U.S. patent application number 16/971647 was filed with the patent office on 2020-12-17 for endophyte screening.
The applicant listed for this patent is The Grains Research and Development Corporation, Grasslanz Technology Limited, National University Corporation Tottori University. Invention is credited to Richard David Johnson, Wayne Roydon Simpson, Hisashi Tsujimoto.
Application Number | 20200390055 16/971647 |
Document ID | / |
Family ID | 1000005089495 |
Filed Date | 2020-12-17 |
![](/patent/app/20200390055/US20200390055A1-20201217-D00000.png)
![](/patent/app/20200390055/US20200390055A1-20201217-D00001.png)
![](/patent/app/20200390055/US20200390055A1-20201217-P00001.png)
![](/patent/app/20200390055/US20200390055A1-20201217-P00002.png)
![](/patent/app/20200390055/US20200390055A1-20201217-P00003.png)
![](/patent/app/20200390055/US20200390055A1-20201217-P00004.png)
![](/patent/app/20200390055/US20200390055A1-20201217-P00005.png)
![](/patent/app/20200390055/US20200390055A1-20201217-P00006.png)
![](/patent/app/20200390055/US20200390055A1-20201217-P00007.png)
![](/patent/app/20200390055/US20200390055A1-20201217-P00008.png)
![](/patent/app/20200390055/US20200390055A1-20201217-P00009.png)
View All Diagrams
United States Patent
Application |
20200390055 |
Kind Code |
A1 |
Simpson; Wayne Roydon ; et
al. |
December 17, 2020 |
Endophyte Screening
Abstract
The present invention relates to isolated strains of Epichloe
endophytes that form stable symbiotic associations with cereal
grasses, particularly wheat, wherein the symbiotic associations are
combinations of endophytes and host plants that are not found in
nature The invention also relates to methods of identifying and/or
selecting fungal endophytes that form stable symbiotic associations
with wheat plants including methods of screening for fungal
endophytes that form stable symbiotic associations with wheat
plants, and to methods of screening for wheat plants that form
stable symbiotic associations with fungal endophytes.
Inventors: |
Simpson; Wayne Roydon;
(Palmerston North, NZ) ; Johnson; Richard David;
(Palmerston North, NZ) ; Tsujimoto; Hisashi;
(Tottori, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
National University Corporation Tottori University
Grasslanz Technology Limited
The Grains Research and Development Corporation |
Tottori
Lincoln
Barton |
|
JP
NZ
AU |
|
|
Family ID: |
1000005089495 |
Appl. No.: |
16/971647 |
Filed: |
February 20, 2019 |
PCT Filed: |
February 20, 2019 |
PCT NO: |
PCT/IB19/51395 |
371 Date: |
August 20, 2020 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6895 20130101;
A01N 63/30 20200101; A01H 17/00 20130101; C12Q 2600/156
20130101 |
International
Class: |
A01H 17/00 20060101
A01H017/00; A01N 63/30 20060101 A01N063/30; C12Q 1/6895 20060101
C12Q001/6895 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 21, 2018 |
NZ |
740055 |
Claims
1.-19. (canceled)
20. A method of identifying a wheat plant that forms a stable
symbiotic combination with a fungal endophyte comprising
artificially inoculating a fungal endophyte into a candidate wheat
plant to form a wheat plant/endophyte combination, propagating the
wheat plant/endophyte combination, obtaining seed from the
propagated combination, and identifying the presence of the
endophyte in the seed, and optionally selecting a wheat plant that
is capable of forming a stable symbiotic combination with a fungal
endophyte.
21. A method of making a stable symbiotic combination comprising a
wheat plant and a fungal endophyte comprising artificially
inoculating a fungal endophyte into a candidate wheat plant to form
a wheat plant/endophyte combination, propagating the wheat
plant/endophyte combination, obtaining seed from the propagated
combination, and identifying the presence of the endophyte in the
seed, and optionally selecting a stable symbiotic combination
comprising the wheat plant and the fungal endophyte.
22. The method of claim 21, wherein the fungal endophyte is
isolated from Elymus spp.
23. The method of claim 21, wherein the fungal endophyte is an
Epichloe fungal endophyte.
24. The method of claim 21, wherein the fungal endophyte is an
Epichloe fungal endophyte isolated from wild cereal grasses
selected from the group consisting of Elymus spp. grasses and
Hordeum species grasses.
25. The method of claim 21, wherein the fungal endophyte is a
species or strain of Epichloe bromicola or a hybrid strain of E.
bromicola and another Epichloe species.
26. The method of claim 21, wherein the fungal endophyte is an
isolated strain of Epichloe fungal endophyte selected from the
group consisting of AR3002 (NRRL#50579), AR3013 (NRRL#67557),
AR3060 (NRRL#67592), AR3067 (NRRL#50719), AR3070 (NRRL#67564) and
AR3108 (NRRL#67572), and combinations thereof.
27. The method of claim 21, wherein the wheat plant comprises
chromosome modifications that increase the compatibility of the
wheat plant with an Epichloe endophyte infection.
28. The method of claim 21, wherein the wheat plant is a plant from
a line obtained from the Tottori Alien Chromosome Bank of Wheat
(TACBOW) selected from the group consisting of TACBOW0003,
TACBOW0005, TACBOW0010, TACBOW0011, TACBOW0018, TACBOW0028,
TACBOW0044, TACBOW0045, TACBOW0054, TACBOW0059, TACBOW0067,
TACBOW0128, TACBOW0209, TACBOW0221, TACBOW0226, TACBOW0236,
TACBOW237, TACBOW0244, TACBOW0260, TACBOW0261, TACBOW0272, and
TACBOW0275.
29. The method of claim 21, wherein the wheat plant in the
combination shows a normal morphological phenotype.
30. The method of claim 21, the wheat plant in the combination has
a tall floral phenotype that produces seed containing the
endophyte.
31. The method of claim 21, wherein the wheat plant in the
combination produces seed that is viable, wherein the seed will
germinate to form a next generation of the combination.
32. The method of claim 21, wherein the wheat plant/endophyte
combination produces an alkaloid that confers at least some level
of pest protection or resistance, or disease protection or
resistance, on the combination, wherein the alkaloid is selected
from the group consisting of lolines, peramine, indole diterpene
alkaloids and ergot alkaloids.
33. A stable symbiotic combination comprising an isolated strain of
Epichloe fungal endophyte selected from the group consisting of
AR3002 (NRRL#50579), AR3013 (NRRL#67557), AR3060 (NRRL#67592),
AR3067 (NRRL#50719), AR3070 (NRRL#67564) and AR3108 (NRRL#67572),
and combinations thereof and a wheat plant.
34. The combination of claim 33, wherein the wheat plant in the
combination shows a normal morphological phenotype.
35. The combination of claim 33, wherein the wheat plant shows a
tall floral phenotype that produces seed containing the
endophyte.
36. The combination of claim 33, wherein the wheat plant produces
seed that is viable, wherein the seed will germinate to form a next
generation of the combination.
Description
TECHNICAL FIELD
[0001] The present invention generally relates to select strains of
Epichloe fungal endophytes that form stable symbiotic associations
with cereal grasses, particularly wheat, to methods of identifying
and/or selecting fungal endophytes that form stable symbiotic
associations with wheat plants including methods of screening for
fungal endophytes that form stable symbiotic associations with
wheat plants, and to methods of screening for wheat plants that
form stable symbiotic associations with fungal endophytes.
BACKGROUND OF THE INVENTION
[0002] Grown worldwide, wheat is one of the oldest and most
important cereal crops. Wheat grain is used widely to produce the
flour used in a large array of baked goods and for making pasta.
Wheat is also used for the production of starch, malt, dextrose,
gluten, alcohol and other commercial products. Vegetative portions
of wheat plants may be used as straw, or converted to silage, or
used for animal fodder, including for in situ grazing.
[0003] More cultivable land worldwide is used for wheat production
than any other food crop with 2014 production estimates in the
neighbourhood of 220 million hectares of wheat sown (UN Food and
Agriculture Organization, 2014). Amongst the cereals, wheat
production is second only to maize, with about 750 million tonnes
of wheat produced in 2016 (UN Food and Agriculture Organization,
2016). Wheat has a protein content of about 13% and is a leading
source of human vegetal protein. Whole wheat is a source of
essential nutrients and dietary fibre.
[0004] As would be expected from such a widely grown agricultural
crop, wheat is targeted by many pests, the activities of which can
severely reduce overall production. Known pests include, but are
not limited to, many Lepidoptera (moths and butterflies) including
pink borer and armyworms; aphids including cereal aphids
(Homoptera); thrips (Thysanoptera); wireworms, ground beetle
(Zabrus tenebrioides), cereal leaf beetles (Oulema melanopus, O.
gallaeciana) and white grubs (Coleoptera); Diptera including
leatherjackets (Tipula spp.), wheat bulb fly (Delia coarctata),
leaf miners (Agromyza spp.), fruit fly (Oscinella frit), stem
boring flies (Diptera), Hessian fly (Mayetiola destructor), saddle
gall midge (Haplodiplosis marginata); grasshoppers (Orthoptera);
termites (Isoptera); nematodes and slugs.
[0005] To combat losses in productivity, effective pest protection
during cultivation is required to ensure that a good quantity of
acceptable quality grain is produced.
[0006] Known methods of pest control for wheat include some or all
of the following practices: the use of pest resistant cultivars,
optimizing time of planting and planting with healthy seeds,
effective crop rotation, destruction, and/or burial or removal of
crop debris (stubble). Additional methods of pest control that may
be required include the use of various pesticides on plants and/or
seeds. At times, simultaneous application of two or more active
substances may be required for the control of pests.
[0007] However, the use of many pesticides can be problematic due
to the known problems associated with the chemicals frequently used
for such purposes. Many pesticides are toxic and can be dangerous
to human and animal consumers of treated agricultural crops (Casida
and Quistad, 1998). In particular, the accumulation, in humans and
animals of toxic pesticides can lead to serious health issues for
individuals, particularly during early development. For example,
pesticide exposure has been linked to respiratory disorders,
developmental cancers and shown to have lasting effects on the
development of mental abilities (Zejda et al. 1993). Many
pesticides also kill beneficial organisms that help control pests
and that carry out essential ecosystem services such as pollination
and nutrient cycling.
[0008] The use of pesticides may be difficult to control in
variable environmental conditions leading to unwanted dispersal of
toxic compounds, for example by drift of sprays or by soil
leaching. In addition, the pests may develop pesticide resistance
for a number of reasons, including improper practice and handling,
which can pose a real threat to crop (grain) yields. Accordingly,
there is a need for pest control measures that do not use applied
pesticides.
[0009] In some crops, particularly forage grasses, fungal
endophytes are used to increase plant resistance to certain pests,
diseases and abiotic stresses. However, the range of agricultural
crops that harbour useful fungal endophyte strains is limited.
[0010] Therefore, it is an object of the present invention to
provide at least one strain of Epichloe fungal endophyte that forms
a stable symbiotic association with at least one cereal grass,
particularly wheat and/or to provide a method of identifying a
fungal endophyte that will form a stable symbiotic association with
a wheat plant and confer at least some level of pest protection on
the wheat plant and/or to provide a method of identifying a wheat
plant that will form a stable symbiotic association with a fungal
endophyte wherein the endophyte will confer at least some level of
pest protection on the wheat plant and/or to at least provide the
public with a useful choice.
[0011] In this specification where reference has been made to
patent specifications, other external documents, or other sources
of information, this is generally for the purpose of providing a
context for discussing the features of the invention. Unless
specifically stated otherwise, reference to such external documents
is not to be construed as an admission that such documents, or such
sources of information, in any jurisdiction, are prior art, or form
part of the common general knowledge in the art.
SUMMARY OF THE INVENTION
[0012] In one aspect the invention relates to an isolated strain of
Epichloe fungal endophyte selected from the group consisting of
AR3002 (NRRL#50579), AR3013 (NRRL#67557), AR3060 (NRRL#67592),
AR3070 (NRRL#67564) and AR3108 (NRRL#67572), and combinations
thereof.
[0013] In another aspect the invention relates to a method of
identifying a wheat plant that forms a stable symbiotic association
with a fungal endophyte comprising [0014] artificially inoculating
a fungal endophyte into a candidate wheat plant to form a wheat
plant/endophyte combination, [0015] propagating the wheat
plant/endophyte combination, [0016] obtaining seed from the
propagated combination, and [0017] identifying the presence of the
endophyte in the seed, and [0018] optionally selecting a wheat
plant that is capable of forming a stable symbiotic association
with a fungal endophyte.
[0019] In another aspect the invention relates to a method of
making a stable symbiotic combination comprising a wheat plant and
a fungal endophyte comprising [0020] artificially inoculating a
fungal endophyte into a candidate wheat plant to form a wheat
plant/endophyte combination, [0021] propagating the wheat
plant/endophyte combination, [0022] obtaining seed from the
propagated combination, and [0023] identifying the presence of the
endophyte in the seed, and [0024] optionally selecting a stable
symbiotic combination comprising the wheat plant and the fungal
endophyte.
[0025] In another aspect the invention relates to a method of
conferring at least some level of pest protection or resistance on
a wheat plant comprising artificially infecting a wheat plant with
at least one Epichloe fungal endophyte wherein the wheat
plant/endophyte combination produces at least one metabolite at a
level sufficient to confer at least some level of pest protection
or resistance on the wheat plant.
[0026] In another aspect the invention relates to a method of
conferring at least some level of disease protection or resistance
on a wheat plant comprising artificially infecting a wheat plant
with at least one Epichloe fungal endophyte wherein the wheat
plant/endophyte combination produces at least one alkaloid at a
level sufficient to confer at least some level of disease
protection or resistance on the wheat plant.
[0027] In another aspect the invention relates to a wheat plant
infected with a fungal endophyte wherein the wheat plant is not a
natural host of the endophyte, and wherein the wheat plant and the
fungal endophyte form a stable symbiotic association.
[0028] In another aspect the invention relates to a wheat seed
infected with a fungal endophyte wherein the wheat seed is not a
natural host of the endophyte, and wherein the wheat seed is
capable of germinating and growing into a wheat plant comprising
the fungal endophyte in a stable symbiotic association.
[0029] In another aspect the invention relates to a method of
identifying a wheat germplasm that is compatible with an Epichloe
endophyte comprising contacting the germplasm with at least one
Epichloe endophyte, and propagating the germplasm for sufficient
time to determine if the endophyte is or will be present in the
seed of a wheat plant regenerated from, derived from or grown from
the germplasm, wherein the presence of the endophyte in the seed
indicates that the wheat germplasm is compatible with the Epichloe
endophyte.
