U.S. patent application number 17/001572 was filed with the patent office on 2020-12-10 for 7-substituted sulfonimidoylpurinone compounds for the treatment of virus infection.
This patent application is currently assigned to Hoffmann-La Roche Inc.. The applicant listed for this patent is Hoffmann-La Roche Inc.. Invention is credited to Lu Gao, Chungen Liang, Kun Miao, Jianping Wang, Hongying Yun, Bo Zhang, Xiufang Zheng.
Application Number | 20200385387 17/001572 |
Document ID | / |
Family ID | 1000005046887 |
Filed Date | 2020-12-10 |
View All Diagrams
United States Patent
Application |
20200385387 |
Kind Code |
A1 |
Gao; Lu ; et al. |
December 10, 2020 |
7-SUBSTITUTED SULFONIMIDOYLPURINONE COMPOUNDS FOR THE TREATMENT OF
VIRUS INFECTION
Abstract
The present invention relates to compounds of formula (I),
##STR00001## wherein R.sup.1, R.sup.2 and R.sup.3 are as described
herein, and their prodrugs or pharmaceutically acceptable salt,
enantiomer or diastereomer thereof, and compositions including the
compounds and methods of using the compounds.
Inventors: |
Gao; Lu; (Shanghai, CN)
; Liang; Chungen; (Shanghai, CN) ; Yun;
Hongying; (Shanghai, CN) ; Zheng; Xiufang;
(Shanghai, CN) ; Wang; Jianping; (Shanghai,
CN) ; Miao; Kun; (Shanghai, CN) ; Zhang;
Bo; (Shanghai, CN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Hoffmann-La Roche Inc. |
Little Falls |
NJ |
US |
|
|
Assignee: |
Hoffmann-La Roche Inc.
Little Falls
NJ
|
Family ID: |
1000005046887 |
Appl. No.: |
17/001572 |
Filed: |
August 24, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16260744 |
Jan 29, 2019 |
10752630 |
|
|
17001572 |
|
|
|
|
15689136 |
Aug 29, 2017 |
10233184 |
|
|
16260744 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07D 473/24
20130101 |
International
Class: |
C07D 473/24 20060101
C07D473/24 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 29, 2016 |
CN |
PCT/CN2016/097140 |
Jul 12, 2017 |
CN |
PCT/CN2017/092653 |
Claims
1. A compound of formula (I), ##STR00185## wherein: R.sup.1 is
C.sub.1-6alkyl; R.sup.2 is benzyl, said benzyl being unsubstituted
or substituted by one, two or three substituents independently
selected from halogen and C.sub.1-6alkyl; R.sup.3 is
--NR.sup.4R.sup.5, wherein: R.sup.4 is C.sub.1-6alkyl or
C.sub.1-6alkoxyC.sub.1-6alkyl; R.sup.5 is
(C.sub.1-6alkyl).sub.2NCOOC.sub.1-6alkyl,
C.sub.1-6alkoxyC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyl(C.sub.1-6alkyl)aminoC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyl(phenyl)C.sub.1-6alkyl,
C.sub.1-6alkoxycarbonylC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyloxyC.sub.1-6alkyl, C.sub.1-6alkyl,
C.sub.1-6alkylcarbonyl(C.sub.1-6alkyl)aminoC.sub.1-6alkyl or
pyrrolidinylcarbamoyloxyC.sub.1-6alkyl; or R.sup.4 and R.sup.5
together with the nitrogen they are attached to form a
heterocyclyl; or pharmaceutically acceptable salt, enantiomer or
diastereomer thereof; with the proviso that
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7-(pyrrolidine-1-carbonyl)purin--
8-one;
6-amino-9-benzyl-7-(piperidine-1-carbonyl)-2-(propylsulfonimidoyl)p-
urin-8-one;
6-amino-9-benzyl-7-(morpholine-4-carbonyl)-2-(propylsulfonimidoyl)purin-8-
-one;
6-amino-9-benzyl-7-(3,3-dimethylpyrrolidine-1-carbonyl)-2-(propylsul-
fonimidoyl)purin-8-one; ethyl
1-[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]pyrrol-
idine-2-carboxylate;
6-amino-7-(2-azaspiro[3.3]heptane-2-carbonyl)-9-benzyl-2-(propylsulfonimi-
doyl)purin-8-one;
6-amino-9-benzyl-7-(2-oxa-6-azaspiro[3.3]heptane-6-carbonyl)-2-(propylsul-
fonimidoyl)purin-8-one;
6-amino-9-benzyl-7-(3,3-difluoropyrrolidine-1-carbonyl)-2-(propylsulfonim-
idoyl)purin-8-one;
6-amino-9-benzyl-7-(3-fluoro-3-methyl-pyrrolidine-1-carbonyl)-2-(propylsu-
lfonimidoyl)purin-8-one; and their enantiomers or diastereomers are
excluded.
2. A compound according to claim 1, wherein: R.sup.1 is
C.sub.1-6alkyl; R.sup.2 is benzyl, said benzyl being unsubstituted
or substituted by halogen or C.sub.1-6alkyl; R.sup.3 is azetidinyl;
piperazinyl substituted by C.sub.1-6alkyl; piperidinyl substituted
by piperidinyl; pyrrolidinyl; or --NR.sup.4R.sup.5, wherein:
R.sup.4 is C.sub.1-6alkyl or C.sub.1-6alkoxyC.sub.1-6alkyl; R.sup.5
is (C.sub.1-6alkyl).sub.2NCOOC.sub.1-6alkyl,
C.sub.1-6alkoxyC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyl(C.sub.1-6alkyl)-aminoC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyl(phenyl)C.sub.1-6alkyl,
C.sub.1-6alkoxycarbonylC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyloxyC.sub.1-6alkyl, C.sub.1-6alkyl,
C.sub.1-6alkylcarbonyl(C.sub.1-6alkyl)aminoC.sub.1-6alkyl or
pyrrolidinylcarbamoyloxyC.sub.1-6alkyl.
3. A compound according to claim 1 or 2, wherein: R.sup.1 is ethyl
or propyl; R.sup.2 is benzyl, bromobenzyl, chlorobenzyl,
fluorobenzyl or methylbenzyl; R.sup.3 is azetidinyl;
4-methylpiperazinyl; piperidinylpiperidinyl; pyrrolidinyl; or
--NR.sup.4R.sup.5, wherein: R.sup.4 is methyl, ethyl, propyl or
methoxyethyl; R.sup.5 is acetyl(methyl)aminoethyl, butyl,
butyl(methyl)carbamoyloxyethyl, diethylcarbamoyloxyethyl,
ethoxycarbonyl(methyl)aminoethyl, ethoxycarbonylethyl,
ethoxycarbonylisobutyl, ethoxycarbonylisopentyl,
ethoxycarbonylmethyl, ethoxycarbonyloxyethyl,
ethoxycarbonyl(phenyl)ethyl, ethyl, isobutyl,
isopropoxycarbonylisopentyl, isopropoxycarbonyl(phenyl)ethyl,
isopropyl, methoxycarbonyl(methyl)aminoethyl, methoxyethyl,
methoxypropyl, propyl, propyl(methyl)carbamoyloxyethyl,
pyrrolidinylcarbamoyloxyethyl,
tert-butoxycarbonyl(methyl)aminoethyl, tert-butoxycarbonylethyl,
tert-butoxycarbonylisopentyl or
tert-butoxycarbonyl(phenyl)ethyl.
4. A compound according to claim 3, wherein R.sup.3 is azetidinyl,
4-methylpiperazinyl, piperidinylpiperidinyl, pyrrolidinyl,
acetyl(methyl)aminoethyl(methyl)amino, bis(methoxyethyl)amino,
butyl(ethyl)amino, butyl(methyl)amino,
butyl(methyl)carbamoyloxyethyl(methyl)amino,
diethylcarbamoyloxyethyl(methyl)amino,
ethoxycarbonyl(methyl)aminoethyl(methyl)amino,
ethoxycarbonylethyl(methyl)amino,
ethoxycarbonylisobutyl(methyl)amino,
ethoxycarbonylisopentyl(methyl)amino,
ethoxycarbonylmethyl(methyl)amino,
ethoxycarbonyloxyethyl(methyl)amino,
ethoxycarbonyl(phenyl)ethyl(methyl)amino, ethyl(methyl)amino,
isobutyl(methyl)amino, isopropoxycarbonylisopentyl(methyl)amino,
isopropoxycarbonyl(phenyl)ethyl(methyl)amino,
isopropyl(methyl)amino,
methoxycarbonyl(methyl)aminoethyl(methyl)amino,
methoxyethyl(ethyl)amino, methoxyethyl(methyl)amino,
methoxyethyl(propyl)amino, methoxypropyl(methyl)amino,
propyl(ethyl)amino, propyl(methyl)amino,
propyl(methyl)carbamoyloxyethyl(methyl)amino,
pyrrolidinylcarbamoyloxyethyl(methyl)amino,
tert-butoxycarbonyl(methyl)aminoethyl(methyl)amino,
tert-butoxycarbonyl ethyl(methyl)amino,
tert-butoxycarbonylisopentyl(methyl)amino or
tert-butoxycarbonyl(phenyl)ethyl(methyl)amino.
5. A compound according to any one of claims 1 to 4, wherein
R.sup.1 is ethyl.
6. A compound according to claim 1 or 2, wherein R.sup.2 is benzyl
substituted by halogen or C.sub.1-6alkyl.
7. A compound according to any one of claims 2 to 6, wherein
R.sup.2 is bromobenzyl, chlorobenzyl, fluorobenzyl or
methylbenzyl.
8. A compound according to claim 7, wherein R.sup.2 is bromobenzyl,
chlorobenzyl or fluorobenzyl.
9. A compound according to claim 1 or 2, wherein R.sup.3 is
--NR.sup.4R.sup.5, wherein R.sup.4 is C.sub.1-6alkyl, R.sup.5 is
C.sub.1-6alkyl.
10. A compound according to claim 9, wherein R.sup.3 is
propyl(methyl)amino or ethyl(methyl)amino.
11. A compound according to any one of claims 1, 2, 6 and 9,
wherein: R.sup.1 is C.sub.1-6alkyl; R.sup.2 is benzyl, said benzyl
being substituted by halogen or C.sub.1-6alkyl; R.sup.3 is
--NR.sup.4R.sup.5, wherein R.sup.4 is C.sub.1-6alkyl, R.sup.5 is
C.sub.1-6alkyl.
12. A compound according to claim 11, wherein: R.sup.1 is ethyl;
R.sup.2 is methylbenzyl, bromobenzyl, chlorobenzyl or fluorobenzyl;
R.sup.3 is propyl(methyl)amino or ethyl(methyl)amino.
13. A compound selected from:
6-amino-9-benzyl-N-methyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7--
carboxamide;
6-amino-9-benzyl-N-(2-methoxyethyl)-N-methyl-8-oxo-2-(propylsulfonimidoyl-
)purine-7-carboxamide;
6-amino-9-benzyl-N-ethyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-c-
arboxamide;
6-amino-9-benzyl-7-[4-(1-piperidyl)piperidine-1-carbonyl]-2-(propylsulfon-
imidoyl)purin-8-one;
6-amino-9-benzyl-N-ethyl-N-(2-methoxyethyl)-8-oxo-2-(propylsulfonimidoyl)-
purine-7-carboxamide;
6-amino-9-benzyl-N-butyl-N-ethyl-8-oxo-2-(propylsulfonimidoyl)purine-7-ca-
rboxamide;
6-amino-9-benzyl-N-(2-methoxyethyl)-8-oxo-N-propyl-2-(propylsul-
fonimidoyl)purine-7-carboxamide;
6-amino-9-benzyl-N,N-bis(2-methoxyethyl)-8-oxo-2-(propylsulfonimidoyl)pur-
ine-7-carboxamide;
6-amino-7-(azetidine-1-carbonyl)-9-benzyl-2-(propylsulfonimidoyl)purin-8--
one;
6-amino-9-benzyl-N-isopropyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)pu-
rine-7-carboxamide;
6-amino-9-benzyl-7-(4-methylpiperazine-1-carbonyl)-2-(propylsulfonimidoyl-
)purin-8-one;
6-amino-9-benzyl-N-(3-methoxypropyl)-N-methyl-8-oxo-2-(propylsulfonimidoy-
l)purine-7-carboxamide;
6-amino-9-benzyl-N-isobutyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine--
7-carboxamide; ethyl
2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]acetate; ethyl
3-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]propanoate; tert-butyl
3-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]propanoate; ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]propanoate; tert-butyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-4-methyl-pentanoate; isopropyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-4-methyl-pentanoate; ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-3-methyl-butanoate; ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-4-methyl-pentanoate; ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-3-phenyl-propanoate; isopropyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-3-phenyl-propanoate; tert-butyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-3-phenyl-propanoate;
N-[2-[acetyl(methyl)amino]ethyl]-6-amino-9-benzyl-N-methyl-8-oxo-2-(propy-
lsulfonimidoyl)purine-7-carboxamide; Methyl
N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-m-
ethyl-amino]ethyl]-N-methyl-carbamate; tert-Butyl
N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-m-
ethyl-amino]ethyl]-N-methyl-carbamate; ethyl
N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-m-
ethyl-amino]ethyl]-N-methyl-carbamate;
2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl N-butyl-N-methyl-carbamate;
2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl pyrrolidine-1-carboxylate;
2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl N-methyl-N-propyl-carbamate;
2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl N,N-diethylcarbamate;
2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl ethyl carbonate;
6-amino-N-butyl-9-[(4-chlorophenyl)methyl]-N-methyl-8-oxo-2-[S(S)-propyls-
ulfonimidoyl]purine-7-carboxamide;
6-amino-N-butyl-9-[(4-chlorophenyl)methyl]-N-methyl-8-oxo-2-[S(S)-propyls-
ulfonimidoyl]purine-7-carboxamide;
6-amino-9-[(4-chlorophenyl)methyl]-N-ethyl-N-methyl-8-oxo-2-(propylsulfon-
imidoyl)purine-7-carboxamide;
6-amino-N-methyl-8-oxo-N-propyl-2[S(S)-propylsulfonimidoyl]-9-(p-tolylmet-
hyl)purine-7-carboxamide;
6-amino-N-methyl-8-oxo-N-propyl-2[S(R)-propylsulfonimidoyl]-9-(p-tolylmet-
hyl)purine-7-carboxamide;
6-amino-2-[S(S)-propylsulfonimidoyl]-9-(p-tolylmethyl)-7-(pyrrolidine-1-c-
arbonyl)purin-8-one;
6-amino-2-[S(R)-propylsulfonimidoyl]-9-(p-tolylmethyl)-7-(pyrrolidine-1-c-
arbonyl)purin-8-one;
6-amino-N-(2-methoxyethyl)-N-methyl-8-oxo-2-[S(S)-propylsulfonimidoyl]-9--
(p-tolylmethyl)purine-7-carboxamide;
6-amino-N-(2-methoxyethyl)-N-methyl-8-oxo-2-[S(R)-propylsulfonimidoyl]-9--
(p-tolylmethyl)purine-7-carboxamide;
6-amino-N-ethyl-N-methyl-8-oxo-2-(propyl
sulfonimidoyl)-9-(p-tolylmethyl)purine-7-carboxamide;
6-amino-N-butyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)p-
urine-7-carboxamide;
6-amino-9-[(4-chlorophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-
-oxo-N-propyl-purine-7-carboxamide;
6-amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-
-oxo-N-propyl-purine-7-carboxamide;
6-amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-m-
ethyl-8-oxo-purine-7-carboxamide;
6-amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N--
methyl-8-oxo-purine-7-carboxamide;
6-amino-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmet-
hyl)purine-7-carboxamide;
6-amino-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmet-
hyl)purine-7-carboxamide;
6-amino-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethy-
l)purine-7-carboxamide;
6-amino-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmeth-
yl)purine-7-carboxamide;
6-amino-2-[S(S)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide;
6-amino-2-[S(R)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide;
6-amino-N-ethyl-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methy-
l-8-oxo-purine-7-carboxamide;
6-amino-N-ethyl-2-[S(S)-(ethylsulfonimidoyl)]-9-[(4-fluorophenyl)methyl]--
N-methyl-8-oxo-purine-7-carboxamide;
6-amino-N-ethyl-2-[S(R)-(ethylsulfonimidoyl)]-9-[(4-fluorophenyl)methyl]--
N-methyl-8-oxo-purine-7-carboxamide;
6-amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-N-
-propyl-purine-7-carboxamide;
6-amino-2-[S(R)-ethylsulfonimidoyl]-9-[(4-bromophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide;
6-amino-2-[S(S)-ethylsulfonimidoyl]-9-[(4-bromophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide;
6-amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-(ethylsulfonimidoyl)-N-methyl-
-8-oxo-purine-7-carboxamide;
6-amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-[S(S)-(ethylsulfonimidoyl)]-N-
-methyl-8-oxo-purine-7-carboxamide; and
6-amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-[S(R)-(ethylsulfonimidoyl)]-N-
-methyl-8-oxo-purine-7-carboxamide; or pharmaceutically acceptable
salt, enantiomer or diastereomer thereof.
14. A compound according to claim 13, selected from:
6-amino-9-benzyl-N-methyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7--
carboxamide;
6-amino-9-[(4-chlorophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-
-oxo-N-propyl-purine-7-carboxamide;
6-amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-
-oxo-N-propyl-purine-7-carboxamide;
6-amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-m-
ethyl-8-oxo-purine-7-carboxamide;
6-amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N--
methyl-8-oxo-purine-7-carboxamide;
6-amino-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmet-
hyl)purine-7-carboxamide;
6-amino-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmet-
hyl)purine-7-carboxamide;
6-amino-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethy-
l)purine-7-carboxamide;
6-amino-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmeth-
yl)purine-7-carboxamide;
6-amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo--
N-propyl-purine-7-carboxamide;
6-amino-2-[S(S)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide; and
6-amino-2-[S(R)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide; or pharmaceutically acceptable
salt, enantiomer or diastereomer thereof.
15. A process for preparing a compound according to any one of
claims 1 to 14, the process comprising the following step: the
reaction of a compound of formula (II), ##STR00186## with carbamoyl
chloride in the presence of a mixed base; wherein the mixed base is
pyridine and triethylamine, pyridine and DIPEA, DMAP and
triethylamine, or DMAP and DIPEA; R.sup.1 and R.sup.2 are defined
as in any one of claims 1 to 14.
16. A compound or pharmaceutically acceptable salt, enantiomer or
diastereomer according to any one of claims 1 to 14 for use as
therapeutically active substance.
17. A pharmaceutical composition comprising a compound in
accordance with any one of claims 1 to 14 and a therapeutically
inert carrier.
18. The use of a compound according to any one of claims 1 to 14
for the treatment or prophylaxis of hepatitis B virus
infection.
19. The use of a compound according to any one of claims 1 to 14
for the preparation of a medicament for the treatment or
prophylaxis of hepatitis B virus infection.
20. The use of a compound according to any one of claims 1 to 14 as
the TLR7 agonist.
21. The use of a compound according to any one of claims 1 to 14 to
induce production of interferon-.alpha..
22. A compound or pharmaceutically acceptable salt, enantiomer or
diastereomer according to any one of claims 1 to 14 for the
treatment or prophylaxis of hepatitis B virus infection.
23. A compound or pharmaceutically acceptable salt, enantiomer or
diastereomer according to any one of claims 1 to 14, when
manufactured according to a process of claim 15.
24. A method for the treatment or prophylaxis of hepatitis B virus
infection, which method comprises administering a therapeutically
effective amount of a compound as defined in any one of claims 1 to
14.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 16/260,744, now U.S. Pat. No. 10,752,630, which is a
continuation of U.S. application Ser. No. 15/689,136, filed Aug.
29, 2017, now U.S. Pat. No. 10,233,184 which claims the benefit of
priority to International Application No. PCT/CN2017/092653, filed
Jul. 12, 2017 and International Application No. PCT/CN2016/097140,
filed Aug. 29, 2016, each of which is incorporated herein by
reference in its entirety.
SEQUENCE LISTING
[0002] This application contains a Sequence Listing which has been
submitted via EFS-Web and is hereby incorporated by reference in
its entirety. Said ASCII copy, created on Aug. 12, 2020, is named
P33761US2SEQLIST and is 903 bytes in size.
[0003] The present invention relates to novel
sulfonimidoylpurinones derivatives that have in vivo Toll-like
receptor agonism activity, as well as their manufacture,
pharmaceutical compositions containing them and their potential use
as medicaments.
FIELD OF THE INVENTION
[0004] The present invention relates to compounds of formula
(I),
##STR00002##
[0005] wherein R.sup.1 to R.sup.3 are described below, or
pharmaceutically acceptable salt, enantiomer or diastereomer
thereof.
[0006] Toll-like receptors (TLRs) detect a wide range of conserved
pathogen-associated molecular patterns (PAMPs). They play an
important role of sensing invading pathogens and subsequent
initiation of innate immune responses. There are 10 known members
of the TLR family in human, which are type I transmembrane proteins
featuring an extracellular leucine-rich domain and a cytoplasmic
tail that contains a conserved Toll/interleukin (IL)-1 receptor
(TIR) domain. Within this family, TLR3, TLR7, TLR8 and TLR9 are
located within endosomes. TLR7 can be activated by binding to a
specific small molecule ligand (i.e., TLR7 agonist) or its native
ligand (i.e., single-stranded RNA, ssRNA). Following binding of
ssRNA to TLR7, the receptor in its dimerized form is believed to
undergo a structural change leading to the subsequent recruitment
of adapter proteins at its cytoplasmic domain, including the
myeloid differentiation primary response gene 88 (MyD88). Following
the initiation of the receptor signalling cascade via the MyD88
pathway, cytoplasmic transcription factors such as interferon
regulatory factor 7 (IRF-7) and nuclear factor kappa B
(NF-.kappa.B) are activated. These transcription factors then
translocate to the nucleus and initiate the transcription of
various genes, e.g., IFN-.alpha. and other antiviral cytokine
genes. TLR7 is predominately expressed on plasmacytoid cells, and
also on B-cells.
[0007] Altered responsiveness of immune cells might contribute to
the reduced innate immune responses during chronic viral
infections. Agonist-induced activation of TLR7 might therefore
represent a novel approach for the treatment of chronic viral
infections. (D. J Connolly and L. A J O'Neill, Current Opinion in
Pharmacology 2012, 12:510-518, P. A. Roethle et al, J. Med. Chem.
2013, 56, 7324-7333).
[0008] The current therapy of chronic HBV infection is based on two
different types of drugs: the traditional antiviral nucleos(t)ide
analogues and the more recent Pegylated IFN-.alpha.
(PEG-IFN-.alpha.). The oral nucleos(t)ide analogues act by
suppressing the HBV replication. This is a life-long course of
treatment during which drug resistance often occurs. As an
alternative option, Pegylated IFN-.alpha. (PEG-IFN-.alpha.) has
been used to treat some chronic infected HBV patients within finite
therapy duration. Although it has achieved seroconversion in HBeAg
at least in a small percentage of HBV patients, the adverse effect
makes it poorly tolerable. Notably, functional cure defined as
HBsAg seroconversion is very rare with both current therapies. A
new generation therapeutic option to treat HBV patients for a
functional cure is therefore of urgent need. Treatment with an oral
TLR7 agonist represents a promising solution to provide greater
efficacy with better tolerability. Pegylated IFN-.alpha.
(PEG-IFN-.alpha.) is currently used to treat chronic HBV and is an
alternative to potentially life-long treatment with antiviral
nucleos(t)ide analogues. In a subset of chronic HBV patients,
PEG-IFN-.alpha. therapy can induce sustained immunologic control of
the virus following a finite duration of therapy. However, the
percentage of HBV patients that achieve seroconversion with
interferon therapy is low (up to 27% for HBeAg-positive patients)
and the treatment is typically poorly tolerated. Furthermore,
functional cure (defined as HBsAg loss and seroconversion) is also
very infrequent with both PEG-IFN-.alpha. and nucleos(t)ide
treatment. Given these limitations, there is an urgent need for
improved therapeutic options to treat and induce a functional cure
for chronic HBV. Treatment with an oral, small-molecule TLR7
agonist is a promising approach that has the potential to provide
greater efficacy and tolerability (T. Asselah et al, Clin Liver Dis
2007, 11, 839-849).
[0009] In fact, several identified TLR7 agonists have been
considered for therapeutic purposes. So far Imiquimod (ALDARA.TM.)
is a U.S. FDA approved TLR7 agonist drug for topical use to treat
skin lesions by human papillomavirus. The TLR7/8 dual agonist
resiquimod (R-848) and the TLR7 agonist 852A have been evaluated
for treating human genital herpes and chemotherapy-refractory
metastatic melanoma, respectively. ANA773 is an oral pro-drug TLR7
agonist, developed for the treatment of patients with chronic
hepatitis C virus (HCV) infection and chronic hepatitis B
infection. GS-9620 is an orally available TLR7 agonist. A phase Ib
study demonstrated that treatment with GS-9620 was safe, well
tolerated and resulted in dose-dependent ISG15 mRNA induction in
patients with chronic hepatitis B (E. J. Gane et al, Annu Meet Am
Assoc Study Liver Dis (November 1-5, Washington, D.C.) 2013, Abst
946). Therefore there is high unmet clinical need for developing
potent and safe TLR7 agonists as new HBV treatment to offer more
therapeutic solutions or replace existing partly effective
treatment.
SUMMARY OF THE INVENTION
[0010] The present invention provides a series of novel
6-amino-2-sulfonimidoyl-9-substituted-7-substituted-purin-8-one
compounds that have Toll-like receptor agonism activity and their
prodrugs. The invention also provides the bio-activity of such
compounds to induce SEAP level increase by activating Toll-like
receptors, such as TLR7 receptor, the metabolic conversion of
prodrugs to parent compounds in the presence of human hepatocytes,
and the therapeutic or prophylactic use of such compounds and their
pharmaceutical compositions comprising these compounds and their
prodrugs to treat or prevent infectious disease like HBV or HCV.
The present invention also provides compounds with superior
activity. In addition, the compounds of formula (I) also show good
solubility and PK profiles.
[0011] The present invention relates to novel compounds of formula
(I),
##STR00003##
[0012] wherein
[0013] R.sup.1 is C.sub.1-6alkyl;
[0014] R.sup.2 is benzyl, said benzyl being unsubstituted or
substituted by one, two or three substituents independently
selected from halogen and C.sub.1-6alkyl;
[0015] R.sup.3 is --NR.sup.4R.sup.5, wherein
[0016] R.sup.4 is C.sub.1-6alkyl or
C.sub.1-6alkoxyC.sub.1-6alkyl;
[0017] R.sup.5 is (C.sub.1-6alkyl).sub.2NCOOC.sub.1-6alkyl,
C.sub.1-6alkoxyC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyl(C.sub.1-6alkyl)aminoC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyl(phenyl)C.sub.1-6alkyl,
C.sub.1-6alkoxycarbonylC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyloxyC.sub.1-6alkyl, C.sub.1-6alkyl,
C.sub.1-6alkylcarbonyl(C.sub.1-6alkyl)aminoC.sub.1-6alkyl or
pyrrolidinylcarbamoyloxyC.sub.1-6alkyl; or
[0018] R.sup.4 and R.sup.5 together with the nitrogen they are
attached to form a heterocyclyl;
[0019] or pharmaceutically acceptable salt, enantiomer or
diastereomer thereof;
[0020] with the proviso that [0021]
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7-(pyrrolidine-1-carbonyl)purin--
8-one; [0022]
6-amino-9-benzyl-7-(piperidine-1-carbonyl)-2-(propylsulfonimidoyl)purin-8-
-one; [0023]
6-amino-9-benzyl-7-(morpholine-4-carbonyl)-2-(propylsulfonimidoyl)purin-8-
-one; [0024]
6-amino-9-benzyl-7-(3,3-dimethylpyrrolidine-1-carbonyl)-2-(propylsulfonim-
idoyl)purin-8-one; [0025] ethyl
1-[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]pyrrol-
idine-2-carboxylate; [0026]
6-amino-7-(2-azaspiro[3.3]heptane-2-carbonyl)-9-benzyl-2-(propyl
sulfonimidoyl)purin-8-one; [0027]
6-amino-9-benzyl-7-(2-oxa-6-azaspiro[3.3]heptane-6-carbonyl)-2-(propylsul-
fonimidoyl)purin-8-one; [0028]
6-amino-9-benzyl-7-(3,3-difluoropyrrolidine-1-carbonyl)-2-(propylsulfonim-
idoyl)purin-8-one; [0029]
6-amino-9-benzyl-7-(3-fluoro-3-methyl-pyrrolidine-1-carbonyl)-2-(propylsu-
lfonimidoyl)purin-8-one;
[0030] and their enantiomers or diastereomers are excluded.
