U.S. patent application number 16/819766 was filed with the patent office on 2020-12-10 for delivering crispr therapeutics with lipid nanoparticles.
This patent application is currently assigned to ARBUTUS BIOPHARMA CORPORATION. The applicant listed for this patent is ARBUTUS BIOPHARMA CORPORATION. Invention is credited to Amy C. H. LEE, Nicholas D. WEBER.
Application Number | 20200385721 16/819766 |
Document ID | / |
Family ID | 1000005039051 |
Filed Date | 2020-12-10 |
![](/patent/app/20200385721/US20200385721A1-20201210-C00001.png)
![](/patent/app/20200385721/US20200385721A1-20201210-C00002.png)
![](/patent/app/20200385721/US20200385721A1-20201210-C00003.png)
![](/patent/app/20200385721/US20200385721A1-20201210-C00004.png)
![](/patent/app/20200385721/US20200385721A1-20201210-C00005.png)
![](/patent/app/20200385721/US20200385721A1-20201210-C00006.png)
![](/patent/app/20200385721/US20200385721A1-20201210-C00007.png)
![](/patent/app/20200385721/US20200385721A1-20201210-C00008.png)
![](/patent/app/20200385721/US20200385721A1-20201210-C00009.png)
![](/patent/app/20200385721/US20200385721A1-20201210-C00010.png)
![](/patent/app/20200385721/US20200385721A1-20201210-C00011.png)
United States Patent
Application |
20200385721 |
Kind Code |
A1 |
LEE; Amy C. H. ; et
al. |
December 10, 2020 |
DELIVERING CRISPR THERAPEUTICS WITH LIPID NANOPARTICLES
Abstract
The present invention provides lipid particles comprising
therapeutic nucleic acids such as gRNA that target gene
expression.
Inventors: |
LEE; Amy C. H.; (Burnaby,
CA) ; WEBER; Nicholas D.; (Vancouver, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ARBUTUS BIOPHARMA CORPORATION |
Burnaby |
|
CA |
|
|
Assignee: |
ARBUTUS BIOPHARMA
CORPORATION
Burnaby
CA
|
Family ID: |
1000005039051 |
Appl. No.: |
16/819766 |
Filed: |
March 16, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15570103 |
Oct 27, 2017 |
10626393 |
|
|
PCT/US2016/036069 |
Jun 6, 2016 |
|
|
|
16819766 |
|
|
|
|
62171148 |
Jun 4, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 9/22 20130101; C12N
2310/3515 20130101; A61K 48/0025 20130101; C12N 15/1137 20130101;
C12N 15/113 20130101; C12N 2320/32 20130101; C12N 15/111 20130101;
A61K 9/5146 20130101; C07K 7/06 20130101; A61K 9/5123 20130101;
C12N 2310/10 20130101; A61K 9/127 20130101; C12N 15/1131 20130101;
C12N 2310/20 20170501; C12N 2310/3513 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; C12N 15/11 20060101 C12N015/11; A61K 9/127 20060101
A61K009/127; A61K 9/51 20060101 A61K009/51; A61K 48/00 20060101
A61K048/00; C07K 7/06 20060101 C07K007/06; C12N 9/22 20060101
C12N009/22 |
Claims
1. A nucleic acid-lipid particle comprising: (a) one or more guide
RNA (gRNA) sequences that comprise a first sequence that
corresponds to a target sequence and a second sequence that is a
tracer RNA sequence located 3' of the first sequence; (b) a
cationic lipid; and (c) a non-cationic lipid.
2. The nucleic acid-lipid particle of claim 1, which further
comprises a mRNA sequence encoding a CRISPR associated protein 9
(Cas9).
3. The nucleic acid-lipid particle of claim 2, wherein the mRNA
sequence encoding the Cas9 further comprises a sequence encoding a
nuclear localization signal (NLS).
4. (canceled)
5. The nucleic acid-lipid particle of claim 2, wherein the mRNA
sequence encoding the Cas9 further comprises a polyA tail, a 5'
untranslated region (UTR) and/or a 3' UTR.
6. The nucleic acid-lipid particle of claim 1, wherein the cationic
lipid is selected from the group consisting of
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA),
1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
1,2-di-.gamma.-linolenyloxy-N,N-dimethylaminopropane
(.gamma.-DLenDMA; Compound (15)),
3-((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yloxy)-N,N-dimethy-
lpropan-1-amine (DLin-MP-DMA; Compound (8)),
(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethyl
amino)butanoate) (Compound (7)),
(6Z,16Z)-12-((Z)-dec-4-enyl)docosa-6,16-dien-11-yl
5-(dimethylamino)pentanoate (Compound (13)), a salt thereof, and a
mixture thereof.
7. The nucleic acid-lipid particle of claim 1, wherein the
non-cationic lipid is cholesterol or a derivative thereof.
8. The nucleic acid-lipid particle of claim 1, wherein the
non-cationic lipid is a phospholipid.
9. The nucleic acid-lipid particle of claim 1, further comprising a
conjugated lipid that inhibits aggregation of particles.
10. The nucleic acid-lipid particle of claim 9, wherein the
conjugated lipid that inhibits aggregation of particles is a
polyethyleneglycol (PEG)-lipid conjugate.
11. The nucleic acid-lipid particle of claim 10, wherein the
PEG-lipid conjugate is selected from the group consisting of a
PEG-diacylglycerol (PEG-DAG) conjugate, a PEG-dialkyloxypropyl
(PEG-DAA) conjugate, a PEG-phospholipid conjugate, a PEG-ceramide
(PEG-Cer) conjugate, and a mixture thereof.
12. The nucleic acid-lipid particle of claim 10, wherein the
PEG-lipid conjugate is PEG2000-C-DMA.
13. (canceled)
14. The nucleic acid-lipid particle of claim 1, wherein the gRNA is
fully encapsulated in the particle.
15. The nucleic acid-lipid particle of claim 1, wherein the
particle has a total lipid:gRNA mass ratio of from about 5:1 to
about 15:1.
16. (canceled)
17. The nucleic acid-lipid particle of claim 1, wherein the
particle has an electron dense core.
18. (canceled)
19. (canceled)
20. The nucleic acid-lipid particle of claim 9, wherein the
conjugated lipid that inhibits aggregation of particles comprises
from about 0.5 mol % to about 3 mol % of the total lipid present in
the particle.
21. (canceled)
22. The nucleic acid-lipid particle of claim 1 comprising two
different gRNA sequences.
23. (canceled)
24. (canceled)
25. (canceled)
26. (canceled)
27. A pharmaceutical composition comprising a nucleic acid-lipid
particle of claim 1 and a pharmaceutically acceptable carrier.
28. (canceled)
29. A method for silencing expression of a target gene in a cell,
the method comprising the step of contacting a cell comprising an
expressed target gene with the nucleic acid-lipid particle of claim
1 under conditions to silence the expression of the gene within the
cell.
30. (canceled)
31. (canceled)
32. (canceled)
33. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATION(S)
[0001] This application is a continuation of U.S. patent
application Ser. No. 15/570,103, filed Oct. 27, 2017, which is a 35
U.S.C. 371 application of International Application Serial No.
PCT/US2016/036069, filed Jun. 6, 2016, which claims the benefit of
U.S. Provisional Application Ser. No. 62/171,148, filed Jun. 4,
2015. The entire content of the applications referenced above are
hereby incorporated by reference herein.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on May 16, 2018, is named 08155_043US1_SL.txt and is 7 kb in
size.
BACKGROUND
[0003] Targeted genome editing using engineered nucleases has
progressed from being a niche technology to a method used by many
biological researchers. This adoption has been largely fueled by
the emergence of the clustered, regularly interspaced, short
palindromic repeat (CRISPR) technology, an important new approach
for generating RNA-guided nucleases, such as Cas9. See, e.g.,
Sander et al., Nature Biotechnology, 32(4), 347-355, including
Supplementary Information (2014).
[0004] There is a continuing need for compositions and methods for
delivering CRISPR therapeutics to patients in need thereof.
BRIEF SUMMARY
[0005] Provided herein are compositions and methods for utilizing
CRISPR technology to treat disease by using lipid nanoparticles to
deliver CRISPR therapeutics. The methods of the invention are
useful, for example, for the treatment of a targeted disease when
administered in a therapeutic amount to a human subject having the
disease. More generally, the invention provides lipid nanoparticles
that are capable of inhibiting or silencing target gene expression
in vitro and in vivo by delivering CRISPR therapeutics.
[0006] The present invention provides nucleic acid-lipid particles,
and formulations thereof, wherein the lipid particles each include
one or more (e.g., a cocktail) of the molecules described herein, a
cationic lipid, and a non-cationic lipid, and optionally a
conjugated lipid that inhibits aggregation of particles.
[0007] The present invention also provides formulations that
include gRNA encapsulated within lipid particles. The different
gRNA molecules may be co-encapsulated in the same lipid particle,
or each type of gRNA species present in the cocktail may be
encapsulated in separate particles, or some gRNA species may be
coencapsulated in the same particle while other gRNA species are
encapsulated in different particles within the formulation.
Typically, the gRNA molecules of the invention are fully
encapsulated in the lipid particle. In certain embodiments, the
lipid particles comprise both gRNA and an mRNA encoding a Cas9. In
certain embodiments, one population lipid particles comprises the
gRNA and another population of lipid particles comprises the mRNA
encoding a Cas9, which lipid particles may be in the same
composition or in different compositions, and may be administered
concurrently or sequentially.
[0008] The nucleic acid-lipid particles of the invention are useful
for the prophylactic or therapeutic delivery, into a human having a
disease, of gRNA molecules that silence the expression of one or
more genes associated with the disease, thereby ameliorating at
least one symptom of the disease in the human. In some embodiments,
one or more of the gRNA molecules described herein are formulated
into nucleic acid-lipid particles, and the particles are
administered to a mammal (e.g., a human) requiring such treatment.
In certain instances, a therapeutically effective amount of the
nucleic acid-lipid particle can be administered to the mammal.
Administration of the nucleic acid-lipid particle can be by any
route known in the art, such as, e.g., oral, intranasal,
intravenous, intraperitoneal, intramuscular, intra-articular,
intralesional, intratracheal, subcutaneous, or intradermal. In
particular embodiments, the nucleic acid-lipid particle is
administered systemically, e.g., via enteral or parenteral routes
of administration.
[0009] In some embodiments, downregulation of target gene
expression is determined by detecting target RNA or protein levels
in a biological sample from a mammal after nucleic acid-lipid
particle administration. In other embodiments, downregulation of
target gene expression is determined by detecting target mRNA or
protein levels in a biological sample from a mammal after nucleic
acid-lipid particle administration. In certain embodiments,
downregulation of target gene expression is detected by monitoring
symptoms associated with target infection in a mammal after
particle administration. In certain embodiments, inactivating
mutations (e.g., specific inactivating mutations) in target DNA are
detected to determine the efficacy of CRISPR/Cas9 at inactivating
target expression.
[0010] In another embodiment, the present invention provides
methods for introducing a combination of gRNA and Cas9 to silence
target gene expression in a living cell, the method comprising the
step of contacting the cell with a nucleic acid-lipid particle of
the invention, wherein the nucleic acid-lipid particle includes an
gRNA that targets target, under conditions whereby the gRNA enters
the cell with the Cas9 mRNA and silences the expression of a target
gene within the cell.
[0011] In another embodiment, the present invention provides
methods for silencing target gene expression in a mammal (e.g., a
human) in need thereof, wherein the methods each include the step
of administering to the mammal a nucleic acid-lipid particle of the
present invention.
[0012] In a further aspect, the present invention provides for use
of a pharmaceutical composition of the present invention for
inhibiting target gene expression in a living cell.
[0013] The compositions of the invention are also useful, for
example, in biological assays (e.g., in vivo or in vitro assays)
for inhibiting the expression of one or more target genes.
[0014] Other objects, features, and advantages of the present
invention will be apparent to one of skill in the art from the
following.
DETAILED DESCRIPTION
[0015] The therapy described herein advantageously provides
significant new compositions and methods for treating targeted
disease(s) in human beings and the symptoms associated therewith.
Embodiments of the present invention can be administered, for
example, once per day, once per week, or once every several weeks
(e.g., once every two, three, four, five or six weeks).
[0016] Furthermore, the nucleic acid-lipid particles described
herein enable the effective delivery of a nucleic acid drug into
target tissues and cells within the body. The presence of the lipid
particle confers protection from nuclease degradation in the
bloodstream, allows preferential accumulation in target tissue and
provides a means of drug entry into the cells.
[0017] Accordingly, certain embodiments of the present invention
provide a nucleic acid-lipid particle comprising: (a) one or more
guide RNA (gRNA) sequences that comprise a first sequence that
corresponds to a target sequence and a second sequence that is a
tracer RNA sequence, e.g., located 3' of the first sequence; (b) a
cationic lipid; and (c) a non-cationic lipid.
[0018] In certain embodiments, the nucleic acid-lipid particle
further comprises a mRNA sequence encoding a CRISPR associated
protein 9 (Cas9).
[0019] In certain embodiments, the mRNA sequence encoding the Cas9
further comprises a sequence encoding a nuclear localization signal
(NLS).
[0020] In certain embodiments, the NLS is a PKKKRKV (SEQ ID
NO:1).
[0021] In certain embodiments, the mRNA sequence encoding the Cas9
further comprises a polyA tail, a 5' untranslated region (UTR)
and/or a 3' UTR.
[0022] In certain embodiments, the cationic lipid is selected from
the group consisting of 1,2-dilinoleyloxy-N,N-dimethylaminopropane
(DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
1,2-di-.gamma.-linolenyloxy-N,N-dimethylaminopropane
(.gamma.-DLenDMA; Compound (15)),
3-((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yloxy)-N,N-dimethy-
lpropan-1-amine (DLin-MP-DMA; Compound (8)),
(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl
4-(dimethylamino)butanoate) (Compound (7)),
(6Z,16Z)-12-((Z)-dec-4-enyl)docosa-6,16-dien-11-yl
5-(dimethylamino)pentanoate (Compound (13)), a salt thereof, and a
mixture thereof.
[0023] In certain embodiments, the non-cationic lipid is
cholesterol or a derivative thereof.
[0024] In certain embodiments, the non-cationic lipid is a
phospholipid.
[0025] In certain embodiments, the nucleic acid-lipid particle
further comprises a conjugated lipid that inhibits aggregation of
particles.
[0026] In certain embodiments, the conjugated lipid that inhibits
aggregation of particles is a polyethyleneglycol (PEG)-lipid
conjugate.
[0027] In certain embodiments, the PEG-lipid conjugate is selected
from the group consisting of a PEG-diacylglycerol (PEG-DAG)
conjugate, a PEG-dialkyloxypropyl (PEG-DAA) conjugate, a
PEG-phospholipid conjugate, a PEG-ceramide (PEG-Cer) conjugate, and
a mixture thereof.
[0028] In certain embodiments, the PEG-lipid conjugate is a PEG-DAA
conjugate.
[0029] In certain embodiments, the PEG-DAA conjugate is selected
from the group consisting of a PEG-didecyloxypropyl (C.sub.10)
conjugate, a PEG-dilauryloxypropyl (C.sub.12) conjugate, a
PEG-dimyristyloxypropyl (C.sub.14) conjugate, a
PEG-dipalmityloxypropyl (C.sub.16) conjugate, a
PEG-distearyloxypropyl (C.sub.18) conjugate, and a mixture
thereof.
[0030] In certain embodiments, the gRNA is fully encapsulated in
the particle.
[0031] In certain embodiments, the particle has a total lipid:gRNA
mass ratio of from about 5:1 to about 15:1.
[0032] In certain embodiments, the particle has a median diameter
of from about 30 nm to about 150 nm.
[0033] In certain embodiments, the particle has an electron dense
core.
[0034] In certain embodiments, the cationic lipid comprises from
about 48 mol % to about 62 mol % of the total lipid present in the
particle.
[0035] In certain embodiments, the nucleic acid-lipid particle
comprises a phospholipid and cholesterol or cholesterol derivative,
wherein the phospholipid comprises from about 7 mol % to about 17
mol % of the total lipid present in the particle and the
cholesterol or derivative thereof comprises from about 25 mol % to
about 40 mol % of the total lipid present in the particle.
[0036] In certain embodiments, the conjugated lipid that inhibits
aggregation of particles comprises from about 0.5 mol % to about 3
mol % of the total lipid present in the particle.
[0037] In certain embodiments, the lipids are formulated as
described in any one of formulations A, B, C, D, E, F, G, H, I, J,
K, L, M, N, O, P, Q, R, S, T, U, V, W, X, Y or Z.
[0038] In certain embodiments, the nucleic acid-lipid particle
comprises two different gRNA sequences.
[0039] In certain embodiments, the nucleic acid-lipid particle
comprises three different gRNA sequences.
[0040] In certain embodiments, the nucleic acid-lipid particle
comprises four different gRNA sequences.
[0041] In certain embodiments, the nucleic acid-lipid particle
comprises five different gRNA sequences.
[0042] In certain embodiments, the target sequence corresponds to a
target sequence described in International Publication Number WO
2013/151665.
[0043] Certain embodiments provide a pharmaceutical composition
comprising a nucleic acid-lipid particle described herein and a
pharmaceutically acceptable carrier.
[0044] Certain embodiments provide a pharmaceutical composition
comprising a nucleic acid-lipid particle as described herein and a
pharmaceutically acceptable carrier, which composition optionally
comprises a second nucleic acid-lipid particle comprising a mRNA
sequence encoding a Cas9, which second nucleic acid-lipid particle
does not comprise a gRNA.
[0045] Certain embodiments provide a method for silencing
expression of a target gene in a cell, the method comprising the
step of contacting a cell comprising an expressed target gene with
a composition described herein under conditions to silence the
expression of the gene within the cell.
[0046] In certain embodiments, the cell is in a mammal.
[0047] In certain embodiments, the cell is contacted by
administering the particle to the mammal via a systemic route.
[0048] Certain embodiments provide a nucleic acid-lipid particle or
a pharmaceutical composition described herein for use in silencing
expression of a gene (e.g., a target gene) in a cell in a mammal
(e.g., a human).
[0049] Certain embodiments provide the use of a nucleic acid-lipid
particle or a pharmaceutical composition described herein to
prepare a medicament for silencing expression of a gene (e.g., a
target gene) in a cell in a mammal (e.g., a human).
[0050] As used herein, the following terms have the meanings
ascribed to them unless specified otherwise.
[0051] Briefly, the CRISPR technology can be utilized by combining
the CRISPR associated protein 9 (Cas9), an RNA-guided DNA
endonuclease enzyme, with a guide RNA (gRNA) sequence that is
designed to be utilized by the Cas9 to target a specific sequence.
This combination functions to inhibit target gene expression.
[0052] An example of an open reading frame (ORF) for the
Streptococcus pyogenes (SP) Cas9, found in a plasmid provided by
the George Church Lab to addgene.org, is provided below. The mRNA
encoding Cas9 will also generally include a polyA tail and other
elements (e.g., including 5' & 3' UTR). Cas9 mRNA can also be
purchased, e.g., from TriLink BioTechnologies, Inc. Other versions
of this Cas9 mRNA may be used by varying the codons without
changing the translated protein. Also the nature of the NLS
(nuclear localization signal) can vary. An example includes a SV40
NLS (PKKKRKV; SEQ ID NO:1) at the 3' end. Further descriptions of
CRISPR related proteins, and the expression thereof, can be found,
e.g., in International Publication Number WO 2015/006747.
TABLE-US-00001 An Open Reading Frame for the Streptococcus pyogenes
(SP) Cas9 (SEQ ID NO: 2)
5'ATGGACAAGAAGTACTCCATTGGGCTCGATATCGGCACAAACAGCGTC
GGCTGGGCCGTCATTACGGACGAGTACAAGGTGCCGAGCAAAAAATTCAA
AGTTCTGGGCAATACCGATCGCCACAGCATAAAGAAGAACCTCATTGGCG
CCCTCCTGTTCGACTCCGGGGAGACGGCCGAAGCCACGCGGCTCAAAAGA
ACAGCACGGCGCAGATATACCCGCAGAAAGAATCGGATCTGCTACCTGCA
GGAGATCTTTAGTAATGAGATGGCTAAGGTGGATGACTCTTTCTTCCATA
GGCTGGAGGAGTCCTTTTTGGTGGAGGAGGATAAAAAGCACGAGCGCCAC
CCAATCTTTGGCAATATCGTGGACGAGGTGGCGTACCATGAAAAGTACCC
AACCATATATCATCTGAGGAAGAAGCTTGTAGACAGTACTGATAAGGCTG
ACTTGCGGTTGATCTATCTCGCGCTGGCGCATATGATCAAATTTCGGGGA
CACTTCCTCATCGAGGGGGACCTGAACCCAGACAACAGCGATGTCGACAA
ACTCTTTATCCAACTGGTTCAGACTTACAATCAGCTTTTCGAAGAGAACC
CGATCAACGCATCCGGAGTTGACGCCAAAGCAATCCTGAGCGCTAGGCTG
TCCAAATCCCGGCGGCTCGAAAACCTCATCGCACAGCTCCCTGGGGAGAA
GAAGAACGGCCTGTTTGGTAATCTTATCGCCCTGTCACTCGGGCTGACCC
CCAACTTTAAATCTAACTTCGACCTGGCCGAAGATGCCAAGCTTCAACTG
AGCAAAGACACCTACGATGATGATCTCGACAATCTGCTGGCCCAGATCGG
CGACCAGTACGCAGACCTTTTTTTGGCGGCAAAGAACCTGTCAGACGCCA
TTCTGCTGAGTGATATTCTGCGAGTGAACACGGAGATCACCAAAGCTCCG
CTGAGCGCTAGTATGATCAAGCGCTATGATGAGCACCACCAAGACTTGAC
TTTGCTGAAGGCCCTTGTCAGACAGCAACTGCCTGAGAAGTACAAGGAAA
TTTTCTTCGATCAGTCTAAAAATGGCTACGCCGGATACATTGACGGCGGA
GCAAGCCAGGAGGAATTTTACAAATTTATTAAGCCCATCTTGGAAAAAAT
GGACGGCACCGAGGAGCTGCTGGTAAAGCTTAACAGAGAAGATCTGTTGC
GCAAACAGCGCACTTTCGACAATGGAAGCATCCCCCACCAGATTCACCTG
GGCGAACTGCACGCTATCCTCAGGCGGCAAGAGGATTTCTACCCCTTTTT
GAAAGATAACAGGGAAAAGATTGAGAAAATCCTCACATTTCGGATACCCT
ACTATGTAGGCCCCCTCGCCCGGGGAAATTCCAGATTCGCGTGGATGACT
CGCAAATCAGAAGAGACCATCACTCCCTGGAACTTCGAGGAAGTCGTGGA
TAAGGGGGCCTCTGCCCAGTCCTTCATCGAAAGGATGACTAACTTTGATA
AAAATCTGCCTAACGAAAAGGTGCTTCCTAAACACTCTCTGCTGTACGAG
TACTTCACAGTTTATAACGAGCTCACCAAGGTCAAATACGTCACAGAAGG
GATGAGAAAGCCAGCATTCCTGTCTGGAGAGCAGAAGAAAGCTATCGTGG
ACCTCCTCTTCAAGACGAACCGGAAAGTTACCGTGAAACAGCTCAAAGAA
GACTATTTCAAAAAGATTGAATGTTTCGACTCTGTTGAAATCAGCGGAGT
GGAGGATCGCTTCAACGCATCCCTGGGAACGTATCACGATCTCCTGAAAA
TCATTAAAGACAAGGACTTCCTGGACAATGAGGAGAACGAGGACATTCTT
GAGGACATTGTCCTCACCCTTACGTTGTTTGAAGATAGGGAGATGATTGA
AGAACGCTTGAAAACTTACGCTCATCTCTTCGACGACAAAGTCATGAAAC
AGCTCAAGAGGCGCCGATATACAGGATGGGGGCGGCTGTCAAGAAAACTG
ATCAATGGGATCCGAGACAAGCAGAGTGGAAAGACAATCCTGGATTTTCT
TAAGTCCGATGGATTTGCCAACCGGAACTTCATGCAGTTGATCCATGATG
ACTCTCTCACCTTTAAGGAGGACATCCAGAAAGCACAAGTTTCTGGCCAG
GGGGACAGTCTTCACGAGCACATCGCTAATCTTGCAGGTAGCCCAGCTAT
CAAAAAGGGAATACTGCAGACCGTTAAGGTCGTGGATGAACTCGTCAAAG
TAATGGGAAGGCATAAGCCCGAGAATATCGTTATCGAGATGGCCCGAGAG
AACCAAACTACCCAGAAGGGACAGAAGAACAGTAGGGAAAGGATGAAGAG
GATTGAAGAGGGTATAAAAGAACTGGGGTCCCAAATCCTTAAGGAACACC
CAGTTGAAAACACCCAGCTTCAGAATGAGAAGCTCTACCTGTACTACCTG
CAGAACGGCAGGGACATGTACGTGGATCAGGAACTGGACATCAATCGGCT
CTCCGACTACGACGTGGATCATATCGTGCCCCAGTCTTTTCTCAAAGATG
ATTCTATTGATAATAAAGTGTTGACAAGATCCGATAAAAATAGAGGGAAG
AGTGATAACGTCCCCTCAGAAGAAGTTGTCAAGAAAATGAAAAATTATTG
GCGGCAGCTGCTGAACGCCAAACTGATCACACAACGGAAGTTCGATAATC
TGACTAAGGCTGAACGAGGTGGCCTGTCTGAGTTGGATAAAGCCGGCTTC
ATCAAAAGGCAGCTTGTTGAGACACGCCAGATCACCAAGCACGTGGCCCA
AATTCTCGATTCACGCATGAACACCAAGTACGATGAAAATGACAAACTGA
TTCGAGAGGTGAAAGTTATTACTCTGAAGTCTAAGCTGGTCTCAGATTTC
AGAAAGGACTTTCAGTTTTATAAGGTGAGAGAGATCAACAATTACCACCA
TGCGCATGATGCCTACCTGAATGCAGTGGTAGGCACTGCACTTATCAAAA
AATATCCCAAGCTTGAATCTGAATTTGTTTACGGAGACTATAAAGTGTAC
GATGTTAGGAAAATGATCGCAAAGTCTGAGCAGGAAATAGGCAAGGCCAC
CGCTAAGTACTTCTTTTACAGCAATATTATGAATTTTTTCAAGACCGAGA
TTACACTGGCCAATGGAGAGATTCGGAAGCGACCACTTATCGAAACAAAC
GGAGAAACAGGAGAAATCGTGTGGGACAAGGGTAGGGATTTCGCGACAGT
CCGGAAGGTCCTGTCCATGCCGCAGGTGAACATCGTTAAAAAGACCGAAG
TACAGACCGGAGGCTTCTCCAAGGAAAGTATCCTCCCGAAAAGGAACAGC
GACAAGCTGATCGCACGCAAAAAAGATTGGGACCCCAAGAAATACGGCGG
ATTCGATTCTCCTACAGTCGCTTACAGTGTACTGGTTGTGGCCAAAGTGG
AGAAAGGGAAGTCTAAAAAACTCAAAAGCGTCAAGGAACTGCTGGGCATC
ACAATCATGGAGCGATCAAGCTTCGAAAAAAACCCCATCGACTTTCTCGA
GGCGAAAGGATATAAAGAGGTCAAAAAAGACCTCATCATTAAGCTTCCCA
AGTACTCTCTCTTTGAGCTTGAAAACGGCCGGAAACGAATGCTCGCTAGT
GCGGGCGAGCTGCAGAAAGGTAACGAGCTGGCACTGCCCTCTAAATACGT
TAATTTCTTGTATCTGGCCAGCCACTATGAAAAGCTCAAAGGGTCTCCCG
AAGATAATGAGCAGAAGCAGCTGTTCGTGGAACAACACAAACACTACCTT
GATGAGATCATCGAGCAAATAAGCGAATTCTCCAAAAGAGTGATCCTCGC
CGACGCTAACCTCGATAAGGTGCTTTCTGCTTACAATAAGCACAGGGATA
AGCCCATCAGGGAGCAGGCAGAAAACATTATCCACTTGTTTACTCTGACC
AACTTGGGCGCGCCTGCAGCCTTCAAGTACTTCGACACCACCATAGACAG
AAAGCGGTACACCTCTACAAAGGAGGTCCTGGACGCCACACTGATTCATC
AGTCAATTACGGGGCTCTATGAAACAAGAATCGACCTCTCTCAGCTCGGT
GGAGACAGCAGGGCTGACCCCAAGAAGAAGAGGAAGGTGTGA3'
[0053] CRISPR Guide RNA (gRNA)
[0054] Regarding gRNA described herein, the first 20 Ns in gRNA
sequence below correspond to a target sequence. The remaining
portion of the gRNA sequence (the tracer RNA sequence) comprises
sequences for guiding the gRNA into the Cas9. The gRNA scaffold
below was described in Sander et al., Nature Biotechnology, 32(4),
347-355, including Supplementary Information (2014). As is
described in Sander et al., different gRNA strategies (e.g.,
utilizing different tracer RNA sequences) have been tried with more
or less success.
