U.S. patent application number 16/962136 was filed with the patent office on 2020-12-17 for modulators of dnm2 expression.
The applicant listed for this patent is IONIS PHARMACEUTICALS, INC.. Invention is credited to Huynh-Hoa BUI, Susan M. FREIER, Shuling GUO, Brett P. MONIA, Susan F. MURRAY.
Application Number | 20200392510 16/962136 |
Document ID | / |
Family ID | 1000005091737 |
Filed Date | 2020-12-17 |
View All Diagrams
United States Patent
Application |
20200392510 |
Kind Code |
A1 |
FREIER; Susan M. ; et
al. |
December 17, 2020 |
MODULATORS OF DNM2 EXPRESSION
Abstract
The present embodiments provide methods, compounds, and
compositions useful for inhibiting DNM2 expression, which may be
useful for treating, preventing, or ameliorating a disease
associated with DNM2.
Inventors: |
FREIER; Susan M.; (Carlsbad,
CA) ; BUI; Huynh-Hoa; (Carlsbad, CA) ; MURRAY;
Susan F.; (Carlsbad, CA) ; MONIA; Brett P.;
(Carlsbad, CA) ; GUO; Shuling; (Carlsbad,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
IONIS PHARMACEUTICALS, INC. |
Carlsbad |
CA |
US |
|
|
Family ID: |
1000005091737 |
Appl. No.: |
16/962136 |
Filed: |
January 15, 2019 |
PCT Filed: |
January 15, 2019 |
PCT NO: |
PCT/US2019/013689 |
371 Date: |
July 14, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62617411 |
Jan 15, 2018 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2310/341 20130101;
C12N 2310/351 20130101; C12N 2310/346 20130101; C12N 2310/3231
20130101; C12N 2310/315 20130101; C12N 2310/14 20130101; C12N
2320/35 20130101; C12N 15/1137 20130101; C12N 2310/3341 20130101;
C12N 2310/11 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1. A compound comprising a modified oligonucleotide 14 to 30 linked
nucleosides in length having i) a nucleobase sequence comprising at
least 14 contiguous nucleobases of SEQ ID NO: 2879; ii) a
nucleobase sequence comprising a portion of at least 14 contiguous
nucleobases 100% complementary to an equal length portion of
nucleobases 87,359-90,915; 90,968-97,263; 83,573-87,287;
3,404-44,737; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of
SEQ ID NO: 1, iii) a nucleobase sequence complementary to intron
12, intron 13, intron 11, intron 1, intron 14, exon 10, or the
3'-UTR of a human DNM2 pre-mRNA or human DNM2 mRNA, or iv) a
nucleobase sequence comprising at least 12, at least 13, at least
14, or at least 15 contiguous nucleobases of any one of the
nucleobase sequences of SEQ ID NOs: 7-3134, or a pharmaceutically
acceptable salt thereof.
2. The compound according to claim 1, wherein the modified
oligonucleotide has a nucleobase sequence consisting of any one of
SEQ ID NOs: 2879, 2123, 2189, 2160, 3056, 2453, or 2232.
3. The compound according to claim 1, wherein the modified
oligonucleotide comprises: a gap segment consisting of 8-12 linked
2'-deoxynucleosides; a 5' wing segment consisting of 1-7 linked
nucleosides; and a 3' wing segment consisting of 1-7 linked
nucleosides; wherein the gap segment is positioned between the 5'
wing segment and the 3' wing segment and wherein each terminal wing
nucleoside comprises a modified sugar.
4. The compound according to claim 1, wherein the modified
oligonucleotide is at least 80%, 85%, 90%, 95% or 100%
complementary to any of SEQ ID NOs: 1, 2, 3, or 3135.
5. The compound according to claim 1, wherein the modified
oligonucleotide comprises at least one modified internucleoside
linkage.
6. The compound according to claim 1, wherein the modified
oligonucleotide comprises at least one bicyclic sugar.
7. The compound according to claim 1, wherein the modified
oligonucleotide comprises at least one 5-methylcytosine.
8. The compound according to claim 1, wherein the compound is
single-stranded.
9. The compound according to claim 1, wherein the compound is
double-stranded.
10. The compound according to claim 1, wherein the modified
oligonucleotide consists of 16 to 20 linked nucleosides.
11. A compound comprising a modified oligonucleotide according to
the following formula: Gks Tks Tks Tds Ads Tds Tds Ads Tds Ads Gds
Gds Gds mCks Tks Tk; wherein, A=an adenine, mC=a 5-methylcytosine
G=a guanine, T=a thymine, k=a cEt sugar moiety, d=a 2'-deoxyribosyl
sugar moiety, and s=a phosphorothioate internucleoside linkage.
12. (canceled)
13. A compound according to the following formula: ##STR00012##
##STR00013## or a salt thereof.
14. (canceled)
15. A chirally enriched population of the compound according to
claim 1, wherein the population is enriched for modified
oligonucleotides comprising at least one particular
phosphorothioate internucleoside linkage having a particular
stereochemical configuration.
16. A pharmaceutical composition comprising the compound according
to claim 1 and at least one pharmaceutically acceptable diluent or
carrier.
17. (canceled)
18. A method of treating, preventing, or ameliorating a disease
associated with DNM2 in an individual, comprising administering to
the individual the compound according to claim 1.
19. An in vitro method of inhibiting expression of DNM2 in a cell
comprising contacting the cell with a single-stranded compound
comprising a modified oligonucleotide 100% complementary to exon
10, an intron, or the 3'-UTR of a DNM2 nucleic acid transcript,
thereby inhibiting expression of DNM2 in the cell.
20. The compound according to claim 5, wherein the at least one
modified internucleoside is a phosphorothioate internucleoside
linkage.
21. The compound according to claim 6, wherein the at least one
bicyclic sugar is selected from the group consisting of LNA, ENA,
and cEt.
22. The compound according to claim 1, comprising a conjugate
group.
23. The compound according to claim 22, wherein the compound
consists of the modified oligonucleotide and the conjugate
group.
24. The compound according to claim 1, wherein the pharmaceutically
acceptable salt is a sodium salt or a potassium salt.
25. The method according to claim 18, wherein the disease is
centronuclear myopathy, Duchenne Muscular Dystrophy, Charcot-Marie
Tooth disease, X-linked myotubular myopathy, autosomal recessive
centronuclear myopathy, or autosomal dominant centronuclear
myopathy.
26. The method according to claim 18, wherein the disease is
associated with a mutation in at least one gene selected from among
MTM1, BIN1, and DNM2.
Description
SEQUENCE LISTING
[0001] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled BIOL0322WOSEQ_ST25.txt created Jan. 10, 2019 which is
784 kb in size. The information in the electronic format of the
sequence listing is incorporated herein by reference in its
entirety.
FIELD
[0002] The present embodiments provide methods, compounds, and
compositions useful for inhibiting DNM2 expression, which can be
useful for treating, preventing, or ameliorating a disease
associated with DNM2.
BACKGROUND
[0003] Dynamin 2 (DNM2) is a large GTPase that is involved in
membrane trafficking and microtubule dynamics (See, e.g., Durieux
et al. J Mol Med, 88, 339 (2010)). Mutations in DNM2 are associated
with several diseases, including centronuclear myopathy (CNM) and
Charcot-Marie-Tooth disease. DNM2 is also associated with
Duchenne's Muscular Dystrophy (See, e.g., WO 2015/055859 and WO
2016/170162). CNM and CNM-like myopathy are also associated with
mutations in MTM1, BIN1, RYR1, TTN, CCDC78, and MTMR14
SUMMARY
[0004] Certain embodiments provided herein are directed to potent
and tolerable compounds and compositions useful for inhibiting DNM2
expression, which can be useful for treating, preventing,
ameliorating, or slowing progression of diseases, such as
centronuclear myopathy (CNM), Charcot-Marie-Tooth disease (CMT),
and Duchenne's Muscular Dystrophy (DMD). Certain embodiments
provided herein comprise modified oligonucleotides complementary to
a DNM2 nucleic acid that potently reduce DNM2 expression in
animals.
[0005] One object of the present invention is a compound comprising
a modified oligonucleotide 8 to 50 linked nucleosides in length
having a nucleobase sequence comprising at least 8 contiguous
nucleobases of any of the nucleobase sequences of SEQ ID NOs:
7-3134. Another object of the present invention is a compound
comprising a modified oligonucleotide 9 to 50 linked nucleosides in
length having a nucleobase sequence comprising at least 9
contiguous nucleobases of any of the nucleobase sequences of SEQ ID
NOs: 7-3134. Another object of the present invention is a compound
comprising a modified oligonucleotide 10 to 50 linked nucleosides
in length having a nucleobase sequence comprising at least 10
contiguous nucleobases of any of the nucleobase sequences of SEQ ID
NOs: 7-3134. Another object of the present invention is a compound
comprising a modified oligonucleotide 11 to 50 linked nucleosides
in length having a nucleobase sequence comprising at least 11
contiguous nucleobases of any of the nucleobase sequences of SEQ ID
NOs: 7-3134. Another object of the present invention is a compound
comprising a modified oligonucleotide 12 to 50 linked nucleosides
in length having a nucleobase sequence comprising at least 12, at
least 13, at least 14, or at least 15 contiguous nucleobases of any
of the nucleobase sequences of SEQ ID NOs: 7-3134. Another object
of the present invention is a compound comprising a modified
oligonucleotide 16 to 50 linked nucleosides in length having a
nucleobase sequence comprising the nucleobase sequence of any of
SEQ ID NOs: 7-3134. Another object of the present invention is a
compound comprising a modified oligonucleotide having a nucleobase
sequence consisting of any one of SEQ ID NOs: 7-3134. Another
object of the present invention is a compound comprising a modified
oligonucleotide 8 to 50 linked nucleosides in length complementary
within nucleobases 3,404-44,737; 83,573-87,287; 87,359-90,915;
90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of
SEQ ID NO: 1, wherein said modified oligonucleotide is at least
85%, 90%, 95%, or 100% complementary to SEQ ID NO: 1. Another
object of the present invention is a compound comprising a modified
oligonucleotide 8 to 50 linked nucleosides in length having a
nucleobase sequence comprising a portion of at least 8 contiguous
nucleobases 100% complementary to an equal length portion of
nucleobases 3,404-44,737; 83,573-87,287; 87,359-90,915;
90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of
SEQ ID NO: 1, wherein the nucleobase sequence of the modified
oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to
SEQ ID NO: 1. Another object of the present invention is a compound
comprising a modified oligonucleotide 8 to 50 linked nucleosides in
length complementary within nucleobases 83,573-87,287 or
87,359-90,915 of SEQ ID NO: 1, wherein said modified
oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to
SEQ ID NO: 1. Another object of the present invention is a compound
comprising a modified oligonucleotide complementary to intron 1 of
a human DNM2 pre-mRNA. Another object of the present invention is a
compound comprising a modified oligonucleotide complementary to
intron 11 of a human DNM2 pre-mRNA. Another object of the present
invention is a compound comprising a modified oligonucleotide
complementary to intron 12 of a human DNM2 pre-mRNA. Another object
of the present invention is a compound comprising a modified
oligonucleotide complementary to intron 13 of a human DNM2
pre-mRNA. Another object of the present invention is a compound
comprising a modified oligonucleotide complementary to intron 14 of
a human DNM2 pre-mRNA. Another object of the present invention is a
compound comprising a modified oligonucleotide complementary to
exon 10 of a human DNM2 pre-mRNA or human DNM2 mRNA. Another object
of the present invention is a compound comprising a modified
oligonucleotide complementary to the 3'-UTR of a human DNM2
pre-mRNA or human DNM2 mRNA. Another object of the present
invention is a compound comprising a modified oligonucleotide 16 to
50 linked nucleosides in length having a nucleobase sequence
comprising any of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160,
or 2232. Another object of the present invention is a compound
comprising a modified oligonucleotide having a nucleobase sequence
consisting of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453,
2160, or 2232. Another object of the present invention is a
compound comprising a modified oligonucleotide having a nucleobase
sequence comprising SEQ ID NO: 2879.
[0006] Another object of the present invention is a compound
comprising a modified oligonucleotide 16 to 50 linked nucleosides
in length having a nucleobase sequence comprising any of SEQ ID
NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232, wherein the
modified oligonucleotide comprises: [0007] a gap segment consisting
of 8-12 linked 2'-deoxynucleosides; [0008] a 5' wing segment
consisting of 1-7 linked nucleosides; and [0009] a 3' wing segment
consisting of 1-7 linked nucleosides;
[0010] wherein the gap segment is positioned between the 5' wing
segment and the 3' wing segment and wherein each terminal wing
nucleoside comprises a modified sugar.
[0011] Another object of the present invention is a compound
comprising a modified oligonucleotide 16 linked nucleosides in
length having a nucleobase sequence consisting of the sequence
recited in SEQ ID NO: 2879, 3056, 2123, 2189, 2453, 2160, or 2232,
wherein the modified oligonucleotide comprises [0012] a gap segment
consisting of 10 linked 2'-deoxynucleosides; [0013] a 5' wing
segment consisting of 3 linked nucleosides; and [0014] a 3' wing
segment consisting of 3 linked nucleosides;
[0015] wherein the gap segment is positioned between the 5' wing
segment and the 3' wing segment; wherein each nucleoside of each
wing segment comprises a cEt sugar moiety; wherein each
internucleoside linkage is a phosphorothioate linkage; and wherein
each cytosine is a 5-methylcytosine.
In one embodiment, the oligonucleotide is at least 80%, 85%, 90%,
95% or 100% complementary to any of SEQ ID NO: 1, 2, 3, or 3135. In
one embodiment, the modified oligonucleotide comprises at least one
modified internucleoside linkage. In one embodiment, the at least
one modified internucleoside linkage is a phosphorothioate
internucleoside linkage. In one embodiment, the modified
oligonucleotide comprises at least one bicyclic sugar. In one
embodiment, the at least one bicyclic sugar is selected from the
group consisting of LNA, ENA, and cEt. In one embodiment, the at
least one bicyclic sugar moiety is a cEt sugar moiety.
[0016] In one embodiment, the modified oligonucleotide comprises at
least one 5-methylcytosine. In one embodiment, the modified
oligonucleotide comprises:
[0017] a gap segment consisting of linked 2'-deoxynucleosides;
[0018] a 5' wing segment consisting of linked nucleosides; and
[0019] a 3' wing segment consisting of linked nucleosides;
[0020] wherein the gap segment is positioned immediately adjacent
to and between the 5' wing segment and the 3' wing segment and
wherein each nucleoside of each wing segment comprises a modified
sugar moiety.
[0021] In one embodiment, the compound is single-stranded. In one
embodiment, the compound is double-stranded.
[0022] In one embodiment, the compound comprises at least one
unmodified ribosyl sugar moiety. In one embodiment, the compound
comprises at least one unmodified 2'-deoxyribosyl sugar moiety.
[0023] In one embodiment, the modified oligonucleotide consists of
10 to 30 linked nucleosides. In one embodiment, the modified
oligonucleotide consists of 12 to 30 linked nucleosides. In one
embodiment, the modified oligonucleotide consists of 15 to 30
linked nucleosides. In one embodiment, the modified oligonucleotide
consists of 16 to 20 linked nucleosides.
[0024] Another object of the present invention is a compound
comprising a modified oligonucleotide according to the following
formula: Gks Tks Tks Tds Ads Tds Tds Ads Tds Ads Gds Gds Gds mCks
Tks Tk; wherein, [0025] A=an adenine, [0026] mC=a 5-methylcytosine
[0027] G=a guanine, [0028] T=a thymine, [0029] k=a cEt sugar
moiety, [0030] d=a 2'-deoxyribosyl sugar moiety, and [0031] s=a
phosphorothioate internucleoside linkage.
[0032] In one embodiment, the compound of the invention comprises a
conjugate group. In one embodiment, the compound of the invention
consists of the modified oligonucleotide and the conjugate
group.
[0033] Another object of the present invention is a compound
according to the following formula:
##STR00001##
[0034] In one embodiment, the compound consists of the modified
oligonucleotide.
[0035] The present invention further relates to a compound
consisting of a pharmaceutically acceptable salt form of any one of
the compounds described herein. In one embodiment, the
pharmaceutically acceptable salt is a sodium salt. In one
embodiment, the pharmaceutically acceptable salt is a potassium
salt.
[0036] The present invention also relates to a pharmaceutical
composition comprising a compound as described herein and at least
one pharmaceutically acceptable carrier or diluent.
[0037] The present invention further relates to a chirally enriched
population of the compounds described herein, wherein the
population is enriched for modified oligonucleotides comprising at
least one particular phosphorothioate internucleoside linkage
having a particular stereochemical configuration. In one
embodiment, the population is enriched for modified
oligonucleotides comprising at least one particular
phosphorothioate internucleoside linkage having the (Sp)
configuration. In one embodiment, the population is enriched for
modified oligonucleotides comprising at least one particular
phosphorothioate internucleoside linkage having the (Rp)
configuration. In one embodiment, the population is enriched for
modified oligonucleotides having a particular, independently
selected stereochemical configuration at each phosphorothioate
internucleoside linkage. In one embodiment, the population is
enriched for modified oligonucleotides having the (Sp)
configuration at each phosphorothioate internucleoside linkage. In
one embodiment, the population is enriched for modified
oligonucleotides having the (Rp) configuration at each
phosphorothioate internucleoside linkage. In one embodiment, the
population is enriched for modified oligonucleotides having the
(Rp) configuration at one particular phosphorothioate
internucleoside linkage and the (Sp) configuration at each of the
remaining phosphorothioate internucleoside linkages. In one
embodiment, the population is enriched for modified
oligonucleotides having at least 3 contiguous phosphorothioate
internucleoside linkages in the Sp, Sp, and Rp configurations, in
the 5' to 3' direction. In one embodiment, all of the
phosphorothioate internucleoside linkages of the modified
oligonucleotide are stereorandom.
[0038] The present invention further relates to a pharmaceutical
composition comprising the population of compounds described herein
and at least one pharmaceutically acceptable diluent or
carrier.
[0039] The present invention further relates to a compound
described herein, a pharmaceutical composition comprising said
compound and at least one pharmaceutically acceptable carrier or
diluent, or a pharmaceutical composition comprising the population
of compounds described herein and at least one pharmaceutically
acceptable carrier or diluent, for use in therapy.
[0040] The present invention further relates to a compound
described herein, a pharmaceutical composition comprising said
compound and at least one pharmaceutically acceptable carrier or
diluent, or a pharmaceutical composition comprising the population
of compounds described herein and at least one pharmaceutically
acceptable carrier or diluent, for use in treating, preventing, or
ameliorating centronuclear myopathy, Duchenne Muscular Dystrophy,
or Charcot-Marie Tooth disease.
[0041] The present invention also relates to a method of treating,
preventing, or ameliorating a disease associated with DNM2 in an
individual comprising administering to the individual a compound or
composition described herein, thereby treating, preventing, or
ameliorating the disease.
[0042] The present invention also relates to a method of treating,
preventing, or ameliorating a disease associated with DNM2 in an
individual comprising administering to the individual a compound
comprising a modified oligonucleotide 100% complementary to an exon
10, an intron, or the 3'-UTR of a DNM2 nucleic acid transcript,
thereby treating, preventing, or ameliorating the disease.
[0043] In one embodiment, the disease is centronuclear myopathy,
Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease. In one
embodiment, the compound is single-stranded. In one embodiment, the
DNM2 nucleic acid transcript is a pre-mRNA. In one embodiment, the
disease is X-linked myotubular myopathy, autosomal recessive
centronuclear myopathy, or autosomal dominant centronuclear
myopathy. In one embodiment, the individual has at least one
mutation in at least one gene selected from among MTM1, BIN1, and
DNM2. In one embodiment, the administering increases body weight or
muscle strength.
[0044] The present invention further relates to a method of
inhibiting expression of DNM2 in a cell comprising contacting the
cell with a single-stranded compound comprising a modified
oligonucleotide 100% complementary to exon 10, an intron, or the
3'-UTR of a DNM2 nucleic acid transcript, thereby inhibiting
expression of DNM2 in the cell. In one embodiment, the method is an
in vitro method. In one embodiment, the cell is in the muscle of an
individual. In one embodiment, the individual has, or is at risk of
having, a centronuclear myopathy, Duchenne Muscular Dystrophy, or
Charcot-Marie Tooth disease.
[0045] The present invention further relates to a method of
increasing body weight or muscle strength in an individual having,
or at risk of having, a disease associated with DNM2 comprising
administering a single-stranded compound comprising a modified
oligonucleotide 100% complementary to a DNM2 nucleic acid
transcript to the individual, thereby increasing body weight or
muscle strength in the individual. In one embodiment, the
individual has, or is at risk of having, centronuclear myopathy,
Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.
[0046] In one embodiment, the compound is a compound as described
herein. In one embodiment, the compound is a member of the chirally
enriched population described herein. In one embodiment, the
compound is a component of the pharmaceutical composition described
herein.
[0047] In one embodiment, the compound is administered to the
individual via subcutaneous injection. In one embodiment, the
compound is administered to the individual via intramuscular
injection. In one embodiment, the compound is administered to the
individual via intravenous injection.
[0048] The present invention further relates to the use of a
single-stranded compound comprising a modified oligonucleotide 100%
complementary to exon 10, intron 1, intron 11, intron, 12, intron
13, intron 14, or the 3'-UTR of a DNM2 nucleic acid transcript for
treating, preventing, or ameliorating a disease associated with
DNM2. In one embodiment, the disease is centronuclear myopathy,
Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.
[0049] The present invention further relates to the use of the
compound described herein or the composition described herein for
treating, preventing, or ameliorating a disease associated with
DNM2.
[0050] The present invention further relates to the use of the
compound described herein or the composition described herein in
the manufacture of a medicament for treating, preventing, or
ameliorating a disease associated with DNM2.
[0051] In one embodiment, the disease is centronuclear myopathy,
Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease. In one
embodiment, the disease is X-linked myotubular myopathy, autosomal
recessive centronuclear myopathy, or autosomal dominant
centronuclear myopathy. In one embodiment, the disease is
associated with a mutation in at least one gene selected from among
MTM1, BIN1, and DNM2. The present invention further relates to the
use of the compound described herein or the composition described
herein in the preparation of a medicament for treating, preventing,
or ameliorating a disease associated with DNM2. In one embodiment,
the disease is centronuclear myopathy, Duchenne Muscular Dystrophy,
or Charcot-Marie Tooth disease. In one embodiment, the disease is
X-linked myotubular myopathy, autosomal recessive centronuclear
myopathy, or autosomal dominant centronuclear myopathy. In one
embodiment, the the disease is associated with a mutation in at
least one gene selected from among MTM1, BIN1, and DNM2.
DETAILED DESCRIPTION
[0052] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the embodiments, as
claimed. Herein, the use of the singular includes the plural unless
specifically stated otherwise. As used herein, the use of "or"
means "and/or" unless stated otherwise. Furthermore, the use of the
term "including" as well as other forms, such as "includes" and
"included", is not limiting.
[0053] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
this application, including, but not limited to, patents, patent
applications, articles, books, treatises, and GenBank and NCBI
reference sequence records are hereby expressly incorporated by
reference for the portions of the document discussed herein, as
well as in their entirety.
[0054] It is understood that the sequence set forth in each SEQ ID
NO contained herein is independent of any modification to a sugar
moiety, an internucleoside linkage, or a nucleobase. As such,
compounds defined by a SEQ ID NO may comprise, independently, one
or more modifications to a sugar moiety, an internucleoside
linkage, or a nucleobase.
[0055] As used herein, "2'-deoxynucleoside" means a nucleoside
comprising 2'-H(H) ribosyl sugar moiety, as found in naturally
occurring deoxyribonucleic acids (DNA). In certain embodiments, a
2'-deoxynucleoside may comprise a modified nucleobase or may
comprise an RNA nucleobase (uracil).
[0056] As used herein, "2'-substituted nucleoside" or "2-modified
nucleoside" means a nucleoside comprising a 2'-substituted or
2'-modified sugar moiety. As used herein, "2'-substituted" or
"2-modified" in reference to a furanosyl sugar moiety means a sugar
moiety comprising at least one 2'-substituent group other than H or
OH.
[0057] As used herein, "administration" or "administering" refers
to routes of introducing a compound or composition provided herein
to an individual to perform its intended function. An example of a
route of administration that can be used includes, but is not
limited to, administration by inhalation.
[0058] As used herein, "administered concomitantly" or
"co-administration" means administration of two or more compounds
in any manner in which the pharmacological effects of both are
manifest in the patient. Concomitant administration does not
require that both compounds be administered in a single
pharmaceutical composition, in the same dosage form, by the same
route of administration, or at the same time. The effects of both
compounds need not manifest themselves at the same time. The
effects need only be overlapping for a period of time and need not
be coextensive. Concomitant administration or co-administration
encompasses administration in parallel or sequentially.
[0059] As used herein, "animal" refers to a human or non-human
animal, including, but not limited to, mice, rats, rabbits, dogs,
cats, pigs, and non-human primates, including, but not limited to,
monkeys and chimpanzees.
[0060] As used herein, "antisense activity" means any detectable
and/or measurable change attributable to the hybridization of an
antisense compound to its target nucleic acid. In certain
embodiments, antisense activity is a decrease in the amount or
expression of a target nucleic acid or protein encoded by such
target nucleic acid compared to target nucleic acid levels or
target protein levels in the absence of the antisense compound.
[0061] As used herein, "antisense compound" means a compound
comprising an antisense oligonucleotide and optionally one or more
additional features, such as a conjugate group or terminal
group.
[0062] As used herein, "antisense oligonucleotide" means an
oligonucleotide having a nucleobase sequence that is at least
partially complementary to a target nucleic acid.
[0063] As used herein, "ameliorate" in reference to a treatment
means improvement in at least one symptom relative to the same
symptom in the absence of the treatment. In certain embodiments,
amelioration is the reduction in the severity or frequency of a
symptom or the delayed onset or slowing of progression in the
severity or frequency of a symptom.
[0064] As used herein, "bicyclic nucleoside" or "BNA" means a
nucleoside comprising a bicyclic sugar moiety. As used herein,
"bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar
moiety comprising two rings, wherein the second ring is formed via
a bridge connecting two of the atoms in the first ring thereby
forming a bicyclic structure. In certain embodiments, the first
ring of the bicyclic sugar moiety is a furanosyl moiety. In certain
embodiments, the bicyclic sugar moiety does not comprise a
furanosyl moiety.
[0065] As used herein, "cEt" or "constrained ethyl" means a
bicyclic sugar moiety, wherein the first ring of the bicyclic sugar
moiety is a ribosyl sugar moiety, the second ring of the bicyclic
sugar is formed via a bridge connecting the 4'-carbon and the
2'-carbon, the bridge has the formula 4'-CH(CH.sub.3)--O-2', and
the methyl group of the bridge is in the S configuration. A cEt
bicyclic sugar moiety is in the .beta.-D configuration.
[0066] As used herein, "chirally enriched population" means a
plurality of molecules of identical molecular formula, wherein the
number or percentage of molecules within the population that
contain a particular stereochemical configuration at a particular
chiral center is greater than the number or percentage of molecules
expected to contain the same particular stereochemical
configuration at the same particular chiral center within the
population if the particular chiral center were stereorandom.
Chirally enriched populations of molecules having multiple chiral
centers within each molecule may contain one or more sterorandom
chiral centers. In certain embodiments, the molecules are modified
oligonucleotides. In certain embodiments, the molecules are
compounds comprising modified oligonucleotides.
[0067] As used herein, "complementary" in reference to an
oligonucleotide means that at least 70% of the nucleobases of such
oligonucleotide or one or more regions thereof and the nucleobases
of another nucleic acid or one or more regions thereof are capable
of hydrogen bonding with one another when the nucleobase sequence
of the oligonucleotide and the other nucleic acid are aligned in
opposing directions. Complementary nucleobases are nucleobase pairs
that are capable of forming hydrogen bonds with one another.
Complementary nucleobase pairs include adenine (A) and thymine (T),
adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl
cytosine (.sup.mC) and guanine (G). Complementary oligonucleotides
and/or nucleic acids need not have nucleobase complementarity at
each nucleoside. Rather, some mismatches are tolerated. As used
herein, "fully complementary" or "100% complementary" in reference
to oligonucleotides means that such oligonucleotides are
complementary to another oligonucleotide or nucleic acid at each
nucleoside of the oligonucleotide.
[0068] As used herein, "conjugate group" means a group of atoms
that is directly or indirectly attached to an oligonucleotide.
Conjugate groups include a conjugate moiety and a conjugate linker
that attaches the conjugate moiety to the oligonucleotide.
[0069] As used herein, "conjugate linker" means a group of atoms
comprising at least one bond that connects a conjugate moiety to an
oligonucleotide.
[0070] As used herein, "conjugate moiety" means a group of atoms
that is attached to an oligonucleotide via a conjugate linker.
[0071] As used herein, "contiguous" in the context of an
oligonucleotide refers to nucleosides, nucleobases, sugar moieties,
or internucleoside linkages that are immediately adjacent to each
other. For example, "contiguous nucleobases" means nucleobases that
are immediately adjacent to each other in a sequence.
[0072] As used herein, "double-stranded antisense compound" means
an antisense compound comprising two oligomeric compounds that are
complementary to each other and form a duplex, and wherein one of
the two said oligomeric compounds comprises an antisense
oligonucleotide.
[0073] As used herein, "effective amount" means the amount of
compound sufficient to effectuate a desired physiological outcome
in an individual in need of the compound. The effective amount may
vary among individuals depending on the health and physical
condition of the individual to be treated, the taxonomic group of
the individuals to be treated, the formulation of the composition,
assessment of the individual's medical condition, and other
relevant factors.
[0074] As used herein, "efficacy" means the ability to produce a
desired effect.
[0075] As used herein "DNM2" means any Dynamin 2 nucleic acid or
protein. "DNM2 nucleic acid" means any nucleic acid encoding DNM2.
For example, in certain embodiments, a DNM2 nucleic acid includes a
DNA chromosomal region encoding DNM2, an RNA transcribed from DNA
encoding DNM2 (e.g., a pre-mRNA transcript), and an mRNA transcript
encoding DNM2.
[0076] As used herein, "expression" includes all the functions by
which a gene's coded information is converted into structures
present and operating in a cell. Such structures include, but are
not limited to, the products of transcription and translation.
Methods for measuring expression levels (such as a transcription
level or a translation level) are well-known in the field and
include, but are not limited to, RT-PCR, RT-qPCR, Northern Blot,
hybridization techniques such as, for example, use of microarrays,
and combinations thereof including but not limited to,
hybridization of amplicons obtained by RT-PCR, sequencing such as,
for example, next-generation DNA sequencing (NGS) or RNA-seq (also
known as "Whole Transcriptome Shotgun Sequencing") and the like,
immunohistochemistry, Multiplex methods (Luminex), western blot,
enzyme-linked immunosorbent assay (ELISA), sandwich ELISA,
multiplex ELISA, electrochemiluminescence (ECL) (Elecsys.RTM.,
Roche Diagnostics), enzyme-linked fluorescent assay (ELFA) (such as
VIDAS.RTM., Biomdrieux), fluorescent-linked immunosorbent assay
(FLISA), enzyme immunoassay (EIA), radioimmunoassay (RIA), flow
cytometry (FACS), surface plasmon resonance (SPR), biolayer
interferometry (BLI), immunochromatographic assay (ICA) (such as
NEXUS IB10, Sphingotech) and mass spectrometry-based
approaches.
[0077] As used herein, "gapmer" means an oligonucleotide, such as
an antisense oligonucleotide, comprising an internal segment having
a plurality of nucleosides that support RNase H cleavage positioned
between external segments, each having one or more nucleosides,
wherein the nucleosides comprising the internal segment are
chemically distinct from the immediately adjacent nucleoside or
nucleosides comprising the external segments. The internal segment
may be referred to as the "gap" or "gap segment" and the external
segments may be referred to as the "wings" or "wing segments".
[0078] As used herein, "hybridization" means the pairing or
annealing of complementary oligonucleotides and/or nucleic acids.
While not limited to a particular mechanism, the most common
mechanism of hybridization involves hydrogen bonding, which may be,
for example, Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen
bonding, between complementary nucleobases.
[0079] As used herein, "individual" means a human or non-human
animal selected for treatment or therapy.
[0080] As used herein, "inhibiting the expression or activity"
refers to a reduction or blockade of the expression or activity
relative to the expression or activity in an untreated or control
sample and does not necessarily indicate a total elimination of
expression or activity. In one embodiment, inhibiting the
expression or activity refers to a reduction or blockade of the
expression or activity relative to the expression or activity in an
untreated or control sample of at least about 40%, at least about
50%, at least about 60%, at least about 70%, at least about 80%, or
at least about 90%. In one embodiment, inhibiting the expression or
activity refers to a reduction or blockade of the expression or
activity relative to the expression or activity in an untreated or
control sample of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.
[0081] As used herein, the term "about" preceding a figure means
plus or less 10% of the value of said figure.
[0082] As used herein, the terms "internucleoside linkage" means a
group or bond that forms a covalent linkage between adjacent
nucleosides in an oligonucleotide. As used herein "modified
internucleoside linkage" means any internucleoside linkage other
than a naturally occurring, phosphate internucleoside linkage.
Non-phosphate linkages are referred to herein as modified
internucleoside linkages. "Phosphorothioate linkage" means a
modified phosphate linkage in which one of the non-bridging oxygen
atoms is replaced with a sulfur atom. A phosphorothioate
internucleoside linkage is a modified internucleoside linkage.
Modified internucleoside linkages include linkages that comprise
abasic nucleosides. As used herein, "abasic nucleoside" means a
sugar moiety in an oligonucleotide or oligomeric compound that is
not directly connected to a nucleobase. In certain embodiments, an
abasic nucleoside is adjacent to one or two nucleosides in an
oligonucleotide.
[0083] As used herein, "linker-nucleoside" means a nucleoside that
links, either directly or indirectly, an oligonucleotide to a
conjugate moiety. Linker-nucleosides are located within the
conjugate linker of an oligomeric compound. Linker-nucleosides are
not considered part of the oligonucleotide portion of an oligomeric
compound even if they are contiguous with the oligonucleotide.
[0084] As used herein, "non-bicyclic modified sugar" or
"non-bicyclic modified sugar moiety" means a modified sugar moiety
that comprises a modification, such as a substituent, that does not
form a bridge between two atoms of the sugar to form a second
ring.
[0085] As used herein, "linked nucleosides" are nucleosides that
are connected in a continuous sequence (i.e. no additional
nucleosides are present between those that are linked).
[0086] As used herein, "mismatch" or "non-complementary" means a
nucleobase of a first oligonucleotide that is not complementary
with the corresponding nucleobase of a second oligonucleotide or
target nucleic acid when the first and second oligomeric compound
are aligned.
[0087] As used herein, "modulating" refers to changing or adjusting
a feature in a cell, tissue, organ or organism. For example,
modulating DNM2 expression can mean to increase or decrease the
level of an DNM2 RNA and/or a DNM2 protein in a cell, tissue, organ
or organism. A "modulator" effects the change in the cell, tissue,
organ or organism. For example, a compound that modulates DNM2
expression can be a modulator that decreases the amount of a DNM2
RNA and/or a DNM2 protein in a cell, tissue, organ or organism.
[0088] As used herein, "MOE" means methoxyethyl. "2'-MOE" or
"2'-O-methoxyethyl" means a 2'-OCH.sub.2CH.sub.2OCH.sub.3 group in
place of the 2'OH group of a ribosyl ring.
[0089] As used herein, "motif" means the pattern of unmodified
and/or modified sugar moieties, nucleobases, and/or internucleoside
linkages, in an oligonucleotide.
[0090] As used herein, "naturally occurring" means found in
nature.
[0091] As used herein, "nucleobase" means an unmodified nucleobase
or a modified nucleobase. As used herein an "unmodified nucleobase"
is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine
(G). As used herein, a modified nucleobase is a group of atoms
capable of pairing with at least one unmodified nucleobase. A
universal base is a nucleobase that can pair with any one of the
five unmodified nucleobases.
[0092] As used herein, "nucleobase sequence" means the order of
contiguous nucleobases in a nucleic acid or oligonucleotide
independent of any sugar or internucleoside linkage
modification.
[0093] As used herein, "nucleoside" means a moiety comprising a
nucleobase and a sugar moiety. The nucleobase and sugar moiety are
each, independently, unmodified or modified. As used herein,
"modified nucleoside" means a nucleoside comprising a modified
nucleobase and/or a modified sugar moiety.
[0094] As used herein, "oligomeric compound" means a compound
consisting of an oligonucleotide and optionally one or more
additional features, such as a conjugate group or terminal
group.
[0095] As used herein, "oligonucleotide" means a strand of linked
nucleosides connected via internucleoside linkages, wherein each
nucleoside and internucleoside linkage may be modified or
unmodified. Unless otherwise indicated, oligonucleotides consist of
8-50 linked nucleosides. As used herein, "modified oligonucleotide"
means an oligonucleotide, wherein at least one nucleoside or
internucleoside linkage is modified. As used herein, "unmodified
oligonucleotide" means an oligonucleotide that does not comprise
any nucleoside modifications or internucleoside modifications.
[0096] As used herein, "pharmaceutically acceptable carrier or
diluent" means any substance suitable for use in administering to
an animal. Certain such carriers enable pharmaceutical compositions
to be formulated as, for example, liquids, powders, or suspensions
that can be aerosolized or otherwise dispersed for inhalation by a
subject. In certain embodiments, a pharmaceutically acceptable
carrier or diluent is sterile water; sterile saline; or sterile
buffer solution. In one embodiment, the pharmaceutically acceptable
carrier or diluent does not produce an adverse, allergic or other
untoward reaction when administered to an animal, preferably a
human. It includes any and all solvents, dispersion media,
coatings, antibacterial and antifungal agents, isotonic and
absorption delaying agents and the like. For human administration,
preparations should meet sterility, pyrogenicity, general safety
and purity standards as required by regulatory offices, such as,
for example, FDA Office or EMA.
[0097] As used herein "pharmaceutically acceptable salts" means
physiologically and pharmaceutically acceptable salts of compounds,
such as oligomeric compounds, i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto.
[0098] As used herein "pharmaceutical composition" means a mixture
of substances suitable for administering to a subject. For example,
a pharmaceutical composition may comprise an antisense compound and
an aqueous solution.
[0099] As used herein, "phosphorus moiety" means a group of atoms
comprising a phosphorus atom. In certain embodiments, a phosphorus
moiety comprises a mono-, di-, or tri-phosphate, or
phosphorothioate.
[0100] As used herein "prodrug" means a therapeutic agent in a form
outside the body that is converted to a differentform within the
body or cells thereof. Typically conversion of a prodrug within the
body is facilitated by the action of an enzymes (e.g., endogenous
or viral enzyme) or chemicals present in cells or tissues and/or by
physiologic conditions.
[0101] As used herein, "RNAi compound" means an antisense compound
that acts, at least in part, through RISC or Ago2 to modulate a
target nucleic acid and/or protein encoded by a target nucleic
acid. RNAi compounds include, but are not limited to
double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA,
including microRNA mimics. In certain embodiments, an RNAi compound
modulates the amount, activity, and/or splicing of a target nucleic
acid. The term RNAi compound excludes antisense oligonucleotides
that act through RNase H.
[0102] As used herein, the term "single-stranded" in reference to
an antisense compound means such a compound consisting of one
oligomeric compound that is not paired with a second oligomeric
compound to form a duplex. "Self-complementary" in reference to an
oligonucleotide means an oligonucleotide that at least partially
hybridizes to itself. A compound consisting of one oligomeric
compound, wherein the oligonucleotide of the oligomeric compound is
self-complementary, is a single-stranded compound. A
single-stranded antisense or oligomeric compound may be capable of
binding to a complementary oligomeric compound to form a duplex, in
which case the compound would no longer be single-stranded.
[0103] As used herein, "standard cell assay" means any of the
assays described in Examples 1-9, and reasonable variations
thereof.
[0104] As used herein, "standard in vivo experiment" means the
procedure described in Example 10 and reasonable variations
thereof.
[0105] As used herein, "stereorandom chiral center" in the context
of a population of molecules of identical molecular formula means a
chiral center having a random stereochemical configuration. For
example, in a population of molecules comprising a stereorandom
chiral center, the number of molecules having the (S) configuration
of the stereorandom chiral center may be but is not necessarily the
same as the number of molecules having the (R) configuration of the
stereorandom chiral center. The stereochemical configuration of a
chiral center is considered random when it is the result of a
synthetic method that is not designed to control the stereochemical
configuration. In certain embodiments, a stereorandom chiral center
is a stereorandom phosphorothioate internucleoside linkage.
[0106] As used herein, "sugar moiety" means an unmodified sugar
moiety or a modified sugar moiety. As used herein, "unmodified
sugar moiety" means a 2'-OH(H) ribosyl moiety, as found in RNA (an
"unmodified RNA sugar moiety"), or a 2'-H(H) moiety, as found in
DNA (an "unmodified DNA sugar moiety"). As used herein, "modified
sugar moiety" or "modified sugar" means a modified furanosyl sugar
moiety or a sugar surrogate. As used herein, modified furanosyl
sugar moiety means a furanosyl sugar comprising a non-hydrogen
substituent in place of at least one hydrogen of an unmodified
sugar moiety. In certain embodiments, a modified furanosyl sugar
moiety is a 2'-substituted sugar moiety. Such modified furanosyl
sugar moieties include bicyclic sugars and non-bicyclic sugars. As
used herein, "sugar surrogate" means a modified sugar moiety having
other than a furanosyl moiety that can link a nucleobase to another
group, such as an internucleoside linkage, conjugate group, or
terminal group in an oligonucleotide. Modified nucleosides
comprising sugar surrogates can be incorporated into one or more
positions within an oligonucleotide and such oligonucleotides are
capable of hybridizing to complementary oligomeric compounds or
nucleic acids.
[0107] As used herein, "target nucleic acid," "target RNA," "target
RNA transcript" and "nucleic acid target" mean a nucleic acid that
an antisense compound is designed to affect.
[0108] As used herein, "target region" means a portion of a target
nucleic acid to which an antisense compound is designed to
hybridize.
[0109] As used herein, "terminal group" means a chemical group or
group of atoms that is covalently linked to a terminus of an
oligonucleotide.
[0110] As used herein, "terminal wing nucleoside" means a
nucleoside that is located at the terminus of a wing segment of a
gapmer. Any wing segment that comprises or consists of at least two
nucleosides has two termini: one that is immediately adjacent to
the gap segment; and one that is at the end opposite the gap
segment. Thus, any wing segment that comprises or consists of at
least two nucleosides has two terminal nucleosides, one at each
terminus.
[0111] As used herein, "therapeutically effective amount" means an
amount of a compound, pharmaceutical agent, or composition that
provides a therapeutic benefit to an individual. In certain
embodiments, the therapeutically effective amount refers to the
level or amount of a compound that treats or ameliorates symptoms
of a disease associated with DNM2. In certain embodiments, the
therapeutically effective amount may be administered prior to the
onset of the disease associated with DNM2 or may be administered
after initiation of the disease associated with DNM2.
[0112] As used herein, "treat" refers to administering a compound
or pharmaceutical composition to an animal in order to effect an
alteration or improvement of a disease, disorder, or condition in
the animal. In one embodiment, a subject is successfully treated
if, after receiving a therapeutically effective amount of a
compound according to the present invention, the subject shows
observable and/or measurable reduction or relief to some extent of
one or more of the symptoms associated with the specific disease
associated with DNM2, such as but not limited to reduced morbidity
and mortality, improvement in quality of life issues, increased
body weight, preservation or increase in muscle strength, decrease
in time taken to rise from the floor, decrease in nine-meter
walking time, decrease in time taken to climb four stairs,
increased ability to lift weight, increased distance of a 6 minute
walk, increased leg function grade, improved pulmonary function
and/or cardiac function. Parameters for assessing successful
treatment and improvement in the disease are readily measurable by
routine procedures familiar to a physician.
Certain Embodiments
[0113] Certain embodiments provide methods, compounds and
compositions for inhibiting DNM2 expression.
[0114] Certain embodiments provide methods, compounds and
compositions for inhibiting DNM2 expression as compared to an
untreated or control sample. In one embodiment, said inhibition is
an inhibition of DNM2 expression of at least about 40%, at least
about 50%, at least about 60%, at least about 70%, at least about
80%, or at least about 90%. In one embodiment, inhibiting the
expression or activity refers to a reduction or blockade of the
expression or activity relative to the expression or activity in an
untreated or control sample of at least 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%
as compared to an untreated or control sample.
[0115] Certain embodiments provide compounds comprising or
consisting of oligonucleotides complementary to a DNM2 nucleic
acid. In certain embodiments, the DNM2 nucleic acid has the
sequence set forth in RefSeq or GenBank Accession No. NC_000019.10
truncated from nucleosides 10715001 to Ser. No. 10/835,000
(disclosed herein as SEQ ID NO: 1), NM_004945.3 (disclosed herein
as SEQ ID NO: 2), NM_001005361.2 (disclosed herein as SEQ ID NO:
3), or NM_001005360.2 (disclosed herein as SEQ ID NO: 3135). In
certain embodiments, the compound is an antisense compound or
oligomeric compound. In certain embodiments, the compound is
single-stranded. In certain embodiments, the compound is
double-stranded.
[0116] Certain embodiments provide a compound comprising a modified
oligonucleotide 8 to 50 linked nucleosides in length and having a
nucleobase sequence comprising at least 8 contiguous nucleobases of
any of the nucleobase sequences of SEQ ID NOs: 7-3134 or of any
sequence having at least about 70% identity with any of the
nucleobase sequences of SEQ ID NOs: 7-3134, such as, for example,
at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99% identity or more with any of the nucleobase sequences
of SEQ ID NOs: 7-3134.
[0117] As used herein, the term "identity" refers to the subunit
sequence identity between two nucleic acid molecules, such as, two
DNA molecules or two RNA molecules. When a subunit position in both
of the two molecules is occupied by the same monomeric subunit;
e.g., if a position in each of two DNA molecules is occupied by
adenine, then they are identical (or homologous) at that position.
The homology between two sequences is a direct function of the
number of matching or homologous positions; e.g., if half (e.g.,
five positions in a polymer ten subunits in length) of the
positions in two sequences are homologous, the two sequences are
50% homologous; if 90% of the positions (e.g., 9 of 10), are
matched or homologous, the two sequences are 90% homologous. Thus,
the term "homologous" or "identical", when used in a relationship
between the sequences of two or more nucleic acid molecules, refers
to the degree of sequence relatedness between nucleic acid
molecules, as determined by the number of matches between strings
of two or more nucleotide residues. "Identity" measures the percent
of identical matches between the smaller of two or more sequences
with gap alignments (if any) addressed by a particular mathematical
model or computer program (i.e., "algorithms"). Identity of related
polypeptides can be readily calculated by known methods. Such
methods include, but are not limited to, those described in
Computational Molecular Biology, Lesk, A. M., ed., Oxford
University Press, New York, 1988; Biocomputing: Informatics and
Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993;
Computer Analysis of Sequence Data, Part 1, Griffin, A. M., and
Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence
Analysis in Molecular Biology, von Heinje, G., Academic Press,
1987; Sequence Analysis Primer, Gribskov, M. and Devereux, J.,
eds., M. Stockton Press, New York, 1991; and Carillo et al., SIAM
J. Applied Math. 48, 1073 (1988). Preferred methods for determining
identity are designed to give the largest match between the
sequences tested. Methods of determining identity are described in
publicly available computer programs. Preferred computer program
methods for determining identity between two sequences include the
GCG program package, including GAP (Devereux et al., Nucl. Acid.
Res. 2, 387 (1984); Genetics Computer Group, University of
Wisconsin, Madison, Wis.), BLASTP, BLASTN, and FASTA (Altschul et
al., J. MoI. Biol. 215, 403-410 (1990)). The BLASTX program is
publicly available from the National Center for Biotechnology
Information (NCBI) and other sources (BLAST Manual, Altschul et al.
NCB/NLM/NIH Bethesda, Md. 20894; Altschul et al., supra). The
well-known Smith Waterman algorithm may also be used to determine
identity.
[0118] In certain embodiments, the compound is an antisense
compound or oligomeric compound. In certain embodiments, the
compound is single-stranded. In certain embodiments, the compound
is double-stranded. In certain embodiments, the modified
oligonucleotide is 10 to 30 linked nucleosides in length.
[0119] Certain embodiments provide a compound comprising a modified
oligonucleotide 8 to 50 linked nucleosides in length and having a
nucleobase sequence comprising at least 8 contiguous nucleobases of
any of the nucleobase sequences of SEQ ID NOs: 2879, 3056, 2123,
2189, 2453, 2160, or 2232 or at least 8 contiguous nucleobases of a
sequence having at least 70% identity with any of the nucleobase
sequences of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or
2232. In certain embodiments, the nucleobase sequence of the
modified oligonucleotide comprises or consists of SEQ ID NO: 2879
or a sequence having at least 70% identity with SEQ ID NO: 2879. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide comprises or consists of SEQ ID NO: 3056 or a
sequence having at least 70% identity with SEQ ID NO: 3056. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide comprises or consists of SEQ ID NO: 2123 or a
sequence having at least 70% identity with SEQ ID NO: 2123. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide comprises or consists of SEQ ID NO: 2189 or a
sequence having at least 70% identity with SEQ ID NO: 2189. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide comprises or consists of SEQ ID NO: 2453 or a
sequence having at least 70% identity with SEQ ID NO: 2453. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide comprises or consists of SEQ ID NO: 2160 or a
sequence having at least 70% identity with SEQ ID NO: 2160. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide comprises or consists of SEQ ID NO: 2232 or a
sequence having at least 70% identity with SEQ ID NO: 2232. In
certain embodiments, the compound is an antisense compound or
oligomeric compound. In certain embodiments, the compound is
single-stranded. In certain embodiments, the compound is
double-stranded. In certain embodiments, the modified
oligonucleotide is 10 to 30 linked nucleosides in length. In
certain embodiments, the modified oligonucleotide has a nucleobase
sequence comprising at least 12 contiguous nucleobases of any of
SEQ ID Numbers from 7 to 3134 or of any sequence having at least
about 70% identity with any of the nucleobase sequences of SEQ ID
NOs: 7-3134, such as, for example, at least about 75%, 80%, 85%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity or more
with any of the nucleobase sequences of SEQ ID NOs: 7-3134.
[0120] Certain embodiments provide a compound comprising a modified
oligonucleotide 10 to 50 linked nucleosides in length and having a
nucleobase sequence comprising at least 10 contiguous nucleobases
of any of the nucleobase sequences of SEQ ID NOs: 7-3134 or of any
sequence having at least about 70% identity with any of the
nucleobase sequences of SEQ ID NOs: 7-3134, such as, for example,
at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99% identity or more with any of the nucleobase sequences
of SEQ ID NOs: 7-3134. In certain embodiments, the compound is an
antisense compound or oligomeric compound. In certain embodiments,
the compound is single-stranded. In certain embodiments, the
compound is double-stranded. In certain embodiments, the modified
oligonucleotide is 10 to 30 linked nucleosides in length.
[0121] Certain embodiments provide a compound comprising a modified
oligonucleotide 11 to 50 linked nucleosides in length and having a
nucleobase sequence comprising at least 11 contiguous nucleobases
of any of the nucleobase sequences of SEQ ID NOs: 7-3134 or of any
sequence having at least about 70% identity with any of the
nucleobase sequences of SEQ ID NOs: 7-3134, such as, for example,
at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99% identity or more with any of the nucleobase sequences
of SEQ ID NOs: 7-3134. In certain embodiments, the compound is an
antisense compound or oligomeric compound. In certain embodiments,
the compound is single-stranded. In certain embodiments, the
compound is double-stranded. In certain embodiments, the modified
oligonucleotide is 11 to 30 linked nucleosides in length.
[0122] Certain embodiments provide a compound comprising a modified
oligonucleotide 12 to 50 linked nucleosides in length and having a
nucleobase sequence comprising at least 12 contiguous nucleobases
of any of the nucleobase sequences of SEQ ID NOs: 7-3134 or of any
sequence having at least about 70% identity with any of the
nucleobase sequences of SEQ ID NOs: 7-3134, such as, for example,
at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99% identity or more with any of the nucleobase sequences
of SEQ ID NOs: 7-3134. In certain embodiments, the compound is an
antisense compound or oligomeric compound. In certain embodiments,
the compound is single-stranded. In certain embodiments, the
compound is double-stranded. In certain embodiments, the modified
oligonucleotide is 12 to 30 linked nucleosides in length.
[0123] In certain embodiments, the compound comprises a modified
oligonucleotide 16 linked nucleosides in length. In certain
embodiments, the compound is an antisense compound or oligomeric
compound.
[0124] Certain embodiments provide a compound comprising a modified
oligonucleotide 16 to 50 linked nucleosides in length and having a
nucleobase sequence comprising the nucleobase sequence of any one
of SEQ ID NOs: 7-3134 or of any sequence having at least about 70%
identity with any of the nucleobase sequences of SEQ ID NOs:
7-3134, such as, for example, at least about 75%, 80%, 85%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity or more with
any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain
embodiments, the compound is an antisense compound or oligomeric
compound. In certain embodiments, the compound is single-stranded.
In certain embodiments, the compound is double-stranded. In certain
embodiments, the modified oligonucleotide is 16 to 30 linked
nucleosides in length.
[0125] Certain embodiments provide a compound comprising a modified
oligonucleotide consisting of the nucleobase sequence of any one of
SEQ ID NOs: 7-3134 or of any sequence having at least about 70%
identity with any of the nucleobase sequences of SEQ ID NOs:
7-3134, such as, for example, at least about 75%, 80%, 85%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity or more with
any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain
embodiments, the compound is an antisense compound or oligomeric
compound. In certain embodiments, the compound is single-stranded.
In certain embodiments, the compound is double-stranded.
[0126] In certain embodiments, compounds comprise or consist of
modified oligonucleotides complementary to an intron of a DNM2
nucleic acid transcript. In certain embodiments, modified
oligonucleotides are complementary to intron 1, intron 2, intron 3,
intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron
9-10a, intron 10, intron 10a-11, intron 11, intron 12, intron 13,
intron 14, intron 15, intron 16, intron 17, intron 18, intron 19,
or intron 19-20a of a DNM2 nucleic acid transcript. In certain such
embodiments, modified oligonucleotides are complementary to a
sequence within nucleotides 3404-44,737; 44,812-57,478;
57,629-60,702; 60,907-62,117; 62,217-67,959; 68,121-71,563;
71,707-78,719; 78,856-80,371; 80,440-81,060; 80,440-82,379;
81,200-83,485; 82,519-83,485; 83,573-87,287; 87,359-90,915;
90,968-97,263; 97,378-104,979; 105,090-108,787; 108,990-110,056;
110,222-114,035; 114,269-115,126; 115,379-115,977; or
115,379-115,980 of SEQ ID NO: 1. In certain embodiments, compounds
comprise or consist of oligonucleotides having at least an 8, 9,
10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion
complementary to an equal length portion of intron 1, intron 2,
intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron
9, intron 9-10a, intron 10, intron 10a-11, intron 11, intron 12,
intron 13, intron 14, intron 15, intron 16, intron 17, intron 18,
intron 19, or intron 19-20a of a DNM2 nucleic acid transcript. In
certain embodiments, such oligonucleotides have at least an 8, 9,
10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion
complementary to an equal length portion within nucleotides
3404-44,737; 44,812-57,478; 57,629-60,702; 60,907-62,117;
62,217-67,959; 68,121-71,563; 71,707-78,719; 78,856-80,371;
80,440-81,060; 80,440-82,379; 81,200-83,485; 82,519-83,485;
83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979;
105,090-108,787; 108,990-110,056; 110,222-114,035; 114,269-115,126;
115,379-115,977; or 115,379-115,980 of SEQ ID NO: 1. In certain
embodiments, these compounds are antisense compounds or oligomeric
compounds. Compounds comprising a modified oligonucleotide
complementary to certain introns of a DNM2 nucleic acid transcript,
e.g., intron 1, intron 11, intron 12, intron 13, or intron 14 of a
DNM2 pre-mRNA, are generally especially potent and tolerable. Thus,
such certain introns can be considered hot spot regions for
targeting a DNM2 nucleic acid transcript.
[0127] In certain embodiments, compounds comprise or consist of
modified oligonucleotides complementary to intron 1, intron 11,
intron 12, intron 13, intron 14, exon 10, or the 3'-UTR of a DNM2
nucleic acid transcript. In certain embodiments, modified
oligonucleotides are complementary to a sequence within nucleotides
3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263;
97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1.
In certain embodiments, compounds comprise or consist of
oligonucleotides having at least an 8, 9, 10, 11, 12, 13, 14, 15,
or 16 contiguous nucleobase portion complementary to an equal
length portion of intron 1, intron 11, intron 12, intron 13, intron
14, exon 10, or the 3'-UTR of a DNM2 nucleic acid transcript.
[0128] In certain embodiments, such oligonucleotides have at least
an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase
portion complementary to an equal length portion within nucleotides
3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263;
97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1.
In certain embodiments, these compounds are antisense compounds or
oligomeric compounds.
[0129] In certain embodiments, a compound comprises a modified
oligonucleotide 8 to 50 linked nucleosides in length and having at
least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase
portion complementary to an equal length portion within nucleotides
3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263;
97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1.
In certain embodiments, the modified oligonucleotide is 10 to 30
linked nucleosides in length.
[0130] In certain embodiments, compounds comprise or consist of
modified oligonucleotides complementary to intron 1, intron 11,
intron 12, intron 13, or intron 14 of a DNM2 nucleic acid
transcript. In certain embodiments, modified oligonucleotides are
complementary to a sequence within nucleotides 3,404-44,737;
83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of
SEQ ID NO: 1. In certain embodiments, compounds comprise or consist
of oligonucleotides having at least an 8, 9, 10, 11, 12, 13, 14,
15, or 16 contiguous nucleobase portion complementary to an equal
length portion of intron 1, intron 11, intron 12, intron 13, or
intron 14 of a DNM2 nucleic acid transcript. In certain
embodiments, such oligonucleotides have at least an 8, 9, 10, 11,
12, 13, 14, 15, or 16 contiguous nucleobase portion complementary
to an equal length portion within nucleotides 3,404-44,737;
83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of
SEQ ID NO: 1. In certain embodiments, these compounds are antisense
compounds or oligomeric compounds.
[0131] In certain embodiments, a compound comprises a modified
oligonucleotide 8 to 50 linked nucleosides in length and having at
least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase
portion complementary to an equal length portion within nucleotides
3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; or
97,378-104,979; of SEQ ID NO: 1. In certain embodiments, the
modified oligonucleotide is 10 to 30 linked nucleosides in
length.
[0132] In certain embodiments, a compound comprises a modified
oligonucleotide 8 to 50 linked nucleosides in length and
complementary within nucleotides 89,722-89,737; 83,880-83,895;
90,081-90,096; 94,450-94,465; 11,960-11,975; 93,322-93,337; or
97,855-97,870 of SEQ ID NO: 1. In certain embodiments, the modified
oligonucleotide is 10 to 30 linked nucleosides in length.
[0133] In certain embodiments, a compound comprises a modified
oligonucleotide 8 to 50 linked nucleosides in length and having a
nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13,
14, 15, or 16 contiguous nucleobase portion of the nucleobase
sequence of any one of compound numbers 951799, 949935, 950023,
950089, 951372, 950060, or 950132 (SEQ ID NOs: 2879, 3056, 2123,
2189, 2453, 2160, or 2232). In certain embodiments, the modified
oligonucleotide is 10 to 30 linked nucleosides in length. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide comprises or consists of SEQ ID NO: 2879 or of a
sequence having at least 70% identity with SEQ ID NO: 2879. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide comprises or consists of SEQ ID NO: 3056 or of a
sequence having at least 70% identity with SEQ ID NO: 3056. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide comprises or consists of SEQ ID NO: 2123 or of a
sequence having at least 70% identity with SEQ ID NO: 2123. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide comprises or consists of SEQ ID NO: 2189 or of a
sequence having at least 70% identity with SEQ ID NO: 2189. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide comprises or consists of SEQ ID NO: 2453 or of a
sequence having at least 70% identity with SEQ ID NO: 2453. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide comprises or consists of SEQ ID NO: 2160 or of a
sequence having at least 70% identity with SEQ ID NO: 2160. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide comprises or consists of SEQ ID NO: 2232 or of a
sequence having at least 70% identity with SEQ ID NO: 2232.
[0134] In certain embodiments, a compound comprises or consists of
a modified oligonucleotide 8 to 50 linked nucleosides in length and
having a nucleobase sequence comprising the nucleobase sequence of
any one of compound numbers 951799, 949935, 950023, 950089, 951372,
950060, or 950132 (SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160,
or 2232). In certain embodiments, the modified oligonucleotide is
10 to 30 linked nucleosides in length.
[0135] In certain embodiments, a compound comprises or consists of
a modified oligonucleotide having a nucleobase sequence consisting
of the nucleobase sequence of any one of compound numbers 951799,
949935, 950023, 950089, 951372, 950060, or 950132 (SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232). In certain
embodiments, a compound comprises or consists of a modified
oligonucleotide 8 to 50 linked nucleosides in length and having a
nucleobase sequence comprising the nucleobase sequence of the
compound number 951799 (SEQ ID NO: 2879). In certain embodiments,
the modified oligonucleotide is 10 to 30 linked nucleosides in
length.
[0136] In certain embodiments, a compound comprising or consisting
of a modified oligonucleotide complementary to DNM2 is compound
number 951799. Out of the over 3,000 compounds that were screened
as described in the Examples section below, compound numbers
951799, 949935, 950023, 950089, 951372, 950060, and 950132 emerged
as the top lead compounds. In particular, compound number 951799
exhibited the best combination of properties in terms of potency
and tolerability out of over 3,000 compounds.
[0137] In certain embodiments, any of the foregoing
oligonucleotides is a modified oligonucleotide comprising at least
one modified internucleoside linkage, at least one modified sugar,
and/or at least one modified nucleobase.
[0138] In certain embodiments, any of the foregoing modified
oligonucleotides comprises at least one modified sugar. In certain
embodiments, at least one modified sugar is a bicyclic sugar, such
as a cEt bicyclic sugar, an LNA bicyclic sugar, or an ENA bicyclic
sugar.
[0139] In certain embodiments, the modified oligonucleotide
comprises at least one modified internucleoside linkage, such as a
phosphorothioate internucleoside linkage.
[0140] In certain embodiments, any of the foregoing modified
oligonucleotides comprises at least one modified nucleobase, such
as 5-methylcytosine.
[0141] In certain embodiments, any of the foregoing modified
oligonucleotides comprises: [0142] a gap segment consisting of
linked 2'-deoxynucleosides; [0143] a 5' wing segment consisting of
linked nucleosides; and [0144] a 3' wing segment consisting of
linked nucleosides;
[0145] wherein the gap segment is positioned between the 5' wing
segment and the 3' wing segment and wherein each nucleoside of each
wing segment comprises a modified sugar. In certain embodiments,
the modified oligonucleotide is 16 to 50 linked nucleosides in
length having a nucleobase sequence comprising the sequence recited
in anyone of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or
2232 or a sequence having at least 70% identity with any one of SEQ
ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain
embodiments, the modified oligonucleotide is 16 to 50 linked
nucleosides in length having a nucleobase sequence comprising the
sequence recited in SEQ ID NO: 2879 or a sequence having at least
70% identity with SEQ ID NO: 2879. In certain embodiments, the
modified oligonucleotide is 10 to 30 linked nucleosides in length
having a nucleobase sequence comprising the sequence recited in any
one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232 or a
sequence having at least 70% identity with any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain
embodiments, the modified oligonucleotide is 10 to 30 linked
nucleosides in length having a nucleobase sequence comprising the
sequence recited in SEQ ID NO: 2879 or a sequence having at least
70% identity with SEQ ID NO: 2879. In certain embodiments, the
modified oligonucleotide is 16 linked nucleosides in length having
a nucleobase sequence consisting of the sequence recited in any one
of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232 or a
sequence having at least 70% identity with any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain
embodiments, the modified oligonucleotide is 16 linked nucleosides
in length having a nucleobase sequence consisting of the sequence
recited in SEQ ID NO: 2879 or a sequence having at least 70%
identity with SEQ ID NO: 2879.
[0146] In certain embodiments, a compound comprises or consists of
a modified oligonucleotide 20-50 linked nucleobases in length
having a nucleobase sequence comprising the sequence recited in any
one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232 or a
sequence having at least 70% identity with any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232, wherein the modified
oligonucleotide comprises
[0147] a gap segment consisting often linked
2'-deoxynucleosides;
[0148] a 5' wing segment consisting of three linked nucleosides;
and
[0149] a 3' wing segment consisting of three linked
nucleosides;
[0150] wherein the gap segment is positioned between the 5' wing
segment and the 3' wing segment; wherein the nucleosides of the 5'
wing segment each comprise a cEt bicyclic sugar; wherein the
nucleosides of the 3' wing segment each comprises a cEt bicyclic
sugar; wherein each internucleoside linkage is a phosphorothioate
linkage; and wherein each cytosine is a 5-methylcytosine. In
certain embodiments, the modified oligonucleotide is 16-80 linked
nucleosides in length. In certain embodiments, the modified
oligonucleotide is 16-30 linked nucleosides in length. In certain
embodiments, the modified oligonucleotide is 16 linked nucleosides
in length.