[0031] The invention also relates to their manufacture, medicaments
based on a compound in accordance with the invention and their
production as well as the use of compounds of formula (I) thereof
as TLR7 agonist. Accordingly, the compounds of formula (I) are
useful for the treatment or prophylaxis of HBV and/or HCV infection
with Toll-like receptors agonism. DETAILED DESCRIPTION OF THE
INVENTION
[0032] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
Furthermore, the following definitions are set forth to illustrate
and define the meaning and scope of the various terms used to
describe the invention.
Definitions
[0033] The term "C.sub.1-6alkyl" denotes a saturated, linear or
branched chain alkyl group containing 1 to 6, particularly 1 to 4
carbon atoms, for example methyl, ethyl, n-propyl, isopropyl,
n-butyl, isobutyl, tert-butyl and the like. Particular
"C.sub.1-6alkyl" groups are methyl, ethyl and n-propyl.
[0034] The term "C.sub.1-6alkoxy" denotes a group of the formula
C.sub.1-6alkyl-O--. Examples of C.sub.1-6alkoxy group include, but
not limited to, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy,
isobutoxy and tert-butoxy. Particular "C.sub.1-6alkoxy" groups are
methoxy, ethoxy and isopropoxy. A more particular C.sub.1-6alkoxy
group is ethoxy.
[0035] The term "halogen" and "halo" are used interchangeably
herein and denote fluoro, chloro, bromo, or iodo.
[0036] The term "heterocyclyl" denotes a monovalent saturated or
partly unsaturated mono or bicyclic ring system of 3 to 10 ring
atoms, comprising 1 to 5 ring heteroatoms selected from N, O and S,
the remaining ring atoms being carbon. In particular embodiments,
heterocyclyl is a monovalent saturated monocyclic ring system of 4
to 7 ring atoms, comprising 1, 2, or 3 ring heteroatoms selected
from N, O and S, the remaining ring atoms being carbon. Examples
for monocyclic saturated heterocyclyl are aziridinyl, oxiranyl,
azetidinyl, oxetanyl, pyrrolidinyl, dimethylpyrrolidinyl,
ethoxycarbonylpyrrolidinyl, tetrahydrofuranyl, tetrahydro-thienyl,
pyrazolidinyl, imidazolidinyl, oxazolidinyl, isoxazolidinyl,
thiazolidinyl, piperidinyl, tetrahydropyranyl,
tetrahydrothiopyranyl, piperazinyl, morpholinyl, thiomorpholinyl,
dioxothiomorpholinyl, azepanyl, diazepanyl, homopiperazinyl, or
oxazepanyl. Monocyclic saturated heterocyclyl can be further
substituted by one to three substituents independently selected
from halogen, C.sub.1-6alkyl and C.sub.1-6alkoxycarbonyl. Examples
for substituted monocyclic saturated heterocyclyl are
4-methylpiperazinyl, dimethylpyrrolidinyl,
ethoxycarbonylpyrrolidinyl, difluoropyrrolidinyl,
fluoro(methyl)pyrrolidinyl. Examples for bicyclic saturated
heterocyclyl are azabicyclo[3.2.1]octyl, quinuclidinyl,
oxaazabicyclo[3.2.1]octyl, azabicyclo[3.3.1]nonyl,
oxaazabicyclo[3.3.1]nonyl, thiaazabicyclo[3.3.1]nonyl,
azaspiro[3.3]heptanyl and oxaazaspiro[3.3]heptanyl. Examples for
partly unsaturated heterocyclyl are dihydrofuryl, imidazolinyl,
dihydrooxazolyl, tetrahydropyridinyl and dihydropyranyl.
[0037] The term "carbonyl" alone or in combination refers to the
group --C(O)--.
[0038] The term "C.sub.1-6alkylcarbonyl" refers to a group
C.sub.1-6alkyl-C(O)--, wherein the "C.sub.1-6alkyl" is as defined
above. Particular "C.sub.1-6alkylcarbonyl" group is acetyl.
[0039] The term "enantiomer" denotes two stereoisomers of a
compound which are non-superimposable mirror images of one
another.
[0040] The term "diastereomer" denotes a stereoisomer with two or
more centers of chirality and whose molecules are not mirror images
of one another. Diastereomers have different physical properties,
e.g. melting points, boiling points, spectral properties, and
reactivities.
[0041] The term "pharmaceutically acceptable salts" denotes salts
which are not biologically or otherwise undesirable.
Pharmaceutically acceptable salts include both acid and base
addition salts.
[0042] The term "pharmaceutically acceptable acid addition salt"
denotes those pharmaceutically acceptable salts formed with
inorganic acids such as hydrochloric acid, hydrobromic acid,
sulfuric acid, nitric acid, carbonic acid, phosphoric acid, and
organic acids selected from aliphatic, cycloaliphatic, aromatic,
araliphatic, heterocyclic, carboxylic, and sulfonic classes of
organic acids such as formic acid, acetic acid, propionic acid,
glycolic acid, gluconic acid, lactic acid, pyruvic acid, oxalic
acid, malic acid, maleic acid, maloneic acid, succinic acid,
fumaric acid, tartaric acid, citric acid, aspartic acid, ascorbic
acid, glutamic acid, anthranilic acid, benzoic acid, cinnamic acid,
mandelic acid, embonic acid, phenylacetic acid, methanesulfonic
acid, ethanesulfonic acid, p-toluenesulfonic acid, and salicyclic
acid.
[0043] The term "pharmaceutically acceptable base addition salt"
denotes those pharmaceutically acceptable salts formed with an
organic or inorganic base. Examples of acceptable inorganic bases
include sodium, potassium, ammonium, calcium, magnesium, iron,
zinc, copper, manganese, and aluminum salts. Salts derived from
pharmaceutically acceptable organic nontoxic bases includes salts
of primary, secondary, and tertiary amines, substituted amines
including naturally occurring substituted amines, cyclic amines and
basic ion exchange resins, such as isopropylamine, trimethylamine,
diethylamine, triethylamine, tripropylamine, ethanolamine,
2-diethylaminoethanol, trimethamine, dicyclohexylamine, lysine,
arginine, histidine, caffeine, procaine, hydrabamine, choline,
betaine, ethylenediamine, glucosamine, methylglucamine,
theobromine, purines, piperizine, piperidine, N-ethylpiperidine,
and polyamine resins.
[0044] Compounds of the general formula (I) and their prodrugs
which contain one or several chiral centers can either be present
as racemates, diastereomeric mixtures, or optically active single
isomers. The racemates can be separated according to known methods
into the enantiomers. Particularly, diastereomeric salts which can
be separated by crystallization are formed from the racemic
mixtures by reaction with an optically active acid such as e.g. D-
or L-tartaric acid, mandelic acid, malic acid, lactic acid or
camphorsulfonic acid.
[0045] The term "prodrug" denotes a form or derivative of a
compound which is metabolized in vivo, e.g., by biological fluids
or enzymes by a subject after administration, into a
pharmacologically active form of the compound in order to produce
the desired pharmacological effect. Prodrugs are described e.g. in
"The Organic Chemistry of Drug Design and Drug Action", by Richard
B. Silverman, Academic Press, San Diego, 2004, Chapter 8 Prodrugs
and Drug Delivery Systems, pp. 497-558.
[0046] "A pharmaceutically active metabolite" is intended to mean a
pharmacologically active product produced through metabolism in the
body of a specified compound or salt thereof. After entry into the
body, most drugs are substrates for chemical reactions that may
change their physical properties and biologic effects. These
metabolic conversions, which usually affect the polarity of the
compounds of the invention, alter the way in which drugs are
distributed in and excreted from the body. However, in some cases,
metabolism of a drug is required for therapeutic effect.
[0047] The term "therapeutically effective amount" denotes an
amount of a compound or molecule of the present invention that,
when administered to a subject, (i) treats or prevents the
particular disease, condition or disorder, (ii) attenuates,
ameliorates or eliminates one or more symptoms of the particular
disease, condition, or disorder, or (iii) prevents or delays the
onset of one or more symptoms of the particular disease, condition
or disorder described herein. The therapeutically effective amount
will vary depending on the compound, the disease state being
treated, the severity of the disease treated, the age and relative
health of the subject, the route and form of administration, the
judgement of the attending medical or veterinary practitioner, and
other factors.
[0048] The term "pharmaceutical composition" denotes a mixture or
solution comprising a therapeutically effective amount of an active
pharmaceutical ingredient together with pharmaceutically acceptable
excipients to be administered to a mammal, e.g., a human in need
thereof.
[0049] TLR7 Agonist and Prodrug
[0050] The present invention relates to a compound of formula
(I),
##STR00004##
[0051] wherein
[0052] R.sup.1 is C.sub.1-6alkyl;
[0053] R.sup.2 is benzyl, said benzyl being unsubstituted or
substituted by one, two or three substituents independently
selected from halogen and C.sub.1-6alkyl;
[0054] R.sup.3 is --NR.sup.4R.sup.5, wherein
[0055] R.sup.4 is C.sub.1-6alkyl or
C.sub.1-6alkoxyC.sub.1-6alkyl;
[0056] R.sup.5 is (C.sub.1-6alkyl).sub.2NCOOC.sub.1-6alkyl,
C.sub.1-6alkoxyC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyl(C.sub.1-6alkyl)aminoC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyl(phenyl)C.sub.1-6alkyl,
C.sub.1-6alkoxycarbonylC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyloxyC.sub.1-6alkyl, C.sub.1-6alkyl,
C.sub.1-6alkylcarbonyl(C.sub.1-6alkyl)aminoC.sub.1-6alkyl or
pyrrolidinylcarbamoyloxyC.sub.1-6alkyl; or
[0057] R.sup.4 and R.sup.5 together with the nitrogen they are
attached to form a heterocyclyl;
[0058] or pharmaceutically acceptable salt, enantiomer or
diastereomer thereof;
[0059] with the proviso that [0060]
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7-(pyrrolidine-1-carbonyl)purin--
8-one; [0061]
6-amino-9-benzyl-7-(piperidine-1-carbonyl)-2-(propylsulfonimidoyl)purin-8-
-one; [0062] 6-amino-9-benzyl-7-(morpholine-4-carbonyl)-2-(propyl
sulfonimidoyl)purin-8-one; [0063]
6-amino-9-benzyl-7-(3,3-dimethylpyrrolidine-1-carbonyl)-2-(propylsulfonim-
idoyl)purin-8-one; [0064] ethyl
1-[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]pyrrol-
idine-2-carboxylate; [0065]
6-amino-7-(2-azaspiro[3.3]heptane-2-carbonyl)-9-benzyl-2-(propylsulfonimi-
doyl)purin-8-one; [0066]
6-amino-9-benzyl-7-(2-oxa-6-azaspiro[3.3]heptane-6-carbonyl)-2-(propylsul-
fonimidoyl)purin-8-one; [0067]
6-amino-9-benzyl-7-(3,3-difluoropyrrolidine-1-carbonyl)-2-(propylsulfonim-
idoyl)purin-8-one; [0068]
6-amino-9-benzyl-7-(3-fluoro-3-methyl-pyrrolidine-1-carbonyl)-2-(propyl
sulfonimidoyl)purin-8-one;
[0069] and their enantiomers or diastereomers are excluded.
[0070] A further embodiment of present invention is (ii) a compound
of formula (I), wherein
[0071] R.sup.1 is C.sub.1-6alkyl;
[0072] R.sup.2 is benzyl, said benzyl being unsubstituted or
substituted by halogen or C.sub.1-6alkyl;
[0073] R.sup.3 is azetidinyl;
[0074] piperazinyl substituted by C.sub.1-6alkyl;
[0075] piperidinyl substituted by piperidinyl;
[0076] pyrrolidinyl; or
[0077] --NR.sup.4R.sup.5, wherein
[0078] R.sup.4 is C.sub.1-6alkyl or
C.sub.1-6alkoxyC.sub.1-6alkyl;
[0079] R.sup.5 is (C.sub.1-6alkyl).sub.2NCOOC.sub.1-6alkyl,
C.sub.1-6alkoxyC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyl(C.sub.1-6alkyl)aminoC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyl(phenyl)C.sub.1-6alkyl,
C.sub.1-6alkoxycarbonylC.sub.1-6alkyl,
C.sub.1-6alkoxycarbonyloxyC.sub.1-6alkyl, C.sub.1-6alkyl,
C.sub.1-6alkylcarbonyl(C.sub.1-6alkyl)aminoC.sub.1-6alkyl or
pyrrolidinylcarbamoyloxyC.sub.1-6alkyl;
[0080] or pharmaceutically acceptable salt, enantiomer or
diastereomer thereof.
[0081] A further embodiment of present invention is (iii) a
compound of formula (I), wherein
[0082] R.sup.1 is ethyl or propyl;
[0083] R.sup.2 is benzyl, bromobenzyl, chlorobenzyl, fluorobenzyl
or methylbenzyl;
[0084] R.sup.3 is azetidinyl;
[0085] 4-methylpiperazinyl;
[0086] piperidinylpiperidinyl;
[0087] pyrrolidinyl; or
[0088] --NR.sup.4R.sup.5, wherein [0089] R.sup.4 is methyl, ethyl,
propyl or methoxyethyl; [0090] R.sup.5 is acetyl(methyl)aminoethyl,
butyl, butyl(methyl)carbamoyloxyethyl, diethylcarbamoyloxyethyl,
ethoxycarbonyl(methyl)aminoethyl, ethoxycarbonylethyl,
ethoxycarbonylisobutyl, ethoxycarbonylisopentyl,
ethoxycarbonylmethyl, ethoxycarbonyloxyethyl,
ethoxycarbonyl(phenyl)ethyl, ethyl, isobutyl,
isopropoxycarbonylisopentyl, isopropoxycarbonyl(phenyl)ethyl,
isopropyl, methoxycarbonyl(methyl)aminoethyl, methoxyethyl,
methoxypropyl, propyl, propyl(methyl)carbamoyloxyethyl,
pyrrolidinylcarbamoyloxyethyl,
tert-butoxycarbonyl(methyl)aminoethyl, tert-butoxycarbonylethyl,
tert-butoxycarbonylisopentyl or tert-butoxycarbonyl(phenyl)ethyl;
or pharmaceutically acceptable salt, enantiomer or diastereomer
thereof.
[0091] A further embodiment of present invention is (iii-1) a
compound of formula (I), wherein
R.sup.1 is ethyl or propyl;
[0092] R.sup.2 is benzyl, chlorobenzyl, fluorobenzyl or
methylbenzyl;
[0093] R.sup.3 is azetidinyl;
[0094] 4-methylpiperazinyl; piperidinylpiperidinyl;
[0095] pyrrolidinyl; or
[0096] --NR.sup.4R.sup.5, wherein [0097] R.sup.4 is methyl, ethyl,
propyl or methoxyethyl; [0098] R.sup.5 is acetyl(methyl)aminoethyl,
butyl, butyl(methyl)carbamoyloxyethyl, diethylcarbamoyloxyethyl,
ethoxycarbonyl(methyl)aminoethyl, ethoxycarbonylethyl,
ethoxycarbonylisobutyl, ethoxycarbonylisopentyl,
ethoxycarbonylmethyl, ethoxycarbonyloxyethyl,
ethoxycarbonyl(phenyl)ethyl, ethyl, isobutyl,
isopropoxycarbonylisopentyl, isopropoxycarbonyl(phenyl)ethyl,
isopropyl, methoxycarbonyl(methyl)aminoethyl, methoxyethyl,
methoxypropyl, propyl, propyl(methyl)carbamoyloxyethyl,
pyrrolidinylcarbamoyloxyethyl,
tert-butoxycarbonyl(methyl)aminoethyl, tert-butoxycarbonylethyl,
tert-butoxycarbonylisopentyl or tert-butoxycarbonyl(phenyl)ethyl;
or pharmaceutically acceptable salt, enantiomer or diastereomer
thereof.
[0099] A further embodiment of present invention is (iv) a compound
of formula (I), wherein R.sup.3 is azetidinyl, 4-methylpiperazinyl,
piperidinylpiperidinyl, pyrrolidinyl,
acetyl(methyl)aminoethyl(methyl)amino, bis(methoxyethyl)amino,
butyl(ethyl)amino, butyl(methyl)amino,
butyl(methyl)carbamoyloxyethyl(methyl)amino,
diethylcarbamoyloxyethyl(methyl)amino,
ethoxycarbonyl(methyl)aminoethyl(methyl)amino,
ethoxycarbonylethyl(methyl)amino,
ethoxycarbonylisobutyl(methyl)amino,
ethoxycarbonylisopentyl(methyl)amino,
ethoxycarbonylmethyl(methyl)amino,
ethoxycarbonyloxyethyl(methyl)amino,
ethoxycarbonyl(phenyl)ethyl(methyl)amino, ethyl(methyl)amino,
isobutyl(methyl)amino, isopropoxycarbonylisopentyl(methyl)amino,
isopropoxycarbonyl(phenyl)ethyl(methyl)amino,
isopropyl(methyl)amino,
methoxycarbonyl(methyl)aminoethyl(methyl)amino,
methoxyethyl(ethyl)amino, methoxyethyl(methyl)amino,
methoxyethyl(propyl)amino, methoxypropyl(methyl)amino,
propyl(ethyl)amino, propyl(methyl)amino,
propyl(methyl)carbamoyloxyethyl(methyl)amino,
pyrrolidinylcarbamoyloxyethyl(methyl)amino,
tert-butoxycarbonyl(methyl)aminoethyl(methyl)amino,
tert-butoxycarbonyl ethyl(methyl)amino,
tert-butoxycarbonylisopentyl(methyl)amino or
tert-butoxycarbonyl(phenyl)ethyl(methyl)amino; or pharmaceutically
acceptable salt, enantiomer or diastereomer thereof.
[0100] A further embodiment of present invention is (v) a compound
of formula (I), wherein R.sup.1 is ethyl.
[0101] A further embodiment of present invention is (vi) a compound
of formula (I), wherein R.sup.2 is benzyl substituted by halogen or
C.sub.1-6alkyl.
[0102] A further embodiment of present invention is (vii) a
compound of formula (I), wherein R.sup.2 is bromobenzyl,
chlorobenzyl, fluorobenzyl or methylbenzyl.
[0103] A further embodiment of present invention is (vii-1) a
compound of formula (I), wherein R.sup.2 is chlorobenzyl,
fluorobenzyl or methylbenzyl.
[0104] A further embodiment of present invention is (viii) a
compound of formula (I), wherein R.sup.2 is bromobenzyl,
chlorobenzyl or fluorobenzyl.
[0105] A further embodiment of present invention is (viii-1) a
compound of formula (I), wherein R.sup.2 is chlorobenzyl or
fluorobenzyl.
[0106] A further embodiment of present invention is (ix) a compound
of formula (I), wherein R.sup.3 is --NR.sup.4R.sup.5, wherein
R.sup.4 is C.sub.1-6alkyl, R.sup.5 is C.sub.1-6alkyl.
[0107] A further embodiment of present invention is (x) a compound
of formula (I), wherein R.sup.3 is propyl(methyl)amino or
ethyl(methyl)amino.
[0108] A further embodiment of present invention is (xi) a compound
of formula (I), wherein
[0109] R.sup.1 is C.sub.1-6alkyl;
[0110] R.sup.2 is benzyl, said benzyl being substituted by halogen
or C.sub.1-6alkyl;
[0111] R.sup.3 is --NR.sup.4R.sup.5, wherein R.sup.4 is
C.sub.1-6alkyl, R.sup.5 is C.sub.1-6alkyl;
[0112] or pharmaceutically acceptable salt, enantiomer or
diastereomer thereof.
[0113] A further embodiment of present invention is (xii) a
compound of formula (I), wherein
[0114] R.sup.1 is ethyl;
[0115] R.sup.2 is methylbenzyl, bromobenzyl, chlorobenzyl or
fluorobenzyl;
[0116] R.sup.3 is propyl(methyl)amino or ethyl(methyl)amino;
[0117] or pharmaceutically acceptable salt, enantiomer or
diastereomer thereof.
[0118] A further embodiment of present invention is (xii-1) a
compound of formula (I), wherein
[0119] R.sup.1 is ethyl;
[0120] R.sup.2 is methylbenzyl, chlorobenzyl or fluorobenzyl;
[0121] R.sup.3 is propyl(methyl)amino or ethyl(methyl)amino;
[0122] or pharmaceutically acceptable salt, enantiomer or
diastereomer thereof.
[0123] Another embodiment of present invention is that (xiii)
particular compounds of formula (I) are the following: [0124]
6-Amino-9-benzyl-N-methyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7--
carboxamide; [0125]
6-Amino-9-benzyl-N-(2-methoxyethyl)-N-methyl-8-oxo-2-(propylsulfonimidoyl-
)purine-7-carboxamide; [0126]
6-Amino-9-benzyl-N-ethyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-c-
arboxamide; [0127]
6-Amino-9-benzyl-7-[4-(1-piperidyl)piperidine-1-carbonyl]-2-(propylsulfon-
imidoyl)purin-8-one; [0128]
6-Amino-9-benzyl-N-ethyl-N-(2-methoxyethyl)-8-oxo-2-(propylsulfonimidoyl)-
purine-7-carboxamide; [0129]
6-Amino-9-benzyl-N-butyl-N-ethyl-8-oxo-2-(propylsulfonimidoyl)purine-7-ca-
rboxamide; [0130]
6-Amino-9-benzyl-N-(2-methoxyethyl)-8-oxo-N-propyl-2-(propylsulfonimidoyl-
)purine-7-carboxamide; [0131]
6-Amino-9-benzyl-N,N-bis(2-methoxyethyl)-8-oxo-2-(propylsulfonimidoyl)pur-
ine-7-carboxamide; [0132]
6-Amino-7-(azetidine-1-carbonyl)-9-benzyl-2-(propylsulfonimidoyl)purin-8--
one; [0133]
6-Amino-9-benzyl-N-isopropyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-
-7-carboxamide; [0134]
6-Amino-9-benzyl-7-(4-methylpiperazine-1-carbonyl)-2-(propylsulfonimidoyl-
)purin-8-one; [0135]
6-Amino-9-benzyl-N-(3-methoxypropyl)-N-methyl-8-oxo-2-(propylsulfonimidoy-
l)purine-7-carboxamide; [0136]
6-Amino-9-benzyl-N-isobutyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine--
7-carboxamide; [0137] Ethyl
2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]acetate; [0138] Ethyl
3-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]propanoate; [0139] tert-Butyl
3-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]propanoate; [0140] Ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]propanoate; [0141] tert-Butyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-4-methyl-pentanoate; [0142] Isopropyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-4-methyl-pentanoate; [0143] Ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-3-methyl-butanoate; [0144] Ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-4-methyl-pentanoate; [0145] Ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-3-phenyl-propanoate; [0146] Isopropyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-3-phenyl-propanoate; [0147] tert-Butyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-3-phenyl-propanoate; [0148]
N-[2-[Acetyl(methyl)amino]ethyl]-6-amino-9-benzyl-N-methyl-8-oxo-2-(propy-
lsulfonimidoyl)purine-7-carboxamide; [0149] Methyl
N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-m-
ethyl-amino]ethyl]-N-methyl-carbamate; [0150] tert-Butyl
N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-m-
ethyl-amino]ethyl]-N-methyl-carbamate; [0151] Ethyl
N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-m-
ethyl-amino]ethyl]-N-methyl-carbamate; [0152]
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl N-butyl-N-methyl-carbamate; [0153]
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl pyrrolidine-1-carboxylate; [0154]
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl N-methyl-N-propyl-carbamate; [0155]
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl N,N-diethylcarbamate; [0156]
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl ethyl carbonate; [0157]
6-Amino-N-butyl-9-[(4-chlorophenyl)methyl]-N-methyl-8-oxo-2-[S(S)-propyl
sulfonimidoyl]purine-7-carboxamide; [0158]
6-amino-N-butyl-9-[(4-chlorophenyl)methyl]-N-methyl-8-oxo-2-[S(S)-propyls-
ulfonimidoyl]purine-7-carboxamide; [0159]
6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-N-methyl-8-oxo-2-(propylsulfon-
imidoyl)purine-7-carboxamide; [0160]
6-Amino-N-methyl-8-oxo-N-propyl-2[S(S)-propylsulfonimidoyl]-9-(p-tolylmet-
hyl)purine-7-carboxamide; [0161]
6-Amino-N-methyl-8-oxo-N-propyl-2[S(R)-propylsulfonimidoyl]-9-(p-tolylmet-
hyl)purine-7-carboxamide; [0162]
6-Amino-2-[S(S)-propylsulfonimidoyl]-9-(p-tolylmethyl)-7-(pyrrolidine-1-c-
arbonyl)purin-8-one; [0163]
6-Amino-2-[S(R)-propylsulfonimidoyl]-9-(p-tolylmethyl)-7-(pyrrolidine-1-c-
arbonyl)purin-8-one; [0164]
6-Amino-N-(2-methoxyethyl)-N-methyl-8-oxo-2-[S(S)-propylsulfonimidoyl]-9--
(p-tolylmethyl)purine-7-carboxamide; [0165]
6-Amino-N-(2-methoxyethyl)-N-methyl-8-oxo-2-[S(R)-propylsulfonimidoyl]-9--
(p-tolylmethyl)purine-7-carboxamide; [0166]
6-Amino-N-ethyl-N-methyl-8-oxo-2-(propyl
sulfonimidoyl)-9-(p-tolylmethyl)purine-7-carboxamide; [0167]
6-Amino-N-butyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)p-
urine-7-carboxamide; [0168]
6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-
-oxo-N-propyl-purine-7-carboxamide; [0169]
6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-
-oxo-N-propyl-purine-7-carboxamide; [0170]
6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-m-
ethyl-8-oxo-purine-7-carboxamide; [0171]
6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N--
methyl-8-oxo-purine-7-carboxamide; [0172]
6-Amino-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmet-
hyl)purine-7-carboxamide; [0173]
6-Amino-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmet-
hyl)purine-7-carboxamide; [0174]
6-Amino-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethy-
l)purine-7-carboxamide; [0175]
6-Amino-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmeth-
yl)purine-7-carboxamide; [0176]
6-Amino-2-[S(S)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide; [0177] 6-Amino-2-[S(R)ethyl
sulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo-N-propyl-purine--
7-carboxamide; [0178]
6-Amino-N-ethyl-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methy-
l-8-oxo-purine-7-carboxamide; [0179]
6-Amino-N-ethyl-2-[S(S)-(ethylsulfonimidoyl)]-9-[(4-fluorophenyl)methyl]--
N-methyl-8-oxo-purine-7-carboxamide; [0180]
6-Amino-N-ethyl-2-[S(R)-(ethylsulfonimidoyl)]-9-[(4-fluorophenyl)methyl]--
N-methyl-8-oxo-purine-7-carboxamide; [0181]
6-Amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-N-
-propyl-purine-7-carboxamide; [0182]
6-Amino-2-[S(R)-ethylsulfonimidoyl]-9-[(4-bromophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide; [0183]
6-Amino-2-[S(S)-ethylsulfonimidoyl]-9-[(4-bromophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide; [0184]
6-Amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-(ethylsulfonimidoyl)-N-methyl-
-8-oxo-purine-7-carboxamide; [0185]
6-Amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-[S(S)-(ethylsulfonimidoyl)]-N-
-methyl-8-oxo-purine-7-carboxamide; and [0186]
6-Amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-[S(R)-(ethylsulfonimidoyl)]-N-
-methyl-8-oxo-purine-7-carboxamide;
[0187] or pharmaceutically acceptable salt, enantiomer or
diastereomer thereof.
