determination of K.sub.d, columns are calibrated to
establish the fraction at which molecules are fully excluded
(V.sub.0), (K.sub.d=0), and the fraction representing the maximum
retention (V.sub.i), (K.sub.d=1). The fraction at which a specified
sample attribute is reached (V.sub.e), is related to K.sub.d by the
expression, K.sub.d=(V.sub.e-V.sub.0)/(V.sub.i-V.sub.0).
[0134] In a preferred embodiment, at least 30% of the
glycoconjugate has a K.sub.d below or equal to 0.3 in a CL-4B
column. In a preferred embodiment, at least 40% of the
glycoconjugate has a K.sub.d below or equal to 0.3 in a CL-4B
column. In a preferred embodiment, at least 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, or 85% of the glycoconjugate has a K.sub.d
below or equal to 0.3 in a CL-4B column. In a preferred embodiment,
at least 60% of the glycoconjugate has a K.sub.d below or equal to
0.3 in a CL-4B column. In a preferred embodiment, between 50% and
80% of the glycoconjugate has a K.sub.d below or equal to 0.3 in a
CL-4B column. In a preferred embodiment, between 65% and 80% of the
glycoconjugate has a K.sub.d below or equal to 0.3 in a CL-4B
column.
[0135] The frequency of attachment of the saccharide chain to a
lysine on the carrier protein is another parameter for
characterizing the glycoconjugates of the invention. For example,
in some embodiments, at least one covalent linkage between the
carrier protein and the polysaccharide occurs for every 4
saccharide repeat units of the polysaccharide. In another
embodiment, the covalent linkage between the carrier protein and
the polysaccharide occurs at least once in every 10 saccharide
repeat units of the polysaccharide. In another embodiment, the
covalent linkage between the carrier protein and the polysaccharide
occurs at least once in every 15 saccharide repeat units of the
polysaccharide. In a further embodiment, the covalent linkage
between the carrier protein and the polysaccharide occurs at least
once in every 25 saccharide repeat units of the polysaccharide.
[0136] In frequent embodiments, the carrier protein is CRM.sub.197
and the covalent linkage via an eTEC spacer between the CRM.sub.197
and the polysaccharide occurs at least once in every 4, 10, 15 or
25 saccharide repeat units of the polysaccharide.
[0137] In other embodiments, the conjugate comprises at least one
covalent linkage between the carrier protein and saccharide for
every 5 to 10 saccharide repeat units; every 2 to 7 saccharide
repeat units; every 3 to 8 saccharide repeat units; every 4 to 9
saccharide repeat units; every 6 to 11 saccharide repeat units;
every 7 to 12 saccharide repeat units; every 8 to 13 saccharide
repeat units; every 9 to 14 saccharide repeat units; every 10 to 15
saccharide repeat units; every 2 to 6 saccharide repeat units,
every 3 to 7 saccharide repeat units; every 4 to 8 saccharide
repeat units; every 6 to 10 saccharide repeat units; every 7 to 11
saccharide repeat units; every 8 to 12 saccharide repeat units;
every 9 to 13 saccharide repeat units; every 10 to 14 saccharide
repeat units; every 10 to 20 saccharide repeat units; every 4 to 25
saccharide repeat units or every 2 to 25 saccharide repeat units.
In frequent embodiments, the carrier protein is CRM.sub.197.
[0138] In another embodiment, at least one linkage between carrier
protein and saccharide occurs for every 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25
saccharide repeat units of the polysaccharide. In an embodiment,
the carrier protein is CRM.sub.197. Any whole number integer within
any of the above ranges is contemplated as an embodiment of the
disclosure.
[0139] 1.3.2 Pneumococcal Polysaccharide from S. pneumoniae
Serotype 39
[0140] S. pneumoniae 39 capsular polysaccharides comprise repeating
oligosaccharide units which contain 7 sugar residues and are
composed of: D-Galp, D-GapNAc, D-Galf and Ribitol in the molar
ratios of 3:1:2:1 (Petersen et al., Carbohydr. Res. 2014, 395,
38-46.; Bush et al., J. Bacteriol. 2014, 196, 3271-3278). S.
pneumoniae 39 capsular polysaccharides are O-acetylated at two
positions of terminal .beta.-Galf. The molecular weight of a
repeating unit of Pn 39 polysaccharide (sodium salt) is 1334 g/mol
or 1334 Da when O-acetylated at said two positions and 1250 g/mol
or 1250 Da for de-O-acetylated polysaccharide.
[0141] In an embodiment, serotype 39 capsular saccharide of the
invention may be oligosaccharides. Oligosaccharides have a low
number of repeat units (typically) and are typically derived
synthetically or by hydrolysis of polysaccharides.
[0142] In such embodiment, serotype 39 saccharide of the invention
may be as short as one oligosaccharide unit (7 sugar residues, 1250
to 1334 Da). In another embodiment, serotype 39 capsular saccharide
of the invention is 2 to 15 repeat units long (2.5-20 kDa).
[0143] Serotype 39 saccharides can be obtained directly from
bacteria using isolation procedures known to one of ordinary skill
in the art (see for example methods disclosed in U.S. Patent App.
Pub. Nos. 2006/0228380, 2006/0228381, 2007/0184071, 2007/0184072,
2007/0231340, and 2008/0102498 and WO 2008/118752). In addition,
they can be produced using synthetic protocols.
[0144] Serotype 39 S. pneumoniae strains may be obtained from
established culture collections (such as for example the
Streptococcal Reference Laboratory (Centers for Disease Control and
Prevention, Atlanta, Ga.)) or clinical specimens.
[0145] In some embodiments, the purified polysaccharides from S.
pneumoniae serotype 39 before conjugation have a molecular weight
of between 1.25 kDa and 2,000 kDa. In one embodiment, the capsular
polysaccharide has a molecular weight of between 10 kDa and 2,000
kDa. In one embodiment, the capsular polysaccharide has a molecular
weight of between 50 kDa and 1,000 kDa. In another embodiment, the
capsular polysaccharide has a molecular weight of between 70 kDa
and 900 kDa. In another embodiment, the capsular polysaccharide has
a molecular weight of between 100 kDa and 800 kDa.
[0146] In further embodiments, the capsular polysaccharide has a
molecular weight of 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa
to 400 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400
kDa; 200 kDa to 600 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa;
250 kDa to 600 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa
to 350 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400
kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa; and similar desired
molecular weight ranges. Any whole number integer within any of the
above ranges is contemplated as an embodiment of the
disclosure.
[0147] A polysaccharide can become slightly reduced in size during
normal purification procedures. Additionally, as described herein,
polysaccharide can be subjected to sizing techniques before
conjugation. The molecular weight ranges mentioned above refer to
purified polysaccharides before conjugation (e.g., before
activation) after an eventual sizing step.
[0148] S. pneumoniae 39 capsular polysaccharides is O-acetylated at
two positions of terminal 3-Galf (Petersen et al., Carbohydr. Res.
2014, 395, 38-46.; Bush et al., J. Bacteriol. 2014, 196, 3271-3278)
and therefore may contain up to two O-acetyl groups per
polysaccharide repeating unit.
[0149] The degree of O-acetylation of the polysaccharide can be
determined by any method known in the art, for example, by proton
NMR (see for example Lemercinier et al. (1996) Carbohydrate
Research 296:83-96; Jones et al. (2002) J. Pharmaceutical and
Biomedical Analysis 30:1233-1247; WO 2005/033148 and WO 00/56357).
Another commonly used method is described in Hestrin, S. (1949) J.
Biol. Chem. 180:249-261. Preferably, the presence of O-acetyl
groups is determined by ion-HPLC analysis.
[0150] The presence of O-acetyl in a purified, isolated or
activated serotype 39 capsular polysaccharide or in a serotype 39
polysaccharide-carrier protein conjugate is expressed as the number
of mM of acetate per mM of repeat unit of said polysaccharide
(counting the 0-acetyl group only, i.e. excluding the N-acetyl
group of the D-GalpNAc moiety) or as the number of O-acetyl group
per polysaccharide repeating unit. In an embodiment, the isolated
serotype 39 capsular polysaccharide comprises at least 0.01, 0.1,
0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4,
1.5, 1.6, 1.7, 1.8, 1.9 or 2 O-acetyl group per polysaccharide
repeating unit of said serotype 39 capsular polysaccharide.
Preferably, the isolated serotype 39 capsular polysaccharide
comprises at least 0.01, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8,
0.9 or 1.0 O-acetyl group per polysaccharide repeating unit of said
serotype 39 capsular polysaccharide. In a preferred embodiment, the
isolated serotype 39 capsular polysaccharide comprises about 0.8
mM, about 0.9 mM or about 1 mM O-acetyl group per polysaccharide
repeating unit of said serotype 39 capsular polysaccharide.
[0151] In another embodiment, the isolated serotype 39 capsular
polysaccharide is de-O-acetylated. De-O-acetylation can be achieved
prior to conjugation for example by treatment of the polysaccharide
with mild base (e.g. 0.1MNH.sub.4OH).
[0152] In such said embodiment, the isolated serotype 39 capsular
polysaccharide comprises less than 0.01, 0.1, 0.2, 0.3, 0.4, 0.5,
0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8,
1.9 or less than 2 O-acetyl group per polysaccharide repeating unit
of said serotype 39 capsular polysaccharide. Preferably in said
embodiment, the isolated serotype 39 capsular polysaccharide
comprises less than 0.01, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8,
0.9 or less than 1.0 O-acetyl group per polysaccharide repeating
unit of said serotype 39 capsular polysaccharide. Even more
preferably, in such said embodiment, the isolated serotype 39
capsular polysaccharide comprises less than 0.01, 0.1, 0.2, 0.3,
0.4 or less than 0.5 O-acetyl group per polysaccharide repeating
unit of said serotype 39 capsular polysaccharide. In an embodiment,
the serotype 39 glycoconjugates are obtained by activating
polysaccharide with 1-cyano-4-dimethylamino pyridinium
tetrafluoroborate (CDAP) to form a cyanate ester (CDAP chemistry).
The activated polysaccharide may be coupled directly (direct CDAP
chemistry) or via a spacer (linker) group (indirect CDAP chemistry)
to an amino group on the carrier protein. For example, the spacer
could be cystamine or cysteamine to give a thiolated polysaccharide
which could be coupled to the carrier via a thioether linkage
obtained after reaction with a maleimide-activated carrier protein
(for example using GMBS) or a haloacetylated carrier protein (for
example using iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP).
Preferably, the cyanate ester (optionally made by CDAP chemistry)
is coupled with hexane diamine or adipic acid dihydrazide (ADH) and
the amino-derivatised saccharide is conjugated to the carrier
protein using carbodiimide (e.g., EDAC or EDC) chemistry via a
carboxyl group on the protein carrier. Such conjugates are
described for example in WO 93/15760, WO 95/08348 and WO
96/129094.
[0153] Other suitable techniques use carbodiimides, hydrazides,
active esters, norborane, p-nitrobenzoic acid,
N-hydroxysuccinimide, S--NHS, EDC, TSTU. Many are described in
International Patent Application Publication No. WO 98/42721.
Conjugation may involve a carbonyl linker which may be formed by
reaction of a free hydroxyl group of the saccharide with CDI (See
Bethell et al. (1979) J. Biol. Chern. 254:2572-2574; Hearn et al.
(1981) J. Chromatogr. 218:509-518) followed by reaction with a
protein to form a carbamate linkage. This may involve reduction of
the anomeric terminus to a primary hydroxyl group, optional
protection/deprotection of the primary hydroxyl group, reaction of
the primary hydroxyl group with CDI to form a CDI carbamate
intermediate and coupling the CDI carbamate intermediate with an
amino group on a protein (CDI chemistry).
[0154] In preferred embodiments, the serotype 39 glycoconjugates of
the invention are prepared using reductive amination.
[0155] In some embodiments, the glycoconjugate from S. pneumoniae
serotype 39 comprises a saccharide which has a degree of
O-acetylation of between 10 and 100%, between 20 and 100%, between
30 and 100%, between 40 and 100%, between 50 and 100%, between 60
and 100%, between 70 and 100%, between 75 and 100%, 80 and 100%, 90
and 100%, 95 and 100%, 50 and 90%, 60 and 90%, 70 and 90%, 80 and
90%, 50 and 95%, 60 and 95%, 70 and 95%, 80 and 95%, 85 and 95%, 90
and 95%, 50 and 98%, 60 and 98%, 70 and 98%, 80 and 98%, 85 and
98%, 90 and 99% or 95 and 98%. In other embodiments, the degree of
O-acetylation is 10%, .gtoreq.20%, .gtoreq.30%, .gtoreq.40%,
.gtoreq.50%, .gtoreq.60%, .gtoreq.70%, .gtoreq.80%, .gtoreq.90%, or
about 100%.
[0156] In some embodiments, the glycoconjugate from S. pneumoniae
serotype 39 is de-O-acetylated. In some said embodiments, the
glycoconjugate from S. pneumoniae serotype 39 comprise a saccharide
which has a degree of O-acetylation of between 0 and 50%, between 0
and 40%, between 0 and 30%, between 0 and 20%, between 0 and 10%,
between 0 and 5%, or between 0 and 2%. In other embodiments, the
degree of O-acetylation is .ltoreq.50%, .ltoreq.40%, 30%,
.ltoreq.20%, .ltoreq.10%, .ltoreq.5%, .ltoreq.2%, or
.ltoreq.1%.
[0157] By % of O-acetylation it is meant the percentage of a given
saccharide relative to 100% (where D-GalpNAc moiety of each repeat
unit is fully acetylated at two positions).
[0158] In some embodiments, the serotype 39 glycoconjugates of the
present invention comprise a saccharide having a molecular weight
of between 1.25 kDa and 2,000 kDa. In other such embodiments, the
saccharide has a molecular weight of between 10 kDa and 2,000 kDa.
In other such embodiments, the saccharide has a molecular weight of
between 50 kDa and 2,000 kDa. In further such embodiments, the
saccharide has a molecular weight of between 50 kDa and 1,750 kDa;
between 50 kDa and 1,500 kDa; between 50 kDa and 1,300 kDa; between
750 kDa and 1,250 kDa; between 50 kDa and 750 kDa; between 100 kDa
and 1000 kDa; between 500 kDa and 2,000 kDa; between 750 kDa and
1,750 kDa; between 1000 kDa and 1,500 kDa; between 1000 kDa and
1,250 kDa; between 200 kDa and 2,000 kDa; between 200 kDa and 1,750
kDa; between 200 kDa and 1,500 kDa; between 200 kDa and 1,250 kDa;
between 200 kDa and 1,000 kDa; between 200 kDa and 750 kDa; or
between 200 kDa and 500 kDa; between 10 kDa and 500 kDa; between 50
kDa and 250 kDa; between 50 kDa and 150 kDa or between 50 kDa and
125 kDa. In some such embodiments, the serotype 39 glycoconjugates
are prepared using reductive amination. In some such embodiments,
the serotype 39 glycoconjugates are prepared using direct or
indirect CDAP chemistry. In some such embodiments, the serotype 39
glycoconjugates are prepared using CDI chemistry.
[0159] In some embodiments, the serotype 39 glycoconjugate of the
invention has a molecular weight of between 50 kDa and 30,000 kDa.
In other embodiments, the serotype 39 glycoconjugate has a
molecular weight of between 50 kDa and 25,000 kDa. In other
embodiments, the serotype 39 glycoconjugate has a molecular weight
of between 500 kDa and 20,000 kDa. In other embodiments, the
serotype 39 glycoconjugate has a molecular weight of between 50 kDa
and 15,000 kDa. In other embodiments, the serotype 39
glycoconjugate has a molecular weight of between 500 kDa and 30,000
kDa, 500 kDa and 25,000 kDa, 500 kDa and 15,000 kDa, between 500
kDa and 10,000 kDa; between 2,000 kDa and 10,000 kDa; or between
3,000 kDa and 8,000 kDa. In other embodiments, the serotype 39
glycoconjugate has a molecular weight of between 1,000 kDa and
10,000 kDa.
