U.S. patent application number 16/898892 was filed with the patent office on 2020-12-24 for agents for treatment of claudin expressing cancer diseases.
The applicant listed for this patent is BioNTech AG, Ganymed Pharmaceuticals GmbH, TRON TRON-Translationale Onkologie an der Universitatsmedizin der Johannes Gutenberg-Universitat Ma. Invention is credited to Hayat Bahr-Mahmud, Tim Beissert, Markus Fiedler, Julia Holland, Arne Jendretzki, Fabrice Le Gall, Laura Plum, Ugur Sahin, Christiane Stadler, Ozlem Tureci.
Application Number | 20200399370 16/898892 |
Document ID | / |
Family ID | 1000005073535 |
Filed Date | 2020-12-24 |
![](/patent/app/20200399370/US20200399370A1-20201224-D00001.png)
![](/patent/app/20200399370/US20200399370A1-20201224-D00002.png)
![](/patent/app/20200399370/US20200399370A1-20201224-D00003.png)
![](/patent/app/20200399370/US20200399370A1-20201224-D00004.png)
![](/patent/app/20200399370/US20200399370A1-20201224-D00005.png)
![](/patent/app/20200399370/US20200399370A1-20201224-D00006.png)
![](/patent/app/20200399370/US20200399370A1-20201224-D00007.png)
![](/patent/app/20200399370/US20200399370A1-20201224-D00008.png)
![](/patent/app/20200399370/US20200399370A1-20201224-D00009.png)
![](/patent/app/20200399370/US20200399370A1-20201224-D00010.png)
![](/patent/app/20200399370/US20200399370A1-20201224-D00011.png)
View All Diagrams
United States Patent
Application |
20200399370 |
Kind Code |
A1 |
Sahin; Ugur ; et
al. |
December 24, 2020 |
Agents for Treatment of Claudin Expressing Cancer Diseases
Abstract
The present invention provides binding agents that contain a
binding domain that is specific for CD3 allowing binding to T cells
and a binding domain that is specific for a tumor-associated
claudin molecule and methods of using these binding agents or
nucleic acids encoding therefor for treating cancer.
Inventors: |
Sahin; Ugur; (Mainz, DE)
; Tureci; Ozlem; (Mainz, DE) ; Stadler;
Christiane; (Bensheim, DE) ; Holland; Julia;
(Mainz, DE) ; Bahr-Mahmud; Hayat; (Wiesbaden,
DE) ; Beissert; Tim; (Gross-Gerau, DE) ; Plum;
Laura; (Mainz, DE) ; Le Gall; Fabrice; (Mainz,
DE) ; Jendretzki; Arne; (Mainz-Kostheim, DE) ;
Fiedler; Markus; (Halle an der Saale, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BioNTech AG
Ganymed Pharmaceuticals GmbH
TRON TRON-Translationale Onkologie an der Universitatsmedizin der
Johannes Gutenberg-Universitat Ma |
Mainz
Mainz
Mainz |
|
DE
DE
DE |
|
|
Family ID: |
1000005073535 |
Appl. No.: |
16/898892 |
Filed: |
June 11, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16117197 |
Aug 30, 2018 |
10717780 |
|
|
16898892 |
|
|
|
|
14442445 |
May 13, 2015 |
10093736 |
|
|
PCT/EP2013/003399 |
Nov 12, 2013 |
|
|
|
16117197 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 16/2809 20130101;
C07K 16/30 20130101; C07K 16/28 20130101; A61K 2039/505 20130101;
C07K 2317/74 20130101; C07K 2317/622 20130101; C07K 2317/31
20130101; C07K 2317/73 20130101 |
International
Class: |
C07K 16/28 20060101
C07K016/28; C07K 16/30 20060101 C07K016/30 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 13, 2012 |
EP |
PCT/EP2012/004712 |
Jul 30, 2013 |
EP |
PCT/EP2013/002270 |
Claims
1.-38. (canceled)
39. A bispecific antibody comprising a first binding domain and a
second binding domain, wherein the first binding domain binds to
claudin 6 (CLDN6) and the second binding domain binds to CD3,
wherein (a) the first binding domain comprises a variable domain of
a heavy chain of an immunoglobulin (VH) comprising an amino acid
sequence selected from the group consisting of SEQ ID NOs: 20, 22,
24, and 26 and a variable domain of a light chain of an
immunoglobulin (VL) comprising an amino acid sequence selected from
the group consisting of SEQ ID NOs: 21, 23, 25, and 27 to 29; and
(b) the second binding domain of said bispecific antibody comprises
a VH comprising an amino acid sequence selected from the group
consisting of SEQ ID NOs: 30, 32, 34, and 36 and a VL comprising an
amino acid sequence selected from the group consisting of SEQ ID
NOs: 31, 33, 35, and 37.
40. The bispecific antibody of claim 39, further comprising an
N-terminal secretion signal.
41. The bispecific antibody of claim 39, further comprising a
C-terminal His tag or a C-terminal IgG constant region.
42. The bispecific antibody of claim 39, wherein the first binding
domain comprises a VH comprising an amino acid sequence according
to SEQ ID NO: 22 and a VL comprising an amino acid sequence
according to SEQ ID NO: 21.
43. The bispecific antibody of claim 39, wherein the VH of the
first binding domain is covalently linked to the VL of the first
binding domain.
44. The bispecific antibody of claim 39, wherein the bispecific
antibody is conjugated to a therapeutic moiety.
45. The bispecific antibody of claim 44, wherein the therapeutic
moiety is a cytotoxin, a drug or a radioisotope.
46. A recombinant nucleic acid comprising a nucleic acid sequence
encoding the bispecific antibody of claim 39.
47. A cell comprising one or more nucleic acid sequences encoding
the bispecific antibody of claim 39.
48. A composition comprising the bispecific antibody of claim 39 or
one or more nucleic acid sequences encoding the bispecific antibody
of claim 39.
49. The composition of claim 48 further comprising pharmaceutically
acceptable salts, buffer substances, preservatives, carriers,
diluents and/or excipients.
50. A method of treating a patient affected from a cancer
characterized by cancer cells expressing claudin 6 (CLDN6), the
method comprising administering to the patient a composition of
claim 49, wherein the composition is delivered by parenteral
administration.
51. The method of claim 50, wherein the cancer is selected from the
group consisting of urinary bladder cancer, ovarian cancer, in
particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung
cancer, including small cell lung cancer (SCLC) and non-small cell
lung cancer (NSCLC), in particular squamous cell, lung carcinoma
and adenocarcinoma, gastric cancer, breast cancer, hepatic cancer,
pancreatic cancer, skin cancer, in particular basal cell carcinoma
and squamous cell carcinoma, malignant melanoma, head and neck
cancer, in particular malignant pleomorphic adenoma, sarcoma, in
particular synovial sarcoma and carcinosarcoma, bile duct cancer,
cancer of the urinary bladder, in particular transitional cell
carcinoma, and papillary carcinoma, kidney cancer, in particular
renal cell carcinoma including clear cell renal cell carcinoma and
papillary renal cell carcinoma, colon cancer, small bowel cancer,
including cancer of the ileum, in particular small bowel
adenocarcinoma and adenocarcinoma of the ileum, testicular
embryonal carcinoma, placental choriocarcinoma, cervical cancer,
testicular cancer, in particular testicular seminoma, testicular
teratoma and embryonic testicular cancer, uterine cancer, germ cell
tumors such as a teratocarcinoma or an embryonal carcinoma, in
particular germ cell tumors of the testis, and the metastatic forms
thereof.
52. The method of claim 50, wherein the composition comprises the
bispecific antibody in Ringer's lactate.
53. The method of claim 51, wherein the composition comprises the
bispecific antibody in Ringer's lactate.
54. The method of claim 50, wherein the composition comprises the
one or more nucleic acid sequences encoding the bispecific antibody
of claim 1 in sterile water, Ringer's solution, Ringer's lactate
solution, sterile sodium chloride solution, polyalkylene glycols,
hydrogenated naphthalenes and, in particular, biocompatible lactide
polymers, lactide/glycolide copolymers or
polyoxyethylene/polyoxy-propylene copolymers, and wherein the
recombinant nucleic acid is RNA.
55. The method of claim 51, wherein the composition comprises the
one or more nucleic acid sequences encoding the bispecific antibody
of claim 1 in sterile water, Ringer's solution, Ringer's lactate
solution, sterile sodium chloride solution, polyalkylene glycols,
hydrogenated naphthalenes and, in particular, biocompatible lactide
polymers, lactide/glycolide copolymers or
polyoxyethylene/polyoxy-propylene copolymers, and wherein the
recombinant nucleic acid is RNA.
56. The method of claim 54, wherein the RNA is delivered as a
liposome or viral particle.
57. The method of claim 55, wherein the RNA is delivered as a
liposome or viral particle.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 16/117,197, filed Aug. 30, 2018, which is a divisional of U.S.
application Ser. No. 14/442,445, filed Oct. 9, 2018, is a national
stage entry of PCT/EP2013/003399, filed on Nov. 12, 2013, each of
which is incorporated by reference herein in its entirety.
REFERENCE TO SEQUENCE LISTING
[0002] The Sequence Listing submitted Jun. 11, 2020 as a text file
named "37592-_0001U3_Sequence_Listing.txt," created on Jun. 9,
2020, and having a size of 226,612 bytes is hereby incorporated by
reference pursuant to 37 C.F.R. .sctn. 1.52(e)(5).
[0003] Claudins are integral membrane proteins located within the
tight junctions of epithelia and endothelia. Claudins are predicted
to have four transmembrane segments with two extracellular loops,
and N- and C-termini located in the cytoplasm. The claudin (CLDN)
family of transmembrane proteins plays a critical role in the
maintenance of epithelial and endothelial tight junctions and might
also play a role in the maintenance of the cytoskeleton and in cell
signaling.
[0004] The claudin 18 (CLDN18) molecule is an integral
transmembrane protein (tetraspanin) having four membrane spanning
hydrophobic regions and two extracellular loops (loop1 embraced by
hydrophobic region 1 and hydrophobic region 2; loop2 embraced by
hydrophobic regions 3 and 4). CLDN18 exists in two different splice
variants, which are described in mouse and in human (Niimi, Mol.
Cell. Biol. 21:7380-90, 2001). The splice variants (Genbank
accession number: splice variant 1 (CLDN18.1): NP 057453, NM
016369, and splice variant 2 (CLDN18.2): NM_001002026, NP
001002026) have a molecular weight of approximately 27.9/27.72 kD.
The splice variants CLDN18.1 and CLDN18.2 differ in the N-terminal
portion which comprises the first transmembrane (TM) region and
loop1, whereas the primary protein sequence of the C-terminus is
identical.
[0005] In normal tissues, there is no detectable expression of
CLDN18.2 with exception of stomach where CLDN18.2 is expressed
exclusively on short-lived differentiated gastric epithelial cells.
CLDN18.2 is maintained in the course of malignant transformation
and thus frequently displayed on the surface of human gastric
cancer cells. Moreover, this pan-tumoral antigen is ectopically
activated at significant levels in esophageal, pancreatic and lung
adenocarcinomas. The CLDN18.2 protein is also localized in lymph
node metastases of gastric cancer adenocarcinomas and in distant
metastases especially into the ovary (so-called Krukenberg
tumors).
[0006] CLDN6 is expressed in a series of different human cancer
cells while expression in normal tissues is limited to
placenta.
[0007] The differential expression of claudins such as CLDN18.2 and
CLDN6 between cancer and normal cells, their membrane localization
and their absence from the vast majority of toxicity relevant
normal tissues makes these molecules attractive targets for cancer
immunotherapy and the use of antibody-based therapeutics for
targeting claudins in cancer therapy promises a high level of
therapeutic specificity.
[0008] Approaches using the potential of T cells for the treatment
of cancer include vaccination with tumor-derived proteins, RNA or
peptide antigen, infusion of tumor-derived, ex-vivo expanded T
cells (called adoptive transfer), T cell receptor gene transfer or
direct engagement of T cells by bi- or trispecific antibodies.
Likewise, many stimulants of T cell responses are clinically tested
in combination or as monotherapy, such as ligands for Toll-like
receptors, antibodies blocking CTLA-4 on T cells, immune
stimulatory cytokines, or antibodies neutralizing molecules
involved in immune escape of cancer cells such as TGF-beta or
B7-H1. The intense development of T cell-based therapies is
motivated by the observation that patients appear to live
significantly longer if their tumors are infiltrated by T cells.
Moreover, numerous mouse models have shown that engagement of T
cells by various means can eradicate even large tumors and a number
of T cell therapies have recently made significant progress in
treating various cancer indications.
[0009] It has been an object of the invention to provide novel
agents and methods for the therapy of cancer diseases.
[0010] The solution of the problem underlying the invention is
based on the concept of generating a binding agent that contains a
binding domain that is specific for a tumor-associated claudin
molecule, i.e. cancer cells. The other binding domain is specific
for CD3 allowing binding to T cells and allows to pull the T cells
into the complex, thus making it possible to target the cytotoxic
effect of the T cells to the cancer cells. Formation of this
complex can induce signalling in cytotoxic T cells, either on its
own or in combination with accessory cells, which leads to the
release of cytotoxic mediators.
[0011] We report for the first time that binding agents targeting
claudin and CD3 can induce potent T cell-mediated lysis and are
effective in treating tumor diseases.
SUMMARY OF THE INVENTION
[0012] In one aspect the invention relates to a binding agent
comprising at least two binding domains, wherein a first binding
domain binds to claudin and a second binding domain binds to CD3.
The binding agent of the invention may bind to a cytotoxic cell (by
engaging the CD3 receptor) and a cancer cell expressing CLDN to be
destroyed as a target.
[0013] In one embodiment the binding agent is a bispecific molecule
such as a bispecific antibody, in particular a bispecific single
chain antibody. In one embodiment said claudin is expressed in a
cancer cell. In one embodiment said claudin is expressed on the
surface of a cancer cell. In one embodiment said claudin is
selected from the group consisting of claudin 18.2 and claudin 6.
In one embodiment said first binding domain binds to an
extracellular domain of said claudin. In one embodiment said first
binding domain binds to native epitopes of CLDN present on the
surface of living cells. In one embodiment said first binding
domain binds to the first extracellular loop of CLDN. In one
embodiment said second binding domain binds to the epsilon-chain of
CD3. In one embodiment said CD3 is expressed on the surface of a T
cell. In one embodiment binding of said binding agent to CD3 on T
cells results in proliferation and/or activation of said T cells,
wherein said activated T cells preferably release cytotoxic
factors, e.g. performs and granzymes, and initiate cytolysis and
apoptosis of cancer cells. In one embodiment said binding to
claudin and/or said binding to CD3 is a specific binding.
[0014] In one embodiment the binding agent is in the format of a
full-length antibody or an antibody fragment. In one embodiment the
binding agent comprises four antibody variable domains with at
least two binding domains, wherein at least one binding domain
binds to claudin and at least one binding domain binds to CD3. In
one embodiment the binding agent comprises a variable domain of a
heavy chain of an immunoglobulin (VH) with a specificity for a
claudin antigen (VH(CLDN)), a variable domain of a light chain of
an immunoglobulin (VL) with a specificity for a claudin antigen
(VL(CLDN)), a variable domain of a heavy chain of an immunoglobulin
(VH) with a specificity for CD3 (VH(CD3)), and a variable domain of
a light chain of an immunoglobulin (VL) with a specificity for CD3
(VL(CD3)).
[0015] In one embodiment the binding agent is in the format of a
diabody that comprises a heavy chain variable domain connected to a
light chain variable domain on the same polypeptide chain such that
the two domains do not pair. In one embodiment the diabody
comprises two polypeptide chains, wherein one polypeptide comprises
VH(CLDN) and VL(CD3) and the other polypeptide chain comprises
VH(CD3) and VL(CLDN).
[0016] In one embodiment the binding agent is in the format of a
bispecific single chain antibody that consists of two scFv
molecules connected via a linker peptide, wherein the heavy chain
variable regions (VH) and the corresponding light chain variable
regions (VL) are preferably arranged, from N-terminus to
C-terminus, in the order VH(CLDN)-VL(CLDN)-VH(CD3)-VL(CD3),
VH(CD3)-VL(CD3)-VH(CLDN)-VL(CLDN) or
VH(CD3)-VL(CD3)-VL(CLDN)-VH(CLDN). In one embodiment said heavy
chain variable regions (VH) and the corresponding light chain
variable regions (VL) are connected via a long peptide linker,
preferably, a peptide linker comprising the amino acid sequences
(GGGGS)3 or VE(GGGGS)2GGVD. In one embodiment said two VH-VL or
VL-VH scFv units are connected via a short peptide linker,
preferable a peptide linker comprising the amino acid sequence
SGGGGS or GGGGS.
[0017] In one embodiment said CLDN is CLDN18.2 and said VH(CLDN)
comprises an amino acid sequence represented by SEQ ID NO: 8 or a
fragment thereof or a variant of said amino acid sequence or
fragment and the VL(CLDN) comprises an amino acid sequence
represented by SEQ ID NO: 15 or a fragment thereof or a variant of
said amino acid sequence or fragment.
[0018] In one embodiment said CLDN is CLDN18.2 and said VH(CLDN)
comprises an amino acid sequence represented by SEQ ID NO: 6 or a
fragment thereof or a variant of said amino acid sequence or
fragment and the VL(CLDN) comprises an amino acid sequence
represented by SEQ ID NO: 11 or a fragment thereof or a variant of
said amino acid sequence or fragment.
[0019] In one embodiment said CLDN is CLDN6 and said VH(CLDN)
comprises an amino acid sequence represented by SEQ ID NO: 22 or a
fragment thereof or a variant of said amino acid sequence or
fragment and the VL(CLDN) comprises an amino acid sequence
represented by SEQ ID NO: 23 or a fragment thereof or a variant of
said amino acid sequence or fragment.
[0020] In one embodiment said CLDN is CLDN6 and said VH(CLDN)
comprises an amino acid sequence represented by SEQ ID NO: 22 or a
fragment thereof or a variant of said amino acid sequence or
fragment and the VL(CLDN) comprises an amino acid sequence
represented by SEQ ID NO: 97, 98, 99 or 100, or a fragment thereof
or a variant of said amino acid sequence or fragment.
[0021] In one embodiment said VH(CD3) comprises an amino acid
sequence represented by SEQ ID NO: 36, 94 or 95, or a fragment
thereof or a variant of said amino acid sequence or fragment and
the VL(CD3) comprises an amino acid sequence represented by SEQ ID
NO: 37 or 96 or a fragment thereof or a variant of said amino acid
sequence or fragment.
[0022] In one embodiment said VH(CD3) comprises an amino acid
sequence represented by SEQ ID NO: 36 or a fragment thereof or a
variant of said amino acid sequence or fragment and the VL(CD3)
comprises an amino acid sequence represented by SEQ ID NO: 37 or a
fragment thereof or a variant of said amino acid sequence or
fragment.
[0023] In one embodiment said VH(CD3) comprises an amino acid
sequence represented by SEQ ID NO: 95, or a fragment thereof or a
variant of said amino acid sequence or fragment and the VL(CD3)
comprises an amino acid sequence represented by SEQ ID NO: 96 or a
fragment thereof or a variant of said amino acid sequence or
fragment.
[0024] In one aspect the binding agent of the invention is in the
format of a bispecific single chain antibody that comprises two
scFv molecules connected via a linker peptide, wherein the heavy
chain variable regions (VH) and the corresponding light chain
variable regions (VL) are arranged, from N-terminus to C-terminus,
in the order VH(CLDN)-VL(CLDN)-VH(CD3)-VL(CD3). In one embodiment
said VH(CD3) and VL(CD3) are connected via a peptide linker
consisting of 15 to 20, preferably 15 or 20 amino acids, preferably
glycine and/or serine, and preferably are connected via a peptide
linker comprising the amino acid sequence (GGGGS)4. In one
embodiment said VH(CLDN) and VL(CLDN) are connected via a peptide
linker consisting of 15 to 20, preferably 15 or 20 amino acids,
preferably glycine and/or serine, and preferably are connected via
a peptide linker comprising the amino acid sequence (GGGGS)4. In
one embodiment said two VH-VL scFv units are connected via a linker
peptide comprising the amino acid sequence SGGGGS. One or both of
said two VH-VL scFv units may comprise one or more interface
disulfide bridges.
[0025] In one aspect the binding agent of the invention is in the
format of a bispecific single chain antibody that comprises two
scFv molecules connected via a linker peptide, wherein the heavy
chain variable regions (VH) and the corresponding light chain
variable regions (VL) are arranged, from N-terminus to C-terminus,
in the order VL(CLDN)-VH(CLDN)-VH(CD3)-VL(CD3). In one embodiment
said VH(CD3) and VL(CD3) are connected via a peptide linker
consisting of 15 to 20, preferably 15 or 20 amino acids, preferably
glycine and/or serine, and preferably are connected via a peptide
linker comprising the amino acid sequence (GGGGS)4. In one
embodiment said VL(CLDN) and VH(CLDN) are connected via a peptide
linker consisting of 20 to 25, preferably 20 or 25 amino acids,
preferably glycine and/or serine, and preferably are connected via
a peptide linker comprising the amino acid sequence (GGGGS)5. In
one embodiment said VL-VH and VH-VL scFv units are connected via a
linker peptide comprising the amino acid sequence SGGGGS. One or
both of said two VL-VH or VH-VL scFv units may comprise one or more
interface disulfide bridges.
[0026] In one aspect the binding agent of the invention is in the
format of a bispecific single chain antibody that comprises two
scFv molecules connected via a linker peptide, wherein the heavy
chain variable regions (VH) and the corresponding light chain
variable regions (VL) are arranged, from N-terminus to C-terminus,
in the order VH(CLDN)-VL(CLDN)-VL(CD3)-VH(CD3). Preferably, said
VL(CD3)-VH(CD3) scFv unit comprises one or more interface disulfide
bridges. In one embodiment said VL(CD3) and VH(CD3) are connected
via a peptide linker consisting of 20 to 25, preferably 20 or 25
amino acids, preferably glycine and/or serine, and preferably are
connected via a peptide linker comprising the amino acid sequence
(GGGGS)5. In one embodiment said VH(CLDN) and VL(CLDN) are
connected via a peptide linker consisting of 15 to 20, preferably
15 or 20 amino acids, preferably glycine and/or serine, and
preferably are connected via a peptide linker comprising the amino
acid sequence (GGGGS)4. In one embodiment said VH-VL and VL-VH scFv
units are connected via a linker peptide comprising the amino acid
sequence SGGGGS. Said VH(CLDN)-VL(CLDN) scFv unit may comprise one
or more interface disulfide bridges.
[0027] In one aspect the binding agent of the invention is in the
format of a bispecific single chain antibody that comprises two
scFv molecules connected via a linker peptide, wherein the heavy
chain variable regions (VH) and the corresponding light chain
variable regions (VL) are arranged, from N-terminus to C-terminus,
in the order VL(CLDN)-VH(CLDN)-VL(CD3)-VH(CD3). Preferably, said
VL(CD3)-VH(CD3) scFv unit comprises one or more interface disulfide
bridges. In one embodiment said VL(CD3) and VH(CD3) are connected
via a peptide linker consisting of 20 to 25, preferably 20 or 25
amino acids, preferably glycine and/or serine, and preferably are
connected via a peptide linker comprising the amino acid sequence
(GGGGS)5. In one embodiment said VL(CLDN) and VH(CLDN) are
connected via a peptide linker consisting of 20 to 25, preferably
20 or 25 amino acids, preferably glycine and/or serine, and
preferably are connected via a peptide linker comprising the amino
acid sequence (GGGGS)5. In one embodiment said two VL-VH scFv units
are connected via a linker peptide comprising the amino acid
sequence SGGGGS. Said VL(CLDN)-VH(CLDN) scFv unit may comprise one
or more interface disulfide bridges.
[0028] In one embodiment of any of the above aspects, said CLDN is
CLDN18.2. Preferably said VH(CLDN) comprises an amino acid sequence
represented by SEQ ID NO: 8 or a fragment thereof or a variant of
said amino acid sequence or fragment and the VL(CLDN) comprises an
amino acid sequence represented by SEQ ID NO: 15 or a fragment
thereof or a variant of said amino acid sequence or fragment.
Alternatively, said VH(CLDN) comprises an amino acid sequence
represented by SEQ ID NO: 6 or a fragment thereof or a variant of
said amino acid sequence or fragment and the VL(CLDN) comprises an
amino acid sequence represented by SEQ ID NO: 11 or a fragment
thereof or a variant of said amino acid sequence or fragment. In
one embodiment said VH(CD3) comprises an amino acid sequence
represented by SEQ ID NO: 95 or a fragment thereof or a variant of
said amino acid sequence or fragment and the VL(CD3) comprises an
amino acid sequence represented by SEQ ID NO: 96 or a fragment
thereof or a variant of said amino acid sequence or fragment.
[0029] In one aspect the binding agent of the invention is in the
format of a bispecific single chain antibody that comprises two
scFv molecules connected via a linker peptide, wherein the heavy
chain variable regions (VH) and the corresponding light chain
variable regions (VL) are arranged, from N-terminus to C-terminus,
in the order VH(CLDN)-VL(CLDN)-VH(CD3)-VL(CD3) or in the order
VH(CD3)-VL(CD3)-VH(CLDN)-VL(CLDN). In one embodiment said VH(CLDN)
and VL(CLDN) are connected via a peptide linker consisting of 15 to
20, preferably 15 or 20 amino acids, preferably glycine and/or
serine, and preferably are connected via a peptide linker
comprising the amino acid sequence (GGGGS)3. In one embodiment said
VH(CD3) and VL(CD3) are connected via a peptide linker consisting
of 15 to 20, preferably 15 or 20 amino acids, preferably glycine
and/or serine, and preferably are connected via a peptide linker
comprising the amino acid sequence GGGGS(GGS)3GGGS. In one
embodiment said two VH-VL scFv units are connected via a linker
peptide comprising the amino acid sequence SGGGGS.
[0030] In one embodiment of the above aspect, said CLDN is CLDN6.
Preferably said VH(CLDN) comprises an amino acid sequence
represented by SEQ ID NO: 22 or a fragment thereof or a variant of
said amino acid sequence or fragment. Preferably said VL(CLDN)
comprises an amino acid sequence represented by SEQ ID NO: 98, 99
or 100 or a fragment thereof or a variant of said amino acid
sequence or fragment. Most preferably, said VL(CLDN) comprises an
amino acid sequence represented by SEQ ID NO: 99 or a fragment
thereof or a variant of said amino acid sequence or fragment. In
one embodiment said VH(CD3) comprises an amino acid sequence
represented by SEQ ID NO: 95, or a fragment thereof or a variant of
said amino acid sequence or fragment and the VL(CD3) comprises an
amino acid sequence represented by SEQ ID NO: 96 or a fragment
thereof or a variant of said amino acid sequence or fragment.
[0031] In one embodiment said CLDN is CLDN18.2 and said binding
agent of the invention comprises an amino acid sequence selected
from the group consisting of SEQ ID NOs: 38, 39, 40 and 41 or a
fragment or variant thereof.
[0032] In one embodiment said CLDN is CLDN18.2 and said binding
agent of the invention comprises an amino acid sequence selected
from the group consisting of SEQ ID NOs: 103, 66, 67, 68, 69, 70,
71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87,
88, 89, 90, 91, 92 and 93 or a fragment or variant thereof. In one
embodiment, said CLDN is CLDN18.2 and said binding agent comprises
an amino acid sequence selected from the group consisting of SEQ ID
NOs: 103, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79,
80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 and 93 or a
fragment or variant thereof, wherein said amino acid sequence lacks
secretion signals such as N-terminal secretion signals, in
particular the sequence according to SEQ ID NO: 51 and/or lacks
His-tags such as C-terminal His-tags, in particular the sequence
Gly-Gly-Ser-(His).sub.6 or (His).sub.6, if present.
[0033] In one embodiment said CLDN is CLDN6 and said binding agent
of the invention comprises an amino acid sequence selected from the
group consisting of SEQ ID NOs: 42, 43, 44 and 45 or a fragment or
variant thereof.
[0034] In one embodiment said CLDN is CLDN6 and said binding agent
of the invention comprises an amino acid sequence selected from the
group consisting of SEQ ID NOs: 101, 102, 60, 61, 62, 63, 64 and 65
or a fragment or variant thereof. In one embodiment said CLDN is
CLDN6 and said binding agent comprises an amino acid sequence
selected from the group consisting of SEQ ID NOs: 101, 102, 60, 61,
62, 63, 64 and 65 or a fragment or variant thereof, wherein said
amino acid sequence lacks secretion signals such as N-terminal
secretion signals, in particular the sequence according to SEQ ID
NO: 51 and/or lacks His-tags such as C-terminal His-tags, in
particular the sequence Gly-Gly-Ser-(His).sub.6 or (His).sub.6, if
present.
[0035] In one embodiment said cancer cells expressing CLDN18.2 are
cancer cells of a cancer selected from the group consisting of
gastric cancer, esophageal cancer, pancreatic cancer, lung cancer
such as non small cell lung cancer (NSCLC), breast cancer, ovarian
cancer, colon cancer, hepatic cancer, head-neck cancer, cancer of
the gallbladder and the metastasis thereof, a Krukenberg tumor,
peritoneal metastasis and/or lymph node metastasis.
[0036] In one embodiment said cancer cells expressing CLDN6 are
cancer cells of a cancer selected from the group consisting of
urinary bladder cancer, ovarian cancer, in particular ovarian
adenocarcinoma and ovarian teratocarcinoma, lung cancer, including
small cell lung cancer (SCLC) and non-small cell lung cancer
(NSCLC), in particular squamous cell lung carcinoma and
adenocarcinoma, gastric cancer, breast cancer, hepatic cancer,
pancreatic cancer, skin cancer, in particular basal cell carcinoma
and squamous cell carcinoma, malignant melanoma, head and neck
cancer, in particular malignant pleomorphic adenoma, sarcoma, in
particular synovial sarcoma and carcinosarcoma, bile duct cancer,
cancer of the urinary bladder, in particular transitional cell
carcinoma and papillary carcinoma, kidney cancer, in particular
renal cell carcinoma including clear cell renal cell carcinoma and
papillary renal cell carcinoma, colon cancer, small bowel cancer,
including cancer of the ileum, in particular small bowel
adenocarcinoma and adenocarcinoma of the ileum, testicular
embryonal carcinoma, placental choriocarcinoma, cervical cancer,
testicular cancer, in particular testicular seminoma, testicular
teratoma and embryonic testicular cancer, uterine cancer, germ cell
tumors such as a teratocarcinoma or an embryonal carcinoma, in
particular germ cell tumors of the testis, and the metastatic forms
thereof.
[0037] In one embodiment the binding agent has an N-terminal
secretion signal and/or a C-terminal histidin epitope tag,
preferable a six hisidin epitope tag.
[0038] In one aspect the invention relates to a recombinant nucleic
acid which encodes a binding agent of the invention. In one
embodiment the recombinant nucleic acid is in the form of a vector.
In one embodiment the recombinant nucleic acid is RNA.
[0039] In one aspect the invention relates to a host cell
comprising a recombinant nucleic acid of the invention.
[0040] In one aspect the invention relates to the binding agent of
the invention, the recombinant nucleic acid of the invention or the
host cell of the invention for use in therapy, in particular for
use in treating or preventing cancer.
[0041] In one aspect the invention relates to a pharmaceutical
composition comprising the binding agent of the invention, the
recombinant nucleic acid of the invention or the host cell of the
invention.
[0042] In one aspect the invention relates to a method of treating
or preventing a cancer disease comprising administering to a
patient the pharmaceutical composition of the invention.
[0043] In one embodiment cells of said cancer express a claudin to
which said binding agent is capable of binding.
[0044] In one embodiment said claudin is CLDN18.2 and said cancer
is selected from the group consisting of gastric cancer, esophageal
cancer, pancreatic cancer, lung cancer such as non small cell lung
cancer (NSCLC), breast cancer, ovarian cancer, colon cancer,
hepatic cancer, head-neck cancer, cancer of the gallbladder and the
metastasis thereof, a Krukenberg tumor, peritoneal metastasis
and/or lymph node metastasis.
[0045] In one embodiment said claudin is CLDN6 and said cancer is
selected from the group consisting of urinary bladder cancer,
ovarian cancer, in particular ovarian adenocarcinoma and ovarian
teratocarcinoma, lung cancer, including small cell lung cancer
(SCLC) and non-small cell lung cancer (NSCLC), in particular
squamous cell lung carcinoma and adenocarcinoma, gastric cancer,
breast cancer, hepatic cancer, pancreatic cancer, skin cancer, in
particular basal cell carcinoma and squamous cell carcinoma,
malignant melanoma, head and neck cancer, in particular malignant
pleomorphic adenoma, sarcoma, in particular synovial sarcoma and
carcinosarcoma, bile duct cancer, cancer of the urinary bladder, in
particular transitional cell carcinoma and papillary carcinoma,
kidney cancer, in particular renal cell carcinoma including clear
cell renal cell carcinoma and papillary renal cell carcinoma, colon
cancer, small bowel cancer, including cancer of the ileum, in
particular small bowel adenocarcinoma and adenocarcinoma of the
ileum, testicular embryonal carcinoma, placental choriocarcinoma,
cervical cancer, testicular cancer, in particular testicular
seminoma, testicular teratoma and embryonic testicular cancer,
uterine cancer, germ cell tumors such as a teratocarcinoma or an
embryonal carcinoma, in particular germ cell tumors of the testis,
and the metastatic forms thereof.
[0046] In one aspect, the invention provides a binding agent or
nucleic acid coding therefor or a host cell as described herein for
use in the methods of treatment described herein. In one
embodiment, the invention provides a pharmaceutical composition as
described herein for use in the methods of treatment described
herein.
[0047] According to the invention, CLDN18.2 preferably has the
amino acid sequence according to SEQ ID NO: 1 and CLDN6 preferably
has the amino acid sequence according to SEQ ID NO: 2 or 3.
[0048] Other features and advantages of the instant invention will
be apparent from the following detailed description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0049] FIGS. 1A and 1B show a Modular scheme illustrating the
design of recombinant bi-scFv proteins targeting TAA CLDN18.2.
[0050] Design of the bi-scFvs in (A) N-terminal and (B) C-terminal
position regarding the anti-TAA variable regions. Anti-CLDN18.2
V.sub.H and V.sub.L regions are generated from the sequence of a
monoclonal CLDN18.2 antibody (mCLDN18.2ab). Anti-CD3 stands
comprehensive for VH and V.sub.L regions generated from the
sequences of the following monoclonal CD3 antibodies: UCHT1-HU
(humanized mAB), UCHT1, CLB-T3, TR66, 145-2C11. Bi-scFv indicates
bispecific single chain variable fragment; His, hexahistidyl-tag;
HU, humanized; LL, long linker (15-18 amino acids); Sec, secretion
signal; SL, short linker (5-6 amino acids); TAA, tumor associated
antigen; V, variable region of the heavy (H) and light (L) chain of
the antibody.
[0051] FIG. 2. Effect of domain orientation and anti-CD3-scFv
selection on specific target cell lysis: 5'-mCLDN18.2ab
.sup.V.sub.H-.sup.V.sub.L_TR66 .sup.V.sub.H-.sup.V.sub.L-3'
bi-scFvs 1BiMAB and no. 15 are the most potent variants.
[0052] Several bi-scFv variants directed against CLDN18.2 and CD3
were transiently expressed in HEK293T cells and small-scale
purified with Ni-NTA columns for the comparison of their potency in
a cytotox assay. CLDN18.2 endogenously expressing NugC4 cells which
stably express luciferase were taken as target cells. Human T cells
and target cells were incubated in an E:T ratio of 5:1 with 5 ng/ml
of each bi-scFv protein in a 96-well format. As negative controls
no.35 targeting a non-expressed TAA, no.11, and no.16--both
targeting murine but not human T cells--were taken. Each test
sample was plated sixfold, the control sample for L.sub.min was
plated ninefold. Coincubation times before analysis were 8 h, 16 h,
and 24 h. After addition of luciferin solution at the given time
points, the luminescence was measured in an Infinite M200 TECAN
reader. Specific target cell lysis was calculated by normalization
to samples with control bi-scFv no.35 (L.sub.min). The most potent
bi-scFv proteins--1BiMAB and no.15--share the domain orientation
and the anti-CD3 origin of mAB TR66 but differ in their codon
optimization (HS and CHO, respectively) and the long linker
sequences. CHO indicates Chinese Hamster Ovary; mAB, monoclonal
antibody; HU, humanized; TAA, tumor associated antigen.
[0053] FIGS. 3A and 3B show a Coomassie gel and western blot
analysis of bi-scFv protein 1BiMAB.
[0054] Supernatant without FCS of monoclonal HEK293 cells stably
expressing 1BiMAB was purified via Ni-NTA affinity chromatography
(IMAC). Aliquots of different purification steps were loaded to
4-12% Bis-Tris gels. (A) Coomassie staining of cell supernatant,
flow through and eight fractions of the eluate. Fractions of the
first eluted peak were discarded, fractions of the second eluted
peak were pooled for further studies, dialyzed against PBS and
subsequently against 200 mM arginine buffer. (Lane 1: HEK293/1BiMAB
SN; lane 2: IMAC flow through fraction; lanes 3-4: Fractions of
elution peak 1 (discarded); lanes 5-10: Fractions of elution peak 2
(pooled)) (B) Western blot analysis of 0.5 .mu.g of 1BiMAB from
three independent purifications (lane 1, 2, 3). Detection was
performed with primary monoclonal anti-His and secondary peroxidase
conjugated anti-mouse antibody. IMAC indicates immobilized metal
affinity chromatography; PBS, phosphate buffered saline; SN,
supernatant; WB, western blot.
[0055] FIGS. 4A, 4B, 4C, and 4D show Bi-scFv protein 1BiMAB binds
efficiently and specifically to CLDN18.2-expressing target cells
and human T cells.
[0056] (A) 2.5.times.10.sup.5 CLDN18.2 endogenously expressing
NugC4 cells were incubated with 50 .mu.g/ml 1BiMAB or 10 .mu.g/ml
mCLDN18.2ab as positive control and the corresponding
APC-conjugated secondary antibodies. Control stainings included
secondary APC-conjugated antibodies alone (g-a-h, g-a-m), anti-His
and g-a-m APC, or 1BiMAB and g-a-m APC. Analysis was performed via
flow cytometry. MFI of APC signal was calculated by FlowJo
software. (B) 1.times.10.sup.5 CLDN18.2 endogenously expressing
NugC4 cells were stained with escalating 1BiMAB concentrations (20
pg/ml-20 .mu.g/ml), anti-His and g-a-m APC. As negative control
cells were incubated with anti-His and g-a-m APC. As positive
control mCLDN18.2ab and g-a-h APC was used. MFI of APC signal was
calculated by FlowJo software. (C) 1.times.10.sup.6 human T cells
were incubated with escalating 1BiMAB concentrations (2 ng/ml-2
.mu.g/ml), anti-His and g-a-m APC. As negative control cells were
incubated with anti-His and g-a-m APC or g-a-m APC alone. MFI of
APC signal was calculated by FlowJo software. (D) 1.times.10.sup.5
CLDN18.2 negative PA-1 cells were incubated with escalating 1BiMAB
concentrations (10 ng/ml-10 .mu.g/ml), anti-His and g-a-m APC. As
negative control, cells were stained with anti-His and g-a-m APC or
g-a-h APC alone. 10 .mu.g/ml mCLDN18.2ab and g-a-h APC were used to
confirm CLDN18.2 negativity of cells. G-a-h indicates
goat-anti-human; g-a-m, goat-anti mouse; MFI, mean fluorescence
intensity; TL, T lymphocyte.
[0057] FIG. 5. Bi-scFv protein 1BiMAB leads to T cell clustering on
CLDN18.2 positive target cells. CLDN18.2 endogenously expressing
NugC4 cells were incubated for 24 h with 1 ng/ml and 1 .mu.g/ml
1BiMAB and human T cells in an effector to target ratio of 5:1 in
6-well plates. T cells alone (TL), target cells alone (NugC4) and
human T cells with target cells (-ctrl) were chosen as control
samples. After 24 h samples were photographed with a Nikon Eclipse
Ti microscope with 200.times. magnification. White arrowheads point
to T cell clusters on target cells. TL indicates T lymphocyte.
[0058] FIGS. 6A and 6B show 1BiMAB mediates T cell activation in a
dose dependent manner. CLDN18.2 endogenously expressing NugC4 cells
were incubated for 24 h and 48 h with escalating concentrations of
bi-scFv protein 1BiMAB (0.001-1000 ng/ml) and human T cells in an
effector to target ratio of 5:1 in duplicates in a 24-well format.
As control human T cells were incubated with 1-1000 ng/ml 1BiMAB
without NugC4 target cells to verify the target dependent
activation of T cells mediated by 1BiMAB. After 24 h (A) and 48 h
(B) T cells were harvested and labeled with anti-CD3-FITC,
anti-CD25-PE, and anti-CD69-APC and analyzed by flow cytometry. TL
indicates T lymphocyte.
[0059] FIGS. 7A and 7B show 1BiMAB mediates strictly target
dependent T cell activation even after long term incubation with
CLDN18.2 high, low, and non-expressing cell lines.
[0060] (A) RT-PCR data generated from total RNA of six tumor cell
lines are shown. Ct-values of CLDN18.2 expression normalized to
housekeeping gene HPRT has been calculated from two independent
experiments. Breast cancer cell line MCF7 (grey bar) was chosen as
negative CLDN18.2-expressing control cell line. (B) Cancer cell
lines from (A) were incubated for 144h with 5 ng/ml bi-scFv protein
1BiMAB with or without human T cells in an effector to target ratio
of 5:1 in duplicates in a 6-well format. T cells were labeled with
anti-CD3-FITC, anti-CD25-PE and anti-CD69-APC to analyze total T
cell population (CD3), early activation (CD69), and late activation
(CD25) of T cells by flow cytometry. TL indicates T lymphocyte.
[0061] FIGS. 8A and 8B show 1BiMAB induces T cell proliferation and
Granzyme B upregulation only in the presence of CLDN18.2 positive
target cells.
[0062] (A) Human T cells were CFSE stained and cultivated alone
(TL) or in the presence of 1 ng/ml 1BiMAB (TL+1 ng/ml 1BiMAB),
NugC4 cells (TL+NugC4), or NugC4 cells and 1 ng/ml 1BiMAB (TL+1
ng/ml 1BiMAB+NugC4) for 120h. A 5:1 effector to target ratio was
selected. Decrease of CFSE signal indicating T cell proliferation
was analyzed by flow cytometry. (B) Human T cells were incubated
with or without NugC4 target cells and with or without 5 ng/ml
bi-scFv 1BiMAB protein. Effector to target ratio was of 5:1 in a
6-well format. After 96h of coincubation T cells were harvested and
intracellularly stained with anti-GrB-PE and analyzed by flow
cytometry. MFI of anti-GrB-PE signal was calculated by FlowJo
software. The signal of unstained sample TL+NugC4+5 ng/ml 1BiMAB
was substracted from all samples. CFSE indicates carboxyfluorescein
succinimidyl ester; GrB, Granzyme B; MFI, mean fluorescence
intensity; PE, phycoerythrin; TL, T lymphocytes.
[0063] FIG. 9. EC50 of 1BiMAB for specific target cell lysis after
48 h is approximately 10 pg/ml.
[0064] CLDN18.2 endogenously expressing NugC4 cells which stably
express luciferase were incubated for 24 h and 48 h with bi-scFv
protein 1BiMAB in escalating concentrations (0.001-1000 ng/ml) with
human T cells in an effector to target ratio of 5:1 in triplicates
in a 96-well format. As minimum lysis (L.sub.min) control effector
and target cells were plated without bi-scFv 1BiMAB. Maximum lysis
(L.sub.max) for the normalization to spontaneous luminescence
counts was achieved by addition of Triton X-100 to control wells
containing effector and target cells in the absence of bi-scFv
shortly prior to luciferin addition. After addition of luciferin
solution the luminescence was measured in an Infinite M200 Tecan
microplate reader after 24 h and 48 h. Specific target cell lysis
was calculated by the formula: % specific
lysis=[1-(luminescence.sub.test
sample-L.sub.max)/(L.sub.min-L.sub.max)].times.100. Values were
plotted against log 10 of 1BiMAB concentration. EC50 indicates the
half maximal effective concentration; L, lysis.
[0065] FIGS. 10A, 10B, 10C, and 10D show 1BiMAB shows therapeutic
in vivo efficacy in an advanced SC tumor model.
[0066] NOD.Cg-Prkdscid IL2rgtm1Wj1/SzJ (NSG) mice were injected SC
with 1.times.10.sup.7 HEK293 stably expressing CLDN18.2. Five days
later 2.times.10.sup.7 human PBMC effector cells were injected IP
to groups G3 and G4, control groups (G1 and G2) received PBS only.
Daily IP application of 5 .mu.g bi-scFv protein 1BiMAB per animal
or vehicle as control started at the following day. Therapy was
administered for 22 days, tumor volume was measured using a caliper
and calculated by the formula mm.sup.3=length mm.times.width
mm.times.(width mm/2). (A) The tumor volume of single mice and the
median per group is shown for treatment days 0 and 15 (upper row),
and 3 and 13 days after the end of treatment (bottom row). (B) The
mean tumor volume of the two treatment groups engrafted with human
effector cells is shown. Dashes indicate sacrificed animals. (C)
Kaplan-Meier survival curve presenting all groups from the day of
tumor inoculation to day 41. Animals were sacrificed as soon as the
tumor volume exceeded 500 mm.sup.3. After day 41 all remaining
animals were sacrificed to analyze the engraftment of human
effector cells in the spleens of mice. (D) Splenocytes of all mice
were isolated and stained with anti-CD45-APC and anti-CD3-FITC to
detect human T cells by flow cytometry. Median engraftment is shown
in a boxplot diagram. G indicates group; IP, intraperitoneal; PBMC,
peripheral blood mononuclear cells; PBS, phosphate buffered saline;
SC, subcutaneous.
[0067] FIGS. 11A and 11B show Modular scheme illustrating the
design of recombinant bi-scFv proteins targeting TAA CLDN6.
[0068] Design of the bi-scFvs in (A) N-terminal and (B) C-terminal
position regarding the anti-TAA variable regions. Anti-CLDN6
V.sub.H and V.sub.L regions are generated from the sequence of a
monoclonal CLDN6 antibody (mCLDN6ab). Anti-CD3 V.sub.H and V.sub.L
regions are generated from the sequence of the monoclonal CD3
antibody TR66. Bi-scFv indicates bispecific single chain variable
fragment; His, hexahistidyl-tag; LL, long linker (15-18 amino
acids); Sec, secretion signal; SL, short linker (5 amino acids);
TAA, tumor associated antigen; V, variable region of the heavy (H)
and light (L) chain of the antibody.
[0069] FIG. 12. Bi-scFv proteins 6PHU5 and 6PHU3 lead to T cell
clustering on CLDN6 positive target cells.
[0070] CLDN6 endogenously expressing PA-1 cells were incubated for
24 h with 50 ng/ml 6PHU5 or 6PHU3 and human T cells in an effector
to target ratio of 5:1 in 6-well plates. T cells alone (TL), target
cells alone (PA-1) and human T cells with target cells (-ctrl) were
chosen as control samples. After 24 h samples were photographed
with a Nikon Eclipse T.sub.i microscope with 200.times.
magnification. White arrowheads point to T cell clusters on target
cells. TL indicates T lymphocyte.
[0071] FIG. 13. Effect of domain orientation on efficacy: bi-scFv
protein 6PHU3 is slightly more efficient in inducing T cell
activation than 6PHU5.
[0072] CLDN6 endogenously expressing PA-1 cells were incubated for
44h with escalating concentrations (5-200 ng/ml) of 6PHU5 or 6PHU3
and human T cells in an effector to target ratio of 5:1 in
duplicates in a 6-well format. As control human T cells were
incubated with 100 and 200 ng/ml 6PHU5 or 6PHU3 without target
cells. After 44 h T cells were harvested and labeled with
anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC. Dose-dependent T
cell activation was analyzed by flow cytometry. Hu indicates human;
TL, T lymphocyte.
[0073] FIGS. 14A and 14B show Coomassie gel and western blot
analysis of 6PHU3 protein.
[0074] Supernatant without FCS of polyclonal HEK293 cells stably
expressing 6PHU3 was purified via Ni-NTA affinity chromatography
(IMAC). Aliquots of different purification steps were loaded to
4-12% Bis-Tris gels. (A) Coomassie staining of cell supernatant,
flow through and nine fractions of eluate. Fractions of the first
eluted peak were discarded, fractions of the second and third
eluted peaks were pooled for further studies, dialyzed against PBS
and subsequently against 200 mM arginine buffer. (Lane 1:
HEK293/6PHU3 SN; lane 2: IMAC flow through fraction; lanes 3-5:
Fractions of elution peak 1 (discarded); lanes 6-11: Fractions of
elution peaks 2 and 3 (pooled)) (B) Western blot analysis of 0.5
.mu.g of 6PHU3 from two independent purifications. Detection was
performed with primary monoclonal anti-His and secondary peroxidase
conjugated anti-mouse antibody. IMAC indicates immobilized metal
affinity chromatography; PBS; phosphate buffered saline; SN,
supernatant; WB, western blot.
[0075] FIGS. 15A, 15B, and 15C show Bi-scFv protein 6PHU3 binds
efficiently and specifically to CLDN6-expressing target cells and
human T cells.
[0076] (A) 1.times.10.sup.5 CLDN6 endogenously expressing PA-1 and
OV-90 cells were incubated with escalating concentrations of 6PHU3
or control bi-scFv 1BiMAB (10 ng/ml-10 .mu.g/ml) and 10 .mu.g/ml
mCLDN6ab or control mAB mCLDN18.2ab with the corresponding
APC-conjugated secondary antibodies. Control stainings were
secondary APC-conjugated antibodies alone (g-a-h, g-a-m). Analysis
was performed via flow cytometry. MFI of APC signal was calculated
by FlowJo software. (B) 5.times.10.sup.5 human T cells were
incubated with escalating 6PHU3 concentrations (100 ng/ml-10
.mu.g/ml), anti-His and g-a-m PE. As negative control cells were
incubated with anti-His and g-a-m PE, or g-a-m PE alone. MFI of PE
signal was calculated by FlowJo software. (C) 1.times.10.sup.5
CLDN6 negative NugC4 cells were incubated with escalating 6PHU3 and
1BiMAB concentrations (10 ng/ml-10 .mu.g/ml), anti-His and g-a-m
APC. As negative control cells were incubated with g-a-m APC alone.
10 .mu.g/ml mCLDN6ab and g-a-h APC were used to confirm CLDN6
negativity of cells. As positive control mCLDN18.2ab and g-a-h APC
was used. MFI of APC signal was calculated by FlowJo software. APC
indicates allophycocyanin; g-a-h, goat-anti-human; g-a-m,
goat-anti-mouse; mAB, monoclonal antibody; MFI, mean fluorescence
intensity; PE, phycoerythrin; TL, T lymphocyte.
[0077] FIGS. 16A and 16B show 6PHU3 mediates T cell activation in a
dose dependent manner. CLDN6 endogenously expressing PA-1 cells
were incubated for 24 h and 48 h with escalating concentrations of
bi-scFv protein 6PHU3 (0.001-1000 ng/ml) and human T cells in an
effector to target ratio of 5:1 in duplicates in a 24-well format.
As control human T cells were incubated with 1-1000 ng/ml 6PHU3
without PA-1 target cells to verify the target dependent activation
of T cells mediated by 6PHU3. After 24 h (A) and 48 h (B) T cells
were harvested and labeled with anti-CD3-FITC, anti-CD25-PE, and
anti-CD69-APC and analyzed by flow cytometry. TL indicates T
lymphocyte.
[0078] FIG. 17. EC50 of 6PHU3 for specific target cell lysis after
48 h is approximately 10 .mu.g/ml.
[0079] CLDN6 endogenously expressing PA-1 cells which stably
express luciferase were incubated for 24 h and 48 h with 6PHU3
protein in escalating concentrations (0.001-1000 ng/ml) with human
T cells in an effector to target ratio of 5:1 in triplicates in a
96-well format. As minimum lysis control (L.sub.min) effector and
target cells were plated without bi-scFv 6PHU3. Maximum lysis
(L.sub.max) for the normalization to spontaneous luminescence
counts was achieved by addition of Triton X-100 to control wells
containing effector and target cells in the absence of bi-scFv
shortly prior to luciferin addition. After addition of luciferin
solution the luminescence was measured in an Infinite M200 Tecan
microplate reader after 24 h and 48 h. Specific target cell lysis
was calculated by the formula: % specific
lysis=[1-(luminescence.sub.test
sample-L.sub.max)/(L.sub.min-L.sub.max)].times.100. Values were
plotted against log 10 of 6PHU3 concentration. EC50 indicates the
half maximal effective concentration; L, lysis.
[0080] FIGS. 18A, 18B, 18C, and 18D show 6PHU3 shows therapeutic in
vivo efficacy in an advanced SC tumor model.
[0081] NOD.Cg-Prkd.sup.scid IL2rg.sup.tmlWjl/SzJ (NSG) mice were
injected SC with 1.times.10.sup.7 PA-1 endogenously expressing
CLDN6. 15 days later 2.times.10.sup.7 human PBMC were injected IP
to groups G3 and G4, control groups (G1 and G2) received PBS only.
Daily IP application of 5 .mu.g 6PHU3 per animal or control bi-scFv
1BiMAB or vehicle alone as control started five days after PBMC
injection. Therapy was administered for 25 days, tumor volume was
measured using a caliper and calculated by the formula
mm.sup.3=length mm.times.width mm.times.(width mm/2). (A) The tumor
volume of single mice and the median per group is shown for
treatment days 0 and 14 (upper row), and 21 and 25 (bottom row).
(B) The mean tumor volume of all treatment groups is shown. Dashes
indicate sacrificed animals. (C) A Kaplan-Meier survival curve of
all groups from the day of tumor inoculation till day 45 is shown.
Animals were sacrificed at a tumor volume >1500 mm.sup.3. After
day 45 all remaining animals were sacrificed to analyze the
engraftment of human effector cells in the spleens of mice. (D)
Splenocytes of all mice were isolated and stained with
anti-CD45-APC and anti-CD3-FITC to detect human T cells by flow
cytometry. Median engraftment is shown in a boxplot diagram. IP
indicates intraperitoneal; PBMC, peripheral blood mononuclear
cells; PBS, phosphate buffered saline; SC, subcutaneous.
[0082] FIGS. 19A, 19B, 19C, 19D, and 19E show Enhanced T cell
infiltration into SC PA-1 tumors in response to 6PHU3
treatment.
[0083] NSG mice were injected SC with 1.times.10.sup.7 PA-1
endogenously expressing CLDN6. 15 days later 2.times.10.sup.7 human
PBMC were injected IP to groups G3 and G4, control groups (G1 and
G2) received PBS only. Daily IP application of 5 .mu.g 6PHU3 per
animal or control bi-scFv 1BiMAB or vehicle alone as control
started five days after PBMC injection. Tumors were dissected at a
size of 1500 mm3 or at the end of the experiment, and conserved in
4% buffered formaldehyde solution for paraffin embedding.
[0084] Paraffin embedded tumor tissues of SC PA-1 tumors were
subjected to immunohistochemical stainings. Consecutive sections
were stained either with polyclonal primary antibody anti-Claudin 6
or anti-human CD3. Primary antibodies were detected using secondary
HRP-conjugated anti-rabbit antibodies. Upper rows of A-E show the
CLDN6 staining, lower rows the CD3 staining. Images were taken with
a Mirax scanner. (A) and (B) show the PBS control groups G1 and G2
that received no human effector cells and vehicle or bi-scFv 6PHU3,
respectively, (C) shows control group G3 that received human
effector cells and vehicle as treatment, (D) shows group G4 that
received human effector cells and bi-scFv 6PHU3 as treatment, and
(E) shows control group G5 that received human effector cells and
control bi-scFv 1BiMAB. Positive signals appear as red staining.
Black arrowheads point to examples of CD3 signals. IP indicates
intraperitoneal; PBMC, peripheral blood mononuclear cells; PBS,
phosphate buffered saline; SC, subcutaneous.
[0085] FIGS. 20A and 20B show Schematic illustration of IVT-RNA
molecules encoding bi-scFv antibodies targeting TAA CLDN18.2.
[0086] Scheme of in vitro transcribed RNA sequences encoding
anti-CLDN18.2 bi-scFv antibodies. (A) IVT-mRNA in 5'- and
3'-position regarding the anti-TAA variable regions. (B) IVT
alphaviral replicon in 5'-position regarding the anti-TAA variable
regions. Anti-CLDN18.2 V.sub.H and V.sub.L regions were generated
from the sequence of a monoclonal CLDN18.2 antibody (mCLDN18.2ab).
"Cap" is uniformly used for ARCA, beta-S-ARCA (D1) or beta-S-ARCA
(D2). In (A) "anti-CD3" stands comprehensively for V.sub.H and
V.sub.L regions generated from the sequences of the following
monoclonal CD3 antibodies: UCHT1-HU (humanized mAB), UCHT1, CLB-T3,
TR66, 145-2C11, in (B) "anti-CD3" describes only V.sub.H and
V.sub.L from TR66. A indicates adenine; bi-scFv, bispecific single
chain variable fragment; hAg, human alpha globin 5'-UTR; hBg, human
beta globin 3'-UTR; His, hexahistidyl-tag; IVT, in vitro
transcribed; LL, long linker (15-18 amino acids); nsP1-4,
non-structural proteins 1-4; Sec, secretion signal; sgP, subgenomic
promoter; SL, short linker (5-6 amino acids); TAA, tumor associated
antigen; UTR, untranslated region; V, variable region of the heavy
(H) and light (L) chain of the antibody.
[0087] FIG. 21. Effect of domain orientation and anti-CD3-scFv
selection on target dependent T cell activation and specific target
cell lysis.
[0088] CLDN18.2 endogenously expressing NugC4 cells were
transiently transfected with several bi-scFv variants directed
against CLDN18.2 and CD3 for the comparison of their potency in a
cytotox assay. Per variant, 5.times.10.sup.6 NugC4 cells were
electroporated with 20 .mu.g/ml IVT-mRNA. Transfected target cells
were counted, 1.times.10.sup.5 cells seeded per 6-well plate and
incubated with human cytotoxic T cells (CD8.sup.+ selected T cells)
in an E:T ratio of 5:1. As negative controls a bi-scFv IVT-mRNA
targeting a non-expressed TAA (ctrl), and the parental IgG mAB
chCLDN18.2ab (ctrl IgG) targeting CLDN18.2 but not T cells were
chosen. 1BiMAB protein served as positive control in a
concentration of 5 ng/ml. As background dead cell reference,
electroporated target cells were seeded without T cells and, as
background activation reference, T cells were seeded without target
cells. Each sample was seeded in duplicate. After 48 h T cells and
target cells were harvested and labeled with anti-CD3-FITC,
anti-CD25-PE, anti-CD69-APC and 7-AAD for live-dead staining and
analyzed by flow cytometry. (A) TAA-dependent bi-scFv mediated T
cell activation was observed with all anti-CLDN18.2 bi-scFv
variants. (B) Specific target cell lysis was determined by
subtraction of 7-AAD reference population from 7-AAD sample target
cell population. The bi-scFv antibodies leading to a marginal
higher target cell lysis--1BiMAB and no.5--share the domain
orientation and the anti-CD3 origin of mAB TR66 but differ in their
codon optimization (HS and CHO, respectively) and the long linker
sequences. Bi-scFv indicates bispecific single chain variable
fragment; ctrl, control; IgG, immunoglobuline G; IVT, in vitro
transcribed; mRNA, messenger RNA; TL, T lymphocyte.
[0089] FIG. 22. Coincubation of target cells transfected with
1BiMAB IVT-mRNA and human T cells leads to T cell clustering.
[0090] CLDN18.2 endogenously expressing NugC4 cells were
transiently transfected by electroporation with 80 .mu.g/ml 1BiMAB
IVT-mRNA and coincubated with human cytotoxic T cells (CD8.sup.+
selected T cells) in an effector to target ratio of 5:1 in 96-well
plates. As negative control sample NugC4 target cells transfected
with a bi-scFv IVT-mRNA targeting a non-expressed TAA (-ctrl)
coincubated with human cytotoxic T cells were used (upper row,
left). The bottom row shows NugC4 cells transfected with control
bi-scFv (left) or 1BiMAB IVT-mRNA (right) without human T cells.
After 24 h of coincubation samples were photographed with a Nikon
Eclipse Ti microscope in 200.times. magnification. White arrowheads
point to T cell clusters on target cells. CTL indicates cytotoxic T
lymphocyte; ctrl, control; hu, human.
[0091] FIGS. 23A and 23B show 1BiMAB secreted by target cells after
IVT-mRNA transfection mediates T cell activation in a concentration
dependent manner.
[0092] CLDN18.2 endogenously expressing NugC4 cells were
transiently transfected by electroporation with a total of 40
.mu.g/ml IVT-mRNA containing 0.4-40 .mu.g/ml 1BiMAB IVT-mRNA plus
appropriate amounts of luciferase IVT-mRNA. Transfected target
cells were coincubated with human cytotoxic T cells (CD8.sup.+
selected T cells) in an effector to target ratio of 5:1 in 6-well
plates in duplicates. As T cell activation reference human T cells
were coincubated with NugC4 target cells transfected with 40
.mu.g/ml luciferase IVT-mRNA (0.0 .mu.g/ml 1BiMAB IVT-mRNA). After
24 h (A) and 48 h (B) T cells were harvested and labeled with
anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC and analyzed by flow
cytometry. Graphs demonstrate percentage of positively stained
cytotoxic human T cells as determined with FlowJo software. IVT
indicates in vitro transcribed; mRNA, messenger RNA; TL, T
lymphocyte.
[0093] FIG. 24. 1BiMAB secreted by target cells after IVT-mRNA
transfection leads to a concentration dependent target cell
lysis.
[0094] CLDN18.2 endogenously expressing NugC4 cells were
transiently transfected by electroporation with a total of 40
.mu.g/ml IVT-mRNA containing 0.4-40 .mu.g/ml 1BiMAB IVT-mRNA plus
appropriate amounts of luciferase IVT-mRNA or with 40 .mu.g/ml
luciferase IVT-mRNA only as reference sample. Transfected target
cells were seeded with human cytotoxic T cells (CD8.sup.+ selected
T cells) in an effector to target ratio of 5:1 or without effector
cells to determine the percentage of background dead target cells
by each individual electroporation. All samples were cultured in
6-well plates in duplicates. After 24 h (A) and 48 h (B) T cells
were harvested, labeled with propidium iodide (PI) for life/dead
staining and analyzed by flow cytometry. The percentage of dead
(PI.sup.+) target cells was determined via FlowJo software. Values
were further normalized to each individual background sample and to
the reference sample. IVT indicates in vitro transcribed; mRNA,
messenger RNA; TL, T lymphocyte.
[0095] FIG. 25. T cell proliferation is specifically induced in
response to 1BiMAB secretion by target cells in the presence of
CLDN18.2
[0096] Human T cells were CFSE stained for the assay. T cells were
cultivated without target cells (T cells) in combination with 5
.mu.g/ml OKT3 and 2 .mu.g/ml .alpha.CD28 as positive activation
control (+ctrl), with 5 ng/ml non-targeting control bi-scFv (-ctrl
protein) or with 5 ng/ml 1BiMAB protein (1BiMAB protein). T cells
and NugC4 target cells overexpressing CLDN18.2 were incubated
together (T cells+CLDN18.2 positive target cells) without anything
(mock) or with 5 ng/ml 1BiMAB protein (1BiMAB protein). To test
IVT-mRNA, NugC4 cells were transfected with 20 .mu.g/ml 1BiMAB
IVT-mRNA (1BiMAB mRNA) or a bi-scFv IVT-mRNA targeting a
non-expressed TAA (-ctrl mRNA) and incubated with T cells. In
addition, NugC4 cells transfected with a bi-scFv IVT-mRNA targeting
a non-expressed TAA were combined with 5 ng/ml 1BiMAB protein
(-ctrl mRNA+1BiMAB protein). As further specificity control,
samples with the CLDN18.2-non expressing target cell line
MDA-MB-231 together with T cells were included (T cells+CLDN18.2
negative target cells). MDA-MB-231 were either used untreated and
incubated without anything (mock), with 5 ng/ml control bi-scFv
protein (-ctrl protein) or 5 ng/ml 1BiMAB protein (1BiMAB protein)
or MDA-MB-231 were transfected with 20 .mu.g/ml 1BiMAB IVT-mRNA
(1BiMAB mRNA) or a bi-scFv IVT-mRNA targeting a non-expressed TAA
(-ctrl mRNA). The assay was performed in a 5:1 effector to target
ratio in 96-wells, with each sample in triplicate and incubation
times of 72 h. Decrease of CFSE signal indicating T cell
proliferation was analyzed by flow cytometry, calculated by FlowJo
software and plotted as % proliferating T cells. CFSE indicates
carboxyfluorescein succinimidyl ester; IVT, in vitro transcribed;
mRNA, messenger RNA.
[0097] FIGS. 26A and 26B show T cell activation and T cell-mediated
target cell lysis in response to 1BiMAB secretion starts with an
effector to target ratio of 0.3:1.
[0098] CLDN18.2 endogenously expressing NugC4 cells were
transiently transfected by electroporation with 40 .mu.g/ml 1BiMAB
IVT-mRNA. Transfected target cells were coincubated with human
cytotoxic T cells (CD8.sup.+ selected T cells) in the indicated
effector to target ratios from 0.3:1 to 10:1 in 6-well plates in
duplicates. As references human T cells were cultured in the
absence of target cells ((A) 1:0) and target cells transfected with
control IVT-mRNA were cultured in the absence of effector cells
((B) 0:1). As negative control human T cells were coincubated with
NugC4 target cells transfected with 40 .mu.g/ml luciferase IVT-mRNA
(ctrl IVT-mRNA) in an E:T ratio of 10:1 ((A) and (B) ctrl IVT-mRNA
10:1). After 48 h cells were harvested and labeled with
anti-CD3-FITC, anti-CD25-PE, anti-CD69-APC and propidium iodide
(PI) for life/dead staining and analyzed by flow cytometry. (A)
shows the percentage of positively stained cytotoxic human T cells.
(B) demonstrates the percentage of dead (PI.sup.+) target cells.
All values were determined via FlowJo software. E:T indicates
effector to target; IVT, in vitro transcribed; mRNA, messenger RNA;
TL, T lymphocyte.
[0099] FIGS. 27A and 27B show Human cytotoxic T cells are able to
serve as bi-scFv IVT-mRNA recipient and producer cells
[0100] Human cytotoxic T cells were freshly isolated from PBMCs by
CD8 positive selection and subsequently transiently transfected by
electroporation with 80 or 240 .mu.g/ml 1BiMAB IVT-mRNA.
Transfected effector cells were coincubated with NugC4 target cells
endogenously expressing CLDN18.2 in an effector to target ratio of
5:1 in 6-well plates in duplicates. As reference untreated human T
cells were cultured with target cells. As negative control human T
cells transfected with 80 or 240 .mu.g/ml eGFP control IVT-mRNA
were coincubated with NugC4 target cells. After 48 h cells were
harvested and labeled with anti-CD3-FITC, anti-CD25-PE,
anti-CD69-APC and propidium iodide (PI) for life/dead staining and
analyzed by flow cytometry. (A) shows the percentage of positively
stained cytotoxic human T cells. In (B) the percentage of dead
(PI.sup.+) target cells normalized to the reference sample is
plotted. All values were determined via FlowJo software. Ctrl
indicates control; IVT; in vitro transcribed; mRNA, messenger RNA;
TL, T lymphocyte.
[0101] FIG. 28. CLDN18.2 negative target cells transfected with
1BiMAB IVT-mRNA are not lysed by T cells
[0102] CLDN18.2 negative cell line PA-1 stably expressing
luciferase served as target cell line. 5.times.10.sup.6 PA-1/luc
cells were transfected by electroporation with a total of 40
.mu.g/ml IVT-mRNA. 4 and 40 .mu.g/ml 1BiMAB IVT-mRNA or 6RHU3
targeting endogenously expressed CLDN6 as positive control were
transfected. As bi-scFv negative control, 40 .mu.g/ml of bi-scFv
IVT-mRNA targeting a non-expressed TAA (-ctrl) was transfected.
This IVT-mRNA served also as fill-up RNA in the 4 .mu.g/ml IVT-mRNA
samples (IVT-mRNA 4 .mu.g/ml 1BiMAB, IVT-mRNA 4 .mu.g/ml 6RHU3).
Protein control samples with 1BiMAB and 6PHU3 in combination with
bi-scFv negative control transfected PA-1/luc cells and effector
cells were included.
[0103] Transfected target cells were seeded with human cytotoxic T
cells (Pan T cells) in an effector to target ratio of 5:1. All
samples were seeded in triplicates in a 96-well format and
coincubated for 72 h. As minimum lysis control (L.sub.min) each
individual transfected target cell sample was seeded without
effector cells. Maximum lysis (L.sub.max) for the normalization to
spontaneous luminescence counts was achieved by addition of Triton
X-100 to control wells containing effector and non-treated target
cells (L.sub.max1) or non-treated target cells alone (L.sub.max2)
prior to luciferin addition. 30 min after addition of luciferin
solution the luminescence was measured in an Infinite M200 Tecan
microplate reader. Specific target cell lysis was calculated by the
formula: % specific lysis=[1-(luminescence.sub.test
sample-L.sub.max1)/(L.sub.min_test sample-L.sub.max2)].times.100.
Ctrl indicates control; IVT; in vitro transcribed; mRNA, messenger
RNA.
[0104] FIGS. 29A, 29B, and 29C show Proof of 1BiMAB production by
mammalian cells transfected with bi-scFv IVT-mRNA or -replicon
RNA
[0105] (A) 5.times.10.sup.6 BHK21 cells were transiently
transfected by electroporation with 40 .mu.g/ml of 1BiMAB IVT-mRNA
or -replicon RNA. As mock control cells were electroporated without
RNA. 18 h post transfection supernatant and cells were harvested.
Cells were lysed and supernatants were subjected to .about.50-fold
concentration. Untreated and concentrated supernatants were
analyzed by ELISA using Ni-NTA plates, anti-chCLDN18.2ab idiotypic
mAB and a secondary AP-conjugated antibody. Purified 1BiMAB protein
in a dilution row ranging from 2.3 to 37.5 ng/ml in steps of 2 was
used as standard. (B) Concentrated supernatant, cell lysates of (A)
and 0.1 .mu.g purified 1BiMAB protein as positive control were
separated via SDS-PAGE. Western Blot analysis was performed with
primary monoclonal anti-His and secondary peroxidase conjugated
anti-mouse antibody. (C) 5.times.10.sup.6 BHK21 cells were
transiently transfected by electroporation with 40 .mu.g/ml of
1BiMAB or no.25 IVT-mRNA. As mock control cells were electroporated
without RNA. 48 h post transfection supernatant was harvested and
subjected to 40-fold concentration. SN and 0.1 .mu.g purified
1BiMAB protein as positive control were separated via SDS-PAGE.