[0188] Another embodiment of present invention is that (xiv) more
particular compounds of formula (I) are the following: [0189]
6-Amino-9-benzyl-N-methyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7--
carboxamide; [0190]
6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-
-oxo-N-propyl-purine-7-carboxamide; [0191]
6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-
-oxo-N-propyl-purine-7-carboxamide; [0192]
6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-m-
ethyl-8-oxo-purine-7-carboxamide; [0193]
6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N--
methyl-8-oxo-purine-7-carboxamide; [0194]
6-Amino-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmet-
hyl)purine-7-carboxamide; [0195]
6-Amino-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmet-
hyl)purine-7-carboxamide; [0196]
6-Amino-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethy-
l)purine-7-carboxamide; [0197]
6-Amino-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmeth-
yl)purine-7-carboxamide; [0198]
6-amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo--
N-propyl-purine-7-carboxamide; [0199]
6-Amino-2-[S(S)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide; [0200]
6-Amino-2-[S(R)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide; [0201]
6-Amino-N-ethyl-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methy-
l-8-oxo-purine-7-carboxamide; [0202]
6-Amino-N-ethyl-2-[S(S)-(ethylsulfonimidoyl)]-9-[(4-fluorophenyl)methyl]--
N-methyl-8-oxo-purine-7-carboxamide; [0203]
6-Amino-N-ethyl-2-[S(R)-(ethylsulfonimidoyl)]-9-[(4-fluorophenyl)methyl]--
N-methyl-8-oxo-purine-7-carboxamide; [0204]
6-Amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-N-
-propyl-purine-7-carboxamide; [0205]
6-Amino-2-[S(R)-ethylsulfonimidoyl]-9-[(4-bromophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide; [0206]
6-Amino-2-[S(S)-ethylsulfonimidoyl]-9-[(4-bromophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide; [0207]
6-Amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-(ethylsulfonimidoyl)-N-methyl-
-8-oxo-purine-7-carboxamide; [0208]
6-Amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-[S(S)-(ethylsulfonimidoyl)]-N-
-methyl-8-oxo-purine-7-carboxamide; and [0209]
6-Amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-[S(R)-(ethylsulfonimidoyl)]-N-
-methyl-8-oxo-purine-7-carboxamide;
[0210] or pharmaceutically acceptable salt, enantiomer or
diastereomer thereof.
[0211] In some embodiments, compounds of present invention were
tested and compared with the following reference compounds. As the
most successful biopharmaceutical companies focusing on discovery
and development of TLR7 agonists for treating liver diseases,
Gilead has the most advanced TLR7 agonist pipeline with leading
compounds such as GS-9620 which has entered into Phase II studies.
Gilead compound GS-9620 disclosed in US20100143301 as example 49,
compound S-2 and compound S-3 disclosed in JP1999193282 were all
chosen as the reference compounds in this application:
##STR00005##
[0212] Synthesis
[0213] The compounds of the present invention can be prepared by
any conventional means. Suitable processes for synthesizing these
compounds as well as their starting materials are provided in the
schemes below and in the examples. All substituents, in particular,
R.sup.1 to R.sup.4 are as defined above unless otherwise indicated.
Furthermore, and unless explicitly otherwise stated, all reactions,
reaction conditions, abbreviations and symbols have the meanings
well known to a person of ordinary skill in organic chemistry.
##STR00006##
[0214] A compound of formula VI is prepared by cyclization of
isocyanate VII with aminomalononitrilep-toluenesulfonate. Then
bicycle V is synthesized by reaction of compound of formula VI with
benzoyl isothiocyanate in the presence of inorganic base, such as
NaOH or KOH. Alkylation of bicycle V with alkylhalide in the
presence of base, such as K.sub.2CO.sub.3, NaH or Cs.sub.2CO.sub.3,
gives compound of formula IV. Compound of formula III is prepared
by oxidation of compound of formula IV with an oxidant, such as
meta-chloroperoxybenzoic acid, urea-hydrogen peroxide adduct and
HIO.sub.4. Compound of formula II is obtained by imination of
compound of formula III with imination reagent, such as sodium
azide in acid, said acid is, for example, Eaton's reagent or PPA.
Compound of formula I is obtained by reaction of compound of
formula II with carbamoyl chloride in the presence of a mixed base
such as pyridine and triethylamine, pyridine and DIPEA, DMAP and
triethylamine, or DMAP and DIPEA.
##STR00007##
[0215] Compound of formula II can also be prepared as Scheme 2.
[0216] A compound of formula X is prepared by reaction of compound
of formula XI with R.sup.2HN.sub.2. Reduction of compound X with
reducing reagent, such as Zinc or Iron powder in AcOH, gives the
compound of formula IX. Cyclization of compound of formula IX with
cyclization reagents, such as phosgene, carbonyl diimidazole,
diethyl carbonate and triphosgene, affords compound of formula
VIII. A compound of formula IVa is prepared by treating the
compound of formula VIII with PMBHN.sub.2. A compound of formula
III is prepared by deprotection of compound of formula IVa with
acid, such as CF.sub.3COOH, followed by oxidation with an oxidant,
such as meta-chloroperoxybenzoic acid, urea-hydrogen peroxide
adduct and HIO.sub.4. Compound of formula II is obtained by the
imination of compound of formula III with imination reagent, such
as sodium azide in acid, said acid is for example Eaton's reagent
or PPA.
[0217] This invention also relates to a process for the preparation
of a compound of formula (I) comprising the reaction of:
[0218] the reaction of a compound of formula (II),
##STR00008##
[0219] with carbamoyl chloride in the presence of a mixed base;
[0220] wherein R.sup.1 and R.sup.2 are defined above.
[0221] In above step, the mixed base can be, for example, pyridine
and triethylamine, pyridine and DIPEA, DMAP and triethylamine, or
DMAP and DIPEA.
[0222] A compound of formula (I) when manufactured according to the
above process is also an object of the invention.
[0223] Pharmaceutical Compositions and Administration
[0224] Another embodiment provides pharmaceutical compositions or
medicaments containing the compounds of the invention and a
therapeutically inert carrier, diluent or excipient, as well as
methods of using the compounds of the invention to prepare such
compositions and medicaments. In one example, compounds of formula
(I) may be formulated by mixing at ambient temperature at the
appropriate pH, and at the desired degree of purity, with
physiologically acceptable carriers, i.e., carriers that are
non-toxic to recipients at the dosages and concentrations employed
into a galenical administration form. The pH of the formulation
depends mainly on the particular use and the concentration of
compound, but preferably ranges anywhere from about 3 to about 8.
In one example, a compound of formula (I) are formulated in an
acetate buffer, at pH 5. In another embodiment, the compounds of
formula (I) are sterile. The compound may be stored, for example,
as a solid or amorphous composition, as a lyophilized formulation
or as an aqueous solution.
[0225] Compositions are formulated, dosed, and administered in a
fashion consistent with good medical practice. Factors for
consideration in this context include the particular disorder being
treated, the particular mammal being treated, the clinical
condition of the individual patient, the cause of the disorder, the
site of delivery of the agent, the method of administration, the
scheduling of administration, and other factors known to medical
practitioners. The "effective amount" of the compound to be
administered will be governed by such considerations, and is the
minimum amount necessary to activate TLR7 receptor and lead to
produce INF-.alpha. and other cytokines, which can be used, but not
limited, for the treatment or prevention of hepatitis B and/or C
viral infected patients.
[0226] In one example, the pharmaceutically effective amount of the
compound of the invention administered parenterally per dose will
be in the range of about 0.1 to 50 mg/kg, alternatively about 0.1
to 30 mg/kg of patient body weight per day, with the typical
initial range of compound used being 0.3 to 15 mg/kg/day. In
another embodiment, oral unit dosage forms, such as tablets and
capsules, preferably contain from about 20 to about 1000 mg of the
compound of the invention.
[0227] The compounds of the invention may be administered by any
suitable means, including oral, topical (including buccal and
sublingual), rectal, vaginal, transdermal, parenteral,
subcutaneous, intraperitoneal, intrapulmonary, intradermal,
intrathecal and epidural and intranasal, and, if desired for local
treatment, intralesional administration. Parenteral infusions
include intramuscular, intravenous, intraarterial, intraperitoneal,
or subcutaneous administration.
[0228] The compounds of the present invention may be administered
in any convenient administrative form, e.g., tablets, powders,
capsules, solutions, dispersions, suspensions, syrups, sprays,
suppositories, gels, emulsions, patches, etc. Such compositions may
contain components conventional in pharmaceutical preparations,
e.g., diluents, carriers, pH modifiers, sweeteners, bulking agents,
and further active agents.
[0229] A typical formulation is prepared by mixing a compound of
the present invention and a carrier or excipient. Suitable carriers
and excipients are well known to those skilled in the art and are
described in detail in, e.g., Ansel, Howard C., et al., Ansel's
Pharmaceutical Dosage Forms and Drug Delivery Systems.
Philadelphia: Lippincott, Williams & Wilkins, 2004; Gennaro,
Alfonso R., et al. Remington: The Science and Practice of Pharmacy.
Philadelphia: Lippincott, Williams & Wilkins, 2000; and Rowe,
Raymond C. Handbook of Pharmaceutical Excipients. Chicago,
Pharmaceutical Press, 2005. The formulations may also include one
or more buffers, stabilizing agents, surfactants, wetting agents,
lubricating agents, emulsifiers, suspending agents, preservatives,
antioxidants, opaquing agents, glidants, processing aids,
colorants, sweeteners, perfuming agents, flavoring agents, diluents
and other known additives to provide an elegant presentation of the
drug (i.e., a compound of the present invention or pharmaceutical
composition thereof) or aid in the manufacturing of the
pharmaceutical product (i.e., medicament).
[0230] An example of a suitable oral dosage form is a tablet
containing about 20 to 1000 mg of the compound of the invention
compounded with about 30 to 90 mg anhydrous lactose, about 5 to 40
mg sodium croscarmellose, about 5 to 30 mg polyvinylpyrrolidone
(PVP) K30, and about 1 to 10 mg magnesium stearate. The powdered
ingredients are first mixed together and then mixed with a solution
of the PVP. The resulting composition can be dried, granulated,
mixed with the magnesium stearate and compressed to tablet form
using conventional equipment. An example of an aerosol formulation
can be prepared by dissolving the compound, for example 20 to 1000
mg, of the invention in a suitable buffer solution, e.g. a
phosphate buffer, adding a tonicifier, e.g. a salt such sodium
chloride, if desired. The solution may be filtered, e.g., using a
0.2 micron filter, to remove impurities and contaminants.
[0231] An embodiment, therefore, includes a pharmaceutical
composition comprising a compound of formula (I) or
pharmaceutically acceptable salts or enantiomers or diastereomers
thereof.
[0232] In a further embodiment includes a pharmaceutical
composition comprising a compound of formula (I) or
pharmaceutically acceptable salts or enantiomers or diastereomers
thereof, together with a pharmaceutically acceptable carrier or
excipient.
[0233] Another embodiment includes a pharmaceutical composition
comprising a compound of formula (I) or pharmaceutically acceptable
salts or enantiomers or diastereomers thereof for use in the
treatment of hepatitis B virus infection.
[0234] Indications and Methods of Treatment
[0235] The present invention provides methods for treating or
preventing a hepatitis B viral infection and/or hepatitis C viral
infection in a patient in need thereof.
[0236] The present invention further provides methods for
introducing a therapeutically effective amount of a compound of
formula (I) or other compounds of the invention into the blood
stream of a patient for the treatment and/or prevention of
hepatitis B and/or C viral infection.
[0237] The methods of the present invention are particularly well
suited for human patients. In particular, the methods and doses of
the present invention can be useful for, but not limited to, HBV
and/or HCV infected patients. The methods and doses of the present
invention are also useful for patients undergoing other antiviral
treatments. The prevention methods of the present invention are
particularly useful for patients at risk of viral infection. These
patients include, but are not limited to health care workers, e.g.,
doctors, nurses, hospice care givers; military personnel; teachers;
childcare workers; patients traveling to, or living in, foreign
locales, in particular third world locales including social aid
workers, missionaries, and foreign diplomats. Finally, the methods
and compositions include the treatment of refractory patients or
patients resistant to treatment such as resistance to reverse
transcriptase inhibitors, protease inhibitors, etc.
[0238] Another embodiment includes a method of treating or
preventing hepatitis B viral infection and/or hepatitis C viral
infection in a mammal in need of such treatment, wherein the method
comprises administering to said mammal a therapeutically effective
amount of a compound of formula (I) or enantiomers, diastereomers,
prodrugs or pharmaceutically acceptable salts thereof.
BRIEF DESCRIPTION OF THE FIGURES
[0239] FIG. 1 Single crystal X-ray diffraction of Example 41-B.
[0240] FIG. 2 Single crystal X-ray diffraction of Example 42-A.
[0241] FIG. 3 Single crystal X-ray diffraction of Example 43-B.
[0242] FIG. 4 shows the HBV DNA, HBsAg, and anti-HBs antibody level
of the AAV-HBV infected mice treated with Vehicle, Example 43-A at
10 mg/kg QOD and QW for 42 days. The results are presented as
mean.+-.SEM. LLOQ: lower limit of quantification.
[0243] FIG. 5 shows the HBV DNA, HBsAg, and anti-HBs antibody
levels of AAV-HBV infected mice treated with Vehicle, Example 41-A
at 1, 3, 10 mg/kg QOD, and 10 mg/kg QW for 42 days. The results are
presented as mean.+-.SEM. LLOQ: lower limit of quantification.
[0244] FIG. 6 shows the HBV DNA, HBsAg, and anti-HBs antibody
levels of AAV-HBV infected mice treated with Vehicle, Example 42-A
at 1, 3, and 10 mg/kg QOD for 42 days. The results are presented as
mean.+-.SEM. LLOQ: lower limit of quantification.
[0245] FIG. 7 shows the HBV DNA, HBsAg, and anti-HBs antibody
levels of AAV-HBV infected mice treated with Vehicle, Example 41-B
at 1, 3, and 10 mg/kg QOD for 42 days. The results are presented as
mean.+-.SEM. LLOQ: lower limit of quantification.
EXAMPLES
[0246] The invention will be more fully understood by reference to
the following examples. They should not, however, be construed as
limiting the scope of the invention.
ABBREVIATIONS
[0247] aq. aqueous [0248] BSA: N, O-bis(trimethylsilyl)acetamide
[0249] CDI: N,N'-carbonyl diimidazole [0250] DIEPA: N,
N-diethylpropylamine [0251] DBU: 1,8-Diazabicycloundec-7-ene [0252]
DPPA: diphenylphosphoryl azide [0253] EC.sub.50: the molar
concentration of an agonist, which produces 50% of the maximum
possible response for that agonist. [0254] EDC:
N1-((ethylimino)methylene)-N3,N3-diethylpropane-1,3-diamine [0255]
EtOAc or EA: ethyl acetate [0256] HATU:
(1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium
3-oxid hexafluorophosphate) [0257] hr(s): hour(s) [0258] HPLC: high
performance liquid chromatography [0259] HOBt:
N-hydroxybenzotriazole [0260] MS (ESI): mass spectroscopy (electron
spray ionization) [0261] m-CPBA: 3-chloroperbenzoic acid [0262]
MTEB: methyl tert-butyl ether [0263] NMP: N-methylpyrrolidone
[0264] obsd. observed [0265] PE: petroleum ether [0266] PMB:
p-methoxybenzyl [0267] PPA: polyphosphoric acid [0268] QOD every
other day [0269] QW once a week [0270] RT or rt: room temperature
[0271] sat. saturated [0272] TFA: trifluoroacetic acid [0273] TEA:
triethylamine [0274] V/V volume ratio
[0275] General Experimental Conditions
[0276] Intermediates and final compounds were purified by flash
chromatography using one of the following instruments: i) Biotage
SP1 system and the Quad 12/25 Cartridge module. ii) ISCO
combi-flash chromatography instrument. Silica gel Brand and pore
size: i) KP-SIL 60 .ANG., particle size: 40-60 .mu.m; ii) CAS
registry NO: Silica Gel: 63231-67-4, particle size: 47-60 micron
silica gel; iii) ZCX from Qingdao Haiyang Chemical Co., Ltd, pore:
200-300 or 300-400.
[0277] Intermediates and final compounds were purified by
preparative HPLC on reversed phase column using X Bridge.TM. Perp
C18 (5 .mu.m, OBD.TM. 30.times.100 mm) column or SunFire.TM. Perp
C.sub.18 (5 .mu.m, OBD.TM. 30.times.100 mm) column.
[0278] LC/MS spectra were obtained using a Waters UPLC-SQD Mass.
Standard LC/MS conditions were as follows (running time 3 minutes):
[0279] Acidic condition: A: 0.1% formic acid and 1% acetonitrile in
H.sub.2O; B: 0.1% formic acid in acetonitrile; [0280] Basic
condition: A: 0.05% HN.sub.3.H.sub.2O in H.sub.2O; B:
acetonitrile.
[0281] Mass spectra (MS): generally only ions which indicate the
parent mass are reported, and unless otherwise stated the mass ion
quoted is the positive mass ion (M+H).sup.+.
[0282] NMR Spectra were obtained using Bruker Avance 400 MHz.
[0283] All reactions involving air-sensitive reagents were
performed under an argon atmosphere. Reagents were used as received
from commercial suppliers without further purification unless
otherwise noted.
PREPARATIVE EXAMPLES
Preparation of Intermediate
Intermediate AA
N-methyl-N-propyl-carbamoyl chloride
##STR00009##
[0285] To a mixture of N-methylpropan-1-amine (5 g, 68.4 mmol) and
sodium hydrogencarbonate (11.5 g, 137 mmol) in DCM (70 mL) at
0.degree. C. was added bis(trichloromethyl) carbonate (8.11 g, 27.3
mmol) in DCM (30 mL) dropwise. The mixture was stirred at room
temperature for 2 hrs and filtered. The filtrate was concentrated
in vacuo. The obtained N-methyl-N-propyl-carbamoyl chloride (7.2 g,
Intermediate AA) was used for next step without further
purification.
Intermediate AB
N-(2-Methoxyethyl)-N-methyl-carbamoyl chloride
##STR00010##
[0287] Intermediate AB was prepared in analogy to Intermediate AA
by using 2-methoxy-N-methyl-ethanamine instead of
N-methylpropan-1-amine. N-(2-Methoxyethyl)-N-methyl-carbamoyl
chloride (8 g, Intermediate AB) was obtained and used for next step
without further purification.
Intermediate AC
N-Ethyl-N-propyl-carbamoyl chloride
##STR00011##
[0289] Intermediate AC was prepared in analogy to Intermediate AA
by using N-ethylpropan-1-amine instead of N-methylpropan-1-amine.
N-Ethyl-N-propyl-carbamoyl chloride (12.6 g, Intermediate AC) was
obtained as a yellow oil and used for next step without further
purification.
Intermediate AD
N-Ethyl-N-(2-methoxyethyl)carbamoyl chloride
##STR00012##
[0291] Intermediate AD was prepared in analogy to Intermediate AA
by using N-ethyl-2-methoxyethanamine instead of
N-methylpropan-1-amine. The crude
N-ethyl-N-(2-methoxyethyl)carbamoyl chloride (2.5 g, Intermediate
AD) was obtained as a light yellow oil and used for next step
without further purification.
Intermediate AE
N-Butyl-N-ethyl-carbamoyl chloride
##STR00013##
[0293] Intermediate AE was prepared in analogy to Intermediate AA
by using N-ethylbutan-1-amine (5 g) instead of
N-methylpropan-1-amine. The crude N-butyl-N-ethyl-carbamoyl
chloride (6.3 g, Intermediate AE) was obtained as a light yellow
oil and used for next step without further purification.
Intermediate AF
N-(2-Methoxyethyl)-N-propyl-carbamoyl chloride
##STR00014##
[0295] Intermediate AF was prepared in analogy to Intermediate AA
by using N-(2-methoxyethyl)propan-1-amine (2 g, 17.1 mmol) instead
of N-methylpropan-1-amine. The crude
N-(2-methoxyethyl)-N-propyl-carbamoyl chloride (2.5 g, Intermediate
AF) was obtained as a light yellow oil and used for next step
without further purification.
Intermediate AG
N,N-Bis(2-methoxyethyl)carbamoyl chloride
##STR00015##
[0297] Intermediate AG was prepared in analogy to Intermediate AA
by using of bis(2-methoxyethyl)amine (2 g, 15 mmol) instead of
N-methylpropan-1-amine. The crude product
N,N-bis(2-methoxyethyl)carbamoyl chloride (2.6 g, Intermediate AG)
was obtained as a light yellow oil and used for next step without
further purification.
Intermediate AH
Azetidine-1-carbonyl chloride
##STR00016##
[0299] Intermediate AH was prepared in analogy to Intermediate AA
by using azetidine hydrochloride (10.7 g, 107 mmol) and sodium
bicarbonate (3 equiv.) instead of N-methylpropan-1-amine and sodium
bicarbonate (2 equiv.). The crude azetidine-1-carbonyl chloride
(1.5 g, Intermediate AH) was obtained as a light yellow oil and
used for next step without further purification.
Intermediate AI
N-Isopropyl-N-methyl-carbamoyl chloride
##STR00017##
[0301] Intermediate AI was prepared in analogy to Intermediate AA
by using N-methylpropan-2-amine (5 g, 19.4 mmol) instead of
N-methylpropan-1-amine. The crude N-isopropyl-N-methyl-carbamoyl
chloride (8.6 g, Intermediate AI) was obtained as a yellow oil and
used for next step without further purification.
Intermediate AL
N-Isobutyl-N-methyl-carbamoyl chloride
##STR00018##
[0303] Intermediate AL was prepared in analogy to Intermediate AA
by using N-2-dimethylpropan-1-amine (4.8 g) instead of
N-methylpropan-1-amine. The crude N-isobutyl-N-methyl-carbamoyl
chloride (8.1 g, Intermediate AL) was obtained as a light yellow
oil and used for next step without further purification.
Intermediate AP
Ethyl 2-[chlorocarbonyl)methyl)amino]acetate
##STR00019##
[0305] To a solution of triphosgene (728 mg, 2.45 mmol) in DCM (5
mL) was added a solution of ethyl 2-(methylamino)acetate
hydrochloride (1.3 g, 8.46 mmol) and pyridine (1 mL) in DCM (5 mL)
dropwise at 0.degree. C. The reaction mixture became orange and a
yellow precipitate appeared, then it was allowed to warm to room
temperature. After stirred for 1 hr, aqueous HCl (0.1N, 25 mL) was
added to the reaction mixture, the organic layer was separated,
washed with 0.1 N HCl (10 mL) twice, brine (10 mL), dried over
Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude ethyl
2-[chlorocarbonyl(methyl)amino]acetate (2.0 g, Intermediate AP) as
a light yellow oil and used for next step without further
purification.
Intermediate AR
tert-Butyl 3-[chlorocarbonyl(methyl)amino]propanoate
##STR00020##
[0306] Step 1: Preparation of tert-butyl 3-(methylamino)propanoate
(Compound AR-1)
##STR00021##
[0308] To a solution of tert-butyl acrylate (3 g) in DMF (40 mL)
was added methylamine hydrochloride (4.74 g, 70 mmol) and DBU (21.4
g, 140 mmol) at -45.degree. C. Then the reaction temperature was
allowed to warm to -10.degree. C. The reaction mixture was stirred
at the same temperature for 2.5 hrs. Et.sub.2O (200 mL) was added
and the resulting mixture was washed with brine (50 mL) four times.
The separated organic layer was dried over Na.sub.2SO.sub.4 and
concentrated in vacuo to afford tert-butyl
3-(methylamino)propanoate (3.5 g, Compound AR-1) as a light yellow
oil.
Step 2: Preparation of tert-butyl
3-[chlorocarbonyl(methyl)amino]propanoate (Intermediate AR)
##STR00022##
[0310] Intermediate AR was prepared in analogy to Intermediate AP
by using tert-butyl 3-(methylamino)propanoate (3.4 g, Compound
AR-1) instead of ethyl 2-(methylamino)acetate hydrochloride. The
crude tert-butyl 3-[chlorocarbonyl(methyl)amino]propanoate (3.5 g,
Intermediate AR) was obtained and used for next step without
further purification.
Intermediate AS
Ethyl (2S)-2-[chlorocarbonyl(methyl)amino]propanoate
##STR00023##
[0311] Step 1: Preparation of ethyl (2S)-2-(methylamino)propanoate
hydrochloride (Compound AS-1)
##STR00024##
[0313] To a solution of (2S)-2-(methylamino)propanoic acid (1 g,
9.70 mmol) in EtOH (10 mL) was added SOCl.sub.2 (1.50 g, 12.61
mmol) dropwise at 0.degree. C. in 0.5 hr. The reaction mixture was
stirred at 25.degree. C. for 15.5 hrs, then diluted with EA (20
mL), washed with H.sub.2O (5 mL) and brine (5 mL). The organic
layer was dried over Na.sub.2SO.sub.4 and concentrated in vacuo.
Ethyl (2S)-2-(methylamino)propanoate hydrochloride (1.8 g, Compound
AS-1) was obtained as a yellow oil and used for next step without
further purification.
Step 2: Preparation of ethyl (2S)-2-(methylamino)propanoate
(Compound AS-2)
##STR00025##
[0315] A solution of ethyl (2S)-2-(methylamino)propanoate
hydrochloride (1.8 g, Compound AS-1) in EA (10 mL) was adjusted to
pH=8 with 10 wt. % aqueous NaHCO.sub.3. The reaction mixture was
stirred at room temperature for 0.5 hr. The organic layer was
washed with brine (5 mL), dried over Na.sub.2SO.sub.4 and
concentrated in vacuo. Ethyl (2S)-2-(methylamino)propanoate (620
mg, Compound AS-2) was obtained as a yellow oil and used for the
next step without further purification.
Step 3: Preparation of ethyl
(2S)-2-[chlorocarbonyl(methyl)amino]propanoate (Intermediate
AS)
##STR00026##
[0317] Intermediate AS was prepared in analogy to Intermediate AP
by using ethyl (2S)-2-(methylamino)propanoate (260 mg, Compound
AS-2) instead of ethyl 2-(methylamino)acetate hydrochloride. The
crude ethyl (2S)-2-[chlorocarbonyl(methyl)amino]propanoate (200 mg,
Intermediate AS) was obtained as a yellow oil and used for the next
step without further purification.
Intermediate AT
tert-Butyl
(2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate
##STR00027##
[0318] Step 1: Preparation of tert-butyl
(2S)-4-methyl-2-(methylamino)pentanoate (Compound AT-1)
##STR00028##
[0320] 2-Methylpropene (25 g, 446 mmol) was bubbled into DCM (50
mL) at -78.degree. C. Then the 2-methylpropene solution was added
to a solution of (S)-4-methyl-2-(methylamino)pentanoic acid
hydrochloride (500 mg, 2.75 mmol) and H.sub.2SO.sub.4 (3.68 g, 2
mL, 37.5 mmol) in dioxane (20 mL) at 0.degree. C. The reaction
mixture was stirred at room temperature for 18 hrs in a sealed
tube. The reaction solution was poured into an ice cold aqueous KOH
solution (8.4 g in water (30 mL)) and the resulting mixture was
extracted with DCM (50 mL) twice. The combined organic layer was
washed with brine (30 mL) twice, dried over Na.sub.2SO.sub.4 and
concentrated in vacuo to afford the crude product tert-butyl
(2S)-4-methyl-2-(methylamino)pentanoate (Compound AT-1) as a light
yellow oil.