[0160] In other embodiments, the serotype 39 glycoconjugate has a
molecular weight of between 1000 kDa and 8,000 kDa. In still other
embodiments, the serotype 39 glycoconjugate has a molecular weight
of between 2,000 kDa and 8,000 kDa or between 3,000 kDa and 7,000
kDa. In further embodiments, the serotype 39 glycoconjugate of the
invention has a molecular weight of between 200 kDa and 30,000 kDa;
between 200 kDa and 25,000 kDa; between 200 kDa and 20,000 kDa;
between 200 kDa and 15,000 kDa; between 200 kDa and 10,000 kDa;
between 200 kDa and 7,500 kDa; between 200 kDa and 5,000 kDa;
between 200 kDa and 3,000 kDa; between 200 kDa and 1,000 kDa;
between 500 kDa and 30,000 kDa; between 500 kDa and 25,000 kDa;
between 500 kDa and 20,000 kDa; between 500 kDa and 15,000 kDa;
between 500 kDa and 12,500 kDa; between 500 kDa and 10,000 kDa;
between 500 kDa and 7,500 kDa; between 500 kDa and 6,000 kDa;
between 500 kDa and 5,000 kDa; between 500 kDa and 4,000 kDa;
between 500 kDa and 3,000 kDa; between 500 kDa and 2,000 kDa;
between 500 kDa and 1,500 kDa; between 500 kDa and 1,000 kDa;
between 750 kDa and 30,000 kDa; between 750 kDa and 25,000 kDa;
between 750 kDa and 20,000 kDa; between 750 kDa and 15,000 kDa;
between 750 kDa and 12,500 kDa; between 750 kDa and 10,000 kDa;
between 750 kDa and 7,500 kDa; between 750 kDa and 6,000 kDa;
between 750 kDa and 5,000 kDa; between 750 kDa and 4,000 kDa;
between 750 kDa and 3,000 kDa; between 750 kDa and 2,000 kDa;
between 750 kDa and 1,500 kDa; between 1,000 kDa and 30,000 kDa;
between 1,000 kDa and 25,000 kDa; between 1,000 kDa and 20,000 kDa;
between 1,000 kDa and 15,000 kDa; between 1,000 kDa and 12,500 kDa;
between 1,000 kDa and 10,000 kDa; between 1,000 kDa and 7,500 kDa;
between 1,000 kDa and 6,000 kDa; between 1,000 kDa and 5,000 kDa;
between 1,000 kDa and 4,000 kDa; between 1,000 kDa and 2,500 kDa;
between 2,000 kDa and 30,000 kDa; between 2,000 kDa and 25,000 kDa;
between 2,000 kDa and 20,000 kDa; between 2,000 kDa and 15,000 kDa;
between 2,000 kDa and 12,500 kDa; between 2,000 kDa and 10,000 kDa;
between 2,000 kDa and 7,500 kDa; between 2,000 kDa and 6,000 kDa;
between 2,000 kDa and 5,000 kDa; between 2,000 kDa and 4,000 kDa;
or between 2,000 kDa and 3,000 kDa. In further embodiments, the
serotype 39 glycoconjugate of the invention has a molecular weight
of between 3,000 kDa and 30,000 kDa; between 3,000 kDa and 25,000
kDa; between 3,000 kDa and 20,000 kDa; between 3,000 kDa and 15,000
kDa; between 3,000 kDa and 10,000 kDa; between 3,000 kDa and 7,500
kDa; between 3,000 kDa and 5,000 kDa; between 4,000 kDa and 30,000
kDa; between 4,000 kDa and 25,000 kDa; between 4,000 kDa and 20,000
kDa; between 4,000 kDa and 15,000 kDa; between 4,000 kDa and 12,500
kDa; between 4,000 kDa and 10,000 kDa; between 4,000 kDa and 7,500
kDa; between 4,000 kDa and 6,000 kDa; or between 4,000 kDa and
5,000 kDa. In further embodiments, the serotype 39 glycoconjugate
of the invention has a molecular weight of between 5,000 kDa and
30,000 kDa; between 5,000 kDa and 25,000 kDa; between 5,000 kDa and
20,000 kDa; between 5,000 kDa and 15,000 kDa; between 5,000 kDa and
10,000 kDa or between 5,000 kDa and 7,500 kDa. In further
embodiments, the serotype 39 glycoconjugate of the invention has a
molecular weight of between 6,000 kDa and 30,000 kDa; between 6,000
kDa and 25,000 kDa; between 6,000 kDa and 20,000 kDa; between 6,000
kDa and 15,000 kDa; between 6,000 kDa and 10,000 kDa or between
6,000 kDa and 7,500 kDa. In further embodiments, the serotype 39
glycoconjugate of the invention has a molecular weight of between
7,000 kDa and 30,000 kDa; between 7,000 kDa and 25,000 kDa; between
7,000 kDa and 20,000 kDa; between 7,000 kDa and 15,000 kDa; between
7,000 kDa and 10,000 kDa or between 7,000 kDa and 8,000 kDa. In
further embodiments, the serotype 39 glycoconjugate of the
invention has a molecular weight of between 8,000 kDa and 30,000
kDa; between 8,000 kDa and 25,000 kDa; between 8,000 kDa and 20,000
kDa; between 8,000 kDa and 15,000 kDa; or between 8,000 kDa and
10,000 kDa.
[0161] Any whole number integer within any of the above ranges is
contemplated as an embodiment of the disclosure. The molecular
weight of the glycoconjugate is measured by SEC-MALLS. In an
embodiment, the serotype 39A glycoconjugate of the invention
comprises at least 0.01, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8,
0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2 O-acetyl
group per polysaccharide repeating unit of said serotype 39
polysaccharide. In a preferred embodiment, the serotype 39A
glycoconjugate of the invention comprises at least 0.01, 0.1, 0.2,
0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1.0 O-acetyl group per
polysaccharide repeating unit of said serotype 39 polysaccharide.
In a preferred embodiment, the glycoconjugate comprises at least
0.8, 0.9 or 0.95 O-acetyl group per polysaccharide repeating unit
of serotype 39 polysaccharide. In a preferred embodiment, the
glycoconjugate comprises at least 0.8 O-acetyl group per
polysaccharide repeating unit of serotype 39 polysaccharide. In a
preferred embodiment, the glycoconjugate comprises at least 0.9
O-acetyl group per polysaccharide repeating unit of serotype 39
polysaccharide.
[0162] In another embodiment, the isolated serotype 39 capsular
polysaccharide is de-Oacetylated. De-Oacetylation can be achieved
prior to conjugation for example by treatment of the polysaccharide
with mild base (e.g. 0.1MNH.sub.4OH).
[0163] In some embodiments, the glycoconjugate from S. pneumoniae
serotype 39 is de-O-acetylated. In some said embodiments, the
glycoconjugate from S. pneumoniae serotype 39 comprise less than
0.01, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2,
1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or less than 2 O-acetyl group per
polysaccharide repeating unit of said serotype 39 capsular
polysaccharide. Preferably, in some said embodiments, the
glycoconjugate from S. pneumoniae serotype 39 comprise less than
0.01, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or less than 1.0
O-acetyl group per polysaccharide repeating unit of said serotype
39 capsular polysaccharide. Even more preferably, in such said
embodiment, the glycoconjugate comprises less than 0.01, 0.1, 0.2,
0.3, 0.4 or less than 0.5 O-acetyl group per polysaccharide
repeating unit of serotype 39 capsular polysaccharide.
[0164] Another way to characterize the serotype 39 glycoconjugates
of the invention is by the number of lysine residues in the carrier
protein (e.g., CRM.sub.197) that become conjugated to the
saccharide which can be characterized as a range of conjugated
lysines (degree of conjugation). The evidence for lysine
modification of the carrier protein, due to covalent linkages to
the polysaccharides, can be obtained by amino acid analysis using
routine methods known to those of skill in the art. Conjugation
results in a reduction in the number of lysine residues recovered
compared to the CRM.sub.197 protein starting material used to
generate the conjugate materials.
[0165] In a preferred embodiment, the degree of conjugation of the
serotype 39 glycoconjugate is between 2 and 19, between 2 and 17, 2
and 15, between 2 and 13, between 2 and 10, between 2 and 8,
between 2 and 6, between 2 and 5, between 2 and 4, between 3 and
19, between 3 and 17, between 3 and 15, between 3 and 13, between 3
and 10, between 3 and 8, between 3 and 6, between 3 and 5, between
3 and 4, between 5 and 19, between 5 and 17, between 5 and 15,
between 5 an 10, between 8 and 19, between 8 and 17, between 8 and
15, between 8 and 12, between 10 and 19, between 10 and 17, between
10 and 15, between 10 and 12, between 12 and 19, between 12 and 17
or between 12 and 15. In a preferred embodiment, the degree of
conjugation of the serotype 39 glycoconjugate is between 3 and 6.
In a preferred embodiment, the carrier protein is CRM.sub.197. In
another preferred embodiment, the carrier protein is TT.
[0166] The serotype 39 glycoconjugates of the invention may also be
characterized by the ratio (weight/weight) of saccharide to carrier
protein. In some embodiments, the saccharide to carrier protein
ratio (w/w) is between 0.5 and 3.0 (e.g., about 0.5, about 0.6,
about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2,
about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8,
about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4,
about 2.5, about 2.6, about 2.7, about 2.8, about 2.9 or about
3.0). In a preferred embodiment, the ratio of serotype 39
saccharide to carrier protein in the conjugate is between 0.5 and
2.0, 0.5 and 1.5, 0.5 and 1.0, 1.0 and 1.5 or 1.0 and 2.0. In a
preferred embodiment, the ratio of serotype 39 polysaccharide to
carrier protein in the conjugate is between 0.4 and 0.9. In a
preferred embodiment, the ratio of serotype 39 capsular
polysaccharide to carrier protein in the conjugate is between 0.4
and 0.8 (e.g., about 0.4, about 0.5 about 0.6, about 0.7, or about
0.8). In some such embodiments, the carrier protein is
CRM.sub.197.
[0167] The serotype 39 glycoconjugates and immunogenic compositions
of the invention may contain free saccharide that is not covalently
conjugated to the carrier protein, but is nevertheless present in
the glycoconjugate composition. The free saccharide may be
noncovalently associated with (i.e., noncovalently bound to,
adsorbed to, or entrapped in or with) the glycoconjugate.
[0168] In some embodiments, the serotype 39 glycoconjugates of the
invention comprise less than about 50% free saccharide, less than
about 45% free saccharide, less than about 40% free saccharide,
less than about 35% free saccharide, less than about 30% free
saccharide, less than about 25% free saccharide, less than about
20% free saccharide, less than about 15% free saccharide, less than
about 10% free saccharide, or less than about 5% free saccharide
relative to the total amount of 39 saccharide. Preferably, serotype
39 the glycoconjugate comprises less than 15% free saccharide, more
preferably less than 10% free saccharide, and still more
preferably, less than 5% of free saccharide.
[0169] The serotype 39 glycoconjugates may also be characterized by
their molecular size distribution (K.sub.d). Size exclusion
chromatography media (CL-4B) can be used to determine the relative
molecular size distribution of the conjugate, as mentioned
above.
[0170] In a preferred embodiment, at least 30% of the serotype 39
glycoconjugates of the invention have a K.sub.d below or equal to
0.3 in a CL-4B column. In a preferred embodiment, at least 40% of
the serotype 39 glycoconjugates of the invention have a K.sub.d
below or equal to 0.3 in a CL-4B column. In a preferred embodiment,
at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the
serotype 39 glycoconjugates of the invention have a K.sub.d below
or equal to 0.3 in a CL-4B column. In a preferred embodiment, at
least 60% of the serotype 39 glycoconjugates have a K.sub.d below
or equal to 0.3 in a CL-4B column. In a preferred embodiment,
between 50% and 80% of the serotype 39 glycoconjugates of the
invention have a K.sub.d below or equal to 0.3 in a CL-4B
column.
[0171] 1.4 Combination of Glycoconjugates of the Invention
[0172] In an embodiment the immunogenic composition of the
invention comprises any of the glycoconjugates disclosed
herein.
[0173] 1.4.1 Combinations of Glycoconjugates
[0174] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate from S. pneumoniae
serotype 39.
[0175] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the two
following S. pneumoniae serotypes: 39 and 4, 39 and 6B, 39 and 14,
39 and 18C, 39 and 19F or 39 and 23F.
[0176] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the
eighth following S. pneumoniae serotypes: 39, 4, 6B, 9V, 14, 18C,
19F and 23F.
[0177] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the nine
following S. pneumoniae serotypes: 39, 9V, 1, 4, 6B, 14, 18C, 19F
and 23F; 39, 9V, 4, 5, 6B, 14, 18C, 19F, and 23F; 39, 9V, 4, 6B7F,
14, 18C, 19F, and 23F.
[0178] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the
eleven following S. pneumoniae serotypes: 39, 1, 5, 4, 6B, 7F, 9V,
14, 18C, 19F and 23F.
[0179] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the
twelve following S. pneumoniae serotypes: 39, 1, 4, 5, 6A, 6B, 7F,
9V, 14, 18C, 19F and 23F; 39, 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19A,
19F and 23F.
[0180] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the
thirteen following S. pneumoniae serotypes: 39, 1, 4, 5, 6A, 6B,
7F, 9V, 14, 18C, 19A, 19F and 23F.
[0181] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the
fourteen following S. pneumoniae serotypes: 39, 1, 3, 4, 5, 6A, 6B,
7F, 9V, 14, 18C, 19A, 19F, and 23F.
[0182] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate from S. pneumoniae
serotype 10A.
[0183] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the two
following S. pneumoniae serotypes: 10A and 4, 10A and 6B, 10A and
14, 10A and 18C, 10A and 19F or 10A and 23F.
[0184] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the
eighth following S. pneumoniae serotypes: 10A, 4, 6B, 9V, 14, 18C,
19F and 23F.
[0185] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the nine
following S. pneumoniae serotypes: 10A, 9V, 1, 4, 6B, 14, 18C, 19F
and 23F; 10A, 9V, 4, 5, 6B, 14, 18C, 19F, and 23F; 10A, 9V, 4,
6B7F, 14, 18C, 19F, and 23F.
[0186] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the
eleven following S. pneumoniae serotypes: 10A, 1, 5, 4, 6B, 7F, 9V,
14, 18C, 19F and 23F.
[0187] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the
twelve following S. pneumoniae serotypes: 10A, 1, 4, 5, 6A, 6B, 7F,
9V, 14, 18C, 19F and 23F; 10A, 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19A,
19F and 23F.
[0188] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the
thirteen following S. pneumoniae serotypes: 10A, 1, 4, 5, 6A, 6B,
7F, 9V, 14, 18C, 19A, 19F and 23F.
[0189] In an embodiment the immunogenic composition of the
invention comprises at least one glycoconjugate of each of the
thirteen following S. pneumoniae serotypes: 10A, 1, 3, 4, 5, 6A,
6B, 7F, 9V, 14, 18C, 19A, 19F and 23F. 1.4.2 Additional
combinations of glycoconjugates. In an embodiment any of the
immunogenic composition defined at 1.4.1 above comprises in
addition at least one glycoconjugate of S. pneumoniae serotype
15B.
[0190] In an embodiment any of the immunogenic composition defined
at 1.4.1 above comprises in addition at least one glycoconjugate of
S. pneumoniae serotype 22F.
[0191] In an embodiment any of the immunogenic composition defined
at 1.4.1 above comprises in addition at least one glycoconjugate of
S. pneumoniae serotype 33F.
[0192] In an embodiment any of the immunogenic composition defined
at 1.4.1 above comprises in addition at least one glycoconjugate of
S. pneumoniae serotype 8.
[0193] In an embodiment any of the immunogenic composition defined
at 1.4.1 above comprises (if not present) in addition at least one
glycoconjugate of S. pneumoniae serotype 10A.
[0194] In an embodiment any of the immunogenic composition defined
at 1.4.1 above comprises in addition at least one glycoconjugate of
S. pneumoniae serotype 11A.
[0195] In an embodiment any of the immunogenic composition defined
at 1.4.1 above comprises in addition at least one glycoconjugate of
S. pneumoniae serotype 12F.
[0196] In an embodiment any of the immunogenic composition defined
at 1.4.1 above comprises in addition at least one glycoconjugate of
each of the two following S. pneumoniae serotypes:
[0197] 15B and 22F,
[0198] 15B and 33F,
[0199] 15B and 12F,
[0200] 15B and 10A,
[0201] 15B and 11A,
[0202] 15B and 8,
[0203] 22F and 33F,
[0204] 22F and 12F,
[0205] 22F and 10A,
[0206] 22F and 11A,
[0207] 22F and 8,
[0208] 33F and 12F,
[0209] 33F and 10A,
[0210] 33F and 11A,
[0211] 33F and 8,
[0212] 12F and 10A,
[0213] 12F and 11A,
[0214] 12F and 8,
[0215] 10A and 11A,
[0216] 10A and 8, or
[0217] 11A and 8.
[0218] In an embodiment any of the immunogenic composition defined
at 1.4.1 above comprises in addition at least one glycoconjugate of
each of the three following S. pneumoniae serotypes:
[0219] 15B and 22F and 33F,
[0220] 15B and 22F and 12F,
[0221] 15B and 22F and 10A,
[0222] 15B and 22F and 11A,
[0223] 15B and 22F and 8,
[0224] 15B and 33F and 12F,
[0225] 15B and 33F and 11A,
[0226] 15B and 33F and A,
[0227] 15B and 33F and 8,
[0228] 15B and 12F and 10A,
[0229] 15B and 12F and 11A,
[0230] 15B and 12F and 8,
[0231] 15B and 10A and 11A,
[0232] 15B and 10A and 8,
[0233] 15B and 11A and 8,
[0234] 22F and 33F and 12F,
[0235] 22F and 33F and 10A,
[0236] 22F and 33F and 11A,
[0237] 22F and 33F and 8,
[0238] 22F and 12F and 10A,
[0239] 22F and 12F and 11A,
[0240] 22F and 12F and 8,
[0241] 22F and 10A and 11A,
[0242] 22F and 10A and 8,
[0243] 22F and 11A and 8,
[0244] 33F and 12F and 10A,
[0245] 33F and 12F and 11A,
[0246] 33F and 12F and 8,
[0247] 33F and 10A and 11A,
[0248] 33F and 10A and 8,
[0249] 33F and 11A and 8,
[0250] 12F and 10A and 11A,
[0251] 12F and 10A and 8,
[0252] 12F and 11A and 8, or
[0253] 10A and 11A and 8.