Western Blot analysis was performed with primary monoclonal
anti-His and secondary peroxidase conjugated anti-mouse antibody.
Ctrl indicates control; mAB, monoclonal antibody; SN, supernatant;
WB, Western blot.
[0106] FIG. 30. Injection of 1BiMAB bi-scFv IVT-mRNA or -replicon
RNA leads to in vivo production and detectable 1BiMAB bi-scFv
molecules in mice
[0107] 10 .mu.g 1BiMAB IVT-mRNA with or without EBK IVT-mRNA or 10
.mu.g 1BiMAB IVT-replicon was IM injected into NSG mice. Serum from
blood, collected 2, 4 and 7 days post injection was applied in an
in vitro cytotox assay. CLDN18.2 and luciferase stably expressing
NugC4-LVT-CLDN18.2/luc target cells were coincubated with human T
cells in an E:T ratio of 30:1 with 20 .mu.l sample serum for 48 h.
Standard 1BiMAB protein control, L.sub.min and L.sub.max contained
20 .mu.l NSG mock serum. EBK indicates vaccinia virus protein
cocktail E3, B-18R, K3; IM, intramuscular.
[0108] FIGS. 31A and 31B show Schematic illustration of IVT-RNA
molecules encoding bi-scFv antibodies targeting TAA CLDN6.
[0109] Scheme of in vitro transcribed RNA sequences encoding
anti-CLDN6 bi-scFv antibodies. (A) IVT mRNA in 5'- and 3'-position
regarding the anti-TAA variable regions. (B) IVT alphaviral
replicon in 3'-position regarding the anti-TAA variable regions.
Anti-CLDN6 V.sub.H and V.sub.L regions are generated from the
sequence of a monoclonal CLDN6 antibody (mCLDN6ab). "Cap" is
uniformly used for ARCA, beta-S-ARCA (D1) or beta-S-ARCA (D2).
Anti-CD3 V.sub.H and V.sub.L regions are generated from the
sequence of the monoclonal CD3 antibody TR66. A indicates adenine;
bi-scFv, bispecific single chain variable fragment; hAg, human
alpha globin 5'-UTR; hBg, human beta globin 3'-UTR; His,
hexahistidyl-tag; IVT, in vitro transcribed; LL, long linker (15-18
amino acids); nsP1-4, non-structural proteins 1-4; Sec, secretion
signal; sgP, subgenomic promoter; SL, short linker (5-6 amino
acids); TAA, tumor associated antigen; UTR, untranslated region; V,
variable region of the heavy (H) and light (L) chain of the
antibody.
[0110] FIG. 32. Coincubation of target cells transfected with
anti-CLDN6 bi-scFv IVT-mRNA and human T cells leads to T cell
clustering.
[0111] CLDN6 endogenously expressing PA-1 cells were transiently
transfected by electroporation with 20 .mu.g/ml 6RHU5 or 6RHU3
IVT-mRNA and coincubated with human T cells (Pan T cells) in an
effector to target ratio of 5:1 in 6-well plates. As negative
control sample PA-1 target cells transfected with a bi-scFv
IVT-mRNA targeting a non-expressed TAA (-ctrl) coincubated with
human T cells were used (upper row, left photo). The middle row
shows untreated PA-1 cells and human T cells without protein as
negative control (mock, left photo) or with 50 .mu.g/ml purified
anti-CLDN6 bi-scFv proteins 6PHU5 (middle) or 6PHU3 (right) as
positive controls. The bottom row shows untreated PA-1 cells (left)
and human T cells alone (right). After 24 h of coincubation samples
were photographed with a Nikon Eclipse Ti microscope in 200.times.
magnification. White arrowheads point to T cell clusters on target
cells. Bi-scFv indicates bispecific single chain variable fragment;
ctrl, control; hu, human; IVT, in vitro transcribed; mRNA,
messenger RNA; TL, T lymphocyte.
[0112] FIGS. 33A and 33B show Effect of domain orientation on
efficacy: target cell transfection with anti-CLDN6 bi-scFv 6RHU3
leads to higher percentages of activated T cells than with
6RHU5.
[0113] CLDN6 endogenously expressing PA-1 cells were transiently
transfected with the two bi-scFv variants 6RHU5 and 6RHU3 directed
against CLDN6 and CD3 for the comparison of their potency in a T
cell activation assay. Per variant 5.times.10.sup.6 PA-1 cells were
electroporated with 20 .mu.g/ml IVT-mRNA. Transfected target cells
were re-counted, 1.times.10.sup.5 cells seeded per 6-well plate and
incubated with human cytotoxic T cells (CD8.sup.+ selected T cells)
in an E:T ratio of 5:1. As negative controls untreated target cells
(hu TL+PA-1 untreated) and target cells transfected with a bi-scFv
IVT-mRNA targeting a non-expressed TAA (hu TL+PA-1-ctrl) were
chosen. 6PHU5 protein served as positive control in a concentration
of 50 ng/ml (hu TL+PA-1 protein ctrl). Further, T cells were seeded
without target cells with or without 6PHU5 protein as background
activation reference. Each sample was seeded in duplicate. Analysis
was performed after 24 h and 48 h: T cells were harvested and
labeled with anti-CD3-FITC, anti-CD25-PE, anti-CD69-APC and 7-AAD
for live-dead staining and analyzed by flow cytometry.
TAA-dependent bi-scFv mediated T cell activation was observed with
both anti-CLDN6 bi-scFv variants after 24 h (A) and 48 h (B) of
coincubation. Bi-scFv 6RHU3 transfection led to approximately 20%
higher T cell activation in both time points. Bi-scFv indicates
bispecific single chain variable fragment; ctrl, control; hu,
human; IVT, in vitro transcribed; mRNA, messenger RNA; TL, T
lymphocyte.
[0114] FIG. 34. 6RHU3 secretion mediates T cell activation in a
concentration dependent manner.
[0115] CLDN6 endogenously expressing PA-1 cells were transiently
transfected by electroporation with a total of 20 .mu.g/ml IVT-mRNA
containing 0.2-20 .mu.g/ml 6RHU3 IVT-mRNA plus appropriate amounts
of a bi-scFv IVT-mRNA targeting a non-expressed TAA. Transfection
of 20 .mu.g/ml bi-scFv IVT-mRNA targeting a non-expressed TAA (0.0
.mu.g/ml 6RHU3 IVT-mRNA) served as specificity control. Transfected
target cells were coincubated with human cytotoxic T cells (Pan T
cells) in an effector to target ratio of 5:1 in 6-well plates in
duplicates. As T cell activation reference human T cells were
cultured alone without 6PHU5 protein (hu TL-) or with 6PHU5 protein
(hu TL protein ctrl). As negative control T cells were coincubated
with untreated PA-1 target cells (hu TL+PA-1-ctrl). 6PHU5 protein
served as positive control in a concentration of 50 ng/ml (hu
TL+PA-1 protein ctrl). After 48 h T cells were harvested and
labeled with anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC and
analyzed by flow cytometry. Graphs demonstrate percentages of
positively stained human T cells as determined via FlowJo software.
Bi-scFv indicates bispecific single chain variable fragment; ctrl,
control; hu, human; IVT, in vitro transcribed; mRNA, messenger RNA;
TL, T lymphocyte.
[0116] FIG. 35. EC50 of 6RHU3 for specific target cell lysis after
48 h is approximately 200 ng/ml.
[0117] CLDN6 endogenously expressing PA-1 cells which stably
express luciferase were transiently transfected by electroporation
with a total concentration of 13.3 .mu.g/ml bi-scFv IVT-mRNA
containing 0.004-13.3 .mu.g/ml 6RHU3 and an appropriate amount of a
bi-scFv IVT-mRNA targeting a non-expressed TAA. Transfected target
cells were seeded with human T cells in an effector to target ratio
of 5:1 in triplicates in a 96-well format. As minimum lysis control
(L.sub.min) each individual transfected target cell sample was
seeded without effector cells. Maximum lysis (L.sub.max) for the
normalization to spontaneous luminescence counts was achieved by
addition of Triton X-100 to control wells containing effector and
non-treated target cells shortly prior to luciferin addition. 30
min after addition of luciferin solution the luminescence was
measured in an Infinite M200 Tecan microplate reader after 24 h and
48 h. Specific target cell lysis was calculated by the formula: %
specific lysis=[1-(luminescence.sub.test
sample-L.sub.max)/(L.sub.min_test sample-L.sub.max)].times.100.
Values were plotted against log 10 of 6RHU3 concentration. EC50
indicates the half maximal effective concentration; L, lysis.
[0118] FIG. 36. T cell proliferation is specifically induced in
response to 6RHU3 secretion by target cells in the presence of
CLDN6.
[0119] Human T cells were CFSE stained for the assay. T cells were
cultivated without target cells (T cells) in combination with 5
.mu.g/ml OKT3 and 2 .mu.g/ml .alpha.CD28 as positive activation
control (+ctrl), with 5 ng/ml non-targeting control bi-scFv (-ctrl
protein) or with 5 ng/ml 6PHU3 protein (6PHU3 protein). T cells and
PA-1 target cells endogenously expressing CLDN6 were incubated
together (T cells+CLDN6 positive target cells) without anything
(mock) or with 5 ng/ml 6PHU3 protein (6PHU3 protein). To test
IVT-mRNA, PA-1 cells were transfected with 20 .mu.g/ml 6RHU3
IVT-mRNA (6RHU3 mRNA) or a bi-scFv IVT-mRNA targeting a
non-expressed TAA (-ctrl mRNA) and incubated with T cells. In
addition, PA-1 cells transfected with a bi-scFv IVT-mRNA targeting
a non-expressed TAA were combined with 5 ng/ml 6PHU3 protein (-ctrl
mRNA+6PHU3 protein). As further specificity control, samples with
the CLDN6-non expressing target cell line MDA-MB-231 together with
T cells were included (T cells+CLDN6 negative target cells).
MDA-MB-231 were either used untreated and incubated without
anything (mock), with 5 ng/ml control bi-scFv protein (-ctrl
protein) or 5 ng/ml 6PHU3 protein (6PHU3 protein) or MDA-MB-231
were transfected with 20 .mu.g/ml 6RHU3 IVT-mRNA (6RHU3 mRNA) or a
bi-scFv IVT-mRNA targeting a non-expressed TAA (-ctrl mRNA). The
assay was performed in a 5:1 effector to target ratio in 96-wells,
with each sample in triplicate and incubation times of 72 h.
Decrease of CFSE signal indicating T cell proliferation was
analyzed by flow cytometry, calculated by FlowJo software and
plotted as % proliferating T cells. CFSE indicates
carboxyfluorescein succinimidyl ester; IVT, in vitro transcribed;
mRNA, messenger RNA.
[0120] FIGS. 37A, 37B, and 37C show Proof of 6RHU3 translation by
mammalian cells transfected with bi-scFv IVT-mRNA or -replicon
RNA
[0121] (A) 5.times.10.sup.6 BHK21 cells were transiently
transfected by electroporation with 40 .mu.g/ml of 6RHU3 IVT-mRNA
or -replicon RNA. Transfection of 40 .mu.g/ml no.25 IVT-mRNA was
included as extra sample. As mock ctrl cells were electroporated
without RNA. 18 h post transfection supernatant and cells were
harvested. Cells were lysed and supernatants were subjected to
.about.50-fold concentration. Untreated and concentrated
supernatants were analyzed by ELISA using Ni-NTA plates,
anti-mCLDN6ab idiotypic mAB and a secondary AP-conjugated antibody.
Purified 6PHU3 protein in a dilution row ranging from 2.3 to 150
ng/ml in steps of 2 was used as standard. (B) Concentrated
supernatant and cell lysates of (A) and 0.1 .mu.g purified 6PHU3
protein as positive control were separated via SDS-PAGE. Western
Blot analysis was performed with primary monoclonal anti-His and
secondary peroxidase conjugated anti-mouse antibody. (C)
5.times.10.sup.6 BHK21 cells were transiently transfected by
electroporation with 40 .mu.g/ml of 6RHU3 or no.25 IVT-mRNA. As
mock control cells were electroporated without RNA. 48 h post
transfection supernatant was harvested and subjected to 40-fold
concentration. SN and 0.1 .mu.g purified 6PHU3 protein as positive
control were separated via SDS-PAGE. Western Blot analysis was
performed with primary monoclonal anti-His and secondary peroxidase
conjugated anti-mouse antibody. Ctrl indicates control; mAB,
monoclonal antibody; SN, supernatant; WB, Western blot.
[0122] FIG. 38. Injection of 6RHU3 bi-scFv IVT-mRNA or -replicon
RNA leads to in vivo translation and detectable bi-scFv molecules
in mice
[0123] 10 .mu.g 6RHU3 IVT-mRNA with or without EBK IVT-mRNA or 10
.mu.g 6RHU3 IVT-replicon was IM injected into NSG mice. Serum from
blood, collected 7 days post injection was applied in an in vitro
cytotox assay. CLDN6 endogenously and luciferase stably expressing
PA-1/luc target cells were coincubated with human T cells in an E:T
ratio of 30:1 with 20 .mu.l sample serum for 48 h. Standard 6PHU3
protein control, L.sub.min and L.sub.max contained 20 .mu.l NSG
mock serum. EBK indicates vaccinia virus protein cocktail E3,
B-18R, K3; IM, intramuscular.
[0124] FIGS. 39A, 39B, 39C, and 39D show Cytotoxic results of
anti-CLDN18.2 bi-scFv proteins containing the scFv anti-CD3 binding
domain at the C-terminal part of the protein.
[0125] Bi-scFv variants directed against CLDN18.2 and CD3 were
transiently expressed in CHO cells and purified with Protein-L
resin for the comparison of their potency in a cytotoxic assay.
CLDN18.2 endogenously expressing NugC4 cells which stably express
luciferase were taken as target cells. Human T cells and target
cells were incubated in an E:T ratio of 5:1 with 5000, 1000, 200
and 40 ng/ml of each of the bi-scFv proteins in a 96-well format.
Each test sample was plated threefold, the control sample for
L.sub.min was plated threefold. Coincubation times before analysis
were 24 h and 48 h. After addition of luciferin solution at the
given time points, the luminescence was measured in an Infinite
M200 TECAN reader. Specific target cell lysis was calculated for
each concentration and reported.
a. The variable domains of the anti-CD3 are in the VH-VL domain
order and separated by the LL4 peptide linker. b. The variable
domains of the anti-CD3 are in the VH-VL order and separated by the
LL4 peptide linker. The scFv anti-CD3 contains an interface
disulfide bridge between the VH and VL domains. c. The variable
domains of the anti-CD3 are in the VL-VH order and separated by the
LL5 peptide linker. d. The variable domains of the anti-CD3 are in
the VL-VH order and separated by the LL5 peptide linker. The scFv
anti-CD3 contains an interface disulfide bridge between the VL and
VH domains.
[0126] FIGS. 40A, 40B, and 40C show Intra-assay comparison of EC50
values obtained in luciferase cytotoxic assay with anti-CLDN6
bi-scFv proteins.
[0127] Luciferase cytotoxic assays were performed with three
different donors for T cell preparation. The calculated EC50
values, calculated with the 6 tested anti-CLDN6 bi-scFv proteins
after 24h and 48 h incubation, are reported for each independent
assay (A, B and C). CLDN6 endogenously expressing PA-1 cells were
incubated for 24 h and 48 h with escalating concentrations
(0.025-50000 ng/ml for A and B, 0.0025-5000 ng/ml for C) of
anti-CLDN6 bi-scFv proteins and human T cells in an effector to
target ratio of 5:1 in triplicates in a 96-well format. As minimum
lysis control (L.sub.min) effector and target cells were plated
without bi-scFv proteins. Maximum lysis (L.sub.max) for the
normalization to spontaneous luminescence counts was achieved by
addition of Triton X-100 to control wells containing effector and
target cells in the absence of bi-scFv shortly prior to luciferin
addition. 30 min after addition of luciferin solution the
luminescence was measured in an Infinite M200 Tecan microplate
reader after 24 h and 48 h of target and effector cell incubation.
Specific target cell lysis was calculated by the formula: %
specific lysis=[1-(luminescence.sub.test
sample-L.sub.max)/(L.sub.min-L.sub.max)].times.100. EC50 indicates
the half maximal effective concentration; L, lysis; NA, not
applicable.
DETAILED DESCRIPTION OF THE INVENTION
[0128] Although the present invention is described in detail below,
it is to be understood that this invention is not limited to the
particular methodologies, protocols and reagents described herein
as these may vary. It is also to be understood that the terminology
used herein is for the purpose of describing particular embodiments
only, and is not intended to limit the scope of the present
invention which will be limited only by the appended claims. Unless
defined otherwise, all technical and scientific terms used herein
have the same meanings as commonly understood by one of ordinary
skill in the art.
[0129] In the following, the elements of the present invention will
be described. These elements are listed with specific embodiments,
however, it should be understood that they may be combined in any
manner and in any number to create additional embodiments. The
variously described examples and preferred embodiments should not
be construed to limit the present invention to only the explicitly
described embodiments. This description should be understood to
support and encompass embodiments which combine the explicitly
described embodiments with any number of the disclosed and/or
preferred elements. Furthermore, any permutations and combinations
of all described elements in this application should be considered
disclosed by the description of the present application unless the
context indicates otherwise.
[0130] Preferably, the terms used herein are defined as described
in "A multilingual glossary of biotechnological terms: (IUPAC
Recommendations)", H. G. W. Leuenberger, B. Nagel, and H. Kolbl,
Eds., Helvetica Chimica Acta, CH-4010 Basel, Switzerland,
(1995).
[0131] The practice of the present invention will employ, unless
otherwise indicated, conventional methods of chemistry,
biochemistry, cell biology, immunology, and recombinant DNA
techniques which are explained in the literature in the field (cf.,
e.g., Molecular Cloning: A Laboratory Manual, 2.sup.nd Edition, J.
Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold
Spring Harbor 1989).
[0132] Throughout this specification and the claims which follow,
unless the context requires otherwise, the word "comprise", and
variations such as "comprises" and "comprising", will be understood
to imply the inclusion of a stated member, integer or step or group
of members, integers or steps but not the exclusion of any other
member, integer or step or group of members, integers or steps
although in some embodiments such other member, integer or step or
group of members, integers or steps may be excluded, i.e. the
subject-matter consists in the inclusion of a stated member,
integer or step or group of members, integers or steps. The terms
"a" and "an" and "the" and similar reference used in the context of
describing the invention (especially in the context of the claims)
are to be construed to cover both the singular and the plural,
unless otherwise indicated herein or clearly contradicted by
context. Recitation of ranges of values herein is merely intended
to serve as a shorthand method of referring individually to each
separate value falling within the range. Unless otherwise indicated
herein, each individual value is incorporated into the
specification as if it were individually recited herein. All
methods described herein can be performed in any suitable order
unless otherwise indicated herein or otherwise clearly contradicted
by context. The use of any and all examples, or exemplary language
(e.g., "such as"), provided herein is intended merely to better
illustrate the invention and does not pose a limitation on the
scope of the invention otherwise claimed. No language in the
specification should be construed as indicating any non-claimed
element essential to the practice of the invention.
[0133] Several documents are cited throughout the text of this
specification. Each of the documents cited herein (including all
patents, patent applications, scientific publications,
manufacturer's specifications, instructions, etc.), whether supra
or infra, are hereby incorporated by reference in their entirety.
Nothing herein is to be construed as an admission that the
invention is not entitled to antedate such disclosure by virtue of
prior invention.
[0134] Claudins are a family of proteins that are the most
important components of tight junctions, where they establish the
paracellular barrier that controls the flow of molecules in the
intercellular space between cells of an epithelium. Claudins are
transmembrane proteins spanning the membrane 4 times with the
N-terminal and the C-terminal end both located in the cytoplasm.
The first extracellular loop, termed EC1 or ECL1, consists on
average of 53 amino acids, and the second extracellular loop,
termed EC2 or ECL2, consists of around 24 amino acids. Cell surface
proteins of the claudin family, such as CLDN6 and CLDN18.2, are
expressed in tumors of various origins, and are particularly suited
as target structures in connection with antibody-mediated cancer
immunotherapy due to their selective expression (no expression in a
toxicity relevant normal tissue) and localization to the plasma
membrane.
[0135] In the context of the present invention, the preferred
claudins are CLDN6 and CLDN18.2. CLDN6 and CLDN18.2 have been
identified as differentially expressed in tumor tissues, with the
only normal tissues expressing CLDN18.2 being stomach and the only
normal tissue expressing CLDN6 being placenta.
[0136] CLDN18.2 is selectively expressed in normal tissues in
differentiated epithelial cells of the gastric mucosa. CLDN18.2 is
expressed in cancers of various origins such as pancreatic
carcinoma, esophageal carcinoma, gastric carcinoma, bronchial
carcinoma, breast carcinoma, and ENT tumors. CLDN18.2 is a valuable
target for the prevention and/or treatment of primary tumors, such
as gastric cancer, esophageal cancer, pancreatic cancer, lung
cancer such as non small cell lung cancer (NSCLC), ovarian cancer,
colon cancer, hepatic cancer, head-neck cancer, and cancers of the
gallbladder, and metastases thereof, in particular gastric cancer
metastasis such as Krukenberg tumors, peritoneal metastasis, and
lymph node metastasis.
[0137] CLDN6 has been found to be expressed, for example, in
ovarian cancer, lung cancer, gastric cancer, breast cancer, hepatic
cancer, pancreatic cancer, skin cancer, melanomas, head neck
cancer, sarcomas, bile duct cancer, renal cell cancer, and urinary
bladder cancer. CLDN6 is a particularly preferred target for the
prevention and/or treatment of ovarian cancer, in particular
ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer,
including small cell lung cancer (SCLC) and non-small cell lung
cancer (NSCLC), in particular squamous cell lung carcinoma and
adenocarcinoma, gastric cancer, breast cancer, hepatic cancer,
pancreatic cancer, skin cancer, in particular basal cell carcinoma
and squamous cell carcinoma, malignant melanoma, head and neck
cancer, in particular malignant pleomorphic adenoma, sarcoma, in
particular synovial sarcoma and carcinosarcoma, bile duct cancer,
cancer of the urinary bladder, in particular transitional cell
carcinoma and papillary carcinoma, kidney cancer, in particular
renal cell carcinoma including clear cell renal cell carcinoma and
papillary renal cell carcinoma, colon cancer, small bowel cancer,
including cancer of the ileum, in particular small bowel
adenocarcinoma and adenocarcinoma of the ileum, testicular
embryonal carcinoma, placental choriocarcinoma, cervical cancer,
testicular cancer, in particular testicular seminoma, testicular
teratoma and embryonic testicular cancer, uterine cancer, germ cell
tumors such as a teratocarcinoma or an embryonal carcinoma, in
particular germ cell tumors of the testis, and the metastatic forms
thereof. In one embodiment, the cancer disease associated with
CLDN6 expression is selected from the group consisting of ovarian
cancer, lung cancer, metastatic ovarian cancer and metastatic lung
cancer. Preferably, the ovarian cancer is a carcinoma or an
adenocarcinoma. Preferably, the lung cancer is a carcinoma or an
adenocarcinoma, and preferably is bronchiolar cancer such as a
bronchiolar carcinoma or bronchiolar adenocarcinoma.
[0138] The term "CLDN" as used herein means claudin and includes
CLDN18.2 and CLDN6. Preferably, a claudin is a human claudin.
[0139] The term "CLDN18" relates to claudin 18 and includes any
variants, including claudin 18 splice variant 1 (claudin 18.1
(CLDN18.1)) and claudin 18 splice variant 2 (claudin 18.2
(CLDN18.2)).
[0140] The term "CLDN18.2" preferably relates to human CLDN18.2,
and, in particular, to a protein comprising, preferably consisting
of the amino acid sequence according to SEQ ID NO: 1 of the
sequence listing or a variant of said amino acid sequence. The
first extracellular loop of CLDN18.2 preferably comprises amino
acids 27 to 81, more preferably amino acids 29 to 78 of the amino
acid sequence shown in SEQ ID NO: 1. The second extracellular loop
of CLDN18.2 preferably comprises amino acids 140 to 180 of the
amino acid sequence shown in SEQ ID NO: 1. Said first and second
extracellular loops preferably form the extracellular portion of
CLDN18.2.
[0141] The term "CLDN6" preferably relates to human CLDN6, and, in
particular, to a protein comprising, preferably consisting of the
amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3 of the sequence
listing or a variant of said amino acid sequence. The first
extracellular loop of CLDN6 preferably comprises amino acids 28 to
80, more preferably amino acids 28 to 76 of the amino acid sequence
shown in SEQ ID NO: 2 or the amino acid sequence shown in SEQ ID
NO: 3. The second extracellular loop of CLDN6 preferably comprises
amino acids 138 to 160, preferably amino acids 141 to 159, more
preferably amino acids 145 to 157 of the amino acid sequence shown
in SEQ ID NO: 2 or the amino acid sequence shown in SEQ ID NO: 3.
Said first and second extracellular loops preferably form the
extracellular portion of CLDN6.
[0142] The term "variant" according to the invention refers, in
particular, to mutants, splice variants, conformations, isoforms,
allelic variants, species variants and species homologs, in
particular those which are naturally present. An allelic variant
relates to an alteration in the normal sequence of a gene, the
significance of which is often unclear. Complete gene sequencing
often identifies numerous allelic variants for a given gene. A
species homolog is a nucleic acid or amino acid sequence with a
different species of origin from that of a given nucleic acid or
amino acid sequence. The term "variant" shall encompass any
posttranslationally modified variants and conformation
variants.
[0143] The second target molecule of the binding agents described
herein is CD3 (cluster of differentiation 3). The CD3 complex
denotes an antigen that is expressed on mature human T-cells,
thymocytes and a subset of natural killer cells as part of the
multimolecular T-cell receptor (TCR) complex. The T-cell
co-receptor is a protein complex and is composed of four distinct
chains. In mammals, the complex contains a CD3.gamma. chain, a
CD3.delta. chain, and two CD3.epsilon. chains. These chains
associate with a molecule known as the T-cell receptor (TCR) and
the .zeta.-chain to generate an activation signal in T lymphocytes.
The TCR, .zeta.-chain, and CD3 molecules together comprise the TCR
complex.
[0144] The human CD3 epsilon is indicated in GenBank Accession No.
NM_000733 and comprises SEQ ID NO: 4. The human CD3 gamma is
indicated in GenBank Accession No. NM 000073. The human CD3 delta
is indicated in GenBank Accession No. NM 000732. CD3 is responsible
for the signal transduction of the TCR. As described by Lin and
Weiss, Journal of Cell Science 114, 243-244 (2001), activation of
the TCR complex by binding of MHC-presented specific antigen
epitopes results in the phosphorylation of immunoreceptor
tyrosine-based activation motifs (ITAMs) by Src family kinases,
triggering recruitment of further kinases which results in T cell
activation including Ca.sup.2+ release. Clustering of CD3 on T
cells, e.g. by immobilized anti-CD3-antibodies, leads to T cell
activation similar to the engagement of the T cell receptor, but
independent from its clone typical specificity.
[0145] As used herein, "CD3" includes human CD3 and denotes an
antigen that is expressed on human T cells as part of the
multimolecular T cell receptor complex.
[0146] With respect to CD3, the binding agent of the invention
preferably recognizes the epsilon-chain of CD3, particular, it
recognizes an epitope that corresponds to the first 27 N-terminal
amino acids of CD3 epsilon or functional fragments of this 27 amino
acid stretch.
[0147] According to the invention, the term "claudin positive
cancer" or similar terms means a cancer involving cancer cells
expressing a claudin, preferably on the surface of said cancer
cells.
[0148] "Cell surface" is used in accordance with its normal meaning
in the art, and thus includes the outside of the cell which is
accessible to binding by proteins and other molecules
[0149] A claudin is expressed on the surface of cells if it is
located at the surface of said cells and is accessible to binding
by claudin-specific antibodies added to the cells.
[0150] The term "extracellular portion" in the context of the
present invention refers to a part of a molecule such as a protein
that is facing the extracellular space of a cell and preferably is
accessible from the outside of said cell, e.g., by antigen-binding
molecules such as antibodies located outside the cell. Preferably,
the term refers to one or more extracellular loops or domains or a
fragment thereof.
[0151] The terms "part" or "fragment" are used interchangeably
herein and refer to a continuous element. For example, a part of a
structure such as an amino acid sequence or protein refers to a
continuous element of said structure. A portion, a part or a
fragment of a structure preferably comprises one or more functional
properties of said structure. For example, a portion, a part or a
fragment of an epitope or peptide is preferably immunologically
equivalent to the epitope or peptide it is derived from. A part or
fragment of a protein sequence preferably comprises a sequence of
at least 6, in particular at least 8, at least 12, at least 15, at
least 20, at least 30, at least 50, or at least 100 consecutive
amino acids of the protein sequence.
[0152] According to the invention, CLDN18.2 is not substantially
expressed in a cell if the level of expression is lower compared to
expression in stomach cells or stomach tissue. Preferably, the
level of expression is less than 10%, preferably less than 5%, 3%,
2%, 1%, 0.5%, 0.1% or 0.05% of the expression in stomach cells or
stomach tissue or even lower. Preferably, CLDN18.2 is not
substantially expressed in a cell if the level of expression
exceeds the level of expression in non-cancerous tissue other than
stomach by no more than 2-fold, preferably 1.5-fold, and preferably
does not exceed the level of expression in said non-cancerous
tissue. Preferably, CLDN18.2 is not substantially expressed in a
cell if the level of expression is below the detection limit and/or
if the level of expression is too low to allow binding by
CLDN18.2-specific antibodies added to the cells.
[0153] According to the invention, CLDN18.2 is expressed in a cell
if the level of expression exceeds the level of expression in
non-cancerous tissue other than stomach preferably by more than
2-fold, preferably 10-fold, 100-fold, 1000-fold, or 10000-fold.
Preferably, CLDN18.2 is expressed in a cell if the level of
expression is above the detection limit and/or if the level of
expression is high enough to allow binding by CLDN18.2-specific
antibodies added to the cells. Preferably, CLDN18.2 expressed in a
cell is expressed or exposed on the surface of said cell.
[0154] According to the invention, CLDN6 is not substantially
expressed in a cell if the level of expression is lower compared to
expression in placenta cells or placenta tissue. Preferably, the
level of expression is less than 10%, preferably less than 5%, 3%,
2%, 1%, 0.5%, 0.1% or 0.05% of the expression in placenta cells or
placenta tissue or even lower. Preferably, CLDN6 is not
substantially expressed in a cell if the level of expression
exceeds the level of expression in non-cancerous tissue other than
placenta by no more than 2-fold, preferably 1.5-fold, and
preferably does not exceed the level of expression in said
non-cancerous tissue. Preferably, CLDN6 is not substantially
expressed in a cell if the level of expression is below the
detection limit and/or if the level of expression is too low to
allow binding by CLDN6-specific antibodies added to the cells.
[0155] According to the invention, CLDN6 is expressed in a cell if
the level of expression exceeds the level of expression in
non-cancerous tissue other than placenta preferably by more than
2-fold, preferably 10-fold, 100-fold, 1000-fold, or 10000-fold.
Preferably, CLDN6 is expressed in a cell if the level of expression
is above the detection limit and/or if the level of expression is
high enough to allow binding by CLDN6-specific antibodies added to
the cells. Preferably, CLDN6 expressed in a cell is expressed or
exposed on the surface of said cell.
[0156] According to the invention, the term "disease" refers to any
pathological state, including cancer, in particular those forms of
cancer described herein. Any reference herein to cancer or
particular forms of cancer also includes cancer metastasis thereof.
In a preferred embodiment, a disease to be treated according to the
present application involves cells expressing claudin (CLDN) such
as CLDN18.2 and/or CLDN6.
[0157] "Diseases associated with cells expressing CLDN" or similar
expressions means according to the invention that CLDN is expressed
in cells of a diseased tissue or organ. In one embodiment,
expression of CLDN in cells of a diseased tissue or organ is
increased compared to the state in a healthy tissue or organ. An
increase refers to an increase by at least 10%, in particular at
least 20%, at least 50%, at least 100%, at least 200%, at least
500%, at least 1000%, at least 10000% or even more. In one
embodiment, expression is only found in a diseased tissue, while
expression in a healthy tissue is repressed. According to the
invention, diseases associated with cells expressing CLDN include
cancer diseases. Furthermore, according to the invention, cancer
diseases preferably are those wherein the cancer cells express
CLDN.
[0158] As used herein, a "cancer disease" or "cancer" includes a
disease characterized by aberrantly regulated cellular growth,
proliferation, differentiation, adhesion, and/or migration. By
"cancer cell" is meant an abnormal cell that grows by a rapid,
uncontrolled cellular proliferation and continues to grow after the
stimuli that initiated the new growth cease. Preferably, a "cancer
disease" is characterized by cells expressing CLDN and a cancer
cell expresses CLDN. A cell expressing CLDN preferably is a cancer
cell, preferably of the cancers described herein.
[0159] The term "cancer" according to the invention comprises
leukemias, seminomas, melanomas, teratomas, lymphomas,
neuroblastomas, gliomas, rectal cancer, endometrial cancer, kidney
cancer, adrenal cancer, thyroid cancer, blood cancer, skin cancer,
cancer of the brain, cervical cancer, intestinal cancer, liver
cancer, colon cancer, stomach cancer, intestine cancer, head and
neck cancer, gastrointestinal cancer, lymph node cancer, esophagus
cancer, colorectal cancer, pancreas cancer, ear, nose and throat
(ENT) cancer, breast cancer, prostate cancer, cancer of the uterus,
ovarian cancer and lung cancer and the metastases thereof. Examples
thereof are lung carcinomas, mamma carcinomas, prostate carcinomas,
colon carcinomas, renal cell carcinomas, cervical carcinomas, or
metastases of the cancer types or tumors described above. The term
cancer according to the invention also comprises cancer
metastases.
[0160] According to the invention, a "carcinoma" is a malignant
tumor derived from epithelial cells. This group represents the most
common cancers, including the common forms of breast, prostate,
lung and colon cancer.
[0161] "Adenocarcinoma" is a cancer that originates in glandular
tissue. This tissue is also part of a larger tissue category known
as epithelial tissue. Epithelial tissue includes skin, glands and a
variety of other tissue that lines the cavities and organs of the
body. Epithelium is derived embryologically from ectoderm, endoderm
and mesoderm. To be classified as adenocarcinoma, the cells do not
necessarily need to be part of a gland, as long as they have
secretory properties. This form of carcinoma can occur in some
higher mammals, including humans. Well differentiated
adenocarcinomas tend to resemble the glandular tissue that they are
derived from, while poorly differentiated may not. By staining the
cells from a biopsy, a pathologist will determine whether the tumor
is an adenocarcinoma or some other type of cancer.
[0162] Adenocarcinomas can arise in many tissues of the body due to
the ubiquitous nature of glands within the body. While each gland
may not be secreting the same substance, as long as there is an
exocrine function to the cell, it is considered glandular and its
malignant form is therefore named adenocarcinoma. Malignant
adenocarcinomas invade other tissues and often metastasize given
enough time to do so. Ovarian adenocarcinoma is the most common
type of ovarian carcinoma. It includes the serous and mucinous
adenocarcinomas, the clear cell adenocarcinoma and the endometrioid
adenocarcinoma.
[0163] By "metastasis" is meant the spread of cancer cells from its
original site to another part of the body. The formation of
metastasis is a very complex process and depends on detachment of
malignant cells from the primary tumor, invasion of the
extracellular matrix, penetration of the endothelial basement
membranes to enter the body cavity and vessels, and then, after
being transported by the blood, infiltration of target organs.
Finally, the growth of a new tumor at the target site depends on
angiogenesis. Tumor metastasis often occurs even after the removal
of the primary tumor because tumor cells or components may remain
and develop metastatic potential. In one embodiment, the term
"metastasis" according to the invention relates to "distant
metastasis" which relates to a metastasis which is remote from the
primary tumor and the regional lymph node system. In one
embodiment, the term "metastasis" according to the invention
relates to lymph node metastasis. One particular form of metastasis
which is treatable using the therapy of the invention is metastasis
originating from gastric cancer as primary site. In preferred
embodiments such gastric cancer metastasis is Krukenberg tumors,
peritoneal metastasis and/or lymph node metastasis.
[0164] Krukenberg tumor is an uncommon metastatic tumor of the
ovary accounting for 1% to 2% of all ovarian tumors. Prognosis of
Krukenberg tumor is still very poor and there is no established
treatment for Krukenberg tumors. Krukenberg tumor is a metastatic
signet ring cell adenocarcinoma of the ovary. Stomach is the
primary site in most Krukenberg tumor cases (70%). Carcinomas of
colon, appendix, and breast (mainly invasive lobular carcinoma) are
the next most common primary sites. Rare cases of Krukenberg tumor
originating from carcinomas of the gallbladder, biliary tract,
pancreas, small intestine, ampulla of Vater, cervix, and urinary
bladder/urachus have been reported.
[0165] By "treat" is meant to administer a compound or composition
or a combination of compounds or compositions to a subject in order
to prevent or eliminate a disease, including reducing the size of a
tumor or the number of tumors in a subject; arrest or slow a
disease in a subject; inhibit or slow the development of a new
disease in a subject; decrease the frequency or severity of
symptoms and/or recurrences in a subject who currently has or who
previously has had a disease; and/or prolong, i.e. increase the
lifespan of the subject.
[0166] In particular, the term "treatment of a disease" includes
curing, shortening the duration, ameliorating, preventing, slowing
down or inhibiting progression or worsening, or preventing or
delaying the onset of a disease or the symptoms thereof.
[0167] In the context of the present invention, terms such as
"protect", "prevent", "prophylactic", "preventive", or "protective"
relate to the prevention or treatment or both of the occurrence
and/or the propagation of a disease in a subject and, in
particular, to minimizing the chance that a subject will develop a
disease or to delaying the development of a disease. For example, a
person at risk for cancer would be a candidate for therapy to
prevent cancer.
[0168] By "being at risk" is meant a subject that is identified as
having a higher than normal chance of developing a disease, in
particular cancer, compared to the general population. In addition,
a subject who has had, or who currently has, a disease, in
particular cancer, is a subject who has an increased risk for
developing a disease, as such a subject may continue to develop a
disease. Subjects who currently have, or who have had, a cancer
also have an increased risk for cancer metastases.
[0169] The term "patient" means according to the invention a
subject for treatment, in particular a diseased subject, including
human beings, nonhuman primates or another animals, in particular
mammals such as cows, horses, pigs, sheeps, goats, dogs, cats or
rodents such as mice and rats. In a particularly preferred
embodiment, a patient is a human being.
[0170] "Target cell" shall mean any undesirable cell such as a
cancer cell. In preferred embodiments, the target cell expresses
CLDN.
[0171] The term "antigen" relates to an agent such as a protein or
peptide comprising an epitope against which an immune response is
directed and/or is to be directed. In a preferred embodiment, an
antigen is a tumor-associated antigen, such as CLDN18.2 or CLDN6,
i.e., a constituent of cancer cells which may be derived from the
cytoplasm, the cell surface and the cell nucleus, in particular
those antigens which are produced, preferably in large quantity,
intracellular or as surface antigens on cancer cells.
[0172] In the context of the present invention, the term
"tumor-associated antigen" preferably relates to proteins that are
under normal conditions specifically expressed in a limited number
of tissues and/or organs or in specific developmental stages and
are expressed or aberrantly expressed in one or more tumor or
cancer tissues. In the context of the present invention, the
tumor-associated antigen is preferably associated with the cell
surface of a cancer cell and is preferably not or only rarely
expressed in normal tissues.
[0173] The term "epitope" refers to an antigenic determinant in a
molecule, i.e., to the part in a molecule that is recognized by the
immune system, for example, that is recognized by an antibody. For
example, epitopes are the discrete, three-dimensional sites on an
antigen, which are recognized by the immune system. Epitopes
usually consist of chemically active surface groupings of molecules
such as amino acids or sugar side chains and usually have specific
three dimensional structural characteristics, as well as specific
charge characteristics. Conformational and non-conformational
epitopes are distinguished in that the binding to the former but
not the latter is lost in the presence of denaturing solvents. An
epitope of a protein preferably comprises a continuous or
discontinuous portion of said protein and is preferably between 5
and 100, preferably between 5 and 50, more preferably between 8 and
30, most preferably between 10 and 25 amino acids in length, for
example, the epitope may be preferably 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in
length.
[0174] The term "antibody" refers to a glycoprotein comprising at
least two heavy (H) chains and two light (L) chains inter-connected
by disulfide bonds. The term "antibody" includes monoclonal
antibodies, recombinant antibodies, human antibodies, humanized
antibodies and chimeric antibodies. Each heavy chain is comprised
of a heavy chain variable region (abbreviated herein as VH) and a
heavy chain constant region. Each light chain is comprised of a
light chain variable region (abbreviated herein as VL) and a light
chain constant region. The VH and VL regions can be further
subdivided into regions of hypervariability, termed complementarity
determining regions (CDR), interspersed with regions that are more
conserved, termed framework regions (FR). Each VH and VL is
composed of three CDRs and four FRs, arranged from amino-terminus
to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2,
FR3, CDR3, FR4. The variable regions of the heavy and light chains
contain a binding domain that interacts with an antigen. The
constant regions of the antibodies may mediate the binding of the
immunoglobulin to host tissues or factors, including various cells
of the immune system (e.g., effector cells) and the first component
(Clq) of the classical complement system.
[0175] The term "monoclonal antibody" as used herein refers to a
preparation of antibody molecules of single molecular composition.
A monoclonal antibody displays a single binding specificity and
affinity. In one embodiment, the monoclonal antibodies are produced
by a hybridoma which includes a B cell obtained from a non-human
animal, e.g., mouse, fused to an immortalized cell.
[0176] The term "recombinant antibody", as used herein, includes
all antibodies that are prepared, expressed, created or isolated by
recombinant means, such as (a) antibodies isolated from an animal
(e.g., a mouse) that is transgenic or transchromosomal with respect
to the immunoglobulin genes or a hybridoma prepared therefrom, (b)
antibodies isolated from a host cell transformed to express the
antibody, e.g., from a transfectoma, (c) antibodies isolated from a
recombinant, combinatorial antibody library, and (d) antibodies
prepared, expressed, created or isolated by any other means that
involve splicing of immunoglobulin gene sequences to other DNA
sequences.
[0177] The term "human antibody", as used herein, is intended to
include antibodies having variable and constant regions derived
from human germline immunoglobulin sequences. Human antibodies may
include amino acid residues not encoded by human germline
immunoglobulin sequences (e.g., mutations introduced by random or
site-specific mutagenesis in vitro or by somatic mutation in
vivo).
[0178] The term "humanized antibody" refers to a molecule having an
antigen binding site that is substantially derived from an
immunoglobulin from a non-human species, wherein the remaining
immunoglobulin structure of the molecule is based upon the
structure and/or sequence of a human immunoglobulin. The antigen
binding site may either comprise complete variable domains fused
onto constant domains or only the complementarity determining
regions (CDR) grafted onto appropriate framework regions in the
variable domains. Antigen binding sites may be wild-type or
modified by one or more amino acid substitutions, e.g. modified to
resemble human immunoglobulins more closely. Some forms of
humanized antibodies preserve all CDR sequences (for example a
humanized mouse antibody which contains all six CDRs from the mouse
antibody). Other forms have one or more CDRs which are altered with
respect to the original antibody.
[0179] The term "chimeric antibody" refers to those antibodies
wherein one portion of each of the amino acid sequences of heavy
and light chains is homologous to corresponding sequences in
antibodies derived from a particular species or belonging to a
particular class, while the remaining segment of the chain is
homologous to corresponding sequences in another. Typically the
variable region of both light and heavy chains mimics the variable
regions of antibodies derived from one species of mammals, while
the constant portions are homologous to sequences of antibodies
derived from another. One clear advantage to such chimeric forms is
that the variable region can conveniently be derived from presently
known sources using readily available B-cells or hybridomas from
non-human host organisms in combination with constant regions
derived from, for example, human cell preparations. While the
variable region has the advantage of ease of preparation and the
specificity is not affected by the source, the constant region
being human, is less likely to elicit an immune response from a
human subject when the antibodies are injected than would the
constant region from a non human source. However the definition is
not limited to this particular example.
[0180] Antibodies may be derived from different species, including
but not limited to mouse, rat, rabbit, guinea pig and human.
[0181] Antibodies described herein include IgA such as IgA1 or
IgA2, IgG1, IgG2, IgG3, IgG4, IgE, IgM, and IgD antibodies. In
various embodiments, the antibody is an IgG1 antibody, more
particularly an IgG1, kappa or IgG1, lambda isotype (i.e. IgG1,
.kappa., .lamda.), an IgG2a antibody (e.g. IgG2a, .kappa.,
.lamda.), an IgG2b antibody (e.g. IgG2b, .kappa., .lamda.), an IgG3
antibody (e.g. IgG3, .kappa., .lamda.) or an IgG4 antibody (e.g.
IgG4, .kappa., .lamda.).
[0182] As used herein, a "heterologous antibody" is defined in
relation to a transgenic organism producing such an antibody. This
term refers to an antibody having an amino acid sequence or an
encoding nucleic acid sequence corresponding to that found in an
organism not consisting of the transgenic organism, and being
generally derived from a species other than the transgenic
organism.
[0183] As used herein, a "heterohybrid antibody" refers to an
antibody having light and heavy chains of different organismal
origins. For example, an antibody having a human heavy chain
associated with a murine light chain is a heterohybrid
antibody.
[0184] The antibodies described herein are preferably isolated. An
"isolated antibody" as used herein, is intended to refer to an
antibody which is substantially free of other antibodies having
different antigenic specificities (e.g., an isolated antibody that
specifically binds to CLDN18.2 is substantially free of antibodies
that specifically bind antigens other than CLDN18.2). An isolated
antibody that specifically binds to an epitope, isoform or variant
of human CLDN18.2 may, however, have cross-reactivity to other
related antigens, e.g., from other species (e.g., CLDN18.2 species
homologs). Moreover, an isolated antibody may be substantially free
of other cellular material and/or chemicals. In one embodiment of
the invention, a combination of "isolated" monoclonal antibodies
relates to antibodies having different specificities and being
combined in a well defined composition or mixture.
[0185] The terms "antigen-binding portion" of an antibody (or
simply "binding portion") or "antigen-binding fragment" of an
antibody (or simply "binding fragment") or similar terms refer to
one or more fragments of an antibody that retain the ability to
specifically bind to an antigen. It has been shown that the
antigen-binding function of an antibody can be performed by
fragments of a full-length antibody. Examples of binding fragments
encompassed within the term "antigen-binding portion" of an
antibody include (i) Fab fragments, monovalent fragments consisting
of the VL, VH, CL and CH domains; (ii) F(ab').sub.2 fragments,
bivalent fragments comprising two Fab fragments linked by a
disulfide bridge at the hinge region; (iii) Fd fragments consisting
of the VH and CH domains; (iv) Fv fragments consisting of the VL
and VH domains of a single arm of an antibody, (v) dAb fragments
(Ward et al., (1989) Nature 341: 544-546), which consist of a VH
domain; (vi) isolated complementarity determining regions (CDR),
and (vii) combinations of two or more isolated CDRs which may
optionally be joined by a synthetic linker. Furthermore, although
the two domains of the Fv fragment, VL and VH, are coded for by
separate genes, they can be joined, using recombinant methods, by a
synthetic linker that enables them to be made as a single protein
chain in which the VL and VH regions pair to form monovalent
molecules (known as single chain Fv (scFv); see e.g., Bird et al.
(1988) Science 242: 423-426; and Huston et al. (1988) Proc. Natl.
Acad. Sci. USA 85: 5879-5883). Such single chain antibodies are
also intended to be encompassed within the term "antigen-binding
fragment" of an antibody. A further example is binding-domain
immunoglobulin fusion proteins comprising (i) a binding domain
polypeptide that is fused to an immunoglobulin hinge region
polypeptide, (ii) an immunoglobulin heavy chain CH2 constant region
fused to the hinge region, and (iii) an immunoglobulin heavy chain
CH3 constant region fused to the CH2 constant region. The binding
domain polypeptide can be a heavy chain variable region or a light
chain variable region. The binding-domain immunoglobulin fusion
proteins are further disclosed in US 2003/0118592 and US
2003/0133939. These antibody fragments are obtained using
conventional techniques known to those with skill in the art, and
the fragments are screened for utility in the same manner as are
intact antibodies.
[0186] The term "binding domain" characterizes in connection with
the present invention a structure, e.g. of an antibody, which binds
to/interacts with a given target structure/antigen/epitope. Thus,
the binding domain according to the invention designates an
"antigen-interaction-site".
[0187] All antibodies and derivatives of antibodies such as
antibody fragments as described herein for the purposes of the
invention are encompassed by the term "antibody". The term
"antibody derivatives" refers to any modified form of an antibody,
e.g., a conjugate of the antibody and another agent or antibody, or
an antibody fragment. Furthermore, the antibodies and derivatives
of antibodies as described herein are useful for producing binding
agents of the invention such as antibody fragments.
[0188] Naturally occurring antibodies are generally monospecific,
i.e. they bind to a single antigen. The present invention provides
binding agents binding to a cytotoxic cell (by engaging the CD3
receptor) and a cancer cell (by engaging CLDN). The binding agents
of the present invention are at least bispecific or multispecific
such as trispecific, tetraspecific and so on.
[0189] The binding agent of the invention may be in the format of
an antibody molecule or of an antibody-like molecule or of a
protein scaffold with antibody-like properties or of a cyclic
peptide with at least two binding specificities. Thus, the binding
agent may comprise one or more antibodies as described herein or
fragments thereof.
[0190] According to the invention, a bispecific molecule, in
particular a bispecific protein, such as a bispecific antibody is a
molecule that has two different binding specificities and thus may
bind to two different types of antigen such as CLDN and CD3.
Particularly, the term "bispecific antibody" as used herein refers
to an antibody comprising two antigen-binding sites, a first
binding site having affinity for a first antigen or epitope and a
second binding site having binding affinity for a second antigen or
epitope distinct from the first. In particular, a bispecific
antibody is an artificial protein that is composed of fragments of
two different antibodies (said fragments of two different
antibodies forming two binding domains) and consequently binds to
two different types of antigen. A bispecific antibody according to
the invention is engineered to simultaneously bind to an immune
cell, such as an immune effector cell, in particular a T cell such
as a cytotoxic cell (by binding to CD3) and a target cell like a
cancer cell (by binding to the tumor-associated antigen CLDN) to be
destroyed.
[0191] The term "bispecific antibody" also includes diabodies.
Diabodies are bivalent, bispecific antibodies in which VH and VL
domains are expressed on a single polypeptide chain, but using a
linker that is too short to allow for pairing between the two
domains on the same chain, thereby forcing the domains to pair with
complementary domains of another chain and creating two antigen
binding sites (see e.g., Holliger, P., et al. (1993) Proc. Natl.
Acad. Sci. USA 90: 6444-6448; Poljak, R. J., et al. (1994)
Structure 2: 1121-1123).
[0192] "Multispecific binding agents" are molecules which have more
than two different binding specificities.
[0193] Particularly preferred according to the invention are
bispecific antibodies including bispecific antibody fragments, in
particular bispecific single chain antibodies including bispecific
single chain antibody fragments. The term "bispecific single chain
antibody" denotes a single polypeptide chain comprising two binding
domains. In particular, the term "bispecific single chain antibody"
or "single chain bispecific antibody" or related terms in
accordance with the present invention preferably mean antibody
constructs resulting from joining at least two antibody variable
regions in a single polypeptide chain devoid of the constant and/or
Fc portion(s) present in full immunoglobulins.
[0194] For example, a bispecific single chain antibody may be a
construct with a total of two antibody variable regions, for
example two VH regions, each capable of specifically binding to a
separate antigen, and connected with one another through a short
polypeptide spacer such that the two antibody variable regions with
their interposed spacer exist as a single contiguous polypeptide
chain. Another example of a bispecific single chain antibody may be
a single polypeptide chain with three antibody variable regions.
Here, two antibody variable regions, for example one VH and one VL,
may make up an scFv, wherein the two antibody variable regions are
connected to one another via a synthetic polypeptide linker, the
latter often being genetically engineered so as to be minimally
immunogenic while remaining maximally resistant to proteolysis.
This scFv is capable of specifically binding to a particular
antigen, and is connected to a further antibody variable region,
for example a VH region, capable of binding to a different antigen
than that bound by the scFv. Yet another example of a bispecific
single chain antibody may be a single polypeptide chain with four
antibody variable regions. Here, the first two antibody variable
regions, for example a VH region and a VL region, may form one scFv
capable of binding to one antigen, whereas the second VH region and
VL region may form a second scFv capable of binding to another
antigen. Within a single contiguous polypeptide chain, individual
antibody variable regions of one specificity may advantageously be
separated by a synthetic polypeptide linker, whereas the respective
scFvs may advantageously be separated by a short polypeptide spacer
as described above.
[0195] According to one embodiment of the invention, the first
binding domain of the bispecific antibody comprises one antibody
variable domain, preferably a VHH domain. According to one
embodiment of the invention, the first binding domain of the
bispecific antibody comprises two antibody variable domains,
preferably a scFv, i.e. VH-VL or VL-VH. According to one embodiment
of the invention, the second binding domain of the bispecific
antibody comprises one antibody variable domain, preferably a VHH
domain. According to one embodiment of the invention, the second
binding domain of the bispecific antibody comprises two antibody
variable domains, preferably a scFv, i.e. VH-VL or VL-VH. In its
minimal form, the total number of antibody variable regions in the
bispecific antibody according to the invention is thus only two.
For example, such an antibody could comprise two VH or two VHH
domains.
[0196] According to one embodiment of the invention, the first
binding domain and the second binding domain of the bispecific
antibody each comprise one antibody variable domain, preferably a
VHH domain. According to one embodiment of the invention, the first
binding domain and the second binding domain of the bispecific
antibody each comprise two antibody variable domains, preferably a
scFv, i.e. VH-VL or VL-VH. In this embodiment, the binding agent of
the invention preferably comprises (i) a heavy chain variable
domain (VH) of a CLDN antibody, (ii) a light chain variable domain
(VL) of a CLDN antibody, (iii) a heavy chain variable domain (VH)
of a CD3 antibody and (iv) a light chain variable domain (VL) of a
CD3 antibody.
[0197] Bispecific full-length antibodies may be obtained by
covalently linking two monoclonal antibodies or by conventional
hybrid-hybridoma techniques. Covalent linking of two monoclonal
antibodies is described in Anderson, Blood 80 (1992), 2826-34. In
the context of this invention, one of the antibodies is specific
for CLDN and the other one for CD3.
[0198] In one embodiment, the bispecific binding agent is in the
format of an antibody-like molecule with a heavy chain containing
two consecutive N-terminal variable domains with different
specificities and a light chain with two consecutive variable
domains with different specificities resulting in four binding
domains with two different specificities (Wu et al., Nat.
Biotechnology, 2007, 25(11)), wherein one specificity is CD3 and
the other specificity is CLDN.
[0199] In a preferred embodiment, the bispecific binding agent of
the invention is in the format of an antibody fragment.
[0200] In one embodiment, the bispecific molecules according to the
invention comprises two Fab regions, one being directed against
CLDN and the other being directed against CD3. In one embodiment,
the molecule of the invention is an antigen binding fragment (Fab)2
complex. The Fab2 complex is composed of two Fab fragments, one Fab
fragment comprising a Fv domain, i.e. VH and VL domains, specific
for a CD3 antigen, and the other Fab fragment comprising a Fv
domain specific for CLDN. Each of the Fab fragments may be composed
of two single chains, a VL-CL module and a VH-CH module.
Alternatively, each of the individual Fab fragments may be arranged
in a single chain, preferably, VL-CL-CH-VH, and the individual
variable and constant domains may be connected with a peptide
linker. In general, the individual single chains and Fab fragments
may be connected via disulfide bonds, adhesive domains, chemically
linked and/or peptide linker. The bispecific molecule may also
comprise more than two Fab fragments, in particular, the molecule
may be a Fab3, Fab4, or a multimeric Fab complex with specificity
for 2, 3, 4, or more different antigens. The invention also
includes chemically linked Fabs.
[0201] In one embodiment, the binding agent according to the
invention includes various types of bivalent and trivalent
single-chain variable fragments (scFvs), fusion proteins mimicking
the variable domains of two antibodies. A single-chain variable
fragment (scFv) is a fusion protein of the variable regions of the
heavy (VH) and light chains (VL) of immunoglobulins, connected with
a short linker peptide of ten to about 25 amino acids. The linker
is usually rich in glycine for flexibility, as well as serine or
threonine for solubility, and can either connect the N-terminus of
the VH with the C-terminus of the VL, or vice versa. Divalent (or
bivalent) single-chain variable fragments (di-scFvs, bi-scFvs) can
be engineered by linking two scFvs. This can be done by producing a
single peptide chain with two VH and two VL regions, yielding
tandem scFvs. The invention also includes multispecific molecules
comprising more than two scFvs binding domains. This makes it
possible that the molecule comprises either multiple antigen
specificities and is a trispecific, tetraspecific, or multispecific
molecule, or the molecule is a bispecific molecule comprising more
than one scFv binding domain with specificity for the same antigen.
In particular, the molecule of the invention may be a multispecific
single chain Fv.
[0202] Another possibility is the creation of scFvs with linker
peptides that are too short for the two variable regions to fold
together (about five amino acids), forcing scFvs to dimerize. This
type is known as diabodies. Still shorter linkers (one or two amino
acids) lead to the formation of trimers, so-called triabodies or
tribodies. Tetrabodies have also been produced. They exhibit an
even higher affinity to their targets than diabodies.
[0203] A particularly preferred example of a bispecific antibody
fragment is a diabody (Kipriyanov, Int. J. Cancer 77 (1998),
763-772), which is a small bivalent and bispecific antibody
fragment. Diabodies comprise a heavy chain variable domain (VH)
connected to a light chain variable domain (VL) on the same
polypeptide chain (VH-VL) connected by a peptide linker that is too
short to allow pairing between the two domains on the same chain.
This forces pairing with the complementary domains of another chain
and promotes the assembly of a dimeric molecule with two functional
antigen binding sites. To construct bispecific diabodies of the
invention, the V-domains of an anti-CD3 antibody and an anti-CLDN
antibody may be fused to create the two chains VH(CD3)-VL(CLDN),
VH(CLDN)-VL(CD3). Each chain by itself is not able to bind to the
respective antigen, but recreates the functional antigen binding
sites of an anti-CD3 antibody and an anti-CLDN antibody on pairing
with the other chain. To this end, a peptide linker that is too
short to allow pairing between the two domains on the same chain is
used. The two scFv molecules, with a linker between heavy chain
variable domain and light chain variable domain that is too short
for intramolecular dimerization, are co-expressed and self assemble
to form bi-specific molecules with the two binding sites at
opposite ends.
[0204] In one embodiment, the multispecific molecule according to
the invention comprises variable (VH, VL) and constant domains (C)
of immunoglobulins. In one embodiment the bispecific molecule is a
minibody, preferably, a minibody comprising two single VH-VL-C
chains that are connected with each other via the constant domains
(C) of each chain. According to this aspect, the corresponding
variable heavy chain regions (VH), corresponding variable light
chain regions (VL) and constant domains (C) are arranged, from
N-terminus to C-terminus, in the order VH(CLDN)-VL(CLDN)-(C) and
VH(CD3)-VL(CD3)-C, wherein C is preferably a CH3 domain. Pairing of
the constant domains results in formation of the minibody.
[0205] According to another particularly preferred aspect, the
bispecific binding agent of the invention is in the format of a
bispecific single chain antibody construct, whereby said construct
comprises or consists of at least two binding domains, whereby one
of said domains binds to CLDN and a second domain binds to CD3.
Such molecules, also termed "bispecific T cell engagers" (BiTEs;
the term BiTE only refers to bi-specific molecules of which one arm
is specific for CD3) consist of two scFv molecules connected via a
linker peptide.
[0206] As used herein, a "bispecific single chain antibody" denotes
a single polypeptide chain comprising two binding domains. Each
binding domain comprises one variable region from an antibody heavy
chain ("VH region"), wherein the VH region of the first binding
domain specifically binds to the CLDN, and the VH region of the
second binding domain specifically binds to CD3. The two binding
domains are optionally linked to one another by a short polypeptide
spacer. A non-limiting example for a polypeptide spacer is
Gly-Gly-Gly-Gly-Ser (G-G-G-G-S) and repeats thereof. Each binding
domain may additionally comprise one variable region from an
antibody light chain ("VL region"), the VH region and VL region
within each of the first and second binding domains being linked to
one another via a polypeptide linker long enough to allow the VH
region and VL region of the first binding domain and the VH region
and VL region of the second binding domain to pair with one
another.
[0207] According to this aspect, the corresponding variable heavy
chain regions (VH) and the corresponding variable light chain
regions (VL) are arranged, from N-terminus to C-terminus, in the
order VH(CLDN)-VL(CLDN)-VH(CD3)-VL(CD3),
VH(CD3)-VL(CD3)-VH(CLDN)-VL(CLDN) or
VH(CD3)-VL(CD3)-VL(CLDN)-VH(CLDN). It is, however, also envisaged
that the bispecific single chain antibodies of the invention
comprise other domain arrangements, such as
VL(CLDN)-VH(CLDN)-VH(CD3)-VL(CD3),
VL(CLDN)-VH(CLDN)-VL(CD3)-VH(CD3),
VH(CLDN)-VL(CLDN)-VL(CD3)-VH(CD3),
VL(CD3)-VH(CD3)-VH(CLDN)-VL(CLDN),
VL(CD3)-VH(CD3)-VL(CLDN)-VH(CLDN).
[0208] A long linker generally connects the corresponding variable
heavy chain regions (VH) and the corresponding variable light chain
regions (VL) to create a scFv binding domain while a short linker
generally connects two scFv binding domains. The linker is
generally designed to provide flexibility and protease resistance,
and preferably, the linker comprises glycine and/or serine amino
acid residues. Short peptide linkers may consist of 12 or less such
as 11, 10, 9, 8, 7, 6, 5, 4, 3 or 2 amino acids, and preferably, 5
or 6 amino acids. Short peptide linkers preferably comprise the
amino acid sequences SGGGGS or GGGGS. Long peptide linkers may
consist of 12 or more, such as 15 to 25 or 15 to 20 or 15 to 18
amino acids. Long peptide linkers preferably comprise the amino
acid sequences (GGGGS)3 or VE(GGSGGS)2GGVD. Further long peptide
linkers may comprise the amino acid sequences (GGGGS)4, (GGGGS)5 or
GGGGS(GGS)3GGGS.
[0209] Binding agents according to the invention may also comprises
an amino acid sequence for facilitating secretion of the molecule,
such as a N-terminal secretion signal, and/or one or more epitope
tags facilitating binding, purification or detection of the
molecule.
[0210] Preferably, the secretion signal is a signal sequence (e.g.
selected from any one of SEQ ID NOs: 51, 52, 53, 54, 55) that
allows a sufficient passage through the secretory pathway and/or
secretion of the binding agent into the extracellular environment.
Preferably, the secretion signal sequence is cleavable and is
removed from the mature binding agent. The secretion signal
sequence preferably is chosen with respect to the cell or organism
wherein the binding agent is produced in.
[0211] The amino acid sequence of an epitope tag may be introduced
to any position within the amino acid sequence of the binding
agent, and may take the shape of a loop within the encoded protein
structure, or it may be N-terminally or C-terminally fused to the
binding agent. Preferably, the epitope tag is C-terminally fused to
the binding agent. The epitope tag may contain a cleavage site that
allows a removal of the tag from the binding agent. Said epitope
tag can be any kind of epitope tag that is functional under native
and/or denaturing conditions, preferable a histidin tag, most
preferable a tag comprising six histidins.
[0212] The bispecific binding agent of the invention may contain,
in addition to said first and second binding domain, a further
binding domain which serves e.g. to enhance selectivity for tumor
cells. This can be achieved e.g. by providing binding domains that
bind to other antigens expressed on tumor cells.
[0213] In the context of the present invention, the binding agents
generated are preferably capable of eliciting immune effector
functions as described herein. Preferably, said immune effector
functions are directed against cells carrying the tumor-associated
antigen CLDN on their surface.
[0214] The term "immune effector functions" in the context of the
present invention includes any functions mediated by components of
the immune system that result e.g. in the inhibition of tumor
growth and/or inhibition of tumor development, including inhibition
of tumor dissemination and metastasis. Preferably, immune effector
functions result in killing of tumor cells. Such functions comprise
complement dependent cytotoxicity (CDC), antibody-dependent
cell-mediated cytotoxicity (ADCC), antibody-dependent cell-mediated
phagocytosis (ADCP), induction of apoptosis in the cells carrying
the tumor-associated antigen, cytolysis of the cells carrying the
tumor-associated antigen, and/or inhibition of proliferation of the
cells carrying the tumor-associated antigen. Binding agents may
also exert an effect simply by binding to tumor-associated antigens
on the surface of a cancer cell. For example, antibodies may block
the function of the tumor-associated antigen or induce apoptosis
just by binding to the tumor-associated antigen on the surface of a
cancer cell.
[0215] The binding agents described herein may be conjugated to a
therapeutic moiety or agent, such as a cytotoxin, a drug (e.g., an
immunosuppressant) or a radioisotope. A cytotoxin or cytotoxic
agent includes any agent that is detrimental to and, in particular,
kills cells. Examples include taxol, cytochalasin B, gramicidin D,
ethidium bromide, emetine, mitomycin, etoposide, tenoposide,
vincristine, vinblastine, colchicin, doxorubicin, daunorubicin,
dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin
D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, and puromycin and analogs or homologs
thereof. Suitable therapeutic agents for forming conjugates
include, but are not limited to, antimetabolites (e.g.,
methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine,
fludarabin, 5-fluorouracil decarbazine), alkylating agents (e.g.,
mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU)
and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol,
streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II)
(DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly
daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin
(formerly actinomycin), bleomycin, mithramycin, and anthramycin
(AMC), and anti-mitotic agents (e.g., vincristine and vinblastine).
In a preferred embodiment, the therapeutic agent is a cytotoxic
agent or a radiotoxic agent. In another embodiment, the therapeutic
agent is an immunosuppressant. In yet another embodiment, the
therapeutic agent is GM-CSF. In a preferred embodiment, the
therapeutic agent is doxorubicin, cisplatin, bleomycin, sulfate,
carmustine, chlorambucil, cyclophosphamide or ricin A.
[0216] Binding agents also can be conjugated to a radioisotope,
e.g., iodine-131, yttrium-90 or indium-111, to generate cytotoxic
radiopharmaceuticals.
[0217] Techniques for conjugating such therapeutic moiety to
antibodies are well known, see, e.g., Arnon et al., "Monoclonal
Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in
Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.),
pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies
For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson
et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe,
"Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al. (eds.), pp. 475-506 (1985);
"Analysis, Results, And Future Prospective Of The Therapeutic Use
Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal
Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.),
pp. 303-16 (Academic Press 1985), and Thorpe et al., "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev., 62: 119-58 (1982).
[0218] The term "binding" according to the invention preferably
relates to a specific binding.
[0219] According to the present invention, an agent such as an
antibody is capable of binding to a predetermined target if it has
a significant affinity for said predetermined target and binds to
said predetermined target in standard assays. "Affinity" or
"binding affinity" is often measured by equilibrium dissociation
constant (K.sub.D). Preferably, the term "significant affinity"
refers to the binding to a predetermined target with a dissociation
constant (K.sub.D) of 10.sup.-5 M or lower, 10.sup.-6 M or lower,
10.sup.-7 M or lower, 10.sup.-8 M or lower, 10.sup.-9 M or lower,
10.sup.-10 M or lower, 10.sup.-11 M or lower, or 10.sup.-12 M or
lower.
[0220] An agent is not (substantially) capable of binding to a
target if it has no significant affinity for said target and does
not bind significantly, in particular does not bind detectably, to
said target in standard assays. Preferably, the agent does not
detectably bind to said target if present in a concentration of up
to 2, preferably 10, more preferably 20, in particular 50 or 100
.mu.g/ml or higher. Preferably, an agent has no significant
affinity for a target if it binds to said target with a K.sub.D
that is at least 10-fold, 100-fold, 10.sup.3-fold, 10.sup.4-fold,
10.sup.5-fold, or 10.sup.6-fold higher than the K.sub.D for binding
to the predetermined target to which the agent is capable of
binding. For example, if the K.sub.D for binding of an agent to the
target to which the agent is capable of binding is 10.sup.-7 M, the
K.sub.D for binding to a target for which the agent has no
significant affinity would be at least 10.sup.-6 M, 10.sup.-5 M,
10.sup.-4 M, 10.sup.-3 M, 10.sup.-2 M, or 10.sup.-1 M.
[0221] An agent such as an antibody is specific for a predetermined
target if it is capable of binding to said predetermined target
while it is not capable of binding to other targets, i.e. has no
significant affinity for other targets and does not significantly
bind to other targets in standard assays. According to the
invention, an agent is specific for CLDN if it is capable of
binding to CLDN but is not (substantially) capable of binding to
other targets. Preferably, an agent is specific for CLDN if the
affinity for and the binding to such other targets does not
significantly exceed the affinity for or binding to CLDN-unrelated
proteins such as bovine serum albumin (BSA), casein, human serum
albumin (HSA) or non-claudin transmembrane proteins such as MHC
molecules or transferrin receptor or any other specified
polypeptide. Preferably, an agent is specific for a predetermined
target if it binds to said target with a K.sub.D that is at least
10-fold, 100-fold, 10.sup.3-fold, 10.sup.4-fold, 10.sup.5-fold, or
10.sup.6-fold lower than the K.sub.D for binding to a target for
which it is not specific. For example, if the K.sub.D for binding
of an agent to the target for which it is specific is 10.sup.-7 M,
the K.sub.D for binding to a target for which it is not specific
would be at least 10.sup.-6 M, 10.sup.-5 M, 10.sup.-4 M, 10.sup.-3
M, 10.sup.-2 M, or 10.sup.-1 M.
[0222] Binding of an agent to a target can be determined
experimentally using any suitable method; see, for example,
Berzofsky et al., "Antibody-Antigen Interactions" In Fundamental
Immunology, Paul, W. E., Ed., Raven Press New York, N Y (1984),
Kuby, Janis Immunology, W. H. Freeman and Company New York, N Y
(1992), and methods described herein. Affinities may be readily
determined using conventional techniques, such as by equilibrium
dialysis; by using the BIAcore 2000 instrument, using general
procedures outlined by the manufacturer; by radioimmunoassay using
radiolabeled target antigen; or by another method known to the
skilled artisan. The affinity data may be analyzed, for example, by
the method of Scatchard et al., Ann N.Y. Acad. ScL, 51:660 (1949).
The measured affinity of a particular antibody-antigen interaction
can vary if measured under different conditions, e.g., salt
concentration, pH. Thus, measurements of affinity and other
antigen-binding parameters, e.g., K.sub.D, IC.sub.50, are
preferably made with standardized solutions of antibody and
antigen, and a standardized buffer.
[0223] As used herein, "isotype" refers to the antibody class
(e.g., IgM or IgG1) that is encoded by heavy chain constant region
genes.