[0151] In certain embodiments, a compound comprises or consists of
a modified oligonucleotide according to one of the following
formulas:
TABLE-US-00001 (SEQ ID NO: 2879) Gks Tks Tks Tds Ads Tds Tds Ads
Tds Ads Gds Gds Gds mCks Tks Tk; (SEQ ID NO: 3056) Gks Gks Aks Tds
Tds Tds Tds Ads Gds Gds Ads Gds Gds Tks Gks Ak; (SEQ ID NO: 2123)
Gks mCks Aks Tds Ads Gds Ads mCds Ads Ads Ads Tds mCds mCks mCks
Ak; (SEQ ID NO: 2189) Gks mCks Aks Ads Ads Tds Ads Tds Gds Ads Tds
Tds mCds Aks Tks mCk; (SEQ ID NO: 2453) Gks Gks Tks mCds Ads Tds
Tds Ads Ads Ads Gds Ads Tds Tks mCks Tk; (SEQ ID NO: 2160) Aks Tks
Gks Tds Ads Tds Tds Ads mCds mCds Tds Ads mCds Gks Gks mCk; or (SEQ
ID NO: 2232) Gks Tks Aks mCds Ads Ads Tds Gds Tds Ads Ads Gds mCds
mCks Tks Tk
wherein A=an adenine, mC=a 5-methylcytosine, G=a guanine, T=a
thymine, k=a cEt sugar moiety, d=a 2'-deoxyribosyl sugar moiety,
and s=a phosphorothioate internucleoside linkage.
[0152] In certain embodiments, a compound comprises or consists of
compound 951799, or salt thereof, a modified oligonucleotide having
the following chemical structure:
##STR00002##
[0153] In certain embodiments, a compound comprises or consists of
the sodium salt of compound 951799 having the following chemical
structure:
##STR00003##
[0154] In any of the foregoing embodiments, the compound or
oligonucleotide can be at least 85%, at least 90%, at least 95%, at
least 98%, at least 99%, or 100% complementary to a nucleic acid
encoding DNM2.
[0155] In any of the foregoing embodiments, the compound can be
single-stranded. In certain embodiments, the compound comprises
2'-deoxyribonucleosides. In certain embodiments, the compound is
double-stranded. In certain embodiments, the compound is
double-stranded and comprises ribonucleosides. In any of the
foregoing embodiments, the compound can be an antisense compound or
oligomeric compound.
[0156] In any of the foregoing embodiments, the compound can be 8
to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50,
15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to
22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or
20 to 30 linked nucleosides in length. In certain embodiments, the
compound comprises or consists of an oligonucleotide.
[0157] The present invention thus relates to a modified
oligonucleotide or compounds comprising modified oligonucleotides
complementary to a DNM2 nucleic acid as described hereinabove.
[0158] In certain embodiments, a compound comprises a modified
oligonucleotide described herein and a conjugate group. In certain
embodiments, the conjugate group is linked to the modified
oligonucleotide at the 5' end of the modified oligonucleotide. In
certain embodiments, the conjugate group is linked to the modified
oligonucleotide at the 3' end of the modified oligonucleotide.
[0159] In certain embodiments, compounds or compositions provided
herein comprise a salt of the modified oligonucleotide. In certain
embodiments, the salt is a sodium salt. In certain embodiments, the
salt is a potassium salt.
[0160] In certain embodiments, the compounds or compositions as
described herein are active by virtue of having at least one of an
in vitro IC.sub.50 of less than 300 nM, 200 nM, 100 nM, 80 nM, 50
nM, or 30 nM in a standard cell assay. Standard cell assays are
described in the Examples.
[0161] In certain embodiments, the compounds or compositions as
described herein are highly tolerable as demonstrated by having at
least one of an increase an alanine transaminase (ALT) or aspartate
transaminase (AST) value of no more than 4 fold, 3 fold, 2 fold, or
1.5 fold over saline treated animals or an increase in liver,
spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%,
5%, or 2% compared to control treated animals. In certain
embodiments, the compounds or compositions as described herein are
highly tolerable as demonstrated by having no increase of ALT or
AST over control treated animals. In certain embodiments, the
compounds or compositions as described herein are highly tolerable
as demonstrated by having no increase in liver, spleen, or kidney
weight over control animals.
[0162] Certain embodiments provide a composition comprising or
consisting essentially of the compound of any of the aforementioned
embodiments or salt thereof.
[0163] Certain embodiments provide a composition comprising or
consisting essentially of the compound of any of the aforementioned
embodiments or salt thereof and at least one of a pharmaceutically
acceptable carrier or diluent. Therefore, in one embodiment, the
composition of the invention is a pharmaceutical composition.
[0164] Certain embodiments provide a medicament comprising or
consisting essentially of the compound of any of the aforementioned
embodiments or salt thereof. Therefore, in one embodiment, the
composition of the invention is a medicament.
[0165] As used herein, the term "consists essentially of", with
reference to a composition, pharmaceutical composition or
medicament, means that the compound of the invention is the only
active ingredient, therapeutic agent or agent with a biologic
activity within said pharmaceutical composition or medicament.
[0166] In certain embodiments, the composition has a viscosity less
than about 40 centipoise (cP), less than about 30 cP, less than
about 20 cP, less than about 15 cP, less than about 10 cP, less
than about 5 cP, or less than about 3 cP, or less than about 1.5
cP. In certain embodiments, the composition having any of the
aforementioned viscosities comprises a compound provided herein at
a concentration of about 15 mg/mL, 20 mg/mL, 25 mg/mL, 50 mg/mL,
100 mg/mL, 150 mg/mL, or about 200 mg/mL. In certain embodiments,
the composition having any of the aforementioned viscosities and/or
compound concentrations has a temperature of room temperature or
about 20.degree. C., about 21.degree. C., about 22.degree. C.,
about 23.degree. C., about 24.degree. C., about 25.degree. C.,
about 26.degree. C., about 27.degree. C., about 28.degree. C.,
about 29.degree. C., or about 30.degree. C.
[0167] Embodiment 1. A compound comprising a modified
oligonucleotide 8 to 50 linked nucleosides in length having a
nucleobase sequence comprising at least 8 contiguous nucleobases of
any of the nucleobase sequences of SEQ ID NOs: 7-3134.
[0168] Embodiment 2. A compound comprising a modified
oligonucleotide 9 to 50 linked nucleosides in length having a
nucleobase sequence comprising at least 9 contiguous nucleobases of
any of the nucleobase sequences of SEQ ID NOs: 7-3134.
[0169] Embodiment 3. A compound comprising a modified
oligonucleotide 10 to 50 linked nucleosides in length having a
nucleobase sequence comprising at least 10 contiguous nucleobases
of any of the nucleobase sequences of SEQ ID NOs: 7-3134.
[0170] Embodiment 4. A compound comprising a modified
oligonucleotide 11 to 50 linked nucleosides in length having a
nucleobase sequence comprising at least 11 contiguous nucleobases
of any of the nucleobase sequences of SEQ ID NOs: 7-3134.
[0171] Embodiment 5. A compound comprising a modified
oligonucleotide 12 to 50 linked nucleosides in length having a
nucleobase sequence comprising at least 12, at least 13, at least
14, or at least 15 contiguous nucleobases of any of the nucleobase
sequences of SEQ ID NOs: 7-3134.
[0172] Embodiment 6. A compound comprising a modified
oligonucleotide 16 to 50 linked nucleosides in length having a
nucleobase sequence comprising the nucleobase sequence of any of
SEQ ID NOs: 7-3134.
[0173] Embodiment 7. A compound comprising a modified
oligonucleotide having a nucleobase sequence consisting of any one
of SEQ ID NOs: 7-3134.
[0174] Embodiment 8. A compound comprising a modified
oligonucleotide 8 to 50 linked nucleosides in length complementary
within nucleobases 3,404-44,737; 83,573-87,287; 87,359-90,915;
90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of
SEQ ID NO: 1, wherein said modified oligonucleotide is at least
85%, 90%, 95%, or 100% complementary to SEQ ID NO: 1.
[0175] Embodiment 9. A compound comprising a modified
oligonucleotide 8 to 50 linked nucleosides in length having a
nucleobase sequence comprising a portion of at least 8 contiguous
nucleobases 100% complementary to an equal length portion of
nucleobases 3,404-44,737; 83,573-87,287; 87,359-90,915;
90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of
SEQ ID NO: 1, wherein the nucleobase sequence of the modified
oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to
SEQ ID NO: 1.
[0176] Embodiment 10. A compound comprising a modified
oligonucleotide 8 to 50 linked nucleosides in length complementary
within nucleobases 83,573-87,287 or 87,359-90,915 of SEQ ID NO: 1,
wherein said modified oligonucleotide is at least 85%, 90%, 95%, or
100% complementary to SEQ ID NO: 1.
[0177] Embodiment 11. A compound comprising a modified
oligonucleotide complementary to intron 1 of a human DNM2
pre-mRNA.
[0178] Embodiment 12. A compound comprising a modified
oligonucleotide complementary to intron 11 of a human DNM2
pre-mRNA.
[0179] Embodiment 13. A compound comprising a modified
oligonucleotide complementary to intron 12 of a human DNM2
pre-mRNA.
[0180] Embodiment 14. A compound comprising a modified
oligonucleotide complementary to intron 13 of a human DNM2
pre-mRNA.
[0181] Embodiment 15. A compound comprising a modified
oligonucleotide complementary to intron 14 of a human DNM2
pre-mRNA.
[0182] Embodiment 16. A compound comprising a modified
oligonucleotide complementary to exon 10 of a human DNM2 pre-mRNA
or human DNM2 mRNA.
[0183] Embodiment 17. A compound comprising a modified
oligonucleotide complementary to the 3'-UTR of a human DNM2
pre-mRNA or human DNM2 mRNA.
[0184] Embodiment 18. A compound comprising a modified
oligonucleotide 16 to 50 linked nucleosides in length having a
nucleobase sequence comprising any of SEQ ID NOs: 2879, 3056, 2123,
2189, 2453, 2160, or 2232.
[0185] Embodiment 19. A compound comprising a modified
oligonucleotide having a nucleobase sequence consisting of any one
of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232.
[0186] Embodiment 20. A compound comprising a modified
oligonucleotide having a nucleobase sequence comprising SEQ ID NO:
2879.
[0187] Embodiment 21. A compound comprising a modified
oligonucleotide 16 to 50 linked nucleosides in length having a
nucleobase sequence comprising any of SEQ ID NOs: 2879, 3056, 2123,
2189, 2453, 2160, or 2232, wherein the modified oligonucleotide
comprises: a gap segment consisting of 8-12 linked
2'-deoxynucleosides; a 5' wing segment consisting of 1-7 linked
nucleosides; and a 3' wing segment consisting of 1-7 linked
nucleosides; wherein the gap segment is positioned between the 5'
wing segment and the 3' wing segment and wherein each terminal wing
nucleoside comprises a modified sugar.
[0188] Embodiment 22. A compound comprising a modified
oligonucleotide 16 linked nucleosides in length having a nucleobase
sequence consisting of the sequence recited in SEQ ID NO: 2879,
3056, 2123, 2189, 2453, 2160, or 2232, wherein the modified
oligonucleotide comprises [0189] a gap segment consisting of 10
linked 2'-deoxynucleosides; [0190] a 5' wing segment consisting of
3 linked nucleosides; and [0191] a 3' wing segment consisting of 3
linked nucleosides; [0192] wherein the gap segment is positioned
between the 5' wing segment and the 3' wing segment; wherein each
nucleoside of each wing segment comprises a cEt sugar moiety;
wherein each internucleoside linkage is a phosphorothioate linkage;
and wherein each cytosine is a 5-methylcytosine.
[0193] Embodiment 23. The compound of any one of embodiments 1-22,
wherein the oligonucleotide is at least 80%, 85%, 90%, 95% or 100%
complementary to any of SEQ ID NO: 1, 2, 3, or 3135.
[0194] Embodiment 24. The compound of any one of embodiments 1-23,
wherein the modified oligonucleotide comprises at least one
modified internucleoside linkage.
[0195] Embodiment 25. The compound of embodiments 24, wherein the
at least one modified internucleoside linkage is a phosphorothioate
internucleoside linkage.
[0196] Embodiment 26. The compound of any one of embodiments 1-21
or 23-25, wherein the modified oligonucleotide comprises at least
one bicyclic sugar.
[0197] Embodiment 27. The compound of Embodiments 26, wherein the
at least one bicyclic sugar is selected from the group consisting
of LNA, ENA, and cEt.
[0198] Embodiment 28. The compound of embodiment 27, wherein the at
least one bicyclic sugar moiety is a cEt sugar moiety.
[0199] Embodiment 29. The compound of any one of embodiments 1-28,
wherein the modified oligonucleotide comprises at least one
5-methylcytosine.
[0200] Embodiment 30. The compound of any one of embodiments 1-29,
wherein the modified oligonucleotide comprises:
[0201] a gap segment consisting of linked 2'-deoxynucleosides;
[0202] a 5' wing segment consisting of linked nucleosides; and
[0203] a 3' wing segment consisting of linked nucleosides;
[0204] wherein the gap segment is positioned immediately adjacent
to and between the 5' wing segment and the 3' wing segment and
wherein each nucleoside of each wing segment comprises a modified
sugar moiety.
[0205] Embodiment 31. The compound of any one of embodiments 1-30,
wherein the compound is single-stranded.
[0206] Embodiment 32. The compound of any one of embodiments 1-30,
wherein the compound is double-stranded.
[0207] Embodiment 33. The compound of any one of embodiments 1-32,
wherein the compound comprises at least one unmodified ribosyl
sugar moiety.
[0208] Embodiment 34. The compound of any one of embodiments 1-33,
wherein the compound comprises at least one unmodified
2'-deoxyribosyl sugar moiety.
[0209] Embodiment 35. The compound of any one of embodiments 1-34,
wherein the modified oligonucleotide consists of 10 to 30 linked
nucleosides.
[0210] Embodiment 36. The compound of any one of embodiments 1-34,
wherein the modified oligonucleotide consists of 12 to 30 linked
nucleosides.
[0211] Embodiment 37. The compound of any one of embodiments 1-34,
wherein the modified oligonucleotide consists of 15 to 30 linked
nucleosides.
[0212] Embodiment 38. The compound of any one of embodiments 1-34,
wherein the modified oligonucleotide consists of 16 to 20 linked
nucleosides.
[0213] Embodiment 39. A compound comprising a modified
oligonucleotide according to the following formula: Gks Tks Tks Tds
Ads Tds Tds Ads Tds Ads Gds Gds Gds mCks Tks Tk; wherein, [0214]
A=an adenine, [0215] mC=a 5-methylcytosine [0216] G=a guanine,
[0217] T=a thymine, [0218] k=a cEt sugar moiety, [0219] d=a
2'-deoxyribosyl sugar moiety, and [0220] s=a phosphorothioate
internucleoside linkage.
[0221] Embodiment 40. The compound of any one of embodiments 1-39
comprising a conjugate group.
[0222] Embodiment 41. The compound of embodiment 40, wherein the
compound consists of the modified oligonucleotide and the conjugate
group.
[0223] Embodiment 42. A compound according to the following
formula:
##STR00004##
[0224] Embodiment 43. The compound of any one of embodiments 1-39
or 42, wherein the compound
[0225] consists of the
modified oligonucleotide.
[0226] Embodiment 44. A compound consisting of a pharmaceutically
acceptable salt form of any one of the compounds of embodiments
1-43.
[0227] Embodiment 45. The compound of embodiment 44, wherein the
pharmaceutically acceptable salt is a sodium salt.
[0228] Embodiment 46. The compound of embodiment 44, wherein the
pharmaceutically acceptable salt is a potassium salt.
[0229] Embodiment 47. A pharmaceutical composition comprising the
compound of any one of embodiments 1-44 and at least one
pharmaceutically acceptable carrier or diluent.
[0230] Embodiment 48. A chirally enriched population of the
compounds of any one of embodiments 1-46, wherein the population is
enriched for modified oligonucleotides comprising at least one
particular phosphorothioate internucleoside linkage having a
particular stereochemical configuration.
[0231] Embodiment 49. The chirally enriched population of
embodiment 48, wherein the population is enriched for modified
oligonucleotides comprising at least one particular
phosphorothioate internucleoside linkage having the (Sp)
configuration.
[0232] Embodiment 50. The chirally enriched population of
embodiment 48, wherein the population is enriched for modified
oligonucleotides comprising at least one particular
phosphorothioate internucleoside linkage having the (Rp)
configuration.
[0233] Embodiment 51. The chirally enriched population of
embodiment 48, wherein the population is enriched for modified
oligonucleotides having a particular, independently selected
stereochemical configuration at each phosphorothioate
internucleoside linkage
[0234] Embodiment 52. The chirally enriched population of
embodiment 51, wherein the population is enriched for modified
oligonucleotides having the (Sp) configuration at each
phosphorothioate internucleoside linkage.
[0235] Embodiment 53. The chirally enriched population of
embodiment 51, wherein the population is enriched for modified
oligonucleotides having the (Rp) configuration at each
phosphorothioate internucleoside linkage.
[0236] Embodiment 54. The chirally enriched population of
embodiment 51, wherein the population is enriched for modified
oligonucleotides having the (Rp) configuration at one particular
phosphorothioate internucleoside linkage and the (Sp) configuration
at each of the remaining phosphorothioate internucleoside
linkages.
[0237] Embodiment 55. The chirally enriched population of
embodiment 48 or embodiment 51, wherein the population is enriched
for modified oligonucleotides having at least 3 contiguous
phosphorothioate internucleoside linkages in the Sp, Sp, and Rp
configurations, in the 5' to 3' direction.
[0238] Embodiment 56. A chirally enriched population of the
compounds of any one of embodiments 1-46, wherein all of the
phosphorothioate internucleoside linkages of the modified
oligonucleotide are stereorandom.
[0239] Embodiment 57. A pharmaceutical composition comprising the
population of compounds of any one of embodiments 48-56 and at
least one pharmaceutically acceptable diluent or carrier.
[0240] Embodiment 58. The compound of any one of embodiments 1-46,
a pharmaceutical composition comprising the compound of any one of
embodiments 1-46 and at least one pharmaceutically acceptable
carrier or diluent, or a pharmaceutical composition comprising the
population of compounds of any one of embodiments 48-56 and at
least one pharmaceutically acceptable carrier or diluent, for use
in therapy.
[0241] Embodiment 59. The compound or composition of embodiment 58,
for use in treating, preventing, or ameliorating centronuclear
myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth
disease.
[0242] Embodiment 60. A method of treating, preventing, or
ameliorating a disease associated with DNM2 in an individual
comprising administering to the individual any of the compounds or
compositions of embodiment 1-59, thereby treating, preventing, or
ameliorating the disease.
[0243] Embodiment 61. A method of treating, preventing, or
ameliorating a disease associated with DNM2 in an individual
comprising administering to the individual a compound comprising a
modified oligonucleotide 100% complementary to an exon 10, an
intron, or the 3'-UTR of a DNM2 nucleic acid transcript, thereby
treating, preventing, or ameliorating the disease.
[0244] Embodiment 62. The method of embodiment 60 or 61, wherein
the disease is centronuclear myopathy, Duchenne Muscular Dystrophy,
or Charcot-Marie Tooth disease.
[0245] Embodiment 63. The method of any one of embodiments 60-62,
wherein the compound is single-stranded.
[0246] Embodiment 64. The method of any one of embodiments 60-63,
wherein the DNM2 nucleic acid transcript is a pre-mRNA.
[0247] Embodiment 65. The method of any one of embodiments 60-64,
wherein the disease is X-linked myotubular myopathy, autosomal
recessive centronuclear myopathy, or autosomal dominant
centronuclear myopathy.
[0248] Embodiment 66. The method of embodiment 65, wherein the
individual has at least one mutation in at least one gene selected
from among MTM1, BIN1, and DNM2.
[0249] Embodiment 67. The method of any one of embodiments 60-66,
wherein the administering increases body weight or muscle
strength.
[0250] Embodiment 68. A method of inhibiting expression of DNM2 in
a cell comprising contacting the cell with a single-stranded
compound comprising a modified oligonucleotide 100% complementary
to exon 10, an intron, or the 3'-UTR of a DNM2 nucleic acid
transcript, thereby inhibiting expression of DNM2 in the cell.
[0251] Embodiment 69. The method of embodiment 68, wherein the cell
is in the muscle of an individual.
[0252] Embodiment 70. The method of embodiment 69, wherein the
individual has, or is at risk of having, a centronuclear myopathy,
Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.
[0253] Embodiment 71. A method of increasing body weight or muscle
strength in an individual having, or at risk of having, a disease
associated with DNM2 comprising administering a single-stranded
compound comprising a modified oligonucleotide 100% complementary
to a DNM2 nucleic acid transcript to the individual, thereby
increasing body weight or muscle strength in the individual.
[0254] Embodiment 72. The method of embodiment 71, wherein the
individual has, or is at risk of having, centronuclear myopathy,
Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.
[0255] Embodiment 73. The method of any one of embodiments 60-72,
wherein the compound is the compound of any one of embodiments
1-46.
[0256] Embodiment 74. The method of any one of embodiments 60-72,
wherein the compound is a member of the chirally enriched
population of any one of embodiments 48-56.
[0257] Embodiment 75. The method of any one of embodiments 60-72,
wherein the compound is a component of the pharmaceutical
composition of embodiment 57.
[0258] Embodiment 76. The method any one of embodiments 60-67 or
69-75, wherein the compound is administered to the individual via
subcutaneous injection.
[0259] Embodiment 77. The method any one of embodiments 60-67 or
69-75, wherein the compound is administered to the individual via
intramuscular injection.
[0260] Embodiment 78. The method of any one of embodiments 60-67 or
69-77, wherein the compound is administered to the individual via
intravenous injection.
[0261] Embodiment 79. Use of a single-stranded compound comprising
a modified oligonucleotide 100% complementary to exon 10, intron 1,
intron 11, intron, 12, intron 13, intron 14, or the 3'-UTR of a
DNM2 nucleic acid transcript for treating, preventing, or
ameliorating a disease associated with DNM2.
[0262] Embodiment 80. The use of embodiment 79, wherein the disease
is centronuclear myopathy, Duchenne Muscular Dystrophy, or
Charcot-Marie Tooth disease.
[0263] Embodiment 81. Use of the compound of any one of embodiments
1-46 or the composition of embodiment 57 for treating, preventing,
or ameliorating a disease associated with DNM2.
[0264] Embodiment 82. Use of the compound of any one of embodiments
1-46 or the composition of embodiment 57 in the manufacture of a
medicament for treating, preventing, or ameliorating a disease
associated with DNM2.
[0265] Embodiment 83. The use of embodiment 81 or 82, wherein the
disease is centronuclear myopathy, Duchenne Muscular Dystrophy, or
Charcot-Marie Tooth disease.
[0266] Embodiment 84. The use of embodiment 80 or 83, wherein the
disease is X-linked myotubular myopathy, autosomal recessive
centronuclear myopathy, or autosomal dominant centronuclear
myopathy.
[0267] Embodiment 85. The use of embodiment 84, wherein the disease
is associated with a mutation in at least one gene selected from
among MTM1, BIN1, and DNM2.
[0268] Embodiment 86. Use of the compound of any one of embodiments
1-46 or the composition of embodiment 57 in the preparation of a
medicament for treating, preventing, or ameliorating a disease
associated with DNM2.
[0269] Embodiment 87. The use of embodiment 86, wherein the disease
is centronuclear myopathy, Duchenne Muscular Dystrophy, or
Charcot-Marie Tooth disease.
[0270] Embodiment 88. The use of embodiment 87, wherein the disease
is X-linked myotubular myopathy, autosomal recessive centronuclear
myopathy, or autosomal dominant centronuclear myopathy.
[0271] Embodiment 89. The use of embodiment 88, wherein the disease
is associated with a mutation in at least one gene selected from
among MTM1, BIN1, and DNM2.
Certain Indications
[0272] Certain embodiments provided herein relate to methods of
inhibiting DNM2 expression, which can be useful for treating,
preventing, or ameliorating a disease associated with DNM2 in an
individual, by administration of a compound that targets DNM2, such
as the compound described herein. In certain diseases associated
with DNM2, modest or partial inhibition of DNM2 expression is
sufficient to treat, prevent, or ameliorate the disease (See, e.g.,
Cowling et al. J Clin. Invest. 124, 1350-1363 (2014) and Tasfaout
et al. Nat. Commun. June 7; 8:15661 (2017).) In certain
embodiments, the compound can be an antisense compound, oligomeric
compound, or oligonucleotide complementary to DNM2, such as the
ones described herein.
[0273] Examples of diseases associated with DNM2 that are
treatable, preventable, and/or ameliorable with the methods
provided herein include centronuclear myopathy (CNM),
Charcot-Marie-Tooth disease (CMT), and Duchenne's Muscular
Dystrophy (DMD). Centronuclear myopathy includes X-linked CNM
(XLCNM), autosomal dominant CNM (ADCNM) and autosomal recessive CNM
(ARCNM). Mutations in several genes are associated with CNM,
including mutations in MTM1, BIN1, and DNM2. Other genes have been
linked to a CNM-like myopathy: RYR1 encoding for the ryanodine
receptor, TTN encoding Titin, CCDC78 (OMIM 614807) and the
phosphoinositides phosphatase MTMR14 (called hJUMPY; OMIM
160150).
[0274] In certain embodiments, a method of treating, preventing, or
ameliorating a disease associated with DNM2 in an individual
comprises administering to the individual a compound comprising an
antisense compound targeted to DNM2, thereby treating, preventing,
or ameliorating the disease. In certain embodiments, the compound
comprises an oligonucleotide complementary to a DNM2 nucleic acid
transcript. In certain embodiments, the compound is a compound as
described herein. In certain embodiments, the compound comprises or
consists of a modified oligonucleotide complementary to intron 1,
intron 11, intron 12, intron 13, intron 14, exon 10, or the 3'-UTR
of a DNM2 nucleic acid transcript. In certain embodiments, the
modified oligonucleotide is complementary to a sequence within
nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915;
90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of
SEQ ID NO: 1. In certain embodiments, the compound comprises or
consists of a modified oligonucleotide complementary to intron 1,
intron 11, intron 12, intron 13, or intron 14 of a DNM2 nucleic
acid transcript. In certain embodiments, the modified
oligonucleotide is complementary to a sequence within nucleotides
3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; or
97,378-104,979 of SEQ ID NO: 1. In certain embodiments, the
compound comprises a modified oligonucleotide 8 to 50 linked
nucleosides in length and having a nucleobase sequence comprising
at least 8 contiguous nucleobases of any of the nucleobase
sequences of SEQ ID NOs: 7-3134. In certain embodiments, the
compound comprises a modified oligonucleotide 12 to 50 linked
nucleosides in length and having a nucleobase sequence comprising
the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In
certain embodiments, the compound comprises a modified
oligonucleotide consisting of the nucleobase sequence of any one of
SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises
a modified oligonucleotide 16 to 50 linked nucleosides in length
having a nucleobase sequence comprising any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain
embodiments, the compound comprises a modified oligonucleotide
having a nucleobase sequence consisting of any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the
foregoing embodiments, the modified oligonucleotide can be 10 to 30
linked nucleosides in length. In certain embodiments, the compound
is compound number 951799, 949935, 950023, 950089, 951372, 950060,
or 950132. In any of the foregoing embodiments, the compound can be
single-stranded or double-stranded. In any of the foregoing
embodiments, the compound can be an antisense compound or
oligomeric compound. In certain embodiments, the compound is
administered to the individual subcutaneously, intradermally,
intranodally, intramedullary, intramuscularly, intrasternally, by
intravenous (i.v.) injection, by infusion techniques or
intraperitoneally. In certain embodiments, the compound is
administered to the individual via subcutaneous injection. In
certain embodiments, administering the compound increases or
preserves body weight or muscle strength.
[0275] In certain embodiments, a method of treating, preventing, or
ameliorating CNM, DMD, or CMT comprises administering to the
individual a compound comprising a modified oligonucleotide
complementary to a DNM2 nucleic acid, thereby treating, preventing,
or ameliorating CNM, DMD, or CMT. In certain embodiments, the
compound is a compound as described herein. In certain embodiments,
the compound is an antisense compound targeted to DNM2. In certain
embodiments, the compound comprises or consists of a modified
oligonucleotide complementary to intron 1, intron 11, intron 12,
intron 13, intron 14, exon 10, or the 3'-UTR of a DNM2 nucleic acid
transcript. In certain embodiments, the modified oligonucleotide is
complementary to a sequence within nucleotides 3,404-44,737;
83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979;
81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1. In certain
embodiments, the compound comprises or consists of a modified
oligonucleotide complementary to intron 1, intron 11, intron 12,
intron 13, or intron 14 of a DNM2 nucleic acid transcript. In
certain embodiments, the modified oligonucleotide is complementary
to a sequence within nucleotides 3,404-44,737; 83,573-87,287;
87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In
certain embodiments, the compound comprises a modified
oligonucleotide 8 to 50 linked nucleosides in length and having a
nucleobase sequence comprising at least 8 contiguous nucleobases of
any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain
embodiments, the compound comprises a modified oligonucleotide 12
to 50 linked nucleosides in length and having a nucleobase sequence
comprising the nucleobase sequence of any one of SEQ ID NOs:
7-3134. In certain embodiments, the compound comprises a modified
oligonucleotide consisting of the nucleobase sequence of any one of
SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises
a modified oligonucleotide 16 to 50 linked nucleosides in length
having a nucleobase sequence comprising any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain
embodiments, the compound comprises a modified oligonucleotide
having a nucleobase sequence consisting of any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the
foregoing embodiments, the modified oligonucleotide can be 10 to 30
linked nucleosides in length. In certain embodiments, the compound
is compound number 951799, 949935, 950023, 950089, 951372, 950060,
or 950132. In any of the foregoing embodiments, the compound can be
single-stranded or double-stranded. In any of the foregoing
embodiments, the compound can be an antisense compound or
oligomeric compound. In certain embodiments, the compound is
administered to the individual subcutaneously, intradermally,
intratumorally, intranodally, intramedullary, intramuscularly,
intrasternally, by intravenous (i.v.) injection, by infusion
techniques or intraperitoneally. In certain embodiments, the
compound is administered to the individual systemically, e.g., via
subcutaneous or intramuscular injection. In certain embodiments,
administering the compound increases or preserves body weight or
muscle strength. In certain such embodiments, time taken to rise
from the floor, nine-meter walking time, or time taken to climb
four stairs is decreased. In certain embodiments, ability to lift
weight, distance of a 6 minute walk, or leg function grade is
increased. In certain embodiments, pulmonary function or cardiac
function is improved. In certain embodiments, the individual is
identified as having or at risk of having a disease associated with
DNM2. Examples of factors of risk of having a disease associated
with DNM2 include, but are not limited to, genetic predisposition,
such as, for example, a mutation in at least one gene selected from
among MTM1, BIN1, and DNM2.
[0276] In certain embodiments, a method of inhibiting expression of
DNM2 in an individual having, or at risk of having, a disease
associated with DNM2 comprises administering to the individual a
compound comprising a modified oligonucleotide complementary to a
DNM2 nucleic acid, thereby inhibiting expression of DNM2 in the
individual. In certain embodiments, administering the compound
inhibits expression of DNM2 in skeletal muscle. In certain
embodiments, the individual has, or is at risk of having CNM, DMD,
or CMT. In certain embodiments, the compound comprises an antisense
compound targeted to DNM2. In certain embodiments, the antisense
compound comprises an oligonucleotide complementary to a DNM2
nucleic acid transcript. In certain embodiments, the compound is a
compound as described herein. In certain embodiments, the compound
comprises or consists of a modified oligonucleotide complementary
to intron 1, intron 11, intron 12, intron 13, intron 14, exon 10,
or the 3'-UTR of a DNM2 nucleic acid transcript. In certain
embodiments, the modified oligonucleotide is complementary to a
sequence within nucleotides 3,404-44,737; 83,573-87,287;
87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or
116,048-116,903 of SEQ ID NO: 1. In certain embodiments, the
compound comprises or consists of a modified oligonucleotide
complementary to intron 1, intron 11, intron 12, intron 13, or
intron 14 of a DNM2 nucleic acid transcript. In certain
embodiments, the modified oligonucleotide is complementary to a
sequence within nucleotides 3,404-44,737; 83,573-87,287;
87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In
certain embodiments, the compound comprises a modified
oligonucleotide 8 to 50 linked nucleosides in length and having a
nucleobase sequence comprising at least 8 contiguous nucleobases of
any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain
embodiments, the compound comprises a modified oligonucleotide 12
to 50 linked nucleosides in length and having a nucleobase sequence
comprising the nucleobase sequence of any one of SEQ ID NOs:
7-3134. In certain embodiments, the compound comprises a modified
oligonucleotide consisting of the nucleobase sequence of any one of
SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises
a modified oligonucleotide 16 to 50 linked nucleosides in length
having a nucleobase sequence comprising any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain
embodiments, the compound comprises a modified oligonucleotide
having a nucleobase sequence consisting of any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the
foregoing embodiments, the modified oligonucleotide can be 10 to 30
linked nucleosides in length. In certain embodiments, the compound
is compound number 951799, 949935, 950023, 950089, 951372, 950060,
or 950132. In any of the foregoing embodiments, the compound can be
single-stranded or double-stranded. In any of the foregoing
embodiments, the compound can be an antisense compound or
oligomeric compound. In certain embodiments, the compound is
administered to the individual subcutaneously, intradermally,
intranodally, intramedullary, intramuscularly, intrasternally, by
intravenous (i.v.) injection, by infusion techniques or
intraperitoneally. In certain embodiments, the compound is
administered to the individual systemically, e.g., via subcutaneous
or intramuscular injection. In certain embodiments, administering
the compound increases or preserves body weight or muscle strength.
In certain embodiments, the individual is identified as having or
at risk of having a disease associated with DNM2.
[0277] In certain embodiments, a method of inhibiting expression of
DNM2 in a cell comprises contacting the cell with a compound
comprising an antisense compound targeted to DNM2, thereby
inhibiting expression of DNM2 in the cell. In one embodiment, the
expression of DNM2 is inhibited by at least about 40%, at least
about 50%, at least about 60%, at least about 70%, at least about
80%, or at least about 90%. In one embodiment, the expression of
DNM2 is inhibited by at least 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% as compared
to an untreated or control sample. In one embodiment, the method is
an in vitro method. In certain embodiments, the cell is a muscle
cell. In certain embodiments, the cell is a skeletal muscle cell.
In certain embodiments, the muscle cell is in an individual who
has, or is at risk of having CNM, DMD, or CMT. In certain
embodiments, the compound comprises an oligonucleotide
complementary to a DNM2 nucleic acid transcript. In certain
embodiments, the compound is a compound as described herein. In
certain embodiments, the compound comprises or consists of a
modified oligonucleotide complementary to intron 1, intron 11,
intron 12, intron 13, intron 14, exon 10, or the 3'-UTR of a DNM2
nucleic acid transcript. In certain embodiments, the modified
oligonucleotide is complementary to a sequence within nucleotides
3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263;
97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1.
In certain embodiments, the compound comprises or consists of a
modified oligonucleotide complementary to intron 1, intron 11,
intron 12, intron 13, or intron 14 of a DNM2 nucleic acid
transcript. In certain embodiments, the modified oligonucleotide is
complementary to a sequence within nucleotides 3,404-44,737;
83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of
SEQ ID NO: 1. In certain embodiments, the compound comprises a
modified oligonucleotide 8 to 50 linked nucleosides in length and
having a nucleobase sequence comprising at least 8 contiguous
nucleobases of any of the nucleobase sequences of SEQ ID NOs:
7-3134. In certain embodiments, the compound comprises a modified
oligonucleotide 12 to 50 linked nucleosides in length and having a
nucleobase sequence comprising the nucleobase sequence of any one
of SEQ ID NOs: 7-3134. In certain embodiments, the compound
comprises a modified oligonucleotide consisting of the nucleobase
sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments,
the compound comprises a modified oligonucleotide 16 to 50 linked
nucleosides in length having a nucleobase sequence comprising any
one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In
certain embodiments, the compound comprises a modified
oligonucleotide having a nucleobase sequence consisting of any one
of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any
of the foregoing embodiments, the modified oligonucleotide can be
10 to 30 linked nucleosides in length. In certain embodiments, the
compound is compound number 951799, 949935, 950023, 950089, 951372,
950060, or 950132. In any of the foregoing embodiments, the
compound can be single-stranded or double-stranded. In any of the
foregoing embodiments, the compound can be an antisense compound or
oligomeric compound.
[0278] In certain embodiments, a method of increasing or preserving
body weight or muscle strength of an individual having, or at risk
of having, a disease associated with DNM2 comprises administering
to the individual a compound comprising an antisense compound
targeted to DNM2, increasing or preserving body weight or muscle
strength of the individual. In certain such embodiments, time taken
to rise from the floor, nine-meter walking time, or time taken to
climb four stairs is decreased. In certain embodiments, ability to
lift weight, distance of a 6 minute walk, or leg function grade is
increased. In certain embodiments, pulmonary function or cardiac
function is improved. In certain embodiments, the individual has,
or is at risk of having, CNM, DMD, or CMT. In certain embodiments,
the compound comprises an oligonucleotide complementary to a DNM2
nucleic acid transcript. In certain embodiments, the compound is a
compound as described herein. In certain embodiments, the compound
comprises or consists of a modified oligonucleotide complementary
to intron 1, intron 11, intron 12, intron 13, intron 14, exon 10,
or the 3'-UTR of a DNM2 nucleic acid transcript. In certain
embodiments, the modified oligonucleotide is complementary to a
sequence within nucleotides 3,404-44,737; 83,573-87,287;
87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or
116,048-116,903 of SEQ ID NO: 1. In certain embodiments, the
compound comprises or consists of a modified oligonucleotide
complementary to intron 1, intron 11, intron 12, intron 13, or
intron 14 of a DNM2 nucleic acid transcript. In certain
embodiments, the modified oligonucleotide is complementary to a
sequence within nucleotides 3,404-44,737; 83,573-87,287;
87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In
certain embodiments, the compound comprises a modified
oligonucleotide 8 to 50 linked nucleosides in length and having a
nucleobase sequence comprising at least 8 contiguous nucleobases of
any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain
embodiments, the compound comprises a modified oligonucleotide 12
to 50 linked nucleosides in length and having a nucleobase sequence
comprising the nucleobase sequence of any one of SEQ ID NOs:
7-3134. In certain embodiments, the compound comprises a modified
oligonucleotide consisting of the nucleobase sequence of any one of
SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises
a modified oligonucleotide 16 to 50 linked nucleosides in length
having a nucleobase sequence comprising any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain
embodiments, the compound comprises a modified oligonucleotide
having a nucleobase sequence consisting of any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the
foregoing embodiments, the modified oligonucleotide can be 10 to 30
linked nucleosides in length. In certain embodiments, the compound
is compound number 951799, 949935, 950023, 950089, 951372, 950060,
or 950132. In any of the foregoing embodiments, the compound can be
single-stranded or double-stranded. In any of the foregoing
embodiments, the compound can be an antisense compound or
oligomeric compound. In certain embodiments, the compound is
administered to the individual subcutaneously, intradermally,
intranodally, intramedullary, intramuscularly, intrasternally, by
intravenous (i.v.) injection, by infusion techniques or
intraperitoneally. In certain embodiments, the compound is
administered to the individual systemically, e.g., via subcutaneous
or intramuscular injection. In certain embodiments, the individual
is identified as having or at risk of having a disease associated
with DNM2.
[0279] Certain embodiments are drawn to a compound comprising an
antisense compound targeted to DNM2 for use in treating a disease
associated with DNM2. In certain embodiments, the disease is CNM,
DMD, or CMT. In certain embodiments, the compound comprises an
oligonucleotide complementary to a DNM2 nucleic acid transcript. In
certain embodiments, the compound is a compound as described
herein. In certain embodiments, the compound comprises or consists
of a modified oligonucleotide complementary to intron 1, intron 11,
intron 12, intron 13, intron 14, exon 10, or the 3'-UTR of a DNM2
nucleic acid transcript. In certain embodiments, the modified
oligonucleotide is complementary to a sequence within nucleotides
3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263;
97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1.
In certain embodiments, the compound comprises or consists of a
modified oligonucleotide complementary to intron 1, intron 11,
intron 12, intron 13, or intron 14 of a DNM2 nucleic acid
transcript. In certain embodiments, the modified oligonucleotide is
complementary to a sequence within nucleotides 3,404-44,737;
83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of
SEQ ID NO: 1. In certain embodiments, the compound comprises a
modified oligonucleotide 8 to 50 linked nucleosides in length and
having a nucleobase sequence comprising at least 8 contiguous
nucleobases of any of the nucleobase sequences of SEQ ID NOs:
7-3134. In certain embodiments, the compound comprises a modified
oligonucleotide 12 to 50 linked nucleosides in length and having a
nucleobase sequence comprising the nucleobase sequence of any one
of SEQ ID NOs: 7-3134. In certain embodiments, the compound
comprises a modified oligonucleotide consisting of the nucleobase
sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments,
the compound comprises a modified oligonucleotide 16 to 50 linked
nucleosides in length having a nucleobase sequence comprising any
one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In
certain embodiments, the compound comprises a modified
oligonucleotide having a nucleobase sequence consisting of any one
of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any
of the foregoing embodiments, the modified oligonucleotide can be
10 to 30 linked nucleosides in length. In certain embodiments, the
compound is compound number 951799, 949935, 950023, 950089, 951372,
950060, or 950132. In any of the foregoing embodiments, the
compound can be single-stranded or double-stranded. In any of the
foregoing embodiments, the compound can be an antisense compound or
oligomeric compound. In certain embodiments, the compound is
administered to the individual subcutaneously, intradermally,
intranodally, intramedullary, intramuscularly, intrasternally, by
intravenous (i.v.) injection, by infusion techniques or
intraperitoneally. In certain embodiments, the compound is to be
administered to the individual systemically, e.g., via subcutaneous
or intramuscular injection.
[0280] Certain embodiments are drawn to a compound comprising an
antisense compound targeted to DNM2 for use in increasing or
preserving body weight or muscle strength of an individual having
or at risk of having CNM, DMD, or CMT. In certain embodiments, the
compound comprises an oligonucleotide complementary to a DNM2
nucleic acid transcript. In certain embodiments, the compound is a
compound as described herein. In certain embodiments, the compound
comprises or consists of a modified oligonucleotide complementary
to intron 1, intron 11, intron 12, intron 13, intron 14, exon 10,
or the 3'-UTR of a DNM2 nucleic acid transcript. In certain
embodiments, the modified oligonucleotide is complementary to a
sequence within nucleotides 3,404-44,737; 83,573-87,287;
87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or
116,048-116,903 of SEQ ID NO: 1. In certain embodiments, the
compound comprises or consists of a modified oligonucleotide
complementary to intron 1, intron 11, intron 12, intron 13, or
intron 14 of a DNM2 nucleic acid transcript. In certain
embodiments, the modified oligonucleotide is complementary to a
sequence within nucleotides 3,404-44,737; 83,573-87,287;
87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In
certain embodiments, the compound comprises a modified
oligonucleotide 8 to 50 linked nucleosides in length and having a
nucleobase sequence comprising at least 8 contiguous nucleobases of
any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain
embodiments, the compound comprises a modified oligonucleotide 12
to 50 linked nucleosides in length and having a nucleobase sequence
comprising the nucleobase sequence of any one of SEQ ID NOs:
7-3134. In certain embodiments, the compound comprises a modified
oligonucleotide consisting of the nucleobase sequence of any one of
SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises
a modified oligonucleotide 16 to 50 linked nucleosides in length
having a nucleobase sequence comprising any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain
embodiments, the compound comprises a modified oligonucleotide
having a nucleobase sequence consisting of any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the
foregoing embodiments, the modified oligonucleotide can be 10 to 30
linked nucleosides in length. In certain embodiments, the compound
is compound number 951799, 949935, 950023, 950089, 951372, 950060,
or 950132. In any of the foregoing embodiments, the compound can be
single-stranded or double-stranded. In any of the foregoing
embodiments, the compound can be an antisense compound or
oligomeric compound.
[0281] Certain embodiments are drawn to use of the compound
comprising an antisense compound targeted to DNM2 for the
manufacture or preparation of a medicament for treating a disease
associated with DNM2. Certain embodiments are drawn to use of the
compound comprising an antisense compound targeted to DNM2 for the
preparation of a medicament for treating a disease associated with
DNM2. In certain embodiments, the disease is CNM, DMD, or CMT. In
certain embodiments, the compound comprises an oligonucleotide
complementary to a DNM2 nucleic acid transcript. In certain
embodiments, the compound is a compound as described herein. In
certain embodiments, the compound comprises or consists of a
modified oligonucleotide complementary to intron 1, intron 11,
intron 12, intron 13, intron 14, exon 10, or the 3'-UTR of a DNM2
nucleic acid transcript. In certain embodiments, the modified
oligonucleotide is complementary to a sequence within nucleotides
3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263;
97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1.
In certain embodiments, the compound comprises or consists of a
modified oligonucleotide complementary to intron 1, intron 11,
intron 12, intron 13, or intron 14 of a DNM2 nucleic acid
transcript. In certain embodiments, the modified oligonucleotide is
complementary to a sequence within nucleotides 3,404-44,737;
83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of
SEQ ID NO: 1. In certain embodiments, the compound comprises a
modified oligonucleotide 8 to 50 linked nucleosides in length and
having a nucleobase sequence comprising at least 8 contiguous
nucleobases of any of the nucleobase sequences of SEQ ID NOs:
7-3134. In certain embodiments, the compound comprises a modified
oligonucleotide 12 to 50 linked nucleosides in length and having a
nucleobase sequence comprising the nucleobase sequence of any one
of SEQ ID NOs: 7-3134. In certain embodiments, the compound
comprises a modified oligonucleotide consisting of the nucleobase
sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments,
the compound comprises a modified oligonucleotide 16 to 50 linked
nucleosides in length having a nucleobase sequence comprising any
one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In
certain embodiments, the compound comprises a modified
oligonucleotide having a nucleobase sequence consisting of any one
of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any
of the foregoing embodiments, the modified oligonucleotide can be
10 to 30 linked nucleosides in length. In certain embodiments, the
compound is compound number 951799, 949935, 950023, 950089, 951372,
950060, or 950132. In any of the foregoing embodiments, the
compound can be single-stranded or double-stranded. In any of the
foregoing embodiments, the compound can be an antisense compound or
oligomeric compound.
[0282] Certain embodiments are drawn to use of a compound
comprising an antisense compound targeted to DNM2 for the
manufacture or preparation of a medicament for increasing or
preserving body weight or muscle strength of an individual having
or at risk of having CNM, DMD, or CMT. In certain embodiments, the
compound comprises an oligonucleotide complementary to a DNM2
nucleic acid transcript. In certain embodiments, the compound is a
compound as described herein. In certain embodiments, the compound
comprises or consists of a modified oligonucleotide complementary
to intron 1, intron 11, intron 12, intron 13, intron 14, exon 10,
or the 3'-UTR of a DNM2 nucleic acid transcript. In certain
embodiments, the modified oligonucleotide is complementary to a
sequence within nucleotides 3,404-44,737; 83,573-87,287;
87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or
116,048-116,903 of SEQ ID NO: 1. In certain embodiments, the
compound comprises or consists of a modified oligonucleotide
complementary to intron 1, intron 11, intron 12, intron 13, or
intron 14 of a DNM2 nucleic acid transcript. In certain
embodiments, the modified oligonucleotide is complementary to a
sequence within nucleotides 3,404-44,737; 83,573-87,287;
87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In
certain embodiments, the compound comprises a modified
oligonucleotide 8 to 50 linked nucleosides in length and having a
nucleobase sequence comprising at least 8 contiguous nucleobases of
any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain
embodiments, the compound comprises a modified oligonucleotide 12
to 50 linked nucleosides in length and having a nucleobase sequence
comprising the nucleobase sequence of any one of SEQ ID NOs:
7-3134. In certain embodiments, the compound comprises a modified
oligonucleotide consisting of the nucleobase sequence of any one of
SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises
a modified oligonucleotide 16 to 50 linked nucleosides in length
having a nucleobase sequence comprising any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain
embodiments, the compound comprises a modified oligonucleotide
having a nucleobase sequence consisting of any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the
foregoing embodiments, the modified oligonucleotide can be 10 to 30
linked nucleosides in length. In certain embodiments, the compound
is compound number 951799, 949935, 950023, 950089, 951372, 950060,
or 950132. In any of the foregoing embodiments, the compound can be
single-stranded or double-stranded. In any of the foregoing
embodiments, the compound can be an antisense compound or
oligomeric compound.
[0283] In any of the foregoing methods or uses, the compound can be
targeted to a DNM2 nucleic acid transcript. In certain embodiments,
the compound comprises or consists of a modified oligonucleotide,
for example a modified oligonucleotide 8 to 50 linked nucleosides
in length, 10 to 30 linked nucleosides in length, 12 to 30 linked
nucleosides in length, or 20 linked nucleosides in length. In
certain embodiments, the modified oligonucleotide is at least 80%,
85%, 90%, 95% or 100% complementary to any of the nucleobase
sequences recited in SEQ ID NOs: 1, 2, 3, or 3135. In certain
embodiments, the modified oligonucleotide comprises at least one
modified internucleoside linkage, at least one modified sugar, and
at least one modified nucleobase. In certain such embodiments, the
at least one modified internucleoside linkage is a phosphorothioate
internucleoside linkage, the at least one modified sugar is a
bicyclic sugar, and the at least one modified nucleobase is a
5-methylcytosine. In certain embodiments, the modified
oligonucleotide comprises a gap segment consisting of linked
2'-deoxynucleosides; a 5' wing segment consisting of linked
nucleosides; and a 3' wing segment consisting of linked
nucleosides, wherein the gap segment is positioned immediately
adjacent to and between the 5' wing segment and the 3' wing segment
and wherein each terminal wing nucleoside comprises a modified
sugar.
[0284] In any of the foregoing embodiments, the modified
oligonucleotide may be 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16
to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22,
16 to 20, or 17 or 20 linked nucleosides in length. In certain
embodiments, the modified oligonucleotide is at least 80%, 85%,
90%, 95% or 100% complementary to any of the nucleobase sequences
recited in SEQ ID NOs: 1, 2, 3, or 3135. In certain embodiments,
the modified oligonucleotide comprises at least one modified
internucleoside linkage, at least one modified sugar, and at least
one modified nucleobase. In certain embodiments, the at least one
modified internucleoside linkage is a phosphorothioate
internucleoside linkage, the at least one modified sugar is a
bicyclic sugar, and the at least one modified nucleobase is a
5-methylcytosine. In certain embodiments, the modified
oligonucleotide comprises a gap segment consisting of linked
2'-deoxynucleosides; a 5' wing segment consisting of linked
nucleosides; and a 3' wing segment consisting of linked
nucleosides, wherein the gap segment is positioned immediately
adjacent to and between the 5' wing segment and the 3' wing segment
and wherein each terminal wing nucleoside comprises a modified
sugar.
[0285] In any of the foregoing methods or uses, the compound may
comprise or consist of a modified oligonucleotide 16 to 30 linked
nucleosides in length and having a nucleobase sequence comprising
any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232,
wherein the modified oligonucleotide comprises: [0286] a gap
segment consisting of linked 2'-deoxynucleosides; [0287] a 5' wing
segment consisting of linked nucleosides; and [0288] a 3' wing
segment consisting of linked nucleosides;
[0289] wherein the gap segment is positioned between the 5' wing
segment and the 3' wing segment and wherein each nucleoside of each
wing segment comprises a modified sugar.
[0290] In any of the foregoing methods or uses, the compound may
comprise or consist of a modified oligonucleotide 16 to 30 linked
nucleosides in length and having a nucleobase sequence comprising
any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232,
wherein the modified oligonucleotide comprises: [0291] a gap
segment consisting of linked 2'-deoxynucleosides; [0292] a 5' wing
segment consisting of linked nucleosides; and [0293] a 3' wing
segment consisting of linked nucleosides;
[0294] wherein the gap segment is positioned between the 5' wing
segment and the 3' wing segment, wherein each terminal wing
nucleoside comprises a modified sugar.
[0295] In any of the foregoing methods or uses, the compound may
comprise or consist of a modified oligonucleotide 16 to 50 linked
nucleobases in length having a nucleobase sequence comprising or
consisting of the sequence recited in any one of SEQ ID NOs: 2879,
3056, 2123, 2189, 2453, 2160, or 2232, wherein the modified
oligonucleotide comprises: [0296] a gap segment consisting of 10
linked 2'-deoxynucleosides; [0297] a 5' wing segment consisting of
3 linked nucleosides; and [0298] a 3' wing segment consisting of 3
linked nucleosides;
[0299] wherein the gap segment is positioned between the 5' wing
segment and the 3' wing segment, wherein each nucleoside of each
wing segment comprises a cEt sugar; wherein each internucleoside
linkage is a phosphorothioate linkage and wherein each cytosine is
a 5-methylcytosine. In certain embodiments, the modified
oligonucleotide consists of 16-30 linked nucleosides. In certain
embodiments, the modified oligonucleotide consists of 16 linked
nucleosides.
[0300] In one embodiment, in any of the foregoing methods or uses,
the compound has the following chemical structure:
##STR00005##
[0301] In one embodiment, in any of the foregoing methods or uses,
the compound can be administered systemically. In certain
embodiments, the compound of any of the foregoing methods or uses
can be administered through injection or infusion. In certain
embodiments, the compound of any of the foregoing methods or uses
can be administered via subcutaneous administration, intravenous
administration, intramuscular administration, intraarterial
administration, intraperitoneal administration, or intracranial
administration, e.g. intrathecal or intracerebroventricular
administration. In certain embodiments, the compound is
administered to the individual intradermally, intranodally,
intramedullary or intrasternally. In certain embodiments, the
compound of any of the foregoing methods or uses can be
administered orally.
Certain Combinations and Combination Therapies
[0302] In certain embodiments, a first agent comprising the
compound described herein is co-administered with one or more
secondary agents. In certain embodiments, such second agents are
designed to treat the same disease, disorder, or condition as the
first agent described herein. In certain embodiments, such second
agents are designed to treat a different disease, disorder, or
condition as the first agent described herein. In certain
embodiments, a first agent is designed to treat an undesired side
effect of a second agent. In certain embodiments, second agents are
co-administered with the first agent to treat an undesired effect
of the first agent. In certain embodiments, such second agents are
designed to treat an undesired side effect of one or more
pharmaceutical compositions as described herein. In certain
embodiments, second agents are co-administered with the first agent
to produce a combinational effect. In certain embodiments, second
agents are co-administered with the first agent to produce a
synergistic effect. In certain embodiments, the co-administration
of the first and second agents permits use of lower dosages than
would be required to achieve a therapeutic or prophylactic effect
if the agents were administered as independent therapy.
[0303] In certain embodiments, one or more compounds or
compositions provided herein are co-administered with one or more
secondary agents. In certain embodiments, one or more compounds or
compositions provided herein and one or more secondary agents, are
administered at different times. In certain embodiments, one or
more compounds or compositions provided herein and one or more
secondary agents, are prepared together in a single formulation. In
certain embodiments, one or more compounds or compositions provided
herein and one or more secondary agents, are prepared
separately.
[0304] Certain embodiments are directed to the use of a compound
comprising a modified oligonucleotide complementary to a DNM2
nucleic acid transcript as described herein in combination with a
secondary agent. In particular embodiments such use is in a method
of treating a patient suffering from CNM, DMD, or CMT, or in the
preparation or manufacture of a medicament for treating CNM, DMD,
or CMT.
[0305] In certain embodiments the compound comprising a modified
oligonucleotide complementary to a DNM2 nucleic acid transcript as
described herein and the secondary agent are used in combination
treatment by administering the two agents simultaneously,
separately or sequentially. In certain embodiments the two agents
are formulated as a fixed dose combination product. In other
embodiments the two agents are provided to the patient as separate
units which can then either be taken simultaneously or serially
(sequentially).
Certain Compounds
[0306] In certain embodiments, compounds described herein can be
antisense compounds. In certain embodiments, the antisense compound
comprises or consists of an oligomeric compound. In certain
embodiments, the oligomeric compound comprises or consists of a
modified oligonucleotide. In certain embodiments, the modified
oligonucleotide has a nucleobase sequence complementary to that of
a target nucleic acid.
[0307] In certain embodiments, a compound described herein
comprises or consists of a modified oligonucleotide. In certain
embodiments, the modified oligonucleotide has a nucleobase sequence
complementary to that of a target nucleic acid.
[0308] In certain embodiments, a compound or antisense compound is
single-stranded. Such a single-stranded compound or antisense
compound comprises or consists of an oligomeric compound. In
certain embodiments, such an oligomeric compound comprises or
consists of an oligonucleotide and optionally a conjugate group. In
certain embodiments, the oligonucleotide is an antisense
oligonucleotide. In certain embodiments, the oligonucleotide is
modified. In certain embodiments, the oligonucleotide of a
single-stranded antisense compound or oligomeric compound comprises
a self-complementary nucleobase sequence.
[0309] In certain embodiments, a compound or antisense compound is
double-stranded. Such double-stranded compounds comprise a first
oligomeric compound comprising or consisting of a first modified
oligonucleotide having a region complementary to a target nucleic
acid and a second oligomeric compound comprising or consisting of a
second oligonucleotide having a region complementary to the first
modified oligonucleotide. In certain embodiments, the first
oligonucleotide is 100% complementary to the second
oligonucleotide. In certain embodiments, the first and second
oligonucleotides include non-complementary, overhanging
nucleosides. In certain embodiments, the first modified
oligonucleotide comprises unmodified ribosyl sugar moieties as
those found in RNA. In such embodiments, thymine nucleobases in the
first and/or second oligonucleotide are replaced by uracil
nucleobases. In certain embodiments, the first and/or second
oligomeric compound comprises a conjugate group. In certain
embodiments, the first modified oligonucleotide is 12-30 linked
nucleosides in length and the second oligonucleotide is 12-30
linked nucleosides in length. In certain embodiments, the second
oligonucleotide is modified. In certain embodiments, the first
modified oligonucleotide has a nucleobase sequence comprising at
least 8 contiguous nucleobases of any of SEQ ID NOs: 7-3134.
[0310] Examples of single-stranded and double-stranded compounds
include but are not limited to oligonucleotides, siRNAs, microRNA
targeting oligonucleotides, and single-stranded RNAi compounds,
such as small hairpin RNAs (shRNAs), single-stranded siRNAs
(ssRNAs), and microRNA mimics.
[0311] In certain embodiments, a compound described herein has a
nucleobase sequence that, when written in the 5' to 3' direction,
comprises the reverse complement of the target segment of a target
nucleic acid to which it is targeted.
[0312] In certain embodiments, a compound described herein
comprises an oligonucleotide 10 to 30 linked subunits in length. In
certain embodiments, a compound described herein comprises an
oligonucleotide 12 to 30 linked subunits in length. In certain
embodiments, a compound described herein comprises an
oligonucleotide 12 to 22 linked subunits in length. In certain
embodiments, compound described herein comprises an oligonucleotide
14 to 30 linked subunits in length. In certain embodiments,
compound described herein comprises an oligonucleotide 14 to 20
linked subunits in length. In certain embodiments, a compound
described herein comprises an oligonucleotide 15 to 30 linked
subunits in length. In certain embodiments, a compound described
herein comprises an oligonucleotide 15 to 20 linked subunits in
length. In certain embodiments, a compound described herein
comprises an oligonucleotide 16 to 30 linked subunits in length. In
certain embodiments, a compound described herein comprises an
oligonucleotide 16 to 20 linked subunits in length. In certain
embodiments, a compound described herein comprises an
oligonucleotide 17 to 30 linked subunits in length. In certain
embodiments, a compound described herein comprises an
oligonucleotide 17 to 20 linked subunits in length. In certain
embodiments, a compound described herein comprises an
oligonucleotide 18 to 30 linked subunits in length. In certain
embodiments, a compound described herein comprises an
oligonucleotide 18 to 21 linked subunits in length. In certain
embodiments, a compound described herein comprises an
oligonucleotide 18 to 20 linked subunits in length. In certain
embodiments, a compound described herein comprises an
oligonucleotide 20 to 30 linked subunits in length. In other words,
such oligonucleotides are 12 to 30 linked subunits, 14 to 30 linked
subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits,
16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20
subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits,
20 to 30 subunits, or 12 to 22 linked subunits in length,
respectively. In certain embodiments, a compound described herein
comprises an oligonucleotide 14 linked subunits in length. In
certain embodiments, a compound described herein comprises an
oligonucleotide 16 linked subunits in length. In certain
embodiments, a compound described herein comprises an
oligonucleotide 17 linked subunits in length. In certain
embodiments, compound described herein comprises an oligonucleotide
18 linked subunits in length. In certain embodiments, a compound
described herein comprises an oligonucleotide 19 linked subunits in
length. In certain embodiments, a compound described herein
comprises an oligonucleotide 20 linked subunits in length. In other
embodiments, a compound described herein comprises an
oligonucleotide 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14
to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50,
18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to
50, or 20 to 30 linked subunits. In certain such embodiments, the
compound described herein comprises an oligonucleotide 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,
45, 46, 47, 48, 49, or 50 linked subunits in length, or a range
defined by any two of the above values. In some embodiments the
linked subunits are nucleotides, nucleosides, or nucleobases.
[0313] In certain embodiments, the compound may further comprise
additional features or elements, such as a conjugate group, that
are attached to the oligonucleotide. In certain embodiments, such
compounds are antisense compounds. In certain embodiments, such
compounds are oligomeric compounds. In embodiments where a
conjugate group comprises a nucleoside (i.e. a nucleoside that
links the conjugate group to the oligonucleotide), the nucleoside
of the conjugate group is not counted in the length of the
oligonucleotide.
[0314] In certain embodiments, compounds may be shortened or
truncated. For example, a single subunit may be deleted from the 5'
end (5' truncation), or alternatively from the 3' end (3'
truncation). A shortened or truncated compound targeted to a DNM2
nucleic acid may have two subunits deleted from the 5' end, or
alternatively may have two subunits deleted from the 3' end, of the
compound. Alternatively, the deleted nucleosides may be dispersed
throughout the compound.
[0315] When a single additional subunit is present in a lengthened
compound, the additional subunit may be located at the 5' or 3' end
of the compound. When two or more additional subunits are present,
the added subunits may be adjacent to each other, for example, in a
compound having two subunits added to the 5' end (5' addition), or
alternatively to the 3' end (3' addition), of the compound.
Alternatively, the added subunits may be dispersed throughout the
compound.
[0316] It is possible to increase or decrease the length of a
compound, such as an oligonucleotide, and/or introduce mismatch
bases without eliminating activity (Woolf et al. Proc. Nat. Acad.
Sci. USA 1992, 89:7305-7309; Gautschi et al. J Nat. Cancer Inst.
March 2001, 93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998,
16:3341-3358). However, seemingly small changes in oligonucleotide
sequence, chemistry and motif can make large differences in one or
more of the many properties required for clinical development (Seth
et al. J Med. Chem. 2009, 52, 10; Egli et al. J. Am. Chem. Soc.
2011, 133, 16642).
[0317] In certain embodiments, compounds described herein are
interfering RNA compounds (RNAi), which include double-stranded RNA
compounds (also referred to as short-interfering RNA or siRNA) and
single-stranded RNAi compounds (or ssRNA). Such compounds work at
least in part through the RISC pathway to degrade and/or sequester
a target nucleic acid (thus, include microRNA/microRNA-mimic
compounds). As used herein, the term siRNA is meant to be
equivalent to other terms used to describe nucleic acid molecules
that are capable of mediating sequence specific RNAi, for example
short interfering RNA (siRNA), double-stranded RNA (dsRNA),
micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering
oligonucleotide, short interfering nucleic acid, short interfering
modified oligonucleotide, chemically modified siRNA,
post-transcriptional gene silencing RNA (ptgsRNA), and others. In
addition, as used herein, the term "RNAi" is meant to be equivalent
to other terms used to describe sequence specific RNA interference,
such as post transcriptional gene silencing, translational
inhibition, or epigenetics.
[0318] In certain embodiments, a compound described herein can
comprise any of the oligonucleotide sequences targeted to a DNM2
nucleic acid transcript described herein. In certain embodiments,
the compound can be double-stranded. In certain embodiments, the
compound comprises a first strand comprising at least an 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase
portion of any one of SEQ ID NOs: 7-3134 and a second strand. In
certain embodiments, the compound can be double-stranded. In
certain embodiments, the compound comprises a first strand
comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs:
2879, 3056, 2123, 2189, 2453, 2160, or 2232 and a second strand. In
certain embodiments, the compound can be double-stranded. In
certain embodiments, the compound comprises a first strand
comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, or 20 contiguous nucleobase portion of SEQ ID NO: 2879 and a
second strand. In certain embodiments, the compound comprises a
first strand comprising the nucleobase sequence of any one of SEQ
ID NOs: 7-3134 and a second strand. In certain embodiments, the
compound comprises a first strand comprising the nucleobase
sequence of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453,
2160, or 2232 and a second strand. In certain embodiments, the
compound comprises a first strand comprising the nucleobase
sequence of SEQ ID NO: 2879 and a second strand. In certain
embodiments, the compound comprises ribonucleotides in which the
first strand has uracil (U) in place of thymine (T) in any one of
SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises
(i) a first strand comprising a nucleobase sequence complementary
to the site on a DNM2 nucleic acid to which any of SEQ ID NOs:
7-3134 is complementary, and (ii) a second strand. In certain
embodiments, the compound comprises one or more modified
nucleotides in which the 2' position in the sugar contains a
halogen (such as fluorine group; 2'-F) or contains an alkoxy group
(such as a methoxy group; 2'-OMe). In certain embodiments, the
compound comprises at least one 2'-F sugar modification and at
least one 2'-OMe sugar modification. In certain embodiments, the at
least one 2'-F sugar modification and at least one 2'-OMe sugar
modification are arranged in an alternating pattern for at least 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20
contiguous nucleobases along a strand of the dsRNA compound. In
certain embodiments, the compound comprises one or more linkages
between adjacent nucleotides other than a naturally-occurring
phosphodiester linkage. Examples of such linkages include
phosphoramide, phosphorothioate, and phosphorodithioate linkages.