Step 2: Preparation of tert-butyl
(2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate
(Intermediate AT)
##STR00029##
[0322] Intermediate AT was prepared in analogy to Intermediate AP
by using tert-butyl (2S)-4-methyl-2-(methylamino)pentanoate (300
mg, Compound AT-1) instead of ethyl 2-(methylamino)acetate
hydrochloride. The crude tert-butyl
(2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate (350 mg,
Intermediate AT) was obtained as a light yellow oil and used for
the next step without further purification.
Intermediate AU
Isopropyl
(2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate
##STR00030##
[0323] Step 1: Preparation of isopropyl
(2S)-4-methyl-2-(methylamino)pentanoate hydrochloride (Compound
AU-1)
##STR00031##
[0325] To a solution of (S)-4-methyl-2-(methylamino)pentanoic acid
hydrochloride (0.5 g) in i-PrOH (7.8 g, 10 mL) was added thionyl
chloride (655 mg, 402 .mu.L) dropwise at room temperature. The
resulting mixture was stirred and refluxed for 16 hrs and then
concentrated in vacuo. The residue was basified with saturated
aqueous NaHCO.sub.3 (30 mL) and extracted with DCM (50 mL). The
organic layer was washed with brine, dried over Na.sub.2SO.sub.4
and concentrated in vacuo. The residue was salified with HCl/EtOAc
(10 mL, 1 mmol/mL) and concentrated to afford isopropyl
(2S)-4-methyl-2-(methylamino)pentanoate hydrochloride (510 mg,
Compound AU-1) as a white solid.
Step 2: Preparation of isopropyl
(2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate
(Intermediate AU)
##STR00032##
[0327] Intermediate AU was prepared in analogy to Intermediate AP
by using isopropyl (2S)-4-methyl-2-(methylamino)pentanoate
hydrochloride (500 mg, Compound AU-1) instead of ethyl
2-(methylamino)acetate hydrochloride. The crude isopropyl
(2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate (650 mg,
Intermediate AU) was obtained as a light yellow oil and used for
the next step without further purification.
Intermediate AV
Ethyl (2S)-2-[chlorocarbonyl(methyl)amino]-3-methyl-butanoate
##STR00033##
[0328] Step 1: Preparation of ethyl
(2S)-3-methyl-2-(methylamino)butanoate hydrochloride (Compound
AV-1)
##STR00034##
[0330] To a solution of (2S)-3-methyl-2-(methylamino)butanoic acid
(1.0 g, 7.6 mmol) in EtOH (10 mL) was added thionyl chloride (2.45
g, 21 mmol) dropwise at room temperature. The resulting mixture was
stirred and refluxed for 16 hrs and then concentrated in vacuo. The
residue was basified with saturated aqueous NaHCO.sub.3 (30 mL) and
extracted with DCM (50 mL) twice. The combined organic layer was
washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in
vacuo. The residue was dissolved in HCl/EtOAc (10 mL, 1 M) and
concentrated to afford ethyl (2S)-3-methyl-2-(methylamino)butanoate
hydrochloride (1.9 g, Compound AV-1) as a white solid.
Step 2: Preparation of ethyl
(2S)-2-[chlorocarbonyl(methyl)amino]-3-methyl-butanoate
(Intermediate AV)
##STR00035##
[0332] Intermediate AV was prepared in analogy to Intermediate AP
by using ethyl (2S)-3-methyl-2-(methylamino)butanoate hydrochloride
(500 mg, Compound AV-1) instead of ethyl 2-(methylamino)acetate
hydrochloride. The crude ethyl
(2S)-2-[chlorocarbonyl(methyl)amino]-3-methyl-butanoate (600 mg,
Intermediate AV) was obtained as a light yellow oil and used for
the next step without further purification.
Intermediate AW
Ethyl (2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate
##STR00036##
[0333] Step 1: Preparation of ethyl
(2S)-4-methyl-2-(methylamino)pentanoate hydrochloride (Compound
AW-1)
##STR00037##
[0335] To a solution of (2S)-4-methyl-2-(methylamino)pentanoic acid
(1 g, 6.9 mmol) in EtOH (10 mL) was added thionyl chloride (1.07 g,
8.3 mmol) dropwise at room temperature. The resulting mixture was
stirred at reflux for 16 hrs and then concentrated in vacuo. The
residue was basified with saturated aqueous NaHCO.sub.3 (30 mL) and
extracted with DCM (50 mL). The organic layer was washed with
brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The
residue was salified with HCl/EtOAc (10 mL, 1 mmol/mL) and
concentrated to give ethyl (2S)-4-methyl-2-(methylamino)pentanoate
hydrochloride (1.8 g, Compound AW-1) as a white solid.
Step 2: Preparation of ethyl
(2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate
(Intermediate AW)
##STR00038##
[0337] Intermediate AW was prepared in analogy to Intermediate AP
by using ethyl (2S)-4-methyl-2-(methylamino)pentanoate
hydrochloride (610 mg, AW-1) instead of ethyl
2-(methylamino)acetate hydrochloride. The crude ethyl
(2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate (280 mg,
Intermediate AW) was obtained as a light yellow oil and used for
the next step without further purification.
Intermediate AX
Ethyl (2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate
##STR00039##
[0339] Intermediate AX was prepared in analogy to Intermediate AP
by using (S)-ethyl-2-(methylamino)-3-phenyl propanoate instead of
ethyl 2-(methylamino)acetate hydrochloride. The crude ethyl
(2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate (200 mg,
Intermediate AX) was obtained as a light yellow oil and used for
the next step without further purification
Intermediate AY
Isopropyl
(2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate
##STR00040##
[0341] Intermediate AY was prepared in analogy to Intermediate AP
by using isopropyl (2S)-2-(methylamino)-3-phenyl-propanoate (190
mg) instead of ethyl 2-(methylamino)acetate hydrochloride. The
crude isopropyl
(2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate (220 mg,
Intermediate AY) was obtained as light brown oil and used for the
next step without further purification.
Intermediate AZ
(S)-tert-butyl
2-((chlorocarbonyl)(methyl)amino)-3-phenylpropanoate
##STR00041##
[0343] Step 1: Preparation of tert-butyl
(2S)-2-(methylamino)-3-phenyl-propanoate (Compound AZ-1)
##STR00042##
[0344] 2-Methylpropene (25 g, 446 mmol) was bubbled into DCM (50
mL) at -78.degree. C. Then the 2-methylpropene solution was added
to a solution of (S)-2-(methylamino)-3-phenylpropanoic acid (500
mg) and H.sub.2SO.sub.4 (3.68 g, 2 mL) in dioxane (20 mL) at
0.degree. C. The reaction mixture was stirred at room temperature
for 18 hrs in a sealed tube. The reaction mixture was poured into
an ice cold aqueous KOH solution (8.4 g in water (30 mL)) and the
resulting mixture was extracted with DCM (50 mL) twice. The organic
layer was washed with brine (30 mL) 2 times, dried over
Na.sub.2SO.sub.4 and concentrated in vacuo to afford tert-butyl
(2S)-2-(methylamino)-3-phenyl-propanoate (710 mg, Compound AZ-1) as
a light yellow oil.
Step 2: Preparation of (S)-tert-butyl
2-((chlorocarbonyl)(methyl)amino)-3-phenylpropanoate (Intermediate
AZ)
##STR00043##
[0346] Intermediate AZ was prepared in analogy to intermediate AP
by using tert-butyl (2S)-2-(methylamino)-3-phenyl-propanoate
(Compound AZ-1) instead of ethyl 2-(methylamino)acetate
hydrochloride. The crude tert-butyl
(2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate (360 mg,
Intermediate AZ) was obtained as a light yellow oil and used for
next step without further purification
Intermediate BA
N-[2-[acetyl(methyl)amino]ethyl]-N-methyl-carbamoyl chloride
##STR00044##
[0347] Step 1: Preparation of tert-butyl
N-[2-[acetyl(methyl)amino]ethyl]-N-methyl-carbamate (Compound
BA-1)
##STR00045##
[0349] To a solution of tert-butyl
methyl(2-(methylamino)ethyl)carbamate (1.13 g, 6 mmol) in pyridine
(10 mL) was added acetic anhydride (3.06 g, 30 mmol) dropwise at
0.degree. C. Then the solution was stirred at room temperature for
0.5 hr. The solvent was removed in vacuo and the residue was
partitioned between EtOAc (50 mL) and saturated aqueous NaHCO.sub.3
(25 mL). The organic layer was separated, washed with brine (20
mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo to
afford tert-butyl
N-[2-[acetyl(methyl)amino]ethyl]-N-methyl-carbamate (1.28 g,
Compound BA-1) as a yellow oil.
Step 2: Preparation of N-methyl-N-(2-(methylamino)ethyl)acetamide
hydrochloride (Compound BA-2)
##STR00046##
[0351] A mixture of tert-butyl
N-[2-[acetyl(methyl)amino]ethyl]-N-methyl-carbamate (1.1 g,
Compound BA-1) in HCl/EtOAc (10 mL, 1N HCl in EtOAc) was stirred at
room temperature for 2 hrs, then the mixture was filtered. The
collected solid was washed with EtOAc (5 mL) three times and dried
in vacuo to afford the crude
N-methyl-N-(2-(methylamino)ethyl)acetamide hydrochloride (460 mg,
Compound BA-2) as a white solid.
Step 3: Preparation of
N-[2-[acetyl(methyl)amino]ethyl]-N-methyl-carbamoyl chloride
(Intermediate BA)
##STR00047##
[0353] Intermediate BA was prepared in analogy to Intermediate AP
by using N-methyl-N-(2-(methylamino)ethyl)acetamide hydrochloride
(200 mg, Compound BA-2) instead of ethyl 2-(methylamino)acetate
hydrochloride The crude
N-[2-[acetyl(methyl)amino]ethyl]-N-methyl-carbamoyl chloride (300
mg, Intermediate BA) was obtained and used for next step without
further purification.
Intermediate BB
Methyl
N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate
##STR00048##
[0354] Step 1: Preparation of methyl
N-methyl-N-[2-(methylamino)ethyl]carbamate (Compound BB-1)
##STR00049##
[0356] To a solution of N,N-dimethylethane-1,2-diamine (10 g) in
THF (40 mL) was added methyl chloroformate (1.92 g) dropwise at
-70.degree. C. in 1 hr. The mixture was stirred at 25.degree. C.
for 15 hrs and then filtered and washed with water and brine. The
organic layer was dried and concentrated to afford a yellow
residue, which was purified by column chromatography to afford
methyl N-methyl-N-[2-(methylamino)ethyl]carbamate (2 g, Compound
BB-1) as a colorless oil.
Step 2: Preparation of methyl
N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate
(Intermediate BB)
##STR00050##
[0358] Intermediate BB was prepared in analogy to Intermediate AP
by using methyl N-methyl-N-[2-(methylamino)ethyl]carbamate (2.0 g,
Compound BB-1) instead of ethyl 2-(methylamino)acetate
hydrochloride. The crude methyl
N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate (2.2 g,
Intermediate BB) was obtained and used for next step without
further purification.
Intermediate BC
tert-Butyl
N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate
##STR00051##
[0359] Step 1: Preparation of tert-butyl
N-methyl-N-[2-(methylamino)ethyl]carbamate (Compound BC-1)
##STR00052##
[0361] To a solution of N,N'-dimethylethane-1,2-diamine (40.4 g) in
DCM (300 mL) was added a solution of Boc.sub.2O (10 g, 10.6 mL,
45.8 mmol) in DCM (100 mL) dropwise at 0.degree. C. over 1 hr. The
reaction mixture was stirred at room temperature for 18 hrs. The
organic layer was washed with saturated aqueous NaHCO.sub.3 (50
mL), brine (50 mL), dried over Na.sub.2SO.sub.4 and concentrated in
vacuo. The residue was purified by column chromatography to afford
tert-butyl N-methyl-N-[2-(methylamino)ethyl]carbamate (6.8 g,
Compound BC-1) as a yellow oil. .sup.1H NMR (400 MHz, CDCl.sub.3)
.delta. ppm: 3.34 (br. s., 2H), 2.89 (s, 3H), 2.74 (t, J=6.7 Hz,
2H), 2.46 (s, 3H), 1.47 (s, 9H).
Step 2: Preparation of tert-butyl
N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate
(Intermediate BC)
##STR00053##
[0363] Intermediate BC was prepared in analogy to Intermediate AP
by using tert-butyl N-methyl-N-[2-(methylamino)ethyl]carbamate
(1.15 g, Compound BC-1) instead of ethyl 2-(methylamino)acetate
hydrochloride. The crude tert-butyl
N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate (1.3 g,
Intermediate BC) was obtained and used for the next step without
further purification.
Intermediate BD
Ethyl
N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate
##STR00054##
[0364] Step 1: Preparation of ethyl
N-methyl-N-[2-(methylamino)ethyl]carbamate (Compound BD-1)
##STR00055##
[0366] To a solution of N,N-dimethylethane-1,2-diamine (10 g) in
DCM (40 mL) was added ethyl chloroformate (2.58 g) dropwise at
-70.degree. C. in 1 hr. The reaction mixture was stirred at
25.degree. C. for 15 hrs and then filtered and washed with water
and brine. The organic layer was dried and concentrated in vacuo.
The yellow residue was purified by column chromatography to afford
ethyl N-methyl-N-[2-(methylamino)ethyl]carbamate (2 g, Compound
BD-1) as a colorless oil.
Step 2: Preparation of ethyl
N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate
(Intermediate BD)
##STR00056##
[0368] Intermediate BD was prepared in analogy to Intermediate AA
by using ethyl N-methyl-N-[2-(methylamino)ethyl]carbamate (Compound
BD-1) instead of ethyl 2-(methylamino)acetate hydrochloride. The
crude ethyl
N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate (2.2 g,
Intermediate BD) was obtained and used for the next step without
further purification.
Intermediate BE
2-[Chlorocarbonyl(methyl)amino]ethyl N-butyl-N-methyl-carbamate
##STR00057##
[0369] Step 1: Preparation of tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (Compound BE-1)
##STR00058##
[0371] To a solution of 2-(methylamino)ethanol (10 g, 133.14 mmol)
in DCM (10 mL) was added Boc.sub.2O (34.87 g, 159.77 mmol) at
25.degree. C. The mixture was stirred at 25.degree. C. for 16 hrs
and then concentrated. The residue was purified by column
chromatography to afford tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (20 g, Compound BE-1) as a
colorless oil.
Step 2: Preparation of 2-[tert-butoxycarbonyl(methyl)amino]ethyl
N-butyl-N-methyl-carbamate (Compound BE-2)
##STR00059##
[0373] To a solution of tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (880 mg, Compound BE-1) and
Et.sub.3N (1 g, 10.08 mmol) in DCM (10 mL) was added
N-butyl-N-methyl-carbamoyl chloride (903 mg, 7.04 mmol) dropwise at
-10.degree. C. in 1 hr. The reaction mixture was stirred at
25.degree. C. for 15 hrs and then filtered and washed with water
and brine. The organic layer was dried and concentrated to afford
2-[tert-butoxycarbonyl(methyl)amino]ethyl
N-butyl-N-methyl-carbamate (2 g, Compound BE-2) as a colorless
oil.
Step 3: Preparation of 2-(methylamino)ethyl
N-butyl-N-methyl-carbamate hydrochloride (Compound BE-3)
##STR00060##
[0375] To a solution of 2-[tert-butoxycarbonyl(methyl)amino]ethyl
N-butyl-N-methyl-carbamate (1 g, Compound BE-2) was added HCl/EA
(40 mL, 1M). The reaction mixture was stirred at 0.degree. C. for
0.5 hr and warmed to 25.degree. C. and stirred for another 15.5
hrs. The reaction mixture was concentrated to afford
2-(methylamino)ethyl-N-butyl-N-methyl-carbamate hydrochloride (400
mg, Compound BE-3) as a colorless oil.
Step 4: Preparation of 2-[chlorocarbonyl(methyl)amino]ethyl
N-butyl-N-methyl-carbamate (Intermediate BE)
##STR00061##
[0377] Intermediate BE was prepared in analogy to Intermediate AP
by using 2-(methylamino)ethyl N-butyl-N-methyl-carbamate
hydrochloride (374 mg, Compound BE-3) instead of ethyl
2-(methylamino)acetate hydrochloride. The crude
2-[chlorocarbonyl(methyl)amino]ethyl N-butyl-N-methyl-carbamate
(330 mg, Intermediate BE) was obtained and used for next step
without further purification.
Intermediate BF
2-[Chlorocarbonyl(methyl)amino]ethyl pyrrolidine-1-carboxylate
##STR00062##
[0378] Step 1: Preparation of tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (Compound BF-1)
##STR00063##
[0380] To a solution of 2-(methylamino)ethanol (10 g, 133.14 mmol)
in DCM (10 mL) was added Boc.sub.2O (34.87 g, 159.77 mmol) at
25.degree. C. The mixture was stirred at 25.degree. C. for 16 hrs.
The reaction mixture was concentrated to give the residue, which
was purified by column chromatography to afford tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (20 g, Compound BF-1) as a
colorless oil.
Step 2: Preparation of 2-[tert-butoxycarbonyl(methyl)amino]ethyl
pyrrolidine-1-carboxylate (Compound BF-2)
##STR00064##
[0382] To a solution of tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (300 mg, 1.71 mmol, Compound
BF-1) and Et.sub.3N (578 mg, 5.71 mmol) in DCM (5 mL) was added
pyrrolidine-1-carbonyl chloride (458 mg, 3.4 mmol) dropwise at
0.degree. C. for 0.5 hr and then stirred at 25.degree. C. for 15.5
hrs. After filtration, the filtrate was washed with water and
brine. The organic layer was dried and concentrated to afford the
2-[tert-butoxycarbonyl(methyl)amino]ethyl pyrrolidine-1-carboxylate
(335 mg, Compound BF-2) as a colorless oil.
Step 3: Preparation of 2-(methylamino)ethyl
pyrrolidine-1-carboxylate hydrochloride (Compound BF-3)
##STR00065##
[0384] 2-[tert-butoxycarbonyl(methyl)amino]ethyl
pyrrolidine-1-carboxylate (335 mg, Compound BF-2) was added to HCl
in EA (12.3 mL, 1M) and the mixture was stirred at 0.degree. C. for
0.5 hr and then at 25.degree. C. for another 15.5 hrs. The reaction
mixture was concentrated to afford 2-(methylamino)ethyl
pyrrolidine-1-carboxylate hydrochloride (300 mg, Compound BF-3) as
a colorless oil.
Step 4: Preparation of 2-[chlorocarbonyl(methyl)amino]ethyl
pyrrolidine-1-carboxylate (Intermediate BF)
##STR00066##
[0386] Intermediate BF was prepared in analogy to Intermediate AP
by using the 2-(methylamino)ethyl pyrrolidine-1-carboxylate
hydrochloride (299 mg, Compound BF-3) instead of ethyl
2-(methylamino)acetate hydrochloride. The crude
2-[chlorocarbonyl(methyl)amino]ethyl pyrrolidine-1-carboxylate (230
mg, Intermediate BF) was obtained and used for next step without
further purification.
Intermediate BG
2-[Chlorocarbonyl(methyl)amino]ethyl
N-methyl-N-propyl-carbamate
##STR00067##
[0387] Step 1: Preparation of tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (Compound BG-1)
##STR00068##
[0389] To a solution of 2-(methylamino)ethanol (10 g, 133.14 mmol)
in DCM (10 mL) was added Boc.sub.2O (34.87 g, 159.77 mmol) at
25.degree. C. The reaction mixture was stirred at 25.degree. C. for
16 hrs, then concentrated to give the residue, which was purified
by column chromatography to afford tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (20 g, Compound BG-1) as a
colorless oil.
Step 2: Preparation of
tert-butyl-N-methyl-N-[2-[methyl(propyl)carbamoyl]oxyethyl]carbamate
(Compound BG-2)
##STR00069##
[0391] To a solution of tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (265 mg, Compound BG-1) and
Et.sub.3N (1 mL, 5.71 mmol) in DCM (5 mL) was added
N-methyl-N-propyl-carbamoyl chloride (410 mg, 1.83 mmol) dropwise
at 0.degree. C. for 0.5 hr. The reaction mixture was stirred at
25.degree. C. for 15.5 hrs and then filtered and the filtrate was
washed with water and brine. The organic layer was dried and
concentrated to afford tert-butyl
N-methyl-N-[2-[methyl(propyl)carbamoyl]oxyethyl]carbamate (380 mg,
Compound BG-2) as a colorless oil.
Step 3: Preparation of 2-(methylamino)ethyl
N-methyl-N-propyl-carbamate hydrochloride (Compound BG-3)
##STR00070##
[0393] tert-butyl
N-methyl-N-[2-[methyl(propyl)carbamoyl]oxyethyl]carbamate (380 mg,
Compound BG-2) was added to HCl in EA (13.7 mL, 1M). The mixture
was stirred at 0.degree. C. for 0.5 hr. Then the mixture was
stirred at 25.degree. C. for another 15.5 hrs and concentrated to
afford 2-(methylamino)ethyl N-methyl-N-propyl-carbamate
hydrochloride (300 mg, Compound BG-3) as a colorless oil.
Step 4: Preparation of 2-[chlorocarbonyl(methyl)amino]ethyl
N-methyl-N-propyl-carbamate (Intermediate BG)
##STR00071##
[0395] Intermediate BG was prepared in analogy to Intermediate AP
by using 2-(methylamino)ethyl N-methyl-N-propyl-carbamate
hydrochloride (330 mg, Compound BG-3) instead of ethyl
2-(methylamino)acetate hydrochloride. The
2-[chlorocarbonyl(methyl)amino]ethyl-N-methyl-N-propyl-carbamate
(300 mg, Intermediate BG) was obtained and used for next step
without further purification.
Intermediate BH
2-[Chlorocarbonyl(methyl)amino]ethyl N,N-diethylcarbamate
##STR00072##
[0396] Step 1: Preparation of tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (Compound BH-1)
##STR00073##
[0398] To a solution of 2-(methylamino)ethanol (10 g, 133.14 mmol)
in DCM (10 mL) was added Boc.sub.2O (34.87 g, 159.77 mmol) at
25.degree. C. The mixture was stirred at 25.degree. C. for 16 hrs
and then concentrated, the residue was purified by column
chromatography to afford tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (20 g, Compound BH-1) as a
colorless oil.
Step 2: Preparation of
2-[tert-butoxycarbonyl(methyl)amino]ethyl-N,N-diethylcarbamate
(Compound BH-2)
##STR00074##
[0400] To a solution of tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (200 mg, 1.14 mmol, Compound
BH-1) and Et.sub.3N (578 mg, 5.71 mmol) in DCM (5 mL) was added
N,N-diethylcarbamoyl chloride (248 mg, 1.83 mmol) dropwise at
0.degree. C. for 0.5 hr and stirred at 25.degree. C. for 15.5 hrs.
After filtration, the filtrate was washed with water and brine. The
organic layer was dried and concentrated to afford the
2-[tert-butoxycarbonyl(methyl)amino]ethyl N,N-diethylcarbamate (313
mg, Compound BH-2) as a colorless oil.
Step 3: Preparation of 2-(methylamino)ethyl N,N-diethylcarbamate
hydrochloride (Compound BH-3)
##STR00075##
[0402] 2-[tert-butoxycarbonyl(methyl)amino]ethyl
N,N-diethylcarbamate (436 mg, 1.77 mmol, Compound BH-2) was added
to HCl in EA (17 mL, 1M). The mixture was stirred at 0.degree. C.
for 0.5 hr. Then the mixture was stirred at 25.degree. C. for
another 15.5 hrs and concentrated to afford 2-(methylamino)ethyl
N,N-diethylcarbamate hydrochloride (230 mg, Compound BH-3) as a
colorless oil.
Step 4: Preparation of 2-[chlorocarbonyl(methyl)amino]ethyl
N,N-diethylcarbamate (Intermediate BH)
##STR00076##
[0404] Intermediate BH was prepared in analogy to Intermediate AP
by using 2-(methylamino)ethyl N,N-diethylcarbamate hydrochloride
(274 mg, Compound BH-3) instead of ethyl 2-(methylamino)acetate
hydrochloride. The crude 2-[chlorocarbonyl(methyl)amino]ethyl
N,N-diethylcarbamate (250 mg, Intermediate BH) was obtained and
used for next step without further purification.
Intermediate BI
2-[Chlorocarbonyl(methyl)amino]ethyl ethyl carbonate
##STR00077##
[0405] Step 1: Preparation of tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (Compound BI-1)
##STR00078##
[0407] To a solution of 2-(methylamino)ethanol (1 g, 13.31 mmol) in
DCM (10 mL) was added Boc.sub.2O (3.49 g, 15.98 mmol) at 25.degree.
C. The reaction mixture was stirred at 25.degree. C. for 16 hrs,
then concentrated to give the crude product, which was purified by
column chromatography to afford tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (1.6 g, Compound BI-1) as a
colorless oil.
Step 2: Preparation of 2-[tert-butoxycarbonyl(methyl)amino]ethyl
methyl carbonate (Compound BI-2)
##STR00079##
[0409] To a solution of tert-butyl
N-(2-hydroxyethyl)-N-methyl-carbamate (1 g, Compound BI-1), DMAP
(0.1 g) and pyridine (1.15 g, 11.41 mmol) in EA (20 mL) was added
methyl chloroformate (1.21 g, 11.15 mmol) dropwise at -10.degree.
C. The mixture was stirred at -10.degree. C. for 1 hr. The reaction
mixture was filtered and the filtrate was washed with 5% citric
acid and brine. The organic layer was dried and concentrated to
afford 2-[tert-butoxycarbonyl(methyl)amino]ethyl methyl carbonate
(1.22 g, Compound BI-2) as a colorless oil.
Step 3: Preparation of ethyl 2-(methylamino)ethyl carbonate
hydrochloride (Compound BI-3)
##STR00080##
[0411] 2-[tert-butoxycarbonyl(methyl)amino]ethyl methyl carbonate
(1.22 g, 4.94 mmol, Compound BI-2) was added to HCl in EA (10 mL,
40 mmol) and the mixture was stirred at 0.degree. C. for 0.5 hr and
at 25.degree. C. for another 15.5 hrs. The reaction mixture was
concentrated to afford ethyl 2-(methylamino)ethyl carbonate
hydrochloride (1.06 g, Compound BI-3).
Step 4: Preparation of 2-[chlorocarbonyl(methyl)amino]ethyl ethyl
carbonate (Intermediate BI)
##STR00081##
[0413] Intermediate BI was prepared in analogy to Intermediate AP
by using ethyl 2-(methylamino)ethyl carbonate hydrochloride (150
mg, Intermediate BI-3) instead of ethyl 2-(methylamino)acetate
hydrochloride. The crude 2-[chlorocarbonyl(methyl)amino]ethyl ethyl
carbonate (145 mg, Intermediate BI) was obtained and used for next
step without further purification.