[0224] As used herein, "isotype switching" refers to the phenomenon
by which the class, or isotype, of an antibody changes from one Ig
class to one of the other Ig classes.
[0225] The term "naturally occurring" as used herein as applied to
an object refers to the fact that an object can be found in nature.
For example, a polypeptide or polynucleotide sequence that is
present in an organism (including viruses) that can be isolated
from a source in nature and which has not been intentionally
modified by man in the laboratory is naturally occurring.
[0226] The term "rearranged" as used herein refers to a
configuration of a heavy chain or light chain immunoglobulin locus
wherein a V segment is positioned immediately adjacent to a D-J or
J segment in a conformation encoding essentially a complete VH or
VL domain, respectively. A rearranged immunoglobulin (antibody)
gene locus can be identified by comparison to germline DNA; a
rearranged locus will have at least one recombined heptamer/nonamer
homology element.
[0227] The term "unrearranged" or "germline configuration" as used
herein in reference to a V segment refers to the configuration
wherein the V segment is not recombined so as to be immediately
adjacent to a D or J segment.
[0228] In one embodiment, a binding agent of the invention has the
ability of binding to CLDN18.2, i.e. the ability of binding to an
epitope present in CLDN18.2, preferably an epitope located within
the extracellular domains of CLDN18.2, in particular the first
extracellular loop, preferably amino acid positions 29 to 78 of
CLDN18.2. In particular embodiments, an agent having the ability of
binding to CLDN18.2 binds to an epitope on CLDN18.2 which is not
present on CLDN18.1.
[0229] An agent having the ability of binding to CLDN18.2
preferably binds to CLDN18.2 but not to CLDN18.1. Preferably, an
agent having the ability of binding to CLDN18.2 is specific for
CLDN18.2. Preferably, an agent having the ability of binding to
CLDN18.2 binds to CLDN18.2 expressed on the cell surface. In
particular preferred embodiments, an agent having the ability of
binding to CLDN18.2 binds to native epitopes of CLDN18.2 present on
the surface of living cells.
[0230] In a preferred embodiment, an agent having the ability of
binding to CLDN18.2 comprises a heavy chain variable region (VH)
comprising an amino acid sequence selected from the group
consisting of SEQ ID NOs: 5, 6, 7, 8, 9, 10, and a fragment
thereof.
[0231] In a preferred embodiment, an agent having the ability of
binding to CLDN18.2 comprises a light chain variable region (VL)
comprising an amino acid sequence selected from the group
consisting of SEQ ID NOs: 11, 12, 13, 14, 15, 16, 17, 18, 19, and a
fragment thereof.
[0232] In certain preferred embodiments, an agent having the
ability of binding to CLDN18.2 comprises a combination of heavy
chain variable region (VH) and light chain variable region (VL)
selected from the following possibilities (i) to (ix):
(i) the VH comprises an amino acid sequence represented by SEQ ID
NO: 5 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 12 or a fragment thereof, (ii)
the VH comprises an amino acid sequence represented by SEQ ID NO: 6
or a fragment thereof and the VL comprises an amino acid sequence
represented by SEQ ID NO: 11 or a fragment thereof, (iii) the VH
comprises an amino acid sequence represented by SEQ ID NO: 7 or a
fragment thereof and the VL comprises an amino acid sequence
represented by SEQ ID NO: 13 or a fragment thereof, (iv) the VH
comprises an amino acid sequence represented by SEQ ID NO: 9 or a
fragment thereof and the VL comprises an amino acid sequence
represented by SEQ ID NO: 16 or a fragment thereof, (v) the VH
comprises an amino acid sequence represented by SEQ ID NO: 8 or a
fragment thereof and the VL comprises an amino acid sequence
represented by SEQ ID NO: 15 or a fragment thereof, (vi) the VH
comprises an amino acid sequence represented by SEQ ID NO: 10 or a
fragment thereof and the VL comprises an amino acid sequence
represented by SEQ ID NO: 14 or a fragment thereof, (vii) the VH
comprises an amino acid sequence represented by SEQ ID NO: 10 or a
fragment thereof and the VL comprises an amino acid sequence
represented by SEQ ID NO: 17 or a fragment thereof, (viii) the VH
comprises an amino acid sequence represented by SEQ ID NO: 10 or a
fragment thereof and the VL comprises an amino acid sequence
represented by SEQ ID NO: 18 or a fragment thereof, (ix) the VH
comprises an amino acid sequence represented by SEQ ID NO: 10 or a
fragment thereof and the VL comprises an amino acid sequence
represented by SEQ ID NO: 19 or a fragment thereof.
[0233] In a particularly preferred embodiment, an agent having the
ability of binding to CLDN18.2 comprises the following combination
of heavy chain variable region (VH) and light chain variable region
(VL):
the VH comprises an amino acid sequence represented by SEQ ID NO: 8
or a fragment thereof and the VL comprises an amino acid sequence
represented by SEQ ID NO: 15 or a fragment thereof.
[0234] In a further particularly preferred embodiment, an agent
having the ability of binding to CLDN18.2 comprises the following
combination of heavy chain variable region (VH) and light chain
variable region (VL):
the VH comprises an amino acid sequence represented by SEQ ID NO: 6
or a fragment thereof and the VL comprises an amino acid sequence
represented by SEQ ID NO: 11 or a fragment thereof.
[0235] The term "fragment" refers, in particular, to one or more of
the complementarity-determining regions (CDRs), preferably at least
the CDR3 variable region, of the heavy chain variable region (VH)
and/or of the light chain variable region (VL). In one embodiment
said one or more of the complementarity-determining regions (CDRs)
are selected from a set of complementarity-determining regions
CDR1, CDR2 and CDR3. In a particularly preferred embodiment, the
term "fragment" refers to the complementarity-determining regions
CDR1, CDR2 and CDR3 of the heavy chain variable region (VH) and/or
of the light chain variable region (VL).
[0236] In one embodiment a binding agent comprising one or more
CDRs, a set of CDRs or a combination of sets of CDRs as described
herein comprises said CDRs together with their intervening
framework regions. Preferably, the portion will also include at
least about 50% of either or both of the first and fourth framework
regions, the 50% being the C-terminal 50% of the first framework
region and the N-terminal 50% of the fourth framework region.
Construction of binding agents made by recombinant DNA techniques
may result in the introduction of residues N- or C-terminal to the
variable regions encoded by linkers introduced to facilitate
cloning or other manipulation steps, including the introduction of
linkers to join variable regions of the invention to further
protein sequences including immunoglobulin heavy chains, other
variable domains (for example in the production of diabodies) or
protein labels.
[0237] In one embodiment a binding agent comprising one or more
CDRs, a set of CDRs or a combination of sets of CDRs as described
herein comprises said CDRs in a human antibody framework.
[0238] In one embodiment, a binding agent of the invention has the
ability of binding to CLDN6, i.e. the ability of binding to an
epitope present in CLDN6, preferably an epitope located within the
extracellular domains of CLDN6, in particular the first
extracellular loop, preferably amino acid positions 28 to 76 of
CLDN6 or the second extracellular loop, preferably amino acid
positions 141 to 159 of CLDN6. In particular embodiments, an agent
having the ability of binding to CLDN6 binds to an epitope on CLDN6
which is not present on CLDN9. Preferably, an agent having the
ability of binding to CLDN6 binds to an epitope on CLDN6 which is
not present on CLDN4 and/or CLDN3. Most preferably, an agent having
the ability of binding to CLDN6 binds to an epitope on CLDN6 which
is not present on a CLDN protein other than CLDN6.
[0239] An agent having the ability of binding to CLDN6 preferably
binds to CLDN6 but not to CLDN9 and preferably does not bind to
CLDN4 and/or CLDN3. Preferably, an agent having the ability of
binding to CLDN6 is specific for CLDN6. Preferably, an agent having
the ability of binding to CLDN6 binds to CLDN6 expressed on the
cell surface. In particular preferred embodiments, an agent having
the ability of binding to CLDN6 binds to native epitopes of CLDN6
present on the surface of living cells.
[0240] In a preferred embodiment, an agent having the ability of
binding to CLDN6 comprises a heavy chain variable region (VH)
comprising an amino acid sequence selected from the group
consisting of SEQ ID NOs: 20, 22, 24, 26, and a fragment
thereof.
[0241] In a preferred embodiment, an agent having the ability of
binding to CLDN6 comprises a light chain variable region (VL)
comprising an amino acid sequence selected from the group
consisting of SEQ ID NOs: 21, 23, 25, 27, 28, 29, 97, 98, 99, 100,
and a fragment thereof.
[0242] In certain preferred embodiments, an agent having the
ability of binding to CLDN6 comprises a combination of heavy chain
variable region (VH) and light chain variable region (VL) selected
from the following possibilities (i) to (xi):
(i) the VH comprises an amino acid sequence represented by SEQ ID
NO: 20 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 21 or a fragment thereof, (ii)
the VH comprises an amino acid sequence represented by SEQ ID NO:
22 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 23 or a fragment thereof, (iii)
the VH comprises an amino acid sequence represented by SEQ ID NO:
24 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 25 or a fragment thereof, (iv)
the VH comprises an amino acid sequence represented by SEQ ID NO:
26 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 27 or a fragment thereof, (v)
the VH comprises an amino acid sequence represented by SEQ ID NO:
22 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 21 or a fragment thereof, (vi)
the VH comprises an amino acid sequence represented by SEQ ID NO:
22 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 28 or a fragment thereof, (vii)
the VH comprises an amino acid sequence represented by SEQ ID NO:
22 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 29 or a fragment thereof, (viii)
the VH comprises an amino acid sequence represented by SEQ ID NO:
22 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 97 or a fragment thereof, (ix)
the VH comprises an amino acid sequence represented by SEQ ID NO:
22 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 98 or a fragment thereof, (x)
the VH comprises an amino acid sequence represented by SEQ ID NO:
22 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 99 or a fragment thereof, (xi)
the VH comprises an amino acid sequence represented by SEQ ID NO:
22 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 100 or a fragment thereof.
[0243] In a particularly preferred embodiment, an agent having the
ability of binding to CLDN6 comprises the following combination of
heavy chain variable region (VH) and light chain variable region
(VL):
the VH comprises an amino acid sequence represented by SEQ ID NO:
22 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 23 or a fragment thereof.
[0244] In a further particularly preferred embodiment, an agent
having the ability of binding to CLDN6 comprises the following
combination of heavy chain variable region (VH) and light chain
variable region (VL):
the VH comprises an amino acid sequence represented by SEQ ID NO:
22 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 97 or a fragment thereof.
[0245] In a further particularly preferred embodiment, an agent
having the ability of binding to CLDN6 comprises the following
combination of heavy chain variable region (VH) and light chain
variable region (VL):
the VH comprises an amino acid sequence represented by SEQ ID NO:
22 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 98 or a fragment thereof.
[0246] In a further particularly preferred embodiment, an agent
having the ability of binding to CLDN6 comprises the following
combination of heavy chain variable region (VH) and light chain
variable region (VL):
the VH comprises an amino acid sequence represented by SEQ ID NO:
22 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 99 or a fragment thereof
[0247] In a further particularly preferred embodiment, an agent
having the ability of binding to CLDN6 comprises the following
combination of heavy chain variable region (VH) and light chain
variable region (VL):
the VH comprises an amino acid sequence represented by SEQ ID NO:
22 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 100 or a fragment thereof.
[0248] The term "fragment" refers, in particular, to one or more of
the complementarity-determining regions (CDRs), preferably at least
the CDR3 variable region, of the heavy chain variable region (VH)
and/or of the light chain variable region (VL). In one embodiment
said one or more of the complementarity-determining regions (CDRs)
are selected from a set of complementarity-determining regions
CDR1, CDR2 and CDR3. In a particularly preferred embodiment, the
term "fragment" refers to the complementarity-determining regions
CDR1, CDR2 and CDR3 of the heavy chain variable region (VH) and/or
of the light chain variable region (VL).
[0249] In one embodiment a binding agent comprising one or more
CDRs, a set of CDRs or a combination of sets of CDRs as described
herein comprises said CDRs together with their intervening
framework regions. Preferably, the portion will also include at
least about 50% of either or both of the first and fourth framework
regions, the 50% being the C-terminal 50% of the first framework
region and the N-terminal 50% of the fourth framework region.
Construction of binding agents made by recombinant DNA techniques
may result in the introduction of residues N- or C-terminal to the
variable regions encoded by linkers introduced to facilitate
cloning or other manipulation steps, including the introduction of
linkers to join variable regions of the invention to further
protein sequences including immunoglobulin heavy chains, other
variable domains (for example in the production of diabodies) or
protein labels.
[0250] In one embodiment a binding agent comprising one or more
CDRs, a set of CDRs or a combination of sets of CDRs as described
herein comprises said CDRs in a human antibody framework.
[0251] Anti-CD3 antibodies which are useful for providing binding
agents according to the invention include but are not limited to
UCHT1-HS (humanized mAB), UCHT1-MM (murine mAB), CLB-T3, TR66,
145-2C11.
[0252] UCHT1 is a monoclonal IgG1 anti-CD3 monoclonal antibody
which detects CD3 in human and primate sample types. CLB-T3 is a
mouse monoclonal anti-CD3 antibody which is directed against the
CD3 antigen and reacts with 80-90% human peripheral T lymphocytes
and medullary thymocytes. TR66 is a mouse IgG1 monoclonal anti-CD3
antibody which recognizes the epsilon-chain of human CD3. 145-2C11
is an armenian hamster monoclonal anti-mouse CD3 antibody.
[0253] Preferably, the VH and VL regions of the CD3-binding domain
are derived from antibodies/antibody molecules and antibody-like
molecules which are capable of specifically recognizing the human
CD3 in the context of other TCR subunits as present on activated
primary human T cells expressing the TCR in its native
configuration. The VH and VL regions derived from an antibody
specific for the CD3-epsilon chain are most preferred and said
(parental) antibodies should be capable of specifically binding
epitopes reflecting the native or near-native structure or a
conformational epitope of human CD3 presented in the context of the
TCR complex. In a preferred embodiment of the invention, the VH and
VL regions of the CD3-binding domain are derived from a CD3
specific antibody selected from the group consisting of UCHT1-HS,
UCHT1-MM, CLB-T3 and TR66, preferably TR66.
[0254] In a preferred embodiment, an agent having the ability of
binding to CD3 comprises a heavy chain variable region (VH)
comprising an amino acid sequence selected from the group
consisting of SEQ ID NOs: 30, 32, 34, 36, 94, 95, and a fragment
thereof.
[0255] In a preferred embodiment, an agent having the ability of
binding to CD3 comprises a light chain variable region (VL)
comprising an amino acid sequence selected from the group
consisting of SEQ ID NOs: 31, 33, 35, 37, 96, and a fragment
thereof.
[0256] In certain preferred embodiments, an agent having the
ability of binding to CD3 comprises a combination of heavy chain
variable region (VH) and light chain variable region (VL) selected
from the following possibilities (i) to (ix):
(i) the VH comprises an amino acid sequence represented by SEQ ID
NO: 30 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 31 or a fragment thereof, (ii)
the VH comprises an amino acid sequence represented by SEQ ID NO:
32 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 33 or a fragment thereof, (iii)
the VH comprises an amino acid sequence represented by SEQ ID NO:
34 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 34 or a fragment thereof, (iv)
the VH comprises an amino acid sequence represented by SEQ ID NO:
36 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 37 or a fragment thereof, (v)
the VH comprises an amino acid sequence represented by SEQ ID NO:
94 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 37 or a fragment thereof, (vi)
the VH comprises an amino acid sequence represented by SEQ ID NO:
95 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 37 or a fragment thereof, (vii)
the VH comprises an amino acid sequence represented by SEQ ID NO:
36 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 96 or a fragment thereof, (viii)
the VH comprises an amino acid sequence represented by SEQ ID NO:
94 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 96 or a fragment thereof, (ix)
the VH comprises an amino acid sequence represented by SEQ ID NO:
95 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 96 or a fragment thereof.
[0257] In a particularly preferred embodiment, an agent having the
ability of binding to CD3 comprises the following combination of
heavy chain variable region (VH) and light chain variable region
(VL):
the VH comprises an amino acid sequence represented by SEQ ID NO:
36 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 37 or a fragment thereof
[0258] In a further particularly preferred embodiment, an agent
having the ability of binding to CD3 comprises the following
combination of heavy chain variable region (VH) and light chain
variable region (VL):
the VH comprises an amino acid sequence represented by SEQ ID NO:
94 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 37 or a fragment thereof.
[0259] In a further particularly preferred embodiment, an agent
having the ability of binding to CD3 comprises the following
combination of heavy chain variable region (VH) and light chain
variable region (VL):
the VH comprises an amino acid sequence represented by SEQ ID NO:
95 or a fragment thereof and the VL comprises an amino acid
sequence represented by SEQ ID NO: 96 or a fragment thereof.
[0260] The term "fragment" refers, in particular, to one or more of
the complementarity-determining regions (CDRs), preferably at least
the CDR3 variable region, of the heavy chain variable region (VH)
and/or of the light chain variable region (VL). In one embodiment
said one or more of the complementarity-determining regions (CDRs)
are selected from a set of complementarity-determining regions
CDR1, CDR2 and CDR3. In a particularly preferred embodiment, the
term "fragment" refers to the complementarity-determining regions
CDR1, CDR2 and CDR3 of the heavy chain variable region (VH) and/or
of the light chain variable region (VL).
[0261] In one embodiment a binding agent comprising one or more
CDRs, a set of CDRs or a combination of sets of CDRs as described
herein comprises said CDRs together with their intervening
framework regions. Preferably, the portion will also include at
least about 50% of either or both of the first and fourth framework
regions, the 50% being the C-terminal 50% of the first framework
region and the N-terminal 50% of the fourth framework region.
Construction of binding agents made by recombinant DNA techniques
may result in the introduction of residues N- or C-terminal to the
variable regions encoded by linkers introduced to facilitate
cloning or other manipulation steps, including the introduction of
linkers to join variable regions of the invention to further
protein sequences including immunoglobulin heavy chains, other
variable domains (for example in the production of diabodies) or
protein labels.
[0262] In one embodiment a binding agent comprising one or more
CDRs, a set of CDRs or a combination of sets of CDRs as described
herein comprises said CDRs in a human antibody framework.
[0263] According to the invention, a preferred binding agent
targeting CLDN18.2 comprises an amino acid sequence selected from
the group consisting of SEQ ID NOs: 38, 39, 40 and 41 or a variant
thereof.
[0264] According to the invention, a further preferred binding
agent targeting CLDN18.2 comprises an amino acid sequence selected
from the group consisting of SEQ ID NOs: 103, 66, 67, 68, 69, 70,
71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87,
88, 89, 90, 91, 92 and 93 or a fragment or variant thereof. In one
embodiment, said amino acid sequence lacks secretion signals such
as N-terminal secretion signals, in particular the sequence
according to SEQ ID NO: 51 and/or lacks His-tags such as C-terminal
His-tags, in particular the sequence Gly-Gly-Ser-(His).sub.6 or
(His).sub.6, if present.
[0265] According to the invention, a preferred binding agent
targeting CLDN6 comprises an amino acid sequence selected from the
group consisting of SEQ ID NOs: 42, 43, 44 and 45 or a variant
thereof.
[0266] According to the invention, a further preferred binding
agent targeting CLDN6 comprises an amino acid sequence selected
from the group consisting of SEQ ID NOs: 101, 102, 60, 61, 62, 63,
64 and 65 or a fragment or variant thereof. In one embodiment said
amino acid sequence lacks secretion signals such as N-terminal
secretion signals, in particular the sequence according to SEQ ID
NO: 51 and/or lacks His-tags such as C-terminal His-tags, in
particular the sequence Gly-Gly-Ser-(His).sub.6 or (His).sub.6, if
present.
[0267] It is to be understood that the binding agents described
herein may be delivered to a patient by administering a nucleic
acid such as RNA encoding the agent and/or by administering a host
cell comprising a nucleic acid such as RNA encoding the agent.
Thus, a nucleic acid encoding a binding agent when administered to
a patient may be present in naked form or in a suitable delivery
vehicle such as in the form of liposomes or viral particles, or
within a host cell. The nucleic acid provided can produce the agent
over extended time periods in a sustained manner mitigating the
instability at least partially observed for therapeutic antibodies,
in particular bispecific antibodies. Nucleic acids to be delivered
to a patient can be produced by recombinant means. If a nucleic
acid is administered to a patient without being present within a
host cell, it is preferably taken up by cells of the patient for
expression of the binding agent encoded by the nucleic acid. If a
nucleic acid is administered to a patient while being present
within a host cell, it is preferably expressed by the host cell
within the patient so as to produce the binding agent encoded by
the nucleic acid.
[0268] The term "recombinant" in the context of the present
invention means "made through genetic engineering". Preferably, a
"recombinant object" such as a recombinant nucleic acid in the
context of the present invention is not occurring naturally.
[0269] The term "naturally occurring" as used herein refers to the
fact that an object can be found in nature. For example, a peptide
or nucleic acid that is present in an organism (including viruses)
and can be isolated from a source in nature and which has not been
intentionally modified by man in the laboratory is naturally
occurring.
[0270] The term "nucleic acid", as used herein, is intended to
include DNA and RNA such as genomic DNA, cDNA, mRNA, recombinantly
produced and chemically synthesized molecules. A nucleic acid may
be single-stranded or double-stranded. RNA includes in vitro
transcribed RNA (IVT RNA) or synthetic RNA.
[0271] Nucleic acids may be comprised in a vector. The term
"vector" as used herein includes any vectors known to the skilled
person including plasmid vectors, cosmid vectors, phage vectors
such as lambda phage, viral vectors such as adenoviral or
baculoviral vectors, or artificial chromosome vectors such as
bacterial artificial chromosomes (BAC), yeast artificial
chromosomes (YAC), or P1 artificial chromosomes (PAC). Said vectors
include expression as well as cloning vectors. Expression vectors
comprise plasmids as well as viral vectors and generally contain a
desired coding sequence and appropriate DNA sequences necessary for
the expression of the operably linked coding sequence in a
particular host organism (e.g., bacteria, yeast, plant, insect, or
mammal) or in in vitro expression systems. Cloning vectors are
generally used to engineer and amplify a certain desired DNA
fragment and may lack functional sequences needed for expression of
the desired DNA fragments.
[0272] In the context of the present invention, the term "RNA"
relates to a molecule which comprises ribonucleotide residues and
preferably being entirely or substantially composed of
ribonucleotide residues. "Ribonucleotide" relates to a nucleotide
with a hydroxyl group at the 2'-position of a (3-D-ribofuranosyl
group. The term includes double stranded RNA, single stranded RNA,
isolated RNA such as partially purified RNA, essentially pure RNA,
synthetic RNA, recombinantly produced RNA, as well as modified RNA
that differs from naturally occurring RNA by the addition,
deletion, substitution and/or alteration of one or more
nucleotides. Such alterations can include addition of
non-nucleotide material, such as to the end(s) of a RNA or
internally, for example at one or more nucleotides of the RNA.
Nucleotides in RNA molecules can also comprise non-standard
nucleotides, such as non-naturally occurring nucleotides or
chemically synthesized nucleotides or deoxynucleotides. These
altered RNAs can be referred to as analogs or analogs of
naturally-occurring RNA.
[0273] According to the present invention, the term "RNA" includes
and preferably relates to "mRNA" which means "messenger RNA" and
relates to a "transcript" which may be produced using DNA as
template and encodes a peptide or protein. mRNA typically comprises
a 5' non translated region (5'-UTR), a protein or peptide coding
region and a 3' non translated region (3'-UTR). mRNA has a limited
halftime in cells and in vitro. Preferably, mRNA is produced by in
vitro transcription using a DNA template. In one embodiment of the
invention, the RNA is obtained by in vitro transcription or
chemical synthesis. The in vitro transcription methodology is known
to the skilled person. For example, there is a variety of in vitro
transcription kits commercially available.
[0274] In one embodiment of the present invention, RNA is
self-replicating RNA, such as single stranded self-replicating RNA.
In one embodiment, the self-replicating RNA is single stranded RNA
of positive sense. In one embodiment, the self-replicating RNA is
viral RNA or RNA derived from viral RNA. In one embodiment, the
self-replicating RNA is alphaviral genomic RNA or is derived from
alphaviral genomic RNA. In one embodiment, the self-replicating RNA
is a viral gene expression vector. In one embodiment, the virus is
Semliki forest virus. In one embodiment, the self-replicating RNA
contains one or more transgenes at least one of said transgenes
encoding the binding agent described herein. In one embodiment, if
the RNA is viral RNA or derived from viral RNA, the transgenes may
partially or completely replace viral sequences such as viral
sequences encoding structural proteins. In one embodiment, the
self-replicating RNA is in vitro transcribed RNA.
[0275] The genome of alphaviruses is single stranded RNA of
positive sense (ssRNA(+)) that encodes two open reading frames
(ORF) for large polyproteins. The ORF at the 5'-end of the genome
encodes the non-structural proteins nSP1 to nSP4 (nsP1-4), which
are translated and processed to an RNA-dependent RNA-polymerase
(replicase); the ORF at the 3'-end encodes the structural
proteins--capsid and glycoproteins. Both ORFs are separated by the
so called subgenomic promoter (SGP), which governs the
transcription of the structural ORF. When exploited as gene
vectors, the structural proteins behind the SGP are commonly
replaced by transgenes. In order to package such vectors into viral
particles, the structural proteins are commonly expressed in trans
from helper constructs. Alphaviruses replicate in the cytoplasm of
infected cells exclusively at the RNA level. After infection, the
ssRNA(+) genome acts as mRNA for the translation of the nsP1234
poly-protein precursor which is at early stages of the viral life
cycle autoproteolytically processed to the fragments nsP123 and
nsP4. Fragments nsP123 and nsP4 form the (-)strand replicase
complex that transcribes (-)stranded RNA from the genomic RNA
template. At later stages, the nsP1234 polyprotein is completely
cleaved to the single proteins which assemble to the (+)strand
replicase complex that synthesizes new (+)stranded genomes, as well
as subgenomic transcripts that code the structural proteins or
transgenes. Subgenomic RNA as well as new genomic RNA is capped and
poly-adenylated and thus recognized as mRNA after target cells
infection. Only new genomic RNA contains a packaging signal which
ensures exclusive packaging of genomic RNA into budding virions.
The attractiveness of alphaviral replicons for vectorology is based
on the positive orientation of the capped and poly-adenylated RNA
genome. Translatable replicon RNA can easily be synthesized in
vitro, whereby capping may be achieved with cap-analoga added to
the in vitro transcription reaction and poly-A tails may be encoded
as poly-T tracks on the plasmid templates. In vitro transcribed
(IVT) replicons are transfected by conventional transfection
techniques and even low amounts of starting IVT RNA are multiplied
rapidly. Within a few hours after transfer, transgenes which are
placed downstream of the SGP are transcribed to very high copy
numbers of about 40.000 to 200.000 copies of subgenomic RNA per
cell, thus it is not surprising that recombinant proteins are
strongly expressed. Dependent on the specific aim, IVT replicons
may be transfected directly into target cells, or packaged into
alphaviral particles with helper vectors that provide structural
genes in trans. Transfer into the skin or muscles leads to high and
sustained local expression, paralleled by a strong induction of
humoral and cellular immune response
[0276] In order to increase expression and/or stability of the RNA
used according to the present invention, it may be modified,
preferably without altering the sequence of the expressed peptide
or protein.
[0277] The term "modification" in the context of RNA as used
according to the present invention includes any modification of RNA
which is not naturally present in said RNA.
[0278] In one embodiment of the invention, the RNA used according
to the invention does not have uncapped 5'-triphosphates. Removal
of such uncapped 5'-triphosphates can be achieved by treating RNA
with a phosphatase.
[0279] The RNA according to the invention may have modified
naturally occurring or synthetic ribonucleotides in order to
increase its stability and/or decrease cytotoxicity. For example,
in one embodiment, in the RNA used according to the invention
5-methylcytidine is substituted partially or completely, preferably
completely, for cytidine. Alternatively or additionally, in one
embodiment, in the RNA used according to the invention
pseudouridine is substituted partially or completely, preferably
completely, for uridine.
[0280] In one embodiment, the term "modification" relates to
providing an RNA with a 5'-cap or 5'-cap analog. The term "5'-cap"
refers to a cap structure found on the 5'-end of an mRNA molecule
and generally consists of a guanosine nucleotide connected to the
mRNA via an unusual 5' to 5' triphosphate linkage. In one
embodiment, this guanosine is methylated at the 7-position. The
term "conventional 5'-cap" refers to a naturally occurring RNA
5'-cap, preferably to the 7-methylguanosine cap (m7G). In the
context of the present invention, the term "5'-cap" includes a
5'-cap analog that resembles the RNA cap structure and is modified
to possess the ability to stabilize RNA if attached thereto,
preferably in vivo and/or in a cell.
[0281] Providing an RNA with a 5'-cap or 5'-cap analog may be
achieved by in vitro transcription of a DNA template in the
presence of said 5'-cap or 5'-cap analog, wherein said 5'-cap is
co-transcriptionally incorporated into the generated RNA strand, or
the RNA may be generated, for example, by in vitro transcription,
and the 5'-cap may be attached to the RNA post-transcriptionally
using capping enzymes, for example, capping enzymes of vaccinia
virus.
[0282] The RNA may comprise further modifications. For example, a
further modification of the RNA used in the present invention may
be an extension or truncation of the naturally occurring poly(A)
tail or an alteration of the 5'- or 3'-untranslated regions (UTR)
such as introduction of a UTR which is not related to the coding
region of said RNA, for example, the insertion of one or more,
preferably two copies of a 3'-UTR derived from a globin gene, such
as alpha2-globin, alpha1-globin, beta-globin, preferably
beta-globin, more preferably human beta-globin.
[0283] Therefore, in order to increase stability and/or expression
of the RNA used according to the present invention, it may be
modified so as to be present in conjunction with a poly-A sequence,
preferably having a length of 10 to 500, more preferably 30 to 300,
even more preferably 65 to 200 and especially 100 to 150 adenosine
residues. In an especially preferred embodiment the poly-A sequence
has a length of approximately 120 adenosine residues. In addition,
incorporation of two or more 3'-non translated regions (UTR) into
the 3'-non translated region of an RNA molecule can result in an
enhancement in translation efficiency. In one particular embodiment
the 3'-UTR is derived from the human .beta.-globin gene.
[0284] Preferably, RNA if delivered to, i.e. transfected into, a
cell, in particular a cell present in vivo, expresses the protein,
peptide or antigen it encodes.
[0285] The term "transfection" relates to the introduction of
nucleic acids, in particular RNA, into a cell. For purposes of the
present invention, the term "transfection" also includes the
introduction of a nucleic acid into a cell or the uptake of a
nucleic acid by such cell, wherein the cell may be present in a
subject, e.g., a patient. Thus, according to the present invention,
a cell for transfection of a nucleic acid described herein can be
present in vitro or in vivo, e.g. the cell can form part of an
organ, a tissue and/or an organism of a patient. According to the
invention, transfection can be transient or stable. For some
applications of transfection, it is sufficient if the transfected
genetic material is only transiently expressed. Since the nucleic
acid introduced in the transfection process is usually not
integrated into the nuclear genome, the foreign nucleic acid will
be diluted through mitosis or degraded. Cells allowing episomal
amplification of nucleic acids greatly reduce the rate of dilution.
If it is desired that the transfected nucleic acid actually remains
in the genome of the cell and its daughter cells, a stable
transfection must occur. RNA can be transfected into cells to
transiently express its coded protein.
[0286] The term "stability" of RNA relates to the "half-life" of
RNA. "Half-life" relates to the period of time which is needed to
eliminate half of the activity, amount, or number of molecules. In
the context of the present invention, the half-life of an RNA is
indicative for the stability of said RNA. The half-life of RNA may
influence the "duration of expression" of the RNA. It can be
expected that RNA having a long half-life will be expressed for an
extended time period.
[0287] In the context of the present invention, the term
"transcription" relates to a process, wherein the genetic code in a
DNA sequence is transcribed into RNA. Subsequently, the RNA may be
translated into protein. According to the present invention, the
term "transcription" comprises "in vitro transcription", wherein
the term "in vitro transcription" relates to a process wherein RNA,
in particular mRNA, is in vitro synthesized in a cell-free system,
preferably using appropriate cell extracts. Preferably, cloning
vectors are applied for the generation of transcripts. These
cloning vectors are generally designated as transcription vectors
and are according to the present invention encompassed by the term
"vector".
[0288] The term "translation" according to the invention relates to
the process in the ribosomes of a cell by which a strand of
messenger RNA directs the assembly of a sequence of amino acids to
make a peptide or protein.
[0289] The term "expression" is used according to the invention in
its most general meaning and comprises the production of RNA and/or
peptides or proteins, e.g. by transcription and/or translation.
With respect to RNA, the term "expression" or "translation" relates
in particular to the production of peptides or proteins. It also
comprises partial expression of nucleic acids. Moreover, expression
can be transient or stable. According to the invention, the term
expression also includes an "aberrant expression" or "abnormal
expression".
[0290] "Aberrant expression" or "abnormal expression" means
according to the invention that expression is altered, preferably
increased, compared to a reference, e.g. a state in a subject not
having a disease associated with aberrant or abnormal expression of
a certain protein, e.g., a tumor antigen. An increase in expression
refers to an increase by at least 10%, in particular at least 20%,
at least 50% or at least 100%, or more. In one embodiment,
expression is only found in a diseased tissue, while expression in
a healthy tissue is repressed.
[0291] The term "specifically expressed" means that a protein is
essentially only expressed in a specific tissue or organ. For
example, a tumor antigen specifically expressed in gastric mucosa
means that said protein is primarily expressed in gastric mucosa
and is not expressed in other tissues or is not expressed to a
significant extent in other tissue or organ types. Thus, a protein
that is exclusively expressed in cells of the gastric mucosa and to
a significantly lesser extent in any other tissue, such as testis,
is specifically expressed in cells of the gastric mucosa. In some
embodiments, a tumor antigen may also be specifically expressed
under normal conditions in more than one tissue type or organ, such
as in 2 or 3 tissue types or organs, but preferably in not more
than 3 different tissue or organ types. In this case, the tumor
antigen is then specifically expressed in these organs. For
example, if a tumor antigen is expressed under normal conditions
preferably to an approximately equal extent in lung and stomach,
said tumor antigen is specifically expressed in lung and
stomach.
[0292] According to the invention, the term "RNA encoding" means
that RNA, if present in the appropriate environment, preferably
within a cell, can be expressed to produce a protein or peptide it
encodes.
[0293] Some aspects of the invention rely on the adoptive transfer
of host cells which are transfected in vitro with a nucleic acid
such as RNA encoding a binding agent described herein and
transferred to recipients such as patients, preferably after ex
vivo expansion from low precursor frequencies to clinically
relevant cell numbers. The host cells used for treatment according
to the invention may be autologous, allogeneic, or syngeneic to a
treated recipient.
[0294] The term "autologous" is used to describe anything that is
derived from the same subject. For example, "autologous transplant"
refers to a transplant of tissue or organs derived from the same
subject. Such procedures are advantageous because they overcome the
immunological barrier which otherwise results in rejection.
[0295] The term "allogeneic" is used to describe anything that is
derived from different individuals of the same species. Two or more
individuals are said to be allogeneic to one another when the genes
at one or more loci are not identical.
[0296] The term "syngeneic" is used to describe anything that is
derived from individuals or tissues having identical genotypes,
i.e., identical twins or animals of the same inbred strain, or
their tissues.
[0297] The term "heterologous" is used to describe something
consisting of multiple different elements. As an example, the
transfer of one individual's bone marrow into a different
individual constitutes a heterologous transplant. A heterologous
gene is a gene derived from a source other than the subject.
[0298] The term "peptide" according to the invention comprises
oligo- and polypeptides and refers to substances comprising two or
more, preferably 3 or more, preferably 4 or more, preferably 6 or
more, preferably 8 or more, preferably 9 or more, preferably 10 or
more, preferably 13 or more, preferably 16 more, preferably 21 or
more and up to preferably 8, 10, 20, 30, 40 or 50, in particular
100 amino acids joined covalently by peptide bonds. The term
"protein" refers to large peptides, preferably to peptides with
more than 100 amino acid residues, but in general the terms
"peptides" and "proteins" are synonyms and are used interchangeably
herein.
[0299] The teaching given herein with respect to specific amino
acid sequences, e.g. those shown in the sequence listing, is to be
construed so as to also relate to variants of said specific
sequences resulting in sequences which are functionally equivalent
to said specific sequences, e.g. amino acid sequences exhibiting
properties identical or similar to those of the specific amino acid
sequences. One important property is to retain binding to a target
or to sustain effector functions. Preferably, a sequence which is a
variant with respect to a specific sequence, when it replaces the
specific sequence in an antibody retains binding of said antibody
to CLDN and/or CD3 and preferably functions of said antibody as
described herein, e.g. CDC mediated lysis or ADCC mediated
lysis.
[0300] For example, the sequences shown in the sequence listing can
be modified so as to remove one or more, preferably all free
cysteine residues, in particular by replacing the cysteine residues
by amino acids other than cysteine, preferably serine, alanine,
threonine, glycine, tyrosine, leucine or methionine, most
preferably alanine or serine. For example, the cysteine at position
103 of the sequence shown in SEQ ID NO: 36 of the sequence listing
or the corresponding cysteine in a sequence comprising said
sequence may be modified in this way. Further cysteines which can
be modified this way are the cysteines at position 178 of SEQ ID
NO: 42, at position 197 of SEQ ID NO: 43, at position 427 of SEQ ID
NO: 44 or at position 446 of SEQ ID NO: 45.
[0301] It will be appreciated by those skilled in the art that in
particular the sequences of the CDR, hypervariable and variable
regions can be modified without losing the ability to bind CLDN
and/or CD3. For example, CDR regions will be either identical or
highly homologous to the regions of antibodies specified herein. By
"highly homologous" it is contemplated that from 1 to 5, preferably
from 1 to 4, such as 1 to 3 or 1 or 2 substitutions may be made in
the CDRs. In addition, the hypervariable and variable regions may
be modified so that they show substantial homology with the regions
of antibodies specifically disclosed herein.
[0302] For the purposes of the present invention, "variants" of an
amino acid sequence comprise amino acid insertion variants, amino
acid addition variants, amino acid deletion variants and/or amino
acid substitution variants. Amino acid deletion variants that
comprise the deletion at the N-terminal and/or C-terminal end of
the protein are also called N-terminal and/or C-terminal truncation
variants.
[0303] Amino acid insertion variants comprise insertions of single
or two or more amino acids in a particular amino acid sequence. In
the case of amino acid sequence variants having an insertion, one
or more amino acid residues are inserted into a particular site in
an amino acid sequence, although random insertion with appropriate
screening of the resulting product is also possible.
[0304] Amino acid addition variants comprise amino- and/or
carboxy-terminal fusions of one or more amino acids, such as 1, 2,
3, 5, 10, 20, 30, 50, or more amino acids.
[0305] Amino acid deletion variants are characterized by the
removal of one or more amino acids from the sequence, such as by
removal of 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. The
deletions may be in any position of the protein.
[0306] Amino acid substitution variants are characterized by at
least one residue in the sequence being removed and another residue
being inserted in its place. Preference is given to the
modifications being in positions in the amino acid sequence which
are not conserved between homologous proteins or peptides and/or to
replacing amino acids with other ones having similar properties.
Preferably, amino acid changes in protein variants are conservative
amino acid changes, i.e., substitutions of similarly charged or
uncharged amino acids. A conservative amino acid change involves
substitution of one of a family of amino acids which are related in
their side chains. Naturally occurring amino acids are generally
divided into four families: acidic (aspartate, glutamate), basic
(lysine, arginine, histidine), non-polar (alanine, valine, leucine,
isoleucine, proline, phenylalanine, methionine, tryptophan), and
uncharged polar (glycine, asparagine, glutamine, cysteine, serine,
threonine, tyrosine) amino acids. Phenylalanine, tryptophan, and
tyrosine are sometimes classified jointly as aromatic amino
acids.
[0307] Preferably the degree of similarity, preferably identity
between a given amino acid sequence and an amino acid sequence
which is a variant of said given amino acid sequence will be at
least about 60%, 65%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%,
88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The
degree of similarity or identity is given preferably for an amino
acid region which is at least about 10%, at least about 20%, at
least about 30%, at least about 40%, at least about 50%, at least
about 60%, at least about 70%, at least about 80%, at least about
90% or about 100% of the entire length of the reference amino acid
sequence. For example, if the reference amino acid sequence
consists of 200 amino acids, the degree of similarity or identity
is given preferably for at least about 20, at least about 40, at
least about 60, at least about 80, at least about 100, at least
about 120, at least about 140, at least about 160, at least about
180, or about 200 amino acids, preferably continuous amino acids.
In preferred embodiments, the degree of similarity or identity is
given for the entire length of the reference amino acid sequence.
The alignment for determining sequence similarity, preferably
sequence identity can be done with art known tools, preferably
using the best sequence alignment, for example, using Align, using
standard settings, preferably EMBOSS:needle, Matrix: Blosum62, Gap
Open 10.0, Gap Extend 0.5.
[0308] "Sequence similarity" indicates the percentage of amino
acids that either are identical or that represent conservative
amino acid substitutions. "Sequence identity" between two amino
acid sequences indicates the percentage of amino acids that are
identical between the sequences.
[0309] The term "percentage identity" is intended to denote a
percentage of amino acid residues which are identical between the
two sequences to be compared, obtained after the best alignment,
this percentage being purely statistical and the differences
between the two sequences being distributed randomly and over their
entire length. Sequence comparisons between two amino acid
sequences are conventionally carried out by comparing these
sequences after having aligned them optimally, said comparison
being carried out by segment or by "window of comparison" in order
to identify and compare local regions of sequence similarity. The
optimal alignment of the sequences for comparison may be produced,
besides manually, by means of the local homology algorithm of Smith
and Waterman, 1981, Ads App. Math. 2, 482, by means of the local
homology algorithm of Neddleman and Wunsch, 1970, J. Mol. Biol. 48,
443, by means of the similarity search method of Pearson and
Lipman, 1988, Proc. Natl Acad. Sci. USA 85, 2444, or by means of
computer programs which use these algorithms (GAP, BESTFIT, FASTA,
BLAST P, BLAST N and TFASTA in Wisconsin Genetics Software Package,
Genetics Computer Group, 575 Science Drive, Madison, Wis.).
[0310] The percentage identity is calculated by determining the
number of identical positions between the two sequences being
compared, dividing this number by the number of positions compared
and multiplying the result obtained by 100 so as to obtain the
percentage identity between these two sequences.
[0311] The binding agents of the invention can be produced either
intracellullarly (e.g. in the cytosol, in the periplasma or in
inclusion bodies) and then isolated from the host cells and
optionally further purified; or they can be produced
extracellularly (e.g. in the medium in which the host cells are
cultured) and then isolated from the culture medium and optionally
further purified. Methods and reagents used for the recombinant
production of polypeptides, such as specific suitable expression
vectors, transformation or transfection methods, selection markers,
methods of induction of protein expression, culture conditions, and
the like, are known in the art. Similarly, protein isolation and
purification techniques are well known to the skilled person.
[0312] The term "cell" or "host cell" preferably relates to an
intact cell, i.e. a cell with an intact membrane that has not
released its normal intracellular components such as enzymes,
organelles, or genetic material. An intact cell preferably is a
viable cell, i.e. a living cell capable of carrying out its normal
metabolic functions. Preferably said term relates according to the
invention to any cell which can be transfected with an exogenous
nucleic acid. Preferably, the cell when transfected with an
exogenous nucleic acid and transferred to a recipient can express
the nucleic acid in the recipient. The term "cell" includes
bacterial cells; other useful cells are yeast cells, fungal cells
or mammalian cells. Suitable bacterial cells include cells from
gram-negative bacterial strains such as strains of Escherichia
coli, Proteus, and Pseudomonas, and gram-positive bacterial strains
such as strains of Bacillus, Streptomyces, Staphylococcus, and
Lactococcus. Suitable fungal cell include cells from species of
Trichoderma, Neurospora, and Aspergillus. Suitable yeast cells
include cells from species of Saccharomyces (Tor example
Saccharomyces cerevisiae), Schizosaccharomyces (for example Schizo
saccharomyces pombe), Pichia (for example Pichia pastoris and
Pichia methanolicd), and Hansenula. Suitable mammalian cells
include for example CHO cells, BHK cells, HeLa cells, COS cells,
293 HEK and the like. However, amphibian cells, insect cells, plant
cells, and any other cells used in the art for the expression of
heterologous proteins can be used as well. Mammalian cells are
particularly preferred for adoptive transfer, such as cells from
humans, mice, hamsters, pigs, goats, and primates. The cells may be
derived from a large number of tissue types and include primary
cells and cell lines such as cells of the immune system, in
particular antigen-presenting cells such as dendritic cells and T
cells, stem cells such as hematopoietic stem cells and mesenchymal
stem cells and other cell types. An antigen-presenting cell is a
cell that displays antigen in the context of major
histocompatibility complex on its surface. T cells may recognize
this complex using their T cell receptor (TCR).
[0313] "Reduce", "decrease" or "inhibit" as used herein means an
overall decrease or the ability to cause an overall decrease,
preferably of 5% or greater, 10% or greater, 20% or greater, more
preferably of 50% or greater, and most preferably of 75% or
greater, in the level, e.g. in the level of expression or in the
level of proliferation of cells.
[0314] Terms such as "increase" or "enhance" preferably relate to
an increase or enhancement by about at least 10%, preferably at
least 20%, preferably at least 30%, more preferably at least 40%,
more preferably at least 50%, even more preferably at least 80%,
and most preferably at least 100%, at least 200%, at least 500%, at
least 1000%, at least 10000% or even more.
[0315] Antibody-Dependent Cell-Mediated Cytotoxicity
[0316] ADCC describes the cell-killing ability of effector cells as
described herein, in particular lymphocytes, which preferably
requires the target cell being marked by an antibody.
[0317] ADCC preferably occurs when antibodies bind to antigens on
tumor cells and the antibody Fc domains engage Fc receptors (FcR)
on the surface of immune effector cells. Several families of Fc
receptors have been identified, and specific cell populations
characteristically express defined Fc receptors. ADCC can be viewed
as a mechanism to directly induce a variable degree of immediate
tumor destruction that leads to antigen presentation and the
induction of tumor-directed T-cell responses. Preferably, in vivo
induction of ADCC will lead to tumor-directed T-cell responses and
host-derived antibody responses.
[0318] Complement-Dependent Cytotoxicity
[0319] CDC is another cell-killing method that can be directed by
antibodies. IgM is the most effective isotype for complement
activation. IgG1 and IgG3 are also both very effective at directing
CDC via the classical complement-activation pathway. Preferably, in
this cascade, the formation of antigen-antibody complexes results
in the uncloaking of multiple Clq binding sites in close proximity
on the CH2 domains of participating antibody molecules such as IgG
molecules (Clq is one of three subcomponents of complement C1).
Preferably these uncloaked Clq binding sites convert the previously
low-affinity Clq-IgG interaction to one of high avidity, which
triggers a cascade of events involving a series of other complement
proteins and leads to the proteolytic release of the effector-cell
chemotactic/activating agents C3a and C5a. Preferably, the
complement cascade ends in the formation of a membrane attack
complex, which creates pores in the cell membrane that facilitate
free passage of water and solutes into and out of the cell.
[0320] Antibodies described herein for e.g. providing VL and VH
regions can be produced by a variety of techniques, including
conventional monoclonal antibody methodology, e.g., the standard
somatic cell hybridization technique of Kohler and Milstein, Nature
256: 495 (1975). Although somatic cell hybridization procedures are
preferred, in principle, other techniques for producing monoclonal
antibodies can be employed, e.g., viral or oncogenic transformation
of B-lymphocytes or phage display techniques using libraries of
antibody genes.
[0321] The preferred animal system for preparing hybridomas that
secrete monoclonal antibodies is the murine system. Hybridoma
production in the mouse is a very well established procedure.
Immunization protocols and techniques for isolation of immunized
splenocytes for fusion are known in the art. Fusion partners (e.g.,
murine myeloma cells) and fusion procedures are also known.
[0322] Other preferred animal systems for preparing hybridomas that
secrete monoclonal antibodies are the rat and the rabbit system
(e.g. described in Spieker-Polet et al., Proc. Natl. Acad. Sci.
U.S.A. 92:9348 (1995), see also Rossi et al., Am. J. Clin. Pathol.
124: 295 (2005)).
[0323] In yet another preferred embodiment, human monoclonal
antibodies can be generated using transgenic or transchromosomal
mice carrying parts of the human immune system rather than the
mouse system. These transgenic and transchromosomic mice include
mice known as HuMAb mice and KM mice, respectively, and are
collectively referred to herein as "transgenic mice." The
production of human antibodies in such transgenic mice can be
performed as described in detail for CD20 in WO2004 035607
[0324] Yet another strategy for generating monoclonal antibodies is
to directly isolate genes encoding antibodies from lymphocytes
producing antibodies of defined specificity e.g. see Babcock et
al., 1996; A novel strategy for generating monoclonal antibodies
from single, isolated lymphocytes producing antibodies of defined
specificities. For details of recombinant antibody engineering see
also Welschof and Kraus, Recombinant antibodes for cancer therapy
ISBN-0-89603-918-8 and Benny K. C. Lo Antibody Engineering ISBN
1-58829-092-1.
[0325] To generate antibodies, mice can be immunized with
carrier-conjugated peptides derived from the antigen sequence, i.e.
the sequence against which the antibodies are to be directed, an
enriched preparation of recombinantly expressed antigen or
fragments thereof and/or cells expressing the antigen, as
described. Alternatively, mice can be immunized with DNA encoding
the antigen or fragments thereof. In the event that immunizations
using a purified or enriched preparation of the antigen do not
result in antibodies, mice can also be immunized with cells
expressing the antigen, e.g., a cell line, to promote immune
responses.
[0326] The immune response can be monitored over the course of the
immunization protocol with plasma and serum samples being obtained
by tail vein or retroorbital bleeds. Mice with sufficient titers of
immunoglobulin can be used for fusions. Mice can be boosted
intraperitonealy or intravenously with antigen expressing cells 3
days before sacrifice and removal of the spleen to increase the
rate of specific antibody secreting hybridomas.
[0327] To generate hybridomas producing monoclonal antibodies,
splenocytes and lymph node cells from immunized mice can be
isolated and fused to an appropriate immortalized cell line, such
as a mouse myeloma cell line. The resulting hybridomas can then be
screened for the production of antigen-specific antibodies.
Individual wells can then be screened by ELISA for antibody
secreting hybridomas. By Immunofluorescence and FACS analysis using
antigen expressing cells, antibodies with specificity for the
antigen can be identified. The antibody secreting hybridomas can be
replated, screened again, and if still positive for monoclonal
antibodies can be subcloned by limiting dilution. The stable
subclones can then be cultured in vitro to generate antibody in
tissue culture medium for characterization.
[0328] Antibodies also can be produced in a host cell transfectoma
using, for example, a combination of recombinant DNA techniques and
gene transfection methods as are well known in the art (Morrison,
S. (1985) Science 229: 1202).
[0329] For example, in one embodiment, the gene(s) of interest,
e.g., antibody genes, can be ligated into an expression vector such
as a eukaryotic expression plasmid such as used by the GS gene
expression system disclosed in WO 87/04462, WO 89/01036 and EP 338
841 or other expression systems well known in the art. The purified
plasmid with the cloned antibody genes can be introduced in
eukaryotic host cells such as CHO cells, NS/0 cells, HEK293T cells
or HEK293 cells or alternatively other eukaryotic cells like plant
derived cells, fungal or yeast cells. The method used to introduce
these genes can be methods described in the art such as
electroporation, lipofectine, lipofectamine or others. After
introduction of these antibody genes in the host cells, cells
expressing the antibody can be identified and selected. These cells
represent the transfectomas which can then be amplified for their
expression level and upscaled to produce antibodies. Recombinant
antibodies can be isolated and purified from these culture
supernatants and/or cells.
[0330] Alternatively, the cloned antibody genes can be expressed in
other expression systems, including prokaryotic cells, such as
microorganisms, e.g. E. coli. Furthermore, the antibodies can be
produced in transgenic non-human animals, such as in milk from
sheep and rabbits or in eggs from hens, or in transgenic plants;
see e.g. Verma, R., et al. (1998) J. Immunol. Meth. 216: 165-181;
Pollock, et al. (1999) J. Immunol. Meth. 231: 147-157; and Fischer,
R., et al. (1999) Biol. Chem. 380: 825-839.
[0331] Chimerization
[0332] Nonlabeled murine antibodies are highly immunogenic in man
when repetitively applied leading to reduction of the therapeutic
effect. The main immunogenicity is mediated by the heavy chain
constant regions. The immunogenicity of murine antibodies in man
can be reduced or completely avoided if respective antibodies are
chimerized or humanized. Chimeric antibodies are antibodies, the
different portions of which are derived from different animal
species, such as those having a variable region derived from a
murine antibody and a human immunoglobulin constant region.
Chimerisation of antibodies is achieved by joining of the variable
regions of the murine antibody heavy and light chain with the
constant region of human heavy and light chain (e.g. as described
by Kraus et al., in Methods in Molecular Biology series,
Recombinant antibodies for cancer therapy ISBN-0-89603-918-8). In a
preferred embodiment chimeric antibodies are generated by joining
human kappa-light chain constant region to murine light chain
variable region. In an also preferred embodiment chimeric
antibodies can be generated by joining human lambda-light chain
constant region to murine light chain variable region. The
preferred heavy chain constant regions for generation of chimeric
antibodies are IgG1, IgG3 and IgG4. Other preferred heavy chain
constant regions for generation of chimeric antibodies are IgG2,
IgA, IgD and IgM.
[0333] Humanization
[0334] Antibodies interact with target antigens predominantly
through amino acid residues that are located in the six heavy and
light chain complementarity determining regions (CDRs). For this
reason, the amino acid sequences within CDRs are more diverse
between individual antibodies than sequences outside of CDRs.
Because CDR sequences are responsible for most antibody-antigen
interactions, it is possible to express recombinant antibodies that
mimic the properties of specific naturally occurring antibodies by
constructing expression vectors that include CDR sequences from the
specific naturally occurring antibody grafted onto framework
sequences from a different antibody with different properties (see,
e.g., Riechmann, L. et al. (1998) Nature 332: 323-327; Jones, P. et
al. (1986) Nature 321: 522-525; and Queen, C. et al. (1989) Proc.
Natl. Acad. Sci. U.S.A. 86: 10029-10033). Such framework sequences
can be obtained from public DNA databases that include germline
antibody gene sequences. These germline sequences will differ from
mature antibody gene sequences because they will not include
completely assembled variable genes, which are formed by V (D) J
joining during B cell maturation. Germline gene sequences will also
differ from the sequences of a high affinity secondary repertoire
antibody at individual evenly across the variable region.
[0335] The ability of antibodies and other binding agents to bind
an antigen can be determined using standard binding assays (e.g.,
ELISA, Western Blot, Immunofluorescence and flow cytometric
analysis).
[0336] To purify antibodies, selected producer cell lines can be
grown in two-liter spinner-flasks for recombinant antibody
purification. Alternatively, antibodies can be produced in dialysis
based bioreactors. Supernatants can be filtered and, if necessary,
concentrated before affinity chromatography with protein
L-sepharose. Eluted IgG can be checked by gel electrophoresis and
high performance liquid chromatography to ensure purity. The buffer
solution can be exchanged into PBS, and the concentration can be
determined by OD280 using the respective extinction coefficient.
The recombinant antibodies can be aliquoted and stored at
-80.degree. C.
[0337] In order to demonstrate binding of monoclonal antibodies to
living cells expressing antigen, flow cytometry can be used. Cell
lines expressing naturally or after transfection antigen and
negative controls lacking antigen expression (grown under standard
growth conditions) can be mixed with various concentrations of
monoclonal antibodies in hybridoma supernatants or in PBS
containing 1% FBS, and can be incubated at 4.degree. C. for 30 min.
After washing, the APC- or Alexa647-labeled anti IgG antibody can
bind to antigen-bound monoclonal antibody under the same conditions
as the primary antibody staining. The samples can be analyzed by
flow cytometry with a FACS instrument using light and side scatter
properties to gate on single, living cells. In order to distinguish
antigen-specific monoclonal antibodies from non-specific binders in
a single measurement, the method of co-transfection can be
employed. Cells transiently transfected with plasmids encoding
antigen and a fluorescent marker can be stained as described above.
Transfected cells can be detected in a different fluorescence
channel than antibody-stained cells. As the majority of transfected
cells express both transgenes, antigen-specific monoclonal
antibodies bind preferentially to fluorescence marker expressing
cells, whereas non-specific antibodies bind in a comparable ratio
to non-transfected cells. An alternative assay using fluorescence
microscopy may be used in addition to or instead of the flow
cytometry assay. Cells can be stained exactly as described above
and examined by fluorescence microscopy.
[0338] In order to demonstrate binding of monoclonal antibodies to
living cells expressing antigen, immunofluorescence microscopy
analysis can be used. For example, cell lines expressing either
spontaneously or after transfection antigen and negative controls
lacking antigen expression are grown in chamber slides under
standard growth conditions in DMEM/F12 medium, supplemented with
10% fetal calf serum (FCS), 2 mM L-glutamine, 100 IU/ml penicillin
and 100 .mu.g/ml streptomycin. Cells can then be fixed with
methanol or paraformaldehyde or left untreated. Cells can then be
reacted with monoclonal antibodies against the antigen for 30 min.
at 25.degree. C. After washing, cells can be reacted with an
Alexa555-labelled anti-mouse IgG secondary antibody (Molecular
Probes) under the same conditions. Cells can then be examined by
fluorescence microscopy.
[0339] Cell extracts from cells expressing antigen and appropriate
negative controls can be prepared and subjected to sodium dodecyl
sulfate (SDS) polyacrylamide gel electrophoresis. After
electrophoresis, the separated antigens will be transferred to
nitrocellulose membranes, blocked, and probed with the monoclonal
antibodies to be tested. IgG binding can be detected using
anti-mouse IgG peroxidase and developed with ECL substrate.
[0340] Antibodies can be further tested for reactivity with antigen
by Immunohistochemistry in a manner well known to the skilled
person, e.g. using paraformaldehyde or acetone fixed cryosections
or paraffin embedded tissue sections fixed with paraformaldehyde
from non-cancer tissue or cancer tissue samples obtained from
patients during routine surgical procedures or from mice carrying
xenografted tumors inoculated with cell lines expressing
spontaneously or after transfection antigen. For immunostaining,
antibodies reactive to antigen can be incubated followed by
horseradish-peroxidase conjugated goat anti-mouse or goat
anti-rabbit antibodies (DAKO) according to the vendors
instructions.
[0341] Preclinical Studies
[0342] Binding agents described herein also can be tested in an in
vivo model (e.g. in immune deficient mice carrying xenografted
tumors inoculated with cell lines expressing CLDN to determine
their efficacy in controlling growth of CLDN-expressing tumor
cells.
[0343] In vivo studies after xenografting CLDN-expressing tumor
cells into immunocompromised mice or other animals can be performed
using binding agents described herein. Binding agents can be
administered to tumor free mice followed by injection of tumor
cells to measure the effects of the binding agents to prevent
formation of tumors or tumor-related symptoms. Binding agents can
be administered to tumor-bearing mice to determine the therapeutic
efficacy of respective binding agents to reduce tumor growth,
metastasis or tumor related symptoms. Application of binding agents
can be combined with application of other substances as cystostatic
drugs, growth factor inhibitors, cell cycle blockers, angiogenesis
inhibitors or antibodies to determine synergistic efficacy and
potential toxicity of combinations. To analyze toxic side effects
mediated by binding agents animals can be inoculated with binding
agents or control reagents and thoroughly investigated for symptoms
possibly related to CLDN-binding agent therapy.
[0344] Mapping of epitopes recognized by binding agents can be
performed as described in detail in "Epitope Mapping Protocols
(Methods in Molecular Biology) by Glenn E. Morris ISBN-089603-375-9
and in "Epitope Mapping: A Practical Approach" Practical Approach
Series, 248 by Olwyn M. R. Westwood, Frank C. Hay.
[0345] The compounds and agents described herein may be
administered in the form of any suitable pharmaceutical
composition.
[0346] The pharmaceutical compositions of the invention are
preferably sterile and contain an effective amount of the binding
agents described herein and optionally of further agents as
discussed herein to generate the desired reaction or the desired
effect.
[0347] Pharmaceutical compositions are usually provided in a
uniform dosage form and may be prepared in a manner known per se. A
pharmaceutical composition may e.g. be in the form of a solution or
suspension.
[0348] A pharmaceutical composition may comprise salts, buffer
substances, preservatives, carriers, diluents and/or excipients all
of which are preferably pharmaceutically acceptable. The term
"pharmaceutically acceptable" refers to the non-toxicity of a
material which does not interact with the action of the active
component of the pharmaceutical composition.
[0349] Salts which are not pharmaceutically acceptable may be used
for preparing pharmaceutically acceptable salts and are included in
the invention. Pharmaceutically acceptable salts of this kind
comprise in a non limiting way those prepared from the following
acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric,
maleic, acetic, salicylic, citric, formic, malonic, succinic acids,
and the like. Pharmaceutically acceptable salts may also be
prepared as alkali metal salts or alkaline earth metal salts, such
as sodium salts, potassium salts or calcium salts.
[0350] Suitable buffer substances for use in a pharmaceutical
composition include acetic acid in a salt, citric acid in a salt,
boric acid in a salt and phosphoric acid in a salt.
[0351] Suitable preservatives for use in a pharmaceutical
composition include benzalkonium chloride, chlorobutanol, paraben
and thimerosal.
[0352] An infectible formulation may comprise a pharmaceutically
acceptable excipient such as Ringer Lactate.
[0353] The term "carrier" refers to an organic or inorganic
component, of a natural or synthetic nature, in which the active
component is combined in order to facilitate, enhance or enable
application. According to the invention, the term "carrier" also
includes one or more compatible solid or liquid fillers, diluents
or encapsulating substances, which are suitable for administration
to a patient.
[0354] Possible carrier substances for parenteral administration
are e.g. sterile water, Ringer, Ringer lactate, sterile sodium
chloride solution, polyalkylene glycols, hydrogenated naphthalenes
and, in particular, biocompatible lactide polymers,
lactide/glycolide copolymers or polyoxyethylene/polyoxy-propylene
copolymers.
[0355] The term "excipient" when used herein is intended to
indicate all substances which may be present in a pharmaceutical
composition and which are not active ingredients such as, e.g.,
carriers, binders, lubricants, thickeners, surface active agents,
preservatives, emulsifiers, buffers, flavoring agents, or
colorants.
[0356] The agents and compositions described herein may be
administered via any conventional route, such as by parenteral
administration including by injection or infusion. Administration
is preferably parenterally, e.g. intravenously, intraarterially,
subcutaneously, intradermally or intramuscularly.
[0357] Compositions suitable for parenteral administration usually
comprise a sterile aqueous or nonaqueous preparation of the active
compound, which is preferably isotonic to the blood of the
recipient. Examples of compatible carriers and solvents are Ringer
solution and isotonic sodium chloride solution. In addition,
usually sterile, fixed oils are used as solution or suspension
medium.
[0358] The agents and compositions described herein are
administered in effective amounts. An "effective amount" refers to
the amount which achieves a desired reaction or a desired effect
alone or together with further doses. In the case of treatment of a
particular disease or of a particular condition, the desired
reaction preferably relates to inhibition of the course of the
disease. This comprises slowing down the progress of the disease
and, in particular, interrupting or reversing the progress of the
disease. The desired reaction in a treatment of a disease or of a
condition may also be delay of the onset or a prevention of the
onset of said disease or said condition.
[0359] An effective amount of an agent or composition described
herein will depend on the condition to be treated, the severeness
of the disease, the individual parameters of the patient, including
age, physiological condition, size and weight, the duration of
treatment, the type of an accompanying therapy (if present), the
specific route of administration and similar factors. Accordingly,
the doses administered of the agents described herein may depend on
various of such parameters. In the case that a reaction in a
patient is insufficient with an initial dose, higher doses (or
effectively higher doses achieved by a different, more localized
route of administration) may be used.
[0360] The agents and compositions described herein can be
administered to patients, e.g., in vivo, to treat or prevent a
variety of disorders such as those described herein. Preferred
patients include human patients having disorders that can be
corrected or ameliorated by administering the agents and
compositions described herein. This includes disorders involving
cells characterized by an altered expression pattern of CLDN such
as CLDN18.2 and/or CLDN6.
[0361] For example, in one embodiment, agents described herein can
be used to treat a patient with a cancer disease, e.g., a cancer
disease such as described herein characterized by the presence of
cancer cells expressing CLDN.
[0362] The pharmaceutical compositions and methods of treatment
described according to the invention may also be used for
immunization or vaccination to prevent a disease described
herein.
[0363] The pharmaceutical composition of the invention may be
administered together with supplementing immunity-enhancing
substances such as one or more adjuvants and may comprise one or
more immunity-enhancing substances to further increase its
effectiveness, preferably to achieve a synergistic effect of
immunostimulation. The term "adjuvant" relates to compounds which
prolongs or enhances or accelerates an immune response. Various
mechanisms are possible in this respect, depending on the various
types of adjuvants. For example, compounds which allow the
maturation of the DC, e.g. lipopolysaccharides or CD40 ligand, form
a first class of suitable adjuvants. Generally, any agent which
influences the immune system of the type of a "danger signal" (LPS,
GP96, dsRNA etc.) or cytokines, such as GM-CSF, can be used as an
adjuvant which enables an immune response to be intensified and/or
influenced in a controlled manner. CpG oligodeoxynucleotides can
optionally also be used in this context, although their side
effects which occur under certain circumstances, as explained
above, are to be considered. Particularly preferred adjuvants are
cytokines, such as monokines, lymphokines, interleukins or
chemokines, e.g. IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-10, IL-12, INF.alpha., INF-.gamma., GM-CSF, LT-.alpha., or
growth factors, e.g. hGH. Further known adjuvants are aluminium
hydroxide, Freund's adjuvant or oil such as Montanide.RTM., most
preferred Montanide.RTM. ISA51. Lipopeptides, such as Pam3Cys, are
also suitable for use as adjuvants in the pharmaceutical
composition of the present invention.
[0364] The agents and compositions provided herein may be used
alone or in combination with conventional therapeutic regimens such
as surgery, irradiation, chemotherapy and/or bone marrow
transplantation (autologous, syngeneic, allogeneic or
unrelated).
[0365] Treatment of cancer represents a field where combination
strategies are especially desirable since frequently the combined
action of two, three, four or even more cancer drugs/therapies
generates synergistic effects which are considerably stronger than
the impact of a monotherapeutic approach. Thus, in another
embodiment of the present invention, a cancer treatment which
utilizes immune- or vaccination-based mechanisms such as the
methods and pharmaceutical compositions of the present invention
may be effectively combined with various other drugs and/or methods
targeting similar or other specific mechanisms. Among those are
e.g. combinations with conventional tumor therapies, multi-epitope
strategies, additional immunotherapy, and treatment approaches
targeting angiogenesis or apoptosis (for review see e.g. Andersen
et al. 2008: Cancer treatment: the combination of vaccination with
other therapies. Cancer Immunology Immunotherapy, 57(11):
1735-1743.) Sequential administration of different agents may
inhibit cancer cell growth at different check points, while other
agents may e.g. inhibit neo-angiogenesis, survival of malignant
cells or metastases, potentially converting cancer into a chronic
disease. The following list provides some non-limiting examples of
anti-cancer drugs and therapies which can be used in combination
with the present invention:
[0366] 1. Chemotherapy
[0367] Chemotherapy is the standard of care for multiple types of
cancer. The most common chemotherapy agents act by killing cells
that divide rapidly, one of the main properties of cancer cells.
Thus, a combination with conventional chemotherapeutic drugs such
as e.g. alkylating agents, antimetabolites, anthracyclines, plant
alkaloids, topoisomerase inhibitors, and other antitumour agents
which either affect cell division or DNA synthesis may
significantly improve the therapeutic effects of the present
invention by clearing suppressor cells, reboot of the immune
system, by rendering tumor cells more susceptible to immune
mediated killing, or by additional activation of cells of the
immune system. A synergistic anti-cancer action of chemotherapeutic
and vaccination-based immunotherapeutic drugs has been demonstrated
in multiple studies (see e.g. Quoix et al. 2011: Therapeutic
vaccination with TG4010 and first-line chemotherapy in advanced
non-small-cell lung cancer: a controlled phase 2B trial. Lancet
Oncol. 12(12): 1125-33; see also Liseth et al. 2010: Combination of
intensive chemotherapy and anticancer vaccines in the treatment of
human malignancies: the hematological experience. J Biomed
Biotechnol. 2010: 6920979; see also Hirooka et al 2009: A
combination therapy of gemcitabine with immunotherapy for patients
with inoperable locally advanced pancreatic cancer. Pancreas 38(3):
e69-74). There are hundreds of chemotherapeutic drugs available
which are basically suitable for combination therapies. Some
(non-limiting) examples of chemotherapeutic drugs which can be
combined with the present invention are carboplatin (Paraplatin),
cisplatin (Platinol, Platinol-AQ), cyclophosphamide (Cytoxan,
Neosar), docetaxel (Taxotere), doxorubicin (Adriamycin), erlotinib
(Tarceva), etoposide (VePesid), fluorouracil (5-FU), gemcitabine
(Gemzar), imatinib mesylate (Gleevec), irinotecan (Camptosar),
methotrexate (Folex, Mexate, Amethopterin), paclitaxel (Taxol,
Abraxane), sorafinib (Nexavar), sunitinib (Sutent), topotecan
(Hycamtin), vincristine (Oncovin, Vincasar PFS), and vinblastine
(Velban).
[0368] 2. Surgery
[0369] Cancer surgery--an operation to remove the tumor--remains
the foundation of cancer treatment. Surgery can be combined with
other cancer treatments in order to delete any remaining tumor
cells. Combining surgical methods with subsequent immunotherapeutic
treatment is a promising approach which has been demonstrated
countless times.
[0370] 3. Radiation
[0371] Radiation therapy remains an important component of cancer
treatment with approximately 50% of all cancer patients receiving
radiation therapy during their course of illness. The main goal of
radiation therapy is to deprive cancer cells of their
multiplication (cell division) potential. The types of radiation
used to treat cancer are photons radiation (x-rays and gamma rays)
and particle radiations (electron, proton and neutron beams.) There
are two ways to deliver the radiation to the location of the
cancer. External beam radiation is delivered from outside the body
by aiming high-energy rays (photons, protons or particle radiation)
to the location of the tumor. Internal radiation or brachytherapy
is delivered from inside the body by radioactive sources, sealed in
catheters or seeds directly into the tumor site. Radiation therapy
techniques which are applicable in combination with the present
invention are e.g. fractionation (radiation therapy delivered in a
fractionated regime, e.g. daily fractions of 1.5 to 3 Gy given over
several weeks), 3D conformal radiotherapy (3DCRT; delivering
radiation to the gross tumor volume), intensity modulated radiation
therapy (IMRT; computer-controlled intensity modulation of multiple
radiation beams), image guided radiotherapy (IGRT; a technique
comprising pre-radiotherapy imaging which allows for correction),
and stereotactic body radiation therapy (SRBT, delivers very high
individual doses of radiation over only a few treatment fractions).