[0030] In another aspect the invention relates to a method of
identifying an Epichloe endophyte that is compatible with a wheat
germplasm comprising contacting the endophyte with at least one
wheat germplasm, and propagating the germplasm for sufficient time
to determine if the endophyte is or will be present in the seed of
a wheat plant regenerated to from, derived from or grown from the
germplasm, wherein the presence of the endophyte in the seed
indicates that the endophyte is compatible with a wheat
germplasm.
[0031] Other aspects of the invention may become apparent from the
following description which is given by way of example only and
with reference to the accompanying drawings.
[0032] The invention may also be said broadly to consist in the
parts, elements and features referred to or indicated in the
specification of application, individually or collectively, in any
or all combinations of two or more of said parts, elements or
features, and where specific integers are mentioned herein that
have known equivalents in the art to which the invention relates,
such known equivalents are deemed to be incorporated herein as if
individually set forth.
BRIEF DESCRIPTION OF THE DRAWINGS
[0033] The invention will now be described by way of example only
and with reference to the drawings in which:
[0034] FIG. 1: Symbiotic phenotypes observed in Experiment 2. 1a:
Chinese Spring uninfected; 1b: Line TACBOW0236 infected with AR3060
(left) and uninfected (right); 1c: Line TACBOW0059 infected with
AR3060 (left) and uninfected (right); 1d: Monad infected (left) and
uninfected (right).
[0035] FIG. 2: Seed squash depicting transmission of Epichloe
endophyte into a wheat grain.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0036] The following definitions are presented to better define the
present invention and as a guide for those of ordinary skill in the
art in the practice of the present invention.
[0037] Unless otherwise specified, all technical and scientific
terms used herein are to be understood as having the same meanings
as is understood by one of ordinary skill in the relevant art to
which this disclosure pertains. Examples of definitions of common
terms in botany, microbiology, molecular biology and biochemistry
can be found in Biology of Plants, Raven et al. (eds.), W.H.
Freeman and Company, (2005); Plant Physiology, Taiz et al. (eds.),
Sinauer Associates, Incorporated, (2010); Botany: An Introduction
to Plant Biology, J. D. Mauseth, Jones & Bartlett Learning,
(2003); Methods for General and Molecular Microbiology, 3rd
Edition, C. A. Reddy, et al. (eds.), ASM Press, (2008);
Encyclopedia of Microbiology, 2nd ed., Joshua Lederburg, (ed.),
Academic Press, (2000); Microbiology By Cliffs Notes, I. Edward
Alcamo, Wiley, (1996); Dictionary of Microbiology and Molecular
Biology, Singleton et al. (2d ed.) (1994); Biology of
Microorganisms 11.sup.th ed., Brock et al., Pearson Prentice Hall,
(2006); Biodiversity of Fungi: Inventory and Monitoring Methods,
Mueller et al., Academic Press, (2004); Genes IX, Benjamin Lewin,
Jones & Bartlett Publishing, (2007); The Encyclopedia of
Molecular Biology, Kendrew et al. (eds.), Blackwell Science Ltd.,
(1994); Molecular Biology and Biotechnology: a Comprehensive Desk
Reference, Robert A. Meyers (ed.), VCH Publishers, Inc., (1995);
Symbioses of grasses with seedborne fungal endophytes. Schardl C L
et al. (2004) Annual Review of Plant Biology 55: 315-340; and
Chemotype diversity of Epichloe, fungal symbionts of grasses,
Schardl C L, Young C A, Faulkner J R, Florea S, Pan J (2012) Fungal
Ecology 331-344 (Schardl et al., 2012).
[0038] It is also believed that practice of the present invention
can be performed using standard botanical, microbiological,
molecular biology and biochemistry protocols and procedures as
known in the art, and as described, for example in Methods of
Studying Root Systems, vol. 33, Wolfgang Bahm, Springer-Verlag,
(1979); Root methods: A Handbook, Albert L. Smit Springer, (2000);
Biodiversity of Fungi: Inventory and Monitoring Methods, Mueller et
al., Academic Press, (2004); Environmental Microbiology: Methods
and Protocols, J. F. T. Spencer et al., Humana Press, (2004);
Environmental Microbiology, P. D. Sharma, Alpha Science
International, (2005); Environmental Microbiology, J. R.
Leadbetter, Gulf Professional Publishing, (2005), Molecular
Cloning: A Laboratory Manual, Maniatis et al., Cold Spring Harbor
Laboratory Press, (1982); Molecular Cloning: A Laboratory Manual (2
ed.), Sambrook et al., Cold Spring Harbor Laboratory Press, (1989);
Guide to Molecular Cloning Techniques Vol. 152, S. L. Berger and A.
R. Kimmerl (Eds.), Academic Press Inc., (1987); Biotechnology of
Endophytic Fungi of Grasses. 1994 Bacon and White (Eds.), and other
commonly available reference materials relevant in the art to which
this disclosure pertains, and which are all incorporated by
reference herein in their entireties.
[0039] The term "plant" as used herein encompasses whole plants and
all parts of a plant from all stages of a plant life cycle
including but not limited to vegetative and reproductive cells and
tissues, germplasm, propagules, seeds, embryos, shoots, stems,
leaves, leaf sheaths and blades, inflorescences, roots, anthers,
ligules, palisade, mesophyll, epidermis, auricles, palea, lemma and
tillers.
[0040] The term "wheat plant" as used herein specifically encompass
wheat plant parts, including but not limited to all parts of a
wheat plant from all stages of a wheat plant life cycle including
but not limited to vegetative and reproductive cells and tissues,
germplasm, propagules, seeds, embryos, shoots, stems, leaves, leaf
sheaths and blades, inflorescences, roots, anthers, ligules,
palisade, mesophyll, epidermis, auricles, palea, lemma and
tillers.
[0041] The term "alien" when used in reference to a gene, or
chromosome or part thereof that is present in a wheat plant means
that the gene, or chromosome or part thereof is not naturally
present in the wheat plant but has been introduced by artificial
manipulation of the wheat plant genetics.
[0042] The term, "Epichloe" as used herein refers to a collective
group of fungal endophytes previously referred to in the literature
as the "epichloae", an endophyte group containing the two
previously named genera of fungal endophytes: the members of the
anamorphic forms Neotyphodium and the members of the teleomorphic
forms Epichloe (Leuchtmann et al., 2014).
[0043] The term, "conferring at least some level of pest protection
or pest resistance or both" and grammatical variations thereof as
used herein encompasses an increase in pest protection or
resistance that results in a measurable reduction in the incidence,
severity and/or duration of the effects of a pest on a wheat plant,
particularly detrimental effects, as compared to a control plant
that is a host plant lacking the Epichloe fungal endophyte or a
host plant combined with a different fungal endophyte. Preferably a
measurable reduction is a statistically significant reduction with
a P-value of 0.05 or less.
[0044] The terms, "a level sufficient to confer pest protection"
and "a level sufficient to confer pest resistance" and grammatical
variations thereof as used herein with reference to levels of
secondary metabolites, particularly alkaloids, mean any level of a
secondary metabolite, particularly an alkaloid, that when produced
by a stable plant-endophyte symbiosis, is sufficient to produce a
measurable reduction in the incidence, severity or duration of a
pest infestation or infection or detrimental effect due to the pest
infestation or infection, on a wheat plant that is infected with an
Epichloe fungal endophyte according to the invention as compared to
a control plant that is a host plant lacking the Epichloe fungal
endophyte or a host plant combined with a different fungal
endophyte.
[0045] Preferably the alkaloid is an Epichloe synthesized alkaloid
with demonstrated bioactivity. Preferably the alkaloid is an indole
diterpene alkaloid or an ergot alkaloid or peramine or loline or a
loline derivative. Preferably a measurable reduction is a
statistically significant reduction with a P-value of 0.05 or
less.
[0046] The term, "has increased resistance to plant disease" and
grammatical variations thereof as used herein encompasses
measurably reducing the incidence, severity and/or duration of the
effects of a plant disease on a host plant as compared to a control
plant that is a host plant lacking the Epichloe fungal endophyte or
a host plant combined with a different fungal endophyte.
[0047] In some embodiments the host plant is a Triticum spp.
(wheat) plant, preferably a T. aestivum host plant that is infected
with an Epichloe fungal endophyte according to the invention.
Preferably a measurable reduction is a statistically significant
reduction with a P-value of 0.05 or less.
[0048] The terms, "a level sufficient to confer protection from
plant disease" and "a level sufficient to confer resistance to
plant disease" and grammatical variations thereof as used herein
with reference to levels of alkaloids mean any level of an alkaloid
produced by the host plant-endophyte symbiosis that is sufficient
to produce a measurable reduction in the incidence, severity or
duration of a plant disease infestation, infection or detrimental
effect on a host plant as compared to a control plant that is a
host plant lacking the Epichloe fungal endophyte or a host plant
combined with a different fungal endophyte, preferably wherein the
host plant is a wheat plant. Preferably the alkaloid is an Epichloe
synthesized alkaloid with demonstrated bioactivity. Preferably the
alkaloid is an indole diterpene alkaloid or an ergot alkaloid or
peramine or loline or a loline derivative. Preferably a measurable
reduction is a statistically significant reduction with a P-value
of 0.05 or less.
[0049] The term "statistically significant" as used herein refers
to the likelihood that a result or relationship is caused by
something other than random chance. A result may be found to be
statistically significant using statistical hypothesis testing as
known and used in the art. Statistical hypothesis testing provides
a "P-value" as known in the art, which represents the probability
that the measured result is due to random chance alone. It is
believed to be generally accepted in the art that levels of
significance of 5% (0.05) or lower are considered to be
statistically significant.
[0050] The term, "enhanced pest protection" as used herein refers
to a level of pest protection conferred on a wheat plant in stable
symbiotic association with an Epichloe fungal endophyte that
reduces the incidence, severity and/or duration of a pest
infestation, infection or detrimental effect on the wheat plant due
to the presence and/or activity of a given pest as compared to the
incidence, severity and/or duration of the same pest infestation,
infection and/or detrimental effect on a wheat plant lacking a
fungal endophyte (a control plant), and/or a wheat plant having a
different fungal endophyte.
[0051] The terms, "artificially infecting", "artificially
inoculating", "artificial inoculation" and other similar
grammatical variations mean any inoculation or infection of a
plant, particularly a wheat plant, with a fungal endophyte to form
a plant/fungal symbiotic association that is not known from
nature.
[0052] The term "in planta" as used herein in the context of fungal
endophytes refers to the endophyte when it is living symbiotically
within a host plant. Preferably the fungal endophyte is living in a
stable symbiotic association within the host plant.
[0053] The terms a "stable symbiosis", "stable symbiotic
association" and "stable symbiotic combination", and grammatical
variations thereof, mean that the endophyte is vertically
transmitted via the normal life cycle of the host plant to the next
generation of host plant via seed. Being "vertically transmitted",
including to the next generation of host plant via seed, means that
the host plant is infected with the endophyte in a first generation
and produces seeds which when germinated grow into a second
generation of host plants that are also infected with the
endophyte.
[0054] The term "receptive wheat plant or part thereof" and
grammatical variations thereof means a wheat plant or part thereof
that is able to be infected by an Epichloe fungal endophyte to form
a stable symbiosis.
[0055] The term "normal life cycle" as used herein refers to the
normal reproductive cycle of wheat, particularly a hexaploid wheat,
which includes growth of a first generation of plant to produce
seeds which when germinated grow into a second generation of
plant.
[0056] The term "normal phenotype" of a host plant as used herein
refers to the typical morphology, growth and other phenotypic
characteristics of the host plant as displayed during the life
cycle of the host plant, including the host plant reproductive
cycle and host plant seed as known and generally accepted in the
art for that host plant when not containing endophyte. In a
preferred embodiment, a normal phenotype is a tall floral
phenotype.
[0057] The term "abnormal phenotype" referring to a host plant as
used herein refers to the morphology, growth or other phenotypic
characteristics of the host plant at any stage of the host plant
life cycle including the host plant reproductive cycle and host
plant seed which is different from that known and generally
accepted in the art as typical or within the generally observed
range for that host plant. The term "abnormal phenotype" referring
to a host plant as used herein may include stunted plants or dwarf
plants or plants with obvious visual external evidence of endophyte
infection or plants failing to complete normal reproduction through
seed but is not limited thereto.
[0058] The term "comprising" as used in this specification means
"consisting at least in part of". When interpreting statements in
this specification that include that term, the features, prefaced
by that term in each statement, all need to be present but other
features can also be present. Related terms such as "comprise" and
"comprised" are to be interpreted in the same manner.
[0059] The term "consisting essentially of" as used herein means
the specified materials or steps and those that do not materially
affect the basic and novel characteristic(s) of the claimed
invention.
[0060] The term "consisting of" as used herein means the specified
materials or steps of the claimed invention, excluding any element,
step, or ingredient not specified in the claim.
[0061] It is intended that reference to a range of numbers
disclosed herein (for example, 1 to 10) also incorporates reference
to all rational numbers within that range (for example, 1, 1.1, 2,
3, 3.9, 4, 5, 6, 6.5, 7, 8, 9 and 10) and also any range of
rational numbers within that range (for example, 2 to 8, 1.5 to 5.5
and 3.1 to 4.7) and, therefore, all sub-ranges of all ranges
expressly disclosed herein are hereby expressly disclosed. These
are only examples of what is specifically intended and all possible
combinations of numerical values between the lowest value and the
highest value enumerated are to be considered to be expressly
stated in this application in a similar manner.
DETAILED DESCRIPTION
[0062] Many cool-season grasses (Poaceae, subfam. Pooideae) possess
seed-borne Epichloe fungal endophytes that are known for their
bioprotective properties, and especially for production of
anti-pest alkaloids such as lolines (Zhang et al., 2010) and
peramine (Koulman et al., 2007). Asexual Epichloe (Neotyphodium
species) are primarily or entirely transmitted vertically, whereas
the sexual structures (stromata) of the related Epichloe species
can give rise to horizontally transmissible spores (ascospores)
(Zhang et al., 2010).
[0063] The majority of Neotyphodium species are considered closely
related to species of the genus Epichloe. Many Neotyphodium species
may have evolved from Epichloe by processes involving interspecific
hybridization (Tsai et al., 1994). Based on molecular phylogenetic
evidence, some authors consider that asexual Neotyphodium species
are derived either from individual Epichloe species, or from
hybrids sharing at least two ancestral Epichloe species (Tsai et
al., 1994; Moon et al., 2004). Current taxonomy considers that the
members of the anamorphic form genus Neotyphodium are very closely
related to members within the teleomorphic genus Epichloe (Glenn et
al., 1996). Following previous codes of botanical nomenclature,
anamorphic form genus refers to an asexual spore or vegetative
state, and a teleomorphic genus refers to the sexual state.