[0254] In an embodiment any of the immunogenic composition defined
at 1.4.1 above comprises in addition at least one glycoconjugate of
each of the four following S. pneumoniae serotypes:
[0255] 15B and 22F and 33F and 12F,
[0256] 15B and 22F and 33F and 10A,
[0257] 15B and 22F and 33F and 11A,
[0258] 15B and 22F and 33F and 8,
[0259] 15B and 22F and 12F and 10A,
[0260] 15B and 22F and 12F and 11A,
[0261] 15B and 22F and 12F and 8,
[0262] 15B and 22F and 10A and 11A,
[0263] 15B and 22F and 10A and 8,
[0264] 15B and 22F and 11A and 8,
[0265] 15B and 33F and 12F and 10A,
[0266] 15B and 33F and 12F and 11A,
[0267] 15B and 33F and 12F and 8,
[0268] 15B and 33F and 10A and 11A,
[0269] 15B and 33F and 10A and 8,
[0270] 15B and 33F and 11A and 8,
[0271] 15B and 12F and 10A and 11A,
[0272] 15B and 12F and 10A and 8,
[0273] 15B and 12F and 11A and 8,
[0274] 15B and 10A and 11A and 8,
[0275] 22F and 33F and 12F and 10A,
[0276] 22F and 33F and 12F and 11A,
[0277] 22F and 33F and 12F and 8,
[0278] 22F and 33F and 10A and 11A,
[0279] 22F and 33F and 10A and 8,
[0280] 22F and 33F and 11A and 8,
[0281] 22F and 12F and 10A and 11A,
[0282] 22F and 12F and 10A and 8,
[0283] 22F and 12F and 11A and 8,
[0284] 22F and 10A and 11A and 8,
[0285] 33F and 12F and 10A and 11A,
[0286] 33F and 12F and 10A and 8,
[0287] 33F and 12F and 11A and 8,
[0288] 33F and 10A and 11A and 8 or
[0289] 12F and 10A and 11A and 8.
[0290] In an embodiment any of the immunogenic composition defined
at 1.4.1 above comprises in addition at least one glycoconjugate of
each of the five following S. pneumoniae serotypes:
[0291] 15B and 22F and 33F and 12F and 10A,
[0292] 15B and 22F and 33F and 12F and 11A,
[0293] 15B and 22F and 33F and 12F and 8,
[0294] 15B and 22F and 33F and 10A and 11A,
[0295] 15B and 22F and 33F and 10A and 8,
[0296] 15B and 22F and 33F and 11A and 8,
[0297] 15B and 22F and 12F and 10A and 11A,
[0298] 15B and 22F and 12F and 10A and 8,
[0299] 15B and 22F and 12F and 11A and 8,
[0300] 15B and 22F and 10A and 11A and 8,
[0301] 15B and 33F and 12F and 10A and 11A,
[0302] 15B and 33F and 12F and 10A and 8,
[0303] 15B and 33F and 12F and 11A and 8,
[0304] 15B and 33F and 10A and 11A and 8,
[0305] 15B and 12F and 10A and 11A and 8,
[0306] 22F and 33F and 12F and 10A and 11A,
[0307] 22F and 33F and 12F and 10A and 8,
[0308] 22F and 33F and 12F and 11A and 8,
[0309] 22F and 33F and 10A and 11A and 8,
[0310] 22F and 12F and 10A and 11A and 8 or
[0311] 33F and 12F and 10A and 11A and 8.
[0312] In an embodiment any of the immunogenic composition defined
at 1.4.1 above comprises in addition at least one glycoconjugate of
each of the six following S. pneumoniae serotypes:
[0313] 15B and 22F and 33F and 12F and 10A and 11A,
[0314] 15B and 22F and 33F and 12F and 10A and 8,
[0315] 15B and 22F and 33F and 12F and 1A and 8,
[0316] 15B and 22F and 33F and 10A and 11A and 8,
[0317] 15B and 22F and 12F and 10A and 11A and 8,
[0318] 15B and 33F and 12F and 10A and 11A and 8 or
[0319] 22F and 33F and 12F and 10A and 11A and 8.
[0320] In an embodiment any of the immunogenic composition defined
at 1.4.1 above comprises in addition at least one glycoconjugate of
each of the seven following S. pneumoniae serotypes: 15B and 22F
and 33F and 12F and 10A and 11A and 8.
[0321] In an embodiment any of the immunogenic composition above
comprises in addition glycoconjugates from S. pneumoniae serotype
2.
[0322] In an embodiment any of the immunogenic composition above
comprises in addition glycoconjugates from S. pneumoniae serotype
17F.
[0323] In an embodiment any of the immunogenic composition above
comprises in addition glycoconjugates from S. pneumoniae serotype
20.
[0324] In an embodiment any of the immunogenic composition above
comprises in addition glycoconjugates from S. pneumoniae serotype
15C.
[0325] In an embodiment any of the immunogenic composition above
comprises in addition glycoconjugates from S. pneumoniae serotype
9N.
[0326] Preferably, all the glycoconjugates of the above immunogenic
composition are individually conjugated to the carrier protein.
[0327] In an embodiment of any of the above immunogenic
composition, the glycoconjugates from S. pneumoniae serotype 39 is
conjugated to CRM.sub.197. In an embodiment of any of the above
immunogenic compositions, the glycoconjugates from S. pneumoniae
serotype 22F is conjugated to CRM.sub.197. In an embodiment of any
of the above immunogenic composition, the glycoconjugates from S.
pneumoniae serotype 33F is conjugated to CRM.sub.197. In an
embodiment of any of the above immunogenic composition, the
glycoconjugates from S. pneumoniae serotype 15B is conjugated to
CRM.sub.197. In an embodiment of any of the above immunogenic
composition, the glycoconjugates from S. pneumoniae serotype 12F is
conjugated to CRM.sub.197. In an embodiment of any of the above
immunogenic composition, the glycoconjugates from S. pneumoniae
serotype 10A is conjugated to CRM.sub.197. In an embodiment of any
of the above immunogenic composition, the glycoconjugates from S.
pneumoniae serotype 11A is conjugated to CRM.sub.197. In an
embodiment of any of the above immunogenic composition, the
glycoconjugates from S. pneumoniae serotype 8 is conjugated to
CRM.sub.197. In an embodiment of any of the above immunogenic
composition, the glycoconjugates from S. pneumoniae serotypes 4,
6B, 9V, 14, 18C, 19F and 23F are conjugated to CRM.sub.197. In an
embodiment of any of the above immunogenic composition, the
glycoconjugates from S. pneumoniae serotypes 1, 5 and 7F are
conjugated to CRM.sub.197. In an embodiment of any of the above
immunogenic composition, the glycoconjugates from S. pneumoniae
serotypes 6A and 19A are conjugated to CRM.sub.197. In an
embodiment of any of the above immunogenic composition, the
glycoconjugates from S. pneumoniae serotype 3 is conjugated to
CRM.sub.197. In an embodiment of any of the above immunogenic
compositions, the glycoconjugates from S. pneumoniae serotype 2 is
conjugated to CRM.sub.197. In an embodiment of any of the above
immunogenic compositions, the glycoconjugates from S. pneumoniae
serotype 17F is conjugated to CRM.sub.197. In an embodiment of any
of the above immunogenic compositions, the glycoconjugates from S.
pneumoniae serotype 20 is conjugated to CRM.sub.197. In an
embodiment of any of the above immunogenic compositions, the
glycoconjugates from S. pneumoniae serotype 15C is conjugated to
CRM.sub.197. In an embodiment of any of the above immunogenic
compositions, the glycoconjugates from S. pneumoniae serotype 9N is
conjugated to CRM.sub.197.
[0328] In an embodiment, the glycoconjugates of the above
immunogenic compositions are all individually conjugated to
CRM.sub.197.
[0329] In an embodiment, the glycoconjugate from S. pneumoniae
serotype 39 of any of the above immunogenic composition is
individually conjugated to PD.
[0330] In an embodiment, the glycoconjugates from S. pneumoniae
serotypes 1, 4, 5, 6B, 7F, 9V, 14 and/or 23F of any of the above
immunogenic compositions are individually conjugated to PD.
[0331] In an embodiment, the glycoconjugate from S. pneumoniae
serotype 18C of any of the above immunogenic compositions is
conjugated to TT.
[0332] In an embodiment, the glycoconjugate from S. pneumoniae
serotype 19F of any of the above immunogenic compositions is
conjugated to DT.
[0333] In an embodiment, the glycoconjugates from S. pneumoniae
serotypes 1, 4, 5, 6B, 7F, 9V, 14 and/or 23F of any of the above
immunogenic compositions are individually conjugated to PD, the
glycoconjugate from S. pneumoniae serotype 18C is conjugated to TT
and the glycoconjugate from S. pneumoniae serotype 19F is
conjugated to DT.
[0334] In an embodiment the above immunogenic composition comprises
from 7 to 26 different serotypes of S. pneumoniae. In one
embodiment the above immunogenic composition comprises
glycoconjugates from 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25 or 26 different serotypes.
[0335] In an embodiment the above immunogenic composition comprises
from 7 to 20 different serotypes of S. pneumoniae. In one
embodiment the above immunogenic composition comprises
glycoconjugates from 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19 or 20 different serotypes. In one embodiment the above
immunogenic composition comprises glycoconjugates from 16 or 20
different serotypes.
[0336] Preferably, all the glycoconjugates of the immunogenic
composition of the invention are individually conjugated to the
carrier protein. In an embodiment, the glycoconjugates of the
immunogenic composition above are individually conjugated to
CRM.sub.197.
[0337] Preferably, any of the immunogenic compositions defined at
1.4.1 or 1.4.2 above that comprise at least one glycoconjugate of
S. pneumoniae serotype 10A do not comprise capsular saccharide from
S. pneumoniae serotype 39. Therefore, preferably, any of the
immunogenic compositions defined at 1.4.1 or 1.4.2 above that
comprise at least one glycoconjugate of S. pneumoniae serotype 10A
do not comprise glycoconjugate of S. pneumoniae serotype 39.
[0338] Preferably, any of the immunogenic compositions defined at
1.4.1 or 1.4.2 above that comprise at least one glycoconjugate of
S. pneumoniae serotype 39 do not comprise capsular saccharide from
S. pneumoniae serotype 10A. Therefore, preferably, any of the
immunogenic compositions defined at 1.4.1 or 1.4.2 above that
comprise at least one glycoconjugate of S. pneumoniae serotype 39
do not comprise glycoconjugate of S. pneumoniae serotype 10A.
[0339] After conjugation of the capsular polysaccharide to the
carrier protein, the glycoconjugates are purified (enriched with
respect to the amount of polysaccharide-protein conjugate) by a
variety of techniques. These techniques include
concentration/diafiltration operations, precipitation/elution,
column chromatography, and depth filtration. See, e.g., U.S. Appl.
Publication No. 2007/0184072 and WO 2008/079653. After the
individual glycoconjugates are purified, they are compounded to
formulate the immunogenic composition of the present invention.
2 DOSAGE OF THE IMMUNOGENIC COMPOSITIONS
[0340] 2.1 Polysaccharide Amount
[0341] The amount of glycoconjugate(s) in each dose is selected as
an amount which induces an immunoprotective response without
significant, adverse side effects in typical vaccines.
[0342] Such amount will vary depending upon which specific
immunogen is employed and how it is presented.
[0343] The amount of a particular glycoconjugate in an immunogenic
composition can be calculated based on total polysaccharide for
that conjugate (conjugated and non-conjugated). For example, a
glycoconjugate with 20% free polysaccharide will have about 80
.mu.g of conjugated polysaccharide and about 20 .mu.g of
non-conjugated polysaccharide in a 100 .mu.g polysaccharide dose.
The amount of glycoconjugate can vary depending upon the
streptococcal serotype. The saccharide concentration can be
determined by the uronic acid assay.
[0344] The "immunogenic amount" of the different polysaccharide
components in the immunogenic composition, may diverge and each may
comprise about 1.0 .mu.g, about 2.0 .mu.g, about 3.0 .mu.g, about
4.0 .mu.g, about 5.0 .mu.g, about 6.0 .mu.g, about 7.0 .mu.g, about
8.0 .mu.g, about 9.0 .mu.g, about 10.0 .mu.g, about 15.0 .mu.g,
about 20.0 .mu.g, about 30.0 .mu.g, about 40.0 .mu.g, about 50.0
.mu.g, about 60.0 .mu.g, about 70.0 .mu.g, about 80.0 .mu.g, about
90.0 .mu.g, or about 100.0 .mu.g of any particular polysaccharide
antigen.
[0345] Generally, each dose will comprise 0.1 .mu.g to 100 .mu.g of
polysaccharide for a given serotype, particularly 0.5 .mu.g to 20
.mu.g, more particularly 1 .mu.g to 10 .mu.g, and even more
particularly 2 .mu.g to 5 .mu.g. Any whole number integer within
any of the above ranges is contemplated as an embodiment of the
disclosure.
[0346] In an embodiment, each dose will comprise 1 .mu.g, 2 .mu.g,
3 .mu.g, 4 .mu.g, 5 .mu.g, 6 .mu.g, 7 .mu.g, 8 .mu.g, 9 .mu.g, 10
.mu.g, 15 .mu.g or 20 .mu.g of polysaccharide for a given
serotype.
[0347] 2.2 Carrier Amount
[0348] Generally, each dose will comprise 5 .mu.g to 150 .mu.g of
carrier protein, particularly 10 .mu.g to 100 .mu.g of carrier
protein, more particularly 15 .mu.g to 100 .mu.g of carrier
protein, more particularly 25 to 75 .mu.g of carrier protein, more
particularly 30 .mu.g to 70 .mu.g of carrier protein, more
particularly to 60 .mu.g of carrier protein, more particularly 30
.mu.g to 50 .mu.g of carrier protein and even more particularly 40
to 60 .mu.g of carrier protein. In an embodiment, said carrier
protein is CRM.sub.197.
[0349] In an embodiment, each dose will comprise about 25 .mu.g,
about 26 .mu.g, about 27 .mu.g, about 28 .mu.g, about 29 .mu.g,
about 30 .mu.g, about 31 .mu.g, about 32 .mu.g, about 33 .mu.g,
about 34 .mu.g, about .mu.g, about 36 .mu.g, about 37 .mu.g, about
38 .mu.g, about 39 .mu.g, about 40 .mu.g, about 41 .mu.g, about 42
.mu.g, about 43 .mu.g, about 44 .mu.g, about 45 .mu.g, about 46
.mu.g, about 47 .mu.g, about 48 .mu.g, about 49 .mu.g, about 50
.mu.g, about 51 .mu.g, about 52 .mu.g, about 53 .mu.g, about 54
.mu.g, about 55 .mu.g, about 56 .mu.g, about 57 .mu.g, about 58
.mu.g, about 59 .mu.g, about 60 .mu.g, about 61 .mu.g, about 62
.mu.g, about 63 .mu.g, about 64 .mu.g, about 65 .mu.g, about 66
.mu.g, about 67 .mu.g, 68 .mu.g, about 69 .mu.g, about 70 .mu.g,
about 71 .mu.g, about 72 .mu.g, about 73 .mu.g, about 74 .mu.g or
about 75 .mu.g of carrier protein. In an embodiment, said carrier
protein is CRM.sub.197.
3 FURTHER ANTIGENS
[0350] Immunogenic compositions of the invention comprise
conjugated S. pneumoniae saccharide antigens (glycoconjugates).
They may also further include antigens from other pathogens,
particularly from bacteria and/or viruses. Preferred further
antigens are selected from: a diphtheria toxoid (D), a tetanus
toxoid (T), a pertussis antigen (P), which is typically acellular
(Pa), a hepatitis B virus (HBV) surface antigen (HBsAg), a
hepatitis A virus (HAV) antigen, a conjugated Haemophilus
influenzae type b capsular saccharide (Hib), inactivated poliovirus
vaccine (IPV).
[0351] In an embodiment, the immunogenic compositions of the
invention comprise D-T-Pa. In an embodiment, the immunogenic
compositions of the invention comprise D-T-Pa-Hib, D-T-Pa-IPV or
D-T-Pa-HBsAg. In an embodiment, the immunogenic compositions of the
invention comprise D-T-Pa-HBsAg-IPV or D-T-Pa-HBsAg-Hib. In an
embodiment, the immunogenic compositions of the invention comprise
D-T-Pa-HBsAg-IPV-Hib.
[0352] Pertussis antigens: Bordetella pertussis causes whooping
cough. Pertussis antigens in vaccines are either cellular (whole
cell, in the form of inactivated B. pertussis cells) or acellular.
Preparation of cellular pertussis antigens is well documented
(e.g., it may be obtained by heat inactivation of phase I culture
of B. pertussis). Preferably, however, the invention uses acellular
antigens. Where acellular antigens are used, it is preferred to use
one, two or (preferably) three of the following antigens: (1)
detoxified pertussis toxin (pertussis toxoid, or PT); (2)
filamentous hemagglutinin (FHA); (3) pertactin (also known as the
69 kiloDalton outer membrane protein). FHA and pertactin may be
treated with formaldehyde prior to use according to the invention.
PT is preferably detoxified by treatment with formaldehyde and/or
glutaraldehyde. Acellular pertussis antigens are preferably
adsorbed onto one or more aluminum salt adjuvants. As an
alternative, they may be added in an unadsorbed state. Where
pertactin is added then it is preferably already adsorbed onto an
aluminum hydroxide adjuvant. PT and FHA may be adsorbed onto an
aluminum hydroxide adjuvant or an aluminum phosphate. Adsorption of
all of PT, FHA and pertactin to aluminum hydroxide is most
preferred.
[0353] Inactivated poliovirus vaccine: Poliovirus causes
poliomyelitis. Rather than use oral poliovirus vaccine, preferred
embodiments of the invention use IPV. Prior to administration to
patients, polioviruses must be inactivated, and this can be
achieved by treatment with formaldehyde. Poliomyelitis can be
caused by one of three types of poliovirus. The three types are
similar and cause identical symptoms, but they are antigenically
different and infection by one type does not protect against
infection by others. It is therefore preferred to use three
poliovirus antigens in the invention: poliovirus Type 1 (e.g.,
Mahoney strain), poliovirus Type 2 (e.g., MEF-1 strain), and
poliovirus Type 3 (e.g., Saukett strain). The viruses are
preferably grown, purified and inactivated individually, and are
then combined to give a bulk trivalent mixture for use with the
invention.
[0354] Diphtheria toxoid: Corynebacterium diphtheriae causes
diphtheria. Diphtheria toxin can be treated (e.g., using formalin
or formaldehyde) to remove toxicity while retaining the ability to
induce specific anti-toxin antibodies after injection. These
diphtheria toxoids are used in diphtheria vaccines. Preferred
diphtheria toxoids are those prepared by formaldehyde treatment.