For a radiation therapy review see Baskar et al. 2012: Cancer and
radiation therapy: current advances and future directions. Int. J
Med Sci. 9(3): 193-199.
[0372] 4. Antibodies
[0373] Antibodies (preferably monoclonal antibodies) achieve their
therapeutic effect against cancer cells through various mechanisms.
They can have direct effects in producing apoptosis or programmed
cell death. They can block components of signal transduction
pathways such as e.g. growth factor receptors, effectively
arresting proliferation of tumor cells. In cells that express
monoclonal antibodies, they can bring about anti-idiotype antibody
formation. Indirect effects include recruiting cells that have
cytotoxicity, such as monocytes and macrophages. This type of
antibody-mediated cell kill is called antibody-dependent cell
mediated cytotoxicity (ADCC). Antibodies also bind complement,
leading to direct cell toxicity, known as complement dependent
cytotoxicity (CDC). Combining surgical methods with
immunotherapeutic drugs or methods is an successful approach, as
e.g. demonstrated in Gadri et al. 2009: Synergistic effect of
dendritic cell vaccination and anti-CD20 antibody treatment in the
therapy of murine lymphoma. J Immunother. 32(4): 333-40. The
following list provides some non-limiting examples of anti-cancer
antibodies and potential antibody targets (in brackets) which can
be used in combination with the present invention: Abagovomab
(CA-125), Abciximab (CD41), Adecatumumab (EpCAM), Afutuzumab
(CD20), Alacizumab pegol (VEGFR2), Altumomab pentetate (CEA),
Amatuximab (MORAb-009), Anatumomab mafenatox (TAG-72), Apolizumab
(HLA-DR), Arcitumomab (CEA), Bavituximab (phosphatidylserine),
Bectumomab (CD22), Belimumab (BAFF), Bevacizumab (VEGF-A),
Bivatuzumab mertansine (CD44 v6), Blinatumomab (CD19), Brentuximab
vedotin (CD30 TNFRSF8), Cantuzumab mertansin (mucin CanAg),
Cantuzumab ravtansine (MUC1), Capromab pendetide (prostatic
carcinoma cells), Carlumab (CNT0888), Catumaxomab (EpCAM, CD3),
Cetuximab (EGFR), Citatuzumab bogatox (EpCAM), Cixutumumab (IGF-1
receptor), Claudiximab (Claudin), Clivatuzumab tetraxetan (MUC1),
Conatumumab (TRAIL-R2), Dacetuzumab (CD40), Dalotuzumab
(insulin-like growth factor I receptor), Denosumab (RANKL),
Detumomab (B-lymphoma cell), Drozitumab (DRS), Ecromeximab (GD3
ganglioside), Edrecolomab (EpCAM), Elotuzumab (SLAMF7),
Enavatuzumab (PDL192), Ensituximab (NPC-1C), Epratuzumab (CD22),
Ertumaxomab (HER2/neu, CD3), Etaracizumab (integrin
.alpha.v.beta.3), Farletuzumab (folate receptor 1), FBTA05 (CD20),
Ficlatuzumab (SCH 900105), Figitumumab (IGF-1 receptor),
Flanvotumab (glycoprotein 75), Fresolimumab (TGF-.beta.), Galiximab
(CD80), Ganitumab (IGF-I), Gemtuzumab ozogamicin (CD33),
Gevokizumab (IL-1.beta.), Girentuximab (carbonic anhydrase 9
(CA-IX)), Glembatumumab vedotin (GPNMB), Ibritumomab tiuxetan
(CD20), Icrucumab (VEGFR-1), Igovoma (CA-125), Indatuximab
ravtansine (SDC1), Intetumumab (CD51), Inotuzumab ozogamicin
(CD22), Ipilimumab (CD152), Iratumumab (CD30), Labetuzumab (CEA),
Lexatumumab (TRAIL-R2), Libivirumab (hepatitis B surface antigen),
Lintuzumab (CD33), Lorvotuzumab mertansine (CD56), Lucatumumab
(CD40), Lumiliximab (CD23), Mapatumumab (TRAIL-R1), Matuzumab
(EGFR), Mepolizumab (IL-5), Milatuzumab (CD74), Mitumomab (GD3
ganglioside), Mogamulizumab (CCR4), Moxetumomab pasudotox (CD22),
Nacolomab tafenatox (C242 antigen), Naptumomab estafenatox (5T4),
Narnatumab (RON), Necitumumab (EGFR), Nimotuzumab (EGFR), Nivolumab
(IgG4), Ofatumumab (CD20), Olaratumab (PDGF-R .alpha.), Onartuzumab
(human scatter factor receptor kinase), Oportuzumab monatox
(EpCAM), Oregovomab (CA-125), Oxelumab (OX-40), Panitumumab (EGFR),
Patritumab (HER3), Pemtumoma (MUC1), Pertuzumab (HER2/neu),
Pintumomab (adenocarcinoma antigen), Pritumumab (vimentin),
Racotumomab (N-glycolylneuraminic acid), Radretumab (fibronectin
extra domain-B), Rafivirumab (rabies virus glycoprotein),
Ramucirumab (VEGFR2), Rilotumumab (HGF), Rituximab (CD20),
Robatumumab (IGF-1 receptor), Samalizumab (CD200), Sibrotuzumab
(FAP), Siltuximab (IL-6), Tabalumab (BAFF), Tacatuzumab tetraxetan
(alpha-fetoprotein), Taplitumomab paptox (CD19), Tenatumomab
(tenascin C), Teprotumumab (CD221), Ticilimumab (CTLA-4),
Tigatuzumab (TRAIL-R2), TNX-650 (IL-13), Tositumomab (CD20),
Trastuzumab (HER2/neu), TRBS07 (GD2), Tremelimumab (CTLA-4),
Tucotuzumab celmoleukin (EpCAM), Ublituximab (MS4A1), Urelumab
(4-1BB), Volociximab (integrin .alpha.5.beta.1), Votumumab (tumor
antigen CTAA16.88), Zalutumumab (EGFR), Zanolimumab (CD4).
[0374] 5. Cytokines, Chemokines, Costimulatory Molecules, Fusion
Proteins
[0375] Combined usage of the antigen-coding pharmaceutical
compositions of the present invention with cytokines, chemokines,
costimulatory molecules and/or fusion proteins thereof to evoke
beneficial immune modulation or tumor inhibition effects is another
embodiment of the present invention. In order to increase the
infiltration of immune cells into the tumor and facilitate the
movement of antigen-presenting cells to tumor-draining lymph nodes,
various chemokines with C, CC, CXC and CX3C structures might be
used. Some of the most promising chemokines are e.g. CCR7 and its
ligands CCL19 and CCL21, furthermore CCL2, CCL3, CCL5, and CCL16.
Other examples are CXCR4, CXCR7 and CXCL12. Furthermore,
costimulatory or regulatory molecules such as e.g. B7 ligands (B7.1
and B7.2) are useful. Also useful are other cytokines such as e.g.
interleukins especially (e.g. IL-1 to IL17), interferons (e.g.
IFNalpha1 to IFNalpha8, IFNalpha10, IFNalpha1 3, IFNalpha14,
IFNalpha16, IFNalpha17, IFNalpha21, IFNbeta1, IFNW, IFNE1 and
IFNK), hematopoietic factors, TGFs (e.g. TGF-.alpha., TGF-.beta.,
and other members of the TGF family), finally members of the tumor
necrosis factor family of receptors and their ligands as well as
other stimulatory molecules, comprising but not limited to 4-1BB,
4-1BB-L, CD137, CD137L, CTLA-4GITR, GITRL, Fas, Fas-L, TNFR1,
TRAIL-R1, TRAIL-R2, p75NGF-R, DR6, LT.beta.R, RANK, EDAR1, XEDAR,
Fn114, Troy/Trade, TM, TNFRII, HVEM, CD27, CD30, CD40, 4-1BB, OX40,
GITR, GITRL, TACI, BAFF-R, BCMA, RELT, and CD95 (Fas/APO-1),
glucocorticoid-induced TNFR-related protein, TNF receptor-related
apoptosis-mediating protein (TRAMP) and death receptor-6 (DR6).
Especially CD40/CD40L and OX40/OX40L are important targets for
combined immunotherapy because of their direct impact on T cell
survival and proliferation. For a review see Lechner et al. 2011:
Chemokines, costimulatory molecules and fusion proteins for the
immunotherapy of solid tumors. Immunotherapy 3 (11), 1317-1340.
[0376] 6. Bacterial Treatments
[0377] Researchers have been using anaerobic bacteria, such as
Clostridium novyi, to consume the interior of oxygen-poor tumours.
These should then die when they come in contact with the tumour's
oxygenated sides, meaning they would be harmless to the rest of the
body. Another strategy is to use anaerobic bacteria that have been
transformed with an enzyme that can convert a non-toxic prodrug
into a toxic drug. With the proliferation of the bacteria in the
necrotic and hypoxic areas of the tumour, the enzyme is expressed
solely in the tumour. Thus, a systemically applied prodrug is
metabolised to the toxic drug only in the tumour. This has been
demonstrated to be effective with the nonpathogenic anaerobe
Clostridium sporogenes.
[0378] 7. Kinase Inhibitors
[0379] Another large group of potential targets for complementary
cancer therapy comprises kinase inhibitors, because the growth and
survival of cancer cells is closely interlocked with the
deregulation of kinase activity. To restore normal kinase activity
and therefor reduce tumor growth a broad range of inhibitors is in
used. The group of targeted kinases comprises receptor tyrosine
kinases e.g. BCR-ABL, B-Raf, EGFR, HER-2/ErbB2, IGF-IR,
PDGFR-.alpha., PDGFR-.beta., c-Kit, Flt-4, Flt3, FGFR1, FGFR3,
FGFR4, CSF1R, c-Met, RON, c-Ret, ALK, cytoplasmic tyrosine kinases
e.g. c-SRC, c-YES, Abl, JAK-2, serine/threonine kinases e.g. ATM,
Aurora A & B, CDKs, mTOR, PKCi, PLKs, b-Raf, S6K, STK11/LKB1
and lipid kinases e.g. PI3K, SK1. Small molecule kinase inhibitors
are e.g. PHA-739358, Nilotinib, Dasatinib, and PD166326, NSC
743411, Lapatinib (GW-572016), Canertinib (CI-1033), Semaxinib
(SU5416), Vatalanib (PTK787/ZK222584), Sutent (SU11248), Sorafenib
(BAY 43-9006) and Leflunomide (SU101). For more information see
e.g. Zhang et al. 2009: Targeting cancer with small molecule kinase
inhibitors. Nature Reviews Cancer 9, 28-39.
[0380] 8. Toll-Like Receptors
[0381] The members of the Toll-like receptor (TLRs) family are an
important link between innate and adaptive immunity and the effect
of many adjuvants rely on the activation of TLRs. A large number of
established vaccines against cancer incorporate ligands for TLRs
for boosting vaccine responses. Besides TLR2, TLR3, TLR4 especially
TLR7 and TLR 8 have been examined for cancer therapy in passive
immunotherapy approaches. The closely related TLR7 and TLR8
contribute to antitumor responses by affecting immune cells, tumor
cells, and the tumor microenvironment and may be activated by
nucleoside analogue structures. All TLR's have been used as
stand-alone immunotherapeutics or cancer vaccine adjuvants and may
be synergistically combined with the formulations and methods of
the present invention. For more information see van Duin et al.
2005: Triggering TLR signaling in vaccination. Trends in
Immunology, 27(1):49-55.
[0382] 9. Angiogenesis Inhibitors
[0383] In addition to therapies which target immune modulatory
receptors affected by tumor-mediated escape mechanisms and immune
suppression there are therapies which target the tumor environment.
Angiogenesis inhibitors prevent the extensive growth of blood
vessels (angiogenesis) that tumors require to survive. The
angiogenesis promoted by tumor cells to meet their increasing
nutrient and oxygen demands for example can be blocked by targeting
different molecules. Non-limiting examples of
angiogenesis-mediating molecules or angiogenesis inhibitors which
may be combined with the present invention are soluble VEGF (VEGF
isoforms VEGF121 and VEGF165, receptors VEGFR1, VEGFR2 and
co-receptors Neuropilin-1 and Neuropilin-2) 1 and NRP-1,
angiopoietin 2, TSP-1 and TSP-2, angiostatin and related molecules,
endostatin, vasostatin, calreticulin, platelet factor-4, TIMP and
CDAI, Meth-1 and Meth-2, IFN-.alpha., -.beta. and -.gamma., CXCL10,
IL-4, -12 and -18, prothrombin (kringle domain-2), antithrombin III
fragment, prolactin, VEGI, SPARC, osteopontin, maspin, canstatin,
proliferin-related protein, restin and drugs like e.g. bevacizumab,
itraconazole, carboxyamidotriazole, TNP-470, CM101, IFN-.alpha.,
platelet factor-4, suramin, SU5416, thrombospondin, VEGFR
antagonists, angiostatic steroids+heparin, cartilage-derived
angiogenesis Inhibitory factor, matrix metalloproteinase
inhibitors, 2-methoxyestradiol, tecogalan, tetrathiomolybdate,
thalidomide, thrombospondin, prolactina V.beta.3 inhibitors,
linomide, tasquinimod, For review see Schoenfeld and Dranoff 2011:
Anti-angiogenesis immunotherapy. Hum Vaccin. (9): 976-81.
[0384] 10. Small Molecule Targeted Therapy Drugs
[0385] Small molecule targeted therapy drugs are generally
inhibitors of enzymatic domains on mutated, overexpressed, or
otherwise critical proteins within the cancer cell. Prominent and
non-limiting examples are the tyrosine kinase inhibitors imatinib
(Gleevec/Glivec) and gefitinib (Iressa). The use of small molecules
e.g. sunitinib malate and/or sorafenib tosylate targeting some
kinases in combination with vaccines for cancer therapy is also
described in previous patent application US2009004213.
[0386] 11. Virus-Based Vaccines
[0387] There are a number of virus-based cancer vaccines available
or under development which can be used in a combined therapeutic
approach together with the formulations of the present invention.
One advantage of the use of such viral vectors is their intrinsic
ability to initiate immune responses, with inflammatory reactions
occurring as a result of the viral infection creating the danger
signal necessary for immune activation. An ideal viral vector
should be safe and should not introduce an anti-vector immune
response to allow for boosting antitumour specific responses.
Recombinant viruses such as vaccinia viruses, herpes simplex
viruses, adenoviruses, adeno-associated viruses, retroviruses and
avipox viruses have been used in animal tumour models and based on
their encouraging results, human clinical trials have been
initiated. Especially important virus-based vaccines are virus-like
particles (VLPs), small particles that contain certain proteins
from the outer coat of a virus. Virus-like particles do not contain
any genetic material from the virus and cannot cause an infection
but they can be constructed to present tumor antigens on their
coat. VLPs can be derived from various viruses such as e.g. the
hepatitis B virus or other virus families including Parvoviridae
(e.g. adeno-associated virus), Retroviridae (e.g. HIV), and
Flaviviridae (e.g. Hepatitis C virus). For a general review see
Sorensen and Thompsen 2007: Virus-based immunotherapy of cancer:
what do we know and where are we going? APMIS 115(11):1177-93;
virus-like particles against cancer are reviewed in Buonaguro et
al. 2011: Developments in virus-like particle-based vaccines for
infectious diseases and cancer. Expert Rev Vaccines 10(11):1569-83;
and in Guillen et al. 2010: Virus-like particles as vaccine
antigens and adjuvants: application to chronic disease, cancer
immunotherapy and infectious disease preventive strategies.
Procedia in Vaccinology 2 (2), 128-133.
[0388] 12. Multi-Epitope Strategies
[0389] The use of multi epitopes shows promising results for
vaccination. Fast sequencing technologies combined with intelligent
algorithms systems allow the exploitation of the tumor mutanome and
may provide multi epitopes for individualized vaccines which can be
combined with the present invention. For more information see 2007:
Vaccination of metastatic colorectal cancer patients with matured
dendritic cells loaded with multiple major histocompatibility
complex class I peptides. J Immunother 30: 762-772; furthermore
Castle et al. 2012: Exploiting the mutanome for tumor vaccination.
Cancer Res 72 (5):1081-91.
[0390] 13. Adoptive T cell transfer
[0391] For example, a combination of a tumor antigen vaccination
and T cell transfer is described in: Rapoport et al. 2011:
Combination immunotherapy using adoptive T-cell transfer and tumor
antigen vaccination on the basis of hTERT and survivin after ASCT
for myeloma. Blood 117(3):788-97.
[0392] 14. Peptide-Based Target Therapies
[0393] Peptides can bind to cell surface receptors or affected
extracellular matrix surrounding the tumor. Radionuclides which are
attached to these peptides (e.g. RGDs) eventually kill the cancer
cell if the nuclide decays in the vicinity of the cell. Especially
oligo- or multimers of these binding motifs are of great interest,
since this can lead to enhanced tumor specificity and avidity. For
non-limiting examples see Yamada 2011: Peptide-based cancer vaccine
therapy for prostate cancer, bladder cancer, and malignant glioma.
Nihon Rinsho 69(9): 1657-61.
[0394] 15. Other Therapies
[0395] There are numerous other cancer therapies which can be
combined with the formulations and methods of the present invention
in order to create synergistic effects. Non-limiting examples are
treatments targeting apoptosis, hyperthermia, hormonal therapy,
telomerase therapy, insulin potentiation therapy, gene therapy and
photodynamic therapy.
[0396] The present invention is further illustrated by the
following examples which are not be construed as limiting the scope
of the invention.
EXAMPLES
Example 1: Generation and Testing of Bispecific Binding Agents
Targeting CLDN18.2 and CD3
[0397] a. Sequence Origin, Design of Bi-scFv Constructs, and
Cloning into Expression Vectors
[0398] Bispecific tandem single chain antibody constructs (bi-scFv)
containing binding domains specific for the human T cell receptor
component CD3 and human tumor associated antigens (TAA) were
prepared. The corresponding variable heavy chain regions (V.sub.H)
and the corresponding variable light chain regions (V.sub.L) for
each construct were specifically arranged from N- to C-terminus in
consecutive order:
N-V.sub.H.sup..alpha.CLDN18.2-V.sub.L.sup..alpha.CLDN18.2-V.sub.H.sup..al-
pha.CD3-V.sub.L.sup..alpha.CD3-C (1BiMAB, 18PHU5, no.11-15)
N-V.sub.H.sup..alpha.CD3-V.sub.L.sup..alpha.CD3-V.sub.H.sup..alpha.CLDN18-
.2-V.sub.L.sup..alpha.CLDN18.2-C (18PHU3, no. 16-20)
[0399] Table 1 summarizes all bi-scFv constructs specific for the
TAA CLDN18.2 and PLAC1 that were generated in the course of the
invention. The bi-scFv constructs were generated by gene synthesis
by GeneArt AG (GeneArt/Life Technologies GmbH, Regensburg, Germany)
using the VH and VL sequences of the corresponding antibodies.
Codon optimizations such as Homo sapiens (HS), Mus musculus (MM),
or Chinese Hamster Ovary (CHO) were implemented by GeneArt's
GeneOptimizer.RTM. software, and are listed in Table 1. Information
on specificity, sequence origin from monoclonal antibodies (mAB),
codon usage, additional sequence features and references of all
applied domains are summarized in Table 2. Variable domain sequence
origin of the respective CD3 antibodies are listed in Table 2. Due
to the high homology of human and mouse TAAs, the same anti-TAA VH
and VL sequences could be used for the generation of bi-scFv
constructs for mouse assays, but in combination with the VH, VL
sequences of the mouse specific anti-CD3 antibody clone
145-2C11.
[0400] DNA cloning and expression vector construction was carried
out according to standard procedures (Green/Sambrook, Molecular
Cloning, 2012) well known by the skilled person. Briefly, the
leadoff bi-scFv DNA sequences were provided with a 5' HindIII and a
3' XhoI restriction site (HindIII and XbaI in case of bi-scFv
1BiMAB) for cloning into expression plasmids. A secretion signal
sequence was introduced at the 5' end upstream of the bi-scFv
sequence for protein secretion from cellular cytoplasm into the
culture medium. A sequence coding for a 15 to 18 amino acid
flexible glycine-serine peptide linker was inserted to join the
V.sub.H and V.sub.L domains for the composition of the single chain
variable antibody fragments (scFv) of which one binds to CD3 and
the other to the TAA. To form a bispecific single chain antibody,
the two scFv domain sequences were connected by a sequence coding
for a short peptide linker (GGGGS). Together with this linker
sequence a BamHI restriction site was introduced for scFv domain
exchanges for the cloning of upcoming bi-scFV constructs. In-depth,
5'scFv-domains could be exchanged by HindIII and BamHI restriction
and 3'scFv-domains by BamHI and XhoI restriction. For construct
schemata see also FIG. 1.
[0401] All used bi-scFv antibody constructs were cloned into the
standard mammalian expression vector pcDNA.TM.3.1/myc-His (+)
(Invitrogen/Life Technologies GmbH, Darmstadt, Germany). The
C-terminal 6.times.His-tag served for metal affinity purification
of the protein and for detection analysis. All constructs were
verified by sequencing via MWG's single read sequence service
(Eurofins MWG Operon, Ebersberg, Germany).
TABLE-US-00001 TABLE 1 Summary of TAA and CD3 specific bispecific
single chain antibody constructs Internal name TAA Specificity
5'-V.sub.H-V.sub.L 3'-V.sub.H-V.sub.L Codon usage 1BiMAB CLDN18.2
human mCLDN18.2ab TR66 HS no. 11 CLDN18.2 murine mCLDN18.2ab
145-2C11 CHO no. 12 CLDN18.2 human mCLDN18.2ab UCHT1-HU CHO no. 13
CLDN18.2 human mCLDN18.2ab UCHT1 CHO no. 14 CLDN18.2 human
mCLDN18.2ab CLB-T3 CHO no. 15 CLDN18.2 human mCLDN18.2ab TR66 CHO
no. 16 CLDN18.2 murine 145-2C11 mCLDN18.2ab CHO no. 17 CLDN18.2
human UCHT1-HU mCLDN18.2ab CHO no. 18 CLDN18.2 human UCHT1
mCLDN18.2ab CHO no. 19 CLDN18.2 human CLB-T3 mCLDN18.2ab CHO no. 20
CLDN18.2 human TR66 mCLDN18.2ab CHO 18PHU5 CLDN18.2 human
mCLDN18.2ab TR66 HS 18PHU3 CLDN18.2 human TR66 mCLDN18.2ab HS
18PMU5 CLDN18.2 murine mCLDN18.2ab 145-2C11 MM 18PMU3 CLDN18.2
murine 145-2C11 mCLDN18.2ab MM control bi-scFv no. 35 PLAC1 human
78H11 TR66 CHO CHO, Chinese Hamster Ovary; HS, Homo sapiens; HU,
humanized; MM, Mus
TABLE-US-00002 TABLE 2 Summary of bi-scFv construct information CD3
binding moiety Internal mAB Species TAA binding moiety Species
Short name origin reactivity TAA mAB origin reactivity
5'-V.sub.H-V.sub.L 3'-V.sub.H-V.sub.L linker 1BiMAB TR66 human
CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab TR66 GGGGS murine no. 11
145-2C11 murine CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab 145-2C11
SGGGGS murine no. 12 UCHT1-HU human CLDN18.2 mCLDN18.2ab human,
mCLDN18.2ab UCHT1-HU SGGGGS murine no. 13 UCHT1 human CLDN18.2
mCLDN18.2ab human, mCLDN18.2ab UCHT1 SGGGGS murine no. 14 CLB-T3
human CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab CLB-T3 SGGGGS murine
no. 15 TR66 human CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab TR66
SGGGGS murine no. 16 145-2C11 murine CLDN18.2 mCLDN18.2ab human,
145-2C11 mCLDN18.2ab SGGGGS murine no. 17 UCHT1-HU human CLDN18.2
mCLDN18.2ab human, UCHT1-HU mCLDN18.2ab SGGGGS murine no. 18 UCHT1
human CLDN18.2 mCLDN18.2ab human, UCHT1 mCLDN18.2ab SGGGGS murine
no. 19 CLB-T3 human CLDN18.2 mCLDN18.2ab human, CLB-T3 mCLDN18.2ab
SGGGGS murine no. 20 TR66 human CLDN18.2 mCLDN18.2ab human, TR66
mCLDN18.2ab SGGGGS murine 18PHU5 TR66 human CLDN18.2 mCLDN18.2ab
human, mCLDN18.2ab TR66 SGGGGS murine 18PHU3 TR66 human CLDN18.2
mCLDN18.2ab human, TR66 mCLDN18.2ab SGGGGS murine 18PMU5 145-2C11
murine CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab 145-2C11 SGGGGS
murine 18PMU3 145-2C11 murine CLDN18.2 mCLDN18.2ab human, 145-2C11
mCLDN18.2ab SGGGGS murine no. 35 TR66 human PLAC1 78H11 human,
78H11 TR66 SGGGGS murine Anti-CD3 Internal 5'-long 3'-long Codon
mAB name linker linker Secretion signal usage reference 1BiMAB
(GGGGS).sub.3 VE(GGSGGS).sub.2 MGWSCIILFLVATATGVHS HS Lanzavecchia
& Scheidegger, Eur GGVD J Immunol 1987 no.11 (GGGGS).sub.3
(GGGGS).sub.3 MGWSCIILFLVATATGVHS CHO Leo et al., Proc Natl Acad
Sci, 1987 no. 12 (GGGGS).sub.3 (GGGGS).sub.3 MGWSCIILFLVATATGVHS
CHO Shalaby et al., J Exp Med 1992 no. 13 (GGGGS).sub.3
(GGGGS).sub.3 MGWSCIILFLVATATGVHS CHO Beverley et al., Eur J
Immunol 1981 no. 14 (GGGGS).sub.3 (GGGGS).sub.3 MGWSCIILFLVATATGVHS
CHO Van Lier et al., Immunology 1989 no. 15 (GGGGS).sub.3
(GGGGS).sub.3 MGWSCIILFLVATATGVHS CHO Lanzavecchia &
Scheidegger, Eur J Immunol 1987 no. 16 (GGGGS).sub.3 (GGGGS).sub.3
MNSGLQLVFFVLTLKGIQG CHO Leo et al., Proc Natl Acad Sci, 1987 no. 17
(GGGGS).sub.3 (GGGGS).sub.3 MGWSCIILFLVATATGVHS CHO Shalaby et al.,
J Exp Med 1992 no. 18 (GGGGS).sub.3 (GGGGS).sub.3
MNSGLQLVFFVLTLKGIQG CHO Beverley et al., Eur J Immunol 1981 no. 19
(GGGGS).sub.3 (GGGGS).sub.3 MNFGLSLIFLALILKGVQC CHO Van Lier et
al., Immunology 1989 no. 20 (GGGGS).sub.3 (GGGGS).sub.3
MEWSWIFLFLLSVTTGVHS CHO Lanzavecchia & Scheidegger, Eur J
Immunol 1987 18PHU5 (GGGGS).sub.3 VE(GGSGGS).sub.2
MGWSCIILFLVATATGVHS HS Lanzavecchia & Scheidegger, Eur GGVD J
Immunol 1987 18PHU3 VE(GGSGGS).sub.2 (GGGGS).sub.3
MGWSCIILFLVATATGVHS HS Lanzavecchia & Scheidegger, Eur GGVD J
Immunol 1987 18PMU5 (GGGGS).sub.3 VE(GGSGGS).sub.2
MGWSCIILFLVATATGVHS MM Leo et al., Proc Natl Acad Sci, GGVD 1987
18PMU3 VE(GGSGGS).sub.2 (GGGGS).sub.3 MNSGLQLVFFVLTLKGIQG MM Leo et
al., Proc Natl Acad Sci, GGVD 1987 no. 35 (GGGGS).sub.3
(GGGGS).sub.3 MGWLWNLLFLMAAAQSAQA CHO Lanzavecchia &
Scheidegger, Eur J Immunol 1987 CHO indicates Chinese Hamster
Ovary; HS, Homo sapiens; mAB, monoclonal antibody; MM, Mus
musculus; TAA, tumor associated antigen.
[0402] b. Generation of Stable Producer Cell Lines
[0403] To generate stable producer cell clones of CLDN18.2 specific
bi-scFv proteins the human embryonic kidney cell line HEK293 (ATCC
CRL-1573) and the Chinese Hamster Ovary cell line CHO-K1 (ATCC
CCL-61) were used.
[0404] HEK293 Transfection
[0405] 1.times.10.sup.7 HEK293 cells were plated two days prior to
transfection on 14.5 cm tissue culture dishes in 20 ml complete
DMEM medium (DMEM/F-12 GlutaMax supplemented with 10% heat
inactivated FBS and 0.5% penicillin-streptomycin; all reagents from
Gibco/Life Technologies GmbH, Darmstadt, Germany). Before
transfection, cells were washed with DPBS supplemented with 2 mM
EDTA, then 20 ml of plain DMEM medium without FBS or antibiotics
were added. 20 .mu.g of linearized DNA of the constructs described
under Example 1.a were diluted in 0.5 ml plain DMEM/F-12 medium. 75
.mu.l of 1 mg/ml linear PEI solution (Polyethylenimine;
Polysciences Europe GmbH, Eppelheim, Germany) were added to the
diluted DNA and rigorously vortexed. After 15 min incubation at RT,
the DNA/PEI complexes were added dropwise to the cells, cell
culture dishes were gently rotated and then incubated at 37.degree.
C., 5% CO.sub.2. 24 h after transfection the medium was changed.
Selection of transfected cells started 48 h after transfection with
G418 sulfate (Gibco/Life Technologies GmbH, Darmstadt, Germany) in
a final concentration of 0.8 mg/ml. G418 was added permanently to
the culture medium for cell culturing.
[0406] CHO-K1 Transfection
[0407] 1.times.10.sup.6 CHO-K1 cells were plated one day prior to
transfection on 6-well tissue culture plates in 2 ml complete DMEM
medium (DMEM/F-12 GlutaMax supplemented with 10% heat inactivated
FBS, without antibiotics; all reagents from Gibco/Life Technologies
GmbH, Darmstadt, Germany). Before transfection, cells were washed
with DPBS supplemented with 2 mM EDTA, then 1.5 ml of plain DMEM
medium without FCS or antibiotics were added. 4 .mu.g of linearized
DNA of the constructs described under Example 1.a were diluted in
0.25 ml plain DMEM/F-12 medium and mixed gently. In a second
reaction tube, 2.5 .mu.l Lipofectamine 2000 (Invitrogen/Life
Technologies GmbH, Darmstadt, Germany) were diluted in 0.25 ml
plain DMEM/F12 medium, mixed gently and incubated for 5 min at RT.
DNA mix and Lipofectamine mix were combined in a 1:1 ratio, mixed
gently and incubated for 20 min at RT. The DNA/Lipofectamine 2000
complexes were added dropwise to the cells, cell culture dishes
were gently rotated and then incubated at 37.degree. C., 5%
CO.sub.2. 6 h after transfection the medium was changed to complete
DMEM/F-12 medium. Cells were splitted the following day in a 1:10
ratio. Selection of transfected cells started 48 h after
transfection with G418 sulfate (Gibco/Life Technologies GmbH,
Darmstadt, Germany) in a final concentration of 0.5 mg/ml. G418 was
added permanently to the culture medium for cell culturing.
[0408] c. Selection of HEK293 as Producer Cells
[0409] Expression of bi-scFv proteins by stably transfected HEK293
and CHO-K1 cell lines described under Example 1.b was characterized
by immunofluorescence staining to detect bi-scFv expression
according to standard procedures (Current Protocols in Immunology,
2012). Briefly, 2.times.10.sup.5 cells were grown on glass slides
for 24 h and then permealized with 2% PFA. DPBS supplemented with
5% BSA and 0.2% Saponin was used as blocking buffer. After washing
with DPBS and blocking with blocking buffer, cells were incubated
with primary antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg,
Germany) diluted 1:500 in blocking buffer for 30 min at RT. After
washing with blocking buffer, secondary Cy3-conjugated
goat-anti-mouse IgG (H+L) antibody (Jackson ImmunoResearch Europe,
Suffolk, England) diluted 1:500 in blocking buffer was added and
incubated for 3 h at RT. After washing with blocking buffer and
H.sub.2O, cells were embedded in DAKO-mounting medium (Dako,
Carpinteria, Calif., USA) supplemented with Hoechst 33342 dye
(Pierce/Thermo Fisher Scientific, Rockford, Ill., USA). Slides were
investigated and photographed with a Nikon-Eclipse Ti fluorescence
microscope for the presence of bi-scFv positive cells (data not
shown). HEK293 cells showed an overall better expression of bi-scFv
proteins than CHO-K1 cells and were therefore chosen as producer
cell line.
[0410] d Production and Detection of Bi-scFv Protein 1BiMAB with
HEK293 Clone #28
[0411] Bi-scFv 1BiMAB was chosen as first bi-scFv protein to be
produced, purified and used for the establishment of various
assays. For this purpose, clonal cell lines of HEK293 bulk cells
stably expressing 1BiMAB (see Example 1.b) were produced by single
cell sorting using a FACSAria cell sorter (BD Biosciences,
Heidelberg, Germany). After expansion of nearly 40 clonal lines,
the best producer clone was selected by immunofluorescence as
described under Example 1.c. Selected producer clone #28 was
expanded and cultured in a 10-layer Cell Factory (Nunc, Roskilde,
Denmark) in DMEM/F-12 GlutaMax supplemented with 10% FBS, 0.5%
penicillin-streptomycin and 0.8 mg/ml G418 (all reagents from
Gibco/Life Technologies GmbH, Darmstadt, Germany) according to the
manufacturer's guidelines. At confluent stage, cells were washed
with DPBS and medium was changed to DMEM/F-12 medium with
antibiotics but without FBS. Cell supernatant containing bi-scFv
protein 1BiMAB was harvested every 3-5 days for up to 4 weeks.
Supernatant was filtered with 500 ml Steritop Filter Units (Merck
Millipore, Billerica, Mass., USA) and stored at 4.degree. C. until
FPLC-purification.
[0412] Before FPLC-purification, presence of bi-scFv in the cell
culture supernatant was tested by polyacrylamid gel electrophoresis
followed by coomassie staining and western blot analysis performed
by standard (Current Protocols in Protein Science, 2012). The
supernatant was concentrated 5.times.-10.times. by Centricon
Centrifugal Filter Devices -10 K MWCO (Merck Millipore, Billerica,
Mass., USA) according to the manufacturer's protocol. Concentrated
and non-concentrated supernatants were separated on NuPAGE Novex
4-12% Bis-Tris Gels (Invitrogen/Life Technologies GmbH, Darmstadt,
Germany). Subsequently, the gels were stained with Coomassie
Brilliant Blue solution according to standard procedures to detect
bi-scFv protein 1BiMAB between 50 and 60 kD and other proteins
contained in the cell culture supernatant. Western blot analysis
was performed to specifically detect bi-scFc protein 1BiMAB via its
6.times.His-tag. Briefly, after blotting proteins on PVDF membrane
and blocking with PBST/3% milk powder, the membrane was incubated
for 1 h at 4.degree. C. with primary antibody Anti-HIS Epitope-Tag
(Dianova GmbH, Hamburg, Germany) diluted 1:500 in blocking buffer.
After washing with blocking buffer, membranes were incubated with
Fc-specific secondary peroxidase-conjugated goat-anti-mouse IgG
antibody (Sigma Aldrich, Germany) diluted 1:10000 in blocking
buffer for 1 h at 4.degree. C. After washing with blocking buffer,
the signals were visualized by SuperSignal West Femto
Chemiluminescent Substrate (Pierce/Thermo Fisher Scientific,
Rockford, Ill., USA) and recorded by an ImageQuant LAS 4000 Imager
(GE Healthcare Life Sciences, Munich, Germany). Signals of bi-scFv
were detected between 50 and 60 kD as compared to the internal
molecular weight standard (see FIGS. 3A and B).
[0413] e. Purification and Quantification of Bi-scFv Protein
1BiMAB
[0414] Cell culture supernatant of HEK293 clone #28 containing
bi-scFv protein 1BiMAB (described under Example 1.d) was subjected
to immobilized metal affinity chromatography (IMAC) using standard
procedures (Current Protocols in Protein Science, 2012). Briefly,
filtered cell culture supernatant was loaded onto a His Trap FF 5
ml column connected to an AKTA Purifier 10 FPLC system (both GE
Healthcare Life Sciences, Munich, Germany). PBS washing buffer
contained 10 mM imidazol, PBS elution buffer contained 500 mM NaCl,
50 mM NaH.sub.2PO.sub.4 and 250 mM imidazol, pH of both buffers was
adjusted to 7.4. Elution was performed by a stepwise gradient.
Eluted bi-scFv protein 1BiMAB was immediately dialyzed against
1.times.PBS using a Slide-A-Lyzer G2 Dialysis Cassette 10K MWCO
(Pierce/Thermo Fisher Scientific, Rockford, Ill., USA). After
dialysis against 1.times.PBS, bi-scFv was dialyzed against an
H.sub.2O based 200 mM arginine buffer (L-Arginin-monohydrochloride;
Roth, Karlsruhe, Germany).
[0415] Bi-scFv concentration was determined by measurement at 280
nm with a NanoDrop 2000c under consideration of the extinction
coefficient and the molecular weight of bi-scFv protein 1BiMAB
determined via the ProtParam tool
(http://web.expasy.org/protparam/). Purified protein was aliquoted
and stored at -80.degree. C. for long time storage or kept at
4.degree. C. for immediate use.
[0416] Quality and purity of bi-scFv protein 1BiMAB was tested by
Coomassie staining and western blot analysis as described under
Example 1.d (see also FIGS. 3A and B). A BSA standard dilution was
included in the Coomassie procedure to roughly confirm the
concentration measured by NanoDrop (data not shown).
[0417] f. Establishment of an ELISA Assay
[0418] For the quantification of 1BiMAB in cell culture supernatant
of HEK293 cells, a specific ELISA assay had to be established. For
this purpose, supernatant from Example 1.d and purified bi-scFv
protein 1BiMAB described under Example 1.e was used. BSA
pre-blocked Ni-NTA plates (Thermo Fisher Scientific, Rockford,
Ill., USA) were used to immobilize bi-scFv protein 1BiMAB via its
6.times.His-tag. All washing steps were conducted three times with
200 .mu.l 1.times.PBS/0.05% Tween (washing buffer) per well and all
steps were executed at room temperature. As standard, purified
1BiMAB protein was used, diluted in 1.times.PBS within the range of
10-500 ng/ml. Supernatants were diluted 1:10 in 1.times.PBS. 100
.mu.l of diluted protein or supernatant were transferred to each
well and incubated for one hour while shaking. After washing, an
anti-idiotypic antibody against the V.sub.H-V.sub.L domains of
mCLDN18.2ab was diluted to a final concentration of 0.5 .mu.g/ml in
1.times.PBS/3% BSA. 100 .mu.l of the anti-mCLDN18.2ab solution were
added per well and incubated for one hour while shaking. After
washing, an AP-conjugated anti-mouse-Fc antibody (Jackson
ImmunoResearch Europe, Suffolk, England) was diluted to a final
concentration of 300 ng/ml in 1.times.PBS/3% BSA. 100 .mu.l of this
secondary antibody solution were added per well and incubated for
an additional hour while shaking. As negative controls, secondary
antibody only, 1BiMAB plus secondary antibody, and anti-mCLDN18.2ab
plus secondary antibody were used. In addition, HEK293 cell
supernatant without bi-scFv protein was included in the assay.
Finally, 50 .mu.l AP substrate solution (1.5 mg pNPP per ml
substrate buffer, AppliChem GmbH, Darmstadt, Germany) were added
per well after washing. After 5, 15, and 30 min incubation in the
dark absorption at 405 nm with an excitation wavelength of 492 nm
was measured with an Infinite M200 Tecan microplate-reader (Tecan,
Mannedorf, Switzerland). Concentration of bi-scFv protein from
supernatant was determined by calculation against the standard row
(data not shown).
[0419] g. Transient Transfection of CLDN18.2-Specific Bi-scFv
Proteins for Comparison Studies
[0420] To transiently generate preferably high amounts of CLDN18.2
specific bi-scFv proteins the human embryonic kidney cell line
HEK293T (ATCC CRL-11268) was used for transfection.
1.times.10.sup.7 HEK293T cells were plated two days prior to
transfection on 14.5 cm tissue culture dishes in 20 ml complete
DMEM medium (DMEM/F-12 GlutaMax supplemented with 10% heat
inactivated FBS and 0.5% penicillin-streptomycin; all reagents from
Gibco/Life Technologies GmbH, Darmstadt, Germany). Before
transfection, cells were washed with DPBS supplemented with 2 mM
EDTA, then 20 ml of plain DMEM medium without FBS or antibiotics
were added. 20 .mu.g of the circular DNA constructs 1BiMAB,
no.11-20, and no.35 (described under Example 1.b) were diluted in
0.5 ml plain DMEM/F-12 medium. 75 .mu.l of 1 mg/ml linear PEI
solution (Polyethylenimine; Polysciences Europe GmbH, Eppelheim,
Germany) were added to the diluted DNA and rigorously vortexed.
After 15 min incubation at RT, the DNA/PEI complexes were added
dropwise to the cells, cell culture dishes were gently rotated and
then incubated at 37.degree. C., 5% CO.sub.2 for 24h. After a
medium change with plain DMEM/F-12 cells were incubated for another
48 h at 33.degree. C., 5% CO.sub.2. Cell supernatant was harvested
after incubation and sterile filtered with 0.2 .mu.m Minisart
syringe filters (Sigma-Aldrich, Germany). Subsequently, bi-scFv
proteins were small-scale purified from cell culture supernatants
by Ni-NTA spin columns according to the manufacturer's protocol
(Qiagen, Hilden, Gemany). Bi-scFv protein concentrations were
estimated by an ELISA as described under Example 1.f and verified
by western blot analysis as described under Example 1.e (data not
shown). Purified proteins were stored at 4.degree. C. for immediate
use.
Example 2: Establishment of Functional Assays to Monitor Specific T
Cell Activation and Target Cell Lysis by Redirected T Cells
Mediated by Bi-scFv Proteins
[0421] FPLC-purified bi-scFv protein 1BiMAB was used to establish
in vitro assays to monitor the capability of bi-scFv proteins to
specifically redirect human effector cells to TAA-positive target
cells. The aim was to visualize the effects and to quantify the
activation of human T cells and the specific target cell lysis.
[0422] a. Microscopic Analysis of T Cells Redirected to Target
Cells by Bi-scFv Protein
[0423] For the visualization of bi-scFv protein functionality, an
assay to show the redirection of effector cells to
CLDN18.2-expressing target cells by bi-scFv proteins via microscope
had to be established. For this purpose, the gastric carcinoma cell
line NugC4 that endogenously expresses relatively high levels of
human CLDN18.2 (Sahin U. et al., Clin Cancer Res. 2008 Dec. 1;
14(23):7624-34) was used as target cell line.
[0424] Human effector cells were freshly isolated from human blood
from healthy donors according to standard procedures (Current
Protocols in Immunology, 2012): briefly, blood was diluted with
DPBS, layered on Ficoll-Paque Plus (GE Healthcare Life Sciences,
Munich, Germany) and centrifuged. Peripheral blood mononuclear
cells (PBMCs) were collected from the interphase, washed with cold
DPBS supplemented with 2 mM EDTA and counted. Human T cells were
subsequently separated by magnetic-activated cell separation (MACS)
from PBMCs by Pan T Cell Isolation Kit II (Miltenyi Biotec,
Teterow, Germany) according to the manufacturer's guidelines.
[0425] 1.times.10.sup.5 NugC4 cells were seeded per well into
tissue culture 6-well plates. Human cells were prepared as
described above and added in an effector to target (E:T) ratio of
5:1. RPMI 1640 medium supplemented with 5% heat inactivated human
AB serum, 0.5% penicillin-streptomycin, 1.times.NEAA and 1 mM
sodium pyruvate (Gibco/Life Technologies GmbH, Darmstadt, Germany)
was used for all cells and the final volume per well was adjusted
to 2 ml per well. Control samples comprised target or T cells alone
with and without bi-scFv protein. Tissue culture plates were
subsequently incubated at 37.degree. C., 5% CO.sub.2. The assay was
continuously observed with a Wilovert S inverted microscope (Hund,
Wetzlar, Germany) from 6 h to 48 h of coincubation. Significant
effects in terms of T cell clustering on target cells, formation of
an immunologic synapse and target cell killing in the presence of
bi-scFv protein 1BiMAB were seen at 24 h. After 48 h viable target
cells could hardly be found. Pictures were taken at 24 h with a
Nikon Eclipse TS100 inverted microscope (Nikon, Japan). See also
FIG. 5.
[0426] This assay was further on included as visibility control in
all cytotox assays in various well formats.
[0427] b. Target-Dependent T Cell Activation by Bi-scFv Protein
1BiMAB
[0428] For the detection of a specific activation of human T cells
by bi-scFv proteins a flow cytometric assay was established. For
the detection of T cell activation, the early activation marker
CD69 and the late activation marker CD25 were selected for staining
by fluorescence-conjugated antibodies. For the detection of human T
cells in the mixture of target and T cells, CD3 on T cells was
stained.
[0429] The assay set-up from above was chosen (Example 2.a).
Briefly, NugC4 target cells were seeded with human T cells in an
E:T ratio of 5:1 in 2 ml complete medium and bi-scFv protein 1BiMAB
was added in a concentration within the range of 0.001-1000 ng/ml.
Control samples contained target or T cells alone with and without
bi-scFv protein 1BiMAB. After 24 h and/or 48 h--depending on the
result of the visibility control--all cells were harvested by
gentle scraping with Cell Scrapers (Sarstedt AG & Co,
Nurmbrecht, Germany) and transferred to 5 ml round bottom tubes (BD
Falcon, Heidelberg, Germany). Cells were centrifuged and washed
with DPBS. For cell staining Mouse Anti-Human CD3-FITC, Mouse
Anti-Human CD69-APC, and Mouse Anti-Human CD25-PE (all antibodies
BD Biosciences, Heidelberg, Germany) were used. Cell pellets were
resuspended in 50 .mu.l FACS-buffer (DPBS supplemented with 5% FBS)
containing the fluorescence-conjugated antibodies. After incubation
for 20 min at 4.degree. C. in the dark, samples were washed with 4
ml DPBS and cell pellets were resuspended in 200 .mu.l FACS buffer
containing propidium iodide (PI) or 7-AAD (both Sigma Aldrich,
Germany) in a final dilution of 1:1000 for the detection of dead
cells. Samples were kept on ice and dark throughout the
measurement. Establishment of the assay was performed with a
FACSCalibur, later measurements were performed with a FACSCanto II
flow cytometer (both BD Biosciences, Heidelberg, Germany). Analysis
was evaluated by FlowJo software (Tree Star, San Carlos, Calif.,
USA).
[0430] As shown in FIGS. 6A and B, no 1BiMAB mediated T cell
activation is detectable in the absence of target cells underlining
the strict target dependency of bi-scFv functionality. A
significant T cell activation in the presence of target cells
occurred with only 0.01 ng/ml 1BiMAB after 24 h. Maximum efficiency
was reached using 100 ng/ml 1BiMAB.
[0431] Besides the study of T cell activation, this assay also
allows the qualitative analysis of bi-scFv mediated effects on
target cell killing by gating on the target cell population and
estimating the percentage of PI- or 7-AAD-positive target cells (no
data shown). All analyses were performed with FlowJo software (Tree
Star, San Carlos, Calif., USA).
[0432] c. Luciferase Cytotox Assay
[0433] To determine subtle differences in the target cell killing
potential of bi-scFv proteins directed against CLDN18.2 and CD3, a
highly sensitive assay had to be developed. The aim was, to
establish an assay with which the target cell killing could be
quantitatively monitored in a high throughput fashion. To achieve
this, a luciferase cytotox assay was chosen. Herewith the
measurement of luciferase-expression by viable target cells allows
to indirectly determine the target cell lysis mediated by cytotoxic
effector cells in the presence of antibody.
[0434] First, NugC4 cells (described above) were transduced with a
lentiviral vector carrying firefly luciferase, an EGFP reporter
gene and an antibiotic selection marker. After antibiotic selection
of transduced cells, EGFP high expressing cells were sorted by a
FACSAria cell sorter (BD Biosciences, Heidelberg, Germany),
analyzed for high luciferase expression and subsequently expanded
for further studies.
[0435] Human effector cells were prepared as described under
Example 2.a. Establishment of the assay was performed within the
range of 1-100 ng/ml of the bi-scFv protein 1BiMAB, whereby a
concentration of 5 ng/ml was found to result in highly efficient
and reproducible effects and was further used as standard
concentration. NugC4 cells stably expressing luciferase (described
above) were used as target cells. 1.times.10.sup.4 target cells
were seeded per well into white flat bottom 96-well plates. Human T
cells (prepared as described under Example 2.a) were added in an
E:T ratio of 5:1. The medium described above (Example 2.a) was used
and the final volume per well was adjusted to 100 .mu.l. Test
samples and control samples were plated at least in triplicates.
Cell culture microplates were incubated for 24 h and 48 h at
37.degree. C., 5% CO.sub.2. For analysis, 50 .mu.l of a water
solution containing 1 mg/ml luciferin (BD Monolight, BD
Biosciences, Heidelberg, Germany) and 50 mM HEPES were added per
well and plates subsequently incubated for 30 min in the dark at
37.degree. C. Luminescence arising from oxidation of luciferin by
luciferase expressing viable cells was measured in a
microplate-reader (Infinite M200, Tecan, Mannedorf, Switzerland).
Percentage of specific target cell lysis was calculated by the
following formula: % specific lysis=[1-(luminescence.sub.test
sample-L.sub.max)/(L.sub.min-L.sub.max)].times.100, whereas "L"
indicates lysis. L.sub.min refers to the minimum lysis in the
absence of bi-scFv and L.sub.max to the maximum lysis (equal to
spontaneous luminescence counts) in the absence of bi-scFv achieved
by addition of Triton X-100 (2% final concentration).
[0436] Potential direct effects of bi-scFv proteins on target cells
independent of effector cells were determined by plating target
cells without human T cells including all controls such as
L.sub.min and L.sub.max.
[0437] This assay was used for further studies to investigate the
specific T cell mediated lysis of target cells. Modifications were
implemented e.g. by varying bi-scFv concentrations, bi-scFv
proteins, E:T ratios, or effector cells (CD8+, CD4+ T cells,
PBMCs).
Example 3: Selection of a CLDN18.2-Specific Bi-scFv Lead
Candidate
[0438] Luciferase Cytotox Assay with Various CLDN18.2-Specific
Bi-scFv Proteins for the Selection of the Most Potent Bi-scFv
Variant
[0439] All 10 CHO-codon optimized constructs (no.11-20) specific
for the TAA CLDN18.2 were tested in comparison to the human codon
optimized bi-scFv protein 1BiMAB in a luciferase cytotox assay with
NugC4 target cells that endogenously express CLDN18.2 and
ectopically express luciferase (see also Example 2.c).
Characteristics of used bi-scFv proteins are specified in Table 2.
Bi-scFv no.35 specific for TAA PLAC1 was used as isotype control
because PLAC1 is not expressed by NugC4 cells. Binding activity to
CD3 on human T cells had been proven in a FACS binding assay (data
not shown). All bi-scFv proteins were generated as described under
Example 1.g and used for a cytotox assay set up as described under
Example 2.c.
[0440] All bi-scFv proteins were used in a final concentration of 5
ng/ml. For the determination of L.sub.min, control bi-scFv protein
no.35 was seeded with target and T cells ninefold, test samples
were plated sixfold. Per time point one plate was prepared for
analysis.
[0441] The specific lysis at each analyzed time point (8 h, 16 h,
24 h) was plotted against the used bi-scFv proteins. Bi-scFv
proteins 1BiMAB (SEQ ID NO: 39) and no.15 (SEQ ID NO: 41)--which
are constructed in the same orientation and contain the same
anti-CD3 sequence (TR66) and differ only in their codon usage on
nucleic acid level and in the linker sequences--proved to be the
most potent antibodies in mediating target cell lysis (see FIG. 2).
Because 1BiMAB and no.15 are equal in their efficiency, the so far
better investigated bi-scFv protein 1BiMAB was selected for all
following assays. Constructs 18PHU3 and 18PHU5 (see Table 1 and 2)
were compared at a later time point to 1BiMAB. Efficiency of 18PHU5
was equivalent to 1BiMAB, 18PHU3 was less potent (data not
shown).
Example 4: Binding Capacity of Bi-scFv Protein 1BiMAB
[0442] Establishment of a FACS-Based Binding Assay
[0443] To assess the binding capacity of the CLDN18.2 and the
CD3-targeting moieties of bi-scFv proteins a flow cytometric assay
was established. CLDN18.2 endogenously expressing NugC4 cells were
used to investigate the anti-CLDN18.2 site and human T cells were
used to investigate the anti-CD3 site.
[0444] For the investigation of the anti-CLDN18.2 binding capacity,
NugC4 cells were trypsinized, washed with complete RPMI 1640 medium
and subsequently with DPBS. All washing steps were conducted by
centrifugation at 1200 rpm for 6 min at 4.degree. C.
2.5.times.10.sup.5 NugC4 cells were transferred to 5 ml round
bottom tubes and incubated with 50 .mu.g/ml FPLC-purified 1BiMAB
protein in FACS-buffer for 30 min at 4.degree. C. Cells were washed
with 2 ml FACS-buffer and subsequently incubated with 3.3 .mu.g/ml
of monoclonal antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg,
Germany) for 30 min at 4.degree. C. After washing with 2 ml
FACS-buffer, the cell pellet was incubated with an APC-conjugated
goat-anti-mouse secondary antibody (Jackson ImmunoResearch Europe,
Suffolk, England) in a 1:200 dilution in FACS-buffer for 20 min at
4.degree. C. in the dark. Cells were washed twice with 2 ml
FACS-buffer and finally resuspended in 150 .mu.l FACS-buffer
supplemented with 1 .mu.g/ml PI (Sigma Aldrich, Germany) to
counterstain dead cells. Another staining with the same procedure
was included using 50 .mu.g/ml 1BiMAB and APC-conjugated
goat-anti-mouse secondary antibody (1:200) but without Anti-HIS
Epitope-Tag antibody. Negative control samples included secondary
goat-anti-mouse APC antibody alone, monoclonal antibody Anti-HIS
Epitope-Tag plus secondary goat-anti-mouse APC antibody. As
positive control 10 .mu.g/ml monoclonal CLDN18.2-specific antibody
mCLDN18.2ab stained with secondary goat-anti-human APC antibody
(Jackson ImmunoResearch Europe, Suffolk, England) and its secondary
antibody only control were implemented.
[0445] Samples were measured with a FACSCalibur flow cytometer (BD
Biosciences, Heidelberg, Germany) and analyzed by FlowJo Software
(Tree Star, San Carlos, Calif., USA). Strong signals were detected
by sequential staining with 1BiMAB, Anti-HIS Epitope-Tag and
goat-anti-mouse APC. Signal intensity was comparable to positive
control mCLDN18.2ab with goat-anti-human APC. A low direct binding
of goat-anti-mouse APC to 1BiMAB was observed in the sample stained
with 1BiMAB and goat-anti-mouse APC without Anti-HIS Epitope-Tag
(see FIG. 4A). For all further FACS-binding assays to investigate
the binding capacity of bi-scFv proteins the sequential staining
protocol with bi-scFv, Anti-HIS Epitope-Tag and goat-anti-mouse APC
was used (see FIGS. 4B, C, and D). To rule out an unspecific
binding of 1BiMAB, target cells that do not express CLDN18.2 as
verified by RT-PCR (data not shown) were subjected to the
FACS-based binding assay. No unspecific binding of 1BiMAB was
detected as shown in FIG. 4D.
[0446] For investigation of the binding capacity of the anti-CD3
arm of bi-scFv protein 1BiMAB, human T cells were used.
1.times.10.sup.6 T cells prepared as described in Example 2.a were
transferred to 5 ml round bottom tubes and incubated with
FPLC-purified 1BiMAB protein within a range of 0.002-2 .mu.g/ml in
FACS-buffer for 30 min at 4.degree. C. Further staining procedure
was as described above. Control samples included secondary
goat-anti-mouse APC antibody alone and monoclonal antibody Anti-HIS
Epitope-Tag plus secondary goat-anti-mouse APC antibody.
Measurement and analysis were performed as described above. A
significant signal was obtained with 2 .mu.g/ml 1BiMAB (see FIG.
4C).
Example 5: Investigation of Highly Specific, Target Dependent T
Cell Activation by Bi-scFv 1BiMAB
[0447] Cancer cell lines that endogenously express high or low
levels of CLDN18.2 and cancer cell lines that do not express
CLDN18.2 were chosen to prove the strict target dependency of
bi-scFv protein 1BiMAB in an in vitro cytotox assay. The chosen
cell lines were of the two predominant carcinoma types that express
CLDN18.2: gastric (NugC4, MKN7, SNU-1) and pancreatic (DanG, KP-4)
carcinoma. Breast carcinoma cell line MCF7 was used as negative
control.
[0448] a. CLDN18.2 RT-PCR of Cancer Cell Lines
[0449] Total RNA was extracted from the carcinoma cell lines
mentioned above by RNEasy Mini Kit procedure according to the
manufacturer's protocol (Quiagen, Hilden, Germany). 5 .mu.g of RNA
were used for cDNA synthesis with SuperScript II Reverse
Transcriptase (Life Technologies GmbH, Darmstadt, Germany).
[0450] RT-PCR analyses was run on an ABI Prism 7300 Real Time PCR
System (Applied Biosystems/Life Technologies GmbH, Darmstadt,
Germany) using Sybr Green dye and the following primers:
TABLE-US-00003 CLDN18.2: for TGGCTCTGTGTCGACACTGTG; rev
GTGTACATGTTAGCTGTGGAC HPRT: for TGACACTGGCAAAACAATGCA; rev
GGTCCTTTTCACCAGCAAGCT
[0451] Delta Ct was calculated by subtraction of the Ct-value of
the housekeeping gene HPRT from the Ct-value of CLDN18.2 (for
results see FIG. 7A).
[0452] b. Exclusive T Cell Activation in the Presence of
CLDN18.2
[0453] A cytotoxic assay was set up as described under Example 2.a.
The carcinoma cell lines examined for CLDN18.2 transcripts under
Example 5.a via quantitative RT-PCR were used as target cells. The
concentration of bi-scFv protein 1BiMAB in this assay was set to 5
ng/ml. Target cells were seeded with human T cells and 1BiMAB in
duplicates to analyze T cell activation. To monitor any potential
alloreactivity of T cells against target cells independently of
bi-scF protein 1BiMAB, target and T cells were seeded without
1BiMAB in duplicates. Cells were continuously sighted through a
microscope to observe T cell clustering and target cell binding. In
the case of the high CLDN18.2-expressing cell line NugC4,
significant effects occurred after 24 h; after 48 h viable target
cells were hardly visible. In the case of the low
CLDN18.2-expressing cell line DanG, first effects were seen after
96 h and significant effects after 120 h. With the CLDN18.2
negative cell lines no effects indicating any T cell activation
could be seen even after 144 h. T cells of all samples were
analyzed after 144 h of coincubation with target cells via flow
cytometry as described under Example 2.a for the early T cell
activation marker CD69 and the late activation marker CD25,
counterstained with CD3 for the T cell population and PI for dead
cells. Intriguingly, up to 100% of the T cells coincubated with
NugC4 and 1BiMAB were CD25 positive but CD69 negative indicating a
longterm activation of T cells when CD69 downregulation already
occurred. Roughly 75% of T cells coincubated with DanG and 1BiMAB
were activated, of which about 40% simultaneously expressed CD25
and CD69 indicating a T cell activation that is still ongoing. T
cells coincubated with the CLDN18.2 negative cell lines did not
show any sign of T cell activation induction: neither CD69 nor CD25
expression was significantly elevated compared to the levels of
samples without 1BiMAB (see also FIG. 7B).
Example 6: Investigation of Bi-scFv Protein 1BiMAB Induced T Cell
Function
[0454] a. Induction of T Cell Proliferation
[0455] T cell proliferation is an indicator of T cell activation.
To show T cell proliferation in response to bi-scFv protein 1BiMAB
in the presence of CLDN18.2 positive target cells, a flow
cytometric assay was used. Briefly, 1.times.10.sup.6 human T cells
isolated as described under Example 2.a were stained in the dark at
37.degree. C. for 10 min with 0.5 .mu.M carboxyfluorescein
diacetate succinimidyl ester (CellTrace CFSE, Invitrogen/Life
Technologies GmbH, Germany) dissolved in DPBS. Staining was stopped
by addition of 5 volumes of cold complete RPMI 1640 medium. Cells
were kept on ice for 5 min and washed 3 times with complete RPMI
medium (5% heat inactivated human AB serum, 0.5%
penicillin-streptomycin, lx NEAA and 1 mM sodium pyruvate) and were
subsequently resuspended to 1.times.10.sup.5 cells per ml. A
cytotox assay as described under Example 2.b was set up with
CLDN18.2 endogenously expressing NugC4 cells and human T cells as
effector cells. 50 U IL-2 per ml medium were added to the cells.
Samples included T cells alone, T cells with 1 ng/ml 1BiMAB, T
cells and NugC4 cells, and T cells with 1 ng/ml 1BiMAB and NugC4
cells. After 120 h of coincubation, the T cells were harvested,
collected in 5 ml round bottom tubes, washed and stained with a
1:1000 7-AAD DPBS solution to counterstain dead cells for 15 min at
4.degree. C. After washing with DPBS, cells were resuspended in
FACS-buffer and analyzed with a FACSCanto II (BD Biosciences,
Heidelberg, Germany).
[0456] Proliferation of T cells was detected by decreasing
CFSE-signal only in the presence of target cells and bi-scFv
protein 1BiMAB (see also FIG. 8A).
[0457] b. Induction of Serine Protease Granzyme B
[0458] To demonstrate the upregulation of proteolytic molecules
after T cell activation mediated by bi-scFv protein 1BiMAB in the
presence of CLDN18.2 positive target cells, the detection of serine
protease Granzyme B via flow cytometric analysis was elected. A
cytotox assay as described under Example 2.b was set up with
CLDN18.2 endogenously expressing NugC4 cells and human T cells as
effector cells. Samples included T cells alone, T cells with 5
ng/ml 1BiMAB, T cells and NugC4 cells, and T cells with 5 ng/ml
1BiMAB and NugC4 cells. After 96h of coincubation, the T cells were
harvested, collected in 5 ml round bottom tubes, washed and stained
with a 1:1000 7-AAD DPBS solution to counterstain dead cells for 15
min at 4.degree. C. After washing with DPBS, cells were fixed with
100 .mu.l Cytoperm/Cytofix solution for 20 min at RT. Cells were
washed with 1.times. Perm/Wash and subsequently stained with
PE-conjugated Mouse Anti-Human Granzyme B antibody for 20 min at
RT. After washing, cells were resuspended in FACS-buffer and
analyzed with a FACSCanto II (all reagents and FACS machine BD
Biosciences, Heidelberg, Germany).
[0459] Granzyme B upregulation in T cells was detected only in the
presence of target cells and bi-scFv protein 1BiMAB (see also FIG.
8B).
Example 7: Determination of EC50 of Bi-scFv Protein 1BiMAB in an In
Vitro Cytotox Assay
[0460] Luciferase Cytotox Assay
[0461] For the determination of the half maximal effective dose of
bi-scFv protein 1BiMAB, a titration row of 1BiMAB was tested in an
in vitro luciferase cytotox assay, mainly as described under
Example 2.c.
[0462] Stably luciferase-expressing NugC4 cells described under
Example 2.c were incubated with human T cells and bi-scFv protein
1BiMAB concentrations within the range of 1 .mu.g/ml to 1 .mu.g/ml
(in steps of 10) or without 1BiMAB to determine the L.sub.min
values. Luminescence of viable cells was measured with an Infinite
M200 Tecan plate reader 24 h and 48 h after assay set up. Specific
target cell lysis was calculated by the formula exemplified under
Example 2.c. Maximum lysis was reached after 48 h with 1-10 ng/ml
1BiMAB. The determined EC50 after 48 h in this assay is
approximately 10 .mu.g/ml (see also FIG. 9). Outcome of this assay
strongly depends on the potency of the human T cells which varies
according to the immune status of the donor as also reported by
others (e.g. Lutterbuese, R et al., Proc. Natl. Acad. Sci. USA.
2010 Jul. 13; 107(28):12605-10). In addition to that, the used
target cell line NugC4 shows varying expression of CLDN18.2 also
influencing the outcome. Thus, an EC50 value variation of bi-scFv
protein 1BiMAB in a range within 10-300 .mu.g/ml has been observed
during the course of this invention.
Example 8: Efficacy in a Mouse Xenograft Model
[0463] To investigate the therapeutic potential of bi-scFv protein
1BiMAB in vivo, the mouse strain NOD.Cg-Prkd.sup.scid
IL2rg.sup.tm1Wj1/SzJ or short NSG (Jackson laboratory, Bar Harbour,
Me., USA) was chosen. For the described study the engraftment of
human effector cells and human T lymphocytes in mice is
indispensable to study the effects of T cell engaging bi-scFv in
vivo. Because of the complete lack of B-, T- and NK cells the mouse
strain NSG is suitable for this kind of xenograft studies. A mouse
model with mainly engrafted human T cells after PBMC injection was
established as part of the invention.
[0464] a. Late Onset Treatment of Advanced Highly CLDN18.2
Expressing Tumors in Mice with Bi-scFv Protein 1BiMAB
[0465] In the exemplified study, 40 female NSG mice at the age of 8
weeks were subcutaneously inoculated with 1.times.10.sup.7 HEK293
cells stably expressing high levels of human CLDN18.2
(HEK293-CLDN18.2). 5 days after tumor cell inoculation mice were
stratified according to their tumor volume into treatment groups,
mice without tumor growth were excluded. At the same day peripheral
blood mononuclear cells (PBMCs) were isolated from human blood of
healthy donors by Ficoll density gradient technique as described
under Example 2.a and used as effector cells in vivo.
2.times.10.sup.7 PBMCs diluted in 300 .mu.l DPBS were injected
intraperitoneally at the day of isolation to the experimental
treatment groups designated with "PBMC". With "PBS" designated
treatment groups received 300 .mu.l plain DPBS intraperitoneally
instead and served as control without human effector cells. With
the "PBS" control groups the investigation of a potential effect on
tumor growth by 1BiMAB itself or any potential side effects which
are caused by 1BiMAB or vehicle and not by human effector cells
against mouse tissue (i.e. graft-versus-host reaction exerted by
human effector cells against murine tissue) could be examined.
Group "PBS/vehicle" comprised 4 mice (n=4), "PBS/1BiMAB" 5 mice
(n=5), "PBMC/vehicle" 13 mice (n=13) and "PBMC/1BiMAB" 15 mice
(n=15). The therapy was started 1 day after DPBS or PBMC
application: groups "PBS/1BiMAB" and "PBMC/1BiMAB" received
intraperitoneally 5 .mu.g purified bi-scFv protein 1BiMAB diluted
in 200 .mu.l of DPBS per animal. Groups "PBS/vehicle" and
"PBMC/vehicle" received intraperitoneally 200 .mu.l of vehicle
buffer (200 mM L-Arginin-monohydrochloride dissolved in H.sub.2O,
sterile filtered) diluted in DPBS. Treatment groups are summarized
in Table 3. Therapy was conducted on a daily basis for 22 days.
Twice per week tumor dimensions were measured with a digital
calibrated caliper and the tumor volume calculated according to the
formula mm.sup.3=length.times.width.times.(width/2). FIGS. 10A and
B exemplify the inhibition of tumor growth and the elimination of
tumor burden in half of the mice of the "PBMC/1BiMAB" group only by
the antibody in the presence of human effector cells. Mice were
sacrificed by cervical dislocation when the tumor volume exceeded
500 mm.sup.3 or in case of severe morbidity (graft-versus-host
symptoms were observed in some mice).
TABLE-US-00004 TABLE 3 Treatment groups Treatment # of Effector
Bi-scFv .mu.g bi-scFv group (G) mice (n) cells protein
protein/mouse G1 4 -- -- -- G2 5 -- 1BiMAB 5 G3 13 PBMC -- -- G4 15
PBMC 1BiMAB 5
[0466] b. Determination of Therapy Influence on Body Weight
[0467] The body weight of each mouse was examined twice per week
using a laboratory scale. No mouse in any group showed weight loss
over the time of treatment (data not shown). Some mice in both
"PBMC" groups showed symptoms of a graft-versus-host reaction 4
weeks after PBMC injection and several days after the end of
treatment. Effects by 1BiMAB itself on body weight or any other
side effects concerning the health of the mice were not
observed.
[0468] c. Tissue Conservation and Splenocyte Isolation
[0469] After killing of mice, tumors were dissected and the tissue
was immediately fixed in 10 ml Roti-Histofix 4% (Carl Roth,
Karlsruhe, Germany) for immunohistochemical analysis. Moreover,
spleens were dissected to detect the engraftment of human cells by
flow cytometric analysis. Splenocyte isolation was performed
immediately after spleen dissection by mashing the spleens through
a 70 .mu.m cell strainer placed into a 50 ml reaction tube with a
sterile plunger of a 3-5 ml syringe and repeated flushing of the
cell strainer with warm DPBS. Isolated splenocytes were
centrifuged, DPBS decanted and the splenocyte pellets resuspended
in 1 ml heat inactivated fetal bovine serum supplemented with 10%
DMSO. Samples were immediately frozen at -80.degree. C. and stored
until splenocyte samples from all mice were complete.
[0470] d Analysis of Engraftment of Human T Lymphocytes in Mouse
Spleens
[0471] Splenocytes from all mice were collected and frozen as
described under Example 8.c The complete collection of splenocyte
samples was thawed at one time, all cells were washed twice with
warm DPBS and 1.times.10.sup.6 splenocytes per sample were
incubated with fluorescence-conjugated antibodies for 20 min at
4.degree. C. in the dark to detect the engraftment of human cells
by anti-CD45 staining and the percentage of human T cells by
anti-CD3, anti-CD4, and anti-CD8 staining. Flow cytometric analysis
was conducted with a FACSCalibur (BD Biosciences, Heidelberg,
Germany). Human T cell engraftment in both "PBMC" groups could be
confirmed by high percentage of CD45-CD3 double positive
splenocytes as shown in FIG. 10D.
Example 9: Generation and Testing of Bispecific Binding Agents
Targeting CLDN6 and CD3 a. Sequence Origin, Design of Bi-scFv
Constructs, and Cloning into Expression Vectors
[0472] The bispecific tandem single chain antibody constructs
(bi-scFv) contained binding domains specific for the human T cell
receptor component CD3 and human tumor associated antigens (TAA).