The compounds may also be chemically modified nucleic acid
molecules as taught in U.S. Pat. No. 6,673,661. In other
embodiments, the compound contains one or two capped strands, as
disclosed, for example, by WO 00/63364, filed Apr. 19, 2000.
[0319] In certain embodiments, the first strand of the compound is
an siRNA guide strand and the second strand of the compound is an
siRNA passenger strand. In certain embodiments, the second strand
of the compound is complementary to the first strand. In certain
embodiments, each strand of the compound is 16, 17, 18, 19, 20, 21,
22, or 23 linked nucleosides in length. In certain embodiments, the
first or second strand of the compound can comprise a conjugate
group.
[0320] In certain embodiments, a compound described herein can
comprise any of the oligonucleotide sequences targeted to a DNM2
nucleic acid described herein. In certain embodiments, the compound
is single-stranded. In certain embodiments, such a compound is a
single-stranded RNAi (ssRNAi) compound. In certain embodiments, the
compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ
ID NOs: 7-3134. In certain embodiments, the compound comprises at
least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20
contiguous nucleobase portion of any one of SEQ ID NOs: 2879, 3056,
2123, 2189, 2453, 2160, or 2232. In certain embodiments, the
compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, or 20 contiguous nucleobase portion of SEQ ID NO: 2879.
In certain embodiments, the compound comprises the nucleobase
sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments,
the compound comprises the nucleobase sequence of any one of SEQ ID
NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain
embodiments, the compound comprises the nucleobase sequence of SEQ
ID NO: 2879. In certain embodiments, the compound comprises
ribonucleotides in which uracil (U) is in place of thymine (T) in
any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound
comprises a nucleobase sequence complementary to the site on DNM2
to which any of SEQ ID NOs: 7-3134 is targeted. In certain
embodiments, the compound comprises one or more modified
nucleotides in which the 2' position in the sugar contains a
halogen (such as fluorine group; 2'-F) or contains an alkoxy group
(such as a methoxy group; 2'-OMe). In certain embodiments, the
compound comprises at least one 2'-F sugar modification and at
least one 2'-OMe sugar modification. In certain embodiments, the at
least one 2'-F sugar modification and at least one 2'-OMe sugar
modification are arranged in an alternating pattern for at least 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20
contiguous nucleobases along a strand of the compound. In certain
embodiments, the compound comprises one or more linkages between
adjacent nucleotides other than a naturally-occurring
phosphodiester linkage. Examples of such linkages include
phosphoramide, phosphorothioate, and phosphorodithioate linkages.
The compounds may also be chemically modified nucleic acid
molecules as taught in U.S. Pat. No. 6,673,661. In other
embodiments, the compound contains a capped strand, as disclosed,
for example, by WO 00/63364, filed Apr. 19, 2000. In certain
embodiments, the compound consists of 16, 17, 18, 19, 20, 21, 22,
or 23 linked nucleosides. In certain embodiments, the compound can
comprise a conjugate group.
[0321] Certain compounds described herein (e.g., modified
oligonucleotides) have one or more asymmetric center and thus give
rise to enantiomers, diastereomers, and other stereoisomeric
configurations that may be defined, in terms of absolute
stereochemistry, as (R) or (S), as .alpha. or .beta., such as for
sugar anomers, or as (D) or (L), such as for amino acids, etc.
Compounds provided herein that are drawn or described as having
certain stereoisomeric configurations include only the indicated
compounds. Compounds provided herein that are drawn or described
with undefined stereochemistry include all such possible isomers,
including their stereorandom and optically pure forms. All
tautomeric forms of the compounds provided herein are included
unless otherwise indicated.
[0322] The compounds described herein include variations in which
one or more atoms are replaced with a non-radioactive isotope or
radioactive isotope of the indicated element. For example,
compounds herein that comprise hydrogen atoms encompass all
possible deuterium substitutions for each of the .sup.1H hydrogen
atoms. Isotopic substitutions encompassed by the compounds herein
include but are not limited to: .sup.2H or .sup.3H in place of
.sup.1H, .sup.13C or .sup.14C in place of .sup.12C, .sup.15N in
place of .sup.14N, .sup.17O or .sup.18O in place of .sup.16O, and
.sup.33S, .sup.34S, .sup.35S, or .sup.36S in place of .sup.32S. In
certain embodiments, non-radioactive isotopic substitutions may
impart new properties on the oligomeric compound that are
beneficial for use as a therapeutic or research tool. In certain
embodiments, radioactive isotopic substitutions may make the
compound suitable for research or diagnostic purposes such as
imaging.
Certain Mechanisms
[0323] In certain embodiments, compounds described herein comprise
or consist of modified oligonucleotides. In certain embodiments,
compounds described herein are antisense compounds. In certain
embodiments, compounds comprise oligomeric compounds. In certain
embodiments, compounds described herein are capable of hybridizing
to a DNM2 target nucleic acid, resulting in at least one antisense
activity. In certain embodiments, compounds described herein
selectively affect one or more target nucleic acid. Such compounds
comprise a nucleobase sequence that hybridizes to one or more
target nucleic acid, resulting in one or more desired antisense
activity and does not hybridize to one or more non-target nucleic
acid or does not hybridize to one or more non-target nucleic acid
in such a way that results in a significant undesired antisense
activity.
[0324] In certain antisense activities, hybridization of a compound
described herein to a target nucleic acid results in recruitment of
a protein that cleaves the target nucleic acid. For example,
certain compounds described herein result in RNase H mediated
cleavage of the target nucleic acid. RNase H is a cellular
endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The
DNA in such an RNA:DNA duplex need not be unmodified DNA. In
certain embodiments, compounds described herein are sufficiently
"DNA-like" to elicit RNase H activity. Further, in certain
embodiments, one or more non-DNA-like nucleoside in the gap of a
gapmer is tolerated.
[0325] In certain antisense activities, compounds described herein
or a portion of the compound is loaded into an RNA-induced
silencing complex (RISC), ultimately resulting in cleavage of the
target nucleic acid. For example, certain compounds described
herein result in cleavage of the target nucleic acid by Argonaute.
Compounds that are loaded into RISC are RNAi compounds. RNAi
compounds may be double-stranded (siRNA) or single-stranded
(ssRNA).
[0326] Antisense activities may be observed directly or indirectly.
In certain embodiments, observation or detection of an antisense
activity involves observation or detection of a change in an amount
of a target nucleic acid or protein encoded by such target nucleic
acid, a change in the ratio of splice variants of a nucleic acid or
protein, and/or a phenotypic change in a cell or animal.
Target Nucleic Acids, Target Regions and Nucleotide Sequences
[0327] In certain embodiments, compounds described herein comprise
or consist of an oligonucleotide comprising a region that is
complementary to a target nucleic acid. In certain embodiments, the
target nucleic acid is an endogenous RNA molecule. In certain
embodiments, the target nucleic acid encodes a protein. In certain
such embodiments, the target nucleic acid is selected from: an mRNA
and a pre-mRNA, including intronic, exonic and untranslated
regions. In certain embodiments, the target RNA is an mRNA. In
certain embodiments, the target nucleic acid is a pre-mRNA. In
certain embodiments, a pre-mRNA and corresponding mRNA are both
target nucleic acids of a single compound. In certain such
embodiments, the target region is entirely within an intron of a
target pre-mRNA. In certain embodiments, the target region spans an
intron/exon junction. In certain embodiments, the target region is
at least 50% within an intron. Target nucleic acid sequences that
encode DNM2 include, without limitation, the following: RefSeq or
GenBank Accession No. NC_000019.10 truncated from nucleosides
10715001 to Ser. No. 10/835,000, NM_004945.3, NM_001005361.2, or
NM_001005360.2 (SEQ ID Nos: 1, 2, 3, and 3135, respectively).
Hybridization
[0328] In some embodiments, hybridization occurs between a compound
disclosed herein and a DNM2 nucleic acid. The most common mechanism
of hybridization involves hydrogen bonding (e.g., Watson-Crick,
Hoogsteen or reversed Hoogsteen hydrogen bonding) between
complementary nucleobases of the nucleic acid molecules.
[0329] Hybridization can occur under varying conditions.
Hybridization conditions are sequence-dependent and are determined
by the nature and composition of the nucleic acid molecules to be
hybridized.
[0330] Methods of determining whether a sequence is specifically
hybridizable to a target nucleic acid are well known in the art. In
certain embodiments, the compounds provided herein are specifically
hybridizable with a DNM2 nucleic acid.
Complementarity
[0331] In certain embodiments, compounds described herein comprise
or consist of modified oligonucleotides. In certain embodiments,
compounds described herein are antisense compounds. In certain
embodiments, compounds comprise oligomeric compounds. In certain
embodiments, oligonucleotides complementary to a DNM2 nucleic acid
comprise nucleobase that are non-complementary with the DNM2
nucleic acid, yet may be tolerated provided that the compound
remains able to specifically hybridize to a target nucleic acid.
Moreover, a compound may hybridize over one or more segments of a
DNM2 nucleic acid such that intervening or adjacent segments are
not involved in the hybridization event (e.g., a loop structure,
mismatch or hairpin structure).
[0332] In certain embodiments, the compounds provided herein, or a
specified portion thereof, are, are at least, or are up to 70%,
80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99%, or 100% complementary to a DNM2 nucleic acid, a
target region, target segment, or specified portion thereof. In
certain embodiments, the compounds provided herein, or a specified
portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to
90%, 90% to 95%, 95% to 100%, or any number in between these
ranges, complementary to a DNM2 nucleic acid, a target region,
target segment, or specified portion thereof. Percent
complementarity of a compound with a target nucleic acid can be
determined using routine methods.
[0333] For example, a compound in which 18 of 20 nucleobases of the
compound are complementary to a target region, and would therefore
specifically hybridize, would represent 90 percent complementarity.
In this example, the remaining non-complementary nucleobases may be
clustered or interspersed with complementary nucleobases and need
not be contiguous to each other or to complementary nucleobases. As
such, a compound which is 18 nucleobases in length having four
non-complementary nucleobases which are flanked by two regions of
complete complementarity with the target nucleic acid would have
77.8% overall complementarity with the target nucleic acid. Percent
complementarity of a compound with a region of a target nucleic
acid can be determined routinely using BLAST programs (basic local
alignment search tools) and PowerBLAST programs known in the art
(Altschul et al., J Mol. Biol., 1990, 215, 403 410; Zhang and
Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence
identity or complementarity, can be determined by, for example, the
Gap program (Wisconsin Sequence Analysis Package, Version 8 for
Unix, Genetics Computer Group, University Research Park, Madison
Wis.), using default settings, which uses the algorithm of Smith
and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
[0334] In certain embodiments, compounds described herein, or
specified portions thereof, are fully complementary (i.e. 100%
complementary) to a target nucleic acid, or specified portion
thereof. For example, a compound may be 100% complementary to a
DNM2 nucleic acid, or a target region, or a target segment or
target sequence thereof. As used herein, "fully complementary"
means each nucleobase of a compound is complementary to the
corresponding nucleobase of a target nucleic acid. For example, a
20 nucleobase compound is fully complementary to a target sequence
that is 400 nucleobases long, so long as there is a corresponding
20 nucleobase portion of the target nucleic acid that is fully
complementary to the compound. Fully complementary can also be used
in reference to a specified portion of the first and/or the second
nucleic acid. For example, a 20 nucleobase portion of a 30
nucleobase compound can be "fully complementary" to a target
sequence that is 400 nucleobases long. The 20 nucleobase portion of
the 30 nucleobase compound is fully complementary to the target
sequence if the target sequence has a corresponding 20 nucleobase
portion wherein each nucleobase is complementary to the 20
nucleobase portion of the compound. At the same time, the entire 30
nucleobase compound may or may not be fully complementary to the
target sequence, depending on whether the remaining 10 nucleobases
of the compound are also complementary to the target sequence.
[0335] In certain embodiments, compounds described herein comprise
one or more mismatched nucleobases relative to the target nucleic
acid. In certain such embodiments, antisense activity against the
target is reduced by such mismatch, but activity against a
non-target is reduced by a greater amount. Thus, in certain such
embodiments selectivity of the compound is improved. In certain
embodiments, the mismatch is specifically positioned within an
oligonucleotide having a gapmer motif. In certain such embodiments,
the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the
5'-end of the gap segment. In certain such embodiments, the
mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3'-end
of the gap segment. In certain such embodiments, the mismatch is at
position 1, 2, 3, or 4 from the 5'-end of the wing segment. In
certain such embodiments, the mismatch is at position 4, 3, 2, or 1
from the 3'-end of the wing segment. In certain embodiments, the
mismatch is specifically positioned within an oligonucleotide not
having a gapmer motif. In certain such embodiments, the mismatch is
at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the
5'-end of the oligonucleotide. In certain such embodiments, the
mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12
from the 3'-end of the oligonucleotide.
[0336] The location of a non-complementary nucleobase may be at the
5' end or 3' end of the compound. Alternatively, the
non-complementary nucleobase or nucleobases may be at an internal
position of the compound. When two or more non-complementary
nucleobases are present, they may be contiguous (i.e., linked) or
non-contiguous. In one embodiment, a non-complementary nucleobase
is located in the wing segment of a gapmer oligonucleotide.
[0337] In certain embodiments, compounds described herein that are,
or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases
in length comprise no more than 4, no more than 3, no more than 2,
or no more than 1 non-complementary nucleobase(s) relative to a
target nucleic acid, such as a DNM2 nucleic acid, or specified
portion thereof.
[0338] In certain embodiments, compounds described herein that are,
or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no
more than 6, no more than 5, no more than 4, no more than 3, no
more than 2, or no more than 1 non-complementary nucleobase(s)
relative to a target nucleic acid, such as a DNM2 nucleic acid, or
specified portion thereof.
[0339] In certain embodiments, compounds described herein also
include those which are complementary to a portion (a defined
number of contiguous nucleobases within a region or segment) of a
target nucleic acid. In certain embodiments, the compounds, are
complementary to at least an 8 nucleobase portion of a target
segment. In certain embodiments, the compounds are complementary to
at least a 9 nucleobase portion of a target segment. In certain
embodiments, the compounds are complementary to at least a 10
nucleobase portion of a target segment. In certain embodiments, the
compounds are complementary to at least an 11 nucleobase portion of
a target segment. In certain embodiments, the compounds are
complementary to at least a 12 nucleobase portion of a target
segment. In certain embodiments, the compounds are complementary to
at least a 13 nucleobase portion of a target segment. In certain
embodiments, the compounds are complementary to at least a 14
nucleobase portion of a target segment. In certain embodiments, the
compounds are complementary to at least a 15 nucleobase portion of
a target segment. In certain embodiments, the compounds are
complementary to at least a 16 nucleobase portion of a target
segment. Also contemplated are compounds that are complementary to
at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more
nucleobase portion of a target segment, or a range defined by any
two of these values.
Certain Compounds
[0340] In certain embodiments, compounds described herein comprise
or consist of oligonucleotides consisting of linked nucleosides.
Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or
may be modified oligonucleotides. Modified oligonucleotides
comprise at least one modification relative to unmodified RNA or
DNA (i.e., comprise at least one modified nucleoside (comprising a
modified sugar moiety and/or a modified nucleobase) and/or at least
one modified internucleoside linkage).
[0341] I. Modifications
[0342] A. Modified Nucleosides
[0343] Modified nucleosides comprise a modified sugar moiety or a
modified nucleobase or both a modified sugar moiety and a modified
nucleobase.
[0344] 1. Modified Sugar Moieties
[0345] In certain embodiments, sugar moieties are non-bicyclic
modified sugar moieties. In certain embodiments, modified sugar
moieties are bicyclic or tricyclic sugar moieties. In certain
embodiments, modified sugar moieties are sugar surrogates. Such
sugar surrogates may comprise one or more substitutions
corresponding to those of other types of modified sugar
moieties.
In certain embodiments, modified sugar moieties are non-bicyclic
modified furanosyl sugar moieties comprising one or more acyclic
substituent, including but not limited to substituents at the 2',
4', and/or 5' positions. In certain embodiments, the furanosyl
sugar moiety is a ribosyl sugar moiety. In certain embodiments one
or more acyclic substituent of non-bicyclic modified sugar moieties
is branched. Examples of 2'-substituent groups suitable for
non-bicyclic modified sugar moieties include but are not limited
to: 2'-F, 2'-OCH.sub.3 ("OMe" or "O-methyl"), and
2'-O(CH.sub.2).sub.2OCH.sub.3 ("MOE"). In certain embodiments,
2'-substituent groups are selected from among: halo, allyl, amino,
azido, SH, CN, OCN, CF.sub.3, OCF.sub.3, O--C.sub.1-C.sub.10
alkoxy, O--C.sub.1-C.sub.10 substituted alkoxy, C.sub.1-C.sub.10
alkyl, O--C.sub.1-C.sub.10 substituted alkyl, S-alkyl,
N(R.sub.m)-alkyl, O-alkenyl, S-alkenyl, N(R.sub.m)-alkenyl,
O-alkynyl, S-alkynyl, N(R.sub.m)-alkynyl, O-alkylenyl-O-alkyl,
alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl,
O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2N(R.sub.m)(R.sub.n) or
OCH.sub.2C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group, or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl, and the
2'-substituent groups described in Cook et al., U.S. Pat. No.
6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al.,
U.S. Pat. No. 6,005,087. Certain embodiments of these
2'-substituent groups can be further substituted with one or more
substituent groups independently selected from among: hydroxyl,
amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol,
thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
Examples of 4'-substituent groups suitable for non-bicyclic
modified sugar moieties include but are not limited to alkoxy
(e.g., methoxy), alkyl, and those described in Manoharan et al., WO
2015/106128. Examples of 5'-substituent groups suitable for
non-bicyclic modified sugar moieties include but are not limited
to: 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain
embodiments, non-bicyclic modified sugars comprise more than one
non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar
moieties and the modified sugar moieties and modified nucleosides
described in Migawa et al., WO 2008/101157 and Rajeev et al.,
US2013/0203836).
[0346] In certain embodiments, a 2'-substituted nucleoside or
2'-non-bicyclic modified nucleoside comprises a sugar moiety
comprising a non-bridging 2'-substituent group selected from: F,
NH.sub.2, N.sub.3, OCF.sub.3, OCH.sub.3, O(CH.sub.2).sub.3NH.sub.2,
CH.sub.2CH.dbd.CH.sub.2, OCH.sub.2CH.dbd.CH.sub.2,
OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3,
O(CH.sub.2).sub.20N(R.sub.m)(R.sub.n),
O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
N-substituted acetamide (OCH.sub.2C(.dbd.O)--N(R.sub.m)(R.sub.n)),
where each R.sub.m and R.sub.n is, independently, H, an amino
protecting group, or substituted or unsubstituted C.sub.1-C.sub.10
alkyl.
[0347] In certain embodiments, a 2'-substituted nucleoside or
2'-non-bicyclic modified nucleoside comprises a sugar moiety
comprising a non-bridging 2'-substituent group selected from: F,
OCF.sub.3, OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3,
O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.20N(CH.sub.3).sub.2,
O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
OCH.sub.2C(.dbd.O)--N(H)CH.sub.3 ("NMA").
[0348] In certain embodiments, a 2'-substituted nucleoside or
2'-non-bicyclic modified nucleoside comprises a sugar moiety
comprising a non-bridging 2'-substituent group selected from: F,
OCH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.
[0349] Nucleosides comprising modified sugar moieties, such as
non-bicyclic modified sugar moieties, may be referred to by the
position(s) of the substitution(s) on the sugar moiety of the
nucleoside. For example, nucleosides comprising 2'-substituted or
2-modified sugar moieties are referred to as 2'-substituted
nucleosides or 2-modified nucleosides.
[0350] Certain modified sugar moieties comprise a bridging sugar
substituent that forms a second ring resulting in a bicyclic sugar
moiety. In certain such embodiments, the bicyclic sugar moiety
comprises a bridge between the 4' and the 2' furanose ring atoms.
In certain such embodiments, the furanose ring is a ribose ring.
Examples of such 4' to 2' bridging sugar substituents include but
are not limited to: 4'-CH.sub.2-2', 4'-(CH.sub.2).sub.2-2',
4'-(CH.sub.2).sub.3-2', 4'-CH.sub.2--O-2' ("LNA"),
4'-CH.sub.2--S-2', 4'-(CH.sub.2).sub.2--O-2' ("ENA"), 4'-
CH(CH.sub.3)--O-2' (referred to as "constrained ethyl" or "cEt"
when in the S configuration), 4'-CH.sub.2--O--CH.sub.2-2',
4'-CH.sub.2--N(R)-2', 4'-C--H(CH.sub.2OCH.sub.3)--O-2'
("constrained MOE" or "cMOE") and analogs thereof (see, e.g., Seth
et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No.
7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et
al., U.S. Pat. No. 8,022,193), 4'-C(CH.sub.3)(CH.sub.3)--O-2' and
analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283),
4'-CH.sub.2--N(OCH.sub.3)-2' and analogs thereof (see, e.g.,
Prakash et al., U.S. Pat. No. 8,278,425),
4'-CH.sub.2--O--N(CH.sub.3)-2' (see, e.g., Allerson et al., U.S.
Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745),
4'-CH.sub.2--C(H)(CH.sub.3)-2' (see, e.g., Zhou, et al., J Org.
Chem., 2009, 74, 118-134), 4'-CH.sub.2--C(.dbd.CH.sub.2)-2' and
analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426),
4'-C(R.sub.aR.sub.b)--N(R)--O-2', 4'-C(R.sub.aR.sub.b)--O--N(R)-2',
4'-CH.sub.2--N(R)-2', and 4'-CH.sub.2--N(R)--O-2', wherein each R,
R.sub.a, and R.sub.b is, independently, H, a protecting group, or
C.sub.1-C.sub.12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No.
7,427,672).
[0351] In certain embodiments, such 4' to 2' bridges independently
comprise from 1 to 4 linked groups independently selected from:
--[C(R.sub.a)(R.sub.b)].sub.n--,
--[C(R.sub.a)(R.sub.b)].sub.n--O--, --C(R.sub.a).dbd.C(R.sub.b)--,
--C(R.sub.a).dbd.N--, --C(.dbd.NR.sub.a)--, --C(.dbd.O)--,
--C(.dbd.S)--, --O--, --Si(R.sub.a).sub.2--, --S(.dbd.O).sub.x--,
and --N(R.sub.a)--;
[0352] wherein:
[0353] x is 0, 1, or 2;
[0354] n is 1, 2, 3, or 4;
[0355] each R.sub.a and R.sub.b is, independently, H, a protecting
group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle
radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7
alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical,
halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1,
acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
[0356] each J.sub.1 and J.sub.2 is, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.
[0357] Additional bicyclic sugar moieties are known in the art,
see, for example: Freier et al., Nucleic Acids Research, 1997,
25(22), 4429-4443, Albaek et al., J Org. Chem., 2006, 71,
7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin
et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg.
Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J Org. Chem.,
1998, 63, 10035-10039; Srivastava et al., J Am. Chem. Soc., 20017,
129, 8362-8379; Elayadi et al., Wengel et a., U.S. Pat. No.
7,053,207; Imanishi et al., U.S. Pat. No. 6,268,490; Imanishi et
al. U.S. Pat. No. 6,770,748; Imanishi et al., U.S. RE44,779; Wengel
et al., U.S. Pat. No. 6,794,499; Wengel et al., U.S. Pat. No.
6,670,461; Wengel et al., U.S. Pat. No. 7,034,133; Wengel et al.,
U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909;
Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat.
No. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191;
Torsten et al., WO 2004/106356; Wengel et al., WO 1999/014226; Seth
et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth
et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No.
8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S.
Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et
al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640;
Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No.
8,501,805; and U.S. Patent Publication Nos. Allerson et al.,
US2008/0039618 and Migawa et al., US2015/0191727.
[0358] In certain embodiments, bicyclic sugar moieties and
nucleosides incorporating such bicyclic sugar moieties are further
defined by isomeric configuration. For example, an LNA nucleoside
(described herein) may be in the .alpha.-L configuration or in the
.beta.-D configuration.
##STR00006##
.alpha.-L-methyleneoxy (4'-CH.sub.2--O-2') or .alpha.-L-LNA
bicyclic nucleosides have been incorporated into antisense
oligonucleotides that showed antisense activity (Frieden et al.,
Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general
descriptions of bicyclic nucleosides include both isomeric
configurations. When the positions of specific bicyclic nucleosides
(e.g., LNA) are identified in exemplified embodiments herein, they
are in the f-D configuration, unless otherwise specified.
[0359] In certain embodiments, modified sugar moieties comprise one
or more non-bridging sugar substituent and one or more bridging
sugar substituent (e.g., 5'-substituted and 4'-2' bridged
sugars).
[0360] In certain embodiments, modified sugar moieties are sugar
surrogates. In certain such embodiments, the oxygen atom of the
sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen
atom. In certain such embodiments, such modified sugar moieties
also comprise bridging and/or non-bridging substituents as
described herein. For example, certain sugar surrogates comprise a
4'-sulfur atom and a substitution at the 2'-position (see, e.g.,
Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No.
7,939,677) and/or the 5' position.
[0361] In certain embodiments, sugar surrogates comprise rings
having other than 5 atoms. For example, in certain embodiments, a
sugar surrogate comprises a six-membered tetrahydropyran ("THP").
Such tetrahydropyrans may be further modified or substituted.
Nucleosides comprising such modified tetrahydropyrans include but
are not limited to hexitol nucleic acid ("HNA"), anitol nucleic
acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, C
J. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:
##STR00007##
("F-HNA", see e.g. Swayze et al., U.S. Pat. No. 8,088,904; Swayze
et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S. Pat. No.
8,796,437; and Swayze et al., U.S. Pat. No. 9,005,906; F-HNA can
also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and
nucleosides comprising additional modified THP compounds having the
formula:
##STR00008##
wherein, independently, for each of said modified THP
nucleoside:
[0362] Bx is a nucleobase moiety;
[0363] T.sub.3 and T.sub.4 are each, independently, an
internucleoside linking group linking the modified THP nucleoside
to the remainder of an oligonucleotide or one of T.sub.3 and
T.sub.4 is an internucleoside linking group linking the modified
THP nucleoside to the remainder of an oligonucleotide and the other
of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked
conjugate group, or a 5' or 3-terminal group; q.sub.1, q.sub.2,
q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each,
independently, H, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted
C.sub.2-C.sub.6 alkynyl; and
[0364] each of R.sub.1 and R.sub.2 is independently selected from
among: hydrogen, halogen, substituted or unsubstituted alkoxy,
NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1,
OC(.dbd.X)NJ.sub.1J.sub.2, NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2, and
CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and
J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.
[0365] In certain embodiments, modified THP nucleosides are
provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5,
q.sub.6 and q.sub.7 are each H. In certain embodiments, at least
one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and
q.sub.7 is other than H. In certain embodiments, at least one of
q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is
methyl. In certain embodiments, modified THP nucleosides are
provided wherein one of R.sub.1 and R.sub.2 is F. In certain
embodiments, R.sub.1 is F and R.sub.2 is H, in certain embodiments,
R.sub.1 is methoxy and R.sub.2 is H, and in certain embodiments,
R.sub.1 is methoxyethoxy and R.sub.2 is H.
[0366] In certain embodiments, sugar surrogates comprise rings
having more than 5 atoms and more than one heteroatom. For example,
nucleosides comprising morpholino sugar moieties and their use in
oligonucleotides have been reported (see, e.g., Braasch et al.,
Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat.
No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton
et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat.
No. 5,034,506). As used here, the term "morpholino" means a sugar
surrogate having the following structure:
##STR00009##
In certain embodiments, morpholinos may be modified, for example by
adding or altering various substituent groups from the above
morpholino structure. Such sugar surrogates are referred to herein
as "modified morpholinos."
[0367] In certain embodiments, sugar surrogates comprise acyclic
moieties. Examples of nucleosides and oligonucleotides comprising
such acyclic sugar surrogates include but are not limited to:
peptide nucleic acid ("PNA"), acyclic butyl nucleic acid (see,
e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and
nucleosides and oligonucleotides described in Manoharan et al.,
WO2011/133876.
[0368] Many other bicyclic and tricyclic sugar and sugar surrogate
ring systems are known in the art that can be used in modified
nucleosides).
[0369] 2. Modified Nucleobases
[0370] In certain embodiments, modified nucleobases are selected
from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl
substituted pyrimidines, alkyl substituted purines, and N-2, N-6
and O-6 substituted purines. In certain embodiments, modified
nucleobases are selected from: 2-aminopropyladenine,
5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine,
6-N-methylguanine, 6-N-methyladenine, 2-propyladenine,
2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl
(--C.ident.C--CH.sub.3) uracil, 5-propynylcytosine, 6-azouracil,
6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil),
4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl,
8-aza and other 8-substituted purines, 5-halo, particularly
5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine,
7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine,
7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine,
6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine,
4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl
4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous
bases, size-expanded bases, and fluorinated bases. Further modified
nucleobases include tricyclic pyrimidines, such as
1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and
9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified
nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in Merigan et al., U.S.
Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of
Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley
& Sons, 1990, 858-859; Englisch et al., Angewandte Chemie,
International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15,
Antisense Research and Applications, Crooke, S. T. and Lebleu, B.,
Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6
and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press,
2008, 163-166 and 442-443.
[0371] Publications that teach the preparation of certain of the
above noted modified nucleobases as well as other modified
nucleobases include without limitation, Manohara et al.,
US2003/0158403; Manoharan et al., US2003/0175906; Dinh et al., U.S.
Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302;
Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S.
Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner
et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No.
5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al.,
U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908;
Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S.
Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540;
Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat.
No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et
al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No.
5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S.
Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et
al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470;
Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat.
No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et
al., U.S. Pat. No. 5,808,027; Cook et al., 6,166,199; and Matteucci
et al., U.S. Pat. No. 6,005,096.
[0372] In certain embodiments, compounds comprise or consist of a
modified oligonucleotide complementary to an .alpha.-DNM2 nucleic
acid comprising one or more modified nucleobases. In certain
embodiments, the modified nucleobase is 5-methylcytosine. In
certain embodiments, each cytosine is a 5-methylcytosine.
[0373] B. Modified Internucleoside Linkages
[0374] In certain embodiments, compounds described herein having
one or more modified internucleoside linkages are selected over
compounds having only phosphodiester internucleoside linkages
because of desirable properties such as, for example, enhanced
cellular uptake, enhanced affinity for target nucleic acids, and
increased stability in the presence of nucleases.
[0375] In certain embodiments, compounds comprise or consist of a
modified oligonucleotide complementary to a DNM2 nucleic acid
comprising one or more modified internucleoside linkages. In
certain embodiments, the modified internucleoside linkages are
phosphorothioate linkages. In certain embodiments, each
internucleoside linkage of an antisense compound is a
phosphorothioate internucleoside linkage.
[0376] In certain embodiments, nucleosides of modified
oligonucleotides may be linked together using any internucleoside
linkage. The two main classes of internucleoside linking groups are
defined by the presence or absence of a phosphorus atom.
Representative phosphorus-containing internucleoside linkages
include but are not limited to phosphates, which contain a
phosphodiester bond ("P.dbd.O") (also referred to as unmodified or
naturally occurring linkages), phosphotriesters,
methylphosphonates, phosphoramidates, and phosphorothioates
("P.dbd.S"), and phosphorodithioates ("HS--P=S"). Representative
non-phosphorus containing internucleoside linking groups include
but are not limited to methylenemethylimino
(--CH.sub.2--N(CH.sub.3)--O--CH.sub.2--), thiodiester,
thionocarbamate (--O--C(.dbd.O)(NH)--S--); siloxane
(--O--SiH.sub.2--O--); and N,N'-dimethylhydrazine
(--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--). Modified internucleoside
linkages, compared to naturally occurring phosphate linkages, can
be used to alter, typically increase, nuclease resistance of the
oligonucleotide. Methods of preparation of phosphorous-containing
and non-phosphorous-containing internucleoside linkages are well
known to those skilled in the art.
[0377] Representative internucleoside linkages having a chiral
center include but are not limited to alkylphosphonates and
phosphorothioates. Modified oligonucleotides comprising
internucleoside linkages having a chiral center can be prepared as
populations of modified oligonucleotides comprising stereorandom
internucleoside linkages, or as populations of modified
oligonucleotides comprising phosphorothioate linkages in particular
stereochemical configurations. In certain embodiments, populations
of modified oligonucleotides comprise phosphorothioate
internucleoside linkages wherein all of the phosphorothioate
internucleoside linkages are stereorandom. Such modified
oligonucleotides can be generated using synthetic methods that
result in random selection of the stereochemical configuration of
each phosphorothioate linkage. Nonetheless, as is well understood
by those of skill in the art, each individual phosphorothioate of
each individual oligonucleotide molecule has a defined
stereoconfiguration. In certain embodiments, populations of
modified oligonucleotides are enriched for modified
oligonucleotides comprising one or more particular phosphorothioate
internucleoside linkages in a particular, independently selected
stereochemical configuration. In certain embodiments, the
particular configuration of the particular phosphorothioate linkage
is present in at least 65% of the molecules in the population. In
certain embodiments, the particular configuration of the particular
phosphorothioate linkage is present in at least 70% of the
molecules in the population. In certain embodiments, the particular
configuration of the particular phosphorothioate linkage is present
in at least 80% of the molecules in the population. In certain
embodiments, the particular configuration of the particular
phosphorothioate linkage is present in at least 90% of the
molecules in the population. In certain embodiments, the particular
configuration of the particular phosphorothioate linkage is present
in at least 99% of the molecules in the population. Such chirally
enriched populations of modified oligonucleotides can be generated
using synthetic methods known in the art, e.g., methods described
in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res.
42, 13456 (2014), and WO 2017/015555. In certain embodiments, a
population of modified oligonucleotides is enriched for modified
oligonucleotides having at least one indicated phosphorothioate in
the (Sp) configuration. In certain embodiments, a population of
modified oligonucleotides is enriched for modified oligonucleotides
having at least one phosphorothioate in the (Rp) configuration. In
certain embodiments, modified oligonucleotides comprising (Rp)
and/or (Sp) phosphorothioates comprise one or more of the following
formulas, respectively, wherein "B" indicates a nucleobase:
##STR00010##
Unless otherwise indicated, chiral internucleoside linkages of
modified oligonucleotides described herein can be stereorandom or
in a particular stereochemical configuration.
[0378] Neutral internucleoside linkages include, without
limitation, phosphotriesters, methylphosphonates, MMI
(3'-CH.sub.2--N(CH.sub.3)--O-5'), amide-3
(3'-CH.sub.2--C(.dbd.O)--N(H)-5'), amide-4
(3'-CH.sub.2--N(H)--C(.dbd.O)-5'), formacetal
(3'-O--CH.sub.2--O-5'), methoxypropyl, and thioformacetal
(3'-S--CH.sub.2--O-5'). Further neutral internucleoside linkages
include nonionic linkages comprising siloxane (dialkylsiloxane),
carboxylate ester, carboxamide, sulfide, sulfonate ester and amides
(See for example: Carbohydrate Modifications in Antisense Research;
Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580;
Chapters 3 and 4, 40-65). Further neutral internucleoside linkages
include nonionic linkages comprising mixed N, O, S and CH2
component parts.
[0379] II. Certain Motifs
[0380] In certain embodiments, compounds described herein comprise
or consist of oligonucleotides. Oligonucleotides can have a motif,
e.g. a pattern of unmodified and/or modified sugar moieties,
nucleobases, and/or internucleoside linkages. In certain
embodiments, modified oligonucleotides comprise one or more
modified nucleoside comprising a modified sugar. In certain
embodiments, modified oligonucleotides comprise one or more
modified nucleosides comprising a modified nucleobase. In certain
embodiments, modified oligonucleotides comprise one or more
modified internucleoside linkage. In such embodiments, the
modified, unmodified, and differently modified sugar moieties,
nucleobases, and/or internucleoside linkages of a modified
oligonucleotide define a pattern or motif. In certain embodiments,
the patterns or motifs of sugar moieties, nucleobases, and
internucleoside linkages are each independent of one another. Thus,
a modified oligonucleotide may be described by its sugar motif,
nucleobase motif and/or internucleoside linkage motif (as used
herein, nucleobase motif describes the modifications to the
nucleobases independent of the sequence of nucleobases).
[0381] A. Certain Sugar Motifs
[0382] In certain embodiments, compounds described herein comprise
or consist of oligonucleotides. In certain embodiments,
oligonucleotides comprise one or more type of modified sugar and/or
unmodified sugar moiety arranged along the oligonucleotide or
region thereof in a defined pattern or sugar motif. In certain
instances, such sugar motifs include but are not limited to any of
the sugar modifications discussed herein.
[0383] In certain embodiments, modified oligonucleotides comprise
or consist of a region having a gapmer motif, which comprises two
external segments or "wings" and a central or internal segment or
"gap." The three segments of a gapmer motif (the 5'-wing, the gap,
and the 3'-wing) form a contiguous sequence of nucleosides wherein
at least some of the sugar moieties of the nucleosides of each of
the wings differ from at least some of the sugar moieties of the
nucleosides of the gap. Specifically, at least the sugar moieties
of the nucleosides of each wing that are immediately adjacent to
the gap (the 3'-terminal wing nucleoside of the 5'-wing and the
5'-terminal wing nucleoside of the 3'-wing) differ from the sugar
moiety of the adjacent gap nucleosides. In certain embodiments, the
sugar moieties within the gap are the same as one another. In
certain embodiments, the gap includes one or more nucleoside having
a sugar moiety that differs from the sugar moiety of one or more
other nucleosides of the gap.
[0384] In certain embodiments, the wings of a gapmer each comprise
1-5 nucleosides. In certain embodiments, the wings of a gapmer each
comprise 2-5 nucleosides. In certain embodiments, the wings of a
gapmer each comprise 3-5 nucleosides. In certain embodiments, the
nucleosides of the wings of a gapmer are all modified nucleosides.
In certain such embodiments, the sugar moieties of the wings of a
gapmer are all modified sugar moieties.
[0385] In certain embodiments, the gap of a gapmer comprises 7-12
nucleosides. In certain embodiments, the gap of a gapmer comprises
7-10 nucleosides. In certain embodiments, the gap of a gapmer
comprises 8-10 nucleosides. In certain embodiments, the gap of a
gapmer comprises 10 nucleosides. In certain embodiments, each
nucleoside of the gap of a gapmer is a 2'-deoxynucleoside.
[0386] In certain embodiments, the gapmer is a deoxy gapmer. In
such embodiments, the nucleosides on the gap side of each wing/gap
junction are 2'-deoxynucleosides and the terminal wing nucleosides
immediately adjacent to the gap comprise modified sugar moieties.
In certain such embodiments, each nucleoside of the gap is a
2'-deoxynucleoside. In certain such embodiments, each nucleoside of
each wing comprises a modified sugar moiety.
[0387] In certain embodiments, a modified oligonucleotide has a
fully modified sugar motif wherein each nucleoside of the modified
oligonucleotide comprises a modified sugar moiety. In certain
embodiments, modified oligonucleotides comprise or consist of a
region having a fully modified sugar motif wherein each nucleoside
of the region comprises a modified sugar moiety. In certain
embodiments, modified oligonucleotides comprise or consist of a
region having a fully modified sugar motif, wherein each nucleoside
within the fully modified region comprises the same modified sugar
moiety, referred to herein as a uniformly modified sugar motif. In
certain embodiments, a fully modified oligonucleotide is a
uniformly modified oligonucleotide. In certain embodiments, each
nucleoside of a uniformly modified oligonucleotide comprises the
same 2'-modification.
[0388] B. Certain Nucleobase Motifs
[0389] In certain embodiments, compounds described herein comprise
or consist of oligonucleotides. In certain embodiments,
oligonucleotides comprise modified and/or unmodified nucleobases
arranged along the oligonucleotide or region thereof in a defined
pattern or motif. In certain embodiments, each nucleobase is
modified. In certain embodiments, none of the nucleobases are
modified. In certain embodiments, each purine or each pyrimidine is
modified. In certain embodiments, each adenine is modified. In
certain embodiments, each guanine is modified. In certain
embodiments, each thymine is modified. In certain embodiments, each
uracil is modified. In certain embodiments, each cytosine is
modified. In certain embodiments, some or all of the cytosine
nucleobases in a modified oligonucleotide are
5-methylcytosines.
[0390] In certain embodiments, modified oligonucleotides comprise a
block of modified nucleobases. In certain such embodiments, the
block is at the 3'-end of the oligonucleotide. In certain
embodiments the block is within 3 nucleosides of the 3'-end of the
oligonucleotide. In certain embodiments, the block is at the 5'-end
of the oligonucleotide. In certain embodiments the block is within
3 nucleosides of the 5'-end of the oligonucleotide.
[0391] In certain embodiments, oligonucleotides having a gapmer
motif comprise a nucleoside comprising a modified nucleobase. In
certain such embodiments, one nucleoside comprising a modified
nucleobase is in the gap of an oligonucleotide having a gapmer
motif. In certain such embodiments, the sugar moiety of said
nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the
modified nucleobase is selected from: a 2-thiopyrimidine and a
5-propynepyrimidine.
[0392] C. Certain Internucleoside Linkage Motifs
[0393] In certain embodiments, compounds described herein comprise
or consist of oligonucleotides. In certain embodiments,
oligonucleotides comprise modified and/or unmodified
internucleoside linkages arranged along the oligonucleotide or
region thereof in a defined pattern or motif. In certain
embodiments, each internucleoside linking group is a phosphodiester
internucleoside linkage (P.dbd.O). In certain embodiments, each
internucleoside linking group of a modified oligonucleotide is a
phosphorothioate internucleoside linkage (P.dbd.S). In certain
embodiments, each internucleoside linkage of a modified
oligonucleotide is independently selected from a phosphorothioate
internucleoside linkage and phosphodiester internucleoside linkage.
In certain embodiments, each phosphorothioate internucleoside
linkage is independently selected from a stereorandom
phosphorothioate, a (Sp) phosphorothioate, and a (Rp)
phosphorothioate. In certain embodiments, the sugar motif of a
modified oligonucleotide is a gapmer and the internucleoside
linkages within the gap are all modified. In certain such
embodiments, some or all of the internucleoside linkages in the
wings are unmodified phosphate linkages. In certain embodiments,
the terminal internucleoside linkages are modified. In certain
embodiments, the sugar motif of a modified oligonucleotide is a
gapmer, and the internucleoside linkage motif comprises at least
one phosphodiester internucleoside linkage in at least one wing,
wherein the at least one phosphodiester linkage is not a terminal
internucleoside linkage, and the remaining internucleoside linkages
are phosphorothioate internucleoside linkages. In certain such
embodiments, all of the phosphorothioate linkages are stereorandom.
In certain embodiments, all of the phosphorothioate linkages in the
wings are (Sp) phosphorothioates, and the gap comprises at least
one Sp, Sp, Rp motif. In certain embodiments, populations of
modified oligonucleotides are enriched for modified
oligonucleotides comprising such internucleoside linkage
motifs.
[0394] In certain embodiments, oligonucleotides comprise a region
having an alternating internucleoside linkage motif. In certain
embodiments, oligonucleotides comprise a region of uniformly
modified internucleoside linkages. In certain such embodiments, the
internucleoside linkages are phosphorothioate internucleoside
linkages. In certain embodiments, all of the internucleoside
linkages of the oligonucleotide are phosphorothioate
internucleoside linkages. In certain embodiments, each
internucleoside linkage of the oligonucleotide is selected from
phosphodiester or phosphate and phosphorothioate. In certain
embodiments, each internucleoside linkage of the oligonucleotide is
selected from phosphodiester or phosphate and phosphorothioate and
at least one internucleoside linkage is phosphorothioate.
[0395] In certain embodiments, the oligonucleotide comprises at
least 6 phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least 8
phosphorothioate internucleoside linkages. In certain embodiments,
the oligonucleotide comprises at least 10 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least one block of at least 6
consecutive phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least one block of at
least 8 consecutive phosphorothioate internucleoside linkages. In
certain embodiments, the oligonucleotide comprises at least one
block of at least 10 consecutive phosphorothioate internucleoside
linkages. In certain embodiments, the oligonucleotide comprises at
least block of at least one 12 consecutive phosphorothioate
internucleoside linkages. In certain such embodiments, at least one
such block is located at the 3' end of the oligonucleotide. In
certain such embodiments, at least one such block is located within
3 nucleosides of the 3' end of the oligonucleotide.
[0396] In certain embodiments, oligonucleotides comprise one or
more methylphosphonate linkages. In certain embodiments,
oligonucleotides having a gapmer nucleoside motif comprise a
linkage motif comprising all phosphorothioate linkages except for
one or two methylphosphonate linkages. In certain embodiments, one
methylphosphonate linkage is in the gap of an oligonucleotide
having a gapmer sugar motif.
[0397] In certain embodiments, it is desirable to arrange the
number of phosphorothioate internucleoside linkages and
phosphodiester internucleoside linkages to maintain nuclease
resistance. In certain embodiments, it is desirable to arrange the
number and position of phosphorothioate internucleoside linkages
and the number and position of phosphodiester internucleoside
linkages to maintain nuclease resistance. In certain embodiments,
the number of phosphorothioate internucleoside linkages may be
decreased and the number of phosphodiester internucleoside linkages
may be increased. In certain embodiments, the number of
phosphorothioate internucleoside linkages may be decreased and the
number of phosphodiester internucleoside linkages may be increased
while still maintaining nuclease resistance. In certain embodiments
it is desirable to decrease the number of phosphorothioate
internucleoside linkages while retaining nuclease resistance. In
certain embodiments it is desirable to increase the number of
phosphodiester internucleoside linkages while retaining nuclease
resistance.
[0398] III. Certain Modified Oligonucleotides
[0399] In certain embodiments, compounds described herein comprise
or consist of modified oligonucleotides. In certain embodiments,
the above modifications (sugar, nucleobase, internucleoside
linkage) are incorporated into a modified oligonucleotide. In
certain embodiments, modified oligonucleotides are characterized by
their modifications, motifs, and overall lengths. In certain
embodiments, such parameters are each independent of one another.
Thus, unless otherwise indicated, each internucleoside linkage of
an oligonucleotide having a gapmer sugar motif may be modified or
unmodified and may or may not follow the gapmer modification
pattern of the sugar modifications. Likewise, such gapmer
oligonucleotides may comprise one or more modified nucleobase
independent of the gapmer pattern of the sugar modifications.
Furthermore, in certain instances, an oligonucleotide is described
by an overall length or range and by lengths or length ranges of
two or more regions (e.g., a region of nucleosides having specified
sugar modifications), in such circumstances it may be possible to
select numbers for each range that result in an oligonucleotide
having an overall length falling outside the specified range. In
such circumstances, both elements must be satisfied. For example,
in certain embodiments, a modified oligonucleotide consists of
15-20 linked nucleosides and has a sugar motif consisting of three
regions or segments, A, B, and C, wherein region or segment A
consists of 2-6 linked nucleosides having a specified sugar motif,
region or segment B consists of 6-10 linked nucleosides having a
specified sugar motif, and region or segment C consists of 2-6
linked nucleosides having a specified sugar motif. Such embodiments
do not include modified oligonucleotides where A and C each consist
of 6 linked nucleosides and B consists of 10 linked nucleosides
(even though those numbers of nucleosides are permitted within the
requirements for A, B, and C) because the overall length of such
oligonucleotide is 22, which exceeds the upper limit of 20 for the
overall length of the modified oligonucleotide. Unless otherwise
indicated, all modifications are independent of nucleobase sequence
except that the modified nucleobase 5-methylcytosine is necessarily
a "C" in an oligonucleotide sequence.
[0400] In certain embodiments, oligonucleotides consist of X to Y
linked nucleosides, where X represents the fewest number of
nucleosides in the range and Y represents the largest number
nucleosides in the range. In certain such embodiments, X and Y are
each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and
50; provided that X.ltoreq.Y. For example, in certain embodiments,
oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16,
12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to
23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12
to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19,
13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to
26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14
to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23,
14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to
30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15
to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28,
15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to
21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16
to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21,
17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to
28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18
to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29,
18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to
25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20
to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28,
20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to
26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22
to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24,
23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to
25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25
to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29,
26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29
to 30 linked nucleosides.
[0401] In certain embodiments oligonucleotides have a nucleobase
sequence that is complementary to a second oligonucleotide or an
identified reference nucleic acid, such as a target nucleic acid.
In certain embodiments, a region of an oligonucleotide has a
nucleobase sequence that is complementary to a second
oligonucleotide or an identified reference nucleic acid, such as a
target nucleic acid. In certain embodiments, the nucleobase
sequence of a region or entire length of an oligonucleotide is at
least 70%, at least 80%, at least 90%, at least 95%, or 100%
complementary to the second oligonucleotide or nucleic acid, such
as a target nucleic acid.
[0402] IV. Certain Conjugated Compounds
[0403] In certain embodiments, the compounds described herein
comprise or consist of an oligonucleotide (modified or unmodified)
and optionally one or more conjugate groups and/or terminal groups.
Conjugate groups consist of one or more conjugate moiety and a
conjugate linker that links the conjugate moiety to the
oligonucleotide. Conjugate groups may be attached to either or both
ends of an oligonucleotide and/or at any internal position. In
certain embodiments, conjugate groups are attached to the
2-position of a nucleoside of a modified oligonucleotide. In
certain embodiments, conjugate groups that are attached to either
or both ends of an oligonucleotide are terminal groups. In certain
such embodiments, conjugate groups or terminal groups are attached
at the 3' and/or 5'-end of oligonucleotides. In certain such
embodiments, conjugate groups (or terminal groups) are attached at
the 3'-end of oligonucleotides. In certain embodiments, conjugate
groups are attached near the 3'-end of oligonucleotides. In certain
embodiments, conjugate groups (or terminal groups) are attached at
the 5'-end of oligonucleotides. In certain embodiments, conjugate
groups are attached near the 5'-end of oligonucleotides.
[0404] Examples of terminal groups include but are not limited to
conjugate groups, capping groups, phosphate moieties, protecting
groups, modified or unmodified nucleosides, and two or more
nucleosides that are independently modified or unmodified.
[0405] A. Certain Conjugate Groups
[0406] In certain embodiments, oligonucleotides are covalently
attached to one or more conjugate groups. In certain embodiments,
conjugate groups modify one or more properties of the attached
oligonucleotide, including but not limited to pharmacodynamics,
pharmacokinetics, stability, binding, absorption, tissue
distribution, cellular distribution, cellular uptake, charge and
clearance. In certain embodiments, conjugate groups impart a new
property on the attached oligonucleotide, e.g., fluorophores or
reporter groups that enable detection of the oligonucleotide.
[0407] Certain conjugate groups and conjugate moieties have been
described previously, for example: cholesterol moiety (Letsinger et
al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid
(Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a
thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y.
Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med.
Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et
al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain,
e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al.,
EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990,
259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic, a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J
Pharmacol. Exp. Ther., 1996, i, 923-937), a tocopherol group
(Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220;
doi:10.1038/mtna.2014.72 and Nishina et al., Molecular Therapy,
2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).
[0408] 1. Conjugate Moieties
[0409] Conjugate moieties include, without limitation,
intercalators, reporter molecules, polyamines, polyamides,
peptides, carbohydrates (e.g., GalNAc), vitamin moieties,
polyethylene glycols, thioethers, polyethers, cholesterols,
thiocholesterols, cholic acid moieties, folate, lipids,
phospholipids, biotin, phenazine, phenanthridine, anthraquinone,
adamantane, acridine, fluoresceins, rhodamines, coumarins,
fluorophores, and dyes.
[0410] In certain embodiments, a conjugate moiety comprises an
active drug substance, for example, aspirin, warfarin,
phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen,
(S)-(+)-pranoprofen, carprofen, dansylsarcosine,
2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic
acid, a benzothiadiazide, chlorothiazide, a diazepine,
indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an
antidiabetic, an antibacterial or an antibiotic.
[0411] 2. Conjugate Linkers
[0412] Conjugate moieties are attached to oligonucleotides through
conjugate linkers. In certain compounds, a conjugate group is a
single chemical bond (i.e. conjugate moiety is attached to an
oligonucleotide via a conjugate linker through a single bond). In
certain embodiments, the conjugate linker comprises a chain
structure, such as a hydrocarbyl chain, or an oligomer of repeating
units such as ethylene glycol, nucleosides, or amino acid
units.
[0413] In certain embodiments, a conjugate linker comprises one or
more groups selected from alkyl, amino, oxo, amide, disulfide,
polyethylene glycol, ether, thioether, and hydroxylamino. In
certain such embodiments, the conjugate linker comprises groups
selected from alkyl, amino, oxo, amide and ether groups. In certain
embodiments, the conjugate linker comprises groups selected from
alkyl and amide groups. In certain embodiments, the conjugate
linker comprises groups selected from alkyl and ether groups. In
certain embodiments, the conjugate linker comprises at least one
phosphorus moiety. In certain embodiments, the conjugate linker
comprises at least one phosphate group. In certain embodiments, the
conjugate linker includes at least one neutral linking group.
[0414] In certain embodiments, conjugate linkers, including the
conjugate linkers described above, are bifunctional linking
moieties, e.g., those known in the art to be useful for attaching
conjugate groups to parent compounds, such as the oligonucleotides
provided herein. In general, a bifunctional linking moiety
comprises at least two functional groups. One of the functional
groups is selected to bind to a particular site on a compound and
the other is selected to bind to a conjugate group. Examples of
functional groups used in a bifunctional linking moiety include but
are not limited to electrophiles for reacting with nucleophilic
groups and nucleophiles for reacting with electrophilic groups. In
certain embodiments, bifunctional linking moieties comprise one or
more groups selected from amino, hydroxyl, carboxylic acid, thiol,
alkyl, alkenyl, and alkynyl.
[0415] Examples of conjugate linkers include but are not limited to
pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and
6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include
but are not limited to substituted or unsubstituted
C.sub.1-C.sub.10 alkyl, substituted or unsubstituted
C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted
C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred
substituent groups includes hydroxyl, amino, alkoxy, carboxy,
benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl,
alkenyl and alkynyl.
[0416] In certain embodiments, conjugate linkers comprise 1-10
linker-nucleosides. In certain embodiments, such linker-nucleosides
are modified nucleosides. In certain embodiments such
linker-nucleosides comprise a modified sugar moiety. In certain
embodiments, linker-nucleosides are unmodified. In certain
embodiments, linker-nucleosides comprise an optionally protected
heterocyclic base selected from a purine, substituted purine,
pyrimidine or substituted pyrimidine. In certain embodiments, a
cleavable moiety is a nucleoside selected from uracil, thymine,
cytosine, 4-N-benzoylcytosine, 5-methylcytosine,
4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine
and 2-N-isobutyrylguanine. It is typically desirable for
linker-nucleosides to be cleaved from the compound after it reaches
a target tissue. Accordingly, linker-nucleosides are typically
linked to one another and to the remainder of the compound through
cleavable bonds. In certain embodiments, such cleavable bonds are
phosphodiester bonds.
[0417] Herein, linker-nucleosides are not considered to be part of
the oligonucleotide. Accordingly, in embodiments in which a
compound comprises an oligonucleotide consisting of a specified
number or range of linked nucleosides and/or a specified percent
complementarity to a reference nucleic acid and the compound also
comprises a conjugate group comprising a conjugate linker
comprising linker-nucleosides, those linker-nucleosides are not
counted toward the length of the oligonucleotide and are not used
in determining the percent complementarity of the oligonucleotide
for the reference nucleic acid. For example, a compound may
comprise (1) a modified oligonucleotide consisting of 8-30
nucleosides and (2) a conjugate group comprising 1-10
linker-nucleosides that are contiguous with the nucleosides of the
modified oligonucleotide. The total number of contiguous linked
nucleosides in such a compound is more than 30. Alternatively, an
compound may comprise a modified oligonucleotide consisting of 8-30
nucleosides and no conjugate group. The total number of contiguous
linked nucleosides in such a compound is no more than 30. Unless
otherwise indicated conjugate linkers comprise no more than 10
linker-nucleosides. In certain embodiments, conjugate linkers
comprise no more than 5 linker-nucleosides. In certain embodiments,
conjugate linkers comprise no more than 3 linker-nucleosides. In
certain embodiments, conjugate linkers comprise no more than 2
linker-nucleosides. In certain embodiments, conjugate linkers
comprise no more than 1 linker-nucleoside.
[0418] In certain embodiments, it is desirable for a conjugate
group to be cleaved from the oligonucleotide. For example, in
certain circumstances compounds comprising a particular conjugate
moiety are better taken up by a particular cell type, but once the
compound has been taken up, it is desirable that the conjugate
group be cleaved to release the unconjugated or parent
oligonucleotide. Thus, certain conjugate may comprise one or more
cleavable moieties, typically within the conjugate linker. In
certain embodiments, a cleavable moiety is a cleavable bond. In
certain embodiments, a cleavable moiety is a group of atoms
comprising at least one cleavable bond. In certain embodiments, a
cleavable moiety comprises a group of atoms having one, two, three,
four, or more than four cleavable bonds. In certain embodiments, a
cleavable moiety is selectively cleaved inside a cell or
subcellular compartment, such as a lysosome. In certain
embodiments, a cleavable moiety is selectively cleaved by
endogenous enzymes, such as nucleases.
[0419] In certain embodiments, a cleavable bond is selected from
among: an amide, an ester, an ether, one or both esters of a
phosphodiester, a phosphate ester, a carbamate, or a disulfide. In
certain embodiments, a cleavable bond is one or both of the esters
of a phosphodiester. In certain embodiments, a cleavable moiety
comprises a phosphate or phosphodiester. In certain embodiments,
the cleavable moiety is a phosphate linkage between an
oligonucleotide and a conjugate moiety or conjugate group.
[0420] In certain embodiments, a cleavable moiety comprises or
consists of one or more linker-nucleosides. In certain such
embodiments, one or more linker-nucleosides are linked to one
another and/or to the remainder of the compound through cleavable
bonds. In certain embodiments, such cleavable bonds are unmodified
phosphodiester bonds. In certain embodiments, a cleavable moiety is
2'-deoxy nucleoside that is attached to either the 3' or
5'-terminal nucleoside of an oligonucleotide by a phosphate
internucleoside linkage and covalently attached to the remainder of
the conjugate linker or conjugate moiety by a phosphate or
phosphorothioate linkage. In certain such embodiments, the
cleavable moiety is 2'-deoxyadenosine.
[0421] 3. Certain Cell-Targeting Conjugate Moieties
[0422] In certain embodiments, a conjugate group comprises a
cell-targeting conjugate moiety. In certain embodiments, a
conjugate group has the general formula:
##STR00011## [0423] wherein n is from 1 to about 3, m is 0 when n
is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or
0.
[0424] In certain embodiments, n is 1, j is 1 and k is 0. In
certain embodiments, n is 1, j is 0 and k is 1. In certain
embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n
is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and
k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In
certain embodiments, n is 3, j is 1 and k is 0. In certain
embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n
is 3, j is 1 and k is 1.
[0425] In certain embodiments, conjugate groups comprise
cell-targeting moieties that have at least one tethered ligand. In
certain embodiments, cell-targeting moieties comprise two tethered
ligands covalently attached to a branching group. In certain
embodiments, cell-targeting moieties comprise three tethered
ligands covalently attached to a branching group.
[0426] In certain embodiments, the cell-targeting moiety comprises
a branching group comprising one or more groups selected from
alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether,
thioether and hydroxylamino groups. In certain embodiments, the
branching group comprises a branched aliphatic group comprising
groups selected from alkyl, amino, oxo, amide, disulfide,
polyethylene glycol, ether, thioether and hydroxylamino groups. In
certain such embodiments, the branched aliphatic group comprises
groups selected from alkyl, amino, oxo, amide and ether groups. In
certain such embodiments, the branched aliphatic group comprises
groups selected from alkyl, amino and ether groups. In certain such
embodiments, the branched aliphatic group comprises groups selected
from alkyl and ether groups. In certain embodiments, the branching
group comprises a mono or polycyclic ring system.
[0427] In certain embodiments, each tether of a cell-targeting
moiety comprises one or more groups selected from alkyl,
substituted alkyl, ether, thioether, disulfide, amino, oxo, amide,
phosphodiester, and polyethylene glycol, in any combination. In
certain embodiments, each tether is a linear aliphatic group
comprising one or more groups selected from alkyl, ether,
thioether, disulfide, amino, oxo, amide, and polyethylene glycol,
in any combination. In certain embodiments, each tether is a linear
aliphatic group comprising one or more groups selected from alkyl,
phosphodiester, ether, amino, oxo, and amide, in any combination.
In certain embodiments, each tether is a linear aliphatic group
comprising one or more groups selected from alkyl, ether, amino,
oxo, and amid, in any combination. In certain embodiments, each
tether is a linear aliphatic group comprising one or more groups
selected from alkyl, amino, and oxo, in any combination. In certain
embodiments, each tether is a linear aliphatic group comprising one
or more groups selected from alkyl and oxo, in any combination. In
certain embodiments, each tether is a linear aliphatic group
comprising one or more groups selected from alkyl and
phosphodiester, in any combination. In certain embodiments, each
tether comprises at least one phosphorus linking group or neutral
linking group. In certain embodiments, each tether comprises a
chain from about 6 to about 20 atoms in length. In certain
embodiments, each tether comprises a chain from about 10 to about
18 atoms in length. In certain embodiments, each tether comprises
about 10 atoms in chain length.
[0428] In certain embodiments, each ligand of a cell-targeting
moiety has an affinity for at least one type of receptor on a
target cell. In certain embodiments, each ligand has an affinity
for at least one type of receptor on the surface of a mammalian
lung cell.
[0429] In certain embodiments, each ligand of a cell-targeting
moiety is a carbohydrate, carbohydrate derivative, modified
carbohydrate, polysaccharide, modified polysaccharide, or
polysaccharide derivative. In certain such embodiments, the
conjugate group comprises a carbohydrate cluster (see, e.g., Maier
et al., "Synthesis of Antisense Oligonucleotides Conjugated to a
Multivalent Carbohydrate Cluster for Cellular Targeting,"
Bioconjugate Chemistry, 2003, 14, 18-29, or Rensen et al., "Design
and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids
for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein
Receptor," J. Med. Chem. 2004, 47, 5798-5808, which are
incorporated herein by reference in their entirety).
[0430] In certain such embodiments, each ligand is an amino sugar
or a thio sugar. For example, amino sugars may be selected from any
number of compounds known in the art, such as sialic acid,
.alpha.-D-galactosamine, .beta.-muramic acid,
2-deoxy-2-methylamino-L-glucopyranose,
4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose,
2-deoxy-2-sulfoamino-D-glucopyranose and N-sulfo-D-glucosamine, and
N-glycoloyl-.alpha.-neuraminic acid. For example, thio sugars may
be selected from 5-Thio-.beta.-D-glucopyranose, methyl
2,3,4-tri-O-acetyl-1-thio-6-O-trityl-.alpha.-D-glucopyranoside,
4-thio-.beta.-D-galactopyranose, and ethyl
3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-.alpha.-D-gluco-heptopyranoside-
.