TABLE-US-00002 A gRNA Sequence (SEQ ID NO: 3)
5'NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGUUAAA
AUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU UU3'
[0055] Other examples of tracer RNA sequences are provided below.
(see, e.g., Ran et al., Nature, 520, 186-191 (2015))
TABLE-US-00003 A Tracer RNA for Streptococcus aureus (SA) (SEQ ID
NO: 4) 5'GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCG
UGUUUAUCUCGUCAACUUGUUGGCGAGAUUUU3' A Tracer RNA for Streptococcus
thermophilus (ST) (SEQ ID NO: 5)
5'GUUUUUGUACUCGAAAGAAGCUACAAAGAUAAGGCUUCAUGCCGAAAU
CAACACCCUGUCAUUUUAUGGCAGGGUGUUUU3'
[0056] The tracer RNA sequence of the gRNA of the present invention
in certain embodiments corresponds to one of the three tracer
sequences described hereinabove. In certain embodiments, the tracer
sequence is at least 90% identical to any one of the three tracer
sequences (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98% or 99% identical).
[0057] International Publication Number WO 2013/151665 (e.g., see
Table 6; which document is specifically incorporated by reference,
particularly including Table 6, and the associated Sequence
Listing) describes about 35,000 mRNA sequences, claimed in the
context of an mRNA expression construct. Certain embodiments of the
present invention provide lipid nanoparticles that comprise CRISPR
components that target the expression of any of these
sequences.
[0058] Cas9 recognizes protospacer adjacent motifs (PAMs) in
nucleic acid sequences. As such, in certain embodiments, the target
sequences are associated with a PAM sequence, such as a PAM
sequence in the chart below.
TABLE-US-00004 Species PAM Sequence Streptococcus pyogenes (SP) NGG
Neisseria meningitidis (NM) NNNNGATT Streptococcus thermophilus
(ST) NNAGAAW Streptococcus aureus (SA) NNGRRT
[0059] The phrase "inhibiting expression of a target gene" refers
to the ability to silence, reduce, or inhibit expression of a
target gene. To examine the extent of gene silencing, a test sample
(e.g., a biological sample from an organism of interest expressing
the target gene or a sample of cells in culture expressing the
target gene) is contacted with a composition that silences,
reduces, or inhibits expression of the target gene. Expression of
the target gene in the test sample is compared to expression of the
target gene in a control sample (e.g., a biological sample from an
organism of interest expressing the target gene or a sample of
cells in culture expressing the target gene) that is not contacted
with the composition. Control samples (e.g., samples expressing the
target gene) may be assigned a value of 100%. In particular
embodiments, silencing, inhibition, or reduction of expression of a
target gene is achieved when the value of the test sample relative
to the control sample (e.g., buffer only, an gRNA sequence that
targets a different gene, a scrambled gRNA sequence, etc.) is about
100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%,
87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%,
70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%,
5%, or 0%. Suitable assays include, without limitation, examination
of protein or mRNA levels using techniques known to those of skill
in the art, such as, e.g., dot blots, Northern blots, in situ
hybridization, ELISA, immunoprecipitation, enzyme function, as well
as phenotypic assays known to those of skill in the art. An
"effective amount" or "therapeutically effective amount" of a
therapeutic nucleic acid is an amount sufficient to produce the
desired effect, e.g., an inhibition of expression of a target
sequence in comparison to the normal expression level detected in
the absence of the nucleic acid. In particular embodiments,
inhibition of expression of a target gene or target sequence is
achieved when the value obtained relative to the control (e.g.,
buffer only, an gRNA sequence that targets a different gene, a
scrambled gRNA sequence, etc.) is about 100%, 99%, 98%, 97%, 96%,
95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%,
82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 70%, 65%, 60%, 55%, 50%,
45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 0%. Suitable assays
for measuring the expression of a target gene or target sequence
include, but are not limited to, examination of protein or mRNA
levels using techniques known to those of skill in the art, such
as, e.g., dot blots, Northern blots, in situ hybridization, ELISA,
immunoprecipitation, enzyme function, as well as phenotypic assays
known to those of skill in the art.
[0060] The term "nucleic acid" as used herein refers to a polymer
containing at least two nucleotides (i.e., deoxyribonucleotides or
ribonucleotides) in either single- or double-stranded form and
includes DNA and RNA. "Nucleotides" contain a sugar deoxyribose
(DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides
are linked together through the phosphate groups. "Bases" include
purines and pyrimidines, which further include natural compounds
adenine, thymine, guanine, cytosine, uracil, inosine, and natural
analogs, and synthetic derivatives of purines and pyrimidines,
which include, but are not limited to, modifications which place
new reactive groups such as, but not limited to, amines, alcohols,
thiols, carboxylates, and alkylhalides. Nucleic acids include
nucleic acids containing known nucleotide analogs or modified
backbone residues or linkages, which are synthetic, naturally
occurring, and non-naturally occurring, and which have similar
binding properties as the reference nucleic acid. Examples of such
analogs and/or modified residues include, without limitation,
phosphorothioates, phosphoramidates, methyl phosphonates,
chiral-methyl phosphonates, 2'-O-methyl ribonucleotides, and
peptide-nucleic acids (PNAs).
[0061] The term "nucleic acid" includes any oligonucleotide or
polynucleotide, with fragments containing up to 60 nucleotides
generally termed oligonucleotides, and longer fragments termed
polynucleotides. A deoxyribooligonucleotide consists of a 5-carbon
sugar called deoxyribose joined covalently to phosphate at the 5'
and 3' carbons of this sugar to form an alternating, unbranched
polymer. DNA may be in the form of, e.g., antisense molecules,
plasmid DNA, pre-condensed DNA, a PCR product, vectors, expression
cassettes, chimeric sequences, chromosomal DNA, or derivatives and
combinations of these groups. A ribooligonucleotide consists of a
similar repeating structure where the 5-carbon sugar is ribose.
Accordingly, in the context of this invention, the terms
"polynucleotide" and "oligonucleotide" refer to a polymer or
oligomer of nucleotide or nucleoside monomers consisting of
naturally-occurring bases, sugars and intersugar (backbone)
linkages. The terms "polynucleotide" and "oligonucleotide" also
include polymers or oligomers comprising non-naturally occurring
monomers, or portions thereof, which function similarly. Such
modified or substituted oligonucleotides are often preferred over
native forms because of properties such as, for example, enhanced
cellular uptake, reduced immunogenicity, and increased stability in
the presence of nucleases.
[0062] Unless otherwise indicated, a particular nucleic acid
sequence also implicitly encompasses conservatively modified
variants thereof (e.g., degenerate codon substitutions), alleles,
orthologs, SNPs, and complementary sequences as well as the
sequence explicitly indicated. Specifically, degenerate codon
substitutions may be achieved by generating sequences in which the
third position of one or more selected (or all) codons is
substituted with mixed-base and/or deoxyinosine residues (Batzer et
al., Nucleic Acid Res., 19:5081 (1991); Ohtsuka et al., J. Biol.
Chem., 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes,
8:91-98 (1994)).
[0063] In certain embodiments, a nucleic acid sequence may include
at least one "unlocked nucleobase analogue" (UNA).
[0064] The invention encompasses isolated or substantially purified
nucleic acid molecules and compositions containing those molecules.
In the context of the present invention, an "isolated" or
"purified" DNA molecule or RNA molecule is a DNA molecule or RNA
molecule that exists apart from its native environment. An isolated
DNA molecule or RNA molecule may exist in a purified form or may
exist in a non-native environment such as, for example, a
transgenic host cell. For example, an "isolated" or "purified"
nucleic acid molecule or biologically active portion thereof, is
substantially free of other cellular material, or culture medium
when produced by recombinant techniques, or substantially free of
chemical precursors or other chemicals when chemically synthesized.
In one embodiment, an "isolated" nucleic acid is free of sequences
that naturally flank the nucleic acid (i.e., sequences located at
the 5' and 3' ends of the nucleic acid) in the genomic DNA of the
organism from which the nucleic acid is derived. For example, in
various embodiments, the isolated nucleic acid molecule can contain
less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of
nucleotide sequences that naturally flank the nucleic acid molecule
in genomic DNA of the cell from which the nucleic acid is
derived.
[0065] The term "gene" refers to a nucleic acid (e.g., DNA or RNA)
sequence that comprises partial length or entire length coding
sequences necessary for the production of a polypeptide or
precursor polypeptide.
[0066] "Gene product," as used herein, refers to a product of a
gene such as an RNA transcript or a polypeptide.
[0067] The term "unlocked nucleobase analogue" (abbreviated as
"UNA") refers to an acyclic nucleobase in which the C2' and C3'
atoms of the ribose ring are not covalently linked. The term
"unlocked nucleobase analogue" includes nucleobase analogues having
the following structure identified as Structure A:
##STR00001##
wherein R is hydroxyl, and Base is any natural or unnatural base
such as, for example, adenine (A), cytosine (C), guanine (G) and
thymine (T). UNA useful in the practice of the present invention
include the molecules identified as acyclic 2'-3'-seco-nucleotide
monomers in U.S. Pat. No. 8,314,227 which is incorporated by
reference herein in its entirety.
[0068] The term "lipid" refers to a group of organic compounds that
include, but are not limited to, esters of fatty acids and are
characterized by being insoluble in water, but soluble in many
organic solvents. They are usually divided into at least three
classes: (1) "simple lipids," which include fats and oils as well
as waxes; (2) "compound lipids," which include phospholipids and
glycolipids; and (3) "derived lipids" such as steroids.
[0069] The term "lipid particle" includes a lipid formulation that
can be used to deliver a therapeutic nucleic acid (e.g., gRNA) to a
target site of interest (e.g., cell, tissue, organ, and the like).
In preferred embodiments, the lipid particle of the invention is
typically formed from a cationic lipid, a non-cationic lipid, and
optionally a conjugated lipid that prevents aggregation of the
particle. A lipid particle that includes a nucleic acid molecule
(e.g., gRNA molecule) is referred to as a nucleic acid-lipid
particle. Typically, the nucleic acid is fully encapsulated within
the lipid particle, thereby protecting the nucleic acid from
enzymatic degradation.
[0070] In certain instances, nucleic acid-lipid particles are
extremely useful for systemic applications, as they can exhibit
extended circulation lifetimes following intravenous (i.v.)
injection, they can accumulate at distal sites (e.g., sites
physically separated from the administration site), and they can
mediate silencing of target gene expression at these distal sites.
The nucleic acid may be complexed with a condensing agent and
encapsulated within a lipid particle as set forth in PCT
Publication No. WO 00/03683, the disclosure of which is herein
incorporated by reference in its entirety for all purposes.
[0071] The lipid particles of the invention typically have a mean
diameter of from about 30 nm to about 150 nm, from about 40 nm to
about 150 nm, from about 50 nm to about 150 nm, from about 60 nm to
about 130 nm, from about 70 nm to about 110 nm, from about 70 nm to
about 100 nm, from about 80 nm to about 100 nm, from about 90 nm to
about 100 nm, from about 70 to about 90 nm, from about 80 nm to
about 90 nm, from about 70 nm to about 80 nm, or about 30 nm, 35
nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm,
85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125
nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm, and are
substantially non-toxic. In addition, nucleic acids, when present
in the lipid particles of the present invention, are resistant in
aqueous solution to degradation with a nuclease. Nucleic acid-lipid
particles and their method of preparation are disclosed in, e.g.,
U.S. Patent Publication Nos. 20040142025 and 20070042031, the
disclosures of which are herein incorporated by reference in their
entirety for all purposes.
[0072] As used herein, "lipid encapsulated" can refer to a lipid
particle that provides a therapeutic nucleic acid such as a gRNA,
with full encapsulation, partial encapsulation, or both. In a
preferred embodiment, the nucleic acid (e.g., gRNA) is fully
encapsulated in the lipid particle (e.g., to form a nucleic
acid-lipid particle).
[0073] The term "lipid conjugate" refers to a conjugated lipid that
inhibits aggregation of lipid particles. Such lipid conjugates
include, but are not limited to, PEG-lipid conjugates such as,
e.g., PEG coupled to dialkyloxypropyls (e.g., PEG-DAA conjugates),
PEG coupled to diacylglycerols (e.g., PEG-DAG conjugates), PEG
coupled to cholesterol, PEG coupled to phosphatidylethanolamines,
and PEG conjugated to ceramides (see, e.g., U.S. Pat. No.
5,885,613), cationic PEG lipids, polyoxazoline (POZ)-lipid
conjugates (e.g., POZ-DAA conjugates), polyamide oligomers (e.g.,
ATTA-lipid conjugates), and mixtures thereof. Additional examples
of POZ-lipid conjugates are described in PCT Publication No. WO
2010/006282. PEG or POZ can be conjugated directly to the lipid or
may be linked to the lipid via a linker moiety. Any linker moiety
suitable for coupling the PEG or the POZ to a lipid can be used
including, e.g., non-ester containing linker moieties and
ester-containing linker moieties. In certain preferred embodiments,
non-ester containing linker moieties, such as amides or carbamates,
are used.
[0074] The term "amphipathic lipid" refers, in part, to any
suitable material wherein the hydrophobic portion of the lipid
material orients into a hydrophobic phase, while the hydrophilic
portion orients toward the aqueous phase. Hydrophilic
characteristics derive from the presence of polar or charged groups
such as carbohydrates, phosphate, carboxylic, sulfato, amino,
sulfhydryl, nitro, hydroxyl, and other like groups. Hydrophobicity
can be conferred by the inclusion of apolar groups that include,
but are not limited to, long-chain saturated and unsaturated
aliphatic hydrocarbon groups and such groups substituted by one or
more aromatic, cycloaliphatic, or heterocyclic group(s). Examples
of amphipathic compounds include, but are not limited to,
phospholipids, aminolipids, and sphingolipids.
[0075] Representative examples of phospholipids include, but are
not limited to, phosphatidylcholine, phosphatidylethanolamine,
phosphatidylserine, phosphatidylinositol, phosphatidic acid,
palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine,
lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine,
dioleoylphosphatidylcholine, di stearoylphosphatidylcholine, and
dilinoleoylphosphatidylcholine. Other compounds lacking in
phosphorus, such as sphingolipid, glycosphingolipid families,
diacylglycerols, and .beta.-acyloxyacids, are also within the group
designated as amphipathic lipids. Additionally, the amphipathic
lipids described above can be mixed with other lipids including
triglycerides and sterols.
[0076] The term "neutral lipid" refers to any of a number of lipid
species that exist either in an uncharged or neutral zwitterionic
form at a selected pH. At physiological pH, such lipids include,
for example, diacylphosphatidylcholine,
diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin,
cholesterol, cerebrosides, and diacylglycerols.
[0077] The term "non-cationic lipid" refers to any amphipathic
lipid as well as any other neutral lipid or anionic lipid.
[0078] The term "anionic lipid" refers to any lipid that is
negatively charged at physiological pH. These lipids include, but
are not limited to, phosphatidylglycerols, cardiolipins,
diacylphosphatidylserines, diacylphosphatidic acids, N-dodecanoyl
phosphatidylethanolamines, N-succinyl phosphatidylethanolamines,
N-glutarylphosphatidylethanolamines, lysylphosphatidylglycerols,
palmitoyloleyolphosphatidylglycerol (POPG), and other anionic
modifying groups joined to neutral lipids.
[0079] The term "hydrophobic lipid" refers to compounds having
apolar groups that include, but are not limited to, long-chain
saturated and unsaturated aliphatic hydrocarbon groups and such
groups optionally substituted by one or more aromatic,
cycloaliphatic, or heterocyclic group(s). Suitable examples
include, but are not limited to, diacylglycerol, dialkylglycerol,
N--N-dialkylamino, 1,2-diacyloxy-3-aminopropane, and
1,2-dialkyl-3-aminopropane.
[0080] The terms "cationic lipid" and "amino lipid" are used
interchangeably herein to include those lipids and salts thereof
having one, two, three, or more fatty acid or fatty alkyl chains
and a pH-titratable amino head group (e.g., an alkylamino or
dialkylamino head group). The cationic lipid is typically
protonated (i.e., positively charged) at a pH below the pK.sub.a of
the cationic lipid and is substantially neutral at a pH above the
pK.sub.a. The cationic lipids of the invention may also be termed
titratable cationic lipids. In some embodiments, the cationic
lipids comprise: a protonatable tertiary amine (e.g.,
pH-titratable) head group; C.sub.18 alkyl chains, wherein each
alkyl chain independently has 0 to 3 (e.g., 0, 1, 2, or 3) double
bonds; and ether, ester, or ketal linkages between the head group
and alkyl chains. Such cationic lipids include, but are not limited
to, DSDMA, DODMA, DLinDMA, DLenDMA, .gamma.-DLenDMA, DLin-K-DMA,
DLin-K-C2-DMA (also known as DLin-C2K-DMA, XTC2, and C2K),
DLin-K-C3-DMA, DLin-K-C4-DMA, DLen-C2K-DMA, .gamma.-DLen-C2K-DMA,
DLin-M-C2-DMA (also known as MC2), and DLin-M-C3-DMA (also known as
MC3).
[0081] The term "salts" includes any anionic and cationic complex,
such as the complex formed between a cationic lipid and one or more
anions. Non-limiting examples of anions include inorganic and
organic anions, e.g., hydride, fluoride, chloride, bromide, iodide,
oxalate (e.g., hemioxalate), phosphate, phosphonate, hydrogen
phosphate, dihydrogen phosphate, oxide, carbonate, bicarbonate,
nitrate, nitrite, nitride, bisulfite, sulfide, sulfite, bisulfate,
sulfate, thiosulfate, hydrogen sulfate, borate, formate, acetate,
benzoate, citrate, tartrate, lactate, acrylate, polyacrylate,
fumarate, maleate, itaconate, glycolate, gluconate, malate,
mandelate, tiglate, ascorbate, salicylate, polymethacrylate,
perchlorate, chlorate, chlorite, hypochlorite, bromate,
hypobromite, iodate, an alkylsulfonate, an arylsulfonate, arsenate,
arsenite, chromate, dichromate, cyanide, cyanate, thiocyanate,
hydroxide, peroxide, permanganate, and mixtures thereof. In
particular embodiments, the salts of the cationic lipids disclosed
herein are crystalline salts.
[0082] The term "alkyl" includes a straight chain or branched,
noncyclic or cyclic, saturated aliphatic hydrocarbon containing
from 1 to 24 carbon atoms. Representative saturated straight chain
alkyls include, but are not limited to, methyl, ethyl, n-propyl,
n-butyl, n-pentyl, n-hexyl, and the like, while saturated branched
alkyls include, without limitation, isopropyl, sec-butyl, isobutyl,
tert-butyl, isopentyl, and the like. Representative saturated
cyclic alkyls include, but are not limited to, cyclopropyl,
cyclobutyl, cyclopentyl, cyclohexyl, and the like, while
unsaturated cyclic alkyls include, without limitation,
cyclopentenyl, cyclohexenyl, and the like.
[0083] The term "alkenyl" includes an alkyl, as defined above,
containing at least one double bond between adjacent carbon atoms.
Alkenyls include both cis and trans isomers. Representative
straight chain and branched alkenyls include, but are not limited
to, ethylenyl, propylenyl, 1-butenyl, 2-butenyl, isobutylenyl,
1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl,
2,3-dimethyl-2-butenyl, and the like.
[0084] The term "alkynyl" includes any alkyl or alkenyl, as defined
above, which additionally contains at least one triple bond between
adjacent carbons. Representative straight chain and branched
alkynyls include, without limitation, acetylenyl, propynyl,
1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1 butynyl,
and the like.
[0085] The term "acyl" includes any alkyl, alkenyl, or alkynyl
wherein the carbon at the point of attachment is substituted with
an oxo group, as defined below. The following are non-limiting
examples of acyl groups: --C(.dbd.O)alkyl, --C(.dbd.O)alkenyl, and
--C(.dbd.O)alkynyl.
[0086] The term "heterocycle" includes a 5- to 7-membered
monocyclic, or 7- to 10-membered bicyclic, heterocyclic ring which
is either saturated, unsaturated, or aromatic, and which contains
from 1 or 2 heteroatoms independently selected from nitrogen,
oxygen and sulfur, and wherein the nitrogen and sulfur heteroatoms
may be optionally oxidized, and the nitrogen heteroatom may be
optionally quaternized, including bicyclic rings in which any of
the above heterocycles are fused to a benzene ring. The heterocycle
may be attached via any heteroatom or carbon atom. Heterocycles
include, but are not limited to, heteroaryls as defined below, as
well as morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl,
piperizynyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl,
tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl,
tetrahydroprimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl,
tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl,
and the like.
[0087] The terms "optionally substituted alkyl", "optionally
substituted alkenyl", "optionally substituted alkynyl", "optionally
substituted acyl", and "optionally substituted heterocycle" mean
that, when substituted, at least one hydrogen atom is replaced with
a substituent. In the case of an oxo substituent (.dbd.O), two
hydrogen atoms are replaced. In this regard, substituents include,
but are not limited to, oxo, halogen, heterocycle, --CN,
--OR.sup.x, --NR.sup.xR.sup.y, --NR.sup.xC(.dbd.O)R.sup.y,
--NR.sup.xSO.sub.2R.sup.y, --C(.dbd.O)R.sup.x, --C(.dbd.O)OR.sup.x,
--C(.dbd.O)NR.sup.xR.sup.y, --SO.sub.nR.sup.x, and
--SO.sub.nNR.sup.xR.sup.y, wherein n is 0, 1, or 2, R.sup.x and
R.sup.y are the same or different and are independently hydrogen,
alkyl, or heterocycle, and each of the alkyl and heterocycle
substituents may be further substituted with one or more of oxo,
halogen, --OH, --CN, alkyl, --OR.sup.x, heterocycle,
--NR.sup.xR.sup.y, --NR.sup.xC(.dbd.O)R.sup.y,
--NR.sup.xSO.sub.2R.sup.y, --C(.dbd.O)R.sup.x, --C(.dbd.O)OR.sup.x,
--C(.dbd.O)NR.sup.xR.sup.y, --SO.sub.nR.sup.x, and
--SO.sub.nNR.sup.xR.sup.y. The term "optionally substituted," when
used before a list of substituents, means that each of the
substituents in the list may be optionally substituted as described
herein.
[0088] The term "halogen" includes fluoro, chloro, bromo, and
iodo.
[0089] The term "fusogenic" refers to the ability of a lipid
particle to fuse with the membranes of a cell. The membranes can be
either the plasma membrane or membranes surrounding organelles,
e.g., endosome, nucleus, etc.
[0090] As used herein, the term "aqueous solution" refers to a
composition comprising in whole, or in part, water.
[0091] As used herein, the term "organic lipid solution" refers to
a composition comprising in whole, or in part, an organic solvent
having a lipid.
[0092] The term "electron dense core", when used to describe a
lipid particle of the present invention, refers to the dark
appearance of the interior portion of a lipid particle when
visualized using cryo transmission electron microscopy ("cyroTEM").
Some lipid particles of the present invention have an electron
dense core and lack a lipid bilayer structure. Some lipid particles
of the present invention have an elctron dense core, lack a lipid
bilayer structure, and have an inverse Hexagonal or Cubic phase
structure. While not wishing to be bound by theory, it is thought
that the non-bilayer lipid packing provides a 3-dimensional network
of lipid cylinders with water and nucleic acid on the inside, i.e.,
essentially a lipid droplet interpenetrated with aqueous channels
containing the nucleic acid.
[0093] "Distal site," as used herein, refers to a physically
separated site, which is not limited to an adjacent capillary bed,
but includes sites broadly distributed throughout an organism.
[0094] "Serum-stable" in relation to nucleic acid-lipid particles
means that the particle is not significantly degraded after
exposure to a serum or nuclease assay that would significantly
degrade free DNA or RNA. Suitable assays include, for example, a
standard serum assay, a DNAse assay, or an RNAse assay.