The corresponding variable heavy chain regions (V.sub.H) and the
corresponding variable light chain regions (VL) are for each
construct specifically arranged from N- to C-terminus in
consecutive order:
N-V.sub.H.sup..alpha.CLDN6-V.sub.L.sup..alpha.CLDN6-V.sub.H.sup..alpha.CD-
3-V.sub.L.sup..alpha.CD3-C (6PHU5; SEQ ID NO: 43)
N-V.sub.H.sup..alpha.CD3-V.sub.L.sup..alpha.CD3-V.sub.H.sup..alpha.CLDN6--
V.sub.L.sup..alpha.CLDN6-C (6PHU3; SEQ ID NO: 45)
[0473] Table 4 summarizes all bi-scFv constructs specific for the
TAA CLDN6 that were generated in the course of the invention. The
CLDN18.2 specific bi-scFv construct 1BiMAB was used as control
antibody. The bi-scFv constructs were generated by gene synthesis
by GeneArt AG (GeneArt/Life Technologies GmbH, Regensburg, Germany)
using the V.sub.H and V.sub.L sequences of the corresponding
antibodies. Codon optimizations such as Homo sapiens (HS) or Mus
musculus (MM) were implemented by GeneArt's GeneOptimizer.RTM.
software, and are listed in Table 5. Information on specificity,
sequence origin from monoclonal antibodies (mAB), codon usage,
additional sequence features and references of all applied domains
are summarized in Table 5. Variable domain sequence origin of the
respective CD3 antibodies are listed in Table 5. Due to the high
homology of human and mouse TAAs, the same anti-TAA V.sub.H and
V.sub.L sequences could be used for the generation of bi-scFv
constructs for mouse assays, but in combination with the V.sub.H,
V.sub.L sequences of the mouse specific anti-CD3 antibody clone
145-2C11.
[0474] DNA cloning and expression vector construction was carried
out according to standard procedures (Sambrook, 1989) well known by
the skilled person. Briefly, the bi-scFv DNA sequences were
provided with a 5' HindIII and a 3' BamHI restriction for cloning
into expression plasmids. A secretion signal sequence was
introduced at the 5' end upstream of the bi-scFv sequence for
protein secretion from cellular cytoplasm into the culture medium.
A sequence coding for a 15 to 18 amino acid flexible glycine-serine
peptide linker was inserted to join the V.sub.H and V.sub.L domains
for the composition of the single chain variable antibody fragments
(scFv) of which one binds to CD3 and the other to the TAA. To form
a bispecific single chain antibody, the two scFv domain sequences
were connected by a sequence coding for a short peptide linker
(GGGGS). Together with this linker sequence a BamHI restriction
site was introduced for scFv domain exchanges for the cloning of
upcoming bi-scFV constructs. In-depth, 5'scFv-domains could be
exchanged by HindIII and BamHI restriction and 3'scFv-domains by
BamHI and XhoI restriction.
[0475] All used bi-scFv antibody constructs were cloned into the
standard mammalian expression vector pcDNA.TM.3.1/myc-His (+)
(Invitrogen/Life Technologies GmbH, Darmstadt, Germany). The
C-terminal 6.times.His-tag served for metal affinity purification
of the protein and for detection analysis. All constructs were
verified by sequencing via MWG's single read sequence service
(Eurofins MWG Operon, Ebersberg, Germany). For construct schemata
see also FIG. 11.
TABLE-US-00005 TABLE 4 Summary of TAA and CD3 specific bispecific
single chain antibody constructs Internal name TAA Specificity
5'-V.sub.H-V.sub.L 3'-V.sub.H-V.sub.L Codon usage 1BiMAB CLDN18.2
human mCLDN18.2ab TR66 HS 6PHU5 CLDN6 human mCLDN6ab TR66 HS 6PHU3
CLDN6 human TR66 mCLDN6ab HS 6PMU5 CLDN6 murine mCLDN6ab 145-2C11
MM 6PMU3 CLDN6 murine 145-2C11 mCLDN6ab MM HS, Homo sapiens; MM,
Mus musculus; TAA, tumor associated antigen.
TABLE-US-00006 TABLE 5 Summary of bi-scFv construct information CD3
binding moiety TAA binding moiety Internal mAB Species mAB Species
Short name origin reactivity TAA origin reactivity
5'-V.sub.H-V.sub.L 3'-V.sub.H-V.sub.L linker 1BiMAB TR66 human
CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab TR66 GGGGS murine 6PHU5
TR66 human CLDN6 mCLDN6ab human, mCLDN6ab TR66 SGGGGS murine 6PHU3
TR66 human CLDN6 mCLDN6ab human, TR66 mCLDN6ab SGGGGS murine 6PMU5
145-2C11 murine CLDN6 mCLDN6ab human, mCLDN6ab 145-2C11 SGGGGS
murine 6PMU3 145-2C11 murine CLDN6 mCLDN6ab human, 145-2C11
mCLDN6ab SGGGGS murine Anti-CD3 Internal Secretion Codon mAB name
5'-long linker 3'-long linker ssignal usage reference 1BiMAB
(GGGGS).sub.3 VE(GGSGGS).sub.2GGVD MGWSCIILFLVATATGVHS HS
Lanzavecchia & Scheidegger, Eur J Immunol 1987 6PHU5
(GGGGS).sub.3 VE(GGSGGS).sub.2GGVD MGWSCIILFLVATATGVHS HS
Lanzavecchia & Scheidegger, Eur J Immuno1 1987 6PHU3
VE(GGSGGS).sub.2GGVD (GGGGS).sub.3 MGWSCIILFLVATATGVHS HS
Lanzavecchia & Scheidegger, Eur J Immuno1 1987 6PMU5
(GGGGS).sub.3 VE(GGSGGS).sub.2GGVD MGWSCIILFLVATATGVHS MM Leo et
al., Proc Natl Acad Sci, 1987 6PMU3 VE(GGSGGS).sub.2GGVD
(GGGGS).sub.3 MNSGLQLVFFVLTLKGIQG MM Leo et al., Proc Natl Acad
Sci, 1987 HS, Homo sapiens; mAB, monoclonal antibody; MM, Mus
musculus; TAA, tumor associated antigen.
[0476] b. Generation of Stable Producer Cell Lines
[0477] To generate stable producer cell clones of CLDN6 specific
bi-scFv proteins the human embryonic kidney cell line HEK293 (ATCC
CRL-1573) was used. 1.times.10.sup.7 HEK293 cells were plated two
days prior to transfection on 14.5 cm tissue culture dishes in 20
ml complete DMEM medium (DMEM/F-12 GlutaMax supplemented with 10%
heat inactivated FBS and 0.5% penicillin-streptomycin; all reagents
from Gibco/Life Technologies GmbH, Darmstadt, Germany). Before
transfection, cells were washed with DPBS supplemented with 2 mM
EDTA, then 20 ml of plain DMEM medium without FBS or antibiotics
were added. 20 .mu.g of linearized DNA of the constructs
pcDNA3.1/6PHU5 and pcDNA3.1/6PHU3 (described under Example 9.a)
were diluted in 0.5 ml plain DMEM/F-12 medium. 75 .mu.l of 1 mg/ml
linear PEI solution (Polyethylenimine; Polysciences Europe GmbH,
Eppelheim, Germany) were added to the diluted DNA and rigorously
vortexed. After 15 min incubation at RT, the DNA/PEI complexes were
added dropwise to the cells, cell culture dishes were gently
rotated and then incubated at 37.degree. C., 5% CO.sub.2. 24 h
after transfection the medium was changed. Selection of transfected
cells was started 48 h after transfection with G418 sulfate
(Gibco/Life Technologies GmbH GmbH, Darmstadt, Germany) in a final
concentration of 0.8 mg/ml. G418 was added permanently to the
culture medium for cell culturing.
[0478] c. Small-Scale Production of Bi-scFv Proteins 6PHU5 and
6PHU3 with Polyclonal HEK293 Cells
[0479] Bi-scFv proteins 6PHU5 and 6PHU3 were small-scale produced
and purified from polyclonal HEK293 cell supernatants for in vitro
comparison.
[0480] Briefly, at confluent state, supernatant without FBS was
harvested from the polyclonal cell lines described under Example
9.b and filtered with 0.2 .mu.m Minisart syringe filters
(Sigma-Aldrich, Germany). Subsequently, bi-scFv proteins were
small-scale purified from cell culture supernatants by Ni-NTA spin
columns according to the manufacturer's protocol (Qiagen, Hilden,
Germany). Bi-scFv protein concentrations were determined by
measurement at 280 nm with a NanoDrop 2000c under consideration of
the extinction coefficient and molecular weight--determined via the
ProtParam tool (http://web.expasy.org/protparam/)--of bi-scFv
protein 6PHU5 and 6PHU3. Purified proteins were stored at 4.degree.
C. for immediate use.
[0481] Bi-scFv proteins were tested by polyacrylamid gel
electrophoresis followed by coomassie staining and western blot
analysis performed by standard procedures (Current Protocols in
Protein Science, 2012). Small-scale purified proteins were
separated on NuPAGE Novex 4--12% Bis-Tris Gels (Invitrogen/Life
Technologies GmbH, Darmstadt, Germany). Subsequently, the gels were
stained with Coomassie Brilliant Blue solution according to
standard procedures (Current Protocols in Protein Science, 2012) to
detect bi-scFv proteins 6PHU5, 6PHU3, and other proteins contained
in the cell culture supernatant. Western blot analysis was
performed to specifically detect bi-scFv proteins 6PHU5 and 6PHU3
via their 6.times.His-tag. Briefly, after blotting proteins on PVDF
membrane and blocking with PBST/3% milk powder, the membrane was
incubated for 1 h at 4.degree. C. with primary antibody Anti-HIS
Epitope-Tag (Dianova GmbH, Hamburg, Germany) diluted 1:500 in
blocking buffer. After washing with blocking buffer, membranes were
incubated with Fc-specific secondary peroxidase-conjugated
goat-anti-mouse IgG antibody (Sigma Aldrich, Germany) diluted
1:10000 in blocking buffer for 1 h at 4.degree. C. After washing
with blocking buffer again, the signals were visualized by
SuperSignal West Femto Chemiluminescent Substrate (Pierce/Thermo
Fisher Scientific, Rockford, Ill., USA) and recorded by an
ImageQuant LAS 4000 Imager (GE Healthcare Life Sciences, Munich,
Germany). Signals of bi-scFv proteins were detected between 50 and
60 kD as compared to the internal molecular weight standard.
[0482] d Large Scale Production of Bi-scFv Protein 6PHU3 with
Polyclonal HEK293 Cells
[0483] The polyclonal producer cell line was cultured in a 10-layer
Cell Factory (Nunc, Roskilde, Denmark) in DMEM/F-12 GlutaMax
supplemented with 10% FBS, 0.5% penicillin-streptomycin and 0.8
mg/ml G418 (all reagents from Gibco/Life Technologies GmbH,
Darmstadt, Germany) according to the manufacturer's guidelines. At
confluent stage, cells were washed with DPBS and medium was changed
to DMEM/F-12 medium with antibiotics but without FBS. Cell
supernatant containing bi-scFv protein 6PHU3 was harvested every
3-5 days for up to 3 weeks. Supernatant was filtered with 500 ml
Steritop Filter Units (Merck Millipore, Billerica, Mass., USA) and
stored at 4.degree. C. until FPLC-purification.
[0484] Before FPLC-purification, presence of bi-scFv in the cell
culture supernatant was tested by polyacrylamid gel electrophoresis
followed by coomassie staining and western blot analysis performed
by standard procedures as briefly described under Example 9.c.
[0485] e. Purification and Quantification of Bi-scFv Protein
6PHU3
[0486] Cell culture supernatant of polyclonal HEK293 cells
containing bi-scFv protein 6PHU3 (described under Example 9.b) was
subjected to immobilized metal affinity chromatography (IMAC) using
standard procedures (Current Protocols in Protein Science, 2012).
Briefly, cell culture supernatant was loaded onto a His Trap FF 5
ml column connected to an AKTA Purifier 10 FPLC system (both GE
Healthcare Life Sciences, Munich, Germany). PBS washing buffer
contained 10 mM imidazol, PBS elution buffer contained 500 mM NaCl,
50 mM NaH.sub.2PO.sub.4 and 250 mM imidazol, pH of both buffers was
adjusted to 7.4. Elution was performed by a stepwise gradient.
Eluted bi-scFv protein 6PHU3 was immediately dialyzed against
1.times.PBS using a Slide-A-Lyzer G2 Dialysis Cassette 10K MWCO
(Pierce/Thermo Fisher Scientific, Rockford, Ill., USA). After PBS
dialysis, bi-scFv was dialyzed against a 200 mM arginine buffer
(L-Arginin-monohydrochloride; Roth, Karlsruhe, Germany) based on
H.sub.2O.
[0487] Bi-scFv concentration was determined by measurement at 280
nm with a NanoDrop 2000c under consideration of the extinction
coefficient and molecular weight of bi-scFv protein 6PHU3. Purified
protein was aliquoted and stored at -80.degree. C. for long time
storage or kept at 4.degree. C. for immediate use.
[0488] Quality and purity of bi-scFv protein 6PHU3 was tested by
Coomassie staining and western blot analysis as described under
Example 9.c. A BSA standard dilution was included in the Coomassie
procedure to roughly confirm the concentration measured by NanoDrop
(data not shown).
Example 10: Efficiency of CLDN6-Targeting Bi-scFv Candidates 6PHU5
and 6PHU3
[0489] a. Microscopic Analysis of T Cells Redirected to Target
Cells by Bi-scFv Proteins 6PHU5 and 6PHU3
[0490] To visualize the redirection of effector cells to
CLDN6-expressing target cells by bi-scFv proteins via microscopic
analysis, an in vitro cytotox assay was performed. NiNTA
column-purified bi-scFv proteins 6PHU3 and 6PHU5 (see Example 9.c)
were used to compare these two variants according to their
efficiency. As target cell line the ovarian teratocarcinoma cell
line PA-1 that endogenously expresses high levels of human CLDN6
was used.
[0491] Human effector cells were freshly isolated from human blood
from healthy donors according to standard procedures (Current
Protocols in Protein Science, 2012): briefly, blood was diluted
with DPBS, layered on Ficoll-Paque Plus (GE Healthcare Life
Sciences, Munich, Germany) and centrifuged. Peripheral blood
mononuclear cells (PBMCs) were collected from the interphase,
washed with cold DPBS supplemented with 2 mM EDTA and counted.
Human T cells were subsequently separated by magnetic-activated
cell separation (MACS) from PBMCs by Pan T Cell Isolation Kit II
(Miltenyi Biotec, Teterow, Germany) according to the manufacturer's
guidelines.
[0492] 1.times.10.sup.5 PA-1 cells per well were seeded into tissue
culture 6-well plates. Human cells were prepared as described above
and added in an effector to target (E:T) ratio of 5:1. MEM medium
supplemented with 10% heat inactivated FBS, 0.5%
penicillin-streptomycin, 1.times.NEAA, 1 mM sodium bicarbonate and
1 mM sodium pyruvate (Gibco/Life Technologies GmbH, Darmstadt,
Germany) was used for all cells and the final volume per well was
adjusted to 2 ml per well. The used bi-scFv protein concentration
was 50 ng/ml in this assay. Control samples comprised target or T
cells alone without bi-scFv protein. Tissue culture plates were
subsequently incubated at 37.degree. C., 5% CO.sub.2. The assay was
continuously observed with a Wilovert S inverted microscope (Hund,
Wetzlar, Germany) from 6 h to 24 h of coincubation. Significant
effects in terms of T cell clustering on target cells, formation of
an immunologic synapse and target cell killing in the presence of
bi-scFv protein 6PHU5 and 6PHU3 were seen at 24 h and photographed
with a Nikon Eclipse TS100 inverted microscope (Nikon, Japan). Both
bi-scFv proteins lead to strong T cell clustering and target cell
killing as shown in FIG. 12.
[0493] b. T Cell Activation Mediated by Bi-scFv Proteins 6PHU5 and
6PHU3
[0494] For the detection of T cell activation and to define
differences in the efficiency of the two CLDN6-specific bi-scFv
variants, a FACS-based T cell activation assay was used. The early
activation marker CD69 and the late activation marker CD25 were
selected for staining by fluorescence-conjugated antibodies. For
the detection of human T cells in the mixture of target and T
cells, CD3 on T cells was stained.
[0495] In general, the assay set-up from above was chosen (Example
10.a). Briefly, PA-1 target cells endogenously expressing CLDN6
were seeded with human T cells in an E:T ratio of 5:1 in 2 ml
complete medium and bi-scFv proteins 6PHU5 or 6PHU3 were added in a
concentration within the range of 5-200 ng/ml. Control samples
comprised target or T cells alone with and without bi-scFv
proteins. After 24 h and 48 h the T cells were harvested by
flushing and transferred to 5 ml round bottom tubes (BD Falcon,
Heidelberg, Germany). Cells were centrifuged and washed with DPBS.
For cell staining Mouse Anti-Human CD3-FITC, Mouse Anti-Human
CD69-APC, and Mouse Anti-Human CD25-PE (all antibodies BD
Biosciences, Heidelberg, Germany) were used. Cell pellets were
resuspended in 50 .mu.l FACS-buffer (DPBS supplemented with 5% FBS)
containing the fluorescence-conjugated antibodies and and 2 .mu.l
7-AAD (BD Biosciences, Heidelberg, Germany). After incubation for
20 min at 4.degree. C. in the dark, samples were washed with 4 ml
DPBS and cell pellets were resuspended in 200 .mu.l FACS buffer.
Samples were kept on ice and dark throughout the measurement with a
FACSCanto II flow cytometer (both BD Biosciences, Heidelberg,
Germany). Analysis was evaluated by FlowJo software (Tree Star, San
Carlos, Calif., USA).
[0496] Both CDLN6-specific bi-scFv variants resulted in efficient T
cell activation of up to 60%. Variant 6PHU3 (bi-scFv
CD3.times.CLDN6) was more potent in the low concentration range of
5-10 ng/ml (see also FIG. 13) and was therefore chosen for further
studies.
Example 11: Binding Capacity of Bi-scFv 6PHU3
[0497] FACS Binding Assay
[0498] To assess the binding capacity of the CLDN6- and the
CD3-targeting moieties of bi-scFv protein 6PHU3 a flow cytometric
assay was used. CLDN6 endogenously expressing PA-1 and OV-90 cells
were used to investigate the anti-CLDN6 site and human T cells were
used to investigate the anti-CD3 site. CLDN6-negative NugC4 cells
were used as control cells.
[0499] For the investigation of the anti-CLDN6 binding capacity,
CLDN6 positive cells (PA-1, OV-90) and CLDN6 negative cells (NugC4)
were trypsinized, washed with complete medium and subsequently with
DPBS. All washing steps were conducted by centrifugation at 1200
rpm for 6 min at 4.degree. C. 1.times.10.sup.5 cells were
transferred to 5 ml round bottom tubes and incubated with 0.01-10
.mu.g/ml pg/ml FPLC-purified 6PHU3 protein or control bi-scFv
protein 1BiMAB in FACS-buffer for 30 min at 4.degree. C. Cells were
washed with 2 ml FACS-buffer and subsequently incubated with 3.3
.mu.g/ml of monoclonal antibody Anti-HIS Epitope-Tag (Dianova GmbH,
Hamburg, Germany) for 30 min at 4.degree. C. After washing with 2
ml FACS-buffer, the cell pellets were incubated with APC-conjugated
goat-anti-mouse secondary antibody (Jackson ImmunoResearch Europe,
Suffolk, England) in a 1:200 dilution in FACS-buffer for 20 min at
4.degree. C. in the dark. Cells were washed twice with 2 ml
FACS-buffer and finally resuspended in 150 .mu.l FACS-buffer
supplemented with 1 .mu.g/ml PI (Sigma Aldrich, Germany) to
counterstain dead cells. Negative control samples included
secondary goat-anti-mouse APC antibody alone. As positive control
10 .mu.g/ml monoclonal CLDN6-specific antibody mCLDN6ab stained
with secondary goat-anti-human APC antibody (Jackson ImmunoResearch
Europe, Suffolk, England) and the proper secondary antibody only
control were implemented.
[0500] Samples were measured with a FACSCalibur flow cytometer (BD
Biosciences, Heidelberg, Germany) and analyzed by FlowJo Software
(Tree Star, San Carlos, Calif., USA). Signal intensity of 10
.mu.g/ml 6PHU3 was 4-9 times lower than the positive control
mCLDN6ab (see FIG. 15A). Unspecific binding of 6PHU3 to
CLDN6-negative cell line NugC4 was not detected (FIG. 15C).
[0501] For investigation of the binding capacity of the anti-CD3
arm of bi-scFv protein 6PHU3, human T cells were used.
5.times.10.sup.5 T cells were transferred to 5 ml round bottom
tubes and incubated with FPLC-purified 6PHU3 protein within a range
of 100 ng/ml-10 .mu.g/ml in FACS-buffer for 30 min at 4.degree. C.
Further staining procedure was as described above. Control samples
included secondary goat-anti-mouse APC antibody alone and
monoclonal antibody Anti-HIS Epitope-Tag plus secondary
goat-anti-mouse PE antibody. Measurement and analysis were
performed as described above. A significant signal was obtained
with 100 ng/ml 6PHU3 (see also FIG. 15B).
Example 12: Investigation of Target Dependent T Cell Activation by
Bi-scFv 6PHU3
[0502] A cytotox assay as described under Example 10.a and b was
performed. Briefly, PA-1 target cells endogenously expressing CLDN6
were seeded with human T cells in an E:T ratio of 5:1 in 2 ml
complete medium and bi-scFv protein 6PHU3 was added in a
concentration within the range of 0.001-1000 ng/ml. To analyze the
target dependency for bi-scFv mediated T cell activation, T cells
were seeded without target cells but were incubated with the same
bi-scFv 6PHU3 concentrations as the target plus T cell samples.
After 24 h and 48 h the T cells were harvested by flushing and
transferred to 5 ml round bottom tubes (BD Falcon, Heidelberg,
Germany). Cell staining and analysis was conducted as described
under Example 10.b. As shown in FIGS. 16A and B, no 6PHU3 mediated
T cell activation is detectable in the absence of target cells
underlining the strict target dependency of bi-scFv functionality.
A significant T cell activation occurred with only 0.1 ng/ml 6PHU3
after 48 h.
Example 13: Determination of EC50 of Bi-scFv 6PHU3 in an In Vitro
Cytotox Assay
[0503] Luciferase Cytotox Assay
[0504] For the determination of the half maximal effective dose of
bi-scFv protein 6PHU3, a titration row of 6PHU3 was tested in an in
vitro luciferase cytotox assay.
[0505] Stably luciferase-expressing PA-1 cells and human T cells in
an E:T ratio of 5:1 were incubated with bi-scFv protein 6PHU3
concentrations within the range of 1 .mu.g/ml to 1 .mu.g/ml (in
steps of 10) or without 6PHU3 to determine the L.sub.min
values.
[0506] Cell culture microplates were incubated for 24 h and 48 h at
37.degree. C., 5% CO.sub.2. For analysis, 50 .mu.l of a water
solution containing 1 mg/ml luciferin (BD Monolight, BD
Biosciences, Heidelberg, Germany) and 50 mM HEPES were added per
well and plates were subsequently incubated for 30 min in the dark
at 37.degree. C. Luminescence arising from oxidation of luciferin
by luciferase expressing viable cells was measured with an
Inifinite M200 Tecan microplate-reader (Tecan, Mannedorf,
Switzerland). Percentage of specific target cell lysis was
calculated by the following formula: % specific
lysis=[1-(luminescence.sub.test
sample-L.sub.max)/(L.sub.min-L.sub.max)].times.100, whereas "L"
indicates lysis. L.sub.min refers to the minimum lysis in the
absence of bi-scFv and L.sub.max to the maximum lysis (equal to
spontaneous luminescence counts) in the absence of bi-scFv achieved
by addition of Triton X-100 (2% final concentration).
[0507] Maximum lysis was reached after 48 h with 1-10 ng/ml 6PHU3,
the determined EC50 after 48 h is approximately 10 .mu.g/ml (see
also FIG. 17). Outcome of this assay strongly depends on the
potency of the human T cells which varies according to the immune
status of the donor as also reported by others (see e.g.
Lutterbuese, R et al., 2010, Proc. Natl. Acad. Sci USA. 2010 Jul.
13; 107(28):12605-10). Thus, an EC50 value variation of bi-scFv
protein 6PHU3 by the factor of 3 has been observed during the
course of this invention.
Example 14: Efficacy in a Mouse Xenograft Model
[0508] To investigate the therapeutic potential of bi-scFv protein
6PHU3 in vivo, the mouse strain NOD.Cg-Prkd.sup.scid
IL2rg.sup.tm1Wj1/SzJ or short NSG (Jackson laboratory, Bar Harbour,
Me., USA) was chosen. For the described study the engraftment of
human effector cells and human T lymphocytes in mice is
indispensable to study the effects of T cell engaging bi-scFv in
vivo. Because of the complete lack of B-, T- and NK cells the mouse
strain NSG is suitable for this kind of xenograft studies. A mouse
model with mainly engrafted human T cells after PBMC injection was
established as part of the invention.
[0509] a. Late Onset Treatment of Advanced Highly CLDN6 Expressing
Tumors in Mice with Bi-scFv Protein 6PHU3
[0510] In the exemplified study, 25 female and 25 male NSG mice at
the age of 8-11 weeks were subcutaneously inoculated with
1.times.10.sup.7 PA-1 cells endogenously expressing high levels of
human CLDN6. 15 days after tumor cell inoculation mice were
stratified according to their tumor volume into treatment groups,
mice without tumor growth were excluded. At the same day peripheral
blood mononuclear cells (PBMCs) were isolated from human blood of
healthy donors by Ficoll density gradient technique and used as
effector cells in vivo. 2.times.10.sup.7 PBMCs diluted in 200 .mu.l
DPBS were injected intraperitoneally at the day of isolation to the
experimental treatment groups designated with "PBMC". With "PBS"
designated treatment groups received 200 .mu.l plain DPBS
intraperitoneally instead and served as control without human
effector cells. With the "PBS" control groups the investigation of
a potential effect on tumor growth by 6PHU3 itself or any potential
side effects which are caused by 6PHU3 or vehicle and not by human
effector cells against mouse tissue (i.e. graft-versus-host
reaction exerted by human effector cells against murine tissue)
could be examined. Group "PBS/vehicle" comprised 8 mice (n=8),
"PBS/6PHU3" 8 mice (n=8), "PBMC/vehicle" 7 mice (n=7), "PBMC/6PHU3"
7 mice (n=7) and "PBMC/1BiMAB" 8 mice (n=8). The therapy was
started 7 days after DPBS or PBMC application: groups "PBS/6PHU3",
"PBMC/6PHU3" and "PBMC/1BiMAB" received intraperitoneally 5 .mu.g
purified bi-scFv protein 6PHU3 or 1BiMAB diluted in 200 .mu.l of
DPBS per animal. Groups "PBS/vehicle" and "PBMC/vehicle" received
intraperitoneally 200 .mu.l of vehicle buffer (200 mM
L-Arginin-monohydrochloride dissolved in H.sub.2O, sterile
filtered) diluted in DPBS. Treatment groups are summarized in Table
6. Therapy was conducted on a daily basis for 26 days. Twice per
week tumor dimensions were measured with a digital calibrated
caliper and the tumor volume calculated according to the formula
mm.sup.3=length.times.width.times.width/2. FIGS. 18A and B
exemplify the inhibition of tumor growth in all mice of the
"PBMC/6PHU3" group by the antibody in the presence of human
effector cells. Mice were sacrificed by cervical dislocation when
the tumor volume reached 1500 mm.sup.3 or in case of severe
morbidity (graft-versus-host symptoms were observed in some
mice).
TABLE-US-00007 TABLE 6 Treatment groups Treatment # of Effector
Bi-scFv .mu.g bi-scFv group (G) mice (n) cells protein
protein/mouse G1 8 -- -- -- G2 8 -- 6PHU3 5 G3 7 PBMC -- -- G4 7
PBMC 6PHU3 5 G5 8 PBMC 1BiMAB 5
[0511] b. Determination of Therapy Influence on Body Weight
[0512] The body weight of each mouse was examined twice per week
using a laboratory scale. No mouse in any group showed weight loss
over the time of treatment (data not shown).
[0513] c. Tissue Conservation and Splenocyte Isolation
[0514] After killing of mice, tumors were dissected and the tissue
was immediately fixed in 10 ml Roti-Histofix 4% (Carl Roth,
Karlsruhe, Germany) for immunohistochemical analysis. Moreover,
spleens were dissected to detect the engraftment of human cells by
flow cytometric analysis. Splenocyte isolation was performed
immediately after spleen dissection by mashing the spleens through
a 70 .mu.m cell strainer placed into a 50 ml reaction tube with a
sterile plunger of a 3-5 ml syringe and repeated flushing of the
cell strainer with warm DPBS. Isolated splenocytes were
centrifuged, DPBS decanted and the splenocyte pellets resuspended
in 1 ml heat inactivated fetal bovine serum supplemented with 10%
DMSO. Samples were immediately frozen at -80.degree. C. and stored
until splenocyte samples from all mice were complete.
[0515] d Analysis of Engraftment of Human T Lymphocytes in Mouse
Spleens
[0516] Splenocytes from all mice were collected and frozen as
described under Example 14.c. The complete collection of splenocyte
samples was thawed at one time, all cells were washed twice with
warm DPBS and 1.times.10.sup.6 splenocytes per sample were
incubated with fluorescence-conjugated antibodies for 20 min at
4.degree. C. in the dark to detect the engraftment of human cells
by anti-CD45 staining and the percentage of human T cells by
anti-CD3, anti-CD4, and anti-CD8 staining. Flow cytometric analysis
was conducted with a FACSCalibur (BD Biosciences, Heidelberg,
Germany). Human T cell engraftment in both "PBMC" groups could be
confirmed by high percentage of CD45-CD3 double positive
splenocytes as shown in FIG. 18D.
[0517] e. Immunohistochemistry for the Determination of Target
Expression and T Cell Infiltration
[0518] Tumors were fixed after dissection using 4% buffered
formaldehyde-solution (Roti-Histofix, Carl Roth, Karlsruhe,
Germany) for 48 h at 4.degree. C. The fixed tumors were divided
into two parts and transferred into the automated vacuum tissue
processor ASP200 for dehydration (Leica Microsystems GmbH, Wetzlar,
Germany) followed by embedding into paraffin (Paraplast, Carl Roth,
Karlsruhe, Germany) via the paraffin dispenser station MPS/C (Slee
Medical GmbH, Mainz, Germany). For immunohistochemical stainings, 3
.mu.m thick sections of the formalin-fixed and paraffin-embedded
tissues were generated using the rotary microtome RM2255 (Leica
Microsystems GmbH, Wetzlar, Germany). Deparaffinization and
re-hydrations were conducted in the bi-linear batch stainer
StainMate Max (Thermo Fisher Scientific, Rockford, Ill., USA)
followed by heat-induced epitope retrieval in 10 mM citric buffer,
pH6 with 0.05% Tween20 for 10 min at 120.degree. C. Endogenous
peroxidases were quenched subsequently using 0.3% H.sub.2O.sub.2
solution in PBS for 15 min (Carl Roth), followed by incubation with
10% goat serum in PBS (PAA Laboratories GmbH/GE Healthcare,
Pasching, Austria) for 30 min to block unspecific antibody binding
sites. TAA Claudin 6 was detected by incubation with the polyclonal
primary antibody Anti-Mouse Claudin 6 (C) Rabbit (IBL-America,
Minneapolis, Minn., USA) at 4.degree. C. over night; T cells were
detected on consecutive sections using the polyclonal anti-CD3 AB
(Abcam, Cambridge, UK) at 4.degree. C. over night followed by
incubation with a BrightVision polymer HRP-conjugated anti-rabbit
secondary antibody (ImmunoLogic, Duiven, Netherlands). Binding
reactions were visualized using the Vector NovaRED kit (Vector
Laboratories Ltd., Peterborough, UK) according to the
manufacturer's instructions, followed by hematoxylin
counterstaining (Carl Roth), dehydration and mounting. Analysis and
documentation were performed using either the Axio Imager M2 or the
Mirax scanner (both Carl Zeiss Microscopy GmbH, Goettingen,
Germany).
[0519] As shown in FIG. 19, highest T cell infiltration was
detected in the tumors of the "PBMC/6PHU3" group by CD3 staining,
especially in the border areas of CLDN6 expression. The
heterogeneous expression pattern of TAA CLDN6 in the control groups
(FIGS. 19A, B, C, and D) changed to more compact areas of CLDN6
expression in the tumors of the "PBMC/6PHU3" group as a result of
the therapy (FIG. 19D).
Example 15: Generation and Testing of Bispecific Binding Agents
Targeting CLDN18.2 and CD3
[0520] a. Sequence Origin, Design of Bi-scFv Constructs, and
Cloning into Template Vectors
[0521] Bispecific tandem single chain antibody constructs (bi-scFv)
containing binding domains specific for the human T cell receptor
component CD3 epsylon and human tumor associated antigens (TAA)
were prepared. The corresponding variable heavy chain regions (VH)
and the corresponding variable light chain regions (VL) for each
construct were specifically arranged from 5'- to 3'-end in
consecutive order:
pST1-hAgKozak-V.sub.H.sup..alpha.CLDN18.2-V.sub.L.sup..alpha.CLDN18.2-V.s-
ub.H.sup..alpha.CD3-V.sub.L.sup..alpha.CD3-His-2hBgUTR-A120
(1BiMAB, 18RHU5, no. 1-5)
psT1-hAgKozak-V.sub.H.sup..alpha.CD3-V.sub.L.sup..alpha.CD3-V.sub.L.sup..-
alpha.CLDN18.2-V.sub.L.sup..alpha.CLDN18.2-His-2hBgUTR-A120
(18RHU3, no. 6-10)
[0522] Table 7 summarizes all bi-scFv constructs specific for the
TAA CLDN18.2 and PLAC1 that were generated in the course of the
invention. The bi-scFv constructs were generated by gene synthesis
by GeneArt AG (GeneArt/Life Technologies GmbH, Regensburg, Germany)
using the VH and VL sequences of the corresponding antibodies.
Codon optimizations such as Homo sapiens (HS), Mus musculus (MM),
or Chinese Hamster Ovary (CHO) were implemented by GeneArt's
GeneOptimizer.RTM. software, and are listed in Table 7. Information
on specificity, sequence origin from monoclonal antibodies (mAB),
codon usage, additional sequence features and references of all
applied domains are summarized in Table 8. Variable domain sequence
origin of the respective CD3 antibodies are listed in Table 8. Due
to the high homology of human and mouse TAAs, the same anti-TAA
V.sub.H and V.sub.L sequences could be used for the generation of
bi-scFv constructs for mouse assays, but in combination with the
VH, VL sequences of the mouse specific anti-CD3 antibody clone
145-2C11.
[0523] DNA cloning and expression vector construction was carried
out according to standard procedures (Green/Sambrook, Molecular
Cloning, 2012) well known by the skilled person. Briefly, the
leadoff bi-scFv DNA sequences were provided with a 5'-BsmBI and a
3'-XhoI restriction site for cloning into pST1 plasmids. A
secretion signal sequence was introduced at the 5' end upstream of
the bi-scFv sequence for bi-scFv secretion. A sequence coding for a
15 to 18 amino acid flexible glycine-serine peptide linker was
inserted to join the VH and VL domains for the composition of the
single chain variable antibody fragments (scFv) of which one binds
to CD3 and the other to the TAA. To form a bispecific single chain
antibody, the two scFv domain sequences were connected by a
sequence coding for a short peptide linker (GGGGS). Together with
this linker sequence a BamHI restriction site was introduced for
scFv domain exchanges for the cloning of upcoming bi-scFv
constructs. Briefly, 5'scFv-domains were exchanged by BsmBI and
BamHI restriction and 3'scFv-domains by BamHI and XhoI restriction.
A C-terminal 6.times.His-tag was implemented for detection analysis
of the translated protein. Untranslated regions of human alpha
globin 5' and of human beta globin 3' of the bi-scFv sequence were
present in the pST1 vector (for details see WO2007/036366A2;
Waggoner, S. et al. (2003) Exp. Biol. Med. (Maywood) 228 (4), pp.
387-395).
[0524] For 1BiMAB replicon vector production, the full 1BiMAB
sequence including secretion signal and 6.times.His-tag was
subcloned 3' to the subgenomic promoter of the Semliki forest virus
replicon vector (pSFV) kindly provided by K. Lundstrom (Lundstrom,
K. et al. (2001) Histochem. Cell Biol. 115 (1), pp. 83-91;
Ehrengruber, M. U. et al. (1999) Proc. Natl. Acad. Sci. U.S.A. 96
(12), pp. 7041-7046).
[0525] All constructs were verified by sequencing via MWG's single
read sequence service (Eurofins MWG Operon, Ebersberg, Germany) and
only those with correct sequence and a poly(A) tail of more than
100 adenines were used for in vitro RNA transcription.
[0526] For construct schemata see also FIG. 20 A.
TABLE-US-00008 TABLE 7 Summary of TAA and CD3 specific bispecific
single chain antibody mRNA-template constructs Internal name TAA
Specificity 5'-V.sub.H-V.sub.L 3'-V.sub.H-V.sub.L Codon usage
1BiMAB CLDN18.2 human mCLDN18.2ab TR66 HS no. 1 CLDN18.2 murine
mCLDN18.2ab 145-2C11 CHO no. 2 CLDN18.2 human mCLDN18.2ab UCHT1-HU
CHO no. 3 CLDN18.2 human mCLDN18.2ab UCHT1 CHO no. 4 CLDN18.2 human
mCLDN18.2ab CLB-T3 CHO no. 5 CLDN18.2 human mCLDN18.2ab TR66 CHO
no. 6 CLDN18.2 murine 145-2C11 mCLDN18.2ab CHO no. 7 CLDN18.2 human
UCHT1-HU mCLDN18.2ab CHO no. 8 CLDN18.2 human UCHT1 mCLDN18.2ab CHO
no. 9 CLDN18.2 human CLB-T3 mCLDN18.2ab CHO no. 10 CLDN18.2 human
TR66 mCLDN18.2ab CHO 18RHU5 CLDN18.2 human mCLDN18.2ab TR66 HS
18RHU3 CLDN18.2 human TR66 mCLDN18.2ab HS 18RMU5 CLDN18.2 murine
mCLDN18.2ab 145-2C11 MM 18RMU3 CLDN18.2 murine 145-2C11 mCLDN18.2ab
MM control bi-scFv no. 25 PLAC1 human 78H11 TR66 CHO Bi-scFv
indicates bispecific single chain variable fragment; CHO, Chinese
Hamster Ovary; HS, Homo sapiens; HU, humanized; MM, Mus musculus;
TAA, tumor associated antigen; V.sub.H, variable heavy chain
domain, V.sub.L, variable light chain domain.
TABLE-US-00009 TABLE 8 Summary of bi-scFv mRNA-template construct
information CD3 binding moiety Internal mAB Species TAA binding
moiety Species Short name origin reactivity TAA mAB origin
reactivity 5'-V.sub.H-V.sub.L 3'-V.sub.H-V.sub.L linker 1BiMAB TR66
human CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab TR66 GGGGS murine no.
1 145-2C11 murine CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab 145-2C11
SGGGGS murine no. 2 UCHT1-HU human CLDN18.2 mCLDN18.2ab human,
mCLDN18.2ab UCHT1-HU SGGGGS murine no. 3 UCHT1 human CLDN18.2
mCLDN18.2ab human, mCLDN18.2ab UCHT1 SGGGGS murine no. 4 CLB-T3
human CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab CLB-T3 SGGGGS murine
no. 5 TR66 human CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab TR66
SGGGGS murine no. 6 145-2C11 murine CLDN18.2 mCLDN18.2ab human,
145-2C11 mCLDN18.2ab SGGGGS murine no. 7 UCHT1-HU human CLDN18.2
mCLDN18.2ab human, UCHT1-HU mCLDN18.2ab SGGGGS murine no. 8 UCHT1
human CLDN18.2 mCLDN18.2ab human, UCHT1 mCLDN18.2ab SGGGGS murine
no. 9 CLB-T3 human CLDN18.2 mCLDN18.2ab human, CLB-T3 mCLDN18.2ab
SGGGGS murine no. 10 TR66 human CLDN18.2 mCLDN18.2ab human, TR66
mCLDN18.2ab SGGGGS murine 18RHU5 TR66 human CLDN18.2 mCLDN18.2ab
human, mCLDN18.2ab TR66 SGGGGS murine 18RHU3 TR66 human CLDN18.2
mCLDN18.2ab human, TR66 mCLDN18.2ab SGGGGS murine 18RMU5 145-2C11
murine CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab 145-2C11 SGGGGS
murine 18RMU3 145-2C11 murine CLDN18.2 mCLDN18.2ab human, 145-2C11
mCLDN18.2ab SGGGGS murine no. 25 TR66 human PLAC1 78H11 human,
78H11 TR66 SGGGGS murine Anti-CD3 Internal 5'-long 3'-long
Secretion Codon mAB name linker linker signal usage reference
1BiMAB (GGGGS).sub.3 VE(GGSGGS).sub.2 MGWSCIILFLVAT HS Lanzavecchia
& Scheidegger, Eur J GGVD ATGVHS Immunol 1987 no. 1
(GGGGS).sub.3 (GGGGS).sub.3 MGWSCIILFLVAT CHO Leo et al., Proc Natl
Acad Sci, 1987 ATGVHS no. 2 (GGGGS).sub.3 (GGGGS).sub.3
MGWSCIILFLVAT CHO Shalaby et al., JExp Med 1992 ATGVHS no. 3
(GGGGS).sub.3 (GGGGS).sub.3 MGWSCIILFLVAT CHO Beverley et al., Eur
J Immunol 1981 ATGVHS no. 4 (GGGGS).sub.3 (GGGGS).sub.3
MGWSCIILFLVAT CHO Van Lier et al., Immunology 1989 ATGVHS no. 5
(GGGGS).sub.3 (GGGGS).sub.3 MGWSCIILFLVAT CHO Lanzavecchia &
Scheidegger, Eur J ATGVHS Immunol 1987 no. 6 (GGGGS).sub.3
(GGGGS).sub.3 MNSGLQLVFFVL CHO Leo et al., Proc Natl Acad Sci, 1987
TLKGIQG no. 7 (GGGGS).sub.3 (GGGGS).sub.3 MGWSCIILFLVAT CHO Shalaby
et al., J Exp Med 1992 ATGVHS no. 8 (GGGGS).sub.3 (GGGGS).sub.3
MNSGLQLVFFVL CHO Beverley et al., Eur J Immunol 1981 TLKGIQG no. 9
(GGGGS).sub.3 (GGGGS).sub.3 MNFGLSLIFLALI CHO Van Lier et al.,
Immunology 1989 LKGVQC no. 10 (GGGGS).sub.3 (GGGGS).sub.3
MEWSWIFLFLLS CHO Lanzavecchia & Scheidegger, Eur J VTTGVHS
Immunol 1987 18RHU5 (GGGGS).sub.3 VE(GGSGGS).sub.2 MGWSCIILFLVAT HS
Lanzavecchia & Scheidegger, Eur J GGVD ATGVHS Immunol 1987
18RHU3 VE(GGSGGS).sub.2 (GGGGS).sub.3 MGWSCIILFLVAT HS Lanzavecchia
& Scheidegger, Eur J GGVD ATGVHS Immunol 1987 1RPMU5
(GGGGS).sub.3 VE(GGSGGS).sub.2 MGWSCIILFLVAT MM Leo et al., Proc
Natl Acad Sci, 1987 GGVD ATGVHS 18RMU3 VE(GGSGGS).sub.2
(GGGGS).sub.3 MNSGLQLVFFVL MM Leo et al., Proc Natl Acad Sci, 1987
GGVD TLKGIQG no.25 (GGGGS).sub.3 (GGGGS).sub.3 MGWLWNLLFLM CHO
Lanzavecchia & Scheidegger, Eur J AAAQSAQA Immunol 1987 CHO
indicates Chinese Hamster Ovary; HS, Homo sapiens; mAB, monoclonal
antibody; MM, Mus musculus; TAA, tumor associated antigen.
[0527] b. IVT-RNA Synthesis
[0528] For the generation of anti-CLDN18.2-specific bi-scFv IVT
templates, plasmids were linearized downstream the poly(A)-tail
using a class IIs endonuclease. Linearized template DNA was
purified by phenol/chloroform extraction and sodium acetate
precipitation as described elsewhere (Holtkamp, S. et al. (2006)
Blood 108 (13), pp. 4009-4017).
[0529] Linearized DNA templates were subjected to in vitro
transcription using MEGAscript Kits (Ambion/Life Technologies,
Darmstadt, Germany) according to the manufacturer's guidelines:
pST1 templates were transcribed with the MEGAscript T7 Kit and pSFV
templates with the MEGAscript SP6 Kit. For reactions with cap
analoga, the GTP concentration was lowered to 1.5 mM, and 6 mM of
ARCA, beta-S-ARCA(D1), or beta-S-ARCA(D2), synthesized as described
elsewhere (Kowalska, J. et al. (2008) RNA 14 (6), pp. 1119-1131;
Grudzien, E. et al. (2004) RNA 10 (9), pp. 1479-1487; Stepinski, J.
et al. (2001) RNA 7 (10), pp. 1486-1495) was added to the reaction.
Purification of IVT-mRNA was carried out with the MEGAclear Kit
(Ambion/Life Technologies, Darmstadt, Germany) according to the
manual. Concentration and quality of the IVT-RNA were assessed by
spectrophotometry and analysis on a 2100 Bioanalyzer (Agilent
Technologies, Santa Clara, Calif., USA).
Example 16: T Cell Activation in Response to Bi-scFv Secretion by
Target Cells Transfected with Various CLDN18.2-Specific
IVT-mRNAs
[0530] For the examination of CLDN18.2-specific bi-scFv IVT-RNA
functionality, the gastric carcinoma cell line NugC4 that
endogenously expresses relatively high levels of human CLDN18.2
(Sahin, U. et al. (2008) Clin. Cancer Res. 14 (23), pp. 7624-7634)
was used as target cell line.
[0531] NugC4 target cells--that are routinely tested for TAA
expression by FACS analysis before every assay--were washed twice
with ice cold X-Vivo 15 medium (LONZA, Basel, Switzerland) and
resuspended to a density of 2.times.10.sup.7 cells/ml. 250 .mu.l
cell suspension was transferred to pre-cooled 0.4 cm Gene
Pulser/MicroPulser Cuvettes (Bio-Rad, Dreieich, Germany) and 20
.mu.g/ml IVT-mRNA was added. IVT-mRNAs used were: 1BiMAB, no.2,
no.3, no.4, no.5, no.7, no.8, no.9 and no.10. For detailed
information on bi-scFv variants see Tables 7 and 8. After careful
mixing, cells were transfected with a BTX ECM 830 electroporator
(Harvard Apparatus, Holliston, Mass., USA) using the following
conditions: 250 V, 2 pulses, 12 ms pulse length, 400 ms interval
length. Immediately after electroporation, cuvettes were shortly
put on ice and then the cell suspensions were transferred into RT
warm assay medium (RPMI 1640 medium supplemented with 5% heat
inactivated human AB serum, 0.5% penicillin-streptomycin, lx NEAA
and 1 mM sodium pyruvate (Gibco/Life Technologies GmbH, Darmstadt,
Germany)) in 15 ml tubes. Transfected target cells were counted and
adjusted to 1.times.10.sup.5 cells per ml.
[0532] Human effector cells were freshly isolated from human blood
of healthy donors according to standard procedures (Current
Protocols in Immunology, 2012): briefly, blood was diluted with
DPBS, layered on Ficoll-Paque Plus (GE Healthcare Life Sciences,
Munich, Germany) and centrifuged. Peripheral blood mononuclear
cells (PBMCs) were collected from the interphase, washed with cold
DPBS supplemented with 2 mM EDTA and counted. Human cytotoxic T
cells were isolated by magnetic-activated cell separation (MACS)
from PBMCs by CD8.sup.+ T Cell Isolation Kit, human (Miltenyi
Biotec, Teterow, Germany) according to the manufacturer's
guidelines. Effector cell separations were routinely tested for
successful T cell isolation via FACS analysis (CD4, CD8 staining).
T cells were adjusted to 5.times.10.sup.5 cells per ml in assay
medium.
[0533] 1.times.10.sup.5 target cells were seeded per well of a
6-well plate and human cytotoxic T cells were added to an E:T ratio
of 5:1. The final volume per well was 2 ml. Control samples
containing effector and target cells comprised target cells
secreting no.25, the parental IgG mAB chCLDN18.2ab and 1BiMAB
protein as positive control in a final concentration of 5 ng/ml.
Controls included electroporated target cells alone or T cells
alone with and without 1BiMAB protein. After 48 h T cells and
target cells were harvested, labeled and analyzed by flow
cytometry. Briefly, all cells were harvested by gentle scraping
with Cell Scrapers (Sarstedt AG & Co, Nurmbrecht, Germany) and
transferred to 5 ml round bottom tubes (BD Falcon, Heidelberg,
Germany). Cells were centrifuged and washed with DPBS. For cell
staining Mouse Anti-Human CD3-FITC, Mouse Anti-Human CD69-APC, and
Mouse Anti-Human CD25-PE (all antibodies BD Biosciences,
Heidelberg, Germany) were used. Cell pellets were resuspended in 50
.mu.l FACS-buffer (DPBS supplemented with 5 FBS) containing the
fluorescence-conjugated antibodies. After incubation for 20 min at
4.degree. C. in the dark, samples were washed with 4 ml DPBS and
cell pellets were resuspended in 200 .mu.l FACS buffer containing
propidium iodide (PI) (Sigma Aldrich, Germany) in a final dilution
of 1:1000 for the detection of dead cells. Samples were kept on ice
and dark until measured. Establishment of the assay was performed
with a FACSCalibur (BD Biosciences, Heidelberg, Germany). Analysis
was evaluated by FlowJo software (Tree Star, San Carlos, Calif.,
USA).
[0534] As shown in FIG. 21 A, each CLDN18.2-specific IVT-mRNA
resulted in secretion of bi-scFv protein as seen in the efficient T
cell activation. The most potent variants with only marginal
differences in T cell activation were
no.5>no.8>no.10>no.3>1BiMAB in descending order. All of
these variants led to a total T cell activation of above 55%
whereas variants no.2, no.4, no.7 and no.9 led to a total T cell
activation of 40 to 50%.
[0535] Specific target cell lysis was calculated by the formula: %
lysis=(% PI.sup.+ target cells.sub.sample-% PI.sup.+ target
cells.sub.EP reference) where "sample" specifies coincubated
effector and target cells and "EP reference" electroporated target
cells of each individual IVT-mRNA electroporation alone. As shown
in FIG. 21 B, target cell lysis above 65% was achieved by the
variants 1BiMAB>no.5>no.8>no.3 in descending order. The
other variants mediated a target cell lysis of 55-64%. The most
potent CLDN18.2-specific bi-scFv carry the V.sub.H and V.sub.L
domains of TR66 (1BiMAB, no.5, no.10) or UCHT1 (no.3, no.8).
Regarding the domain orientations, no significant difference was
observed in contrast to the protein bi-scFv variants (see example
3). In accordance with the protein studies IVT-mRNA encoding 1BiMAB
was chosen for further studies.
[0536] Constructs 18RHU5 and 18RHU3 (see Tables 7 and 8) were
compared at a later time point to 1BiMAB. Efficiency of 18RHU5 was
equivalent to 1BiMAB, 18RHU3 was less potent (data not shown).
Example 17: Microscopic Analysis of T Cells Redirected to Target
Cells Secreting CLDN18.2-Specific Bi-scFv 1BiMAB
[0537] The assay set-up was essentially as described under example
2.a.
[0538] Human cytotoxic T cells were isolated by MACS from freshly
isolated PBMCs by CD8.sup.+ T Cell Isolation Kit, human (Miltenyi
Biotec, Teterow, Germany) according to the manufacturer's
guidelines.
[0539] NugC4 target cells were prepared and transfected as
described under example 16 with the exception that 80 .mu.g/ml
1BiMAB IVT-mRNA or 80 .mu.g/ml no.25 ctrl IVT-mRNA was used.
Transfected target cells were counted and adjusted to
2.times.10.sup.5 cells per ml. 1.times.10.sup.4 target cells were
seeded per well of a 96-well plate and human cytotoxic T cells were
added according to an E:T ratio of 5:1. The final volume per well
was 100 .mu.l. Control samples comprised transfected target cells
alone to proof healthiness after electroporation and control
bi-scFv transfected target cells with effector cells. Tissue
culture plates were subsequently incubated at 37.degree. C., 5%
CO.sub.2. Significant effects in terms of T cell clustering on
target cells, formation of an immunologic synapse and target cell
killing in samples containing 1BiMAB transfected target cells were
seen at 24 h and recorded with a Nikon Eclipse TS100 inverted
microscope (Nikon, Japan). No T cell clustering or target cell
lysis was observed in the control sample with no.25 transfected
target cells implying the strict dependency on TAA expression to
induce an activation of T cells. See also FIG. 22.
Example 18: Flow Cytometric Analysis of Concentration Dependent T
Cell Activation by CLDN18.2-Specific Bi-scFv 1BiMAB
[0540] To investigate a bi-scFv concentration dependent activation
of T cells in the presence of TAA-expressing target cells a
three-fold dilution series was applied to the transfection
process.
[0541] NugC4 target cells were prepared and transfected as
described under example 16 but with a final IVT-mRNA concentration
of 40 .mu.g/ml. 1BiMAB IVT-mRNA concentrations ranged from 0.4-40
.mu.g/ml and were filled up with appropriate amounts of luciferase
IVT-mRNA with the purpose to expose all samples to the same stress
level regarding IVT-mRNA amounts.
[0542] 1.times.10.sup.5 transfected target cells and human
cytotoxic T cells (isolated as described under example 16) were
seeded in an E:T ratio of 10:1 in 2 ml assay medium in a 6-well
format. Control samples contained target cells transfected with 40
.mu.g/ml luciferase IVT-mRNA but not with 1BiMAB IVT-mRNA. After 24
h and 48 h of target and effector cell coincubation, cells were
harvested, stained and analyzed as described under example 16.
[0543] As shown in FIGS. 23 A and B, significant T cell activation
was observed in samples containing target cells transfected with 4
.mu.g/ml 1BiMAB IVT-mRNA. Maximum T cell activation in this assay
was reached with 40 .mu.g/ml 1BiMAB IVT-mRNA. Expression of CD69
and CD25 varied with the coincubation time (FIG. 23 A to B) and the
IVT-mRNA concentration. Higher 1BiMAB IVT-mRNA amounts (12 and 40
.mu.g/ml) led to faster initiation of the T cell activation
mechanism as visible e.g. at the increased expression of CD25
compared to that of CD69 in FIG. 23 B. Total T cell activation did
not exceed .about.40%.
Example 19: Flow Cytometric Analysis of Concentration Dependent T
Cell Mediated Target Cell Lysis by CLDN18.2-Specific Bi-scFv
1BiMAB
[0544] To investigate a bi-scFv concentration dependent T cell
mediated target cell lysis the experimental set-up described under
example 18 was used. Besides the effector and target cell
coincubation samples ("sample") also the individually
electroporated target cells alone were seeded. The latter served as
reference samples ("EP reference") to subtract target cells killed
by the electroporation process itself from target cells lysed by T
cells.
[0545] Harvest and staining was performed according to example 18.
Target cells were finally analysed via their incorporation of
propidium iodide with a FACSCalibur (BD Biosciences, Heidelberg,
Germany).
[0546] Percentage of specific target cell lysis was determined by a
two-step subtraction of background dead cells:
1. % T cell mediated lysis=(% PI.sup.+ target cells.sub.sample-%
PI.sup.+ target cells.sup.EP reference) 2. % specific lysis=(% T
cell mediated lysis.sub.sample-% T cell mediated
lysis.sub.ctrl)
[0547] "T cell mediated lysis.sub.ctrl" is deduced from the
difference of PI.sup.+ target cells of control samples (40 .mu.g/ml
luciferase IVT-mRNA only) with and without effector cells.
[0548] By this calculation a maximum specific lysis of 55.5%+/-5.6%
is reached with 12 .mu.g/ml 1BiMAB IVT-mRNA in this experiment. Due
to the sensitivity of NugC4 target cells to electroporation stress
and the therewith unavoidable dead background target cells that are
subtracted, the plotted specific target cell lysis might be lower
in this experimental set-up than the actual lysis percentage.
Example 20: T Cell Proliferation in Response to 1BiMAB IVT-mRNA
Transfection
[0549] T cell proliferation is an indicator of T cell activation.
To show specific T cell proliferation in response to bi-scFv
encoding IVT-mRNA 1BiMAB in the presence of CLDN18.2 positive
target cells, a flow cytometric assay was used. Briefly,
1.times.10.sup.7 human T cells isolated as described under example
16 were stained with 1 .mu.M carboxyfluorescein diacetate
succinimidyl ester (CellTrace CFSE, Invitrogen/Life Technologies
GmbH, Germany) dissolved in DPBS in the dark at RT for 5 min. Cells
were washed twice with DPBS/5% FCS and resuspended in assay medium
to 2.times.10.sup.6 cells per ml. As target cells, NugC4 cells
lentivirally transduced with human CLDN18.2 and--for specificity
testing--the CLDN18.2-negative breast cancer cell line MDA-MB-231
were chosen. 20 .mu.g/ml of IVT-mRNAs 1BiMAB or a non-targeting
control were used for electroporation. Electroporation of NugC4 was
performed as described under example 16. MDA-MB-231 electroporation
was conducted using the following conditions: 400 V, 3 ms pulse
length, 1 pulse, 400 ms interval length in 0.4 cm Gene
Pulser/MicroPulser Cuvettes (Bio-Rad, Dreieich, Germany). A cytotox
assay as described under example 16 was set up with the transfected
target cells and human CFSE-labeled T cells as effector cells. T
cells alone and untransfected or control transfected target cells
plus T cells were used as negative controls. T cells alone
stimulated with 5 .mu.g/ml OKT3 (Bio X Cell, West Lebanon, N.H.,
USA) and 2 .mu.g/ml anti-CD28 (BioLegend, Fell, Germany) served as
positive control. 1BiMAB protein in a concentration of 5 ng/ml was
applied to untransfected target plus T cells to confirm the assay
validity. Samples combined with the non-targeting bi-scFv protein
6PHU3 were included as specificity control. All samples were set up
in triplicates in a total volume of 0.2 ml assay medium in 96
wells. After 72 h of coincubation, T cells were harvested,
collected in 5 ml round bottom tubes, washed and stained at
4.degree. C. for 30 min with 2 .mu.l anti-CD45-APC to differentiate
human T cells from tumor cells and 0.25 .mu.l eFluor506 (BD
Biosciences, Heidelberg, Germany) to counterstain dead cells in 200
.mu.l DPBS. After washing with DPBS, cells were resuspended in
FACS-buffer and analyzed with a FACSCanto II (BD Biosciences,
Heidelberg, Germany). Proliferation of T cells was detected by
decreasing CFSE-signal only in the presence of CLDN18.2 positive
target cells and bi-scFv 1BiMAB (see also FIG. 25). Besides the
positive control, T cell proliferation of 42-48% could be observed
in the presence of CDLN18.2 positive target cells in combination
with 1BiMAB protein. Target positive cells transfected with 1BiMAB
IVT-mRNA led to 22%+/-3%. The lower proliferation in response to
IVT-mRNA than to protein is probably due to the low transfection
efficiency achievable with NugC4 target cells. T cells incubated
with CLDN18.2 negative target cells MDA-MB-231 do not show a
significant proliferation in any constellation as well as T cells
without target cells except for the positive control.
Example 21: Titration of Effector to Target Ratios to Determine a
Potent Ratio
[0550] For the determination of a suitable E:T ratio in the setting
of the in vitro cytotox assay based on FACS analysis, E:T ratios
ranging from 0.3:1 to 10:1 in 3-fold steps were chosen.
[0551] NugC4 target cells were prepared and transfected as
described under example 16 with an IVT-mRNA concentration of 40
.mu.g/ml. One preparation of 1BiMAB IVT-mRNA transfected cells was
used for all test samples. Transfection of 40 .mu.g/ml luciferase
IVT-mRNA was selected as negative control.
[0552] Human cytotoxic T cells were separated from freshly isolated
PBMCs as described under example 16 and served as effector cells.
1.times.10.sup.5 transfected target cells were coincubated with
cytotoxic T cells in 6-well plates in duplicates in the following
effector to target ratios: 0.3:1-1:1-3:1-10:1. Additionally, human
cytotoxic T cells were cultured in the absence of target cells to
determine background T cell activation. Target cells transfected
with control IVT-mRNA or 1BiMAB IVT-mRNA were also cultured in the
absence of effector cells to define background dead cells by
electroporation stress. The luciferase negative control was only
seeded in the maximum E:T ratio of 10:1. After 48 h of coincubation
cells were harvested, labeled and analyzed as described under
example 16.
[0553] FIG. 26 A shows a specific activation of cytotoxic T cells
in response to 1BiMAB secretion by NugC4 target cells. Independent
of the number of T cells in the samples, a total activation of
50-60% was detected. Moreover, the distribution of CD25 and CD69
expression in the samples is highly comparable. This indicates that
there is a given percentage of T cells in the cytotoxic T cell
population that can be activated.
[0554] In FIG. 26 B the dependency of efficient target cell lysis
of the cytotoxic T cell number becomes obvious. Even though target
cells are lysed in an E:T ratio of only 0.3:1 a potent lysis starts
with a ratio of 3:1.
Example 22: Analysis of T Cell Activation and Target Cell Lysis in
a FACS-Based Assay with 1BiMAB IVT-mRNA Transfected Effector
Cells
[0555] In this experiment the aim was to test whether also human
effector cells are capable to produce and secrete 1BiMAB after
IVT-mRNA transfection. The rational behind this was a hypothetical
patient's scenario in which the patient's own T cells could be
transfected with bi-scFv followed by a retransfer into the
patient.
[0556] Human cytotoxic T cells--isolated as described under example
16--were washed twice with X-Vivo 15 medium (LONZA, Basel,
Switzerland) and resuspended to a density of 2.times.10.sup.7
cells/ml. 250 .mu.l cell suspension was transferred to pre-cooled
0.4 cm Gene Pulser/MicroPulser Cuvettes (Bio-Rad, Dreieich,
Germany) and 80 or 240 .mu.g/ml IVT-mRNA was added. IVT-mRNAs used
were 1BiMAB and eGFP as control. After careful mixing, cells were
electroporated with a BTX ECM 830 (Harvard Apparatus, Holliston,
Mass., USA) electroporator using the following conditions: 500 V, 1
pulse, 3 ms pulse length, 400 ms interval length. Immediately after
electroporation, cuvettes were shortly put on ice and then the cell
suspensions were transferred into assay medium (RPMI 1640 medium
supplemented with 5% heat inactivated human AB serum, 0.5%
penicillin-streptomycin, lx NEAA and 1 mM sodium pyruvate
(Gibco/Life Technologies GmbH, Darmstadt, Germany)) containing 10
U/ml IL-2. Transfected effector cells were cultivated over night at
37.degree. C., 5% CO.sub.2. The next day, the transfection
efficiency was analyzed by FACS revealing a transfection efficiency
above 70% for both eGFP IVT-mRNA concentrations. Each effector cell
sample was counted and adjusted to 5.times.10.sup.5 cells per ml.
NugC4 target cells were harvested by trypsinization, washed with
assay medium, counted and adjusted to 1.times.10.sup.5 cells per
ml. Effector and target cells were mixed and seeded to 6-wells in
duplicates with a final E:T ratio of 5:1 and a final volume of 2
ml. Untreated T cells were seeded without target cells for
determination of background activation signals. Assay analysis was
performed as described under example 16 after 48 h of coincubation
at 37.degree. C., 5% CO.sub.2.
[0557] A significant activation of cytotoxic T cells transfected
with 1BiMAB IVT-mRNA and coincubated with target cells was achieved
as shown in FIG. 27 A. Target cell lysis by 1BiMAB IVT-mRNA
transfected T cells was above 60% as plotted in FIG. 27 B. The
effects of 80 .mu.g/ml 1BiMAB IVT-mRNA could not be increased with
higher RNA amounts.
[0558] Concluding from this experiment, effector cells could
theoretically be used as bi-scFv producing and secreting recipient
cells.
Example 23: Investigation of Target Specificity of 1BiMAB IVT-mRNA
in a Luciferase-Based Cytotox Assay Using CLDN18.2 Negative Target
Cells
[0559] Strict target specificity is an important issue to avoid
unwanted adverse effects in patients. In this preliminary study, a
CLDN18.2 negative cell line--the teratocarcinoma cell line PA-1
(ATCC CRL-1572)--has been chosen to examine an unspecific cytolytic
potential of 1BiMAB introduced as IVT-mRNA.
[0560] The PA-1 cell line used had been stably transduced with a
lentiviral luciferase vector and could therefore be applied in a
luciferase-based cytotox assay. PA-1/luc target cells were prepared
for electroporation as described under example 16. A total of 40
.mu.g/ml IVT-mRNA was transfected per sample. IVT-mRNAs used were:
1BiMAB, no. 25 and 6RHU3. No. 25 targets the non-expressed TAA
PLAC-1 and 6RHU3 targets the highly expressed target CLDN6 in
PA-1/luc cells. For detailed information on bi-scFv variants see
Tables 7 and 8. No. 25 was used as fill-up IVT-mRNA in
electroporation samples with 4 .mu.g/ml IVT-mRNA to ensure the same
stress level caused by RNA transfection for all target cell
samples. After careful mixing, cells were transfected with a BTX
ECM 830 electroporator (Harvard Apparatus, Holliston, Mass., USA)
using the following conditions for a 0.4 cm cuvette: 200 V, 2
pulses, 12 ms pulse length, 400 ms interval length. Immediately
after electroporation, cuvettes were shortly put on ice and then
the cell suspensions were transferred into RT warm PA-1 assay
medium (MEM medium supplemented with 10% heat inactivated FCS, 0.5%
penicillin-streptomycin, lx NEAA, 1.5 g/l sodium bicarbonate and 1
mM sodium pyruvate (Gibco/Life Technologies GmbH, Darmstadt,
Germany)) in 15 ml tubes. Transfected target cells were counted and
adjusted to 1.times.10.sup.5 cells per ml.
[0561] Human effector cells were isolated as described under
example 16. Human cytotoxic T cells were isolated by
magnetic-activated cell separation (MACS) from PBMCs by Pan T Cell
Isolation Kit II, human (Miltenyi Biotec, Teterow, Germany)
according to the manufacturer's guidelines. T cells were adjusted
to 5.times.10.sup.5 cells per ml in PA-1 assay medium.
1.times.10.sup.4 target cells were seeded per well of a 96-well
plate and human cytotoxic T cells were added to an E:T ratio of
5:1. The final volume per well was 100 .mu.l. Control samples
containing effector and target cells comprised target cells
secreting no.25 as negative control, 6RHU3 or 6PHU3 protein as
positive control and 1BiMAB protein. Protein concentrations were
set to a final concentration of 100 ng/ml and were combined with
no.25-transfected target cells to ensure the same condition for the
used target cells. Minimal lysis controls (L.sub.min) included each
electroporated target cell sample alone. Spontaneous lysis controls
(L.sub.max) consisted of untreated target and effector cells
(L.sub.max1) for subtraction from L.sub.test sample or untreated
target cells alone (L.sub.max2) for subtraction from L.sub.min.
Each sample was seeded in triplicate. Assay analysis was undertaken
after 72 h incubation at 37.degree. C., 5% CO.sub.2. Spontaneous
lysis controls (L.sub.max) were treated with Triton X-100 in a
final concentration of 2%.
[0562] For analysis, 50 .mu.l of a water solution containing 1
mg/ml luciferin (BD Monolight, BD Biosciences, Heidelberg, Germany)
and 50 mM HEPES were added per well and plates subsequently
incubated for 30 min in the dark at 37.degree. C. Luminescence
arising from oxidation of luciferin by luciferase expressing viable
cells was measured in a microplate-reader (Infinite M200, Tecan,
Mannedorf, Switzerland). Percentage of specific target cell lysis
was calculated by the following formula: % specific
lysis=[1-(luminescence.sub.test
sample-L.sub.max1)/(L.sub.min-L.sub.max2)].times.100.
[0563] FIG. 28 shows the percentage of specific target cell lysis.
CLDN18.2 negative PA-1/luc cells transfected with the negative
control no.25 or with 1BiMAB do not show significant lysis even
after an incubation of 72 h. Also 100 ng/ml 1BiMAB protein do not
result in significant lysis, whereas lysis by bi-scFv secretion of
TAA-targeting 6RHU3 or by 100 ng/ml 6PHU3 protein was between
85-93%. 24 h and 48 h time points were analyzed as well and show
equivalent results (data not shown).
Example 24: Qualitative Analysis of 1BiMAB Protein Production after
IVT-RNA Transfection of Mammalian Cells
[0564] For the investigation of RNA translation into protein in
mammalian cells the cell line BHK21 (ATCC CRL-13001) was chosen as
expression system. 2.times.10.sup.7 BHK21 cells per ml were
transfected by electroporation as described under example 16 with
the difference that all steps were conducted at RT. 250 .mu.l cell
suspension was transferred to 0.4 cm Gene Pulser/MicroPulser
Cuvettes (Bio-Rad, Dreieich, Germany) and 40 .mu.g/ml 1BiMAB
IVT-mRNA or IVT-replicon RNA was added. Electroporation conditions
were as follows: 300 V, 16 ms pulse length, 1 pulse, 400 ms
interval length.
[0565] Electroporated cells were resuspended in RT culture medium
(RPMI1640, 10% FCS) and transferred into 15 cm culture dishes. 5 h
after seeding, medium containing FCS was replaced by FCS-free
medium. In case of examples 24 a and b, cell culture supernatant
and cells were harvested separately 18 h after electroporation.
Cell pellets were lysed in 1.times.LDS sample buffer (cat. no.
NP0008; Life technologies, Darmstadt, Germany) and heated at
72.degree. C. for 15 min. For ELISA analysis non-concentrated and
approximately 50-fold concentrated supernatant was used.
Concentration was carried out with Amicon ultra-15 centrifugal
filter units (Merck Millipore, Billerica, Mass., USA) according to
the manufacturer's protocol. In case of example 24 c (IVT-mRNA
only), supernatant was harvested 48 h post transfection and
subjected to 40-fold concentration as described above.
[0566] a. ELISA Using Supernatant
[0567] For ELISA analysis Nickel coated plates (Thermo Fisher
Scientific, Bonn, Germany) were used for capturing the analyte via
its His-Tag. First, the plate was washed three times with 200 .mu.l
wash buffer (0.01% Tween-20 in 1.times.PBS) per well. As standard,
purified 1BiMAB protein was diluted into 1.75% Na-Casein in
1.times.PBS(=diluent). The dilution row ranged from 2.34 to 37.50
ng/ml in steps of 2. 100 .mu.l per standard dilution was
transferred to the wells in triplicates of each concentration.