[0431] In certain embodiments compounds described herein comprise a
conjugate group found in any of the following references: Lee,
Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem,
1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22,
539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al.,
Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron
Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38,
1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Kim et
al., Tetrahedron Lett, 1997, 38, 3487-3490; Lee et al., Bioconjug
Chem, 1997, 8, 762-765; Kato et al., Glycobiol, 2001, 11, 821-829;
Rensen et al., J Biol Chem, 2001, 276, 37577-37584; Lee et al.,
Methods Enzymol, 2003, 362, 38-43; Westerlind et al., Glycoconj J,
2004, 21, 227-241; Lee et al., Bioorg Med Chem Lett, 2006, 16(19),
5132-5135; Maierhofer et al., Bioorg Med Chem, 2007, 15, 7661-7676;
Khorev et al., Bioorg Med Chem, 2008, 16, 5216-5231; Lee et al.,
Bioorg Med Chem, 2011, 19, 2494-2500; Korilova et al., Analyt
Biochem, 2012, 425, 43-46; Pujol et al., Angew Chemie Int Ed Engl,
2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38,
1846-1852; Sliedregt et al., J Med Chem, 1999, 42, 609-618; Rensen
et al., J Med Chem, 2004, 47, 5798-5808; Rensen et al.,
Arterioscler Thromb Vasc Biol, 2006, 26, 169-175; van Rossenberg et
al., Gene Ther, 2004, 11, 457-464; Sato et al., J Am Chem Soc,
2004, 126, 14013-14022; Lee et al., J Org Chem, 2012, 77,
7564-7571; Biessen et al., FASEB J, 2000, 14, 1784-1792; Rajur et
al., Bioconjug Chem, 1997, 8, 935-940; Duff et al., Methods
Enzymol, 2000, 313, 297-321; Maier et al., Bioconjug Chem, 2003,
14, 18-29; Jayaprakash et al., Org Lett, 2010, 12, 5410-5413;
Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12, 103-128;
Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al.,
Bioorg Med Chem, 2013, 21, 5275-5281; International applications
WO1998/013381; WO2011/038356; WO1997/046098; WO2008/098788;
WO2004/101619; WO2012/037254; WO2011/120053; WO2011/100131;
WO2011/163121; WO2012/177947; WO2013/033230; WO2013/075035;
WO2012/083185; WO2012/083046; WO2009/082607; WO2009/134487;
WO2010/144740; WO2010/148013; WO1997/020563; WO2010/088537;
WO2002/043771; WO2010/129709; WO2012/068187; WO2009/126933;
WO2004/024757; WO2010/054406; WO2012/089352; WO2012/089602;
WO2013/166121; WO2013/165816; U.S. Pat. Nos. 4,751,219; 8,552,163;
6,908,903; 7,262,177; 5,994,517; 6,300,319; 8,106,022; 7,491,805;
7,491,805; 7,582,744; 8,137,695; 6,383,812; 6,525,031; 6,660,720;
7,723,509; 8,541,548; 8,344,125; 8,313,772; 8,349,308; 8,450,467;
8,501,930; 8,158,601; 7,262,177; 6,906,182; 6,620,916; 8,435,491;
8,404,862; 7,851,615; Published U.S. Patent Application
Publications US2011/0097264; US2011/0097265; US2013/0004427;
US2005/0164235; US2006/0148740; US2008/0281044; US2010/0240730;
US2003/0119724; US2006/0183886; US2008/0206869; US2011/0269814;
US2009/0286973; US2011/0207799; US2012/0136042; US2012/0165393;
US2008/0281041; US2009/0203135; US2012/0035115; US2012/0095075;
US2012/0101148; US2012/0128760; US2012/0157509; US2012/0230938;
US2013/0109817; US2013/0121954; US2013/0178512; US2013/0236968;
US2011/0123520; US2003/0077829; US2008/0108801; and
US2009/0203132.
Compositions and Methods for Formulating Pharmaceutical
Compositions
[0432] Compounds described herein may be admixed with
pharmaceutically acceptable active or inert substances for the
preparation of pharmaceutical compositions. Compositions and
methods for the formulation of pharmaceutical compositions are
dependent upon a number of criteria, including, but not limited to,
route of administration, extent of disease, or dose to be
administered.
[0433] Certain embodiments provide pharmaceutical compositions
comprising one or more compounds or a salt thereof. Certain
embodiments provide pharmaceutical compositions comprising one or
more compounds described herein or a salt thereof. In certain
embodiments, the compounds are antisense compounds or oligomeric
compounds. In certain embodiments, the compounds comprise or
consist of a modified oligonucleotide. In certain such embodiments,
the pharmaceutical composition comprises a suitable
pharmaceutically acceptable diluent or carrier. In certain
embodiments, a pharmaceutical composition comprises a sterile
saline solution and one or more compound. In certain embodiments,
such pharmaceutical composition consists of a sterile saline
solution and one or more compound. In certain embodiments, the
sterile saline is pharmaceutical grade saline. In certain
embodiments, a pharmaceutical composition comprises one or more
compound and sterile water. In certain embodiments, a
pharmaceutical composition consists of one compound and sterile
water. In certain embodiments, the sterile water is pharmaceutical
grade water. In certain embodiments, a pharmaceutical composition
comprises or consists of one or more compound and
phosphate-buffered saline (PBS). In certain embodiments, a
pharmaceutical composition consists of one or more compound and
sterile PBS. In certain embodiments, the sterile PBS is
pharmaceutical grade PBS. Compositions and methods for the
formulation of pharmaceutical compositions are dependent upon a
number of criteria, including, but not limited to, route of
administration, extent of disease, or dose to be administered.
[0434] A compound described herein complementary to a DNM2 nucleic
acid can be utilized in pharmaceutical compositions by combining
the compound with a suitable pharmaceutically acceptable diluent or
carrier and/or additional components such that the pharmaceutical
composition is suitable for injection. In certain embodiments, a
pharmaceutically acceptable diluent is phosphate buffered saline.
Accordingly, in one embodiment, employed in the methods described
herein is a pharmaceutical composition comprising a compound
complementary to a DNM2 nucleic acid and a pharmaceutically
acceptable diluent. In certain embodiments, the pharmaceutically
acceptable diluent is phosphate buffered saline. In certain
embodiments, the compound comprises or consists of a modified
oligonucleotide provided herein.
[0435] Pharmaceutical compositions comprising compounds provided
herein encompass any pharmaceutically acceptable salts, esters, or
salts of such esters, or any other oligonucleotide which, upon
administration to an animal, including a human, is capable of
providing (directly or indirectly) the biologically active
metabolite or residue thereof. In certain embodiments, the
compounds are antisense compounds or oligomeric compounds. In
certain embodiments, the compound comprises or consists of a
modified oligonucleotide. Accordingly, for example, the disclosure
is also drawn to pharmaceutically acceptable salts of compounds,
prodrugs, pharmaceutically acceptable salts of such prodrugs, and
other bioequivalents. Suitable pharmaceutically acceptable salts
include, but are not limited to, sodium and potassium salts.
[0436] A prodrug can include the incorporation of additional
nucleosides at one or both ends of a compound which are cleaved by
endogenous nucleases within the body, to form the active
compound.
In certain embodiments, the compounds or compositions further
comprise a pharmaceutically acceptable carrier or diluent.
EXAMPLES
[0437] The Examples below describe the screening process used to
identify lead compounds targeted to DNM2. Out of over 3,000
oligonucleotides that were screened, many potent and tolerable
oligonucleotides were identified, and compounds 951799, 949935,
950023, 950089, 951372, 950060, and 950132 emerged as the top lead
compounds. In particular, compound 951799 exhibited the best
combination of properties in terms of potency and tolerability.
Non-Limiting Disclosure and Incorporation by Reference
[0438] Although the sequence listing accompanying this filing
identifies each sequence as either "RNA" or "DNA" as required, in
reality, those sequences may be modified with any combination of
chemical modifications. One of skill in the art will readily
appreciate that such designation as "RNA" or "DNA" to describe
modified oligonucleotides is, in certain instances, arbitrary. For
example, an oligonucleotide comprising a nucleoside comprising a
2'-OH sugar moiety and a thymine nucleobase could be described as a
DNA having an RNA sugar, or as an RNA having a DNA nucleobase.
[0439] Accordingly, nucleic acid sequences provided herein,
including, but not limited to those in the sequence listing, are
intended to encompass nucleic acids containing any combination of
unmodified or modified RNA and/or DNA, including, but not limited
to such nucleic acids having modified nucleobases. By way of
further example and without limitation, an oligonucleotide having
the nucleobase sequence "ATCGATCG" encompasses any oligonucleotides
having such nucleobase sequence, whether modified or unmodified,
including, but not limited to, such compounds comprising RNA bases,
such as those having sequence "AUCGAUCG" and those having some DNA
bases and some RNA bases such as "AUCGATCG" and compounds having
other modified nucleobases, such as "AT.sup.mCGAUCG," wherein
.sup.mC indicates a cytosine base comprising a methyl group at the
5-position.
[0440] While certain compounds, compositions and methods described
herein have been described with specificity in accordance with
certain embodiments, the following examples serve only to
illustrate the compounds described herein and are not intended to
limit the same. Each of the references recited in the present
application is incorporated herein by reference in its
entirety.
Example 1: Effect of Modified Oligonucleotides Complementary to
Dynamin 2 In Vitro
[0441] Modified oligonucleotides complementary to one or more
dynamin 2 (DNM2) nucleic acids were designed and tested for their
effect on dynamin 2 mRNA expression in vitro. The modified
oligonucleotides were tested in a series of experiments that had
similar culture conditions.
[0442] A431 cells were cultured at a density of 10,000 cells per
well and treated with 4,000 nM modified oligonucleotide via free
uptake or no modified oligonucleotide for untreated controls. After
approximately 24 hours, RNA was isolated from the cells and DNM2
mRNA levels were measured by quantitative real-time PCR. Human
primer probe set RTS36027 (forward sequence GACCTCATGCCAAAGACCAT,
designated herein as SEQ ID NO: 4; reverse sequence
GTCTGCCGAGGAGTATAGGTA, designated herein as SEQ ID NO: 5; probe
sequence CCTTCATCCACCACGAGCTGCT, designated herein as SEQ ID: 6)
was used to measure mRNA levels. DNM2 mRNA levels were normalized
to total RNA content, as measured by RIBOGREEN.RTM.. Results are
presented in the tables below as normalized DNM2 mRNA level,
relative to untreated control cells.
[0443] The modified oligonucleotides in the tables below each have
a 3-10-3 cEt gapmer motif, wherein the central gap segment contains
ten 2'-deoxynucleosides and is flanked by wing segments on the 3'
and 5' ends, each containing three cEt nucleosides. All cytosine
residues throughout each modified oligonucleotide are 5-methyl
cytosines. All internucleoside linkages are phosphorothioate
internucleoside linkages.
[0444] Each modified oligonucleotide listed in the table below is
100% complementary to human DNM2 nucleic acid sequence GENBANK
Number NC_000019.10, truncated from 10715001 to 1083500 (designated
herein as SEQ ID NO: 1) and/or GENBANK Number NM_004945.3
(designated herein as SEQ ID NO: 2). "Start Site" indicates the
5'-most nucleoside of the DNM2 nucleic acid to which the
oligonucleotide is complementary. "Stop Site" indicates the 3'-most
nucleoside of the DNM2 nucleic acid to which the oligonucleotide is
complementary. `N/A` indicates that the modified oligonucleotide is
not 10000 complementary to the particular nucleic acid. Several
oligonucleotides match two or more sites on a nucleic acid, as
shown in the table below. As shown below, modified oligonucleotides
complementary to human DNM2 inhibited human DNM2 mRNA
expression.
TABLE-US-00002 TABLE 1 DNM2 mRNA Expression SEQ SEQ SEQ ID: SEQ ID:
ID: 2 ID 2: SEQ Compound 1 Start 1 Stop DNM2 Start Stop ID Number
Site Site Sequence (%Control) Site Site NO 694793 3066 3081
CTCAGGCGACACCCGA 96 14 29 7 694833 60707 60722 GATGAGGGTCAAGTTC 20
580 595 8 694838 60773 60788 CTTGATCTGGTACTCG 5 646 661 9 694852
N/A N/A GTCCGTAGGCCTTGGG 46 774 789 10 694853 62119 62134
ACCGATGGTCCGTAGG 76 781 796 11 695014 115999 116014
AATGGTGGGCCGGCTG 99 N/A N/A 12 695171 82451 82466 ACACACTTCAAACTCG
7 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG 9 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 5 N/A N/A 13 695171 82451 82466
ACACACTTCAAACTCG 6 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG 7
N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG 8 N/A N/A 13 695171
82451 82466 ACACACTTCAAACTCG 6 N/A N/A 13 695171 82451 82466
ACACACTTCAAACTCG 6 N/A N/A 13 907925 3055 3070 CCCGACCCGAGCGACC 96
3 18 14 907926 3057 3072 CACCCGACCCGAGCGA 77 5 20 15 907927 3059
3074 GACACCCGACCCGAGC 115 7 22 16 907928 3062 3077 GGCGACACCCGACCCG
96 10 25 17 907929 3069 3084 GTTCTCAGGCGACACC 101 17 32 18 907930
3072 3087 CCGGTTCTCAGGCGAC 95 20 35 19 907931 3075 3090
CATCCGGTTCTCAGGC 58 23 38 20 907932 3078 3093 CCTCATCCGGTTCTCA 47
26 41 21 907933 3083 3098 CGCCGCCTCATCCGGT 69 31 46 22 907934 3086
3101 GGTCGCCGCCTCATCC 65 34 49 23 907935 3089 3104 CACGGTCGCCGCCTCA
29 37 52 24 907936 3091 3106 CTCACGGTCGCCGCCT 42 39 54 25 907937
3093 3108 GCCTCACGGTCGCCGC 65 41 56 26 907938 3095 3110
CGGCCTCACGGTCGCC 106 43 58 27 907939 3098 3113 GCTCGGCCTCACGGTC 44
46 61 28 907940 3101 3116 CCGGCTCGGCCTCACG 87 49 64 29 907941 3111
3126 ACGCCCGCTCCCGGCT 100 59 74 30 907942 3123 3138
GGCCTCGGCAAGACGC 96 71 86 31 907943 3126 3141 CCGGGCCTCGGCAAGA 97
74 89 32 907944 3129 3144 CGCCCGGGCCTCGGCA 84 77 92 33 907945 3144
3159 CCGTTGCTCCCCGCCC 5 92 107 34 907946 3146 3161 AGCCGTTGCTCCCCGC
12 94 109 35 907947 3149 3164 TGTAGCCGTTGCTCCC 10 97 112 36 907948
3153 3168 CGTCTGTAGCCGTTGC 8 101 116 37 907949 3171 3186
AACGACCTGGCCCCGC 12 119 134 38 907950 3177 3192 ACCCTCAACGACCTGG 41
125 140 39 907951 3180 3195 CCGACCCTCAACGACC 26 128 143 40 907952
3182 3197 CGCCGACCCTCAACGA 54 130 145 41 907953 3186 3201
CCGCCGCCGACCCTCA 35 134 149 42 907954 3190 3205 TCGCCCGCCGCCGACC 61
138 153 43 907955 3196 3211 CGCTCCTCGCCCGCCG 52 144 159 44 907956
3198 3213 TGCGCTCCTCGCCCGC 120 146 161 45 907957 3201 3216
CCCTGCGCTCCTCGCC 32 149 164 46 907958 3204 3219 GCGCCCTGCGCTCCTC
105 152 167 47 907959 3220 3235 GCGGCCCCCGGCCCGA 90 168 183 48
907960 3302 3317 CTGGCCGATGGAGCTG 129 250 265 49 907961 3304 3319
CTCTGGCCGATGGAGC 70 252 267 50 907962 3308 3323 GCAGCTCTGGCCGATG 46
256 271 51 907963 N/A N/A GGGAAGGAAGTCCCGG 97 349 364 52 907964
44749 44764 ATTCCTGAACCGCGGG 89 363 378 53 907965 44751 44766
CGATTCCTGAACCGCG 47 365 380 54 907966 44753 44768 GACGATTCCTGAACCG
11 367 382 55 907967 57491 57506 GACTTGCAGTGCAAAA 6 438 453 56
907968 57493 57508 TGGACTTGCAGTGCAA 15 440 455 57 907969 57495
57510 TTTGGACTTGCAGTGC 2 442 457 58 907970 57499 57514
ACTTTTTGGACTTGCA 5 446 461 59 907971 57526 57541 CCTGCCGGACTTCATC
17 473 488 60 907972 57529 57544 TCTCCTGCCGGACTTC 13 476 491 61
907973 57532 57547 CAATCTCCTGCCGGAC 20 479 494 62 907974 57534
57549 TTCAATCTCCTGCCGG 25 481 496 63 907975 60711 60726
GGTCGATGAGGGTCAA 8 584 599 64 907976 60716 60731 CGGGAGGTCGATGAGG
66 589 604 65 907977 60718 60733 CCCGGGAGGTCGATGA 117 591 606 66
907978 60722 60737 GATACCCGGGAGGTCG 55 595 610 67 907979 60724
60739 GTGATACCCGGGAGGT 11 597 612 68 907980 60728 60743
CTTGGTGATACCCGGG 57 601 616 69 907981 60734 60749 AGGCACCTTGGTGATA
40 607 622 70 907982 60776 60791 GTCCTTGATCTGGTAC 28 649 664 71
907983 60778 60793 ATGTCCTTGATCTGGT 8 651 666 72 907984 60784 60799
AGGATCATGTCCTTGA 58 657 672 73 907985 60788 60803 CTGCAGGATCATGTCC
35 661 676 74 907986 60798 60813 GGCTGATGAACTGCAG 56 671 686 75
907987 60806 60821 GCTCTCCCGGCTGATG 40 679 694 76 907988 60809
60824 GCTGCTCTCCCGGCTG 68 682 697 77 907989 60826 60841
GTGACAGCCAGAATGA 26 699 714 78 907990 60842 60857 GTCCATGTTGGCGGGC
66 715 730 79 907991 60882 60897 CGACTTCCTTGGCCAG 68 755 770 80
907992 60884 60899 ATCGACTTCCTTGGCC 99 757 772 81 907993 N/A N/A
TGGTCCGTAGGCCTTG 72 776 791 82 907994 62116 62131 GATGGTCCGTAGGCCT
68 778 793 83 907995 62195 62210 TCAACGGGAGCAACTT 18 857 872 84
907996 N/A N/A GCCTCTTCTCAACGGG 105 865 880 85 907997 N/A N/A
TAGCCTCTTCTCAACG 17 867 882 86 907998 68005 68020 GCACGGATGTCCTTCT
8 924 939 87 907999 68008 68023 GCTGCACGGATGTCCT 25 927 942 88
908000 68013 68028 CCAGTGCTGCACGGAT 17 932 947 89 908001 68057
68072 GTGCCGGTAGGCCGGG 91 976 991 90 908002 68059 68074
ATGTGCCGGTAGGCCG 83 978 993 91 908003 68062 68077 GCCATGTGCCGGTAGG
77 981 996 92 908004 68064 68079 CGGCCATGTGCCGGTA 90 983 998 93
908005 68096 68111 CGTCTTCTGCAGATGT 26 1015 1030 94 908006 71583
71598 GCCGGCAGCGACTCCC 107 1059 1074 95 908007 71586 71601
AGGGCCGGCAGCGACT 64 1062 1077 96 908008 71589 71604
CGTAGGGCCGGCAGCG 67 1065 1080 97 908009 71603 71618
TCTGTAGTTTGCTACG 34 1079 1094 98 908010 71605 71620
GCTCTGTAGTTTGCTA 42 1081 1096 99 908011 71659 71674
GTCGGGCCGAAAGTTC 15 1135 1150 100 908012 71681 71696
CTTTGGTTTTGCGGGT 36 1157 1172 101 908013 78772 78787
GAGTGTCCACCTGATC 11 1235 1250 102 908014 78786 78801
CCCGGAGAGCTCCAGA 58 1249 1264 103 908015 78789 78804
GCCCCCGGAGAGCTCC 71 1252 1267 104 908016 78791 78806
GCGCCCCCGGAGAGCT 129 1254 1269 105 908017 78804 78819
GCGATTGATTCGGGCG 50 1267 1282 106 908018 78808 78823
AGATGCGATTGATTCG 14 1271 1286 107 908019 80422 80437
GACTCCATGGATGTTC 91 1369 1384 108 908020 N/A N/A GCCCGGTCCTGACTCC
54 1379 1394 109 908021 N/A N/A AAGCCCGGTCCTGACT 81 1381 1396 110
908022 81058 81073 GAAAAGCCCGGTCCTG 35 1384 1399 111 908023 81061
81076 GGTGAAAAGCCCGGTC 58 1387 1402 112 908024 81076 81091
GAATGCCAAGTCCGGG 43 1402 1417 113 908025 81079 81094
CTCGAATGCCAAGTCC 8 1405 1420 114 908026 81082 81097
GGCCTCGAATGCCAAG 169 1408 1423 115 908027 81103 81118
GACGACCTGCTTTTTC 4 1429 1444 116 908028 81106 81121
CTTGACGACCTGCTTT 13 1432 1447 117 908029 81107 81122
GCTTGACGACCTGCTT 14 1433 1448 118 908030 81109 81124
CAGCTTGACGACCTGC 33 1435 1450 119 908031 81111 81126
TTCAGCTTGACGACCT 5 1437 1452 120
908032 81113 81128 CTTTCAGCTTGACGAC 22 1439 1454 121 908033 81115
81130 CTCTTTCAGCTTGACG 7 1441 1456 122 908034 81137 81152
GGTCGACACATTTCAG 13 1463 1478 123 908035 81139 81154
CAGGTCGACACATTTC 2 1465 1480 124 908036 81147 81162
TGGATAACCAGGTCGA 14 1473 1488 125 908037 81160 81175
ATTGATTAGCTCCTGG 2 1486 1501 126 908038 81170 81185
GCCTAACTGTATTGAT 22 1496 1511 127 908039 81172 81187
CTGCCTAACTGTATTG 28 1498 1513 128 908040 81175 81190
ACACTGCCTAACTGTA 54 1501 1516 129 908041 81182 81197
TACTGGTACACTGCCT 4 1508 1523 130 908042 N/A N/A CTGAGCTTACTGGTAC 19
1515 1530 131 908043 N/A N/A GAACTGAGCTTACTGG 10 1518 1533 132
908044 N/A N/A GGTAGGAACTGAGCTT 8 1523 1538 133 908045 83499 83514
TCCTCTCGCAACCGGG 46 1539 1554 134 908046 83502 83517
GTCTCCTCTCGCAACC 34 1542 1557 135 908047 83505 83520
TCTGTCTCCTCTCGCA 11 1545 1560 136 908048 83517 83532
GTGACGATTCGCTCTG 48 1557 1572 137 908049 83522 83537
AAGTGGTGACGATTCG 5 1562 1577 138 908050 83524 83539
GTAAGTGGTGACGATT 17 1564 1579 139 908051 83536 83551
CCGTTCCCGGATGTAA 86 1576 1591 140 908052 83548 83563
CGTTCTCCCCTCCCGT 9 1588 1603 141 908053 N/A N/A CAGAAGAATCTGGTCC 33
1606 1621 142 908054 87290 87305 GTCGATCAGCAGAAGA 33 1615 1630 143
908055 87294 87309 CAATGTCGATCAGCAG 16 1619 1634 144 908056 87296
87311 CTCAATGTCGATCAGC 10 1621 1636 145 908057 87299 87314
CTGCTCAATGTCGATC 18 1624 1639 146 908058 87302 87317
GGACTGCTCAATGTCG 58 1627 1642 147 908059 87304 87319
TAGGACTGCTCAATGT 3 1629 1644 148 908060 87308 87323
GATGTAGGACTGCTCA 19 1633 1648 149 908061 87311 87326
GTTGATGTAGGACTGC 3 1636 1651 150 908062 97288 97303
GGCTGATGTTGTTGAT 31 1760 1775 151 908063 97290 97305
CAGGCTGATGTTGTTG 36 1762 1777 152 908064 97294 97309
TCATCAGGCTGATGTT 100 1766 1781 153 908065 97299 97314
GCCTTTCATCAGGCTG 89 1771 1786 154 908066 97338 97353
TGACTCGGCAGTCAGC 86 1810 1825 155 908067 97341 97356
CAGTGACTCGGCAGTC 24 1813 1828 156 908068 97345 97360
AGGACAGTGACTCGGC 17 1817 1832 157 908069 105015 105030
ATCACGGATCTTGAGG 40 1885 1900 158 908070 105019 105034
CCACATCACGGATCTT 12 1889 1904 159 908071 105020 105035
TCCACATCACGGATCT 31 1890 1905 160 908072 105022 105037
TCTCCACATCACGGAT 72 1892 1907 161 908073 105060 105075
GAAGATGGCGAAGACG 81 1930 1945 162 908074 108791 108806
CAGGTCCTTGTAGACG 60 1963 1978 163 908075 108804 108819
GCTCGATCTGCCGCAG 55 1976 1991 164 908076 108806 108821
CAGCTCGATCTGCCGC 54 1978 1993 165 908077 108857 108872
TCGGAGGAACGAGGCC 80 2029 2044 166 908078 108859 108874
GCTCGGAGGAACGAGG 67 2031 2046 167 908079 108861 108876
CAGCTCGGAGGAACGA 59 2033 2048 168 908080 108863 108878
GCCAGCTCGGAGGAAC 93 2035 2050 169 908081 N/A N/A GCCTGGTCCTTCTCGG
70 2058 2073 170 908082 110075 110090 AGGTGTTCTCCTGGGC 74 2090 2105
171 908083 110077 110092 GAAGGTGTTCTCCTGG 81 2092 2107 172 908084
110080 110095 GGAGAAGGTGTTCTCC 119 2095 2110 173 908085 110160
110175 ATGGACTTGTTGATGA 11 2175 2190 174 908086* 110166 110181
TCGCGGATGGACTTGT 36 2181 2196 175 908087* 110168 110183
GGTCGCGGATGGACTT 58 2183 2198 176 908088* 110171 110186
TGAGGTCGCGGATGGA 4 2186 2201 177 908089* 114042 114057
CGTGGTGGATGAAGGC 3 2243 2258 178 908090* 114069 114084
CCGAGGAGTATAGGTA 17 2270 2285 179 908091* 114072 114087
CTGCCGAGGAGTATAG 14 2273 2288 180 908092* 114074 114089
GTCTGCCGAGGAGTAT 11 2275 2290 181 908093* 114077 114092
CTGGTCTGCCGAGGAG 9 2278 2293 182 908094* 114080 114095
GCTCTGGTCTGCCGAG 39 2281 2296 183 908095 115141 115156
CTGGACACCGGTCGGC 39 2484 2499 184 908096 115144 115159
ATGCTGGACACCGGTC 47 2487 2502 185 908097 115146 115161
GTATGCTGGACACCGG 33 2489 2504 186 908098 115150 115165
GGGTGTATGCTGGACA 11 2493 2508 187 908099 115214 115229
CACGGGAACAGGAATC 25 2557 2572 188 908100 115221 115236
CTGCCCCCACGGGAAC 80 2564 2579 189 908101 115238 115253
CGCCGAGAAGGAGGCT 97 2581 2596 190 908102 115283 115298
GTTGGCAAACACGCTC 16 2626 2641 191 908103 115285 115300
CTGTTGGCAAACACGC 30 2628 2643 192 908104 115292 115307
GAGGTCACTGTTGGCA 9 2635 2650 193 908105 115324 115339
GGCCGAGATGGGATCT 73 2667 2682 194 908106 115326 115341
CTGGCCGAGATGGGAT 45 2669 2684 195 908107 115329 115344
GAACTGGCCGAGATGG 6 2672 2687 196 908108 115332 115347
TCCGAACTGGCCGAGA 33 2675 2690 197 908109 115336 115351
GGGATCCGAACTGGCC 82 2679 2694 198 908110 116010 116025
GCTGGGCGGATAATGG 45 2754 2769 199 908111 116015 116030
GCTCGGCTGGGCGGAT 101 2759 2774 200 908112 116017 116032
TGGCTCGGCTGGGCGG 89 2761 2776 201 908113 116022 116037
AGGGATGGCTCGGCTG 75 2766 2781 202 908114 116030 116045
AGTCGAGCAGGGATGG 53 2774 2789 203 908115 116035 116050
GGCCTAGTCGAGCAGG 104 2779 2794 204 908116 116038 116053
CGAGGCCTAGTCGAGC 79 2782 2797 205 908117 116042 116057
CCCTCGAGGCCTAGTC 87 2786 2801 206 908118 116045 116060
CCCCCCTCGAGGCCTA 69 2789 2804 207 908119 116047 116062
CGCCCCCCTCGAGGCC 89 2791 2806 208 908120 116057 116072
CCCGAGAGCACGCCCC 40 2801 2816 209 908121 116060 116075
CCCCCCGAGAGCACGC 38 2804 2819 210 908122 116063 116078
GGCCCCCCCGAGAGCA 95 2807 2822 211 908123 116068 116083
CGTGAGGCCCCCCCGA 67 2812 2827 212 908124 116088 116103
AAGCTCCTGCGCCGCG 55 2832 2847 213 908125 116096 116111
GACCACTGAAGCTCCT 32 2840 2855 214 908126 116098 116113
CAGACCACTGAAGCTC 38 2842 2857 215 908127 116108 116123
CGGAGGGCCCCAGACC 100 2852 2867 216 908128 116110 116125
GGCGGAGGGCCCCAGA 91 2854 2869 217 908129 116128 116143
TGGTCCCAGCATAGGG 88 2872 2887 218 908130 116130 116145
CCTGGTCCCAGCATAG 73 2874 2889 219 908131 116138 116153
ACTGGGAGCCTGGTCC 72 2882 2897 220 908132 116164 116179
CGTTAAGGAAGAGGCC 69 2908 2923 221 908133 116209 116224
GCGGTGTCCAGCCAGG 49 2953 2968 222 908134 116211 116226
GTGCGGTGTCCAGCCA 37 2955 2970 223 908135 116215 116230
CGCAGTGCGGTGTCCA 13 2959 2974 224 908136 116218 116233
TTGCGCAGTGCGGTGT 29 2962 2977 225 908137 116220 116235
CTTTGCGCAGTGCGGT 15 2964 2979 226 908138 116223 116238
CCCCTTTGCGCAGTGC 12 2967 2982 227 908139 116226 116241
GGGCCCCTTTGCGCAG 101 2970 2985 228 908140 116228 116243
CAGGGCCCCTTTGCGC 92 2972 2987 229 908141 116260 116275
TGCAACACCCCAGCGC 78 3004 3019 230 908142 116265 116280
CAAAGTGCAACACCCC 20 3009 3024 231 908143 116268 116283
CCCCAAAGTGCAACAC 47 3012 3027 232 908144 116300 116315
TGGTCCCCCCTCTGCC 64 3044 3059 233 908145 116309 116324
CAAGGGTTCTGGTCCC 45 3053 3068 234 908146 116312 116327
TGTCAAGGGTTCTGGT 15 3056 3071 235 908147 116314 116329
GGTGTCAAGGGTTCTG 8 3058 3073 236 908148 116318 116333
GGATGGTGTCAAGGGT 7 3062 3077 237 908149 116331 116346
GACCCCTCATTCAGGA 84 3075 3090 238 908150 116333 116348
TGGACCCCTCATTCAG 64 3077 3092 239 908151 116336 116351
GGCTGGACCCCTCATT 80 3080 3095 240 908152 116348 116363
GAGTCCCCCCCAGGCT 63 3092 3107 241 908153 116352 116367
GGTAGAGTCCCCCCCA 31 3096 3111 242 908154 116356 116371
CCTTGGTAGAGTCCCC 3 3100 3115 243 908155 116359 116374
AGACCTTGGTAGAGTC 73 3103 3118 244 908156 116385 116400
CCTACATGGGCTTTCC 37 3129 3144 245 908157 116389 116404
CTGCCCTACATGGGCT 115 3133 3148 246
908158 116398 116413 ATAGAAGGCCTGCCCT 71 3142 3157 247 908159
116400 116415 TTATAGAAGGCCTGCC 41 3144 3159 248 908160 116404
116419 GCACTTATAGAAGGCC 70 3148 3163 249 908161 116408 116423
GCCCGCACTTATAGAA 45 3152 3167 250 908162 116410 116425
GTGCCCGCACTTATAG 66 3154 3169 251 908163 116418 116433
CGCCCTTGGTGCCCGC 62 3162 3177 252 908164 116455 116470
TATACCCCTGCACCCC 11 3199 3214 253 908165 116464 116479
GGAAGTTGATATACCC 29 3208 3223 254 908166 116471 116486
GCTAATGGGAAGTTGA 13 3215 3230 255 908167 116474 116489
CCTGCTAATGGGAAGT 14 3218 3233 256 908168 116477 116492
GCTCCTGCTAATGGGA 139 3221 3236 257 908169 116481 116496
GGGAGCTCCTGCTAAT 102 3225 3240 258 908170 116497 116512
GCCAGGCTTGCCGCTG 80 3241 3256 259 908171 116499 116514
GGGCCAGGCTTGCCGC 87 3243 3258 260 908172 116511 116526
ACCGAGCCCACTGGGC 72 3255 3270 261 908173 116513 116528
CTACCGAGCCCACTGG 57 3257 3272 262 908174 116518 116533
GGGCACTACCGAGCCC 87 3262 3277 263 908175 116523 116538
CAGCTGGGCACTACCG 86 3267 3282 264 908176 116541 116556
TGTACACCTCAGGCCT 83 3285 3300 265 908177 116544 116559
CTATGTACACCTCAGG 10 3288 3303 266 908178 116547 116562
GGACTATGTACACCTC 7 3291 3306 267 908179 116550 116565
GAAGGACTATGTACAC 8 3294 3309 268 908180 116556 116571
GGCCGGGAAGGACTAT 51 3300 3315 269 908181 116558 116573
ATGGCCGGGAAGGACT 78 3302 3317 270 908182 116561 116576
AATATGGCCGGGAAGG 19 3305 3320 271 908183 116565 116580
GGTTAATATGGCCGGG 13 3309 3324 272 908184 116573 116588
GGCTGTGTGGTTAATA 8 3317 3332 273 908185 116603 116618
CCTCTGGCAGCCGAGG 100 3347 3362 274 908186 116606 116621
GCACCTCTGGCAGCCG 73 3350 3365 275 908187 116608 116623
AGGCACCTCTGGCAGC 61 3352 3367 276 908188 116614 116629
TAGCAAAGGCACCTCT 41 3358 3373 277 908189 116617 116632
GCCTAGCAAAGGCACC 146 3361 3376 278 908190 116621 116636
CCGGGCCTAGCAAAGG 60 3365 3380 279 908191 116624 116639
GCTCCGGGCCTAGCAA 123 3368 3383 280 908192 116626 116641
CGGCTCCGGGCCTAGC 97 3370 3385 281 908193 116630 116645
CCAACGGCTCCGGGCC 117 3374 3389 282 908194 116638 116653
GGCCCGGGCCAACGGC 109 3382 3397 283 908195 116640 116655
CCGGCCCGGGCCAACG 104 3384 3399 284 908196 116642 116657
GGCCGGCCCGGGCCAA 99 3386 3401 285 908197 116644 116659
AAGGCCGGCCCGGGCC 86 3388 3403 286 908198 116646 116661
GCAAGGCCGGCCCGGG 88 3390 3405 287 908199 116648 116663
GGGCAAGGCCGGCCCG 125 3392 3407 288 908200 116650 116665
TAGGGCAAGGCCGGCC 99 3394 3409 289 908201 116655 116670
AGGAATAGGGCAAGGC 6 3399 3414 290 908202 116712 116727
ACCACCCACATAGCCC 31 3456 3471 291 908203 116729 116744
CAAGACCCCCCGCCAC 64 3473 3488 292 908204 116732 116747
CCCCAAGACCCCCCGC 59 3476 3491 293 908205 116738 116753
AGAGGCCCCCAAGACC 86 3482 3497 294 908206 116772 116787
GGCCCACCCATCAGGG 110 3516 3531 295 908207 116774 116789
TGGGCCCACCCATCAG 127 3518 3533 296 908208 116789 116804
AGAGAGAGGCCGCCCT 37 3533 3548 297 908209 116791 116806
TCAGAGAGAGGCCGCC 70 3535 3550 298 908210 116808 116823
GAGTGGGTGAGGTCTC 77 3552 3567 299 908211 116815 116830
GAGCGAGGAGTGGGTG 59 3559 3574 300 908212 116819 116834
AACTGAGCGAGGAGTG 55 3563 3578 301 908213 116822 116837
TCAAACTGAGCGAGGA 5 3566 3581 302 908214 116826 116841
GTGGTCAAACTGAGCG 15 3570 3585 303 908215 116832 116847
CTTACAGTGGTCAAAC 10 3576 3591 304 908216 116843 116858
GAGTGCAGGCACTTAC 48 3587 3602 305 908217 116849 116864
AATACAGAGTGCAGGC 4 3593 3608 306 908221 82462 82477
CCACGAGATCAACACA 20 N/A N/A 307 908222 82464 82479 GACCACGAGATCAACA
88 N/A N/A 308 908223 82465 82480 AGACCACGAGATCAAC 82 N/A N/A 309
908224 82468 82483 CTGAGACCACGAGATC 34 N/A N/A 310 908225 82471
82486 GCTCTGAGACCACGAG 59 N/A N/A 311 908226 82482 82497
GACCGTGGCCAGCTCT 52 N/A N/A 312 908227 82484 82499 ATGACCGTGGCCAGCT
54 N/A N/A 313 908228 82485 82500 TATGACCGTGGCCAGC 31 N/A N/A 314
908229 82487 82502 TTTATGACCGTGGCCA 64 N/A N/A 315 908230 82488
82503 TTTTATGACCGTGGCC 102 N/A N/A 316 908231 82498 82513
CGGCACACTTTTTTAT 37 N/A N/A 317 908232 82502 82517 TTCTCGGCACACTTTT
4 N/A N/A 318 908236 N/A N/A CCCCGCCGCGGGCACG 103 3506 3521 319
908237 4387 4402 CCAAAGGAGGGCCCCC 88 N/A N/A 320 908238 4857 4872
CGCCAGCCTAGTGGCC 142 N/A N/A 321 908239 5585 5600 TGGGACTACCACCCTA
129 N/A N/A 322 908240 6095 6110 CTCCATACTGGCCGGC 91 N/A N/A 323
908241 6449 6464 CTTAACGAGGCCAGCC 56 N/A N/A 324 908242 7057 7072
ACCCATCTAGGCCCCA 23 N/A N/A 325 908243 7335 7350 TGGTGCACCGCAGACA
61 N/A N/A 326 908244 8045 8060 TCAGGAGGCGAGATTG 93 N/A N/A 327
908245 8318 8333 CGGGAAAACCCCGCCT 123 N/A N/A 328 908246 8813 8828
AGCCACTAAGTGGCCC 130 N/A N/A 329 908247 9601 9616 GCTAAACTGGCCTCCG
78 N/A N/A 330 908248 9989 10004 GCCAACGGGCATCCGA 104 N/A N/A 331
908249 10650 10665 GTCCACTCCCAGTAGG 77 N/A N/A 332 908250 11631
11646 GGTGATCCGATGCTGG 34 N/A N/A 333 908251 12300 12315
GGCCATCTTCCGCCCT 102 N/A N/A 334 908252 12662 12677
CTAACCTAGGCCGGGT 70 N/A N/A 335 908253 12991 13006 AGACGCAGGGCCACAT
66 N/A N/A 336 908254 13381 13396 GGCTCTAGAGGGCCCA 110 N/A N/A 337
908255 13954 13969 CCGCATACAGCCTTTT 12 N/A N/A 338 908256 14620
14635 GCATTCCACGGGCAGC 34 N/A N/A 339 908257 15396 15411
CACCGCTACCCTAGCT 63 N/A N/A 340 908258 15792 15807 GGGCACCCCGCAGGTT
102 N/A N/A 341 908259 16235 16250 TCTAGAAGGACCCTGT 64 N/A N/A 342
908260 16810 16825 AGCCGGGCTTCCGTCT 84 N/A N/A 343 908261 17238
17253 TTTAAGGGCGCGGTGG 99 N/A N/A 344 908262 17624 17639
TGCACTTCCGGACAGG 82 N/A N/A 345 908263 18173 18188 CACCAGCCCAGGCGCG
117 N/A N/A 346 908264 18617 18632 AGCTAGGTTAATTTCT 64 N/A N/A 347
908265 19070 19085 CAACATCCCGCCAGGC 80 N/A N/A 348 908266 19407
19422 AGCAATCTAGCCTCCC 39 N/A N/A 349 908267 19819 19834
TGCAATGTCCAGTCCT 11 N/A N/A 350 908268 20435 20450 ACCTAGCAAGCCTACC
64 N/A N/A 351 908269 21415 21430 GCTACAGCAATATAGA 67 N/A N/A 352
908270 21839 21854 TCTTAACAGGCTCCCT 63 N/A N/A 353 908271 22199
22214 CCTCAGGGACGACTTC 87 N/A N/A 354 908272 22636 22651
TATACGGGCATGTTGA 55 N/A N/A 355 908273 22916 22931 GTGCATCCCGAGAGGG
89 N/A N/A 356 908274 23292 23307 ATGAAAGTCTCCACTT 61 N/A N/A 357
908275 23543 23558 AACCGCTGGGATCCCC 71 N/A N/A 358 908276 24229
24244 GTACAGGAGTTCCCCA 90 N/A N/A 359 908277 25038 25053
AAATACACCCTAGATG 83 N/A N/A 360 908278 25670 25685 GAAGATTTTGGCCGGG
85 N/A N/A 361 908279 25997 26012 CTCCAGGACACACCGT 42 N/A N/A 362
908280 27088 27103 GGGAGTAGGCTCGACC 51 N/A N/A 363 908281 27400
27415 CCCTATTCCACAGGAC 85 N/A N/A 364 908282 27746 27761
GCTAAGAGCAGCCCTC 80 N/A N/A 365 908283 28198 28213 GGCATCACGGCCGGGC
76 N/A N/A 366 908284 29125 29140 TGTCACCCCAGCCGAA 67 N/A N/A 367
908285 29568 29583 AGCCGGGCACCACCCA 67 N/A N/A 368 908286 30330
30345 GGCAAGGACAGCCGAC 94 N/A N/A 369 908287 30334 30349
GTTTGGCAAGGACAGC 40 N/A N/A 370 908288 30337 30352 GTGGTTTGGCAAGGAC
14 N/A N/A 371
908289 30340 30355 GCAGTGGTTTGGCAAG 46 N/A N/A 372 908290 30342
30357 ATGCAGTGGTTTGGCA 86 N/A N/A 373 908291 30401 30416
TCAACACCTTGAGGGC 34 N/A N/A 374 908292 30498 30513 TGCCTAGGCGATCCTC
88 N/A N/A 375 908293 30928 30943 GACATTGCTGTCGCAG 78 N/A N/A 376
908294 31347 31362 TCCCAAGTGCCCCCCA 90 N/A N/A 377 908295 31703
31718 AGCCGGCACGGTTGCT 125 N/A N/A 378 908296 32187 32202
GAGAACATTCGCCCCA 27 N/A N/A 379 908297 32386 32401 TGACCTGTGGCAATTC
26 N/A N/A 380 908298 32388 32403 GGTGACCTGTGGCAAT 44 N/A N/A 381
908299 32689 32704 TCCCGTATCGGCCCCT 85 N/A N/A 382 908300 33343
33358 GTCCAGCCGCGAGTCC 59 N/A N/A 383 908301 33635 33650
GGCAGACCCGCAGTCA 73 N/A N/A 384 908302 34108 34123 GGGCAAGCCACCCCTC
93 N/A N/A 385 908303 34623 34638 AAGTCGAGCTCCGCCC 63 N/A N/A 386
908304 35031 35046 TGGTCCTAGCCCGTCC 78 N/A N/A 387 908305 35549
35564 GGGTACAGGCAAACCT 88 N/A N/A 388 908306 36028 36043
CCATACCCCCATCTGA 102 N/A N/A 389 908307 36712 36727
GCGCAGAGGGCCTCGC 123 N/A N/A 390 908308 37097 37112
CACTACAGACATCCCT 64 N/A N/A 391 908309 37538 37553 AGCCAGGGCCCGGCTT
93 N/A N/A 392 908310 38044 38059 CTCCAACTGTAGGGCT 87 N/A N/A 393
908311 39735 39750 GCGGATGGTGGCATTC 90 N/A N/A 394 908312 40399
40414 CAGCAGCGGCGGTGAC 84 N/A N/A 395 908313 41143 41158
CTCTTAGCATGGCCCC 73 N/A N/A 396 908314 41620 41635 GGCCTGGGATGCTACC
129 N/A N/A 397 908315 41957 41972 TTAAACCCCCCTCTGG 104 N/A N/A 398
908316 42239 42254 GCCCAAGCCCTCGGCG 147 N/A N/A 399 908317 42806
42821 ATGCACGCGCTACCAT 106 N/A N/A 400 908318 43841 43856
ACATATCCTGGCCGGG 112 N/A N/A 401 908319 44266 44281
CTGGATGTGGGAACGG 94 N/A N/A 402 908320 44817 44832 CCTCAGGCCGCCCCAT
57 N/A N/A 403 908321 45179 45194 GGCCATGGAGGGTCAC 111 N/A N/A 404
908322 45544 45559 GGGACAACTGGCGACA 39 N/A N/A 405 908323 45952
45967 TGGTAGAGGGCTGGTG 78 N/A N/A 406 908324 46827 46842
GCCCATCGGCTGCTGT 153 N/A N/A 407 908325 47604 47619
GGGTAGGCCTGCGCTC 119 N/A N/A 408 908326 48030 48045
TGCCATGATCAGGCGG 109 N/A N/A 409 908327 48530 48545
ACCAAGTGGGCACCTA 92 N/A N/A 410 908328 49088 49103 CCACAAGGCCCCGCCG
103 N/A N/A 411 908329 49883 49898 GTGACCAGGTGCGGGT 84 N/A N/A 412
908330 50310 50325 CTGGGCAGAGCCGATC 95 N/A N/A 413 908331 50840
50855 GACGAGGCTGGCCCTG 36 N/A N/A 414 908332 51504 51519
CCCCACTGTGCTAAAC 91 N/A N/A 415 908333 51765 51780 AGTCAGCCGTCCTCGC
58 N/A N/A 416 908334 52587 52602 CACCAGGCCGAGAGCA 111 N/A N/A 417
908335 53006 53021 GCCCAGGCACCGACCA 92 N/A N/A 418 908336 53680
53695 CCCCGGAACCTCAGGC 85 N/A N/A 419 908337 54271 54286
CAGCACGCTGTGTGCA 65 N/A N/A 420 908338 54667 54682 CACTCGGCCGCTCTTC
80 N/A N/A 421 908339 55325 55340 GCGCACTGCCCTGTCG 77 N/A N/A 422
908340 56452 56467 CAAGAGGGCCCCCTAC 110 N/A N/A 423 908341 56855
56870 TATGAATCCCCCTCCC 99 N/A N/A 424 908342 57413 57428
GCGCATGGACTGCGGG 150 N/A N/A 425 908343 57695 57710
TGGAAGTACACAGGCT 40 N/A N/A 426 908344 58949 58964 GTCTATGGCCCCGGGC
102 N/A N/A 427 908345 59713 59728 GCATAGGCCAACGCAG 88 N/A N/A 428
908346 60635 60650 AAACAGGCCCGCAGCC 95 N/A N/A 429 908347 61004
61019 CCTACAGCGGCCATGG 115 N/A N/A 430 908348 61545 61560
GTGCTAACCGTGTGTG 85 N/A N/A 431 908349 62025 62040 GTCCAGTTGGCCCTGA
84 N/A N/A 432 908350 62964 62979 AACCACCGAAGCTGGG 125 N/A N/A 433
908351 63324 63339 GGAAGATGGCCGGGTG 111 N/A N/A 434 908352 63675
63690 GCTACAATGCCTAGGA 85 N/A N/A 435 908353 64393 64408
GGTCAACGCAGGCTCA 48 N/A N/A 436 908354 64657 64672 AGCCAGGAGCAATCGC
78 N/A N/A 437 908355 65114 65129 GGCAACCAAGGTCTGA 15 N/A N/A 438
908356 65639 65654 CGCCTAGCCTGGGTTC 67 N/A N/A 439 908357 66042
66057 CACCATCACACACGGA 44 N/A N/A 440 908358 66433 66448
GGGAGAGGTGCCGGTC 99 N/A N/A 441 908359 66885 66900 CACCGAGAAGGAGGTA
99 N/A N/A 442 908360 67650 67665 AAAATCTCGGCCGGGA 101 N/A N/A 443
908361 67903 67918 GCCAAGTGGACCTGGC 84 N/A N/A 444 908362 68192
68207 GCCTGAAACAAGTGCC 75 N/A N/A 445 908363 68628 68643
CCCCAGGCAATGCATA 125 N/A N/A 446 908364 68993 69008
AGAACGATAGGCCAGG 52 N/A N/A 447 908365 69310 69325 TCTTTTCCCGGCCCCC
48 N/A N/A 448 908366 71364 71379 CGGCACGGAGCTGCCC 126 N/A N/A 449
908367 71557 71572 GGTCAGTTGCTGCAGG 40 N/A N/A 450 908368 72040
72055 GGCCGGCCAATGCTCA 118 N/A N/A 451 908369 73315 73330
TTGCACTGGCCGGGCT 75 N/A N/A 452 908370 73937 73952 CCCTTAGCCCACGACC
92 N/A N/A 453 908371 74402 74417 CTGCCAGTTTGTCCCC 25 N/A N/A 454
908372 74408 74423 TGTAATCTGCCAGTTT 53 N/A N/A 455 908373 74410
74425 CTTGTAATCTGCCAGT 55 N/A N/A 456 908374 74415 74430
GGCACCTTGTAATCTG 96 N/A N/A 457 908375 74908 74923 TGTGATGGGCATCCCC
56 N/A N/A 458 908376 75761 75776 ATACATGAGGTCCGGG 106 N/A N/A 459
908377 76583 76598 GCCCAACCCACGCTGC 79 N/A N/A 460 908378 77237
77252 CCCCAACTGGGAGAGG 107 N/A N/A 461 908379 77517 77532
TAGAACGGGCCTGGCC 93 N/A N/A 462 908380 78331 78346 TCCATAGGTTCCCGCC
89 N/A N/A 463 908381 78849 78864 GGGCACTACCTTCACC 138 N/A N/A 464
908382 79488 79503 TCCCACGGATTATAGG 140 N/A N/A 465 908383 80002
80017 GCCCAGGAAGGTCGAA 105 N/A N/A 466 908384 80333 80348
ATGCATGGAGGCACCC 93 N/A N/A 467 908385 80626 80641 TGCAATGGACGCAGGA
37 N/A N/A 468 908386 80968 80983 GGCCGGGTCCCCAACA 113 N/A N/A 469
908387 81643 81658 GGCCATTCCCGGAGCT 114 N/A N/A 470 908388 82021
82036 CCTTTTCTAATCGAAG 116 N/A N/A 471 908389 82046 82061
ACCTGTTTGGACTGTT 5 N/A N/A 472 908390 82049 82064 CCAACCTGTTTGGACT
74 N/A N/A 473 908391 82051 82066 TTCCAACCTGTTTGGA 54 N/A N/A 474
908392 82055 82070 CGTTTTCCAACCTGTT 3 N/A N/A 475 908393 82069
82084 GGCTCTAGGACGAGCG 55 N/A N/A 476 908394 82072 82087
CCTGGCTCTAGGACGA 41 N/A N/A 477 908395 82083 82098 TGTCCATGACACCTGG
66 N/A N/A 478 908396 82086 82101 TCATGTCCATGACACC 8 N/A N/A 479
908397 82088 82103 ATTCATGTCCATGACA 25 N/A N/A 480 908398 82704
82719 CCCCACGGGCAGCCAC 127 N/A N/A 481 908399 83290 83305
GGGCACCGTGGACCGG 112 N/A N/A 482 908400 83646 83661
CATATGCAGCTGTCAG 27 N/A N/A 483 83734 83749 N/A N/A 83822 83837 N/A
N/A 908401 83647 83662 CCATATGCAGCTGTCA 2 N/A N/A 484 83735 83750
N/A N/A 83823 83838 N/A N/A 908402 83649 83664 TGCCATATGCAGCTGT 27
N/A N/A 485 83737 83752 N/A N/A 83825 83840 N/A N/A 908403 83650
83665 TTGCCATATGCAGCTG 18 N/A N/A 486 83738 83753 N/A N/A 83826
83841 N/A N/A 908404 83651 83666 TTTGCCATATGCAGCT 17 N/A N/A 487
83739 83754 N/A N/A 83827 83842 N/A N/A 908405 83658 83673
GGGTTACTTTGCCATA 7 N/A N/A 488 83746 83761 N/A N/A 83834 83849 N/A
N/A 908406 83659 83674 AGGGTTACTTTGCCAT 74 N/A N/A 489 83747 83762
N/A N/A 83835 83850 N/A N/A 908407 83660 83675 AAGGGTTACTTTGCCA 7
N/A N/A 490
83748 83763 N/A N/A 83836 83851 N/A N/A 908408 83661 83676
TAAGGGTTACTTTGCC 2 N/A N/A 491 83749 83764 N/A N/A 83837 83852 N/A
N/A 908409 83662 83677 GTAAGGGTTACTTTGC 8 N/A N/A 492 83750 83765
N/A N/A 83838 83853 N/A N/A 908410 83663 83678 GGTAAGGGTTACTTTG 12
N/A N/A 493 83751 83766 N/A N/A 83839 83854 N/A N/A 908411 83664
83679 AGGTAAGGGTTACTTT 17 N/A N/A 494 83752 83767 N/A N/A 83840
83855 N/A N/A 908412 83665 83680 GAGGTAAGGGTTACTT 12 N/A N/A 495
83753 83768 N/A N/A 83841 83856 N/A N/A 908413 83666 83681
TGAGGTAAGGGTTACT 3 N/A N/A 496 83754 83769 N/A N/A 83842 83857 N/A
N/A 908414 83667 83682 TTGAGGTAAGGGTTAC 5 N/A N/A 497 83755 83770
N/A N/A 83843 83858 N/A N/A 908415 83669 83684 AACCCTTACCTCAATC 3
N/A N/A 498 83757 83772 N/A N/A 83845 83860 N/A N/A 908416 83670
83685 TGATTGAGGTAAGGGT 4 N/A N/A 499 83758 83773 N/A N/A 83846
83861 N/A N/A 908417 83671 83686 TTGATTGAGGTAAGGG 2 N/A N/A 500
83759 83774 N/A N/A 83847 83862 N/A N/A 908418 83672 83687
CTTGATTGAGGTAAGG 8 N/A N/A 501 83760 83775 N/A N/A 83848 83863 N/A
N/A 908419 83673 83688 TCTTGATTGAGGTAAG 5 N/A N/A 502 83761 83776
N/A N/A 83849 83864 N/A N/A 908420 83674 83689 ATCTTGATTGAGGTAA 2
N/A N/A 503 83762 83777 N/A N/A 83850 83865 N/A N/A 908421 83684
83699 ACCGCTCTGTATCTTG 3 N/A N/A 504 83772 83787 N/A N/A 83860
83875 N/A N/A 908422 83685 83700 AACCGCTCTGTATCTT 3 N/A N/A 505
83773 83788 N/A N/A 83861 83876 N/A N/A 908423 83686 83701
AGATACAGAGCGGTTC 28 N/A N/A 506 83774 83789 N/A N/A 83862 83877 N/A
N/A 908424 83687 83702 GGAACCGCTCTGTATC 8 N/A N/A 507 83775 83790
N/A N/A 83863 83878 N/A N/A 908425 83688 83703 CGGAACCGCTCTGTAT 13
N/A N/A 508 83776 83791 N/A N/A 83864 83879 N/A N/A 908426 83689
83704 ACGGAACCGCTCTGTA 47 N/A N/A 509 83777 83792 N/A N/A 83865
83880 N/A N/A 908427 83690 83705 GACGGAACCGCTCTGT 21 N/A N/A 510
83778 83793 N/A N/A 83866 83881 N/A N/A 908428 83691 83706
TGACGGAACCGCTCTG 33 N/A N/A 511 83779 83794 N/A N/A 83867 83882 N/A
N/A 908429 83692 83707 GTGACGGAACCGCTCT 44 N/A N/A 512 83780 83795
N/A N/A 83868 83883 N/A N/A 908430 83693 83708 GGTGACGGAACCGCTC 27
N/A N/A 513 83781 83796 N/A N/A 83869 83884 N/A N/A 908431 83694
83709 AGCGGTTCCGTCACCT 67 N/A N/A 514 83782 83797 N/A N/A 83870
83885 N/A N/A 908432 83695 83710 GAGGTGACGGAACCGC 69 N/A N/A 515
83783 83798 N/A N/A 83871 83886 N/A N/A 908433 83696 83711
GGAGGTGACGGAACCG 62 N/A N/A 516 83784 83799 N/A N/A 83872 83887 N/A
N/A 908434 83697 83712 AGGAGGTGACGGAACC 6 N/A N/A 517 83785 83800
N/A N/A 83873 83888 N/A N/A 908435 83698 83713 TAGGAGGTGACGGAAC 16
N/A N/A 518 83786 83801 N/A N/A 83874 83889 N/A N/A 908436 83699
83714 TTAGGAGGTGACGGAA 14 N/A N/A 519 83787 83802 N/A N/A 83875
83890 N/A N/A 908437 83709 83724 GACAGGGATTTTAGGA 29 N/A N/A 520
83885 83900 N/A N/A 908438 83710 83725 GGACAGGGATTTTAGG 49 N/A N/A
521 83886 83901 N/A N/A 908439 83719 83734 CCTGTCCCTATCATGC 3 N/A
N/A 522 83807 83822 N/A N/A 908440 83720 83735 AGCATGATAGGGACAG 4
N/A N/A 523 83808 83823 N/A N/A 908441 83721 83736 CAGCATGATAGGGACA
2 N/A N/A 524 83809 83824 N/A N/A 908442 83722 83737
TCAGCATGATAGGGAC 4 N/A N/A 525 83810 83825 N/A N/A 908443 83723
83738 GTCAGCATGATAGGGA 4 N/A N/A 526 83811 83826 N/A N/A 908444
83724 83739 TGTCAGCATGATAGGG 4 N/A N/A 527 83812 83827 N/A N/A
908445 83725 83740 CTGTCAGCATGATAGG 44 N/A N/A 528 83813 83828 N/A
N/A 908446 83726 83741 GCTGTCAGCATGATAG 70 N/A N/A 529 83814 83829
N/A N/A 908447 83727 83742 TATCATGCTGACAGCT 55 N/A N/A 530 83815
83830 N/A N/A 908448 83910 83925 GAGGTTGACTACAAAG 12 N/A N/A 531
908449 83913 83928 TGAGAGGTTGACTACA 6 N/A N/A 532 908450 83915
83930 TTTGAGAGGTTGACTA 17 N/A N/A 533 908451 83921 83936
TGGGTTTTTGAGAGGT 9 N/A N/A 534 908452 84177 84192 GGCGATGGCACGACCA
71 N/A N/A 535 908453 84938 84953 GTATAAGGACGGCCCA 45 N/A N/A 536
908454 85500 85515 TCAGATCCGGCCTGGC 191 N/A N/A 537 908455 86165
86180 GTGGTGTGGCGTGCGC 75 N/A N/A 538 908456 86583 86598
GAACTTACTGTCTCCC 14 N/A N/A 539 908457 87056 87071 AGGCAGGGCCGCTGTC
100 N/A N/A 540 908458 87386 87401 AGGATTGGTGCCGCCC 36 N/A N/A 541
908459 87906 87921 AATCAGCGGGTGATGC 118 N/A N/A 542 908460 88179
88194 GCCCAGTGGCCGCCCT 70 N/A N/A 543 908461 88831 88846
CTACAGCTGGTGCGGT 40 N/A N/A 544 908462 89400 89415 CGCCAGGCTTGGGCCC
100 N/A N/A 545 908463 89711 89726 GCCCAGATAAGAAGCC 38 N/A N/A 546
908464 90096 90111 GGCTAGTTCATGCCGG 63 N/A N/A 547 908465 90743
90758 ACGGCCTGGGCACACG 52 N/A N/A 548 908466 90747 90762
GGAAACGGCCTGGGCA 64 N/A N/A 549 908467 90750 90765 AAGGGAAACGGCCTGG
76 N/A N/A 550 908468 90753 90768 CGCAAGGGAAACGGCC 108 N/A N/A 551
908469 90755 90770 TGCGCAAGGGAAACGG 87 N/A N/A 552 908470 90757
90772 GCTGCGCAAGGGAAAC 124 N/A N/A 553 908471 90761 90776
CCCTTGCGCAGCTCTG 18 N/A N/A 554 908472 90765 90780 CACACAGAGCTGCGCA
57 N/A N/A 555 908473 90778 90793 GAAGCCCCCTGCACAC 37 N/A N/A 556
908474 90781 90796 AGAGAAGCCCCCTGCA 72 N/A N/A 557 908475 90809
90824 CCAAGTGAGCAGCCAC 9 N/A N/A 558 908476 90811 90826
GACCAAGTGAGCAGCC 27 N/A N/A 559 908477 90813 90828 GGGACCAAGTGAGCAG
63 N/A N/A 560 908478 91157 91172 CACTAGGCCCTGCCAG 128 N/A N/A 561
908479 91836 91851 GAGCGGGGGTCTGTGA 58 N/A N/A 562 908480 92802
92817 CAGCACTTTGTCCGGG 82 N/A N/A 563 908481 93315 93330
ACCTACGGCAAGCGCA 31 N/A N/A 564 908482 93568 93583 TACCAGGATCTCCCCC
19 N/A N/A 565 908483 94077 94092 GCTAGAGGAGCGGCAC 74 N/A N/A 566
908484 94531 94546 GCCCATCTCACGCCCC 71 N/A N/A 567 908485 95058
95073 CCAGAGGCCACGGCCA 94 N/A N/A 568 908486 95635 95650
CCGCACACCCCTCGGT 111 N/A N/A 569 908487 96522 96537
CAGGCCGCCCTGTGCG 93 N/A N/A 570 908488 97096 97111 CCCAAGCATTTCCAGC
37 N/A N/A 571 908489 97109 97124 AGTTCCACCCTGTCCC 23 N/A N/A 572
908490 97144 97159 TAGAGACACCTCCAGC 47 N/A N/A 573 908491 97147
97162 CAATAGAGACACCTCC 44 N/A N/A 574 908492 97150 97165
CCGCAATAGAGACACC 43 N/A N/A 575 908493 97152 97167 GACCGCAATAGAGACA
64 N/A N/A 576 908494 97154 97169 GGGACCGCAATAGAGA 94 N/A N/A 577
908495 97157 97172 CTATTGCGGTCCCTGG 31 N/A N/A 578 908496 97159
97174 AGCCAGGGACCGCAAT 85 N/A N/A 579 908497 97426 97441
GCCCACCCGCTCTTCC 80 N/A N/A 580
908498 98041 98056 TGGAACCCCGGTGCCC 119 N/A N/A 581 908499 98971
98986 CTTCACCGTTTGGCCA 45 N/A N/A 582 908500 100149 100164
CGCGGAGCCAGGCCCT 114 N/A N/A 583 908501 101337 101352
CCCCAGAGTCCCGCAG 72 N/A N/A 584 908502 101845 101860
ACACGAAGGGCCCCTC 52 N/A N/A 585 908503 102223 102238
GCAGACTGATAGGGCC 103 N/A N/A 586 908504 102495 102510
GGATAGCCGGCCCCGC 102 N/A N/A 587 908505 102955 102970
CGCGGCCGGAAGCTTC 93 N/A N/A 588 908506 103211 103226
CAGAGCATAGGAGAGG 7 N/A N/A 589 103249 103264 N/A N/A 908507 103213
103228 AGCAGAGCATAGGAGA 12 N/A N/A 590 103251 103266 N/A N/A 908508
103216 103231 GGGAGCAGAGCATAGG 16 N/A N/A 591 103254 103269 N/A N/A
908509 104082 104097 GCCAGCCACGGCTGTC 81 N/A N/A 592 908510 104495
104510 GCTGACGGCACGCACA 65 N/A N/A 593 908511 105108 105123
TGGGGATGGCTCGGGG 79 N/A N/A 594 908512 105526 105541
CACCAGGGCTCCGCCT 107 N/A N/A 595 908513 106268 106283
GGCACACGGCTCAGGG 93 N/A N/A 596 908514 106974 106989
CAGCAAGTGGCTGCCC 107 N/A N/A 597 908515 107645 107660
TGGGAGTGGTACTGCA 70 N/A N/A 598 908516 108733 108748
TGCCATGGGTCTGGCA 86 N/A N/A 599 908517 108893 108908
GCTCCTCACCTGGTCC 92 N/A N/A 600 908518 108899 108914
AGGACGGCTCCTCACC 111 N/A N/A 601 908519 108902 108917
GAGGAGCCGTCCTGCG 85 N/A N/A 602 908520 108906 108921
GCTGCGCAGGACGGCT 104 N/A N/A 603 908521 109226 109241
GGGCGAACCACCCACC 78 N/A N/A 604 908522 109577 109592
GCCCAAAGGATCTGCC 88 N/A N/A 605 908523 109968 109983
CCCTATTGTCCCACCA 43 N/A N/A 606 908524 110612 110627
GTGCACTCTAGGCTTA 100 N/A N/A 607 908525 111378 111393
GGACACAGCGGCTGCC 78 N/A N/A 608 908526 111925 111940
CCGCAGGTTTCTGTGG 122 N/A N/A 609 908527 112198 112213
ACCGATAGGATCGGAG 95 N/A N/A 610 908528 112578 112593
GGCCGTCACAACTTTT 116 N/A N/A 611 908529 112910 112925
CTGGAACCTCCTACTG 87 N/A N/A 612 908530 114292 114307
GGCCGAATGCTTGAGG 97 N/A N/A 613 908531 114921 114936
TCACAGGGCCCCCTCA 68 N/A N/A 614 908532 115371 115386
GGCCTTACCTGGGCAC 101 N/A N/A 615 908533 115837 115852
CCGCAAGCCACCAGGG 87 N/A N/A 616 *Oligos with an asterisk target an
amplicon region.
[0445] Each modified oligonucleotide listed in the table below is
100% complementary to human DNM2 nucleic acid sequence GENBANK
Number NM_001005361.2 (designated herein as SEQ ID NO:3). "Start
Site" indicates the 5'-most nucleoside of SEQ ID No: 3 to which the
oligonucleotide is complementary. "Stop Site" indicates the 3'-most
nucleoside of SEQ ID No: 3 to which the oligonucleotide is
complementary. `N/A` indicates that the modified oligonucleotide is
not 100% complementary to the particular nucleic acid. As shown
below, modified oligonucleotides complementary to DNM2 reduced
human DNM2 mRNA expression.