Currently the code of botanical nomenclature treats a single fungus
with a single naming protocol (Miller et al. 2011). Collectively,
the two genera, Neotyphodium and Epichloe, are known in the art as
the "Epichloe" endophytes, although these two genera have been
merged recently into the single genus, Epichloe (Leuchtmann et al.,
2014).
[0064] Symbiotic associations between Epichloe fungi and host
grasses are common, and molecular phylogenetic evidence suggests
that the species specificity observed in these symbiotic
associations is due to the co-evolution of these groups of plants
and fungal endophytes (Schardl et al., 2008).
[0065] No modern domesticated cereals are naturally infected with
Epichloe endophytes although some wild type relatives may be
(Marshall et al., 1999). Without wishing to be bound by theory, the
inventors believe that during the evolution of modern cereals,
agricultural practices such as storing seed may have led to the
loss of historical associations, if they existed (Welty et al.,
1987).
[0066] Generally speaking, symbiotic associations formed between
host plants and their Epichloe fungal endophytes are based on
complex and intimate biological interactions which lead to a high
degree of species specificity for both the endophyte and host
(Simpson and Mace, 2012).
[0067] Accordingly, establishment of a stable plant/fungal
symbiosis between an Epichloe fungal endophyte and a host plant
that is not a natural host for the fungus is both problematic and
unpredictable (Simpson and Mace, 2012). Of note, modern wheat
cultivars do not naturally harbour Epichloe endophytes. As the
skilled artisan will appreciate endophytes are host specific and it
is difficult to move endophytes between different host species.
[0068] This is thought to be due to the requirement, in the
formation of such symbioses, for successful integration of multiple
biological variables between partners which can include ecological,
biochemical and/or molecular incompatibilities (Christensen et al.,
2000). The present disclosure details the large volume of research
required, including significant trial and error experimentation, to
develop successful protocols and procedures by which stable
symbiotic associations between certain strains of Epichloe fungal
endophytes and wheat plants that are not the natural hosts for such
fungi have been established.
[0069] Surprisingly, the inventors have determined that artificial
inoculation can be used to establish stable symbioses between some
Epichloe fungal endophytes and wheat plants, particularly hexaploid
wheat plants. Through the use of the inventive methods described
herein, the inventors are able to produce infected wheat plants
that form a stable symbiotic association with the infecting fungus
allowing the infected plant to progress through a normal life
cycle, particularly that produce a tall floral phenotype that
progresses through a normal life cycle including producing seed
containing the endophyte that is able to germinate to form an
infected next generation of the host plant.
[0070] Additionally, the inventors have found that methods
disclosed herein can identify symbiotic associations that can
provide at least some level of benefit to the host plant in terms
of the production in the plant of at least one metabolite,
preferably at least one secondary metabolite, preferably an
alkaloid, that may confer at least some level of pest protection or
resistance and/or at least some level of disease protection or
resistance to the host plant, particularly a wheat host plant. Of
particular interest are stable symbiotic associations that produce
at least one loline alkaloid, loline alkaloid derivative, indole
diterpene alkaloid, peramine or ergot alkaloid or a combination
thereof. Also, of particular interest in this invention are stable
symbiotic associations that produce at least one secondary
metabolite, preferably at least one alkaloid, wherein the
association does not produce known mammalian toxins, preferably
ergovaline and/or lolitrem B.
[0071] This has meant similar efforts to introduce Epichloe
endophytes into modern wheat, which do not naturally harbour
endophytes, have struggled in creating a stable combination, where
the resulting combination often shows a compromised phenotype,
particularly in its stature and reproductive ability. This has
meant that resulting combinations are stunted in stature and often
do not set seed, or if seeds are made, they are visibly less
healthy, appearing shrivelled.
[0072] The inventors have surprisingly determined that certain
fungal endophyte isolates taken from wild relatives of cereals are
suitable for establishing stable plant/fungal symbioses with wheat
plants. In particular, the inventors have established stable
symbiotic associations that result in an Epichloe fungal
endophyte/wheat plant combination that may have at least some level
of enhanced pest protection or resistance as compared to wheat
control plants; i.e., plants of the same wheat species or line that
are un-infected with the same symbiotic Epichloe fungal strain.
Without wishing to be bound by theory, the inventors believe that
enhanced pest protection or resistance is to be expected in fungal
endophyte/host plant combinations that produce certain secondary
metabolites, particularly alkaloids, particularly loline, loline
derivatives, indole diterpenes, ergot alkaloids and/or peramine.
For example, certain fungal endophyte/host plant combinations are
expected to produce peramine, N-acetylnorloline, loline,
N-formylloline, N-acetylloline and/or N-methylloline, but not
limited thereto. Other fungal endophyte/host plant combinations are
expected to produce other metabolites, particularly secondary
metabolites that have previously demonstrated bioactivity. In one
non-limiting example such secondary metabolites may be alkaloids.
Preferably such alkaloids are not ergovaline, lolitrem B or
derivatives or variants of these alkaloids that have previously
demonstrated mammalian toxicity.
[0073] The inventors believe that the production of secondary
metabolites, particularly alkaloids, particularly indole diterpenes
and/or loline and/or peramine and/or ergot alkaloid(s) by the
Epichloe fungal endophyte or the fungal endophyte/host plant
combination provides at least some level of enhanced pest
protection and/or increased disease resistance to the host plant.
In particular, following from the use of the inventive methods
disclosed herein, the inventors anticipate that wheat plants,
particularly hexaploid wheat plants, particularly T. aestivum spp.
host plants, infected with certain strains of Epichloe fungal
endophyte will have enhanced protection against a variety of pests,
including insect pests, as compared to wheat control plants.
[0074] As a result of a lengthy research program, the applicants
have identified for the first time, Epichloe fungi that form stable
plant/fungal symbioses with wheat plants and have established that
these and other Epichloe fungi can be used in methods of screening
wheat plants for endophyte compatibility and/or for identifying
and/or selecting wheat plants that will form stable symbioses with
an Epichloe.
[0075] The applicants have further identified endophytes capable of
conferring to an infected wheat host plant, when in symbiosis with
that plant, the ability to produce one or more alkaloids known to
provide at least some level of enhanced pest protection to the
plant, as compared to an un-infected control plant. In particular,
the one or more alkaloids may be loline, loline derivatives or
peramine alkaloids.
[0076] In one aspect the invention relates to an isolated strain of
Epichloe fungal endophyte selected from the group consisting of
AR3002 (NRRL#50579), AR3013 (NRRL#67557), AR3060 (NRRL#67592),
AR3070 (NRRL#67564) and AR3108 (NRRL#67572), and combinations
thereof. Also described herein is the isolated strain of Epichloe
fungal endophyte: AR3067 (NRRL#50719).
[0077] Fungal endophyte strains AR3002, AR3013, AR3060, AR3067,
AR3070 and AR3108 were deposited at The United States Department of
Agriculture, Agricultural Research Service Midwest Area, National
Center for Agricultural Utilization Research, 1815 North University
Street, Peoria, Ill., 61604-3902, USA on the dates shown below for
strains:
[0078] AR3002 (NRRL#50579) on 13 Oct. 2011
[0079] AR3013 (NRRL#67557) on 5 Feb. 2018
[0080] AR3060 (NRRL#67592) on 5 Feb. 2018
[0081] AR3067 (NRRL#50719) on 6 Mar. 2012
[0082] AR3070 (NRRL#67592) on 5 Feb. 2018, and
[0083] AR3108 (NRRL#67572) on 5 Feb. 2018
[0084] according to the Budapest Treaty for purposes of patent
procedure.
[0085] AR3067 was first deposited in relation to PCT/IB2014/059479,
the entirety of which is incorporated by reference herein.
[0086] The endophytes were isolated from Elymus spp., including E.
mutabilis, E. dahuricus, E. dahuricus sub species excelsus, E.
elymoides sub species brevifolius and/or E. uralensis obtained from
locations in Canada, China, Kyrgyzstan, Kazakhstan, the USSR and
Russia as described in PCT IB/2014/059479, the entirety of which is
herein incorporated by reference.
[0087] Endophytes were isolated from the plants following surface
sterilisation of plant tissue as described by Christensen et al.
(2002).
[0088] Once isolated, the isolated and/or biologically pure fungal
endophyte may be cultured using standard techniques as known in the
art and as disclosed herein, including in the examples.
[0089] In one embodiment the isolated strain of Epichloe endophyte
comprises at least one SSR allele selected from the group
consisting of ans016, ans019, ans033, ans036, egs027, egs031,
ces0004, ces0022, ces0041, ces0054, ces0060, ces0061, ces0067,
ces0075, ces0076, ces0078, ces0089, ces0093, ces0094, and ces0095
as shown by strain in Table 2, wherein the at least one SSR allele
has the number of base pairs (bp) as shown in Table 2, .+-.0.8
bp.
[0090] In one embodiment the isolated strain of Epichloe endophyte
comprises at least two SSR alleles, preferably at least 3, at least
4, at least 5, at least 6, at least 7, at least 8, at least 9, at
least 10, at least 11, at least 12, at least 13, at least 14, at
least 15, at least 16, at least 17, at least 18, at least 19
additional SSR alleles, preferably 20 SSR alleles as shown by
strain in Table 2, wherein each of the additional SSR alleles has
the number of base pairs (bp) as shown in Table 2, .+-.0.8 bp.
[0091] In one embodiment the isolated strain of Epichloe endophyte
comprises the following 22 SSR alleles: B10, B11, ans016, ans019,
ans033, ans036, egs027, egs031, ces0004, ces0022, ces0041, ces0054,
ces0060, ces0061, ces0067, ces0075, ces0076, ces0078, ces0089,
ces0093, ces0094, and ces0095 as shown by strain in Table 2,
wherein the 22 SSR alleles have the number of base pairs (bp) as
shown in Table 2, .+-.0.8 bp.
[0092] In another aspect the invention relates to a stable
symbiotic combination comprising an isolated Epichloe fungal
endophyte selected from the group consisting of AR3002
(NRRL#50579), AR3013 (NRRL#67557), AR3060 (NRRL#67592), AR3067
(NRRL#50719), AR3070 (NRRL#67564) and AR3108 (NRRL#67572), and
combinations thereof.
[0093] Accordingly, in another aspect the invention relates to a
method of identifying a wheat plant that forms a stable symbiotic
combination with a fungal endophyte comprising [0094] artificially
inoculating a fungal endophyte into a candidate wheat plant to form
a wheat plant/endophyte combination, [0095] propagating the wheat
plant/endophyte combination, [0096] obtaining seed from the
propagated combination, and [0097] identifying the presence of the
endophyte in the seed, and [0098] optionally selecting a wheat
plant that is capable of forming a stable symbiotic combination
with a fungal endophyte.
[0099] In one embodiment the fungal endophyte is an Epichloe fungal
endophyte. In one embodiment the Epichloe fungal endophyte was
isolated from wild cereal grasses, preferably Elymus spp. grasses
and/or Hordeum species grasses. In one embodiment the Epichloe
fungal endophyte was isolated from a genus within the grass tribe
Hordeeae (Triticeace). In one embodiment the Epichloe fungal
endophyte is a species or strain of Epichloe bromicola or a hybrid
strain of E. bromicola and another Epichloe species.
[0100] In one embodiment the fungal endophyte is a fungal endophyte
isolated from Elymus spp. Preferably the fungal endophyte is AR3002
isolated from E. dahuricus, E. dahuricus sub species excelsus,
and/or E. uralensis.
[0101] In one embodiment the Epichloe fungal endophyte strain is
selected from the group consisting of AR3002 (NRRL#50579), AR3013
(NRRL#67557), AR3060 (NRRL#67592), AR3067 (NRRL#50719), AR3070
(NRRL#67564) and AR3108 (NRRL#67572), and combinations thereof.
[0102] In one embodiment the isolated strain is AR3002.
[0103] In one embodiment the isolated strain is AR3013.
[0104] In one embodiment the isolated strain is AR3060.
[0105] In one embodiment the isolated strain is AR3067.
[0106] In one embodiment the isolated strain is AR3070.
[0107] In one embodiment the isolated strain is AR3108.
[0108] In one embodiment the wheat plant comprises chromosome
modifications that increase the compatibility of the wheat plant
with an Epichloe endophyte infection.
[0109] Ultimately the combination of the wheat plant and Epichloe
fungal endophyte in a stable symbiotic association is selected that
produces secondary metabolites, preferably alkaloids such as
lolines, peramines, indole diterpenes, or other pesticidal
alkaloids that provide deterrence against pests and diseases,
abiotic stress protection and as such also have the potential to
provide future-proofing of various crops against the effects of
climate change.
[0110] In another embodiment the wheat plant is a plant from a line
obtained from the Tottori Alien Chromosome Bank of Wheat (TACBOW)
selected from the group consisting of TACBOW0003, TACBOW0005,
TACBOW0010, TACBOW0011, TACBOW0018, TACBOW0028, TACBOW0044,
TACBOW0045, TACBOW0054, TACBOW0059, TACBOW0067, TACBOW0128,
TACBOW0209, TACBOW0221, TACBOW0226, TACBOW0236, TACBOW0237,
TACBOW0244, TACBOW0260, TACBOW0261, TACBOW0272, and TACBOW0275.
[0111] Under certain conditions, fungal endophytes that are
obligate symbionts of one host plant species or strain may be
introduced to different host plant species or strain to form a
combination that is not normally found in nature. However, such
combinations can be unstable and result in host plants having an
abnormal phenotype, i.e., abnormal morphological and/or
physiological features as compared to host plants of the same
line/cultivar or species that are either uninfected or that
comprise a naturally occurring symbiont. Abnormal phenotypic
features can include dwarf plants (Simpson and Mace, 2012; Simpson
et al. 2014), plants with conspicuous epiphytic growth (Christensen
et al., 2012), vascular bundle colonisation (Christensen et al.,
2001) and localised cell death (Christensen, 1995).
[0112] The applicant is the first to provide a stable symbiotic
combination between wheat plants and Epichloe fungal endophytes
that results in a stable plant/fungal combination that shows no
abnormal effects of endophyte infection. Stable symbiotic
combinations provided herein can exhibit a normal morphological
phenotype. In some embodiments a stable symbiotic combination
exhibits a normal morphological phenotype that is a tall floral
phenotype as described herein. In some embodiments a stable
symbiotic combination exhibits a tall floral phenotype that has a
complete and normal reproductive cycle.
[0113] In one embodiment the wheat plant in the combination shows a
normal morphological phenotype. In one embodiment the normal
morphological phenotype is a tall floral phenotype that produces
seed containing the endophyte. In one embodiment the seed is
viable. In one embodiment the seed will germinate to form a next
generation of the combination.
[0114] In one embodiment the wheat plant/endophyte combination
produces at least one secondary metabolite, preferably at least one
alkaloid that confers at least some level of pest protection or
resistance, or disease protection or resistance, on the
combination. In one embodiment the alkaloid is selected from the
group consisting of lolines, peramine, indole diterpene alkaloids
and ergot alkaloids.