PREPARATIVE EXAMPLES
Example 1
6-Amino-9-benzyl-N-methyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-c-
arboxamide
##STR00082##
[0414] Method A
Step 1: Preparation of
4-amino-3-benzyl-2-oxo-1H-imidazole-5-carbonitrile (Compound
1a)
##STR00083##
[0416] To a solution of aminomalononitrilep-toluenesulfonate (25 g,
98.5 mmol, TCI, Catalog number: A1119-25G) in dry THF (100 mL) was
added benzyl isocyanate (13.2 g, 98.5 mmol) and TEA (10.2 g, 79.0
mmol) at RT. After stirred at RT for 24 hrs, the reaction was
concentrated in vacuo and the residue was partitioned between EtOAc
(500 mL) and water (250 mL). The separated organic layer was washed
with brine (50 mL) twice, and extracted with sodium hydroxide
solution (50 mL, 1N) twice. The combined sodium hydroxide solution
layer was neutralized with 10 wt. % sodium hydrogen sulfate
solution and extracted with EtOAc. The separated organic layer was
washed with brine, dried over Na.sub.2SO.sub.4, filtered and
concentrated in vacuo. The residue was triturated in
2-isopropoxypropane and then the suspension was filtered to give
4-amino-3-benzyl-2-oxo-1H-imidazole-5-carbonitrile (15 g, Compound
1a) as a yellow solid. The product was used for the next step
without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:
215.
Step 2: Preparation of 6-amino-9-benzyl-2-sulfanyl-7H-purin-8-one
(Compound 1b)
##STR00084##
[0418] To a solution of
4-amino-3-benzyl-2-oxo-1H-imidazole-5-carbonitrile (15.0 g, 70.0
mmol, Compound 1a) in THF (700 mL) was added benzoylisothiocyanate
(28.6 g, 175.1 mmol, TCI, Catalog number: A11596-100G) dropwise.
After stirred at RT for 12 hrs, the reaction mixture was
concentrated in vacuo. The residue was triturated in diethyl ether
(100 mL) and the resulting precipitate was collected by
filtration.
[0419] To a solution of the obtained precipitate in THF (700 mL)
was added sodium hydroxide (70 mL, 2 N). The mixture was refluxed
for 50 hrs, and then acidified to pH=3 with 10 wt. % aqueous sodium
hydrogen sulfate solution. The resulting precipitate was collected
by filtration to give a crude
6-amino-9-benzyl-2-sulfanyl-7H-purin-8-one (8.1 g, Compound 1b) as
a yellow solid. The product was used for the next step without
further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 274.
Step 3: Preparation of
6-amino-9-benzyl-2-(2-propylsulfanyl)-7H-purin-8-one (Compound
1c)
##STR00085##
[0421] To a solution of 6-amino-9-benzyl-2-sulfanyl-7H-purin-8-one
(5.46 g, 20.0 mmol, Compound 1b) in DMF was added potassium
carbonate (2.76 g, 20.0 mmol). And then 1-bromopropane (2.44 g,
20.0 mmol, TCI, Catalog number: B0638-500G) in DMF (5.0 mL) was
slowly added to previous solution. After stirred at RT for 12 hrs,
the reaction mixture was poured into water (200 mL), then acidified
with 10 wt. % aqueous sodium hydrogen sulfate solution and
extracted with EtOAc (100 mL) twice. The organic layer was washed
with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo
to give the crude product, which was purified by flash
chromatography on silica gel to give
6-amino-9-benzyl-2-(2-propylsulfanyl)-7H-purin-8-one (4.8 g,
Compound 1c) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]:
316.
Step 4: Preparation of
6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (Compound 1d)
##STR00086##
[0423] To a suspension of compound
6-amino-9-benzyl-2-(2-propylsulfanyl)-7H-purin-8-one (2.7 g, 8.7
mmol, Compound 1c) in DCM/MeOH (500 mL, V/V=1:1) was added
3-chloroperbenzoic acid (2.15 g, 8.7 mmol, 70% purity, Aldrich,
Catalog number: 273031-100G). After reaction mixture was stirred
for 2 hrs, the volume of reaction mixture was reduced in vacuo to
about 50 mL. The resulting precipitate was collected by filtration,
washed with methanol and dried to give
6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (1.0 g, Compound
1d) as a white solid. The product was used for the next step
without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:
332.
Step 5: Preparation of
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound
1e)
##STR00087##
[0425] To a solution of
6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (1.52 g, 4.6 mmol,
Compound 1d) in Eaton's reagent (40 mL, phosphorus pentoxide, 7.5
wt. % in methanesulphonic acid, Aldrich, Catalog number:
380814-100ML) was added sodium azide (360 mg, 5.5 mmol) at
50.degree. C. After being stirred at this temperature for 30
minutes, the reaction mixture was cooled to RT and poured into sat.
aqueous sodium bicarbonate solution. The reaction mixture was
extracted with n-BuOH (100 mL) twice, and the organic phase was
concentrated in vacuo. The residue was submitted for purification
by prep-HPLC to give
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (1.2 g,
Compound 1e) as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. ppm: 10.65 (br. s., 1H), 7.26-7.37 (m, 5H), 6.98 (br. s.,
2H), 4.97 (s, 2H), 4.02 (s, 1H), 3.33 (t, J=7.53 Hz, 2H), 1.55-1.74
(m, 2H), 0.92 (t, J=7.53 Hz, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 347.
[0426] Separation of compound 1e by chiral HPLC afforded Compound
1e-A (slower eluting, 500 mg) and Compound 1e-B (faster eluting,
490 mg) as white solid. (Separation condition: methanol 5%-40%
(0.05% DEA)/CO.sub.2 on ChiralPak AS-3 column.)
[0427] Compound 1e-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz)
.delta.ppm: 10.56 (s, 1H), 7.21-7.46 (m, 5H), 7.03 (s, 2H), 4.96
(s, 2H), 4.04 (s, 1H), 3.25-3.33 (m, 2H), 1.59-1.67 (m, 2H), 0.92
(t, J=7.4 Hz, 3H).
[0428] Compound 1e-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz)
.delta.ppm: 10.57 (s, 1H), 7.23-7.39 (m, 5H), 6.97 (s, 2H), 4.96
(s, 2H), 4.05 (s, 1H), 3.31-3.30 (m, 2H), 1.49-1.74 (m, 2H), 0.91
(t, J=7.4 Hz, 3H).
Step 6: Preparation of
6-amino-9-benzyl-N-methyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7--
carboxamide (Example 1)
##STR00088##
[0430] To a solution of 6-amino-9-benzyl-2-(propyl
sulfonimidoyl)-7H-purin-8-one (300 mg, Compound 1e), pyridine (329
mg, 4.2 mmol) and DIPEA (538 mg, 4.2 mmol) in NMP (5 mL) was added
N-methyl-N-propyl-carbamoyl chloride (564 mg, 4.2 mmol,
Intermediate AA) at RT. The mixture was stirred at RT for 10 hrs.
The reaction mixture was concentrated and the residue was purified
by prep-HPLC to give
6-amino-9-benzyl-N-methyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7--
carboxamide (108 mg, Example 1) as a white solid. .sup.1H NMR (400
MHz, DMSO-d.sub.6) .delta. ppm: 7.45-7.24 (m, 5H), 6.89 (s, 2H),
5.01 (s, 2H), 4.17 (s, 1H), 3.44-3.34 (m, 2H), 3.36-3.34 (m, 2H),
3.10-3.00 (m, 3H), 1.74-1.52 (m, 4H), 1.01-0.72 (m, 6H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 446.
[0431] Separation of compound of Example 1 by chiral HPLC afforded
Example 1-A (slower eluting, 50 mg) and Example 1-B (faster
eluting, 40 mg) as white solid with isopropanol 5%-40% (0.05%
DEA)/CO.sub.2 on ChiralPak AD-3 column.
[0432] Example 1-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 7.44-7.24 (m, 5H), 6.89 (s, 2H), 5.01 (s, 2H), 4.17 (s, 1H),
3.44-3.37 (m, 2H), 3.37-3.35 (m, 2H), 3.10-3.00 (m, 3H), 1.74-1.52
(m, 4H), 1.00-0.72 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:
446.
[0433] Example 1-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 7.45-7.26 (m, 5H), 6.88 (s, 2H), 5.01 (s, 2H), 4.15 (s, 1H),
3.44-3.36 (m, 2H), 3.34 (s, 2H), 3.10-3.01 (m, 3H), 1.77-1.52 (m,
4H), 1.02-0.67 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:
446.
Method B: Alternative method to prepare
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound
1e)
##STR00089##
[0434] Step 1: Preparation of
N-benzyl-6-chloro-5-nitro-2-propylsulfanyl-pyrimidin-4-amine
(Compound 1f)
##STR00090##
[0436] To a solution of
4,6-dichloro-5-nitro-2-propylsulfanylpyrimidine (150.0 g, 559.5
mmol) and DIPEA (108.5 g, 839.2 mmol) in THF (1.5 L) was added
phenylmethanamine (60.0 g, 559.5 mmol) in THF (200 mL) slowly at
-78.degree. C. After addition, the mixture was warmed to 25.degree.
C., and stirred at this temperature for 16 hrs. The resulting
mixture was diluted with EA (1 L), washed with water (400 mL) three
times and brine (500 mL). The separated organic phase was dried
over Na.sub.2SO.sub.4, filtered and concentrated in vacuo to give
N-benzyl-6-chloro-5-nitro-2-propylsulfanyl-pyrimidin-4-amine (180.0
g, Compound 1f) as a yellow solid and used for next step without
further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:
339.1.
Step 2: Preparation of
N4-benzyl-6-chloro-2-propylsulfanyl-pyrimidine-4,5-diamine
(Compound 1g)
##STR00091##
[0438] To a solution of
N-benzyl-6-chloro-5-nitro-2-propylsulfanyl-pyrimidin-4-amine (180
g, Compound 1f) and HOAc (319 g, 5.31 mol) in THF (3.0 L) was added
Zn (174 g, 2.66 mol) slowly at 25.degree. C. After the addition,
the mixture was stirred at 25.degree. C. for 16 hrs. The reaction
was filtered and the filtrate was basified with saturated aq.
NaHCO.sub.3 (800 mL), extracted with EA (400 mL) three times, dried
over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was
purified by silica gel chromatography to give
N4-benzyl-6-chloro-2-propylsulfanyl-pyrimidine-4,5-diamine (125 g,
Compound 1g) as a brown solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]:
309.1.
Step 3: Preparation of
9-benzyl-6-chloro-2-propylsulfanyl-7H-purin-8-one (Compound 1h)
##STR00092##
[0440] To a solution of
N-benzyl-6-chloro-2-(propylsulfanyl)pyrimidine-4,5-diamine (72.0 g,
233.1 mmol, Compound 1g) and CDI (75.2 g, 233.1 mmol) in THF (800
mL) was stirred at 80.degree. C. for 16 hrs. The resulting mixture
was diluted with EA (400 mL), washed with water (200 mL) twice and
brine (200 mL). The separated organic layer was dried over
Na.sub.2SO.sub.4, concentrated in vacuo. The residue was washed
with MTBE (200 mL) to give
9-benzyl-6-chloro-2-propylsulfanyl-7H-purin-8-one (58.0 g, Compound
1h) as a white solid and was used in next step without further
purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 335.1.
Step 4: Preparation of
9-benzyl-6-[(4-methoxyphenyl)methylamino]-2-propylsulfanyl-7H-purin-8-one
(Compound 1i)
##STR00093##
[0442] A solution of
9-benzyl-6-chloro-2-propylsulfanyl-7H-purin-8-one (58.0 g, Compound
1h) and PMBHN.sub.2 (54.7 g, 398.42 mmol) in n-BuOH (600 mL) was
stirred at 120.degree. C. for 20 hrs. The reaction was concentrated
and the residue was washed with MTBE (400 mL) to give
9-benzyl-6-[(4-methoxyphenyl)methylamino]-2-propylsulfanyl-7H-purin-8-one
(75 g, Compound 1i) as a white solid and was used in next step
without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:
436.2.
Step 5: Preparation of
6-amino-9-benzyl-2-propylsulfanyl-7H-purin-8-one (Compound 1c)
##STR00094##
[0444]
9-Benzyl-6-[(4-methoxyphenyl)methylamino]-2-propylsulfanyl-7H-purin-
-8-one (87.0 g, Compound 1i) in TFA (200 mL) was stirred at
80.degree. C. for 16 hrs. The resulting reaction mixture was
concentrated, basified with saturated aq. NaHCO.sub.3 (600 mL). The
resulting precipitate was collected by filtration and washed with
(PE/DCM=2:1, 400 mL) to give
6-amino-9-benzyl-2-propylsulfanyl-7H-purin-8-one (38.0 g, Compound
1c) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]:
316.1.
Step 6: Preparation of
6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (Compound 1d)
##STR00095##
[0446] To a solution of m-CPBA (22.98 g, 113.2 mmol) in THF (50 mL)
was added dropwise to a suspension of
6-amino-9-benzyl-2-propylsulfanyl-7H-purin-8-one (35.0 g, compound
1c) in THF (200 mL) at 0.degree. C. After the addition, the
reaction mixture was stirred at 25.degree. C. for 0.5 hr. The
mixture was filtered and washed with MeCN (400 mL), MTBE (500 mL)
to give 6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (35.1 g,
Compound 1d) as a white solid, which was used for the next step
without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:
332.1.
Step 7: Preparation of
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound
1e)
##STR00096##
[0448] To a solution of
6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (34.0 g, Compound
1d) in Eaton's reagent (170.0 mL, 7.5 wt. % in methanesulphonic
acid) was added NaN.sub.3 (15.34 g, 253.97 mmol) at 60.degree. C.
slowly. Then the mixture was stirred at 60.degree. C. for 30 mins.
The resulting reaction mixture was cooled to 25.degree. C., poured
into ice cold HN.sub.3E.sub.2O (500 mL, 1 mol/L), extracted with
n-BuOH (100 mL) four times and concentrated in vacuo. The residue
was purified by prep-HPLC to give 6-amino-9-benzyl-2-(propyl
sulfonimidoyl)-7H-purin-8-one (10 g, Compound 1e). .sup.1H NMR (400
MHz, DMSO-d.sub.6) .delta. ppm: 10.65 (br. s., 1H), 7.26-7.37 (m,
5H), 6.98 (br. s., 2H), 4.97 (s, 2H), 4.02 (s, 1H), 3.33 (t, J=7.53
Hz, 2H), 1.55-1.74 (m, 2H), 0.92 (t, J=7.53 Hz, 3H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 347.
Example 2
6-Amino-9-benzyl-N-(2-methoxyethyl)-N-methyl-8-oxo-2-(propylsulfonimidoyl)-
purine-7-carboxamide
##STR00097##
[0450] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using N-(2-methoxyethyl)-N-methyl-carbamoyl
chloride (Intermediate AB) instead of N-methyl-N-propyl-carbamoyl
chloride (Intermediate AA).
6-Amino-9-benzyl-N-(2-methoxyethyl)-N-methyl-8-oxo-2-(propylsulfonimidoyl-
)purine-7-carboxamide (120 mg, Example 2) was obtained as a white
solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.27-7.39
(m, 5H), 6.89 (br. s., 1H), 6.78 (br. s., 1H), 5.00 (s, 2H), 4.16
(br. d, J=4 Hz, 1H), 3.62 (br. dd, J=4, 12 Hz, 2H), 3.28-3.42 (m,
6H), 3.12 (d, J=12 Hz, 3H), 3.05 (s, 1H), 1.58-1.72 (m, 2H), 0.93
(t, J=8 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 462.
[0451] Separation of compound of Example 2 by chiral HPLC afforded
Example 2-A (faster eluting, 33 mg) and Example 2-B (slower
eluting, 46 mg) as white solid with methanol 5%-40% (0.05%
DEA)/CO.sub.2 on ChiralPak OJ-3 column.
[0452] Example 2-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 7.27-7.39 (m, 5H), 6.89 (br. s., 1H), 6.78 (br. s., 1H), 5.00
(s, 2H), 4.16 (br. d, J=4 Hz, 1H), 3.62 (br. dd, J=4, 12 Hz, 2H),
3.28-3.42 (m, 6H), 3.12 (d, J=12 Hz, 3H), 3.05 (s, 1H), 1.58-1.72
(m, 2H), 0.93 (t, J=8 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:
462.
[0453] Example 2-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 7.27-7.39 (m, 5H), 6.89 (br. s., 1H), 6.78 (br. s., 1H), 5.00
(s, 2H), 4.16 (br. d, J=4 Hz, 1H), 3.62 (br. dd, J=4, 12 Hz, 2H),
3.28-3.42 (m, 6H), 3.12 (d, J=12 Hz, 3H), 3.05 (s, 1H), 1.58-1.72
(m, 2H), 0.93 (t, J=8 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:
462.
Example 3
6-Amino-9-benzyl-N-ethyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-ca-
rboxamide
##STR00098##
[0455] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using N-ethyl-N-propyl-carbamoyl chloride
(Intermediate AC) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA).
6-Amino-9-benzyl-N-ethyl-8-oxo-N-propyl-2-(propylsulfonimidoyl)purine-7-c-
arboxamide (51 mg, Example 3) was obtained as a white solid.
.sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.27-7.39 (m, 5H),
6.85 (br. s., 2H), 4.99 (s, 2H), 4.20 (br. d, J=8.0 Hz, 1H),
3.13-3.54 (m, 4H), 1.46-1.72 (m, 4H), 1.30-1.39 (m, 1H), 1.00-1.26
(m, 6H), 0.81-0.95 (m, 5H), 0.73 (t, J=8 Hz, 1H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 474.
Example 4
6-Amino-9-benzyl-7-[4-(1-piperidyl)piperidine-1-carbonyl]-2-(propylsulfoni-
midoyl)purin-8-one
##STR00099##
[0457] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using (1,4'-bipiperidine)-1'-carbonyl chloride
instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
6-Amino-9-benzyl-7-[4-(1-piperidyl)piperidine-1-carbonyl]-2-(propylsulfon-
imidoyl)purin-8-one (55 mg, Example 4) was obtained as a white
powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.39-7.27
(m, 5H), 6.97 (br. s., 2H), 4.99 (s, 2H), 4.20 (br. s., 2H), 3.85
(d, J=12.5 Hz, 1H), 3.43-3.15 (m, 3H), 2.96 (t, J=12.3 Hz, 2H),
2.56 (m, 4H), 1.83 (m, 1H), 1.79-1.54 (m, 4H), 1.50 (br. s., 4H),
1.45-1.33 (m, 3H), 0.93 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 541.2.
Example 5
6-Amino-9-benzyl-N-ethyl-N-(2-methoxyethyl)-8-oxo-2-(propylsulfonimidoyl)p-
urine-7-carboxamide
##STR00100##
[0459] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using N-ethyl-N-(2-methoxyethyl)carbamoyl
chloride (Intermediate AD) instead of N-methyl-N-propyl-carbamoyl
chloride (Intermediate AA).
6-Amino-9-benzyl-N-ethyl-N-(2-methoxyethyl)-8-oxo-2-(propylsulfonimidoyl)-
purine-7-carboxamide (34 mg, Example 5) was obtained as a white
powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.39-7.28
(m, 5H), 6.89 (br. s., 1H), 6.74 (br. s., 1H), 4.99 (s, 2H), 4.17
(d, J=8.1 Hz, 1H), 3.67 (br. s., 2H), 3.63-3.51 (m, 2H), 3.50-3.34
(m, 4H), 3.29 (s, 1H), 3.11 (s, 2H), 1.73-1.59 (m, 2H), 1.23-1.07
(m, 3H), 0.93 (t, J=7.5 Hz, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 476.3.
Example 6
6-Amino-9-benzyl-N-butyl-N-ethyl-8-oxo-2-(propylsulfonimidoyl)purine-7-car-
boxamide
##STR00101##
[0461] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using N-butyl-N-ethyl-carbamoyl chloride
(Intermediate AE) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA).
6-Amino-9-benzyl-N-butyl-N-ethyl-8-oxo-2-(propylsulfonimidoyl)purine-7-ca-
rboxamide (51 mg, Example 6) was obtained as a white solid. .sup.1H
NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.27-7.39 (m, 5H), 6.85
(br. s., 2H), 4.99 (s, 2H), 4.20 (br. d, J=8.0 Hz, 1H), 3.13-3.54
(m, 4H), 1.46-1.72 (m, 4H), 1.30-1.39 (m, 1H), 1.00-1.26 (m, 6H),
0.81-0.95 (m, 5H), 0.73 (t, J=8 Hz, 1H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 474.
Example 7
6-Amino-9-benzyl-N-(2-methoxyethyl)-8-oxo-N-propyl-2-(propylsulfonimidoyl)-
purine-7-carboxamide
##STR00102##
[0463] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using N-ethyl-N-(2-methoxyethyl)carbamoyl
chloride (Intermediate AF) instead of N-methyl-N-propyl-carbamoyl
chloride (Intermediate AA).
6-amino-9-benzyl-N-(2-methoxyethyl)-8-oxo-N-propyl-2-(propylsulfonimidoyl-
)purine-7-carboxamide (35 mg, Example 7) was obtained as a white
powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.40-7.28
(m, 5H), 6.89 (br. s., 1H), 6.75 (br. s., 1H), 5.00 (d, J=5.5 Hz,
2H), 4.24-4.16 (m, 1H), 3.77 (br. s., 1H), 3.67 (br. s., 1H),
3.62-3.53 (m, 1H), 3.42-3.27 (m, 5H), 3.23-3.02 (m, 3H), 1.66-1.38
(m, 4H), 0.96-0.70 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:
490.5.
Example 8
6-Amino-9-benzyl-N,N-bis(2-methoxyethyl)-8-oxo-2-(propylsulfonimidoyl)puri-
ne-7-carboxamide
##STR00103##
[0465] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using bis(2-methoxyethyl)carbamic chloride
(Intermediate AG) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA).
6-Amino-9-benzyl-N,N-bis(2-methoxyethyl)-8-oxo-2-(propylsulfonimidoyl)pur-
ine-7-carboxamide (35 mg, Example 8) was obtained as a white
powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.40-7.28
(m, 5H), 6.83 (br. s., 2H), 4.99 (s, 2H), 3.71 (br. s., 3H),
3.52-3.27 (m, 11H), 3.09 (s, 3H), 1.73-1.59 (m, 2H), 0.93 (t, J=7.5
Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 506.
Example 9
6-Amino-7-(azetidine-1-carbonyl)-9-benzyl-2-(propylsulfonimidoyl)purin-8-o-
ne
##STR00104##
[0467] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using azetidine-1-carbonyl chloride
(Intermediate AH) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA).
6-Amino-7-(azetidine-1-carbonyl)-9-benzyl-2-(propylsulfonimidoyl)purin-8--
one (120 mg, Example 9) was obtained as a white powder. .sup.1H NMR
(400 MHz, DMSO-d.sub.6) .delta. ppm: 7.02-7.43 (m, 7H), 4.99 (s,
2H), 4.31 (t, J=7.65 Hz, 2H), 4.08-4.23 (m, 3H), 3.34-3.41 (m, 2H),
2.28 (m, 2H), 1.56-1.73 (m, 2H), 0.93 (t, J=7.40 Hz, 3H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 430.
Example 10
6-Amino-9-benzyl-N-isopropyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine--
7-carboxamide
##STR00105##
[0469] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using N-isopropyl-N-methyl-carbamoyl chloride
(Intermediate AI) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA).
6-Amino-9-benzyl-N-isopropyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-
-7-carboxamide (97 mg, Example 10) was obtained as a white solid.
.sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.27-7.39 (m, 5H),
6.87 (br. s., 2H), 4.99 (s, 2H), 4.38-4.45 (m, 1H), 4.09-4.21 (m,
1H), 3.29-3.43 (m, 2H), 2.89-2.95 (m, 3H), 1.58-1.73 (m, 2H), 1.21
(br d, J=8 Hz, 6H), 0.93 (t, J=8 Hz, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 446.
Example 11
6-Amino-9-benzyl-7-(4-methylpiperazine-1-carbonyl)-2-(propylsulfonimidoyl)-
purin-8-one
##STR00106##
[0471] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using 4-methylpiperazine-1-carbonyl chloride
instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
6-Amino-9-benzyl-7-(4-methylpiperazine-1-carbonyl)-2-(propylsulfonimidoyl-
)purin-8-one (59.5 mg, Example 11) was obtained as a yellow solid.
.sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.ppm: 7.39-7.31 (m, 5H),
6.99 (s, 2H), 4.98 (s, 2H), 4.18 (s, 1H), 3.58-3.49 (m, 6H), 2.42
(m, 4H), 2.22 (s, 3H), 1.66-1.61 (m, 2H), 0.95-0.91 (t, J=7.2 Hz,
3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 473.
Example 12
6-Amino-9-benzyl-N-(3-methoxypropyl)-N-methyl-8-oxo-2-(propylsulfonimidoyl-
)purine-7-carboxamide
##STR00107##
[0473] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using N-(3-methoxypropyl)-N-methyl-carbamoyl
chloride instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA).
6-Amino-9-benzyl-N-(3-methoxypropyl)-N-methyl-8-oxo-2-(propylsulfonimidoy-
l)purine-7-carboxamide (92.2 mg, Example 12) was obtained as a
white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.ppm:
7.23-7.45 (m, 5H), 6.94 (s., 2H), 4.93-5.08 (m, 2H), 4.19 (s, 1H),
3.30-3.62 (m, 6H), 3.25 (s, 3H), 3.02-3.10 (m, 3H), 1.74-1.90 (m,
2H), 1.55-1.77 (m, 2H), 0.98-0.82 (m, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 476.3.
Example 13
6-Amino-9-benzyl-N-isobutyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine-7-
-carboxamide
##STR00108##
[0475] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using N-isobutyl-N-methyl-carbamoyl chloride
(Intermediate AL) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA).
6-Amino-9-benzyl-N-isobutyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)purine--
7-carboxamide (64 mg, Example 13) was obtained as a white solid.
.sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.27-7.40 (m, 5H),
6.89 (br. s., 2H), 5.00 (s, 2H), 4.16 (br. s., 1H), 3.25-3.44 (m,
4H), 3.07 (s, 2H), 3.03 (s, 1H), 1.87-2.09 (m, 1H), 1.57-1.74 (m,
2H), 0.75-0.99 (m, 9H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:
460.
Example 14
Ethyl
2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]acetate
##STR00109##
[0477] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using ethyl
2-((chlorocarbonyl)(methyl)amino)acetate (Intermediate AP) instead
of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). Ethyl
2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]acetate (38 mg, Example 14) was obtained as a light yellow
powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.41-7.27
(m, 5H), 6.82 (br. s., 1H), 5.04-4.95 (m, 2H), 4.35 (br. s., 1H),
4.28 (br. s., 1H), 4.23-4.16 (m, 2H), 4.08 (q, J=7.2 Hz, 1H),
3.43-3.28 (m, 3H), 3.15 (s, 2H), 3.08 (s, 1H), 1.71-1.58 (m, 2H),
1.24 (t, J=7.0 Hz, 2H), 1.12 (t, J=7.0 Hz, 1H), 0.93 (t, J=7.4 Hz,
3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 490.
Example 15
Ethyl
3-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]propanoate
##STR00110##
[0479] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using ethyl
3-((chlorocarbonyl)(methyl)amino)propanoate instead of
N-methyl-N-propyl-carbamoyl chloride (Intermediate AA). Ethyl
3-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]propanoate (35 mg, Example 15) was obtained as a white
powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.43-7.26
(m, 5H), 6.93 (br. s., 2H), 4.99 (s, 2H), 4.16 (s, 1H), 4.08 (q,
J=7.1 Hz, 1H), 3.99 (d, J=7.0 Hz, 1H), 3.67 (br. s., 2H), 3.40-3.29
(m, 2H), 3.08 (s, 2H), 2.99 (s, 1H), 2.71 (t, J=6.4 Hz, 2H),
1.74-1.56 (m, 2H), 1.27-1.05 (m, 3H), 0.93 (t, J=7.5 Hz, 3H). MS
obsd. (ESI.sup.+) [(M+H).sup.+]: 504.