[0095] "Systemic delivery," as used herein, refers to delivery of
lipid particles that leads to a broad biodistribution of an active
agent within an organism. Some techniques of administration can
lead to the systemic delivery of certain agents, but not others.
Systemic delivery means that a useful, preferably therapeutic,
amount of an agent is exposed to most parts of the body. To obtain
broad biodistribution generally requires a blood lifetime such that
the agent is not rapidly degraded or cleared (such as by first pass
organs (liver, lung, etc.) or by rapid, nonspecific cell binding)
before reaching a disease site distal to the site of
administration. Systemic delivery of lipid particles can be by any
means known in the art including, for example, intravenous,
subcutaneous, and intraperitoneal. In a preferred embodiment,
systemic delivery of lipid particles is by intravenous
delivery.
[0096] "Local delivery," as used herein, refers to delivery of an
active agent directly to a target site within an organism. For
example, an agent can be locally delivered by direct injection into
a disease site, other target site, or a target organ such as the
liver, heart, pancreas, kidney, and the like.
[0097] The term "virus particle load", as used herein, refers to a
measure of the number of virus particles present in a bodily fluid,
such as blood. For example, particle load may be expressed as the
number of virus particles per milliliter of, e.g., blood. Particle
load testing may be performed using nucleic acid amplification
based tests, as well as non-nucleic acid-based tests (see, e.g.,
Puren et al., The Journal of Infectious Diseases, 201:S27-36
(2010)).
[0098] The term "mammal" refers to any mammalian species such as a
human, mouse, rat, dog, cat, hamster, guinea pig, rabbit,
livestock, and the like.
[0099] Description of Certain Embodiments
[0100] The present invention provides gRNA molecules that target
the expression of one or more target genes, nucleic acid-lipid
particles comprising one or more (e.g., a cocktail) of the gRNAs,
and methods of delivering and/or administering the nucleic
acid-lipid particles. The gRNA molecules may be delivered
concurrently with or sequentially with a mRNA molecule that encodes
Cas9, thereby delivering components to utilize the CRISPR/Cas9
system to treat disease in a human in need of such treatment. The
Cas9 mRNA and gRNA may be present in the same nucleic acid-lipid
particle, or they may be present in different nucleic acid-lipid
particles.
[0101] In one aspect, the present invention provides gRNA molecules
that target expression of one or more genes. In certain instances,
the present invention provides compositions comprising a
combination (e.g., a cocktail, pool, or mixture) of gRNAs that
target different regions of an identified gene or genome.
[0102] The present invention also provides a pharmaceutical
composition comprising one or more (e.g., a cocktail) of the gRNAs
described herein and a pharmaceutically acceptable carrier.
[0103] In certain embodiments, a composition described herein
comprises one or more gRNA molecules, which silences expression of
a target gene.
[0104] In another aspect, the present invention provides a nucleic
acid-lipid particle that targets gene expression of a specifically
identified gene that causes a disease or disorder. The nucleic
acid-lipid particles typically comprise one or more (e.g., a
cocktail) of the molecules described herein, a cationic lipid, and
a non-cationic lipid. In certain instances, the nucleic acid-lipid
particles further comprise a conjugated lipid that inhibits
aggregation of particles. The nucleic acid-lipid particles may
comprise one or more (e.g., a cocktail) of the molecules described
herein, a cationic lipid, a non-cationic lipid, and a conjugated
lipid that inhibits aggregation of particles.
[0105] In some embodiments, the gRNAs of the present invention are
fully encapsulated in the nucleic acid-lipid particle. With respect
to formulations comprising an gRNA cocktail, the different types of
gRNA species present in the cocktail (e.g., gRNA compounds with
different sequences) may be co-encapsulated in the same particle,
or each type of gRNA species present in the cocktail may be
encapsulated in a separate particle. The gRNA cocktail may be
formulated in the particles described herein using a mixture of
two, three or more individual gRNAs (each having a unique sequence)
at identical, similar, or different concentrations or molar ratios.
In one embodiment, a cocktail of gRNAs (corresponding to a
plurality of gRNAs with different sequences) is formulated using
identical, similar, or different concentrations or molar ratios of
each gRNA species, and the different types of gRNAs are
co-encapsulated in the same particle. In another embodiment, each
type of gRNA species present in the cocktail is encapsulated in
different particles at identical, similar, or different gRNA
concentrations or molar ratios, and the particles thus formed (each
containing a different gRNA payload) are administered separately
(e.g., at different times in accordance with a therapeutic
regimen), or are combined and administered together as a single
unit dose (e.g., with a pharmaceutically acceptable carrier). The
particles described herein are serum-stable, are resistant to
nuclease degradation, and are substantially non-toxic to mammals
such as humans.
[0106] The cationic lipid in the nucleic acid-lipid particles of
the invention may comprise, e.g., one or more cationic lipids of
Formula I-III described herein or any other cationic lipid species.
In one embodiment, cationic lipid is a dialkyl lipid. In another
embodiment, the cationic lipid is a trialkyl lipid. In one
particular embodiment, the cationic lipid is selected from the
group consisting of 1,2-dilinoleyloxy-N,N-dimethylaminopropane
(DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
1,2-di-.gamma.-linolenyloxy-N,N-dimethylaminopropane
(.gamma.-DLenDMA; Compound (15)),
2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane
(DLin-K-C2-DMA),
2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA),
dilinoleylmethyl-3-dimethylaminopropionate (DLin-M-C2-DMA),
(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl
4-(dimethylamino)butanoate (DLin-M-C3-DMA; Compound (7)), salts
thereof, and mixtures thereof.
[0107] In another particular embodiment, the cationic lipid is
selected from the group consisting of
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA),
1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
1,2-di-.gamma.-linolenyloxy-N,N-dimethylaminopropane
(.gamma.-DLenDMA; Compound (15)),
3-((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yloxy)-N,N-dimethy-
lpropan-1-amine (DLin-MP-DMA; Compound (8)),
(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl
4-(dimethylamino)butanoate) (Compound (7)),
(6Z,16Z)-12-((Z)-dec-4-enyl)docosa-6,16-dien-11-yl
5-(dimethylamino)pentanoate (Compound (13)), a salt thereof, or a
mixture thereof.
[0108] In certain embodiments, the cationic lipid comprises from
about 48 mol % to about 62 mol % of the total lipid present in the
particle.
[0109] The non-cationic lipid in the nucleic acid-lipid particles
of the present invention may comprise, e.g., one or more anionic
lipids and/or neutral lipids. In some embodiments, the non-cationic
lipid comprises one of the following neutral lipid components: (1)
a mixture of a phospholipid and cholesterol or a derivative
thereof; (2) cholesterol or a derivative thereof; or (3) a
phospholipid. In certain preferred embodiments, the phospholipid
comprises dipalmitoylphosphatidylcholine (DPPC), di
stearoylphosphatidylcholine (DSPC), or a mixture thereof. In a
preferred embodiment, the non-cationic lipid is a mixture of DPPC
and cholesterol. In a preferred embodiment, the non-cationic lipid
is a mixture of DSPC and cholesterol.
[0110] In certain embodiments, the non-cationic lipid comprises a
mixture of a phospholipid and cholesterol or a derivative thereof,
wherein the phospholipid comprises from about 7 mol % to about 17
mol % of the total lipid present in the particle and the
cholesterol or derivative thereof comprises from about 25 mol % to
about 40 mol % of the total lipid present in the particle.
[0111] The lipid conjugate in the nucleic acid-lipid particles of
the invention inhibits aggregation of particles and may comprise,
e.g., one or more of the lipid conjugates described herein. In one
particular embodiment, the lipid conjugate comprises a PEG-lipid
conjugate. Examples of PEG-lipid conjugates include, but are not
limited to, PEG-DAG conjugates, PEG-DAA conjugates, and mixtures
thereof. In certain embodiments, the PEG-lipid conjugate is
selected from the group consisting of a PEG-diacylglycerol
(PEG-DAG) conjugate, a PEG-dialkyloxypropyl (PEG-DAA) conjugate, a
PEG-phospholipid conjugate, a PEG-ceramide (PEG-Cer) conjugate, and
a mixture thereof. In certain embodiments, the PEG-lipid conjugate
is a PEG-DAA conjugate. In certain embodiments, the PEG-DAA
conjugate in the lipid particle may comprise a PEG-didecyloxypropyl
(C.sub.10) conjugate, a PEG-dilauryloxypropyl (C.sub.12) conjugate,
a PEG-dimyristyloxypropyl (C.sub.14) conjugate, a
PEG-dipalmityloxypropyl (C.sub.16) conjugate, a
PEG-distearyloxypropyl (C.sub.18) conjugate, or mixtures thereof.
In certain embodiments, wherein the PEG-DAA conjugate is a
PEG-dimyristyloxypropyl (C.sub.14) conjugate. In another
embodiment, the PEG-DAA conjugate is a compound (66) (PEG-C-DMA)
conjugate. In another embodiment, the lipid conjugate comprises a
POZ-lipid conjugate such as a POZ-DAA conjugate.
[0112] In certain embodiments, the conjugated lipid that inhibits
aggregation of particles comprises from about 0.5 mol % to about 3
mol % of the total lipid present in the particle.
[0113] In certain embodiments, the nucleic acid-lipid particle has
a total lipid:gRNA mass ratio of from about 5:1 to about 15:1.
[0114] In certain embodiments, the nucleic acid-lipid particle has
a median diameter of from about 30 nm to about 150 nm.
[0115] In certain embodiments, the nucleic acid-lipid particle has
an electron dense core.
[0116] In some embodiments, the present invention provides nucleic
acid-lipid particles comprising: (a) one or more (e.g., a cocktail)
gRNA molecules described herein; (b) one or more cationic lipids or
salts thereof comprising from about 50 mol % to about 85 mol % of
the total lipid present in the particle; (c) one or more
non-cationic lipids comprising from about 13 mol % to about 49.5
mol % of the total lipid present in the particle; and (d) one or
more conjugated lipids that inhibit aggregation of particles
comprising from about 0.5 mol % to about 2 mol % of the total lipid
present in the particle.
[0117] In one aspect of this embodiment, the nucleic acid-lipid
particle comprises: (a) one or more (e.g., a cocktail) gRNA
molecules described herein; (b) a cationic lipid or a salt thereof
comprising from about 52 mol % to about 62 mol % of the total lipid
present in the particle; (c) a mixture of a phospholipid and
cholesterol or a derivative thereof comprising from about 36 mol %
to about 47 mol % of the total lipid present in the particle; and
(d) a PEG-lipid conjugate comprising from about 1 mol % to about 2
mol % of the total lipid present in the particle. In one particular
embodiment, the formulation is a four-component system comprising
about 1.4 mol % PEG-lipid conjugate (e.g., PEG2000-C-DMA), about
57.1 mol % cationic lipid (e.g., DLin-K-C2-DMA) or a salt thereof,
about 7.1 mol % DPPC (or DSPC), and about 34.3 mol % cholesterol
(or derivative thereof).
[0118] In another aspect of this embodiment, the nucleic acid-lipid
particle comprises: (a) one or more (e.g., a cocktail) gRNA
molecules described herein; (b) a cationic lipid or a salt thereof
comprising from about 56.5 mol % to about 66.5 mol % of the total
lipid present in the particle; (c) cholesterol or a derivative
thereof comprising from about 31.5 mol % to about 42.5 mol % of the
total lipid present in the particle; and (d) a PEG-lipid conjugate
comprising from about 1 mol % to about 2 mol % of the total lipid
present in the particle. In one particular embodiment, the
formulation is a three-component system which is phospholipid-free
and comprises about 1.5 mol % PEG-lipid conjugate (e.g.,
PEG2000-C-DMA), about 61.5 mol % cationic lipid (e.g.,
DLin-K-C2-DMA) or a salt thereof, and about 36.9 mol % cholesterol
(or derivative thereof).
[0119] Additional formulations are described in PCT Publication No.
WO 09/127060 and published US patent application publication number
US 2011/0071208 A1, the disclosures of which are herein
incorporated by reference in their entirety for all purposes.
[0120] In other embodiments, the present invention provides nucleic
acid-lipid particles comprising: (a) one or more (e.g., a cocktail)
gRNA molecules described herein; (b) one or more cationic lipids or
salts thereof comprising from about 2 mol % to about 50 mol % of
the total lipid present in the particle; (c) one or more
non-cationic lipids comprising from about 5 mol % to about 90 mol %
of the total lipid present in the particle; and (d) one or more
conjugated lipids that inhibit aggregation of particles comprising
from about 0.5 mol % to about 20 mol % of the total lipid present
in the particle.
[0121] In one aspect of this embodiment, the nucleic acid-lipid
particle comprises: (a) one or more (e.g., a cocktail) gRNA
molecules described herein; (b) a cationic lipid or a salt thereof
comprising from about 30 mol % to about 50 mol % of the total lipid
present in the particle; (c) a mixture of a phospholipid and
cholesterol or a derivative thereof comprising from about 47 mol %
to about 69 mol % of the total lipid present in the particle; and
(d) a PEG-lipid conjugate comprising from about 1 mol % to about 3
mol % of the total lipid present in the particle. In one particular
embodiment, the formulation is a four-component system which
comprises about 2 mol % PEG-lipid conjugate (e.g., PEG2000-C-DMA),
about 40 mol % cationic lipid (e.g., DLin-K-C2-DMA) or a salt
thereof, about 10 mol % DPPC (or DSPC), and about 48 mol %
cholesterol (or derivative thereof).
[0122] In further embodiments, the present invention provides
nucleic acid-lipid particles comprising: (a) one or more (e.g., a
cocktail) gRNA molecules described herein; (b) one or more cationic
lipids or salts thereof comprising from about 50 mol % to about 65
mol % of the total lipid present in the particle; (c) one or more
non-cationic lipids comprising from about 25 mol % to about 45 mol
% of the total lipid present in the particle; and (d) one or more
conjugated lipids that inhibit aggregation of particles comprising
from about 5 mol % to about 10 mol % of the total lipid present in
the particle.
[0123] In one aspect of this embodiment, the nucleic acid-lipid
particle comprises: (a) one or more (e.g., a cocktail) gRNA
molecules described herein; (b) a cationic lipid or a salt thereof
comprising from about 50 mol % to about 60 mol % of the total lipid
present in the particle; (c) a mixture of a phospholipid and
cholesterol or a derivative thereof comprising from about 35 mol %
to about 45 mol % of the total lipid present in the particle; and
(d) a PEG-lipid conjugate comprising from about 5 mol % to about 10
mol % of the total lipid present in the particle. In certain
instances, the non-cationic lipid mixture in the formulation
comprises: (i) a phospholipid of from about 5 mol % to about 10 mol
% of the total lipid present in the particle; and (ii) cholesterol
or a derivative thereof of from about 25 mol % to about 35 mol % of
the total lipid present in the particle. In one particular
embodiment, the formulation is a four-component system which
comprises about 7 mol % PEG-lipid conjugate (e.g., PEG750-C-DMA),
about 54 mol % cationic lipid (e.g., DLin-K-C2-DMA) or a salt
thereof, about 7 mol % DPPC (or DSPC), and about 32 mol %
cholesterol (or derivative thereof).
[0124] In another aspect of this embodiment, the nucleic acid-lipid
particle comprises: (a) one or more (e.g., a cocktail) gRNA
molecules described herein; (b) a cationic lipid or a salt thereof
comprising from about 55 mol % to about 65 mol % of the total lipid
present in the particle; (c) cholesterol or a derivative thereof
comprising from about 30 mol % to about 40 mol % of the total lipid
present in the particle; and (d) a PEG-lipid conjugate comprising
from about 5 mol % to about 10 mol % of the total lipid present in
the particle. In one particular embodiment, the formulation is a
three-component system which is phospholipid-free and comprises
about 7 mol % PEG-lipid conjugate (e.g., PEG750-C-DMA), about 58
mol % cationic lipid (e.g., DLin-K-C2-DMA) or a salt thereof, and
about 35 mol % cholesterol (or derivative thereof).
[0125] Additional embodiments of useful formulations are described
in published US patent application publication number US
2011/0076335 A1, the disclosure of which is herein incorporated by
reference in its entirety for all purposes.
[0126] In certain embodiments of the invention, the nucleic
acid-lipid particle comprises: (a) one or more (e.g., a cocktail)
gRNA molecules described herein; (b) a cationic lipid or a salt
thereof comprising from about 48 mol % to about 62 mol % of the
total lipid present in the particle; (c) a mixture of a
phospholipid and cholesterol or a derivative thereof, wherein the
phospholipid comprises about 7 mol % to about 17 mol % of the total
lipid present in the particle, and wherein the cholesterol or
derivative thereof comprises about 25 mol % to about 40 mol % of
the total lipid present in the particle; and (d) a PEG-lipid
conjugate comprising from about 0.5 mol % to about 3.0 mol % of the
total lipid present in the particle. Exemplary lipid formulations
A-Z of this aspect of the invention are included below.
[0127] Exemplary lipid formulation A includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (1.2%), cationic lipid (53.2%),
phospholipid (9.3%), cholesterol (36.4%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (1.2%), the cationic lipid is
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA) (53.2%), the
phospholipid is DPPC (9.3%), and cholesterol is present at 36.4%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol %). Thus,
certain embodiments of the invention provide a nucleic acid-lipid
particle based on formulation A, which comprises one or more gRNA
molecules described herein. For example, in certain embodiments,
the nucleic acid lipid particle based on formulation A may comprise
two different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation A may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0128] Exemplary lipid formulation B which includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (0.8%), cationic lipid (59.7%),
phospholipid (14.2%), cholesterol (25.3%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DOMG (compound
(67)) (0.8%), the cationic lipid is
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA) (59.7%), the
phospholipid is DSPC (14.2%), and cholesterol is present at 25.3%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol %). Thus,
certain embodiments of the invention provide a nucleic acid-lipid
particle based on formulation B, which comprises one or more gRNA
molecules described herein. For example, in certain embodiments,
the nucleic acid lipid particle based on formulation B may comprise
two different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation B may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0129] Exemplary lipid formulation C includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (1.9%), cationic lipid (52.5%),
phospholipid (14.8%), cholesterol (30.8%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DOMG (compound
(67)) (1.9%), the cationic lipid is
1,2-di-.gamma.-linolenyloxy-N,N-dimethylaminopropane
(.gamma.-DLenDMA; Compound (15)) (52.5%), the phospholipid is DSPC
(14.8%), and cholesterol is present at 30.8%, wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, 0.5 mol
%, 0.25 mol %, or .+-.0.1 mol %). Thus, certain embodiments of the
invention provide a nucleic acid-lipid particle based on
formulation C, which comprises one or more gRNA molecules described
herein. For example, in certain embodiments, the nucleic acid lipid
particle based on formulation C may comprise two different gRNA
molecules, wherein a combination of the two different gRNA
molecules is selected from any one of the combinations described
herein. In certain other embodiments, the nucleic acid lipid
particle based on formulation C may comprise three different gRNA
molecules, wherein a combination of the three different gRNA
molecules is selected from any one of the combinations described
herein. In certain embodiments, the nucleic acid-lipid particle has
a total lipid:gRNA mass ratio of from about 5:1 to about 15:1, or
about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, or
15:1, or any fraction thereof or range therein. In certain
embodiments, the nucleic acid-lipid particle has a total lipid:gRNA
mass ratio of about 9:1 (e.g., a lipid:drug ratio of from 8.5:1 to
10:1, or from 8.9:1 to 10:1, or from 9:1 to 9.9:1, including 9.1:1,
9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1, and 9.8:1).
[0130] Exemplary lipid formulation D includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (0.7%), cationic lipid (60.3%),
phospholipid (8.4%), cholesterol (30.5%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (0.7%), the cationic lipid is
3-((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yloxy)-N,N-dimethy-
lpropan-1-amine (DLin-MP-DMA; Compound (8) (60.3%), the
phospholipid is DSPC (8.4%), and cholesterol is present at 30.5%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, 0.5 mol %, 0.25 mol %, or .+-.0.1 mol %). Thus, certain
embodiments of the invention provide a nucleic acid-lipid particle
based on formulation D, which comprises one or more gRNA molecules
described herein. For example, in certain embodiments, the nucleic
acid lipid particle based on formulation D may comprise two
different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation D may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0131] Exemplary lipid formulation E includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (1.8%), cationic lipid (52.1%),
phospholipid (7.5%), cholesterol (38.5%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (1.8%), the cationic lipid is
(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl
4-(dimethylamino)butanoate) (Compound (7)) (52.1%), the
phospholipid is DPPC (7.5%), and cholesterol is present at 38.5%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, 0.5 mol %, 0.25 mol %, or .+-.0.1 mol %). Thus, certain
embodiments of the invention provide a nucleic acid-lipid particle
based on formulation E, which comprises one or more gRNA molecules
described herein. For example, in certain embodiments, the nucleic
acid lipid particle based on formulation E may comprise two
different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation E may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0132] Exemplary formulation F includes the following components
(wherein the percentage values of the components are mole percent):
PEG-lipid (0.9%), cationic lipid (57.1%), phospholipid (8.1%),
cholesterol (33.8%), wherein the actual amounts of the lipids
present may vary by, e.g., .+-.5% (or e.g., .+-.4 mol %, .+-.3 mol
%, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %,
or .+-.0.1 mol %). For example, in one representative embodiment,
the PEG-lipid is PEG-C-DOMG (compound (67)) (0.9%), the cationic
lipid is 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
1,2-di-.gamma.-linolenyloxy-N,N-dimethylaminopropane
(.gamma.-DLenDMA; Compound (15)) (57.1%), the phospholipid is DSPC
(8.1%), and cholesterol is present at 33.8%, wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). Thus, certain embodiments
of the invention provide a nucleic acid-lipid particle based on
formulation F, which comprises one or more gRNA molecules described
herein. For example, in certain embodiments, the nucleic acid lipid
particle based on formulation F may comprise two different gRNA
molecules, wherein a combination of the two different gRNA
molecules is selected from any one of the combinations described
herein. In certain other embodiments, the nucleic acid lipid
particle based on formulation F may comprise three different gRNA
molecules, wherein a combination of the three different gRNA
molecules is selected from any one of the combinations described
herein. In certain embodiments, the nucleic acid-lipid particle has
a total lipid:gRNA mass ratio of from about 5:1 to about 15:1, or
about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, or
15:1, or any fraction thereof or range therein. In certain
embodiments, the nucleic acid-lipid particle has a total lipid:gRNA
mass ratio of about 9:1 (e.g., a lipid:drug ratio of from 8.5:1 to
10:1, or from 8.9:1 to 10:1, or from 9:1 to 9.9:1, including 9.1:1,
9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1, and 9.8:1).
[0133] Exemplary lipid formulation G includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (1.7%), cationic lipid (61.6%),
phospholipid (11.2%), cholesterol (25.5%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DOMG (compound
(67)) (1.7%), the cationic lipid is
1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
1,2-di-.gamma.-linolenyloxy-N,N-dimethylaminopropane
(.gamma.-DLenDMA; Compound (15)) (61.6%), the phospholipid is DPPC
(11.2%), and cholesterol is present at 25.5%, wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). Thus, certain embodiments
of the invention provide a nucleic acid-lipid particle based on
formulation G, which comprises one or more gRNA molecules described
herein. For example, in certain embodiments, the nucleic acid lipid
particle based on formulation G may comprise two different gRNA
molecules, wherein a combination of the two different gRNA
molecules is selected from any one of the combinations described
herein. In certain other embodiments, the nucleic acid lipid
particle based on formulation G may comprise three different gRNA
molecules, wherein a combination of the three different gRNA
molecules is selected from any one of the combinations described
herein. In certain embodiments, the nucleic acid-lipid particle has
a total lipid:gRNA mass ratio of from about 5:1 to about 15:1, or
about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, or
15:1, or any fraction thereof or range therein. In certain
embodiments, the nucleic acid-lipid particle has a total lipid:gRNA
mass ratio of about 9:1 (e.g., a lipid:drug ratio of from 8.5:1 to
10:1, or from 8.9:1 to 10:1, or from 9:1 to 9.9:1, including 9.1:1,
9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1, and 9.8:1).
[0134] Exemplary lipid formulation H includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (1.1%), cationic lipid (55.0%),
phospholipid (11.0%), cholesterol (33.0%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (1.1%), the cationic lipid is
(6Z,16Z)-12-((Z)-dec-4-enyl)docosa-6,16-dien-11-yl
5-(dimethylamino)pentanoate (Compound (13)) (55.0%), the
phospholipid is DSPC (11.0%), and cholesterol is present at 33.0%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, 0.5 mol %, 0.25 mol %, or .+-.0.1 mol %). Thus, certain
embodiments of the invention provide a nucleic acid-lipid particle
based on formulation H, which comprises one or more gRNA molecules
described herein. For example, in certain embodiments, the nucleic
acid lipid particle based on formulation H may comprise two
different gRNA molecules wherein a combination of the two different
gRNA molecules is selected from any one of the combinations
described herein. In certain other embodiments, the nucleic acid
lipid particle based on formulation H may comprise three different
gRNA molecules, wherein a combination of the three different gRNA
molecules is selected from any one of the combinations described
herein. In certain embodiments, the nucleic acid-lipid particle has
a total lipid:gRNA mass ratio of from about 5:1 to about 15:1, or
about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, or
15:1, or any fraction thereof or range therein. In certain
embodiments, the nucleic acid-lipid particle has a total lipid:gRNA
mass ratio of about 9:1 (e.g., a lipid:drug ratio of from 8.5:1 to
10:1, or from 8.9:1 to 10:1, or from 9:1 to 9.9:1, including 9.1:1,
9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1, and 9.8:1).