[0115] In one embodiment the alkaloid is selected from the group
consisting of peramine, N-acetylnorloline, loline, N-formylloline,
N-acetylloline and N-methylloline.
[0116] In one embodiment the alkaloid confers at least some level
of pest protection or pest resistance on the plant/endophyte
combination.
[0117] In one embodiment the alkaloid confers at least some level
of disease protection or disease resistance on the wheat
plant/endophyte combination.
[0118] In one embodiment the alkaloid is produced at a level
sufficient to confer pest protection or pest resistance to the
wheat plant/endophyte combination.
[0119] In one embodiment the alkaloid is produced at a level
sufficient to confer protection or resistance to wheat plant
disease to the plant/endophyte combination.
[0120] In one embodiment the wheat plant/endophyte combination has
increased resistance to pests or increased resistance to plant
disease or both, as compared to a wheat plant that is not infected
with an Epichloe endophyte.
[0121] In one embodiment the wheat plant/endophyte combination has
increased resistance to pests, wherein the pests are selected from
the group consisting of: (1) species of aphids selected from the
group consisting of Rhopalosiphum padi, Schizaphis graminum,
Rhopalosiphum maidis, Metopoliphium dirhodum, Sitobion spp.,
Sitobion avenae, Sitobion fragariae, and Diuraphis noxis; (2)
species of grass and cereal flies selected from the group
consisting of Oscinella frit, Oscinella pusilla, Mayetiola
destructor, Cerodontha spp., Cerodontha australis, Cerodontha
angustipennis, Formia fumigata, Meromyze americana, Haplodiplosis
marginata, Chlorops pumilionis, Tipula spp. Chromatomyia fuscula,
Cephus pygmaeus, Chromatomyia fuscula, and Contarinia tritici; (3)
species of thrips selected from the group consisting of Limothrips
cerealium, Limothrips denticornis, Aptinothrips rufus, and
Stenothrips graminum; (4) species of grasshoppers and crickets
selected from the group consisting of Locusta migratoria,
Phaulacridium marginate, Phaulacridium vittatum, Melanoplus spp.,
and Teleogryllus commodus; (5) species of bugs Nyssius huttoni or
Blissus leucopertus leucopertus; (6) weevils of Sphenophorus spp.
or Listronotus spp., including Listronotus bonariensis (Argentine
stem weevil); (7) species of armyworm, cutworm and leafrollers
selected from the group consisting of Pseudaletia umpuncta,
Spodoptera spp., Mythimna separata; Persectania aversa, Agrotis
ipsilon and Epiphyas postvittana; (8) Oulema melanopus leaf bugs;
(9) species of white grubs selected from the group consisting of
Popillia japonica, Costelytra giveni (formerly C. zealandica),
Phyllopertha spp., Rhizotrogus majalis, and Anisoplia segetum; (10)
species of mealybug selected from the group consisting of
Phenacoccus hordei, Balanococcus poae, Ripersella rumicis, and
Porphyrophora tritici; (11) species of wireworms Conoderus spp., or
Limonius spp.; (12) Zabrus tenebrioides beetles; (13) species of
mites selected from the group consisting of Penthaleus spp.,
Halotydeus destructor, and Aceria spp.; (14) species of stored
product pests selected from the group consisting of Sitophilus
oryzae, Sitophilus granarius, Sitotroga cerealella, Rhyzopertha
dominica, Cryptolestes spp., Oryzaephilus surinamensis, Cadra
cautella, Plodia interpunctella, Tribolium confusum, Tribolium
castaneum, and Lasioderma erricorne; (15) Philaenus spumarius
froghoppers; (16) species of nematodes selected from the group
consisting of root lesion nematodes of Pratylenchus spp. selected
from the group consisting of P. thornei, P. crenatus, P. neglectus
and P. penetrans, cereal cyst nematodes of Heterodera spp. and
Punctodera spp. selected from the group consisting of H. avenae, H.
latipons, H. hordecalis, H. filipjevi, H. mani, H. bifenestra, H.
pakistanensis and P. punctata, root knot nematodes of Meloidogyne
spp. selected from the group consisting of M. chitwoodi, M. naasi,
M. artiellia, M. microtyla, M. ottersoni, M. graminicola, M.
graminis, M. kikuyensis and M. spartinae, stem nematodes of
Ditylenchus spp. selected from the group consisting of D. dipsicai
and D. radicicola; and the seed gall nematode Anguina tritici; (17)
species of slugs selected from the group consisting of Deroceras
reticulatum, Arion hortensis agg. and A. subfuscus.
[0122] In one embodiment the pests are nematodes, preferably root
lesion nematodes (Pratylenchus spp.).
[0123] In one embodiment the pests are Listronotus bonariensis
(Argentine stem weevil).
[0124] In one embodiment the wheat plant/endophyte combination has
increased resistance to plant disease, wherein the plant disease is
caused by a plant pathogen selected from the group consisting of
Barley yellow dwarf virus (Leteovirus), wheat soil-borne mosaic
virus (Furovirus) and wheat streak mosaic virus (Tritimovirus),
Xanthomonas campestris, Pseudomonas syringae, Colletotrichum
graminicola, Glomerella graminicola [teleomorph], Alternaria spp.,
Cladosporium herbarum, Mycosphaerella tassiana [teleomorph],
Epicoccum spp., Sporobolomyces spp., Stemphylium spp., Bipolaris
sorokiniana, Cochliobolus sativus [teleomorph], Fusarium spp.,
Tilletia caries, Tilletia tritici, Tilletia laevis, Tilletia
foetida, Hymenula cerealis, Cephalosporium gramineum,
Helminthosporium sativum, Cochliobolus sativus [teleomorph],
Coprinus sychromorbidus, Dilophospora alopecuri, Tilletia
controversa, Claviceps purpurea, Sphacelia segetum [anamorph],
Fusarium culmorum, Pseudoseptoria donacis, Selenophoma donacis,
Neovossia indica, Tilletia indica, Puccinia recondita, Aecidium
clematidis [anamorph], Cercosporidium graminis, Scolicotrichum
graminis, Phaeosphaeria herpotrichoides, Leptosphaeria
herpotrichoides, Ustilago tritici, Microdochiurn nivale, Fusarium
nivale, Monographella nivalis [teleomorph], Erysiphe graminis,
Pythium aphanidermatum, Pythium arrhenomanes, Pythium debaryanum,
Pythium graminicola, Pythium ultimum, Gibberella zeae, Fusarium
graminearum [anamorph], Septoria secalis, Septoria tritici,
Mycosphaerella graminicola [teleomorph], Rhizoctonia cerealis,
Rhizoctonia solani, Rhizoctonia zeae, Blumeria spp., Ceratobasidium
cereale [teleomorph], Myriosclerotinia borealis, Sclerotinia
borealis, Typhula idahoensis, Typhula incarnate, Typhula
ishikariensis, Typhula ishikariensis var. canadensis, Stagonospora
nodorum, Septoria nodorum, Phaeosphaeria nodorum [teleomorph],
Leptosphaeria nodorum, Urocystis occulta, Puccinia graminis,
Aspergillus spp., Nigrospora spp., Penicillium spp., Rhizopus spp.,
Pseudocercosporella herpotrichoides, Tapesia acuformis
[teleomorph], Uredo glumarum [anamorph], Pyrenophora
tritici-repentis, Drechslera tritici-repentis [anamorph],
Helminthosporium tritici-repentis, Puccinia triticina, Pythium
spp., Rhynchosporiurn secalis, Puccinia striiformis, Gaeumannomyces
graminis, Magnaporthe oryzae and Fusarium pseudo graminearum.
[0125] Preferably the plant pathogen is Puccinia recondita,
Puccinia triticina, Puccinia graminis, Fusarium spp., Pythium spp.,
Rhynchosporiurn secalis, Puccinia striiformis, Gaeumannomyces
graminis, or Fusarium pseudograminearum.
[0126] In one embodiment propagating the wheat plant/endophyte
combination through at least one generation comprises propagating
the wheat plant/endophyte combination until the endophyte is
vertically transmitted from the first generation of the wheat plant
to a second generation of the wheat plant. In one embodiment,
vertical transmission is by propagule, floral tiller or seed. In
one embodiment vertical transmission is by floral tillers and
subsequently produced seed. Preferably vertical transmission is by
seed.
[0127] In one embodiment propagating the wheat plant/endophyte
combination through at least one generation comprises growing the
wheat plant/endophyte combination until it produces seeds.
[0128] In one embodiment propagating is for sufficient time to
determine if the endophyte is or will be present in the seed of the
wheat plant. In one embodiment the method comprises a step of,
after determining if the endophyte is or will be present in the
seed of the wheat plant, selecting the endophyte as an endophyte
that forms stable symbioses with wheat.
[0129] In one embodiment identifying comprises determining that the
endophyte is present in the seed using metabolic, genetic or
morphological criteria.
[0130] In one embodiment the morphological criteria comprise
visualizing the endophyte in a seed squash prepared from the
seed.
[0131] In one embodiment selecting a wheat plant comprises
germinating and growing the seed to obtain a second generation
wheat plant, identifying that the second generation wheat plant is
a stable symbiotic association comprising the candidate endophyte,
and selecting the candidate endophyte as an endophyte that forms a
stable symbiotic association in a wheat plant.
[0132] In one embodiment selecting a wheat plant comprises
selecting a fungal endophyte-wheat plant combination that produces
at least one secondary metabolite at a level sufficient to confer
at least some level of pest protection, pest resistance, disease
protection or disease resistance or a combination thereof on the
wheat plant. Preferably the secondary metabolite is an
alkaloid.
[0133] In one embodiment the at least one alkaloid is selected from
the group consisting of lolines, peramine, indole diterpenes and
ergot alkaloids.
[0134] In one embodiment the at least one alkaloid is selected from
the group consisting of peramine, N-acetylnorloline, loline,
N-formylloline, N-acetylloline and N-methylloline.
[0135] In another aspect the invention relates to a method of
making a stable symbiotic combination comprising a wheat plant and
a fungal endophyte comprising [0136] artificially inoculating a
fungal endophyte into a candidate wheat plant to form a wheat
plant/endophyte combination, [0137] propagating the wheat
plant/endophyte combination, [0138] obtaining seed from the
propagated combination, and [0139] identifying the presence of the
endophyte in the seed, and [0140] optionally selecting a stable
symbiotic combination comprising the wheat plant and the fungal
endophyte.
[0141] In one embodiment selecting a stable symbiotic combination
comprises germinating and growing the seed to obtain a second
generation wheat plant, identifying that the second generation
wheat plant is a stable symbiotic association comprising the
candidate endophyte, and selecting the stable combination.
[0142] In one embodiment selecting comprises selecting a stable
symbiotic combination that produces at least one secondary
metabolite at a level sufficient to confer at least some level of
pest protection, pest resistance, disease protection or disease
resistance or a combination thereof on the wheat plant. Preferably
the secondary metabolite is an alkaloid.
[0143] In one embodiment the at least one alkaloid is selected from
the group consisting of lolines, peramine, indole diterpenes and
ergot alkaloids.
[0144] In one embodiment the at least one alkaloid is selected from
the group consisting of peramine, N-acetylnorloline, loline,
N-formylloline, N-acetylloline and N-methylloline.
[0145] Contemplated herein as specific embodiments of this aspect
of the invention relating to a method of making a stable symbiotic
combination are all of the embodiments set out above relating to
the other aspects of the invention that are an isolated strain of
Epichloe fungal endophyte and a method of identifying a wheat plant
that forms a stable symbiotic association with a fungal endophyte,
including but not limited to particular Epichloe fungal endophytes,
wheat plants, wheat plant/endophyte combinations, secondary
metabolites, and alkaloids produced by wheat plant/endophyte
combinations, all as described herein.
[0146] In another aspect the invention relates to a method of
conferring at least some level of pest protection or resistance on
a wheat plant comprising artificially infecting a wheat plant with
at least one Epichloe fungal endophyte wherein the wheat
plant/endophyte combination produces at least one alkaloid at a
level sufficient to confer at least some level of pest protection
or resistance on the wheat plant.
[0147] In another aspect the invention relates to a method of
conferring at least some level of disease protection or resistance
on a wheat plant comprising artificially infecting a wheat plant
with at least one Epichloe fungal endophyte wherein the wheat
plant/endophyte combination produces at least one alkaloid at a
level sufficient to confer at least some level of disease
protection or resistance on the wheat plant.
[0148] "Artificially inoculating" or "artificially infecting" a
wheat plant according to any of the method aspects of the invention
may be carried out using whole plants, or parts thereof including
germplasm. In one embodiment, artificially inoculating comprises
inoculating wheat seedlings that have been germinated for about two
weeks. Preferably the seedlings have been germinated for 4 to 9
days.
[0149] Outside of this range, seedlings may still form effective
associations but in some cases may be too young or too old for
establishment of the fungal endophyte. Seeds need to be free of
non-target fungi and bacteria to ensure that the seedlings are not
overcome by microbial contamination.
[0150] In one embodiment, artificial inoculation may be carried out
using basal inoculation of wheat seedlings. To effectively
establish the fungal symbiont/wheat plant association, inoculation
of the endophyte should be made into the wheat plant meristem by
incision of the plant and insertion of cultured fungal
mycelium.
[0151] Contemplated herein as specific embodiments of these aspects
of the invention relating to a method of conferring at least some
level of pest or disease protection or resistance on a wheat plant
are all of the embodiments set out above relating to the other
aspects of the invention that are an isolated strain of Epichloe
fungal endophyte, a method of identifying a wheat plant that forms
a stable symbiotic association with a fungal endophyte and a method
of making a stable symbiotic combination, including but not limited
to particular Epichloe fungal endophytes, wheat plants, wheat
plant/endophyte combinations, secondary metabolites, and alkaloids
produced by wheat plant/endophyte combinations, all as described
herein.
[0152] It is known to those familiar in the arts of natural pest
resistance and protection of grasses that Epichloe endophytes
growing symbiotically with host grass plants may confer upon the
combination some protection from pests. In particular it is known
that loline alkaloids and the alkaloid peramine confer some such
protection without notable or known toxicity to mammals or humans
consuming the grass or products derived indirectly from consumption
of the grass.
[0153] Lolines are a group of related bioactive natural products
which share distinct chemical and biological characteristics.