Example 16
tert-Butyl
3-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carb-
onyl]-methyl-amino]propanoate
##STR00111##
[0481] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using tert-butyl
3-[chlorocarbonyl(methyl)amino]propanoate (Intermediate AR) instead
of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
tert-Butyl
3-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]propanoate (60 mg, Example 16) was obtained as a white
powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.41-7.27
(m, 5H), 6.93 (br. s., 2H), 4.99 (s, 2H), 4.15 (s, 1H), 3.64 (br.
s., 2H), 3.51-3.33 (m, 2H), 3.08 (s, 2H), 2.98 (s, 1H), 2.62 (t,
J=6.9 Hz, 2H), 1.71-1.57 (m, 2H), 1.41 (s, 6H), 1.34 (s, 3H), 0.93
(t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 532.
Example 17
Ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carb-
onyl]-methyl-amino]propanoate
##STR00112##
[0483] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using ethyl
(2S)-2-[chlorocarbonyl(methyl)amino]propanoate (Intermediate AS)
instead of N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
Ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]propanoate (34.1 mg, Example 17) was obtained as a
yellow solid. .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. ppm:
7.22-7.49 (m, 5H), 6.78 (br. s., 2H), 4.93-5.08 (m, 2H), 4.75 (br.
s., 1H), 3.96-4.29 (m, 3H), 3.30-3.46 (m, 2H), 3.09 (s, 2H), 2.93
(br. s., 1H), 1.55-1.77 (m, 2H), 1.48 (d, J=7.16 Hz, 3H), 1.09-1.29
(m, 3H), 0.94 (t, J=7.44 Hz, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 504.2.
Example 18
tert-Butyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-
-carbonyl]-methyl-amino]-4-methyl-pentanoate
##STR00113##
[0485] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using tert-butyl
(2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate
(Intermediate AT) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA). tert-Butyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-4-methyl-pentanoate (22 mg, Example 18) was obtained
as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm:
7.42-7.27 (m, 5H), 6.78 (br. s., 2H), 5.05-4.96 (m, 2H), 4.78 (br.
s., 1H), 4.33 (br. s., 1H), 3.51-3.37 (m, 2H), 3.01 (s, 3H),
1.75-1.54 (m, 4H), 1.44 (s, 8H), 1.33-1.11 (m, 2H), 0.99-0.82 (m,
9H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 574.3.
Example 19
Isopropyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7--
carbonyl]-methyl-amino]-4-methyl-pentanoate
##STR00114##
[0487] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using isopropyl
(2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate
(Intermediate AU) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA). Isopropyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propyl
sulfonimidoyl)purine-7-carbonyl]-methyl-amino]-4-methyl-pentanoate
(43 mg, Example 19) was obtained as a white powder. .sup.1H NMR
(400 MHz, DMSO-d.sub.6) .delta. ppm: 7.43-7.27 (m, 5H), 6.75 (br.
s., 2H), 5.05-4.94 (m, 3H), 4.88 (br. s., 1H), 4.19 (br. s., 1H),
3.43-3.34 (m, 2H), 3.01 (s, 3H), 1.91 (br. s., 1H), 1.77-1.56 (m,
4H), 1.25-1.16 (m, 6H), 0.99-0.83 (m, 9H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 560.3.
Example 20
Ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carb-
onyl]-methyl-amino]-3-methyl-butanoate
##STR00115##
[0489] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using ethyl
(2S)-2-[chlorocarbonyl(methyl)amino]-3-methyl-butanoate
(Intermediate AV) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA). Ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-3-methyl-butanoate (51.5 mg, Example 20) was
obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. ppm: 7.23-7.51 (m, 5H), 6.76 (br. s., 2H), 5.01 (br. s.,
2H), 4.42 (br. s., 1H), 3.97-4.26 (m, 3H), 3.34-3.45 (m, 2H), 3.12
(br. s., 3H), 2.24 (br. s., 1H), 1.65 (br. s., 2H), 1.13-1.29 (m,
3H), 0.88-1.10 (m, 9H). MS obsd. (ESI.sup.+) [M+H.sup.+]:
532.2.
Example 21
Ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carb-
onyl]-methyl-amino]-4-methyl-pentanoate
##STR00116##
[0491] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using ethyl
(2S)-2-[chlorocarbonyl(methyl)amino]-4-methyl-pentanoate
(Intermediate AW) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA). Ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-car-
bonyl]-methyl-amino]-4-methyl-pentanoate (17.3 mg, Example 21) was
obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. ppm: 7.26-7.45 (m, 5H), 6.73 (br. s., 2H), 4.91-5.09 (m,
3H), 4.06-4.25 (m, 3H), 3.34-3.45 (m, 2H), 3.04 (br. s., 3H), 1.93
(br. s., 1H), 1.54-1.78 (m, 4H), 1.22 (t, J=7.09 Hz, 3H), 0.77-1.01
(m, 9H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 546.3.
Example 22
Ethyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carb-
onyl]-methyl-amino]-3-phenyl-propanoate
##STR00117##
[0493] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using ethyl
(2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate
(Intermediate AX) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA). Ethyl (2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propyl
sulfonimidoyl)purine-7-carbonyl]-methyl-amino]-3-phenyl-propanoate
(30 mg, Example 22) was obtained as a white powder. .sup.1H NMR
(400 MHz, DMSO-d.sub.6) .delta. ppm: 7.42-7.16 (m, 10H), 4.97 (s,
3H), 4.19 (q, J=7.1 Hz, 2H), 3.35-3.15 (m, 6H), 3.10-2.90 (m, 3H),
1.71-1.46 (m, 2H), 1.28-1.18 (m, 4H), 0.97-0.85 (m, 3H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 580.
Example 23
Isopropyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7--
carbonyl]-methyl-amino]-3-phenyl-propanoate
##STR00118##
[0495] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using isopropyl
(2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate
(Intermediate AY) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA). Isopropyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-
-carbonyl]-methyl-amino]-3-phenyl-propanoate (22 mg, Example 23)
was obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. ppm: 7.35-7.01 (m, 10H), 5.02-4.89 (m, 3H), 3.37-3.17 (m,
3H), 3.02-3.09 (m, 3H), 3.10-2.90 (m, 3H), 1.66-1.62 (m, 2H),
1.22-1.11 (m, 8H), 0.92 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 594.
Example 24
tert-Butyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-
-carbonyl]-methyl-amino]-3-phenyl-propanoate
##STR00119##
[0497] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using tert-butyl
(2S)-2-[chlorocarbonyl(methyl)amino]-3-phenyl-propanoate
(Intermediate AZ) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA). tert-Butyl
(2S)-2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-
-methyl-amino]-3-phenyl-propanoate (34 mg, Example 24) was obtained
as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm:
7.42-7.16 (m, 10H), 5.03-4.90 (m, 3H), 3.68-3.24 (m, 5H), 3.24-3.09
(m, 2H), 3.01 (s, 3H), 1.68-1.57 (m, 2H), 1.43 (s, 9H), 0.99-0.85
(m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 608.3.
Example 25
N-[2-[Acetyl(methyl)amino]ethyl]-6-amino-9-benzyl-N-methyl-8-oxo-2-(propyl-
sulfonimidoyl)purine-7-carboxamide
##STR00120##
[0499] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using
N-[2-[acetyl(methyl)amino]ethyl]-N-methyl-carbamoyl chloride
(Intermediate BA) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA).
N-[2-[Acetyl(methyl)amino]ethyl]-6-amino-9-benzyl-N-methyl-8-oxo-2-(propy-
lsulfonimidoyl)purine-7-carboxamide (26.1 mg, Example 25) was
obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. ppm: 7.43-7.27 (m, 5H), 7.02 (br, 2H), 5.04-4.97 (m, 2H),
4.19-4.13 (m, 1H), 3.57 (d, J=5.5 Hz, 2H), 3.49-3.34 (m, 2H), 3.14
(s, 1H), 3.12-3.02 (m, 4H), 2.86 (d, J=7.5 Hz, 2H), 2.69-2.64 (m,
1H), 2.05 (s, 1H), 1.99 (s, 1H), 1.91-1.83 (m, 1H), 1.70-1.59 (m,
2H), 0.97-0.90 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:
503.2.
Example 26
Methyl
N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbo-
nyl]-methyl-amino]ethyl]-N-methyl-carbamate
##STR00121##
[0501] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using methyl
N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate
(Intermediate BB) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA). Methyl N-[2-[[6-amino-9-benzyl-8-oxo-2-(propyl
sulfonimidoyl)purine-7-carbonyl]-methyl-amino]ethyl]-N-methyl-carbamate
(65 mg, Example 26) was obtained as a yellow solid. .sup.1H NMR
(400 MHz, CDCl.sub.3) .delta. ppm: 7.29-7.49 (m, 5H), 5.63-5.92 (m,
2H), 5.03-5.17 (m, 2H), 3.43-3.69 (m, 8H), 3.13-3.27 (m, 3H),
2.96-3.05 (m, 2H), 2.72 (br. s., 1H), 1.05 (t, J=7.40 Hz, 3H), 1.87
(dd, J=14.12, 6.96 Hz, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:
519.2.
Example 27
tert-Butyl
N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-c-
arbonyl]-methyl-amino]ethyl]-N-methyl-carbamate
##STR00122##
[0503] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using tert-butyl
N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate
(Intermediate BC) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA). tert-Butyl
N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-m-
ethyl-amino]ethyl]-N-methyl-carbamate (32 mg, Example 27) was
obtained as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. ppm: 7.43-7.26 (m, 5H), 6.89 (br. s., 2H), 4.99 (d, J=5.0
Hz, 2H), 4.16 (s, 1H), 3.55 (br. s., 2H), 3.48-3.34 (m, 2H), 3.10
(s, 2H), 3.07 (s, 1H), 2.86 (d, J=12.8 Hz, 2H), 2.74 (d, J=9.5 Hz,
1H), 2.70-2.60 (m, 1H), 1.72-1.54 (m, 2H), 1.39 (s, 6H), 1.23 (s,
2H), 1.13 (s, 2H), 0.93 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 562.
Example 28
Ethyl
N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbon-
yl]-methyl-amino]ethyl]-N-methyl-carbamate
##STR00123##
[0505] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using ethyl
N-[2-[chlorocarbonyl(methyl)amino]ethyl]-N-methyl-carbamate
(Intermediate BD) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA). Ethyl
N-[2-[[6-amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbo-
nyl]-methyl-amino]ethyl]-N-methyl-carbamate (87 mg, Example 28) was
obtained as a yellow solid. .sup.1H NMR (400 MHz, CDCl.sub.3)
.delta. ppm: 7.29-7.53 (m, 5H), 5.65-5.90 (m, 2H), 5.02-5.14 (m,
2H), 3.38-4.21 (m, 9H), 3.14-3.26 (m, 3H), 3.00 (br. s., 2H), 2.73
(s, 1H), 1.76-1.99 (m, 2H), 1.22-1.31 (m, 3H), 1.05 (s, 3H). MS
obsd. (ESI.sup.+) [(M+H).sup.+]: 533.2.
Example 29
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methy-
l-amino]ethyl N-butyl-N-methyl-carbamate
##STR00124##
[0507] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using 2-[chlorocarbonyl(methyl)amino]ethyl
N-butyl-N-methyl-carbamate (Intermediate BE) instead of
N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl N-butyl-N-methyl-carbamate (19 mg, Compound 29) was
obtained as yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. ppm: 7.25-7.48 (m, 5H), 6.96 (br. s., 2H), 4.99 (s, 2H),
4.06-4.36 (m, 3H), 3.59-3.83 (m, 1H), 3.33-3.49 (m, 3H), 3.07-3.21
(m, 4H), 2.79 (s, 2H), 1.65 (br. s., 2H), 1.05-1.47 (m, 6H), 0.93
(t, J=7.40 Hz, 3H), 0.70-0.87 (m, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 561.2.
Example 30
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methy-
l-amino]ethyl pyrrolidine-1-carboxylate
##STR00125##
[0509] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using 2-[chlorocarbonyl(methyl)amino]ethyl
pyrrolidine-1-carboxylate (Intermediate BF) instead of
N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl pyrrolidine-1-carboxylate (10.0 mg, Example 30) was
obtained as a yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. ppm: 7.26-7.41 (m, 5H), 6.96 (br.s., 2H), 4.99 (s, 2H),
4.01-4.35 (m, 4H), 3.29-3.47 (m, 3H), 3.23 (br. s., 3H), 3.03-3.17
(m, 4H), 1.52-1.84 (m, 6H), 0.90-0.96 (m, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 545.2.
Example 31
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methy-
l-amino]ethyl N-methyl-N-propyl-carbamate
##STR00126##
[0511] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using 2-[chlorocarbonyl(methyl)amino]ethyl
N-methyl-N-propyl-carbamate (Intermediate BG) instead of
N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl N-methyl-N-propyl-carbamate (3.7 mg, Example 31) was
obtained as a yellow solid. .sup.1H NMR (400 MHz, CD.sub.3OD)
.delta. ppm: 7.22-7.48 (m, 5H), 5.09-5.22 (m, 4H), 4.55 (s, 2H),
3.38-3.57 (m, 4H), 3.13 (s, 3H), 1.61-1.85 (m, 4H), 1.22-1.41 (m,
3H), 0.88-1.13 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:
547.2.
Example 32
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methy-
l-amino]ethyl N,N-diethylcarbamate
##STR00127##
[0513] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using 2-[chlorocarbonyl(methyl)amino]ethyl
N,N-diethylcarbamate (Intermediate BH) instead of
N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl N,N-diethylcarbamate (21.7 mg, Example 32) was
obtained as yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. ppm: 7.25-7.41 (m, 5H), 6.96 (br. s., 2H), 4.99 (s, 2H),
4.08-4.36 (m, 3H), 3.70 (br, 1H), 3.33-3.46 (m, 3H), 3.01-3.24 (m,
7H), 1.55-1.74 (m, 2H), 0.86-1.05 (m, 9H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 547.2.
Example 33
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-methy-
l-amino]ethyl ethyl carbonate
##STR00128##
[0515] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using 2-[chlorocarbonyl(methyl)amino]ethyl
ethyl carbonate (Intermediate BI) instead of
N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
2-[[6-Amino-9-benzyl-8-oxo-2-(propylsulfonimidoyl)purine-7-carbonyl]-meth-
yl-amino]ethyl ethyl carbonate (46 mg, Example 33) was obtained as
yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm:
0.82-0.99 (m, 3H), 1.02-1.28 (m, 3H), 1.56-1.76 (m, 2H), 3.05-3.18
(m, 3H), 3.35-3.48 (m, 3H), 3.73 (t, J=5.08 Hz, 2H), 4.08-4.27 (m,
3H), 4.37 (br. s., 1H), 5.00 (s, 2H), 6.76-7.11 (m, 2H), 7.22-7.45
(m, 5H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 520.
Example 34-A and Example 34-B
6-Amino-N-butyl-9-[(4-chlorophenyl)methyl]-N-methyl-8-oxo-2-[S(S)-propylsu-
lfonimidoyl]purine-7-carboxamide and
6-amino-N-butyl-9-[(4-chlorophenyl)methyl]-N-methyl-8-oxo-2-[S(S)-propyls-
ulfonimidoyl]purine-7-carboxamide
##STR00129##
[0516] Step 1: Preparation of
4-amino-3-[(4-chlorophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile
(Compound 34a)
##STR00130##
[0518] Compound 34a was prepared in analogy to Example 1, Method A,
Step 1 by using 4-chlorobenzyl isocyanate instead of benzyl
isocyanate.
4-Amino-3-[(4-chlorophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile
(8.0 g, Compound 34a) was obtained as a yellow solid. MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 249.
Step 2: Preparation of
6-amino-9-[(4-chlorophenyl)methyl]-2-sulfanyl-7H-purin-8-one
(Compound 34b)
##STR00131##
[0520] Compound 34b was prepared in analogy to Example 1, Method A,
Step 2 by using
4-Amino-3-[(4-chlorophenyl)methyl]-2-oxo-1H-imidazole-5-carbonit-
rile (Compound 34a) instead of
4-amino-3-phenylmethyl-2-oxo-1H-imidazole-5-carbonitrile (Compound
1a). 6-Amino-9-[(4-chlorophenyl)methyl]-2-sulfanyl-7H-purin-8-one
(6.4 g, Compound 34b) was obtained as a yellow solid and was used
for the next step without further purification. MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 308.
Step 3: Preparation of
6-amino-9-[(4-chlorophenyl)methyl]-2-propylsulfanyl-7H-purin-8-one
(Compound 34c)
##STR00132##
[0522] Compound 34c was prepared in analogy to Example 1, Method A,
Step 3 by using
6-amino-9-[(4-chlorophenyl)methyl]-2-sulfanyl-7H-purin-8-one
(Compound 34b) instead of
6-amino-9-phenylmethyl-2-sulfanyl-7H-purin-8-one (Compound 1b).
6-Amino-9-[(4-chlorophenyl)methyl]-2-propylsulfanyl-7H-purin-8-one
(800 mg, Compound 34c) was obtained as a white solid. MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 350.
Step 4: Preparation of
6-amino-9-[(4-chlorophenyl)methyl]-2-propylsulfinyl-7H-purin-8-one
(Compound 34d)
##STR00133##
[0524] Compound 34d was prepared in analogy to Example 1, Method A,
Step 4 by using
6-amino-9-[(4-chlorophenyl)methyl]-2-propylsulfanyl-7H-purin-8-o-
ne (Compound 34c) instead of
6-amino-9-benzyl-2-propylsulfanyl-7H-purin-8-one (Compound 1c).
6-Amino-9-[(4-chlorophenyl)methyl]-2-propylsulfinyl-7H-purin-8-one
(150 mg, Compound 34d) was obtained as a white solid. MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 366.
Step 5: Preparation of
6-amino-9-[(4-chlorophenyl)methyl]-2-(propylsulfonimidoyl)-7H-purin-8-one
(compound 34e),
6-amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-propylsulfonimidoyl)-7H-purin--
8-one and
6-amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-propylsulfonimidoyl)--
7H-purin-8-one (Compound 34e-A and Compound 34e-B)
##STR00134##
[0526] Compound 34e was prepared in analogy to Example 1, Method A,
Step 5 by using
6-amino-9-[(4-chlorophenyl)methyl]-2-propylsulfinyl-7H-purin-8-o-
ne (Compound 34d) instead of
6-amino-9-benzyl-2-(2-propylsulfinyl)-7H-purin-8-one (Compound 1d).
6-Amino-9-[(4-chlorophenyl)methyl]-2-(propylsulfonimidoyl)-7H-purin-8-one
(250 mg, compound 34e) was obtained as a white solid. .sup.1H NMR
(400 MHz, DMSO-d.sub.6) .delta. ppm: 10.60 (br. s, 1H), 7.32-7.42
(m, 4H), 6.98 (br. s, 2H), 4.96 (s, 2H), 4.03 (s, 1H), 3.25-3.41
(m, 2H), 1.56-1.68 (m, 2H), 0.91 (t, J=8 Hz, 3H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 381.
[0527] Separation of compound of Compound 34e by chiral HPLC
afforded Compound 34e-A (faster eluting, 110 mg) and Compound 34e-B
(slower eluting, 100 mg) as white solid with methanol 5%-40% (0.05%
DEA)/CO.sub.2 on ChiralPak OJ-3 column.
[0528] Compound 34e-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 10.63 (br. s, 1H), 7.33-7.42 (m, 4H), 6.99 (br. s, 2H), 4.96
(s, 2H), 4.05 (br. s, 1H), 3.26-3.39 (m, 2H), 1.53-1.69 (m, 2H),
0.91 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:
381.
[0529] Compound 34e-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 10.63 (br. s, 1H), 7.33-7.42 (m, 4H), 6.99 (br. s, 2H), 4.96
(s, 2H), 4.05 (br. s, 1H), 3.26-3.40 (m, 2H), 1.54-1.69 (m, 2H),
0.91 (t, J=7.5 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:
381.
Step 6:
6-Amino-N-butyl-9-[(4-chlorophenyl)methyl]-N-methyl-8-oxo-2-[S(S)--
propylsulfonimidoyl]purine-7-carboxamide and
6-amino-N-butyl-9-[(4-chlorophenyl)methyl]-N-methyl-8-oxo-2-[S(S)-propyls-
ulfonimidoyl]purine-7-carboxamide (Example 34-A and Example
34-B)
##STR00135##
[0531] Example 34-A was prepared in analogy to Example 1, Method A,
Step 6 by using Compound 34e-A and N-butyl-N-methyl-carbamoyl
chloride instead of 6-amino-9-benzyl-2-(propyl
sulfonimidoyl)-7H-purin-8-one (Compound 1e) and
N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
[0532] Example 34-A (160 mg): .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. ppm: 7.37-7.45 (m, 4H), 6.91 (br. s., 2H), 4.99 (s, 2H),
4.17 (s, 1H), 3.28-3.40 (m, 4H), 3.05 (s, 2H), 3.02 (s, 1H),
1.49-1.70 (m, 4H), 1.15-1.37 (m, 2H), 0.89-0.94 (m, 5H), 0.76 (t,
J=8 Hz, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 494.
[0533] Example 34-B (167 mg) was prepared in analogy to Example
34-A by using Compound 34e-B instead of Compound 34e-A.
[0534] Example 34-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 7.36-7.45 (m, 4H), 6.91 (br. s., 2H), 4.99 (s, 2H), 4.17 (s,
1H), 3.28-3.41 (m, 4H), 3.05 (s, 2H), 3.02 (s, 1H), 1.50-1.71 (m,
4H), 1.15-1.37 (m, 2H), 0.89-0.94 (m, 5H), 0.76 (t, J=7.4 Hz, 1H).
MS obsd. (ESI.sup.+) [(M+H).sup.+]: 494.
Example 35
6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-N-methyl-8-oxo-2-(propylsulfoni-
midoyl)purine-7-carboxamide
##STR00136##
[0536] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using
6-amino-9-[(4-chlorophenyl)methyl]-2-(propylsulfonimidoyl)-7H-purin-8-one
(Compound 34e) and N-ethyl-N-methyl-carbamoyl chloride instead of
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound
1e) and N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-N-methyl-8-oxo-2-(propylsulfon-
imidoyl)purine-7-carboxamide (60 mg, Example 35) was obtained as a
white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.40
(s, 4H), 6.91 (br s, 2H), 4.99 (s, 2H), 4.16 (s, 1H), 3.34-3.44 (m,
4H), 3.05 (s, 2H), 3.01 (s, 1H), 1.58-1.67 (m, 2H), 1.18 (t, J=8.0
Hz, 3H), 0.92 (t, J=8.0 Hz, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 466.
Example 36-A and Example 36-B
6-Amino-N-methyl-8-oxo-N-propyl-2[S(S)-propylsulfonimidoyl]-9-(p-tolylmeth-
yl)purine-7-carboxamide and
6-amino-N-methyl-8-oxo-N-propyl-2[S(R)-propylsulfonimidoyl]-9-(p-tolylmet-
hyl)purine-7-carboxamide
##STR00137##
[0537] Step 1: Preparation of
6-chloro-5-nitro-2-propylsulfanyl-N-(p-tolylmethyl)pyrimidin-4-amine
(Compound 36a)
##STR00138##
[0539] Compound 36a was prepared in analogy to Example 1, Method B,
Step 1 by using p-tolylmethylamine instead of phenylmethanamine.
6-Chloro-5-nitro-2-propyl
sulfanyl-N-(p-tolylmethyl)pyrimidin-4-amine (3.9 g, Compound 36a)
was obtained as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]:
353.
Step 2: Preparation of
6-chloro-2-propylsulfanyl-N4-(p-tolylmethyl)pyrimidine-4,5-diamine
(Compound 36b)
##STR00139##
[0541] Compound 36b was prepared in analogy to Example 1, Method B,
Step 2 by using 6-chloro-5-nitro-2-propyl
sulfanyl-N-(p-tolylmethyl)pyrimidin-4-amine (Compound 36a) instead
of N-benzyl-6-chloro-5-nitro-2-propylsulfanyl-pyrimidin-4-amine
(Compound 1f).
6-Chloro-2-propylsulfanyl-N4-(p-tolylmethyl)pyrimidine-4,5-diamine
(2.2 g, Compound 36b) was obtained as a white solid. MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 323.
Step 3: Preparation of
6-chloro-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one
(Compound 36c)
##STR00140##
[0543] Compound 36c was prepared in analogy to Example 1, Method B,
Step 3 by using
6-chloro-2-propylsulfanyl-N4-(p-tolylmethyl)pyrimidine-4,5-diami-
ne (Compound 36b) instead of
N-benzyl-6-chloro-2-(propylsulfanyl)pyrimidine-4,5-diamine
(Compound 1g).
6-Chloro-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (2.2 g,
Compound 36c) was obtained as a white solid. MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 349.
Step 4: Preparation of
6-[(4-methoxyphenyl)methylamino]-2-propylsulfanyl-9-(p-tolylmethyl)-7H-pu-
rin-8-one (Compound 36d)
##STR00141##
[0545] Compound 36d was prepared in analogy to Example 1, Method B,
Step 4, by using
6-chloro-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one
(Compound 36c) instead of
9-benzyl-6-chloro-2-propylsulfanyl-7H-purin-8-one (Compound 1h).
6-[(4-methoxyphenyl)methylamino]-2-propylsulfanyl-9-(p-tolylmethyl)-7H-pu-
rin-8-one (2.0 g, Compound 36d) was obtained as a white solid. MS
obsd. (ESI.sup.+) [(M+H).sup.+]: 450.
Step 5: Preparation of
6-amino-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound
36e)
##STR00142##
[0547] Compound 36e was prepared in analogy to Example 1, Method B,
Step 5 by using
6-[(4-methoxyphenyl)methylamino]-2-propylsulfanyl-9-(p-tolylmeth-
yl)-7H-purin-8-one (Compound 36d) instead of
6-amino-9-benzyl-2-propylsulfanyl-7H-purin-8-one (Compound 1i).
6-amino-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (1.0 g,
Compound 36e) was obtained as a white solid. MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 330.
Step 6: Preparation of
6-amino-2-propylsulfinyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound
36f)
##STR00143##
[0549] Compound 36f was prepared in analogy to Example 1, Method B,
Step 6 by using
6-amino-2-propylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound
36e) instead of
6-amino-9-benzyl-2-(2-propylsulfanyl)-7H-purin-8-one (Compound 1c).
6-amino-2-propylsulfinyl-9-(p-tolylmethyl)-7H-purin-8-one (220 mg,
Compound 36f) was obtained as a white solid MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 345.
Step 7: Preparation of
6-amino-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)-7H-purin-8-one
(Compound 36g)
##STR00144##
[0551] Compound 36g was prepared in analogy to Example 1, Method B,
Step 7 by using
6-amino-2-propylsulfinyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound
36f) instead of 6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one
(Compound 1d).
6-Amino-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)-7H-purin-8-one
(127 mg, Compound 36g) was obtained as a white solid. .sup.1H NMR
(400 MHz, DMSO-d.sub.6) .delta. ppm: 10.67 (br. s., 1H), 7.23 (d,
J=8.0 Hz, 2H), 7.13 (d, J=8.0 Hz, 2H), 6.98 (br. s., 2H), 4.91 (s,
2H), 4.05 (s, 1H), 3.34-3.27 (m, 2H), 2.26 (s, 3H), 1.67-1.62 (m,
2H), 0.92 (t, J=8.0 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:
361.
[0552] Separation of compound 36g by chiral HPLC afforded compound
36g-A (faster eluting, 50 mg) and compound 36g-B (slower eluting,
49 mg) as white solid with 30% isopropanol (0.05% DEA)/CO.sub.2 on
ChiralPak AD-3 column.