TABLE-US-00003 TABLE 2 DNM2 mRNA Expression SEQ SEQ ID: 3 ID: 3 SEQ
Compound Start Stop Dynamin2 ID Number Site Site Sequence
(%Control) NO 695118 1728 1743 ATCTCCCCCTGATTGG 60 617 908218 1732
1747 CAGGATCTCCCCCTGA 114 618 908219 1379 1394 GCCCCGTCCTGACTCC 61
619 908220 1381 1396 GAGCCCCGTCCTGACT 92 620 908233 1515 1530
CTGAGCTTCTCGGCAC 70 621 908234 1517 1532 AACTGAGCTTCTCGGC 85 622
908235 1519 1534 GGAACTGAGCTTCTCG 33 623
Example 2: Effect of Modified Oligonucleotides Complementary to
Dynamin 2 In Vitro
[0446] Modified oligonucleotides complementary to dynamin (DNM2)
nucleic acid were designed and tested for their effect on dynamin 2
mRNA in vitro. The modified oligonucleotides were tested in a
series of experiments that had similar culture conditions.
[0447] A431 cells cultured at a density of 10,000 cells per well
were treated with 2,000 nM of modified oligonucleotide via free
uptake or no oligonucleotide for untreated controls. After
approximately 24 hours, RNA was isolated from the cells and DNM2
mRNA levels were measured by quantitative real-time PCR as
described in Example 1.
[0448] The modified oligonucleotides in the tables below each have
a 3-10-3 cEt gapmer motif, wherein the central gap segment contains
ten 2'-deoxynucleosides and is flanked by wing segments on the 3'
and 5' ends, each containing three cEt nucleosides. All cytosine
residues throughout each modified oligonucleotide are 5-methyl
cytosines. All internucleoside linkages are phosphorothioate
internucleoside linkages.
[0449] Each modified oligonucleotide listed in the tables below is
100% complementary to human DNM2 nucleic acid sequence GENBANK
Number NC_000019.10, truncated from 10715001 to 1083500 (SEQ ID NO:
1) and/or GENBANK Number NM_004945.3 (SEQ ID NO:2). As shown below,
modified oligonucleotides complementary to human DNM2 inhibited
human DNM2 mRNA expression.
TABLE-US-00004 TABLE 3 DNM2 mRNA Expression SEQ SEQ SEQ ID: SEQ ID:
ID: 2 ID 2: SEQ Compound 1 Start 1 Stop Dunamin2 Start Stop ID
Number Site Site Sequence (%Control) Site Site NO 694792 3060 3075
CGACACCCGACCCGAG 26 N/A N/A 624 694812 3317 3332 GTCCAGGTGGCAGCTC
37 265 280 625 694826 57522 57537 CCGGACTTCATCAAAG 82 469 484 626
694999 115263 115278 GTCCAGGCCGGGATGG 92 2606 N/A 627 695015 116005
116020 GCGGATAATGGTGGGC 12 2749 N/A 628 695016 116011 116026
GGCTGGGCGGATAATG 76 2755 N/A 629 695170 82446 82461
CTTCAAACTCGGCTCT 9 N/A N/A 630 695171 82451 82466 ACACACTTCAAACTCG
7 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG 12 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 9 N/A N/A 13 695171 82451 82466
ACACACTTCAAACTCG 8 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG
11 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG 7 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 121 N/A N/A 13 695171 82451
82466 ACACACTTCAAACTCG 14 N/A N/A 13 695171 82451 82466
ACACACTTCAAACTCG 8 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG 6
N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG 31 N/A N/A 13 695171
82451 82466 ACACACTTCAAACTCG 8 N/A N/A 13 695171 82451 82466
ACACACTTCAAACTCG 6 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG
10 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG 8 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 12 N/A N/A 13 695171 82451
82466 ACACACTTCAAACTCG 11 N/A N/A 13 695171 82451 82466
ACACACTTCAAACTCG 11 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG
5 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG 12 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 7 N/A N/A 13 695171 82451 82466
ACACACTTCAAACTCG 120 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG
6 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG 8 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 9 N/A N/A 13 695171 82451 82466
ACACACTTCAAACTCG 7 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG
10 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG 9 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 9 N/A N/A 13 695171 82451 82466
ACACACTTCAAACTCG 9 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG
10 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG 7 N/A N/A 13
948484 82379 82394 GTGAAGAGCCCCGTCC 42 N/A N/A 631 948485 82380
82395 GGTGAAGAGCCCCGTC 103 N/A N/A 632 948486 82443 82458
CAAACTCGGCTCTTTG 99 N/A N/A 633 948487 82444 82459 TCAAACTCGGCTCTTT
15 N/A N/A 634 948488 82445 82460 TTCAAACTCGGCTCTT 5 N/A N/A 635
948489 82448 82463 CACTTCAAACTCGGCT 3 N/A N/A 636 948490 82449
82464 ACACTTCAAACTCGGC 1 N/A N/A 637 948491 82450 82465
CACACTTCAAACTCGG 25 N/A N/A 638 948492 82452 82467 AACACACTTCAAACTC
11 N/A N/A 639 948493 82453 82468 CAACACACTTCAAACT 51 N/A N/A 640
948494 82454 82469 TCAACACACTTCAAAC 30 N/A N/A 641 948495 82458
82473 GAGATCAACACACTTC 19 N/A N/A 642 948496 82460 82475
ACGAGATCAACACACT 5 N/A N/A 643 948497 82461 82476 CACGAGATCAACACAC
28 N/A N/A 644 948498 82463 82478 ACCACGAGATCAACAC 50 N/A N/A 645
948499 82467 82482 TGAGACCACGAGATCA 55 N/A N/A 646 948500 82469
82484 TCTGAGACCACGAGAT 107 N/A N/A 647 948501 82470 82485
CTCTGAGACCACGAGA 119 N/A N/A 648 948502 82490 82505
TTTTTTATGACCGTGG 18 N/A N/A 649 948503 82496 82511 GCACACTTTTTTATGA
17 N/A N/A 650 948504 82497 82512 GGCACACTTTTTTATG 54 N/A N/A 651
948505 82499 82514 TCGGCACACTTTTTTA 10 N/A N/A 652 948506 82500
82515 CTCGGCACACTTTTTT 3 N/A N/A 653 948507 82501 82516
TCTCGGCACACTTTTT 3 N/A N/A 654 948508 82503 82518 CTTCTCGGCACACTTT
3 N/A N/A 655 948514 3056 3071 ACCCGACCCGAGCGAC 81 4 19 656 948515
3067 3082 TCTCAGGCGACACCCG 88 15 30 657 948516 3092 3107
CCTCACGGTCGCCGCC 56 40 55 658 948517 3094 3109 GGCCTCACGGTCGCCG 98
42 57 659 948518 3103 3118 TCCCGGCTCGGCCTCA 48 51 66 660 948519
3139 3154 GCTCCCCGCCCGCCCG 71 87 102 661 948520 3141 3156
TTGCTCCCCGCCCGCC 23 89 104 662 948521 3142 3157 GTTGCTCCCCGCCCGC 10
90 105 663 948522 3143 3158 CGTTGCTCCCCGCCCG 50 91 106 664 948523
3145 3160 GCCGTTGCTCCCCGCC 53 93 108 665 948524 3147 3162
TAGCCGTTGCTCCCCG 17 95 110 666 948525 3148 3163 GTAGCCGTTGCTCCCC 14
96 111 667 948526 3150 3165 CTGTAGCCGTTGCTCC 10 98 113 668 948527
3151 3166 TCTGTAGCCGTTGCTC 9 99 114 669 948528 3152 3167
GTCTGTAGCCGTTGCT 13 100 115 670 948529 3168 3183 GACCTGGCCCCGCGGC
76 116 131 671 948530 3169 3184 CGACCTGGCCCCGCGG 83 117 132 672
948531 3170 3185 ACGACCTGGCCCCGCG 36 118 133 673 948532 3172 3187
CAACGACCTGGCCCCG 17 120 135 674 948533 3173 3188 TCAACGACCTGGCCCC
20 121 136 675 948534 3174 3189 CTCAACGACCTGGCCC 30 122 137 676
948535 3175 3190 CCTCAACGACCTGGCC 101 123 138 677 948536 3176 3191
CCCTCAACGACCTGGC 57 124 139 678 948537 3278 3293 CTGCAGTTTGTTGACC
45 226 241 679 948538 3299 3314 GCCGATGGAGCTGAAG 7 247 262 680
948539 3300 3315 GGCCGATGGAGCTGAA 104 248 263 681 948540 N/A N/A
AAGGAAGTCCCGGCCC 81 346 361 682 948541 N/A N/A GAAGGAAGTCCCGGCC 101
347 362 683 948542 44750 44765 GATTCCTGAACCGCGG 106 364 379 684
948543 44752 44767 ACGATTCCTGAACCGC 38 366 381 685 948544 44754
44769 TGACGATTCCTGAACC 18 368 383 686 948545 44755 44770
GTGACGATTCCTGAAC 40 369 384 687 948546 44756 44771 GGTGACGATTCCTGAA
42 370 385 688 948547 44758 44773 CGGGTGACGATTCCTG 111 372 387 689
948548 44761 44776 CGCCGGGTGACGATTC 44 375 390 690 948549 44769
44784 TGAGAGGCCGCCGGGT 11 383 398 691 948550 44771 44786
AATGAGAGGCCGCCGG 76 385 400 692 948551 44772 44787 GAATGAGAGGCCGCCG
67 386 401 693 948552 44775 44790 GCAGAATGAGAGGCCG 99 389 404 694
948553 57480 57495 CAAAAACTCGGCATGT 20 427 442 695 948554 57481
57496 GCAAAAACTCGGCATG 15 428 443 696 948555 57490 57505
ACTTGCAGTGCAAAAA 15 437 452 697 948556 57492 57507 GGACTTGCAGTGCAAA
7 439 454 698 948557 57494 57509 TTGGACTTGCAGTGCA 3 441 456 699
948558 57497 57512 TTTTTGGACTTGCAGT 10 444 459 700 948559 57498
57513 CTTTTTGGACTTGCAG 6 445 460 701 948560 57500 57515
AACTTTTTGGACTTGC 3 447 462 702 948561 57501 57516 AAACTTTTTGGACTTG
92 448 463 703 948562 57502 57517 TAAACTTTTTGGACTT 8 449 464 704
948563 57503 57518 GTAAACTTTTTGGACT 26 450 465 705 948564 57504
57519 TGTAAACTTTTTGGAC 15 451 466 706 948565 57524 57539
TGCCGGACTTCATCAA 31 471 486 707 948566 57525 57540 CTGCCGGACTTCATCA
24 472 487 708 948567 57527 57542 TCCTGCCGGACTTCAT 26 474 489 709
948568 57530 57545 ATCTCCTGCCGGACTT 14 477 492 710 948569 57531
57546 AATCTCCTGCCGGACT 18 478 493 711 948570 57535 57550
CTTCAATCTCCTGCCG 29 482 497 712
948571 57597 57612 TCGAAGGTTGATGGGC 89 544 559 713 948572 57598
57613 CTCGAAGGTTGATGGG 88 545 560 714 948573 57599 57614
ACTCGAAGGTTGATGG 75 546 561 715 948574 60706 60721 ATGAGGGTCAAGTTCA
52 579 594 716 948575 60708 60723 CGATGAGGGTCAAGTT 15 581 596 717
948576 60709 60724 TCGATGAGGGTCAAGT 28 582 597 718 948577 60710
60725 GTCGATGAGGGTCAAG 22 583 598 719 948578 60712 60727
AGGTCGATGAGGGTCA 15 585 600 720 948579 60714 60729 GGAGGTCGATGAGGGT
53 587 602 721 948580 60717 60732 CCGGGAGGTCGATGAG 93 590 605 722
948581 60721 60736 ATACCCGGGAGGTCGA 32 594 609 723 948582 60723
60738 TGATACCCGGGAGGTC 34 596 611 724 948583 60725 60740
GGTGATACCCGGGAGG 32 598 613 725 948584 60726 60741 TGGTGATACCCGGGAG
79 599 614 726 948585 60727 60742 TTGGTGATACCCGGGA 27 600 615 727
948586 60729 60744 CCTTGGTGATACCCGG 44 602 617 728 948587 60774
60789 CCTTGATCTGGTACTC 6 647 662 729 948588 60775 60790
TCCTTGATCTGGTACT 20 648 663 730 948589 60777 60792 TGTCCTTGATCTGGTA
12 650 665 731 948590 60779 60794 CATGTCCTTGATCTGG 13 652 667 732
948591 60781 60796 ATCATGTCCTTGATCT 34 654 669 733 948592 60782
60797 GATCATGTCCTTGATC 57 655 670 734 948593 60783 60798
GGATCATGTCCTTGAT 38 656 671 735 948594 60815 60830 AATGAGGCTGCTCTCC
42 688 703 736 948595 60820 60835 GCCAGAATGAGGCTGC 92 693 708 737
948596 60848 60863 GGCCAGGTCCATGTTG 92 721 736 738 948597 N/A N/A
GGTCCGTAGGCCTTGG 45 775 790 739 948598 62120 62135 CACCGATGGTCCGTAG
49 782 797 740 948599 62192 62207 ACGGGAGCAACTTGTT 76 854 869 741
948600 62196 62211 CTCAACGGGAGCAACT 48 858 873 742 948601 62197
62212 TCTCAACGGGAGCAAC 45 859 874 743 948602 68004 68019
CACGGATGTCCTTCTT 8 923 938 744 948603 68006 68021 TGCACGGATGTCCTTC
25 925 940 745 948604 68007 68022 CTGCACGGATGTCCTT 5 926 941 746
948605 68009 68024 TGCTGCACGGATGTCC 16 928 943 747 948606 68010
68025 GTGCTGCACGGATGTC 20 929 944 748 948607 68011 68026
AGTGCTGCACGGATGT 22 930 945 749 948608 68012 68027 CAGTGCTGCACGGATG
8 931 946 750 948609 68014 68029 GCCAGTGCTGCACGGA 37 933 948 751
948610 68015 68030 TGCCAGTGCTGCACGG 50 934 949 752 948611 68016
68031 CTGCCAGTGCTGCACG 27 935 950 753 948612 68018 68033
AGCTGCCAGTGCTGCA 107 937 952 754 948613 68056 68071
TGCCGGTAGGCCGGGT 122 975 990 755 948614 71653 71668
CCGAAAGTTCTTGTAC 31 1129 1144 756 948615 71656 71671
GGGCCGAAAGTTCTTG 88 1132 1147 757 948616 71657 71672
CGGGCCGAAAGTTCTT 75 1133 1148 758 948617 71658 71673
TCGGGCCGAAAGTTCT 42 1134 1149 759 948618 71660 71675
CGTCGGGCCGAAAGTT 20 1136 1151 760 948619 71683 71698
GGCTTTGGTTTTGCGG 80 1159 1174 761 948620 78729 78744
ATCCACCCCAAACTGC 45 1192 1207 762 948621 78771 78786
AGTGTCCACCTGATCT 27 1234 1249 763 948622 78773 78788
AGAGTGTCCACCTGAT 11 1236 1251 764 948623 78774 78789
CAGAGTGTCCACCTGA 88 1237 1252 765 948624 78775 78790
CCAGAGTGTCCACCTG 74 1238 1253 766 948625 78777 78792
CTCCAGAGTGTCCACC 51 1240 1255 767 948626 78785 78800
CCGGAGAGCTCCAGAG 98 1248 1263 768 948627 78787 78802
CCCCGGAGAGCTCCAG 44 1250 1265 769 948628 78805 78820
TGCGATTGATTCGGGC 11 1268 1283 770 948629 78806 78821
ATGCGATTGATTCGGG 3 1269 1284 771 948630 78810 78825
GAAGATGCGATTGATT 10 1273 1288 772 948631 78811 78826
GGAAGATGCGATTGAT 3 1274 1289 773 948632 78812 78827
TGGAAGATGCGATTGA 9 1275 1290 774 948633 78813 78828
GTGGAAGATGCGATTG 8 1276 1291 775 948634 78829 78844
CAAATGGGAACCGCTC 60 1292 1307 776 948335 78830 78845
TCAAATGGGAACCGCT 65 1293 1308 777 948636 78831 78846
CTCAAATGGGAACCGC 81 1294 1309 778 948637 78832 78847
GCTCAAATGGGAACCG 58 1295 1310 779 948638 78833 78848
AGCTCAAATGGGAACC 43 1296 1311 780 948639 78837 78852
CACCAGCTCAAATGGG 70 1300 1315 781 948640 80420 80435
CTCCATGGATGTTCTT 42 1367 1382 782 948641 81059 81074
TGAAAAGCCCGGTCCT 38 1385 1400 783 948642 81060 81075
GTGAAAAGCCCGGTCC 37 1386 1401 784 948643 81062 81077
GGGTGAAAAGCCCGGT 120 1388 1403 785 948644 81077 81092
CGAATGCCAAGTCCGG 84 1403 1418 786 948645 81078 81093
TCGAATGCCAAGTCCG 28 1404 1419 787 948646 81080 81095
CCTCGAATGCCAAGTC 13 1406 1421 788 948647 81081 81096
GCCTCGAATGCCAAGT 73 1407 1422 789 948648 81084 81099
ATGGCCTCGAATGCCA 94 1410 1425 790 948649 81088 81103
CACAATGGCCTCGAAT 35 1414 1429 791 948650 81104 81119
TGACGACCTGCTTTTT 15 1430 1445 792 948651 81105 81120
TTGACGACCTGCTTTT 21 1431 1446 793 948652 81108 81123
AGCTTGACGACCTGCT 84 1434 1449 794 948653 81110 81125
TCAGCTTGACGACCTG 61 1436 1451 795 948654 81112 81127
TTTCAGCTTGACGACC 11 1438 1453 796 948655 81114 81129
TCTTTCAGCTTGACGA 27 1440 1455 797 948656 81116 81131
GCTCTTTCAGCTTGAC 3 1442 1457 798 948657 81117 81132
GGCTCTTTCAGCTTGA 59 1443 1458 799 948658 81118 81133
GGGCTCTTTCAGCTTG 73 1444 1459 800 948659 81120 81135
CAGGGCTCTTTCAGCT 75 1446 1461 801 948660 81132 81147
ACACATTTCAGACAGG 3 1458 1473 802 948661 81134 81149
CGACACATTTCAGACA 7 1460 1475 803 948662 81135 81150
TCGACACATTTCAGAC 10 1461 1476 804 948663 81136 81151
GTCGACACATTTCAGA 51 1462 1477 805 948664 81138 81153
AGGTCGACACATTTCA 3 1464 1479 806 948665 81140 81155
CCAGGTCGACACATTT 6 1466 1481 807 948666 81141 81156
ACCAGGTCGACACATT 8 1467 1482 808 948667 81142 81157
AACCAGGTCGACACAT 34 1468 1483 809 948668 81146 81161
GGATAACCAGGTCGAC 34 1472 1487 810 948669 81148 81163
CTGGATAACCAGGTCG 43 1474 1489 811 948670 81149 81164
CCTGGATAACCAGGTC 111 1475 1490 812 948671 81150 81165
TCCTGGATAACCAGGT 100 1476 1491 813 948672 81152 81167
GCTCCTGGATAACCAG 51 1478 1493 814 948673 81159 81174
TTGATTAGCTCCTGGA 2 1485 1500 815 948674 81161 81176
TATTGATTAGCTCCTG 8 1487 1502 816 948675 81162 81177
GTATTGATTAGCTCCT 2 1488 1503 817 948676 81163 81178
TGTATTGATTAGCTCC 1 1489 1504 818 948677 81164 81179
CTGTATTGATTAGCTC 2 1490 1505 819 948678 81165 81180
ACTGTATTGATTAGCT 7 1491 1506 820 948679 81168 81183
CTAACTGTATTGATTA 56 1494 1509 821 948680 81169 81184
CCTAACTGTATTGATT 44 1495 1510 822 948681 81171 81186
TGCCTAACTGTATTGA 25 1497 1512 823 948682 81177 81192
GTACACTGCCTAACTG 23 1503 1518 824 948683 81180 81195
CTGGTACACTGCCTAA 14 1506 1521 825 948684 81181 81196
ACTGGTACACTGCCTA 8 1507 1522 826 948685 81183 81198
TTACTGGTACACTGCC 2 1509 1524 827 948686 81184 81199
CTTACTGGTACACTGC 1 1510 1525 828 948687 N/A N/A GCTTACTGGTACACTG 6
1511 1526 829 948688 N/A N/A AGCTTACTGGTACACT 26 1512 1527 830
948689 N/A N/A GAGCTTACTGGTACAC 12 1513 1528 831 948690 N/A N/A
ACTGAGCTTACTGGTA 47 1516 1531 832 948691 N/A N/A AACTGAGCTTACTGGT
24 1517 1532 833 948692 N/A N/A GGAACTGAGCTTACTG 10 1519 1534 834
948693 N/A N/A AGGAACTGAGCTTACT 12 1520 1535 835 948694 N/A N/A
TAGGAACTGAGCTTAC 17 1521 1536 836 948695 N/A N/A GTAGGAACTGAGCTTA
15 1522 1537 837 948696 83484 83499 GGGTAGGAACTGAGCT 28 1524 1539
838
948697 83500 83515 CTCCTCTCGCAACCGG 56 1540 1555 839 948698 83503
83518 TGTCTCCTCTCGCAAC 44 1543 1558 840 948699 83504 83519
CTGTCTCCTCTCGCAA 27 1544 1559 841 948700 83506 83521
CTCTGTCTCCTCTCGC 5 1546 1561 842 948701 83507 83522
GCTCTGTCTCCTCTCG 8 1547 1562 843 948702 83508 83523
CGCTCTGTCTCCTCTC 5 1548 1563 844 948703 83510 83525
TTCGCTCTGTCTCCTC 5 1550 1565 845 948704 83514 83529
ACGATTCGCTCTGTCT 69 1554 1569 846 948705 83515 83530
GACGATTCGCTCTGTC 91 1555 1570 847 948706 83516 83531
TGACGATTCGCTCTGT 37 1556 1571 848 948707 83521 83536
AGTGGTGACGATTCGC 5 1561 1576 849 948708 83523 83538
TAAGTGGTGACGATTC 25 1563 1578 850 948709 83525 83540
TGTAAGTGGTGACGAT 21 1565 1580 851 948710 83526 83541
ATGTAAGTGGTGACGA 27 1566 1581 852 948711 83527 83542
GATGTAAGTGGTGACG 37 1567 1582 853 948712 83530 83545
CCGGATGTAAGTGGTG 60 1570 1585 854 948713 83543 83558
TCCCCTCCCGTTCCCG 40 1583 1598 855 948714 83545 83560
TCTCCCCTCCCGTTCC 30 1585 1600 856 948715 83546 83561
TTCTCCCCTCCCGTTC 43 1586 1601 857 948716 83547 83562
GTTCTCCCCTCCCGTT 14 1587 1602 858 948717 N/A N/A GCAGAAGAATCTGGTC
27 1607 1622 859 948718 87287 87302 GATCAGCAGAAGAATC 126 1612 1627
860 948719 87289 87304 TCGATCAGCAGAAGAA 70 1614 1629 861 948720
87291 87306 TGTCGATCAGCAGAAG 27 1616 1631 862 948721 87292 87307
ATGTCGATCAGCAGAA 51 1617 1632 863 948722 87293 87308
AATGTCGATCAGCAGA 41 1618 1633 864 948723 87295 87310
TCAATGTCGATCAGCA 17 1620 1635 865 948724 87297 87312
GCTCAATGTCGATCAG 14 1622 1637 866 948725 87298 87313
TGCTCAATGTCGATCA 41 1623 1638 867 948726 87301 87316
GACTGCTCAATGTCGA 91 1626 1641 868 948727 87303 87318
AGGACTGCTCAATGTC 28 1628 1643 869 948728 87305 87320
GTAGGACTGCTCAATG 136 1630 1645 870 948729 87306 87321
TGTAGGACTGCTCAAT 2 1631 1646 871 948730 87307 87322
ATGTAGGACTGCTCAA 18 1632 1647 872 948731 87309 87324
TGATGTAGGACTGCTC 6 1634 1649 873 948732 87310 87325
TTGATGTAGGACTGCT 13 1635 1650 874 948733 87312 87327
TGTTGATGTAGGACTG 39 1637 1652 875 948734 87313 87328
GTGTTGATGTAGGACT 22 1638 1653 876 948735 87314 87329
CGTGTTGATGTAGGAC 3 1639 1654 877 948736 N/A N/A GGCATTGGCAAACCCG
106 1672 1687 878 948737 97293 97308 CATCAGGCTGATGTTG 43 1765 1780
879 948738 97296 97311 TTTCATCAGGCTGATG 90 1768 1783 880 948739
97340 97355 AGTGACTCGGCAGTCA 100 1812 1827 881 948740 97342 97357
ACAGTGACTCGGCAGT 25 1814 1829 882 948741 97343 97358
GACAGTGACTCGGCAG 13 1815 1830 883 948742 97344 97359
GGACAGTGACTCGGCA 33 1816 1831 884 948743 97346 97361
CAGGACAGTGACTCGG 23 1818 1833 885 948744 97347 97362
CCAGGACAGTGACTCG 36 1819 1834 886 948745 97348 97363
ACCAGGACAGTGACTC 23 1820 1835 887 948746 97349 97364
TACCAGGACAGTGACT 93 1821 1836 888 948747 105014 105029
TCACGGATCTTGAGGT 27 1884 1899 889 948748 105016 105031
CATCACGGATCTTGAG 52 1886 1901 890 948749 105017 105032
ACATCACGGATCTTGA 43 1887 1902 891 948750 105018 105033
CACATCACGGATCTTG 19 1888 1903 892 948751 105021 105036
CTCCACATCACGGATC 60 1891 1906 893 948752 105024 105039
CTTCTCCACATCACGG 4 1894 1909 894 948753 105061 105076
TGAAGATGGCGAAGAC 52 1931 1946 895 948754 105062 105077
TTGAAGATGGCGAAGA 101 1932 1947 896 948755 105063 105078
GTTGAAGATGGCGAAG 83 1933 1948 897 948756 108794 108809
CCGCAGGTCCTTGTAG 60 1966 1981 898 948757 108796 108811
TGCCGCAGGTCCTTGT 42 1968 1983 899 948758 108809 108824
GGCCAGCTCGATCTGC 85 1981 1996 900 948759 108855 108870
GGAGGAACGAGGCCTT 80 2027 2042 901 948760 108856 108871
CGGAGGAACGAGGCCT 107 2028 2043 902 948761 108858 108873
CTCGGAGGAACGAGGC 111 2030 2045 903 948762 108864 108879
CGCCAGCTCGGAGGAA 125 2036 2051 904 948763 110079 110094
GAGAAGGTGTTCTCCT 98 2094 2109 905 948764 110082 110097
ATGGAGAAGGTGTTCT 112 2097 2112 906 948765 110158 110173
GGACTTGTTGATGATG 9 2173 2188 907 948766 110159 110174
TGGACTTGTTGATGAT 10 2174 2189 908 948767 110161 110176
GATGGACTTGTTGATG 12 2176 2191 909 948768 110162 110177
GGATGGACTTGTTGAT 8 2177 2192 910 948769 110163 110178
CGGATGGACTTGTTGA 10 2178 2193 911 948770 110164 110179
GCGGATGGACTTGTTG 36 2179 2194 912 948771 110165 110180
CGCGGATGGACTTGTT 78 2180 2195 913 948772 110173 110188
CATGAGGTCGCGGATG 25 2188 2203 914 948773 110174 110189
GCATGAGGTCGCGGAT 4 2189 2204 915 948774 110176 110191
TGGCATGAGGTCGCGG 9 2191 2206 916 948775 114037 114052
TGGATGAAGGCCTTCG 6 2238 2253 917 948776 114065 114080
GGAGTATAGGTAGGCC 15 2266 2281 918 948777 114067 114082
GAGGAGTATAGGTAGG 7 2268 2283 919 948778 114070 114085
GCCGAGGAGTATAGGT 51 2271 2286 920 948779 114071 114086
TGCCGAGGAGTATAGG 17 2272 2287 921 948780 114152 114167
CTTGAGGGCATGGTAC 48 2353 2368 922 948781 114225 114240
TGTCATCGACAGGCGG 32 2426 2441 923 948782 115139 115154
GGACACCGGTCGGCGC 103 2482 2497 924 948783 115140 115155
TGGACACCGGTCGGCG 43 2483 2498 925 948784 115145 115160
TATGCTGGACACCGGT 33 2488 2503 926 948785 115147 115162
TGTATGCTGGACACCG 22 2490 2505 927 948786 115148 115163
GTGTATGCTGGACACC 78 2491 2506 928 948787 115149 115164
GGTGTATGCTGGACAC 79 2492 2507 929 948788 115212 115227
CGGGAACAGGAATCAG 13 2555 2570 930 948789 115213 115228
ACGGGAACAGGAATCA 19 2556 2571 931 948790 115217 115232
CCCCACGGGAACAGGA 101 2560 2575 932 948791 115235 115250
CGAGAAGGAGGCTGCT 45 2578 2593 933 948792 115236 115251
CCGAGAAGGAGGCTGC 37 2579 2594 934 948793 115237 115252
GCCGAGAAGGAGGCTG 124 2580 2595 935 948794 115279 115294
GCAAACACGCTCTGGG 6 2622 2637 936 948795 115280 115295
GGCAAACACGCTCTGG 11 2623 2638 937 948796 115281 115296
TGGCAAACACGCTCTG 31 2624 2639 938 948797 115282 115297
TTGGCAAACACGCTCT 23 2625 2640 939 948798 115284 115299
TGTTGGCAAACACGCT 15 2627 2642 940 948799 115286 115301
ACTGTTGGCAAACACG 66 2629 2644 941 948800 115287 115302
CACTGTTGGCAAACAC 39 2630 2645 942 948801 115288 115303
TCACTGTTGGCAAACA 28 2631 2646 943 948802 115289 115304
GTCACTGTTGGCAAAC 17 2632 2647 944 948803 115290 115305
GGTCACTGTTGGCAAA 16 2633 2648 945 948804 115291 115306
AGGTCACTGTTGGCAA 9 2634 2649 946 948805 115293 115308
AGAGGTCACTGTTGGC 3 2636 2651 947 948806 115294 115309
AAGAGGTCACTGTTGG 7 2637 2652 948 948807 115295 115310
GAAGAGGTCACTGTTG 19 2638 2653 949 948808 115297 115312
GGGAAGAGGTCACTGT 13 2640 2655 950 948809 115321 115336
CGAGATGGGATCTGAG 33 2664 2679 951 948810 115322 115337
CCGAGATGGGATCTGA 18 2665 2680 952 948811 115323 115338
GCCGAGATGGGATCTG 28 2666 2681 953 948812 115327 115342
ACTGGCCGAGATGGGA 13 2670 2685 954 948813 115328 115343
AACTGGCCGAGATGGG 20 2671 2686 955 948814 115330 115345
CGAACTGGCCGAGATG 27 2673 2688 956 948815 115331 115346
CCGAACTGGCCGAGAT 46 2674 2689 957 948816 115333 115348
ATCCGAACTGGCCGAG 35 2676 2691 958 948817 115334 115349
GATCCGAACTGGCCGA 105 2677 2692 959 948818 115991 116006
GCCGGCTGGGCGCAGC 124 2735 2750 960 948819 116000 116015
TAATGGTGGGCCGGCT 83 2744 2759 961 948820 116002 116017
GATAATGGTGGGCCGG 96 2746 2761 962 948821 116003 116018
GGATAATGGTGGGCCG 73 2747 2762 963
948822 116004 116019 CGGATAATGGTGGGCC 41 2748 2763 964 948823
116014 116029 CTCGGCTGGGCGGATA 109 2758 2773 965 948824 116023
116038 CAGGGATGGCTCGGCT 48 2767 2782 966 948825 116028 116043
TCGAGCAGGGATGGCT 84 2772 2787 967 948826 116029 116044
GTCGAGCAGGGATGGC 135 2773 2788 968 948827 116034 116049
GCCTAGTCGAGCAGGG 84 2778 2793 969 948828 116055 116070
CGAGAGCACGCCCCCC 37 2799 2814 970 948829 116058 116073
CCCCGAGAGCACGCCC 73 2802 2817 971 948830 116092 116107
ACTGAAGCTCCTGCGC 75 2836 2851 972 948831 116109 116124
GCGGAGGGCCCCAGAC 94 2853 2868 973 948832 116163 116178
GTTAAGGAAGAGGCCA 27 2907 2922 974 948833 116210 116225
TGCGGTGTCCAGCCAG 42 2954 2969 975 948834 116212 116227
AGTGCGGTGTCCAGCC 24 2956 2971 976 948835 116213 116228
CAGTGCGGTGTCCAGC 9 2957 2972 977 948836 116214 116229
GCAGTGCGGTGTCCAG 11 2958 2973 978 948837 116216 116231
GCGCAGTGCGGTGTCC 60 2960 2975 979 948838 116217 116232
TGCGCAGTGCGGTGTC 58 2961 2976 980 948839 116221 116236
CCTTTGCGCAGTGCGG 57 2965 2980 981 948840 116222 116237
CCCTTTGCGCAGTGCG 21 2966 2981 982 948841 116224 116239
GCCCCTTTGCGCAGTG 104 2968 2983 983 948842 116225 116240
GGCCCCTTTGCGCAGT 98 2969 2984 984 948843 116261 116276
GTGCAACACCCCAGCG 58 3005 3020 985 948844 116266 116281
CCAAAGTGCAACACCC 31 3010 3025 986 948845 116267 116282
CCCAAAGTGCAACACC 82 3011 3026 987 948846 116288 116303
TGCCACCCTGAGACTC 62 3032 3047 988 948847 116310 116325
TCAAGGGTTCTGGTCC 10 3054 3069 989 948848 116311 116326
GTCAAGGGTTCTGGTC 28 3055 3070 990 948849 116313 116328
GTGTCAAGGGTTCTGG 8 3057 3072 991 948850 116315 116330
TGGTGTCAAGGGTTCT 6 3059 3074 992 948851 116316 116331
ATGGTGTCAAGGGTTC 5 3060 3075 993 948852 116317 116332
GATGGTGTCAAGGGTT 6 3061 3076 994 948853 116319 116334
AGGATGGTGTCAAGGG 13 3063 3078 995 948854 116320 116335
CAGGATGGTGTCAAGG 11 3064 3079 996 948855 116321 116336
TCAGGATGGTGTCAAG 13 3065 3080 997 948856 116323 116338
ATTCAGGATGGTGTCA 13 3067 3082 998 948857 116325 116340
TCATTCAGGATGGTGT 20 3069 3084 999 948858 116327 116342
CCTCATTCAGGATGGT 82 3071 3086 1000 948859 116351 116366
GTAGAGTCCCCCCCAG 22 3095 3110 1001 948860 116353 116368
TGGTAGAGTCCCCCCC 44 3097 3112 1002 948861 116354 116369
TTGGTAGAGTCCCCCC 19 3098 3113 1003 948862 116355 116370
CTTGGTAGAGTCCCCC 9 3099 3114 1004 948863 116357 116372
ACCTTGGTAGAGTCCC 4 3101 3116 1005 948864 116358 116373
GACCTTGGTAGAGTCC 94 3102 3117 1006 948865 116361 116376
GAAGACCTTGGTAGAG 6 3105 3120 1007 948866 116363 116378
AAGAAGACCTTGGTAG 17 3107 3122 1008 948867 116364 116379
CAAGAAGACCTTGGTA 60 3108 3123 1009 948868 116365 116380
CCAAGAAGACCTTGGT 62 3109 3124 1010 948869 116366 116381
CCCAAGAAGACCTTGG 70 3110 3125 1011 948870 116367 116382
GCCCAAGAAGACCTTG 60 3111 3126 1012 948871 116384 116399
CTACATGGGCTTTCCC 85 3128 3143 1013 948872 116386 116401
CCCTACATGGGCTTTC 98 3130 3145 1014 948873 116399 116414
TATAGAAGGCCTGCCC 100 3143 3158 1015 948874 116401 116416
CTTATAGAAGGCCTGC 20 3145 3160 1016 948875 116402 116417
ACTTATAGAAGGCCTG 25 3146 3161 1017 948876 116403 116418
CACTTATAGAAGGCCT 34 3147 3162 1018 948877 116405 116420
CGCACTTATAGAAGGC 57 3149 3164 1019 948878 116406 116421
CCGCACTTATAGAAGG 83 3150 3165 1020 948879 116450 116465
CCCTGCACCCCAGCAA 128 3194 3209 1021 948880 116454 116469
ATACCCCTGCACCCCA 18 3198 3213 1022 948881 116456 116471
ATATACCCCTGCACCC 45 3200 3215 1023 948882 116457 116472
GATATACCCCTGCACC 11 3201 3216 1024 948883 116458 116473
TGATATACCCCTGCAC 13 3202 3217 1025 948884 116459 116474
TTGATATACCCCTGCA 9 3203 3218 1026 948885 116460 116475
GTTGATATACCCCTGC 4 3204 3219 1027 948886 116465 116480
GGGAAGTTGATATACC 14 3209 3224 1028 948887 116466 116481
TGGGAAGTTGATATAC 20 3210 3225 1029 948888 116468 116483
AATGGGAAGTTGATAT 59 3212 3227 1030 948889 116469 116484
TAATGGGAAGTTGATA 49 3213 3228 1031 948890 116470 116485
CTAATGGGAAGTTGAT 15 3214 3229 1032 948891 116472 116487
TGCTAATGGGAAGTTG 12 3216 3231 1033 948892 116473 116488
CTGCTAATGGGAAGTT 4 3217 3232 1034 948893 116475 116490
TCCTGCTAATGGGAAG 2 3219 3234 1035 948894 116476 116491
CTCCTGCTAATGGGAA 86 3220 3235 1036 948895 116479 116494
GAGCTCCTGCTAATGG 94 3223 3238 1037 948896 116498 116513
GGCCAGGCTTGCCGCT 99 3242 3257 1038 948897 116512 116527
TACCGAGCCCACTGGG 103 3256 3271 1039 948898 116515 116530
CACTACCGAGCCCACT 82 3259 3274 1040 948899 116517 116532
GGCACTACCGAGCCCA 64 3261 3276 1041 948900 116520 116535
CTGGGCACTACCGAGC 92 3264 3279 1042 948901 116525 116540
GCCAGCTGGGCACTAC 149 3269 3284 1043 948902 116526 116541
TGCCAGCTGGGCACTA 130 3270 3285 1044 948903 116539 116554
TACACCTCAGGCCTGC 28 3283 3298 1045 948904 116540 116555
GTACACCTCAGGCCTG 98 3284 3299 1046 948905 116542 116557
ATGTACACCTCAGGCC 77 3286 3301 1047 948906 116543 116558
TATGTACACCTCAGGC 9 3287 3302 1048 948907 116545 116560
ACTATGTACACCTCAG 5 3289 3304 1049 948908 116546 116561
GACTATGTACACCTCA 16 3290 3305 1050 948909 116548 116563
AGGACTATGTACACCT 125 3292 3307 1051 948910 116549 116564
AAGGACTATGTACACC 5 3293 3308 1052 948911 116551 116566
GGAAGGACTATGTACA 11 3295 3310 1053 948912 116552 116567
GGGAAGGACTATGTAC 28 3296 3311 1054 948913 116553 116568
CGGGAAGGACTATGTA 16 3297 3312 1055 948914 116554 116569
CCGGGAAGGACTATGT 60 3298 3313 1056 948915 116555 116570
GCCGGGAAGGACTATG 40 3299 3314 1057 948916 116560 116575
ATATGGCCGGGAAGGA 21 3304 3319 1058 948917 116562 116577
TAATATGGCCGGGAAG 2 3306 3321 1059 948918 116563 116578
TTAATATGGCCGGGAA 9 3307 3322 1060 948919 116564 116579
GTTAATATGGCCGGGA 16 3308 3323 1061 948920 116566 116581
TGGTTAATATGGCCGG 37 3310 3325 1062 948921 116567 116582
GTGGTTAATATGGCCG 45 3311 3326 1063 948922 116568 116583
TGTGGTTAATATGGCC 10 3312 3327 1064 948923 116570 116585
TGTGTGGTTAATATGG 3 3314 3329 1065 948924 116571 116586
CTGTGTGGTTAATATG 4 3315 3330 1066 948925 116572 116587
GCTGTGTGGTTAATAT 7 3316 3331 1067 948926 116574 116589
AGGCTGTGTGGTTAAT 3 3318 3333 1068 948927 116618 116633
GGCCTAGCAAAGGCAC 118 3362 3377 1069 948928 116631 116646
GCCAACGGCTCCGGGC 119 3375 3390 1070 948929 116637 116652
GCCCGGGCCAACGGCT 96 3381 3396 1071 948930 116645 116660
CAAGGCCGGCCCGGGC 131 3389 3404 1072 948931 116647 116662
GGCAAGGCCGGCCCGG 104 3391 3406 1073 948932 116652 116667
AATAGGGCAAGGCCGG 65 3396 3411 1074 948933 116653 116668
GAATAGGGCAAGGCCG 126 3397 3412 1075 948934 116654 116669
GGAATAGGGCAAGGCC 22 3398 3413 1076 948935 116656 116671
GAGGAATAGGGCAAGG 7 3400 3415 1077 948936 116657 116672
AGAGGAATAGGGCAAG 4 3401 3416 1078 948937 116658 116673
GAGAGGAATAGGGCAA 6 3402 3417 1079 948938 116660 116675
AGGAGAGGAATAGGGC 8 3404 3419 1080 948939 116705 116720
ACATAGCCCAAGCCCA 54 3449 3464 1081 948940 116706 116721
CACATAGCCCAAGCCC 72 3450 3465 1082 948941 116707 116722
CCACATAGCCCAAGCC 90 3451 3466 1083 948942 116709 116724
ACCCACATAGCCCAAG 71 3453 3468 1084 948943 116767 116782
ACCCATCAGGGAGGCA 93 3511 3526 1085 948944 116790 116805
CAGAGAGAGGCCGCCC 43 3534 3549 1086 948945 116793 116808
CCTCAGAGAGAGGCCG 134 3537 3552 1087 948946 116814 116829
AGCGAGGAGTGGGTGA 43 3558 3573 1088 948947 116817 116832
CTGAGCGAGGAGTGGG 57 3561 3576 1089
948948 116818 116833 ACTGAGCGAGGAGTGG 34 3562 3577 1090 948949
116820 116835 AAACTGAGCGAGGAGT 64 3564 3579 1091 948950 116821
116836 CAAACTGAGCGAGGAG 7 3565 3580 1092 948951 116823 116838
GTCAAACTGAGCGAGG 5 3567 3582 1093 948952 116824 116839
GGTCAAACTGAGCGAG 5 3568 3583 1094 948953 116825 116840
TGGTCAAACTGAGCGA 9 3569 3584 1095 948954 116827 116842
AGTGGTCAAACTGAGC 5 3571 3586 1096 948955 116828 116843
CAGTGGTCAAACTGAG 64 3572 3587 1097 948956 116829 116844
ACAGTGGTCAAACTGA 73 3573 3588 1098 948957 116830 116845
TACAGTGGTCAAACTG 69 3574 3589 1099 948958 116831 116846
TTACAGTGGTCAAACT 34 3575 3590 1100 948959 116833 116848
ACTTACAGTGGTCAAA 17 3577 3592 1101 948960 116834 116849
CACTTACAGTGGTCAA 11 3578 3593 1102 948961 116835 116850
GCACTTACAGTGGTCA 4 3579 3594 1103 948962 116836 116851
GGCACTTACAGTGGTC 45 3580 3595 1104 948963 116837 116852
AGGCACTTACAGTGGT 5 3581 3596 1105 948964 116841 116856
GTGCAGGCACTTACAG 43 3585 3600 1106 948965 116844 116859
AGAGTGCAGGCACTTA 7 3588 3603 1107 948966 116846 116861
ACAGAGTGCAGGCACT 8 3590 3605 1108 948967 116847 116862
TACAGAGTGCAGGCAC 12 3591 3606 1109 948968 116848 116863
ATACAGAGTGCAGGCA 6 3592 3607 1110 948969 116850 116865
GAATACAGAGTGCAGG 6 3594 3609 1111 948970 116851 116866
AGAATACAGAGTGCAG 2 3595 3610 1112 948971 116852 116867
TAGAATACAGAGTGCA 1 3596 3611 1113 948972 116854 116869
AATAGAATACAGAGTG 6 3598 3613 1114 948973 3394 3409 GCTCACCGGCCCACGA
72 N/A N/A 1115 948974 3500 3515 CGCGGGCACGCAAGCG 144 N/A N/A 1116
948975 3607 3622 CGTGACACCGCCCCTG 71 N/A N/A 1117 948976 3715 3730
ATCTACCCCAGACCCA 63 N/A N/A 1118 948977 3725 3740 CAGAAGAGGGATCTAC
99 N/A N/A 1119 948978 3776 3791 CAATAGATATCTAGAT 144 N/A N/A 1120
948979 3778 3793 CCCAATAGATATCTAG 59 N/A N/A 1121 948980 3815 3830
AGATACAAGAACAAGC 67 N/A N/A 1122 948981 3934 3949 AGCTAGCCAGACAGCA
146 N/A N/A 1123 948982 4010 4025 CAACAGAGGGACTGCT 85 N/A N/A 1124
948983 4035 4050 ACAGTAGAGGCCAGCT 96 N/A N/A 1125 948984 4130 4145
CGGAAGAGAGGAGCCA 84 N/A N/A 1126 948985 4135 4150 TCACACGGAAGAGAGG
63 N/A N/A 1127 948986 4142 4157 GAAGAATTCACACGGA 50 N/A N/A 1128
948987 4262 4277 GTCCAAACCTCCTCCT 63 N/A N/A 1129 948988 4315 4330
TCCTGAAGTAAGGTAC 96 N/A N/A 1130 948989 4326 4341 TCGGAAAGGAATCCTG
40 N/A N/A 1131 948990 4371 4386 AATTTGTAGGCTGTAG 21 N/A N/A 1132
948991 4388 4403 TCCAAAGGAGGGCCCC 140 N/A N/A 1133 948992 4476 4491
CACCGCGGCTTCTCAA 38 N/A N/A 1134 948993 4624 4639 GAGAAGTGGCCGCCCA
75 N/A N/A 1135 948994 4649 4664 CCACAAATGAGTAGTT 49 N/A N/A 1136
948995 4730 4745 CATTATCCCTTGACAA 115 N/A N/A 1137 948996 4742 4757
ATCAAGAAGGGACATT 85 N/A N/A 1138 948997 4838 4853 GGTGATCACAGTCCCT
72 N/A N/A 1139 948998 4938 4953 AGAGACAAGGTAGCAA 45 N/A N/A 1140
948999 4950 4965 AGGCAATGAGCTAGAG 39 N/A N/A 1141 949000 5049 5064
GAAGATGGTCACTCAA 47 N/A N/A 1142 949001 5051 5066 AGGAAGATGGTCACTC
32 N/A N/A 1143 949002 5162 5177 GTCAACCAAGACTTAG 48 N/A N/A 1144
949003 5545 5560 TAGAATGGCATCTTGT 28 N/A N/A 1145 949004 5710 5725
CCGGATCTGGTTCTGT 88 N/A N/A 1146 949005 5810 5825 AACCAGCCAGATAAAC
94 N/A N/A 1147 949006 5872 5887 GCTTAAGTGTGTAACG 8 N/A N/A 1148
949007 5873 5888 GGCTTAAGTGTGTAAC 10 N/A N/A 1149 949008 5898 5913
GATTATAGCAATGCCT 22 N/A N/A 1150 949009 5940 5955 GCTCAGCTATCTGAGC
107 N/A N/A 1151 949010 6074 6089 CCAGACACCATGGTAG 33 N/A N/A 1152
949011 6150 6165 ATATAATGAGCAACTC 47 N/A N/A 1153 949012 6174 6189
GTGAGACTCGGTGTAA 10 N/A N/A 1154 949013 6298 6313 GTGGTAACGCGCGCCT
41 N/A N/A 1155 949014 6455 6470 AATACTCTTAACGAGG 95 N/A N/A 1156
949015 6556 6571 ACCTTATCTCTTACAC 63 N/A N/A 1157 949016 6697 6712
TCCAGGCTCGGCGCAA 83 N/A N/A 1158 949017 6752 6767 AGCTATAGGGCTGAAC
129 N/A N/A 1159 949018 6816 6831 CGCAGGTAAAACAAAA 38 N/A N/A 1160
949019 6817 6832 ACGCAGGTAAAACAAA 56 N/A N/A 1161 949020 6821 6836
AGCTACGCAGGTAAAA 66 N/A N/A 1162 949021 6824 6839 AAAAGCTACGCAGGTA
27 N/A N/A 1163 949022 6870 6885 CCGGATATTGACTGGA 46 N/A N/A 1164
949023 6891 6906 TGTCTTAGAGCCACAA 131 N/A N/A 1165 949024 6906 6921
CTCTATAGATCTGAGT 123 N/A N/A 1166 949025 6918 6933 GACAACTCAGAACTCT
93 N/A N/A 1167 949026 7031 7046 TACCACCCTCAGCTTA 69 N/A N/A 1168
949027 7131 7146 CGCCAGGTGAAACTGA 86 N/A N/A 1169 949028 7155 7170
CCACAAGGGACAAAGG 89 N/A N/A 1170 949029 7170 7185 TCGAAGCCATTACTGC
89 N/A N/A 1171 949030 7248 7263 TGCTAGGGAGTAGTGG 47 N/A N/A 1172
949031 7273 7288 GCAAAATGATCTAGGC 26 N/A N/A 1173 949032 7328 7343
CCGCAGACAAGCCAGG 99 N/A N/A 1174 949033 7351 7366 CCAAAGTTCTATCTGC
15 N/A N/A 1175 949034 7395 7410 TGACAAGGGTCAAGAG 91 N/A N/A 1176
949035 7400 7415 CTAAATGACAAGGGTC 22 N/A N/A 1177 949036 7402 7417
GGCTAAATGACAAGGG 47 N/A N/A 1178 949037 7645 7660 GTATAAGACCCTATCT
83 N/A N/A 1179 949038 7849 7864 ATTTGAGGCGAGGAGG 58 N/A N/A 1180
949050 8567 8582 TTTTAAAGAAGACGGG 51 N/A N/A 1181 949051 8584 8599
TGCTATTATAACTCCT 15 N/A N/A 1182 949052 8671 8686 GAACAACACCTAATGT
47 N/A N/A 1183 949053 8675 8690 GAACGAACAACACCTA 8 N/A N/A 1184
949054 8678 8693 AATGAACGAACAACAC 22 N/A N/A 1185 949055 8705 8720
AGTAAAAGTACTCAGG 8 N/A N/A 1186 949056 8740 8755 TGGTAACTTGCTCAGG
16 N/A N/A 1187 949057 8773 8788 GCTGAAAGGCCAGCTC 83 N/A N/A 1188
949058 8949 8964 CTACAGGTGTCACCAT 100 N/A N/A 1189 949059 9093 9108
ACTTATCGCCTTTTTT 11 N/A N/A 1190 949061 9613 9628 CTCCACTGGCCTGCTA
4 N/A N/A 1191 949062 9724 9739 AGGGACAGCAGTAGCG 69 N/A N/A 1192
949063 9830 9845 AGAAAAATGGCACGGG 41 N/A N/A 1193 949064 9883 9898
TAAAAACGCAGCTGGA 79 N/A N/A 1194 949065 9971 9986 TGCACTGGTGCAGCAC
115 N/A N/A 1195 949066 10072 10087 GGCTCTAAACTAATAA 143 N/A N/A
1196 949067 10260 10275 TCGGGATTCACTATGT 28 N/A N/A 1197 949068
10379 10394 CGCTTACTGCAAGTTC 40 N/A N/A 1198 949069 10481 10496
CCTAACCGAGCCTTGC 78 N/A N/A 1199 949070 10675 10690
ACAACAATTTGCTACG 45 N/A N/A 1200 949071 10677 10692
TCACAACAATTTGCTA 23 N/A N/A 1201 949072 11266 11281
TGACACCAAACTGAGC 92 N/A N/A 1202 949073 11356 11371
AAAGAAACTAAGGCCG 87 N/A N/A 1203 949074 11384 11399
TAATGATGAGTTCCTT 14 N/A N/A 1204 949075 11392 11407
CAACAGAGTAATGATG 54 N/A N/A 1205 949076 11496 11511
CGATATTTCAGGATCT 88 N/A N/A 1206 949077 11597 11612
CTCATCACCGTACACA 9 N/A N/A 1207 949078 11881 11896 CCCTATCATTGGTTTT
55 N/A N/A 1208 949079 11984 11999 TAACAGGTCTTGTGCA 55 N/A N/A 1209
949080 12093 12108 ACGATTCACATGTGGG 11 N/A N/A 1210 949081 12141
12156 AACCTAATCCCCAAAC 104 N/A N/A 1211 949082 12195 12210
AGCACTTGGACAGCCT 36 N/A N/A 1212 949083 12200 12215
GAAAAAGCACTTGGAC 31 N/A N/A 1213 949084 12214 12229
CAATAAGTAACTCTGA 52 N/A N/A 1214
949085 12318 12333 ATCTACAACTGTCCCC 25 N/A N/A 1215 949086 12555
12570 AATAATGAGACCCCAC 145 N/A N/A 1216 949087 12667 12682
TAAATCTAACCTAGGC 126 N/A N/A 1217 949088 12778 12793
CAGAAGTTTGGCAGAT 5 N/A N/A 1218 949089 12788 12803 TCAAATCGGGCAGAAG
22 N/A N/A 1219 949090 12858 12873 AAATTACGGTTTACAT 71 N/A N/A 1220
949091 12859 12874 TAAATTACGGTTTACA 20 N/A N/A 1221 949092 12878
12893 TTGTAGTTGGCAATCC 12 N/A N/A 1222 949093 12892 12907
GGCTTAATTACAGCTT 86 N/A N/A 1223 949094 12901 12916
CACAATAAGGGCTTAA 10 N/A N/A 1224 949095 12902 12917
ACACAATAAGGGCTTA 10 N/A N/A 1225 949096 12947 12962
CCCTATAAATATCTCA 23 N/A N/A 1226 949097 13037 13052
ACGCACCCGGAAGCAG 71 N/A N/A 1227 949098 13140 13155
AAACAGTCATCCAGCT 105 N/A N/A 1228 949099 13208 13223
TGGCACACGGTGATTC 57 N/A N/A 1229 949100 13215 13230
GCACATGTGGCACACG 27 N/A N/A 1230 949101 13273 13288
AGGGATGCTAAGAGCA 69 N/A N/A 1231 949102 13281 13296
TATAAAGCAGGGATGC 117 N/A N/A 1232 949103 13391 13406
CCATATGTGTGGCTCT 21 N/A N/A 1233 949104 13520 13535
GCATATCCAAAGCCAC 38 N/A N/A 1234 949105 13635 13650
CATTTAACTGTTCACC 28 N/A N/A 1235 949106 13812 13827
CGACAGACAAGTACCA 46 N/A N/A 1236 949107 13952 13967
GCATACAGCCTTTTTT 38 N/A N/A 1237 949108 13953 13968
CGCATACAGCCTTTTT 15 N/A N/A 1238 949109 13955 13970
ACCGCATACAGCCTTT 9 N/A N/A 1239 949110 13956 13971 CACCGCATACAGCCTT
46 N/A N/A 1240 949111 13959 13974 AACCACCGCATACAGC 50 N/A N/A 1241
949112 13961 13976 TGAACCACCGCATACA 40 N/A N/A 1242 949113 14262
14277 TGCAACCTTCAAGTAA 94 N/A N/A 1243 949114 14390 14405
GCAAACCGCTTCTCAC 74 N/A N/A 1244 949115 14492 14507
CCCCAAGTCCTGGCGG 99 N/A N/A 1245 949116 14629 14644
GAAAAGTCGGCATTCC 74 N/A N/A 1246 949117 14757 14772
TGACAGTGGTGCTCCC 66 N/A N/A 1247 949118 15000 15015
TGGCATGTGGTTGTTG 26 N/A N/A 1248 949119 15165 15180
AACAAATATATGCACG 20 N/A N/A 1249 949120 15370 15385
TCGCACCTCGGGATTC 92 N/A N/A 1250 949121 15507 15522
GTGAAATTCACTCCAT 40 N/A N/A 1251 949122 15612 15627
GGAAGATGTCCTTGCT 49 N/A N/A 1252 949123 15643 15658
ATAGATGGAGCAAATC 77 N/A N/A 1253 949124 15647 15662
TTATATAGATGGAGCA 32 N/A N/A 1254 949125 15708 15723
ACGCAGATAGACACCC 53 N/A N/A 1255 949126 15712 15727
GCCAACGCAGATAGAC 93 N/A N/A 1256 949127 15777 15792
TGCCATACAGGGCCTC 116 N/A N/A 1257 949128 15859 15874
GAAAGAGCAGTGGTGC 73 N/A N/A 1258 949129 15973 15988
GGGCATGGAGGTGTCA 90 N/A N/A 1259 949130 16025 16040
CGCGAAAGTGTGTCAC 64 N/A N/A 1260 949131 16117 16132
TATCACCCAGCAGGCA 75 N/A N/A 1261 949132 16275 16290
GGCCAGCTGGTAGGCC 114 N/A N/A 1262 949134 16714 16729
GTCAAGCTGAGCCAGT 52 N/A N/A 1263 949135 16815 16830
ACAGAAGCCGGGCTTC 127 N/A N/A 1264 949136 16926 16941
ATCAATTTTCACCCAG 19 N/A N/A 1265 949137 16930 16945
GTGCATCAATTTTCAC 127 N/A N/A 1266 949138 17244 17259
AAAGAGTTTAAGGGCG 57 N/A N/A 1267 949139 17282 17297
CCACAACGAGTAAACA 15 N/A N/A 1268 949140 17615 17630
GGACAGGGTGAATTGT 62 N/A N/A 1269 949141 17723 17738
AGTCACACCTAGAAAT 32 N/A N/A 1270 949142 17758 17773
GACTTATAGGCTCACT 12 N/A N/A 1271 949143 17763 17778
TACTAGACTTATAGGC 26 N/A N/A 1272 949144 17765 17780
GTTACTAGACTTATAG 19 N/A N/A 1273 949145 17766 17781
TGTTACTAGACTTATA 40 N/A N/A 1274 949146 17834 17849
ATATAGCAGGGACCTG 70 N/A N/A 1275 949147 17838 17853
CTAAATATAGCAGGGA 36 N/A N/A 1276 949148 17840 17855
CACTAAATATAGCAGG 24 N/A N/A 1277 949149 18278 18293
TTTGAGCCCGAGAGGG 46 N/A N/A 1278 949150 18486 18501
TTATTTCTAGGCAGGG 13 N/A N/A 1279 949151 18524 18539
GTAAATTTGAAGCTTA 144 N/A N/A 1280 949152 18583 18598
AATTAGAGGACACTGG 19 N/A N/A 1281 949153 18665 18680
GCTTTAACTCCTAGAC 61 N/A N/A 1282 949154 19040 19055
GTATACCAAGGTTAAT 56 N/A N/A 1283 949155 19050 19065
CTTAATAGTAGTATAC 96 N/A N/A 1284 949156 19458 19473
CACACGAGGTCTCACT 44 N/A N/A 1285 949157 19461 19476
CTACACACGAGGTCTC 72 N/A N/A 1286 949158 19663 19678
TACATTCTGGCTTTGG 12 N/A N/A 1287 949159 19763 19778
TCTCAGTATGTATACT 12 N/A N/A 1288 949160 19814 19829
TGTCCAGTCCTAAGAC 101 N/A N/A 1289 949161 19816 19831
AATGTCCAGTCCTAAG 81 N/A N/A 1290 949162 19817 19832
CAATGTCCAGTCCTAA 19 N/A N/A 1291 949163 19818 19833
GCAATGTCCAGTCCTA 4 N/A N/A 1292 949164 19820 19835 ATGCAATGTCCAGTCC
13 N/A N/A 1293 949165 19821 19836 GATGCAATGTCCAGTC 70 N/A N/A 1294
949166 19822 19837 AGATGCAATGTCCAGT 13 N/A N/A 1295 949167 19824
19839 CTAGATGCAATGTCCA 12 N/A N/A 1296 949168 19843 19858
GCTTAAGGAGATCCGA 17 N/A N/A 1297 949169 19844 19859
GGCTTAAGGAGATCCG 85 N/A N/A 1298 949170 19872 19887
GGCTGAGTTGCTTCCC 79 N/A N/A 1299 949171 19935 19950
TTCCAGATAAGCCCTA 32 N/A N/A 1300 949172 19986 20001
CACCAATGGCCTTCTT 42 N/A N/A 1301 949173 20328 20343
GAAGATGGCTGGACGA 34 N/A N/A 1302 949174 20330 20345
CAGAAGATGGCTGGAC 34 N/A N/A 1303 949175 20378 20393
CAATAATTTATCAGTC 68 N/A N/A 1304 949176 20440 20455
GGGAAACCTAGCAAGC 80 N/A N/A 1305 949177 20487 20502
CCCAAAGGATAGAGTA 23 N/A N/A 1306 949178 20735 20750
TTACATGAGTCTAGGA 50 N/A N/A 1307 949179 20737 20752
TATTACATGAGTCTAG 68 N/A N/A 1308 949180 20740 20755
GATTATTACATGAGTC 49 N/A N/A 1309 949181 20748 20763
GGCAAGAGGATTATTA 53 N/A N/A 1310 949182 20844 20859
AGCAACTTTAGGGAGA 5 N/A N/A 1311 949183 20899 20914 GAACAGACAGTTCAGG
76 N/A N/A 1312 949184 20947 20962 AAGATATGTGGTTTTG 35 N/A N/A 1313
949185 21341 21356 GAGCATCACCAGCCCA 127 N/A N/A 1314 949186 21403
21418 TAGAAATGAGTGGGCG 116 N/A N/A 1315 949187 21416 21431
AGCTACAGCAATATAG 43 N/A N/A 1316 949188 21449 21464
ACTCACATGGCCTGAT 81 N/A N/A 1317 949189 21491 21506
CTAGACTAGACAAAAC 91 N/A N/A 1318 949190 21514 21529
ATATATATGTGGAGGC 4 N/A N/A 1319 949191 21561 21576 CTAATACACAATGATC
34 N/A N/A 1320 949192 21591 21606 CAAAAAACTAATACCG 105 N/A N/A
1321 949193 21698 21713 AACCAGTACCAGCTGG 98 N/A N/A 1322 949194
21758 21773 AGAAACTGTACTGGTC 25 N/A N/A 1323 949195 21845 21860
GGATATTCTTAACAGG 26 N/A N/A 1324 949196 21854 21869
AGCTAGGAAGGATATT 83 N/A N/A 1325 949197 22009 22024
AAGTATGCGCTGCCAT 38 N/A N/A 1326 949198 22018 22033
TGGGACTGTAAGTATG 63 N/A N/A 1327 949199 22133 22148
GGATATAGGGTCTCCC 138 N/A N/A 1328 949200 22243 22258
CATGAGGTAGGACAGC 54 N/A N/A 1329 949201 22251 22266
GAAAAAGCCATGAGGT 100 N/A N/A 1330 949202 22301 22316
CCACAGGGTTATCTGG 119 N/A N/A 1331 949203 22345 22360