[0135] Exemplary lipid formulation I includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (2.6%), cationic lipid (53.1%),
phospholipid (9.4%), cholesterol (35.0%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (2.6%), the cationic lipid is
(6Z,16Z)-12-((Z)-dec-4-enyl)docosa-6,16-dien-11-yl
5-(dimethylamino)pentanoate (Compound (13)) (53.1%), the
phospholipid is DSPC (9.4%), and cholesterol is present at 35.0%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, 0.5 mol %, 0.25 mol %, or .+-.0.1 mol %). Thus, certain
embodiments of the invention provide a nucleic acid-lipid particle
based on formulation I, which comprises one or more gRNA molecules
described herein. For example, in certain embodiments, the nucleic
acid lipid particle based on formulation I may comprise two
different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation I may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0136] Exemplary lipid formulation J includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (0.6%), cationic lipid (59.4%),
phospholipid (10.2%), cholesterol (29.8%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, .+-.1 mol %, 0.75 mol %,
.+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in
one representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (0.6%), the cationic lipid is
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA) (59.4%), the
phospholipid is DPPC (10.2%), and cholesterol is present at 29.8%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol %). Thus,
certain embodiments of the invention provide a nucleic acid-lipid
particle based on formulation J, which comprises one or more gRNA
molecules described herein. For example, in certain embodiments,
the nucleic acid lipid particle based on formulation J may comprise
two different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation J may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0137] Exemplary lipid formulation K includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (0.5%), cationic lipid (56.7%),
phospholipid (13.1%), cholesterol (29.7%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DOMG (compound
(67)) (0.5%), the cationic lipid is
(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl
4-(dimethylamino)butanoate) (Compound (7)) (56.7%), the
phospholipid is DSPC (13.1%), and cholesterol is present at 29.7%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, 0.5 mol %, 0.25 mol %, or .+-.0.1 mol %). Thus, certain
embodiments of the invention provide a nucleic acid-lipid particle
based on formulation K, which comprises one or more gRNA molecules
described herein. For example, in certain embodiments, the nucleic
acid lipid particle based on formulation K may comprise two
different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation K may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0138] Exemplary lipid formulation L includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (2.2%), cationic lipid (52.0%),
phospholipid (9.7%), cholesterol (36.2%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DOMG (compound
(67)) (2.2%), the cationic lipid is
1,2-di-.gamma.-linolenyloxy-N,N-dimethylaminopropane
(.gamma.-DLenDMA; Compound (15)) (52.0%), the phospholipid is DSPC
(9.7%), and cholesterol is present at 36.2%, wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, 0.5 mol
%, 0.25 mol %, or .+-.0.1 mol %). Thus, certain embodiments of the
invention provide a nucleic acid-lipid particle based on
formulation L, which comprises one or more gRNA molecules described
herein. For example, in certain embodiments, the nucleic acid lipid
particle based on formulation L may comprise two different gRNA
molecules, wherein a combination of the two different gRNA
molecules is selected from any one of the combinations described
herein. In certain other embodiments, the nucleic acid lipid
particle based on formulation L may comprise three different gRNA
molecules, wherein a combination of the three different gRNA
molecules is selected from any one of the combinations described
herein. In certain embodiments, the nucleic acid-lipid particle has
a total lipid:gRNA mass ratio of from about 5:1 to about 15:1, or
about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, or
15:1, or any fraction thereof or range therein. In certain
embodiments, the nucleic acid-lipid particle has a total lipid:gRNA
mass ratio of about 9:1 (e.g., a lipid:drug ratio of from 8.5:1 to
10:1, or from 8.9:1 to 10:1, or from 9:1 to 9.9:1, including 9.1:1,
9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1, and 9.8:1).
[0139] Exemplary lipid formulation M includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (2.7%), cationic lipid (58.4%),
phospholipid (13.1%), cholesterol (25.7%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (2.7%), the cationic lipid is
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA) (58.4%), the
phospholipid is DPPC (13.1%), and cholesterol is present at 25.7%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol %). Thus,
certain embodiments of the invention provide a nucleic acid-lipid
particle based on formulation M, which comprises one or more gRNA
molecules described herein. For example, in certain embodiments,
the nucleic acid lipid particle based on formulation M may comprise
two different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation M may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0140] Exemplary lipid formulation N includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (3.0%), cationic lipid (53.3%),
phospholipid (12.1%), cholesterol (31.5%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (3.0%), the cationic lipid is
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA) (53.3%), the
phospholipid is DPPC (12.1%), and cholesterol is present at 31.5%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol %). Thus,
certain embodiments of the invention provide a nucleic acid-lipid
particle based on formulation N, which comprises one or more gRNA
molecules described herein. For example, in certain embodiments,
the nucleic acid lipid particle based on formulation N may comprise
two different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation N may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0141] Exemplary lipid formulation O includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (1.5%), cationic lipid (56.2%),
phospholipid (7.8%), cholesterol (34.7%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, .+-.1 mol %, 0.75 mol %,
.+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in
one representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (1.5%), the cationic lipid is
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA) (56.2%), the
phospholipid is DPPC (7.8%), and cholesterol is present at 34.7%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol %). Thus,
certain embodiments of the invention provide a nucleic acid-lipid
particle based on formulation 0, which comprises one or more gRNA
molecules described herein. For example, in certain embodiments,
the nucleic acid lipid particle based on formulation 0 may comprise
two different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation 0 may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0142] Exemplary lipid formulation P includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (2.1%), cationic lipid (48.6%),
phospholipid (15.5%), cholesterol (33.8%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, .+-.1 mol %, 0.75 mol %,
.+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in
one representative embodiment, the PEG-lipid is PEG-C-DOMG
(compound (67)) (2.1%), the cationic lipid is
3-((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yloxy)-N,N-dimethy-
lpropan-1-amine (DLin-MP-DMA; Compound (8)) (48.6%), the
phospholipid is DSPC (15.5%), and cholesterol is present at 33.8%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, 0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol %). Thus,
certain embodiments of the invention provide a nucleic acid-lipid
particle based on formulation P, which comprises one or more gRNA
molecules described herein. For example, in certain embodiments,
the nucleic acid lipid particle based on formulation P may comprise
two different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation P may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0143] Exemplary lipid formulation Q includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (2.5%), cationic lipid (57.9%),
phospholipid (9.2%), cholesterol (30.3%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (2.5%), the cationic lipid is
(6Z,16Z)-12-((Z)-dec-4-enyl)docosa-6,16-dien-11-yl
5-(dimethylamino)pentanoate (Compound (13)) (57.9%), the
phospholipid is DSPC (9.2%), and cholesterol is present at 30.3%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, 0.5 mol %, 0.25 mol %, or .+-.0.1 mol %). Thus, certain
embodiments of the invention provide a nucleic acid-lipid particle
based on formulation Q, which comprises one or more gRNA molecules
described herein. For example, in certain embodiments, the nucleic
acid lipid particle based on formulation Q may comprise two
different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation Q may comprise
three different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0144] Exemplary lipid formulation R includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (1.6%), cationic lipid (54.6%),
phospholipid (10.9%), cholesterol (32.8%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (1.6%), the cationic lipid is
3-((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yloxy)-N,N-dimethy-
lpropan-1-amine (Compound (8)) (54.6%), the phospholipid is DSPC
(10.9%), and cholesterol is present at 32.8%, wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, 0.5 mol
%, 0.25 mol %, or .+-.0.1 mol %). Thus, certain embodiments of the
invention provide a nucleic acid-lipid particle based on
formulation R, which comprises one or more gRNA molecules described
herein. For example, in certain embodiments, the nucleic acid lipid
particle based on formulation R may comprise two different gRNA
molecules, wherein a combination of the two different gRNA
molecules is selected from any one of the combinations described
herein. In certain other embodiments, the nucleic acid lipid
particle based on formulation R may comprise three different gRNA
molecules, wherein a combination of the three different gRNA
molecules is selected from any one of the combinations described
herein. In certain embodiments, the nucleic acid-lipid particle has
a total lipid:gRNA mass ratio of from about 5:1 to about 15:1, or
about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, or
15:1, or any fraction thereof or range therein. In certain
embodiments, the nucleic acid-lipid particle has a total lipid:gRNA
mass ratio of about 9:1 (e.g., a lipid:drug ratio of from 8.5:1 to
10:1, or from 8.9:1 to 10:1, or from 9:1 to 9.9:1, including 9.1:1,
9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1, and 9.8:1).
[0145] Exemplary lipid formulation S includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (2.9%), cationic lipid (49.6%),
phospholipid (16.3%), cholesterol (31.3%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (2.9%), the cationic lipid is
(6Z,16Z)-12-((Z)-dec-4-enyl)docosa-6,16-dien-11-yl
5-(dimethylamino)pentanoate (Compound (13)) (49.6%), the
phospholipid is DPPC (16.3%), and cholesterol is present at 31.3%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, 0.5 mol %, 0.25 mol %, or .+-.0.1 mol %). Thus, certain
embodiments of the invention provide a nucleic acid-lipid particle
based on formulation S, which comprises one or more gRNA molecules
described herein. For example, in certain embodiments, the nucleic
acid lipid particle based on formulation S may comprise two
different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation S may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0146] Exemplary lipid formulation T includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (0.7%), cationic lipid (50.5%),
phospholipid (8.9%), cholesterol (40.0%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DOMG (compound
(67)) (0.7%), the cationic lipid is
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA) (50.5%), the
phospholipid is DPPC (8.9%), and cholesterol is present at 40.0%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol %). Thus,
certain embodiments of the invention provide a nucleic acid-lipid
particle based on formulation T, which comprises one or more gRNA
molecules described herein. For example, in certain embodiments,
the nucleic acid lipid particle based on formulation T may comprise
two different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation T may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0147] Exemplary lipid formulation U includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (1.0%), cationic lipid (51.4%),
phospholipid (15.0%), cholesterol (32.6%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DOMG (compound
(67)) (1.0%), the cationic lipid is
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA) (51.4%), the
phospholipid is DSPC (15.0%), and cholesterol is present at 32.6%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol %). Thus,
certain embodiments of the invention provide a nucleic acid-lipid
particle based on formulation U, which comprises one or more gRNA
molecules described herein. For example, in certain embodiments,
the nucleic acid lipid particle based on formulation U may comprise
two different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation U may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0148] Exemplary lipid formulation V includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (1.3%), cationic lipid (60.0%),
phospholipid (7.2%), cholesterol (31.5%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DOMG (compound
(67)) (1.3%), the cationic lipid is
1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA) (60.0%), the
phospholipid is DSPC (7.2%), and cholesterol is present at 31.5%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, .+-.1 mol
%, 0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol %).
Thus, certain embodiments of the invention provide a nucleic
acid-lipid particle based on formulation V, which comprises one or
more gRNA molecules described herein. For example, in certain
embodiments, the nucleic acid lipid particle based on formulation V
may comprise two different gRNA molecules, wherein a combination of
the two different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation V may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0149] Exemplary lipid formulation W includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (1.8%), cationic lipid (51.6%),
phospholipid (8.4%), cholesterol (38.3%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (1.8%), the cationic lipid is
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA) (51.6%), the
phospholipid is DSPC (8.4%), and cholesterol is present at 38.3%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %, or .+-.0.1 mol %). Thus,
certain embodiments of the invention provide a nucleic acid-lipid
particle based on formulation W, which comprises one or more gRNA
molecules described herein. For example, in certain embodiments,
the nucleic acid lipid particle based on formulation W may comprise
two different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation W may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0150] Exemplary lipid formulation X includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (2.4%), cationic lipid (48.5%),
phospholipid (10.0%), cholesterol (39.2%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (2.4%), the cationic lipid is
1,2-di-.gamma.-linolenyloxy-N,N-dimethylaminopropane
(.gamma.-DLenDMA; Compound (15)) (48.5%), the phospholipid is DPPC
(10.0%), and cholesterol is present at 39.2%, wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, 0.5 mol
%, 0.25 mol %, or .+-.0.1 mol %). Thus, certain embodiments of the
invention provide a nucleic acid-lipid particle based on
formulation X, which comprises one or more gRNA molecules described
herein. For example, in certain embodiments, the nucleic acid lipid
particle based on formulation X may comprise two different gRNA
molecules, wherein a combination of the two different gRNA
molecules is selected from any one of the combinations described
herein. In certain other embodiments, the nucleic acid lipid
particle based on formulation X may comprise three different gRNA
molecules, wherein a combination of the three different gRNA
molecules is selected from any one of the combinations described
herein. In certain embodiments, the nucleic acid-lipid particle has
a total lipid:gRNA mass ratio of from about 5:1 to about 15:1, or
about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, or
15:1, or any fraction thereof or range therein. In certain
embodiments, the nucleic acid-lipid particle has a total lipid:gRNA
mass ratio of about 9:1 (e.g., a lipid:drug ratio of from 8.5:1 to
10:1, or from 8.9:1 to 10:1, or from 9:1 to 9.9:1, including 9.1:1,
9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1, and 9.8:1).
[0151] Exemplary lipid formulation Y includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (2.6%), cationic lipid (61.2%),
phospholipid (7.1%), cholesterol (29.2%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DMA (compound
(66)) (2.6%), the cationic lipid is
(6Z,16Z)-12-((Z)-dec-4-enyl)docosa-6,16-dien-11-yl
5-(dimethylamino)pentanoate (Compound (13)) (61.2%), the
phospholipid is DSPC (7.1%), and cholesterol is present at 29.2%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, 0.5 mol %, 0.25 mol %, or .+-.0.1 mol %). Thus, certain
embodiments of the invention provide a nucleic acid-lipid particle
based on formulation Y, which comprises one or more gRNA molecules
described herein. For example, in certain embodiments, the nucleic
acid lipid particle based on formulation Y may comprise two
different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation Y may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0152] Exemplary lipid formulation Z includes the following
components (wherein the percentage values of the components are
mole percent): PEG-lipid (2.2%), cationic lipid (49.7%),
phospholipid (12.1%), cholesterol (36.0%), wherein the actual
amounts of the lipids present may vary by, e.g., .+-.5% (or e.g.,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, .+-.0.5
mol %, .+-.0.25 mol %, or .+-.0.1 mol %). For example, in one
representative embodiment, the PEG-lipid is PEG-C-DOMG (compound
(67)) (2.2%), the cationic lipid is
(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl
4-(dimethylamino)butanoate) (Compound (7)) (49.7%), the
phospholipid is DPPC (12.1%), and cholesterol is present at 36.0%,
wherein the actual amounts of the lipids present may vary by, e.g.,
.+-.5% (or e.g., .+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %,
0.75 mol %, 0.5 mol %, 0.25 mol %, or .+-.0.1 mol %). Thus, certain
embodiments of the invention provide a nucleic acid-lipid particle
based on formulation Z, which comprises one or more gRNA molecules
described herein. For example, in certain embodiments, the nucleic
acid lipid particle based on formulation Z may comprise two
different gRNA molecules, wherein a combination of the two
different gRNA molecules is selected from any one of the
combinations described herein. In certain other embodiments, the
nucleic acid lipid particle based on formulation Z may comprise
three different gRNA molecules, wherein a combination of the three
different gRNA molecules is selected from any one of the
combinations described herein. In certain embodiments, the nucleic
acid-lipid particle has a total lipid:gRNA mass ratio of from about
5:1 to about 15:1, or about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, or 15:1, or any fraction thereof or range
therein. In certain embodiments, the nucleic acid-lipid particle
has a total lipid:gRNA mass ratio of about 9:1 (e.g., a lipid:drug
ratio of from 8.5:1 to 10:1, or from 8.9:1 to 10:1, or from 9:1 to
9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1,
and 9.8:1).
[0153] Accordingly, certain embodiments of the invention provide a
nucleic acid-lipid particle described herein, wherein the lipids
are formulated as described in any one of formulations A, B, C, D,
E, F, G, H, I, J, K, L, M, N, O, P, Q, R, S, T, U, V, W, X, Y or
Z.
[0154] The present invention also provides pharmaceutical
compositions comprising a nucleic acid-lipid particle and a
pharmaceutically acceptable carrier.
[0155] The nucleic acid-lipid particles of the present invention
are useful, for example, for the therapeutic delivery of gRNAs that
silence the expression of one or more target genes. In some
embodiments, a cocktail of gRNAs that target different regions
(e.g., overlapping and/or non-overlapping sequences) of a target
gene or transcript is formulated into the same or different nucleic
acid-lipid particles, and the particles are administered to a
mammal (e.g., a human) requiring such treatment. In certain
instances, a therapeutically effective amount of the nucleic
acid-lipid particles can be administered to the mammal.
[0156] In certain embodiments, the present invention provides a
method for introducing one or more gRNA molecules described herein
into a cell by contacting the cell with a nucleic acid-lipid
particle described herein.
[0157] In certain embodiments, the present invention provides a
method for introducing one or more gRNA molecules that silence
expression of a target gene into a cell by contacting the cell with
a nucleic acid-lipid particle described herein under conditions
whereby the gRNA enters the cell and silences the expression of the
target gene within the cell. In certain embodiments, the cell is in
a mammal, such as a human. In certain embodiments, the human has
been diagnosed with a specific disease or disorder.
[0158] In certain embodiments, the present invention provides a
method for silencing expression of a target gene in a cell, the
method comprising the step of contacting a cell comprising an
expressed target gene with a nucleic acid-lipid particle or a
composition (e.g., a pharmaceutical composition) described herein
under conditions whereby the gRNA enters the cell and silences the
expression of the target gene within the cell. In certain
embodiments, the cell is in a mammal, such as a human.
[0159] In some embodiments, the nucleic acid-lipid particles or
compositions (e.g., a pharmaceutical composition) described herein
are administered by one of the following routes of administration:
oral, intranasal, intravenous, intraperitoneal, intramuscular,
intra-articular, intralesional, intratracheal, subcutaneous, and
intradermal. In particular embodiments, the nucleic acid-lipid
particles are administered systemically, e.g., via enteral or
parenteral routes of administration.
[0160] In certain aspects, the present invention provides methods
for silencing target gene expression in a mammal (e.g., human) in
need thereof, the method comprising administering to the mammal a
therapeutically effective amount of a nucleic acid-lipid particle
comprising one or more gRNAs described herein. In some embodiments,
administration of nucleic acid-lipid particles comprising one or
more gRNAs described herein reduces target RNA levels by at least
about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99%, or 100% (or any range therein)
relative to RNA levels detected in the absence of the gRNA (e.g.,
buffer control or irrelevant gRNA control). In other embodiments,
administration of nucleic acid-lipid particles comprising one or
more gRNAs reduces target RNA levels for at least about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95,
or 100 days or more (or any range therein) relative to a negative
control such as, e.g., a buffer control or an irrelevant
non-targeting gRNA control.
[0161] In other aspects, the present invention provides methods for
silencing target gene expression in a mammal (e.g., human) in need
thereof, the method comprising administering to the mammal a
therapeutically effective amount of a nucleic acid-lipid particle
comprising one or more gRNAs described herein. In some embodiments,
administration of nucleic acid-lipid particles comprising one or
more gRNAs reduces target mRNA levels by at least about 5%, 10%,
15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%,
80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99%, or 100% (or any range therein) relative to mRNA
levels detected in the absence of the gRNA (e.g., buffer control or
irrelevant non-targeting gRNA control). In other embodiments,
administration of nucleic acid-lipid particles comprising one or
more gRNAs reduces target mRNA levels for at least about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90,
95, or 100 days or more (or any range therein) relative to a
negative control such as, e.g., a buffer control or an irrelevant
non-targeting gRNA control.
[0162] Certain embodiments of the invention provide a nucleic
acid-lipid particle or a composition (e.g., a pharmaceutical
composition) described herein for use in silencing expression of a
targetgene in a cell in a mammal (e.g., a human).
[0163] Certain embodiments of the invention provide the use of a
nucleic acid-lipid particle or a composition (e.g., a
pharmaceutical composition) described herein to prepare a
medicament for silencing expression of a target gene in a cell in a
mammal (e.g., a human).
[0164] In other aspects, the present invention provides methods for
treating, preventing, reducing the risk or likelihood of developing
(e.g., reducing the susceptibility to), delaying the onset of,
and/or ameliorating one or more symptoms associated with a disease
in a mammal (e.g., human) in need thereof, the method comprising
administering to the mammal a therapeutically effective amount of a
nucleic acid-lipid particle comprising one or more gRNA molecules
described herein that target gene expression.
[0165] Certain embodiments of the invention provide a nucleic
acid-lipid particle or a composition (e.g., a pharmaceutical
composition) for use in treating a disease in a mammal (e.g., a
human).
[0166] Certain embodiments of the invention provide the use of a
nucleic acid-lipid particle or a composition (e.g., a
pharmaceutical composition) to prepare a medicament for treating a
disease in a mammal (e.g., a human).
[0167] Certain embodiments of the invention provide a method for
ameliorating one or more symptoms associated with a disease in a
mammal, the method comprising the step of administering to the
mammal a therapeutically effective amount of a nucleic acid-lipid
particle or composition (e.g., a pharmaceutical composition)
described herein, comprising one or more gRNA molecules. In certain
embodiments, the particle is administered via a systemic route.
[0168] Certain embodiments of the invention provide a nucleic
acid-lipid particle or a composition (e.g., a pharmaceutical
composition) as described herein for use in ameliorating one or
more symptoms associated with a disease in a mammal (e.g., a
human).
[0169] Certain embodiments of the invention provide the use of a
nucleic acid-lipid particle or a composition (e.g., a
pharmaceutical composition) as described herein to prepare a
medicament for ameliorating one or more symptoms associated with a
disease in a mammal (e.g., a human).
[0170] Certain embodiments of the invention provide a nucleic
acid-lipid particle or a composition (e.g., a pharmaceutical
composition) as described herein for use in medical therapy.
[0171] In some embodiments, administration of nucleic acid-lipid
particles comprising one or more gRNAs lowers, reduces, or
decreases target protein levels by at least about 5%, 10%, 15%,
20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99%, or 100% (or any range therein) relative to the target
protein levels detected in the absence of the gRNA.
[0172] By way of example, mRNA can be measured using a branched DNA
assay (QuantiGene.RTM.; Affymetrix). The branched DNA assay is a
sandwich nucleic acid hybridization method that uses bDNA molecules
to amplify signal from captured target RNA.
[0173] In addition to its utility in silencing the expression of
any of the target genes for therapeutic purposes, the lipid
nanoparticles described herein are also useful in research and
development applications as well as diagnostic, prophylactic,
prognostic, clinical, and other healthcare applications. As a
non-limiting example, the gRNA can be used in target validation
studies directed at testing whether a specific member of a gene
family has the potential to be a therapeutic target.
[0174] Generating gRNA Molecules
[0175] In some embodiments, gRNA may be produced enzymatically or
by partial/total organic synthesis, and modified ribonucleotides
can be introduced by in vitro enzymatic or organic synthesis. In
certain instances, the gRNA is prepared chemically. Methods of
synthesizing nucleic acid molecules are known in the art, e.g., the
chemical synthesis methods as described in Verma and Eckstein
(1998) or as described herein.
[0176] Methods for isolating RNA, synthesizing RNA, hybridizing
nucleic acids, making and screening cDNA libraries, and performing
PCR are well known in the art (see, e.g., Gubler and Hoffman, Gene,
25:263-269 (1983); Sambrook et al., supra; Ausubel et al., supra),
as are PCR methods (see, U.S. Pat. Nos. 4,683,195 and 4,683,202;
PCR Protocols: A Guide to Methods and Applications (Innis et al.,
eds, 1990)). Expression libraries are also well known to those of
skill in the art. Additional basic texts disclosing the general
methods of use in this invention include Sambrook et al., Molecular
Cloning, A Laboratory Manual (2nd ed. 1989); Kriegler, Gene
Transfer and Expression: A Laboratory Manual (1990); and Current
Protocols in Molecular Biology (Ausubel et al., eds., 1994). The
disclosures of these references are herein incorporated by
reference in their entirety for all purposes.
[0177] Preferably, gRNA are chemically synthesized. The
oligonucleotides that comprise the gRNA molecules of the invention
can be synthesized using any of a variety of techniques known in
the art, such as those described in Usman et al., J. Am. Chem.
Soc., 109:7845 (1987); Scaringe et al., Nucl. Acids Res., 18:5433
(1990); Wincott et al., Nucl. Acids Res., 23:2677-2684 (1995); and
Wincott et al., Methods Mol. Bio., 74:59 (1997). The synthesis of
oligonucleotides makes use of common nucleic acid protecting and
coupling groups, such as dimethoxytrityl at the 5'-end and
phosphoramidites at the 3'-end. As a non-limiting example, small
scale syntheses can be conducted on an Applied Biosystems
synthesizer using a 0.2 .mu.mol scale protocol. Alternatively,
syntheses at the 0.2 .mu.m01 scale can be performed on a 96-well
plate synthesizer from Protogene (Palo Alto, Calif.). However, a
larger or smaller scale of synthesis is also within the scope of
this invention. Suitable reagents for oligonucleotide synthesis,
methods for RNA deprotection, and methods for RNA purification are
known to those of skill in the art.
[0178] Carrier Systems Containing Therapeutic Nucleic Acids
A. Lipid Particles
[0179] In certain aspects, the present invention provides lipid
particles comprising one or more gRNA molecules and one or more of
cationic (amino) lipids or salts thereof. In some embodiments, the
lipid particles of the invention further comprise one or more
non-cationic lipids. In other embodiments, the lipid particles
further comprise one or more conjugated lipids capable of reducing
or inhibiting particle aggregation.
[0180] The lipid particles of the invention may comprise one or
more gRNA, a cationic lipid, a non-cationic lipid, and a conjugated
lipid that inhibits aggregation of particles. In some embodiments,
the gRNA molecule is fully encapsulated within the lipid portion of
the lipid particle such that the gRNA molecule in the lipid
particle is resistant in aqueous solution to nuclease degradation.
In other embodiments, the lipid particles described herein are
substantially non-toxic to mammals such as humans. The lipid
particles of the invention typically have a mean diameter of from
about 30 nm to about 150 nm, from about 40 nm to about 150 nm, from
about 50 nm to about 150 nm, from about 60 nm to about 130 nm, from
about 70 nm to about 110 nm, or from about 70 to about 90 nm. In
certain embodiments, the lipid particles of the invention have a
median diameter of from about 30 nm to about 150 nm. The lipid
particles of the invention also typically have a lipid:nucleic acid
ratio (e.g., a lipid:gRNA ratio) (mass/mass ratio) of from about
1:1 to about 100:1, from about 1:1 to about 50:1, from about 2:1 to
about 25:1, from about 3:1 to about 20:1, from about 5:1 to about
15:1, or from about 5:1 to about 10:1. In certain embodiments, the
nucleic acid-lipid particle has a lipid:gRNA mass ratio of from
about 5:1 to about 15:1.
[0181] In preferred embodiments, the lipid particles of the
invention are serum-stable nucleic acid-lipid particles which
comprise one or more gRNA molecules, a cationic lipid (e.g., one or
more cationic lipids of Formula I-III or salts thereof as set forth
herein), a non-cationic lipid (e.g., mixtures of one or more
phospholipids and cholesterol), and a conjugated lipid that
inhibits aggregation of the particles (e.g., one or more PEG-lipid
conjugates). The lipid particle may comprise at least 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, or more gRNA molecules that target one or more
of the genes described herein. Nucleic acid-lipid particles and
their method of preparation are described in, e.g., U.S. Pat. Nos.