Lolines are alkaloids, i.e. organic compounds containing basic
nitrogen atoms and are chemically defined as saturated
1-aminopyrrolizidines with an internal ether bridge joining two
ring (C-2 to C-7) carbons. The internal ether bridge, which is
uncommon in organic compounds, is considered a signature feature of
the group. The specific lolines include norloline and derivatives
of its 1-amino moiety being loline (with a methyl group),
N-methylloline (with two methyl groups, NML), N-acetylnorloline
(with an acetyl group, NANL), N-acetylloline (with a methyl group
and an acetyl group, NAL) and N-formylloline (with a formyl group,
NFL) (Schardl et al., 2007; Schardl et al., 2012).
[0154] Lolines are known to be generally pesticidal and
pest-deterring compounds produced in grasses infected by endophytic
Epichloe fungal symbionts (Epichloe/Neotyphodium spp.). Lolines
have been shown to increase resistance of the host grass plants to
pest herbivory (Bush et al., 1997). The specific lolines may have
some variations in the bioactivities against specific pests. It has
also been suggested that the presence of lolines may provide a host
plant with some level of protection from environmental stresses
including drought and spatial competition (Malinowski and Belesky,
2000).
[0155] Loline alkaloids are produced in the symbiotic combination
by the fungal endophyte. What is important is the production of
loline alkaloids by the combination, where the production is
induced in the combination by the presence of the fungal endophyte
on or within the plant tissues, particularly by the presence of
fungal hyphae between plant cells. Historically, the reproduction
of the conditions experienced in symbiosis to allow the production
of loline alkaloids in vitro was found to be extremely difficult
(Porter 1994). It was therefore unknown, until relatively recently,
if the loline alkaloids observed to be produced in these symbiotic
associations were produced by the fungal endophyte itself, or if
they were synthesized in the plant in response to infection. Only
relatively recent work by Blankenship et al. (2001) has
demonstrated that the endophyte Neotyphodium uncinatum can produce
lolines in chemically defined growth media. This work suggests that
the endophyte is also the producer of the lolines in its naturally
occurring host grass (Blankenship et al., 2001). Direct chemical
analysis of naturally occurring Epichloe also demonstrates this
effect (Schardl et al., 2007).
[0156] Peramine (a pyrrolopyrazine alkaloid) is a bioactive
alkaloid produced by some combinations of endophytes and plants
(Schardl et al., 2012). Peramine production has been shown to be
dependent upon the functioning of at least one gene of endophyte
origin (Tanaka et al., 2005). Peramine has been shown to be a
feeding deterrent of some insects which cause damage to plants and
can confer protection against infestation of endophyte-infected
plants by some insects (Rowan and Latch, 1994).
[0157] In another aspect the invention relates to a wheat plant
infected with a fungal endophyte wherein the wheat plant is not a
natural host of the endophyte, and wherein the wheat plant and the
fungal endophyte form a stable symbiotic association.
[0158] In one embodiment the wheat plant is a receptive wheat plant
wherein the receptive wheat plant is not a natural host of the
endophyte, and wherein the receptive wheat plant and the fungal
endophyte form a symbiotic association that allows the endophyte to
be vertically transmitted to the next generation via seed.
[0159] In another aspect the invention relates to a wheat seed
infected with a fungal endophyte wherein the wheat seed is not a
natural host of the endophyte, and wherein the wheat seed is
capable of germinating and growing into a wheat plant comprising
the fungal endophyte in a stable symbiotic association.
[0160] In one embodiment the fungal endophyte is an Epichloe fungal
endophyte.
[0161] In one embodiment the wheat seed is a seed from a receptive
wheat plant.
[0162] Contemplated herein as specific embodiments of the aspects
of the invention relating to a wheat plant infected with a fungal
endophyte and a wheat seed infected with a fungal endophyte are all
of the embodiments set out above relating to the other aspects of
the invention that are an isolated strain of Epichloe fungal
endophyte, a method of identifying a wheat plant that forms a
stable symbiotic association with a fungal endophyte, a method of
making a stable symbiotic combination and methods of conferring at
least some level of pest or disease protection or resistance,
including but not limited to particular Epichloe fungal endophytes,
wheat plants, wheat plant/endophyte combinations, secondary
metabolites, and alkaloids produced by wheat plant/endophyte
combinations, all as described herein.
[0163] In another aspect the invention relates to a method of
identifying a wheat germplasm that is compatible with an Epichloe
endophyte comprising contacting the germplasm with at least one
Epichloe endophyte, and propagating the germplasm for sufficient
time to determine if the endophyte is or will be present in the
seed of a wheat plant regenerated from, derived from or grown from
the germplasm, wherein the presence of the endophyte in the seed
indicates that the wheat germplasm is compatible with the Epichloe
endophyte.
[0164] In one embodiment contacting comprises infecting the
germplasm with at least one Epichloe endophyte.
[0165] In one embodiment the method comprises selecting the
identified wheat germplasm.
[0166] In another aspect the invention relates to a method of
identifying an Epichloe endophyte that is compatible with a wheat
germplasm comprising contacting the endophyte with at least one
wheat germplasm, and propagating the germplasm for sufficient time
to determine if the endophyte is or will be present in the seed of
a wheat plant regenerated from, derived from or grown from the
germplasm, wherein the presence of the endophyte in the seed
indicates that the endophyte is compatible with a wheat
germplasm.
[0167] In one embodiment contacting comprises infecting the
germplasm with at least one Epichloe endophyte.
[0168] In one embodiment the method comprises selecting the
identified endophyte.
[0169] Contemplated herein as specific embodiments of the invention
relating to a method of identifying a wheat germplasm that is
compatible with an Epichloe endophyte and to a method of
identifying an Epichloe endophyte that is compatible with a wheat
germplasm are all of the embodiments set out above relating to the
other aspects of the invention that are an isolated strain of
Epichloe fungal endophyte, a method of identifying a wheat plant
that forms a stable symbiotic association with a fungal endophyte,
a method of making a stable symbiotic combination, methods of
conferring at least some level of pest or disease protection or
resistance, and a wheat plant or wheat seed infected with a fungal
endophyte, including but not limited to particular Epichloe fungal
endophytes, wheat plants, wheat plant/endophyte combinations,
secondary metabolites, and alkaloids produced by wheat
plant/endophyte combinations, all as described herein.
[0170] Various aspects of the invention will now be illustrated in
non-limiting ways by reference to the following examples.
EXAMPLES
Example 1
Materials and Methods
Endophyte Strains
[0171] Endophyte strains used in this study are listed in Table 1
below:
TABLE-US-00001 TABLE 1 Strain Origin Reference AR3002 China Card et
al., 2014 AR3060 China Card et al., 2014 AR3067 Kazakhstan Card et
al., 2014 AR3070 Mongolia Card et al., 2014 AR3108 Canada
Unpublished AR3013 Iran Unpublished
[0172] Naturally occurring endophyte strains were isolated from
parent plants as previously described (Simpson et al., 2012).
Fungal cultures were grown on potato dextrose agar as described
previously (Fleetwood et al., 2007).
Inoculation of Wheat Alien Chromosome Substitution and Addition
Lines
[0173] Four independent experiments involving inoculation of wheat
lines sourced from the Arid Land Research Center (ALRC) (Tottori
University, Tottori, Japan) were performed as described below.
[0174] In experiment 1 (Tottori, Japan, March 2015), five seed of
each of 156 lines consisting of wheat with various alien chromosome
introductions from species of Aegilops, Agropyron, Elymus, Hordeum,
Leymus, Psathyrostachys, Haynaldia and Secale and the cultivar
`Chinese Spring` (Table 4) were inoculated, as described by Latch
& Christensen (1985), using strain AR3060 which had previously
been demonstrated to infect the wheat cultivar "Monad", albeit with
a compromised host phenotype (Simpson et al., 2014). Eleven of
these lines and `Chinese Spring` were additionally inoculated with
strains AR3002 and AR3067. Plants were grown for ca. 6 weeks in 2
cm cell flats containing commercial potting mix before identifying
infected individuals by tissue-print immunoblotting as previously
described (Simpson et al., 2012). Plants that were demonstrated to
be infected with Epichloe by immunoblot were grown for a further 3
months in the same cell flats under glasshouse conditions to
complete their full life cycle.
[0175] In experiment 2 (Tottori, Japan, March 2016), a number of
TACBOW lines that became infected in experiment 1 were
re-inoculated (40 seedlings of each line) with strain AR3060 as
described above. In addition, inoculations into the wheat cultivars
"Monad" and "Chinese Spring" were performed as controls, since
neither of these cultivars contain alien chromosome introgressions
and "Chinese Spring" was used to generate the majority of TACBOW
lines (Table 4). Plants that were demonstrated to be infected with
Epichloe by immunoblot were transplanted into 10.times.30 cm deep
pots containing commercial potting mix and grown for a further 3
months under glasshouse conditions to complete their full life
cycle. Endophyte-free plants of the same lines were also
transplanted under equivalent conditions to serve as direct
comparisons to the infected plants.
[0176] In experiment 3 (Palmerston North, New Zealand, September
2016), TACBOW11, previously shown to transmit AR3060 to grain in
Japan, was inoculated with AR3070 (Table 4). Due to the death of
control inoculations into "Chinese Spring" in experiment 2, further
inoculations with strain AR3060, in addition to AR3070, were
performed into this background cultivar which, as described above,
was used to generate the majority of TACBOW lines, but contains no
alien chromosome introgressions (Table 4).
[0177] In experiment 4 (Palmerston North, New Zealand, October
2018) TACBOW11 was inoculated with a single strain of either
AR3002, AR3060, AR3070, AR3108, AR3067 or AR3013 as described
above. Seed of TACBOW0018, TACBOW0044, TACBOW0067 and TACBOW0237
infected with AR3060 was obtained from Tottori, Japan and grown in
Palmerston North, New Zealand. Eighteen different TACBOW lines were
inoculated with AR3002 as described above. Infection for all plants
was confirmed by immunoblotting and chemistry methods as described
above.
Phenotyping
[0178] Plants were phenotyped at the completion of their life
cycle. Plants that were originally infected as determined by
earlier immunoblotting results, were confirmed as still being
Epichloe infected by microscopy and/or fungal isolation as
described below. Infected individuals were compared to plants of
the same line that did not become infected.
Epidermal Leaf Peel
[0179] Tillers were selected from mature plants for endophyte
detection. Clean, live sheath tissue was placed under a dissecting
microscope at 16.times. magnification with the adaxial epidermis
facing up. A shallow transverse cut was made with a scalpel and the
epidermis gently lifted, separated and pulled off the sheath.
Tissue was mounted in a drop of aniline blue dye (glycerol 50%,
lactic acid 25%, water 24.95%, aniline blue 0.05%) and heated over
a naked flame and examined at 100.times. and 400.times. using a
compound microscope.
Seed Squash
[0180] Grain were covered with a 5% sodium hydroxide solution and
left to imbibe overnight. The following day the solution was
decanted, and the samples thoroughly rinsed with tap water. Samples
were covered with Garner's solution (0.325 g aniline blue, 100 mL
water and 50 mL 85% lactic acid) and heated to boiling on a hot
plate. After cooling, the palea and lemma were removed and the
softened grain mounted on a microscope slide, a cover slip placed
over the mounted grain and gentle, even pressure applied squashing
the preparation. The preparations were then examined under a
compound light microscope at 100.times. and 400.times.
magnification.
Fungal Isolation
[0181] Fungus was isolated from plants following surface
sterilisation of plant tissue as described by Christensen et al.
(2002). Blade tissue was surface sterilised by quick rinse with 96%
ethanol and a 1-minute soak in a sodium hypochlorite solution (10%
Janola: 42 g/L NaOCl domestic bleach), followed by rinsing twice in
sterile water. Tissue was plated on to antibiotic potato dextrose
agar. Plates were incubated at 22-25'C for 3-5 days.
Results and Discussion
Epichloe Infection of Wheat Alien Chromosome Addition/Substitution
Lines.
Experiment 1
[0182] Of the 156 lines inoculated in experiment 1, immunoblot
results indicated that 98 lines appeared to be infected (Table 4)
with Epichloe with the remaining lines being uninfected. All lines
were subsequently phenotyped at maturity. Un-infected lines were
universally tall and floral with fully developed grain. Of the
infected lines, three classes of material were identified (Table
4). These included tall floral plants with fully developed grain
that were comparable to un-infected plants of the same line (class
1), tall floral plants delayed in their maturation which was
exemplified by a `stay green` phenotype and a protracted
elaboration and maturation of floral spike (class 2), and abnormal
phenotype plants that were short in stature and failed to produce
inflorescences (class 3). Additional evidence for endophyte
infection was obtained for a sub-set of plants from each of the
three infection phenotypes using a combination of fungal isolation
and microscopy of leaf and seed material. Although not all of the
plants that had a delayed maturation were confirmed as infected in
this way this phenotype is indicative of endophyte infection and
were classified as such for further analysis. For class 1 plants,
unless confirmed to be infected by isolation or microscopy, loss of
endophyte from tillers of these plants cannot be ruled out.
Experiment 2
[0183] Of the 8 TACBOW lines and 2 control lines inoculated in
experiment 2 (Table 4) most plants did not survive to maturity. Of
those that did, two lines (TACBOW0059 and TACBOW0236) were
confirmed as infected and displayed a tall floral class 1 phenotype
that was comparable to uninfected plants of the same line (FIG.
1b-1c). Whilst no infected "Chinese Spring" plants survived,
uninfected plants were tall and floral (FIG. 1a) and served as an
additional control to compare infected TACBOW lines. Several
"Monad" plants were confirmed as infected and these displayed (FIG.
1d) a dwarf host phenotype similar to that reported in Simpson et
al. (2014).
Experiment 3
[0184] The results obtained with TACBOW11 in experiment 1 indicated
that this line was particularly good at hosting Epichloe strain
AR3060, with all plants examined producing fully mature infected
grain (Table 4). In experiment 3 we inoculated this line with
AR3060 and an additional strain, AR3070. These two strains were
also inoculated into the background "Chinese Spring" cultivar in
which no alien chromosome additions exist. We obtained infection of
TACBOW11 with AR3060, as expected, but we also obtained infected
plants with AR3070. AR3060 infected plants displayed a tall floral
class 1 infection phenotype (Table 4). However, whereas AR3060
infected plants produced mature infected seed that could transmit
endophyte to the next generation, plants infected with AR3070
failed under the conditions employed to set fertile seed and were
therefore a class 2 phenotype.
[0185] The inoculation of "Chinese Spring" in this experiment did
produce some infected individuals. However, in all cases they
displayed a class 3 infection phenotype in which the plants were
short and non-floral.
Experiment 4
[0186] The phenotype class for each of the infected lines for
experiment 4 is shown in Table 5. All the TACBOW lines infected
with the strain AR3060 displayed a tall floral class 1 phenotype.
Most TACBOW lines exhibited a delay in growth when infected with
strains AR3013, AR3067, AR3070 or AR3108, meaning a full growth
cycle was not completed before the conclusion of experiment 5.