The diphtheria toxoid can be obtained by growing C. diphtheriae in
growth medium, followed by formaldehyde treatment, ultrafiltration
and precipitation. The toxoided material may then be treated by a
process comprising sterile filtration and/or dialysis. The
diphtheria toxoid is preferably adsorbed onto an aluminum hydroxide
adjuvant.
[0355] Tetanus toxoid: Clostridium tetani causes tetanus. Tetanus
toxin can be treated to give a protective toxoid. The toxoids are
used in tetanus vaccines. Preferred tetanus toxoids are those
prepared by formaldehyde treatment. The tetanus toxoid can be
obtained by growing C. tetani in growth medium, followed by
formaldehyde treatment, ultrafiltration and precipitation. The
material may then be treated by a process comprising sterile
filtration and/or dialysis.
[0356] Hepatitis A virus antigens: Hepatitis A virus (HAV) is one
of the known agents which causes viral hepatitis. A preferred HAV
component is based on inactivated virus, and inactivation can be
achieved by formalin treatment.
[0357] Hepatitis B virus (HBV) is one of the known agents which
causes viral hepatitis. The major component of the capsid is a
protein known as HBV surface antigen or, more commonly, HBsAg,
which is typically a 226-amino acid polypeptide with a molecular
weight of .about.24 kDa. All existing hepatitis B vaccines contain
HBsAg, and when this antigen is administered to a normal vaccine it
stimulates the production of anti-HBsAg antibodies which protect
against HBV infection.
[0358] For vaccine manufacture, HBsAg has been made in two ways:
purification of the antigen in particulate form from the plasma of
chronic hepatitis B carriers or expression of the protein by
recombinant DNA methods (e.g., recombinant expression in yeast
cells). Unlike native HBsAg (i.e., as in the plasma-purified
product), yeast-expressed HBsAg is generally non-glycosylated, and
this is the most preferred form of HBsAg for use with the
invention.
[0359] Conjugated Haemophilus influenzae type b antigens:
Haemophilus influenzae type b (Hib) causes bacterial meningitis.
Hib vaccines are typically based on the capsular saccharide
antigen, the preparation of which is well documented. The Hib
saccharide can be conjugated to a carrier protein in order to
enhance its immunogenicity, especially in children. Typical carrier
proteins are tetanus toxoid, diphtheria toxoid, CRM.sub.197, H.
influenzae protein D, and an outer membrane protein complex from
serogroup B meningococcus. The saccharide moiety of the conjugate
may comprise full-length polyribosylribitol phosphate (PRP) as
prepared from Hib bacteria, and/or fragments of full-length PRP.
Hib conjugates may or may not be adsorbed to an aluminum salt
adjuvant.
[0360] In an embodiment the immunogenic compositions of the
invention further include a conjugated N. meningitidis serogroup Y
capsular saccharide (MenY), and/or a conjugated N. meningitidis
serogroup C capsular saccharide (MenC).
[0361] In an embodiment the immunogenic compositions of the
invention further include a conjugated N. meningitidis serogroup A
capsular saccharide (MenA), a conjugated N. meningitidis serogroup
W135 capsular saccharide (MenW135), a conjugated N. meningitidis
serogroup Y capsular saccharide (MenY), and/or a conjugated N.
meningitidis serogroup C capsular saccharide (MenC).
[0362] In an embodiment the immunogenic compositions of the
invention further include a conjugated N. meningitidis serogroup
W135 capsular saccharide (MenW135), a conjugated N. meningitidis
serogroup Y capsular saccharide (MenY), and/or a conjugated N.
meningitidis serogroup C capsular saccharide (MenC).
4 ADJUVANT(S)
[0363] In some embodiments, the immunogenic compositions disclosed
herein may further comprise at least one adjuvant (e.g., one, two
or three adjuvants). The term "adjuvant" refers to a compound or
mixture that enhances the immune response to an antigen. Antigens
may act primarily as a delivery system, primarily as an immune
modulator or have strong features of both. Suitable adjuvants
include those suitable for use in mammals, including humans.
Examples of known suitable delivery-system type adjuvants that can
be used in humans include, but are not limited to, alum (e.g.,
aluminum phosphate, aluminum sulfate or aluminum hydroxide),
calcium phosphate, liposomes, oil-in-water emulsions such as MF59
(4.3% w/v squalene, 0.5% w/v polysorbate 80 (Tween 80), 0.5% w/v
sorbitan trioleate (Span 85)), water-in-oil emulsions such as
Montanide, and poly(D,L-actide-co-glycolide) (PLG) microparticles
or nanoparticles.
[0364] In an embodiment, the immunogenic compositions disclosed
herein comprise aluminum salts (alum) as adjuvant (e.g., aluminum
phosphate, aluminum sulfate or aluminum hydroxide). In a preferred
embodiment, the immunogenic compositions disclosed herein comprise
aluminum phosphate or aluminum hydroxide as adjuvant. In an
embodiment, the immunogenic compositions disclosed herein comprise
from 0.1 mg/mL to 1 mg/mL or from 0.2 mg/mL to 0.3 mg/ml of
elemental aluminum in the form of aluminum phosphate. In an
embodiment, the immunogenic compositions disclosed herein comprise
about 0.25 mg/mL of elemental aluminum in the form of aluminum
phosphate.
[0365] Examples of known suitable immune modulatory type adjuvants
that can be used in humans include, but are not limited to, saponin
extracts from the bark of the Aquilla tree (QS21, Quil A), TLR4
agonists such as MPL (Monophosphoryl Lipid A), 3DMPL
(3-O-deacylated MPL) or GLA-AQ, LT/CT mutants, cytokines such as
the various interleukins (e.g., IL-2, IL-12) or GM-CSF, and the
like.
[0366] Examples of known suitable immune modulatory type adjuvants
with both delivery and immune modulatory features that can be used
in humans include, but are not limited to ISCOMS (see, e.g.,
Sjolander et al. (1998) J. Leukocyte Biol. 64:713; WO 90/03184, WO
96/11711, WO 00/48630, WO 98/36772, WO 00/41720, WO 2006/134423 and
WO 2007/026190) or GLA-EM which is a combination of a TLR4 agonist
and an oil-in-water emulsion.
[0367] For veterinary applications including but not limited to
animal experimentation, one can use Complete Freund's Adjuvant
(CFA), Freund's Incomplete Adjuvant (IFA), Emulsigen,
N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP),
N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred
to as nor-MDP),
N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dip-
almitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 19835A,
referred to as MTP-PE), and RIBI, which contains three components
extracted from bacteria, monophosphoryl lipid A, trehalose
dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2%
squalene/Tween 80 emulsion.
[0368] Further exemplary adjuvants to enhance effectiveness of the
pneumococcal vaccines as disclosed herein include, but are not
limited to: (1) oil-in-water emulsion formulations (with or without
other specific immunostimulating agents such as muramyl peptides
(see below) or bacterial cell wall components), such as for example
(a) SAF, containing 10% Squalane, 0.4% Tween 80, 5%
pluronic-blocked polymer L121, and thr-MDP either microfluidized
into a submicron emulsion or vortexed to generate a larger particle
size emulsion, and (b) RIBI.TM. adjuvant system (RAS), (Ribi
Immunochem, Hamilton, Mont.) containing 2% Squalene, 0.2% Tween 80,
and one or more bacterial cell wall components such as
monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell
wall skeleton (CWS), preferably MPL+CWS (DETOX.TM.); (2) saponin
adjuvants, such as QS21, STIMULON.TM. (Cambridge Bioscience,
Worcester, Mass.), Abisco.RTM. (Isconova, Sweden), or
Iscomatrix.RTM. (Commonwealth Serum Laboratories, Australia), may
be used or particles generated therefrom such as ISCOMs
(immunostimulating complexes), which ISCOMS may be devoid of
additional detergent (e.g., WO 00/07621); (3) Complete Freund's
Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA); (4)
cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5,
IL-6, IL-7, IL-12 (WO 99/44636)), interferons (e.g., gamma
interferon), macrophage colony stimulating factor (M-CSF), tumor
necrosis factor (TNF), etc.; (5) monophosphoryl lipid A (MPL) or
3-O-deacylated MPL (3dMPL) (see, e.g., GB-2220221, EP0689454),
optionally in the substantial absence of alum when used with
pneumococcal saccharides (see, e.g., WO 00/56358); (6) combinations
of 3dMPL with, for example, QS21 and/or oil-in-water emulsions
(see, e.g., EP0835318, EP0735898, EP0761231); (7) a polyoxyethylene
ether or a polyoxyethylene ester (see, e.g., WO99/52549); (8) a
polyoxyethylene sorbitan ester surfactant in combination with an
octoxynol (WO 01/21207) or a polyoxyethylene alkyl ether or ester
surfactant in combination with at least one additional non-ionic
surfactant such as an octoxynol (WO 01/21152); (9) a saponin and an
immunostimulatory oligonucleotide (e.g., a CpG oligonucleotide) (WO
00/62800); (10) an immunostimulant and a particle of metal salt
(see e.g., WO00/23105); (11) a saponin and an oil-in-water emulsion
e.g., WO 99/11241; (12) a saponin (e.g., QS21)+3dMPL+IM2
(optionally+a sterol) e.g., WO 98/57659; (13) other substances that
act as immunostimulating agents to enhance the efficacy of the
composition. Muramyl peptides include
N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25
acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP),
N-acetylmuramyl-L-alanyl-D-isoglutarninyl-L-alanine-2-(1'-2'-dipalmitoyl--
sn-glycero-3-hydroxyphosphoryloxy)-ethylamine MTP-PE), etc.
[0369] In an embodiment of the present invention, the immunogenic
compositions as disclosed herein comprise a CpG Oligonucleotide as
adjuvant. A CpG oligonucleotide as used herein refers to an
immunostimulatory CpG oligodeoxynucleotide (CpG ODN), and
accordingly these terms are used interchangeably unless otherwise
indicated. Immunostimulatory CpG oligodeoxynucleotides contain one
or more immunostimulatory CpG motifs that are unmethylated
cytosine-guanine dinucleotides, optionally within certain preferred
base contexts. The methylation status of the CpG immunostimulatory
motif generally refers to the cytosine residue in the dinucleotide.
An immunostimulatory oligonucleotide containing at least one
unmethylated CpG dinucleotide is an oligonucleotide which contains
a 5' unmethylated cytosine linked by a phosphate bond to a 3'
guanine, and which activates the immune system through binding to
Toll-like receptor 9 (TLR-9). In another embodiment the
immunostimulatory oligonucleotide may contain one or more
methylated CpG dinucleotides, which will activate the immune system
through TLR9 but not as strongly as if the CpG motif(s) was/were
unmethylated. CpG immunostimulatory oligonucleotides may comprise
one or more palindromes that in turn may encompass the CpG
dinucleotide. CpG oligonucleotides have been described in a number
of issued patents, published patent applications, and other
publications, including U.S. Pat. Nos. 6,194,388; 6,207,646;
6,214,806; 6,218,371; 6,239,116; and 6,339,068.
[0370] In an embodiment of the present invention, the immunogenic
compositions as disclosed herein comprise any of the CpG
Oligonucleotide described at pages 3, lines 22, to page 12, line
36, of WO 2010/125480.
[0371] Different classes of CpG immunostimulatory oligonucleotides
have been identified. These are referred to as A, B, C and P class,
and are described in greater detail at pages 3, lines 22, to page
12, line 36, of WO 2010/125480. Methods of the invention embrace
the use of these different classes of CpG immunostimulatory
oligonucleotides.
[0372] In an embodiment of the present invention, the immunogenic
compositions as disclosed herein comprise an A class CpG
oligonucleotide. In an embodiment of the present invention, the
immunogenic compositions as disclosed herein comprise a B class CpG
Oligonucleotide.
[0373] The B class CpG oligonucleotide sequences of the invention
are those broadly described above as well as disclosed in published
WO 96/02555, WO 98/18810, and in U.S. Pat. Nos. 6,194,388;
6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068.
Exemplary sequences include but are not limited to those disclosed
in these latter applications and patents.
[0374] In an embodiment, the "B class" CpG oligonucleotide of the
invention has the following nucleic acid sequence:
TABLE-US-00001 (SEQ ID NO: 1) 5' TCGTCGTTTTTCGGTGCTTTT 3', or (SEQ
ID NO: 2) 5' TCGTCGTTTTTCGGTCGTTTT 3', or (SEQ ID NO: 3) 5'
TCGTCGTTTTGTCGTTTTGTCGTT 3', or (SEQ ID NO: 4) 5'
TCGTCGTTTCGTCGTTTTGTCGTT 3', or (SEQ ID NO: 5) 5'
TCGTCGTTTTGTCGTTTTTTTCGA 3'.
[0375] In any of these sequences, all of the linkages may be all
phosphorothioate bonds. In another embodiment, in any of these
sequences, one or more of the linkages may be phosphodiester,
preferably between the "C" and the "G" of the CpG motif making a
semi-soft CpG oligonucleotide. In any of these sequences, an
ethyl-uridine or a halogen may substitute for the 5' T; examples of
halogen substitutions include but are not limited to bromo-uridine
or iodo-uridine substitutions.
[0376] Some non-limiting examples of B-Class oligonucleotides
include:
TABLE-US-00002 (SEQ ID NO: 6) 5'
T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3', or (SEQ ID NO: 7) 5'
T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T 3', or (SEQ ID NO: 8) 5'
T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G* T*T 3', or (SEQ ID NO:
9) 5' T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G* T*T 3', or (SEQ
ID NO: 10) 5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*C* G*A
3'.
[0377] wherein "*" refers to a phosphorothioate bond.
[0378] In an embodiment of the present invention, the immunogenic
compositions as disclosed herein comprise a C class CpG
oligonucleotide.
[0379] In an embodiment of the present invention, the immunogenic
compositions as disclosed herein comprise a P class CpG
oligonucleotide.
[0380] In one embodiment the oligonucleotide includes at least one
phosphorothioate linkage. In another embodiment all internucleotide
linkages of the oligonucleotide are phosphorothioate linkages. In
another embodiment the oligonucleotide includes at least one
phosphodiester-like linkage. In another embodiment the
phosphodiester-like linkage is a phosphodiester linkage. In another
embodiment a lipophilic group is conjugated to the oligonucleotide.
In one embodiment the lipophilic group is cholesterol.
[0381] In an embodiment, all the internucleotide linkage of the CpG
oligonucleotides disclosed herein are phosphodiester bonds ("soft"
oligonucleotides, as described in WO 2007/026190).
[0382] In another embodiment, CpG oligonucleotides of the invention
are rendered resistant to degradation (e.g., are stabilized). A
"stabilized oligonucleotide" refers to an oligonucleotide that is
relatively resistant to in vivo degradation (e.g., via an exo- or
endo-nuclease). Nucleic acid stabilization can be accomplished via
backbone modifications. Oligonucleotides having phosphorothioate
linkages provide maximal activity and protect the oligonucleotide
from degradation by intracellular exo- and endo-nucleases.
[0383] The immunostimulatory oligonucleotides may have a chimeric
backbone, which have combinations of phosphodiester and
phosphorothioate linkages. For purposes of the instant invention, a
chimeric backbone refers to a partially stabilized backbone,
wherein at least one internucleotide linkage is phosphodiester or
phosphodiester-like, and wherein at least one other internucleotide
linkage is a stabilized internucleotide linkage, wherein the at
least one phosphodiester or phosphodiester-like linkage and the at
least one stabilized linkage are different. When the phosphodiester
linkage is preferentially located within the CpG motif such
molecules are called "semi-soft" as described in WO
2007/026190.
[0384] Other modified oligonucleotides include combinations of
phosphodiester, phosphorothioate, methylphosphonate,
methylphosphorothioate, phosphorodithioate, and/or p-ethoxy
linkages.
[0385] Mixed backbone modified ODN may be synthesized as described
in WO 2007/026190.
[0386] The size of the CpG oligonucleotide (i.e., the number of
nucleotide residues along the length of the oligonucleotide) also
may contribute to the stimulatory activity of the oligonucleotide.
For facilitating uptake into cells, CpG oligonucleotide of the
invention preferably have a minimum length of 6 nucleotide
residues. Oligonucleotides of any size greater than 6 nucleotides
(even many kb long) are capable of inducing an immune response if
sufficient immunostimulatory motifs are present, because larger
oligonucleotides are degraded inside cells. In certain embodiments,
the CpG oligonucleotides are 6 to 100 nucleotides long,
preferentially 8 to 30 nucleotides long. In important embodiments,
nucleic acids and oligonucleotides of the invention are not
plasmids or expression vectors.
[0387] In an embodiment, the CpG oligonucleotide disclosed herein
comprise substitutions or modifications, such as in the bases
and/or sugars as described at paragraphs 134 to 147 of WO
2007/026190.
[0388] In an embodiment, the CpG oligonucleotide of the present
invention is chemically modified. Examples of chemical
modifications are known to the skilled person and are described,
for example in Uhlmann et al. (1990) Chem. Rev. 90:543; S. Agrawal,
Ed., Humana Press, Totowa, USA 1993; Crooke. et al. (1996) Annu.
Rev. Pharmacol. Toxicol. 36:107-129; and Hunziker et al., (1995)
Mod. Synth. Methods 7:331-417. An oligonucleotide according to the
invention may have one or more modifications, wherein each
modification is located at a particular phosphodiester
internucleoside bridge and/or at a particular .beta.-D-ribose unit
and/or at a particular natural nucleoside base position in
comparison to an oligonucleotide of the same sequence which is
composed of natural DNA or RNA.
[0389] In some embodiments of the invention, CpG-containing nucleic
acids might be simply mixed with immunogenic carriers according to
methods known to those skilled in the art (see, e.g., WO
03/024480).