Accordingly, 100 .mu.l of the samples was transferred in
triplicates. The plate was sealed with an adhesive film and
incubated at 37.degree. C. for 30 minutes. Afterwards, the plate
was washed three times with 200 .mu.l wash buffer per well. For the
detection of 1BiMAB the anti-idiotypic monoclonal IgG 8B1F3 that
specifically binds to VH-VL of mCLDN18.2ab and therefore also to
1BiMAB was used. 8B1F3 was mixed into the diluent to a final
concentration of 1 .mu.g/ml. 100 .mu.l of the anti-idiotypic
antibody solution was transferred to each well followed by an
incubation time of 30 min at 37.degree. C. Subsequently, the plate
was washed 3.times. with 200 .mu.l wash buffer per well and 100
.mu.l of an AP-conjugated anti-mouse detection antibody (Jackson
Immuno Research Laboratories, West Grove, Pa., USA)--diluted 1:500
in diluent--was added to each well followed by 30 min incubation at
37.degree. C. After a final wash step (3.times.200 .mu.l wash
buffer), 1.5 mg/ml of the substrate pNPP in appropriate substrate
buffer (1 M Diethanolamine, 0.5 mM MgCl.sub.2, 0.01% Na-azide, pH
9.8) was added to each well, followed by incubation for 30 min at
RT in the dark. 100 .mu.l of 3 M KOH was used for each well to stop
the enzymatic reaction. Absorbance was measured with a
microplate-reader (Infinite M200, Tecan, Mannedorf, Switzerland).
For dual wavelength analysis 405 nm was set as measurement
wavelength and 492 nm as reference wavelength. Absorbance values
were calculated by subtraction of reference wavelength from
measurement wavelength.
[0568] In FIG. 29A the mean absorbance values at 405 nm including
standard deviations are plotted. Concentrated supernatant from
1BiMAB IVT-mRNA and IVT-replicon transfected cells led to
significant signals proving the translation of bi-scFv encoding
IVT-RNA. Concentrated supernatant from mock transfected cells did
not result in any signal. Actual protein concentrations cannot be
proposed because of different toxicity of the IVT-mRNA and
IVT-replicon constructs and slightly different x-fold concentrates.
Estimation of approximate protein concentration in unconcentrated
supernatant was in the range of 1.5 ng/ml for IVT-replicon samples
and 2.4 ng/ml for IVT-mRNA samples.
[0569] b. Western Blot Analysis of Supernatant and Cell Lysate
(IVT-mRNA and IVT-Replicon Samples)
[0570] For analysis by Western blot, concentrated supernatants and
cell lysates were separated on NuPAGE Novex 4-12% Bis-Tris Gels
(Invitrogen/Life Technologies GmbH, Darmstadt, Germany).
Supernatant and cell lysate of BHK21 cells transfected with 1BiMAB
IVT-mRNA, IVT-replicon RNA or of untreated cells and a positive
control--0.1 .mu.g purified 1BiMAB protein--were loaded. Western
blot analysis was performed by standard procedures (Current
Protocols in Protein Science, 2012). Briefly, after blotting
proteins on PVDF membrane and blocking with PBST/3% milk powder,
the membrane was incubated for 1 h at 4.degree. C. with primary
antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany)
diluted 1:500 in blocking buffer. After repeated washing with
blocking buffer, membranes were incubated with Fc-specific
secondary peroxidase-conjugated goat-anti-mouse IgG antibody (Sigma
Aldrich, Germany) diluted 1:10000 in blocking buffer for 1 h at
4.degree. C. After repeated washing with blocking buffer, the
signals were visualized by SuperSignal West Femto Chemiluminescent
Substrate (Pierce/Thermo Fisher Scientific, Rockford, Ill., USA)
and recorded by an ImageQuant LAS 4000 Imager (GE Healthcare Life
Sciences, Munich, Germany). Signals of 1BiMAB were detected between
50 and 60 kD as compared to the internal molecular weight standard.
As shown in FIG. 29 B weak signals were detected in supernatant of
IVT-mRNA (lane 2) and IVT-replicon RNA (lane 3) transfected cells,
whereas lane 4 with supernatant from untreated cells is without
signal. Strong signals could be generated with cell lysates of
IVT-mRNA (lane 5) and IVT-replicon RNA (lane 6) transfected cells.
Cell lysate from untreated cells (lane 7) led again to no signal.
All signals appeared at the same height as the purified 1BiMAB
protein control (lane 8). The weak signal in the supernatant and
with it the weak 1BiMAB secretion is probably owed to the
relatively short incubation time after transfection. Due to the
toxic effect of the replicon RNA longer incubation times could not
be tested.
[0571] Both analyses are of qualitative nature and do not serve for
protein concentration determinations.
[0572] c. Western Blot Analysis of Supernatant (IVT-mRNA
Samples)
[0573] Supernatant collected 48 h post transfection was separated
by SDS-PAGE followed by Western blot analysis as described under
example 24 b. As shown in FIG. 29 C, no.25 and 1BiMAB translated
from IVT-mRNA and secreted into the supernatant were detected via
their His-tag. Herewith, the production and secretion of 1BiMAB as
well as of no.25 that has been used as bi-scFv specificity control
could be proven.
Example 25: Detection of In Vivo Translated and Functional 1BiMAB
Protein after Intramuscular RNA Injection
[0574] Female and male NSG mice at an age of 8-16 weeks were
selected and distributed into 4 groups a 5 mice. 40 .mu.l RNA
solution was injected per mouse and femoral muscle. 40 .mu.l RNA
solution consisted of 1.times.PBS, 5 .mu.g D2-capped 1BiMAB
IVT-mRNA or replicon, 2 .mu.g D1-capped luciferase IVT-mRNA and 0
or 15 .mu.g D1-capped EBK IVT-mRNA. The EBK IVT-mRNA encoding the
vaccinia virus proteins E3L, B18R and K3L (EBK) was coinjected to
inhibit IFN response and to counteract PKR activation for the
purpose of RNA translation enhancement (Patent Application
PCT/EP2012/04673). Luciferase signal was monitored 24 h post
injection with a Xenogen IVIS 2000 to exclude mice without signal
from sample collections.
[0575] Blood was collected 2, 4 and 7 days post injection. Serum
was harvested and subsequently frozen at -80.degree. C. Muscles of
mice with strong luminescence signal were dissected and histofixed
for IHC or shock-frozen for Western blot analysis 4 days post RNA
injection.
[0576] Cytotox Assay
[0577] Sera of NSG mice were analyzed in an in vitro cytotox assay.
NugC4 target cells stably transduced with firefly luciferase and
human CLDN18.2 for better target expression were seeded with human
T cells (isolated as described under example 16) in an E:T ratio of
30 to 1 for maximum sensitivity. Assay medium consisted of RPMI
1640 medium supplemented with 10% heat inactivated FCS, 0.5%
penicillin-streptomycin, 1.times.NEAA and 1 mM sodium pyruvate
(Gibco/Life Technologies GmbH, Darmstadt, Germany). 20 .mu.l of
thawed test serum was added per test sample well. Standard 1BiMAB
protein control wells, L.sub.min and L.sub.max wells were completed
with 20 .mu.l serum of untreated NSG mice. Final volume per well
was 100 .mu.l. L.sub.mm was seeded twelvefold, L.sub.max sixfold
and test samples in triplicates. After 48 h incubation at
37.degree. C. and 5% CO.sub.2 L.sub.max wells were mixed with 10
.mu.l 2% Triton X-100 solution and incubated for 10 min. To all
other wells 10 .mu.l assay medium was added. 50 .mu.l luciferin
solution (see example 23) were added and plates were
measured--after a 30 min incubation step at 37.degree. C. in the
dark--in an Infinite M200 microplate reader (TECAN, Mannedorf,
Switzerland). Calculation of specific target cell lysis was
performed as described under example 23.
[0578] In FIG. 30 the percent specific lysis is plotted.
Significant cytotoxic effects were detected in each group.
Cytolytic effects were increased by factor 1.7 in the wells
containing serum of mice injected with EBK and 1BiMAB IVT-mRNA and
harvested 2 days post injection. Significantly lower effects were
achieved by samples harvested 4 or 7 days post injection. In the
case of 1BiMAB-replicon samples, sera harvested at later time
points also generated strong cytolytic effects.
[0579] These data prove the in vivo translation of 1BiMAB from
IVT-mRNA or -replicon and the secretion into the blood stream after
intramuscular injection.
Example 26: Generation and Testing of Bispecific Binding Agents
Targeting CLDN6 and CD3
[0580] a. Sequence Origin, Design of Bi-scFv Constructs, and
Cloning into Template Vectors
[0581] Bispecific tandem single chain antibody constructs (bi-scFv)
containing binding domains specific for the human T cell receptor
component CD3 and human tumor associated antigens (TAA) were
prepared. The corresponding variable heavy chain regions (VH) and
the corresponding variable light chain regions (VL) for each
construct were specifically arranged from 5'- to 3'-end in
consecutive order:
pST1-5'hAgKozak-V.sub.H.sup..alpha.CLDN6-V.sub.L.sup..alpha.CLDN6-V.sub.H-
.sup..alpha.CD3-V.sub.L.sup..alpha.CD3-His-2hBgUTR-A120 (6RHU5)
pST1-5'hAgKozak-V.sub.H.sup..alpha.CD3-V.sub.L.sup..alpha.CD3-V.sub.H.sup-
..alpha.CLDN6-V.sub.L.sup..alpha.CLDN6-His-2hBgUTR-A120 (6RHU3)
[0582] Table 9 summarizes all bi-scFv constructs specific for the
TAA CLDN6 that were generated in the course of the invention. The
CLDN18.2-specific bi-scFv construct 1BiMAB was used as control
antibody. The bi-scFv constructs were generated by gene synthesis
by GeneArt AG (GeneArt/Life Technologies GmbH, Regensburg, Germany)
using the VH and VL sequences of the corresponding antibodies.
Codon optimizations such as Homo sapiens (HS) or Mus musculus (MM)
were implemented by GeneArt's GeneOptimizer.RTM. software, and are
listed in Table 9. Information on specificity, sequence origin from
monoclonal antibodies (mAB), codon usage, additional sequence
features and references of all applied domains are summarized in
Table 10. Variable domain sequence origin of the respective CD3
antibodies are listed in Table 10. Due to the high homology of
human and mouse TAAs, the same anti-TAA VH and VL sequences could
be used for the generation of bi-scFv constructs for mouse assays,
but in combination with the V.sub.H, V.sup.L sequences of the mouse
specific anti-CD3 antibody clone 145-2C11.
[0583] DNA cloning and expression vector construction was carried
out according to standard procedures (Green/Sambrook, Molecular
Cloning, 2012) well known by the skilled person. Briefly, the
leadoff bi-scFv DNA sequences were provided with a 5'-BsmBI and a
3'-XhoI restriction site for cloning into pST1 plasmids. A
secretion signal sequence was introduced at the 5' end upstream of
the bi-scFv sequence for bi-scFv secretion. A sequence coding for a
15 to 18 amino acid flexible glycine-serine peptide linker was
inserted to join the V.sub.H and V.sub.L domains for the
composition of the single chain variable antibody fragments (scFv)
of which one binds to CD3 and the other to the TAA. To form a
bispecific single chain antibody, the two scFv domain sequences
were connected by a sequence coding for a short peptide linker
(GGGGS). Together with this linker sequence a BamHI restriction
site was introduced for scFv domain exchanges for the cloning of
upcoming bi-scFV constructs. Briefly, 5'scFv-domains could be
exchanged by BsmBI and BamHI restriction and 3'scFv-domains by
BamHI and XhoI restriction. A C-terminal 6.times.His-tag served for
detection analysis of the translated protein. For 6RHU3 replicon
vector production, the full 6RHU3 sequence including secretion
signal and 6.times.His-tag was subcloned 3' to the subgenomic
promoter of the Semliki forest virus replicon vector (pSFV) kindly
provided by K. Lundstrom (Lundstrom, K. et al. (2001) Histochem.
Cell Biol. 115 (1), pp. 83-91; Ehrengruber, M. U. et al. (1999)
Proc. Natl. Acad. Sci. U.S.A. 96 (12), pp. 7041-7046).
[0584] All constructs were verified by sequencing via MWG's single
read sequence service (Eurofins MWG Operon, Ebersberg, Germany) and
only those with correct sequence and a Poly(A) tail of more than
100 adenines were used for in vitro RNA transcription.
[0585] For construct schemata see also FIG. 31 A.
TABLE-US-00010 TABLE 9 Summary of TAA and CD3 specific bispecific
single chain antibody mRNA- template constructs Internal name TAA
Specificity 5'-V.sub.H-V.sub.L 3'-V.sub.H-V.sub.L Codon usage
1BiMAB CLDN18.2 human mCLDN18.2ab TR66 HS 6RHU5 CLDN6 human
mCLDN6ab TR66 HS 6RHU3 CLDN6 human TR66 mCLDN6ab HS 6RMU5 CLDN6
murine mCLDN6ab 145-2C11 MM 6RMU3 CLDN6 murine 145-2C11 mCLDN6ab MM
Bi-scFv indicates bispecific single chain variable fragment; HS,
Homo sapiens; MM, Mus musculus; TAA, tumor associated antigen;
V.sub.H, variable heavy chain domain, V.sub.L, variable light chain
domain.
TABLE-US-00011 TABLE 10 Summary of bi-scFy mRNA-template construct
information CD3 binding moiety Internal mAB Species TAA binding
moiety Species Short name origin reactivity TAA mAB origin
reactivity 5'-V.sub.H-V.sub.L 3'-V.sub.H-V.sub.L linker 1BiMAB TR66
human CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab TR66 GGGGS murine
6RHU5 TR66 human CLDN6 mCLDN6ab human, mCLDN6ab TR66 SGGGGS murine
6RHU3 TR66 human CLDN6 mCLDN6ab human, TR66 mCLDN6ab SGGGGS murine
6RMU5 145-2C11 murine CLDN6 mCLDN6ab human, mCLDN6ab 145-2C11
SGGGGS murine 6RMU3 145-2C11 murine CLDN6 mCLDN6ab human, 145-2C11
mCLDN6ab SGGGGS murine Anti-CD3 Internal Secretion mAB name 5'-long
linker 3'-long linker ssignal Codon usage reference 1BiMAB
(GGGGS).sub.3 VE(GGSGGS).sub.2 MGWSCIILFL HS Lanzayecchia &
Scheidegger, GGVD VATATGVHS Eur J Immunol 1987 6RHU5 (GGGGS).sub.3
VE(GGSGGS).sub.2 MGWSCIILFL HS Lanzayecchia & Scheidegger, GGVD
VATATGVHS Eur J Immunol 1987 6RHU3 VE(GGSGGS).sub.2 (GGGGS).sub.3
MGWSCIILFL HS Lanzayecchia & Scheidegger, GGVD VATATGVHS Eur J
Immunol 1987 6RMU5 (GGGGS).sub.3 VE(GGSGGS).sub.2 MGWSCIILFL MM Leo
et al., Proc Natl Acad GGVD VATATGVHS Sci, 1987 6RMU3
VE(GGSGGS).sub.2 (GGGGS).sub.3 MNSGLQLVF MM Leo et al., Proc Natl
Acad GGVD FVLTLKGIQG Sci, 1987 HS, Homo sapiens; mAB, monoclonal
antibody; MM, Mus musculus; TAA, tumor associated antigen.
[0586] b. IVT-RNA Synthesis
[0587] For the generation of anti-CLDN6-specific bi-scFv IVT
templates, plasmids were linearized downstream the poly(A)-tail
using a class IIs endonuclease. Linearized template DNA was
purified by phenol/chloroform extraction and sodium acetate
precipitation as described elsewhere (Holtkamp, S. et al. (2006)
Blood 108 (13), pp. 4009-4017).
[0588] Linearized DNA templates were subjected to in vitro
transcription using MEGAscript Kits (Ambion/Life Technologies,
Darmstadt, Germany) according to the manufacturer's guidelines:
pST1 templates were transcribed with the MEGAscript T7 Kit and pSFV
templates with the MEGAscript SP6 Kit. For reactions with cap
analoga, the GTP concentration was lowered to 1.5 mM, and 6 mM of
ARCA, beta-S-ARCA(D1), or beta-S-ARCA(D2), synthesized as described
elsewhere (Grudzien, E. et al. (2004) RNA 10 (9), pp. 1479-1487;
Kowalska, J. et al. (2008) RNA 14 (6), pp. 1119-1131; Stepinski, J.
et al. (2001) RNA 7 (10), pp. 1486-1495) was added to the reaction.
Purification of IVT-RNA was carried out with the MEGAclear Kit
(Ambion/Life Technologies, Darmstadt, Germany) according to the
manual. Concentration and quality of the IVT-RNA were assessed by
spectrophotometry and analysis on a 2100 Bioanalyzer (Agilent
Technologies, Santa Clara, Calif., USA).
Example 27: Microscopic Analysis of T Cells Redirected to Target
Cells Secreting CLDN6-Specific Bi-scFv 1BiMAB
[0589] The assay set-up was in principle performed as described
under example 2.a.
[0590] As target cell line a subclone of the ovarian
teratocarcinoma cell line PA-1 (ATCC CRL-1572) that endogenously
expresses high levels of human CLDN6 was used. Human cytotoxic T
cells were isolated by MACS from freshly isolated PBMCs by Pan T
Cell Isolation Kit II, human (Miltenyi Biotec, Teterow, Germany)
according to the manufacturer's guidelines.
[0591] PA-1 target cells--that are routinely tested for TAA
expression by FACS analysis before every assay--were washed twice
with ice cold X-Vivo 15 medium (LONZA, Basel, Switzerland) and
resuspended to a density of 2.times.10.sup.7 cells/ml. 250 .mu.l
cell suspension was transferred to pre-cooled 0.4 cm Gene
Pulser/MicroPulser Cuvettes (Bio-Rad, Dreieich, Germany) and 20
.mu.g/ml IVT-mRNA was added. Conditions using a BTX ECM 830
electroporator (Harvard Apparatus, Holliston, Mass., USA) were: 200
V, 12 ms pulse length, 2 pulses, 400 ms interval length. IVT-mRNAs
used were: 6RHU5, 6RHU3, no.25 (for details see tables 9 and 10).
Transfected target cells were counted and adjusted to
1.times.10.sup.5 cells per ml. 1.times.10.sup.5 target cells were
seeded per well of a 6-well plate and human cytotoxic T cells were
added according to an E:T ratio of 5:1. The final volume per well
was 2 ml. Control samples comprised transfected target cells alone
to proof healthiness after electroporation and control bi-scFv
transfected target cells with effector cells. As positive controls
the corresponding CLDN6-specific bi-scFv proteins 6PHU5 and 6PHU3
were implemented in a concentration of 50 .mu.g/ml. Therefore,
untreated PA-1 cells with human T cells were used. Tissue culture
plates were subsequently incubated at 37.degree. C., 5% CO.sub.2.
Significant effects in terms of T cell clustering on target cells,
formation of an immunologic synapse and target cell killing in
samples containing 6RHU5 or 6RHU3 transfected target cells were
seen after 24 h and recorded with a Nikon Eclipse TS100 inverted
microscope (Nikon, Japan). As shown in FIG. 32, no T cell
clustering or target cell lysis was observed in the control sample
with no.25 transfected target cells implying the strict dependency
on TAA expression to induce an activation of T cells. The mock
control without bi-scFv shows also no T cell clustering. Protein
controls instead led to strong T cell clustering and target cell
lysis.
Example 28: T Cell Activation Induced by CLDN6-Targeting Bi-scFv
Candidates 6RHU5 and 6RHU3
[0592] For the detection of T cell activation and to define
differences in the efficiency of the two CLDN6-specific bi-scFv
variants, a FACS-based T cell activation assay was conducted. The
early activation marker CD69 and the late activation marker CD25
were selected for staining by fluorescence-conjugated antibodies.
For the detection of human T cells in the mixture of target and T
cells, CD3 expressed by all T cells was stained.
[0593] Target and effector cells were prepared as described above
(example 27). Briefly, PA-1 target cells endogenously expressing
CLDN6 were transfected by electroporation with 20 .mu.g/ml of the
following IVT-mRNAs: 6RHU5, 6RHU3 and no.25. No. 25, targeting a
non-expressed TAA, served as specificity control, untreated target
cells as mock control. As positive control 50 ng/ml 6PHU5 protein
was used. Further, T cells were seeded without target cells with or
without 6PHU5 protein as background activation references. Each
sample was seeded in duplicate in 6-well plates and incubated at
37.degree. C., 5% CO.sub.2. After 24 h and 48 h T cells were
harvested by scraping and transferred to 5 ml round bottom tubes
(BD Falcon, Heidelberg, Germany). Cells were centrifuged and washed
with DPBS. For cell staining Mouse Anti-Human CD3-FITC, Mouse
Anti-Human CD69-APC, and Mouse Anti-Human CD25-PE (all antibodies
BD Biosciences, Heidelberg, Germany) were used. Cell pellets were
resuspended in 50 .mu.l FACS-buffer (DPBS supplemented with 5 FBS)
containing the fluorescence-conjugated antibodies and 2 .mu.l 7-AAD
(BD Biosciences, Heidelberg, Germany). After incubation for 20 min
at 4.degree. C. in the dark, samples were washed with 4 ml DPBS and
cell pellets were resuspended in 200 .mu.l FACS buffer. Samples
were kept on ice and dark throughout the measurement with a
FACSCanto II flow cytometer (both BD Biosciences, Heidelberg,
Germany). Analysis was evaluated by FlowJo software (Tree Star, San
Carlos, Calif., USA).
[0594] As shown in FIGS. 33 A and B both variants led to T cell
activation, whereas none of the negative controls showed
significant expression of T cell activation markers CD69 or CD25.
Total T cell activation in response to 6RHU3 was 1.53-fold higher
after 24 h (A) and 1.35-fold higher after 48 h (B) of coincubation
than in response to 6RHU5. Based on these findings all further
studies were conducted with variant 6RHU3 only.
Example 29: Concentration Dependent T Cell Activation by
Coincubation with 6RHU3 Transfected Target Cells
[0595] For the determination of the lowest 6RHU3 IVT-mRNA
concentration necessary to induce a target-dependent T cell
activation a dilution range from 0.2-20 .mu.g/ml IVT-mRNA was
transfected into PA-1 target cells. To expose all samples to the
same stress level by RNA electroporation, a total concentration of
20 .mu.g/ml IVT-mRNA was transfected. No. 25--targeting a
non-expressed TAA--was used as fill-up IVT-mRNA. Accordingly, 0
.mu.g/ml 6RHU3 correlates to 20 .mu.g/ml no.25. Electroporation was
performed as described under example 27. Human T cells were used as
effector cells. Isolation from PBMCs was performed following the
manufacturers manual (Pan T Cell Isolation Kit II, Miltenyi,
Teterow, Germany). Effector and target cells were mixed in a 5:1
ratio. Untreated target cells with T cells served as mock control.
Further, T cells were seeded without target cells with or without
6PHU5 protein as background activation references. As positive
control, untreated target cells were mixed with T cells and 50
ng/ml 6PHU5 protein. All samples were prepared in duplicates in
6-well plates.
[0596] Target and effector cells were coincubated for 48 h at
37.degree. C., 5% CO.sub.2. Samples were prepared for flow
cytometric analysis as described under example 28.
[0597] In FIG. 34 the percentage of CD3-positive T cells that
express activation markers is plotted. No T cell activation was
observed in the controls. Detection of a significant T cell
activation started at a concentration of 0.7 .mu.g/ml 6RHU3
IVT-mRNA. Effects in response to 2.0 .mu.g/ml 6RHU3 IVT-mRNA were
comparable to those mediated by 50 ng/ml 6PHU5 protein control.
Hence, protein translation and secretion from transfected IVT-mRNA
seems to be an efficient process.
Example 30: Determination of EC.sub.50 for 6RHU3
[0598] For the determination of the half maximal effective dose of
bi-scFv encoding IVT-mRNA 6RHU3, a titration row of 6RHU3 was
tested in an in vitro luciferase cytotox assay. Stably
luciferase-expressing PA-1 cells were transiently transfected by
electroporation as described under example 27. 6RHU3 IVT-mRNA
concentrations used ranged from 0.004-13.3 .mu.g/ml in 6 dilution
steps. Total IVT-mRNA concentration was constantly set to 13.3
.mu.g/ml, no.25 was used as fill-up IVT-mRNA. As minimum lysis
controls (L.sub.min) all transfected target cell samples were
seeded without effector cells. By this procedure the background
dead cells of each individual electroporation sample is subtracted
and only T cell mediated lysis effects will be obtained.
Transfected target cells were seeded with human T cells in an
effector to target ratio of 5:1 in triplicates in a 96-well format
and incubated at 37.degree. C., 5% CO.sub.2. Maximum lysis
(L.sub.max) for the normalization to spontaneous luminescence
counts was achieved by addition of Triton X-100 to control wells
containing effector and non-treated target cells shortly prior to
luciferin addition. After addition of luciferin solution--per well
50 .mu.l of a water solution containing 1 mg/ml luciferin (BD
Monolight, BD Biosciences, Heidelberg, Germany) and 50 mM
HEPES--the luminescence was measured in an Infinite M200 Tecan
microplate reader after 24 h and 48 h. Specific target cell lysis
was calculated by the formula: % specific
lysis=[1-(luminescence.sub.test sample-L.sub.max)/(L.sub.min_test
sample-L.sub.max)].times.100.
[0599] FIG. 35 depicts the concentration-dependent curve for
specific target cell lysis in response to 6RHU3. Using GraphPad
Prism equation "log(agonist) vs. response--Variable slope" for
calculation of EC.sub.50 values revealed an EC50 (24 h)=548.0
ng/ml, and an EC50 (48 h)=194.5 ng/ml. The outcome of this assay
strongly depends on the potency of the human T cells which varies
according to the immune status of the donor as also reported by
others (see e.g. (Lutterbuese, R. et al. (2010) Proc. Natl. Acad.
Sci. U.S.A. 107 (28), pp. 12605-12610). Therefore, results can
differ with each donor.
Example 31: T Cell Proliferation in Response to 6RHU3 IVT-mRNA
Transfection
[0600] T cell proliferation is an indicator of T cell activation.
To show specific T cell proliferation in response to bi-scFv
encoding IVT-mRNA 1BiMAB in the presence of CLDN6 positive target
cells, a flow cytometric assay was used. Briefly, 1.times.10.sup.7
human T cells isolated as described under example 16 were stained
with 1 .mu.M carboxyfluorescein diacetate succinimidyl ester
(CellTrace CFSE, Invitrogen/Life Technologies GmbH, Germany)
dissolved in DPBS in the dark at RT for 5 min. Cells were washed
twice with DPBS/5% FCS and resuspended in assay medium to
2.times.10.sup.6 cells per ml. As target cells, PA-1 endogenously
expressing CLDN6 and--for specificity testing--the CLDN6-negative
breast cancer cell line MDA-MB-231 were chosen. 20 .mu.g/ml of
IVT-mRNAs 6RHU3 or a non-targeting control were used for
electroporation. Electroporation of PA-1 was performed as described
under example 27. MDA-MB-231 electroporation was conducted using
the following conditions: 400 V, 3 ms pulse length, 1 pulse, 400 ms
interval length in 0.4 cm Gene Pulser/MicroPulser Cuvettes
(Bio-Rad, Dreieich, Germany). A cytotox assay as described under
example 27 was set up with the transfected target cells and human
CFSE-labeled T cells as effector cells. T cells alone and
untransfected or control transfected target cells plus T cells were
used as negative controls. T cells alone stimulated with 5 .mu.g/ml
OKT3 (Bio X Cell, West Lebanon, N.H., USA) and 2 .mu.g/ml anti-CD28
(BioLegend, Fell, Germany) served as positive control. 6PHU3
protein in a concentration of 5 ng/ml was applied to untransfected
target plus T cells to confirm the assay validity. Samples combined
with the non-targeting bi-scFv protein 1BiMAB were included as
specificity control. All samples were set up in triplicates in a
total volume of 0.2 ml assay medium in 96 wells. After 72 h of
coincubation, T cells were harvested, collected in 5 ml round
bottom tubes, washed and stained at 4.degree. C. for 30 min with 2
.mu.l anti-CD45-APC to differentiate human T cells from tumor cells
and 0.25 .mu.l eFluor506 (BD Biosciences, Heidelberg, Germany) to
counterstain dead cells in 200 .mu.l DPBS. After washing with DPBS,
cells were resuspended in FACS-buffer and analyzed with a FACSCanto
II (BD Biosciences, Heidelberg, Germany).
[0601] Proliferation of T cells was detected by decreasing
CFSE-signal only in the presence of CLDN6 positive target cells and
anti-CLDN6-specific bi-scFv (see also FIG. 36). Besides the
positive control, T cell proliferation of 49-61% could be observed
in the presence of CDLN6 positive target cells in combination with
6PHU3 protein. Target positive cells transfected with 6RHU3
IVT-mRNA led to 62%+/-2%. T cells incubated with CLDN6 negative
target cells MDA-MB-231 do not show a significant proliferation in
any constellation as well as T cells without target cells except
for the positive control.
Example 32: Qualitative Analysis of Protein Production after 6RHU3
IVT-RNA Transfection of Mammalian Cells
[0602] For the investigation of RNA translation into protein in
mammalian cells the cell line BHK21 (ATCC CRL-13001) was chosen as
expression system. 2.times.10.sup.7 BHK21 cells per ml were
transfected by electroporation as described under example 16 with
the difference that all steps were conducted at RT. 250 .mu.l cell
suspension was transferred to 0.4 cm Gene Pulser/MicroPulser
Cuvettes (Bio-Rad, Dreieich, Germany) and 40 .mu.g/ml no.25
IVT-mRNA, 6RHU3 IVT-mRNA or 6RHU3 IVT-replicon RNA was added.
Electroporation conditions were as follows: 300 V, 16 ms pulse
length, 1 pulse, 400 ms interval length.
[0603] Electroporated cells were resuspended in RT culture medium
(RPMI1640, 10% FCS) and transferred into 15 cm culture dishes. 5 h
after seeding, medium containing FCS was replaced by FCS-free
medium. In case of examples 32 a and b, 18 h after electroporation
cell culture supernatant and cells were harvested separately. Cell
pellets were lysed in 1.times.LDS sample buffer (cat. no. NP0008;
Life technologies, Darmstadt, Germany) and heated at 72.degree. C.
for 15 min. For ELISA analysis non-concentrated and approximately
50-fold concentrated supernatant was used. Concentration was
carried out with Amicon ultra-15 centrifugal filter units (Merck
Millipore, Billerica, Mass., USA) according to the manufacturer's
protocol. In case of example 32 c (IVT-mRNA only), supernatant was
harvested 48 h post transfection and subjected to 40.times.
concentration as described above.
[0604] a. ELISA Using Supernatant
[0605] For ELISA analysis Nickel coated plates (Thermo Fisher
Scientific, Bonn, Germany) were used for capturing the analyte via
its His-Tag. First, the plate was washed three times with 200 .mu.l
wash buffer (0.01% Tween-20 in 1.times.PBS) per well. As standard,
purified 6PHU3 protein was diluted into 1.75 Na-Casein in
1.times.PBS(=diluent). The dilution row ranged from 2.34 to 150
ng/ml in steps of 2. 100 .mu.l per standard dilution was
transferred to the wells in triplicates of each concentration.
Accordingly, 100 .mu.l of the samples was transferred in
triplicates. The plate was sealed with an adhesive film and
incubated at 37.degree. C. for 30 minutes. Afterwards, the plate
was washed three times with 200 .mu.l wash buffer per well. For the
detection of 6PHU3/6RHU3, the anti-idiotypic monoclonal IgG 4F9
that specifically binds to V.sub.H-V.sub.L of mCLDN6ab and
therefore also to 6PHU3/6RHU3, was used. 4F9 was mixed into the
diluent to a final concentration of 2.5 .mu.g/ml 100 .mu.l of the
anti-idiotypic antibody solution was transferred to each well
followed by an incubation time of 30 min at 37.degree. C.
Subsequently, the plate was washed 3.times. with 200 .mu.l wash
buffer per well and 100 .mu.l of an AP-conjugated anti-mouse
detection antibody (Jackson Immuno Research Laboratories, West
Grove, Pa., USA) diluted 1:500 in diluent was added to each well
followed by 30 min incubation at 37.degree. C. After a final wash
step (3.times.200 .mu.l wash buffer), 1.5 mg/ml of the substrate
pNPP in appropriate substrate buffer (1 M Diethanolamine, 0.5 mM
MgCl.sub.2, 0.01% Na-azide, pH 9.8) was added to each well,
followed by incubation for 30 min at RT in the dark. 100 .mu.l of 3
M KOH was used for each well to stop the enzymatic reaction.
Absorbance was measured with a microplate-reader (Infinite M200,
Tecan, Mannedorf, Switzerland). For dual wavelength analysis 405 nm
was chosen as measurement wavelength and 492 nm as reference
wavelength. Absorbance values were calculated by subtraction of
reference wavelength from measurement wavelength.
[0606] In FIG. 37 A the mean absorbance values including standard
deviations are plotted. Concentrated supernatant from 6RHU3
IVT-mRNA and IVT-replicon transfected cells led to significant
signals proving the translation of bi-scFv encoding IVT-RNA.
Concentrated supernatant from mock and no.25 control (-ctrl)
transfected cells did not result in any signal as expected. Actual
protein concentrations cannot be proposed because of different
toxicity of the IVT-mRNA and IVT-replicon constructs and slightly
different x-fold concentrates. Estimation of approximate protein
concentration in non-concentrated supernatant was in the range of
1.4 ng/ml for IVT-replicon and 5.9 ng/ml for IVT-mRNA samples.
[0607] b. Western Blot Analysis of Supernatant and Cell Lysates
(IVT-mRNA and -Replicon Samples)
[0608] For analysis by Western blot, concentrated supernatants and
cell lysates were separated on NuPAGE Novex 4-12% Bis-Tris Gels
(Invitrogen/Life Technologies GmbH, Darmstadt, Germany).
Supernatant and cell lysate of BHK21 cells transfected with 6RHU3
IVT-mRNA, IVT-replicon RNA, no.25 IVT-mRNA or of untreated cells
and a positive control--0.1 .mu.g purified 6PHU3 protein--were
loaded. Western blot analysis was performed by standard procedures
(Current Protocols in Protein Science, 2012). Briefly, after
blotting proteins on PVDF membrane and blocking with PBST/3% milk
powder, the membrane was incubated for 1 h at 4.degree. C. with
primary antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg,
Germany) diluted 1:500 in blocking buffer. After repeated washing
with blocking buffer, membranes were incubated with Fc-specific
secondary peroxidase-conjugated goat-anti-mouse IgG antibody (Sigma
Aldrich, Germany) diluted 1:10000 in blocking buffer for 1 h at
4.degree. C. After repeated washing again with blocking buffer, the
signals were visualized by SuperSignal West Femto Chemiluminescent
Substrate (Pierce/Thermo Fisher Scientific, Rockford, Ill., USA)
and recorded by an ImageQuant LAS 4000 Imager (GE Healthcare Life
Sciences, Munich, Germany). Signals of 6PHU3 were detected between
50 and 60 kD as compared to the internal molecular weight
standard.
[0609] As shown in FIG. 37 B signals were detected in supernatants
of no.25 IVT-mRNA (lane 1), 6RHU3 IVT-mRNA (lane 4) and 6RHU3
IVT-replicon RNA (lane 5) transfected cells, whereas lane 6 with
supernatant from untreated cells is without signal. Strong signals
could be generated with cell lysates of 6RHU3 IVT-mRNA (lane 8) and
IVT-replicon RNA (lane 9) transfected cells. Cell lysate from no.25
transfected cells led to a very weak signal (lane 2), untreated
cells (lane 10) showed no signal. Purified 6PHU3 protein control
(lane 11) could be detected. The relatively weak signals in the
supernatant and with it the weak 6RHU3 secretion are probably owed
to the relatively short incubation time after transfection. Due to
the toxic effect of the replicon RNA longer incubation times could
not be tested.
[0610] Both analyses--ELISA and Western blot--are of qualitative
nature and do not serve as protein concentration
determinations.
[0611] c. Western Blot Analysis of Supernatant (IVT-mRNA
Samples)
[0612] Supernatant collected 48 h post transfection was separated
by SDS-PAGE followed by Western blot analysis as described under
example 32 b. As shown in FIG. 37 C, no.25 and 6RHU3 translated
from IVT-mRNA and secreted into the supernatant were detected via
their His-tag. Herewith, the production and secretion of 6RHU3 as
well as of no.25 that has been used as bi-scFv specificity control
could be proven.
Example 33: Detection of In Vivo Translated and Functional
CLDN6-Specific Bi-scFv Protein after Intramuscular RNA
Injection
[0613] Female and male NSG mice at an age of 8-16 weeks were
selected and distributed into 4 groups a 5 mice. 40 .mu.l RNA
solution was injected per mouse and femoral muscle. 40 .mu.l RNA
solution consisted of 1.times.PBS, 5 .mu.g D2-capped 6RHU3 IVT-mRNA
or replicon, 2 .mu.g D1-capped luciferase IVT-mRNA and 0 or 15
.mu.g D1-capped EBK IVT-mRNA. The EBK IVT-mRNA encoding the
vaccinia virus proteins E3L, B18R and K3L (EBK) were coinfected to
inhibit IFN response and to counteract PKR activation for the
purpose of RNA translation enhancement (Patent Application
PCT/EP2012/04673). Luciferase signal was monitored 24 h post
injection with a Xenogen IVIS 2000 to exclude mice without signal
from sample collections.
[0614] Blood was collected 7 days post injection. Serum was
harvested and subsequently frozen at -80.degree. C.
[0615] Cytotox Assay
[0616] Sera of NSG mice were analyzed in an in vitro cytotox assay.
PA-1 target cells stably transduced with firefly luciferase and
endogenously expressing CLDN6 were seeded with human T cells
(isolated as described under example 16) in an E:T ratio of 30 to 1
for maximum sensitivity. Assay medium consisted of RPMI 1640 medium
supplemented with 10% heat inactivated FCS, 0.5%
penicillin-streptomycin, lx NEAA and 1 mM sodium pyruvate
(Gibco/Life Technologies GmbH, Darmstadt, Germany). 20 .mu.l of
thawed test serum was added per test sample well. 6PHU3 protein
standard control wells, L.sub.min and L.sub.max wells were
completed with 20 .mu.l serum of untreated NSG mice. Final volume
per well was 100 .mu.l. L.sub.min was seeded twelvefold, L.sub.max
sixfold and test samples in triplicates. After 48 h incubation at
37.degree. C., 5% CO.sub.2 L.sub.max wells were mixed with 10 .mu.l
2% Triton X-100 solution and incubated for 10 min. To all other
wells 10 .mu.l assay medium was added. 50 .mu.l luciferin solution
(see example 23) were added and plates were measured--after a 30
min incubation step at 37.degree. C. in the dark--in an Infinite
M200 microplate reader (TECAN, Mannedorf, Switzerland). Calculation
of specific target cell lysis was performed as described under
example 23.
[0617] In FIG. 38 the percentage of specific lysis is plotted.
Significant cytotoxic effects were detected in each group.
CLDN6-specific bi-scFv protein concentration was significantly
increased by EBK coinjection in the case of 6RHU3 IVT-mRNA.
[0618] These data prove the in vivo translation of 6RHU3 from
IVT-mRNA or -replicon and the secretion into the blood stream after
intramuscular injection.
Example 34: Generation and Testing of Bispecific Binding Agents
Targeting CLDN18.2 or CLDN6 and CD3
[0619] In the further development of anti-CLDN18.2 and anti-CLDN6
specific bi-scFv antibody fragments different aspects for an
optimization of the original protein were addressed. These aspects
referred mainly towards obtaining preparations with higher
homogeneity with respect to different folding species, disulfide
isomers, and oligomers which might form upon recombinant protein
production. These modifications should not be prejudicial to the
functional activity of the bi-scFv proteins.
[0620] Substitution of the Extra (Unpaired) Cysteine Residue in the
Anti-CD3 Binding Domain of the Bi-scFv Proteins
[0621] In order to investigate whether unpaired cysteine residues
occurring within the primary sequence of an Ig domain might
interfere with the correct formation of the intrachain and/or
interchain disulphide bounds which are essential for the proper
folding and the stability of the resulting antibody fragment or
not, several synthetic constructs were generated. Such unpaired
cysteines might compromise efficacy, homogeneity, productivity and
stability of the final protein product and should therefore be
avoided. In addition to the "standard" set of cysteines involved in
disulfide pairing free cysteine residues can be present in the
variable domains.
[0622] For example in the VH domain from the OKT3 antibody, three
residues before the start of CDR-H3 a conserved cysteine at
position H92 is present and forms a structural disulfide bond with
position H22. But in this molecule at the position H100A (CDR-H3),
another Cysteine (Cys) could allow mis-folding where H100A instead
of H92 is involved in forming the disulfide bond with H22, thereby
generating a mis-folded, insoluble and non-functional product. To
overcome this possible mis-pairing of the cysteine residues, site
directed substitution of the free cysteine was performed
(Kipriyanov, Protein Engineering 10:445-453, 1997). By this single
substitution a significant increase of productivity and stability
of the scFv derived from OKT3 was achieved maintaining the overall
binding activity.
[0623] The VH domain of the anti-CD3 antibody TR66 (SEQ ID NO: 36)
used in the present study contains such a free cysteine at position
H103 of the primary sequence as shown in SEQ ID NO: 36. Sequence
comparison of the VH domain of the anti-CD3 antibody TR66 (SEQ ID
NO: 36) with the VH domain of the anti-CD3 antibody OKT3 shows
96.6% sequence homology. Following these results, a substitution of
the free cysteine by a serine residue within the CDR-H3 of the VH
domain of the anti-CD3 antibody TR66 was performed for bi-scFv
proteins targeting CD3 (SEQ ID NO: 94) and either for CLDN18.2 or
CLDN6. The introduction of such substitutions results in the design
of the bi-scFv proteins 1-BiMAB-S(SEQ ID NO: 103) and 6-PHU3-S(SEQ
ID NO: 101) (see Tables 11 and 12, respectively).
[0624] Substitution of the Extra (Unpaired) Cysteine Residues in
Anti-CLDN6 Bi-scFv Proteins
[0625] The parental anti-CLDN6 antibody mCLDN6ab, whose variable
domains were used for the assembly of the corresponding bi-scFv
proteins 6PHU3 (SEQ ID NO: 45) and 6PHU5 (SEQ ID NO: 43), contains
an unpaired cysteine residue within the flanking region of the
CDR-L2 of the VL domain at position 46 of the corresponding primary
sequence. This corresponds to position 45 within SEQ ID NO: 23
where the first amino acid of the VL has been omitted. Different
substitutions were performed to substitute this free cysteine by:
[0626] a serine residue in analogy to the substitution in the VH
domain of the anti-CD3 antibody TR66 (SEQ ID NO: 100). [0627] a
leucine residue, by comparison with the amino acid sequence of
other anti-CLDN6 antibodies (SEQ ID NO: 97 and 98). [0628] a
tryptophan residue, by amino acid sequence comparison with the
germline database (SEQ ID NO: 99).
[0629] Evaluation of Linker Length, Order of V-Domains and
Artificial Interface Disulfide Bonds in Anti-CLDN18.2 Bi-scFv
Proteins
[0630] As another example Arndt et al. (Biochemistry
37:12918-12926, 1998) describe the so called domain swapping as a
possible explanation for the appearance of non-covalently linked
oligomers of scFv fragments. Under this model the protein state is
subjected to a possible thermodynamic equilibrium between a
monomeric and a dimeric/oligomeric form due to a constantly
occurring intra- and intermolecular exchange of the VL/VH interface
contacts. These oligomers could be present already in the cell
culture supernatant and should be eliminated during the
purification process. However these molecular species could be also
formed during the storage of purified monomeric species.
[0631] The preferred energetic status of the protein is strongly
influenced by its overall design (primary sequence, linker length,
VL/VH orientation etc.).
[0632] Worn and Pluckthun (JMB 305:989-1010, 1999) mentioned that
forms with higher content of monomeric species could be obtained by
using a linker of 20 or more residues. Desplancq et al., (Protein
Eng. 7:1027-1033, 1994) indicated that the variable domain
orientation could also have an impact on the formation of dimers
and high molecular forms. In the same publication Desplancq showed
that a linker of 25 or 30 amino acids (aa) gave the best ratio of
monomer over dimer for their particular antibody. The distance
between the C-terminus of VL and the N-terminus of VH is around
39-43 .ANG., and the distance between the C-terminus of VH and
N-terminus of VL is 32-34 .ANG. (Pluckthun et al., From PCR to
fermentation. (J. McCafferty, H. R. Hoogenboom, & D. J.
Chriswell, Eds.). In: (IRL Press., pp. 203-252, 1996). To obtain
similar molecular properties, a linker for the orientation VL-VH
has to be longer than a VH-VL linker. Pluckthun et al., (From PCR
to fermentation. (J. McCafferty, H. R. Hoogenboom, & D. J.
Chriswell, Eds.). In: (IRL Press., pp. 203-252, 1996) recommended
using linkers with a length of 15 or 20 amino acids in the
orientation VH/VL and linkers with a length of 20 or 25 amino acids
in the orientation VL/VH.
[0633] Another possibility to force the formation of monomers and
to stabilize the VH/VL domain interaction is to engineer an
interface disulfide bond into the contact surface between the two
domains. The introduction of a disulfide bridge at the position
H44-L100 (Kabat numbering) has been the most frequently used in
scFvs with satisfactory results (Brinkmann et al., PNAS.
90:7538-7542, 1993; Worn and Pluckthun, Biochemistry 38: 8739-8750,
1999; Weatherill et al., PEDS. 25:321-329, 2012). This strategy has
been used successfully to stabilize IgG-like bispecific antibodies
combining scFv fused to full length IgG (Michaelson et al., mAbs 1:
128-141, 2009; Schanzer et al., Antimicrob. Agents. Chemother.
55:2369-2378, 2011).
[0634] Weatherill et al., (PEDS 25:321-239, 2012) stabilized human
scFvs (VH-(G4S).sub.4-VL and VL-(G4S).sub.4-VH) with a disulfide
bond between the position V.sub.H44 and V.sub.L-100. Moreover this
publication address the problem of possible domain swapping with
scFv containing no interface disulfide bond by performing different
SE-HPLC experiments at different load volume and concentration. The
assays gave different results depending on the sample loading
conditions for the non-stabilized scFv, but independent of the
conditions used the disulfide stabilized molecules eluted like a
monomer. Zhao et al., (Int. J. Mol. Sci. 12:1-11, 2011) introduced
the same mutation in a scFv and observed higher stability of the
stabilized molecule after storage for 20 h at 37.degree. C.
[0635] For the bispecific format using scFv fused to full length
IgG, Schanzer et al., (Antimicrob. Agents Chemother. 55:2369-2378
2011) compared the effect of the linker length and interface
disulfide bond. They fused the parental scFv or scdFv
(VH-(G4S)3-VL) either at the C- or N-terminal part of the heavy
chain or light chains. For the different linker length (20, 25 and
30 amino acids) they fused the parental scFv to the C-terminal part
either of the heavy or light chains. The results obtained with the
different linker length identified the 30 aa peptide as the more
preferable linker for the production of stable monomers. The level
of aggregates after 7 days storage at 40.degree. C. was 50% for
scFv.sub.15, 18% for scFv.sub.20, 8% for scFv.sub.25 and 6% for
scFv.sub.30. But the disulfide scFv.sub.15 stabilized with the
interface disulfide bond was slightly superior to the scFv.sub.30.
The same approach was used by Michaelson et al., (mAbs, 1:128-141
2009), and they improved their parental IgG-like bispecific
antibody containing scFv with 15 aa linker in VH/VL orientation
(generating 40% aggregates), by increasing the linker length to 20
aa of the scFv and introducing the interface disulfide bond between
the position V.sub.H44 and V.sub.L-100. The resulting molecule
yielded more than 98% monomers that were stable after three months
at 4.degree. C. The authors took the decision to work on the
improvement of the scFv molecule before going to the bispecific
format.
[0636] In the case of anti-CLDN18.2 specific bi-scFv proteins, it
is not known if the formation of dimers and high molecular forms
could occur and what is the implication on the anti-Claudin and/or
the anti-CD3 scFv molecules. In order to assess an optimal overall
molecule for the anti-CLDN18.2 specific bi-scFv protein for each
separate scFv the following modifications have been evaluated:
[0637] domain orientation [0638] linker length [0639] introduction
of an interface disulfide bond [0640] Combination of the three
modifications
[0641] For the anti-Claudin 18.2 binding domain, in addition to the
variable domains derived from the mCLDN18.2ab (VH: SEQ ID NO: 8;
VL: SEQ ID NO: 15), the sequences derived from the mCLDN18.2ab1
(VH: SEQ ID NO: 6; VL: SEQ ID NO: 11) have been used for the
construction of anti-CLDN18.2 specific bi-scFv proteins.
[0642] Table 11 in section A.a "Sequence origin, design of 32
anti-CLDN18.2 specific bi-scFv constructs, and cloning into
expression vectors" describes the different constructs.
[0643] A. Generation and Testing of Bispecific Binding Agents
Targeting CLDN18.2 and CD3
[0644] a. Sequence Origin, Design of 32 Anti-CLDN18.2 Specific
Bi-scFv Constructs, and Cloning into Expression Vectors
[0645] The bispecific tandem single chain antibody constructs
bi-scFv presented herein contain two distinct binding domains from
which the first is specific for a human tumor associated antigen
(TAA), whereas the second is specific for the .epsilon.-chain of
human T cell receptor (CD3). Each of the two binding domains of the
bispecific molecule comprises two antibody variable domains,
arranged as scFv moiety in either VH-VL or VL-VH orientation. The
antibody variable domains are connected via a flexible
glycin-serine peptide linker consisting of four or five repeats of
a G.sub.4S subunit, dependent on the orientation. Thus, the scFv
moieties arranged in the VH-VL orientation are connected by a 20
amino acid linker (named "LL4"), the VL-VH is connected by a 25
amino acid linker (named "LL5"). The two scFv moities on the other
hand are connected via a six amino acids long SG.sub.4S linker
(named "SL"). Information on sequence origin from monoclonal
antibodies (mAB) and domain organization are summarized in Table
11.
[0646] The variants 5504, 5505, 5506, 5507, 5512, 5513, 5514, 5515,
5520, 5521, 5522, 5523, 5528, 5529, 5530, 5531, 5536, 5537, 5538,
5539, 5544, 5545, 5546, 5547, 5552, 5553, 5554, 5555, 5560, 5561,
5562 and 5563 comprises the VH anti-CD3 with the SEQ ID NO: 95 and
the VL anti-CD3 with the SEQ ID NO: 96.
[0647] In the particular case of the 1-BiMAB-S, only the
substitution of the free cysteine by a serine in the VH anti-CD3
(SEQ ID NO: 94) is done in comparison to the amino acid sequence of
the 1-BiMAB sequence (SEQ ID NO: 39). It should be noted that SEQ
ID NO: 39 still contains the amino acid sequence of an N-terminal
signal sequence which mediates the secretion of the 1-BiMAB bi-scFv
protein into the cell culture supernatant upon mammalian
expression. This signal sequence is not part of the secreted
recombinant protein since it is cleaved off by a signal peptidase
in the lumen of the reticulum endoplasmic reticulum.
[0648] The genes encoding the bi-scFv constructs were generated via
GeneArt.RTM. gene synthesis (Life Technologies GmbH, Darmstadt,
Germany) using the GeneOptimizer.RTM. software to optimize the
codon usage for expression in CHO cells. Besides a common secretion
signal, all DNA constructs contain the same Kozak sequence and a
HindIII restriction at the 5' end. At the 3' end BsiWI and XhoI
recognition sites were added to allow for flexible subcloning into
different expression vectors. Subcloning into the expression vector
of choice pCEP4 (Life Technologies GmbH, Darmstadt, Germany) was
performed by Life Technologies using the HindIII and XhoI
restriction sites.
TABLE-US-00012 TABLE 11 Summary of the bi-scFv anti-CLDN18.2
constructs Anti- Substitution Domain order Variant Anti-CLDN18.2
CD3 at pos. H103 (from N- to SEQ ID identification origin origin of
TR66 C-terminal) Domain organization*.sup.) NO: 1 BiMAB-S
mCLDN18.2ab TR66 Serine scFv-anti-CLDN18.2- See 1 BiMAB in Example
1 103 scFv anti-CD3 5504 mCLDN18.2ab1 TR66 Serine
scFv-anti-CLDN18.2- VH-LL4-VL-SL-VH-LL4-VL 66 scFv anti-CD3 5505
mCLDN18.2ab1 TR66 Serine scFv-anti-CLDN18.2-
ds-(VH-LL4-VL)-SL-VH-LL4-VL 67 scFv anti-CD3 5506 mCLDN18.2ab TR66
Serine scFv-anti-CLDN18.2- VH-LL4-VL-SL-VH-LL4-VL 68 scFv anti-CD3
5507 mCLDN18.2ab TR66 Serine scFv-anti-CLDN18.2-
ds-(VH-LL4-VL)-SL-VH-LL4-VL 69 scFv anti-CD3 5512 mCLDN18.2ab1 TR66
Serine scFv-anti-CLDN18.2- VH-LL4-VL-SL-ds(VH-LL4-VL) 70 scFv
anti-CD3 5513 mCLDN18.2ab1 TR66 Serine scFv-anti-CLDN18.2-
ds-VH-LL4-VL-SL-ds(VH-LL4-VL) 71 scFv anti-CD3 5514 mCLDN18.2ab
TR66 Serine scFv-anti-CLDN18.2- VH-LL4-VL-SL-ds(VH-LL4-VL) 72 scFv
anti-CD3 5515 mCLDN18.2ab TR66 Serine scFv-anti-CLDN18.2-
ds-VH-LL4-VL-SL-ds(VH-LL4-VL) 73 scFv anti-CD3 5520 mCLDN18.2ab1
TR66 Serine scFv-anti-CLDN18.2- VH-LL4-VL-SL-VL-LL5-VH 74 scFv
anti-CD3 5521 mCLDN18.2ab1 TR66 Serine scFv-anti-CLDN18.2-
ds-(VH-LL4-VL)-SL-VL-LL5-VH 75 scFv anti-CD3 5522 mCLDN18.2ab TR66
Serine scFv-anti-CLDN18.2- VH-LL4-VL-SL-VL-LL5-VH 76 scFv anti-CD3
5523 mCLDN18.2ab TR66 Serine scFv-anti-CLDN18.2-
ds-(VH-LL4-VL)-SL-VL-LL5-VH 77 scFv anti-CD3 5528 mCLDN18.2ab1 TR66
Serine scFv-anti-CLDN18.2- VH-LL4-VL-SL-ds(VL-LL5-VH) 78 scFv
anti-CD3 5529 mCLDN18.2ab1 TR66 Serine scFv-anti-CLDN18.2-
ds-VH-LL4-VL-SL-ds(VL-LL5-VH) 79 scFv anti-CD3 5530 mCLDN18.2ab
TR66 Serine scFv-anti-CLDN18.2- VH-LL4-VL-SL-ds(VL-LL5-VH) 80 scFv
anti-CD3 5531 mCLDN18.2ab TR66 Serine scFv-anti-CLDN18.2-
ds-VH-LL4-VL-SL-ds(VL-LL5-VH) 81 scFv anti-CD3 5536 mCLDN18.2ab1
TR66 Serine scFv-anti-CLDN18.2- VL-LL5-VH-SL-VH-LL4-VL 82 scFv
anti-CD3 5537 mCLDN18.2ab1 TR66 Serine scFv-anti-CLDN18.2-
ds-(VL-LL5-VH)-SL-VH-LL4-VL 83 scFv anti-CD3 5538 mCLDN18.2ab TR66
Serine scFv-anti-CLDN18.2- VL-LL5-VH-SL-VH-LL4-VL 84 scFv anti-CD3
5539 mCLDN18.2ab TR66 Serine scFv-anti-CLDN18.2-
ds-(VL-LL5-VH)-SL-VH-LL4-VL 85 scFv anti-CD3 5544 mCLDN18.2ab1 TR66
Serine scFv-anti-CLDN18.2- VL-LL5-VH-SL-ds(VH-LL4-VL) 86 scFv
anti-CD3 5545 mCLDN18.2ab1 TR66 Serine scFv-anti-CLDN18.2-
ds-VL-LL5-VH-SL-ds(VH-LL4-VL) 87 scFv anti-CD3 5546 mCLDN18.2ab
TR66 Serine scFv-anti-CLDN18.2- VL-LL5-VH-SL-ds(VH-LL4-VL) 88 scFv
anti-CD3 5547 mCLDN18.2ab TR66 Serine scFv-anti-CLDN18.2-
ds-VL-LL5-VH-SL-ds(VH-LL4-VL) 89 scFv anti-CD3 5552 mCLDN18.2ab1
TR66 Serine scFv-anti-CLDN18.2- VL-LL5-VH-SL-VL-LL5-VH -- scFv
anti-CD3 5553 mCLDN18.2ab1 TR66 Serine scFv-anti-CLDN18.2-
ds-(VL-LL5-VH)-SL-VL-LL5-VH -- scFv anti-CD3 5554 mCLDN18.2ab TR66
Serine scFv-anti-CLDN18.2- VL-LL5-VH-SL-VL-LL5-VH -- scFv anti-CD3
5555 mCLDN18.2ab TR66 Serine scFv-anti-CLDN18.2-
ds-(VL-LL5-VH)-SL-VL-LL5-VH -- scFv anti-CD3 5560 mCLDN18.2ab1 TR66
Serine scFv-anti-CLDN18.2- VL-LL5-VH-SL-ds(VL-LL5-VH) 90 scFv
anti-CD3 5561 mCLDN18.2ab1 TR66 Serine scFv-anti-CLDN18.2-
ds-VL-LL5-VH-SL-ds(VL-LL5-VH) 91 scFv anti-CD3 5562 mCLDN18.2ab
TR66 Serine scFv-anti-CLDN18.2- VL-LL5-VH-SL-ds(VL-LL5-VH) 92 scFv
anti-CD3 5563 mCLDN18.2ab TR66 Serine scFv-anti-CLDN18.2-
ds-VL-LL5-VH-SL-ds(VL-LL5-VH) 93 scFv anti-CD3 *.sup.)LL4,
(G.sub.4S).sub.4; LL5, (G.sub.4S).sub.5; SL, SG.sub.4S
[0649] It should be noted that SEQ ID NOs: 66 to 93 still contain
the amino acid sequence of an N-terminal signal sequence which
mediates the secretion of the 1-BiMAB bi-scFv protein into the cell
culture supernatant upon mammalian expression. This signal sequence
is not part of the secreted recombinant protein since it is cleaved
off by a signal peptidase in the lumen of the endoplasmic
reticulum.
[0650] b. Production and Purification of 32 Anti CLDN18.2 Specific
Bi-scFv Proteins by Transient Transfection
[0651] Suspension adapted CHO-cells were sub-cultivated in
serum-free media in a humidified CO2 shaker. One day prior
transfection, cells were seeded in serum-free media in shaker
flasks. On the day of transfection cells were centrifuged (5 min at
200.times.g) and resuspended in fresh DMEM-Medium (Invitrogen,
41965-039) in shaker flasks. DNA and transfection reagent were
added to the cells and gently mixed by shaking. After static
incubation in a CO.sub.2-incubator, the cells were diluted with
serum free growth media and further cultivated for expression in an
incubation shaker. Cells were feeded according to nutritional
requirement with CHO CD EfficientFeed.TM. C (Invitrogen, A13275).
Bi-scFv proteins were harvested after the viability of the cells
starts to decrease. The antibody constructs were purified by Capto
L sepharose. The protein concentration was determined by absorbance
at 280 nm.
[0652] c. Luciferase Cytotoxicity Assay with 32
Anti-CLDN18.2-Specific Bi-scFv Proteins
[0653] For the functional screening of the 32
anti-CLDN18.2-specific bi-scFv proteins, four point titrations
(5000, 1000, 200 and 40 ng/ml) were tested in an in vitro
luciferase cytotoxicity assay, as described in Example 2.c.
[0654] Stable luciferase-expressing NugC4 cells described in
Example 2.c were incubated with human T cells and bi-scFv proteins
or without bi-scFv protein to determine the L.sub.min values.
Luminescence of viable cells was measured with an Infinite M200
Tecan plate reader 24 h and 48 h after assay set up. Specific
target cell lysis was calculated by the formula exemplified in
Example 2.c.
[0655] By performing a qualitative analysis of the cytotoxic
results (FIGS. 39 a, b, c and d) based on the scFv anti-CD3 TR66
binding domains the following observation could be drawn.
[0656] The best performing anti-CLDN18.2-specific bi-scFv proteins
in the luciferase cytotoxic assay contain the anti-CD3 moiety in
the VH/VL domain orientation connected by the "LL4" linker with or
without the interface disulfide bridge (5504, 5505, 5506, 5507,
5536, 5537, 5538, 5539, 5512, 5513, 5514, 5515, 5544, 5545, 5546,
5547; FIGS. 39 a and b). A lower cytotoxic activity is obtained
with the variants containing the anti-CD3 moiety in the VL/VH
domain orientation with the peptide linker "LL5" and containing the
interface disulfide bridge (5528, 5529, 5530, 5531, 5560, 5561,
5562, 5563; FIG. 39 d). The lowest cytotoxic activity is obtained
with the variant containing the anti-CD3 moiety in the VL/VH domain
orientation with the peptide linker "LL5" without interface
disulfide bridge (5520, 5521, 5522, 5523, 5552, 5553, 5554, 5555;
FIG. 39 c).
[0657] B. Generation and Testing of Bispecific Binding Agents
Targeting CLDN6 and CD3
[0658] a. Sequence Origin, Design of Bi-scFv Constructs, and
Cloning into Expression Vectors
[0659] The bispecific tandem single chain antibody constructs
bi-scFv presented herein contain two distinct binding domains from
which one is specific for a human tumor associated antigen (TAA),
whereas the other is specific for the .epsilon.-chain of human T
cell receptor (CD3). Each of the two binding domains of the
bispecific molecule comprises two antibody variable domains,
arranged as scFv moiety in either VH-VL or VL-VH orientation. The
antibody variable domains are connected via a flexible
glycin-serine peptide linker. The scFv moieties targeting the TAA
are arranged in the VH-VL orientation and are connected by a 15
amino acid linker (named "LL3") consisting of three identical
repeats of a G4S subunit. The scFv moieties targeting CD3 are also
arranged in the VH-VL orientation, but are connected by a 18 amino
acid linker (named LLv1) with the sequence
G.sub.4S(G.sub.2S).sub.3G.sub.3S. The two scFv moities on the other
hand are connected via a six amino acid long SG.sub.4S linker
(named "SL"). Information on sequence origin from monoclonal
antibodies (mAB) and domain organization are summarized in Table
12. The variants 5454, 5456, 5458, 5460, 5462 and 5464 comprise for
the anti-CD3 binding domain the VH anti-CD3 with the SEQ ID NO: 95
and the VL anti-CD3 with the SEQ ID NO: 96. The variants 5454 and
5458 comprise the VL anti-CLDN6 with the SEQ ID NO: 98; the
variants 5456 and 5460 comprise the VL anti-CLDN6 with the SEQ ID
NO: 99; the variants 5462 and 5464 comprise the VL anti-CLDN6 with
the SEQ ID NO: 100.
[0660] In the particular case of the 6PHU3-S(SEQ ID NO: 101), only
the substitution of the free cysteine by a serine residue in the VH
anti-CD3 (SEQ ID NO: 94) is done in comparison to the amino acid
sequence of the 6-PHU3 sequence (SEQ ID NO: 45). It should be noted
that SEQ ID NO: 45 still contains the amino acid sequence of an
N-terminal signal sequence which mediates the secretion of the
6-PHU-3 bi-scFv protein into the cell culture supernatant upon
mammalian expression. This signal sequence is not part of the
secreted recombinant protein since it is cleaved off by a signal
peptidase in the lumen of the endoplasmic reticulum. Moreover for
the 6PHU3-SL (SEQ ID NO: 102), the substitution of the free
cysteine by a leucine residue in the VL anti-CLDN6 (SEQ ID NO: 97)
at position 46 of the corresponding primary sequence is performed
in comparison to the amino acid sequence of the 6PHU3-S. This
corresponds to position 45 within SEQ ID NO: 23 where the first
amino acid of the VL has been omitted.
[0661] The genes encoding the bi-scFv constructs were generated via
GeneArt.RTM. gene synthesis (Life Technologies GmbH, Darmstadt,
Germany) using the GeneOptimizer.RTM. software to optimize the
codon usage for expression in CHO cells. Besides a common secretion
signal, all DNA constructs contain the same Kozak sequence and a
HindIII restriction at the 5' end. At the 3' end BsiWI and XhoI
recognition sites were added to allow for flexible subcloning into
different expression vectors. Subcloning into the expression vector
of choice pEE12.4 (Lonza Group Ltd, Basel, Switzerland) was
performed using standard techniques using the HindIII and BsiWI
restriction sites.
TABLE-US-00013 TABLE 12 Summary of the bi-scFv anti-CLDN6
constructs Variant Substitution Anti- Substitution Domain order
Identifi- Anti-CLDN6 at pos. L46 CD3 at pos. H103 (from N- to SEQ
ID cation origin of mCLDN6ab origin of TR66 C-terminal) Domain
organization*.sup.) NO: 5454 mCLDN6ab Leucine TR66 Serine
scFvanti-CLDN6- VH-LL3-VL-SL-VH-LLv1-VL 60 scFvanti-CD3 5456
mCLDN6ab Tryptophan TR66 Serine scFvanti-CLDN6-
VHLL3VL-SL-VH-LLv1-VL 61 scFvanti-CD3 5462 mCLDN6ab Serine TR66
Serine scFvanti-CLDN6- VH-LL3-VL-SL-VH-LLv1-VL 62 scFvanti-CD3
6PHU3-S mCLDN6ab NA TR66 Serine scFvanti-CD3- See 6PHU3 in Example
9 101 scFvanti-CLDN6 6PHU3-SL mCLDN6ab Leucine TR66 Serine
scFvanti-CD3- See 6PHU3 in Example 9 102 scFvanti-CLDN6 5458
mCLDN6ab Leucine TR66 Serine scFvanti-CD3- VH-LLv1-VL-SL-VH-LL3-VL
63 scFvanti-CLDN6 5460 mCLDN6ab Tryptophan TR66 Serine
scFvanti-CD3- VH-LLv1-VL-SL-VH-LL3-VL 64 scFvanti-CLDN6 5464
mCLDN6ab Serine TR66 Serine scFvanti-CD3- VH-LLv1-VL-SL-VH-LL3-VL
65 scFvanti-CLDN6 *.sup.)LL3, (G.sub.4S).sub.3; LLv1,
G.sub.4S(G.sub.2S).sub.3G.sub.3S; SL, SG.sub.4S
[0662] b. Production and Purification of 6 Anti CLDN6 Specific
Bi-scFv Proteins by Transient Transfection
[0663] Suspension adapted CHO-cells were sub-cultivated in
serum-free media in a humidified CO2 shaker. One day prior
transfection, cells were seeded in serum-free media in shaker
flasks. On the day of transfection cells were centrifuged (5 min at
200.times.g) and resuspended in fresh DMEM-Medium (Invitrogen,
41965-039) in shaker flasks. DNA and transfection reagent were
added to the cells and gently mixed by shaking. After static
incubation in a CO2-incubator, the cells were diluted with serum
free growth media and further cultivated for expression in an
incubation shaker. Cells were feeded according to nutritional
requirement with CHO CD EfficientFeed.TM. C (Invitrogen, A13275).
Bi-scFv proteins were harvested after the viability of the cells
starts to decrease. The antibody constructs were purified by FPLC
using Capto L sepharose. The protein concentration was determined
by absorbance at 280 nm.
[0664] c. Determination of EC50 of 6 Anti-CLDN6-Specific Bi-scFv
Proteins
[0665] For the determination of the half maximal effective dose of
anti-CLDN6-specific bi-scFv proteins, a titration row of bi-scFv
proteins was tested in an in vitro luciferase cytotoxic assay as
described in Example 13.
[0666] Stable luciferase-expressing PA-1 cells and human T cells in
an E:T ratio of 5:1 were incubated with bi-scFv protein
concentrations within the range of 2.5 .mu.g/ml to 5 .mu.g/ml (in
steps of 10) or without anti-CLDN6-specific bi-scFv proteins to
determine the L.sub.min values.
[0667] Three independent assays were performed with different human
donors for the preparation of the human T cells. The results are
illustrated in FIG. 40.
[0668] By performing a quantitative comparison of the cytotoxic
results based on the cysteine residue substitution within the
flanking region of the CDR-L2 by either a serine, leucine or
tryptophan and on anti-CLDN6 and anti-CD3 binding domain position
the following observation could be drawn.
[0669] The best performing anti-CLDN6-specific bi-scFv proteins in
the luciferase cytotoxic assay contain the cysteine to tryptophan
substitution with the anti-CLDN6 binding domain in the N-terminal
part of the bi-scFv protein (variant 5456). A slightly lower
cytotoxic activity is obtained with the variants containing the
anti-CLDN6 in the C-terminal part with either the substitution of
the cysteine by a tryptophan (variant 5460) or a serine (variant
5464). For the variants containing the substitution of the cysteine
by a leucine with the anti-CLDN6 in the N--terminal part (variant
5454) or C-terminal part (variant 5458) of the bi-scFv proteins
lower cytotoxic activity is measured in comparison with the
previous variants. Surprisingly, the variant containing the
substitution of the cysteine by a serine with the anti-CLDN6 in the
N-terminal part (variant 5462) of the bi-scFv protein has the
lowest cytotoxic activity.