TACBOW 11 displayed a class 1 tall floral infection phenotype when
infected with AR3002, AR3060, AR3070 or AR3108. TACBOW11 infected
with AR3070 displayed a class 2 infection phenotype.
[0187] A summary of successful inoculations is included in Table 6
for those endophyte strains where at least some of the inoculated
plants were of substantially normal phenotype and were able to
progress through a normal life cycle. Seeds were collected from the
plants as indicated in Table 6.
Conclusion
[0188] The inoculation of commercial hexaploid wheat with Epichloe
has to date been unsuccessful with resulting infected plants having
compromised phenotypes. This result was confirmed here with
inoculations of the wheat cultivar Chinese Spring (no chromosome
additions or substitutions) based on challenge with several
Epichloe strains. However, in this study, inoculation of Chinese
Spring based wheat containing alien chromosome additions or
substitutions sourced from rye and wild grass species (many of
which also host Epichloe) resulted in the production of infected
tall floral plants.
Example 2
Detection of Genetic Variation of Fungal Endophyte Strains
[0189] Endophyte strains AR3002, AR3013, AR3060, AR3067, AR3070 and
AR3108 were characterised and distinguished for genetic variation
by DNA `fingerprinting` based on genotypic data derived from up to
22 selected simple sequence repeat (SSR) marker loci using primer
sequences of Table 2. These primer sequences had previously been
shown to generally amplify Epichloe endophyte polymorphic DNA
sequences from when the endophytes are in planta (Moon et al. 1999;
Kirkby et al, 2011; Simpson et al. 2012; Card et al, 2014).
[0190] Samples of about 100 mg fresh weight of basal tiller were
used to extract total genomic DNA (plant+endophyte), following the
plant DNA isolation procedure of the FastDNA kit as recommended by
the manufacturer (MP Biomedicals, Solon, Ohio, USA) for plant
samples.
[0191] SSR amplification was conducted with oligonucleotide primer
pairs, using one of two polymerase chain reaction (PCR) protocols
(Table 2). In both protocols PCR was carried out using an iCycler
thermocycler (BioRad, Hercules, Calif., USA).
[0192] Protocol 1 was as described by Moon (Moon et al., 1999),
except that an annealing temperature of 60.degree. C. was used. In
this protocol forward primers were labelled at the 5' terminus with
the fluorophore 6-FAM.TM. (Applied Biosystems, Foster City, Calif.,
USA).
[0193] In Protocol 2 forward primers were synthesised with a 21
nucleotide M13 tail sequence at the 5'-terminus
(5'-TGTAAAACGACGGCCAGT-3') (SEQ ID NO: 1), to facilitate universal
labelling of PCR products by a 6-FAM.TM.-labelled M13 primer
(Schuelke, 2000). Reverse primers were synthesised with the
sequence 5'-GTTTCTT-3' (SEQ ID NO: 2) at the 5'-terminus ends to
promote non-templated adenylation at the 3'-terminus end of PCR
product (Brownstein et al., 1996). A 10 .mu.L PCR reaction volume
was used, containing approximately 10 ng of total genomic DNA, 2.5
mM magnesium chloride, 1.times.PCR buffer, 0.05 mM of each dNTP,
0.0375 .mu.M forward primer, 0.15 .mu.M reverse primer, 0.15 .mu.M
of fluorescent-labelled M13 primer and 0.75 U of Platinum Taq DNA
polymerase (Invitrogen, Carlsbad, Calif.). PCR was carried out
using the following profile: (1) 94.degree. C. for 4:00 minutes,
(2) 30 cycles of: 94.degree. C. for 30 seconds, 55.degree. C. for
30 seconds and 72.degree. C. for 30 seconds, (3) 8 cycles of:
94.degree. C. for 30 seconds, 53.degree. C. for 30 seconds and
72.degree. C. for 30 seconds, (4) 72.degree. C. for 30 minutes
(after Schuelke 2000).
[0194] PCR products were analysed by capillary electrophoresis on
an ABI 3130xl Genetic Analyser using a 22 cm capillary array with
POP-7.TM. polymer (Applied Biosystems). GS500 LIZ (Applied
Biosystems) was used as an internal size standard.
Electropherograms were analysed using ABI Prism GeneScan (v 3.7,
Applied Biosystems), and genotype data was scored using Genemarker
analysis software (SoftGenetics LLC, Pennsylvania, USA).
[0195] The inventors note here that in their experience, allele
sizes will vary in some analyses according to a number of factors.
For example, estimates of fragment (allele) sizes based on
capillary electrophoresis are affected by factors including, but
not limited to, the type of instrument, the length of the capillary
array, the type of polymer used and environmental variables
including ambient temperature. Accordingly, the SSR allele sizes in
bp that are reported herein, including those in Table 3 below, are
associated with the analysis platform described and also include a
confidence interval of .+-.0.8 bp.
[0196] Plants examined above were then further characterised by
performing chemical analyses. Six infected seedlings were further
examined for the presence of alkaloids, attributable to the
presence of endophytes, such as indole diterpenes, ergot alkaloids,
peramine and lolines.
TABLE-US-00002 TABLE 2 SSR primer sequences. PCR SEQ proto- ID SSR
Primer sequences (5' - 3') col NO: B10 forward
CGCTCAGGGCTACATACACCATGG 1 3 reverse CTCATCGAGTAACGCAGGCGACG 4 B11
forward CATGGATGGACAAGAGATTGCACG 1 5 reverse
TTCACTGCTACAATTCTGTCCAGC 6 ans016 forward CACAAAGACAAACGCCAAAAG 2 7
reverse GCAAAGCTCACAGACAAAGGTC 8 ans019 forward
TACCTCTGCACGGTGTATTCC 2 9 reverse TGCATAACACTCACCTTATAGTCG 10
ans033 forward CGTTGAGGAGGCTAGATAGAA 2 11 reverse
TTCCAAGCTGAACAAAAGTCAA 12 ans036 forward ATTTGCAGCAGAGATGATGTGT 2
13 reverse CCTGCACCGGACTGTTAGTAAT 14 egs027 forward
GATGACGTATCTTGATGCTACCAC 2 15 reverse CGTGTATAAAGTTCGGGATCCTAT 16
egs031 forward GAGATATCCCGTCTCCTGATCTAA 2 17 reverse
CACAGCGTTACACTATCAACTTCC 18 ces0004 forward
CACTAAACACACCCAAGAACAAGA 2 19 reverse AGACAGGTAAGAAGTTTTCCCCTT 20
ces0022 forward AGCTTTCCAATGACGACATACATA 2 21 reverse
TAATTTAGGGTAGCATTTTCTCCG 22 ces0041 forward
GGTCCCTATTCTAATGCAGGTATG 2 23 reverse CAGTGTACGGGACTTTGTCAATAC 24
ces0054 forward TGTATAATAAACATGGCGTGCTCT 2 25 reverse
GTGTTGAAAGTTGTTGGATCACTC 26 ces0060 forward
CGAAATTGTAGACTATGTTGGAGC 2 27 reverse GTAGATGTATTTTGAGCAGGGCTT 28
ces0061 forward GAGTGAGACCCGGTGTAGTAAGTC 2 29 reverse
GAGTCATTCTTCGTCCATTGTCTT 30 ces0067 forward
GAAATGAGGCGTCTATCTTAAAGC 2 31 reverse TTTCTTGATTTCCAAAGAACAACA 32
ces0075 forward CAGTCATCGATTAAAAGTGAGCAT 2 33 reverse
ATGTCATCTGCTTCAACAAGAGTC 34 ces0076 forward
TCTTCCATACAATTTCTTCCCTTC 2 35 reverse ACTAGTCAATAGCACAAATTGCCA 36
ces0078 forward AGCCCTAGCCTATACATCTTTCCT 2 37 reverse
AATGGGCTTTTCCATTCAATAATA 38 ces0089 forward
AAATGATTGTTCGCTGTATGCTAA 2 39 reverse ATGTCATGTTTGATTCCATTTTTG 40
ces0093 forward CTGCTAGACATACTTGGAACATGG 2 41 reverse
CAGTCGAATAATTTAGGGAGCATT 42 ces0094 forward
ACTGAGTGATGGTAGAAAAGAGGG 2 43 reverse CAGAATTTCTCCCATATATACGCC 44
ces0095 forward TCATCTCTTCAAGACTTTCCTCCT 2 45 reverse
TTTAGTGTCACTTCTTCATCTCGC 46
TABLE-US-00003 TABLE 3 SSR allele sizes for strains AR3002, AR3013,
AR3060, AR3067, AR3070 and AR3108 in base pairs (bp) .+-. 0.8.
Allele size (bp) SSR AR3002 AR3060 AR3067 AR3070 AR3108 AR3013 B10
188 185 159, 185 172 181, 193 177,185 B11 112 112 112, 148 116 127,
138 112 ans016 282 282 282, 309 282 282, 294 282, 291 ans019 204
204 204 204 197 194 ans033 181 176 176 176 184, 194 181 ans036 286
286 267, 286 272 259, 270 286 egs027 359 359 345, 359 366 347, 351
349, 359 egs031 259 259 259, 283 283 308 259, 277 ces0004 185 189
185 174 179, 187 189 ces0022 209 209 204, 209 208 206, 208 209, 215
ces0041 261 259 247, 257 251 254, 286 254, 261 ces0054 261 261 261
267 258, 283 261, 298 ces0060 238 238 238, 250 240 246, 257 238,
250 ces0061 162 null* 154, 177 166 221,252 149, 171 ces0067 277 277
277, 281 268 272, 296 277 ces0075 243 243 243, 278 226 249, 263 243
ces0076 157 180 180 196 153, 236 153 ces0078 310 303 294, 303 303
292, 298 294, 303 ces0089 165 165 165 159 154, 165 162, 165 ces0093
145 145 143, 145 144 143, 145 145, 153 ces0094 329 327 313, 327 323
313, 318 315,329 ces0095 360 360 360 355 334 360 *SSR primer pair
produces no amplicon
TABLE-US-00004 TABLE 4 Infection phenotype class of combinations of
TACBOW wheat lines and selected Epichloe strains from experiments 1
to 3 Infection Phenotype class* (AR3060 unless otherwise Line
Experiment specified) Chinese 1, 2, 3 3, 3 (AR3070) Spring Monad 2
3 TACBOW0001 1 3 TACBOW0003 1 1 TACBOW0004 1 #N/A TACBOW0005 1, 2
1* TACBOW0006 1 #N/A TACBOW0007 1, 2 2* TACBOW0008 1 2* TACBOW0009
1 2* TACBOW0010 1, 2 1 TACBOW0011 1, 2, 3 1*, 1* (AR3070), 1*
(AR3002), 1 (AR3108) TACBOW0012 1,2 3 TACBOW0013 1 #N/A TACBOW0014
1 #N/A TACBOW0015 1 3 TACBOW0016 1 3 TACBOW0017 1 3 TACBOW0018 1 1
TACBOW0020 1 2, 3 (AR3002), 3 (AR3067) TACBOW0024 1 2, 3 (AR3002),
3 (AR3067) TACBOW0025 1 2 TACBOW0026 1 3 TACBOW0027 1 #N/A
TACBOW0028 1 1, 3 (AR3002) TACBOW0029 1 #N/A TACBOW0032 1 3
TACBOW0034 1 3 TACBOW0035 1 #N/A TACBOW0036 1 3 TACBOW0038 1 2
TACBOW0039 1 #N/A TACBOW0040 1 3 TACBOW0041 1 3 TACBOW0042 1 #N/A
TACBOW0043 1 3 TACBOW0044 1 #N/A TACBOW0045 1 1 TACBOW0046 1 3
TACBOW0047 1 3 TACBOW0048 1 3 TACBOW0049 1 3 TACBOW0051 1 #N/A
TACBOW0052 1 2 TACBOW0053 1 2 TACBOW0054 1 1 TACBOW0055 1 3
TACBOW0056 1 2 TACBOW0057 1 3 TACBOW0059 1, 2 1* TACBOW0060 1 #N/A
TACBOW0061 1 #N/A TACBOW0062 1 #N/A TACBOW0064 1 2*, 3 (AR3002)
TACBOW0065 1 #N/A TACBOW0066 1 3 (AR3002), 3* (AR3067) TACBOW0067 1
2, 2 (AR3002), 2 (AR3067) TACBOW0068 1 #N/A TACBOW0069 1 #N/A
TACBOW0070 1 #N/A TACBOW0123 1 #N/A TACBOW0124 1 2 TACBOW0125 1 3
TACBOW0126 1 3 TACBOW0127 1 #N/A TACBOW0128 1 1 TACBOW0133 1 #N/A
TACBOW0136 1 #N/A TACBOW0137 1 #N/A TACBOW0138 1 3 TACBOW0189 1 3
TACBOW0190 1 3 TACBOW0191 1 #N/A TACBOW0193 1 3 TACBOW0195 1 3
TACBOW0196 1 2 TACBOW0197 1 2* TACBOW0198 1 2 TACBOW0201 1 #N/A
TACBOW0202 1 #N/A TACBOW0204 1, 2 2 TACBOW0205 1 #N/A TACBOW0206 1
3 TACBOW0208 1 #N/A TACBOW0209 1 1 TACBOW0213 1 #N/A TACBOW0214 1 3
TACBOW0215 1 2 TACBOW0217 1 3 TACBOW0219 1 3 TACBOW0220 1 3
TACBOW0221 1 1 TACBOW0222 1 3 TACBOW0224 1 2* TACBOW0225 1 #N/A
TACBOW0226 1 1 TACBOW0227 1 #N/A TACBOW0228 1 #N/A TACBOW0229 1
#N/A TACBOW0230 1 3 TACBOW0231 1 #N/A TACBOW0232 1 2* TACBOW0233 1
#N/A TACBOW0235 1 3 TACBOW0236 1, 2 1* TACBOW0237 1 #N/A TACBOW0239
1 3 TACBOW0240 1 #N/A TACBOW0242 1 #N/A TACBOW0244 1 1 TACBOW0245 1
3 TACBOW0246 1 3 TACBOW0247 1 #N/A TACBOW0249 1 #N/A TACBOW0250 1 2
TACBOW0252 1 3 TACBOW0253 1 #N/A TACBOW0254 1 3 TACBOW0256 1 2
TACBOW0257 1 #N/A TACBOW0258 1 #N/A TACBOW0259 1 3 TACBOW0260 1 1
TACBOW0261 1 1 TACBOW0262 1 3 TACBOW0264 1 #N/A TACBOW0265 1 3
TACBOW0266 1 #N/A TACBOW0267 1 2 TACBOW0268 1 #N/A TACBOW0270 1
#N/A TACBOW0271 1 #N/A TACBOW0272 1 1 TACBOW0273 1 2 TACBOW0274 1
#N/A TACBOW0275 1 1 TACBOW0276 1 #N/A TACBOW0277 1 #N/A TACBOW0278
1 2 TACBOW0279 1 2 TACBOW0280 1 3 TACBOW0281 1 #N/A TACBOW0282 1 2
TACBOW0283 1 3 TACBOW0284 1 #N/A TACBOW0286 1 #N/A TACBOW0287 1
#N/A TACBOW0288 1 2 TACBOW0290 1 2 TACBOW0291 1 3 TACBOW0292 1 #N/A
TACBOW0293 1 3 TACBOW0295 1 2 TACBOW0296 1 #N/A TACBOW0297 1 #N/A
TACBOW0298 1 #N/A TACBOW0299 1 3 * = class 1 and 2 plants that were
confirmed infected. #N/A = Not applicable: these plants were either
not infected, or they died.