[0390] In a particular embodiment of the present invention, any of
the immunogenic composition disclosed herein comprises from 2 .mu.g
to 100 mg of CpG oligonucleotide, preferably from 0.1 mg to 50 mg
CpG oligonucleotide, preferably from 0.2 mg to 10 mg CpG
oligonucleotide, preferably from 0.3 mg to 5 mg CpG
oligonucleotide, preferably from 0.3 mg to 5 mg CpG
oligonucleotide, even preferably from 0.5 mg to 2 mg CpG
oligonucleotide, even preferably from 0.75 mg to 1.5 mg CpG
oligonucleotide. In a preferred embodiment, any of the immunogenic
composition disclosed herein comprises about 1 mg CpG
oligonucleotide.
5 FORMULATION
[0391] The immunogenic compositions of the invention may be
formulated in liquid form (i.e., solutions or suspensions) or in a
lyophilized form. Liquid formulations may advantageously be
administered directly from their packaged form and are thus ideal
for injection without the need for reconstitution in aqueous medium
as otherwise required for lyophilized compositions of the
invention.
[0392] Formulation of the immunogenic composition of the present
invention can be accomplished using art-recognized methods. For
instance, the individual pneumococcal conjugates can be formulated
with a physiologically acceptable vehicle to prepare the
composition. Examples of such vehicles include, but are not limited
to, water, buffered saline, polyols (e.g., glycerol, propylene
glycol, liquid polyethylene glycol) and dextrose solutions.
[0393] The present disclosure provides an immunogenic composition
comprising any of combination of glycoconjugates disclosed herein
and a pharmaceutically acceptable excipient, carrier, or
diluent.
[0394] In an embodiment, the immunogenic composition of the
invention is in liquid form, preferably in aqueous liquid form.
[0395] Immunogenic compositions of the disclosure may comprise one
or more of a buffer, a salt, a divalent cation, a non-ionic
detergent, a cryoprotectant such as a sugar, and an anti-oxidant
such as a free radical scavenger or chelating agent, or any
multiple combinations thereof.
[0396] In an embodiment, the immunogenic composition of the
invention comprises a buffer. In an embodiment, said buffer has a
pKa of about 3.5 to about 7.5. In some embodiments, the buffer is
phosphate, succinate, histidine or citrate. In certain embodiments,
the buffer is succinate at a final concentration of 1 mM to 10 mM.
In one particular embodiment, the final concentration of the
succinate buffer is about 5 mM.
[0397] In an embodiment, the immunogenic composition of the
invention comprises a salt. In some embodiments, the salt is
selected from the groups consisting of magnesium chloride,
potassium chloride, sodium chloride and a combination thereof. In
one particular embodiment, the salt is sodium chloride. In one
particular embodiment, the immunogenic composition of the invention
comprises sodium chloride at 150 mM.
[0398] In an embodiment, the immunogenic compositions of the
invention comprise a surfactant. In an embodiment, the surfactant
is selected from the group consisting of polysorbate 20
(TWEEN.TM.20), polysorbate 40 (TWEEN.TM.40), polysorbate 60
(TWEEN.TM.60), polysorbate 65 (TWEEN.TM.65), polysorbate 80
(TWEEN.TM.80), polysorbate 85 (TWEEN.TM.85), TRITON.TM. N-1 01,
TRITON.TM. X-100, oxtoxynol 40, nonoxynol-9, triethanolamine,
triethanolamine polypeptide oleate, polyoxyethylene-660
hydroxystearate (PEG-15, Solutol H 15),
polyoxyethylene-35-ricinoleate (CREMOPHOR.RTM. EL), soy lecithin
and a poloxamer. In one particular embodiment, the surfactant is
polysorbate 80. In some said embodiment, the final concentration of
polysorbate 80 in the formulation is at least 0.0001% to 10%
polysorbate 80 weight to weight (w/w). In some said embodiments,
the final concentration of polysorbate 80 in the formulation is at
least 0.001% to 1% polysorbate 80 weight to weight (w/w). In some
said embodiments, the final concentration of polysorbate 80 in the
formulation is at least 0.01% to 1% polysorbate 80 weight to weight
(w/w). In other embodiments, the final concentration of polysorbate
80 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%,
0.07%, 0.08%, 0.09% or 0.1% polysorbate 80 (w/w). In another
embodiment, the final concentration of the polysorbate 80 in the
formulation is 1% polysorbate 80 (w/w).
[0399] In certain embodiments, the immunogenic composition of the
invention has a pH of 5.5 to 7.5, more preferably a pH of 5.6 to
7.0, even more preferably a pH of 5.8 to 6.0.
[0400] In one embodiment, the present invention provides a
container filled with any of the immunogenic compositions disclosed
herein. In one embodiment, the container is selected from the group
consisting of a vial, a syringe, a flask, a fermentor, a
bioreactor, a bag, a jar, an ampoule, a cartridge and a disposable
pen. In certain embodiments, the container is siliconized.
[0401] In an embodiment, the container of the present invention is
made of glass, metals (e.g., steel, stainless steel, aluminum,
etc.) and/or polymers (e.g., thermoplastics, elastomers,
thermoplastic-elastomers). In an embodiment, the container of the
present invention is made of glass.
[0402] In one embodiment, the present invention provides a syringe
filled with any of the immunogenic compositions disclosed herein.
In certain embodiments, the syringe is siliconized and/or is made
of glass.
[0403] A typical dose of the immunogenic composition of the
invention for injection has a volume of 0.1 mL to 2 mL, more
preferably 0.2 mL to 1 mL, even more preferably a volume of about
0.5 m L.
[0404] Therefore the container or syringe as defined above is filed
with a volume of 0.1 mL to 2 mL, more preferably 0.2 mL to 1 mL,
even more preferably a volume of about 0.5 mL of any of the
immunogenic composition defined herein.
6 ABILITY OF THE IMMUNOGENIC COMPOSITIONS OF THE INVENTION TO
ELICIT CROSS-REACTIVE ANTIBODIES
[0405] In an embodiment, the immunogenic composition of the
invention is able to elicit IgG antibodies in human which are
capable of binding S. pneumoniae serotypes 10A and/or 39
polysaccharide as determined by ELISA assay.
[0406] In the ELISA (Enzyme-linked Immunosorbent Assay) method,
antibodies from the sera of vaccinated subjects are incubated with
polysaccharides which have been adsorbed to a solid support. The
bound antibodies are detected using enzyme-conjugated secondary
detection antibodies.
[0407] In an embodiment said ELISA assay is the standardized ELISA
assay as defined by the WHO in the "Training Manual. For Enzyme
Linked Immunosorbent Assay For The Quantitation Of Streptococcus
Pneumoniae Serotype Specific IgG (Pn PS ELISA)." (available at
http://www.vaccine.uab.edu/ELISA%20protocol.pdf, accessed on Mar.
31, 2014).
[0408] The ELISA measures type specific IgG anti-S. pneumoniae
capsular polysaccharide (PS) antibodies present in human serum.
When dilutions of human sera are added to type-specific capsular
PS-coated microtiter plates, antibodies specific for that capsular
PS bind to the microtiter plates. The antibodies bound to the
plates are detected using a goat anti-human IgG alkaline
phosphatase-labeled antibody followed by a p-nitrophenyl phosphate
substrate. The optical density of the colored end product is
proportional to the amount of anticapsular PS antibody present in
the serum.
[0409] In an embodiment, the immunogenic composition of the
invention is able to elicit IgG antibodies in human which are
capable of binding S. pneumoniae serotypes 10A polysaccharide at a
concentration of at least 0.2 .mu.g/ml, 0.3 .mu.g/ml, 0.35
.mu.g/ml, 0.4 .mu.g/ml or 0.5 .mu.g/ml as determined by ELISA
assay.
[0410] In an embodiment, the immunogenic composition of the
invention is able to elicit IgG antibodies in human which are
capable of binding S. pneumoniae serotypes 39 polysaccharide at a
concentration of at least 0.2 .mu.g/ml, 0.3 .mu.g/ml, 0.35
.mu.g/ml, 0.4 .mu.g/ml or 0.5 .mu.g/ml as determined by ELISA
assay.
[0411] In an embodiment, the immunogenic composition of the
invention is able to elicit functional antibodies in humans which
are capable of killing S. pneumoniae serotype 10A and/or 39 as
determined by in vitro opsonophagocytic assay (OPA) (see e.g.
WO2015110941). In an embodiment, the immunogenic composition of the
invention is able to elicit functional antibodies in humans which
are capable of killing S. pneumoniae serotype 10A and 39 as
determined by in vitro opsonophagocytic assay (OPA).
[0412] The pneumococcal opsonophagocytic assay (OPA), which
measures killing of S. pneumoniae cells by phagocytic effector
cells in the presence of functional antibody and complement, is
considered to be an important surrogate for evaluating the
effectiveness of pneumococcal vaccines.
[0413] In vitro opsonophagocytic assay (OPA) can be conducted by
incubating together a mixture of Streptococcus pneumoniae cells, a
heat inactivated human serum to be tested, differentiated HL-60
cells (phagocytes) and an exogenous complement source (e.g., baby
rabbit complement). Opsonophagocytosis proceeds during incubation
and bacterial cells that are coated with antibody and complement
are killed upon opsonophagocytosis. Colony forming units (cfu) of
surviving bacteria that escape from opsonophagocytosis are
determined by plating the assay mixture. The OPA titer is defined
as the reciprocal dilution that results in a 50% reduction in
bacterial count over control wells without test serum. The OPA
titer is interpolated from the two dilutions that encompass this
50% killing cut-off.
[0414] An endpoint titer of 1:8 or greater is considered a positive
result in these killing type OPA.
[0415] In an embodiment, the immunogenic composition of the
invention is able to elicit a titer of at least 1:8 against S.
pneumoniae serotype 10A in at least 50% of the subjects as
determined by in vitro opsonophagocytic killing assay (OPA). In an
embodiment, the immunogenic composition of the invention is able to
elicit a titer of at least 1:8 against S. pneumoniae serotype 10A
in at least 60%, 70%, 80%, or at least 90% of the subjects as
determined by in vitro opsonophagocytic killing assay (OPA).
[0416] In an embodiment, the immunogenic composition of the
invention is able to elicit a titer of at least 1:8 against S.
pneumoniae serotype 39 in at least 50% of the subjects as
determined by in vitro opsonophagocytic killing assay (OPA). In an
embodiment, the immunogenic composition of the invention is able to
elicit a titer of at least 1:8 against S. pneumoniae serotype 39 in
at least 60%, 70%, 80% or at least 90% of the subjects as
determined by in vitro opsonophagocytic killing assay (OPA).
[0417] In some embodiment, the subjects may have serotype specific
OPA titers prior to pneumococcal vaccination due for example to
natural exposures to S. pneumoniae (e.g., in case of adult
subjects).
[0418] Therefore, comparison of OPA activity of pre- and
post-immunization serum with the immunogenic composition of the
invention can be conducted and compared for their response to
serotypes 10A and 39 to assess the potential increase of
responders.
[0419] In an embodiment the immunogenic composition of the
invention significantly increases the proportion of responders
(i.e., individual with a serum having a titer of at least 1:8 as
determined by in vitro OPA) as compared to the pre-immunized
population.
[0420] Therefore in an embodiment, the immunogenic composition of
the invention is able to significantly increase the proportion of
responders against S. pneumoniae serotype 10A (i.e., individual
with a serum having a titer of at least 1:8 as determined by in
vitro OPA) as compared to the pre-immunized population.
[0421] In an embodiment, the immunogenic composition of the
invention is able to significantly increase the proportion of
responders against S. pneumoniae serotype 39 (i.e., individual with
a serum having a titer of at least 1:8 as determined by in vitro
OPA) as compared to the pre-immunized population.
[0422] In an embodiment, the immunogenic composition of the
invention is able to significantly increase the proportion of
responders against S. pneumoniae serotypes 10A and 39 (i.e.,
individual with a serum having a titer of at least 1:8 as
determined by in vitro OPA) as compared to the pre-immunized
population.
[0423] Comparison of OPA activity of pre- and post-immunization
serum with the immunogenic composition of the invention can also be
done by comparing the potential increase in OPA titers.
[0424] Therefore, comparison of OPA activity of pre- and
post-immunization serum with the immunogenic composition of the
invention can be conducted and compared for their response to
serotypes 10A and 39 to assess the potential for increase in OPA
titers.
[0425] In an embodiment the immunogenic compositions of the
invention are able to significantly increase the OPA titer of human
subjects as compared to the pre-immunized population.
[0426] Therefore in an embodiment, the immunogenic composition of
the invention is able to significantly increase the OPA titers of
human subjects against S. pneumoniae serotype 10A as compared to
the pre-immunized population.
[0427] In an embodiment, the immunogenic composition of the
invention is able to significantly increase the OPA titers of human
subjects against S. pneumoniae serotype 39 as compared to the
pre-immunized population.
[0428] In an embodiment, the immunogenic composition of the
invention is able to significantly increase the OPA titers of human
subjects against S. pneumoniae serotypes 10A and 39 as compared to
the pre-immunized population.
7 USES OF THE IMMUNOGENIC COMPOSITIONS OF THE INVENTION
[0429] In an embodiment, the immunogenic compositions disclosed
herein are for use as a medicament.
[0430] The immunogenic compositions described herein may be used in
various therapeutic or prophylactic methods for preventing,
treating or ameliorating a bacterial infection, disease or
condition in a subject. In particular, immunogenic compositions
described herein may be used to prevent, treat or ameliorate a S.
pneumoniae infection, disease or condition in a subject.
[0431] Thus in one aspect, the invention provides a method of
preventing, treating or ameliorating an infection, disease or
condition associated with S. pneumoniae in a subject, comprising
administering to the subject an immunologically effective amount of
an immunogenic composition of the invention.
[0432] In one aspect, the invention provides a method of
preventing, treating or ameliorating an infection, disease or
condition associated with S. pneumoniae serotype 10A and/or 39 in a
subject, comprising administering to the subject an immunologically
effective amount of an immunogenic composition of the
invention.
[0433] In one aspect, the invention provides a method of inducing
an immune response to S. pneumoniae serotypes 10A and/or 39 in a
subject, comprising administering to the subject an immunologically
effective amount of an immunogenic composition of the
invention.
[0434] In one aspect, the immunogenic compositions of the present
invention are for use in a method for preventing, treating or
ameliorating an infection, disease or condition caused by S.
pneumoniae serotypes 10A and/or 39 in a subject.
[0435] In an embodiment, any of the immunogenic composition
disclosed herein is for use in a method of immunizing a subject
against infection by S. pneumoniae serotype 10A and/or 39.
[0436] In one aspect, the present invention is directed toward the
use of the immunogenic composition disclosed herein for the
manufacture of a medicament for preventing, treating or
ameliorating an infection, disease or condition caused by S.
pneumoniae serotypes 10A and/or 39 in a subject.
[0437] In an embodiment, the present invention is directed toward
the use of the immunogenic composition disclosed herein for the
manufacture of a medicament for immunizing a subject against
infection by S. pneumoniae serotype 10A and/or 39.
[0438] In one aspect, the present invention provides a method for
inducing an immune response to S. pneumoniae serotypes 10A and/or
39 in a subject.
[0439] In an embodiment, the immunogenic compositions disclosed
herein are for use as a vaccine. More particularly, the immunogenic
compositions described herein may be used to prevent serotypes 10A
and/or 39 S. pneumoniae infections in a subject. Thus in one
aspect, the invention provides a method of preventing, an infection
by serotypes 10A and/or 39 S. pneumoniae in a subject, comprising
administering to the subject an immunologically effective amount of
an immunogenic composition of the invention. In some such
embodiments, the infection is selected from the group consisting of
pneumonia, sinusitis, otitis media, acute otitis media, meningitis,
bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis,
septic arthritis, endocarditis, peritonitis, pericarditis,
mastoiditis, cellulitis, soft tissue infection and brain
abscess.
[0440] In one aspect, the subject to be vaccinated is a mammal,
such as a human, cat, sheep, pig, horse, bovine or dog. Preferably,
the subject to be vaccinated is a human.
[0441] In one aspect, the immunogenic compositions disclosed herein
are for use in a method of preventing, treating or ameliorating an
infection, disease or condition associated S. pneumoniae with
serotypes 10A and/or 39 in a subject. In some such embodiments, the
infection, disease or condition is selected from the group
consisting of pneumonia, sinusitis, otitis media, acute otitis
media, meningitis, bacteremia, sepsis, pleural empyema,
conjunctivitis, osteomyelitis, septic arthritis, endocarditis,
peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue
infection and brain abscess.
[0442] In an aspect, the immunogenic composition disclosed herein
are for use in a method of preventing, an infection by serotypes
10A and/or 39 of S. pneumoniae in a subject. In some such
embodiments, the infection is selected from the group consisting of
pneumonia, sinusitis, otitis media, acute otitis media, meningitis,
bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis,
septic arthritis, endocarditis, peritonitis, pericarditis,
mastoiditis, cellulitis, soft tissue infection and brain abscess.
In one aspect, the subject to be vaccinated is a mammal, such as a
human, cat, sheep, pig, horse, bovine or dog.
[0443] In one aspect, the present invention is directed toward the
use of the immunogenic composition disclosed herein for the
manufacture of a medicament for preventing, treating or
ameliorating an infection, disease or condition associated S.
pneumoniae with serotypes 10A and/or 39 in a subject. In some such
embodiments, the infection, disease or condition is selected from
the group consisting of pneumonia, sinusitis, otitis media, acute
otitis media, meningitis, bacteremia, sepsis, pleural empyema,
conjunctivitis, osteomyelitis, septic arthritis, endocarditis,
peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue
infection and brain abscess.