5,753,613; 5,785,992; 5,705,385; 5,976,567; 5,981,501; 6,110,745;
and 6,320,017; and PCT Publication No. WO 96/40964, the disclosures
of which are each herein incorporated by reference in their
entirety for all purposes.
[0182] In the nucleic acid-lipid particles of the invention, the
one or more gRNA molecules may be fully encapsulated within the
lipid portion of the particle, thereby protecting the gRNA from
nuclease degradation. In certain instances, the gRNA in the nucleic
acid-lipid particle is not substantially degraded after exposure of
the particle to a nuclease at 37.degree. C. for at least about 20,
30, 45, or 60 minutes. In certain other instances, the gRNA in the
nucleic acid-lipid particle is not substantially degraded after
incubation of the particle in serum at 37.degree. C. for at least
about 30, 45, or 60 minutes or at least about 2, 3, 4, 5, 6, 7, 8,
9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 hours.
In other embodiments, the gRNA is complexed with the lipid portion
of the particle. One of the benefits of the formulations of the
present invention is that the nucleic acid-lipid particle
compositions are substantially non-toxic to mammals such as
humans.
[0183] The term "fully encapsulated" indicates that the gRNA in the
nucleic acid-lipid particle is not significantly degraded after
exposure to serum or a nuclease assay that would significantly
degrade free DNA or RNA. In a fully encapsulated system, preferably
less than about 25% of the gRNA in the particle is degraded in a
treatment that would normally degrade 100% of free gRNA, more
preferably less than about 10%, and most preferably less than about
5% of the gRNA in the particle is degraded. "Fully encapsulated"
also indicates that the nucleic acid-lipid particles are
serum-stable, that is, that they do not rapidly decompose into
their component parts upon in vivo administration.
[0184] In the context of nucleic acids, full encapsulation may be
determined by performing a membrane-impermeable fluorescent dye
exclusion assay, which uses a dye that has enhanced fluorescence
when associated with nucleic acid. Specific dyes such as
OliGreen.RTM. and RiboGreen.RTM. (Invitrogen Corp.; Carlsbad,
Calif.) are available for the quantitative determination of plasmid
DNA, single-stranded deoxyribonucleotides, and/or single- or
double-stranded ribonucleotides. Encapsulation is determined by
adding the dye to a liposomal formulation, measuring the resulting
fluorescence, and comparing it to the fluorescence observed upon
addition of a small amount of nonionic detergent.
Detergent-mediated disruption of the liposomal bilayer releases the
encapsulated nucleic acid, allowing it to interact with the
membrane-impermeable dye. Nucleic acid encapsulation may be
calculated as E=(I.sub.o-I)/I.sub.o, where I and I.sub.o refer to
the fluorescence intensities before and after the addition of
detergent (see, Wheeler et al., Gene Ther., 6:271-281 (1999)).
[0185] In other embodiments, the present invention provides a
nucleic acid-lipid particle composition comprising a plurality of
nucleic acid-lipid particles.
[0186] In some instances, the nucleic acid-lipid particle
composition comprises a gRNA molecule that is fully encapsulated
within the lipid portion of the particles, such that from about 30%
to about 100%, from about 40% to about 100%, from about 50% to
about 100%, from about 60% to about 100%, from about 70% to about
100%, from about 80% to about 100%, from about 90% to about 100%,
from about 30% to about 95%, from about 40% to about 95%, from
about 50% to about 95%, from about 60% to about 95%, from about 70%
to about 95%, from about 80% to about 95%, from about 85% to about
95%, from about 90% to about 95%, from about 30% to about 90%, from
about 40% to about 90%, from about 50% to about 90%, from about 60%
to about 90%, from about 70% to about 90%, from about 80% to about
90%, or at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%
(or any fraction thereof or range therein) of the particles have
the gRNA encapsulated therein.
[0187] In other instances, the nucleic acid-lipid particle
composition comprises gRNA that is fully encapsulated within the
lipid portion of the particles, such that from about 30% to about
100%, from about 40% to about 100%, from about 50% to about 100%,
from about 60% to about 100%, from about 70% to about 100%, from
about 80% to about 100%, from about 90% to about 100%, from about
30% to about 95%, from about 40% to about 95%, from about 50% to
about 95%, from about 60% to about 95%, from about 70% to about
95%, from about 80% to about 95%, from about 85% to about 95%, from
about 90% to about 95%, from about 30% to about 90%, from about 40%
to about 90%, from about 50% to about 90%, from about 60% to about
90%, from about 70% to about 90%, from about 80% to about 90%, or
at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%,
80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% (or
any fraction thereof or range therein) of the input gRNA is
encapsulated in the particles.
[0188] Depending on the intended use of the lipid particles of the
invention, the proportions of the components can be varied and the
delivery efficiency of a particular formulation can be measured
using, e.g., an endosomal release parameter (ERP) assay.
1. Cationic Lipids
[0189] Any of a variety of cationic lipids or salts thereof may be
used in the lipid particles of the present invention either alone
or in combination with one or more other cationic lipid species or
non-cationic lipid species. The cationic lipids include the (R)
and/or (S) enantiomers thereof.
[0190] In one aspect of the invention, the cationic lipid is a
dialkyl lipid. For example, dialkyl lipids may include lipids that
comprise two saturated or unsaturated alkyl chains, wherein each of
the alkyl chains may be substituted or unsubstituted. In certain
embodiments, each of the two alkyl chains comprise at least, e.g.,
8 carbon atoms, 10 carbon atoms, 12 carbon atoms, 14 carbon atoms,
16 carbon atoms, 18 carbon atoms, 20 carbon atoms, 22 carbon atoms
or 24 carbon atoms.
[0191] In one aspect of the invention, the cationic lipid is a
trialkyl lipid. For example, trialkyl lipids may include lipids
that comprise three saturated or unsaturated alkyl chains, wherein
each of the alkyl chains may be substituted or unsubstituted. In
certain embodiments, each of the three alkyl chains comprise at
least, e.g., 8 carbon atoms, 10 carbon atoms, 12 carbon atoms, 14
carbon atoms, 16 carbon atoms, 18 carbon atoms, 20 carbon atoms, 22
carbon atoms or 24 carbon atoms.
[0192] In one aspect, cationic lipids of Formula I having the
following structure are useful in the present invention:
##STR00002##
[0193] or salts thereof, wherein:
[0194] R.sup.1 and R.sup.2 are either the same or different and are
independently hydrogen (H) or an optionally substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6
alkynyl, or R.sup.1 and R.sup.2 may join to form an optionally
substituted heterocyclic ring of 4 to 6 carbon atoms and 1 or 2
heteroatoms selected from the group consisting of nitrogen (N),
oxygen (O), and mixtures thereof;
[0195] R.sup.3 is either absent or is hydrogen (H) or a
C.sub.1-C.sub.6 alkyl to provide a quaternary amine;
[0196] R.sup.4 and R.sup.5 are either the same or different and are
independently an optionally substituted C.sub.10-C.sub.24 alkyl,
C.sub.10-C.sub.24 alkenyl, C.sub.10-C.sub.24 alkynyl, or
C.sub.10-C.sub.24 acyl, wherein at least one of R.sup.4 and R.sup.5
comprises at least two sites of unsaturation; and
[0197] n is 0, 1, 2, 3, or 4.
[0198] In some embodiments, R.sup.1 and R.sup.2 are independently
an optionally substituted C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4
alkenyl, or C.sub.2-C.sub.4 alkynyl. In one preferred embodiment,
R.sup.1 and R.sup.2 are both methyl groups. In other preferred
embodiments, n is 1 or 2. In other embodiments, R.sup.3 is absent
when the pH is above the pK.sub.a of the cationic lipid and R.sup.3
is hydrogen when the pH is below the pK.sub.a of the cationic lipid
such that the amino head group is protonated. In an alternative
embodiment, R.sup.3 is an optionally substituted C.sub.1-C.sub.4
alkyl to provide a quaternary amine. In further embodiments,
R.sup.4 and R.sup.5 are independently an optionally substituted
C.sub.12-C.sub.20 or C.sub.14-C.sub.22 alkyl, C.sub.12-C.sub.20 or
C.sub.14-C.sub.22 alkenyl, C.sub.12-C.sub.20 or C.sub.14-C.sub.22
alkynyl, or C.sub.12-C.sub.20 or C.sub.14-C.sub.22 acyl, wherein at
least one of R.sup.4 and R.sup.5 comprises at least two sites of
unsaturation.
[0199] In certain embodiments, R.sup.4 and R.sup.5 are
independently selected from the group consisting of a dodecadienyl
moiety, a tetradecadienyl moiety, a hexadecadienyl moiety, an
octadecadienyl moiety, an icosadienyl moiety, a dodecatrienyl
moiety, a tetradectrienyl moiety, a hexadecatrienyl moiety, an
octadecatrienyl moiety, an icosatrienyl moiety, an arachidonyl
moiety, and a docosahexaenoyl moiety, as well as acyl derivatives
thereof (e.g., linoleoyl, linolenoyl, .gamma.-linolenoyl, etc.). In
some instances, one of R.sup.4 and R.sup.5 comprises a branched
alkyl group (e.g., a phytanyl moiety) or an acyl derivative thereof
(e.g., a phytanoyl moiety). In certain instances, the
octadecadienyl moiety is a linoleyl moiety. In certain other
instances, the octadecatrienyl moiety is a linolenyl moiety or a
.gamma.-linolenyl moiety. In certain embodiments, R.sup.4 and
R.sup.5 are both linoleyl moieties, linolenyl moieties, or
.gamma.-linolenyl moieties. In particular embodiments, the cationic
lipid of Formula I is 1,2-dilinoleyloxy-N,N-dimethylaminopropane
(DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
1,2-dilinoleyloxy-(N,N-dimethyl)-butyl-4-amine (C.sub.2-DLinDMA),
1,2-dilinoleoyloxy-(N,N-dimethyl)-butyl-4-amine (C.sub.2-DLinDAP),
or mixtures thereof.
[0200] In some embodiments, the cationic lipid of Formula I forms a
salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula I is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0201] The synthesis of cationic lipids such as DLinDMA and
DLenDMA, as well as additional cationic lipids, is described in
U.S. Patent Publication No. 20060083780, the disclosure of which is
herein incorporated by reference in its entirety for all purposes.
The synthesis of cationic lipids such as C.sub.2-DLinDMA and
C.sub.2-DLinDAP, as well as additional cationic lipids, is
described in international patent application number WO2011/000106
the disclosure of which is herein incorporated by reference in its
entirety for all purposes.
[0202] In another aspect, cationic lipids of Formula II having the
following structure (or salts thereof) are useful in the present
invention:
##STR00003##
[0203] wherein R.sup.1 and R.sup.2 are either the same or different
and are independently an optionally substituted C.sub.12-C.sub.24
alkyl, C.sub.12-C.sub.24 alkenyl, C.sub.12-C.sub.24 alkynyl, or
C.sub.12-C.sub.24 acyl; R.sup.3 and R.sup.4 are either the same or
different and are independently an optionally substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or C.sub.2-C.sub.6
alkynyl, or R.sup.3 and R.sup.4 may join to form an optionally
substituted heterocyclic ring of 4 to 6 carbon atoms and 1 or 2
heteroatoms chosen from nitrogen and oxygen; R.sup.5 is either
absent or is hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a
quaternary amine; m, n, and p are either the same or different and
are independently either 0, 1, or 2, with the proviso that m, n,
and p are not simultaneously O; q is 0, 1, 2, 3, or 4; and Y and Z
are either the same or different and are independently O, S, or NH.
In a preferred embodiment, q is 2.
[0204] In some embodiments, the cationic lipid of Formula II is
2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane
(DLin-K-C.sub.2-DMA; "XTC2" or "C.sub.2K"),
2,2-dilinoleyl-4-(3-dimethylaminopropyl)-[1,3]-dioxolane
(DLin-K-C.sub.3-DMA; "C.sub.3K"),
2,2-dilinoleyl-4-(4-dimethylaminobutyl)-[1,3]-dioxolane
(DLin-K-C.sub.4-DMA; "C.sub.4K"),
2,2-dilinoleyl-5-dimethylaminomethyl-[1,3]-dioxane (DLin-K6-DMA),
2,2-dilinoleyl-4-N-methylpepiazino-[1,3]-dioxolane (DLin-K-MPZ),
2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA),
2,2-dioleoyl-4-dimethylaminomethyl-[1,3]-dioxolane (DO-K-DMA),
2,2-distearoyl-4-dimethylaminomethyl-[1,3]-dioxolane (DS-K-DMA),
2,2-dilinoleyl-4-N-morpholino-[1,3]-dioxolane (DLin-K-MA),
2,2-Dilinoleyl-4-trimethylamino-[1,3]-dioxolane chloride
(DLin-K-TMA. C.sub.1),
2,2-dilinoleyl-4,5-bis(dimethylaminomethyl)-[1,3]-dioxolane
(DLin-K.sup.2-DMA),
2,2-dilinoleyl-4-methylpiperzine-[1,3]-dioxolane
(D-Lin-K-N-methylpiperzine), or mixtures thereof. In preferred
embodiments, the cationic lipid of Formula II is
DLin-K-C.sub.2-DMA.
[0205] In some embodiments, the cationic lipid of Formula II forms
a salt (preferably a crystalline salt) with one or more anions. In
one particular embodiment, the cationic lipid of Formula II is the
oxalate (e.g., hemioxalate) salt thereof, which is preferably a
crystalline salt.
[0206] The synthesis of cationic lipids such as DLin-K-DMA, as well
as additional cationic lipids, is described in PCT Publication No.
WO 09/086558, the disclosure of which is herein incorporated by
reference in its entirety for all purposes. The synthesis of
cationic lipids such as DLin-K-C.sub.2-DMA, DLin-K-C.sub.3-DMA,
DLin-K-C.sub.4-DMA, DLin-K6-DMA, DLin-K-MPZ, DO-K-DMA, DS-K-DMA,
DLin-K-MA, DLin-K-TMA.Cl, DLin-K.sup.2-DMA, and
D-Lin-K-N-methylpiperzine, as well as additional cationic lipids,
is described in PCT Application No. PCT/US2009/060251, entitled
"Improved Amino Lipids and Methods for the Delivery of Nucleic
Acids," filed Oct. 9, 2009, the disclosure of which is incorporated
herein by reference in its entirety for all purposes.
[0207] In a further aspect, cationic lipids of Formula III having
the following structure are useful in the present invention:
##STR00004##
[0208] or salts thereof, wherein: R.sup.1 and R.sup.2 are either
the same or different and are independently an optionally
substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, or
C.sub.2-C.sub.6 alkynyl, or R.sup.1 and R.sup.2 may join to form an
optionally substituted heterocyclic ring of 4 to 6 carbon atoms and
1 or 2 heteroatoms selected from the group consisting of nitrogen
(N), oxygen (O), and mixtures thereof; R.sup.3 is either absent or
is hydrogen (H) or a C.sub.1-C.sub.6 alkyl to provide a quaternary
amine; R.sup.4 and R.sup.5 are either absent or present and when
present are either the same or different and are independently an
optionally substituted C.sub.1-C.sub.10 alkyl or C.sub.2-C.sub.10
alkenyl; and n is 0, 1, 2, 3, or 4.
[0209] In some embodiments, R.sup.1 and R.sup.2 are independently
an optionally substituted C.sub.1-C.sub.4 alkyl, C.sub.2-C.sub.4
alkenyl, or C.sub.2-C.sub.4 alkynyl. In a preferred embodiment,
R.sup.1 and R.sup.2 are both methyl groups. In another preferred
embodiment, R.sup.4 and R.sup.5 are both butyl groups. In yet
another preferred embodiment, n is 1. In other embodiments, R.sup.3
is absent when the pH is above the pK.sub.a of the cationic lipid
and R.sup.3 is hydrogen when the pH is below the pK.sub.a of the
cationic lipid such that the amino head group is protonated. In an
alternative embodiment, R.sup.3 is an optionally substituted
C.sub.1-C.sub.4 alkyl to provide a quaternary amine. In further
embodiments, R.sup.4 and R.sup.5 are independently an optionally
substituted C.sub.2-C.sub.6 or C.sub.2-C.sub.4 alkyl or
C.sub.2-C.sub.6 or C.sub.2-C.sub.4 alkenyl.
[0210] In an alternative embodiment, the cationic lipid of Formula
III comprises ester linkages between the amino head group and one
or both of the alkyl chains. In some embodiments, the cationic
lipid of Formula III forms a salt (preferably a crystalline salt)
with one or more anions. In one particular embodiment, the cationic
lipid of Formula III is the oxalate (e.g., hemioxalate) salt
thereof, which is preferably a crystalline salt.
[0211] Although each of the alkyl chains in Formula III contains
cis double bonds at positions 6, 9, and 12 (i.e.,
cis,cis,cis-.DELTA..sup.6,.DELTA..sup.9,.DELTA..sup.12) in an
alternative embodiment, one, two, or three of these double bonds in
one or both alkyl chains may be in the trans configuration.
[0212] In a particularly preferred embodiment, the cationic lipid
of Formula III has the structure:
##STR00005##
[0213] The synthesis of cationic lipids such as .gamma.-DLenDMA
(15), as well as additional cationic lipids, is described in U.S.
Provisional Application No. 61/222,462, entitled "Improved Cationic
Lipids and Methods for the Delivery of Nucleic Acids," filed Jul.
1, 2009, the disclosure of which is herein incorporated by
reference in its entirety for all purposes.
[0214] The synthesis of cationic lipids such as DLin-M-C.sub.3-DMA
("MC3"), as well as additional cationic lipids (e.g., certain
analogs of MC3), is described in U.S. Provisional Application No.
61/185,800, entitled "Novel Lipids and Compositions for the
Delivery of Therapeutics," filed Jun. 10, 2009, and U.S.
Provisional Application No. 61/287,995, entitled "Methods and
Compositions for Delivery of Nucleic Acids," filed Dec. 18, 2009,
the disclosures of which are herein incorporated by reference in
their entirety for all purposes.
[0215] Examples of other cationic lipids or salts thereof which may
be included in the lipid particles of the present invention
include, but are not limited to, cationic lipids such as those
described in WO2011/000106, the disclosure of which is herein
incorporated by reference in its entirety for all purposes, as well
as cationic lipids such as N,N-dioleyl-N,N-dimethylammonium
chloride (DODAC), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA),
1,2-distearyloxy-N,N-dimethylaminopropane (DSDMA),
N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride
(DOTMA), N,N-distearyl-N,N-dimethylammonium bromide (DDAB),
N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
(DOTAP), 3-(N--(N',N'-dimethylaminoethane)-carbamoyl)cholesterol
(DC-Chol),
N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium
bromide (DMRIE),
2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanamin-
iumtrifluoroacetate (DO SPA), dioctadecylamidoglycyl spermine
(DOGS),
3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-oc-
tadecadienoxy)propane (CLinDMA),
2-[5'-(cholest-5-en-3-beta-oxy)-3'-oxapentoxy)-3-dimethy-1-(cis,cis-9',1--
2'-octadecadienoxy)propane (CpLinDMA),
N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA),
1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP),
1,2-N,N'-dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP),
1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP),
1,2-dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC),
1,2-dilinoleyoxy-3-morpholinopropane (DLin-MA),
1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP),
1,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA),
1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP),
1,2-dilinoleyloxy-3-trimethylaminopropane chloride salt
(DLin-TMA.C.sub.1), 1,2-dilinoleoyl-3-trimethylaminopropane
chloride salt (DLin-TAP.Cl),
1,2-dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ),
3-(N,N-dilinoleylamino)-1,2-propanediol (DLinAP),
3-(N,N-dioleylamino)-1,2-propanedio (DOAP),
1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane
(DLin-EG-DMA), 1,2-dioeylcarbamoyloxy-3-dimethylaminopropane
(DO-C-DAP), 1,2-dimyristoleoyl-3-dimethylaminopropane (DMDAP),
1,2-dioleoyl-3-trimethylaminopropane chloride (DOTAP.Cl),
dilinoleylmethyl-3-dimethylaminopropionate (DLin-M-C.sub.2-DMA;
also known as DLin-M-K-DMA or DLin-M-DMA), and mixtures thereof.
Additional cationic lipids or salts thereof which may be included
in the lipid particles of the present invention are described in
U.S. Patent Publication No. 20090023673, the disclosure of which is
herein incorporated by reference in its entirety for all
purposes.
[0216] The synthesis of cationic lipids such as CLinDMA, as well as
additional cationic lipids, is described in U.S. Patent Publication
No. 20060240554, the disclosure of which is herein incorporated by
reference in its entirety for all purposes. The synthesis of
cationic lipids such as DLin-C-DAP, DLinDAC, DLinMA, DLinDAP,
DLin-S-DMA, DLin-2-DMAP, DLinTMA.Cl, DLinTAP.Cl, DLinMPZ, DLinAP,
DOAP, and DLin-EG-DMA, as well as additional cationic lipids, is
described in PCT Publication No. WO 09/086558, the disclosure of
which is herein incorporated by reference in its entirety for all
purposes. The synthesis of cationic lipids such as DO-C-DAP, DMDAP,
DOTAP.Cl, DLin-M-C.sub.2-DMA, as well as additional cationic
lipids, is described in PCT Application No. PCT/US2009/060251,
entitled "Improved Amino Lipids and Methods for the Delivery of
Nucleic Acids," filed Oct. 9, 2009, the disclosure of which is
incorporated herein by reference in its entirety for all purposes.
The synthesis of a number of other cationic lipids and related
analogs has been described in U.S. Pat. Nos. 5,208,036; 5,264,618;
5,279,833; 5,283,185; 5,753,613; and 5,785,992; and PCT Publication
No. WO 96/10390, the disclosures of which are each herein
incorporated by reference in their entirety for all purposes.
Additionally, a number of commercial preparations of cationic
lipids can be used, such as, e.g., LIPOFECTIN.RTM. (including DOTMA
and DOPE, available from Invitrogen); LIPOFECTAMINE.RTM. (including
DOSPA and DOPE, available from Invitrogen); and TRANSFECTAM.RTM.
(including DOGS, available from Promega Corp.).
[0217] In some embodiments, the cationic lipid comprises from about
50 mol % to about 90 mol %, from about 50 mol % to about 85 mol %,
from about 50 mol % to about 80 mol %, from about 50 mol % to about
75 mol %, from about 50 mol % to about 70 mol %, from about 50 mol
% to about 65 mol %, from about 50 mol % to about 60 mol %, from
about 55 mol % to about 65 mol %, or from about 55 mol % to about
70 mol % (or any fraction thereof or range therein) of the total
lipid present in the particle. In particular embodiments, the
cationic lipid comprises about 50 mol %, 51 mol %, 52 mol %, 53 mol
%, 54 mol %, 55 mol %, 56 mol %, 57 mol %, 58 mol %, 59 mol %, 60
mol %, 61 mol %, 62 mol %, 63 mol %, 64 mol %, or 65 mol % (or any
fraction thereof) of the total lipid present in the particle.
[0218] In other embodiments, the cationic lipid comprises from
about 2 mol % to about 60 mol %, from about 5 mol % to about 50 mol
%, from about 10 mol % to about 50 mol %, from about 20 mol % to
about 50 mol %, from about 20 mol % to about 40 mol %, from about
30 mol % to about 40 mol %, or about 40 mol % (or any fraction
thereof or range therein) of the total lipid present in the
particle.
[0219] Additional percentages and ranges of cationic lipids
suitable for use in the lipid particles of the present invention
are described in PCT Publication No. WO 09/127060, U.S. Published
Application No. US 2011/0071208, PCT Publication No. WO2011/000106,
and U.S. Published Application No. US 2011/0076335, the disclosures
of which are herein incorporated by reference in their entirety for
all purposes.
[0220] It should be understood that the percentage of cationic
lipid present in the lipid particles of the invention is a target
amount, and that the actual amount of cationic lipid present in the
formulation may vary, for example, by .+-.5 mol %. For example, in
one exemplary lipid particle formulation, the target amount of
cationic lipid is 57.1 mol %, but the actual amount of cationic
lipid may be .+-.5 mol %, .+-.4 mol %, .+-.3 mol %, .+-.2 mol %,
.+-.1 mol %, .+-.0.75 mol %, .+-.0.5 mol %, .+-.0.25 mol %, or
.+-.0.1 mol % of that target amount, with the balance of the
formulation being made up of other lipid components (adding up to
100 mol % of total lipids present in the particle; however, one
skilled in the art will understand that the total mol % may deviate
slightly from 100% due to rounding, for example, 99.9 mol % or
100.1 mol %).
[0221] Further examples of cationic lipids useful for inclusion in
lipid particles used in the present invention are shown below:
##STR00006##
2. Non-Cationic Lipids
[0222] The non-cationic lipids used in the lipid particles of the
invention can be any of a variety of neutral uncharged,
zwitterionic, or anionic lipids capable of producing a stable
complex.
[0223] Non-limiting examples of non-cationic lipids include
phospholipids such as lecithin, phosphatidylethanolamine,
lysolecithin, lysophosphatidylethanolamine, phosphatidylserine,
phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM),
cephalin, cardiolipin, phosphatidic acid, cerebrosides,
dicetylphosphate, di stearoylphosphatidylcholine (DSPC),
dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine
(DPPC), dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG),
dioleoylphosphatidylethanolamine (DOPE),
palmitoyloleoyl-phosphatidylcholine (POPC),
palmitoyloleoyl-phosphatidylethanolamine (POPE),
palmitoyloleyol-phosphatidylglycerol (POPG),
dioleoylphosphatidylethanolamine
4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal),
dipalmitoyl-phosphatidylethanolamine (DPPE), dimyristoyl-phosphati
dylethanolamine (DMPE), di stearoyl-phosphatidylethanolamine (D
SPE), monomethyl-phosphatidylethanolamine,
dimethyl-phosphatidylethanolamine,
dielaidoyl-phosphatidylethanolamine (DEPE),
stearoyloleoyl-phosphatidylethanolamine (SOPE),
lysophosphatidylcholine, dilinoleoylphosphatidylcholine, and
mixtures thereof. Other diacylphosphatidylcholine and
diacylphosphatidylethanolamine phospholipids can also be used. The
acyl groups in these lipids are preferably acyl groups derived from
fatty acids having C.sub.10-C.sub.24 carbon chains, e.g., lauroyl,
myristoyl, palmitoyl, stearoyl, or oleoyl.