Sequence CWU 1
1
1081261PRTHomo sapiens 1Met Ala Val Thr Ala Cys Gln Gly Leu Gly Phe
Val Val Ser Leu Ile1 5 10 15Gly Ile Ala Gly Ile Ile Ala Ala Thr Cys
Met Asp Gln Trp Ser Thr 20 25 30Gln Asp Leu Tyr Asn Asn Pro Val Thr
Ala Val Phe Asn Tyr Gln Gly 35 40 45Leu Trp Arg Ser Cys Val Arg Glu
Ser Ser Gly Phe Thr Glu Cys Arg 50 55 60Gly Tyr Phe Thr Leu Leu Gly
Leu Pro Ala Met Leu Gln Ala Val Arg65 70 75 80Ala Leu Met Ile Val
Gly Ile Val Leu Gly Ala Ile Gly Leu Leu Val 85 90 95Ser Ile Phe Ala
Leu Lys Cys Ile Arg Ile Gly Ser Met Glu Asp Ser 100 105 110Ala Lys
Ala Asn Met Thr Leu Thr Ser Gly Ile Met Phe Ile Val Ser 115 120
125Gly Leu Cys Ala Ile Ala Gly Val Ser Val Phe Ala Asn Met Leu Val
130 135 140Thr Asn Phe Trp Met Ser Thr Ala Asn Met Tyr Thr Gly Met
Gly Gly145 150 155 160Met Val Gln Thr Val Gln Thr Arg Tyr Thr Phe
Gly Ala Ala Leu Phe 165 170 175Val Gly Trp Val Ala Gly Gly Leu Thr
Leu Ile Gly Gly Val Met Met 180 185 190Cys Ile Ala Cys Arg Gly Leu
Ala Pro Glu Glu Thr Asn Tyr Lys Ala 195 200 205Val Ser Tyr His Ala
Ser Gly His Ser Val Ala Tyr Lys Pro Gly Gly 210 215 220Phe Lys Ala
Ser Thr Gly Phe Gly Ser Asn Thr Lys Asn Lys Lys Ile225 230 235
240Tyr Asp Gly Gly Ala Arg Thr Glu Asp Glu Val Gln Ser Tyr Pro Ser
245 250 255Lys His Asp Tyr Val 2602220PRTHomo sapiens 2Met Ala Ser
Ala Gly Met Gln Ile Leu Gly Val Val Leu Thr Leu Leu1 5 10 15Gly Trp
Val Asn Gly Leu Val Ser Cys Ala Leu Pro Met Trp Lys Val 20 25 30Thr
Ala Phe Ile Gly Asn Ser Ile Val Val Ala Gln Val Val Trp Glu 35 40
45Gly Leu Trp Met Ser Cys Val Val Gln Ser Thr Gly Gln Met Gln Cys
50 55 60Lys Val Tyr Asp Ser Leu Leu Ala Leu Pro Gln Asp Leu Gln Ala
Ala65 70 75 80Arg Ala Leu Cys Val Ile Ala Leu Leu Val Ala Leu Phe
Gly Leu Leu 85 90 95Val Tyr Leu Ala Gly Ala Lys Cys Thr Thr Cys Val
Glu Glu Lys Asp 100 105 110Ser Lys Ala Arg Leu Val Leu Thr Ser Gly
Ile Val Phe Val Ile Ser 115 120 125Gly Val Leu Thr Leu Ile Pro Val
Cys Trp Thr Ala His Ala Ile Ile 130 135 140Arg Asp Phe Tyr Asn Pro
Leu Val Ala Glu Ala Gln Lys Arg Glu Leu145 150 155 160Gly Ala Ser
Leu Tyr Leu Gly Trp Ala Ala Ser Gly Leu Leu Leu Leu 165 170 175Gly
Gly Gly Leu Leu Cys Cys Thr Cys Pro Ser Gly Gly Ser Gln Gly 180 185
190Pro Ser His Tyr Met Ala Arg Tyr Ser Thr Ser Ala Pro Ala Ile Ser
195 200 205Arg Gly Pro Ser Glu Tyr Pro Thr Lys Asn Tyr Val 210 215
2203220PRTHomo sapiens 3Met Ala Ser Ala Gly Met Gln Ile Leu Gly Val
Val Leu Thr Leu Leu1 5 10 15Gly Trp Val Asn Gly Leu Val Ser Cys Ala
Leu Pro Met Trp Lys Val 20 25 30Thr Ala Phe Ile Gly Asn Ser Ile Val
Val Ala Gln Val Val Trp Glu 35 40 45Gly Leu Trp Met Ser Cys Val Val
Gln Ser Thr Gly Gln Met Gln Cys 50 55 60Lys Val Tyr Asp Ser Leu Leu
Ala Leu Pro Gln Asp Leu Gln Ala Ala65 70 75 80Arg Ala Leu Cys Val
Ile Ala Leu Leu Val Ala Leu Phe Gly Leu Leu 85 90 95Val Tyr Leu Ala
Gly Ala Lys Cys Thr Thr Cys Val Glu Glu Lys Asp 100 105 110Ser Lys
Ala Arg Leu Val Leu Thr Ser Gly Ile Val Phe Val Ile Ser 115 120
125Gly Val Leu Thr Leu Ile Pro Val Cys Trp Thr Ala His Ala Val Ile
130 135 140Arg Asp Phe Tyr Asn Pro Leu Val Ala Glu Ala Gln Lys Arg
Glu Leu145 150 155 160Gly Ala Ser Leu Tyr Leu Gly Trp Ala Ala Ser
Gly Leu Leu Leu Leu 165 170 175Gly Gly Gly Leu Leu Cys Cys Thr Cys
Pro Ser Gly Gly Ser Gln Gly 180 185 190Pro Ser His Tyr Met Ala Arg
Tyr Ser Thr Ser Ala Pro Ala Ile Ser 195 200 205Arg Gly Pro Ser Glu
Tyr Pro Thr Lys Asn Tyr Val 210 215 2204207PRTHomo sapiens 4Met Gln
Ser Gly Thr His Trp Arg Val Leu Gly Leu Cys Leu Leu Ser1 5 10 15Val
Gly Val Trp Gly Gln Asp Gly Asn Glu Glu Met Gly Gly Ile Thr 20 25
30Gln Thr Pro Tyr Lys Val Ser Ile Ser Gly Thr Thr Val Ile Leu Thr
35 40 45Cys Pro Gln Tyr Pro Gly Ser Glu Ile Leu Trp Gln His Asn Asp
Lys 50 55 60Asn Ile Gly Gly Asp Glu Asp Asp Lys Asn Ile Gly Ser Asp
Glu Asp65 70 75 80His Leu Ser Leu Lys Glu Phe Ser Glu Leu Glu Gln
Ser Gly Tyr Tyr 85 90 95Val Cys Tyr Pro Arg Gly Ser Lys Pro Glu Asp
Ala Asn Phe Tyr Leu 100 105 110Tyr Leu Arg Ala Arg Val Cys Glu Asn
Cys Met Glu Met Asp Val Met 115 120 125Ser Val Ala Thr Ile Val Ile
Val Asp Ile Cys Ile Thr Gly Gly Leu 130 135 140Leu Leu Leu Val Tyr
Tyr Trp Ser Lys Asn Arg Lys Ala Lys Ala Lys145 150 155 160Pro Val
Thr Arg Gly Ala Gly Ala Gly Gly Arg Gln Arg Gly Gln Asn 165 170
175Lys Glu Arg Pro Pro Pro Val Pro Asn Pro Asp Tyr Glu Pro Ile Arg
180 185 190Lys Gly Gln Arg Asp Leu Tyr Ser Gly Leu Asn Gln Arg Arg
Ile 195 200 2055117PRTArtificial SequenceAntibody fragment 5Gln Val
Gln Leu Gln Gln Ser Gly Ala Glu Leu Met Lys Pro Gly Ala1 5 10 15Ser
Val Lys Ile Ser Cys Lys Ala Thr Gly Tyr Thr Phe Ser Ser Tyr 20 25
30Trp Ile Glu Trp Val Lys Gln Arg Pro Gly His Gly Leu Glu Trp Ile
35 40 45Gly Glu Ile Leu Pro Gly Ser Gly Ser Thr Asn Tyr Asn Glu Lys
Phe 50 55 60Lys Gly Lys Ala Thr Phe Thr Ala Asp Thr Ser Ser Asn Thr
Ala Tyr65 70 75 80Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala
Val Tyr Tyr Cys 85 90 95Ala Arg Tyr Asp Tyr Pro Trp Phe Ala Tyr Trp
Gly Gln Gly Thr Leu 100 105 110Val Thr Val Ser Ala
1156118PRTArtificial SequenceAntibody fragment 6Gln Ile Gln Leu Val
Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu1 5 10 15Thr Val Lys Ile
Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr 20 25 30Gly Met Asn
Trp Val Lys Gln Ala Pro Gly Lys Gly Leu Lys Trp Met 35 40 45Gly Trp
Ile Asn Thr Asn Thr Gly Glu Pro Thr Tyr Ala Glu Glu Phe 50 55 60Lys
Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser Thr Ala Tyr65 70 75
80Leu Gln Ile Asn Asn Leu Lys Asn Glu Asp Thr Ala Thr Tyr Phe Cys
85 90 95Ala Arg Leu Gly Phe Gly Asn Ala Met Asp Tyr Trp Gly Gln Gly
Thr 100 105 110Ser Val Thr Val Ser Ser 1157116PRTArtificial
SequenceAntibody fragment 7Gln Val Gln Leu Gln Gln Ser Gly Ala Glu
Leu Ala Arg Pro Gly Ala1 5 10 15Ser Val Lys Leu Ser Cys Lys Ala Ser
Gly Tyr Thr Phe Thr Asp Tyr 20 25 30Tyr Ile Asn Trp Val Lys Gln Arg
Thr Gly Gln Gly Leu Glu Trp Ile 35 40 45Gly Glu Ile Tyr Pro Gly Ser
Gly Asn Thr Tyr Tyr Asn Glu Lys Phe 50 55 60Lys Gly Lys Ala Thr Leu
Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr65 70 75 80Met Gln Leu Ser
Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys 85 90 95Ala Arg Ser
Tyr Gly Ala Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu 100 105 110Thr
Val Ser Ser 1158118PRTArtificial SequenceAntibody fragment 8Gln Val
Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala1 5 10 15Ser
Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25
30Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys
Phe 50 55 60Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr
Ala Tyr65 70 75 80Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala
Val Tyr Tyr Cys 85 90 95Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr
Trp Gly Gln Gly Thr 100 105 110Thr Leu Thr Val Ser Ser
1159118PRTArtificial SequenceAntibody fragment 9Gln Val Gln Leu Gln
Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala1 5 10 15Ser Val Lys Met
Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30Val Ile Ser
Trp Val Lys Gln Arg Thr Gly Gln Gly Leu Glu Trp Ile 35 40 45Gly Glu
Ile Tyr Pro Gly Ser Gly Ser Thr Tyr Tyr Asn Glu Lys Phe 50 55 60Lys
Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Asn Thr Ala Tyr65 70 75
80Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys
85 90 95Ala Arg Gly Val Leu Leu Arg Ala Met Asp Tyr Trp Gly Gln Gly
Thr 100 105 110Ser Val Thr Val Ser Ser 11510120PRTArtificial
SequenceAntibody fragment 10Gln Val His Leu Gln Gln Ser Gly Ser Glu
Leu Arg Ser Pro Gly Ser1 5 10 15Ser Val Lys Leu Ser Cys Lys Asp Phe
Asp Ser Glu Val Phe Pro Phe 20 25 30Ala Tyr Met Ser Trp Ile Arg Gln
Lys Pro Gly His Gly Phe Glu Trp 35 40 45Ile Gly Asp Ile Leu Pro Ser
Ile Gly Arg Thr Ile Tyr Gly Glu Lys 50 55 60Phe Glu Asp Lys Ala Thr
Leu Asp Ala Asp Thr Val Ser Asn Thr Ala65 70 75 80Tyr Leu Glu Leu
Asn Ser Leu Thr Ser Glu Asp Ser Ala Ile Tyr Tyr 85 90 95Cys Ala Arg
Gly Glu Gly Tyr Gly Ala Trp Phe Ala Tyr Trp Gly Gln 100 105 110Gly
Thr Leu Val Thr Val Ser Ala 115 12011113PRTArtificial
SequenceAntibody fragment 11Asp Ile Val Met Thr Gln Ser Pro Ser Ser
Leu Thr Val Thr Ala Gly1 5 10 15Glu Lys Val Thr Met Ser Cys Lys Ser
Ser Gln Ser Leu Leu Asn Ser 20 25 30Gly Asn Gln Lys Asn Tyr Leu Thr
Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45Pro Pro Lys Leu Leu Ile Tyr
Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60Pro Asp Arg Phe Thr Gly
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr65 70 75 80Ile Ser Ser Val
Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn 85 90 95Asp Tyr Ser
Tyr Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu 100 105
110Lys12106PRTArtificial SequenceAntibody fragment 12Gln Ile Val
Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly1 5 10 15Glu Lys
Val Thr Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met 20 25 30His
Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Trp Ile Tyr 35 40
45Ser Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser
50 55 60Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Met Glu Ala
Glu65 70 75 80Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Ser Ser Tyr
Pro Pro Thr 85 90 95Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100
10513107PRTArtificial SequenceAntibody fragment 13Asp Ile Val Met
Thr Gln Ser Gln Lys Phe Met Ser Thr Ser Val Gly1 5 10 15Asp Arg Val
Ser Ile Thr Cys Lys Ala Ser Gln Asn Val Arg Thr Ala 20 25 30Val Ala
Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Ala Leu Ile 35 40 45Tyr
Leu Ala Ser Asn Arg His Thr Gly Val Pro Asp Arg Phe Thr Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Val Gln Ser65
70 75 80Glu Asp Leu Ala Asp Tyr Phe Cys Leu Gln His Trp Asn Tyr Pro
Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100
10514113PRTArtificial SequenceAntibody fragment 14Asp Ile Val Met
Ser Gln Ser Pro Ser Ser Leu Ala Val Ser Val Gly1 5 10 15Glu Lys Val
Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser 20 25 30Ser Asn
Gln Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45Ser
Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55
60Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr65
70 75 80Ile Ser Ser Val Lys Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln
Gln 85 90 95Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu
Glu Leu 100 105 110Lys15113PRTArtificial SequenceAntibody fragment
15Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly1
5 10 15Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn
Ser 20 25 30Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro
Gly Gln 35 40 45Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu
Ser Gly Val 50 55 60Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr65 70 75 80Ile Ser Ser Val Gln Ala Glu Asp Leu Ala
Val Tyr Tyr Cys Gln Asn 85 90 95Asp Tyr Ser Tyr Pro Phe Thr Phe Gly
Ser Gly Thr Lys Leu Glu Ile 100 105 110Lys16112PRTArtificial
SequenceAntibody fragment 16Asp Ile Val Met Ser Gln Ser Pro Ser Ser
Leu Ala Val Ser Ala Gly1 5 10 15Glu Lys Val Thr Met Ser Cys Lys Ser
Ser Gln Ser Leu Leu Asn Ser 20 25 30Arg Thr Arg Lys Asn Tyr Leu Ala
Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45Ser Pro Lys Leu Leu Ile Tyr
Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60Pro Asp Arg Phe Thr Gly
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr65 70 75 80Ile Ser Ser Val
Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Lys Gln 85 90 95Ser Tyr Asn
Leu Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105
11017113PRTArtificial SequenceAntibody fragment 17Asp Ile Val Met
Ser Gln Ser Pro Ser Ser Leu Ala Val Ser Val Gly1 5 10 15Glu Lys Val
Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser 20 25 30Ser Asn
Gln Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45Ser
Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55
60Pro Asp Arg Phe Thr Gly Ser Gly Ser Ala Thr Asp Phe Thr Leu Thr65
70 75 80Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Asp Tyr His Cys Gly
Gln 85 90 95Gly Tyr Ser Tyr Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu
Glu Ile 100 105
110Lys18113PRTArtificial SequenceAntibody fragment 18Asp Ile Val
Met Ser Gln Ser Pro Ser Ser Leu Ala Val Ser Val Gly1 5 10 15Glu Lys
Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser 20 25 30Ser
Asn Gln Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40
45Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val
50 55 60Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr65 70 75 80Ile Ser Ser Val Lys Ala Glu Asp Leu Ala Val Tyr Tyr
Cys Gln Gln 85 90 95Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Ala Gly Thr
Lys Leu Glu Leu 100 105 110Lys19107PRTArtificial SequenceAntibody
fragment 19Asn Ile Val Met Thr Gln Ser Pro Lys Ser Met Ser Met Ser
Val Gly1 5 10 15Glu Arg Val Thr Leu Thr Cys Lys Ala Ser Glu Asn Val
Val Thr Tyr 20 25 30Val Ser Trp Tyr Gln Gln Lys Pro Glu Gln Ser Pro
Lys Leu Leu Ile 35 40 45Tyr Gly Ala Ser Asn Arg Tyr Thr Gly Val Pro
Asp Arg Phe Thr Gly 50 55 60Ser Gly Ser Ala Thr Asp Phe Thr Leu Thr
Ile Ser Ser Val Lys Ala65 70 75 80Glu Asp Leu Ala Val Tyr Tyr Cys
Gln Gln Tyr Tyr Ser Tyr Pro Leu 85 90 95Thr Phe Gly Ala Gly Thr Lys
Leu Glu Leu Lys 100 10520117PRTArtificial SequenceAntibody fragment
20Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala1
5 10 15Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly
Tyr 20 25 30Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu Glu
Trp Ile 35 40 45Gly Leu Ile Asn Pro Tyr Asn Gly Gly Thr Ser Tyr Asn
Gln Lys Phe 50 55 60Lys Gly Lys Ala Thr Leu Thr Ile Asp Lys Ser Ser
Ser Thr Ala Tyr65 70 75 80Met Glu Leu Leu Ser Leu Thr Ser Glu Asp
Ser Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Tyr Gly Tyr Val Leu Asp
Tyr Trp Gly Gln Gly Thr Thr 100 105 110Leu Thr Val Ser Ser
11521106PRTArtificial SequenceAntibody fragment 21Ile Val Leu Thr
Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu1 5 10 15Lys Val Thr
Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Leu His 20 25 30Trp Phe
Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Trp Val Tyr Ser 35 40 45Thr
Ser Asn Leu Pro Ser Gly Val Pro Ala Arg Phe Gly Gly Ser Gly 50 55
60Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Met Glu Ala Glu Asp65
70 75 80Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Ser Ile Tyr Pro Pro Trp
Thr 85 90 95Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100
10522117PRTArtificial SequenceAntibody fragment 22Glu Val Gln Leu
Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala1 5 10 15Ser Met Lys
Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25 30Thr Met
Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu Glu Trp Ile 35 40 45Gly
Leu Ile Asn Pro Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe 50 55
60Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr65
70 75 80Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr
Cys 85 90 95Ala Arg Asp Tyr Gly Phe Val Leu Asp Tyr Trp Gly Gln Gly
Thr Thr 100 105 110Leu Thr Val Ser Ser 11523106PRTArtificial
SequenceAntibody fragment 23Ile Val Leu Thr Gln Ser Pro Ser Ile Met
Ser Val Ser Pro Gly Glu1 5 10 15Lys Val Thr Ile Thr Cys Ser Ala Ser
Ser Ser Val Ser Tyr Met His 20 25 30Trp Phe Gln Gln Lys Pro Gly Thr
Ser Pro Lys Leu Cys Ile Tyr Ser 35 40 45Thr Ser Asn Leu Ala Ser Gly
Val Pro Ala Arg Phe Ser Gly Arg Gly 50 55 60Ser Gly Thr Ser Tyr Ser
Leu Thr Ile Ser Arg Val Ala Ala Glu Asp65 70 75 80Ala Ala Thr Tyr
Tyr Cys Gln Gln Arg Ser Asn Tyr Pro Pro Trp Thr 85 90 95Phe Gly Gly
Gly Thr Lys Leu Glu Ile Lys 100 10524117PRTArtificial
SequenceAntibody fragment 24Glu Val Gln Leu Gln Gln Ser Gly Pro Glu
Leu Val Lys Pro Gly Ala1 5 10 15Ser Met Lys Ile Ser Cys Lys Ala Ser
Gly Tyr Ser Phe Thr Gly Tyr 20 25 30Thr Met Asn Trp Val Lys Gln Ser
His Gly Lys Asn Leu Glu Trp Ile 35 40 45Gly Leu Ile Asn Pro Tyr Asn
Gly Gly Ile Ile Tyr Asn Gln Lys Phe 50 55 60Lys Gly Lys Ala Thr Leu
Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr65 70 75 80Met Glu Leu Leu
Ser Leu Thr Ser Glu Asp Ser Ala Val Phe Tyr Cys 85 90 95Ala Arg Asp
Phe Gly Tyr Val Leu Asp Tyr Trp Gly Gln Gly Thr Thr 100 105 110Leu
Thr Val Ser Ser 11525106PRTArtificial SequenceAntibody fragment
25Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu1
5 10 15Lys Val Thr Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met
His 20 25 30Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Trp Ile
Tyr Ser 35 40 45Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser
Gly Ser Gly 50 55 60Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val
Ala Ala Glu Asp65 70 75 80Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Ser
Thr Tyr Pro Pro Trp Thr 85 90 95Phe Gly Gly Gly Thr Lys Leu Glu Ile
Lys 100 10526117PRTArtificial SequenceAntibody fragment 26Glu Val
Gln Leu Gln Gln Ser Arg Pro Glu Leu Val Lys Pro Gly Ala1 5 10 15Ser
Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25
30Thr Leu Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu Glu Trp Ile
35 40 45Gly Leu Ile Asn Pro Tyr Asn Gly Gly Ser Ser Tyr Asn Gln Lys
Phe 50 55 60Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr
Ala Tyr65 70 75 80Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala
Val Tyr Tyr Cys 85 90 95Ala Arg Asp Tyr Gly Tyr Val Phe Asp Tyr Trp
Gly Gln Gly Thr Thr 100 105 110Leu Thr Val Ser Ser
11527106PRTArtificial SequenceAntibody fragment 27Ile Val Leu Thr
Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu1 5 10 15Lys Val Thr
Ile Thr Cys Ser Ala Ser Ser Ser Val Asn Tyr Met His 20 25 30Trp Phe
Gln Leu Lys Pro Gly Thr Ser Pro Lys Leu Leu Ile Tyr Ser 35 40 45Thr
Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Arg Gly 50 55
60Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Met Glu Ala Glu Asp65
70 75 80Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Asn Asn Tyr Pro Pro Trp
Thr 85 90 95Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100
10528106PRTArtificial SequenceAntibody fragment 28Ile Val Leu Thr
Gln Ser Pro Ser Ile Met Ser Val Ser Pro Gly Glu1 5 10 15Lys Val Thr
Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met His 20 25 30Trp Phe
Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Gly Ile Tyr Ser 35 40 45Thr
Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Arg Gly 50 55
60Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Ala Ala Glu Asp65
70 75 80Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Ser Asn Tyr Pro Pro Trp
Thr 85 90 95Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100
10529106PRTArtificial SequenceAntibody fragment 29Ile Val Leu Thr
Gln Ser Pro Ser Ile Met Ser Val Ser Pro Gly Glu1 5 10 15Lys Val Thr
Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met His 20 25 30Trp Phe
Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Ser Ile Tyr Ser 35 40 45Thr
Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Arg Gly 50 55
60Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Ala Ala Glu Asp65
70 75 80Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Ser Asn Tyr Pro Pro Trp
Thr 85 90 95Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100
10530119PRTArtificial SequenceAntibody fragment 30Gln Val Gln Leu
Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala1 5 10 15Ser Val Lys
Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30Thr Met
His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45Gly
Tyr Ile Asn Pro Ser Ser Gly Tyr Thr Lys Tyr Asn Gln Lys Phe 50 55
60Lys Asp Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr65
70 75 80Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr
Cys 85 90 95Ala Arg Trp Gln Asp Tyr Asp Val Tyr Phe Asp Tyr Trp Gly
Gln Gly 100 105 110Thr Thr Leu Thr Val Ser Ser
11531107PRTArtificial SequenceAntibody fragment 31Asp Ile Gln Met
Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val
Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Arg Asn Tyr 20 25 30Leu Asn
Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr
Tyr Thr Ser Arg Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Thr Leu Pro
Trp 85 90 95Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100
10532122PRTArtificial SequenceAntibody fragment 32Glu Val Gln Leu
Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala1 5 10 15Ser Met Lys
Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25 30Thr Met
Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu Glu Trp Met 35 40 45Gly
Leu Ile Asn Pro Tyr Lys Gly Val Ser Thr Tyr Asn Gln Lys Phe 50 55
60Lys Asp Lys Ala Thr Phe Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr65
70 75 80Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr
Cys 85 90 95Ala Arg Ser Gly Tyr Tyr Gly Asp Ser Asp Trp Tyr Phe Asp
Val Trp 100 105 110Gly Ala Gly Thr Thr Val Thr Val Ser Ser 115
12033107PRTArtificial SequenceAntibody fragment 33Asp Ile Gln Met
Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly1 5 10 15Asp Arg Val
Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Arg Asn Tyr 20 25 30Leu Asn
Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile 35 40 45Tyr
Tyr Thr Ser Arg Leu His Ser Gly Val Pro Ser Lys Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln65
70 75 80Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro
Trp 85 90 95Thr Phe Ala Gly Gly Thr Lys Leu Glu Ile Lys 100
10534119PRTArtificial SequenceAntibody fragment 34Glu Val Gln Leu
Val Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Lys
Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met
Phe Trp Val Arg Gln Thr Pro Asp Lys Arg Leu Glu Trp Val 35 40 45Ala
Thr Ile Ser Arg Tyr Ser Arg Tyr Ile Tyr Tyr Pro Asp Ser Val 50 55
60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Val Lys Asn Thr Leu Tyr65
70 75 80Leu Gln Met Ser Ser Leu Lys Ser Glu Asp Thr Ala Ile Tyr Tyr
Cys 85 90 95Ala Arg Arg Pro Leu Tyr Gly Ser Ser Pro Asp Tyr Trp Gly
Gln Gly 100 105 110Thr Thr Leu Thr Val Ser Ser
11535108PRTArtificial SequenceAntibody fragment 35Asp Ile Glu Asn
Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser1 5 10 15Pro Gly Glu
Lys Val Thr Met Thr Cys Ser Ala Ser Ser Ser Val Thr 20 25 30Tyr Val
His Trp Tyr Gln Gln Lys Ser Asn Thr Ser Pro Lys Leu Trp 35 40 45Ile
Tyr Asp Thr Ser Lys Leu Ala Ser Gly Val Pro Gly Arg Val Ser 50 55
60Gly Ser Gly Ser Gly Asn Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu65
70 75 80Ala Glu Asp Val Ala Thr Tyr Tyr Cys Phe Gln Gly Ser Gly Tyr
Pro 85 90 95Leu Thr Phe Gly Ser Gly Thr Lys Leu Glu Met Arg 100
10536117PRTArtificial SequenceAntibody fragment 36Lys Leu Gln Gln
Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val1 5 10 15Lys Met Ser
Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met 20 25 30His Trp
Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr 35 40 45Ile
Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp 50 55
60Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln65
70 75 80Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala
Arg 85 90 95Tyr Tyr Asp Asp His Tyr Cys Leu Asp Tyr Trp Gly Gln Gly
Thr Thr 100 105 110Leu Thr Val Ser Ser 11537106PRTArtificial
SequenceAntibody fragment 37Asp Ile Gln Leu Thr Gln Ser Pro Ala Ile
Met Ser Ala Ser Pro Gly1 5 10 15Glu Lys Val Thr Met Thr Cys Arg Ala
Ser Ser Ser Val Ser Tyr Met 20 25 30Asn Trp Tyr Gln Gln Lys Ser Gly
Thr Ser Pro Lys Arg Trp Ile Tyr 35 40 45Asp Thr Ser Lys Val Ala Ser
Gly Val Pro Tyr Arg Phe Ser Gly Ser 50 55 60Gly Ser Gly Thr Ser Tyr
Ser Leu Thr Ile Ser Ser Met Glu Ala Glu65 70 75 80Asp Ala Ala Thr
Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr 85 90 95Phe Gly Ala
Gly Thr Lys Leu Glu Leu Lys 100 10538495PRTArtificial
SequenceBispecific molecule 38Gln Val Gln Leu Gln Gln Pro Gly Ala
Glu Leu Val Arg Pro Gly Ala1 5 10 15Ser Val Lys Leu Ser Cys Lys Ala
Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30Trp Ile Asn Trp Val Lys Gln
Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45Gly Asn Ile Tyr Pro Ser
Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe 50 55 60Lys Asp Lys Ala Thr
Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr65 70 75 80Met Gln Leu
Ser Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95Thr Arg
Ser Trp Arg Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr 100 105
110Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly
Ser
115 120 125Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln Ser Pro Ser
Ser Leu 130 135 140Thr Val Thr Ala Gly Glu Lys Val Thr Met Ser Cys
Lys Ser Ser Gln145 150 155 160Ser Leu Leu Asn Ser Gly Asn Gln Lys
Asn Tyr Leu Thr Trp Tyr Gln 165 170 175Gln Lys Pro Gly Gln Pro Pro
Lys Leu Leu Ile Tyr Trp Ala Ser Thr 180 185 190Arg Glu Ser Gly Val
Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr 195 200 205Asp Phe Thr
Leu Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val 210 215 220Tyr
Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Ser Gly225 230
235 240Thr Lys Leu Glu Ile Lys Ser Gly Gly Gly Gly Ser Asp Ile Lys
Leu 245 250 255Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser
Val Lys Met 260 265 270Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg
Tyr Thr Met His Trp 275 280 285Val Lys Gln Arg Pro Gly Gln Gly Leu
Glu Trp Ile Gly Tyr Ile Asn 290 295 300Pro Ser Arg Gly Tyr Thr Asn
Tyr Asn Gln Lys Phe Lys Asp Lys Ala305 310 315 320Thr Leu Thr Thr
Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser 325 330 335Ser Leu
Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr 340 345
350Asp Asp His Tyr Cys Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr
355 360 365Val Ser Ser Val Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser
Gly Gly 370 375 380Ser Gly Gly Val Asp Asp Ile Gln Leu Thr Gln Ser
Pro Ala Ile Met385 390 395 400Ser Ala Ser Pro Gly Glu Lys Val Thr
Met Thr Cys Arg Ala Ser Ser 405 410 415Ser Val Ser Tyr Met Asn Trp
Tyr Gln Gln Lys Ser Gly Thr Ser Pro 420 425 430Lys Arg Trp Ile Tyr
Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr 435 440 445Arg Phe Ser
Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser 450 455 460Ser
Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser465 470
475 480Ser Asn Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys
485 490 49539520PRTArtificial SequenceBispecific molecule 39Met Gly
Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val
His Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg 20 25
30Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe
35 40 45Thr Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly
Leu 50 55 60Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn
Tyr Asn65 70 75 80Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp
Lys Ser Ser Ser 85 90 95Thr Ala Tyr Met Gln Leu Ser Ser Pro Thr Ser
Glu Asp Ser Ala Val 100 105 110Tyr Tyr Cys Thr Arg Ser Trp Arg Gly
Asn Ser Phe Asp Tyr Trp Gly 115 120 125Gln Gly Thr Thr Leu Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly
Gly Gly Ser Asp Ile Val Met Thr Gln Ser Pro145 150 155 160Ser Ser
Leu Thr Val Thr Ala Gly Glu Lys Val Thr Met Ser Cys Lys 165 170
175Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr
180 185 190Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile
Tyr Trp 195 200 205Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe
Thr Gly Ser Gly 210 215 220Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser
Ser Val Gln Ala Glu Asp225 230 235 240Leu Ala Val Tyr Tyr Cys Gln
Asn Asp Tyr Ser Tyr Pro Phe Thr Phe 245 250 255Gly Ser Gly Thr Lys
Leu Glu Ile Lys Ser Gly Gly Gly Gly Ser Asp 260 265 270Ile Lys Leu
Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser 275 280 285Val
Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr Thr 290 295
300Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile
Gly305 310 315 320Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn
Gln Lys Phe Lys 325 330 335Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser
Ser Ser Thr Ala Tyr Met 340 345 350Gln Leu Ser Ser Leu Thr Ser Glu
Asp Ser Ala Val Tyr Tyr Cys Ala 355 360 365Arg Tyr Tyr Asp Asp His
Tyr Cys Leu Asp Tyr Trp Gly Gln Gly Thr 370 375 380Thr Leu Thr Val
Ser Ser Val Glu Gly Gly Ser Gly Gly Ser Gly Gly385 390 395 400Ser
Gly Gly Ser Gly Gly Val Asp Asp Ile Gln Leu Thr Gln Ser Pro 405 410
415Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg
420 425 430Ala Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys
Ser Gly 435 440 445Thr Ser Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys
Val Ala Ser Gly 450 455 460Val Pro Tyr Arg Phe Ser Gly Ser Gly Ser
Gly Thr Ser Tyr Ser Leu465 470 475 480Thr Ile Ser Ser Met Glu Ala
Glu Asp Ala Ala Thr Tyr Tyr Cys Gln 485 490 495Gln Trp Ser Ser Asn
Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu 500 505 510Leu Lys His
His His His His His 515 52040490PRTArtificial SequenceBispecific
molecule 40Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro
Gly Ala1 5 10 15Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe
Thr Ser Tyr 20 25 30Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly
Leu Glu Trp Ile 35 40 45Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn
Tyr Asn Gln Lys Phe 50 55 60Lys Asp Lys Ala Thr Leu Thr Val Asp Lys
Ser Ser Ser Thr Ala Tyr65 70 75 80Met Gln Leu Ser Ser Pro Thr Ser
Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95Thr Arg Ser Trp Arg Gly Asn
Ser Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110Thr Leu Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125Gly Gly Gly
Gly Ser Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu 130 135 140Thr
Val Thr Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln145 150
155 160Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr
Gln 165 170 175Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp
Ala Ser Thr 180 185 190Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly
Ser Gly Ser Gly Thr 195 200 205Asp Phe Thr Leu Thr Ile Ser Ser Val
Gln Ala Glu Asp Leu Ala Val 210 215 220Tyr Tyr Cys Gln Asn Asp Tyr
Ser Tyr Pro Phe Thr Phe Gly Ser Gly225 230 235 240Thr Lys Leu Glu
Ile Lys Ser Gly Gly Gly Gly Ser Lys Leu Gln Gln 245 250 255Ser Gly
Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys 260 265
270Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys
275 280 285Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn
Pro Ser 290 295 300Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp
Lys Ala Thr Leu305 310 315 320Thr Thr Asp Lys Ser Ser Ser Thr Ala
Tyr Met Gln Leu Ser Ser Leu 325 330 335Thr Ser Glu Asp Ser Ala Val
Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp 340 345 350His Tyr Cys Leu Asp
Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser 355 360 365Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 370 375 380Asp
Ile Gln Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly385 390
395 400Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr
Met 405 410 415Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg
Trp Ile Tyr 420 425 430Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr
Arg Phe Ser Gly Ser 435 440 445Gly Ser Gly Thr Ser Tyr Ser Leu Thr
Ile Ser Ser Met Glu Ala Glu 450 455 460Asp Ala Ala Thr Tyr Tyr Cys
Gln Gln Trp Ser Ser Asn Pro Leu Thr465 470 475 480Phe Gly Ala Gly
Thr Lys Leu Glu Leu Lys 485 49041515PRTArtificial
SequenceBispecific molecule 41Met Gly Trp Ser Cys Ile Ile Leu Phe
Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Gln Val Gln Leu Gln
Gln Pro Gly Ala Glu Leu Val Arg 20 25 30Pro Gly Ala Ser Val Lys Leu
Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45Thr Ser Tyr Trp Ile Asn
Trp Val Lys Gln Arg Pro Gly Gln Gly Leu 50 55 60Glu Trp Ile Gly Asn
Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn65 70 75 80Gln Lys Phe
Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser 85 90 95Thr Ala
Tyr Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala Val 100 105
110Tyr Tyr Cys Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp Tyr Trp Gly
115 120 125Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser
Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val Met
Thr Gln Ser Pro145 150 155 160Ser Ser Leu Thr Val Thr Ala Gly Glu
Lys Val Thr Met Ser Cys Lys 165 170 175Ser Ser Gln Ser Leu Leu Asn
Ser Gly Asn Gln Lys Asn Tyr Leu Thr 180 185 190Trp Tyr Gln Gln Lys
Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp 195 200 205Ala Ser Thr
Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly 210 215 220Ser
Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp225 230
235 240Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser Tyr Pro Phe Thr
Phe 245 250 255Gly Ser Gly Thr Lys Leu Glu Ile Lys Ser Gly Gly Gly
Gly Ser Lys 260 265 270Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro
Gly Ala Ser Val Lys 275 280 285Met Ser Cys Lys Thr Ser Gly Tyr Thr
Phe Thr Arg Tyr Thr Met His 290 295 300Trp Val Lys Gln Arg Pro Gly
Gln Gly Leu Glu Trp Ile Gly Tyr Ile305 310 315 320Asn Pro Ser Arg
Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys 325 330 335Ala Thr
Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu 340 345
350Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Tyr
355 360 365Tyr Asp Asp His Tyr Cys Leu Asp Tyr Trp Gly Gln Gly Thr
Thr Leu 370 375 380Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly385 390 395 400Gly Gly Ser Asp Ile Gln Leu Thr Gln
Ser Pro Ala Ile Met Ser Ala 405 410 415Ser Pro Gly Glu Lys Val Thr
Met Thr Cys Arg Ala Ser Ser Ser Val 420 425 430Ser Tyr Met Asn Trp
Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg 435 440 445Trp Ile Tyr
Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe 450 455 460Ser
Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met465 470
475 480Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser
Asn 485 490 495Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys
His His His 500 505 510His His His 51542487PRTArtificial
SequenceBispecific molecule 42Glu Val Gln Leu Gln Gln Ser Gly Pro
Glu Leu Val Lys Pro Gly Ala1 5 10 15Ser Met Lys Ile Ser Cys Lys Ala
Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25 30Thr Met Asn Trp Val Lys Gln
Ser His Gly Lys Asn Leu Glu Trp Ile 35 40 45Gly Leu Ile Asn Pro Tyr
Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe 50 55 60Lys Gly Lys Ala Thr
Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr65 70 75 80Met Glu Leu
Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95Ala Arg
Asp Tyr Gly Phe Val Leu Asp Tyr Trp Gly Gln Gly Thr Thr 100 105
110Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
115 120 125Gly Gly Gly Ser Asp Ile Val Leu Thr Gln Ser Pro Ser Ile
Met Ser 130 135 140Val Ser Pro Gly Glu Lys Val Thr Ile Thr Cys Ser
Ala Ser Ser Ser145 150 155 160Val Ser Tyr Met His Trp Phe Gln Gln
Lys Pro Gly Thr Ser Pro Lys 165 170 175Leu Cys Ile Tyr Ser Thr Ser
Asn Leu Ala Ser Gly Val Pro Ala Arg 180 185 190Phe Ser Gly Arg Gly
Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg 195 200 205Val Ala Ala
Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Ser Asn 210 215 220Tyr
Pro Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Ser225 230
235 240Gly Gly Gly Gly Ser Asp Ile Lys Leu Gln Gln Ser Gly Ala Glu
Leu 245 250 255Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Thr
Ser Gly Tyr 260 265 270Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys
Gln Arg Pro Gly Gln 275 280 285Gly Leu Glu Trp Ile Gly Tyr Ile Asn
Pro Ser Arg Gly Tyr Thr Asn 290 295 300Tyr Asn Gln Lys Phe Lys Asp
Lys Ala Thr Leu Thr Thr Asp Lys Ser305 310 315 320Ser Ser Thr Ala
Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser 325 330 335Ala Val
Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His Tyr Cys Leu Asp 340 345
350Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Val Glu Gly Gly
355 360 365Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Val Asp
Asp Ile 370 375 380Gln Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser
Pro Gly Glu Lys385 390 395 400Val Thr Met Thr Cys Arg Ala Ser Ser
Ser Val Ser Tyr Met Asn Trp 405 410 415Tyr Gln Gln Lys Ser Gly Thr
Ser Pro Lys Arg Trp Ile Tyr Asp Thr 420 425 430Ser Lys Val Ala Ser
Gly Val Pro Tyr Arg Phe Ser Gly Ser Gly Ser 435 440 445Gly Thr Ser
Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu Asp Ala 450 455 460Ala
Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr Phe Gly465 470
475 480Ala Gly Thr Lys Leu Glu Leu 48543513PRTArtificial
SequenceBispecific molecule 43Met Gly Trp Ser Cys Ile Ile Leu Phe
Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Glu Val Gln Leu Gln
Gln Ser Gly Pro Glu Leu Val Lys 20 25 30Pro Gly Ala Ser Met Lys Ile
Ser Cys Lys Ala Ser Gly Tyr Ser Phe 35 40 45Thr Gly Tyr Thr Met Asn
Trp Val
Lys Gln Ser His Gly Lys Asn Leu 50 55 60Glu Trp Ile Gly Leu Ile Asn
Pro Tyr Asn Gly Gly Thr Ile Tyr Asn65 70 75 80Gln Lys Phe Lys Gly
Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser 85 90 95Thr Ala Tyr Met
Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val 100 105 110Tyr Tyr
Cys Ala Arg Asp Tyr Gly Phe Val Leu Asp Tyr Trp Gly Gln 115 120
125Gly Thr Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly
130 135 140Gly Ser Gly Gly Gly Gly Ser Asp Ile Val Leu Thr Gln Ser
Pro Ser145 150 155 160Ile Met Ser Val Ser Pro Gly Glu Lys Val Thr
Ile Thr Cys Ser Ala 165 170 175Ser Ser Ser Val Ser Tyr Met His Trp
Phe Gln Gln Lys Pro Gly Thr 180 185 190Ser Pro Lys Leu Cys Ile Tyr
Ser Thr Ser Asn Leu Ala Ser Gly Val 195 200 205Pro Ala Arg Phe Ser
Gly Arg Gly Ser Gly Thr Ser Tyr Ser Leu Thr 210 215 220Ile Ser Arg
Val Ala Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln225 230 235
240Arg Ser Asn Tyr Pro Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu
245 250 255Ile Lys Ser Gly Gly Gly Gly Ser Asp Ile Lys Leu Gln Gln
Ser Gly 260 265 270Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met
Ser Cys Lys Thr 275 280 285Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met
His Trp Val Lys Gln Arg 290 295 300Pro Gly Gln Gly Leu Glu Trp Ile
Gly Tyr Ile Asn Pro Ser Arg Gly305 310 315 320Tyr Thr Asn Tyr Asn
Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr 325 330 335Asp Lys Ser
Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser 340 345 350Glu
Asp Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His Tyr 355 360
365Cys Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Val
370 375 380Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly
Gly Val385 390 395 400Asp Asp Ile Gln Leu Thr Gln Ser Pro Ala Ile
Met Ser Ala Ser Pro 405 410 415Gly Glu Lys Val Thr Met Thr Cys Arg
Ala Ser Ser Ser Val Ser Tyr 420 425 430Met Asn Trp Tyr Gln Gln Lys
Ser Gly Thr Ser Pro Lys Arg Trp Ile 435 440 445Tyr Asp Thr Ser Lys
Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly 450 455 460Ser Gly Ser
Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala465 470 475
480Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu
485 490 495Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys His His His
His His 500 505 510His44488PRTArtificial SequenceBispecific
molecule 44Asp Ile Lys Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro
Gly Ala1 5 10 15Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe
Thr Arg Tyr 20 25 30Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly
Leu Glu Trp Ile 35 40 45Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn
Tyr Asn Gln Lys Phe 50 55 60Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys
Ser Ser Ser Thr Ala Tyr65 70 75 80Met Gln Leu Ser Ser Leu Thr Ser
Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95Ala Arg Tyr Tyr Asp Asp His
Tyr Cys Leu Asp Tyr Trp Gly Gln Gly 100 105 110Thr Thr Leu Thr Val
Ser Ser Val Glu Gly Gly Ser Gly Gly Ser Gly 115 120 125Gly Ser Gly
Gly Ser Gly Gly Val Asp Asp Ile Gln Leu Thr Gln Ser 130 135 140Pro
Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys145 150
155 160Arg Ala Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys
Ser 165 170 175Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys
Val Ala Ser 180 185 190Gly Val Pro Tyr Arg Phe Ser Gly Ser Gly Ser
Gly Thr Ser Tyr Ser 195 200 205Leu Thr Ile Ser Ser Met Glu Ala Glu
Asp Ala Ala Thr Tyr Tyr Cys 210 215 220Gln Gln Trp Ser Ser Asn Pro
Leu Thr Phe Gly Ala Gly Thr Lys Leu225 230 235 240Glu Leu Lys Ser
Gly Gly Gly Gly Ser Glu Val Gln Leu Gln Gln Ser 245 250 255Gly Pro
Glu Leu Val Lys Pro Gly Ala Ser Met Lys Ile Ser Cys Lys 260 265
270Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp Val Lys Gln
275 280 285Ser His Gly Lys Asn Leu Glu Trp Ile Gly Leu Ile Asn Pro
Tyr Asn 290 295 300Gly Gly Thr Ile Tyr Asn Gln Lys Phe Lys Gly Lys
Ala Thr Leu Thr305 310 315 320Val Asp Lys Ser Ser Ser Thr Ala Tyr
Met Glu Leu Leu Ser Leu Thr 325 330 335Ser Glu Asp Ser Ala Val Tyr
Tyr Cys Ala Arg Asp Tyr Gly Phe Val 340 345 350Leu Asp Tyr Trp Gly
Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly 355 360 365Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val 370 375 380Leu
Thr Gln Ser Pro Ser Ile Met Ser Val Ser Pro Gly Glu Lys Val385 390
395 400Thr Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met His Trp
Phe 405 410 415Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Cys Ile Tyr
Ser Thr Ser 420 425 430Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser
Gly Arg Gly Ser Gly 435 440 445Thr Ser Tyr Ser Leu Thr Ile Ser Arg
Val Ala Ala Glu Asp Ala Ala 450 455 460Thr Tyr Tyr Cys Gln Gln Arg
Ser Asn Tyr Pro Pro Trp Thr Phe Gly465 470 475 480Gly Gly Thr Lys
Leu Glu Ile Lys 48545513PRTArtificial SequenceBispecific molecule
45Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1
5 10 15Val His Ser Asp Ile Lys Leu Gln Gln Ser Gly Ala Glu Leu Ala
Arg 20 25 30Pro Gly Ala Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr
Thr Phe 35 40 45Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly
Gln Gly Leu 50 55 60Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr
Thr Asn Tyr Asn65 70 75 80Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr
Thr Asp Lys Ser Ser Ser 85 90 95Thr Ala Tyr Met Gln Leu Ser Ser Leu
Thr Ser Glu Asp Ser Ala Val 100 105 110Tyr Tyr Cys Ala Arg Tyr Tyr
Asp Asp His Tyr Cys Leu Asp Tyr Trp 115 120 125Gly Gln Gly Thr Thr
Leu Thr Val Ser Ser Val Glu Gly Gly Ser Gly 130 135 140Gly Ser Gly
Gly Ser Gly Gly Ser Gly Gly Val Asp Asp Ile Gln Leu145 150 155
160Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr
165 170 175Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met Asn Trp
Tyr Gln 180 185 190Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr
Asp Thr Ser Lys 195 200 205Val Ala Ser Gly Val Pro Tyr Arg Phe Ser
Gly Ser Gly Ser Gly Thr 210 215 220Ser Tyr Ser Leu Thr Ile Ser Ser
Met Glu Ala Glu Asp Ala Ala Thr225 230 235 240Tyr Tyr Cys Gln Gln
Trp Ser Ser Asn Pro Leu Thr Phe Gly Ala Gly 245 250 255Thr Lys Leu
Glu Leu Lys Ser Gly Gly Gly Gly Ser Glu Val Gln Leu 260 265 270Gln
Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala Ser Met Lys Ile 275 280
285Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp
290 295 300Val Lys Gln Ser His Gly Lys Asn Leu Glu Trp Ile Gly Leu
Ile Asn305 310 315 320Pro Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys
Phe Lys Gly Lys Ala 325 330 335Thr Leu Thr Val Asp Lys Ser Ser Ser
Thr Ala Tyr Met Glu Leu Leu 340 345 350Ser Leu Thr Ser Glu Asp Ser
Ala Val Tyr Tyr Cys Ala Arg Asp Tyr 355 360 365Gly Phe Val Leu Asp
Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser 370 375 380Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser385 390 395
400Asp Ile Val Leu Thr Gln Ser Pro Ser Ile Met Ser Val Ser Pro Gly
405 410 415Glu Lys Val Thr Ile Thr Cys Ser Ala Ser Ser Ser Val Ser
Tyr Met 420 425 430His Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys
Leu Cys Ile Tyr 435 440 445Ser Thr Ser Asn Leu Ala Ser Gly Val Pro
Ala Arg Phe Ser Gly Arg 450 455 460Gly Ser Gly Thr Ser Tyr Ser Leu
Thr Ile Ser Arg Val Ala Ala Glu465 470 475 480Asp Ala Ala Thr Tyr
Tyr Cys Gln Gln Arg Ser Asn Tyr Pro Pro Trp 485 490 495Thr Phe Gly
Gly Gly Thr Lys Leu Glu Ile Lys His His His His His 500 505
510His4615PRTArtificial SequenceLinker 46Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser1 5 10 154716PRTArtificial
SequenceLinker 47Val Glu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Gly Gly Val Asp1 5 10 15486PRTArtificial SequenceLinker 48Ser Gly
Gly Gly Gly Ser1 5495PRTArtificial SequenceLinker 49Gly Gly Gly Gly
Ser1 55018PRTArtificial SequenceLinker 50Val Glu Gly Gly Ser Gly
Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly1 5 10 15Val
Asp5119PRTArtificial SequenceSecretion signal 51Met Gly Trp Ser Cys
Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His
Ser5219PRTArtificial SequenceSecretion signal 52Met Asn Ser Gly Leu
Gln Leu Val Phe Phe Val Leu Thr Leu Lys Gly1 5 10 15Ile Gln
Gly5319PRTArtificial SequenceSecretion signal 53Met Asn Phe Gly Leu
Ser Leu Ile Phe Leu Ala Leu Ile Leu Lys Gly1 5 10 15Val Gln
Cys5419PRTArtificial SequenceSecretion signal 54Met Glu Trp Ser Trp
Ile Phe Leu Phe Leu Leu Ser Val Thr Thr Gly1 5 10 15Val His
Ser5519PRTArtificial SequenceSecretion signal 55Met Gly Trp Leu Trp
Asn Leu Leu Phe Leu Met Ala Ala Ala Gln Ser1 5 10 15Ala Gln
Ala5621DNAArtificial SequenceOligonucleotide 56tggctctgtg
tcgacactgt g 215721DNAArtificial SequenceOligonucleotide
57gtgtacatgt tagctgtgga c 215821DNAArtificial
SequenceOligonucleotide 58tgacactggc aaaacaatgc a
215921DNAArtificial SequenceOligonucleotide 59ggtccttttc accagcaagc
t 2160507PRTartificialartificial Antibody 60Met Gly Trp Ser Cys Ile
Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Glu Val
Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys 20 25 30Pro Gly Ala Ser
Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe 35 40 45Thr Gly Tyr
Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu 50 55 60Glu Trp
Ile Gly Leu Ile Asn Pro Tyr Asn Gly Gly Thr Ile Tyr Asn65 70 75
80Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser
85 90 95Thr Ala Tyr Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala
Val 100 105 110Tyr Tyr Cys Ala Arg Asp Tyr Gly Phe Val Leu Asp Tyr
Trp Gly Gln 115 120 125Gly Thr Thr Leu Thr Val Ser Ser Gly Gly Gly
Gly Ser Gly Gly Gly 130 135 140Gly Ser Gly Gly Gly Gly Ser Gln Ile
Val Leu Thr Gln Ser Pro Ser145 150 155 160Ile Met Ser Val Ser Pro
Gly Glu Lys Val Thr Ile Thr Cys Ser Ala 165 170 175Ser Ser Ser Val
Ser Tyr Met His Trp Phe Gln Gln Lys Pro Gly Thr 180 185 190Ser Pro
Lys Leu Leu Ile Tyr Ser Thr Ser Asn Leu Ala Ser Gly Val 195 200
205Pro Ala Arg Phe Ser Gly Arg Gly Ser Gly Thr Ser Tyr Ser Leu Thr
210 215 220Ile Ser Arg Val Ala Ala Glu Asp Ala Ala Thr Tyr Tyr Cys
Gln Gln225 230 235 240Arg Ser Asn Tyr Pro Pro Trp Thr Phe Gly Gly
Gly Thr Lys Leu Glu 245 250 255Ile Lys Ser Gly Gly Gly Gly Ser Gln
Val Gln Leu Gln Gln Ser Gly 260 265 270Ala Glu Leu Ala Arg Pro Gly
Ala Ser Val Lys Met Ser Cys Lys Thr 275 280 285Ser Gly Tyr Thr Phe
Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg 290 295 300Pro Gly Gln
Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly305 310 315
320Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr
325 330 335Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu
Thr Ser 340 345 350Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr
Asp Asp His Tyr 355 360 365Ser Leu Asp Tyr Trp Gly Gln Gly Thr Thr
Leu Thr Val Ser Ser Gly 370 375 380Gly Gly Gly Ser Gly Gly Ser Gly
Gly Ser Gly Gly Ser Gly Gly Gly385 390 395 400Ser Gln Ile Val Leu
Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro 405 410 415Gly Glu Lys
Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr 420 425 430Met
Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile 435 440
445Tyr Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly
450 455 460Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met
Glu Ala465 470 475 480Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp
Ser Ser Asn Pro Leu 485 490 495Thr Phe Gly Ala Gly Thr Lys Leu Glu
Leu Lys 500 50561507PRTartificialartificial Antibody 61Met Gly Trp
Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His
Ser Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys 20 25 30Pro
Gly Ala Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe 35 40
45Thr Gly Tyr Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu
50 55 60Glu Trp Ile Gly Leu Ile Asn Pro Tyr Asn Gly Gly Thr Ile Tyr
Asn65 70 75 80Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Val Asp Lys
Ser Ser Ser 85 90 95Thr Ala Tyr Met Glu Leu Leu Ser Leu Thr Ser Glu
Asp Ser Ala Val 100 105 110Tyr Tyr Cys Ala Arg Asp Tyr Gly Phe Val
Leu Asp Tyr Trp Gly Gln 115 120 125Gly Thr Thr Leu Thr Val Ser Ser
Gly Gly Gly Gly Ser Gly Gly Gly 130 135 140Gly Ser Gly Gly Gly Gly
Ser Gln Ile Val Leu Thr Gln Ser Pro Ser145 150 155 160Ile Met Ser
Val Ser Pro Gly Glu Lys Val Thr Ile Thr Cys Ser Ala 165 170 175Ser
Ser Ser Val Ser Tyr Met His Trp Phe Gln Gln Lys Pro Gly Thr 180 185
190Ser Pro Lys Leu Trp Ile Tyr Ser Thr Ser Asn Leu Ala Ser Gly Val
195 200 205Pro Ala Arg Phe Ser Gly Arg
Gly Ser Gly Thr Ser Tyr Ser Leu Thr 210 215 220Ile Ser Arg Val Ala
Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln225 230 235 240Arg Ser
Asn Tyr Pro Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu 245 250
255Ile Lys Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser Gly
260 265 270Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys
Lys Thr 275 280 285Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp
Val Lys Gln Arg 290 295 300Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr
Ile Asn Pro Ser Arg Gly305 310 315 320Tyr Thr Asn Tyr Asn Gln Lys
Phe Lys Asp Lys Ala Thr Leu Thr Thr 325 330 335Asp Lys Ser Ser Ser
Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser 340 345 350Glu Asp Ser
Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His Tyr 355 360 365Ser
Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Gly 370 375
380Gly Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly
Gly385 390 395 400Ser Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met
Ser Ala Ser Pro 405 410 415Gly Glu Lys Val Thr Met Thr Cys Arg Ala
Ser Ser Ser Val Ser Tyr 420 425 430Met Asn Trp Tyr Gln Gln Lys Ser
Gly Thr Ser Pro Lys Arg Trp Ile 435 440 445Tyr Asp Thr Ser Lys Val
Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly 450 455 460Ser Gly Ser Gly
Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala465 470 475 480Glu
Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu 485 490
495Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 500
50562507PRTartificialartificial Antibody 62Met Gly Trp Ser Cys Ile
Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Glu Val
Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys 20 25 30Pro Gly Ala Ser
Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe 35 40 45Thr Gly Tyr
Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu 50 55 60Glu Trp
Ile Gly Leu Ile Asn Pro Tyr Asn Gly Gly Thr Ile Tyr Asn65 70 75
80Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser
85 90 95Thr Ala Tyr Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala
Val 100 105 110Tyr Tyr Cys Ala Arg Asp Tyr Gly Phe Val Leu Asp Tyr
Trp Gly Gln 115 120 125Gly Thr Thr Leu Thr Val Ser Ser Gly Gly Gly
Gly Ser Gly Gly Gly 130 135 140Gly Ser Gly Gly Gly Gly Ser Gln Ile
Val Leu Thr Gln Ser Pro Ser145 150 155 160Ile Met Ser Val Ser Pro
Gly Glu Lys Val Thr Ile Thr Cys Ser Ala 165 170 175Ser Ser Ser Val
Ser Tyr Met His Trp Phe Gln Gln Lys Pro Gly Thr 180 185 190Ser Pro
Lys Leu Ser Ile Tyr Ser Thr Ser Asn Leu Ala Ser Gly Val 195 200
205Pro Ala Arg Phe Ser Gly Arg Gly Ser Gly Thr Ser Tyr Ser Leu Thr
210 215 220Ile Ser Arg Val Ala Ala Glu Asp Ala Ala Thr Tyr Tyr Cys
Gln Gln225 230 235 240Arg Ser Asn Tyr Pro Pro Trp Thr Phe Gly Gly
Gly Thr Lys Leu Glu 245 250 255Ile Lys Ser Gly Gly Gly Gly Ser Gln
Val Gln Leu Gln Gln Ser Gly 260 265 270Ala Glu Leu Ala Arg Pro Gly
Ala Ser Val Lys Met Ser Cys Lys Thr 275 280 285Ser Gly Tyr Thr Phe
Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg 290 295 300Pro Gly Gln
Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly305 310 315
320Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr
325 330 335Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu
Thr Ser 340 345 350Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr
Asp Asp His Tyr 355 360 365Ser Leu Asp Tyr Trp Gly Gln Gly Thr Thr
Leu Thr Val Ser Ser Gly 370 375 380Gly Gly Gly Ser Gly Gly Ser Gly
Gly Ser Gly Gly Ser Gly Gly Gly385 390 395 400Ser Gln Ile Val Leu
Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro 405 410 415Gly Glu Lys
Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr 420 425 430Met
Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile 435 440
445Tyr Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly
450 455 460Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met
Glu Ala465 470 475 480Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp
Ser Ser Asn Pro Leu 485 490 495Thr Phe Gly Ala Gly Thr Lys Leu Glu
Leu Lys 500 50563507PRTartificialartificial Antibody 63Met Gly Trp
Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His
Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg 20 25 30Pro
Gly Ala Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe 35 40
45Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu
50 55 60Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr
Asn65 70 75 80Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys
Ser Ser Ser 85 90 95Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu
Asp Ser Ala Val 100 105 110Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His
Tyr Ser Leu Asp Tyr Trp 115 120 125Gly Gln Gly Thr Thr Leu Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly 130 135 140Gly Ser Gly Gly Ser Gly
Gly Ser Gly Gly Gly Ser Gln Ile Val Leu145 150 155 160Thr Gln Ser
Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr 165 170 175Met
Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr Gln 180 185
190Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys
195 200 205Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser Gly Ser
Gly Thr 210 215 220Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu
Asp Ala Ala Thr225 230 235 240Tyr Tyr Cys Gln Gln Trp Ser Ser Asn
Pro Leu Thr Phe Gly Ala Gly 245 250 255Thr Lys Leu Glu Leu Lys Ser
Gly Gly Gly Gly Ser Glu Val Gln Leu 260 265 270Gln Gln Ser Gly Pro
Glu Leu Val Lys Pro Gly Ala Ser Met Lys Ile 275 280 285Ser Cys Lys
Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp 290 295 300Val
Lys Gln Ser His Gly Lys Asn Leu Glu Trp Ile Gly Leu Ile Asn305 310
315 320Pro Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe Lys Gly Lys
Ala 325 330 335Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met
Glu Leu Leu 340 345 350Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr
Cys Ala Arg Asp Tyr 355 360 365Gly Phe Val Leu Asp Tyr Trp Gly Gln
Gly Thr Thr Leu Thr Val Ser 370 375 380Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser385 390 395 400Gln Ile Val Leu
Thr Gln Ser Pro Ser Ile Met Ser Val Ser Pro Gly 405 410 415Glu Lys
Val Thr Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met 420 425
430His Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Leu Ile Tyr
435 440 445Ser Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser
Gly Arg 450 455 460Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg
Val Ala Ala Glu465 470 475 480Asp Ala Ala Thr Tyr Tyr Cys Gln Gln
Arg Ser Asn Tyr Pro Pro Trp 485 490 495Thr Phe Gly Gly Gly Thr Lys
Leu Glu Ile Lys 500 50564507PRTartificialartificial Antibody 64Met
Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10
15Val His Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg
20 25 30Pro Gly Ala Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr
Phe 35 40 45Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly Gln
Gly Leu 50 55 60Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr
Asn Tyr Asn65 70 75 80Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr
Asp Lys Ser Ser Ser 85 90 95Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr
Ser Glu Asp Ser Ala Val 100 105 110Tyr Tyr Cys Ala Arg Tyr Tyr Asp
Asp His Tyr Ser Leu Asp Tyr Trp 115 120 125Gly Gln Gly Thr Thr Leu
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly 130 135 140Gly Ser Gly Gly
Ser Gly Gly Ser Gly Gly Gly Ser Gln Ile Val Leu145 150 155 160Thr
Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr 165 170
175Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr Gln
180 185 190Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp Thr
Ser Lys 195 200 205Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser
Gly Ser Gly Thr 210 215 220Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu
Ala Glu Asp Ala Ala Thr225 230 235 240Tyr Tyr Cys Gln Gln Trp Ser
Ser Asn Pro Leu Thr Phe Gly Ala Gly 245 250 255Thr Lys Leu Glu Leu
Lys Ser Gly Gly Gly Gly Ser Glu Val Gln Leu 260 265 270Gln Gln Ser
Gly Pro Glu Leu Val Lys Pro Gly Ala Ser Met Lys Ile 275 280 285Ser
Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp 290 295
300Val Lys Gln Ser His Gly Lys Asn Leu Glu Trp Ile Gly Leu Ile
Asn305 310 315 320Pro Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe
Lys Gly Lys Ala 325 330 335Thr Leu Thr Val Asp Lys Ser Ser Ser Thr
Ala Tyr Met Glu Leu Leu 340 345 350Ser Leu Thr Ser Glu Asp Ser Ala
Val Tyr Tyr Cys Ala Arg Asp Tyr 355 360 365Gly Phe Val Leu Asp Tyr
Trp Gly Gln Gly Thr Thr Leu Thr Val Ser 370 375 380Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser385 390 395 400Gln
Ile Val Leu Thr Gln Ser Pro Ser Ile Met Ser Val Ser Pro Gly 405 410
415Glu Lys Val Thr Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met
420 425 430His Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Trp
Ile Tyr 435 440 445Ser Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg
Phe Ser Gly Arg 450 455 460Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile
Ser Arg Val Ala Ala Glu465 470 475 480Asp Ala Ala Thr Tyr Tyr Cys
Gln Gln Arg Ser Asn Tyr Pro Pro Trp 485 490 495Thr Phe Gly Gly Gly
Thr Lys Leu Glu Ile Lys 500 50565507PRTartificialartificial
Antibody 65Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala
Thr Gly1 5 10 15Val His Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu
Leu Ala Arg 20 25 30Pro Gly Ala Ser Val Lys Met Ser Cys Lys Thr Ser
Gly Tyr Thr Phe 35 40 45Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg
Pro Gly Gln Gly Leu 50 55 60Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg
Gly Tyr Thr Asn Tyr Asn65 70 75 80Gln Lys Phe Lys Asp Lys Ala Thr
Leu Thr Thr Asp Lys Ser Ser Ser 85 90 95Thr Ala Tyr Met Gln Leu Ser
Ser Leu Thr Ser Glu Asp Ser Ala Val 100 105 110Tyr Tyr Cys Ala Arg
Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp 115 120 125Gly Gln Gly
Thr Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly 130 135 140Gly
Ser Gly Gly Ser Gly Gly Ser Gly Gly Gly Ser Gln Ile Val Leu145 150
155 160Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val
Thr 165 170 175Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met Asn
Trp Tyr Gln 180 185 190Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile
Tyr Asp Thr Ser Lys 195 200 205Val Ala Ser Gly Val Pro Tyr Arg Phe
Ser Gly Ser Gly Ser Gly Thr 210 215 220Ser Tyr Ser Leu Thr Ile Ser
Ser Met Glu Ala Glu Asp Ala Ala Thr225 230 235 240Tyr Tyr Cys Gln
Gln Trp Ser Ser Asn Pro Leu Thr Phe Gly Ala Gly 245 250 255Thr Lys
Leu Glu Leu Lys Ser Gly Gly Gly Gly Ser Glu Val Gln Leu 260 265
270Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala Ser Met Lys Ile
275 280 285Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met
Asn Trp 290 295 300Val Lys Gln Ser His Gly Lys Asn Leu Glu Trp Ile
Gly Leu Ile Asn305 310 315 320Pro Tyr Asn Gly Gly Thr Ile Tyr Asn
Gln Lys Phe Lys Gly Lys Ala 325 330 335Thr Leu Thr Val Asp Lys Ser
Ser Ser Thr Ala Tyr Met Glu Leu Leu 340 345 350Ser Leu Thr Ser Glu
Asp Ser Ala Val Tyr Tyr Cys Ala Arg Asp Tyr 355 360 365Gly Phe Val
Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser 370 375 380Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser385 390
395 400Gln Ile Val Leu Thr Gln Ser Pro Ser Ile Met Ser Val Ser Pro
Gly 405 410 415Glu Lys Val Thr Ile Thr Cys Ser Ala Ser Ser Ser Val
Ser Tyr Met 420 425 430His Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro
Lys Leu Ser Ile Tyr 435 440 445Ser Thr Ser Asn Leu Ala Ser Gly Val
Pro Ala Arg Phe Ser Gly Arg 450 455 460Gly Ser Gly Thr Ser Tyr Ser
Leu Thr Ile Ser Arg Val Ala Ala Glu465 470 475 480Asp Ala Ala Thr
Tyr Tyr Cys Gln Gln Arg Ser Asn Tyr Pro Pro Trp 485 490 495Thr Phe
Gly Gly Gly Thr Lys Leu Glu Ile Lys 500
50566530PRTartificialartificial Antibody 66Met Gly Trp Ser Cys Ile
Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Gln Ile
Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys 20 25 30Pro Gly Glu Thr
Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45Thr Asn Tyr
Gly Met Asn Trp Val Lys Gln Ala Pro Gly Lys Gly Leu 50 55 60Lys Trp
Met Gly Trp Ile Asn Thr Asn Thr Gly Glu Pro Thr Tyr Ala65 70 75
80Glu Glu Phe Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser
85 90 95Thr Ala Tyr Leu Gln Ile Asn Asn Leu Lys Asn Glu Asp Thr Ala
Thr 100 105 110Tyr Phe Cys Ala Arg Leu Gly Phe Gly Asn Ala Met Asp
Tyr Trp Gly 115
120 125Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly
Gly 130 135 140Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Asp Ile Val145 150 155 160Met Thr Gln Ser Pro Ser Ser Leu Thr Val
Thr Ala Gly Glu Lys Val 165 170 175Thr Met Ser Cys Lys Ser Ser Gln
Ser Leu Leu Asn Ser Gly Asn Gln 180 185 190Lys Asn Tyr Leu Thr Trp
Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys 195 200 205Leu Leu Ile Tyr
Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg 210 215 220Phe Thr
Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser225 230 235
240Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser
245 250 255Tyr Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys
Ser Gly 260 265 270Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser Gly
Ala Glu Leu Ala 275 280 285Arg Pro Gly Ala Ser Val Lys Met Ser Cys
Lys Thr Ser Gly Tyr Thr 290 295 300Phe Thr Arg Tyr Thr Met His Trp
Val Lys Gln Arg Pro Gly Gln Gly305 310 315 320Leu Glu Trp Ile Gly
Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr 325 330 335Asn Gln Lys
Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser 340 345 350Ser
Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala 355 360
365Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr
370 375 380Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly Gly
Gly Ser385 390 395 400Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Gln 405 410 415Ile Val Leu Thr Gln Ser Pro Ala Ile
Met Ser Ala Ser Pro Gly Glu 420 425 430Lys Val Thr Met Thr Cys Arg
Ala Ser Ser Ser Val Ser Tyr Met Asn 435 440 445Trp Tyr Gln Gln Lys
Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp 450 455 460Thr Ser Lys
Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser Gly465 470 475
480Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu Asp
485 490 495Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu
Thr Phe 500 505 510Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly Ser
His His His His 515 520 525His His 53067530PRTartificialartificial
Antibody 67Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala
Thr Gly1 5 10 15Val His Ser Gln Ile Gln Leu Val Gln Ser Gly Pro Glu
Leu Lys Lys 20 25 30Pro Gly Glu Thr Val Lys Ile Ser Cys Lys Ala Ser
Gly Tyr Thr Phe 35 40 45Thr Asn Tyr Gly Met Asn Trp Val Lys Gln Ala
Pro Gly Lys Cys Leu 50 55 60Lys Trp Met Gly Trp Ile Asn Thr Asn Thr
Gly Glu Pro Thr Tyr Ala65 70 75 80Glu Glu Phe Lys Gly Arg Phe Ala
Phe Ser Leu Glu Thr Ser Ala Ser 85 90 95Thr Ala Tyr Leu Gln Ile Asn
Asn Leu Lys Asn Glu Asp Thr Ala Thr 100 105 110Tyr Phe Cys Ala Arg
Leu Gly Phe Gly Asn Ala Met Asp Tyr Trp Gly 115 120 125Gln Gly Thr
Ser Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val145 150
155 160Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys
Val 165 170 175Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser
Gly Asn Gln 180 185 190Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro
Gly Gln Pro Pro Lys 195 200 205Leu Leu Ile Tyr Trp Ala Ser Thr Arg
Glu Ser Gly Val Pro Asp Arg 210 215 220Phe Thr Gly Ser Gly Ser Gly
Thr Asp Phe Thr Leu Thr Ile Ser Ser225 230 235 240Val Gln Ala Glu
Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser 245 250 255Tyr Pro
Leu Thr Phe Gly Cys Gly Thr Lys Leu Glu Leu Lys Ser Gly 260 265
270Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala
275 280 285Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Thr Ser Gly
Tyr Thr 290 295 300Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg
Pro Gly Gln Gly305 310 315 320Leu Glu Trp Ile Gly Tyr Ile Asn Pro
Ser Arg Gly Tyr Thr Asn Tyr 325 330 335Asn Gln Lys Phe Lys Asp Lys
Ala Thr Leu Thr Thr Asp Lys Ser Ser 340 345 350Ser Thr Ala Tyr Met
Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala 355 360 365Val Tyr Tyr
Cys Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr 370 375 380Trp
Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser385 390
395 400Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Gln 405 410 415Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser
Pro Gly Glu 420 425 430Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser
Val Ser Tyr Met Asn 435 440 445Trp Tyr Gln Gln Lys Ser Gly Thr Ser
Pro Lys Arg Trp Ile Tyr Asp 450 455 460Thr Ser Lys Val Ala Ser Gly
Val Pro Tyr Arg Phe Ser Gly Ser Gly465 470 475 480Ser Gly Thr Ser
Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu Asp 485 490 495Ala Ala
Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr Phe 500 505
510Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly Ser His His His His
515 520 525His His 53068530PRTartificialartificial Antibody 68Met
Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10
15Val His Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg
20 25 30Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr
Phe 35 40 45Thr Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln
Gly Leu 50 55 60Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr
Asn Tyr Asn65 70 75 80Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val
Asp Lys Ser Ser Ser 85 90 95Thr Ala Tyr Met Gln Leu Ser Ser Pro Thr
Ser Glu Asp Ser Ala Val 100 105 110Tyr Tyr Cys Thr Arg Ser Trp Arg
Gly Asn Ser Phe Asp Tyr Trp Gly 115 120 125Gln Gly Thr Thr Leu Thr
Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val145 150 155 160Met
Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val 165 170
175Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln
180 185 190Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro
Pro Lys 195 200 205Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly
Val Pro Asp Arg 210 215 220Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Thr Ile Ser Ser225 230 235 240Val Gln Ala Glu Asp Leu Ala
Val Tyr Tyr Cys Gln Asn Asp Tyr Ser 245 250 255Tyr Pro Phe Thr Phe
Gly Ser Gly Thr Lys Leu Glu Ile Lys Ser Gly 260 265 270Gly Gly Gly
Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala 275 280 285Arg
Pro Gly Ala Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr 290 295
300Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly Gln
Gly305 310 315 320Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly
Tyr Thr Asn Tyr 325 330 335Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu
Thr Thr Asp Lys Ser Ser 340 345 350Ser Thr Ala Tyr Met Gln Leu Ser
Ser Leu Thr Ser Glu Asp Ser Ala 355 360 365Val Tyr Tyr Cys Ala Arg
Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr 370 375 380Trp Gly Gln Gly
Thr Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser385 390 395 400Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln 405 410
415Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu
420 425 430Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr
Met Asn 435 440 445Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg
Trp Ile Tyr Asp 450 455 460Thr Ser Lys Val Ala Ser Gly Val Pro Tyr
Arg Phe Ser Gly Ser Gly465 470 475 480Ser Gly Thr Ser Tyr Ser Leu
Thr Ile Ser Ser Met Glu Ala Glu Asp 485 490 495Ala Ala Thr Tyr Tyr
Cys Gln Gln Trp Ser Ser Asn Pro Leu Thr Phe 500 505 510Gly Ala Gly
Thr Lys Leu Glu Leu Lys Gly Gly Ser His His His His 515 520 525His
His 53069530PRTartificialartificial Antibody 69Met Gly Trp Ser Cys
Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Gln
Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg 20 25 30Pro Gly Ala
Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45Thr Ser
Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Cys Leu 50 55 60Glu
Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn65 70 75
80Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser
85 90 95Thr Ala Tyr Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala
Val 100 105 110Tyr Tyr Cys Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp
Tyr Trp Gly 115 120 125Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Asp Ile Val145 150 155 160Met Thr Gln Ser Pro Ser
Ser Leu Thr Val Thr Ala Gly Glu Lys Val 165 170 175Thr Met Ser Cys
Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln 180 185 190Lys Asn
Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys 195 200
205Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg
210 215 220Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
Ser Ser225 230 235 240Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys
Gln Asn Asp Tyr Ser 245 250 255Tyr Pro Phe Thr Phe Gly Cys Gly Thr
Lys Leu Glu Ile Lys Ser Gly 260 265 270Gly Gly Gly Ser Gln Val Gln
Leu Gln Gln Ser Gly Ala Glu Leu Ala 275 280 285Arg Pro Gly Ala Ser
Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr 290 295 300Phe Thr Arg
Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly305 310 315
320Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr
325 330 335Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys
Ser Ser 340 345 350Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser
Glu Asp Ser Ala 355 360 365Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp
His Tyr Ser Leu Asp Tyr 370 375 380Trp Gly Gln Gly Thr Thr Leu Thr
Val Ser Ser Gly Gly Gly Gly Ser385 390 395 400Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln 405 410 415Ile Val Leu
Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu 420 425 430Lys
Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met Asn 435 440
445Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp
450 455 460Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly
Ser Gly465 470 475 480Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser
Met Glu Ala Glu Asp 485 490 495Ala Ala Thr Tyr Tyr Cys Gln Gln Trp
Ser Ser Asn Pro Leu Thr Phe 500 505 510Gly Ala Gly Thr Lys Leu Glu
Leu Lys Gly Gly Ser His His His His 515 520 525His His
53070530PRTartificialartificial Antibody 70Met Gly Trp Ser Cys Ile
Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Gln Ile
Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys 20 25 30Pro Gly Glu Thr
Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45Thr Asn Tyr
Gly Met Asn Trp Val Lys Gln Ala Pro Gly Lys Gly Leu 50 55 60Lys Trp
Met Gly Trp Ile Asn Thr Asn Thr Gly Glu Pro Thr Tyr Ala65 70 75
80Glu Glu Phe Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser
85 90 95Thr Ala Tyr Leu Gln Ile Asn Asn Leu Lys Asn Glu Asp Thr Ala
Thr 100 105 110Tyr Phe Cys Ala Arg Leu Gly Phe Gly Asn Ala Met Asp
Tyr Trp Gly 115 120 125Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Asp Ile Val145 150 155 160Met Thr Gln Ser Pro Ser
Ser Leu Thr Val Thr Ala Gly Glu Lys Val 165 170 175Thr Met Ser Cys
Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln 180 185 190Lys Asn
Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys 195 200
205Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg
210 215 220Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
Ser Ser225 230 235 240Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys
Gln Asn Asp Tyr Ser 245 250 255Tyr Pro Leu Thr Phe Gly Ala Gly Thr
Lys Leu Glu Leu Lys Ser Gly 260 265 270Gly Gly Gly Ser Gln Val Gln
Leu Gln Gln Ser Gly Ala Glu Leu Ala 275 280 285Arg Pro Gly Ala Ser
Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr 290 295 300Phe Thr Arg
Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Cys305 310 315
320Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr
325 330 335Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys
Ser Ser 340 345 350Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser
Glu Asp Ser Ala 355 360 365Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp
His Tyr Ser Leu Asp Tyr 370 375 380Trp Gly Gln Gly Thr Thr Leu Thr