TABLE-US-00005 TABLE 5 Infection phenotype class of combinations of
TACBOW wheat lines and selected Epichloe strains from experiment 4
Infection Phenotype Class Line AR3002 AR3013 AR3060 AR3067 AR3070
AR3108 TACBOW0003 3 #N/A #N/A #N/A #N/A #N/A TACBOW0005 #N/A #N/A
#N/A #N/A #N/A #N/A TACBOW0010 3 #N/A #N/A #N/A #N/A #N/A
TACBOW0011 1 3 1 #N/A 1 1 TACBOW0018 #N/A #N/A 2 #N/A #N/A #N/A
TACBOW0028 #N/A #N/A #N/A #N/A #N/A #N/A TACBOW0044 #N/A #N/A 1
#N/A #N/A #N/A TACBOW0045 3 #N/A #N/A #N/A #N/A #N/A TACBOW0054 3
#N/A #N/A #N/A #N/A #N/A TACBOW0059 3 #N/A #N/A #N/A #N/A #N/A
TACBOW0128 #N/A #N/A #N/A #N/A #N/A #N/A TACBOW0209 #N/A #N/A #N/A
#N/A #N/A #N/A TACBOW0221 #N/A #N/A #N/A #N/A #N/A #N/A TACBOW0226
#N/A #N/A #N/A #N/A #N/A #N/A TACBOW0236 #N/A #N/A #N/A #N/A #N/A
#N/A TACBOW0237 #N/A #N/A 1 #N/A #N/A #N/A TACBOW0244 3 #N/A #N/A
#N/A #N/A #N/A TACBOW0260 3 #N/A #N/A #N/A #N/A #N/A TACBOW0261 3
#N/A #N/A #N/A #N/A #N/A TACBOW0272 3 #N/A #N/A #N/A #N/A #N/A
TACBOW0275 #N/A #N/A #N/A #N/A #N/A #N/A #N/A = Slow growing plants
- data not available at time of filing.
TABLE-US-00006 TABLE 6 Strains inoculated into and infecting TACBOW
lines and examples of seed production in TACBOW lines. Inoculation
Infected plants Infected plants Seed of TACBOW Seed was of TACBOW
of TACBOW of TACBOW line line was infected infected with Endophyte
TACBOW Line line attempted line obtained produced seed with
endophyte viable endophyte AR3002 TACBOW0003 YES YES N/A N/A N/A
TACBOW0005 YES NO N/A N/A N/A TACBOW0010 YES YES N/A N/A N/A
TACBOW0011 YES YES YES YES YES TACBOW0018 YES YES YES YES YES
TACBOW0028 YES NO N/A N/A N/A TACBOW0045 YES YES N/A N/A N/A
TACBOW0054 YES YES N/A N/A N/A TACBOW0059 YES YES N/A N/A N/A
TACBOW0128 YES NO N/A N/A N/A TACBOW0209 YES NO N/A N/A N/A
TACBOW0221 YES NO N/A N/A N/A TACBOW0226 YES NO N/A N/A N/A
TACBOW0236 YES NO N/A N/A N/A TACBOW0244 YES YES N/A N/A N/A
TACBOW0260 YES YES N/A N/A N/A TACBOW0261 YES YES N/A N/A N/A
TACBOW0272 YES YES N/A N/A N/A TACBOW0275 YES YES N/A N/A N/A
AR3013 TACBOW0011 YES YES YES NO NO AR3060 TACBOW0011 YES YES YES
YES YES TACBOW0018 YES YES YES YES YES TACBOW0044 YES YES YES YES
YES TACBOW0067 YES YES YES YES YES TACBOW237 YES YES YES YES YES
AR3070 TACBOW0011 YES YES NO NO NO AR3108 TACBOW0011 YES YES NO NO
NO N/A - Slow growing plants - data not available at time of
filing.
Example 3
Alkaloid Production in Endophyte Infected TACBOW Plants
Methods
Extraction and Detection of Peramine/Cyclo[Pro,Arg], Ergot
Alkaloids, and Lolines.
[0197] Material for analysis was freeze-dried and ground prior to
chemical analysis (Table 9). Sub-samples of freeze-dried and ground
material were extracted with 80% (v/v) methanol containing internal
standards (1.7 .mu.g/mL homoperamine nitrate (BDG Synthesis, New
Zealand), 0.51 .mu.g/mL ergotamine (Sigma), 0.10 .mu.g/mL
festuclavine (ALFARMA s.r.o., Czech Republic)), with the sub-sample
weight determining the volume of extraction solvent used (1 mL for
30-60 mg, 500 .mu.L for 30-15 mg, 250 .mu.L for <15 mg). Samples
were extracted by end-over-end rotation (30 rpm) for 60 minutes in
the dark prior to being centrifuged at 4500.times.g for 5 minutes,
and the supernatant transferred via syringe filter (13 mm diameter,
0.45-.mu.m-pore polytetrafluoroethylene syringe filter (Jet BioFil,
Guangzhou, China)) into an amber 12.times.32 mm HPLC vial. Samples
were analysed using an LTQxl.TM. linear ion-trap mass spectrometer
(Thermo Scientific, USA). Each sample (1 .mu.L injection) was
chromatographically separated on a Poroshell HILIC-Z 150.times.2.1
mm (2.7 .mu.m) column (Agilent Technologies, USA) using a linear
gradient profile (eluent A is aqueous 16 mM ammonium formate and
eluent B is 97% acetonitrile with 0.1% formic acid) with time 0 min
(T.sub.0) at 92.8% B, T.sub.3.5 at 83% B, T.sub.5 at 83% B, and
T.sub.5.5 at 92.8% B, followed by equilibration to initial
conditions over the following 2 minutes. MRMs as described in Table
7 were used to quantify and confirm the identity of the analytes
and internal standards.
TABLE-US-00007 TABLE 7 Retention times and MRM transitions for
analytes and internal standards. Internal standards (marked*) were
used for preceding analytes. Quanti- Confir- Retention Product
tative mation Compound time ion ion ion Peramine 2.85 min 248 m/z
206 m/z 231 m/z Cyclo[Pro, Arg] 4.10 min 254 m/z 195 m/z 194 m/z
N-Acetyl Norloline 3.20 min 183 m/z 165 m/z 140 m/z N-Formyl Loline
2.95 min 183 m/z 155 m/z 124 m/z N-Acetyl Loline 2.65 min 197 m/z
155 m/z 154 m/z Homoperamine* 2.60 min 262 m/z 245 m/z 220 m/z
Chanoclavine 2.05 min 257 m/z 226 m/z 208 m/z Festuclavine* 1.47
min 241 m/z 210 m/z 168 m/z Ergovaline 1.80 min 534 m/z 286 m/z 516
m/z Ergotamine* 1.65 min 582 m/z 268 m/z 564 m/z Ergovalinine 1.35
min 534 m/z 516 m/z -- Ergotaminine* 1.20 min 582 m/z 564 m/z
--
Extraction and Detection of Dahurelmusin A, and Indole
Diterpenes.
[0198] Material for analysis was freeze-dried and ground prior to
chemical analysis (Table 9). Sub-samples of freeze-dried and ground
material were extracted with 80% (v/v) methanol with the sub-sample
weight determining the volume of extraction solvent used (1 mL for
30-60 mg, 500 .mu.L for 30-15 mg, 250 .mu.L for <15 mg). Samples
were extracted by end-over-end rotation (30 rpm) for 60 minutes in
the dark prior to being centrifuged at 4500.times.g for 5 minutes,
and the supernatant transferred via syringe filter (13 mm diameter,
0.45-.mu.m-pore polytetrafluoroethylene syringe filter (Jet BioFil,
Guangzhou, China)) into an amber 12.times.32 mm HPLC vial. Samples
were analysed using an LTQxl.TM. linear ion-trap mass spectrometer
(Thermo Scientific, USA). Each sample (1 .mu.L injection) was
chromatographically separated on a Accucore C18 150.times.2.1 mm
(2.6 .mu.m) column (Thermo Scientific, USA) using a linear gradient
profile (eluent A is aqueous 0.1% formic acid and eluent B is 97%
acetonitrile with 0.1% formic acid) with time 0 min (T.sub.0) at 2%
B, T.sub.17 at 100% B, T.sub.19 at 100% B, and T.sub.20 at 2% B,
followed by equilibration to initial conditions over the following
5 minutes. MRMs as described in Table 8 were used to quantify and
confirm the identity of the analytes and internal standards.
TABLE-US-00008 TABLE 8 Retention times and MRM transitions for
analytes and internal standards. Quanti- Confir- Retention Product
tative mation Compound time ion ion ion Dahurelmusin A 6.65 min 355
m/z 266 m/z 284 m/z Paspaline 15.25 min 422 m/z 130 m/z 407 m/z
Terpendole E 11.55 min 438 m/z 130 m/z 423 m/z Paxitriol 11.00 min
438 m/z 130 m/z 423 m/z Paxilline 11.40 min 436 m/z 130 m/z 423
m/z
[0199] Quantitation of paxilline was achieve through the use of an
external standard, while semi-quantitation of the remaining indole
diterpenes was achieved through reference to paxilline. Therefore,
paxilline is reported in .mu.g/g, while the other indole diterpenes
detected are reported as paxilline equivalent units (response
factor for all other indole diterpenes is calculated as being the
same as paxilline). No standards (or similar compounds suitable as
standards) were available for Dahurelmusin A, therefore
Dahurelmusin A is reported as area under the curve.
TABLE-US-00009 TABLE 9 Detection of endophyte alkaloids for
endophyte infected TACBOW lines Ergovaline Chanoclavine Peramine
Endophyte Host Plant part sampled n (.mu.g/g) (.mu.g/g) (.mu.g/g)
AR3002 TACBOW045 Tiller (dead) 1 ND 0.11 ND AR3002 TACBOW045 Tiller
(dead) 1 ND 0.03 ND AR3002 TACBOW054 Tiller (dead) 1 ND 0.03 ND
AR3002 TACBOW059 Tiller (dead) 1 ND 0.09 ND AR3002 TACBOW059 Tiller
(dead) 1 ND 0.09 ND AR3002 TACBOW11 Tiller 37 ND 0.23 (0.04) ND
AR3002 TACBOW11 Straw 1 ND 0.5 ND AR3002 TACBOW11 Seed head 1 ND
0.9 ND AR3002 TACBOW244 Tiller (dead) 1 ND 0.14 ND AR3002 TACBOW260
Tiller (dead) 1 ND 0.14 ND AR3002 TACBOW261 Tiller (dead) 1 ND 0.19
ND AR3002 TACBOW272 Tiller (dead) 1 ND 0.13 ND AR3013 TACBOW11
Tiller 3 ND ND ND AR3060 TACBOW11 Seed 1 2.5 0.1 ND AR3060 TACBOW11
Tiller 10 5.86 (0.85) 1.21 (0.13) ND AR3060 TACBOW11 Leaf 2 4.74
(0.12) 1.67 (0.09) ND AR3060 TACBOW11 Straw 4 8.2 (0.6) -- --
AR3060 TACBOW18 Leaf 3 3.36 (1.04) 2.22 (0.87) ND AR3070 TACBOW11
Leaf 1 ND ND 49.4 AR3070 TACBOW11 Tiller 9 ND ND 171.5 (10.1)
Cyclo(Pro, Total Arg) Lolines Dahurelmusin Terpendole (.mu.g/g)
(.mu.g/g) A .sup..dagger-dbl. Paspaline * Paxitriol * E * -- ND
542633 0.001 ND 0.001 -- ND 1004740 0.001 ND 0.001 -- ND 27109 ND
ND ND -- ND 229742 ND ND 0.001 -- ND 156416 ND ND ND ND ND 4786814
(423046) 0.025 (0.002) ND 0.042 (0.004) ND ND 558410 0.03 ND 0.03
ND ND 1547799 0.06 ND 0.04 -- ND 112787 ND ND ND -- ND 419547 0.003
ND 0.004 -- ND 102628 0.001 ND 0.001 -- ND 1029636 0.001 ND 0.002
-- ND ND 0.020 (0.006) 0.140 (0.071) 0.059 (0.037) ND ND -- ND ND
ND -- ND -- -- -- -- ND ND -- ND ND ND -- -- -- -- -- -- ND ND --
ND ND ND ND ND -- ND ND ND ND ND ND ND ND ND .sup..dagger-dbl.
Dahurelmusin A reported as area under the curve * Paspaline,
paxitriol, and terpendole E reported as Paxilline equivalents
units. "ND" = not detected, "--" = sample was not analysed for this
alkaloid. Where multiple samples were analysed (n > 1), the
value given is the mean, with the numbers in brackets referring to
standard error of the mean.
Example 4
TACBOW/Endophyte Combinations Having Bioactivity Against Argentine
Stem Weevil
[0200] Methods: A randomised block design with ten replicates,
three treatments and one Nil endophyte control was used. The three
treatments were, TACBOW0011 plants inoculated with endophyte
AR3002, TACBOW0011 plants inoculated with endophyte AR3060 and
TACBOW0011 plants inoculated with endophyte AR3070. The control
consisted of endophyte free TACBOW0011 plants. Endophyte presence
for the treatment plants was assessed using a standard tissue-print
immunoblot technique. One tiller per plant was tested. The
experiment was set-up in a 20.degree. C. controlled environment
room with 12:12 light:dark regime on 19 Dec. 2018. Adult Argentine
stem weevils (Listronotus bonariensis) were collected in the field
using an insect suction sampler. Six adult Argentine stem weevils
were added to each of the plants and a net cage was put over each
plant.
[0201] On 27.sup.th December the light regime was changed to 14:10
light:dark. On 9 Jan. 2019, covers were removed and the number of
tillers on each plant was recorded. The number of adult feeding
scars on each leaf was counted taking into account the size of the
scar. The number of weevil eggs on each tiller was also
recorded.