AAGGAGGCTTTTAAGC 92 N/A N/A 1332 949204 22446 22461
AGGAATGACAAGTGGT 17 N/A N/A 1333 949205 22466 22481
CGCATAGGTGGAACAA 58 N/A N/A 1334 949206 22478 22493
CAAGAAACCAAACGCA 81 N/A N/A 1335 949207 22638 22653
AATATACGGGCATGTT 82 N/A N/A 1336 949208 22639 22654
AAATATACGGGCATGT 110 N/A N/A 1337 949209 22641 22656
AAAAATATACGGGCAT 104 N/A N/A 1338 949210 22643 22658
ACAAAAATATACGGGC 67 N/A N/A 1339 949211 22644 22659
TACAAAAATATACGGG 33 N/A N/A 1340
949212 22780 22795 TCAAACAAATAGGCCG 86 N/A N/A 1341 949213 22862
22877 ATGCAAGGGACTGCGC 66 N/A N/A 1342 949214 22883 22898
ACCTATCGCATGCCAG 17 N/A N/A 1343 949215 23000 23015
GTTCAGGTCAGAGCCT 51 N/A N/A 1344 949216 23297 23312
TCTCAATGAAAGTCTC 10 N/A N/A 1345 949217 23548 23563
GTAACAACCGCTGGGA 27 N/A N/A 1346 949218 23555 23570
TTAAAGAGTAACAACC 75 N/A N/A 1347 949219 23715 23730
GCCCAGCTAACTAACT 108 N/A N/A 1348 949220 24040 24055
GACTACAGTACAGGCG 74 N/A N/A 1349 949221 24201 24216
AGAACAAGGGAACACG 80 N/A N/A 1350 949222 24210 24225
CCCCATAGAAGAACAA 138 N/A N/A 1351 949223 24289 24304
GATTAGGTATTATGGT 12 N/A N/A 1352 949224 24296 24311
TCAAAAGGATTAGGTA 25 N/A N/A 1353 949225 24315 24330
ATCCACTGAATAGTAT 32 N/A N/A 1354 949226 24364 24379
CTACAAAATCAGATAG 91 N/A N/A 1355 949227 24438 24453
GACATTAGTGGCTTCC 35 N/A N/A 1356 949228 24561 24576
AACCAGCATGGATGAA 87 N/A N/A 1357 949229 24782 24797
TGCAACCTTGCCCCCC 11 N/A N/A 1358 949230 24934 24949
TAGTATTCAAAAAACG 80 N/A N/A 1359 949231 25044 25059
CAAATTAAATACACCC 62 N/A N/A 1360 949232 25058 25073
GAATACTATTCTAACA 118 N/A N/A 1361 949233 25210 25225
CACCACAATTTGCTCT 63 N/A N/A 1362 949234 25305 25320
TCAGAAAAGGAGGGTA 109 N/A N/A 1363 949235 25321 25336
TTCCACTTCAAGAACC 87 N/A N/A 1364 949236 25696 25711
TGTAAGCAACTGTATT 49 N/A N/A 1365 949237 25788 25803
TGAGAAGATATGCTGA 26 N/A N/A 1366 949238 25822 25837
AACCTATGTATCAAAG 87 N/A N/A 1367 949239 25925 25940
CAAAGTAGTTCCTCCA 34 N/A N/A 1368 949240 25927 25942
TACAAAGTAGTTCCTC 68 N/A N/A 1369 949241 26042 26057
CCCAAGAGTAAAATAC 105 N/A N/A 1370 949242 26084 26099
ACGAAACCAATAAGAC 104 N/A N/A 1371 949243 26090 26105
GAAAATACGAAACCAA 99 N/A N/A 1372 949244 26133 26148
TAATAATGGATGGAAC 84 N/A N/A 1373 949245 26155 26170
TGGTATCAGGCAAGAA 35 N/A N/A 1374 949246 27033 27048
CATGATGCTGCAATCA 97 N/A N/A 1375 949247 27177 27192
CACAAGCCTGCGGACC 110 N/A N/A 1376 949248 27191 27206
GAGCATAGCAGACACA 65 N/A N/A 1377 949249 27254 27269
GGCAACATCACTCTAA 62 N/A N/A 1378 949250 27289 27304
CAAAGAGCCTTGGCAC 111 N/A N/A 1379 949251 27390 27405
CAGGACTAGTTCACTA 78 N/A N/A 1380 949252 27473 27488
ATGAAATTGGGATAAC 60 N/A N/A 1381 949253 27509 27524
ATGAAGGCTGCCACTT 103 N/A N/A 1382 949254 27575 27590
AGCAAGATCATTGGGT 65 N/A N/A 1383 949255 27634 27649
GGAAACCTTGGACTCC 91 N/A N/A 1384 949256 27761 27776
GTCTATTGGCACACAG 38 N/A N/A 1385 949257 27775 27790
GATTAAGTCATCCGGT 70 N/A N/A 1386 949258 27872 27887
GGGCACTGCACAAAGC 86 N/A N/A 1387 949259 27975 27990
AGTCAGCGGAGACTGA 98 N/A N/A 1388 949260 28212 28227
CGGCAAAAGAAGCTGG 133 N/A N/A 1389 949261 28320 28335
AGCTAGAGCATCAGCT 122 N/A N/A 1390 949262 28971 28986
CTGGAAACAGTCTCGC 29 N/A N/A 1391 949263 29116 29131
AGCCGAAGTGTAGTGG 51 N/A N/A 1392 949264 29258 29273
GGCCAAGTCTCCCATC 117 N/A N/A 1393 949265 29370 29385
CCGGACCCGTTCTTGA 85 N/A N/A 1394 949266 29501 29516
AGGTAGTGACCTCCAG 114 N/A N/A 1395 949267 29557 29572
ACCCACAGTCTGCATT 97 N/A N/A 1396 949268 29591 29606
GCCCAAGTGAACTAGA 94 N/A N/A 1397 949269 29625 29640
ATGTATGGATTTCCAG 62 N/A N/A 1398 949270 29642 29657
TTACAGGGTGGTCAGC 82 N/A N/A 1399 949271 29721 29736
GTAAAACGGTTGTGGT 30 N/A N/A 1400 949272 29739 29754
CAACAGGTGTCCTGCT 64 N/A N/A 1401 949273 29842 29857
TGTCATCCTAACTGCT 57 N/A N/A 1402 949274 29943 29958
AGAAACTGGCCGGCCC 132 N/A N/A 1403 949275 30052 30067
TTTATAGTCTCCAACG 34 N/A N/A 1404 949276 30178 30193
ACGGACTGGATTATGC 27 N/A N/A 1405 949277 30248 30263
GGCTAAATCAATCTTG 60 N/A N/A 1406 949278 30282 30297
CGATAATGACCTAAAT 84 N/A N/A 1407 949279 30283 30298
CCGATAATGACCTAAA 8 N/A N/A 1408 949280 30406 30421 GAATATCAACACCTTG
35 N/A N/A 1409 949281 30508 30523 AGTGATATGCTGCCTA 39 N/A N/A 1410
949282 30705 30720 GGTTTATTTGCACCTC 39 N/A N/A 1411 949283 30830
30845 TACCAGGGACTCAACT 111 N/A N/A 1412 949284 30933 30948
GGCCAGACATTGCTGT 142 N/A N/A 1413 949285 31273 31288
CACATTGGTGGTCAAG 98 N/A N/A 1414 949286 31373 31388
CTCATAACATTTGACG 45 N/A N/A 1415 949287 31708 31723
AAAAAAGCCGGCACGG 120 N/A N/A 1416 949288 32027 32042
AAAATTGGTTGAGTGC 40 N/A N/A 1417 949289 32161 32176
GTAAAACTCAGGCTGA 81 N/A N/A 1418 949290 32192 32207
CAAAAGAGAACATTCG 64 N/A N/A 1419 949291 32264 32279
TGTTATGTGGGAATGA 35 N/A N/A 1420 949292 32420 32435
AGGGACACAACAGGCT 85 N/A N/A 1421 949293 32560 32575
CACAATCCACTCCTGG 100 N/A N/A 1422 949294 32561 32576
CCACAATCCACTCCTG 83 N/A N/A 1423 949295 32615 32630
TTGCAGAACAATGGGC 105 N/A N/A 1424 949296 32697 32712
GCGCAGGGTCCCGTAT 95 N/A N/A 1425 949297 32719 32734
TATTAGAGTGGCAGCC 86 N/A N/A 1426 949298 32799 32814
TGCCACTCACAACTGG 104 N/A N/A 1427 949299 32852 32867
CGCCATAGGAAGCTGC 111 N/A N/A 1428 949300 32895 32910
GAGCAGGCGGGCAGCT 82 N/A N/A 1429 949301 32899 32914
AACAGAGCAGGCGGGC 92 N/A N/A 1430 949302 32900 32915
TAACAGAGCAGGCGGG 103 N/A N/A 1431 949303 32903 32918
CATTAACAGAGCAGGC 119 N/A N/A 1432 949304 32904 32919
GCATTAACAGAGCAGG 46 N/A N/A 1433 949305 33006 33021
AGCCACATATGCCTCC 91 N/A N/A 1434 949306 33148 33163
TGTTATGGGCCCTCCT 82 N/A N/A 1435 949307 33277 33292
TCCAAGGCTGTCAGCG 106 N/A N/A 1436 949308 33391 33406
CACGAGGCTGCAGACC 40 N/A N/A 1437 949309 33454 33469
CCGCAGGTAGGTGCCA 56 N/A N/A 1438 949310 33488 33503
GCCCAAGCCTTACAGT 117 N/A N/A 1439 949311 33512 33527
AGCCATTGGTCACCCA 43 N/A N/A 1440 949312 33618 33633
CCGCACCCACCTCAGG 132 N/A N/A 1441 949313 33644 33659
CACCAATGAGGCAGAC 69 N/A N/A 1442 949314 33725 33740
GTGGACTGAGGTTCAG 101 N/A N/A 1443 949315 33826 33841
CTCTAACCCCATCTCG 81 N/A N/A 1444 949316 33927 33942
TCGGCAGGAGCCCACA 108 N/A N/A 1445 949317 34028 34043
CCATATGCTCAGCACA 30 N/A N/A 1446 949318 34029 34044
ACCATATGCTCAGCAC 45 N/A N/A 1447 949319 34159 34174
GATAAGCCCACAGAGG 107 N/A N/A 1448 949320 34164 34179
CAACAGATAAGCCCAC 83 N/A N/A 1449 949321 34281 34296
ACAGACCACAAGGCTC 65 N/A N/A 1450 949322 34283 34298
GAACAGACCACAAGGC 82 N/A N/A 1451 949323 34407 34422
CAGGAAGGCGGTAGGG 92 N/A N/A 1452 949324 34539 34554
TGGGAGGACACTTCCA 121 N/A N/A 1453 949325 34546 34561
CATGAAATGGGAGGAC 9 N/A N/A 1454 949326 34561 34576 ACTGACTTGGCCATCC
68 N/A N/A 1455 949327 34654 34669 CCAGACTGTGGAGCCA 35 N/A N/A 1456
949328 34763 34778 GCCAAGACTTCTGCAC 129 N/A N/A 1457 949329 34873
34888 GCCTACCTGGCCATGG 119 N/A N/A 1458 949330 34995 35010
GCTGACCGGGTTCCCC 148 N/A N/A 1459 949331 35150 35165
TCCTATCCATGGGCCC 93 N/A N/A 1460 949332 35178 35193
TACTATTGCATCATTT 33 N/A N/A 1461 949333 35385 35400
CCCTAGTGAACTTCCC 38 N/A N/A 1462 949334 35541 35556
GCAAACCTCAGTCTCG 39 N/A N/A 1463 949335 35921 35936
GCACAATTAAGTAGTT 36 N/A N/A 1464 949336 35950 35965
GCATAGAGTAGGGCTG 55 N/A N/A 1465
949337 35955 35970 CCAAAGCATAGAGTAG 57 N/A N/A 1466 949338 35956
35971 CCCAAAGCATAGAGTA 62 N/A N/A 1467 949339 36021 36036
CCCATCTGAGCTGTGT 79 N/A N/A 1468 949340 36170 36185
TCGAATGACATTTCCT 65 N/A N/A 1469 949341 36211 36226
AGTAAGACAGGGTAAC 136 N/A N/A 1470 949342 36311 36326
GTGCACCCAGGCTGCC 105 N/A N/A 1471 949343 36420 36435
TTCCAGCCTCCGTCAT 90 N/A N/A 1472 949344 36531 36546
CCTAAGGGTTTTCTGG 109 N/A N/A 1473 949345 36532 36547
CCCTAAGGGTTTTCTG 144 N/A N/A 1474 949346 36570 36585
CCAGAAGTCTCCTAGG 108 N/A N/A 1475 949347 36647 36662
CTAAAAGTTCCCAGAC 86 N/A N/A 1476 949348 36757 36772
GGAGACGCAGCTCTCA 103 N/A N/A 1477 949349 36892 36907
GGACAAGCACCCCTCT 26 N/A N/A 1478 949350 36996 37011
CCCGACCCCGGCCAAT 96 N/A N/A 1479 949351 37100 37115
GTTCACTACAGACATC 71 N/A N/A 1480 949352 37105 37120
TTCTAGTTCACTACAG 92 N/A N/A 1481 949353 37243 37258
CATAGTACCCCACACA 56 N/A N/A 1482 949354 37300 37315
TTGTAGTGTGGAATAT 40 N/A N/A 1483 949355 37364 37379
CGCCCAAGAGAACACA 104 N/A N/A 1484 949356 37481 37496
CTCCACTTTGTGTCTG 58 N/A N/A 1485 949357 37583 37598
GCCTTCTGAGCAAACA 90 N/A N/A 1486 949358 37726 37741
AAAATGGGTCTGCTGG 18 N/A N/A 1487 949359 37730 37745
CATTAAAATGGGTCTG 56 N/A N/A 1488 949360 37843 37858
ACCTTAAGTTTCTTGT 70 N/A N/A 1489 949361 37896 37911
TGCAATGGAGTCCAAA 65 N/A N/A 1490 949362 37970 37985
CCTTAAGTTTTTTGGT 132 N/A N/A 1491 949363 38144 38159
TCATGATTATTAACCT 29 N/A N/A 1492 949364 38160 38175
AGGCATTGAGAACTTT 77 N/A N/A 1493 949365 38190 38205
AGCTATTCAACACTGA 65 N/A N/A 1494 949366 38206 38221
CATTAGAGTAGCTAAT 141 N/A N/A 1495 949367 38246 38261
TTGAATTCCGCATCAT 86 N/A N/A 1496 949368 38313 38328
AACAAAACAGGACCCG 108 N/A N/A 1497 949369 38353 38368
GAAGAAAGTCTGTACT 86 N/A N/A 1498 949370 38488 38503
TTGTAGTGATCAGTTT 54 N/A N/A 1499 949371 38588 38603
ATCCATGCTGCTATGC 63 N/A N/A 1500 949372 38688 38703
TTGCACAACAAAGAGC 90 N/A N/A 1501 949373 38948 38963
GATATATTGCTGGGCA 72 N/A N/A 1502 949374 38949 38964
AGATATATTGCTGGGC 44 N/A N/A 1503 949375 39017 39032
ACCTAAGGAAGCTGAC 72 N/A N/A 1504 949376 39062 39077
TTAAAGCCCAGCAACA 93 N/A N/A 1505 949377 39088 39103
ACGAAAAATTCAGATC 104 N/A N/A 1506 949378 39089 39104
GACGAAAAATTCAGAT 83 N/A N/A 1507 949379 39124 39139
ACAGAATTGTTACAAC 104 N/A N/A 1508 949380 39156 39171
GTACAGGGTGGACATT 90 N/A N/A 1509 949381 39162 39177
ACAAAAGTACAGGGTG 66 N/A N/A 1510 949382 39163 39178
TACAAAAGTACAGGGT 86 N/A N/A 1511 949383 39164 39179
ATACAAAAGTACAGGG 54 N/A N/A 1512 949384 39195 39210
AGTCAAGGAGAACATG 63 N/A N/A 1513 949385 39529 39544
TTGTAGTGGGTCACGC 53 N/A N/A 1514 949386 39644 39659
CATGATTGCGCCGTTG 17 N/A N/A 1515 949387 39745 39760
GTAATTCACTGCGGAT 32 N/A N/A 1516 949388 39877 39892
AAACTTGCAGCAGTGG 67 N/A N/A 1517 949389 39981 39996
AAATGGACTAGAAGGG 59 N/A N/A 1518 949390 40014 40029
AGATAGAAATCAGGGC 47 N/A N/A 1519 949391 40058 40073
TCACAGGGTGGACTTG 53 N/A N/A 1520 949392 40089 40104
GTAGACACATGTCCTT 49 N/A N/A 1521 949393 40195 40210
GACTACAGTCTGTTCG 96 N/A N/A 1522 949394 40295 40310
AACACAGGAGCAGCAT 87 N/A N/A 1523 949395 40306 40321
AACGATAAAACAACAC 70 N/A N/A 1524 949396 40409 40424
ACTGAATCACCAGCAG 99 N/A N/A 1525 949397 40837 40852
GCCTTTACTTAAGATA 3 N/A N/A 1526 949398 40961 40976 ACGCAGTGTCTCAGGT
125 N/A N/A 1527 949399 41061 41076 CACAAGTAGCCTTGGC 107 N/A N/A
1528 949400 41107 41122 TCACAGTGGACACCAG 85 N/A N/A 1529 949401
41162 41177 TGACAGACCCCAAAGT 121 N/A N/A 1530 949402 41234 41249
GAACAAGCTACATCAA 100 N/A N/A 1531 949403 41266 41281
TGGAGAGGGTTCTCTG 94 N/A N/A 1532 949404 41272 41287
GATAATTGGAGAGGGT 84 N/A N/A 1533 949405 41393 41408
GCGAACCTTTCTCACT 57 N/A N/A 1534 949406 41447 41462
AAACAGGATACGAGAC 74 N/A N/A 1535 949407 41451 41466
GCACAAACAGGATACG 86 N/A N/A 1536 949408 41497 41512
TAATCCCTTTCCGTCA 92 N/A N/A 1537 949409 41604 41619
TGTCTTCGAGCCACAC 99 N/A N/A 1538 949410 41708 41723
CCCTACAGACACTTGC 101 N/A N/A 1539 949411 41814 41829
CCGTAGGCAGATTCCA 62 N/A N/A 1540 949412 41862 41877
GCGAAACCAGAGAGAT 88 N/A N/A 1541 949413 41863 41878
GGCGAAACCAGAGAGA 86 N/A N/A 1542 949414 41962 41977
AGCTTTTAAACCCCCC 87 N/A N/A 1543 949415 41984 41999
AGCCAGATTATTAACA 58 N/A N/A 1544 949416 42064 42079
GATGAGGAGGCTGGTC 78 N/A N/A 1545 949417 42169 42184
ACGAAGACCCCCCAGG 163 N/A N/A 1546 949418 42203 42218
CATGAGAAAAGGGATC 97 N/A N/A 1547 949419 42249 42264
CAACAAGTCAGCCCAA 100 N/A N/A 1548 949420 42252 42267
ACACAACAAGTCAGCC 78 N/A N/A 1549 949421 42254 42269
CTACACAACAAGTCAG 28 N/A N/A 1550 949422 42318 42333
TTCTAGCCCGTCAGCC 90 N/A N/A 1551 949423 42434 42449
TTCCAGAAGACCTGTT 143 N/A N/A 1552 949424 42507 42522
TAGCACTACAATCATT 71 N/A N/A 1553 949425 42544 42559
AACGAGACAGCATCCT 64 N/A N/A 1554 949426 42577 42592
GCAATTGGTACTGTAC 101 N/A N/A 1555 949427 42584 42599
ACACAGGGCAATTGGT 144 N/A N/A 1556 949428 42727 42742
TCGAACTCAACCTCAG 70 N/A N/A 1557 949429 42860 42875
TGCCTCGGGTTCAAGC 64 N/A N/A 1558 949430 42983 42998
TGAAAGGTTCTAGGCA 64 N/A N/A 1559 949431 42984 42999
GTGAAAGGTTCTAGGC 57 N/A N/A 1560 949432 43017 43032
TCGAAAGGAAATTCTG 89 N/A N/A 1561 949433 43028 43043
ACATTAAAGGCTCGAA 43 N/A N/A 1562 949434 43030 43045
GTACATTAAAGGCTCG 59 N/A N/A 1563 949435 43050 43065
GTAGAAACAGTGGGCT 61 N/A N/A 1564 949436 43094 43109
GTACACTCAGAAAGGA 91 N/A N/A 1565 949437 43141 43156
GTGAATACACCAGGAT 76 N/A N/A 1566 949438 43194 43209
ACTCAGGCACAACCAC 123 N/A N/A 1567 949439 43864 43879
CGACAGAGCTGTTTAA 47 N/A N/A 1568 949440 43884 43899
GCGGAATGTAAATTAC 40 N/A N/A 1569 949441 43918 43933
CTAAAGACCACTAATT 122 N/A N/A 1570 949442 43920 43935
GACTAAAGACCACTAA 53 N/A N/A 1571 949443 44005 44020
GTACAGAGCCATGACT 113 N/A N/A 1572 949444 44161 44176
TAAAAGCCTGGACAAG 77 N/A N/A 1573 949445 44199 44214
TACATCTGGACTATGG 23 N/A N/A 1574 949446 44271 44286
GATACCTGGATGTGGG 80 N/A N/A 1575 949447 44336 44351
GACAAAATAGGATGTG 88 N/A N/A 1576 949448 44351 44366
AGGAAAGTTATTGATG 63 N/A N/A 1577 949449 44356 44371
ATACGAGGAAAGTTAT 112 N/A N/A 1578 949450 44359 44374
AAAATACGAGGAAAGT 80 N/A N/A 1579 949451 44362 44377
GGTAAAATACGAGGAA 23 N/A N/A 1580 949452 44375 44390
CCACATGTATATGGGT 85 N/A N/A 1581 949453 44426 44441
CCATACCCAGGAGATC 57 N/A N/A 1582 949454 44509 44524
AACCATTTCCCTCTGG 58 N/A N/A 1583 949455 44624 44639
GGCGACCTCAGCAAAG 85 N/A N/A 1584 949456 44732 44747
AAGGAAGTCCCTGTGA 106 N/A N/A 1585 949457 44851 44866
GGCAACCACACATCCA 79 N/A N/A 1586 949458 44953 44968
ACTGAGCCGTTTTTCA 42 N/A N/A 1587 949459 45279 45294
CCGAAGTGAGAGGGTC 88 N/A N/A 1588 949460 45364 45379
CAAAATCGGGTTATCT 66 N/A N/A 1589 949461 45365 45380
GCAAAATCGGGTTATC 38 N/A N/A 1590 949462 45412 45427
AAGGATGGATGTGTCA 18 N/A N/A 1591
949463 45503 45518 TGACATGCGGGAATGA 40 N/A N/A 1592 949464 45523
45538 AGTAGAAACTGGGACG 43 N/A N/A 1593 949465 45570 45585
AGCTATAAAACCAGCC 106 N/A N/A 1594 949466 45603 45618
TACAAAAGAGTATAGC 70 N/A N/A 1595 949467 45705 45720
CACCACTGCACGGCCT 97 N/A N/A 1596 949468 45850 45865
AACATAACCCCCATCT 88 N/A N/A 1597 949469 45957 45972
AGCAATGGTAGAGGGC 113 N/A N/A 1598 949470 46279 46294
GCAATGGTGGCCGGGC 96 N/A N/A 1599 949471 46323 46338
TTCAACAGGCTGGGTC 44 N/A N/A 1600 949472 46330 46345
TACTATATTCAACAGG 18 N/A N/A 1601 949473 46344 46359
CCACACATAGGCCATA 35 N/A N/A 1602 949474 46382 46397
ATACACTGAGATCAGG 50 N/A N/A 1603 949475 46431 46446
GCTGGGATATACGCCC 98 N/A N/A 1604 949476 46505 46520
ACGGAGACCCTTACCT 129 N/A N/A 1605 949477 46528 46543
TTGCAGATTAGCAGGG 35 N/A N/A 1606 949478 46560 46575
ACAAACTGAGTGTTGA 73 N/A N/A 1607 949479 46562 46577
ACACAAACTGAGTGTT 78 N/A N/A 1608 949480 46577 46592
CGCAAGAAGACATTAA 54 N/A N/A 1609 949481 46666 46681
GGCAGCATGGCTAAGC 75 N/A N/A 1610 949482 46764 46779
ACGAAAGTGAGGAGTC 66 N/A N/A 1611 949483 46766 46781
GGACGAAAGTGAGGAG 15 N/A N/A 1612 949484 46863 46878
TACGAAATAGCAGAGC 17 N/A N/A 1613 949485 46885 46900
GCCCATTGGCCCATCG 154 N/A N/A 1614 949486 47094 47109
GATCACCCGCCACTGT 105 N/A N/A 1615 949487 47352 47367
CACCAGGGACTCATTA 124 N/A N/A 1616 949488 47466 47481
ACACAGTGGTGGTCCC 59 N/A N/A 1617 949489 47517 47532
TGCTTTAAGGCTAACA 82 N/A N/A 1618 949490 47599 47614
GGCCTGCGCTCTGTGC 87 N/A N/A 1619 949491 47700 47715
TGCCCTAAGGCAAGTG 91 N/A N/A 1620 949492 47797 47812
CAACAGCCACAGGATC 77 N/A N/A 1621 949493 47803 47818
TTCCACCAACAGCCAC 25 N/A N/A 1622 949494 47924 47939
AACTATGCATCCACCT 122 N/A N/A 1623 949495 47927 47942
TGCAACTATGCATCCA 130 N/A N/A 1624 949496 48220 48235
GGCTAGGTGGTGTGCG 116 N/A N/A 1625 949497 48501 48516
GAGATTGGAGCCTGGT 33 N/A N/A 1626 949498 48506 48521
AATAAGAGATTGGAGC 89 N/A N/A 1627 949499 48507 48522
CAATAAGAGATTGGAG 69 N/A N/A 1628 949500 48508 48523
GCAATAAGAGATTGGA 13 N/A N/A 1629 949501 48622 48637
GTGAATCCAACAGACA 70 N/A N/A 1630 949502 48748 48763
CAACATGCCTTCCAGT 124 N/A N/A 1631 949503 48869 48884
TGCCACTCCCTATCCC 79 N/A N/A 1632 949504 48972 48987
GCTTAATGCCTTGCCT 128 N/A N/A 1633 949505 49052 49067
CCGCAATGTGTTCATT 42 N/A N/A 1634 949506 49095 49110
GTATACCCCACAAGGC 73 N/A N/A 1635 949507 49171 49186
GTAAAGGGTGGCAGCC 84 N/A N/A 1636 949508 49196 49211
AGTCACTTTAACAAGT 57 N/A N/A 1637 949509 49218 49233
GCTACCAAGGCACAGA 72 N/A N/A 1638 949510 49265 49280
CATGGCCACGATGGCA 92 N/A N/A 1639 949511 49297 49312
GAAGAGACAGCATACC 69 N/A N/A 1640 949512 49403 49418
AGTTATGGTTCACTGG 29 N/A N/A 1641 949513 49511 49526
ACTCAGAGTTTACGGG 91 N/A N/A 1642 949514 49613 49628
TTCCGGTGAGCACACC 49 N/A N/A 1643 949515 49770 49785
GAATCAGGAGGGAGAT 101 N/A N/A 1644 949516 49888 49903
GGCAAGTGACCAGGTG 55 N/A N/A 1645 949517 49896 49911
ACGAAGGCGGCAAGTG 6 N/A N/A 1646 949518 50269 50284 GCAGAGAGAGTCCATT
38 N/A N/A 1647 949519 50271 50286 GCGCAGAGAGAGTCCA 116 N/A N/A
1648 949520 50402 50417 GCCCAGTAGGCAAGAA 117 N/A N/A 1649 949521
50423 50438 AAGTAACCCCCATCAC 94 N/A N/A 1650 949522 50491 50506
CTAGATACAAGGCTGC 62 N/A N/A 1651 949523 50510 50525
CGCCAGCTTGGTCTGC 70 N/A N/A 1652 949524 50597 50612
ACGCAAATATCTCCCA 41 N/A N/A 1653 949525 50612 50627
CTAATCCGAGGCAATA 59 N/A N/A 1654 949526 50654 50669
GCACACAACACTTCCC 41 N/A N/A 1655 949527 50713 50728
GGCAGGATCCACTCAT 111 N/A N/A 1656 949528 50818 50833
AGGAGAGGAGATCTGC 87 N/A N/A 1657 949529 50847 50862
ACACAATGACGAGGCT 27 N/A N/A 1658 949530 50945 50960
TGTTAGTCTCAGGGAA 54 N/A N/A 1659 949531 50961 50976
ACAAACACGGCTCAGC 77 N/A N/A 1660 949532 51078 51093
CGACACCCAGCTCCGG 95 N/A N/A 1661 949533 51207 51222
TTGAAATGCCCAGGTC 37 N/A N/A 1662 949534 51318 51333
TTCAAAGGAGCTTGTG 100 N/A N/A 1663 949535 51433 51448
TGCAAGCTGCCACCTT 79 N/A N/A 1664 949536 51496 51511
TGCTAAACAGTCAATC 62 N/A N/A 1665 949537 51544 51559
AACCTAGGAGGACATC 62 N/A N/A 1666 949538 51660 51675
CCCTACTGAAGCTGGA 71 N/A N/A 1667 949539 51787 51802
AATCACGCTGCCAAGG 112 N/A N/A 1668 949540 51890 51905
TCAGAGAGGTTCGCAG 57 N/A N/A 1669 949541 51993 52008
CGGCAAACTGCAAAGC 67 N/A N/A 1670 949542 52114 52129
CAACAAGCCACTGAGC 108 N/A N/A 1671 949543 52204 52219
TAACAATCCACTGGCC 116 N/A N/A 1672 949544 52243 52258
GCTCAAGTGCTGGAGA 89 N/A N/A 1673 949545 52494 52509
CAAGATCCTACATGTA 79 N/A N/A 1674 949546 52597 52612
TAAAAGCTTCCACCAG 119 N/A N/A 1675 949547 52610 52625
CCCAATAGAGGTTTAA 100 N/A N/A 1676 949548 52802 52817
TCTCATACTTCGGCCT 111 N/A N/A 1677 949549 52918 52933
CAACAGAGGTTTTTTG 67 N/A N/A 1678 949550 52944 52959
GTGAAAGTAAATGCTG 48 N/A N/A 1679 949551 53030 53045
AACAGAACCACACCAG 216 N/A N/A 1680 949552 53066 53081
CCAGAAAACCGTTTCT 93 N/A N/A 1681 949553 53509 53524
ATGCAGGCTGGGAACC 88 N/A N/A 1682 949554 53548 53563
TGCCAGACTTTGGAGC 92 N/A N/A 1683 949555 53611 53626
CCCAAGTCCGCCCAGT 90 N/A N/A 1684 949556 53712 53727
CTGAATCTAGGTGTCT 54 N/A N/A 1685 949557 53847 53862
CTTGAATGTCCATGCC 60 N/A N/A 1686 949558 53863 53878
ATATAGAGAGCTTTAC 104 N/A N/A 1687 949559 53866 53881
CTAATATAGAGAGCTT 51 N/A N/A 1688 949560 53867 53882
TCTAATATAGAGAGCT 78 N/A N/A 1689 949561 53909 53924
CCCCATAACACTTACT 98 N/A N/A 1690 949562 54006 54021
AGCTACTCTCTCAAGT 53 N/A N/A 1691 949563 54011 54026
GGGCAAGCTACTCTCT 126 N/A N/A 1692 949564 54127 54142
AGCTACGGTCTGAGCA 114 N/A N/A 1693 949565 54237 54252
AGTCAGAGGGCCTGCC 58 N/A N/A 1694 949566 54341 54356
GCTCACTTTGGATTGT 48 N/A N/A 1695 949567 54452 54467
GTCTACAAAGCCCAGC 67 N/A N/A 1696 949568 54562 54577
AAAGAGACCATCTCCC 91 N/A N/A 1697 949569 54673 54688
GGGAAACACTCGGCCG 142 N/A N/A 1698 949570 54784 54799
CAATGAGGACATCTGC 59 N/A N/A 1699 949571 54787 54802
GGGCAATGAGGACATC 54 N/A N/A 1700 949572 54890 54905
AGGAACTTCGCCTCTT 112 N/A N/A 1701 949573 54924 54939
TCCTAAGCCAGATAGC 49 N/A N/A 1702 949574 55043 55058
TCTAAGATCCCCATTT 106 N/A N/A 1703 949575 55144 55159
TTTCACCGTCCCATCA 72 N/A N/A 1704 949576 55247 55262
AATAACACAGCCATGC 84 N/A N/A 1705 949577 55348 55363
ACCCACCCCGGAGATG 100 N/A N/A 1706 949578 55383 55398
TAATAAGTCACACTGG 47 N/A N/A 1707 949579 55384 55399
GTAATAAGTCACACTG 107 N/A N/A 1708 949580 55469 55484
CTATGATCTATGATCA 115 N/A N/A 1709 949581 55678 55693
TCCGTATAAGATGTGA 34 N/A N/A 1710 949582 56054 56069
CTATTATCCAGCACTG 56 N/A N/A 1711 949583 56111 56126
AGCTACTGTAGTGATG 81 N/A N/A 1712 949584 56167 56182
TCGAATTTTCAGAGTA 26 N/A N/A 1713 949585 56229 56244
ACGGAAGGTGGCTGCC 61 N/A N/A 1714 949586 56251 56266
GCAAATATAAGGCATG 60 N/A N/A 1715 949587 56268 56283
CACAGATTGAGGACAA 47 N/A N/A 1716
949588 56319 56334 TGACAAGCAGTGTGGG 48 N/A N/A 1717 949589 56371
56386 GGTATCTGAAAGTCAC 9 N/A N/A 1718 949590 56530 56545
CCACAAGGTAGAGGGA 154 N/A N/A 1719 949591 56538 56553
CAAGGAGCCCACAAGG 114 N/A N/A 1720 949592 56633 56648
GCCCAAGTCCTTGTGG 105 N/A N/A 1721 949593 56691 56706
GATTAAGGTGATGCTG 61 N/A N/A 1722 949594 56692 56707
TGATTAAGGTGATGCT 41 N/A N/A 1723 949595 56734 56749
AGGAAGCACCAGGATA 23 N/A N/A 1724 949596 56860 56875
CATATTATGAATCCCC 66 N/A N/A 1725 949597 56863 56878
TGACATATTATGAATC 105 N/A N/A 1726 949598 56979 56994
ATGACAAGGGTCTTGG 17 N/A N/A 1727 949599 57373 57388
TAATGACCCAGGCTGG 121 N/A N/A 1728 949600 57619 57634
GCCTACCGTGTGGCGA 104 N/A N/A 1729 949601 57654 57669
CCAGAAACGGTCAGTG 132 N/A N/A 1730 949602 57722 57737
TGTGAATGGGCACATG 102 N/A N/A 1731 949603 57840 57855
CAAACAACTTCTTGGC 82 N/A N/A 1732 949604 57948 57963
GAAGACTGGTTCTGGC 60 N/A N/A 1733 949605 57953 57968
TTACAGAAGACTGGTT 91 N/A N/A 1734 949606 58891 58906
GGCAAGGTGGCTAAAA 123 N/A N/A 1735 949607 58993 59008
AGGAACCCATCATGGT 95 N/A N/A 1736 949608 59092 59107
TGACAAGGTAGGTTTT 57 N/A N/A 1737 949609 59093 59108
TTGACAAGGTAGGTTT 25 N/A N/A 1738 949610 59102 59117
CAAAACTGGTTGACAA 47 N/A N/A 1739 949611 59104 59119
TGCAAAACTGGTTGAC 58 N/A N/A 1740 949612 59272 59287
GTGAAGTGCAGTAGCT 88 N/A N/A 1741 949613 59302 59317
TAAGATAGAGGGTCTT 35 N/A N/A 1742 949614 59399 59414
GCTAACAATTTAAGGA 60 N/A N/A 1743 949615 59741 59756
CTGAGAGGCATACAAA 66 N/A N/A 1744 949616 59846 59861
GGAGAAGAAGTGAGCC 109 N/A N/A 1745 949617 60067 60082
ACAAATGGATGAGGCC 129 N/A N/A 1746 949618 60068 60083
GACAAATGGATGAGGC 54 N/A N/A 1747 949619 60379 60394
GACAAACAGATGAGGC 74 N/A N/A 1748 949620 60427 60442
GAATAAATTTCAGCCC 100 N/A N/A 1749 949621 60483 60498
TTCAATGGCACAGTTC 73 N/A N/A 1750 949622 60586 60601
TCAGACTTGAGGATGT 32 N/A N/A 1751 949623 60639 60654
GCACAAACAGGCCCGC 99 N/A N/A 1752 949624 60700 60715
GTCAAGTTCAACACTG 25 N/A N/A 1753 949625 60903 60918
GCTCAGGGTTACCTTG 81 N/A N/A 1754 949626 61033 61048
AGGAAGTGCCATGTTC 64 N/A N/A 1755 949627 61134 61149
TCCCACTCTGGCAACA 79 N/A N/A 1756 949628 61204 61219
AGCTAGATGGGACCTA 102 N/A N/A 1757 949629 61255 61270
GAAGTTCCCGTTCTGA 47 N/A N/A 1758 949630 61336 61351
AAATAGACGATCTCAC 87 N/A N/A 1759 949631 61340 61355
AGGGAAATAGACGATC 96 N/A N/A 1760 949632 61344 61359
TCGAAGGGAAATAGAC 101 N/A N/A 1761 949633 61382 61397
GTAGAAGGATCTGACT 114 N/A N/A 1762 949634 61384 61399
CAGTAGAAGGATCTGA 123 N/A N/A 1763 949635 61480 61495
GTGAAGATCTCTGGTG 88 N/A N/A 1764 949636 61485 61500
CCAGAGTGAAGATCTC 119 N/A N/A 1765 949637 61587 61602
CTGCAGATCAACTGCT 104 N/A N/A 1766 949638 61636 61651
CCACAAGTCATTCCAG 71 N/A N/A 1767 949639 61706 61721
TTCCAGGACTACCTCT 76 N/A N/A 1768 949640 61813 61828
GGCTTTGGGAAACCTC 48 N/A N/A 1769 949641 61839 61854
TATTAAGGACAACCTC 98 N/A N/A 1770 949642 61840 61855
TTATTAAGGACAACCT 81 N/A N/A 1771 949643 61842 61857
TGTTATTAAGGACAAC 125 N/A N/A 1772 949644 61889 61904
TGGCACACGGCAAATA 96 N/A N/A 1773 949645 61904 61919
TCATAAGGGTGAGCCT 70 N/A N/A 1774 949646 61915 61930
TCACAGGGTGGTCATA 68 N/A N/A 1775 949647 61937 61952
GAAGATGGTCACAGCC 51 N/A N/A 1776 949648 61944 61959
GTCGAATGAAGATGGT 38 N/A N/A 1777 949649 62105 62120
GGCCTGAAAGAGCCCA 112 N/A N/A 1778 949650 62252 62267
GATAAGGACCCCACCC 108 N/A N/A 1779 949651 62328 62343
AAAGAAGGAGTTACGG 88 N/A N/A 1780 949652 62378 62393
ACGAATGCATACAAAT 72 N/A N/A 1781 949653 62384 62399
TGAAAAACGAATGCAT 107 N/A N/A 1782 949654 62491 62506
CACCAGTGGCTGTCTG 63 N/A N/A 1783 949655 62887 62902
TCATAATAGGCCGGGT 61 N/A N/A 1784 949656 62969 62984
ATAATAACCACCGAAG 45 N/A N/A 1785 949657 62972 62987
ATAATAATAACCACCG 13 N/A N/A 1786 949658 63350 63365
CCTAGGATTTGTGTTA 101 N/A N/A 1787 949659 63667 63682
GCCTAGGATTTATAGA 96 N/A N/A 1788 949660 63759 63774
CCACAAATGAATGGTA 72 N/A N/A 1789 949661 63780 63795
TGGGATGTGGTCTGGT 98 N/A N/A 1790 949662 63826 63841
CTAATTACCAGCTAAC 46 N/A N/A 1791 949663 63880 63895
ACTTAGGTTACTCCTA 76 N/A N/A 1792 949664 64255 64270
AACTGCTGCTCCGATA 53 N/A N/A 1793 949665 64313 64328
GGCTATAGGGCTGATA 104 N/A N/A 1794 949666 64366 64381
AAATGCACCGCTCTGC 137 N/A N/A 1795 949667 64530 64545
ACAGAATAAGACATCG 55 N/A N/A 1796 949668 64650 64665
AGCAATCGCACATGCC 92 N/A N/A 1797 949669 64984 64999
AGTAGATGCCAGAGGG 54 N/A N/A 1798 949670 65026 65041
GGCTAAGCATGAAGGG 96 N/A N/A 1799 949671 65086 65101
ATCTATCTCAGACATC 110 N/A N/A 1800 949672 65109 65124
CCAAGGTCTGAACTTT 69 N/A N/A 1801 949673 65111 65126
AACCAAGGTCTGAACT 125 N/A N/A 1802 949674 65112 65127
CAACCAAGGTCTGAAC 110 N/A N/A 1803 949675 65113 65128
GCAACCAAGGTCTGAA 31 N/A N/A 1804 949676 65115 65130
TGGCAACCAAGGTCTG 67 N/A N/A 1805 949677 65116 65131
CTGGCAACCAAGGTCT 120 N/A N/A 1806 949678 65117 65132
GCTGGCAACCAAGGTC 156 N/A N/A 1807 949679 65119 65134
ATGCTGGCAACCAAGG 40 N/A N/A 1808 949680 65192 65207
GAATTTAGCCCTGACA 94 N/A N/A 1809 949681 65208 65223
AGCTAAACAGGGTTTT 78 N/A N/A 1810 949682 65343 65358
GTCCAAGGGCAGCCGG 100 N/A N/A 1811 949683 65383 65398
CCCCAAAGGCCCTTAG 97 N/A N/A 1812 949684 65458 65473
GTGGACATCAGTGAGT 53 N/A N/A 1813 949685 65527 65542
CTACAAGTGAGCTGAG 6 N/A N/A 1814 949686 65543 65558 CAAAACGGGAGCAGGC
83 N/A N/A 1815 949687 65544 65559 ACAAAACGGGAGCAGG 51 N/A N/A 1816
949688 65545 65560 CACAAAACGGGAGCAG 76 N/A N/A 1817 949689 65583
65598 AAAAAGGGTCCAGTGG 91 N/A N/A 1818 949690 65599 65614
TCATTAGTACGCCAGG 24 N/A N/A 1819 949691 65686 65701
CCCAACTGTGCTTTCC 26 N/A N/A 1820 949692 66037 66052
TCACACACGGATTTTT 73 N/A N/A 1821 949693 66148 66163
TTCTGCATTGCAGTGG 26 N/A N/A 1822 949694 66218 66233
GTAAAAAGCATCTGGC 83 N/A N/A 1823 949695 66272 66287
GCCAGAGTCACCATCA 73 N/A N/A 1824 949696 66327 66342
TGCCAAGGTGAGGTCA 91 N/A N/A 1825 949697 66373 66388
CGCCAGATCTCTCTTG 104 N/A N/A 1826 949698 66787 66802
TGCCTACCATTGCACT 86 N/A N/A 1827 949699 66882 66897
CGAGAAGGAGGTAGAA 82 N/A N/A 1828 949700 66890 66905
AACTACACCGAGAAGG 101 N/A N/A 1829 949701 66895 66910
TCCAAAACTACACCGA 72 N/A N/A 1830 949702 66973 66988
ATCAAACGAGTATATT 91 N/A N/A 1831 949703 66974 66989
TATCAAACGAGTATAT 101 N/A N/A 1832 949704 66987 67002
AGCTAAAATCCACTAT 110 N/A N/A 1833 949705 66998 67013
CAATAGGGAAGAGCTA 57 N/A N/A 1834 949706 66999 67014
GCAATAGGGAAGAGCT 117 N/A N/A 1835 949707 67000 67015
AGCAATAGGGAAGAGC 75 N/A N/A 1836 949708 67377 67392
ATCAAGACTCTGAATA 86 N/A N/A 1837 949709 67669 67684
TTCAAAGATAGGTGAG 32 N/A N/A 1838 949710 67762 67777
CATTAAGTATTTGGAG 77 N/A N/A 1839 949711 67770 67785
AAGAGCAACATTAAGT 111 N/A N/A 1840 949712 67773 67788
GCGAAGAGCAACATTA 120 N/A N/A 1841 949713 67793 67808
TGCGAATGCACATGGC 138 N/A N/A 1842
949714 67803 67818 ACACAGAGGGTGCGAA 153 N/A N/A 1843 949715 67805
67820 CAACACAGAGGGTGCG 47 N/A N/A 1844 949716 67823 67838
TAACATGTTACTCAGA 75 N/A N/A 1845 949717 67870 67885
TCAAGTATAGAGATGG 46 N/A N/A 1846 949718 68110 68125
AGTACCTGATTCAGCG 147 N/A N/A 1847 949719 68180 68195
TGCCAGTGAGGATTGC 56 N/A N/A 1848 949720 68210 68225
AAAACAAGTGCTGCTC 77 N/A N/A 1849 949721 68491 68506
GAATCAAGTACATTTC 77 N/A N/A 1850 949722 68541 68556
GTAATAGTAGCAGCAC 29 N/A N/A 1851 949723 68542 68557
TGTAATAGTAGCAGCA 20 N/A N/A 1852 949724 68610 68625
GTCTTCTGGGTAAATG 30 N/A N/A 1853 949725 68624 68639
AGGCAATGCATACAGT 25 N/A N/A 1854 949726 68992 69007
GAACGATAGGCCAGGC 90 N/A N/A 1855 949727 68999 69014
AAGAAGAGAACGATAG 67 N/A N/A 1856 949728 69029 69044
GTTTATGCACCATGTG 20 N/A N/A 1857 949729 69102 69117
AAAACAGCGAGGAGGA 90 N/A N/A 1858 949730 69108 69123
TGCTAGAAAACAGCGA 109 N/A N/A 1859 949731 69206 69221
CAGGAACCTACTCTCG 86 N/A N/A 1860 949732 69213 69228
ACAAGGACAGGAACCT 97 N/A N/A 1861 949733 69215 69230
CTACAAGGACAGGAAC 107 N/A N/A 1862 949734 69361 69376
CTAGACACTGACTTCC 89 N/A N/A 1863 949735 69486 69501
GGCCAGCTGGACTTTT 74 N/A N/A 1864 949736 69589 69604
TACTAGGGCACTTAAG 149 N/A N/A 1865 949737 69591 69606
GATACTAGGGCACTTA 69 N/A N/A 1866 949738 69692 69707
ACCAAGGGTCCCTGCC 113 N/A N/A 1867 949739 69781 69796
TACAAAGTGTCTGGCG 53 N/A N/A 1868 949740 69782 69797
ATACAAAGTGTCTGGC 41 N/A N/A 1869 949741 70034 70049
GATTAGGAGACAAGCC 87 N/A N/A 1870 949742 70467 70482
ATCCATTCTGGACAAC 62 N/A N/A 1871 949743 70664 70679
CACTAGAGGATAGGCG 118 N/A N/A 1872 949744 70759 70774
GTAAAGCAGAGTTTGG 25 N/A N/A 1873 949745 70760 70775
TGTAAAGCAGAGTTTG 46 N/A N/A 1874 949746 70766 70781
GCAAAGTGTAAAGCAG 53 N/A N/A 1875 949747 70787 70802
CCATAAAATCAGCCTA 71 N/A N/A 1876 949748 70897 70912
AAAGAACTCGGGAGGT 65 N/A N/A 1877 949749 71020 71035
TTAAGATCAAGAGATC 115 N/A N/A 1878 949750 71155 71170
TCAAGATGAGCTCCCC 65 N/A N/A 1879 949751 71255 71270
GTCCATCCAGACCACG 119 N/A N/A 1880 949752 71260 71275
GGACAGTCCATCCAGA 84 N/A N/A 1881 949753 71369 71384
GGAGACGGCACGGAGC 81 N/A N/A 1882 949754 71371 71386
ACGGAGACGGCACGGA 87 N/A N/A 1883 949755 71473 71488
ACCAAGGGCCAACACC 70 N/A N/A 1884 949756 71697 71712
ACATACTGCAGCAGGG 52 N/A N/A 1885 949757 71797 71812
AATCAATGAGTGGACG 29 N/A N/A 1886 949758 71827 71842
ACGCAGAAGGCTTGCA 87 N/A N/A 1887 949759 71908 71923
CCATTCTGAGCACTCC 41 N/A N/A 1888 949760 72021 72036
TCTAAAGGAGGCTGTT 82 N/A N/A 1889 949761 72175 72190
AGCCTAATTTTGCAAT 133 N/A N/A 1890 949762 72938 72953
GGCCAACACTCATCTT 128 N/A N/A 1891 949763 73188 73203
TGATATGCAGTGACAC 75 N/A N/A 1892 949764 73296 73311
TCCCACACGGCTCCTG 144 N/A N/A 1893 949765 73415 73430
GCACAACCTGCTCTAT 80 N/A N/A 1894 949766 73519 73534
GAGCACCTGAGTCAGT 91 N/A N/A 1895 949767 73639 73654
ACCAACCAAGTCATGG 137 N/A N/A 1896 949768 73653 73668
AGCTAAGCAGCTGCAC 133 N/A N/A 1897 949769 73742 73757
TTACAGGCCAAAAGCC 88 N/A N/A 1898 949770 73868 73883
GAGGAGGCGGTGTCCT 122 N/A N/A 1899 949771 73954 73969
CATAAAAGCACTCTGG 87 N/A N/A 1900 949772 73957 73972
GAGCATAAAAGCACTC 92 N/A N/A 1901 949773 73970 73985
GTCAAGGCTGTCTGAG 56 N/A N/A 1902 949774 74231 74246
GCTGAATCTTGTGTTT 47 N/A N/A 1903 949775 74259 74274
CACAACAACACTTCCT 73 N/A N/A 1904 949776 74351 74366
CTTTAGAGGTGCAGAA 53 N/A N/A 1905 949777 74592 74607
ATCCACTGAAGCCTCT 50 N/A N/A 1906 949778 74872 74887
CTTAACAAGTAGTATT 14 N/A N/A 1907 949779 74874 74889
GGCTTAACAAGTAGTA 38 N/A N/A 1908 949780 74962 74977
GGCAACTGGTTACAAA 58 N/A N/A 1909 949781 74967 74982
TGCAAGGCAACTGGTT 14 N/A N/A 1910 949782 75001 75016
CTCCATGGTGAGAGTG 73 N/A N/A 1911 949783 75055 75070
GCTAAAGCAAGAAGGC 87 N/A N/A 1912 949784 75104 75119
AGAAAGACCGCCCATG 97 N/A N/A 1913 949785 75219 75234
GCGGAGACAGAAGGCT 121 N/A N/A 1914 949786 75320 75335
AAGCATCGGTTAAGGC 142 N/A N/A 1915 949787 75846 75861
CCCAAGTGGTGAGGCT 74 N/A N/A 1916 949788 76007 76022
GTTCAGGCAGGCGGTT 53 N/A N/A 1917 949789 76107 76122
AACAAGAGACCTTGTC 47 N/A N/A 1918 949790 76211 76226
GATCAGGCTACTCAGG 116 N/A N/A 1919 949791 76415 76430
TCATAGCCAATATAAC 42 N/A N/A 1920 949792 76430 76445
TATCACAGGGTGTGCT 67 N/A N/A 1921 949793 76487 76502
TCGGAATGTACTCTTA 23 N/A N/A 1922 949794 76518 76533
GAATTCGGGTTGAATC 107 N/A N/A 1923 949795 76636 76651
GACAAAGCACACCTGG 81 N/A N/A 1924 949796 76637 76652
GGACAAAGCACACCTG 100 N/A N/A 1925 949797 76731 76746
CACTAAACTAATGACA 98 N/A N/A 1926 949798 76734 76749
TAGCACTAAACTAATG 88 N/A N/A 1927 949799 76737 76752
GCATAGCACTAAACTA 83 N/A N/A 1928 949800 76739 76754
AGGCATAGCACTAAAC 80 N/A N/A 1929 949801 76744 76759
AGCAAAGGCATAGCAC 91 N/A N/A 1930 949802 76764 76779
ACCAAACCAGGACCAA 57 N/A N/A 1931 949803 77124 77139
GTTAATGCTTCACCTG 25 N/A N/A 1932 949804 77125 77140
GGTTAATGCTTCACCT 104 N/A N/A 1933 949805 77175 77190
GTAAAGGGTGTGCACA 10 N/A N/A 1934 949806 77224 77239
AGGCAAGCACAAGCTG 115 N/A N/A 1935 949807 77245 77260
CCTTCATACCCCAACT 97 N/A N/A 1936 949808 77343 77358
TACTGAAGTACCTGGG 102 N/A N/A 1937 949809 77421 77436
TCCTAAGCATTCCTAA 113 N/A N/A 1938 949810 77450 77465
GTAGGATGATCTTGTT 27 N/A N/A 1939 949811 77458 77473
GTAAAAAAGTAGGATG 68 N/A N/A 1940 949812 77502 77517
CCTTAAAAAGAGTCTC 75 N/A N/A 1941 949813 77561 77576
GCTCATCTAATGGACA 46 N/A N/A 1942 949814 77634 77649
GGCGAGACAGAGTAAG 12 N/A N/A 1943 949815 77894 77909
TATACTGGACACGGTG 96 N/A N/A 1944 949816 77895 77910
ATATACTGGACACGGT 88 N/A N/A 1945 949817 77897 77912
ATATATACTGGACACG 36 N/A N/A 1946 949818 78035 78050
GTTTTATTGGCCGGGT 20 N/A N/A 1947 949819 78144 78159
AGTCACTGATCCTAAA 74 N/A N/A 1948 949820 78149 78164
CAAGAAGTCACTGATC 69 N/A N/A 1949 949821 78222 78237
ACAAAATGGGTTGAGG 38 N/A N/A 1950 949822 78223 78238
TACAAAATGGGTTGAG 50 N/A N/A 1951 949823 78262 78277
GGACAGGACTTTGCCC 119 N/A N/A 1952 949824 78348 78363
CCACAATTCAGGTGGC 122 N/A N/A 1953 949825 78366 78381
GGAAAGGTAGCCACTT 64 N/A N/A 1954 949826 78470 78485
GCCCACTTATTCCTCC 120 N/A N/A 1955 949827 78561 78576
CCAAATTCAAGAGCTC 45 N/A N/A 1956 949828 78611 78626
TACCATTTTTCAGCAG 25 N/A N/A 1957 949829 78678 78693
TCAAAACGGAGGTTTC 20 N/A N/A 1958 949830 78711 78726
GACCATCCTATGAGGA 106 N/A N/A 1959 949831 78878 78893
GACCAGAGACGGGAGG 58 N/A N/A 1960 949832 78949 78964
GCCTAGAGGTAGGAGC 64 N/A N/A 1961 949833 78961 78976
CCACAAGTTCAGGCCT 107 N/A N/A 1962 949834 79024 79039
TCAAAGCTGAGTGTCA 25 N/A N/A 1963 949835 79143 79158
TGCTAGGGACATCTTC 17 N/A N/A 1964 949836 79212 79227
GTATATATCAGCTCAG 30 N/A N/A 1965 949837 79225 79240
ACATAAGGATGTTGTA 126 N/A N/A 1966 949838 79243 79258
ATCCATGTTCAGTTTC 13 N/A N/A 1967
949839 79330 79345 CGGAAAAAGAAGTCCC 154 N/A N/A 1968 949840 79375
79390 TTCAAGCAAATCACAC 96 N/A N/A 1969 949841 79794 79809
TCAGTATGCACCACCA 6 N/A N/A 1970 949842 79870 79885 AAGCATGACATGACAC
16 N/A N/A 1971 949843 80250 80265 CAGAATATTTAACTCG 26 N/A N/A 1972
949844 80347 80362 GACAAACCAAGCACAT 107 N/A N/A 1973 949845 80435
80450 GTGGAACTTGCCTGAC 86 N/A N/A 1974 949846 80542 80557
TCCAAGAGCCCTCTTA 11 N/A N/A 1975 949847 80662 80677
CCTATTTGATCAGGAG 137 N/A N/A 1976 949848 80759 80774
TGATTCAGTGCCGCCC 7 N/A N/A 1977 949849 80769 80784 CCCAAAACCCTGATTC
17 N/A N/A 1978 949850 80805 80820 TCACGAGGAAGCCATG 54 N/A N/A 1979
949851 80870 80885 GGCGATGGAAGGGCAG 57 N/A N/A 1980 949852 80981
80996 TTTCATTGGCCCTGGC 62 N/A N/A 1981 949853 80987 81002
CAGCAATTTCATTGGC 63 N/A N/A 1982 949854 81187 81202
TACCTTACTGGTACAC 67 N/A N/A 1983 949855 81200 81215
GCCGAGGGAGCAATAC 102 N/A N/A 1984 949856 81201 81216
TGCCGAGGGAGCAATA 49 N/A N/A 1985 949857 81288 81303
GAAAAGGCACCAGTGG 39 N/A N/A 1986 949858 81306 81321
CACAAAGCGATATGGG 7 N/A N/A 1987 949859 81411 81426 GTGCATCTGTCTGGCC
79 N/A N/A 1988 949860 81445 81460 TGCTAGGCTTGGTATC 95 N/A N/A 1989
949861 81530 81545 CAGCAGTTGACGCGGG 127 N/A N/A 1990 949862 81635
81650 CCGGAGCTGAGGGACA 117 N/A N/A 1991 949863 81738 81753
AAAAATGGGCTGCCCC 103 N/A N/A 1992 949864 81740 81755
CCAAAAATGGGCTGCC 90 N/A N/A 1993 949865 81752 81767
GACTAAGTGGATCCAA 2 N/A N/A 1994 949866 81769 81784 GCGCATAGAGGCACTG
56 N/A N/A 1995 949867 81845 81860 AACCAGGCCCGCGGCG 90 N/A N/A 1996
949868 81909 81924 GCGCAAGCACAGACTG 109 N/A N/A 1997 949869 81953
81968 GCAGAAATTCCCTGGC 92 N/A N/A 1998 949870 82004 82019
AGCTTAAGCAGCAAAT 111 N/A N/A 1999 949871 82041 82056
TTTGGACTGTTTTCCC 8 N/A N/A 2000 949872 82043 82058 TGTTTGGACTGTTTTC
2 N/A N/A 2001 949873 82044 82059 CTGTTTGGACTGTTTT 1 N/A N/A 2002
949874 82045 82060 CCTGTTTGGACTGTTT 1 N/A N/A 2003 949875 82047
82062 AACCTGTTTGGACTGT 4 N/A N/A 2004 949876 82048 82063
CAACCTGTTTGGACTG 5 N/A N/A 2005 949877 82050 82065 TCCAACCTGTTTGGAC
27 N/A N/A 2006 949878 82052 82067 TTTCCAACCTGTTTGG 44 N/A N/A 2007
949879 82053 82068 TTTTCCAACCTGTTTG 17 N/A N/A 2008 949880 82054
82069 GTTTTCCAACCTGTTT 4 N/A N/A 2009 949881 82084 82099
ATGTCCATGACACCTG 17 N/A N/A 2010 949882 82085 82100
CATGTCCATGACACCT 39 N/A N/A 2011 949883 82087 82102
TTCATGTCCATGACAC 30 N/A N/A 2012 949884 82089 82104
CATTCATGTCCATGAC 13 N/A N/A 2013 949885 82091 82106
AACATTCATGTCCATG 51 N/A N/A 2014 949886 82154 82169
TACAGAAGGGCCACGG 6 N/A N/A 2015 949887 82155 82170 TTACAGAAGGGCCACG
10 N/A N/A 2016 949888 82259 82274 GATTAGTCCATGCATG 99 N/A N/A 2017
949889 82308 82323 ACACACGCAGGACAGG 85 N/A N/A 2018 949890 82361
82376 GGTCATGCGGAGGGCA 41 N/A N/A 2019 949891 82509 82524
TGTTACCTTCTCGGCA 19 N/A N/A 2020 949892 82529 82544
GCGGAGATGAGAACAA 13 N/A N/A 2021 949893 82619 82634
CTGGTAGGCGGAAGGG 77 N/A N/A 2022 949894 82632 82647
CTCTAAGTGACAACTG 18 N/A N/A 2023 949895 82720 82735
AACAAAGGCTGACCGC 85 N/A N/A 2024 949896 82827 82842
GATGATGTGTTTCCTG 1 N/A N/A 2025 949897 82836 82851 GGCTATACAGATGATG
7 N/A N/A 2026 949898 82948 82963 AACCAGACCTCATGCA 22 N/A N/A 2027
949899 82953 82968 AACTTAACCAGACCTC 12 N/A N/A 2028 949900 82994
83009 CGCCAAATGCCCCCAC 29 N/A N/A 2029 949901 83049 83064
GATAGGAACTCCTTGC 48 N/A N/A 2030 949902 83051 83066
TCGATAGGAACTCCTT 96 N/A N/A 2031 949903 83124 83139
CTGAAGGGCCTCGCCA 119 N/A N/A 2032 949904 83183 83198
TGCCATGCAGGGCTTC 74 N/A N/A 2033 949905 83283 83298
GTGGACCGGAGACAGC 125 N/A N/A 2034 949906 83399 83414
TAGAAAATGCGGAGGG 91 N/A N/A 2035 949907 83424 83439
CGGGAAGCAACATGAA 77 N/A N/A 2036 949908 83429 83444
TGGCACGGGAAGCAAC 87 N/A N/A 2037 949909 83464 83479
GAACAAGCAGAGTGGT 51 N/A N/A 2038 949910 83566 83581
GGCCAGTACCTGGTCC 103 N/A N/A 2039 949911 83622 83637
GAACAGTACACTTGAC 90 N/A N/A 2040 949912 83627 83642
GCACAGAACAGTACAC 100 N/A N/A 2041 949942 83908 83923
GGTTGACTACAAAGGG 5 N/A N/A 2042 949943 83909 83924 AGGTTGACTACAAAGG
3 N/A N/A 2043 949944 83911 83926 AGAGGTTGACTACAAA 4 N/A N/A 2044
949945 83912 83927 GAGAGGTTGACTACAA 2 N/A N/A 2045 949946 83914
83929 TTGAGAGGTTGACTAC 66 N/A N/A 2046 949947 83916 83931
TTTTGAGAGGTTGACT 21 N/A N/A 2047 949948 83918 83933
GTTTTTGAGAGGTTGA 2 N/A N/A 2048 949949 83919 83934 GGTTTTTGAGAGGTTG
3 N/A N/A 2049 949950 83920 83935 GGGTTTTTGAGAGGTT 5 N/A N/A 2050
949951 83922 83937 GTGGGTTTTTGAGAGG 17 N/A N/A 2051 949952 83923
83938 TGTGGGTTTTTGAGAG 25 N/A N/A 2052 949953 83924 83939
CTGTGGGTTTTTGAGA 38 N/A N/A 2053 949954 83926 83941
GCCTGTGGGTTTTTGA 24 N/A N/A 2054 949955 84164 84179
CCATAACTTACTGAAG 69 N/A N/A 2055 949956 84276 84291
GTAGGATAGGGAGCGG 31 N/A N/A 2056 949957 84379 84394
TCCCAAATGCAGACGC 38 N/A N/A 2057 949958 84397 84412
ACAAACAACACGCTTG 88 N/A N/A 2058 949959 84399 84414
CAACAAACAACACGCT 88 N/A N/A 2059 949960 84687 84702
AATTAGGTGGGTAAAG 64 N/A N/A 2060 949961 84860 84875
GCCTTTGCAAGAAAGC 94 N/A N/A 2061 949962 85204 85219
GGTTTCAACAAACAGT 11 N/A N/A 2062 949963 85243 85258
AACAAAGTGACATAGC 8 N/A N/A 2063 949964 85260 85275 GGAGAGGGACCATTTT
94 N/A N/A 2064 949965 85323 85338 AATCAAAACTGGGCGC 100 N/A N/A
2065 949966 85335 85350 AGCAATTGGCCAAATC 55 N/A N/A 2066 949967
85362 85377 GGCATAGGTGGACTGG 21 N/A N/A 2067 949968 85379 85394
AGCTACAGCAGCTATG 83 N/A N/A 2068 949969 85438 85453
CTTACCAACAGTAACA 67 N/A N/A 2069 949970 85541 85556
GGCTGGTTTAGTAAGG 75 N/A N/A 2070 949971 85608 85623
GGGCAAGGCACTCGGA 54 N/A N/A 2071 949972 85618 85633
GAATAAAGTAGGGCAA 44 N/A N/A 2072 949973 85681 85696
CGTCACTGGACTCCCC 75 N/A N/A 2073 949974 85784 85799
CCAGGATGAAGTTGGT 94 N/A N/A 2074 949975 85876 85891
ATCAAGCTAGAAAGGT 19 N/A N/A 2075 949976 85880 85895
AGCTATCAAGCTAGAA 82 N/A N/A 2076 949977 85884 85899
CTCAAGCTATCAAGCT 120 N/A N/A 2077 949978 85946 85961
CCAATTATGAACACTA 7 N/A N/A 2078 949979 85984 85999 GTTCAAAGTGTTGCAT
9 N/A N/A 2079 949980 86329 86344 AGCCACTGCCTTGTAT 74 N/A N/A 2080
949981 86547 86562 AATCATAGCCTCAAAC 85 N/A N/A 2081 949982 86551
86566 GAACAATCATAGCCTC 14 N/A N/A 2082 949983 86933 86948
AATAATGTGCAGTTGT 14 N/A N/A 2083 949984 87041 87056
CCCCAAGGTCTGGAGT 104 N/A N/A 2084 949985 87160 87175
TCCCAGACAGGAGAAC 80 N/A N/A 2085 949986 87349 87364
ACCTACTTGGCAAACC 128 N/A N/A 2086 949987 87359 87374
CTCTAAAAGTACCTAC 127 N/A N/A 2087 949988 87456 87471
CGACAGAGACTGTCTG 130 N/A N/A 2088 949989 87574 87589
CTAAACTAACCATGGG 79 N/A N/A 2089 949990 87595 87610
GAACATAGCACTGCCC 3 N/A N/A 2090 949991 87597 87612 CTGAACATAGCACTGC
3 N/A N/A 2091 949992 87598 87613 TCTGAACATAGCACTG 9 N/A N/A 2092
949993 87680 87695 GCACACTGGTCGCTAA 43 N/A N/A 2093
949994 87782 87797 TTGAAGCTAGGGAGAC 85 N/A N/A 2094 949995 87817
87832 ACGGAAGGTTCTGGTT 69 N/A N/A 2095 949996 87880 87895
GCACACTGAATCGACA 23 N/A N/A 2096 949997 87882 87897
ACGCACACTGAATCGA 43 N/A N/A 2097 949998 87893 87908
TGCCTGAGACCACGCA 152 N/A N/A 2098 949999 88002 88017
TACCAGCGGCACCACC 72 N/A N/A 2099 950000 88014 88029
AGCGAGAGGGCATACC 30 N/A N/A 2100 950001 88119 88134
CACTACACCTTAACGC 70 N/A N/A 2101 950002 88226 88241
CTCTAGAGGCCCTCCC 98 N/A N/A 2102 950003 88271 88286
CACCGATAAATGTTGT 27 N/A N/A 2103 950004 88308 88323
CAGCACGGAACAGATC 51 N/A N/A 2104 950005 88397 88412
AGGGACTTCGGCTCAT 120 N/A N/A 2105 950006 88497 88512
GCAAACCAAAGATGGG 47 N/A N/A 2106 950007 88619 88634
GGTAAGTGGGAAGGCC 73 N/A N/A 2107 950008 88766 88781
CCCCGTAGCTCTTCAG 24 N/A N/A 2108 950009 88878 88893
TTTAAGGACTCCACCT 86 N/A N/A 2109 950010 88992 89007
TGGCATCACCTGACTT 99 N/A N/A 2110 950011 89116 89131
ATCCAAAATCCTCCCC 43 N/A N/A 2111 950012 89192 89207
TCAAATAGCAGCCCAC 38 N/A N/A 2112 950013 89231 89246
CCTAAGGGCCTCCTGG 102 N/A N/A 2113 950014 89335 89350
CACAAGAAGGATTTTC 2 N/A N/A 2114 950015 89459 89474 CAGCAATCGACCCACC
31 N/A N/A 2115 950016 89560 89575 GCTGAGATTACGCACC 38 N/A N/A 2116
950017 89706 89721 CTTATCTGGGCTATTT 7 N/A N/A 2117 950018 89719
89734 TATTATAGGGCTTCTT 20 N/A N/A 2118 950019 89813 89828
GAAAGTAGGCTTCTGT 6 N/A N/A 2119 950020 89966 89981 TGTTACTTATCCATCA