[0444] In an aspect, the present invention is directed toward the
use of the immunogenic composition disclosed herein for the
manufacture of a medicament for preventing, an infection by
serotypes 10A and/or 39 of S. pneumoniae in a subject. In some such
embodiments, the infection is selected from the group consisting of
pneumonia, sinusitis, otitis media, acute otitis media, meningitis,
bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis,
septic arthritis, endocarditis, peritonitis, pericarditis,
mastoiditis, cellulitis, soft tissue infection and brain abscess.
In one aspect, the subject to be vaccinated is a mammal, such as a
human, cat, sheep, pig, horse, bovine or dog.
[0445] The immunogenic compositions of the present invention can be
used to protect or treat a human susceptible to S. pneumoniae
serotypes 10A and/or 39 infection, by means of administering the
immunogenic compositions via a systemic or mucosal route.
[0446] In an embodiment, the immunogenic compositions disclosed
herein are administered by intramuscular, intraperitoneal,
intradermal or subcutaneous routes. In an embodiment, the
immunogenic compositions disclosed herein are administered by
intramuscular, intraperitoneal, intradermal or subcutaneous
injection. In an embodiment, the immunogenic compositions disclosed
herein are administered by intramuscular or subcutaneous
injection.
8 SUBJECT TO BE TREATED WITH THE IMMUNOGENIC COMPOSITIONS OF THE
INVENTION
[0447] As disclosed herein, the immunogenic compositions described
herein may be used in various therapeutic or prophylactic methods
for preventing, treating or ameliorating a bacterial infection,
disease or condition in a subject.
[0448] In a preferred embodiment, said subject is a human. In a
most preferred embodiment, said subject is a newborn (i.e., under
three months of age), an infant (i.e., from 3 months to one year of
age) or a toddler (i.e., from one year to four years of age).
[0449] In an embodiment, the immunogenic compositions disclosed
herein are for use as a vaccine. In such embodiment, the subject to
be vaccinated may be less than 1 year of age. For example, the
subject to be vaccinated can be about 1, about 2, about 3, about 4,
about 5, about 6, about 7, about 8, about 9, about 10, about 11 or
about 12 months of age. In an embodiment, the subject to be
vaccinated is about 2, 4 or 6 months of age. In another embodiment,
the subject to be vaccinated is less than 2 years of age. For
example the subject to be vaccinated can be about 12 to about 15
months of age. In some cases, as little as one dose of the
immunogenic composition according to the invention is needed, but
under some circumstances, a second, third or fourth dose may be
given (see section 9 below).
[0450] In an embodiment of the present invention, the subject to be
vaccinated is a human 50 years of age or older, more preferably a
human 55 years of age or older. In an embodiment, the subject to be
vaccinated is a human 65 years of age or older, 70 years of age or
older, 75 years of age or older or 80 years of age or older.
[0451] In an embodiment the subject to be vaccinated is an
immunocompromised individual, in particular a human. An
immunocompromised individual is generally defined as a person who
exhibits an attenuated or reduced ability to mount a normal humoral
or cellular defense to challenge by infectious agents.
[0452] In an embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from a disease
or condition that impairs the immune system and results in an
antibody response that is insufficient to protect against or treat
pneumococcal disease.
[0453] In an embodiment, said disease is a primary immunodeficiency
disorder. Preferably, said primary immunodeficiency disorder is
selected from the group consisting of: combined T- and B-cell
immunodeficiencies, antibody deficiencies, well-defined syndromes,
immune dysregulation diseases, phagocyte disorders, innate immunity
deficiencies, autoinflammatory disorders, and complement
deficiencies. In an embodiment, said primary immunodeficiency
disorder is selected from the one disclosed on page 24, line 11, to
page 25, line 19, of WO 2010/125480.
[0454] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from a disease
selected from the groups consisting of: HIV-infection, acquired
immunodeficiency syndrome (AIDS), cancer, chronic heart or lung
disorders, congestive heart failure, diabetes mellitus, chronic
liver disease, alcoholism, cirrhosis, spinal fluid leaks,
cardiomyopathy, chronic bronchitis, emphysema, chronic obstructive
pulmonary disease (COPD), spleen dysfunction (such as sickle cell
disease), lack of spleen function (asplenia), blood malignancy,
leukemia, multiple myeloma, Hodgkin's disease, lymphoma, kidney
failure, nephrotic syndrome and asthma.
[0455] In an embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from
malnutrition.
[0456] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated is taking a drug or
treatment that lowers the body's resistance to infection. In an
embodiment, said drug is selected from the one disclosed on page
26, line 33, to page 26, line 4, of WO 2010/125480.
[0457] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated is a smoker.
[0458] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated has a white blood cell
count (leukocyte count) below 5.times.10.sup.9 cells per liter, or
below 4.times.10.sup.9 cells per liter, or below 3.times.10.sup.9
cells per liter, or below 2.times.10.sup.9 cells per liter, or
below 1.times.10.sup.9 cells per liter, or below 0.5.times.10.sup.9
cells per liter, or below 0.3.times.10.sup.9 cells per liter, or
below 0.1.times.10.sup.9 cells per liter.
[0459] White blood cell count (leukocyte count): The number of
white blood cells (WBC) in the blood. The WBC is usually measured
as part of the CBC (complete blood count). White blood cells are
the infection-fighting cells in the blood and are distinct from the
red (oxygen-carrying) blood cells known as erythrocytes. There are
different types of white blood cells, including neutrophils
(polymorphonuclear leukocytes; PMN), band cells (slightly immature
neutrophils), T-type lymphocytes (T-cells), B-type lymphocytes
(B-cells), monocytes, eosinophils, and basophils. All the types of
white blood cells are reflected in the white blood cell count. The
normal range for the white blood cell count is usually between
4,300 and 10,800 cells per cubic millimeter of blood. This can also
be referred to as the leukocyte count and can be expressed in
international units as 4.3-10.8.times.10.sup.9 cells per liter.
[0460] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated suffers from
neutropenia. In a particular embodiment of the present invention,
the immunocompromised subject to be vaccinated has a neutrophil
count below 2.times.10.sup.9 cells per liter, or below
1.times.10.sup.9 cells per liter, or below 0.5.times.10.sup.9 cells
per liter, or below 0.1.times.10.sup.9 cells per liter, or below
0.05.times.10.sup.9 cells per liter.
[0461] A low white blood cell count or "neutropenia" is a condition
characterized by abnormally low levels of neutrophils in the
circulating blood. Neutrophils are a specific kind of white blood
cell that help prevent and fight infections. The most common reason
that cancer patients experience neutropenia is as a side effect of
chemotherapy. Chemotherapy-induced neutropenia increases a
patient's risk of infection and disrupts cancer treatment.
[0462] In a particular embodiment of the present invention, the
immunocompromised subject to be vaccinated has a CD4+ cell count
below 500/mm3, or CD4+ cell count below 300/mm3, or CD4+ cell count
below 200/mm3, CD4+ cell count below 100/mm3, CD4+ cell count below
75/mm3, or CD4+ cell count below 50/mm3.
[0463] CD4 cell tests are normally reported as the number of cells
in mm3. Normal CD4 counts are between 500 and 1600, and CD8 counts
are between 375 and 1100. CD4 counts drop dramatically in people
with HIV.
[0464] In an embodiment of the invention, any of the
immunocompromised subject disclosed herein is a human male or a
human female.
9 REGIMEN
[0465] In some cases, as little as one dose of the immunogenic
composition according to the invention is needed, but under some
circumstances, such as conditions of greater immune deficiency, a
second, third or fourth dose may be given. Following an initial
vaccination, subjects can receive one or several booster
immunizations adequately spaced.
[0466] In an embodiment, the schedule of vaccination of the
immunogenic composition according to the invention is a single
dose. In a particular embodiment, said single dose schedule is for
healthy persons being at least 2 years of age.
[0467] In an embodiment, the schedule of vaccination of the
immunogenic composition according to the invention is a multiple
dose schedule. In a particular embodiment, said multiple dose
schedule consists of a series of 2 doses separated by an interval
of about 1 month to about 2 months. In a particular embodiment,
said multiple dose schedule consists of a series of 2 doses
separated by an interval of about 1 month, or a series of 2 doses
separated by an interval of about 2 months.
[0468] In another embodiment, said multiple dose schedule consists
of a series of 3 doses separated by an interval of about 1 month to
about 2 months. In another embodiment, said multiple dose schedule
consists of a series of 3 doses separated by an interval of about 1
month, or a series of 3 doses separated by an interval of about 2
months.
[0469] In another embodiment, said multiple dose schedule consists
of a series of 3 doses separated by an interval of about 1 month to
about 2 months followed by a fourth dose about months to about 13
months after the first dose. In another embodiment, said multiple
dose schedule consists of a series of 3 doses separated by an
interval of about 1 month followed by a fourth dose about 10 months
to about 13 months after the first dose, or a series of 3 doses
separated by an interval of about 2 months followed by a fourth
dose about 10 months to about 13 months after the first dose.
[0470] In an embodiment, the multiple dose schedule consists of at
least one dose (e.g., 1, 2 or 3 doses) in the first year of age
followed by at least one toddler dose.
[0471] In an embodiment, the multiple dose schedule consists of a
series of 2 or 3 doses separated by an interval of about 1 month to
about 2 months (for example 28-56 days between doses), starting at
2 months of age, and followed by a toddler dose at 12-18 months of
age. In an embodiment, said multiple dose schedule consists of a
series of 3 doses separated by an interval of about 1 to 2 months
(for example 28-56 days between doses), starting at 2 months of
age, and followed by a toddler dose at 12-15 months of age. In
another embodiment, said multiple dose schedule consists of a
series of 2 doses separated by an interval of about 2 months,
starting at 2 months of age, and followed by a toddler dose at
12-18 months of age. In an embodiment, the multiple dose schedule
consists of a 4-dose series of vaccine at 2, 4, 6, and 12-15 months
of age.
[0472] In an embodiment, a prime dose is given at day 0 and one or
more boosts are given at intervals that range from about 2 to about
24 weeks, preferably with a dosing interval of 4-8 weeks.
[0473] In an embodiment, a prime dose is given at day 0 and a boost
is given about 3 months later.
10 KIT AND PROCESS
[0474] In an embodiment, the invention is directed toward a kit
comprising an immunogenic composition disclosed herein and an
information leaflet.
[0475] In an embodiment said information leaflet mentions the
ability of the composition to elicit functional antibodies against
S. pneumoniae serotypes 10A and/or 39.
[0476] In an embodiment said information leaflet mentions the
ability of the composition to elicit anti-capsular antibodies
against S. pneumoniae serotypes 10A and/or 39 at a concentration
0.35 .mu.g/mL in a human population.
[0477] In an embodiment said information leaflet mentions the
ability of the composition to elicit OPA titers against S.
pneumoniae serotypes 10A and/or 39 in a human population.
[0478] In an embodiment, the invention is directed toward a process
for producing a kit comprising an immunogenic composition and an
information leaflet, said process comprising the step of: [0479]
producing an immunogenic composition of the present disclosure and
[0480] combining in the same kit said immunogenic composition and
information leaflet, wherein said information leaflet mentions the
ability of said composition to elicit functional antibodies against
S. pneumoniae serotypes 10A and/or 39.
[0481] In an embodiment, the invention is directed toward a process
for producing a kit comprising an immunogenic composition and an
information leaflet, said process comprising the step of: [0482]
producing an immunogenic composition of the present disclosure and
[0483] combining in the same kit said immunogenic composition and
information leaflet, wherein said information leaflet mentions the
ability of the composition to elicit anti-capsular antibodies
against S. pneumoniae serotypes 10A and/or 39 at a concentration
.gtoreq.0.35 .mu.g/mL in a human population.
[0484] In an embodiment, the invention is directed toward a process
for producing a kit comprising an immunogenic composition and an
information leaflet, said process comprising the step of: [0485]
producing an immunogenic composition of the present disclosure and
[0486] combining in the same kit said immunogenic composition and
information leaflet, wherein said information leaflet mentions the
ability of the composition to elicit OPA titers against S.
pneumoniae serotypes 10A and/or 39 in a human population.
[0487] In an embodiment, the invention is directed toward a process
for producing a kit comprising an immunogenic composition and an
information leaflet, said process comprising the step of: [0488]
producing an immunogenic composition of the present disclosure;
[0489] printing an information leaflet wherein said information
leaflet mentions the ability of said composition to elicit
functional antibodies against S. pneumoniae serotypes 10A and/or
39; [0490] combining in the same kit said immunogenic composition
and said information leaflet.
[0491] In an embodiment, the invention is directed toward a process
for producing a kit comprising an immunogenic composition and an
information leaflet, said process comprising the step of: [0492]
producing an immunogenic composition of the present disclosure;
[0493] printing an information leaflet wherein said information
leaflet mentions the ability of the composition to elicit
anti-capsular antibodies against S. pneumoniae serotypes 10A and/or
39 at a concentration .gtoreq.0.35 .mu.g/mL in a human population;
[0494] combining in the same kit said immunogenic composition and
said information leaflet.
[0495] In an embodiment, the invention is directed toward a process
for producing a kit comprising an immunogenic composition and an
information leaflet, said process comprising the step of: [0496]
producing an immunogenic composition of the present disclosure;
[0497] printing an information leaflet wherein said information
leaflet mentions the ability of the composition to elicit OPA
titers against S. pneumoniae serotypes 10A and/or 39 in a human
population; [0498] combining in the same kit said immunogenic
composition and said information leaflet.
11 METHODS
[0499] In an embodiment, the invention is directed toward a method
comprising the step of: [0500] injecting to a subject an
immunologically effective amount of any of the immunogenic
compositions defined in the present document; [0501] collecting a
serum sample from said subject; [0502] testing said serum sample
for opsonophagocytic killing activity against S. pneumoniae
serotype 10A and/or 39 by in vitro opsonophagocytic killing assay
(OPA).
12 PARTICULAR EMBODIMENTS OF THE INVENTION
[0503] Particular embodiments of the invention are set forth in the
following numbered paragraphs:
[0504] 1. An immunogenic composition comprising at least one
glycoconjugate from S. pneumoniae serotype 39.
[0505] 2. The immunogenic composition of paragraph 1 wherein, said
serotype 39 glycoconjugate has a molecular weight of between 50 kDa
and 30,000 kDa.
[0506] 3. The immunogenic composition of any one of paragraphs 1-2
wherein, said serotype 39 glycoconjugate has a molecular weight of
between 4,000 kDa and 25,000 KDa.
[0507] 4. The immunogenic composition of any one of paragraphs 1-3
wherein, said serotype 39 glycoconjugate comprises a saccharide
which has a degree of O-acetylation of between and 100%.
[0508] 5. The immunogenic composition of any one of paragraphs 1-3
wherein, said serotype 39 glycoconjugate comprises a saccharide
which has a degree of O-acetylation of between 0 and 50%.
[0509] 6. The immunogenic composition of any one of paragraphs 1-3
wherein said serotype 39 glycoconjugate comprises at least 0.01
O-acetyl group per polysaccharide repeating unit of serotype 39
polysaccharide.
[0510] 7. The immunogenic composition of any one of paragraphs 1-3
wherein said serotype 39 glycoconjugate comprises less than 0.5
O-acetyl group per polysaccharide repeating unit of serotype 39
polysaccharide.
[0511] 8. The immunogenic composition of any one of paragraphs 1-7
wherein the degree of conjugation of said serotype 39
glycoconjugate is between 2 and 19.
[0512] 9. The immunogenic composition of any one of paragraphs 1-8
wherein, the ratio (w/w) of serotype 39 capsular saccharide to
carrier protein in serotype 39 glycoconjugate is between 0.5 and
3.
[0513] 10. The immunogenic composition of any one of paragraphs 1-9
wherein said serotype 39 glycoconjugate comprises less than about
50% of free serotype 39 capsular saccharide compared to the total
amount of serotype 39 capsular saccharide.
[0514] 11. The immunogenic composition of any one of paragraphs
1-10 wherein at least 30% of the serotype 39 glycoconjugates have a
K.sub.d below or equal to 0.3 in a CL-4B column.
[0515] 12. The immunogenic composition of any one of paragraphs
1-11 wherein the carrier protein of said serotype 39 glycoconjugate
is selected from the group consisting of: DT (Diphtheria toxin), TT
(tetanus toxid), CRM.sub.197, other DT mutants, PD (Haemophilus
influenzae protein D), or immunologically functional equivalents
thereof.
[0516] 13. The immunogenic composition of any one of paragraphs
1-11 wherein the carrier protein of said serotype 39 glycoconjugate
is CRM.sub.197.
[0517] 14. The immunogenic composition of any one of paragraphs
1-11 wherein the carrier protein of said serotype 39 glycoconjugate
is TT.
[0518] 15. The immunogenic composition of any one of paragraphs
1-14 wherein said serotype 39 glycoconjugate is prepared using
reductive amination.
[0519] 16. The immunogenic composition of any one of paragraphs
1-14 wherein said serotype 39 glycoconjugate is prepared using
direct CDAP chemistry.
[0520] 17. The immunogenic composition of any one of paragraphs
1-14 wherein said serotype 39 glycoconjugate is prepared using
indirect CDAP chemistry.
[0521] 18. The immunogenic composition of any one of paragraphs
1-14 wherein said serotype 39 glycoconjugate is prepared using
direct CDI chemistry.
[0522] 19. An immunogenic composition comprising at least one
glycoconjugate from S. pneumoniae serotype 10A for use in a method
for preventing, treating or ameliorating an infection, disease or
condition caused by S. pneumoniae serotype 39 in a subject.
[0523] 20. The immunogenic composition of any one of paragraphs
1-18, wherein said composition does not comprise capsular
saccharide from S. pneumoniae serotype 10A.