[0202] Two weeks later (24-25 Jan. 2019) each tiller was examined
and larval damage was scored on a scale of 0-3; where 0=no damage,
1=larval feeding on external surface of tiller only, 2=larva has
penetrated and partially mined the tiller and 3=larva has
penetrated and extensively mined the tiller or bored a hole through
the growing point at the tiller base. Endophyte status was
rechecked by blotting one tiller per plant.
[0203] Adult feeding, oviposition and larval damage data were
analysed by analysis of variance. The number of eggs was log
transformed (Log+1) for analysis. Because the number of tillers
differed significantly between treatments this was used as a
covariate in the analysis of adult feeding and oviposition.
Similarly, the number of eggs laid was used as a covariate for
analysis of the percentage of tillers with all levels of larval
damage, and the percentage with moderate and severe damage (scores
2 and 3 combined).
Results:
[0204] Argentine stem weevil adult feeding was significantly
reduced by endophyte AR3070 (P=0.001) compared with endophyte-free
plants (Table 10). AR3070 had fewer eggs/plant than AR3002
(P=0.055) but the number of eggs did not differ from endophyte-free
or AR3060.
[0205] AR3070 had a significantly lower percentage of tillers with
all levels of damage compared with the endophyte-free control
(P=0.012) but differences between the control and AR3002 and AR3060
were not significant (P>0.05) (Table 10). Taking only those that
were moderately and severely damaged (i.e. excluding those with
minor damage), all three endophytes significantly reduced the
amount of damage (P=0.002) compared with the endophyte-free
treatment.
TABLE-US-00010 TABLE 10 Number of Argentine stem weevil adult
feeding scars and eggs and the percentage of tillers with all
levels of larval damage (Total) and with moderate and severe damage
on TACBOW011 plants infected with three different endophyte strains
and an endophyte-free control. Endophyte Treatment AR Nil AR3002
AR3060 3070 SED Adult FS/plant 165 114 198 45 40.5 Eggs (Log 0.90
1.51 1.12 0.19 0.459 N + 1)/plant Total Larval 48.5 32.7 32.0 18.3
8.38 Damage (%) Moderate and 43.2 12.9 11.0 13.8 8.83 severe damage
(%) SED = standard error of the difference.
[0206] Although the invention has been described by way of example
and with reference to particular embodiments, it is to be
understood that modifications and/or improvements may be made
without departing from the scope of the invention.
[0207] In addition, where features or aspects of the invention are
described in terms of Markush groups, those skilled in the art will
recognise that the invention is also thereby described in terms of
any individual member or subgroup of members of the Markush
group.
INDUSTRIAL APPLICATION
[0208] The Epichloe endophyte strains, plant/fungal symbioses,
seeds produced from such symbioses and methods of making such
symbioses and methods of identifying stable symbiotic associations
according to the invention as disclosed herein all have industrial
application for the production of plants that are used for human or
animal consumption.
REFERENCES
[0209] 1. "Crops/World Total/Wheat/Area Harvested/2014 (pick list)"
United Nations, Food and Agriculture Organization, Statistics
Division (FAOSTAT). 2014. Retrieved 8 Dec. 2016. [0210] 2. "World
food situation: FAO cereal supply and demand brief". Rome, Italy:
United Nations, Food and Agriculture Organization. 8 Dec. 2016.
Retrieved 14 Dec. 2016. [0211] 3. Casida J E, Quistad G B (1998)
Golden Age of Insecticide Research: Past, Present, or Future?
Annual Review of Entomology 43: 1-16. [0212] 4. Zejda J E, McDuffie
H H, Dosman J A (1993) Epidemiology of health and safety risks in
agriculture and related industries--Practical applications for
rural physicians. Western Journal of Medicine 158: 56-63. [0213] 5.
Zhang, D X, Nagabhyru P, Blankenship J D, Schardl C L (2010) Are
loline alkaloid levels regulated in grass endophytes by gene
expression or substrate availability? Plant Signaling and Behavior
5 (11): 1419-22. [0214] 6. Koulman A, Lane G A, Christensen M J,
Fraser K, Tapper B A (2007) Peramine and other fungal alkaloids are
exuded in the guttation fluid of endophyte-infected grasses.
Phytochemistry 68: 355-360. [0215] 7. Tsai H F, Liu J S, Staben C,
Christensen M J, Latch G C, Siegel M R, Schardl C L (1994).
Evolutionary diversification of fungal endophytes of tall fescue
grass by hybridization with Epichloe species. Proc. Natl. Acad.
Sci. USA 91 (7): 2542-2546. [0216] 8. Moon C D, Craven K D,
Leuchtmann A, Clements S L, Schardl C L (2004). Prevalence of
interspecific hybrids amongst asexual fungal endophytes of grasses.
Molecular Ecology 13 (6): 1455-1467. [0217] 9. Glenn A E, Bacon C
W, Price R, Hanlin R T (1996) Molecular phylogeny of Acremonium and
its taxonomic implications. Mycologia 88: 369-383. [0218] 10.
Miller J S, Funk V A, Wagner W L, Barrie F, Hoch P C, Herendeen P
(2011) Outcomes of the 2011 botanical nomenclature section at the
XVIII International Botanical Congress. PhytoKeys 5: 1-3. [0219]
11. Schardl C L, Craven K D, Speakman S, Stromberg A, Lindstrom A,
Yoshida R (2008). A novel test for host-symbiont codivergence
indicates ancient origin of fungal endophytes in grasses. Syst
Biol. 57: 483-498. [0220] 12. Marshall D, Tunali B, Nelson L R
(1999) Occurrence of fungal endophytes in species of wild triticum.
Crop Science 39: 1507-1512. [0221] 13. Welty R E, Azevedo M D,
Cooper T M (1987) Influence of moisture content, temperature, and
length of storage on seed germination and survival of endophytic
fungi in seeds of tall fescue and perennial ryegrass.
Phytopathology 77: 893-900. [0222] 14. Simpson W R, Mace W J (2012)
Novel associations between Epichloe endophytes and grasses:
Possibilities and outcomes. In `Epichloe, endophytes of cool season
grasses: Implications, utilization and biology.` (Eds C A Young, G
E Aiken, R L McCulley, J R Strickland, C L Schardl.) pp. 35-39.
(The Samuel Roberts Noble Foundation: Ardmore, Okla.). [0223] 15.
Christensen M J, Simpson W R, Al Samarrai T (2000) Infection of
tall fescue and perennial ryegrass plants by combinations of
different Neotyphodium endophytes. Mycological Research 104:
974-978. [0224] 16. Christensen M J, Bennett R J, Schmid J (2002)
Growth of Epichloe/Neotyphodium and p-endophytes in leaves of
Lolium and Festuca grasses. Mycological Research 106: 93-106.
[0225] 17. Christensen M J, Saulsbury K, Simpson W R (2012)
Conspicuous epiphytic growth of an interspecific hybrid
Neotyphodium sp. endophyte on distorted host inflorescences. Fungal
Biology 116: 42-48. [0226] 18. Christensen M J, Bennett R J, Schmid
J (2001) Vascular bundle colonisation by Neotyphodium endophytes in
natural and novel associations with grasses. Mycological Research
105: 1239-1245. [0227] 19. Christensen M J (1995) Variation in the
ability of Acremonium endophytes of Lolium perenne, Festuca
arundinacea and F. pratensis to form compatible associations in the
3 grasses. Mycological Research 99: 466-470. [0228] 20. Schardl C
L, Grossman R B, Nagabhyru P, Faulkner J R, Mallik U P (2007)
Loline alkaloids: Currencies of mutualism. Phytochemistry 68:
980-996. [0229] 21. Schardl C L, Young C A, Faulkner J R, Florea S,
Pan J (2012) Chemotypic diversity of Epichloe fungal symbionts of
grasses. Fungal Ecology 5: 331-344. [0230] 22. Bush L P, Wilkinson
H H, Schardl C L (1997) Bioprotective Alkaloids of Grass-Fungal
Endophyte Symbioses. Plant Physiology 114: 1-7. [0231] 23.
Malinowski D P, Belesky D P (2000) Adaptations of
endophyte-infected cool-season grasses to environmental stresses:
Mechanisms of drought and mineral stress tolerance. Crop Science:
40: 923-940. [0232] 24. Porter J K (1994). Chemical constituents of
grass endophytes. In: Bacon, C. W., White Jr., J. F (Eds),
Biotechnology of Endophytic Fungi of Grasses. CRC, Boca Raton,
Fla., pp. 103-123. [0233] 25. Blankenship J D, Spiering M J,
Wilkinson H H, Fannin F F, Bush L P, Schardl C L (2001). Production
of loline alkaloids by the grass endophyte, Neotyphodium uncinatum,
in defined media. Phytochemistry 58: 395-401. [0234] 26. Tanaka A,
Tapper B A, Popay A, Parker E J, Scott B (2005) A symbiosis
expressed non-ribosomal peptide synthetase from a mutualistic
fungal endophyte of perennial ryegrass confers protection to the
symbiotum from insect herbivory. Molecular Microbiology 57:
1036-1050. [0235] 27. Rowan D D, Latch G C M (1994) Utilization of
endophyte-infected perennial ryegrasses for increased insect
resistance. In: Bacon C W, White Jr. J F (eds), Biotechnology of
Endophyte Fungi of Grasses. CRC Press, Boca Raton, Forida, pp.
169-183. [0236] 28. Latch G C M, Christensen M J (1985) Artificial
Infection of Grasses with Endophytes. Annals of Applied Biology
107: 17-24. [0237] 29. SIMPSON, W. R., FAVILLE, M. J., MORAGA, R.
A., WILLIAMS, W. M., MCMANUS, M. T. and JOHNSON, R. D. (2014),
Epichloe fungal endophytes and the formation of synthetic symbioses
in Hordeeae (=Triticeae) grasses. Jnl of Systematics Evolution, 52:
794-806. doi:10.1111/jse.12107. [0238] 30. Leuchtmann A, C W Bacon,
C L Schardl, J F White and M Tadych. 2014. Nomenclatural
realignment of Neotyphodium species with genus Epichloe. Mycologia
106: 202-215.
Description of the Microorganism Deposits Made Under the Budapest
Treaty
[0239] The following biological deposits have been made under the
terms of the Budapest Treaty on the International Recognition of
the Deposit of Micro-organisms for the Purposes of Patent
Procedure
TABLE-US-00011 Deposit International Identification Depository Date
of Reference Designation Deposit AR3002 NRRL 50579 13 Oct. 2011
AR3013 NRRL 67557 5 Feb. 2018 AR3060 NRRL 67592 5 Feb. 2018 AR3067
NRRL 50719 6 Mar. 2012 AR3070 NRRL 67564 5 Feb. 2018 AR3108 NRRL
67572 5 Feb. 2018
Certificates of Deposit and Statements of Viability for the above
deposited micro-organisms are appended below.
Sequence CWU 1
1
46118DNAArtificial SequencePrimer 1tgtaaaacga cggccagt
1827DNAArtificial SequencePrimer 2gtttctt 7324DNAArtificial
SequencePrimer 3cgctcagggc tacatacacc atgg 24423DNAArtificial
SequencePrimer 4ctcatcgagt aacgcaggcg acg 23524DNAArtificial
SequencePrimer 5catggatgga caagagattg cacg 24624DNAArtificial
SequencePrimer 6ttcactgcta caattctgtc cagc 24721DNAArtificial
SequencePrimer 7cacaaagaca aacgccaaaa g 21822DNAArtificial
SequencePrimer 8gcaaagctca cagacaaagg tc 22921DNAArtificial
SequencePrimer 9tacctctgca cggtgtattc c 211024DNAArtificial
SequencePrimer 10tgcataacac tcaccttata gtcg 241122DNAArtificial
SequencePrimer 11gcgttgagga ggctagatag aa 221222DNAArtificial
SequencePrimer 12ttccaagctg aacaaaagtc aa 221322DNAArtificial
SequencePrimer 13atttgcagca gagatgatgt gt 221422DNAArtificial
SequencePrimer 14cctgcaccgg actgttagta at 221524DNAArtificial
SequencePrimer 15gatgacgtat cttgatgcta ccac 241624DNAArtificial
SequencePrimer 16cgtgtataaa gttcgggatc ctat 241724DNAArtificial
SequencePrimer 17gagatatccc gtctcctgat ctaa 241824DNAArtificial
SequencePrimer 18cacagcgtta cactatcaac ttcc 241924DNAArtificial
SequencePrimer 19cactaaacac acccaagaac aaga 242024DNAArtificial
SequencePrimer 20agacaggtaa gaagttttcc cctt 242124DNAArtificial
SequencePrimer 21agctttccaa tgacgacata cata 242224DNAArtificial
SequencePrimer 22taatttaggg tagcattttc tccg 242324DNAArtificial
SequencePrimer 23ggtccctatt ctaatgcagg tatg 242424DNAArtificial
SequencePrimer 24cagtgtacgg gactttgtca atac 242524DNAArtificial
SequencePrimer 25tgtataataa acatggcgtg ctct 242624DNAArtificial
SequencePrimer 26gtgttgaaag ttgttggatc actc 242724DNAArtificial
SequencePrimer 27cgaaattgta gactatgttg gagc 242824DNAArtificial
SequencePrimer 28gtagatgtat tttgagcagg gctt 242924DNAArtificial
SequencePrimer 29gagtgagacc cggtgtagta agtc 243024DNAArtificial
SequencePrimer 30gagtcattct tcgtccattg tctt 243124DNAArtificial
SequencePrimer 31gaaatgaggc gtctatctta aagc 243224DNAArtificial
SequencePrimer 32tttcttgatt tccaaagaac aaca 243324DNAArtificial
SequencePrimer 33cagtcatcga ttaaaagtga gcat 243424DNAArtificial
SequencePrimer 34atgtcatctg cttcaacaag agtc 243524DNAArtificial
SequencePrimer 35tcttccatac aatttcttcc cttc 243624DNAArtificial
SequencePrimer 36actagtcaat agcacaaatt gcca 243724DNAArtificial
SequencePrimer 37agccctagcc tatacatctt tcct 243824DNAArtificial
SequencePrimer 38aatgggcttt tccattcaat aata 243924DNAArtificial
SequencePrimer 39aaatgattgt tcgctgtatg ctaa 244024DNAArtificial
SequencePrimer 40atgtcatgtt tgattccatt tttg 244124DNAArtificial
SequencePrimer 41ctgctagaca tacttggaac atgg 244224DNAArtificial
SequencePrimer 42cagtcgaata atttagggag catt 244324DNAArtificial
SequencePrimer 43actgagtgat ggtagaaaag aggg 244424DNAArtificial
SequencePrimer 44cagaatttct cccatatata cgcc 244524DNAArtificial
SequencePrimer 45tcatctcttc aagactttcc tcct 244624DNAArtificial
SequencePrimer 46tttagtgtca cttcttcatc tcgc 24
* * * * *