[0224] Additional examples of non-cationic lipids include sterols
such as cholesterol and derivatives thereof. Non-limiting examples
of cholesterol derivatives include polar analogues such as
5.alpha.-cholestanol, 5.beta.-coprostanol,
cholesteryl-(2'-hydroxy)-ethyl ether,
cholesteryl-(4'-hydroxy)-butyl ether, and 6-ketocholestanol;
non-polar analogues such as 5.alpha.-cholestane, cholestenone,
5.alpha.-cholestanone, 5.beta.-cholestanone, and cholesteryl
decanoate; and mixtures thereof. In preferred embodiments, the
cholesterol derivative is a polar analogue such as
cholesteryl-(4'-hydroxy)-butyl ether. The synthesis of
cholesteryl-(2'-hydroxy)-ethyl ether is described in PCT
Publication No. WO 09/127060, the disclosure of which is herein
incorporated by reference in its entirety for all purposes.
[0225] In some embodiments, the non-cationic lipid present in the
lipid particles comprises or consists of a mixture of one or more
phospholipids and cholesterol or a derivative thereof. In other
embodiments, the non-cationic lipid present in the lipid particles
comprises or consists of one or more phospholipids, e.g., a
cholesterol-free lipid particle formulation. In yet other
embodiments, the non-cationic lipid present in the lipid particles
comprises or consists of cholesterol or a derivative thereof, e.g.,
a phospholipid-free lipid particle formulation.
[0226] Other examples of non-cationic lipids suitable for use in
the present invention include nonphosphorous containing lipids such
as, e.g., stearylamine, dodecylamine, hexadecylamine, acetyl
palmitate, glycerolricinoleate, hexadecyl stereate, isopropyl
myristate, amphoteric acrylic polymers, triethanolamine-lauryl
sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides,
dioctadecyldimethyl ammonium bromide, ceramide, sphingomyelin, and
the like.
[0227] In some embodiments, the non-cationic lipid comprises from
about 10 mol % to about 60 mol %, from about 20 mol % to about 55
mol %, from about 20 mol % to about 45 mol %, from about 20 mol %
to about 40 mol %, from about 25 mol % to about 50 mol %, from
about 25 mol % to about 45 mol %, from about 30 mol % to about 50
mol %, from about 30 mol % to about 45 mol %, from about 30 mol %
to about 40 mol %, from about 35 mol % to about 45 mol %, from
about 37 mol % to about 45 mol %, or about 35 mol %, 36 mol %, 37
mol %, 38 mol %, 39 mol %, 40 mol %, 41 mol %, 42 mol %, 43 mol %,
44 mol %, or 45 mol % (or any fraction thereof or range therein) of
the total lipid present in the particle.
[0228] In embodiments where the lipid particles contain a mixture
of phospholipid and cholesterol or a cholesterol derivative, the
mixture may comprise up to about 40 mol %, 45 mol %, 50 mol %, 55
mol %, or 60 mol % of the total lipid present in the particle.
[0229] In some embodiments, the phospholipid component in the
mixture may comprise from about 2 mol % to about 20 mol %, from
about 2 mol % to about 15 mol %, from about 2 mol % to about 12 mol
%, from about 4 mol % to about 15 mol %, or from about 4 mol % to
about 10 mol % (or any fraction thereof or range therein) of the
total lipid present in the particle. In an certain embodiments, the
phospholipid component in the mixture comprises from about 5 mol %
to about 17 mol %, from about 7 mol % to about 17 mol %, from about
7 mol % to about 15 mol %, from about 8 mol % to about 15 mol %, or
about 8 mol %, 9 mol %, 10 mol %, 11 mol %, 12 mol %, 13 mol %, 14
mol %, or 15 mol % (or any fraction thereof or range therein) of
the total lipid present in the particle. As a non-limiting example,
a lipid particle formulation comprising a mixture of phospholipid
and cholesterol may comprise a phospholipid such as DPPC or DSPC at
about 7 mol % (or any fraction thereof), e.g., in a mixture with
cholesterol or a cholesterol derivative at about 34 mol % (or any
fraction thereof) of the total lipid present in the particle. As
another non-limiting example, a lipid particle formulation
comprising a mixture of phospholipid and cholesterol may comprise a
phospholipid such as DPPC or DSPC at about 7 mol % (or any fraction
thereof), e.g., in a mixture with cholesterol or a cholesterol
derivative at about 32 mol % (or any fraction thereof) of the total
lipid present in the particle.
[0230] By way of further example, a lipid formulation useful in the
practice of the invention has a lipid to drug (e.g., gRNA) ratio of
about 10:1 (e.g., a lipid:drug ratio of from 9.5:1 to 11:1, or from
9.9:1 to 11:1, or from 10:1 to 10.9:1). In certain other
embodiments, a lipid formulation useful in the practice of the
invention has a lipid to drug (e.g., gRNA) ratio of about 9:1
(e.g., a lipid:drug ratio of from 8.5:1 to 10:1, or from 8.9:1 to
10:1, or from 9:1 to 9.9:1, including 9.1:1, 9.2:1, 9.3:1, 9.4:1,
9.5:1, 9.6:1, 9.7:1, and 9.8:1).
[0231] In other embodiments, the cholesterol component in the
mixture may comprise from about 25 mol % to about 45 mol %, from
about 25 mol % to about 40 mol %, from about 30 mol % to about 45
mol %, from about 30 mol % to about 40 mol %, from about 27 mol %
to about 37 mol %, from about 25 mol % to about 30 mol %, or from
about 35 mol % to about 40 mol % (or any fraction thereof or range
therein) of the total lipid present in the particle. In certain
preferred embodiments, the cholesterol component in the mixture
comprises from about 25 mol % to about 35 mol %, from about 27 mol
% to about 35 mol %, from about 29 mol % to about 35 mol %, from
about 30 mol % to about 35 mol %, from about 30 mol % to about 34
mol %, from about 31 mol % to about 33 mol %, or about 30 mol %, 31
mol %, 32 mol %, 33 mol %, 34 mol %, or 35 mol % (or any fraction
thereof or range therein) of the total lipid present in the
particle.
[0232] In embodiments where the lipid particles are
phospholipid-free, the cholesterol or derivative thereof may
comprise up to about 25 mol %, 30 mol %, 35 mol %, 40 mol %, 45 mol
%, 50 mol %, 55 mol %, or 60 mol % of the total lipid present in
the particle.
[0233] In some embodiments, the cholesterol or derivative thereof
in the phospholipid-free lipid particle formulation may comprise
from about 25 mol % to about 45 mol %, from about 25 mol % to about
40 mol %, from about 30 mol % to about 45 mol %, from about 30 mol
% to about 40 mol %, from about 31 mol % to about 39 mol %, from
about 32 mol % to about 38 mol %, from about 33 mol % to about 37
mol %, from about 35 mol % to about 45 mol %, from about 30 mol %
to about 35 mol %, from about 35 mol % to about 40 mol %, or about
30 mol %, 31 mol %, 32 mol %, 33 mol %, 34 mol %, 35 mol %, 36 mol
%, 37 mol %, 38 mol %, 39 mol %, or 40 mol % (or any fraction
thereof or range therein) of the total lipid present in the
particle. As a non-limiting example, a lipid particle formulation
may comprise cholesterol at about 37 mol % (or any fraction
thereof) of the total lipid present in the particle. As another
non-limiting example, a lipid particle formulation may comprise
cholesterol at about 35 mol % (or any fraction thereof) of the
total lipid present in the particle.
[0234] In other embodiments, the non-cationic lipid comprises from
about 5 mol % to about 90 mol %, from about 10 mol % to about 85
mol %, from about 20 mol % to about 80 mol %, about 10 mol % (e.g.,
phospholipid only), or about 60 mol % (e.g., phospholipid and
cholesterol or derivative thereof) (or any fraction thereof or
range therein) of the total lipid present in the particle.
[0235] Additional percentages and ranges of non-cationic lipids
suitable for use in the lipid particles of the present invention
are described in PCT Publication No. WO 09/127060, U.S. Published
Application No. US 2011/0071208, PCT Publication No. WO2011/000106,
and U.S. Published Application No. US 2011/0076335, the disclosures
of which are herein incorporated by reference in their entirety for
all purposes.
[0236] It should be understood that the percentage of non-cationic
lipid present in the lipid particles of the invention is a target
amount, and that the actual amount of non-cationic lipid present in
the formulation may vary, for example, by .+-.5 mol %, .+-.4 mol %,
.+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, 0.5 mol %, 0.25 mol
%, or .+-.0.1 mol %.
3. Lipid Conjugates
[0237] In addition to cationic and non-cationic lipids, the lipid
particles of the invention may further comprise a lipid conjugate.
The conjugated lipid is useful in that it prevents the aggregation
of particles. Suitable conjugated lipids include, but are not
limited to, PEG-lipid conjugates, POZ-lipid conjugates, ATTA-lipid
conjugates, cationic-polymer-lipid conjugates (CPLs), and mixtures
thereof. In certain embodiments, the particles comprise either a
PEG-lipid conjugate or an ATTA-lipid conjugate together with a
CPL.
[0238] In a preferred embodiment, the lipid conjugate is a
PEG-lipid. Examples of PEG-lipids include, but are not limited to,
PEG coupled to dialkyloxypropyls (PEG-DAA) as described in, e.g.,
PCT Publication No. WO 05/026372, PEG coupled to diacylglycerol
(PEG-DAG) as described in, e.g., U.S. Patent Publication Nos.
20030077829 and 2005008689, PEG coupled to phospholipids such as
phosphatidylethanolamine (PEG-PE), PEG conjugated to ceramides as
described in, e.g., U.S. Pat. No. 5,885,613, PEG conjugated to
cholesterol or a derivative thereof, and mixtures thereof. The
disclosures of these patent documents are herein incorporated by
reference in their entirety for all purposes.
[0239] Additional PEG-lipids suitable for use in the invention
include, without limitation,
mPEG2000-1,2-di-O-alkyl-sn3-carbomoylglyceride (PEG-C-DOMG). The
synthesis of PEG-C-DOMG is described in PCT Publication No. WO
09/086558, the disclosure of which is herein incorporated by
reference in its entirety for all purposes. Yet additional suitable
PEG-lipid conjugates include, without limitation,
1-[8'-(1,2-dimyristoyl-3-propanoxy)-carboxamido-3',6'-dioxaoctanyl]carbam-
oyl-.omega.-methyl-poly(ethylene glycol) (2KPEG-DMG). The synthesis
of 2KPEG-DMG is described in U.S. Pat. No. 7,404,969, the
disclosure of which is herein incorporated by reference in its
entirety for all purposes.
[0240] PEG is a linear, water-soluble polymer of ethylene PEG
repeating units with two terminal hydroxyl groups. PEGs are
classified by their molecular weights; for example, PEG 2000 has an
average molecular weight of about 2,000 daltons, and PEG 5000 has
an average molecular weight of about 5,000 daltons. PEGs are
commercially available from Sigma Chemical Co. and other companies
and include, but are not limited to, the following:
monomethoxypolyethylene glycol (MePEG-OH), monomethoxypolyethylene
glycol-succinate (MePEG-S), monomethoxypolyethylene
glycol-succinimidyl succinate (MePEG-S-NHS),
monomethoxypolyethylene glycol-amine (MePEG-NH.sub.2),
monomethoxypolyethylene glycol-tresylate (MePEG-TRES),
monomethoxypolyethylene glycol-imidazolyl-carbonyl (MePEG-IM), as
well as such compounds containing a terminal hydroxyl group instead
of a terminal methoxy group (e.g., HO-PEG-S, HO-PEG-S-NHS,
HO-PEG-NH.sub.2, etc.). Other PEGs such as those described in U.S.
Pat. Nos. 6,774,180 and 7,053,150 (e.g., mPEG (20 KDa) amine) are
also useful for preparing the PEG-lipid conjugates of the present
invention. The disclosures of these patents are herein incorporated
by reference in their entirety for all purposes. In addition,
monomethoxypolyethyleneglycol-acetic acid (MePEG-CH.sub.2COOH) is
particularly useful for preparing PEG-lipid conjugates including,
e.g., PEG-DAA conjugates.
[0241] The PEG moiety of the PEG-lipid conjugates described herein
may comprise an average molecular weight ranging from about 550
daltons to about 10,000 daltons. In certain instances, the PEG
moiety has an average molecular weight of from about 750 daltons to
about 5,000 daltons (e.g., from about 1,000 daltons to about 5,000
daltons, from about 1,500 daltons to about 3,000 daltons, from
about 750 daltons to about 3,000 daltons, from about 750 daltons to
about 2,000 daltons, etc.). In preferred embodiments, the PEG
moiety has an average molecular weight of about 2,000 daltons or
about 750 daltons.
[0242] In certain instances, the PEG can be optionally substituted
by an alkyl, alkoxy, acyl, or aryl group. The PEG can be conjugated
directly to the lipid or may be linked to the lipid via a linker
moiety. Any linker moiety suitable for coupling the PEG to a lipid
can be used including, e.g., non-ester containing linker moieties
and ester-containing linker moieties. In a preferred embodiment,
the linker moiety is a non-ester containing linker moiety. As used
herein, the term "non-ester containing linker moiety" refers to a
linker moiety that does not contain a carboxylic ester bond
(--OC(O)--). Suitable non-ester containing linker moieties include,
but are not limited to, amido (--C(O)NH--), amino (--NR--),
carbonyl (--C(O)--), carbamate (--NHC(O)O--), urea (--NHC(O)NH--),
disulphide (--S--S--), ether (--O--), succinyl
(--(O)CCH.sub.2CH.sub.2C(O)--), succinamidyl
(--NHC(O)CH.sub.2CH.sub.2C(O)NH--), ether, disulphide, as well as
combinations thereof (such as a linker containing both a carbamate
linker moiety and an amido linker moiety). In a preferred
embodiment, a carbamate linker is used to couple the PEG to the
lipid.
[0243] In other embodiments, an ester containing linker moiety is
used to couple the PEG to the lipid. Suitable ester containing
linker moieties include, e.g., carbonate (--OC(O)O--), succinoyl,
phosphate esters (--O--(O)POH--O--), sulfonate esters, and
combinations thereof.
[0244] Phosphatidylethanolamines having a variety of acyl chain
groups of varying chain lengths and degrees of saturation can be
conjugated to PEG to form the lipid conjugate. Such
phosphatidylethanolamines are commercially available, or can be
isolated or synthesized using conventional techniques known to
those of skill in the art. Phosphatidyl-ethanolamines containing
saturated or unsaturated fatty acids with carbon chain lengths in
the range of Cm to C.sub.20 are preferred.
Phosphatidylethanolamines with mono- or diunsaturated fatty acids
and mixtures of saturated and unsaturated fatty acids can also be
used. Suitable phosphatidylethanolamines include, but are not
limited to, dimyristoyl-phosphatidylethanolamine (DMPE),
dipalmitoyl-phosphatidylethanolamine (DPPE),
dioleoylphosphatidylethanolamine (DOPE), and
distearoyl-phosphatidylethanolamine (DSPE).
[0245] The term "ATTA" or "polyamide" includes, without limitation,
compounds described in U.S. Pat. Nos. 6,320,017 and 6,586,559, the
disclosures of which are herein incorporated by reference in their
entirety for all purposes. These compounds include a compound
having the formula:
##STR00007##
[0246] wherein R is a member selected from the group consisting of
hydrogen, alkyl and acyl; R.sup.1 is a member selected from the
group consisting of hydrogen and alkyl; or optionally, R and
R.sup.1 and the nitrogen to which they are bound form an azido
moiety; R.sup.2 is a member of the group selected from hydrogen,
optionally substituted alkyl, optionally substituted aryl and a
side chain of an amino acid; R.sup.3 is a member selected from the
group consisting of hydrogen, halogen, hydroxy, alkoxy, mercapto,
hydrazino, amino and NR.sup.4R.sup.5, wherein R.sup.4 and R.sup.5
are independently hydrogen or alkyl; n is 4 to 80; m is 2 to 6; p
is 1 to 4; and q is 0 or 1. It will be apparent to those of skill
in the art that other polyamides can be used in the compounds of
the present invention.
[0247] The term "diacylglycerol" or "DAG" includes a compound
having 2 fatty acyl chains, R.sup.1 and R.sup.2, both of which have
independently between 2 and 30 carbons bonded to the 1- and
2-position of glycerol by ester linkages. The acyl groups can be
saturated or have varying degrees of unsaturation. Suitable acyl
groups include, but are not limited to, lauroyl (C.sub.12),
myristoyl (C.sub.14), palmitoyl (C.sub.16), stearoyl (C.sub.18),
and icosoyl (C.sub.20). In preferred embodiments, R.sup.1 and
R.sup.2 are the same, i.e., R.sup.1 and R.sup.2 are both myristoyl
(i.e., dimyristoyl), R.sup.1 and R.sup.2 are both stearoyl (i.e.,
distearoyl), etc. Diacylglycerols have the following general
formula:
##STR00008##
[0248] The term "dialkyloxypropyl" or "DAA" includes a compound
having 2 alkyl chains, R.sup.1 and R.sup.2, both of which have
independently between 2 and 30 carbons. The alkyl groups can be
saturated or have varying degrees of unsaturation.
Dialkyloxypropyls have the following general formula:
##STR00009##
[0249] In a preferred embodiment, the PEG-lipid is a PEG-DAA
conjugate having the following formula:
##STR00010##
[0250] wherein R.sup.1 and R.sup.2 are independently selected and
are long-chain alkyl groups having from about 10 to about 22 carbon
atoms; PEG is a polyethyleneglycol; and L is a non-ester containing
linker moiety or an ester containing linker moiety as described
above. The long-chain alkyl groups can be saturated or unsaturated.
Suitable alkyl groups include, but are not limited to, decyl
(C.sub.10), lauryl (C.sub.12), myristyl (C.sub.14), palmityl
(C.sub.16), stearyl (C.sub.18), and icosyl (C.sub.20). In preferred
embodiments, R.sup.1 and R.sup.2 are the same, i.e., R.sup.1 and
R.sup.2 are both myristyl (i.e., dimyristyl), R.sup.1 and R.sup.2
are both stearyl (i.e., distearyl), etc.
[0251] In Formula VII above, the PEG has an average molecular
weight ranging from about 550 daltons to about 10,000 daltons. In
certain instances, the PEG has an average molecular weight of from
about 750 daltons to about 5,000 daltons (e.g., from about 1,000
daltons to about 5,000 daltons, from about 1,500 daltons to about
3,000 daltons, from about 750 daltons to about 3,000 daltons, from
about 750 daltons to about 2,000 daltons, etc.). In preferred
embodiments, the PEG has an average molecular weight of about 2,000
daltons or about 750 daltons. The PEG can be optionally substituted
with alkyl, alkoxy, acyl, or aryl groups. In certain embodiments,
the terminal hydroxyl group is substituted with a methoxy or methyl
group.
[0252] In a preferred embodiment, "L" is a non-ester containing
linker moiety. Suitable non-ester containing linkers include, but
are not limited to, an amido linker moiety, an amino linker moiety,
a carbonyl linker moiety, a carbamate linker moiety, a urea linker
moiety, an ether linker moiety, a disulphide linker moiety, a
succinamidyl linker moiety, and combinations thereof. In a
preferred embodiment, the non-ester containing linker moiety is a
carbamate linker moiety (i.e., a PEG-C-DAA conjugate). In another
preferred embodiment, the non-ester containing linker moiety is an
amido linker moiety (i.e., a PEG-A-DAA conjugate). In yet another
preferred embodiment, the non-ester containing linker moiety is a
succinamidyl linker moiety (i.e., a PEG-S-DAA conjugate).
[0253] In particular embodiments, the PEG-lipid conjugate is
selected from:
##STR00011##
[0254] The PEG-DAA conjugates are synthesized using standard
techniques and reagents known to those of skill in the art. It will
be recognized that the PEG-DAA conjugates will contain various
amide, amine, ether, thio, carbamate, and urea linkages. Those of
skill in the art will recognize that methods and reagents for
forming these bonds are well known and readily available. See,
e.g., March, ADVANCED ORGANIC CHEMISTRY (Wiley 1992); Larock,
COMPREHENSIVE ORGANIC TRANSFORMATIONS (VCH 1989); and Furniss,
VOGEL'S TEXTBOOK OF PRACTICAL ORGANIC CHEMISTRY, 5th ed. (Longman
1989). It will also be appreciated that any functional groups
present may require protection and deprotection at different points
in the synthesis of the PEG-DAA conjugates. Those of skill in the
art will recognize that such techniques are well known. See, e.g.,
Green and Wuts, PROTECTIVE GROUPS IN ORGANIC SYNTHESIS (Wiley
1991).
[0255] Preferably, the PEG-DAA conjugate is a PEG-didecyloxypropyl
(C.sub.10) conjugate, a PEG-dilauryloxypropyl (Cu) conjugate, a
PEG-dimyristyloxypropyl (C.sub.14) conjugate, a
PEG-dipalmityloxypropyl (C.sub.16) conjugate, or a
PEG-distearyloxypropyl (C.sub.18) conjugate. In these embodiments,
the PEG preferably has an average molecular weight of about 750 or
about 2,000 daltons. In one particularly preferred embodiment, the
PEG-lipid conjugate comprises PEG2000-C-DMA, wherein the "2000"
denotes the average molecular weight of the PEG, the "C" denotes a
carbamate linker moiety, and the "DMA" denotes dimyristyloxypropyl.
In another particularly preferred embodiment, the PEG-lipid
conjugate comprises PEG750-C-DMA, wherein the "750" denotes the
average molecular weight of the PEG, the "C" denotes a carbamate
linker moiety, and the "DMA" denotes dimyristyloxypropyl. In
particular embodiments, the terminal hydroxyl group of the PEG is
substituted with a methyl group. Those of skill in the art will
readily appreciate that other dialkyloxypropyls can be used in the
PEG-DAA conjugates of the present invention.
[0256] In addition to the foregoing, it will be readily apparent to
those of skill in the art that other hydrophilic polymers can be
used in place of PEG. Examples of suitable polymers that can be
used in place of PEG include, but are not limited to,
polyvinylpyrrolidone, polymethyloxazoline, polyethyloxazoline,
polyhydroxypropyl methacrylamide, polymethacrylamide and
polydimethylacrylamide, polylactic acid, polyglycolic acid, and
derivatized celluloses such as hydroxymethylcellulose or
hydroxyethylcellulose.
[0257] In addition to the foregoing components, the lipid particles
of the present invention can further comprise cationic
poly(ethylene glycol) (PEG) lipids or CPLs (see, e.g., Chen et al.,
Bioconj. Chem., 11:433-437 (2000); U.S. Pat. No. 6,852,334; PCT
Publication No. WO 00/62813, the disclosures of which are herein
incorporated by reference in their entirety for all purposes).
[0258] Suitable CPLs include compounds of Formula VIII:
A-W--Y (VIII),
[0259] wherein A, W, and Y are as described below.
[0260] With reference to Formula VIII, "A" is a lipid moiety such
as an amphipathic lipid, a neutral lipid, or a hydrophobic lipid
that acts as a lipid anchor. Suitable lipid examples include, but
are not limited to, diacylglycerolyls, dialkylglycerolyls,
N--N-dialkylaminos, 1,2-diacyloxy-3-aminopropanes, and
1,2-dialkyl-3-aminopropanes.
[0261] "W" is a polymer or an oligomer such as a hydrophilic
polymer or oligomer. Preferably, the hydrophilic polymer is a
biocompatable polymer that is nonimmunogenic or possesses low
inherent immunogenicity. Alternatively, the hydrophilic polymer can
be weakly antigenic if used with appropriate adjuvants. Suitable
nonimmunogenic polymers include, but are not limited to, PEG,
polyamides, polylactic acid, polyglycolic acid, polylactic
acid/polyglycolic acid copolymers, and combinations thereof. In a
preferred embodiment, the polymer has a molecular weight of from
about 250 to about 7,000 daltons.
[0262] "Y" is a polycationic moiety. The term polycationic moiety
refers to a compound, derivative, or functional group having a
positive charge, preferably at least 2 positive charges at a
selected pH, preferably physiological pH. Suitable polycationic
moieties include basic amino acids and their derivatives such as
arginine, asparagine, glutamine, lysine, and histidine; spermine;
spermidine; cationic dendrimers; polyamines; polyamine sugars; and
amino polysaccharides. The polycationic moieties can be linear,
such as linear tetralysine, branched or dendrimeric in structure.
Polycationic moieties have between about 2 to about 15 positive
charges, preferably between about 2 to about 12 positive charges,
and more preferably between about 2 to about 8 positive charges at
selected pH values. The selection of which polycationic moiety to
employ may be determined by the type of particle application which
is desired.
[0263] The charges on the polycationic moieties can be either
distributed around the entire particle moiety, or alternatively,
they can be a discrete concentration of charge density in one
particular area of the particle moiety e.g., a charge spike. If the
charge density is distributed on the particle, the charge density
can be equally distributed or unequally distributed. All variations
of charge distribution of the polycationic moiety are encompassed
by the present invention.
[0264] The lipid "A" and the nonimmunogenic polymer "W" can be
attached by various methods and preferably by covalent attachment.
Methods known to those of skill in the art can be used for the
covalent attachment of "A" and "W." Suitable linkages include, but
are not limited to, amide, amine, carboxyl, carbonate, carbamate,
ester, and hydrazone linkages. It will be apparent to those skilled
in the art that "A" and "W" must have complementary functional
groups to effectuate the linkage. The reaction of these two groups,
one on the lipid and the other on the polymer, will provide the
desired linkage. For example, when the lipid is a diacylglycerol
and the terminal hydroxyl is activated, for instance with NHS and
DCC, to form an active ester, and is then reacted with a polymer
which contains an amino group, such as with a polyamide (see, e.g.,
U.S. Pat. Nos. 6,320,017 and 6,586,559, the disclosures of which
are herein incorporated by reference in their entirety for all
purposes), an amide bond will form between the two groups.
[0265] In certain instances, the polycationic moiety can have a
ligand attached, such as a targeting ligand or a chelating moiety
for complexing calcium. Preferably, after the ligand is attached,
the cationic moiety maintains a positive charge. In certain
instances, the ligand that is attached has a positive charge.
Suitable ligands include, but are not limited to, a compound or
device with a reactive functional group and include lipids,
amphipathic lipids, carrier compounds, bioaffinity compounds,
biomaterials, biopolymers, biomedical devices, analytically
detectable compounds, therapeutically active compounds, enzymes,
peptides, proteins, antibodies, immune stimulators, radiolabels,
fluorogens, biotin, drugs, haptens, DNA, RNA, polysaccharides,
liposomes, virosomes, micelles, immunoglobulins, functional groups,
other targeting moieties, or toxins.