[0524] 21. The immunogenic composition of paragraph 19, wherein
said composition does not comprise capsular saccharide from S.
pneumoniae serotype 39.
[0525] 22. The immunogenic composition of any one of paragraphs
1-21, further comprising at least one glycoconjugate from S.
pneumoniae serotype 4.
[0526] 23. The immunogenic composition of any one of paragraphs
1-22 further comprising at least one glycoconjugate from S.
pneumoniae serotype 6B.
[0527] 24. The immunogenic composition of any one of paragraphs
1-23 further comprising at least one glycoconjugate from S.
pneumoniae serotype 14.
[0528] 25. The immunogenic composition of any one of paragraphs
1-24 further comprising at least one glycoconjugate from S.
pneumoniae serotype 18C.
[0529] 26. The immunogenic composition of any one of paragraphs
1-25 further comprising at least one glycoconjugate from S.
pneumoniae serotype 19F.
[0530] 27. The immunogenic composition of any one of paragraphs
1-26 further comprising at least one glycoconjugate from S.
pneumoniae serotype 23F.
[0531] 28. The immunogenic composition of any one of paragraphs
1-21 further comprising glycoconjugates from S. pneumoniae
serotypes 4, 6B, 14, 18C, 19F and 23F.
[0532] 29. The immunogenic composition of any one of paragraphs
1-28 further comprising at least one glycoconjugate from S.
pneumoniae serotype 1.
[0533] 30. The immunogenic composition of any one of paragraphs
1-29 further comprising at least one glycoconjugate from S.
pneumoniae serotype 5.
[0534] 31. The immunogenic composition of any one of paragraphs
1-30 further comprising at least one glycoconjugate from S.
pneumoniae serotype 7F.
[0535] 32. The immunogenic composition of any one of paragraphs
1-28 further comprising glycoconjugates from S. pneumoniae
serotypes 1, 5 and 7F.
[0536] 33. The immunogenic composition of any one of paragraphs
1-32 further comprising at least one glycoconjugate from S.
pneumoniae serotype 6A.
[0537] 34. The immunogenic composition of any one of paragraphs
1-33 further comprising at least one glycoconjugate from S.
pneumoniae serotype 19A.
[0538] 35. The immunogenic composition of any one of paragraphs
1-32 further comprising glycoconjugates from S. pneumoniae
serotypes 6A and 19A.
[0539] 36. The immunogenic composition of any one of paragraphs
1-35 further comprising at least one glycoconjugate from S.
pneumoniae serotype 3.
[0540] 37. The immunogenic composition of any one of paragraphs
1-36 further comprising at least one glycoconjugate from S.
pneumoniae serotype 15B.
[0541] 38. The immunogenic composition of any one of paragraphs
1-37 further comprising at least one glycoconjugate from S.
pneumoniae serotype 22F.
[0542] 39. The immunogenic composition of any one of paragraphs
1-38 further comprising at least one glycoconjugate from S.
pneumoniae serotype 33F.
[0543] 40. The immunogenic composition of any one of paragraphs
1-39 further comprising at least one glycoconjugate from S.
pneumoniae serotype 8.
[0544] 41. The immunogenic composition of any one of paragraphs
1-40 further comprising at least one glycoconjugate from S.
pneumoniae serotype 11A.
[0545] 42. The immunogenic composition of any one of paragraphs
1-41 further comprising at least one glycoconjugate from S.
pneumoniae serotype 12F.
[0546] 43. The immunogenic composition of any one of paragraphs
1-36 further comprising glycoconjugates from S. pneumoniae
serotypes 22F and 33F.
[0547] 44. The immunogenic composition of any one of paragraphs
1-36 further comprising glycoconjugates from S. pneumoniae
serotypes 15B, 22F and 33F.
[0548] 45. The immunogenic composition of any one of paragraphs
1-39 further comprising glycoconjugates from S. pneumoniae
serotypes 12F, 10A, 11A and 8.
[0549] 46. The immunogenic composition of any one of paragraphs
1-45 further comprising at least one glycoconjugate from S.
pneumoniae serotype 2.
[0550] 47. The immunogenic composition of any one of paragraphs
1-46 further comprising at least one glycoconjugate from S.
pneumoniae serotype 17F.
[0551] 48. The immunogenic composition of any one of paragraphs
1-47 further comprising at least one glycoconjugate from S.
pneumoniae serotype 20.
[0552] 49. The immunogenic composition of any one of paragraphs
1-45 further comprising glycoconjugates from S. pneumoniae
serotypes 2, 17F and 20.
[0553] 50. The immunogenic composition of any one of paragraphs
1-49 further comprising at least one glycoconjugate from S.
pneumoniae serotype 15C.
[0554] 51. The immunogenic composition of any one of paragraphs
1-50 further comprising at least one glycoconjugate from S.
pneumoniae serotype 9N.
[0555] 52. The immunogenic composition of any one of paragraphs
1-51 which is a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26-valent pneumococcal
conjugate composition.
[0556] 53. The immunogenic composition of any one of paragraphs
1-51 which is a 13, 14, 15, 16, 17, 18, 19 or 20 valent
pneumococcal conjugate composition.
[0557] 54. The immunogenic composition of any one of paragraphs
1-51 which is a 16-valent pneumococcal conjugate composition.
[0558] 55. The immunogenic composition of any one of paragraphs
1-51 which is a 20-valent pneumococcal conjugate composition.
[0559] 56. The immunogenic composition of any one of paragraphs
1-55 wherein said glycoconjugates are individually conjugated to
CRM.sub.197.
[0560] 57. The immunogenic composition of any one of paragraphs
1-55 wherein all glycoconjugates are individually conjugated to
CRM.sub.197.
[0561] 58. The immunogenic composition of any one of paragraphs
1-55 wherein, the glycoconjugates from S. pneumoniae serotypes 1,
4, 5, 6B, 7F, 9V, 14 and/or 23F are individually conjugated to
PD.
[0562] 59. The immunogenic composition of any one of paragraphs
25-58 wherein the glycoconjugate from S. pneumoniae serotype 18C is
conjugated to TT.
[0563] 60. The immunogenic composition of any one of paragraphs
26-59 wherein the glycoconjugate from S. pneumoniae serotype 19F is
conjugated to DT.
[0564] 61. The immunogenic composition of any one of paragraphs
1-60 wherein said glycoconjugates are prepared using direct or
indirect CDAP chemistry.
[0565] 62. The immunogenic composition of any one of paragraphs
1-60 wherein said glycoconjugates are prepared by reductive
amination.
[0566] 63. The immunogenic composition of any one of paragraphs
33-60 wherein said glycoconjugate from S. pneumoniae serotype 6A is
prepared by reductive amination.
[0567] 64. The immunogenic composition of any one of paragraphs
34-60 wherein said glycoconjugate from S. pneumoniae serotype 19A
is prepared by reductive amination.
[0568] 65. The immunogenic composition of any one of paragraphs
36-60 wherein said glycoconjugate from S. pneumoniae serotype 3 is
prepared by reductive amination.
[0569] 66. The immunogenic composition of any one of paragraphs
1-65 wherein said immunogenic composition further comprises
antigens from other pathogens.
[0570] 67. The immunogenic composition of any one of paragraphs
1-66 wherein said immunogenic composition further comprises
antigens selected from: a diphtheria toxoid (D), a tetanus toxoid
(T), a pertussis antigen (P), which is typically acellular (Pa), a
hepatitis B virus (HBV) surface antigen (HBsAg), a hepatitis A
virus (HAV) antigen, a conjugated Haemophilus influenzae type b
capsular saccharide (Hib) and inactivated poliovirus vaccine
(IPV).
[0571] 68. The immunogenic composition of any one of paragraphs
1-67 wherein said immunogenic composition further comprises at
least one adjuvant, most preferably any of the adjuvant disclosed
herein.
[0572] 69. The immunogenic composition of any one of paragraphs
1-68 wherein said immunogenic composition further comprises at
least one adjuvant selected from the group consisting of aluminum
phosphate, aluminum sulfate and aluminum hydroxide.
[0573] 70. The immunogenic composition of any one of paragraphs
1-69 wherein said immunogenic composition comprises from 0.1 mg/mL
to 1 mg/mL of elemental aluminum in the form of aluminum phosphate
as adjuvant.
[0574] 71. The immunogenic composition of any one of paragraphs
1-70 which is able to elicit IgG antibodies in human, and which is
capable of binding S. pneumoniae serotypes 10A polysaccharide at a
concentration of at least 0.35 .mu.g/ml as determined by ELISA
assay.
[0575] 72. The immunogenic composition of any one of paragraphs
1-71 which is able to elicit IgG antibodies in human, and which is
capable of binding S. pneumoniae serotypes 39 polysaccharide at a
concentration of at least 0.35 .mu.g/ml as determined by ELISA
assay.
[0576] 73. The immunogenic composition of any one of paragraphs
1-72 which is able to elicit functional antibodies in human, and
which is capable of killing S. pneumoniae serotype 10A and/or 39 as
determined by in vitro opsonophagocytic assay (OPA).
[0577] 74. The immunogenic composition of any one of paragraphs
1-73 which is able to elicit a titer of at least 1:8 against S.
pneumoniae serotype 10A in at least 50% of the subjects as
determined by in vitro opsonophagocytic killing assay (OPA).
[0578] 75. The immunogenic composition of any one of paragraphs
1-74 which is able to elicit a titer of at least 1:8 against S.
pneumoniae serotype 39 in at least 50% of the subjects as
determined by in vitro opsonophagocytic killing assay (OPA).
[0579] 76. The immunogenic composition of any one of paragraphs
1-75 which is able to significantly increase the proportion of
responders against S. pneumoniae serotype 10A as compared to the
pre-immunized population.
[0580] 77. The immunogenic composition of any one of paragraphs
1-76 which is able to significantly increase the proportion of
responders against S. pneumoniae serotype 39 as compared to the
pre-immunized population.
[0581] 78. The immunogenic composition of any one of paragraphs
1-77 which is able to significantly increase the OPA titers of
human subjects against S. pneumoniae serotype 10A as compared to
the pre-immunized population.
[0582] 79. The immunogenic composition of any one of paragraphs
1-78 which is able to significantly increase the OPA titers of
human subjects against S. pneumoniae serotype 39 as compared to the
pre-immunized population.
[0583] 80. The immunogenic composition of any one of paragraphs
1-79, for use in a method of immunizing a subject against infection
by S. pneumoniae serotype 10A.
[0584] 81. The immunogenic composition of any one of paragraphs
1-79, for use in a method of immunizing a subject against infection
by S. pneumoniae serotype 39.
[0585] 82. The immunogenic composition of any one of paragraphs
1-79, for use in a method of immunizing a subject against infection
by S. pneumoniae serotype 10A and 39.
[0586] 83. The immunogenic composition of any one of paragraphs
1-79 for use in a method for preventing, treating or ameliorating
an infection, disease or condition caused by S. pneumoniae
serotypes 10A and/or 39 in a subject.
[0587] 84. The immunogenic composition of any one of paragraphs
1-79 for use to prevent serotypes 10A and/or 39 S. pneumoniae
infection in a subject.
[0588] 85. The immunogenic composition of any one of paragraphs
1-79 for use in a method to protect or treat a human susceptible to
S. pneumoniae serotypes 10A and/or 39 infection, by means of
administering said immunogenic compositions via a systemic or
mucosal route.
[0589] 86. A method of preventing, treating or ameliorating an
infection, disease or condition associated with S. pneumoniae
serotypes 10A and/or 39 in a subject, comprising administering to
the subject an immunologically effective amount of an immunogenic
composition of any one of paragraphs 1-79.
[0590] 87. A method of preventing an infection by S. pneumoniae
serotypes 10A and/or 39 in a subject, comprising administering to
the subject an immunologically effective amount of an immunogenic
composition of any one of paragraphs 1-79.
[0591] 88. The immunogenic composition of any one of paragraphs
19-87, wherein said subject is a human less than 1 year of age.
[0592] 89. The immunogenic composition of any one of paragraphs
19-87, wherein said subject is a human is a human less than 2 years
of age.
[0593] 90. The immunogenic composition of any one of paragraphs
19-87, wherein said subject is a human 50 years of age or
older.
[0594] 91. The immunogenic composition of any one of paragraphs
1-90 for use in a multiple dose vaccination schedule.
[0595] 92. A kit comprising an immunogenic composition disclosed
herein and an information leaflet.
[0596] 93. A kit comprising an immunogenic composition of any one
of paragraphs 1-79 and an information leaflet.
[0597] 94. The kit of paragraph 92 or 93 wherein said information
leaflet mentions the ability of the composition to elicit
functional antibodies against S. pneumoniae serotypes 10A and/or
39.
[0598] 95. The kit of paragraph 92 or 93 wherein said information
leaflet mentions the ability of the composition to elicit
functional antibodies against S. pneumoniae serotype 10A.
[0599] 96. The kit of paragraph 92 or 93 wherein said information
leaflet mentions the ability of the composition to elicit
anti-capsular antibodies against S. pneumoniae serotypes 10A and/or
39 at a concentration .gtoreq.0.35 .mu.g/mL in a human
population.
[0600] 97. The kit of paragraph 92 or 93 wherein said information
leaflet mentions the ability of the composition to elicit
anti-capsular antibodies against S. pneumoniae serotype 10A at a
concentration .gtoreq.0.35 .mu.g/mL in a human population.
[0601] 98. The kit of any one of paragraphs 92-96 wherein said
information leaflet mentions the ability of the composition to
elicit OPA titers against S. pneumoniae serotypes 10A and/or 39 in
a human population.
[0602] 99. The kit of any one of paragraphs 92-96 wherein said
information leaflet mentions the ability of the composition to
elicit OPA titers against S. pneumoniae serotypes 10A in a human
population.
[0603] 100. A process for producing a kit comprising an immunogenic
composition and an information leaflet, said process comprising the
steps of: [0604] producing an immunogenic composition of any one of
paragraphs 1-79; and [0605] combining in the same kit said
immunogenic composition and information leaflet, wherein said
information leaflet mentions the ability of said composition to
elicit functional antibodies against S. pneumoniae serotypes 10A
and/or 39.
[0606] 101. A process for producing a kit comprising an immunogenic
composition and an information leaflet, said process comprising the
steps of: [0607] producing an immunogenic composition of any one of
paragraphs 1-79; and [0608] combining in the same kit said
immunogenic composition and information leaflet, wherein said
information leaflet mentions the ability of the composition to
elicit anti-capsular antibodies against S. pneumoniae serotypes 10A
and/or 39 at a concentration .gtoreq.0.35 .mu.g/mL in a human
population.
[0609] 102. A process for producing a kit comprising an immunogenic
composition and an information leaflet, said process comprising the
steps of: [0610] producing an immunogenic composition of any one of
paragraphs 1-79; and [0611] combining in the same kit said
immunogenic composition and information leaflet, wherein said
information leaflet mentions the ability of the composition to
elicit OPA titers against S. pneumoniae serotypes 10A and/or 39 in
a human population.
[0612] 103. A process for producing a kit comprising an immunogenic
composition and an information leaflet, said process comprising the
steps of: [0613] producing an immunogenic composition of any one of
paragraphs 1-79; [0614] printing an information leaflet wherein
said information leaflet mentions the ability of said composition
to elicit functional antibodies against S. pneumoniae serotypes 10A
and/or 39; and [0615] combining in the same kit said immunogenic
composition and said information leaflet.
[0616] 104. A process for producing a kit comprising an immunogenic
composition and an information leaflet, said process comprising the
steps of: [0617] producing an immunogenic composition of any one of
paragraphs 1-79; [0618] printing an information leaflet wherein
said information leaflet mentions the ability of the composition to
elicit anti-capsular antibodies against S. pneumoniae serotypes 10A
and/or 39 at a concentration .gtoreq.0.35 .mu.g/mL in a human
population; and [0619] combining in the same kit said immunogenic
composition and said information leaflet.
[0620] 105. A process for producing a kit comprising an immunogenic
composition and an information leaflet, said process comprising the
steps of: [0621] producing an immunogenic composition of any one of
paragraphs 1-79; [0622] printing an information leaflet wherein
said information leaflet mentions the ability of the composition to
elicit OPA titers against S. pneumoniae serotypes 10A and/or 39 in
a human population; and [0623] combining in the same kit said
immunogenic composition and said information leaflet.
[0624] 106. A method comprising the steps of: [0625] injecting to a
subject an immunologically effective amount of the immunogenic
composition defined at any one of paragraphs 1-79; [0626]
collecting a serum sample from said subject; and [0627] testing
said serum sample for opsonophagocytic killing activity against S.
pneumoniae serotype 10A and/or 39 by in vitro opsonophagocytic
killing assay (OPA).
[0628] 107. A method of inducing an immune response to S.
pneumoniae serotypes 10A and/or 39 in a subject, comprising
administering to the subject an immunologically effective amount of
an immunogenic composition of any one of paragraphs 1-79.
[0629] 108. Use of an immunogenic composition of any one of
paragraphs 1-79 for the manufacture of a medicament for immunizing
a subject against infection by S. pneumoniae serotype 10A and/or
39.
[0630] 109. Use of an immunogenic composition of any one of
paragraphs 1-79 for the manufacture of a medicament for preventing,
treating or ameliorating an infection, disease or condition caused
by S. pneumoniae serotypes 10A and/or 39 in a subject.
[0631] 110. Use of an immunogenic composition of any one of
paragraphs 1-79 for the manufacture of a medicament for preventing
infection by serotypes 10A and/or 39 S. pneumoniae in a
subject.
[0632] As used herein, the term "about" means within a
statistically meaningful range of a value, such as a stated
concentration range, time frame, molecular weight, temperature or
pH. Such a range can be within an order of magnitude, typically
within 20%, more typically within 10%, and even more typically
within 5% or within 1% of a given value or range. Sometimes, such a
range can be within the experimental error typical of standard
methods used for the measurement and/or determination of a given
value or range. The allowable variation encompassed by the term
"about" will depend upon the particular system under study, and can
be readily appreciated by one of ordinary skill in the art.