7 N/A N/A 2120 950021 89980 89995 CAACATATATCTCCTG 8 N/A N/A 2121
950022 90075 90090 ACAAATCCCACTATAT 58 N/A N/A 2122 950023 90081
90096 GCATAGACAAATCCCA 3 N/A N/A 2123 950024 90175 90190
CGACAGGGTGTGTTTC 6 N/A N/A 2124 950025 90197 90212 AAATTTAGAGGACATC
38 N/A N/A 2125 950026 90276 90291 AGCCATCCAGTCTTAG 38 N/A N/A 2126
950027 90541 90556 CTCAAGTAGTTCCCCT 12 N/A N/A 2127 950028 90642
90657 CACTAGAATCCCGGAG 18 N/A N/A 2128 950029 90673 90688
ACTTACTAAAGCGCAG 24 N/A N/A 2129 950030 90722 90737
AGTAAATGTATCTGGT 3 N/A N/A 2130 950031 90754 90769 GCGCAAGGGAAACGGC
97 N/A N/A 2131 950032 90804 90819 TGAGCAGCCACAGGTA 31 N/A N/A 2132
950033 90806 90821 AGTGAGCAGCCACAGG 45 N/A N/A 2133 950034 90807
90822 AAGTGAGCAGCCACAG 83 N/A N/A 2134 950035 90808 90823
CAAGTGAGCAGCCACA 27 N/A N/A 2135 950036 90810 90825
ACCAAGTGAGCAGCCA 14 N/A N/A 2136 950037 90812 90827
GGACCAAGTGAGCAGC 54 N/A N/A 2137 950038 90837 90852
GCGAATGTGGCCGTTC 64 N/A N/A 2138 950039 90889 90904
GAACAGACAGGGTTCA 97 N/A N/A 2139 950040 90978 90993
CGGGAGACTGCAGAGG 44 N/A N/A 2140 950041 91083 91098
AGCAGATGGCCTGGTA 18 N/A N/A 2141 950042 91189 91204
ACATAGGGCCTTCTGG 38 N/A N/A 2142 950043 91226 91241
AGCCAAGAGTCAAGTT 36 N/A N/A 2143 950044 91384 91399
CATGAGCCCACCACTC 120 N/A N/A 2144 950045 91538 91553
CTCCTAACATGCTAGA 75 N/A N/A 2145 950046 91825 91840
CGCTCAAGGGAAAAAT 25 N/A N/A 2146 950047 91934 91949
TCCCAAGCTCCCCTGA 51 N/A N/A 2147 950048 92034 92049
GATACAGCCGTTCATA 11 N/A N/A 2148 950049 92059 92074
TAATAAGGTACTGAAG 54 N/A N/A 2149 950050 92634 92649
ACGAAGCTAGGAGGCG 108 N/A N/A 2150 950051 92635 92650
CACGAAGCTAGGAGGC 35 N/A N/A 2151 950052 92814 92829
GCATGATAATCCCAGC 98 N/A N/A 2152 950053 93110 93125
AGCCGCCCAGGCCAGA 96 N/A N/A 2153 950054 93183 93198
GCAGAAATTTTGCGAA 35 N/A N/A 2154 950055 93185 93200
AGGCAGAAATTTTGCG 48 N/A N/A 2155 950056 93235 93250
GGTGGAGTCCCCGCCC 165 N/A N/A 2156 950057 93248 93263
GTGCAAGGTACATGGT 11 N/A N/A 2157 950058 93303 93318
CGCAAAAATAAATCAT 83 N/A N/A 2158 950059 93304 93319
GCGCAAAAATAAATCA 105 N/A N/A 2159 950060 93322 93337
ATGTATTACCTACGGC 7 N/A N/A 2160 950061 93383 93398 CATATTCATGGTGTTA
10 N/A N/A 2161 950062 93496 93511 AGAGATGGAAGGGACG 89 N/A N/A 2162
950063 93586 93601 CCACACTAAGCATGTA 38 N/A N/A 2163 950064 93600
93615 TCTAATGTTTGCTACC 7 N/A N/A 2164 950065 93601 93616
CTCTAATGTTTGCTAC 4 N/A N/A 2165 950066 93612 93627 ACCACTAGATTCTCTA
56 N/A N/A 2166 950067 93648 93663 GAACAGGGAATATTAG 79 N/A N/A 2167
950068 93744 93759 TTATACCCAGGGCAAC 37 N/A N/A 2168 950069 93854
93869 TAAGTATTTGCCATCC 6 N/A N/A 2169 950070 93908 93923
GCTTAAGCGAGATCTT 42 N/A N/A 2170 950071 93921 93936
GAATTCTGGTCTGGCT 26 N/A N/A 2171 950072 93958 93973
CATAGGAGATAGAAGG 4 N/A N/A 2172 950073 93960 93975 TGCATAGGAGATAGAA
34 N/A N/A 2173 950074 94019 94034 CACAAGAGGGCAAGAT 36 N/A N/A 2174
950075 94050 94065 TGCTAGATCAACTAGC 7 N/A N/A 2175 950076 94058
94073 GCAAAGAGTGCTAGAT 89 N/A N/A 2176 950077 94060 94075
AGGCAAAGAGTGCTAG 78 N/A N/A 2177 950078 94065 94080
GCACAAGGCAAAGAGT 89 N/A N/A 2178 950079 94078 94093
TGCTAGAGGAGCGGCA 114 N/A N/A 2179 950080 94153 94168
CTATAGAACAGGAGTG 15 N/A N/A 2180 950081 94155 94170
TGCTATAGAACAGGAG 9 N/A N/A 2181 950082 94164 94179 AGCCACATCTGCTATA
89 N/A N/A 2182 950083 94176 94191 CCTTAATCACTTAGCC 7 N/A N/A 2183
950084 94200 94215 TATCATATAGGGAGAA 16 N/A N/A 2184 950085 94215
94230 GCATAGAGAAGAGGGT 6 N/A N/A 2185 950086 94270 94285
GACAAGAGGCAGCATC 7 N/A N/A 2186 950087 94333 94348 TCACAGGCCAAGGATA
81 N/A N/A 2187 950088 94371 94386 TGGCAGGAAACGGTGC 42 N/A N/A 2188
950089 94450 94465 GCAAATATGATTCATC 1 N/A N/A 2189 950090 94481
94496 AAGGAGGTGTTACCCA 60 N/A N/A 2190 950091 94581 94596
CTATGAGTAGCAGGCT 3 N/A N/A 2191 950092 94652 94667 GTCCAAGTGTAAGAGC
12 N/A N/A 2192 950093 94695 94710 GCAAAAGGGAGCCCCT 69 N/A N/A 2193
950094 94696 94711 AGCAAAAGGGAGCCCC 88 N/A N/A 2194 950095 94770
94785 TGCCAGAAGAGCCCCG 84 N/A N/A 2195 950096 94791 94806
CTACAAGAAAGACCCT 30 N/A N/A 2196 950097 94805 94820
TAGGATCGGCTCAGCT 18 N/A N/A 2197 950098 94810 94825
TGGCATAGGATCGGCT 54 N/A N/A 2198 950099 94920 94935
GAACACATGAGGAACC 24 N/A N/A 2199 950100 94977 94992
GTACAAGGGAGAAGCA 100 N/A N/A 2200 950101 95047 95062
GGCCACGCTCATGACG 97 N/A N/A 2201 950102 95086 95101
GTAGAGATGGGAACCA 4 N/A N/A 2202 950103 95155 95170 AAGCAGGGATCCTCTG
114 N/A N/A 2203 950104 95189 95204 GCGGTATGGGTGGCAG 106 N/A N/A
2204 950105 95227 95242 GGCTAGGGTGCACAGT 60 N/A N/A 2205 950106
95278 95293 CTTAGAAGGAAGTAGG 100 N/A N/A 2206 950107 95378 95393
CCGTTAGCCATCCACC 73 N/A N/A 2207 950108 95416 95431
CCCTAGGGAGCTGCAA 112 N/A N/A 2208 950109 95443 95458
CCACACGGGTTCAGAG 43 N/A N/A 2209 950110 95496 95511
GCACACCAAGCCTTGG 63 N/A N/A 2210 950111 95645 95660
AGGGATGTGCCCGCAC 87 N/A N/A 2211 950112 95745 95760
TGACAACCAGGTGAGG 24 N/A N/A 2212 950113 95854 95869
TGGGAATGCCTCCATT 95 N/A N/A 2213 950114 95954 95969
AGCCCCTGTGAGGTCA 66 N/A N/A 2214 950115 96079 96094
GTACAGACTTATCCCT 28 N/A N/A 2215 950116 96081 96096
GGGTACAGACTTATCC 95 N/A N/A 2216 950117 96178 96193
GGCTAAAGAGTACCCA 63 N/A N/A 2217 950118 96181 96196
GGTGGCTAAAGAGTAC 23 N/A N/A 2218
950119 96298 96313 GACTACCCCGACCCAC 71 N/A N/A 2219 950120 96399
96414 GCACGGCACGGCAGGA 24 N/A N/A 2220 950121 96523 96538
ACGCACAGGGCGGCCT 111 N/A N/A 2221 950122 96527 96542
AGGCACGCACAGGGCG 83 N/A N/A 2222 950123 96646 96661
CTAACGGCAGGCAGCC 71 N/A N/A 2223 950124 96752 96767
CATCAGGGTTTCAGGC 11 N/A N/A 2224 950125 96860 96875
GGCTAGGGTCAAAGGT 21 N/A N/A 2225 950126 96977 96992
GCCCATGGGAGGAGTC 80 N/A N/A 2226 950127 97078 97093
GAAACCAACATGAGGC 20 N/A N/A 2227 950128 97149 97164
CGCAATAGAGACACCT 32 N/A N/A 2228 950129 97221 97236
GAACCTCGCTCCGTGC 165 N/A N/A 2229 950130 97453 97468
AGTGACTGAGTTCTGC 22 N/A N/A 2230 950131 97809 97824
GGTTACGGTTGTTTTT 26 N/A N/A 2231 950132 97855 97870
GTACAATGTAAGCCTT 3 N/A N/A 2232 950133 97920 97935 TGCTAGTGACTCCATC
27 N/A N/A 2233 950134 98046 98061 AGTGATGGAACCCCGG 48 N/A N/A 2234
950135 98098 98113 CGCAGATAGAAAAACT 26 N/A N/A 2235 950136 98099
98114 TCGCAGATAGAAAAAC 60 N/A N/A 2236 950137 98150 98165
GCACACTGTGGCCAAG 70 N/A N/A 2237 950138 98259 98274
AGTGAACGAGTCCCTC 84 N/A N/A 2238 950139 98353 98368
TTCTACATAGGACCAT 13 N/A N/A 2239 950140 98399 98414
AAACATCACAGGGACC 43 N/A N/A 2240 950141 98508 98523
TCAGAAGAGAGGACCT 42 N/A N/A 2241 950142 98643 98658
AGACACAGGGTAATGC 35 N/A N/A 2242 950143 98866 98881
CAACAATGCAACAACG 15 N/A N/A 2243 950144 99310 99325
CGCCAGATTAATTTTG 46 N/A N/A 2244 950145 99477 99492
AACAATTGTCTGGTGT 85 N/A N/A 2245 950146 99478 99493
CAACAATTGTCTGGTG 63 N/A N/A 2246 950147 99481 99496
TAACAACAATTGTCTG 20 N/A N/A 2247 950148 99493 99508
TAAGACTATAGTTAAC 63 N/A N/A 2248 950149 99519 99534
CAACAGAAGAGTAGGG 26 N/A N/A 2249 950150 99522 99537
GTTCAACAGAAGAGTA 25 N/A N/A 2250 950151 99626 99641
GATAAATACTAGAGGC 45 N/A N/A 2251 950152 99810 99825
GATCAGGGCCATAGAA 79 N/A N/A 2252 950153 99823 99838
CAAGAAACGGGTTGAT 71 N/A N/A 2253 950154 99830 99845
AATTAAGCAAGAAACG 114 N/A N/A 2254 950155 99893 99908
CAACAAGCTATCACAC 92 N/A N/A 2255 950156 99912 99927
CTGGACCGCATCAGAG 92 N/A N/A 2256 950157 99924 99939
TTGAAAGCCAACCTGG 105 N/A N/A 2257 950158 100015 100030
TAACACAGCCATGGCT 123 N/A N/A 2258 950159 100020 100035
CCACATAACACAGCCA 28 N/A N/A 2259 950160 100125 100140
TTGCAGCACAGGGTCA 56 N/A N/A 2260 950161 100161 100176
GGCAACAGGAGACGCG 62 N/A N/A 2261 950162 100227 100242
AGAGGCTACATGGTGA 60 N/A N/A 2262 950163 100328 100343
GAAACAACCAATATCC 58 N/A N/A 2263 950164 100399 100414
CACGAAGGGTTGACAC 101 N/A N/A 2264 950165 100435 100450
GGCCAGAGTCCTGACT 98 N/A N/A 2265 950166 100535 100550
GTTACCAGGACAAAAC 126 N/A N/A 2266 950167 100670 100685
TGCCATCCCAGGGACC 105 N/A N/A 2267 950168 100782 100797
CTACAGAGCATTCCCC 89 N/A N/A 2268 950169 100811 100826
TGCCAGCAAGTCCCCA 80 N/A N/A 2269 950170 100929 100944
GCCAAGAGGCCCGCCT 171 N/A N/A 2270 950171 101038 101053
ACCCGAATAGCAAGCG 54 N/A N/A 2271 950172 101155 101170
GAGCATGGGCCCGCAG 139 N/A N/A 2272 950173 101255 101270
GATGATCCTTTCACCC 90 N/A N/A 2273 950174 101362 101377
CACCACCCTGGGTTTA 132 N/A N/A 2274 950175 101483 101498
GCAGACCACGCCTGGC 44 N/A N/A 2275 950176 101603 101618
TGCAAGGCGGAAAGAG 95 N/A N/A 2276 950177 101718 101733
GGCATTCCCACCCAGG 84 N/A N/A 2277 950178 101808 101823
GAAAACTAGACTTGCA 31 N/A N/A 2278 950179 101810 101825
CTGAAAACTAGACTTG 44 N/A N/A 2279 950180 101850 101865
GAAAAACACGAAGGGC 86 N/A N/A 2280 950181 101951 101966
TCATTACGGCCGGCGC 109 N/A N/A 2281 950182 102059 102074
CTAACTTGGGTGGTGG 43 N/A N/A 2282 950183 102159 102174
AGATATTGATGTCTTG 7 N/A N/A 2283 950184 102264 102279
GCAGAGGGAGCCCCGA 90 N/A N/A 2284 950185 102314 102329
TCGCATAGAAGATTCG 38 N/A N/A 2285 950186 102365 102380
CGGCAGGTGAGTGTCA 30 N/A N/A 2286 950187 102465 102480
GACTACCTGTTCAGGA 112 N/A N/A 2287 950188 102585 102600
GAAGAGTGGTGGTTTC 80 N/A N/A 2288 950189 102639 102654
TGCGAGCCGGCCCCAG 61 N/A N/A 2289 950190 102716 102731
CACGATCCCAAACCCT 79 N/A N/A 2290 950191 102830 102845
TGCCGGCACGCACGCG 135 N/A N/A 2291 950192 102935 102950
CAGCAGGGCCAAGTAA 61 N/A N/A 2292 950193 103102 103117
GGTAACACAGGGCCTG 119 N/A N/A 2293 950207 103286 103301
GAGCATAGGAAGAGGG 27 N/A N/A 2294 950208 103302 103317
GCAAAGAAGTAGGGCA 81 N/A N/A 2295 950209 103323 103338
GATTAGCCTGCCAGGC 20 N/A N/A 2296 950210 103425 103440
CCTCATCTATCCAAGG 99 N/A N/A 2297 950211 103552 103567
GGCACATGGGCTCAGC 119 N/A N/A 2298 950212 103672 103687
CTCCAAGTTCAGGAGC 119 N/A N/A 2299 950213 103832 103847
CGCAAGCCACAGCAGG 101 N/A N/A 2300 950214 103971 103986
ACTCACCCAGTGATGT 111 N/A N/A 2301 950215 104100 104115
GTTCAGGAAGCACCAA 20 N/A N/A 2302 950216 104276 104291
AGCCTTACTCCCTTTC 34 N/A N/A 2303 950217 104326 104341
CGCTTTAGGACATCTT 63 N/A N/A 2304 950218 104410 104425
TAGGAGTGAGTTACCT 102 N/A N/A 2305 950219 104458 104473
CACGAAGTGAATGGAA 13 N/A N/A 2306 950220 104486 104501
ACGCACAACACAACTG 63 N/A N/A 2307 950221 104560 104575
TGCCACTGGACTGACT 69 N/A N/A 2308 950222 104606 104621
GACCTAGGTGCCTGAC 27 N/A N/A 2309 950223 104678 104693
ACTCTACCCGCACCCT 96 N/A N/A 2310 950224 104783 104798
CTCCATGATGCTCCCT 63 N/A N/A 2311 950225 104895 104910
GTGTAGCATGCGCCAC 124 N/A N/A 2312 950226 104953 104968
GGGAAAAGAGTCACCC 113 N/A N/A 2313 950227 105113 105128
CTTCACCCCGAGCCAT 90 N/A N/A 2314 950228 105248 105263
CGGGAAGCATCCCTGG 114 N/A N/A 2315 950229 105253 105268
CAGCACGGGAAGCATC 53 N/A N/A 2316 950230 105366 105381
TGCAAGCACCTGAGCC 99 N/A N/A 2317 950231 105479 105494
CCCTATGGGTTCTGGC 78 N/A N/A 2318 950232 105561 105576
TCACAATTGGTGCCTT 16 N/A N/A 2319 950233 105622 105637
CCCCACCTCGGCCAAT 59 N/A N/A 2320 950234 105668 105683
CTAAATGGAGCTCTTG 64 N/A N/A 2321 950235 105671 105686
GGCCTAAATGGAGCTC 79 N/A N/A 2322 950236 105727 105742
CATCACACTCCTCGAT 96 N/A N/A 2323 950237 105864 105879
ATGTACTGTGAGCTTC 12 N/A N/A 2324 950238 106002 106017
GCTAATCCCTGACTCA 37 N/A N/A 2325 950239 106118 106133
ACTCAGCTGGAGTTGG 63 N/A N/A 2326 950240 106174 106189
GACAAATGGGTCTCGA 124 N/A N/A 2327 950241 106213 106228
GCCTAGAAGAGCTATG 97 N/A N/A 2328 950242 106218 106233
GGCAAGCCTAGAAGAG 95 N/A N/A 2329 950243 106269 106284
AGGCACACGGCTCAGG 55 N/A N/A 2330 950244 106276 106291
GTACAGGAGGCACACG 82 N/A N/A 2331 950245 106340 106355
TACTACTCTGGGTTTC 53 N/A N/A 2332 950246 106457 106472
GAACATGCAGGGCCTG 13 N/A N/A 2333 950247 106838 106853
AAGAAGTAGAAGTCGG 36 N/A N/A 2334 950248 106946 106961
GGATGAGGTTGTGTGG 82 N/A N/A 2335 950249 107060 107075
ACGCACATTTTCCTGT 59 N/A N/A 2336 950250 107115 107130
TGCTAAACAGTGCTTG 76 N/A N/A 2337 950251 107478 107493
AAAGTTTAGGCATGGT 22 N/A N/A 2338 950252 107673 107688
CGTCAATACTAAAATA 119 N/A N/A 2339 950253 108115 108130
GCCCGAATGTGTTTTG 72 N/A N/A 2340 950254 108434 108449
CACCAGAACTTTATTA 92 N/A N/A 2341 950255 108584 108599
GGCAAGTGTCTGAGTT 17 N/A N/A 2342 950256 108685 108700
TCTGACTGATCAGGAA 85 N/A N/A 2343 950257 108748 108763
GCACAAGCTTGACCCT 92 N/A N/A 2344
950258 108970 108985 GAAAATGACCTGTCCT 92 N/A N/A 2345 950259 109080
109095 CCGTGAGGGAACTTTC 69 N/A N/A 2346 950260 109124 109139
AAGCAAGTGGGACCCC 79 N/A N/A 2347 950261 109129 109144
GAACAAAGCAAGTGGG 62 N/A N/A 2348 950262 109183 109198
GGCCAAGGGTGGCCAT 143 N/A N/A 2349 950263 109205 109220
CGGCAAGGCATTTTAA 88 N/A N/A 2350 950264 109407 109422
TTTAAGCGATCTCCTG 31 N/A N/A 2351 950265 109408 109423
GTTTAAGCGATCTCCT 39 N/A N/A 2352 950266 109516 109531
ACCCAACCTTGGGACA 75 N/A N/A 2353 950267 109576 109591
CCCAAAGGATCTGCCC 101 N/A N/A 2354 950268 109649 109664
TGCCTGGGTATGTTTG 76 N/A N/A 2355 950269 109910 109925
AGATAGGCCTGCTTGC 70 N/A N/A 2356 950270 109914 109929
CACCAGATAGGCCTGC 74 N/A N/A 2357 950271 110212 110227
ACTCACATTGTTGATC 92 N/A N/A 2358 950272 110607 110622
CTCTAGGCTTACCACA 53 N/A N/A 2359 950273 110885 110900
GCCTAGGGTGCCTGGC 105 N/A N/A 2360 950274 110899 110914
TACAAACAGGTATGGC 20 N/A N/A 2361 950275 110900 110915
CTACAAACAGGTATGG 46 N/A N/A 2362 950276 111043 111058
TCAAATTTGTTGTTGC 14 N/A N/A 2363 950277 111093 111108
CCAAAGAGGATGGCCG 66 N/A N/A 2364 950278 111150 111165
AGTTAGTGGACTTGAT 37 N/A N/A 2365 950279 111166 111181
CTGCAGTGTTCACTCC 64 N/A N/A 2366 950280 111195 111210
GCCTAAGTTAATTCAG 88 N/A N/A 2367 950281 111339 111354
GCAACCAGGGTAAACG 94 N/A N/A 2368 950282 111471 111486
ACTGAAGAGGAGCCCA 57 N/A N/A 2369 950283 111548 111563
GCCAAAGGCCTGATAC 96 N/A N/A 2370 950284 111581 111596
GGTTTATAAAGCTTCC 35 N/A N/A 2371 950285 111781 111796
TCTTACCTCGGTCTTC 66 N/A N/A 2372 950286 111872 111887
TGAAAGAGGTTCCTGC 36 N/A N/A 2373 950287 111910 111925
GTTGACATTCATATAC 68 N/A N/A 2374 950288 112131 112146
TGAGAATGGGAGCAAC 39 N/A N/A 2375 950289 112147 112162
GAACACTGATCACTAC 32 N/A N/A 2376 950290 112174 112189
AAACATACCAGGACAC 39 N/A N/A 2377 950291 112192 112207
TCCTATCGGTATATGA 139 N/A N/A 2378 950292 112222 112237
TCATAGCAGAAGAACC 28 N/A N/A 2379 950293 112260 112275
TAAACTTGCAGGGTCA 9 N/A N/A 2380 950294 112267 112282
CTAAAAGTAAACTTGC 98 N/A N/A 2381 950295 112360 112375
TCCCATCTTTGGCTGC 37 N/A N/A 2382 950296 112902 112917
TCCTACTGGATACAGA 58 N/A N/A 2383 950299 113293 113308
GCCAATCCTGTTATAT 97 N/A N/A 2384 950300 113614 113629
GCAGAATAATCCTGTT 77 N/A N/A 2385 950301 113616 113631
TGGCAGAATAATCCTG 69 N/A N/A 2386 950302 113780 113795
GTTGACACCATGCTTG 14 N/A N/A 2387 950303 113923 113938
CCCCAGACTTTTTTGA 101 N/A N/A 2388 950304 114269 114284
AACCAGGCTTCCGGAC 83 N/A N/A 2389 950305 114450 114465
AGCTGTAGGGCTGGCT 61 N/A N/A 2390 950306 114637 114652
TCTGGCCACGCCTTGC 93 N/A N/A 2391 950307 114737 114752
CCTTAAGGAACTCCAT 109 N/A N/A 2392 950308 114843 114858
CCTAATATCTCTAGGG 82 N/A N/A 2393 950309 115000 115015
GCGCAGTGGGATCCTC 178 N/A N/A 2394 950310 115042 115057
TGCCAGAACCTGAGGT 96 N/A N/A 2395 950311 115081 115096
ATACAGATGGAGTAGG 63 N/A N/A 2396 950312 115423 115438
ACAGGAGGAGAGACCC 58 N/A N/A 2397 950313 115497 115512
CCAAATAGGGATGAGG 87 N/A N/A 2398 950314 115504 115519
TCGCAAGCCAAATAGG 29 N/A N/A 2399 950315 115538 115553
GAACAAGCCTCTTGGC 142 N/A N/A 2400 950316 115640 115655
GCCCAGTGTGAGGGTT 102 N/A N/A 2401 950317 115795 115810
CATCAACTCGCCTGCT 101 N/A N/A 2402 950318 115915 115930
CCGGGAGCAAGAGGCA 160 N/A N/A 2403 951323 3692 3707 CCAGATGGCAGACTTC
19 N/A N/A 2404 951324 3772 3787 AGATATCTAGATGGCC 111 N/A N/A 2405
951325 3773 3788 TAGATATCTAGATGGC 63 N/A N/A 2406 951326 3774 3789
ATAGATATCTAGATGG 52 N/A N/A 2407 951327 3884 3899 CCAAATGGTGGTGGCA
84 N/A N/A 2408 951328 4373 4388 CCAATTTGTAGGCTGT 9 N/A N/A 2409
951329 4487 4502 ACAGATGGGCACACCG 91 N/A N/A 2410 951330 4647 4662
ACAAATGAGTAGTTCC 6 N/A N/A 2411 951331 4668 4683 TCATTTGGCAGCCACA
41 N/A N/A 2412 951332 4670 4685 TATCATTTGGCAGCCA 77 N/A N/A 2413
951333 4673 4688 TGTTATCATTTGGCAG 13 N/A N/A 2414 951334 4767 4782
CCTTACTTGGGATTCA 64 N/A N/A 2415 951335 4792 4807 ATGATAACACAGCCTC
47 N/A N/A 2416 951336 4793 4808 GATGATAACACAGCCT 46 N/A N/A 2417
951337 4795 4810 GGGATGATAACACAGC 104 N/A N/A 2418 951338 4917 4932
GAGATTTGTGCTGCTT 16 N/A N/A 2419 951339 5744 5759 GTAAGTAAGCACTTTT
45 N/A N/A 2420 951340 5899 5914 GGATTATAGCAATGCC 12 N/A N/A 2421
951341 5970 5985 TCACTTTACAGCCTCC 9 N/A N/A 2422 951342 6124 6139
GGATTCTAGGAGGTCG 36 N/A N/A 2423 951343 6458 6473 ATTAATACTCTTAACG
57 N/A N/A 2424 951344 6738 6753 ACTAACTGGGCTGTTC 53 N/A N/A 2425
951345 6740 6755 GAACTAACTGGGCTGT 40 N/A N/A 2426 951346 6857 6872
GGAAATCTAACACTGG 7 N/A N/A 2427 951347 6908 6923 AACTCTATAGATCTGA
101 N/A N/A 2428 951348 6959 6974 AGACATGGTGGAACCA 81 N/A N/A 2429
951349 7117 7132 GATTACAACAACAGCC 76 N/A N/A 2430 951350 7175 7190
TGAAATCGAAGCCATT 95 N/A N/A 2431 951351 7399 7414 TAAATGACAAGGGTCA
83 N/A N/A 2432 951352 7942 7957 GCTATTATAACTTGTA 8 N/A N/A 2433
951353 8568 8583 ATTTTAAAGAAGACGG 42 N/A N/A 2434 951354 8583 8598
GCTATTATAACTCCTA 11 N/A N/A 2435 951355 8616 8631 CACTTAATCCCTATTC
74 N/A N/A 2436 951356 9095 9110 ATACTTATCGCCTTTT 5 N/A N/A 2437
951357 9099 9114 CATCATACTTATCGCC 6 N/A N/A 2438 951358 9144 9159
TCCAACTGTGATCTCT 8 N/A N/A 2439 951359 10032 10047 CCAAGGAACACATCAC
25 N/A N/A 2440 951360 10064 10079 ACTAATAAGATCTGTT 97 N/A N/A 2441
951361 10131 10146 TGCAATTTGTCTTTGC 78 N/A N/A 2442 951362 10136
10151 CAAGATGCAATTTGTC 3 N/A N/A 2443 951363 10700 10715
CGAGATCACAAATGCT 41 N/A N/A 2444 951364 11386 11401
AGTAATGATGAGTTCC 3 N/A N/A 2445 951365 11416 11431 CACTGATAGGCACTCC
8 N/A N/A 2446 951366 11553 11568 ATTACTTGTTTGCAGC 8 N/A N/A 2447
951367 11556 11571 CCAATTACTTGTTTGC 8 N/A N/A 2448 951368 11572
11587 TAAATAACTCTCACGG 25 N/A N/A 2449 951369 11573 11588
GTAAATAACTCTCACG 86 N/A N/A 2450 951370 11575 11590
GTGTAAATAACTCTCA 10 N/A N/A 2451 951371 11922 11937
GTTGATAGTCGGTTGT 4 N/A N/A 2452 951372 11960 11975 GGTCATTAAAGATTCT
4 N/A N/A 2453 951373 11990 12005 GGTACCTAACAGGTCT 93 N/A N/A 2454
951374 12062 12077 GTCTTTCCGGTCTTTT 4 N/A N/A 2455 951375 12148
12163 GATTATAAACCTAATC 121 N/A N/A 2456 951376 12215 12230
TCAATAAGTAACTCTG 11 N/A N/A 2457 951377 12216 12231
GTCAATAAGTAACTCT 140 N/A N/A 2458 951378 12237 12252
ACCTATCAAGGGCTGT 27 N/A N/A 2459 951379 12244 12259
GTTATGAACCTATCAA 20 N/A N/A 2460 951380 12245 12260
TGTTATGAACCTATCA 47 N/A N/A 2461 951381 12850 12865
GTTTACATGATGTTCT 7 N/A N/A 2462 951382 12860 12875 GTAAATTACGGTTTAC
122 N/A N/A 2463 951383 12861 12876 AGTAAATTACGGTTTA 14 N/A N/A
2464 951384 12890 12905 CTTAATTACAGCTTGT 6 N/A N/A 2465 951385
12934 12949 TCATTATTGGCTTGGA 41 N/A N/A 2466 951386 12935 12950
CTCATTATTGGCTTGG 4 N/A N/A 2467 951387 12971 12986 CCTTTATTCAGATTGT
3 N/A N/A 2468 951388 13136 13151 AGTCATCCAGCTCCCG 54 N/A N/A
2469
951389 13167 13182 ATAAATGTCCAGCAGC 44 N/A N/A 2470 951390 13169
13184 TCATAAATGTCCAGCA 63 N/A N/A 2471 951391 13170 13185
ATCATAAATGTCCAGC 32 N/A N/A 2472 951392 13392 13407
GCCATATGTGTGGCTC 65 N/A N/A 2473 951393 13487 13502
TGTAATCTTGGCCCAG 83 N/A N/A 2474 951394 13521 13536
TGCATATCCAAAGCCA 83 N/A N/A 2475 951395 14442 14457
CCACATGTGAAGCAGC 21 N/A N/A 2476 951396 14476 14491
GGCTATTCCACTGCAG 99 N/A N/A 2477 951397 14694 14709
TCTGTAATGGTTTCCC 5 N/A N/A 2478 951398 14808 14823 TGTACCTAAGTACAGA
97 N/A N/A 2479 951399 14824 14839 TCTATAGGTACCAGCA 50 N/A N/A 2480
951400 15508 15523 AGTGAAATTCACTCCA 47 N/A N/A 2481 951401 15651
15666 CTCTTTATATAGATGG 58 N/A N/A 2482 951402 16748 16763
AGAGATACATCAACCC 35 N/A N/A 2483 951403 17836 17851
AAATATAGCAGGGACC 51 N/A N/A 2484 951404 17839 17854
ACTAAATATAGCAGGG 30 N/A N/A 2485 951405 17842 17857
GGCACTAAATATAGCA 71 N/A N/A 2486 951406 19042 19057
TAGTATACCAAGGTTA 11 N/A N/A 2487 951407 19043 19058
GTAGTATACCAAGGTT 6 N/A N/A 2488 951408 19760 19775 CAGTATGTATACTTCC
2 N/A N/A 2489 951409 19761 19776 TCAGTATGTATACTTC 86 N/A N/A 2490
951410 20345 20360 TCCTGATAAGATTCAC 17 N/A N/A 2491 951411 20392
20407 TCAGTTATCACTGTCA 31 N/A N/A 2492 951412 20458 20473
ACTAGTAACTTTCCAG 37 N/A N/A 2493 951413 20741 20756
GGATTATTACATGAGT 11 N/A N/A 2494 951414 20743 20758
GAGGATTATTACATGA 29 N/A N/A 2495 951415 20864 20879
GCCAACTAATTCCAGA 46 N/A N/A 2496 951416 21512 21527
ATATATGTGGAGGCAA 10 N/A N/A 2497 951417 21513 21528
TATATATGTGGAGGCA 104 N/A N/A 2498 951418 21515 21530
AATATATATGTGGAGG 4 N/A N/A 2499 951419 21654 21669 CACTATTGGCACACCA
115 N/A N/A 2500 951420 21655 21670 ACACTATTGGCACACC 122 N/A N/A
2501 951421 21656 21671 AACACTATTGGCACAC 111 N/A N/A 2502 951422
21840 21855 TTCTTAACAGGCTCCC 41 N/A N/A 2503 951423 22010 22025
TAAGTATGCGCTGCCA 31 N/A N/A 2504 951424 22134 22149
AGGATATAGGGTCTCC 97 N/A N/A 2505 951425 22135 22150
AAGGATATAGGGTCTC 37 N/A N/A 2506 951426 22212 22227
GAACATCATGGAGCCT 33 N/A N/A 2507 951427 23308 23323
TTTGATACTGATCTCA 18 N/A N/A 2508 951428 24284 24299
GGTATTATGGTATGTG 2 N/A N/A 2509 951429 24285 24300 AGGTATTATGGTATGT
2 N/A N/A 2510 951430 24396 24411 TCATATGTATGGGTTT 4 N/A N/A 2511
951431 24398 24413 CTTCATATGTATGGGT 10 N/A N/A 2512 951432 25701
25716 ATAGATGTAAGCAACT 51 N/A N/A 2513 951433 25709 25724
GGAAATTCATAGATGT 113 N/A N/A 2514 951434 25740 25755
ACTTATGGATGCAGCT 52 N/A N/A 2515 951435 25741 25756
AACTTATGGATGCAGC 39 N/A N/A 2516 951436 26160 26175
AGCATTGGTATCAGGC 35 N/A N/A 2517 951437 26168 26183
TGGATATCAGCATTGG 17 N/A N/A 2518 951438 26173 26188
ATGGATGGATATCAGC 41 N/A N/A 2519 951439 26180 26195
TTCAATCATGGATGGA 72 N/A N/A 2520 951440 27070 27085
GGAATACTTGCAGCTA 41 N/A N/A 2521 951441 27071 27086
AGGAATACTTGCAGCT 11 N/A N/A 2522 951442 27224 27239
CAACATGGCACTCCCT 64 N/A N/A 2523 951443 27231 27246
TCTGATGCAACATGGC 12 N/A N/A 2524 951444 27569 27584
ATCATTGGGTGAAGAC 43 N/A N/A 2525 951445 27762 27777
GGTCTATTGGCACACA 32 N/A N/A 2526 951446 27776 27791
AGATTAAGTCATCCGG 90 N/A N/A 2527 951447 27777 27792
GAGATTAAGTCATCCG 61 N/A N/A 2528 951448 27778 27793
AGAGATTAAGTCATCC 73 N/A N/A 2529 951449 28228 28243
GCAAATGCTAGCTGCA 142 N/A N/A 2530 951450 29274 29289
CGCTCTAATGTCCTGA 11 N/A N/A 2531 951451 29308 29323
TGGATATCCAGACCCA 97 N/A N/A 2532 951452 29321 29336
GCAGATCCTGCCTTGG 92 N/A N/A 2533 951453 29584 29599
TGAACTAGAGGCAGGC 29 N/A N/A 2534 951454 29585 29600
GTGAACTAGAGGCAGG 19 N/A N/A 2535 951455 29974 29989
TGTAACTTTCAGCAGT 25 N/A N/A 2536 951456 29999 30014
TGTGATTGCAGGCCAG 13 N/A N/A 2537 951457 30053 30068
TTTTATAGTCTCCAAC 140 N/A N/A 2538 951458 30107 30122
TGTATGGACAGCAGGC 13 N/A N/A 2539 951459 30108 30123
GTGTATGGACAGCAGG 10 N/A N/A 2540 951460 30242 30257
ATCAATCTTGGGAGCT 39 N/A N/A 2541 951461 30246 30261
CTAAATCAATCTTGGG 40 N/A N/A 2542 951462 30348 30363
ATATTAATGCAGTGGT 4 N/A N/A 2543 951463 30349 30364 CATATTAATGCAGTGG
14 N/A N/A 2544 951464 30350 30365 ACATATTAATGCAGTG 66 N/A N/A 2545
951465 30407 30422 AGAATATCAACACCTT 69 N/A N/A 2546 951466 30408
30423 TAGAATATCAACACCT 61 N/A N/A 2547 951467 30426 30441
TTATCTAACAGTCCCA 45 N/A N/A 2548 951468 30429 30444
CATTTATCTAACAGTC 104 N/A N/A 2549 951469 30509 30524
TAGTGATATGCTGCCT 22 N/A N/A 2550 951470 30852 30867
CACAATCCTGGCTATC 56 N/A N/A 2551 951471 30931 30946
CCAGACATTGCTGTCG 108 N/A N/A 2552 951472 31367 31382
ACATTTGACGGTTTGA 15 N/A N/A 2553 951473 32256 32271
GGGAATGATGCCACCT 110 N/A N/A 2554 951474 32270 32285
CCAATCTGTTATGTGG 23 N/A N/A 2555 951475 32336 32351
TGGAATCCAGTATTTC 103 N/A N/A 2556 951476 32498 32513
AGGAATCCTGCAGCTC 108 N/A N/A 2557 951477 32722 32737
TCCTATTAGAGTGGCA 49 N/A N/A 2558 951478 32905 32920
AGCATTAACAGAGCAG 92 N/A N/A 2559 951479 33017 33032
GGCTTTACTCCAGCCA 104 N/A N/A 2560 951480 33518 33533
AACAATAGCCATTGGT 107 N/A N/A 2561 951481 34302 34317
TGTTTATTTACCGTTT 3 N/A N/A 2562 951482 35180 35195 AGTACTATTGCATCAT
28 N/A N/A 2563 951483 36041 36056 TCACATACAGACCCCA 59 N/A N/A 2564
951484 36073 36088 CTAAATGTCACTTAGC 40 N/A N/A 2565 951485 36087
36102 GGAACTAACACATGCT 23 N/A N/A 2566 951486 36362 36377
GAAATCTACCTACTCC 105 N/A N/A 2567 951487 36363 36378
TGAAATCTACCTACTC 121 N/A N/A 2568 951488 36617 36632
GGCACCAACATTCACC 96 N/A N/A 2569 951489 36660 36675
TCCGATTTTGCTTCTA 10 N/A N/A 2570 951490 36665 36680
ACTTATCCGATTTTGC 23 N/A N/A 2571 951491 36809 36824
TGTTATTCCGAACAGT 43 N/A N/A 2572 951492 36911 36926
TCTCATGGCGACTGGC 77 N/A N/A 2573 951493 36948 36963
GGAATAAAGGCTCTCG 22 N/A N/A 2574 951494 37009 37024
TTAGATTGTATGACCC 9 N/A N/A 2575 951495 37194 37209 GGCTTTGTTAGATGCC
107 N/A N/A 2576 951496 37246 37261 ATTCATAGTACCCCAC 62 N/A N/A
2577 951497 37304 37319 GTATTTGTAGTGTGGA 110 N/A N/A 2578 951498
37305 37320 GGTATTTGTAGTGTGG 10 N/A N/A 2579 951499 37446 37461
GACAATGGTGATGCCC 62 N/A N/A 2580 951500 37566 37581
ATCTTAGGCAGACCCT 42 N/A N/A 2581 951501 37570 37585
ACACATCTTAGGCAGA 14 N/A N/A 2582 951502 37729 37744
ATTAAAATGGGTCTGC 77 N/A N/A 2583 951503 37750 37765
CATTTAACCATGACAG 31 N/A N/A 2584 951504 37751 37766
CCATTTAACCATGACA 32 N/A N/A 2585 951505 37971 37986
ACCTTAAGTTTTTTGG 118 N/A N/A 2586 951506 38196 38211
GCTAATAGCTATTCAA 39 N/A N/A 2587 951507 38225 38240
CGCATTACTGAGTTCA 12 N/A N/A 2588 951508 38335 38350
GTGACTAAGACAACCA 40 N/A N/A 2589 951509 38538 38553
AGACATGTAACTCCCT 39 N/A N/A 2590 951510 38540 38555
CTAGACATGTAACTCC 72 N/A N/A 2591 951511 38592 38607
GCCTATCCATGCTGCT 105 N/A N/A 2592 951512 39123 39138
CAGAATTGTTACAACC 47 N/A N/A 2593 951513 39140 39155
CCATTAAAATTTGCCC 30 N/A N/A 2594 951514 39141 39156
TCCATTAAAATTTGCC 44 N/A N/A 2595
951515 39233 39248 TTAACTATATCTAACT 73 N/A N/A 2596 951516 39236
39251 CGATTAACTATATCTA 87 N/A N/A 2597 951517 39547 39562
ATTTATGCGATTGGCC 88 N/A N/A 2598 951518 39548 39563
GATTTATGCGATTGGC 17 N/A N/A 2599 951519 39549 39564
AGATTTATGCGATTGG 11 N/A N/A 2600 951520 39555 39570
TGTTTAAGATTTATGC 41 N/A N/A 2601 951521 39748 39763
AAAGTAATTCACTGCG 81 N/A N/A 2602 951522 40198 40213
ATGGACTACAGTCTGT 110 N/A N/A 2603 951523 40275 40290
TGCAATCACAGACATC 93 N/A N/A 2604 951524 41080 41095
GTATTAACCTCATGAA 93 N/A N/A 2605 951525 41081 41096
GGTATTAACCTCATGA 68 N/A N/A 2606 951526 41125 41140
GTCTTTCCGTCACAGT 40 N/A N/A 2607 951527 41273 41288
GGATAATTGGAGAGGG 94 N/A N/A 2608 951528 41274 41289
GGGATAATTGGAGAGG 68 N/A N/A 2609 951529 42072 42087
GGGATTATGATGAGGA 3 N/A N/A 2610 951530 42327 42342 GATGATGGGTTCTAGC
85 N/A N/A 2611 951531 42355 42370 GGGAGATGTGCTCTTT 49 N/A N/A 2612
951532 42381 42396 GTATTACCCAGTGGCT 62 N/A N/A 2613 951533 42382
42397 TGTATTACCCAGTGGC 15 N/A N/A 2614 951534 42387 42402
GGGAATGTATTACCCA 131 N/A N/A 2615 951535 42501 42516
TACAATCATTCCCAGC 89 N/A N/A 2616 951536 42506 42521
AGCACTACAATCATTC 82 N/A N/A 2617 951537 42569 42584
TACTGTACAGCTGTGC 8 N/A N/A 2618 951538 42578 42593 GGCAATTGGTACTGTA
121 N/A N/A 2619 951539 42599 42614 GAAAATTTGTACAGGA 55 N/A N/A
2620 951540 43029 43044 TACATTAAAGGCTCGA 44 N/A N/A 2621 951541
43843 43858 GTACATATCCTGGCCG 32 N/A N/A 2622 951542 43871 43886
TACTATTCGACAGAGC 31 N/A N/A 2623 951543 43873 43888
ATTACTATTCGACAGA 36 N/A N/A 2624 951544 43876 43891
TAAATTACTATTCGAC 45 N/A N/A 2625 951545 43877 43892
GTAAATTACTATTCGA 63 N/A N/A 2626 951546 43878 43893
TGTAAATTACTATTCG 19 N/A N/A 2627 951547 44416 44431
GAGATCAACACATTTC 57 N/A N/A 2628 951548 44701 44716
AGAAATTACTCTTGCG 116 N/A N/A 2629 951549 44902 44917
TCCAATGACAGCCCAG 26 N/A N/A 2630 951550 44914 44929
GTGAATTCAATGTCCA 11 N/A N/A 2631 951551 44929 44944
ACACATGTGGAACACG 80 N/A N/A 2632 951552 45353 45368
TATCTATAACACATGA 44 N/A N/A 2633 951553 45356 45371
GGTTATCTATAACACA 23 N/A N/A 2634 951554 45446 45461
GTCTTTATTGCATGGG 8 N/A N/A 2635 951555 45569 45584 GCTATAAAACCAGCCA
101 N/A N/A 2636 951556 45590 45605 AGCATTGGATTGAGCA 89 N/A N/A
2637 951557 46280 46295 AGCAATGGTGGCCGGG 109 N/A N/A 2638 951558
46328 46343 CTATATTCAACAGGCT 24 N/A N/A 2639 951559 46329 46344
ACTATATTCAACAGGC 61 N/A N/A 2640 951560 46335 46350
GGCCATACTATATTCA 102 N/A N/A 2641 951561 46428 46443
GGGATATACGCCCACC 8 N/A N/A 2642 951562 46590 46605 TATTTAAAAGGGCCGC
23 N/A N/A 2643 951563 46591 46606 GTATTTAAAAGGGCCG 97 N/A N/A 2644
951564 46861 46876 CGAAATAGCAGAGCTC 75 N/A N/A 2645 951565 46961
46976 TCTATAGTGACTCTCA 9 N/A N/A 2646 951566 46962 46977
TTCTATAGTGACTCTC 6 N/A N/A 2647 951567 47624 47639 GTTCATCCGGGTCAGG
36 N/A N/A 2648 951568 47926 47941 GCAACTATGCATCCAC 141 N/A N/A
2649 951569 48813 48828 GAACATGGCAGCCAGT 82 N/A N/A 2650 951570
48973 48988 TGCTTAATGCCTTGCC 82 N/A N/A 2651 951571 49051 49066
CGCAATGTGTTCATTT 27 N/A N/A 2652 951572 49192 49207
ACTTTAACAAGTCCCG 36 N/A N/A 2653 951573 49193 49208
CACTTTAACAAGTCCC 23 N/A N/A 2654 951574 49227 49242
ACAGATGAAGCTACCA 27 N/A N/A 2655 951575 49443 49458
GGTTATGGTCTTAGGT 16 N/A N/A 2656 951576 49674 49689
TCGATTTGATTCTGAG 84 N/A N/A 2657 951577 50575 50590
GACAAATTGCCACTGG 54 N/A N/A 2658 951578 50595 50610
GCAAATATCTCCCAGT 19 N/A N/A 2659 951579 50845 50860
ACAATGACGAGGCTGG 25 N/A N/A 2660 951580 50979 50994
TCAAATCCCATCAGGA 90 N/A N/A 2661 951581 51714 51729
TGTACTTGCGGGTTTT 42 N/A N/A 2662 951582 51790 51805
AGCAATCACGCTGCCA 99 N/A N/A 2663 951583 51798 51813
AGTCATCCAGCAATCA 43 N/A N/A 2664 951584 51810 51825
ATTAATCTGGGCAGTC 38 N/A N/A 2665 951585 51811 51826
GATTAATCTGGGCAGT 67 N/A N/A 2666 951586 51816 51831
TAAAGGATTAATCTGG 48 N/A N/A 2667 951587 51977 51992
ATTTTGATAGCTCCAC 33 N/A N/A 2668 951588 51979 51994
GCATTTTGATAGCTCC 17 N/A N/A 2669 951589 52601 52616
GGTTTAAAAGCTTCCA 98 N/A N/A 2670 951590 52938 52953
GTAAATGCTGAATGCC 34 N/A N/A 2671 951591 53084 53099
GGATATGGACAGCAGG 17 N/A N/A 2672 951592 53085 53100
AGGATATGGACAGCAG 15 N/A N/A 2673 951593 53553 53568
TCACATGCCAGACTTT 100 N/A N/A 2674 951594 53781 53796
CACACTCACGCATGTT 102 N/A N/A 2675 951595 53852 53867
TTTACCTTGAATGTCC 46 N/A N/A 2676 951596 54009 54024
GCAAGCTACTCTCTCA 88 N/A N/A 2677 951597 54160 54175
TCAATACCTGCACAGG 42 N/A N/A 2678 951598 54161 54176
GTCAATACCTGCACAG 80 N/A N/A 2679 951599 54177 54192
TGTATGAGGACTCAGA 42 N/A N/A 2680 951600 54189 54204
ATCATAACAGGCTGTA 28 N/A N/A 2681 951601 54190 54205
CATCATAACAGGCTGT 94 N/A N/A 2682 951602 54199 54214
TAAAATGCGCATCATA 51 N/A N/A 2683 951603 54255 54270
GTAATGAGCTCAGTCT 45 N/A N/A 2684 951604 55117 55132
GAAACTACGGCACTCT 121 N/A N/A 2685 951605 55385 55400
GGTAATAAGTCACACT 103 N/A N/A 2686 951606 55528 55543
GATTAATATCGGCTGA 44 N/A N/A 2687 951607 55530 55545
TGGATTAATATCGGCT 24 N/A N/A 2688 951608 55531 55546
ATGGATTAATATCGGC 9 N/A N/A 2689 951609 56236 56251 GTTCATCACGGAAGGT
120 N/A N/A 2690 951610 56274 56289 CCGAATCACAGATTGA 71 N/A N/A
2691 951611 56324 56339 GTAATTGACAAGCAGT 16 N/A N/A 2692 951612
56327 56342 TAAGTAATTGACAAGC 29 N/A N/A 2693 951613 56387 56402
GTATATAAGACCCGGG 65 N/A N/A 2694 951614 56388 56403
TGTATATAAGACCCGG 86 N/A N/A 2695 951615 56389 56404
GTGTATATAAGACCCG 53 N/A N/A 2696 951616 56390 56405
AGTGTATATAAGACCC 41 N/A N/A 2697 951617 56459 56474
GACTATTCAAGAGGGC 70 N/A N/A 2698 951618 56567 56582
TCTCATGGCACTCACT 42 N/A N/A 2699 951619 56617 56632
ATTCATGGTCCACCAG 101 N/A N/A 2700 951620 56685 56700
GGTGATGCTGCAGAGC 36 N/A N/A 2701 951621 56725 56740
CAGGATACATCACCCA 128 N/A N/A 2702 951622 56858 56873
TATTATGAATCCCCCT 90 N/A N/A 2703 951623 56859 56874
ATATTATGAATCCCCC 100 N/A N/A 2704 951624 56861 56876
ACATATTATGAATCCC 52 N/A N/A 2705 951625 57375 57390
AGTAATGACCCAGGCT 74 N/A N/A 2706 951626 57642 57657
AGTGATGGGTCCCCAC 94 N/A N/A 2707 951627 57738 57753
GTGAATATCAACTGTT 41 N/A N/A 2708 951628 57916 57931
GCAGATCTGGCTGCCT 71 N/A N/A 2709 951629 58905 58920
AGGATATTTGGCTGGG 70 N/A N/A 2710 951630 59003 59018
ACTTATCGCAAGGAAC 71 N/A N/A 2711 951631 59075 59090
GCGATATACCTTTCTG 26 N/A N/A 2712 951632 59076 59091
TGCGATATACCTTTCT 19 N/A N/A 2713 951633 59174 59189
TGAATGACAGGTGTGT 124 N/A N/A 2714 951634 59346 59361
TACAATCACAATTGCT 47 N/A N/A 2715 951635 60402 60417
GCCAATACCAAAGAAC 96 N/A N/A 2716 951636 60469 60484
TCTAAATCAGGACAGT 86 N/A N/A 2717 951637 61124 61139
GCAACATGGGCACTGC 100 N/A N/A 2718 951638 61190 61205
TAAGATCGCATCTGGG 93 N/A N/A 2719 951639 61274 61289
AGCTATCTGGGTTAGG 105 N/A N/A 2720
951640 61338 61353 GGAAATAGACGATCTC 68 N/A N/A 2721 951641 61460
61475 CCAATTTGGGCATCAA 102 N/A N/A 2722 951642 61461 61476
GCCAATTTGGGCATCA 102 N/A N/A 2723 951643 61530 61545
GTTATATGTGTGGCAT 35 N/A N/A 2724 951644 61531 61546
TGTTATATGTGTGGCA 40 N/A N/A 2725 951645 61532 61547
GTGTTATATGTGTGGC 9 N/A N/A 2726 951646 61680 61695 GCTAAAATTCCACTCT
96 N/A N/A 2727 951647 61796 61811 CGTAAACATGATTCCT 20 N/A N/A 2728
951648 61841 61856 GTTATTAAGGACAACC 120 N/A N/A 2729 951649 61857
61872 CGTTATTGTCATTTGT 46 N/A N/A 2730 951650 61943 61958
TCGAATGAAGATGGTC 30 N/A N/A 2731 951651 62255 62270
AATGATAAGGACCCCA 63 N/A N/A 2732 951652 62257 62272
GTAATGATAAGGACCC 66 N/A N/A 2733 951653 62258 62273
AGTAATGATAAGGACC 80 N/A N/A 2734 951654 62398 62413
GTTAATTGTGCACTTG 15 N/A N/A 2735 951655 62399 62414
TGTTAATTGTGCACTT 80 N/A N/A 2736 951656 62400 62415
GTGTTAATTGTGCACT 109 N/A N/A 2737 951657 62526 62541
AGTTATAAACCCTGGG 11 N/A N/A 2738 951658 63805 63820
ACAATAATTGGCCAAA 86 N/A N/A 2739 951659 63829 63844
GATCTAATTACCAGCT 128 N/A N/A 2740 951660 63881 63896
TACTTAGGTTACTCCT 49 N/A N/A 2741 951661 64400 64415
GACAATGGGTCAACGC 67 N/A N/A 2742 951662 65042 65057
TGCTCTAAATGACTGC 96 N/A N/A 2743 951663 65090 65105
CCACATCTATCTCAGA 112 N/A N/A 2744 951664 65141 65156
AATATCTCAGCAGTGC 54 N/A N/A 2745 951665 65142 65157
CAATATCTCAGCAGTG 126 N/A N/A 2746 951666 65354 65369
GGCCTAACAGTGTCCA 105 N/A N/A 2747 951667 65601 65616
AGTCATTAGTACGCCA 46 N/A N/A 2748 951668 66403 66418
GTCTTGTGGGATGTGA 66 N/A N/A 2749 951669 66821 66836
TCAATACACACTGTTG 85 N/A N/A 2750 951670 66828 66843
GGATAATTCAATACAC 41 N/A N/A 2751 951671 67824 67839
ATAACATGTTACTCAG 71 N/A N/A 2752 951672 67825 67840
CATAACATGTTACTCA 87 N/A N/A 2753 951673 67827 67842
GTCATAACATGTTACT 76 N/A N/A 2754 951674 67828 67843
TGTCATAACATGTTAC 102 N/A N/A 2755 951675 67840 67855
GGCACTCACAGCTGTC 119 N/A N/A 2756 951676 68164 68179
AGCTGTTGTGCAGTGC 73 N/A N/A 2757 951677 68238 68253
GCTAAATGTGGACTGA 28 N/A N/A 2758 951678 68623 68638
GGCAATGCATACAGTC 44 N/A N/A 2759 951679 68650 68665
GTTATTAACCCCCTGT 44 N/A N/A 2760 951680 69011 69026
TCAATTACTTACAAGA 62 N/A N/A 2761 951681 69030 69045
TGTTTATGCACCATGT 57 N/A N/A 2762 951682 69227 69242
GAATTATGCCTTCTAC 25 N/A N/A 2763 951683 69652 69667
GTCTATGTGGGCTGCC 80 N/A N/A 2764 951684 69735 69750
ATCTATGGCATGGAGC 82 N/A N/A 2765 951685 69737 69752
ACATCTATGGCATGGA 75 N/A N/A 2766 951686 71409 71424
ACAGATAAATCAAGCC 50 N/A N/A 2767 951687 71450 71465
CACTATGCGGCCACCA 93 N/A N/A 2768 951688 71699 71714
GTACATACTGCAGCAG 113 N/A N/A 2769 951689 71700 71715
GGTACATACTGCAGCA 107 N/A N/A 2770 951690 71857 71872
GCGAATGCCATGCTTA 82 N/A N/A 2771 951691 71968 71983
GACATTTAACACACTA 7 N/A N/A 2772 951692 73303 73318 GGCTTAATCCCACACG
97 N/A N/A 2773 951693 73694 73709 GAATTTGGGATTGTGG 21 N/A N/A 2774
951694 73828 73843 TCATGCATGGCACTGT 102 N/A N/A 2775 951695 73956
73971 AGCATAAAAGCACTCT 74 N/A N/A 2776 951696 74038 74053
GCTATGAATTTCCTCC 10 N/A N/A 2777 951697 74039 74054
GGCTATGAATTTCCTC 115 N/A N/A 2778 951698 74365 74380
TGCTATGACCCTCACT 82 N/A N/A 2779 951699 75020 75035
ACAGATAACAGTGGCG 24 N/A N/A 2780 951700 75136 75151
GTAATTCCCGTTCTCT 16 N/A N/A 2781 951701 75145 75160
TCTATTACCGTAATTC 23 N/A N/A 2782 951702 75247 75262
TACATGAACAGTCTGT 50 N/A N/A 2783 951703 75327 75342
AACTTACAAGCATCGG 91 N/A N/A 2784 951704 75329 75344
TGAACTTACAAGCATC 94 N/A N/A 2785 951705 75417 75432
ATCAATTTTAAACACG 31 N/A N/A 2786 951706 75765 75780
ACAAATACATGAGGTC 32 N/A N/A 2787 951707 75894 75909
GTATTATTCCCAGCTA 77 N/A N/A 2788 951708 75895 75910
TGTATTATTCCCAGCT 102 N/A N/A 2789 951709 76435 76450
GAGAATATCACAGGGT 10 N/A N/A 2790 951710 76448 76463
TGTAATCAGTCAAGAG 18 N/A N/A 2791 951711 76550 76565
GACAATTGTGACCGGC 88 N/A N/A 2792 951712 76568 76583
CACAATCAGAGCATTC 34 N/A N/A 2793 951713 76593 76608
TGATTTACAGGCCCAA 37 N/A N/A 2794 951714 76594 76609
GTGATTTACAGGCCCA 50 N/A N/A 2795 951715 76725 76740
ACTAATGACAGACAAC 27 N/A N/A 2796 951716 76728 76743
TAAACTAATGACAGAC 92 N/A N/A 2797 951717 76775 76790
TTGAATTGTGGACCAA 60 N/A N/A 2798 951718 77126 77141
AGGTTAATGCTTCACC 54 N/A N/A 2799 951719 77303 77318
TCAAATGGTGACCACT 112 N/A N/A 2800 951720 77432 77447
CGTTTTAGTTTTCCTA 14 N/A N/A 2801 951721 77538 77553
GTAATAACATGTGTCG 45 N/A N/A 2802 951722 77539 77554
GGTAATAACATGTGTC 27 N/A N/A 2803 951723 77570 77585
TAAACAATTGCTCATC 59 N/A N/A 2804 951724 78076 78091
GGTAATTCTGCAAAGA 29 N/A N/A 2805 951725 78080 78095
TAATGGTAATTCTGCA 43 N/A N/A 2806 951726 78082 78097
ACTAATGGTAATTCTG 50 N/A N/A 2807 951727 78166 78181
TTAGATCTCATTACCT 71 N/A N/A 2808 951728 78206 78221
GTAACAACATCTACCT 88 N/A N/A 2809 951729 78207 78222
GGTAACAACATCTACC 3 N/A N/A 2810 951730 78387 78402 TGATTTACAGGATGCT
15 N/A N/A 2811 951731 78388 78403 TTGATTTACAGGATGC 8 N/A N/A 2812
951732 78539 78554 GCAAATGCTGGCTACG 85 N/A N/A 2813 951733 78546
78561 CCCAATGGCAAATGCT 66 N/A N/A 2814 951734 78848 78863
GGCACTACCTTCACCA 109 N/A N/A 2815 951735 79046 79061
TCATATTGTTCTGCCC 15 N/A N/A 2816 951736 79047 79062
TTCATATTGTTCTGCC 11 N/A N/A 2817 951737 79077 79092
GGCTTTTGTCAGAGGA 8 N/A N/A 2818 951738 79153 79168 TTCAATGACATGCTAG
19 N/A N/A 2819 951739 79209 79224 TATATCAGCTCAGTGC 75 N/A N/A 2820
951740 79211 79226 TATATATCAGCTCAGT 66 N/A N/A 2821 951741 79214
79229 TTGTATATATCAGCTC 37 N/A N/A 2822 951742 79229 79244
TCATACATAAGGATGT 91 N/A N/A 2823 951743 79398 79413
GCTCATTGTAAACAGT 20 N/A N/A 2824 951744 79462 79477
TGCATTTGGTCTTGCT 118 N/A N/A 2825 951745 79799 79814
GACTATCAGTATGCAC 118 N/A N/A 2826 951746 79845 79860
CATCATATTGGTGGGA 11 N/A N/A 2827 951747 80265 80280
GCTATATTCACAAGGC 70 N/A N/A 2828 951748 80266 80281
GGCTATATTCACAAGG 39 N/A N/A 2829 951749 80520 80535
AACGATTAGGGACTCA 4 N/A N/A 2830 951750 80663 80678 CCCTATTTGATCAGGA
117 N/A N/A 2831 951751 80845 80860 GCAACTACCTTTGTTA 17 N/A N/A
2832 951752 80986 81001 AGCAATTTCATTGGCC 105 N/A N/A 2833 951753
81192 81207 AGCAATACCTTACTGG 46 N/A N/A 2834 951754 81436 81451
TGGTATCAGGGTCCCA 130 N/A N/A 2835 951755 81663 81678
CATGATGTCGCTGGCA 41 N/A N/A 2836 951756 81741 81756
TCCAAAAATGGGCTGC 28 N/A N/A 2837 951757 82016 82031
TCTAATCGAAGAAGCT 99 N/A N/A 2838 951758 82262 82277
TCTGATTAGTCCATGC 40 N/A N/A 2839 951759 82535 82550
ACAAATGCGGAGATGA 41 N/A N/A 2840 951761 82653 82668
GCCAATGCAAGGTGGC 119 N/A N/A 2841 951762 82803 82818
TGTTTTGGTGCTGGCT 99 N/A N/A 2842 951763 82880 82895
TGGAATGGTTACTCTC 3 N/A N/A 2843 951764 82920 82935 ATCTTCTGCAGTGTGG
2 N/A N/A 2844 951765 83070 83085 GGTATCTGGGCCATCA 101 N/A N/A 2845
951766 83419 83434 AGCAACATGAACCACA 26 N/A N/A 2846
951767 84425 84440 GTAATCAAGGCAGCAA 7 N/A N/A 2847 951768 85210
85225 AGCTCTGGTTTCAACA 82 N/A N/A 2848 951769 85217 85232
TTAATTAAGCTCTGGT 12 N/A N/A 2849 951770 85218 85233
CTTAATTAAGCTCTGG 22 N/A N/A 2850 951771 85220 85235
GGCTTAATTAAGCTCT 67 N/A N/A 2851 951772 85238 85253
AGTGACATAGCAAGCA 7 N/A N/A 2852 951773 85417 85432 AAGAATCAGACTCTTC
110 N/A N/A 2853 951774 85726 85741 CATTTATAACAGGCCA 82 N/A N/A
2854 951775 85727 85742 CCATTTATAACAGGCC 94 N/A N/A 2855 951776
85844 85859 GGCTTATGAGTCCACT 91 N/A N/A 2856 951777 85973 85988
TGCATTAAAACTGCGA 87 N/A N/A 2857 951778 86550 86565
AACAATCATAGCCTCA 114 N/A N/A 2858 951779 86582 86597
AACTTACTGTCTCCCA 37 N/A N/A 2859 951780 86937 86952
GTTTAATAATGTGCAG 40 N/A N/A 2860 951781 86938 86953
GGTTTAATAATGTGCA 11 N/A N/A 2861 951782 86939 86954
GGGTTTAATAATGTGC 27 N/A N/A 2862 951783 87671 87686
TCGCTAAAGGCTCTGA 10 N/A N/A 2863 951784 87858 87873
TGAAATCAGGGCTCCC 31 N/A N/A 2864 951785 88030 88045
CTCTATCACAGGGCCC 92 N/A N/A 2865 951786 88032 88047
TGCTCTATCACAGGGC 30 N/A N/A 2866 951787 88258 88273
TGTATCTGGTGACTCC 5 N/A N/A 2867 951788 88270 88285 ACCGATAAATGTTGTA
65 N/A N/A 2868 951789 88634 88649 TATAGTAACAGCTGGG 73 N/A N/A 2869
951790 88637 88652 CAGTATAGTAACAGCT 94 N/A N/A 2870 951791 88638
88653 TCAGTATAGTAACAGC 41 N/A N/A 2871 951792 88880 88895
TGTTTAAGGACTCCAC 28 N/A N/A 2872 951793 88887 88902
GACAATTTGTTTAAGG 5 N/A N/A 2873 951794 89152 89167 GATCTAATCAGAAGCA
29 N/A N/A 2874 951795 89558 89573 TGAGATTACGCACCAC 5 N/A N/A 2875
951796 89718 89733 ATTATAGGGCTTCTTA 30 N/A N/A 2876 951797 89720
89735 TTATTATAGGGCTTCT 8 N/A N/A 2877 951798 89721 89736
TTTATTATAGGGCTTC 1 N/A N/A 2878 951799 89722 89737 GTTTATTATAGGGCTT
1 N/A N/A 2879 951800 89746 89761 AGTGATATTCCCAACA 19 N/A N/A 2880
951801 89977 89992 CATATATCTCCTGTTA 20 N/A N/A 2881 951802 89999
90014 TCATATCACCACTTGC 29 N/A N/A 2882 951803 90003 90018
ACAATCATATCACCAC 6 N/A N/A 2883 951804 90004 90019 GACAATCATATCACCA
3 N/A N/A 2884 951805 90058 90073 TTATATGTGGACACCT 34 N/A N/A 2885
951806 90059 90074 TTTATATGTGGACACC 10 N/A N/A 2886 951807 90139
90154 CACAATCCCAGATCTC 7 N/A N/A 2887 951808 90161 90176
TCTATAAGGTTCCTTA 14 N/A N/A 2888 951809 90165 90180
TGTTTCTATAAGGTTC 3 N/A N/A 2889 951810 90199 90214 CCAAATTTAGAGGACA
46 N/A N/A 2890 951811 90222 90237 ACATATCTTGCATGAC 4 N/A N/A 2891
951812 90264 90279 TTAGACATCAGACTGT 76 N/A N/A 2892 951813 90267
90282 GTCTTAGACATCAGAC 115 N/A N/A 2893 951814 90706 90721
TCAATTGAGGCTTCTA 7 N/A N/A 2894 951815 90716 90731 TGTATCTGGTTCAATT
11 N/A N/A 2895 951816 90721 90736 GTAAATGTATCTGGTT 2 N/A N/A 2896
951817 91071 91086 GGTACTGAGGCTGTGG 28 N/A N/A 2897 951818 91117
91132 CAGAATTATCAATTCC 145 N/A N/A 2898 951819 91174 91189
GGTGGGTAAAATGTGC 63 N/A N/A 2899 951820 91191 91206
GCACATAGGGCCTTCT 79 N/A N/A 2900 951821 91909 91924
GACAATGTAGTTTCCA 2 N/A N/A 2901 951822 91939 91954 AACTATCCCAAGCTCC
10 N/A N/A 2902 951823 91945 91960 GGCTTCAACTATCCCA 39 N/A N/A 2903
951824 92037 92052 ATTGATACAGCCGTTC 8 N/A N/A 2904 951825 92827
92842 ATGATAAAGGCTGGCA 21 N/A N/A 2905 951826 92828 92843
AATGATAAAGGCTGGC 127 N/A N/A 2906 951827 93169 93184