[0266] In some embodiments, the lipid conjugate (e.g., PEG-lipid)
comprises from about 0.1 mol % to about 3 mol %, from about 0.5 mol
% to about 3 mol %, or about 0.6 mol %, 0.7 mol %, 0.8 mol %, 0.9
mol %, 1.0 mol %, 1.1 mol %, 1.2 mol %, 1.3 mol %, 1.4 mol %, 1.5
mol %, 1.6 mol %, 1.7 mol %, 1.8 mol %, 1.9 mol %, 2.0 mol %, 2.1
mol %, 2.2 mol %, 2.3 mol %, 2.4 mol %, 2.5 mol %, 2.6 mol %, 2.7
mol %, 2.8 mol %, 2.9 mol % or 3 mol % (or any fraction thereof or
range therein) of the total lipid present in the particle.
[0267] In other embodiments, the lipid conjugate (e.g., PEG-lipid)
comprises from about 0 mol % to about 20 mol %, from about 0.5 mol
% to about 20 mol %, from about 2 mol % to about 20 mol %, from
about 1.5 mol % to about 18 mol %, from about 2 mol % to about 15
mol %, from about 4 mol % to about 15 mol %, from about 2 mol % to
about 12 mol %, from about 5 mol % to about 12 mol %, or about 2
mol % (or any fraction thereof or range therein) of the total lipid
present in the particle.
[0268] In further embodiments, the lipid conjugate (e.g.,
PEG-lipid) comprises from about 4 mol % to about 10 mol %, from
about 5 mol % to about 10 mol %, from about 5 mol % to about 9 mol
%, from about 5 mol % to about 8 mol %, from about 6 mol % to about
9 mol %, from about 6 mol % to about 8 mol %, or about 5 mol %, 6
mol %, 7 mol %, 8 mol %, 9 mol %, or 10 mol % (or any fraction
thereof or range therein) of the total lipid present in the
particle.
[0269] It should be understood that the percentage of lipid
conjugate present in the lipid particles of the invention is a
target amount, and that the actual amount of lipid conjugate
present in the formulation may vary, for example, by .+-.5 mol %,
.+-.4 mol %, .+-.3 mol %, .+-.2 mol %, 1 mol %, 0.75 mol %, 0.5 mol
%, 0.25 mol %, or .+-.0.1 mol %.
[0270] Additional percentages and ranges of lipid conjugates
suitable for use in the lipid particles of the present invention
are described in PCT Publication No. WO 09/127060, U.S. Published
Application No. US 2011/0071208, PCT Publication No. WO2011/000106,
and U.S. Published Application No. US 2011/0076335, the disclosures
of which are herein incorporated by reference in their entirety for
all purposes.
[0271] One of ordinary skill in the art will appreciate that the
concentration of the lipid conjugate can be varied depending on the
lipid conjugate employed and the rate at which the lipid particle
is to become fusogenic.
[0272] By controlling the composition and concentration of the
lipid conjugate, one can control the rate at which the lipid
conjugate exchanges out of the lipid particle and, in turn, the
rate at which the lipid particle becomes fusogenic. For instance,
when a PEG-DAA conjugate is used as the lipid conjugate, the rate
at which the lipid particle becomes fusogenic can be varied, for
example, by varying the concentration of the lipid conjugate, by
varying the molecular weight of the PEG, or by varying the chain
length and degree of saturation of the alkyl groups on the PEG-DAA
conjugate. In addition, other variables including, for example, pH,
temperature, ionic strength, etc. can be used to vary and/or
control the rate at which the lipid particle becomes fusogenic.
Other methods which can be used to control the rate at which the
lipid particle becomes fusogenic will become apparent to those of
skill in the art upon reading this disclosure. Also, by controlling
the composition and concentration of the lipid conjugate, one can
control the lipid particle size.
[0273] Preparation of Lipid Particles
[0274] The nucleic acid-lipid particles of the present invention,
in which a nucleic acid (e.g., a gRNA) is entrapped within the
lipid portion of the particle and is protected from degradation,
can be formed by any method known in the art including, but not
limited to, a continuous mixing method, a direct dilution process,
and an in-line dilution process.
[0275] In particular embodiments, the cationic lipids may comprise
lipids of Formula I-III or salts thereof, alone or in combination
with other cationic lipids. In other embodiments, the non-cationic
lipids are egg sphingomyelin (ESM), di stearoylphosphatidylcholine
(DSPC), dioleoylphosphatidylcholine (DOPC),
1-palmitoyl-2-oleoyl-phosphatidylcholine (POPC),
dipalmitoyl-phosphatidylcholine (DPPC),
monomethyl-phosphatidylethanolamine,
dimethyl-phosphatidylethanolamine, 14:0 PE
(1,2-dimyristoyl-phosphatidylethanolamine (DMPE)), 16:0 PE
(1,2-dipalmitoyl-phosphatidylethanolamine (DPPE)), 18:0 PE
(1,2-distearoyl-phosphatidylethanolamine (DSPE)), 18:1 PE
(1,2-dioleoyl-phosphatidylethanolamine (DOPE)), 18:1 trans PE
(1,2-dielaidoyl-phosphatidylethanolamine (DEPE)), 18:0-18:1 PE
(1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE)), 16:0-18:1 PE
(1-palmitoyl-2-oleoyl-phosphatidylethanolamine (POPE)),
polyethylene glycol-based polymers (e.g., PEG 2000, PEG 5000,
PEG-modified diacylglycerols, or PEG-modified dialkyloxypropyls),
cholesterol, derivatives thereof, or combinations thereof.
[0276] In certain embodiments, the present invention provides
nucleic acid-lipid particles produced via a continuous mixing
method, e.g., a process that includes providing an aqueous solution
comprising a gRNA in a first reservoir, providing an organic lipid
solution in a second reservoir (wherein the lipids present in the
organic lipid solution are solubilized in an organic solvent, e.g.,
a lower alkanol such as ethanol), and mixing the aqueous solution
with the organic lipid solution such that the organic lipid
solution mixes with the aqueous solution so as to substantially
instantaneously produce a lipid vesicle (e.g., liposome)
encapsulating the gRNA within the lipid vesicle. This process and
the apparatus for carrying out this process are described in detail
in U.S. Patent Publication No. 20040142025, the disclosure of which
is herein incorporated by reference in its entirety for all
purposes.
[0277] The action of continuously introducing lipid and buffer
solutions into a mixing environment, such as in a mixing chamber,
causes a continuous dilution of the lipid solution with the buffer
solution, thereby producing a lipid vesicle substantially
instantaneously upon mixing. As used herein, the phrase
"continuously diluting a lipid solution with a buffer solution"
(and variations) generally means that the lipid solution is diluted
sufficiently rapidly in a hydration process with sufficient force
to effectuate vesicle generation. By mixing the aqueous solution
comprising a nucleic acid with the organic lipid solution, the
organic lipid solution undergoes a continuous stepwise dilution in
the presence of the buffer solution (i.e., aqueous solution) to
produce a nucleic acid-lipid particle.
[0278] The nucleic acid-lipid particles formed using the continuous
mixing method typically have a size of from about 30 nm to about
150 nm, from about 40 nm to about 150 nm, from about 50 nm to about
150 nm, from about 60 nm to about 130 nm, from about 70 nm to about
110 nm, from about 70 nm to about 100 nm, from about 80 nm to about
100 nm, from about 90 nm to about 100 nm, from about 70 to about 90
nm, from about 80 nm to about 90 nm, from about 70 nm to about 80
nm, less than about 120 nm, 110 nm, 100 nm, 90 nm, or 80 nm, or
about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70
nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115
nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm (or
any fraction thereof or range therein). The particles thus formed
do not aggregate and are optionally sized to achieve a uniform
particle size.
[0279] In another embodiment, the present invention provides
nucleic acid-lipid particles produced via a direct dilution process
that includes forming a lipid vesicle (e.g., liposome) solution and
immediately and directly introducing the lipid vesicle solution
into a collection vessel containing a controlled amount of dilution
buffer. In preferred aspects, the collection vessel includes one or
more elements configured to stir the contents of the collection
vessel to facilitate dilution. In one aspect, the amount of
dilution buffer present in the collection vessel is substantially
equal to the volume of lipid vesicle solution introduced thereto.
As a non-limiting example, a lipid vesicle solution in 45% ethanol
when introduced into the collection vessel containing an equal
volume of dilution buffer will advantageously yield smaller
particles.
[0280] In yet another embodiment, the present invention provides
nucleic acid-lipid particles produced via an in-line dilution
process in which a third reservoir containing dilution buffer is
fluidly coupled to a second mixing region. In this embodiment, the
lipid vesicle (e.g., liposome) solution formed in a first mixing
region is immediately and directly mixed with dilution buffer in
the second mixing region. In preferred aspects, the second mixing
region includes a T-connector arranged so that the lipid vesicle
solution and the dilution buffer flows meet as opposing 180.degree.
flows; however, connectors providing shallower angles can be used,
e.g., from about 27.degree. to about 180.degree. (e.g., about
90.degree.). A pump mechanism delivers a controllable flow of
buffer to the second mixing region. In one aspect, the flow rate of
dilution buffer provided to the second mixing region is controlled
to be substantially equal to the flow rate of lipid vesicle
solution introduced thereto from the first mixing region. This
embodiment advantageously allows for more control of the flow of
dilution buffer mixing with the lipid vesicle solution in the
second mixing region, and therefore also the concentration of lipid
vesicle solution in buffer throughout the second mixing process.
Such control of the dilution buffer flow rate advantageously allows
for small particle size formation at reduced concentrations.
[0281] These processes and the apparatuses for carrying out these
direct dilution and in-line dilution processes are described in
detail in U.S. Patent Publication No. 20070042031, the disclosure
of which is herein incorporated by reference in its entirety for
all purposes.
[0282] The nucleic acid-lipid particles formed using the direct
dilution and in-line dilution processes typically have a size of
from about 30 nm to about 150 nm, from about 40 nm to about 150 nm,
from about 50 nm to about 150 nm, from about 60 nm to about 130 nm,
from about 70 nm to about 110 nm, from about 70 nm to about 100 nm,
from about 80 nm to about 100 nm, from about 90 nm to about 100 nm,
from about 70 to about 90 nm, from about 80 nm to about 90 nm, from
about 70 nm to about 80 nm, less than about 120 nm, 110 nm, 100 nm,
90 nm, or 80 nm, or about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm,
60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105
nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm,
or 150 nm (or any fraction thereof or range therein). The particles
thus formed do not aggregate and are optionally sized to achieve a
uniform particle size.
[0283] If needed, the lipid particles of the invention can be sized
by any of the methods available for sizing liposomes. The sizing
may be conducted in order to achieve a desired size range and
relatively narrow distribution of particle sizes.
[0284] Several techniques are available for sizing the particles to
a desired size. One sizing method, used for liposomes and equally
applicable to the present particles, is described in U.S. Pat. No.
4,737,323, the disclosure of which is herein incorporated by
reference in its entirety for all purposes. Sonicating a particle
suspension either by bath or probe sonication produces a
progressive size reduction down to particles of less than about 50
nm in size. Homogenization is another method which relies on
shearing energy to fragment larger particles into smaller ones. In
a typical homogenization procedure, particles are recirculated
through a standard emulsion homogenizer until selected particle
sizes, typically between about 60 and about 80 nm, are observed. In
both methods, the particle size distribution can be monitored by
conventional laser-beam particle size discrimination, or QELS.
[0285] Extrusion of the particles through a small-pore
polycarbonate membrane or an asymmetric ceramic membrane is also an
effective method for reducing particle sizes to a relatively
well-defined size distribution. Typically, the suspension is cycled
through the membrane one or more times until the desired particle
size distribution is achieved. The particles may be extruded
through successively smaller-pore membranes, to achieve a gradual
reduction in size.
[0286] In some embodiments, the nucleic acids present in the
particles (e.g., the gRNA molecules) are precondensed as described
in, e.g., U.S. patent application Ser. No. 09/744,103, the
disclosure of which is herein incorporated by reference in its
entirety for all purposes.
[0287] In other embodiments, the methods may further comprise
adding non-lipid polycations which are useful to effect the
lipofection of cells using the present compositions. Examples of
suitable non-lipid polycations include, hexadimethrine bromide
(sold under the brand name POLYBRENE.RTM., from Aldrich Chemical
Co., Milwaukee, Wis., USA) or other salts of hexadimethrine. Other
suitable polycations include, for example, salts of
poly-L-ornithine, poly-L-arginine, poly-L-lysine, poly-D-lysine,
polyallylamine, and polyethyleneimine. Addition of these salts is
preferably after the particles have been formed.
[0288] In some embodiments, the nucleic acid (e.g., gRNA) to lipid
ratios (mass/mass ratios) in a formed nucleic acid-lipid particle
will range from about 0.01 to about 0.2, from about 0.05 to about
0.2, from about 0.02 to about 0.1, from about 0.03 to about 0.1, or
from about 0.01 to about 0.08. The ratio of the starting materials
(input) also falls within this range. In other embodiments, the
particle preparation uses about 400 .mu.g nucleic acid per 10 mg
total lipid or a nucleic acid to lipid mass ratio of about 0.01 to
about 0.08 and, more preferably, about 0.04, which corresponds to
1.25 mg of total lipid per 50 .mu.g of nucleic acid. In other
preferred embodiments, the particle has a nucleic acid:lipid mass
ratio of about 0.08.
[0289] In other embodiments, the lipid to nucleic acid (e.g., gRNA)
ratios (mass/mass ratios) in a formed nucleic acid-lipid particle
will range from about 1 (1:1) to about 100 (100:1), from about 5
(5:1) to about 100 (100:1), from about 1 (1:1) to about 50 (50:1),
from about 2 (2:1) to about 50 (50:1), from about 3 (3:1) to about
50 (50:1), from about 4 (4:1) to about 50 (50:1), from about 5
(5:1) to about 50 (50:1), from about 1 (1:1) to about 25 (25:1),
from about 2 (2:1) to about 25 (25:1), from about 3 (3:1) to about
25 (25:1), from about 4 (4:1) to about 25 (25:1), from about 5
(5:1) to about 25 (25:1), from about 5 (5:1) to about 20 (20:1),
from about 5 (5:1) to about 15 (15:1), from about 5 (5:1) to about
10 (10:1), or about 5 (5:1), 6 (6:1), 7 (7:1), 8 (8:1), 9 (9:1), 10
(10:1), 11 (11:1), 12 (12:1), 13 (13:1), 14 (14:1), 15 (15:1), 16
(16:1), 17 (17:1), 18 (18:1), 19 (19:1), 20 (20:1), 21 (21:1), 22
(22:1), 23 (23:1), 24 (24:1), or 25 (25:1), or any fraction thereof
or range therein. The ratio of the starting materials (input) also
falls within this range.
[0290] As previously discussed, the conjugated lipid may further
include a CPL. A variety of general methods for making lipid
particle-CPLs (CPL-containing lipid particles) are discussed
herein. Two general techniques include the "post-insertion"
technique, that is, insertion of a CPL into, for example, a
pre-formed lipid particle, and the "standard" technique, wherein
the CPL is included in the lipid mixture during, for example, the
lipid particle formation steps. The post-insertion technique
results in lipid particles having CPLs mainly in the external face
of the lipid particle bilayer membrane, whereas standard techniques
provide lipid particles having CPLs on both internal and external
faces. The method is especially useful for vesicles made from
phospholipids (which can contain cholesterol) and also for vesicles
containing PEG-lipids (such as PEG-DAAs and PEG-DAGs). Methods of
making lipid particle-CPLs are taught, for example, in U.S. Pat.
Nos. 5,705,385; 6,586,410; 5,981,501; 6,534,484; and 6,852,334;
U.S. Patent Publication No. 20020072121; and PCT Publication No. WO
00/62813, the disclosures of which are herein incorporated by
reference in their entirety for all purposes.
[0291] Kits
[0292] The present invention also provides lipid particles in kit
form. In some embodiments, the kit comprises a container which is
compartmentalized for holding the various elements of the lipid
particles (e.g., the active agents, such as gRNA molecules and the
individual lipid components of the particles). Preferably, the kit
comprises a container (e.g., a vial or ampoule) which holds the
lipid particles of the invention, wherein the particles are
produced by one of the processes set forth herein. In certain
embodiments, the kit may further comprise an endosomal membrane
destabilizer (e.g., calcium ions). The kit typically contains the
particle compositions of the invention, either as a suspension in a
pharmaceutically acceptable carrier or in dehydrated form, with
instructions for their rehydration (if lyophilized) and
administration.
[0293] The formulations of the present invention can be tailored to
preferentially target particular cells, tissues, or organs of
interest. Preferential targeting of a nucleic acid-lipid particle
may be carried out by controlling the composition of the lipid
particle itself. In particular embodiments, the kits of the
invention comprise these lipid particles, wherein the particles are
present in a container as a suspension or in dehydrated form.
[0294] In certain instances, it may be desirable to have a
targeting moiety attached to the surface of the lipid particle to
further enhance the targeting of the particle. Methods of attaching
targeting moieties (e.g., antibodies, proteins, etc.) to lipids
(such as those used in the present particles) are known to those of
skill in the art.
[0295] Administration of Lipid Particles
[0296] Once formed, the lipid particles of the invention are
particularly useful for the introduction of a gRNA molecule into
cells. Accordingly, the present invention also provides methods for
introducing a gRNA molecule into a cell in combination with an mRNA
encoding a Cas9. In particular embodiments, the gRNA molecule and
mRNA encoding a Cas9 are introduced into an infected cell. The
methods may be carried out in vitro or in vivo by first forming the
particles as described above and then contacting the particles with
the cells for a period of time sufficient for delivery of gRNA to
the cells to occur.
[0297] The lipid particles of the invention (e.g., a nucleic-acid
lipid particle) can be adsorbed to almost any cell type with which
they are mixed or contacted. Once adsorbed, the particles can
either be endocytosed by a portion of the cells, exchange lipids
with cell membranes, or fuse with the cells. Transfer or
incorporation of the gRNA portion of the particle can take place
via any one of these pathways. In particular, when fusion takes
place, the particle membrane is integrated into the cell membrane
and the contents of the particle combine with the intracellular
fluid.
[0298] The lipid particles of the invention (e.g., nucleic
acid-lipid particles) can be administered either alone or in a
mixture with a pharmaceutically acceptable carrier (e.g.,
physiological saline or phosphate buffer) selected in accordance
with the route of administration and standard pharmaceutical
practice. Generally, normal buffered saline (e.g., 135-150 mM NaCl)
will be employed as the pharmaceutically acceptable carrier. Other
suitable carriers include, e.g., water, buffered water, 0.4%
saline, 0.3% glycine, and the like, including glycoproteins for
enhanced stability, such as albumin, lipoprotein, globulin, etc.
Additional suitable carriers are described in, e.g., REMINGTON'S
PHARMACEUTICAL SCIENCES, Mack Publishing Company, Philadelphia,
Pa., 17th ed. (1985). As used herein, "carrier" includes any and
all solvents, dispersion media, vehicles, coatings, diluents,
antibacterial and antifungal agents, isotonic and absorption
delaying agents, buffers, carrier solutions, suspensions, colloids,
and the like. The phrase "pharmaceutically acceptable" refers to
molecular entities and compositions that do not produce an allergic
or similar untoward reaction when administered to a human.
[0299] The pharmaceutically acceptable carrier is generally added
following lipid particle formation. Thus, after the lipid particle
is formed, the particle can be diluted into pharmaceutically
acceptable carriers such as normal buffered saline.
[0300] The concentration of particles in the pharmaceutical
formulations can vary widely, i.e., from less than about 0.05%,
usually at or at least about 2 to 5%, to as much as about 10 to 90%
by weight, and will be selected primarily by fluid volumes,
viscosities, etc., in accordance with the particular mode of
administration selected. For example, the concentration may be
increased to lower the fluid load associated with treatment. This
may be particularly desirable in patients having
atherosclerosis-associated congestive heart failure or severe
hypertension. Alternatively, particles composed of irritating
lipids may be diluted to low concentrations to lessen inflammation
at the site of administration.
[0301] The pharmaceutical compositions of the present invention may
be sterilized by conventional, well-known sterilization techniques.
Aqueous solutions can be packaged for use or filtered under aseptic
conditions and lyophilized, the lyophilized preparation being
combined with a sterile aqueous solution prior to administration.
The compositions can contain pharmaceutically acceptable auxiliary
substances as required to approximate physiological conditions,
such as pH adjusting and buffering agents, tonicity adjusting
agents and the like, for example, sodium acetate, sodium lactate,
sodium chloride, potassium chloride, and calcium chloride.
Additionally, the particle suspension may include lipid-protective
agents which protect lipids against free-radical and
lipid-peroxidative damages on storage. Lipophilic free-radical
quenchers, such as alphatocopherol, and water-soluble iron-specific
chelators, such as ferrioxamine, are suitable.
[0302] In some embodiments, the lipid particles of the invention
are particularly useful in methods for the therapeutic delivery of
one or more gRNA molecules. In particular, it is an object of this
invention to provide in vivo methods for treatment of disease in
humans by downregulating or silencing the transcription and/or
translation of one or more target genes.
A. In Vivo Administration
[0303] Systemic delivery for in vivo therapy, e.g., delivery of a
gRNA molecule described herein, to a distal target cell via body
systems such as the circulation, has been achieved using nucleic
acid-lipid particles such as those described in PCT Publication
Nos. WO 05/007196, WO 05/121348, WO 05/120152, and WO 04/002453,
the disclosures of which are herein incorporated by reference in
their entirety for all purposes. The present invention also
provides fully encapsulated lipid particles that protect the gRNA
from nuclease degradation in serum, are non-immunogenic, are small
in size, and are suitable for repeat dosing. Additionally, the one
or more gRNA molecules may be administered alone in the lipid
particles of the invention, or in combination (e.g.,
co-administered) with lipid particles comprising peptides,
polypeptides, or small molecules such as conventional drugs.
[0304] For in vivo administration, administration can be in any
manner known in the art, e.g., by injection, oral administration,
inhalation (e.g., intransal or intratracheal), transdermal
application, or rectal administration. Administration can be
accomplished via single or divided doses. The pharmaceutical
compositions can be administered parenterally, i.e.,
intraarticularly, intravenously, intraperitoneally, subcutaneously,
or intramuscularly. In some embodiments, the pharmaceutical
compositions are administered intravenously or intraperitoneally by
a bolus injection (see, e.g., U.S. Pat. No. 5,286,634).
Intracellular nucleic acid delivery has also been discussed in
Straubringer et al., Methods Enzymol., 101:512 (1983); Mannino et
al., Biotechniques, 6:682 (1988); Nicolau et al., Crit. Rev. Ther.
Drug Carrier Syst., 6:239 (1989); and Behr, Acc. Chem. Res., 26:274
(1993). Still other methods of administering lipid-based
therapeutics are described in, for example, U.S. Pat. Nos.
3,993,754; 4,145,410; 4,235,871; 4,224,179; 4,522,803; and
4,588,578. The lipid particles can be administered by direct
injection at the site of disease or by injection at a site distal
from the site of disease (see, e.g., Culver, HUMAN GENE THERAPY,
MaryAnn Liebert, Inc., Publishers, New York. pp. 70-'71(1994)). The
disclosures of the above-described references are herein
incorporated by reference in their entirety for all purposes.
[0305] In embodiments where the lipid particles of the present
invention are administered intravenously, at least about 5%, 10%,
15%, 20%, or 25% of the total injected dose of the particles is
present in plasma about 8, 12, 24, 36, or 48 hours after injection.
In other embodiments, more than about 20%, 30%, 40% and as much as
about 60%, 70% or 80% of the total injected dose of the lipid
particles is present in plasma about 8, 12, 24, 36, or 48 hours
after injection. In certain instances, more than about 10% of a
plurality of the particles is present in the plasma of a mammal
about 1 hour after administration. In certain other instances, the
presence of the lipid particles is detectable at least about 1 hour
after administration of the particle. In some embodiments, the
presence of a gRNA molecule is detectable in cells at about 8, 12,
24, 36, 48, 60, 72 or 96 hours after administration. In other
embodiments, downregulation of expression of a target sequence,
such as a viral or host sequence, by a gRNA molecule is detectable
at about 8, 12, 24, 36, 48, 60, 72 or 96 hours after
administration. In yet other embodiments, downregulation of
expression of a target sequence, such as a viral or host sequence,
by a gRNA molecule occurs preferentially in infected cells and/or
cells capable of being infected. In further embodiments, the
presence or effect of a gRNA molecule in cells at a site proximal
or distal to the site of administration is detectable at about 12,
24, 48, 72, or 96 hours, or at about 6, 8, 10, 12, 14, 16, 18, 19,
20, 22, 24, 26, or 28 days after administration. In additional
embodiments, the lipid particles of the invention are administered
parenterally or intraperitoneally.
[0306] The compositions of the present invention, either alone or
in combination with other suitable components, can be made into
aerosol formulations (i.e., they can be "nebulized") to be
administered via inhalation (e.g., intranasally or intratracheally)
(see, Brigham et al., Am. J. Sci., 298:278 (1989)). Aerosol
formulations can be placed into pressurized acceptable propellants,
such as dichlorodifluoromethane, propane, nitrogen, and the
like.
[0307] In certain embodiments, the pharmaceutical compositions may
be delivered by intranasal sprays, inhalation, and/or other aerosol
delivery vehicles. Methods for delivering nucleic acid compositions
directly to the lungs via nasal aerosol sprays have been described,
e.g., in U.S. Pat. Nos. 5,756,353 and 5,804,212. Likewise, the
delivery of drugs using intranasal microparticle resins and
lysophosphatidyl-glycerol compounds (U.S. Pat. No. 5,725,871) are
also well-known in the pharmaceutical arts. Similarly, transmucosal
drug delivery in the form of a polytetrafluoroetheylene support
matrix is described in U.S. Pat. No. 5,780,045. The disclosures of
the above-described patents are herein incorporated by reference in
their entirety for all purposes.
[0308] Formulations suitable for parenteral administration, such
as, for example, by intraarticular (in the joints), intravenous,
intramuscular, intradermal, intraperitoneal, and subcutaneous
routes, include aqueous and non-aqueous, isotonic sterile injection
solutions, which can contain antioxidants, buffers, bacteriostats,
and solutes that render the formulation isotonic with the blood of
the intended recipient, and aqueous and non-aqueous sterile
suspensions that can include suspending agents, solubilizers,
thickening agents, stabilizers, and preservatives. In the practice
of this invention, compositions are preferably administered, for
example, by intravenous infusion, orally, topically,
intraperitoneally, intravesically, or intrathecally.