Whenever a range is recited within this application, every whole
number integer within the range is also contemplated as an
embodiment of the disclosure.
[0633] The terms "comprising", "comprise" and "comprises" herein
are intended by the inventors to be optionally substitutable with
the terms "consisting of", "consist of" and "consists of",
respectively, in every instance.
[0634] All references or patent applications cited within this
patent specification are incorporated by reference herein.
[0635] The invention is illustrated in the accompanying examples.
The examples below are carried out using standard techniques, which
are well known and routine to those of skill in the art, except
where otherwise described in detail. The examples are illustrative,
but do not limit the invention.
EXAMPLE
Example 1 Cross-Reactivity of S. pneumoniae (S. Pn.) 10A Monoclonal
Antibody (mAb) with S. pneumoniae 39 Bacterial Strain
[0636] The binding specificity of S. pn. 10A mAb was evaluated by
both flow cytometry and UAD assays.
[0637] For the flow cytometry study, cultured bacteria were fixed
in 1% (vol/vol) paraformaldehyde, stained by S. pn. 10A mAb or
control mouse IgG. The bound S. pn. 10A mAb was detected by
biotinylated goat anti-mouse IgG followed by
streptavidin-phycoerythrin. As shown in FIG. 1, S. pn. 39 strain
exhibited similar higher level of 10A mAb specific signal compared
to that of the homologous S. pn. 10A strain. There was no
significant cross-reactivity of S. pneumoniae mAb observed with
strains of all other 89 S. pneumoniae serotypes including strains
of S. pneumoniae serogroup 10 (10B, 10C, 10F) as well as 407 of
non-S. pneumoniae microorganisms (data not shown).
[0638] The cross-reactivity of the S. pn. 10A mAb with S. pn. 39
was further evaluated using either crude antigens (Sheppard et al,
J. Med. Microbiol. 2011, 60, 49-55.) or purified polysaccharides
(Pride et al, Clin. Vaccine Immunol. 2012, 19, 1131-41) in the
multiplex urinary antigen detection (UAD) assay format.
[0639] The reactivity of S. pn. 10A mAb was presented as mean
fluorescence intensities (MFIs). The equivalent levels of the S.
pn. 10A mAb specific reactivities were detected with equal amounts
of crude bacterial antigens of the S. pn. 10A and S. pn. 39, as
shown in FIG. 2. Baseline MFI was obtained with S. pn 11A crude
bacterial lysate used as negative control. Consistent with these
observations, S. pn. 10A mAb reacted with S. pn. 10A and 39 CPs in
UAD assay and not with other CPs of S. pn. serogroup 10: 10B, 10C
and 10A (Figure-3). These data suggest shared antigenic epitopes
present in both S. pn. 10A and S. pn. 39 capsular polysaccharides
(CPs), which are responsible for the reactivity with S. pn. 10A
serotype specific mAb.
Example 2 S. Pn. Serotype 10A mAbs Mediate Killing of S. Pn.
Serotype 39 Strain
[0640] Several S. pn. serotype 10A capsular polysaccharide (CP)
specific monoclonal antibodies were tested for their capability to
kill a S. pn. 39 and 10A strains in OPA killing assay. S. pn. 11A
strain was used as negative control.
[0641] Results (see FIG. 4) showed that S. pn. 10A specific mAbs
can mediate killing of both S. pn. 10A and S. pn. 39 strains. There
was no killing of S. pn. 11A strain observed with these mAb.
[0642] The 10A mAb OPA killing of S. pn. 10A and S. pn. 39 strains
could be inhibited by the addition of both homologous and
heterologous 10A and 39 capsular polysaccharides respectively.
Addition of serotype 10B, 10C, 1.degree. F., 9V and 36 CPs did not
inhibit the killing (see FIGS. 5 and 6).
[0643] These results confirmed cross-reactivity results observed by
FACS and UAD analysis, suggesting the presence of similar
functional structural epitopes between structures of S. pn. 10A and
S. pn. 39 capsular polysaccharides expressed on the bacterial cells
surface of both serotypes.
Example 3 23 v S. Pn. Polysaccharide Vaccine Immune Sera can
Mediate OPA Killing of Both S. Pn. 10A and 39 Bacteria
[0644] Sera from human subjects immunized with a 23 v S. pn.
polysaccharide vaccine (serotypes 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V,
10A, 11A, 12F, 14, 15B, 17F, 18C, 19F, 19A, 20, 22F, 23F, and 33F),
which contains S. pn. 10A but not S. pn. 39 CP, were tested in S.
pn. serotype 10A and S. pn. 39 OPA killing assays. Data (FIG. 7)
showed good correlation of individual sera to kill both S. pn. 10A
and 39 strains with 23.6 fold increase and 5.6 fold increase in OPA
killing titer of Pn 10A and 39 strain respectively.
[0645] The specificity of the functional antibodies was determined
by OPA killing inhibition studies. The human 23 v S. pn.
polysaccharide vaccine immune sera from four subjects were tested
in S. pn. 10A competition OPA in the presence or absence of S. pn.
serogroup 10 CPs (10A, 10B, 10C, and 10F), and heterologous CPs of
S. pn. serotypes 9V, 36, and 39 (FIG. 8). Results showed that 10A
and 39 CPs inhibited OPA titers for all four tested sera. The 10B
CP was capable of inhibiting OPA killing mediated by two out of
four tested sera. Other polysaccharides did not inhibit 23 v CPs
immune sera killing S. pn. serotype 10A strain activity.
Example 4: Preparation of Pn-39 Conjugates to CRM.sub.197
[0646] Preparation of Isolated S. pneumoniae Serotype 39
Polysaccharide Serotype 39 capsular polysaccharides can be obtained
directly from bacteria using isolation procedures known to one of
ordinary skill in the art (see for example methods disclosed in
U.S. Patent App. Pub. Nos. 2006/0228380, 2006/0228381,
2007/0184071, 2007/0184072, 2007/0231340, and 2008/0102498 and WO
2008/118752). Streptococcus pneumoniae serotype 39 were grown in a
seed bottle and then transferred to a seed fermentor. Once the
targeted optical density was reached, the cells were transferred to
a production fermentor. The fermentation broth was inactivated by
the addition of N-lauroyl sarcosine and purified by ultrafiltration
and diafiltration.
[0647] Oxidation of Isolated Streptococcus pneumoniae Serotype 39
Capsular Polysaccharide
[0648] Polysaccharide oxidation was carried out in 100 mM potassium
phosphate buffer (pH 6.0.+-.0.2) by sequential addition of
calculated amount of 500 mM potassium phosphate buffer (pH 6.0) and
WFI to give final polysaccharide concentration of 2.0 g/L. If
required, the reaction pH was adjusted to pH 6.0, approximately.
After pH adjustment, the reaction temperature was adjusted to
23.+-.2.degree. C. Oxidation was initiated by the addition of
approximately 0.1 molar equivalents of sodium periodate. The
oxidation reaction was performed at 23.+-.2.degree. C. during 16
hrs, approximately.
[0649] Concentration and diafiltration of the activated
polysaccharide was carried out using 10K MWCO ultrafiltration
cassettes. Diafiltration was performed against 20-fold diavolumes
of WFI. The purified activated polysaccharide was then stored at
5.+-.3.degree. C. The purified activated saccharide is
characterized inter alia by (i) saccharide concentration by
colorimetric assay; (ii) aldehyde concentration by colorimetric
assay; (iii) Degree of Oxidation and (iv) Molecular Weight by
SEC-MALLS
[0650] SEC-MALLS is used for the determination of the molecular
weight of polysaccharides and polysaccharide-protein conjugates.
SEC is used to separate the polysaccharides by hydrodynamic volume.
Refractive index (RI) and multi-angle laser light scattering
(MALLS) detectors are used for the determination of the molecular
weight. When light interacts with matter, it scatters and the
amount of scattered light is related to the concentration, the
square of the dn/dc (the specific refractive index increments), and
the molar mass of the matter. The molecular weight measurement is
calculated based on the readings from the scattered light signal
from the MALLS detector and the concentration signal from the RI
detector.
[0651] The degree of oxidation (DO=moles of sugar repeat unit/moles
of aldehyde) of the activated polysaccharide was determined as
follows:
[0652] The moles of sugar repeat unit is determined by various
colorimetric methods, example by using Anthrone method. By the
Anthrone method, the polysaccharide is first broken down to
monosaccharides by the action of sulfuric acid and heat. The
Anthrone reagent reacts with the hexoses to form a yellow-green
colored complex whose absorbance is read spectrophotometrically at
625 nm. Within the range of the assay, the absorbance is directly
proportional to the amount of hexose present.
[0653] The moles of aldehyde also is determined simultaneously,
using MBTH colorimetric method. The MBTH assay involves the
formation of an azine compound by reacting aldehyde groups (from a
given sample) with a 3-methyl-2-benzothiazolone hydrazone (MBTH
assay reagent). The excess 3-methyl-2-benzothiazolone hydrazone
oxidizes to form a reactive cation. The reactive cation and the
azine react to form a blue chromophore. The formed chromophore is
then read spectroscopically at 650 nm.
[0654] The conjugation process consists of the following steps:
[0655] a) Compounding with sucrose excipient and lyophilization
[0656] b) Reconstitution of the lyophilized activated
polysaccharide and CRM.sub.197
[0657] c) Conjugation of activated polysaccharide to CRM.sub.197
and capping
[0658] d) Purification of the conjugate
[0659] a) Compounding with Sucrose Excipient, and
Lyophilization
[0660] The activated polysaccharide was compounded with sucrose to
a ratio of 25 grams of sucrose per gram of activated
polysaccharide. The bottle of compounded mixture was then
lyophilized. Following lyophilization, bottles containing
lyophilized activated polysaccharide were stored at
-20.+-.5.degree. C. Calculated amount of CRM.sub.197 protein was
shell-frozen and lyophilized separately. Lyophilized CRM.sub.197
was stored at -20.+-.5.degree. C.
[0661] b) Reconstitution of Lyophilized Activated Polysaccharide
and CRM.sub.197 Protein
[0662] Lyophilized activated polysaccharide was reconstituted in
anhydrous dimethyl sulfoxide (DMSO). Upon complete dissolution of
polysaccharide, an equal amount of anhydrous DMSO was added to
lyophilized CRM.sub.197 for reconstitution.
[0663] c) Conjugation and Capping
[0664] Reconstituted activated polysaccharide was combined with
reconstituted CRM.sub.197 in the reaction vessel, followed by
mixing thoroughly to obtain a clear solution before initiating the
conjugation with sodium cyanoborohydride. The final polysaccharide
concentration in reaction solution is approximately 1 g/L.
Conjugation was initiated by adding 1.0-1.5 MEq of sodium
cyanoborohydride to the reaction mixture and was incubated at
23.+-.2.degree. C. for 40-48 hrs. Conjugation reaction was
terminated by adding 2 MEq of sodium borohydride (NaBH.sub.4) to
cap unreacted aldehydes. This capping reaction continued at
23.+-.2.degree. C. for 3.+-.1 hrs.
[0665] d) Purification of the Conjugate
[0666] The conjugate solution was diluted 1:10 with chilled 5 mM
succinate-0.9% saline (pH 6.0) in preparation for purification by
tangential flow filtration. The diluted conjugate solution was
passed through a 5 .mu.m filter and diafiltration was performed
using 5 mM succinate-0.9% saline (pH 6.0) as the medium. After the
diafiltration was completed, the conjugate retentate was
transferred through a 0.22 .mu.m filter.
[0667] The conjugate was diluted further with 5 mM succinate/0.9%
saline (pH 6), to a target saccharide concentration of
approximately 0.5 mg/mL. Final 0.22 .mu.m filtration step was
completed to obtain the immunogenic conjugate. The data from the
conjugates, using polysaccharides (MW range 50-100 kDa) are
summarized in Table 1. All the conjugates meet the required quality
attributes, including MW, SPRatio, Free Protein, Modified Lysines
and Free Saccharide levels.
TABLE-US-00003 TABLE 1 MW50A MW50B MW75 MW100 Activation
Polysaccahride MW (kDa) 1203 1203 1203 1203 Degree of Oxidation
(DO) 11.9 11.9 19.4 23.7 Activated Polysaccharide 52 52 73 102 MW
(kDa) Conjugation Saccharide/Protein Ratio 0.76 0.67 0.59 0.48 MW
(kDa) 4111 8778 7664 15080 % Free Saccharide 9.7 8 12.6 17.3 Free
Protein <1% <1% <1% <1% Modified Lysines (AAA) 5.3 4.1
3.1 3.3
Example 5: Preparation of Pn-39 Conjugates to TT
[0668] S. pneumoniae 39 polysaccharide was activated with the
cyanylating reagent 1-cyano-4-dimethylaminopyridinium
tetrafluoroborate (DAP) and then directly conjugated to the tetanus
toxoid (TT) protein under mild alkaline (pH=8.2) conditions as
follows:
[0669] Activation of Pn 39 Polysaccharide
[0670] 0.25 mL of CDAP (100 mg/mL solution in acetonitrile) was
slowly added to 5.35 mL of Pn 39 polysaccharide solution (3.74
mg/mL in 0.9% NaCl). The reaction mixture was vortexed for sec. and
incubated for 30 sec at 25.+-.5.degree. C. After the incubation,
1.0 mL of 0.2 M triethylamine (TEA) was added and the reaction
mixture was incubated for 2-2.5 min at 25.+-.5.degree. C.
[0671] Conjugation of Activated Polysaccharide to Tetanus Toxoid
(TT)
[0672] 8.3 mL of TT (3 mg/mL in 250 mM HEPES, 0.9% NaCl, pH 8.2.TT
carrier protein) was added to the activated Pn 39 polysaccharide
immediately after activation, using a 25 mL sterile serological
pipet. Conjugation mixture was incubated at 25.+-.5.degree. C. for
16 hours and diafiltered against 500 mL of 0.9% NaCl using a
PBMK-300K Millipore membrane. Purified conjugates were
characterized for polysaccharide and protein concentrations, PS:TT
ratio, free saccharide and Mw (see results in table below).
TABLE-US-00004 Conjugate Ratio PS:TT (w:w) Free Saccharide (%) MW
(kDa) Pn 39-TT 0.7:1 7.0 21630
Example 6: S. Pn. 39 Conjugate Hyperimmune Sera are Functional
Against S. Pn 10A Bacteria in Killing OPA
[0673] S. pn. 39 capsular polysaccharide was conjugated to two
protein carriers, tetanus toxoid (TT) and CRM.sub.197. S.pn. 39-TT
conjugate was prepared by CDAP chemistry (see example 5) and two S.
pn. 39-CRM.sub.197 conjugates were prepared by conjugation of S.
pn. 39 CP activated at two activation levels using reductive
amination chemistry (see example 4). NZW rabbits were immunized at
wk. 0 and 2 with 2.2 .mu.g of S. pn. 39 conjugate+0.125 mg of
AlPO4. Sera were collected at week 0 and 4 and analyzed in OPA
assays for their capability to kill S. pn 39 and 10A bacteria.
[0674] Results (see FIGS. 9-10) showed that regardless of the
protein carrier, activation level or conjugation chemistry used, S.
pn. 39 CP conjugates induced antibodies are capable to kill both S.
pn 39 and S. pn 10A bacteria.
[0675] These data demonstrate that in addition to homologous
bacterial serotype strain, S. pn. 39 CP conjugate vaccine is also
able to induce functional antibodies against heterologous S.pn 10A
bacteria.
Example 7: S. Pn. 10A CP Conjugate Hyperimmune Sera are Functional
Against S. Pn 39 Bacteria in Killing OPA
[0676] Rabbit antibodies generated by vaccination with the
monovalent S. pn. 10A CP-CRM conjugate (see WO2015110941) and
multivalent 20V PnC vaccine (formulation of twenty different S. pn.
conjugates which contained S. pn. 10A CP conjugate but not S. pn.
39 CP conjugate; see WO2015110941) were able to kill both S. pn.
10A and 39 bacterial strains in OPA assays (FIGS. 12 and 13).
[0677] All publications and patent applications mentioned in the
specification are indicative of the level of those skilled in the
art to which this invention pertains. All publications and patent
applications are hereby incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
[0678] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, certain changes and modifications may be
practiced within the scope of the appended claims.
Sequence CWU 1
1
10121DNAArtificial Sequence"B class" CpG oligonucleotide
1tcgtcgtttt tcggtgcttt t 21221DNAArtificial Sequence"B class" CpG
oligonucleotide 2tcgtcgtttt tcggtcgttt t 21324DNAArtificial
Sequence"B class" CpG oligonucleotide 3tcgtcgtttt gtcgttttgt cgtt
24424DNAArtificial Sequence"B class" CpG oligonucleotide
4tcgtcgtttc gtcgttttgt cgtt 24524DNAArtificial Sequence"B class"
CpG oligonucleotide 5tcgtcgtttt gtcgtttttt tcga 24621DNAArtificial
Sequence"B class" CpG oligonucleotide 6tcgtcgtttt tcggtgcttt t
21721DNAArtificial Sequence"B class" CpG oligonucleotide
7tcgtcgtttt tcggtcgttt t 21824DNAArtificial Sequence"B class" CpG
oligonucleotide 8tcgtcgtttt gtcgttttgt cgtt 24924DNAArtificial
Sequence"B class" CpG oligonucleotide 9tcgtcgtttc gtcgttttgt cgtt
241024DNAArtificial Sequence"B class" CpG oligonucleotide
10tcgtcgtttt gtcgtttttt tcga 24
* * * * *
References