AAGATTATGGTTTCCT 4 N/A N/A 2907 951828 93170 93185 GAAGATTATGGTTTCC
6 N/A N/A 2908 951829 93241 93256 GTACATGGTGGAGTCC 83 N/A N/A 2909
951830 93321 93336 TGTATTACCTACGGCA 6 N/A N/A 2910 951831 93392
93407 GCTATTAATCATATTC 18 N/A N/A 2911 951832 93572 93587
TACTTACCAGGATCTC 24 N/A N/A 2912 951833 93746 93761
ACTTATACCCAGGGCA 7 N/A N/A 2913 951834 93747 93762 GACTTATACCCAGGGC
81 N/A N/A 2914 951835 93923 93938 ATGAATTCTGGTCTGG 2 N/A N/A 2915
951836 94043 94058 TCAACTAGCCATGTCT 25 N/A N/A 2916 951837 94169
94184 CACTTAGCCACATCTG 5 N/A N/A 2917 951838 94174 94189
TTAATCACTTAGCCAC 8 N/A N/A 2918 951839 94177 94192 ACCTTAATCACTTAGC
5 N/A N/A 2919 951840 94182 94197 ACAATACCTTAATCAC 7 N/A N/A 2920
951841 94284 94299 CAATTTATCTGGAGGA 8 N/A N/A 2921 951842 94350
94365 TCAATTAGTGTTGCCT 119 N/A N/A 2922 951843 94351 94366
ATCAATTAGTGTTGCC 5 N/A N/A 2923 951844 94423 94438 GTCAATCGACTGGTAC
41 N/A N/A 2924 951845 94446 94461 ATATGATTCATCTCGG 2 N/A N/A 2925
951846 94447 94462 AATATGATTCATCTCG 2 N/A N/A 2926 951847 94583
94598 AGCTATGAGTAGCAGG 18 N/A N/A 2927 951848 94885 94900
GCCAACTAATTCCTCC 31 N/A N/A 2928 951849 96000 96015
GCCATTCACGGGCTGC 104 N/A N/A 2929 951850 96084 96099
CAAGGGTACAGACTTA 152 N/A N/A 2930 951851 96224 96239
GGCTGGATGTGAGTGC 63 N/A N/A 2931 951852 96650 96665
ACAACTAACGGCAGGC 17 N/A N/A 2932 951853 96755 96770
ACACATCAGGGTTTCA 56 N/A N/A 2933 951854 97483 97498
TCCTAATGGTGACTCA 40 N/A N/A 2934 951855 97854 97869
TACAATGTAAGCCTTT 7 N/A N/A 2935 951856 98522 98537 GTATTTCAAAGTAGTC
4 N/A N/A 2936 951857 98652 98667 GGTTTTAATAGACACA 6 N/A N/A 2937
951858 98653 98668 GGGTTTTAATAGACAC 53 N/A N/A 2938 951859 99483
99498 GTTAACAACAATTGTC 60 N/A N/A 2939 951860 99712 99727
ACAGATCTTGCATGTT 84 N/A N/A 2940 951861 99888 99903
AGCTATCACACAGAAG 95 N/A N/A 2941 951862 100033 100048
GCAAATCCATTGCCCA 78 N/A N/A 2942 951863 100171 100186
GTGTTAAGGTGGCAAC 43 N/A N/A 2943 951864 100222 100237
CTACATGGTGATGGGT 20 N/A N/A 2944 951865 100285 100300
GTTAGCTGGACTCACA 89 N/A N/A 2945 951866 100375 100390
CAATATCCTGGTGACT 36 N/A N/A 2946 951867 100514 100529
ACACATGCAGTGAGCC 60 N/A N/A 2947 951868 101384 101399
TGTATGGTGGCTCAGC 26 N/A N/A 2948 951869 101385 101400
TTGTATGGTGGCTCAG 44 N/A N/A 2949 951870 101796 101811
TGCAATGCTGCCAGGC 72 N/A N/A 2950 951871 102161 102176
AGAGATATTGATGTCT 51 N/A N/A 2951 951872 102425 102440
GCACATTGGTTAGGCT 93 N/A N/A 2952 951873 102445 102460
CTCAATGTGTACAGTA 22 N/A N/A 2953 951874 102885 102900
TGGAACTGTTTACAGT 10 N/A N/A 2954 951875 102926 102941
CAAGTAACTGAGTCAC 7 N/A N/A 2955 951876 103421 103436
ATCTATCCAAGGAGGA 93 N/A N/A 2956 951877 103897 103912
TCAGTTCACGGATCCC 42 N/A N/A 2957 951878 104120 104135
TGCTTTCTAAGGTTGG 14 N/A N/A 2958 951879 104441 104456
TTTTATCTGGGCTCCA 39 N/A N/A 2959 951880 104447 104462
TGGAACTTTTATCTGG 17 N/A N/A 2960 951881 104452 104467
GTGAATGGAACTTTTA 5 N/A N/A 2961 951882 104843 104858
TGTATATGAGCCCATC 99 N/A N/A 2962 951883 105539 105554
TCATATCCATGCCCAC 31 N/A N/A 2963 951884 105559 105574
ACAATTGGTGCCTTTC 14 N/A N/A 2964 951885 105560 105575
CACAATTGGTGCCTTT 20 N/A N/A 2965 951886 105730 105745
GGACATCACACTCCTC 100 N/A N/A 2966 951887 105777 105792
CGCAATGGTGACTGCC 114 N/A N/A 2967 951888 105791 105806
TGAAATACCATCCACG 40 N/A N/A 2968 951889 105793 105808
CTTGAAATACCATCCA 19 N/A N/A 2969 951890 106015 106030
GCCTTTACTGACAGCT 71 N/A N/A 2970 951891 106173 106188
ACAAATGGGTCTCGAG 101 N/A N/A 2971
951892 106195 106210 GGTTTTCACGGCCAGC 44 N/A N/A 2972 951893 106203
106218 GCTATGAAGGTTTTCA 10 N/A N/A 2973 951894 106204 106219
AGCTATGAAGGTTTTC 20 N/A N/A 2974 951895 106233 106248
TGTCATATGGCCAGGG 17 N/A N/A 2975 951896 106295 106310
TAATATTGTCACCCTC 93 N/A N/A 2976 951897 106296 106311
ATAATATTGTCACCCT 29 N/A N/A 2977 951898 106351 106366
GTTTTTGCAGCTACTA 9 N/A N/A 2978 951899 106371 106386
ACTATCAACCATCTTA 20 N/A N/A 2979 951900 106391 106406
GGACTTAATTTACACA 12 N/A N/A 2980 951901 106392 106407
TGGACTTAATTTACAC 30 N/A N/A 2981 951902 106404 106419
GATACTAAAGTCTGGA 11 N/A N/A 2982 951903 107100 107115
GCAGATGGTGGTCTAC 69 N/A N/A 2983 951904 109198 109213
GCATTTTAATATTGGG 31 N/A N/A 2984 951905 109409 109424
GGTTTAAGCGATCTCC 46 N/A N/A 2985 951906 109955 109970
CCAATAACTGACCTCA 72 N/A N/A 2986 951907 109956 109971
ACCAATAACTGACCTC 54 N/A N/A 2987 951908 111211 111226
AGTTATTCTGATGCCA 3 N/A N/A 2988 951909 111349 111364
GGGTATGGTTGCAACC 92 N/A N/A 2989 951910 111384 111399
TCATTAGGACACAGCG 20 N/A N/A 2990 951911 111385 111400
ATCATTAGGACACAGC 6 N/A N/A 2991 951912 111494 111509
TACTATCAGTACAGCT 83 N/A N/A 2992 951913 111496 111511
GATACTATCAGTACAG 42 N/A N/A 2993 951914 111499 111514
GGAGATACTATCAGTA 115 N/A N/A 2994 951915 111500 111515
TGGAGATACTATCAGT 27 N/A N/A 2995 951916 112149 112164
GTGAACACTGATCACT 86 N/A N/A 2996 951917 112185 112200
GGTATATGAGGAAACA 18 N/A N/A 2997 951918 112208 112223
CCGTATATGTCTCCGA 8 N/A N/A 2998 951919 112209 112224
ACCGTATATGTCTCCG 7 N/A N/A 2999 951920 112293 112308
GGCAATTGTCTCTCTT 47 N/A N/A 3000 951921 112316 112331
TGTATAAGCTCACTTT 40 N/A N/A 3001 951922 112318 112333
CATGTATAAGCTCACT 105 N/A N/A 3002 951923 112320 112335
AGCATGTATAAGCTCA 36 N/A N/A 3003 951924 112369 112384
ATAATTATGTCCCATC 24 N/A N/A 3004 951925 112370 112385
GATAATTATGTCCCAT 5 N/A N/A 3005 951926 112371 112386
GGATAATTATGTCCCA 61 N/A N/A 3006 951927 112372 112387
TGGATAATTATGTCCC 102 N/A N/A 3007 951928 112373 112388
ATGGATAATTATGTCC 105 N/A N/A 3008 951929 112950 112965
ACTACTAGTTTCTGTT 91 N/A N/A 3009 951930 112951 112966
CACTACTAGTTTCTGT 37 N/A N/A 3010 951931 113712 113727
GGTTATGAGATTCTTA 4 N/A N/A 3011 951932 113713 113728
TGGTTATGAGATTCTT 5 N/A N/A 3012 951933 114474 114489
TTTATTCACAGGGTCC 29 N/A N/A 3013 951934 114476 114491
TATTTATTCACAGGGT 28 N/A N/A 3014 951935 114477 114492
GTATTTATTCACAGGG 18 N/A N/A 3015 951936 114510 114525
GCCAATGGAAGGCACC 129 N/A N/A 3016 951937 114524 114539
TCCATTTGGGCTGTGC 86 N/A N/A 3017 951938 114750 114765
TGCGATATCCTCCCCT 15 N/A N/A 3018 951939 115717 115732
GAGAATAAAGCCTGGC 80 N/A N/A 3019 908415 83669 83684
GATTGAGGTAAGGGTT 20 N/A N/A 3020 83757 83772 N/A N/A 83845 83860
N/A N/A 908426 83689 83704 ACGGAACCGCTCTGTA 88 N/A N/A 509 83777
83792 N/A N/A 83865 83880 N/A N/A 908428 83691 83706
TGACGGAACCGCTCTG 73 N/A N/A 511 83779 83794 N/A N/A 83867 83882 N/A
N/A 908507 103213 103228 AGCAGAGCATAGGAGA 20 N/A N/A 590 103251
103266 N/A N/A 949039 7946 7961 AAGTGCTATTATAACT 100 N/A N/A 3021
8587 8602 N/A N/A 949040 7947 7962 GAAGTGCTATTATAAC 8 N/A N/A 3022
8588 8603 N/A N/A 949041 7948 7963 AGAAGTGCTATTATAA 6 N/A N/A 3023
8589 8604 N/A N/A 949042 7949 7964 AAGAAGTGCTATTATA 15 N/A N/A 3024
8590 8605 N/A N/A 949043 7950 7965 AAAGAAGTGCTATTAT 37 N/A N/A 3025
8591 8606 N/A N/A 949044 7951 7966 GAAAGAAGTGCTATTA 19 N/A N/A 3026
8592 8607 N/A N/A 949045 7952 7967 GGAAAGAAGTGCTATT 20 N/A N/A 3027
8593 8608 N/A N/A 949046 7953 7968 GGGAAAGAAGTGCTAT 36 N/A N/A 3028
8594 8609 N/A N/A 949047 7954 7969 AGGGAAAGAAGTGCTA 64 N/A N/A 3029
8595 8610 N/A N/A 949048 7955 7970 AAGGGAAAGAAGTGCT 22 N/A N/A 3030
8596 8611 N/A N/A 949049 7956 7971 AAAGGGAAAGAAGTGC 21 N/A N/A 3031
8597 8612 N/A N/A 949060 9158 9173 TAAAATGTACCCCCTC 42 N/A N/A 3032
9478 9493 N/A N/A 949133 16330 16345 GAAAAGAACAACCTGG 21 N/A N/A
3033 16655 16670 N/A N/A 949913 83642 83657 TGCAGCTGTCAGCATG 61 N/A
N/A 3034 83730 83745 N/A N/A 83818 83833 N/A N/A 949914 83643 83658
ATGCAGCTGTCAGCAT 113 N/A N/A 3035 83731 83746 N/A N/A 83819 83834
N/A N/A 949915 83644 83659 TATGCAGCTGTCAGCA 59 N/A N/A 3036 83732
83747 N/A N/A 83820 83835 N/A N/A 949916 83645 83660
ATATGCAGCTGTCAGC 16 N/A N/A 3037 83733 83748 N/A N/A 83821 83836
N/A N/A 949917 83648 83663 GCCATATGCAGCTGTC 13 N/A N/A 3038 83736
83751 N/A N/A 83824 83839 N/A N/A 949918 83652 83667
CTTTGCCATATGCAGC 8 N/A N/A 3039 83740 83755 N/A N/A 83828 83843 N/A
N/A 949919 83653 83668 ACTTTGCCATATGCAG 15 N/A N/A 3040 83741 83756
N/A N/A 83829 83844 N/A N/A 949920 83654 83669 TACTTTGCCATATGCA 4
N/A N/A 3041 83742 83757 N/A N/A 83830 83845 N/A N/A 949921 83655
83670 TTACTTTGCCATATGC 1 N/A N/A 3042 83743 83758 N/A N/A 83831
83846 N/A N/A 949922 83656 83671 GTTACTTTGCCATATG 4 N/A N/A 3043
83744 83759 N/A N/A 83832 83847 N/A N/A 949923 83657 83672
GGTTACTTTGCCATAT 8 N/A N/A 3044 83745 83760 N/A N/A 83833 83848 N/A
N/A 949924 83668 83683 ATTGAGGTAAGGGTTA 4 N/A N/A 3045 83756 83771
N/A N/A 83844 83859 N/A N/A 949925 83675 83690 TATCTTGATTGAGGTA 6
N/A N/A 3046 83763 83778 N/A N/A 83851 83866 N/A N/A 949926 83676
83691 GTATCTTGATTGAGGT 2 N/A N/A 3047 83764 83779 N/A N/A 83852
83867 N/A N/A 949927 83677 83692 TGTATCTTGATTGAGG 1 N/A N/A 3048
83765 83780 N/A N/A 83853 83868 N/A N/A 949928 83678 83693
CTGTATCTTGATTGAG 4 N/A N/A 3049 83766 83781 N/A N/A 83854 83869 N/A
N/A 949929 83682 83697 CGCTCTGTATCTTGAT 2 N/A N/A 3050 83770 83785
N/A N/A 83858 83873 N/A N/A 949930 83683 83698 CCGCTCTGTATCTTGA 9
N/A N/A 3051 83771 83786 N/A N/A 83859 83874 N/A N/A 949931 83700
83715 TTTAGGAGGTGACGGA 6 N/A N/A 3052 83788 83803 N/A N/A 83876
83891 N/A N/A 949932 83701 83716 TTTTAGGAGGTGACGG 7 N/A N/A 3053
83789 83804 N/A N/A 83877 83892 N/A N/A 949933 83702 83717
ATTTTAGGAGGTGACG 17 N/A N/A 3054 83878 83893 N/A N/A 949934 83703
83718 GATTTTAGGAGGTGAC 15 N/A N/A 3055 83879 83894 N/A N/A 949935
83704 83719 GGATTTTAGGAGGTGA 6 N/A N/A 3056 83880 83895 N/A N/A
949936 83705 83720 GGGATTTTAGGAGGTG 15 N/A N/A 3057 83881 83896 N/A
N/A 949937 83706 83721 AGGGATTTTAGGAGGT 8 N/A N/A 3058 83882 83897
N/A N/A 949938 83707 83722 CAGGGATTTTAGGAGG 12 N/A N/A 3059 83883
83898 N/A N/A 949939 83708 83723 ACAGGGATTTTAGGAG 18 N/A N/A 3060
83884 83899 N/A N/A
949940 83728 83743 CAGCTGTCAGCATGAT 63 N/A N/A 3061 83816 83831 N/A
N/A 949941 83729 83744 GCAGCTGTCAGCATGA 67 N/A N/A 3062 83817 83832
N/A N/A 950194 103191 103206 CGGTGGCCATGGAGGG 67 N/A N/A 3063
103229 103244 N/A N/A 103267 103282 N/A N/A 950195 103192 103207
CCGGTGGCCATGGAGG 98 N/A N/A 3064 103230 103245 N/A N/A 103268
103283 N/A N/A 950196 103193 103208 CCCGGTGGCCATGGAG 91 N/A N/A
3065 103231 103246 N/A N/A 103269 103284 N/A N/A 950197 103194
103209 GCCCGGTGGCCATGGA 122 N/A N/A 3066 103232 103247 N/A N/A
103270 103285 N/A N/A 950198 103195 103210 GGCCCGGTGGCCATGG 106 N/A
N/A 3067 103233 103248 N/A N/A 103271 103286 N/A N/A 950199 103196
103211 GGGCCCGGTGGCCATG 125 N/A N/A 3068 103234 103249 N/A N/A
103272 103287 N/A N/A 950200 103210 103225 AGAGCATAGGAGAGGG 20 N/A
N/A 3069 103248 103263 N/A N/A 950201 103212 103227
GCAGAGCATAGGAGAG 21 N/A N/A 3070 103250 103265 N/A N/A 950202
103214 103229 GAGCAGAGCATAGGAG 23 N/A N/A 3071 103252 103267 N/A
N/A 950203 103215 103230 GGAGCAGAGCATAGGA 22 N/A N/A 3072 103253
103268 N/A N/A 950204 103217 103232 AGGGAGCAGAGCATAG 53 N/A N/A
3073 103255 103270 N/A N/A 950205 103219 103234 GGAGGGAGCAGAGCAT 50
N/A N/A 3074 103257 103272 N/A N/A 950206 103221 103236
ATGGAGGGAGCAGAGC 53 N/A N/A 3075 103259 103274 N/A N/A 950297
113289 113304 ATCCTGTTATATCTTT 3 N/A N/A 3076 113606 113621 N/A N/A
950298 113290 113305 AATCCTGTTATATCTT 2 N/A N/A 3077 113607 113622
N/A N/A
[0450] Each modified oligonucleotide listed in the table below is
100% complementary to human DNM2 nucleic acid sequence GENBANK
Number NM_001005361.2. (SEQ ID No: 3). As shown below, modified
oligonucleotides complementary to human DNM2 inhibited human DNM2
mRNA expression.
TABLE-US-00005 TABLE 4 DNM2 mRNA Expression SEQ SEQ ID: 3 ID: 3
Sequence Dynamin2 SEQ Compound Start Stop (% ID Number Site Site
Control) NO 948482 1735 1750 CACCAGGATCTCCCCC 30 3078 948483 1738
1753 GATCACCAGGATCTCC 101 3079 948509 1511 1526 GCTTCTCGGCACACTT 27
3080 948510 1512 1527 AGCTTCTCGGCACACT 48 3081 948511 1514 1529
TGAGCTTCTCGGCACA 111 3082 948512 1520 1535 AGGAACTGAGCTTCTC 39 3083
948513 1521 1536 TAGGAACTGAGCTTCT 37 3084
Example 3: Effect of Modified Oligonucleotides Complementary to
Dynamin 2 In Vitro
[0451] Modified oligonucleotides complementary to dynamin 2 (DNM2)
nucleic acid were designed and tested for their effect on dynamin 2
mRNA in vitro. The modified oligonucleotides were tested in a
series of experiments that had similar culture conditions.
[0452] A431 cells cultured at a density of 10,000 cells per well
were treated with only 500 nM of modified oligonucleotide via free
uptake or no modified oligonucleotide for untreated controls. After
approximately 24 hours, RNA was isolated from the cells and DNM2
mRNA levels were measured by quantitative real-time PCR as
described in Example 1.
[0453] The modified oligonucleotides described in the tables below
each have a 3-10-3 cEt gapmer motif, wherein the central gap
segment contains ten 2'-deoxynucleosides and is flanked by wing
segments on the 3' and 5' ends, each containing three cEt
nucleosides. Each modified oligonucleotide listed in the tables
below is 100% complementary to human DNM2 nucleic acid sequence
GENBANK Number NC_000019.10, truncated from 10715001 to 1083500
(SEQ ID NO:1) and/or GENBANK Number NM_004945.3 (SEQ ID NO: 2). As
shown below, modified oligonucleotides complementary to human DNM2
inhibited human DNM2 mRNA expression.
TABLE-US-00006 TABLE 5 DNM2 mRNA Expression SEQ SEQ SEQ ID: SEQ ID:
ID: 2 ID 2: SEQ Compound 1 Start 1 Stop DNM2 Start Stop ID Number
Site Site Sequence (% Control) Site Site NO 694824 57496 57511
TTTTGGACTTGCAGTG 25 443 458 3085 695171 82451 82466
ACACACTTCAAACTCG 30 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG
26 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG 28 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 31 N/A N/A 13 695171 82451
82466 ACACACTTCAAACTCG 27 N/A N/A 13 695171 82451 82466
ACACACTTCAAACTCG 42 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG
37 N/A N/A 13 695171 82451 82466 ACACACTTCAAACTCG 29 N/A N/A 13
951371 11922 11937 GTTGATAGTCGGTTGT 9 N/A N/A 2452 951371 11922
11937 GTTGATAGTCGGTTGT 8 N/A N/A 2452 951371 11922 11937
GTTGATAGTCGGTTGT 7 N/A N/A 2452 951371 11922 11937 GTTGATAGTCGGTTGT
7 N/A N/A 2452 951371 11922 11937 GTTGATAGTCGGTTGT 7 N/A N/A 2452
951371 11922 11937 GTTGATAGTCGGTTGT 10 N/A N/A 2452 951371 11922
11937 GTTGATAGTCGGTTGT 19 N/A N/A 2452 951371 11922 11937
GTTGATAGTCGGTTGT 9 N/A N/A 2452 988378 82447 82462 ACTTCAAACTCGGCTC
24 N/A N/A 3086 988379 81166 81181 AACTGTATTGATTAGC 20 1492 1507
3087 988380 116569 116584 GTGTGGTTAATATGGC 2 3313 3328 3088 988381
116853 116868 ATAGAATACAGAGTGC 19 3597 3612 3089 988382 11917 11932
TAGTCGGTTGTCTGGA 21 N/A N/A 3090 988383 11919 11934
GATAGTCGGTTGTCTG 37 N/A N/A 3091 988384 11920 11935
TGATAGTCGGTTGTCT 67 N/A N/A 3092 988385 11921 11936
TTGATAGTCGGTTGTC 26 N/A N/A 3093 988386 11923 11938
AGTTGATAGTCGGTTG 3 N/A N/A 3094 988387 11924 11939 GAGTTGATAGTCGGTT
5 N/A N/A 3095 988388 11925 11940 CGAGTTGATAGTCGGT 9 N/A N/A 3096
988389 11927 11942 AGCGAGTTGATAGTCG 42 N/A N/A 3097 988390 24283
24298 GTATTATGGTATGTGA 14 N/A N/A 3098 988391 24286 24301
TAGGTATTATGGTATG 20 N/A N/A 3099 988392 24287 24302
TTAGGTATTATGGTAT 31 N/A N/A 3100 988393 24288 24303
ATTAGGTATTATGGTA 29 N/A N/A 3101 988394 24290 24305
GGATTAGGTATTATGG 6 N/A N/A 3102 988395 82040 82055 TTGGACTGTTTTCCCC
39 N/A N/A 3103 988396 82042 82057 GTTTGGACTGTTTTCC 7 N/A N/A 3104
988397 82824 82839 GATGTGTTTCCTGTGT 2 N/A N/A 3105 988398 82825
82840 TGATGTGTTTCCTGTG 3 N/A N/A 3106 988399 82826 82841
ATGATGTGTTTCCTGT 5 N/A N/A 3107 988400 82828 82843 AGATGATGTGTTTCCT
4 N/A N/A 3108 988401 82829 82844 CAGATGATGTGTTTCC 4 N/A N/A 3109
988402 82830 82845 ACAGATGATGTGTTTC 7 N/A N/A 3110 988403 82832
82847 ATACAGATGATGTGTT 99 N/A N/A 3111 988404 83917 83932
TTTTTGAGAGGTTGAC 19 N/A N/A 3112 988405 89716 89731
TATAGGGCTTCTTATC 61 N/A N/A 3113 988406 89717 89732
TTATAGGGCTTCTTAT 64 N/A N/A 3114 988407 89723 89738
AGTTTATTATAGGGCT 8 N/A N/A 3115 988408 89724 89739 AAGTTTATTATAGGGC
13 N/A N/A 3116 988409 89725 89740 TAAGTTTATTATAGGG 25 N/A N/A 3117
988410 89726 89741 GTAAGTTTATTATAGG 24 N/A N/A 3118 988411 89727
89742 AGTAAGTTTATTATAG 96 N/A N/A 3119 988412 90717 90732
ATGTATCTGGTTCAAT 34 N/A N/A 3120 988413 90718 90733
AATGTATCTGGTTCAA 11 N/A N/A 3121 988414 90719 90734
AAATGTATCTGGTTCA 8 N/A N/A 3122 988415 90720 90735 TAAATGTATCTGGTTC
11 N/A N/A 3123 988416 90723 90738 AAGTAAATGTATCTGG 15 N/A N/A 3124
988417 90724 90739 CAAGTAAATGTATCTG 51 N/A N/A 3125 988418 90725
90740 ACAAGTAAATGTATCT 45 N/A N/A 3126 988419 90726 90741
AACAAGTAAATGTATC 109 N/A N/A 3127 988420 93918 93933
TTCTGGTCTGGCTTAA 16 N/A N/A 3128 988421 93920 93935
AATTCTGGTCTGGCTT 45 N/A N/A 3129 988422 93922 93937
TGAATTCTGGTCTGGC 7 N/A N/A 3130 988423 93924 93939 AATGAATTCTGGTCTG
30 N/A N/A 3131 988424 93925 93940 GAATGAATTCTGGTCT 80 N/A N/A 3132
988425 93926 93941 AGAATGAATTCTGGTC 20 N/A N/A 3133 988426 93928
93943 CAAGAATGAATTCTGG 74 N/A N/A 3134
Example 4: Dose Response of Modified Oligonucleotides Complementary
to Dynamin 2 In Vitro
[0454] Selected oligonucleotides listed in the Examples above were
tested at various doses via free uptake in A431 cells. Cells were
cultured at a density of 10,000 cells per well and treated with
62.5, 250, 1,000, or 4,000 nM of modified oligonucleotide, as
specified in the table below. After a treatment period of
approximately 48 hours, total RNA was isolated and analyzed by
RT-PCR with primer probe set RTS36027 (described in Example 1),
normalized with ribogreen. As illustrated in the tables below, DNM2
mRNA expression was inhibited in a dose-dependent manner by
modified oligonucleotides complementary to DNM2.
TABLE-US-00007 TABLE 6 DNM2 mRNA Expression Compound DNM2
expression (% control) Number 62.5 nM 250 nM 1,000 nM 4,000 nM
IC.sub.50 (.mu.M) 694838 31 12 5 3 <0.1 695171 74 28 11 4 0.1
695171 83 33 11 5 0.2 695171 57 25 7 3 0.1 695171 59 24 9 4 0.1
695171 51 17 9 4 <0.1 695171 57 28 10 4 0.1 907945 38 10 5 3
<0.1 907946 70 36 17 11 0.2 907947 48 28 9 6 <0.1 907948 51
22 9 5 <0.1 907949 77 43 16 6 0.2 907966 53 30 15 8 <0.1
907967 32 10 6 4 <0.1 907968 65 30 14 8 0.1 907969 19 6 3 2
<0.1 907970 20 5 3 2 <0.1 907971 59 30 17 12 0.1 907972 72 36
18 17 0.2 907975 35 15 7 4 <0.1 907979 55 26 14 10 <0.1
907983 39 16 9 8 <0.1 907998 40 13 6 4 <0.1 908000 71 42 19
11 0.2 908011 53 24 13 9 <0.1 908013 52 25 13 7 <0.1 908025
69 31 13 6 0.1 908027 38 13 5 2 <0.1 908028 80 51 22 9 0.3
908029 83 43 19 9 0.3 908031 44 13 4 2 <0.1 908033 52 18 8 5
<0.1 908034 63 29 13 8 0.1 908035 26 6 2 1 <0.1 908036 71 39
20 11 0.2 908037 26 9 3 1 <0.1 908041 49 19 6 3 <0.1 908043
28 15 10 8 <0.1 908044 43 17 7 3 <0.1 908047 54 28 15 9
<0.1 908049 49 15 6 3 <0.1 908052 53 21 7 4 <0.1 908055 69
36 19 12 0.2 908056 54 23 9 6 <0.1 908059 35 11 3 2 <0.1
908061 27 7 2 1 <0.1 908068 72 41 21 10 0.2 908070 64 35 15 9
0.1 908085 68 33 18 11 0.1 908098 61 28 12 10 0.1 908102 42 28 17
11 <0.1 908104 44 23 12 8 <0.1 908107 51 25 11 7 <0.1
908135 46 23 14 14 <0.1 908138 50 24 11 6 <0.1 908146 58 33
19 15 0.1 908147 37 18 10 6 <0.1 908148 42 15 7 5 <0.1 908154
28 9 3 2 <0.1 908164 65 31 16 10 0.1 908166 44 18 9 5 <0.1
908167 62 28 16 12 0.1 908177 69 37 15 7 0.2 908178 52 22 6 4
<0.1 908179 47 18 7 4 <0.1 908183 58 34 15 11 0.1 908184 56
24 11 8 <0.1 908201 26 13 5 4 <0.1 908213 37 13 5 3 <0.1
908214 57 37 17 12 0.1 908215 63 30 12 6 0.1 908217 32 10 3 2
<0.1 908232 58 26 6 3 0.1 908255 64 28 13 9 0.1 908267 48 28 12
8 <0.1 908355 83 62 42 26 0.6 908389 43 16 5 3 <0.1 908392 12
3 1 1 <0.1 908396 57 19 6 3 <0.1 908401 26 6 2 1 <0.1
908404 58 29 15 8 0.1 908405 49 26 9 4 <0.1 908407 70 30 12 5
0.1 908408 18 2 1 1 <0.1 908409 67 33 13 5 0.1 908410 71 36 15 7
0.2 908412 58 24 10 6 0.1 908413 33 8 2 1 <0.1 908414 25 6 3 2
<0.1 908415 40 11 4 3 <0.1 908416 42 13 4 1 <0.1 908417 26
5 2 1 <0.1 908418 63 33 11 4 0.1 908419 50 11 4 2 <0.1 908420
17 3 1 1 <0.1 908421 23 4 1 1 <0.1 908422 51 16 5 3 <0.1
908424 57 22 9 7 <0.1 908425 57 38 20 12 0.1 908434 54 20 8 3
<0.1 908436 71 40 17 8 0.2 908439 38 9 2 2 <0.1 908440 25 6 3
3 <0.1 908441 33 6 2 1 <0.1 908442 32 9 3 1 <0.1 908443 56
17 5 2 <0.1 908444 31 7 2 1 <0.1 908448 78 44 13 8 0.2 908449
47 20 7 4 <0.1 908451 45 14 6 5 <0.1 908475 66 29 12 5 0.1
908506 34 9 4 3 <0.1 908507 67 39 16 10 0.1 908508 52 30 14 10
<0.1
Example 5: Dose Response of Modified Oligonucleotides Complementary
to Dynamin 2 In Vitro
[0455] Selected oligonucleotides listed in the Examples above were
tested via free uptake at various doses in A431 cells. Cells were
cultured at a density of 10,000 cells per well and treated with
31.25, 125, 500, or 2,000 nM of modified oligonucleotide, as
specified in the tables below. After approximately 48 hours, total
RNA was isolated and analyzed by RT-PCR with primer probe set
RTS36027 (described in Example 1), normalized with ribogreen. As
illustrated in the tables below, DNM2 mRNA expression was inhibited
in a dose-dependent manner by modified oligonucleotides
complementary to DNM2.
TABLE-US-00008 TABLE 7 DNM2 mRNA Expression Compound DNM2
expression (% control) Number 31.25 nM 125 nM 500 nM 2,000 nM IC50
(.mu.M) 695015 105 94 89 94 >2.0 695170 62 30 13 5 0.05 695171
72 33 11 4 0.07 695171 70 33 10 3 0.1 695171 70 35 14 6 0.1 695171
58 22 9 2 <0.03 695171 71 36 12 4 0.08 695171 70 32 11 4 0.07
695171 74 36 12 4 0.08 695171 71 31 10 3 0.07 695171 73 36 14 4
0.08 695171 73 36 17 7 0.09 695171 54 27 10 3 <0.03 695171 69 33
10 5 0.06 695171 74 35 12 4 0.08 695171 81 40 14 4 0.11 695171 79
40 14 5 0.11 695171 77 38 14 5 0.10 695171 72 37 13 5 0.08 695171
71 34 11 4 0.07 695171 66 43 11 5 0.08 695171 68 33 11 4 0.06
695171 63 29 12 5 0.05 948488 79 33 12 4 0.09 948489 53 17 5 1
<0.03 948490 25 5 1 0 <0.03 948492 67 32 9 4 0.06 948496 72
43 15 6 0.09 948505 67 36 12 5 0.07 948506 58 16 5 2 <0.03
948507 80 30 9 3 0.1 948508 63 26 7 3 0.0 948521 79 35 19 13 0.11
948524 70 43 19 9 0.09 948525 75 47 19 7 0.12 948526 73 35 12 7
0.08 948527 62 31 14 9 0.05 948528 64 29 11 20 0.04 948538 104 95
96 91 >2.0 948549 71 38 16 11 0.08 948556 36 11 4 3 <0.03
948557 23 8 4 3 <0.03 948558 68 29 14 10 0.06 948559 48 16 7 5
<0.03 948560 24 7 3 2 <0.03 948562 69 26 10 5 0.06 948568 57
26 11 7 <0.03 948575 73 39 20 10 0.1 948587 43 14 7 4 <0.03
948589 66 21 11 9 0.04 948590 53 35 16 10 0.03 948602 39 15 7 5
<0.03 948604 42 17 7 4 <0.03 948608 54 18 6 4 <0.03 948622
79 47 22 10 0.13 948629 51 13 6 2 <0.03 948630 67 33 13 5 0.06
948631 46 14 5 3 <0.03 948632 42 12 5 2 <0.03 948633 57 21 8
6 <0.03 948646 63 58 23 10 0.11 948654 68 40 13 4 0.08 948656 69
40 22 13 0.09 948660 47 11 2 1 <0.03 948661 80 41 14 4 0.11
948662 63 38 16 8 0.06 948664 45 12 2 1 <0.03 948665 64 25 7 3
0.04 948666 82 37 12 4 0.11 948673 33 9 3 2 <0.03 948674 75 39
12 5 0.1 948675 43 8 2 0 <0.03 948676 40 10 2 0 <0.03 948677
53 11 2 1 <0.03 948678 69 27 9 4 0.06 948684 61 29 11 4 0.04
948685 52 15 5 2 <0.03 948686 24 8 2 1 <0.03 948687 58 19 5 2
<0.03 948689 73 26 17 8 0.07 948692 49 20 8 6 <0.03 948693 71
40 18 10 0.09 948695 75 38 20 7 0.1 948700 63 25 7 3 0.04 948701 64
24 9 4 0.04 948702 60 25 6 1 0.04 948703 66 29 7 2 0.05 948707 69
24 7 3 0.05 948729 47 12 2 1 <0.03 948731 67 33 11 4 0.06 948732
68 40 14 7 0.08 948735 22 9 2 2 <0.03 948741 49 55 24 15 0.06
948752 64 31 12 5 0.05 948765 61 20 7 3 0.03 948766 78 43 18 7 0.11
948767 76 40 19 12 0.1 948768 67 35 17 12 0.1 948769 60 24 10 5 0.0
948788 57 27 13 10 0.03 948794 51 26 5 2 <0.03 948804 42 18 8 5
<0.03 948805 34 13 5 3 <0.03 948806 16 18 7 5 <0.03 948807
56 35 18 11 0.04 948812 77 40 20 11 0.11 948835 66 28 7 3 0.05
948836 52 27 11 6 <0.03 948847 68 32 12 7 0.06 948849 43 13 6 5
<0.03 948850 43 15 7 5 <0.03 948851 45 16 5 3 <0.03 948852
51 16 4 2 <0.03 948853 84 32 9 5 0.10 948854 58 21 7 3 <0.03
948855 56 30 12 6 0.03 948856 70 38 14 8 0.08 948862 55 26 10 4
<0.03 948863 43 8 2 2 <0.03 948865 57 24 10 6 <0.03 948880
84 46 26 14 0.16 948882 66 36 19 8 0.07 948883 81 62 29 16 0.21
948884 59 25 9 4 0.03 948885 53 18 6 4 <0.03 948891 96 52 24 12
0.20 948892 54 24 7 4 <0.03 948893 93 84 59 44 1.24 948906 81 46
19 9 0.13 948907 65 25 8 4 0.05 948910 62 22 8 4 0.0 948911 48 16
10 4 <0.03 948917 81 57 30 19 0.20 948918 69 36 14 6 0.07 948922
64 32 12 6 0.05 948923 30 8 4 3 <0.03 948924 32 11 3 2 <0.03
948925 58 27 9 6 0.03 948926 109 94 105 111 >2.0 948935 38 17 6
3 <0.03 948936 47 12 4 2 <0.03 948937 48 21 7 3 <0.03
948938 49 19 8 5 <0.03 948950 54 27 8 3 <0.03 948951 32 13 5
3 <0.03 948952 46 13 4 2 <0.03 948953 69 41 14 7 0.08 948954
43 15 8 4 <0.03 948960 41 14 8 7 <0.03 948961 48 17 6 3
<0.03 948963 51 23 8 4 <0.03 948965 96 77 53 28 0.57 948966
63 32 11 4 0.05 948967 71 38 13 6 0.08 948968 60 29 9 3 0.04 948969
47 18 6 4 <0.03 948970 31 9 3 2 <0.03 948971 34 9 2 2
<0.03 948972 72 32 9 3 0.07 949006 79 53 19 8 0.1 949007 84 37 9
6 0.1 949012 81 38 17 10 0.11 949040 80 36 11 4 0.10 949041 101 50
14 5 0.18 949051 74 45 16 8 0.10 949053 89 54 18 5 0.2 949055 68 24
8 4 0.0 949059 73 40 15 5 0.09 949061 109 99 83 73 >2.0 949077
82 47 15 5 0.1 949080 48 20 7 5 <0.03 949088 73 24 8 3 0.06
949092 66 24 13 14 0.05 949094 79 48 17 6 0.13 949095 90 66 19 6
0.20 949109 95 55 26 13 0.22 949139 72 47 24 11 0.12 949158 54 20
10 8 <0.03 949159 75 40 15 25 0.10 949163 52 15 4 2 <0.03
949164 42 30 15 10 <0.03 949167 78 39 17 21 0.11 949168 67 36 19
12 0.07 949182 65 27 8 4 0.05 949190 57 15 3 2 <0.03 949216 74
42 14 5 0.10 949223 87 28 16 6 0.1 949229 125 101 92 78 >2.0
949279 85 41 15 5 0.12 949325 98 112 86 75 >2.0 949397 94 96 100
106 >2.0 949483 71 43 21 11 0.10 949500 78 56 24 10 0.16 949517
103 98 97 80 >2.0 949589 111 89 57 42 1.06 949685 101 82 58 40
0.99 949778 90 55 20 9 0.18 949805 106 88 66 48 1.73 949814 59 51
22 8 0.08 949841 87 46 11 4 0.13 949846 48 30 11 7 <0.03 949848
57 18 4 2 <0.03 949858 66 23 10 6 0.04 949865 61 11 3 1 <0.03
949871 70 26 7 3 0.1 949872 47 13 3 1 <0.03 949873 45 10 2 1
<0.03 949874 14 3 1 0 <0.03 949875 54 23 5 2 <0.03 949876
79 32 10 5 0.09 949880 52 20 6 3 <0.03 949884 87 41 16 7 0.13
949886 62 22 6 3 0.04 949887 87 64 21 8 0.19 949892 83 49 22 13 0.2
949896 13 1 1 0 <0.03 949897 67 32 15 7 0.06 949899 80 49 20 6
0.14 949917 80 48 22 10 0.1 949918 84 46 15 4 0.1 949920 59 20 3 2
<0.03 949921 67 19 2 1 0.04 949922 56 21 6 2 <0.03 949923 70
34 15 7 0.07 949924 112 106 5 2 0.31 949925 59 27 6 2 0.04 949926
44 7 1 1 <0.03 949927 37 4 1 1 <0.03 949928 68 20 4 2 0.04
949929 66 18 3 1 0.04 949930 61 30 10 4 0.04 949931 68 27 6 2 0.05
949932 72 31 6 2 0.07 949934 66 42 22 12 0.08 949935 52 20 8 6
<0.03 949937 69 27 7 5 0.06 949938 66 35 14 5 0.06 949942 69 30
8 3 0.06 949943 52 21 6 2 <0.03 949944 60 20 4 3 0.03 949945 54
16 5 3 <0.03 949948 34 5 1 1 <0.03 949949 46 10 2 1 <0.03
949950 46 12 3 2 <0.03
949962 70 34 16 9 0.1 949963 71 43 15 6 0.1 949978 65 35 9 2 0.06
949979 72 35 11 5 0.08 949983 89 66 25 12 0.23 949990 61 23 5 2
0.04 949991 55 21 5 1 <0.03 949992 56 29 11 6 0.03 950014 60 28
8 3 0.04 950017 68 38 11 5 0.07 950019 52 20 8 5 <0.03 950020 84
43 13 5 0.12 950021 80 46 15 6 0.12 950023 57 17 5 2 <0.03
950024 51 17 7 5 <0.03 950030 37 7 1 0 <0.03 950048 57 40 16
6 0.05 950057 65 38 21 9 0.07 950060 26 16 3 2 <0.03 950061 55
34 10 5 0.04 950064 74 32 11 4 0.08 950065 72 30 8 2 0.07 950069 68
31 8 4 0.06 950072 49 20 6 3 <0.03 950075 87 38 13 5 0.12 950080
69 40 15 7 0.08 950081 60 28 8 4 0.04 950083 65 29 12 4 0.1 950085
53 14 6 4 <0.03 950086 76 43 15 4 0.10 950089 46 10 2 1 <0.03
950091 45 12 2 1 <0.03 950092 80 42 14 8 0.11 950102 81 37 9 3
0.10 950124 69 31 14 8 0.06 950132 55 14 4 1 <0.03 950139 87 59
24 9 0.19 950183 44 23 5 2 <0.03 950219 84 37 18 11 0.12 950237
83 48 17 8 0.14 950246 76 33 15 7 0.09 951328 76 37 12 4 0.09
951330 76 40 13 5 0.10 951333 89 45 22 9 0.16 951340 74 42 15 6
0.10 951341 92 58 21 4 0.19 951346 49 22 4 3 <0.03 951352 67 19
7 3 0.04 951354 67 36 12 6 0.07 951356 57 23 6 2 <0.03 951357 62
35 10 4 0.05 951358 76 36 12 5 0.09 951362 53 15 3 1 <0.03
951364 58 18 4 2 <0.03 951365 78 47 16 6 0.12 951366 61 34 12 6
0.05 951367 69 28 8 4 0.06 951370 74 41 16 7 0.10 951371 30 7 2 2
<0.03 951372 61 21 6 4 0.03 951374 62 17 4 2 0.03 951376 67 47
15 5 0.09 951381 63 28 11 6 0.05 951384 63 27 6 2 0.05 951386 66 22
6 3 0.04 951387 68 20 3 1 0.04 951397 69 35 8 4 0.07 951406 73 52
19 9 0.12 951407 56 21 6 3 <0.03 951408 47 15 3 1 <0.03
951413 68 46 20 9 0.09 951416 63 42 17 7 0.07 951418 60 22 6 3 0.03
951428 28 4 1 1 <0.03 951429 32 6 2 2 <0.03 951430 59 25 6 2
0.03 951431 46 32 9 5 <0.03 951441 100 82 67 42 1.33 951450 71
36 12 6 0.08 951458 63 32 15 10 0.05 951459 77 44 17 9 0.11 951462
74 28 6 2 0.07 951463 74 35 15 6 0.09 951481 91 47 26 13 0.18
951489 59 17 8 3 <0.03 951494 64 32 10 5 0.05 951498 58 27 10 7
0.03 951519 60 32 8 3 0.05 951529 90 35 24 18 0.15 951537 103 101
105 168 >2.0 951550 66 42 15 6 0.08 951554 83 36 10 5 0.10
951561 88 59 74 100 >2.0 951565 65 38 13 4 0.07 951566 77 36 9 3
0.09 951608 73 25 8 4 0.06 951645 64 29 12 7 0.05 951657 107 91 64
62 >2.0 951691 58 28 9 3 0.04 951696 58 19 9 5 <0.03 951700
76 40 16 9 0.10 951709 52 25 9 6 <0.03 951729 73 74 88 89
>2.0 951731 70 34 10 4 0.07 951737 57 24 5 4 <0.03 951746 68
31 17 11 0.06 951749 71 27 4 2 0.06 951763 44 11 4 2 <0.03
951764 40 9 2 1 <0.03 951767 87 48 16 5 0.14 951772 62 30 10 7
0.05 951781 95 42 15 7 0.15 951783 56 31 12 5 0.04 951787 53 20 7 4
<0.03 951793 44 11 4 2 <0.03 951795 64 24 7 3 0.04 951797 40
15 6 4 <0.03 951798 31 5 1 1 <0.03 951799 27 5 1 1 <0.03
951803 67 29 9 4 0.06 951804 45 13 3 1 <0.03 951806 65 43 15 7
0.07 951807 59 30 10 4 0.04 951808 69 46 18 6 0.10 951809 47 13 3 1
<0.03 951811 57 22 7 3 <0.03 951814 60 25 10 7 0.04 951815 58
37 15 7 0.05 951816 46 10 2 1 <0.03 951821 41 14 4 2 <0.03
951822 86 44 15 7 0.13 951824 67 23 5 3 0.05 951827 51 17 5 2
<0.03 951828 63 23 9 4 0.04 951830 61 26 10 5 0.04 951833 59 39
9 4 0.05 951835 23 4 1 0 <0.03 951837 53 16 4 1 <0.03 951838
80 51 22 8 0.14 951839 56 25 8 2 <0.03 951840 76 37 12 4 0.09
951841 69 27 11 2 0.06 951843 63 29 8 4 0.05 951845 39 9 3 1
<0.03 951846 45 14 3 1 <0.03 951855 87 65 19 5 0.19 951856 61
18 4 2 <0.03 951857 57 27 7 2 0.03 951874 74 73 68 47 >2.0
951875 66 33 10 4 0.06 951881 49 22 3 2 <0.03 951893 53 26 10 5
<0.03 951898 46 18 5 2 <0.03 951902 61 34 13 7 0.05 951938 85
51 20 11 0.16
Example 6: Dose Response of Modified Oligonucleotides Complementary
to Dynamin 2 In Vitro
[0456] Selected oligonucleotides listed in the Examples above were
tested at various doses via free uptake in A431 cells. Cells were
cultured at a density of 10,000 cells per well and treated with 8,
40, 200, or 1,000 nM of modified oligonucleotide, as specified in
the table below. After approximately 48 hours, total RNA was
isolated and analyzed by RT-PCR with primer probe set RTS36027
(described in Example 1), normalized with GADPH. As illustrated in
the tables below, DNM2 mRNA expression was inhibited in a
dose-dependent manner by modified oligonucleotides complementary to
DNM2.
TABLE-US-00009 TABLE 8 DNM2 mRNA Expression Compound DNM2
expression (% control) Number 8 nM 40 nM 200 nM 1,000 nM IC50
(.mu.M) 695171 90 84 54 26 0.24 951371 105 67 25 9 0.10 951371 101
70 27 11 0.10 951371 109 63 16 4 0.08 951371 91 61 23 8 0.07 951371
94 78 25 9 0.10 951371 91 63 23 8 0.07 951371 59 66 23 8 0.04
951371 94 56 20 7 0.07 951371 88 67 26 10 0.08 988380 77 33 5 1
0.02 988386 93 70 21 6 0.08 988387 101 46 5 1 0.05 988388 97 80 39
11 0.13 988394 120 81 23 5 0.12 988396 113 87 30 9 0.14 988397 77
29 7 2 0.02 988398 86 46 11 3 0.04 988399 81 47 13 3 0.04 988400 88
54 15 3 0.05 988401 98 65 16 6 0.07 988402 94 48 11 2 0.05 988407
99 77 30 8 0.11 988413 84 58 23 7 0.06 988414 95 73 23 6 0.09
988415 82 62 25 7 0.06 988422 91 60 17 7 0.06
Example 7: Dose Response of Modified Oligonucleotides Complementary
to Dynamin 2 In Vitro
[0457] Selected oligonucleotides listed in the Examples above were
tested at various doses via free uptake in A431 cells. Cells were
cultured at a density of 10,000 cells per well treated with 7.8,
31.25, 125, 500, or 2,000 nM of modified oligonucleotide, as
specified in the tables below. After approximately 48 hours, total
RNA was isolated and analyzed by RT-PCR with primer probe set
RTS36027 (described in Example 1), normalized with GADPH. As
illustrated in the tables below, DNM2 expression was inhibited in a
dose-dependent manner by modified oligonucleotides complementary to
DNM2.
TABLE-US-00010 TABLE 9 DNM2 mRNA Expression DNM2 expression (%
control) 7.8 nM 31.25 125 500 2,000 IC50 Compound Number nM nM nM
nM nM (.mu.M) 908166 106 97 57 28 16 0.22 908213 139 85 56 30 16
0.21 908408 98 80 33 7 2 0.08 908420 91 86 45 13 4 0.11 948660 105
90 51 13 2 0.14 948677 101 101 61 23 8 0.21 948951 97 79 35 14 8
0.09 949190 107 101 54 22 8 0.18 949865 94 80 40 16 7 0.10 949935
88 84 58 31 19 0.20 950023 89 75 45 13 4 0.09 950060 81 79 48 29 11
0.13 950089 84 79 53 18 5 0.12 950132 87 83 44 19 9 0.11 950183 88
83 58 35 15 0.21
TABLE-US-00011 TABLE 10 DNM2 mRNA Expression DNM2 expression (%
control) 7.8 nM 31.25 125 500 2,000 IC50 Compound Number nM nM nM
nM nM (.mu.M) 908408 98 80 34 10 2 0.08 951356 190 79 60 28 10 0.23
951362 97 85 63 30 11 0.21 951372 87 80 55 23 10 0.14 951431 100 90
68 38 21 0.31 951797 89 77 42 19 10 0.10 951798 89 58 23 6 1 0.04
951799 90 68 23 6 2 0.05 951816 100 77 38 10 3 0.09 951821 87 57 45
16 6 0.07 951827 94 79 45 17 5 0.11 951839 95 90 69 38 14 0.29
951845 92 71 31 8 2 0.06 951846 91 85 50 19 5 0.13 951856 97 86 54
22 7 0.15
Example 8: Dose Response of Modified Oligonucleotides Complementary
to Dynamin 2 In Vitro
[0458] Selected oligonucleotides listed in the Examples above were
tested at various doses in HSMM cells (human myoblast, Lonza
CC-2580). Cells were cultured at a density of 20,000 cells per well
and transfected via electroporation with 7.8, 31.25, 125, 500, or
2,000 nM of modified oligonucleotide, as specified in the tables
below. After approximately 16 hours, total RNA was isolated and
analyzed by RT-PCR with primer probe set RTS36027 (described in
Example 1), normalized with ribogreen. As illustrated in the tables
below, DNM2 mRNA expression was inhibited in a dose-dependent
manner by modified oligonucleotides complementary to DNM2.
TABLE-US-00012 TABLE 11 DNM2 mRNA Expression DNM2 expression (%
control) 7.8 nM 31.25 125 500 2,000 IC50 Compound Number nM nM nM
nM nM (.mu.M) 908166 104 95 98 66 42 1.29 908213 93 82 70 42 19
0.33 908408 111 100 74 38 17 0.36 908420 91 93 67 39 17 0.30 948660
88 86 83 42 15 0.40 948677 90 80 87 51 22 0.54 948951 88 74 57 31
12 0.16 949190 99 88 82 47 23 0.49 949865 132 106 92 39 19 0.50
949935 90 92 94 60 25 0.77 950023 113 97 86 40 15 0.43 950060 109
105 78 69 32 0.95 950089 111 102 80 54 21 0.58 950132 117 98 79 51
19 0.51 950183 95 110 84 59 23 0.70
TABLE-US-00013 TABLE 12 DNM2 mRNA Expression DNM2 expression (%
control) 7.8 nM 31.25 125 500 2,000 IC50 Compound Number nM nM nM
nM nM (.mu.M) 908408 98 102 81 55 20 0.58 951356 95 102 94 74 41
1.45 951362 95 67 85 56 29 0.62 951372 95 91 86 60 27 0.75 951431
87 90 89 55 35 0.77 951797 94 94 98 72 41 1.40 951798 103 95 79 40
21 0.40 951799 104 100 81 47 20 0.50 951816 106 91 89 53 30 0.70
951821 122 106 66 32 22 0.32 951827 100 87 51 38 20 0.21 951839 123
94 99 72 31 1.17 951845 104 94 75 51 20 0.48 951846 112 91 80 59 27
0.69 951856 113 101 77 50 22 0.52
Example 9: Dose Response of Modified Oligonucleotides Complementary
to Dynamin 2 In Vitro
[0459] Selected oligonucleotides listed in the Examples above were
tested at various doses in SkMC cells (human skeletal muscle, Lonza
CC-2561). Cells were cultured at a density of 20,000 cells per well
and transfected via electroporation with 7.8, 31.25, 125, 500, or
2,000 nM of modified oligonucleotide, as specified in the tables
below. After approximately 16 hours, total RNA was isolated and
analyzed by RT-PCR with primer probe set RTS36027 (described in
Example 1), normalized with ribogreen. As illustrated in the tables
below, DNM2 mRNA expression was inhibited in a dose-dependent
manner by modified oligonucleotides complementary to DNM2.
TABLE-US-00014 TABLE 13 DNM2 mRNA Expression DNM2 expression (%
control) 7.8 nM 31.25 125 500 2,000 IC50 Compound Number nM nM nM
nM nM (.mu.M) 908166 90 84 87 43 13 0.41 908213 101 79 59 21 5 0.15
908408 94 72 57 21 3 0.13 908420 84 72 53 9 4 0.10 948660 95 90 64
12 2 0.16 948677 88 77 58 15 4 0.13 948951 83 67 41 12 5 0.07
949190 103 84 61 16 4 0.16 949865 130 106 55 10 4 0.17 949935 118
100 86 33 7 0.36 950023 129 98 57 11 3 0.17 950060 101 103 72 26 5
0.26 950089 112 78 65 20 4 0.17 950132 115 93 53 14 3 0.15 950183
114 92 70 24 5 0.23
TABLE-US-00015 TABLE 14 DNM2 mRNA Expression DNM2 expression (%
control) 7.8 nM 31.25 125 500 2,000 IC50 Compound Number nM nM nM
nM nM (.mu.M) 908408 91 80 46 10 3 0.10 951356 103 98 90 52 15 0.55
951362 90 88 65 22 4 0.19 951372 99 88 65 16 4 0.18 951431 103 97
70 25 6 0.24 951797 102 94 69 25 7 0.23 951798 99 90 46 8 3 0.12
951799 101 90 49 12 3 0.13 951816 96 78 63 13 4 0.14 951821 104 79
47 12 3 0.11 951827 94 71 44 8 3 0.08 951839 114 103 76 32 6 0.32
951845 97 88 55 12 4 0.14 951846 90 86 41 18 4 0.11 951856 102 91
62 15 4 0.17
Example 10: Administration of Modified Oligonucleotides
Complementary to Human Dynamin 2 to CD1 Mice
[0460] CD1.RTM. mice (Charles River, Mass.) were treated with
modified oligonucleotides selected from Examples above and
evaluated for changes in the levels of various plasma chemistry
markers. Groups of 6 week old male CD1 mice were injected
subcutaneously once a week for 6 weeks with 50 mg/kg of a modified
oligonucleotide listed in the tables below (50 mg/kg/week dose).
Each group contained 4 mice. One control group of male CD1 mice was
injected subcutaneously once a week for 6 weeks with PBS. Mice were
sacrificed 48 hours after the last dose, and organs and plasma were
harvested for further analysis.
[0461] Levels of transaminases, albumin, BUN, and billirubin were
measured using an automated clinical chemistry analyzer (Hitachi
Olympus AU400e, Melville, N.Y.). Kidney, liver, and spleen weights
were also measured. The results, presented in the tables below,
show that many of the modified oligonucleotides complementary to
DNM2 were well tolerated in vivo.
TABLE-US-00016 TABLE 15 Levels of plasma markers ALT AST Albumin
BUN Creatine T. Bil. (U/L) (U/L) (mg/dL) (mg/d) (mg/dL) (g/dL) PBS
48 82 3.36 27.2 0.12 0.66 549144 72 68 3.23 23.6 0.12 0.47 908166
259 108 3.16 20.4 0.11 0.38 908213 93 85 2.95 23.9 0.10 0.34 908389
1073 636 3.17 22.7 0.09 0.55 908408 67 70 2.97 26.2 0.11 0.32
908415 286 209 2.60 26.2 0.10 0.28 908416 425 336 2.35 26.4 0.07
0.19 908420 105 144 2.50 26.5 0.06 0.38 948660 112 165 2.59 21.8
0.08 0.26 948673 225 263 2.15 27.2 0.04 0.82 948675 100 132 2.25
21.4 0.06 0.22 948677 65 91 2.32 17.7 0.05 0.21 948951 107 126 2.46
21.4 0.07 0.22 949158 713 608 2.99 18.6 0.01 0.27 949190 64 62 2.52
22.1 0.07 0.20 949865 45 58 2.62 23.2 0.06 0.22 949873 89 163 2.33
20.7 0.04 0.21 949874 1079 853 2.77 20.7 0.05 0.46 949935 98 81
2.63 22.9 0.07 0.20 950023 42 57 2.52 22.2 0.04 0.20 950030 59 77
2.44 20.6 0.05 0.21
TABLE-US-00017 TABLE 16 Levels of plasma markers Compound ALT AST
Albumin BUN Creatine T. Bil. No. (U/L) (U/L) (mg/dL) (mg/d) (mg/dL)
(g/dL) PBS 37 62 2.78 22.0 0.08 0.46 549144 64 79 2.64 24.0 0.08
0.29 950060 47 63 2.47 22.0 0.09 0.33 950089 40 56 2.65 21.0 0.10
0.22 950132 58 58 2.58 20.0 0.07 0.24 950183 49 62 2.38 21.0 0.06
0.29 951356 64 80 2.39 23.0 0.10 0.25 951362 60 63 2.74 22.0 0.09
0.18 951371 312 209 2.32 20.0 0.09 0.18 951372 59 99 2.54 25.0 0.07
0.21 951407 172 200 2.72 24.0 0.07 0.24 951431 64 80 2.48 23.0 0.08
0.22 951793 319 238 2.5 19.0 0.10 0.20 951797 41 63 2.6 24.0 0.11
0.26 951798 53 97 2.57 26.0 0.10 0.19 951799 44 97 2.44 25.0 0.08
0.19 951816 121 113 2.63 19.0 0.10 0.20 951821 79 80 2.39 23.0 0.07
0.17 951827 56 88 2.46 25.0 0.10 0.21 951839 45 50 2.52 23.0 0.08
0.20 951845 117 132 2.51 21.0 0.08 0.25 951846 35 47 2.59 21.0 0.10
0.21 951856 112 412 2.25 20.0 0.09 0.17
TABLE-US-00018 TABLE 17 Organ weights kidney liver spleen (g) (g)
(g) PBS 0.55 1.9 0.09 549144 0.52 1.9 0.10 908166 0.48 2.0 0.08
908213 0.52 2.0 0.12 908389 0.54 2.6 0.14 908408 0.49 2.2 0.13
908415 0.51 2.2 0.12 908416 0.51 2.1 0.16 908420 0.52 2.0 0.13
948660 0.44 1.8 0.14 948673 0.51 3.9 0.62 948675 0.48 2.1 0.21
948677 0.54 2.0 0.15 948951 0.45 1.9 0.11 949158 0.59 2.3 0.18
949190 0.53 2.2 0.14 949865 0.53 2.1 0.14 949873 0.47 1.8 0.20
949874 0.52 2.3 0.16 949935 0.57 2.0 0.13 950023 0.53 1.9 0.16
950030 0.59 2.1 0.20
TABLE-US-00019 TABLE 18 Organ weights Compound kidney liver spleen
No. (g) (g) (g) PBS 0.57 2.1 0.11 549144 0.57 2.0 0.09 950060 0.57
2.3 0.12 950089 0.60 2.4 0.15 950132 0.59 2.3 0.16 950183 0.60 2.4
0.14 951356 0.57 2.4 0.19 951362 0.58 2.3 0.16 951371 0.51 2.7 0.16
951372 0.55 2.5 0.17 951407 0.53 2.2 0.17 951431 0.54 2.2 0.18
951793 0.55 2.6 0.17 951797 0.52 2.1 0.15 951798 0.57 2.4 0.18
951799 0.54 2.4 0.16 951816 0.50 2.4 0.16 951821 0.50 2.0 0.13
951827 0.47 1.8 0.13 951839 0.51 2.2 0.15 951845 0.55 2.0 0.17
951846 0.57 2.2 0.17 951856 0.60 2.5 0.19
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(https://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20200392510A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(https://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20200392510A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References