Val Ser Ser Gly Gly Gly Gly Ser385 390 395 400Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln 405 410 415Ile Val Leu
Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu 420 425 430Lys
Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met Asn 435 440
445Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp
450
455 460Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser
Gly465 470 475 480Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met
Glu Ala Glu Asp 485 490 495Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser
Ser Asn Pro Leu Thr Phe 500 505 510Gly Cys Gly Thr Lys Leu Glu Leu
Lys Gly Gly Ser His His His His 515 520 525His His
53071530PRTartificialartificial Antibody 71Met Gly Trp Ser Cys Ile
Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Gln Ile
Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys 20 25 30Pro Gly Glu Thr
Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45Thr Asn Tyr
Gly Met Asn Trp Val Lys Gln Ala Pro Gly Lys Cys Leu 50 55 60Lys Trp
Met Gly Trp Ile Asn Thr Asn Thr Gly Glu Pro Thr Tyr Ala65 70 75
80Glu Glu Phe Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser
85 90 95Thr Ala Tyr Leu Gln Ile Asn Asn Leu Lys Asn Glu Asp Thr Ala
Thr 100 105 110Tyr Phe Cys Ala Arg Leu Gly Phe Gly Asn Ala Met Asp
Tyr Trp Gly 115 120 125Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Asp Ile Val145 150 155 160Met Thr Gln Ser Pro Ser
Ser Leu Thr Val Thr Ala Gly Glu Lys Val 165 170 175Thr Met Ser Cys
Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln 180 185 190Lys Asn
Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys 195 200
205Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg
210 215 220Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
Ser Ser225 230 235 240Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys
Gln Asn Asp Tyr Ser 245 250 255Tyr Pro Leu Thr Phe Gly Cys Gly Thr
Lys Leu Glu Leu Lys Ser Gly 260 265 270Gly Gly Gly Ser Gln Val Gln
Leu Gln Gln Ser Gly Ala Glu Leu Ala 275 280 285Arg Pro Gly Ala Ser
Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr 290 295 300Phe Thr Arg
Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Cys305 310 315
320Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr
325 330 335Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys
Ser Ser 340 345 350Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser
Glu Asp Ser Ala 355 360 365Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp
His Tyr Ser Leu Asp Tyr 370 375 380Trp Gly Gln Gly Thr Thr Leu Thr
Val Ser Ser Gly Gly Gly Gly Ser385 390 395 400Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln 405 410 415Ile Val Leu
Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu 420 425 430Lys
Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met Asn 435 440
445Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp
450 455 460Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly
Ser Gly465 470 475 480Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser
Met Glu Ala Glu Asp 485 490 495Ala Ala Thr Tyr Tyr Cys Gln Gln Trp
Ser Ser Asn Pro Leu Thr Phe 500 505 510Gly Cys Gly Thr Lys Leu Glu
Leu Lys Gly Gly Ser His His His His 515 520 525His His
53072530PRTartificialartificial Antibody 72Met Gly Trp Ser Cys Ile
Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Gln Val
Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg 20 25 30Pro Gly Ala Ser
Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45Thr Ser Tyr
Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu 50 55 60Glu Trp
Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn65 70 75
80Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser
85 90 95Thr Ala Tyr Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala
Val 100 105 110Tyr Tyr Cys Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp
Tyr Trp Gly 115 120 125Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Asp Ile Val145 150 155 160Met Thr Gln Ser Pro Ser
Ser Leu Thr Val Thr Ala Gly Glu Lys Val 165 170 175Thr Met Ser Cys
Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln 180 185 190Lys Asn
Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys 195 200
205Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg
210 215 220Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
Ser Ser225 230 235 240Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys
Gln Asn Asp Tyr Ser 245 250 255Tyr Pro Phe Thr Phe Gly Ser Gly Thr
Lys Leu Glu Ile Lys Ser Gly 260 265 270Gly Gly Gly Ser Gln Val Gln
Leu Gln Gln Ser Gly Ala Glu Leu Ala 275 280 285Arg Pro Gly Ala Ser
Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr 290 295 300Phe Thr Arg
Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Cys305 310 315
320Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr
325 330 335Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys
Ser Ser 340 345 350Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser
Glu Asp Ser Ala 355 360 365Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp
His Tyr Ser Leu Asp Tyr 370 375 380Trp Gly Gln Gly Thr Thr Leu Thr
Val Ser Ser Gly Gly Gly Gly Ser385 390 395 400Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln 405 410 415Ile Val Leu
Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu 420 425 430Lys
Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met Asn 435 440
445Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp
450 455 460Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly
Ser Gly465 470 475 480Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser
Met Glu Ala Glu Asp 485 490 495Ala Ala Thr Tyr Tyr Cys Gln Gln Trp
Ser Ser Asn Pro Leu Thr Phe 500 505 510Gly Cys Gly Thr Lys Leu Glu
Leu Lys Gly Gly Ser His His His His 515 520 525His His
53073530PRTartificialartificial Antibody 73Met Gly Trp Ser Cys Ile
Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Gln Val
Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg 20 25 30Pro Gly Ala Ser
Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45Thr Ser Tyr
Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Cys Leu 50 55 60Glu Trp
Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn65 70 75
80Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser
85 90 95Thr Ala Tyr Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala
Val 100 105 110Tyr Tyr Cys Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp
Tyr Trp Gly 115 120 125Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Asp Ile Val145 150 155 160Met Thr Gln Ser Pro Ser
Ser Leu Thr Val Thr Ala Gly Glu Lys Val 165 170 175Thr Met Ser Cys
Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln 180 185 190Lys Asn
Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys 195 200
205Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg
210 215 220Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
Ser Ser225 230 235 240Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys
Gln Asn Asp Tyr Ser 245 250 255Tyr Pro Phe Thr Phe Gly Cys Gly Thr
Lys Leu Glu Ile Lys Ser Gly 260 265 270Gly Gly Gly Ser Gln Val Gln
Leu Gln Gln Ser Gly Ala Glu Leu Ala 275 280 285Arg Pro Gly Ala Ser
Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr 290 295 300Phe Thr Arg
Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Cys305 310 315
320Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr
325 330 335Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys
Ser Ser 340 345 350Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser
Glu Asp Ser Ala 355 360 365Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp
His Tyr Ser Leu Asp Tyr 370 375 380Trp Gly Gln Gly Thr Thr Leu Thr
Val Ser Ser Gly Gly Gly Gly Ser385 390 395 400Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln 405 410 415Ile Val Leu
Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu 420 425 430Lys
Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met Asn 435 440
445Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp
450 455 460Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly
Ser Gly465 470 475 480Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser
Met Glu Ala Glu Asp 485 490 495Ala Ala Thr Tyr Tyr Cys Gln Gln Trp
Ser Ser Asn Pro Leu Thr Phe 500 505 510Gly Cys Gly Thr Lys Leu Glu
Leu Lys Gly Gly Ser His His His His 515 520 525His His
53074535PRTartificialartificial Antibody 74Met Gly Trp Ser Cys Ile
Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Gln Ile
Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys 20 25 30Pro Gly Glu Thr
Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45Thr Asn Tyr
Gly Met Asn Trp Val Lys Gln Ala Pro Gly Lys Gly Leu 50 55 60Lys Trp
Met Gly Trp Ile Asn Thr Asn Thr Gly Glu Pro Thr Tyr Ala65 70 75
80Glu Glu Phe Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser
85 90 95Thr Ala Tyr Leu Gln Ile Asn Asn Leu Lys Asn Glu Asp Thr Ala
Thr 100 105 110Tyr Phe Cys Ala Arg Leu Gly Phe Gly Asn Ala Met Asp
Tyr Trp Gly 115 120 125Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Asp Ile Val145 150 155 160Met Thr Gln Ser Pro Ser
Ser Leu Thr Val Thr Ala Gly Glu Lys Val 165 170 175Thr Met Ser Cys
Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln 180 185 190Lys Asn
Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys 195 200
205Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg
210 215 220Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
Ser Ser225 230 235 240Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys
Gln Asn Asp Tyr Ser 245 250 255Tyr Pro Leu Thr Phe Gly Ala Gly Thr
Lys Leu Glu Leu Lys Ser Gly 260 265 270Gly Gly Gly Ser Gln Ile Val
Leu Thr Gln Ser Pro Ala Ile Met Ser 275 280 285Ala Ser Pro Gly Glu
Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser 290 295 300Val Ser Tyr
Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys305 310 315
320Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg
325 330 335Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile
Ser Ser 340 345 350Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln
Gln Trp Ser Ser 355 360 365Asn Pro Leu Thr Phe Gly Ala Gly Thr Lys
Leu Glu Leu Lys Gly Gly 370 375 380Gly Gly Ser Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly385 390 395 400Gly Ser Gly Gly Gly
Gly Ser Gln Val Gln Leu Gln Gln Ser Gly Ala 405 410 415Glu Leu Ala
Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Thr Ser 420 425 430Gly
Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg Pro 435 440
445Gly Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr
450 455 460Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr
Thr Asp465 470 475 480Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser
Ser Leu Thr Ser Glu 485 490 495Asp Ser Ala Val Tyr Tyr Cys Ala Arg
Tyr Tyr Asp Asp His Tyr Ser 500 505 510Leu Asp Tyr Trp Gly Gln Gly
Thr Thr Leu Thr Val Ser Ser Gly Gly 515 520 525Ser His His His His
His His 530 53575535PRTartificialartificial Antibody 75Met Gly Trp
Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His
Ser Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys 20 25 30Pro
Gly Glu Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40
45Thr Asn Tyr Gly Met Asn Trp Val Lys Gln Ala Pro Gly Lys Cys Leu
50 55 60Lys Trp Met Gly Trp Ile Asn Thr Asn Thr Gly Glu Pro Thr Tyr
Ala65 70 75 80Glu Glu Phe Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr
Ser Ala Ser 85 90 95Thr Ala Tyr Leu Gln Ile Asn Asn Leu Lys Asn Glu
Asp Thr Ala Thr 100 105 110Tyr Phe Cys Ala Arg Leu Gly Phe Gly Asn
Ala Met Asp Tyr Trp Gly 115 120 125Gln Gly Thr Ser Val Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Asp Ile Val145 150 155 160Met Thr Gln
Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val 165 170 175Thr
Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln 180 185
190Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys
195 200 205Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro
Asp Arg 210 215 220Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile Ser Ser225 230 235 240Val Gln Ala Glu Asp Leu Ala Val Tyr
Tyr Cys Gln Asn Asp Tyr Ser
245 250 255Tyr Pro Leu Thr Phe Gly Cys Gly Thr Lys Leu Glu Leu Lys
Ser Gly 260 265 270Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser Pro
Ala Ile Met Ser 275 280 285Ala Ser Pro Gly Glu Lys Val Thr Met Thr
Cys Arg Ala Ser Ser Ser 290 295 300Val Ser Tyr Met Asn Trp Tyr Gln
Gln Lys Ser Gly Thr Ser Pro Lys305 310 315 320Arg Trp Ile Tyr Asp
Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg 325 330 335Phe Ser Gly
Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser 340 345 350Met
Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser 355 360
365Asn Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly
370 375 380Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly385 390 395 400Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu
Gln Gln Ser Gly Ala 405 410 415Glu Leu Ala Arg Pro Gly Ala Ser Val
Lys Met Ser Cys Lys Thr Ser 420 425 430Gly Tyr Thr Phe Thr Arg Tyr
Thr Met His Trp Val Lys Gln Arg Pro 435 440 445Gly Gln Gly Leu Glu
Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr 450 455 460Thr Asn Tyr
Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp465 470 475
480Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu
485 490 495Asp Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His
Tyr Ser 500 505 510Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val
Ser Ser Gly Gly 515 520 525Ser His His His His His His 530
53576535PRTartificialartificial Antibody 76Met Gly Trp Ser Cys Ile
Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Gln Val
Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg 20 25 30Pro Gly Ala Ser
Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45Thr Ser Tyr
Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu 50 55 60Glu Trp
Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn65 70 75
80Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser
85 90 95Thr Ala Tyr Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala
Val 100 105 110Tyr Tyr Cys Thr Arg Ser Trp Arg Gly Asn Ser Phe Asp
Tyr Trp Gly 115 120 125Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Asp Ile Val145 150 155 160Met Thr Gln Ser Pro Ser
Ser Leu Thr Val Thr Ala Gly Glu Lys Val 165 170 175Thr Met Ser Cys
Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln 180 185 190Lys Asn
Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys 195 200
205Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg
210 215 220Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
Ser Ser225 230 235 240Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys
Gln Asn Asp Tyr Ser 245 250 255Tyr Pro Phe Thr Phe Gly Ser Gly Thr
Lys Leu Glu Ile Lys Ser Gly 260 265 270Gly Gly Gly Ser Gln Ile Val
Leu Thr Gln Ser Pro Ala Ile Met Ser 275 280 285Ala Ser Pro Gly Glu
Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser 290 295 300Val Ser Tyr
Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys305 310 315
320Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg
325 330 335Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile
Ser Ser 340 345 350Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln
Gln Trp Ser Ser 355 360 365Asn Pro Leu Thr Phe Gly Ala Gly Thr Lys
Leu Glu Leu Lys Gly Gly 370 375 380Gly Gly Ser Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly385 390 395 400Gly Ser Gly Gly Gly
Gly Ser Gln Val Gln Leu Gln Gln Ser Gly Ala 405 410 415Glu Leu Ala
Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Thr Ser 420 425 430Gly
Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg Pro 435 440
445Gly Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr
450 455 460Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr
Thr Asp465 470 475 480Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser
Ser Leu Thr Ser Glu 485 490 495Asp Ser Ala Val Tyr Tyr Cys Ala Arg
Tyr Tyr Asp Asp His Tyr Ser 500 505 510Leu Asp Tyr Trp Gly Gln Gly
Thr Thr Leu Thr Val Ser Ser Gly Gly 515 520 525Ser His His His His
His His 530 53577535PRTartificialartificial Antibody 77Met Gly Trp
Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His
Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg 20 25 30Pro
Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40
45Thr Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Cys Leu
50 55 60Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr
Asn65 70 75 80Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys
Ser Ser Ser 85 90 95Thr Ala Tyr Met Gln Leu Ser Ser Pro Thr Ser Glu
Asp Ser Ala Val 100 105 110Tyr Tyr Cys Thr Arg Ser Trp Arg Gly Asn
Ser Phe Asp Tyr Trp Gly 115 120 125Gln Gly Thr Thr Leu Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Asp Ile Val145 150 155 160Met Thr Gln
Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val 165 170 175Thr
Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln 180 185
190Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys
195 200 205Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro
Asp Arg 210 215 220Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile Ser Ser225 230 235 240Val Gln Ala Glu Asp Leu Ala Val Tyr
Tyr Cys Gln Asn Asp Tyr Ser 245 250 255Tyr Pro Phe Thr Phe Gly Cys
Gly Thr Lys Leu Glu Ile Lys Ser Gly 260 265 270Gly Gly Gly Ser Gln
Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser 275 280 285Ala Ser Pro
Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser 290 295 300Val
Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys305 310
315 320Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr
Arg 325 330 335Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr
Ile Ser Ser 340 345 350Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys
Gln Gln Trp Ser Ser 355 360 365Asn Pro Leu Thr Phe Gly Ala Gly Thr
Lys Leu Glu Leu Lys Gly Gly 370 375 380Gly Gly Ser Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser Gly Gly Gly385 390 395 400Gly Ser Gly Gly
Gly Gly Ser Gln Val Gln Leu Gln Gln Ser Gly Ala 405 410 415Glu Leu
Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Thr Ser 420 425
430Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg Pro
435 440 445Gly Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg
Gly Tyr 450 455 460Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr
Leu Thr Thr Asp465 470 475 480Lys Ser Ser Ser Thr Ala Tyr Met Gln
Leu Ser Ser Leu Thr Ser Glu 485 490 495Asp Ser Ala Val Tyr Tyr Cys
Ala Arg Tyr Tyr Asp Asp His Tyr Ser 500 505 510Leu Asp Tyr Trp Gly
Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly 515 520 525Ser His His
His His His His 530 53578535PRTartificialartificial Antibody 78Met
Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10
15Val His Ser Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys
20 25 30Pro Gly Glu Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr
Phe 35 40 45Thr Asn Tyr Gly Met Asn Trp Val Lys Gln Ala Pro Gly Lys
Gly Leu 50 55 60Lys Trp Met Gly Trp Ile Asn Thr Asn Thr Gly Glu Pro
Thr Tyr Ala65 70 75 80Glu Glu Phe Lys Gly Arg Phe Ala Phe Ser Leu
Glu Thr Ser Ala Ser 85 90 95Thr Ala Tyr Leu Gln Ile Asn Asn Leu Lys
Asn Glu Asp Thr Ala Thr 100 105 110Tyr Phe Cys Ala Arg Leu Gly Phe
Gly Asn Ala Met Asp Tyr Trp Gly 115 120 125Gln Gly Thr Ser Val Thr
Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val145 150 155 160Met
Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val 165 170
175Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln
180 185 190Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro
Pro Lys 195 200 205Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly
Val Pro Asp Arg 210 215 220Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Thr Ile Ser Ser225 230 235 240Val Gln Ala Glu Asp Leu Ala
Val Tyr Tyr Cys Gln Asn Asp Tyr Ser 245 250 255Tyr Pro Leu Thr Phe
Gly Ala Gly Thr Lys Leu Glu Leu Lys Ser Gly 260 265 270Gly Gly Gly
Ser Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser 275 280 285Ala
Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser 290 295
300Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro
Lys305 310 315 320Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser Gly
Val Pro Tyr Arg 325 330 335Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr
Ser Leu Thr Ile Ser Ser 340 345 350Met Glu Ala Glu Asp Ala Ala Thr
Tyr Tyr Cys Gln Gln Trp Ser Ser 355 360 365Asn Pro Leu Thr Phe Gly
Cys Gly Thr Lys Leu Glu Leu Lys Gly Gly 370 375 380Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly385 390 395 400Gly
Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser Gly Ala 405 410
415Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Thr Ser
420 425 430Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln
Arg Pro 435 440 445Gly Gln Cys Leu Glu Trp Ile Gly Tyr Ile Asn Pro
Ser Arg Gly Tyr 450 455 460Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys
Ala Thr Leu Thr Thr Asp465 470 475 480Lys Ser Ser Ser Thr Ala Tyr
Met Gln Leu Ser Ser Leu Thr Ser Glu 485 490 495Asp Ser Ala Val Tyr
Tyr Cys Ala Arg Tyr Tyr Asp Asp His Tyr Ser 500 505 510Leu Asp Tyr
Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly 515 520 525Ser
His His His His His His 530 53579535PRTartificialartificial
Antibody 79Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala
Thr Gly1 5 10 15Val His Ser Gln Ile Gln Leu Val Gln Ser Gly Pro Glu
Leu Lys Lys 20 25 30Pro Gly Glu Thr Val Lys Ile Ser Cys Lys Ala Ser
Gly Tyr Thr Phe 35 40 45Thr Asn Tyr Gly Met Asn Trp Val Lys Gln Ala
Pro Gly Lys Cys Leu 50 55 60Lys Trp Met Gly Trp Ile Asn Thr Asn Thr
Gly Glu Pro Thr Tyr Ala65 70 75 80Glu Glu Phe Lys Gly Arg Phe Ala
Phe Ser Leu Glu Thr Ser Ala Ser 85 90 95Thr Ala Tyr Leu Gln Ile Asn
Asn Leu Lys Asn Glu Asp Thr Ala Thr 100 105 110Tyr Phe Cys Ala Arg
Leu Gly Phe Gly Asn Ala Met Asp Tyr Trp Gly 115 120 125Gln Gly Thr
Ser Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val145 150
155 160Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys
Val 165 170 175Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser
Gly Asn Gln 180 185 190Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro
Gly Gln Pro Pro Lys 195 200 205Leu Leu Ile Tyr Trp Ala Ser Thr Arg
Glu Ser Gly Val Pro Asp Arg 210 215 220Phe Thr Gly Ser Gly Ser Gly
Thr Asp Phe Thr Leu Thr Ile Ser Ser225 230 235 240Val Gln Ala Glu
Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser 245 250 255Tyr Pro
Leu Thr Phe Gly Cys Gly Thr Lys Leu Glu Leu Lys Ser Gly 260 265
270Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser
275 280 285Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser
Ser Ser 290 295 300Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly
Thr Ser Pro Lys305 310 315 320Arg Trp Ile Tyr Asp Thr Ser Lys Val
Ala Ser Gly Val Pro Tyr Arg 325 330 335Phe Ser Gly Ser Gly Ser Gly
Thr Ser Tyr Ser Leu Thr Ile Ser Ser 340 345 350Met Glu Ala Glu Asp
Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser 355 360 365Asn Pro Leu
Thr Phe Gly Cys Gly Thr Lys Leu Glu Leu Lys Gly Gly 370 375 380Gly
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly385 390
395 400Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser Gly
Ala 405 410 415Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys
Lys Thr Ser 420 425 430Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp
Val Lys Gln Arg Pro 435 440 445Gly Gln Cys Leu Glu Trp Ile Gly Tyr
Ile Asn Pro Ser Arg Gly Tyr 450 455 460Thr Asn Tyr Asn Gln Lys Phe
Lys Asp Lys Ala Thr Leu Thr Thr Asp465 470 475 480Lys Ser Ser Ser
Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu 485 490 495Asp Ser
Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His Tyr Ser 500 505
510Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly
515 520 525Ser His His His His His His 530
53580535PRTartificialartificial Antibody 80Met Gly Trp Ser Cys Ile
Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10
15Val His Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg
20 25 30Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr
Phe 35 40 45Thr Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln
Gly Leu 50 55 60Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr
Asn Tyr Asn65 70 75 80Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val
Asp Lys Ser Ser Ser 85 90 95Thr Ala Tyr Met Gln Leu Ser Ser Pro Thr
Ser Glu Asp Ser Ala Val 100 105 110Tyr Tyr Cys Thr Arg Ser Trp Arg
Gly Asn Ser Phe Asp Tyr Trp Gly 115 120 125Gln Gly Thr Thr Leu Thr
Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val145 150 155 160Met
Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys Val 165 170
175Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln
180 185 190Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Gln Pro
Pro Lys 195 200 205Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly
Val Pro Asp Arg 210 215 220Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Thr Ile Ser Ser225 230 235 240Val Gln Ala Glu Asp Leu Ala
Val Tyr Tyr Cys Gln Asn Asp Tyr Ser 245 250 255Tyr Pro Phe Thr Phe
Gly Ser Gly Thr Lys Leu Glu Ile Lys Ser Gly 260 265 270Gly Gly Gly
Ser Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser 275 280 285Ala
Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser 290 295
300Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro
Lys305 310 315 320Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser Gly
Val Pro Tyr Arg 325 330 335Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr
Ser Leu Thr Ile Ser Ser 340 345 350Met Glu Ala Glu Asp Ala Ala Thr
Tyr Tyr Cys Gln Gln Trp Ser Ser 355 360 365Asn Pro Leu Thr Phe Gly
Cys Gly Thr Lys Leu Glu Leu Lys Gly Gly 370 375 380Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly385 390 395 400Gly
Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser Gly Ala 405 410
415Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Thr Ser
420 425 430Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln
Arg Pro 435 440 445Gly Gln Cys Leu Glu Trp Ile Gly Tyr Ile Asn Pro
Ser Arg Gly Tyr 450 455 460Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys
Ala Thr Leu Thr Thr Asp465 470 475 480Lys Ser Ser Ser Thr Ala Tyr
Met Gln Leu Ser Ser Leu Thr Ser Glu 485 490 495Asp Ser Ala Val Tyr
Tyr Cys Ala Arg Tyr Tyr Asp Asp His Tyr Ser 500 505 510Leu Asp Tyr
Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly 515 520 525Ser
His His His His His His 530 53581535PRTartificialartificial
Antibody 81Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala
Thr Gly1 5 10 15Val His Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu
Leu Val Arg 20 25 30Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser
Gly Tyr Thr Phe 35 40 45Thr Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg
Pro Gly Gln Cys Leu 50 55 60Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp
Ser Tyr Thr Asn Tyr Asn65 70 75 80Gln Lys Phe Lys Asp Lys Ala Thr
Leu Thr Val Asp Lys Ser Ser Ser 85 90 95Thr Ala Tyr Met Gln Leu Ser
Ser Pro Thr Ser Glu Asp Ser Ala Val 100 105 110Tyr Tyr Cys Thr Arg
Ser Trp Arg Gly Asn Ser Phe Asp Tyr Trp Gly 115 120 125Gln Gly Thr
Thr Leu Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val145 150
155 160Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly Glu Lys
Val 165 170 175Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser
Gly Asn Gln 180 185 190Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys Pro
Gly Gln Pro Pro Lys 195 200 205Leu Leu Ile Tyr Trp Ala Ser Thr Arg
Glu Ser Gly Val Pro Asp Arg 210 215 220Phe Thr Gly Ser Gly Ser Gly
Thr Asp Phe Thr Leu Thr Ile Ser Ser225 230 235 240Val Gln Ala Glu
Asp Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser 245 250 255Tyr Pro
Phe Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile Lys Ser Gly 260 265
270Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser
275 280 285Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser
Ser Ser 290 295 300Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly
Thr Ser Pro Lys305 310 315 320Arg Trp Ile Tyr Asp Thr Ser Lys Val
Ala Ser Gly Val Pro Tyr Arg 325 330 335Phe Ser Gly Ser Gly Ser Gly
Thr Ser Tyr Ser Leu Thr Ile Ser Ser 340 345 350Met Glu Ala Glu Asp
Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser 355 360 365Asn Pro Leu
Thr Phe Gly Cys Gly Thr Lys Leu Glu Leu Lys Gly Gly 370 375 380Gly
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly385 390
395 400Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser Gly
Ala 405 410 415Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys
Lys Thr Ser 420 425 430Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp
Val Lys Gln Arg Pro 435 440 445Gly Gln Cys Leu Glu Trp Ile Gly Tyr
Ile Asn Pro Ser Arg Gly Tyr 450 455 460Thr Asn Tyr Asn Gln Lys Phe
Lys Asp Lys Ala Thr Leu Thr Thr Asp465 470 475 480Lys Ser Ser Ser
Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu 485 490 495Asp Ser
Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His Tyr Ser 500 505
510Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Gly Gly
515 520 525Ser His His His His His His 530
53582535PRTartificialartificial Antibody 82Met Gly Trp Ser Cys Ile
Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Asp Ile
Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val 20 25 30Thr Ala Gly Glu
Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu 35 40 45Leu Asn Ser
Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys 50 55 60Pro Gly
Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu65 70 75
80Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe
85 90 95Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr
Tyr 100 105 110Cys Gln Asn Asp Tyr Ser Tyr Pro Leu Thr Phe Gly Ala
Gly Thr Lys 115 120 125Leu Glu Leu Lys Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Gln Ile Gln145 150 155 160Leu Val Gln Ser Gly Pro
Glu Leu Lys Lys Pro Gly Glu Thr Val Lys 165 170 175Ile Ser Cys Lys
Ala Ser Gly Tyr Thr Phe Thr Asn Tyr Gly Met Asn 180 185 190Trp Val
Lys Gln Ala Pro Gly Lys Gly Leu Lys Trp Met Gly Trp Ile 195 200
205Asn Thr Asn Thr Gly Glu Pro Thr Tyr Ala Glu Glu Phe Lys Gly Arg
210 215 220Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser Thr Ala Tyr Leu
Gln Ile225 230 235 240Asn Asn Leu Lys Asn Glu Asp Thr Ala Thr Tyr
Phe Cys Ala Arg Leu 245 250 255Gly Phe Gly Asn Ala Met Asp Tyr Trp
Gly Gln Gly Thr Ser Val Thr 260 265 270Val Ser Ser Ser Gly Gly Gly
Gly Ser Gln Val Gln Leu Gln Gln Ser 275 280 285Gly Ala Glu Leu Ala
Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys 290 295 300Thr Ser Gly
Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln305 310 315
320Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg
325 330 335Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr
Leu Thr 340 345 350Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu
Ser Ser Leu Thr 355 360 365Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala
Arg Tyr Tyr Asp Asp His 370 375 380Tyr Ser Leu Asp Tyr Trp Gly Gln
Gly Thr Thr Leu Thr Val Ser Ser385 390 395 400Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 405 410 415Gly Gly Gly
Ser Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser 420 425 430Ala
Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser 435 440
445Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys
450 455 460Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser Gly Val Pro
Tyr Arg465 470 475 480Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser
Leu Thr Ile Ser Ser 485 490 495Met Glu Ala Glu Asp Ala Ala Thr Tyr
Tyr Cys Gln Gln Trp Ser Ser 500 505 510Asn Pro Leu Thr Phe Gly Ala
Gly Thr Lys Leu Glu Leu Lys Gly Gly 515 520 525Ser His His His His
His His 530 53583535PRTartificialartificial Antibody 83Met Gly Trp
Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His
Ser Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val 20 25 30Thr
Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu 35 40
45Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys
50 55 60Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg
Glu65 70 75 80Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly
Thr Asp Phe 85 90 95Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp Leu
Ala Val Tyr Tyr 100 105 110Cys Gln Asn Asp Tyr Ser Tyr Pro Leu Thr
Phe Gly Cys Gly Thr Lys 115 120 125Leu Glu Leu Lys Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Gln Ile Gln145 150 155 160Leu Val Gln
Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu Thr Val Lys 165 170 175Ile
Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr Gly Met Asn 180 185
190Trp Val Lys Gln Ala Pro Gly Lys Cys Leu Lys Trp Met Gly Trp Ile
195 200 205Asn Thr Asn Thr Gly Glu Pro Thr Tyr Ala Glu Glu Phe Lys
Gly Arg 210 215 220Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser Thr Ala
Tyr Leu Gln Ile225 230 235 240Asn Asn Leu Lys Asn Glu Asp Thr Ala
Thr Tyr Phe Cys Ala Arg Leu 245 250 255Gly Phe Gly Asn Ala Met Asp
Tyr Trp Gly Gln Gly Thr Ser Val Thr 260 265 270Val Ser Ser Ser Gly
Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser 275 280 285Gly Ala Glu
Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys 290 295 300Thr
Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln305 310
315 320Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser
Arg 325 330 335Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala
Thr Leu Thr 340 345 350Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln
Leu Ser Ser Leu Thr 355 360 365Ser Glu Asp Ser Ala Val Tyr Tyr Cys
Ala Arg Tyr Tyr Asp Asp His 370 375 380Tyr Ser Leu Asp Tyr Trp Gly
Gln Gly Thr Thr Leu Thr Val Ser Ser385 390 395 400Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 405 410 415Gly Gly
Gly Ser Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser 420 425
430Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser
435 440 445Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser
Pro Lys 450 455 460Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser Gly
Val Pro Tyr Arg465 470 475 480Phe Ser Gly Ser Gly Ser Gly Thr Ser
Tyr Ser Leu Thr Ile Ser Ser 485 490 495Met Glu Ala Glu Asp Ala Ala
Thr Tyr Tyr Cys Gln Gln Trp Ser Ser 500 505 510Asn Pro Leu Thr Phe
Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly 515 520 525Ser His His
His His His His 530 53584535PRTartificialartificial Antibody 84Met
Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10
15Val His Ser Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val
20 25 30Thr Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser
Leu 35 40 45Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln
Gln Lys 50 55 60Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser
Thr Arg Glu65 70 75 80Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly
Ser Gly Thr Asp Phe 85 90 95Thr Leu Thr Ile Ser Ser Val Gln Ala Glu
Asp Leu Ala Val Tyr Tyr 100 105 110Cys Gln Asn Asp Tyr Ser Tyr Pro
Phe Thr Phe Gly Ser Gly Thr Lys 115 120 125Leu Glu Ile Lys Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln145 150 155 160Leu
Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys 165 170
175Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Ile Asn
180 185 190Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly
Asn Ile 195 200 205Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys
Phe Lys Asp Lys 210 215 220Ala Thr Leu Thr Val Asp Lys Ser Ser Ser
Thr Ala Tyr Met Gln Leu225 230 235 240Ser Ser Pro Thr Ser Glu Asp
Ser Ala Val Tyr Tyr Cys Thr Arg Ser 245 250 255Trp Arg Gly Asn Ser
Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr 260 265 270Val Ser Ser
Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser 275 280 285Gly
Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys 290 295
300Thr Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys
Gln305 310 315
320Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg
325 330 335Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr
Leu Thr 340 345 350Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu
Ser Ser Leu Thr 355 360 365Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala
Arg Tyr Tyr Asp Asp His 370 375 380Tyr Ser Leu Asp Tyr Trp Gly Gln
Gly Thr Thr Leu Thr Val Ser Ser385 390 395 400Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 405 410 415Gly Gly Gly
Ser Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser 420 425 430Ala
Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser 435 440
445Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys
450 455 460Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser Gly Val Pro
Tyr Arg465 470 475 480Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser
Leu Thr Ile Ser Ser 485 490 495Met Glu Ala Glu Asp Ala Ala Thr Tyr
Tyr Cys Gln Gln Trp Ser Ser 500 505 510Asn Pro Leu Thr Phe Gly Ala
Gly Thr Lys Leu Glu Leu Lys Gly Gly 515 520 525Ser His His His His
His His 530 53585535PRTartificialartificial Antibody 85Met Gly Trp
Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His
Ser Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val 20 25 30Thr
Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu 35 40
45Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys
50 55 60Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg
Glu65 70 75 80Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly
Thr Asp Phe 85 90 95Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp Leu
Ala Val Tyr Tyr 100 105 110Cys Gln Asn Asp Tyr Ser Tyr Pro Phe Thr
Phe Gly Cys Gly Thr Lys 115 120 125Leu Glu Ile Lys Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Gln Val Gln145 150 155 160Leu Gln Gln
Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys 165 170 175Leu
Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Ile Asn 180 185
190Trp Val Lys Gln Arg Pro Gly Gln Cys Leu Glu Trp Ile Gly Asn Ile
195 200 205Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe Lys
Asp Lys 210 215 220Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala
Tyr Met Gln Leu225 230 235 240Ser Ser Pro Thr Ser Glu Asp Ser Ala
Val Tyr Tyr Cys Thr Arg Ser 245 250 255Trp Arg Gly Asn Ser Phe Asp
Tyr Trp Gly Gln Gly Thr Thr Leu Thr 260 265 270Val Ser Ser Ser Gly
Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser 275 280 285Gly Ala Glu
Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys 290 295 300Thr
Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln305 310
315 320Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser
Arg 325 330 335Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala
Thr Leu Thr 340 345 350Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln
Leu Ser Ser Leu Thr 355 360 365Ser Glu Asp Ser Ala Val Tyr Tyr Cys
Ala Arg Tyr Tyr Asp Asp His 370 375 380Tyr Ser Leu Asp Tyr Trp Gly
Gln Gly Thr Thr Leu Thr Val Ser Ser385 390 395 400Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 405 410 415Gly Gly
Gly Ser Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser 420 425
430Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser
435 440 445Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser
Pro Lys 450 455 460Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser Gly
Val Pro Tyr Arg465 470 475 480Phe Ser Gly Ser Gly Ser Gly Thr Ser
Tyr Ser Leu Thr Ile Ser Ser 485 490 495Met Glu Ala Glu Asp Ala Ala
Thr Tyr Tyr Cys Gln Gln Trp Ser Ser 500 505 510Asn Pro Leu Thr Phe
Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly 515 520 525Ser His His
His His His His 530 53586535PRTartificialartificial Antibody 86Met
Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10
15Val His Ser Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val
20 25 30Thr Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser
Leu 35 40 45Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln
Gln Lys 50 55 60Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser
Thr Arg Glu65 70 75 80Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly
Ser Gly Thr Asp Phe 85 90 95Thr Leu Thr Ile Ser Ser Val Gln Ala Glu
Asp Leu Ala Val Tyr Tyr 100 105 110Cys Gln Asn Asp Tyr Ser Tyr Pro
Leu Thr Phe Gly Ala Gly Thr Lys 115 120 125Leu Glu Leu Lys Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Gln145 150 155 160Leu
Val Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu Thr Val Lys 165 170
175Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr Gly Met Asn
180 185 190Trp Val Lys Gln Ala Pro Gly Lys Gly Leu Lys Trp Met Gly
Trp Ile 195 200 205Asn Thr Asn Thr Gly Glu Pro Thr Tyr Ala Glu Glu
Phe Lys Gly Arg 210 215 220Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser
Thr Ala Tyr Leu Gln Ile225 230 235 240Asn Asn Leu Lys Asn Glu Asp
Thr Ala Thr Tyr Phe Cys Ala Arg Leu 245 250 255Gly Phe Gly Asn Ala
Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr 260 265 270Val Ser Ser
Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser 275 280 285Gly
Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys 290 295
300Thr Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys
Gln305 310 315 320Arg Pro Gly Gln Cys Leu Glu Trp Ile Gly Tyr Ile
Asn Pro Ser Arg 325 330 335Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys
Asp Lys Ala Thr Leu Thr 340 345 350Thr Asp Lys Ser Ser Ser Thr Ala
Tyr Met Gln Leu Ser Ser Leu Thr 355 360 365Ser Glu Asp Ser Ala Val
Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His 370 375 380Tyr Ser Leu Asp
Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser385 390 395 400Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 405 410
415Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser
420 425 430Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser
Ser Ser 435 440 445Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly
Thr Ser Pro Lys 450 455 460Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala
Ser Gly Val Pro Tyr Arg465 470 475 480Phe Ser Gly Ser Gly Ser Gly
Thr Ser Tyr Ser Leu Thr Ile Ser Ser 485 490 495Met Glu Ala Glu Asp
Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser 500 505 510Asn Pro Leu
Thr Phe Gly Cys Gly Thr Lys Leu Glu Leu Lys Gly Gly 515 520 525Ser
His His His His His His 530 53587535PRTartificialartificial
Antibody 87Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala
Thr Gly1 5 10 15Val His Ser Asp Ile Val Met Thr Gln Ser Pro Ser Ser
Leu Thr Val 20 25 30Thr Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser
Ser Gln Ser Leu 35 40 45Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr
Trp Tyr Gln Gln Lys 50 55 60Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr
Trp Ala Ser Thr Arg Glu65 70 75 80Ser Gly Val Pro Asp Arg Phe Thr
Gly Ser Gly Ser Gly Thr Asp Phe 85 90 95Thr Leu Thr Ile Ser Ser Val
Gln Ala Glu Asp Leu Ala Val Tyr Tyr 100 105 110Cys Gln Asn Asp Tyr
Ser Tyr Pro Leu Thr Phe Gly Cys Gly Thr Lys 115 120 125Leu Glu Leu
Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Gln145 150
155 160Leu Val Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu Thr Val
Lys 165 170 175Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
Gly Met Asn 180 185 190Trp Val Lys Gln Ala Pro Gly Lys Cys Leu Lys
Trp Met Gly Trp Ile 195 200 205Asn Thr Asn Thr Gly Glu Pro Thr Tyr
Ala Glu Glu Phe Lys Gly Arg 210 215 220Phe Ala Phe Ser Leu Glu Thr
Ser Ala Ser Thr Ala Tyr Leu Gln Ile225 230 235 240Asn Asn Leu Lys
Asn Glu Asp Thr Ala Thr Tyr Phe Cys Ala Arg Leu 245 250 255Gly Phe
Gly Asn Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr 260 265
270Val Ser Ser Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser
275 280 285Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser
Cys Lys 290 295 300Thr Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His
Trp Val Lys Gln305 310 315 320Arg Pro Gly Gln Cys Leu Glu Trp Ile
Gly Tyr Ile Asn Pro Ser Arg 325 330 335Gly Tyr Thr Asn Tyr Asn Gln
Lys Phe Lys Asp Lys Ala Thr Leu Thr 340 345 350Thr Asp Lys Ser Ser
Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr 355 360 365Ser Glu Asp
Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His 370 375 380Tyr
Ser Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser385 390
395 400Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Gly 405 410 415Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser Pro Ala
Ile Met Ser 420 425 430Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys
Arg Ala Ser Ser Ser 435 440 445Val Ser Tyr Met Asn Trp Tyr Gln Gln
Lys Ser Gly Thr Ser Pro Lys 450 455 460Arg Trp Ile Tyr Asp Thr Ser
Lys Val Ala Ser Gly Val Pro Tyr Arg465 470 475 480Phe Ser Gly Ser
Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser 485 490 495Met Glu
Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser 500 505
510Asn Pro Leu Thr Phe Gly Cys Gly Thr Lys Leu Glu Leu Lys Gly Gly
515 520 525Ser His His His His His His 530
53588535PRTartificialartificial Antibody 88Met Gly Trp Ser Cys Ile
Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Asp Ile
Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val 20 25 30Thr Ala Gly Glu
Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu 35 40 45Leu Asn Ser
Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys 50 55 60Pro Gly
Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu65 70 75
80Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe
85 90 95Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr
Tyr 100 105 110Cys Gln Asn Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Ser
Gly Thr Lys 115 120 125Leu Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Gln Val Gln145 150 155 160Leu Gln Gln Pro Gly Ala
Glu Leu Val Arg Pro Gly Ala Ser Val Lys 165 170 175Leu Ser Cys Lys
Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Ile Asn 180 185 190Trp Val
Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Asn Ile 195 200
205Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys
210 215 220Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met
Gln Leu225 230 235 240Ser Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr
Tyr Cys Thr Arg Ser 245 250 255Trp Arg Gly Asn Ser Phe Asp Tyr Trp
Gly Gln Gly Thr Thr Leu Thr 260 265 270Val Ser Ser Ser Gly Gly Gly
Gly Ser Gln Val Gln Leu Gln Gln Ser 275 280 285Gly Ala Glu Leu Ala
Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys 290 295 300Thr Ser Gly
Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln305 310 315
320Arg Pro Gly Gln Cys Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg
325 330 335Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr
Leu Thr 340 345 350Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu
Ser Ser Leu Thr 355 360 365Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala
Arg Tyr Tyr Asp Asp His 370 375 380Tyr Ser Leu Asp Tyr Trp Gly Gln
Gly Thr Thr Leu Thr Val Ser Ser385 390 395 400Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 405 410 415Gly Gly Gly
Ser Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser 420 425 430Ala
Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser 435 440
445Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys
450 455 460Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser Gly Val Pro
Tyr Arg465 470 475 480Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser
Leu Thr Ile Ser Ser 485 490 495Met Glu Ala Glu Asp Ala Ala Thr Tyr
Tyr Cys Gln Gln Trp Ser Ser 500 505 510Asn Pro Leu Thr Phe Gly Cys
Gly Thr Lys Leu Glu Leu Lys Gly Gly 515 520 525Ser His His His His
His His 530 53589535PRTartificialartificial Antibody 89Met Gly Trp
Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His
Ser Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val 20 25 30Thr
Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu 35 40
45Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys
50 55 60Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg
Glu65 70 75 80Ser Gly Val Pro Asp Arg
Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe 85 90 95Thr Leu Thr Ile Ser
Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr 100 105 110Cys Gln Asn
Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Cys Gly Thr Lys 115 120 125Leu
Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 130 135
140Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val
Gln145 150 155 160Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly
Ala Ser Val Lys 165 170 175Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe
Thr Ser Tyr Trp Ile Asn 180 185 190Trp Val Lys Gln Arg Pro Gly Gln
Cys Leu Glu Trp Ile Gly Asn Ile 195 200 205Tyr Pro Ser Asp Ser Tyr
Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys 210 215 220Ala Thr Leu Thr
Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu225 230 235 240Ser
Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Ser 245 250
255Trp Arg Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr
260 265 270Val Ser Ser Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln
Gln Ser 275 280 285Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys
Met Ser Cys Lys 290 295 300Thr Ser Gly Tyr Thr Phe Thr Arg Tyr Thr
Met His Trp Val Lys Gln305 310 315 320Arg Pro Gly Gln Cys Leu Glu
Trp Ile Gly Tyr Ile Asn Pro Ser Arg 325 330 335Gly Tyr Thr Asn Tyr
Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr 340 345 350Thr Asp Lys
Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr 355 360 365Ser
Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His 370 375
380Tyr Ser Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser
Ser385 390 395 400Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Gly 405 410 415Gly Gly Gly Ser Gln Ile Val Leu Thr Gln
Ser Pro Ala Ile Met Ser 420 425 430Ala Ser Pro Gly Glu Lys Val Thr
Met Thr Cys Arg Ala Ser Ser Ser 435 440 445Val Ser Tyr Met Asn Trp
Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys 450 455 460Arg Trp Ile Tyr
Asp Thr Ser Lys Val Ala Ser Gly Val Pro Tyr Arg465 470 475 480Phe
Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser 485 490
495Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser
500 505 510Asn Pro Leu Thr Phe Gly Cys Gly Thr Lys Leu Glu Leu Lys
Gly Gly 515 520 525Ser His His His His His His 530
53590540PRTartificialartificial Antibody 90Met Gly Trp Ser Cys Ile
Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Asp Ile
Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val 20 25 30Thr Ala Gly Glu
Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu 35 40 45Leu Asn Ser
Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys 50 55 60Pro Gly
Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu65 70 75
80Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe
85 90 95Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr
Tyr 100 105 110Cys Gln Asn Asp Tyr Ser Tyr Pro Leu Thr Phe Gly Ala
Gly Thr Lys 115 120 125Leu Glu Leu Lys Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Gln Ile Gln145 150 155 160Leu Val Gln Ser Gly Pro
Glu Leu Lys Lys Pro Gly Glu Thr Val Lys 165 170 175Ile Ser Cys Lys
Ala Ser Gly Tyr Thr Phe Thr Asn Tyr Gly Met Asn 180 185 190Trp Val
Lys Gln Ala Pro Gly Lys Gly Leu Lys Trp Met Gly Trp Ile 195 200
205Asn Thr Asn Thr Gly Glu Pro Thr Tyr Ala Glu Glu Phe Lys Gly Arg
210 215 220Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser Thr Ala Tyr Leu
Gln Ile225 230 235 240Asn Asn Leu Lys Asn Glu Asp Thr Ala Thr Tyr
Phe Cys Ala Arg Leu 245 250 255Gly Phe Gly Asn Ala Met Asp Tyr Trp
Gly Gln Gly Thr Ser Val Thr 260 265 270Val Ser Ser Ser Gly Gly Gly
Gly Ser Gln Ile Val Leu Thr Gln Ser 275 280 285Pro Ala Ile Met Ser
Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys 290 295 300Arg Ala Ser
Ser Ser Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser305 310 315
320Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser
325 330 335Gly Val Pro Tyr Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser
Tyr Ser 340 345 350Leu Thr Ile Ser Ser Met Glu Ala Glu Asp Ala Ala
Thr Tyr Tyr Cys 355 360 365Gln Gln Trp Ser Ser Asn Pro Leu Thr Phe
Gly Cys Gly Thr Lys Leu 370 375 380Glu Leu Lys Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly385 390 395 400Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu 405 410 415Gln Gln Ser
Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met 420 425 430Ser
Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp 435 440
445Val Lys Gln Arg Pro Gly Gln Cys Leu Glu Trp Ile Gly Tyr Ile Asn
450 455 460Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp
Lys Ala465 470 475 480Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala
Tyr Met Gln Leu Ser 485 490 495Ser Leu Thr Ser Glu Asp Ser Ala Val
Tyr Tyr Cys Ala Arg Tyr Tyr 500 505 510Asp Asp His Tyr Ser Leu Asp
Tyr Trp Gly Gln Gly Thr Thr Leu Thr 515 520 525Val Ser Ser Gly Gly
Ser His His His His His His 530 535 54091540PRTartificialartificial
Antibody 91Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala
Thr Gly1 5 10 15Val His Ser Asp Ile Val Met Thr Gln Ser Pro Ser Ser
Leu Thr Val 20 25 30Thr Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser
Ser Gln Ser Leu 35 40 45Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr
Trp Tyr Gln Gln Lys 50 55 60Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr
Trp Ala Ser Thr Arg Glu65 70 75 80Ser Gly Val Pro Asp Arg Phe Thr
Gly Ser Gly Ser Gly Thr Asp Phe 85 90 95Thr Leu Thr Ile Ser Ser Val
Gln Ala Glu Asp Leu Ala Val Tyr Tyr 100 105 110Cys Gln Asn Asp Tyr
Ser Tyr Pro Leu Thr Phe Gly Cys Gly Thr Lys 115 120 125Leu Glu Leu
Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Gln145 150
155 160Leu Val Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu Thr Val
Lys 165 170 175Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
Gly Met Asn 180 185 190Trp Val Lys Gln Ala Pro Gly Lys Cys Leu Lys
Trp Met Gly Trp Ile 195 200 205Asn Thr Asn Thr Gly Glu Pro Thr Tyr
Ala Glu Glu Phe Lys Gly Arg 210 215 220Phe Ala Phe Ser Leu Glu Thr
Ser Ala Ser Thr Ala Tyr Leu Gln Ile225 230 235 240Asn Asn Leu Lys
Asn Glu Asp Thr Ala Thr Tyr Phe Cys Ala Arg Leu 245 250 255Gly Phe
Gly Asn Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr 260 265
270Val Ser Ser Ser Gly Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser
275 280 285Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met
Thr Cys 290 295 300Arg Ala Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr
Gln Gln Lys Ser305 310 315 320Gly Thr Ser Pro Lys Arg Trp Ile Tyr
Asp Thr Ser Lys Val Ala Ser 325 330 335Gly Val Pro Tyr Arg Phe Ser
Gly Ser Gly Ser Gly Thr Ser Tyr Ser 340 345 350Leu Thr Ile Ser Ser
Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys 355 360 365Gln Gln Trp
Ser Ser Asn Pro Leu Thr Phe Gly Cys Gly Thr Lys Leu 370 375 380Glu
Leu Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly385 390
395 400Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln
Leu 405 410 415Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser
Val Lys Met 420 425 430Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg
Tyr Thr Met His Trp 435 440 445Val Lys Gln Arg Pro Gly Gln Cys Leu
Glu Trp Ile Gly Tyr Ile Asn 450 455 460Pro Ser Arg Gly Tyr Thr Asn
Tyr Asn Gln Lys Phe Lys Asp Lys Ala465 470 475 480Thr Leu Thr Thr
Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser 485 490 495Ser Leu
Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr 500 505
510Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr
515 520 525Val Ser Ser Gly Gly Ser His His His His His His 530 535
54092540PRTartificialartificial Antibody 92Met Gly Trp Ser Cys Ile
Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser Asp Ile
Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val 20 25 30Thr Ala Gly Glu
Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu 35 40 45Leu Asn Ser
Gly Asn Gln Lys Asn Tyr Leu Thr Trp Tyr Gln Gln Lys 50 55 60Pro Gly
Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu65 70 75
80Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe
85 90 95Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr
Tyr 100 105 110Cys Gln Asn Asp Tyr Ser Tyr Pro Phe Thr Phe Gly Ser
Gly Thr Lys 115 120 125Leu Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Gln Val Gln145 150 155 160Leu Gln Gln Pro Gly Ala
Glu Leu Val Arg Pro Gly Ala Ser Val Lys 165 170 175Leu Ser Cys Lys
Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Ile Asn 180 185 190Trp Val
Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Asn Ile 195 200
205Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys
210 215 220Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met
Gln Leu225 230 235 240Ser Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr
Tyr Cys Thr Arg Ser 245 250 255Trp Arg Gly Asn Ser Phe Asp Tyr Trp
Gly Gln Gly Thr Thr Leu Thr 260 265 270Val Ser Ser Ser Gly Gly Gly
Gly Ser Gln Ile Val Leu Thr Gln Ser 275 280 285Pro Ala Ile Met Ser
Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys 290 295 300Arg Ala Ser
Ser Ser Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser305 310 315
320Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser
325 330 335Gly Val Pro Tyr Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser
Tyr Ser 340 345 350Leu Thr Ile Ser Ser Met Glu Ala Glu Asp Ala Ala
Thr Tyr Tyr Cys 355 360 365Gln Gln Trp Ser Ser Asn Pro Leu Thr Phe
Gly Cys Gly Thr Lys Leu 370 375 380Glu Leu Lys Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly385 390 395 400Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu 405 410 415Gln Gln Ser
Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met 420 425 430Ser
Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp 435 440
445Val Lys Gln Arg Pro Gly Gln Cys Leu Glu Trp Ile Gly Tyr Ile Asn
450 455 460Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp
Lys Ala465 470 475 480Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala
Tyr Met Gln Leu Ser 485 490 495Ser Leu Thr Ser Glu Asp Ser Ala Val
Tyr Tyr Cys Ala Arg Tyr Tyr 500 505 510Asp Asp His Tyr Ser Leu Asp
Tyr Trp Gly Gln Gly Thr Thr Leu Thr 515 520 525Val Ser Ser Gly Gly
Ser His His His His His His 530 535 54093540PRTartificialartificial
Antibody 93Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala
Thr Gly1 5 10 15Val His Ser Asp Ile Val Met Thr Gln Ser Pro Ser Ser
Leu Thr Val 20 25 30Thr Ala Gly Glu Lys Val Thr Met Ser Cys Lys Ser
Ser Gln Ser Leu 35 40 45Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr
Trp Tyr Gln Gln Lys 50 55 60Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr
Trp Ala Ser Thr Arg Glu65 70 75 80Ser Gly Val Pro Asp Arg Phe Thr
Gly Ser Gly Ser Gly Thr Asp Phe 85 90 95Thr Leu Thr Ile Ser Ser Val
Gln Ala Glu Asp Leu Ala Val Tyr Tyr 100 105 110Cys Gln Asn Asp Tyr
Ser Tyr Pro Phe Thr Phe Gly Cys Gly Thr Lys 115 120 125Leu Glu Ile
Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140Gly
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln145 150
155 160Leu Gln Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val
Lys 165 170 175Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
Trp Ile Asn 180 185 190Trp Val Lys Gln Arg Pro Gly Gln Cys Leu Glu
Trp Ile Gly Asn Ile 195 200 205Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr
Asn Gln Lys Phe Lys Asp Lys 210 215 220Ala Thr Leu Thr Val Asp Lys
Ser Ser Ser Thr Ala Tyr Met Gln Leu225 230 235 240Ser Ser Pro Thr
Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Ser 245 250 255Trp Arg
Gly Asn Ser Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr 260 265
270Val Ser Ser Ser Gly Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser
275 280 285Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met
Thr Cys 290 295 300Arg Ala Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr
Gln Gln Lys Ser305 310 315 320Gly Thr Ser Pro Lys Arg Trp Ile Tyr
Asp Thr Ser Lys Val Ala Ser 325 330 335Gly Val Pro Tyr Arg Phe Ser
Gly Ser Gly Ser Gly Thr Ser Tyr Ser 340 345 350Leu Thr Ile Ser Ser
Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys 355 360 365Gln Gln Trp
Ser Ser Asn Pro Leu Thr Phe Gly Cys Gly Thr Lys Leu 370
375 380Glu Leu Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
Gly385 390 395 400Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Gln Val Gln Leu 405 410 415Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro
Gly Ala Ser Val Lys Met 420 425 430Ser Cys Lys Thr Ser Gly Tyr Thr
Phe Thr Arg Tyr Thr Met His Trp 435 440 445Val Lys Gln Arg Pro Gly
Gln Cys Leu Glu Trp Ile Gly Tyr Ile Asn 450 455 460Pro Ser Arg Gly
Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala465 470 475 480Thr
Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser 485 490
495Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr
500 505 510Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly Thr Thr
Leu Thr 515 520 525Val Ser Ser Gly Gly Ser His His His His His His
530 535 54094119PRTMus musculus 94Asp Ile Lys Leu Gln Gln Ser Gly
Ala Glu Leu Ala Arg Pro Gly Ala1 5 10 15Ser Val Lys Met Ser Cys Lys
Thr Ser Gly Tyr Thr Phe Thr Arg Tyr 20 25 30Thr Met His Trp Val Lys
Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45Gly Tyr Ile Asn Pro
Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe 50 55 60Lys Asp Lys Ala
Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr65 70 75 80Met Gln
Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95Ala
Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly 100 105
110Thr Thr Leu Thr Val Ser Ser 11595116PRTMus musculus 95Leu Gln
Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys1 5 10 15Met
Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His 20 25
30Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr Ile
35 40 45Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp
Lys 50 55 60Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met
Gln Leu65 70 75 80Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr
Cys Ala Arg Tyr 85 90 95Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly
Gln Gly Thr Thr Leu 100 105 110Thr Val Ser Ser 11596103PRTMus
musculus 96Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu
Lys Val1 5 10 15Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met
Asn Trp Tyr 20 25 30Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile
Tyr Asp Thr Ser 35 40 45Lys Val Ala Ser Gly Val Pro Tyr Arg Phe Ser
Gly Ser Gly Ser Gly 50 55 60Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met
Glu Ala Glu Asp Ala Ala65 70 75 80Thr Tyr Tyr Cys Gln Gln Trp Ser
Ser Asn Pro Leu Thr Phe Gly Ala 85 90 95Gly Thr Lys Leu Glu Leu Lys
10097107PRTMus musculus 97Asp Ile Val Leu Thr Gln Ser Pro Ser Ile
Met Ser Val Ser Pro Gly1 5 10 15Glu Lys Val Thr Ile Thr Cys Ser Ala
Ser Ser Ser Val Ser Tyr Met 20 25 30His Trp Phe Gln Gln Lys Pro Gly
Thr Ser Pro Lys Leu Leu Ile Tyr 35 40 45Ser Thr Ser Asn Leu Ala Ser
Gly Val Pro Ala Arg Phe Ser Gly Arg 50 55 60Gly Ser Gly Thr Ser Tyr
Ser Leu Thr Ile Ser Arg Val Ala Ala Glu65 70 75 80Asp Ala Ala Thr
Tyr Tyr Cys Gln Gln Arg Ser Asn Tyr Pro Pro Trp 85 90 95Thr Phe Gly
Gly Gly Thr Lys Leu Glu Ile Lys 100 10598106PRTMus musculus 98Ile
Val Leu Thr Gln Ser Pro Ser Ile Met Ser Val Ser Pro Gly Glu1 5 10
15Lys Val Thr Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met His
20 25 30Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Leu Ile Tyr
Ser 35 40 45Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly
Arg Gly 50 55 60Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Ala
Ala Glu Asp65 70 75 80Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Ser Asn
Tyr Pro Pro Trp Thr 85 90 95Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100 10599106PRTMus musculus 99Ile Val Leu Thr Gln Ser Pro Ser Ile
Met Ser Val Ser Pro Gly Glu1 5 10 15Lys Val Thr Ile Thr Cys Ser Ala
Ser Ser Ser Val Ser Tyr Met His 20 25 30Trp Phe Gln Gln Lys Pro Gly
Thr Ser Pro Lys Leu Trp Ile Tyr Ser 35 40 45Thr Ser Asn Leu Ala Ser
Gly Val Pro Ala Arg Phe Ser Gly Arg Gly 50 55 60Ser Gly Thr Ser Tyr
Ser Leu Thr Ile Ser Arg Val Ala Ala Glu Asp65 70 75 80Ala Ala Thr
Tyr Tyr Cys Gln Gln Arg Ser Asn Tyr Pro Pro Trp Thr 85 90 95Phe Gly
Gly Gly Thr Lys Leu Glu Ile Lys 100 105100106PRTMus musculus 100Ile
Val Leu Thr Gln Ser Pro Ser Ile Met Ser Val Ser Pro Gly Glu1 5 10
15Lys Val Thr Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met His
20 25 30Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Ser Ile Tyr
Ser 35 40 45Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly
Arg Gly 50 55 60Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Ala
Ala Glu Asp65 70 75 80Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Ser Asn
Tyr Pro Pro Trp Thr 85 90 95Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100 105101513PRTartificialbispecific molecule 107 101Met Gly Trp
Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His
Ser Asp Ile Lys Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg 20 25 30Pro
Gly Ala Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe 35 40
45Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu
50 55 60Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr
Asn65 70 75 80Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys
Ser Ser Ser 85 90 95Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu
Asp Ser Ala Val 100 105 110Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His
Tyr Ser Leu Asp Tyr Trp 115 120 125Gly Gln Gly Thr Thr Leu Thr Val
Ser Ser Val Glu Gly Gly Ser Gly 130 135 140Gly Ser Gly Gly Ser Gly
Gly Ser Gly Gly Val Asp Asp Ile Gln Leu145 150 155 160Thr Gln Ser
Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr 165 170 175Met
Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr Gln 180 185
190Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys
195 200 205Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser Gly Ser
Gly Thr 210 215 220Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu
Asp Ala Ala Thr225 230 235 240Tyr Tyr Cys Gln Gln Trp Ser Ser Asn
Pro Leu Thr Phe Gly Ala Gly 245 250 255Thr Lys Leu Glu Leu Lys Ser
Gly Gly Gly Gly Ser Glu Val Gln Leu 260 265 270Gln Gln Ser Gly Pro
Glu Leu Val Lys Pro Gly Ala Ser Met Lys Ile 275 280 285Ser Cys Lys
Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp 290 295 300Val
Lys Gln Ser His Gly Lys Asn Leu Glu Trp Ile Gly Leu Ile Asn305 310
315 320Pro Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe Lys Gly Lys
Ala 325 330 335Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met
Glu Leu Leu 340 345 350Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr
Cys Ala Arg Asp Tyr 355 360 365Gly Phe Val Leu Asp Tyr Trp Gly Gln
Gly Thr Thr Leu Thr Val Ser 370 375 380Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser385 390 395 400Asp Ile Val Leu
Thr Gln Ser Pro Ser Ile Met Ser Val Ser Pro Gly 405 410 415Glu Lys
Val Thr Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met 420 425
430His Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Cys Ile Tyr
435 440 445Ser Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser
Gly Arg 450 455 460Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg
Val Ala Ala Glu465 470 475 480Asp Ala Ala Thr Tyr Tyr Cys Gln Gln
Arg Ser Asn Tyr Pro Pro Trp 485 490 495Thr Phe Gly Gly Gly Thr Lys
Leu Glu Ile Lys His His His His His 500 505
510His102513PRTartificialbispecific molecule 123 102Met Gly Trp Ser
Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser
Asp Ile Lys Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg 20 25 30Pro Gly
Ala Ser Val Lys Met Ser Cys Lys Thr Ser Gly Tyr Thr Phe 35 40 45Thr
Arg Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu 50 55
60Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn65
70 75 80Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser
Ser 85 90 95Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser
Ala Val 100 105 110Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His Tyr Ser
Leu Asp Tyr Trp 115 120 125Gly Gln Gly Thr Thr Leu Thr Val Ser Ser
Val Glu Gly Gly Ser Gly 130 135 140Gly Ser Gly Gly Ser Gly Gly Ser
Gly Gly Val Asp Asp Ile Gln Leu145 150 155 160Thr Gln Ser Pro Ala
Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr 165 170 175Met Thr Cys
Arg Ala Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr Gln 180 185 190Gln
Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys 195 200
205Val Ala Ser Gly Val Pro Tyr Arg Phe Ser Gly Ser Gly Ser Gly Thr
210 215 220Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu Asp Ala
Ala Thr225 230 235 240Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Leu
Thr Phe Gly Ala Gly 245 250 255Thr Lys Leu Glu Leu Lys Ser Gly Gly
Gly Gly Ser Glu Val Gln Leu 260 265 270Gln Gln Ser Gly Pro Glu Leu
Val Lys Pro Gly Ala Ser Met Lys Ile 275 280 285Ser Cys Lys Ala Ser
Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp 290 295 300Val Lys Gln
Ser His Gly Lys Asn Leu Glu Trp Ile Gly Leu Ile Asn305 310 315
320Pro Tyr Asn Gly Gly Thr Ile Tyr Asn Gln Lys Phe Lys Gly Lys Ala
325 330 335Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu
Leu Leu 340 345 350Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys
Ala Arg Asp Tyr 355 360 365Gly Phe Val Leu Asp Tyr Trp Gly Gln Gly
Thr Thr Leu Thr Val Ser 370 375 380Ser Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser385 390 395 400Asp Ile Val Leu Thr
Gln Ser Pro Ser Ile Met Ser Val Ser Pro Gly 405 410 415Glu Lys Val
Thr Ile Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met 420 425 430His
Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys Leu Leu Ile Tyr 435 440
445Ser Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Arg
450 455 460Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Ala
Ala Glu465 470 475 480Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Arg Ser
Asn Tyr Pro Pro Trp 485 490 495Thr Phe Gly Gly Gly Thr Lys Leu Glu
Ile Lys His His His His His 500 505
510His103520PRTartificialbispecific molecule 124 103Met Gly Trp Ser
Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly1 5 10 15Val His Ser
Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg 20 25 30Pro Gly
Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45Thr
Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu 50 55
60Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn65
70 75 80Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser
Ser 85 90 95Thr Ala Tyr Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser
Ala Val 100 105 110Tyr Tyr Cys Thr Arg Ser Trp Arg Gly Asn Ser Phe
Asp Tyr Trp Gly 115 120 125Gln Gly Thr Thr Leu Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly 130 135 140Gly Gly Ser Gly Gly Gly Gly Ser
Asp Ile Val Met Thr Gln Ser Pro145 150 155 160Ser Ser Leu Thr Val
Thr Ala Gly Glu Lys Val Thr Met Ser Cys Lys 165 170 175Ser Ser Gln
Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Thr 180 185 190Trp
Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp 195 200
205Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly
210 215 220Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala
Glu Asp225 230 235 240Leu Ala Val Tyr Tyr Cys Gln Asn Asp Tyr Ser
Tyr Pro Phe Thr Phe 245 250 255Gly Ser Gly Thr Lys Leu Glu Ile Lys
Ser Gly Gly Gly Gly Ser Asp 260 265 270Ile Lys Leu Gln Gln Ser Gly
Ala Glu Leu Ala Arg Pro Gly Ala Ser 275 280 285Val Lys Met Ser Cys
Lys Thr Ser Gly Tyr Thr Phe Thr Arg Tyr Thr 290 295 300Met His Trp
Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly305 310 315
320Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys
325 330 335Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala
Tyr Met 340 345 350Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val
Tyr Tyr Cys Ala 355 360 365Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp
Tyr Trp Gly Gln Gly Thr 370 375 380Thr Leu Thr Val Ser Ser Val Glu
Gly Gly Ser Gly Gly Ser Gly Gly385 390 395 400Ser Gly Gly Ser Gly
Gly Val Asp Asp Ile Gln Leu Thr Gln Ser Pro 405 410 415Ala Ile Met
Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg 420 425 430Ala
Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly 435 440
445Thr Ser Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys Val Ala Ser Gly
450 455 460Val Pro Tyr Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr
Ser Leu465 470 475 480Thr Ile Ser Ser Met Glu Ala Glu Asp Ala Ala
Thr
Tyr Tyr Cys Gln 485 490 495Gln Trp Ser Ser Asn Pro Leu Thr Phe Gly
Ala Gly Thr Lys Leu Glu 500 505 510Leu Lys His His His His His His
515 52010420PRTArtificial SequenceLinker 104Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly1 5 10 15Gly Gly Gly Ser
2010525PRTArtificial SequenceLinker 105Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser Gly1 5 10 15Gly Gly Gly Ser Gly Gly
Gly Gly Ser 20 2510618PRTArtificial SequenceLinker 106Gly Gly Gly
Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly1 5 10 15Gly
Ser1076PRTArtificial SequenceHis Tag 107His His His His His His1
51089PRTArtificial SequenceHis Tag 108Gly Gly Ser His His His His
His His1 5
* * * * *
References