[0553] Compound 36g-A: .sup.1H NMR: (400 MHz, DMSO-d.sub.6) .delta.
ppm: 10.51 (s, 1H), 7.22 (d, J=8.0 Hz, 2H), 7.12 (d, J=8.0 Hz, 2H),
7.00 (s, 2H), 4.91 (s, 2H), 4.03 (s, 1H), 3.35-3.31 (m, 2H), 2.26
(s, 3H), 1.70-1.58 (m, 2H), 0.93 (t, J=7.40 Hz, 3H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 361.
[0554] Compound 36g-B: .sup.1H NMR: (400 MHz, DMSO-d.sub.6) .delta.
ppm: 10.54 (s, 1H), 7.23 (d, J=8.0 Hz, 2H), 7.13 (d, J=8.0 Hz, 2H),
6.97 (s, 2H), 4.91 (s, 2H), 4.04 (s, 1H), 3.34-3.30 (m, 2H), 2.26
(s, 3H), 1.72-1.57 (m, 2H), 0.93 (t, J=7.40 Hz, 3H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 361.
Step 8: Preparation of
6-Amino-N-methyl-8-oxo-N-propyl-2[S(S)-propylsulfonimidoyl]-9-(p-tolylmet-
hyl)purine-7-carboxamide and
6-amino-N-methyl-8-oxo-N-propyl-2[S(R)-propylsulfonimidoyl]-9-(p-tolylmet-
hyl)purine-7-carboxamide (Example 36-A and Example 36-B)
##STR00145##
[0556] Example 36-A was prepared in analogy to Example 1, Method A,
Step 6 by using Compound 36g-A instead of
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound
1e). Example 36-A (108 mg) was obtained as a white solid. .sup.1H
NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.27 (d, J=8 Hz, 2H), 7.14
(d, J=8 Hz, 2H), 6.87 (br. s., 2H), 4.95 (s, 2H), 4.15 (s, 1H),
3.33-3.57 (m, 4H), 3.05 (s, 2H), 3.02 (s, 1H), 2.26 (s, 3H),
1.52-1.73 (m, 4H), 0.75-0.97 (m, 6H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 460.
[0557] Example 36-B was prepared in analogy to Example 1, Method A,
Step 6 by using Compound 36g-B instead of
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (compound
1e). Example 36-B (125 mg): .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta. ppm: 7.27 (d, J=8 Hz, 2H), 7.14 (d, J=8 Hz, 2H), 6.87 (br.
s., 2H), 4.95 (s, 2H), 4.15 (s, 1H), 3.33-3.57 (m, 4H), 3.05 (s,
2H), 3.02 (s, 1H), 2.26 (s, 3H), 1.52-1.73 (m, 4H), 0.75-0.97 (m,
5H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 460.
Example 37-A and Example 37-B
6-Amino-2-[S(S)-propylsulfonimidoyl]-9-(p-tolylmethyl)-7-(pyrrolidine-1-ca-
rbonyl)purin-8-one and
6-amino-2-[S(R)-propylsulfonimidoyl]-9-(p-tolylmethyl)-7-(pyrrolidine-1-c-
arbonyl)purin-8-one
##STR00146##
[0559] Example 37-A was prepared in analogy to Example 1, Method A,
Step 6 by using Compound 36g-A and pyrrolidine-1-carbonyl chloride
instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one
(Compound 1e) and N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA).
[0560] Example 37-A (390 mg) was obtained as a white solid. .sup.1H
NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.31-7.11 (m, 4H), 7.04
(s, 2H), 4.95 (s, 2H), 4.15 (s, 1H), 3.65-3.47 (m, 4H), 3.37 (m,
2H), 2.27 (s, 3H), 1.97-1.81 (m, 4H), 1.71-1.59 (m, 2H), 0.94 (t,
J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 458.2.
[0561] Example 37-B (125 mg) was prepared in analogy to Example
37-A by using Compound 36g-B instead of Compound 36g-A. .sup.1H NMR
(400 MHz, DMSO-d.sub.6) .delta.ppm: 7.28-7.14 (m, 4H), 7.04 (s,
2H), 4.95 (s, 2H), 4.15 (s, 1H), 3.65-3.47 (m, 4H), 3.37 (m, 2H),
2.27 (s, 3H), 1.93-1.84 (m, 4H), 1.65-1.60 (m, 2H), 0.95 (t, J=7.4
Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 458.3.
Example 38-A and Example 38-B
6-Amino-N-(2-methoxyethyl)-N-methyl-8-oxo-2-[S(S)-propylsulfonimidoyl]-9-(-
p-tolylmethyl)purine-7-carboxamide and
6-amino-N-(2-methoxyethyl)-N-methyl-8-oxo-2-[S(R)-propylsulfonimidoyl]-9--
(p-tolylmethyl)purine-7-carboxamide
##STR00147##
[0563] Example 38-A was prepared in analogy to Example 1, Method A,
Step 6 by using Compound 36g-A and
N-(2-methoxyethyl)-N-methyl-carbamoyl chloride (Intermediate AB)
instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one
(Compound 1e) and N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA).
[0564] Example 38-A (57.8 mg) was obtained as a white solid.
.sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.26 (d, J=7.6 Hz,
2H), 7.14 (d, J=7.6 Hz, 2H), 6.89-6.78 (m, 2H), 4.95 (s, 2H), 4.18
(s, 1H), 3.62-3.58 (m, 2H), 3.43-3.37 (m, 2H), 3.30-3.10 (m, 3H),
3.09-3.08 (m, 3H), 3.08-3.05 (m, 2H), 2.27 (s, 3H), 1.77-1.54 (m,
2H), 0.95 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:
476.3.
[0565] Example 38-B (46.6 mg) was prepared in analogy to Example
38-A by using Compound 36g-B instead of Compound 36g-A. .sup.1H NMR
(400 MHz, DMSO-d.sub.6) .delta.ppm: 7.26 (d, J=7.6 Hz, 2H), 7.14
(d, J=7.6 Hz, 2H), 6.89-6.78 (m, 2H), 4.95 (s, 2H), 4.18 (s, 1H),
3.62-3.58 (m, 2H), 3.43-3.37 (m, 2H), 3.30-3.10 (m, 3H), 3.09-3.08
(m, 3H), 3.08-3.05 (m, 2H), 2.27 (s, 3H), 1.77-1.54 (m, 2H), 0.95
(t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 476.3.
Example 39
6-Amino-N-ethyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)pu-
rine-7-carboxamide
##STR00148##
[0567] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using N-ethyl-N-methyl-carbamoyl chloride and
6-amino-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)-7H-purin-8-one
(Compound 36g) instead of N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA) and
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound
1e).
6-Amino-N-ethyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)p-
urine-7-carboxamide (141.8 mg, Example 39) was obtained as a light
yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.26
(d, J=7.9 Hz, 2H), 7.15 (d, J=7.9 Hz, 2H), 6.89 (s, 2H), 4.95 (s,
2H), 4.24-4.07 (m, 1H), 3.52-3.35 (m, 4H), 3.10-2.95 (m, 3H), 2.26
(s, 3H), 1.77-1.55 (m, 2H), 1.24-1.10 (m, 3H), 0.95 (t, J=7.4 Hz,
3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 446.1.
Example 40
6-Amino-N-butyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)pu-
rine-7-carboxamide
##STR00149##
[0569] The title compound was prepared in analogy to Example 1,
Method A, Step 6 by using
6-amino-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)-7H-purin-8-one
(Compound 36g) and N-butyl-N-methyl-carbamoyl chloride instead of
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound
1e) and N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
6-Amino-N-butyl-N-methyl-8-oxo-2-(propylsulfonimidoyl)-9-(p-tolylmethyl)p-
urine-7-carboxamide (32 mg, Example 40) was obtained as a white
solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.ppm: 7.28-7.14
(m, 4H), 6.88 (s, 2H), 4.95 (s, 2H), 4.16 (s, 1H), 3.41-3.36 (m,
2H), 3.10-2.99 (m, 3H), 2.53-2.51 (m, 2H), 2.27 (s, 3H), 1.71-1.63
(m, 2H), 1.62-1.51 (m, 2H), 1.42-1.26 (m, 2H), 0.97-0.74 (m, 6H).
MS obsd. (ESI.sup.+) [(M+H).sup.+]: 474.3
Example 41-A and Example 41-B
6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide (Example 41-A) and
6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-
-oxo-N-propyl-purine-7-carboxamide (Example 41-B)
##STR00150##
[0570] Step 1: Preparation of
6-amino-9-[(4-chlorophenyl)methyl]-2-ethylsulfanyl-7H-purin-8-one
[0571] (Compound 41a)
##STR00151##
[0572] Compound 41a was prepared in analogy to Example 1, Method A,
Step 3 by using iodoethane and
6-amino-9-[(4-chlorophenyl)methyl]-2-sulfanyl-7H-purin-8-one
(Compound 34b) instead of bromopropane and
6-amino-9-phenylmethyl-2-sulfanyl-7H-purin-8-one (Compound 1b).
6-Amino-9-[(4-chlorophenyl)methyl]-2-ethylsulfanyl-7H-purin-8-one
(2.5 g, Compound 41a) was obtained as a white solid. MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 336.
Step 2: Preparation of
6-amino-9-(4-chlorobenzyl)-2-ethylsulfinyl-7H-purin-8-one (Compound
41b)
##STR00152##
[0574] Compound 41b was prepared in analogy to Example 1, Method A,
Step 4 by using
6-amino-9-[(4-chlorophenyl)methyl]-2-ethylsulfanyl-7H-purin-8-on- e
(Compound 41a) instead of
6-amino-9-benzyl-2-propylsulfanyl-7H-purin-8-one (Compound 1c).
6-Amino-9-(4-chlorobenzyl)-2-ethylsulfinyl-7H-purin-8-one (1.94 g,
Compound 41b) was obtained as a white solid. MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 352.
Step 3: Preparation of
6-amino-9-[(4-chlorophenyl)methyl]-2-(ethylsulfonimidoyl)-7H-purin-8-one
(Compound 41c)
##STR00153##
[0576] Compound 41c was prepared in analogy to Example 1, Method A,
Step 5 by using
6-amino-9-(4-chlorobenzyl)-2-ethylsulfinyl-7H-purin-8-one (Compound
41b) instead of
6-amino-9-benzyl-2-(2-methylsulfinyl)-7H-purin-8-one (Compound 1d).
6-Amino-9-[(4-chlorophenyl)methyl]-2-(ethylsulfonimidoyl)-7H-purin-8-one
(217 mg, Example 41c) was obtained as a white solid. .sup.1H NMR
(400 MHz, DMSO-d.sub.6) .delta.ppm: 10.61 (s, 1H), 7.42-7.35 (m,
4H), 6.98 (s, 2H), 4.96 (s, 2H), 4.05 (s, 1H), 3.42-3.37 (m, 2H),
1.16 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:
367.0.
[0577] Separation of compound of Compound 41c by chiral HPLC
afforded Compound 41c-A (faster eluting, 31.8 mg) and Compound
41c-B (slower eluting, 10 mg) as white solid with methanol 5%-40%
(0.05% DEA)/CO.sub.2 on ChiralPak IC-3 column.
##STR00154##
[0578] Compound 41c-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta.ppm: 10.76 (s, 1H), 7.45-7.33 (m, 4H), 7.01 (s, 2H), 4.96
(s, 2H), 4.03 (s, 1H), 3.40-3.34 (m, 2H), 1.17 (t, J=7.4 Hz, 3H).
MS obsd. (ESI.sup.+) [(M+H).sup.+]: 367.0.
##STR00155##
[0579] Compound 41c-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta.ppm: 10.70 (s, 1H), 7.46-7.28 (m, 4H), 7.01 (s, 2H), 4.96
(s, 2H), 4.03 (s, 1H), 3.44-3.36 (m, 2H), 1.17 (t, J=7.4 Hz, 3H).
MS obsd. (ESI.sup.+) [(M+H).sup.+]: 367.0.
Step 4:
6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-m-
ethyl-8-oxo-N-propyl-purine-7-carboxamide (Example 41-A) and
6-amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-
-oxo-N-propyl-purine-7-carboxamide (Example 41-B)
##STR00156##
[0581] Example 41-A was prepared in analogy to Example 1, Method A,
Step 6 by using Compound 41c-B instead of
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound
1e).
6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-
-oxo-N-propyl-purine-7-carboxamide (Example 41-A, 78 mg) was
obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta.ppm: 7.43-7.41 (m, 4H), 6.90 (s, 2H), 5.00 (s, 2H), 4.19 (s,
1H), 3.46-3.39 (m, 2H), 3.39-3.38 (m, 2H), 3.09-2.99 (m, 3H),
1.69-1.52 (m, 2H), 1.19 (t, J=7.28 Hz, 3H), 0.95-0.66 (m, 3H). MS
obsd. (ESI.sup.+) [(M+H).sup.+]: 466.1.
[0582] Example 41-B (125 mg) was prepared in analogy to Example 1,
Method A, Step 6 by using Compound 41c-A instead of
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound
1e).
6-Amino-9-[(4-chlorophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-
-oxo-N-propyl-purine-7-carboxamide (Example 41-B, 38 mg) was
obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta.ppm: 7.43-7.41 (m, 4H), 6.90 (s, 2H), 5.00 (s, 2H), 4.20 (s,
1H), 3.46-3.41 (m, 2H), 3.40-3.39 (m, 2H), 3.10-3.00 (m, 3H),
1.69-1.50 (m, 2H), 1.24-1.12 (m, 3H), 0.93-0.73 (m, 3H). (MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 466.2.
[0583] The stereochemistry of Example 41-B was determined by single
crystal X-ray diffraction shown in FIG. 1.
Example 42-A and Example 42-B
6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-m-
ethyl-8-oxo-purine-7-carboxamide (Example 42-A) and
6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N--
methyl-8-oxo-purine-7-carboxamide (Example 42-B)
##STR00157##
[0585] Example 42-A was prepared in analogy to Example 1, Method A,
step 6 by using Compound 41c-A and N-ethyl-N-methyl-carbamoyl
chloride instead of 6-amino-9-benzyl-2-(propyl
sulfonimidoyl)-7H-purin-8-one (Compound 1e) and
N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-m-
ethyl-8-oxo-purine-7-carboxamide (Example 42-A, 40 mg) was obtained
as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.ppm:
7.43-7.41 (m, 4H), 6.90 (s, 2H), 4.99 (s, 2H), 4.18 (s, 1H),
3.48-3.40 (m, 2H), 3.39 (s, 2H), 3.05-3.01 (m, 3H), 1.20-1.14 (m,
6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 452.2.
[0586] Example 42-B was prepared in analogy to Example 1, Method A,
Step 6 by using Compound 41c-B and N-ethyl-N-methyl-carbamoyl
chloride instead of 6-amino-9-benzyl-2-(propyl
sulfonimidoyl)-7H-purin-8-one (Compound 1e) and
N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
6-Amino-9-[(4-chlorophenyl)methyl]-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N--
methyl-8-oxo-purine-7-carboxamide (Example 42-B, 38 mg) was
obtained as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta.ppm: 7.43-7.41 (m, 4H), 6.91 (s, 2H), 4.98 (s, 2H), 4.19 (s,
1H), 3.48-3.40 (m, 2H), 3.39 (s, 2H), 3.09-2.97 (m, 3H), 1.23-1.11
(m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 452.2.
[0587] The stereochemistry of Example 42-A was determined by single
crystal X-ray diffraction shown in FIG. 2.
Example 43-A and Example 43-B
6-Amino-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmeth-
yl)purine-7-carboxamide (Example 43-A) and
6-Amino-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmet-
hyl)purine-7-carboxamide (Example 43-B)
##STR00158##
[0588] Step 1: Preparation of
4-amino-2-oxo-3-(p-tolylmethyl)-1H-imidazole-5-carbonitrile
(Compound 43a)
##STR00159##
[0590] Compound 43a was prepared in analogy to Example 1, Method A,
Step 1 by using 4-methylbenzyl isocyanate instead of benzyl
isocyanate.
4-Amino-2-oxo-3-(p-tolylmethyl)-1H-imidazole-5-carbonitrile (26.6
g, Compound 43a) was obtained as a grey solid and used directly for
next step without further purification. MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 229.2.
Step 2: Preparation of
6-amino-9-(p-tolylmethyl)-2-sulfanyl-7H-purin-8-one (Compound
43b)
##STR00160##
[0592] Compound 43b was prepared in analogy to Example 1, Method A,
Step 2 by using of
4-amino-2-oxo-3-(p-tolylmethyl)-1H-imidazole-5-carbonitrile
(compound 43a) instead of
4-amino-3-benzyl-2-oxo-1H-imidazole-5-carbonitrile (Compound 1a).
6-Amino-9-(p-tolylmethyl)-2-sulfanyl-7H-purin-8-one (20.0 g,
Compound 43b) was obtained as a yellow solid. MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 288.
Step 3: Preparation of
6-amino-2-ethylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound
43c)
##STR00161##
[0594] Compound 43c was prepared in analogy to Example 1, Method A,
Step 3 by using 6-amino-9-(p-tolylmethyl)-2-sulfanyl-7H-purin-8-one
(Compound 43b) and iodoethane instead of
6-amino-9-benzyl-2-sulfanyl-7H-purin-8-one (Compound 1b) and
bromopropane.
6-Amino-2-ethylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (13 g,
Compound 43c) was obtained as a yellow solid. MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 316.
Step 4: Preparation of
6-amino-2-ethylsulfinyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound
43d)
##STR00162##
[0596] Compound 43d was prepared in analogy to Example 1, Method A,
Step 4 by using
6-amino-2-ethylsulfanyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound
43c) instead of 6-amino-9-benzyl-2-methyl sulfanyl-7H-purin-8-one
(Compound 1c).
6-Amino-2-ethylsulfinyl-9-(p-tolylmethyl)-7H-purin-8-one6 (3.5 g,
Compound 43d) was obtained as a yellow solid. MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 332.
Step 5: Preparation of
6-amino-2-(ethylsulfonimidoyl)-9-(p-tolylmethyl)-7H-purin-8-one
(Compound 43e)
##STR00163##
[0598] Compound 43e was prepared in analogy to Example 1, Method A,
Step 5 by using 6-amino-2-ethyl
sulfinyl-9-(p-tolylmethyl)-7H-purin-8-one (Compound 43d) instead of
6-amino-9-benzyl-2-methylsulfinyl-7H-purin-8-one (Compound 1d).
6-Amino-2-(ethylsulfonimidoyl)-9-(p-tolylmethyl)-7H-purin-8-one
(530 mg, Compound 43e) was obtained as a yellow solid. .sup.1H NMR
(400 MHz, DMSO-d.sub.6) .delta.ppm: 10.53 (s, 1H), 7.24 (d, J=8.03
Hz, 2H), 7.13 (d, J=8.03 Hz, 2H), 6.94 (br. s., 2H), 4.91 (s, 2H),
4.03 (s, 1H), 3.36-3.41 (m, 2H), 2.26 (s, 3H), 1.18 (t, J=7.28 Hz,
3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 347.
[0599] Separation of compound of Compound 43e by chiral HPLC
afforded Compound 43e-A (faster eluting, 56.8 mg) and Compound
43e-B (slower eluting, 56.7 mg) as white solid with methanol 5%-40%
(0.05% DEA)/CO.sub.2 on ChiralPak AD-3 column.
##STR00164##
[0600] Compound 43e-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta.ppm: 10.52 (br. s., 1H), 7.23 (d, J=8.0 Hz, 2H), 7.13 (d,
J=7.9 Hz, 2H), 6.94 (br. s., 2H), 4.90 (s, 2H), 4.03 (s, 1H),
3.42-3.33 (m, 2H), 2.25 (s, 3H), 1.17 (t, J=7.3 Hz, 3H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 347.
##STR00165##
[0601] Compound 43e-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6)
.delta.ppm: 10.56 (br. s., 1H), 7.23 (d, J=8.0 Hz, 2H), 7.13 (d,
J=8.0 Hz, 2H), 6.95 (br. s., 2H), 4.90 (s, 2H) 4.03 (s, 1H),
3.44-3.29 (m, 2H), 2.25 (s, 3H), 1.17 (t, J=7.3 Hz, 3H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 347.
Step 6: Preparation of
6-Amino-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmet-
hyl)purine-7-carboxamide (Example 43-A) and
6-Amino-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmet-
hyl)purine-7-carboxamide Example 43-B
##STR00166##
[0603] Example 43-A was prepared in analogy to Example 1, Method A,
Step 6 by using Compound 43e-A instead of
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound
1e).
6-Amino-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmet-
hyl)purine-7-carboxamide (Example 43-A, 58.1 mg, faster eluting,
isopropanol from 5% to 40% (0.05% DEA)/CO.sub.2 on ChiralPak AD-3
column) was obtained as a white solid. .sup.1H NMR (400 MHz,
DMSO-d.sub.6) .delta. ppm: 7.28 (d, J=7.8 Hz, 2H), 7.15 (d, J=7.8
Hz, 2H), 6.88 (br. s., 2H), 5.03-4.87 (m, 2H), 4.19 (s, 1H),
3.61-3.36 (m, 4H), 3.11-2.96 (m, 3H), 2.26 (s, 3H), 1.72-1.45 (m,
2H), 1.20 (t, J=7.2 Hz, 3H), 0.97-0.65 (m, 3H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 446.
[0604] Example 43-B was prepared in analogy to Example 1, Method A,
Step 6 by using Compound 43e-B instead of
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound
1e).
6-Amino-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-N-propyl-9-(p-tolylmet-
hyl)purine-7-carboxamide (Example 43-B, 40.1 mg, slower eluting,
isopropanol from 5% to 40% (0.05% DEA)/CO.sub.2 on ChiralPak AD-3
column) was obtained as a white solid: .sup.1H NMR (400 MHz,
DMSO-d.sub.6) .delta. ppm: 7.28 (d, J=7.5 Hz, 2H), 7.15 (d, J=7.5
Hz, 2H), 6.89 (br. s., 2H), 5.03-4.86 (m, 2H), 4.19 (s, 1H),
3.49-3.37 (m, 4H), 3.08-3.00 (m, 3H), 2.27 (s, 3H), 1.70-1.48 (m,
2H), 1.20 (t, J=7.2 Hz, 3H), 0.95-0.71 (m, 3H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 446.3.
[0605] The stereochemistry of Example 43-B was determined by single
crystal X-ray diffraction shown in FIG. 3.
Example 44-A and Example 44-B
6-Amino-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethyl-
)purine-7-carboxamide (Example 44-A) and
6-Amino-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmeth-
yl)purine-7-carboxamide (Example 44-B)
##STR00167##
[0607] Example 44-A was prepared in analogy to Example 1, Method A,
Step 6 by using Compound 43e-B and N-ethyl-N-methyl-carbamoyl
chloride instead of
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound
1e) and N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
6-Amino-N-ethyl-2[S(S)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmethy-
l)purine-7-carboxamide (Example 44-A, 73.1 mg) was obtained as a
white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.28
(d, J=7.8 Hz, 2H), 7.15 (d, J=7.8 Hz, 2H), 6.90 (br. s., 2H), 4.95
(s, 2H), 4.19 (br. s., 1H), 3.48-3.39 (m, 4H), 3.06-3.00 (m, 3H),
2.27 (s, 3H), 1.29-1.04 (m, 6H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 432.
[0608] Example 44-B was prepared in analogy to Example 1, Method A,
Step 6 by using Compound 43e-A and N-ethyl-N-methyl-carbamoyl
chloride instead of 6-amino-9-benzyl-2-(propyl
sulfonimidoyl)-7H-purin-8-one (Compound 1e) and
N-methyl-N-propyl-carbamoyl chloride (Intermediate AA).
6-Amino-N-ethyl-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8-oxo-9-(p-tolylmeth-
yl)purine-7-carboxamide (Example 44-B, 46.7 mg) was obtained as a
white solid: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 7.28
(d, J=7.9 Hz, 2H), 7.15 (d, J=7.9 Hz, 2H), 6.90 (br. s., 2H), 4.95
(s, 2H), 4.19 (br. s., 1H), 3.50-3.39 (m, 4H), 3.10-2.96 (m, 3H),
2.27 (s, 3H), 1.27-1.10 (m, 6H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 432.
Example 45-A and Example 45-B
6-Amino-2-[S(R)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8-o-
xo-N-propyl-purine-7-carboxamide and
6-Amino-2-[S(S)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide
##STR00168##
[0609] Step 1: Preparation of
4-amino-3-[(4-fluorophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile
(Compound 45a)
##STR00169##
[0611] Compound 45a was prepared in analogy to Example 1, Method A,
Step 1 by using 4-fluorobenzyl isocyanate instead of benzyl
isocyanate.
4-Amino-3-[(4-fluorophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile
(48 g, Compound 45a) was obtained as a light yellow solid and was
used directly for next step without further purification. MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 233.
Step 2: Preparation of
6-amino-9-[(4-fluorophenyl)methyl]-2-sulfanyl-7H-purin-8-one
(Compound 45b)
##STR00170##
[0613] Compound 45b was prepared in analogy to Example 1, Method A,
Step 2 by using of
4-amino-3-[(4-fluorophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile
(Compound 45a) instead of
4-amino-3-phenylmethyl-2-oxo-1H-imidazole-5-carbonitrile (Compound
1a). 6-Amino-9-[(4-fluorophenyl)methyl]-2-sulfanyl-7H-purin-8-one
(32.0 g, Compound 45b) was obtained as a yellow solid. MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 292.
Step 3: Preparation of
6-amino-2-ethylsulfanyl-9-[(4-fluorophenyl)methyl]-7H-purin-8-one
(Compound 45c)
##STR00171##
[0615] Compound 45c was prepared in analogy to Example 1, Method A,
Step 3 by using
6-amino-9-[(4-fluorophenyl)methyl]-2-sulfanyl-7H-purin-8-one
(Compound 45b) and iodoethane instead of
6-amino-9-benzyl-2-sulfanyl-7H-purin-8-one (Compound 1b) and
bromopropane.
6-Amino-2-ethylsulfanyl-9-[(4-fluorophenyl)methyl]-7H-purin-8-one
(5.6 g, Compound 45c) was obtained as a yellow solid. MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 320.
Step 5: Preparation of
6-amino-2-ethylsulfinyl-9-[(4-fluorophenyl)methyl]-7H-purin-8-one
(Compound 45d)
##STR00172##
[0617] Compound 45d was prepared in analogy to Example 1, Method A,
Step 4 by using
6-amino-2-ethylsulfanyl-9-[(4-fluorophenyl)methyl]-7H-purin-8-on- e
(Compound 45c) instead of 6-amino-9-benzyl-2-propyl
sulfanyl-7H-purin-8-one (Compound 1c). 6-Amino-2-ethyl
sulfinyl-9-[(4-fluorophenyl)methyl]-7H-purin-8-one (4.8 g, Compound
45d) was obtained as a yellow solid. MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 332.
Step 6: Preparation of
6-amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-7H-purin-8-one
(Compound 45e)
##STR00173##
[0619] Compound 45e was prepared in analogy to Example 1, Method A,
Step 5 by using
6-amino-2-ethylsulfinyl-9-[(4-fluorophenyl)methyl]-7H-purin-8-on- e
(Compound 45d) instead of
6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (Compound 1d).
6-Amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-7H-purin-8-one
(2.9 g, Compound 45e) was obtained as a yellow solid. .sup.1H NMR
(400 MHz, DMSO-d.sub.6) .delta. ppm: 10.57 (br. s., 1H), 7.40 (dd,
J=8.5, 5.5 Hz, 2H), 7.16 (t, J=8.9 Hz, 2H), 6.97 (br. s., 2H), 4.94
(s, 2H), 4.07 (s, 1H), 3.43-3.36 (m, 2H), 1.17 (t, J=7.4 Hz, 3H).