[0309] Generally, when administered intravenously, the lipid
particle formulations are formulated with a suitable pharmaceutical
carrier. Many pharmaceutically acceptable carriers may be employed
in the compositions and methods of the present invention. Suitable
formulations for use in the present invention are found, for
example, in REMINGTON'S PHARMACEUTICAL SCIENCES, Mack Publishing
Company, Philadelphia, Pa., 17th ed. (1985). A variety of aqueous
carriers may be used, for example, water, buffered water, 0.4%
saline, 0.3% glycine, and the like, and may include glycoproteins
for enhanced stability, such as albumin, lipoprotein, globulin,
etc. Generally, normal buffered saline (135-150 mM NaCl) will be
employed as the pharmaceutically acceptable carrier, but other
suitable carriers will suffice. These compositions can be
sterilized by conventional liposomal sterilization techniques, such
as filtration. The compositions may contain pharmaceutically
acceptable auxiliary substances as required to approximate
physiological conditions, such as pH adjusting and buffering
agents, tonicity adjusting agents, wetting agents and the like, for
example, sodium acetate, sodium lactate, sodium chloride, potassium
chloride, calcium chloride, sorbitan monolaurate, triethanolamine
oleate, etc. These compositions can be sterilized using the
techniques referred to above or, alternatively, they can be
produced under sterile conditions. The resulting aqueous solutions
may be packaged for use or filtered under aseptic conditions and
lyophilized, the lyophilized preparation being combined with a
sterile aqueous solution prior to administration.
[0310] Generally, lipid particles will not be delivered orally.
However, in certain applications, the lipid particles disclosed
herein may be delivered via oral administration to the individual.
The particles may be incorporated with excipients and used in the
form of ingestible tablets, buccal tablets, troches, capsules,
pills, lozenges, elixirs, mouthwash, suspensions, oral sprays,
syrups, wafers, and the like (see, e.g., U.S. Pat. Nos. 5,641,515,
5,580,579, and 5,792,451, the disclosures of which are herein
incorporated by reference in their entirety for all purposes).
These oral dosage forms may also contain the following: binders,
gelatin; excipients, lubricants, and/or flavoring agents. When the
unit dosage form is a capsule, it may contain, in addition to the
materials described above, a liquid carrier. Various other
materials may be present as coatings or to otherwise modify the
physical form of the dosage unit. Of course, any material used in
preparing any unit dosage form should be pharmaceutically pure and
substantially non-toxic in the amounts employed.
[0311] Typically, these oral formulations may contain at least
about 0.1% of the lipid particles or more, although the percentage
of the particles may, of course, be varied and may conveniently be
between about 1% or 2% and about 60% or 70% or more of the weight
or volume of the total formulation. Naturally, the amount of
particles in each therapeutically useful composition may be
prepared is such a way that a suitable dosage will be obtained in
any given unit dose of the compound. Factors such as solubility,
bioavailability, biological half-life, route of administration,
product shelf life, as well as other pharmacological considerations
will be contemplated by one skilled in the art of preparing such
pharmaceutical formulations, and as such, a variety of dosages and
treatment regimens may be desirable.
[0312] Formulations suitable for oral administration can consist
of: (a) liquid solutions, such as an effective amount of a packaged
gRNA molecule suspended in diluents such as water, saline, or PEG
400; (b) capsules, sachets, or tablets, each containing a
predetermined amount of a gRNA molecule, as liquids, solids,
granules, or gelatin; (c) suspensions in an appropriate liquid; and
(d) suitable emulsions. Tablet forms can include one or more of
lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn
starch, potato starch, microcrystalline cellulose, gelatin,
colloidal silicon dioxide, talc, magnesium stearate, stearic acid,
and other excipients, colorants, fillers, binders, diluents,
buffering agents, moistening agents, preservatives, flavoring
agents, dyes, disintegrating agents, and pharmaceutically
compatible carriers. Lozenge forms can comprise a gRNA molecule in
a flavor, e.g., sucrose, as well as pastilles comprising the
therapeutic nucleic acid in an inert base, such as gelatin and
glycerin or sucrose and acacia emulsions, gels, and the like
containing, in addition to the gRNA molecule, carriers known in the
art.
[0313] In another example of their use, lipid particles can be
incorporated into a broad range of topical dosage forms. For
instance, a suspension containing nucleic acid-lipid particles can
be formulated and administered as gels, oils, emulsions, topical
creams, pastes, ointments, lotions, foams, mousses, and the
like.
[0314] When preparing pharmaceutical preparations of the lipid
particles of the invention, it is preferable to use quantities of
the particles which have been purified to reduce or eliminate empty
particles or particles with therapeutic agents such as gRNA
associated with the external surface.
[0315] The methods of the present invention may be practiced in a
variety of hosts. Preferred hosts include mammalian species, such
as primates (e.g., humans and chimpanzees as well as other nonhuman
primates), canines, felines, equines, bovines, ovines, caprines,
rodents (e.g., rats and mice), lagomorphs, and swine.
[0316] The amount of particles administered will depend upon the
ratio of gRNA molecules to lipid, the particular gRNA used, the
disease being treated, the age, weight, and condition of the
patient, and the judgment of the clinician, but will generally be
between about 0.01 and about 50 mg per kilogram of body weight,
preferably between about 0.1 and about 5 mg/kg of body weight, or
about 10.sup.8-10.sup.10 particles per administration (e.g.,
injection).
B. In Vitro Administration
[0317] For in vitro applications, the delivery of gRNA molecules
can be to any cell grown in culture. In preferred embodiments, the
cells are animal cells, more preferably mammalian cells, and most
preferably human cells.
[0318] Contact between the cells and the lipid particles, when
carried out in vitro, takes place in a biologically compatible
medium. The concentration of particles varies widely depending on
the particular application, but is generally between about 1
.mu.mol and about 10 mmol. Treatment of the cells with the lipid
particles is generally carried out at physiological temperatures
(about 37.degree. C.) for periods of time of from about 1 to 48
hours, preferably of from about 2 to 4 hours.
[0319] In one group of preferred embodiments, a lipid particle
suspension is added to 60-80% confluent plated cells having a cell
density of from about 10.sup.3 to about 10.sup.5 cells/ml, more
preferably about 2.times.10.sup.4 cells/ml. The concentration of
the suspension added to the cells is preferably of from about 0.01
to 0.2 .mu.g/ml, more preferably about 0.1 .mu.g/ml.
[0320] To the extent that tissue culture of cells may be required,
it is well-known in the art. For example, Freshney, Culture of
Animal Cells, a Manual of Basic Technique, 3rd Ed., Wiley-Liss, New
York (1994), Kuchler et al., Biochemical Methods in Cell Culture
and Virology, Dowden, Hutchinson and Ross, Inc. (1977), and the
references cited therein provide a general guide to the culture of
cells. Cultured cell systems often will be in the form of
monolayers of cells, although cell suspensions are also used.
[0321] Using an Endosomal Release Parameter (ERP) assay, the
delivery efficiency of a nucleic acid-lipid particle of the
invention can be optimized. An ERP assay is described in detail in
U.S. Patent Publication No. 20030077829, the disclosure of which is
herein incorporated by reference in its entirety for all purposes.
More particularly, the purpose of an ERP assay is to distinguish
the effect of various cationic lipids and helper lipid components
of the lipid particle based on their relative effect on
binding/uptake or fusion with/destabilization of the endosomal
membrane. This assay allows one to determine quantitatively how
each component of the lipid particle affects delivery efficiency,
thereby optimizing the lipid particle. Usually, an ERP assay
measures expression of a reporter protein (e.g., luciferase,
.beta.-galactosidase, green fluorescent protein (GFP), etc.), and
in some instances, a lipid particle formulation optimized for an
expression plasmid will also be appropriate for encapsulating a
gRNA. In other instances, an ERP assay can be adapted to measure
downregulation of transcription or translation of a target sequence
in the presence or absence of a gRNA. By comparing the ERPs for
each of the various lipid particles, one can readily determine the
optimized system, e.g., the lipid particle that has the greatest
uptake in the cell.
C. Detection of Lipid Particles
[0322] In some embodiments, the lipid particles of the present
invention are detectable in the subject at about 1, 2, 3, 4, 5, 6,
7, 8 or more hours. In other embodiments, the lipid particles of
the present invention are detectable in the subject at about 8, 12,
24, 48, 60, 72, or 96 hours, or about 6, 8, 10, 12, 14, 16, 18, 19,
22, 24, 25, or 28 days after administration of the particles. The
presence of the particles can be detected in the cells, tissues, or
other biological samples from the subject. The particles may be
detected, e.g., by direct detection of the particles, detection of
a gRNA sequence, detection of the target sequence of interest
(i.e., by detecting expression or reduced expression of the
sequence of interest), detection of a compound modulated by an EBOV
protein (e.g., interferon), detection of viral load in the subject,
or a combination thereof.
1. Detection of Particles
[0323] Lipid particles of the invention can be detected using any
method known in the art. For example, a label can be coupled
directly or indirectly to a component of the lipid particle using
methods well-known in the art. A wide variety of labels can be
used, with the choice of label depending on sensitivity required,
ease of conjugation with the lipid particle component, stability
requirements, and available instrumentation and disposal
provisions. Suitable labels include, but are not limited to,
spectral labels such as fluorescent dyes (e.g., fluorescein and
derivatives, such as fluorescein isothiocyanate (FITC) and Oregon
Green.TM.; rhodamine and derivatives such Texas red, tetrarhodimine
isothiocynate (TRITC), etc., digoxigenin, biotin, phycoerythrin,
AMCA, CyDyes.TM., and the like; radiolabels such as .sup.3H,
.sup.125I, .sup.35S, .sup.14C, .sup.32P, .sup.33P, etc.; enzymes
such as horse radish peroxidase, alkaline phosphatase, etc.;
spectral colorimetric labels such as colloidal gold or colored
glass or plastic beads such as polystyrene, polypropylene, latex,
etc. The label can be detected using any means known in the
art.
2. Detection of Nucleic Acids
[0324] Nucleic acids (e.g., gRNA molecules) are detected and
quantified herein by any of a number of means well-known to those
of skill in the art. The detection of nucleic acids may proceed by
well-known methods such as Southern analysis, Northern analysis,
gel electrophoresis, PCR, radiolabeling, scintillation counting,
and affinity chromatography. Additional analytic biochemical
methods such as spectrophotometry, radiography, electrophoresis,
capillary electrophoresis, high performance liquid chromatography
(HPLC), thin layer chromatography (TLC), and hyperdiffusion
chromatography may also be employed.
[0325] The selection of a nucleic acid hybridization format is not
critical. A variety of nucleic acid hybridization formats are known
to those skilled in the art. For example, common formats include
sandwich assays and competition or displacement assays.
Hybridization techniques are generally described in, e.g., "Nucleic
Acid Hybridization, A Practical Approach," Eds. Hames and Higgins,
IRL Press (1985).
[0326] The sensitivity of the hybridization assays may be enhanced
through the use of a nucleic acid amplification system which
multiplies the target nucleic acid being detected. In vitro
amplification techniques suitable for amplifying sequences for use
as molecular probes or for generating nucleic acid fragments for
subsequent subcloning are known. Examples of techniques sufficient
to direct persons of skill through such in vitro amplification
methods, including the polymerase chain reaction (PCR), the ligase
chain reaction (LCR), Q.beta.-replicase amplification, and other
RNA polymerase mediated techniques (e.g., NASBA.TM.) are found in
Sambrook et al., In Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press (2000); and Ausubel et al., SHORT
PROTOCOLS IN MOLECULAR BIOLOGY, eds., Current Protocols, Greene
Publishing Associates, Inc. and John Wiley & Sons, Inc. (2002);
as well as U.S. Pat. No. 4,683,202; PCR Protocols, A Guide to
Methods and Applications (Innis et al. eds.) Academic Press Inc.
San Diego, Calif. (1990); Arnheim & Levinson (Oct. 1, 1990),
C&EN 36; The Journal Of NIH Research, 3:81 (1991); Kwoh et al.,
Proc. Natl. Acad. Sci. USA, 86:1173 (1989); Guatelli et al., Proc.
Natl. Acad. Sci. USA, 87:1874 (1990); Lomell et al., J. Clin.
Chem., 35:1826 (1989); Landegren et al., Science, 241:1077 (1988);
Van Brunt, Biotechnology, 8:291 (1990); Wu and Wallace, Gene, 4:560
(1989); Barringer et al., Gene, 89:117 (1990); and Sooknanan and
Malek, Biotechnology, 13:563 (1995). Improved methods of cloning in
vitro amplified nucleic acids are described in U.S. Pat. No.
5,426,039. Other methods described in the art are the nucleic acid
sequence based amplification (NASBA.TM., Cangene, Mississauga,
Ontario) and Q.beta.-replicase systems. These systems can be used
to directly identify mutants where the PCR or LCR primers are
designed to be extended or ligated only when a select sequence is
present. Alternatively, the select sequences can be generally
amplified using, for example, nonspecific PCR primers and the
amplified target region later probed for a specific sequence
indicative of a mutation. The disclosures of the above-described
references are herein incorporated by reference in their entirety
for all purposes.
[0327] Nucleic acids for use as probes, e.g., in in vitro
amplification methods, for use as gene probes, or as inhibitor
components are typically synthesized chemically according to the
solid phase phosphoramidite triester method described by Beaucage
et al., Tetrahedron Letts., 22:1859 1862 (1981), e.g., using an
automated synthesizer, as described in Needham VanDevanter et al.,
Nucleic Acids Res., 12:6159 (1984). Purification of
polynucleotides, where necessary, is typically performed by either
native acrylamide gel electrophoresis or by anion exchange HPLC as
described in Pearson et al., J. Chrom., 255:137 149 (1983). The
sequence of the synthetic polynucleotides can be verified using the
chemical degradation method of Maxam and Gilbert (1980) in Grossman
and Moldave (eds.) Academic Press, New York, Methods in Enzymology,
65:499.
[0328] An alternative means for determining the level of
transcription is in situ hybridization. In situ hybridization
assays are well-known and are generally described in Angerer et
al., Methods Enzymol., 152:649 (1987). In an in situ hybridization
assay, cells are fixed to a solid support, typically a glass slide.
If DNA is to be probed, the cells are denatured with heat or
alkali. The cells are then contacted with a hybridization solution
at a moderate temperature to permit annealing of specific probes
that are labeled. The probes are preferably labeled with
radioisotopes or fluorescent reporters.
EXAMPLES
[0329] The present invention will be described in greater detail by
way of specific examples. The following examples are offered for
illustrative purposes, and are not intended to limit the invention
in any manner. Those of skill in the art will readily recognize a
variety of noncritical parameters which can be changed or modified
to yield essentially the same results.
Example 1
[0330] This example describes CRISPR/Cas9-induced gene editing of
an endogenous gene following delivery of messenger RNA (mRNA) and
single guide RNA (gRNA) to a mouse liver in vivo via lipid
nanoparticles (LNP).
[0331] Mice were injected intravenously with a LNP formulation of
mRNA for the Cas9 protein (2 mg/kg body weight) and a LNP
formulation of a gRNA (0.42 mg/kg) containing a target sequence
within the mouse Pcsk9 gene. The gRNA contained the 20 base-pair
target site GGCTGATGAGGCCGCACATG (SEQ ID NO:6), which lies within
exon 1 of mouse Pcsk9.
[0332] Two days post-treatment, the animal livers were harvested
and hepatic genomic DNA was isolated. This DNA isolate was used as
a template for polymerase chain reaction to generate an amplicon of
415 base pairs in length containing the CRISPR target cut site 291
base pairs from the amplicon end. Surveyor assay (Guschin et al.,
Methods Mol. Biol., 649, 247 (2010)) was run to detect small
insertion/deletion (indel) mutations at the target cut site, and
100% (6/6) of treated animals showed a positive result for gene
editing, while 0% (0/9) of the negative control animals
(Saline-treated or LNP-mRNA only-treated) showed a positive
result.
[0333] This positive Surveyor result from the harvested mouse
livers provided evidence that LNP can be utilized to deliver Cas9
mRNA and gRNA to the liver in vivo and that the intended activity
of the CRISPR reagents, i.e., target site-specific DNA cleavage
followed by imprecise repair and mutagenesis, can be achieved.
Example 2
[0334] This example describes CRISPR/Cas9-induced gene editing of
an exogenously introduced hepatitis B virus (HBV) genome following
delivery of messenger RNA (mRNA) and single guide RNA (gRNA) to a
mouse liver in vivo via lipid nanoparticles (LNP).
[0335] HBV DNA was delivered into the livers of NOD-SCID mice via
hydrodynamic injection (HDI) in the tail vein with a 1.3-overlength
HBV plasmid (10 .mu.g/mouse in 1.6 mL saline in <5 sec). HBV
plasmid HDI results in a stable pool of HBV DNA in the mouse liver
and stable expression of HBV antigens.
[0336] Seven days post-HDI, the mice were injected intravenously
with a LNP formulation of mRNA for the Cas9 protein (2 mg/kg body
weight) and a LNP formulation of a gRNA (0.44 mg/kg) containing a
target sequence within the HBV RT gene. The gRNA contained the 20
base-pair target site TTTCAGTTATATGGATGATG (SEQ ID NO:7), which
lies in the HBV RT gene (Genbank ID: V01460; 2437-2456).
[0337] Two days post-treatment, the animal livers were harvested
and hepatic DNA was isolated. This DNA isolate was used as a
template for polymerase chain reaction to generate an amplicon of
562 base pairs in length containing the CRISPR target cut site 447
base pairs from the amplicon end. Surveyor assay (Guschin et al.,
Methods Mol. Biol., 649, 247 (2010)) was run to detect small
insertion/deletion (indel) mutations at the target cut site, and
100% (8/8) of treated animals showed a positive result for gene
editing, while 0% (0/14) of the negative control animals
(Saline-treated, LNP-mRNA only-treated, or entecavir-treated)
showed a positive result.
[0338] This positive Surveyor result from the harvested mouse
livers provided evidence that LNP can be utilized to deliver Cas9
mRNA and gRNA to the liver in vivo and that the intended activity
of the CRISPR reagents, i.e., target site-specific DNA cleavage
followed by imprecise repair and mutagenesis, can be achieved,
specifically the targeting of exogenous HBV DNA.
Sequence CWU 1
1
717PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 1Pro Lys Lys Lys Arg Lys Val1
524140DNAStreptococcus pyogenes 2atggacaaga agtactccat tgggctcgat
atcggcacaa acagcgtcgg ctgggccgtc 60attacggacg agtacaaggt gccgagcaaa
aaattcaaag ttctgggcaa taccgatcgc 120cacagcataa agaagaacct
cattggcgcc ctcctgttcg actccgggga gacggccgaa 180gccacgcggc
tcaaaagaac agcacggcgc agatataccc gcagaaagaa tcggatctgc
240tacctgcagg agatctttag taatgagatg gctaaggtgg atgactcttt
cttccatagg 300ctggaggagt cctttttggt ggaggaggat aaaaagcacg
agcgccaccc aatctttggc 360aatatcgtgg acgaggtggc gtaccatgaa
aagtacccaa ccatatatca tctgaggaag 420aagcttgtag acagtactga
taaggctgac ttgcggttga tctatctcgc gctggcgcat 480atgatcaaat
ttcggggaca cttcctcatc gagggggacc tgaacccaga caacagcgat
540gtcgacaaac tctttatcca actggttcag acttacaatc agcttttcga
agagaacccg 600atcaacgcat ccggagttga cgccaaagca atcctgagcg
ctaggctgtc caaatcccgg 660cggctcgaaa acctcatcgc acagctccct
ggggagaaga agaacggcct gtttggtaat 720cttatcgccc tgtcactcgg
gctgaccccc aactttaaat ctaacttcga cctggccgaa 780gatgccaagc
ttcaactgag caaagacacc tacgatgatg atctcgacaa tctgctggcc
840cagatcggcg accagtacgc agaccttttt ttggcggcaa agaacctgtc
agacgccatt 900ctgctgagtg atattctgcg agtgaacacg gagatcacca
aagctccgct gagcgctagt 960atgatcaagc gctatgatga gcaccaccaa
gacttgactt tgctgaaggc ccttgtcaga 1020cagcaactgc ctgagaagta
caaggaaatt ttcttcgatc agtctaaaaa tggctacgcc 1080ggatacattg
acggcggagc aagccaggag gaattttaca aatttattaa gcccatcttg
1140gaaaaaatgg acggcaccga ggagctgctg gtaaagctta acagagaaga
tctgttgcgc 1200aaacagcgca ctttcgacaa tggaagcatc ccccaccaga
ttcacctggg cgaactgcac 1260gctatcctca ggcggcaaga ggatttctac
ccctttttga aagataacag ggaaaagatt 1320gagaaaatcc tcacatttcg
gataccctac tatgtaggcc ccctcgcccg gggaaattcc 1380agattcgcgt
ggatgactcg caaatcagaa gagaccatca ctccctggaa cttcgaggaa
1440gtcgtggata agggggcctc tgcccagtcc ttcatcgaaa ggatgactaa
ctttgataaa 1500aatctgccta acgaaaaggt gcttcctaaa cactctctgc
tgtacgagta cttcacagtt 1560tataacgagc tcaccaaggt caaatacgtc
acagaaggga tgagaaagcc agcattcctg 1620tctggagagc agaagaaagc
tatcgtggac ctcctcttca agacgaaccg gaaagttacc 1680gtgaaacagc
tcaaagaaga ctatttcaaa aagattgaat gtttcgactc tgttgaaatc
1740agcggagtgg aggatcgctt caacgcatcc ctgggaacgt atcacgatct
cctgaaaatc 1800attaaagaca aggacttcct ggacaatgag gagaacgagg
acattcttga ggacattgtc 1860ctcaccctta cgttgtttga agatagggag
atgattgaag aacgcttgaa aacttacgct 1920catctcttcg acgacaaagt
catgaaacag ctcaagaggc gccgatatac aggatggggg 1980cggctgtcaa
gaaaactgat caatgggatc cgagacaagc agagtggaaa gacaatcctg
2040gattttctta agtccgatgg atttgccaac cggaacttca tgcagttgat
ccatgatgac 2100tctctcacct ttaaggagga catccagaaa gcacaagttt
ctggccaggg ggacagtctt 2160cacgagcaca tcgctaatct tgcaggtagc
ccagctatca aaaagggaat actgcagacc 2220gttaaggtcg tggatgaact
cgtcaaagta atgggaaggc ataagcccga gaatatcgtt 2280atcgagatgg
cccgagagaa ccaaactacc cagaagggac agaagaacag tagggaaagg
2340atgaagagga ttgaagaggg tataaaagaa ctggggtccc aaatccttaa
ggaacaccca 2400gttgaaaaca cccagcttca gaatgagaag ctctacctgt
actacctgca gaacggcagg 2460gacatgtacg tggatcagga actggacatc
aatcggctct ccgactacga cgtggatcat 2520atcgtgcccc agtcttttct
caaagatgat tctattgata ataaagtgtt gacaagatcc 2580gataaaaata
gagggaagag tgataacgtc ccctcagaag aagttgtcaa gaaaatgaaa
2640aattattggc ggcagctgct gaacgccaaa ctgatcacac aacggaagtt
cgataatctg 2700actaaggctg aacgaggtgg cctgtctgag ttggataaag
ccggcttcat caaaaggcag 2760cttgttgaga cacgccagat caccaagcac
gtggcccaaa ttctcgattc acgcatgaac 2820accaagtacg atgaaaatga
caaactgatt cgagaggtga aagttattac tctgaagtct 2880aagctggtct
cagatttcag aaaggacttt cagttttata aggtgagaga gatcaacaat
2940taccaccatg cgcatgatgc ctacctgaat gcagtggtag gcactgcact
tatcaaaaaa 3000tatcccaagc ttgaatctga atttgtttac ggagactata
aagtgtacga tgttaggaaa 3060atgatcgcaa agtctgagca ggaaataggc
aaggccaccg ctaagtactt cttttacagc 3120aatattatga attttttcaa
gaccgagatt acactggcca atggagagat tcggaagcga 3180ccacttatcg
aaacaaacgg agaaacagga gaaatcgtgt gggacaaggg tagggatttc
3240gcgacagtcc ggaaggtcct gtccatgccg caggtgaaca tcgttaaaaa
gaccgaagta 3300cagaccggag gcttctccaa ggaaagtatc ctcccgaaaa
ggaacagcga caagctgatc 3360gcacgcaaaa aagattggga ccccaagaaa
tacggcggat tcgattctcc tacagtcgct 3420tacagtgtac tggttgtggc
caaagtggag aaagggaagt ctaaaaaact caaaagcgtc 3480aaggaactgc
tgggcatcac aatcatggag cgatcaagct tcgaaaaaaa ccccatcgac
3540tttctcgagg cgaaaggata taaagaggtc aaaaaagacc tcatcattaa
gcttcccaag 3600tactctctct ttgagcttga aaacggccgg aaacgaatgc
tcgctagtgc gggcgagctg 3660cagaaaggta acgagctggc actgccctct
aaatacgtta atttcttgta tctggccagc 3720cactatgaaa agctcaaagg
gtctcccgaa gataatgagc agaagcagct gttcgtggaa 3780caacacaaac
actaccttga tgagatcatc gagcaaataa gcgaattctc caaaagagtg
3840atcctcgccg acgctaacct cgataaggtg ctttctgctt acaataagca
cagggataag 3900cccatcaggg agcaggcaga aaacattatc cacttgttta
ctctgaccaa cttgggcgcg 3960cctgcagcct tcaagtactt cgacaccacc
atagacagaa agcggtacac ctctacaaag 4020gaggtcctgg acgccacact
gattcatcag tcaattacgg ggctctatga aacaagaatc 4080gacctctctc
agctcggtgg agacagcagg gctgacccca agaagaagag gaaggtgtga
41403100RNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotidemodified_base(1)..(20)a, c, u, g, unknown
or other 3nnnnnnnnnn nnnnnnnnnn guuuuagagc uagaaauagc aaguuaaaau
aaggcuaguc 60cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu
100480RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 4guuuuaguac ucuggaaaca gaaucuacua
aaacaaggca aaaugccgug uuuaucucgu 60caacuuguug gcgagauuuu
80580RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 5guuuuuguac ucgaaagaag cuacaaagau
aaggcuucau gccgaaauca acacccuguc 60auuuuauggc aggguguuuu
80620DNAMus sp. 6ggctgatgag gccgcacatg 20720DNAHepatitis B virus
7tttcagttat atggatgatg 20
* * * * *