MS obsd. (ESI.sup.+) [(M+H).sup.+]: 351.
[0620] Separation of compound of Compound 45e by chiral HPLC
afforded Compound 45e-A (faster eluting, 85.4 mg) and Compound
45e-B (slower eluting, 36.4 mg) as white solid with methanol 5%-40%
(0.05% DEA)/CO.sub.2 on ChiralPak AD-3 column.
[0621] Compound 45e-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 10.53 (br. s., 1H), 7.41 (dd, J=8.5, 5.5 Hz, 2H), 7.17 (t,
J=8.9 Hz, 2H), 6.98 (br. s., 2H), 4.95 (s, 2H), 4.07 (s, 1H),
3.45-3.36 (m, 2H), 1.17 (t, J=7.3 Hz, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 351.
[0622] Compound 45e-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 10.53 (br. s., 1H), 7.41 (dd, J=8.5, 5.5 Hz, 2H), 7.17 (t,
J=8.9 Hz, 2H), 6.98 (br. s., 2H), 4.95 (s, 2H), 4.07 (s, 1H),
3.44-3.37 (m, 2H) 1.17 (t, J=7.3 Hz, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 351.
Step 7: Preparation of
6-amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo--
N-propyl-purine-7-carboxamide (Example 45),
6-Amino-2-[S(R)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide and
6-Amino-2-[S(S)ethylsulfonimidoyl]-9-[(4-fluorophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide (Example 45-A and Example
45-B)
##STR00174##
[0624] Example 45 was prepared in analogy to Example 1, Method A,
Step 6 by using
6-amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-7H-pur-
in-8-one (Compound 45e) instead of
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound
1e).
6-Amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methyl-8-oxo--
N-propyl-purine-7-carboxamide (162.4 mg, Example 45) was obtained
as a white solid.
[0625] Separation of compound of Example 45 by chiral HPLC afforded
Example 45-A (faster eluting, 85.3 mg) and Example 45-B (slower
eluting, 52 mg) as white solid with methanol 5%-40% (0.05%
DEA)/CO.sub.2 on ChiralPak AD-3 column
[0626] Example 45-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 7.53-7.38 (m, 2H), 7.18 (t, J=8.9 Hz, 2H), 6.90 (br. s., 2H),
4.99 (s, 2H), 4.21 (s, 1H), 3.48-3.37 (m, 4H), 3.10-3.01 (m, 3H),
1.69-1.49 (m, 2H), 1.25-1.14 (m, 3H), 0.94-0.72 (m, 3H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 450.
[0627] Example 45-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 7.54-7.38 (m, 2H), 7.18 (t, J=8.9 Hz, 2H), 7.01-6.72 (m, 2H),
4.99 (s, 2H), 4.21 (s, 1H), 3.46-3.38 (m, 4H), 3.10-3.01 (m, 3H),
1.76-1.50 (m, 2H), 1.25-1.16 (m, 3H), 0.99-0.69 (m, 3H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 450.
Example 46-A and Example 46-B
6-Amino-N-ethyl-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methyl-
-8-oxo-purine-7-carboxamide (Example 46),
6-amino-N-ethyl-2-[S(S)-(ethylsulfonimidoyl)]-9-[(4-fluorophenyl)methyl]--
N-methyl-8-oxo-purine-7-carboxamide and
6-amino-N-ethyl-2-[S(R)-(ethylsulfonimidoyl)]-9-[(4-fluorophenyl)methyl]--
N-methyl-8-oxo-purine-7-carboxamide (Example 46-A and Example
46-B)
##STR00175##
[0629] Example 46 was prepared in analogy to Example 1, Method A,
Step 6 by using
6-amino-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-7H-pur-
in-8-one (Compound 45e) and N-ethyl-N-methyl carbamoyl chloride
instead of 6-amino-9-benzyl-2-(propyl sulfonimidoyl)-7H-purin-8-one
(Compound 1e) and N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA).
6-Amino-N-ethyl-2-(ethylsulfonimidoyl)-9-[(4-fluorophenyl)methyl]-N-methy-
l-8-oxo-purine-7-carboxamide (51 mg, Example 46) was obtained as a
white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm:
7.46-7.43 (m, 2H), 7.20-7.15 (m, 2H), 6.90 (br. s., 2H), 4.98 (s,
2H), 4.18 (s, 1H), 3.47-3.32 (m, 4H), 3.05-3.01 (m, 3H), 1.21-1.14
(m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 436.
[0630] Separation of compound of Example 46 by chiral HPLC afforded
Example 46-A (faster eluting, 72 mg) and Example 46-B (slower
eluting, 45 mg) as white solid with methanol 5%-40% (0.05%
DEA)/CO.sub.2 on ChiralPak AD-3 column
[0631] Example 46-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 7.46-7.43 (m, 2H), 7.20-7.16 (m, 2H), 6.90 (br. s., 2H), 4.98
(s, 2H), 4.18 (s, 1H), 3.47-3.32 (m, 4H), 3.05-3.01 (m, 3H),
1.21-1.14 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 436.
[0632] Example 46-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 7.46-7.43 (m, 2H), 7.20-7.14 (m, 2H), 6.92 (br. s., 2H), 4.98
(s, 2H), 4.20 (br. s., 1H), 3.47-3.32 (m, 4H), 3.05-3.01 (m, 3H),
1.23-1.19 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 436.
Example 47-A and Example 47-B
6-Amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-N--
propyl-purine-7-carboxamide (Example 47),
6-amino-2-[S(R)-ethylsulfonimidoyl]-9-[(4-bromophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide and
6-amino-2-[S(S)-ethylsulfonimidoyl]-9-[(4-bromophenyl)methyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide
##STR00176##
[0633] Step 1: Preparation of
4-amino-3-[(4-bromophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile
(Compound 47a)
##STR00177##
[0635] Compound 47a was prepared in analogy to Example 1, Method A,
Step 1 by using 4-bromobenzyl isocyanate instead of benzyl
isocyanate.
4-Amino-3-[(4-bromophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile
(500 mg, Compound 47a) was obtained as a light yellow solid and was
used directly for next step without further purification. .sup.1H
NMR (400 MHz, DMSO-d.sub.6) .delta. ppm: 9.94 (S, 1H), 7.55-7.53
(d, J=8.0 Hz, 2H), 7.20-7.18 (d, J=8.0 Hz, 2H), 6.52 (br. s., 2H),
4.74 (s, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 293.
Step 2: Preparation of
6-amino-9-[(4-bromophenyl)methyl]-2-sulfanyl-7H-purin-8-one
(Compound 47b)
##STR00178##
[0637] Compound 47b was prepared in analogy to Example 1, Method A,
Step 2 by using of
4-amino-3-[(4-bromophenyl)methyl]-2-oxo-1H-imidazole-5-carbonitrile
(Compound 47a) instead of
4-amino-3-phenylmethyl-2-oxo-1H-imidazole-5-carbonitrile (Compound
1a). 6-Amino-9-[(4-bromophenyl)methyl]-2-sulfanyl-7H-purin-8-one
(300 mg, Compound 47b) was obtained as a yellow solid. MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 352.
Step 3: Preparation of
6-amino-2-ethylsulfanyl-9-[(4-bromophenyl)methyl]-7H-purin-8-one
(Compound 47c)
##STR00179##
[0639] Compound 47c was prepared in analogy to Example 1, Method A,
Step 3 by using
6-amino-9-[(4-bromophenyl)methyl]-2-sulfanyl-7H-purin-8-one
(Compound 45b) and iodoethane instead of
6-amino-9-benzyl-2-sulfanyl-7H-purin-8-one (Compound 1b) and
bromopropane.
6-Amino-2-ethylsulfanyl-9-[(4-bromophenyl)methyl]-7H-purin-8-one
(5.6 g, Compound 47c) was obtained as a yellow solid. MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 380.
Step 4: Preparation of
6-amino-9-[(4-bromophenyl)methyl]-2-ethylsulfinyl-7H-purin-8-one
(Compound 47d)
##STR00180##
[0641] Compound 47d was prepared in analogy to Example 1, Method B,
Step 6 by using
6-amino-9-[(4-bromophenyl)methyl]-2-ethylsulfanyl-7H-purin-8-one
(Compound 47c) instead of
6-amino-9-benzyl-2-(2-propylsulfanyl)-7H-purin-8-one (Compound 1c).
6-Amino-9-[(4-bromophenyl)methyl]-2-ethylsulfinyl-7H-purin-8-one
(3.2 g, Compound 47d) was obtained as a white solid. MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 396.
Step 5: Preparation of
6-amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-7H-purin-8-one
(Compound 47e)
##STR00181##
[0643] Compound 47e was prepared in analogy to Example 1, Method B,
Step 7 by using
6-amino-9-[(4-bromophenyl)methyl]-2-ethylsulfinyl-7H-purin-8-one
(Compound 47d) instead of
6-amino-9-benzyl-2-propylsulfinyl-7H-purin-8-one (Compound 1d).
6-Amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-7H-purin-8-one
(4.0 g, Compound 47e) was obtained as a white solid. MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 411.
##STR00182##
[0644] Separation of compound of Compound 47e by chiral HPLC
afforded Compound 47e-A (faster eluting, 112 mg) and Compound 47e-B
(slower eluting, 99 mg) as white solid with methanol 5%-40% (0.05%
DEA)/CO.sub.2 on ChiralPak AD-3 column.
[0645] Compound 47e-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 10.58 (br. s., 1H), 7.52-7.54 (d, J=8.0, 2H), 7.31-7.29 (t,
J=8.0 Hz, 2H), 6.54 (br. s., 2H), 4.93 (s, 2H), 4.05 (s, 1H),
3.42-3.31 (m, 2H), 1.15 (t, J=7.3 Hz, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 411.
[0646] Compound 47e-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 10.58 (br. s., 1H), 7.54-7.52 (d, J=8.0, 2H), 7.31-7.29 (t,
J=8.0 Hz, 2H), 6.98 (br. s., 2H), 4.93 (s, 2H), 4.06 (s, 1H),
3.40-3.37 (m, 2H), 1.15 (t, J=7.3 Hz, 3H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 411.
Step 6: Preparation of
6-amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-N-
-propyl-purine-7-carboxamide (Example 47),
6-amino-9-[(4-bromophenyl)methyl]-2-[S(R)-ethylsulfonimidoyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide and
6-amino-9-[(4-bromophenyl)methyl]-2-[S(S)-ethylsulfonimidoyl]-N-methyl-8--
oxo-N-propyl-purine-7-carboxamide (Example 47-A and Example
47-B)
##STR00183##
[0648] Example 47 was prepared in analogy to Example 1, Method A,
Step 6 by using
6-amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-7H-puri-
n-8-one (Compound 47e) instead of
6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one (Compound
1e).
6-Amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-N-
-propyl-purine-7-carboxamide (570 mg, Example 47) was obtained as a
white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm:
7.56-7.53 (m, 2H), 7.36-7.34 (m, 2H), 6.92 (br. s., 2H), 4.97 (s,
2H), 4.18 (s, 1H), 3.45-3.38 (m, 4H), 3.05-3.02 (m, 3H), 1.65-1.56
(m, 2H), 1.19 (t, J=8.0 Hz, 3H), 0.93-0.75 (m, 3H). MS obsd.
(ESI.sup.+) [(M+H).sup.+]: 510.
[0649] Separation of compound of Example 47 by chiral HPLC afforded
Example 47-A (faster eluting, 260 mg) and Example 47-B (slower
eluting, 266 mg) as white solid with methanol 5%-40% (0.05%
DEA)/CO.sub.2 on ChiralPak AD-3 column
[0650] Example 47-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 7.56-7.54 (d, J=8.0 Hz, 2H), 7.36-7.33 (d, J=8.0 Hz, 2H), 6.90
(br. s., 2H), 4.97 (s, 2H), 4.21 (s, 1H), 3.46-3.41 (m, 4H),
3.05-3.02 (m, 3H), 1.65-1.54 (m, 2H), 1.24-1.16 (m, 3H), 0.93-0.75
(m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 510.
[0651] Example 47-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 7.54-7.53 (d, J=8.0 Hz, 2H), 7.36-7.33 (d, J=8.0 Hz, 2H), 6.90
(br. s., 2H), 4.97 (s, 2H), 4.21 (s, 1H), 3.46-3.41 (m, 4H),
3.06-3.02 (m, 3H), 1.65-1.54 (m, 2H), 1.20-1.16 (m, 3H), 0.93-0.75
(m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 510.
Example 48-A and Example 48-B
6-Amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-(ethylsulfonimidoyl)-N-methyl--
8-oxo-purine-7-carboxamide (Example 48),
6-amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-[S(S)-(ethylsulfonimidoyl)]-N-
-methyl-8-oxo-purine-7-carboxamide and
6-amino-9-[(4-bromophenyl)methyl]-N-ethyl-2-[S(R)-(ethylsulfonimidoyl)]-N-
-methyl-8-oxo-purine-7-carboxamide (Example 48-A and Example
48-B)
##STR00184##
[0653] Example 48 was prepared in analogy to Example 1, Method A,
Step 6 by using
6-amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-7H-puri-
n-8-one (Compound 47e) and N-ethyl-N-methyl-carbamoyl chloride
instead of 6-amino-9-benzyl-2-(propylsulfonimidoyl)-7H-purin-8-one
(Compound 1e) and N-methyl-N-propyl-carbamoyl chloride
(Intermediate AA).
6-Amino-9-[(4-bromophenyl)methyl]-2-(ethylsulfonimidoyl)-N-methyl-8-oxo-N-
-propyl-purine-7-carboxamide (469 mg, Example 48) was obtained as a
white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta. ppm:
7.56-7.54 (d, J=8.0 Hz, 2H), 7.36-7.34 (d, J=8.0 Hz, 2H), 6.98 (br.
s., 2H), 4.97 (s, 2H), 3.53-3.46 (m, 4H), 3.05-3.01 (m, 3H),
1.22-1.16 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 496.
[0654] Separation of compound of Example 48 by chiral HPLC afforded
Example 48-A (faster eluting, 198 mg) and Example 48-B (slower
eluting, 202 mg) as white solid with methanol 5%-40% (0.05%
DEA)/CO.sub.2 on ChiralPak AD-3 column.
[0655] Example 48-A: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 7.56-7.54 (d, J=8.0 Hz, 2H), 7.36-7.34 (d, J=8.0 Hz, 2H), 6.92
(br. s., 2H), 4.97 (s, 2H), 4.19-4.18 (m, 1H), 3.46-3.41 (m, 4H),
3.05-3.01 (m, 3H), 1.20-1.14 (m, 6H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 496.
[0656] Example 48-B: .sup.1H NMR (400 MHz, DMSO-d.sub.6) .delta.
ppm: 7.56-7.54 (d, J=8.0 Hz, 2H), 7.36-7.34 (d, J=8.0 Hz, 2H), 6.92
(br. s., 2H), 4.97 (s, 2H), 4.24 (br. s., 1H), 3.58-3.41 (m, 4H),
3.05-3.01 (m, 3H), 1.26-1.01 (m, 6H). MS obsd. (ESI.sup.+)
[(M+H).sup.+]: 496.
Example 49
Activity of Compounds and Examples in HEK293-hTLR-7 Assay
HEK293-Blue-hTLR-7 Cells Assay:
[0657] A stable HEK293-Blue-hTLR-7 cell line was purchased from
InvivoGen (Cat. #: hkb-htlr7, San Diego, Calif., USA). These cells
were designed for studying the stimulation of human TLR7 by
monitoring the activation of NF-.kappa.B. A SEAP (secreted
embryonic alkaline phosphatase) reporter gene was placed under the
control of the IFN-.beta. minimal promoter fused to five
NF-.kappa.B and AP-1-binding sites. The SEAP was induced by
activating NF-.kappa.B and AP-1 via stimulating HEK-Blue hTLR7
cells with TLR7 ligands. Therefore the reporter expression was
regulated by the NF-.kappa.B promoter upon stimulation of human
TLR7 for 20 hrs. The cell culture supernatant SEAP reporter
activity was determined using QUANTI-Blue.TM. kit (Cat. #: rep-qb1,
Invivogen, San Diego, Ca, USA) at a wavelength of 640 nm, a
detection medium that turns purple or blue in the presence of
alkaline phosphatase.
[0658] HEK293-Blue-hTLR7 cells were incubated at a density of
250,000450,000 cells/mL in a volume of 180 .mu.L in a 96-well plate
in Dulbecco's Modified Eagle's medium (DMEM) containing 4.5 g/L
glucose, 50 U/mL penicillin, 50 mg/mL streptomycin, 100 mg/mL
Normocin, 2 mM L-glutamine, 10% (V/V) heat-inactivated fetal bovine
serum for 24 hrs. Then the HEK293-Blue-hTLR-7 cells were incubated
with addition of 20 .mu.L test compound in a serial dilution in the
presence of final DMSO at 1% and perform incubation under
37.degree. C. in a CO.sub.2 incubator for 20 hrs. Then 20 .mu.L of
the supernatant from each well was incubated with 180 .mu.L
Quanti-blue substrate solution at 37.degree. C. for 2 hrs and the
absorbance was read at 620.about.655 nm using a spectrophotometer.
The signalling pathway that TLR7 activation leads to downstream
NF-.kappa.B activation has been widely accepted, and therefore
similar reporter assay was also widely used for evaluating TLR7
agonist (Tsuneyasu Kaisho and Takashi Tanaka, Trends in Immunology,
Volume 29, Issue 7, July 2008, Pages 329.sci; Hiroaki Hemmi et al,
Nature Immunology 3, 196-200 (2002)).
[0659] The Compounds and Examples of the present invention were
tested in HEK293-hTLR-7 assay for their TLR7 agonism activity as
described herein and results are listed in Table 1. The Examples of
prodrugs were found to have EC.sub.50 of about 2.1 .mu.M to about
1000 the Compounds of active forms were found to have EC.sub.50
less than 0.2 .mu.M. The calculated ratio of
EC.sub.50(prodrug)/EC.sub.50(active form) were within the range
from 32 to about 7600.
TABLE-US-00001 TABLE 1 Activity of Examples and Compounds of
present invention in HEK293-hTLR-7 assay HEK293- HEK293- Ratio
hTLR-7 EC.sub.50 Corresponding hTLR-7 EC.sub.50
(EC.sub.50(prodrug)/ Prodrug (Prodrug, .mu.M) Active Form (Active
form, .mu.M) EC.sub.50(active form)) Example 1 50.4 Compound 1e
0.065 775.4 Example 1-A 42.5 Compound 1e-A 0.067 634.3 Example 1-B
27 Compound 1e-B 0.086 314.0 Example 2 32 Compound 1e 0.065 372.1
Example 2-A 3.7 Compound 1e-B 0.086 43.0 Example 2-B 4.4 Compound
1e-A 0.067 65.7 Example 3 15.1 Compound 1e 0.065 232.3 Example 4 23
Compound 1e 0.065 353.8 Example 5 41 Compound 1e 0.065 630.8
Example 6 82.3 Compound 1e 0.065 1266.2 Example 7 19.9 Compound 1e
0.065 306.2 Example 8 2.1 Compound 1e 0.065 32.3 Example 9 19.2
Compound 1e 0.065 295.4 Example 10 68.5 Compound 1e 0.065 1053.8
Example 11 5.6 Compound 1e 0.065 86.2 Example 12 43.9 Compound 1e
0.065 675.4 Example 13 67 Compound 1e 0.065 1030.8 Example 14 2.4
Compound 1e 0.065 36.9 Example 15 494 Compound 1e 0.065 7600
Example 16 32.1 Compound 1e 0.065 493.8 Example 25 24.2 Compound 1e
0.065 372.3 Example 26 13.4 Compound 1e 0.065 206.2 Example 27 31.7
Compound 1e 0.065 487.7 Example 28 6.9 Compound 1e 0.065 106.2
Example 29 48.8 Compound 1e 0.065 750.8 Example 32 22.5 Compound 1e
0.065 346.2 Example 34-A 6.0 Compound 34e-A 0.014 428.6 Example
34-B 6.36 Compound 34e-B 0.011 578.2 Example 36-A 31.8 Compound
36g-A 0.019 1673.7 Example 37-A 26.6 Compound 36g-A 0.019 1400
Example 37-B 47.4 Compound 36g-B 0.022 2154.5 Example 38-A 26.2
Compound 36g-A 0.019 1378.9 Example 38-B 19.5 Compound 36g-B 0.022
886.4 Example 39 4.3 Compound 36g 0.027 159.3 Example 40 52.8
Compound 36g 0.027 1955.6 Example 41 36 Compound 41c 0.053 679.2
Example 41-A 44.1 Compound 41c-B 0.085 518.8 Example 41-B 32.1
Compound 41c-A 0.071 452.1 Example 42-A 40.5 Compound 41c-A 0.071
570.4 Example 42-B 49.2 Compound 41c-B 0.085 578.8 Example 43-A 110
Compound 43e-A 0.11 1000 Example 43-B 78.4 Compound 43e-B 0.035
2240 Example 44-A 65.4 Compound 43e-B 0.035 1868.6 Example 44-B
96.7 Compound 43e-A 0.11 879.1 Example 45-A 153 Compound 45e-B 0.26
or 0.39 588 or 392 or Compound 45e-A Example 45-B >1000 Compound
45e-B 0.26 or 0.39 >3846 or >2564 or Compound 45e-A Example
46-A 45.5 Compound 45e-A 0.26 or 0.39 175 or 116.7 or Compound
45e-B Example 46-B 45.7 Compound 45e-B 0.26 or 0.39 175.7 or 117.2
or Compound 45e-A Example 47-A 10.9 Compound 47e-A 0.021 or 0.025
519.0 or 436 or Compound 47e-B Example 47-B 13.1 Compound 47e-A
0.021 or 0.025 623.8 or 524 or Compound 47e-B Example 48-A 18.3
Compound 47e-A 0.021 or 0.025 871.4 or 732 or Compound 47e-B
Example 48-B 20.8 Compound 47e-A 0.021 or 0.025 990.5 or 832 or
Compound 47e-B
Example 50
Metabolism of Prodrugs of Compound of Formula (I)
[0660] A study was undertaken to evaluate the metabolic conversion
of prodrugs, compound of formula (I), to its corresponding active
form. The compounds of formula (I), if served as prodrugs, can be
metabolized to the active compound or other compounds of the
invention in the body. Human liver microsomes are often used to
assess the degree of metabolic conversion of prodrugs in the body
of animal or human.
Materials
[0661] NADPH cofactor system including .beta.-Nicotinamide adenine
dinucleotide phosphate (NADP), isocitric acid and isocitric
dehydrogenase were purchased from Sigma-Aldrich Co. (St. Louis,
Mo., USA). Human liver microsomes (Cat No. 452117, Lot No. 38290)
were obtained from Corning (Woburn, Mass., USA). Mouse liver
microsomes (Cat No. M1000, Lot No. 1310028) were obtained from
Xenotech.
Working Solution of the Compounds and Other Solution
[0662] Compounds were dissolved in DMSO to make 10 mM stock
solutions. 10 .mu.L of the stock solution was diluted with
acetonitrile (990 .mu.L) to get a 100 .mu.M working solution.
Incubation
[0663] Microsomes were preincubated with test compound for 10 min
at 37.degree. C. in 100 mM potassium phosphate buffer with pH 7.4.
The reactions were initiated by adding NADPH regenerating system to
give a final incubation volume of 200 .mu.L and shaken in a water
bath at 37.degree. C. Incubation mixtures consisted of liver
microsomes (0.5 mg microsomal protein/mL), substrates (1.0 .mu.M),
and NADP (1 mM), isocitric dehydrogenase (1 unit/mL), isocitric
acid (6 mM).
Preparation of Samples for Analysis
[0664] At 30 min, reaction was quenched by adding 600 .mu.L cold
acetonitrile (including 100 ng/mL tolbutamide and 100 ng/mL
labetalol as internal standard). The samples were centrifuged at
4000 rpm for 20 minutes and the resultant supernatants were
subjected to LC-MS/MS analysis.
[0665] The samples for calibration curve were prepared as followed.
Dispense 100 .mu.L/well liver microsomes and 98 .mu.L/well NADPH
regenerating system solution to 96-well plate. Add 600 .mu.L
quenching solution first, and then followed by 2 .mu.L Standard
curve and QC working solution.
Bioanalysis
[0666] The compounds were quantified on an API4000 LC-MC/MC
instrument in the ESI-Positive MRM mode.
[0667] A study was undertaken to evaluate the metabolic conversion
of prodrugs (1 .mu.M), Example 1, Example 1-A, Example 1-B, Example
2, Example 2-A, Example 2-B, Example 3, Example 4, Example 5,
Example 6, Example 7, Example 8, Example 9, Example 10, Example 11,
Example 12, Example 13, Example 14, Example 15, Example 16, Example
17, Example 21, Example 22, Example 23, Example 25, Example 26,
Example 27, Example 28 Example 29, Example 30, Example 31, Example
32, Example 33, Example 34-A, Example 34-B, Example 36-A, Example
36-B, Example 37-A, Example 37-B, Example 38-A, Example 38-B,
Example 39, Example 40, Example 41, Example 41-A, Example 41-B,
Example 42, Example 42-A, Example 42-B, Example 43, Example 43-A,
Example 43-B, Example 44, Example 44-A, Example 44-B and Example
45-A, Example 46-A, Example 46-B, Example 47-A, Example 47-B,
Example 48-A, Example 48-B to the corresponding active forms,
Compound 1e, Compound 1e-A, Compound 1e-B, Compound 34e-A, Compound
34e-B, Compound 36g-A, Compound 36g-B, Compound 36g, Compound 41c,
Compound 41c-B, Compound 41c-A, Compound 43e, Compound 43e-A,
Compound 43e-B, Compound 45e-A, Compound 45e-B, Compound 47e-A, and
Compound 47e-B in the presence of human liver microsomes. Results
were summarized and shown in Table 2.
TABLE-US-00002 TABLE 2 Metabolic conversion of prodrugs in human
liver microsomes Metabolized Metabolized product product
concentration concentration Corresponding in human liver
Corresponding in human liver Metabolized Product microsomes
Metabolized Product microsomes Example No. (active form) (.mu.M)
Example No. (active form) (.mu.M) Example 1 Compound 1e 0.0214
Example 31 Compound 1e 0.005 Example 1-A Compound 1e-A 0.018
Example 32 Compound 1e 0.013 Example 1-B Compound 1e-B 0.022
Example 33 Compound 1e 0.59 Example 2 Compound 1e 0.028 Example
34-A Compound 34e-A 0.2 Example 2-A Compound 1e-B 0.036 Example
34-B Compound 34e-B 0.088 Example 2-B Compound 1e-A 0.029 Example
36-A Compound 36g-A 0.02 Example 3 Compound 1e 0.12 Example 36-B
Compound 36g-B 0.019 Example 5 Compound 1e 0.078 Example 37-A
Compound 36g-A 0.004 Example 6 Compound 1e 0.074 Example 37-B
Compound 36g-B 0.002 Example 7 Compound 1e 0.15 Example 38-A
Compound 36g-A 0.026 Example 8 Compound 1e 0.043 Example 38-B
Compound 36g-B 0.034 Example 9 Compound 1e 0.002 Example 40
Compound 36g 0.032 Example 10 Compound 1e 0.005 Example 41-A
Compound 41c-B 0.38 Example 11 Compound 1e 0.001 Example 41-B
Compound 41c-A 0.36 Example 12 Compound 1e 0.018 Example 42-A
Compound 41c-A 0.14 Example 13 Compound 1e 0.04 Example 42-B
Compound 41c-B 0.004 Example 14 Compound 1e 0.026 Example 43-A
Compound 43e-A 0.014 Example 15 Compound 1e 0.002 Example 43-B
Compound 43e-B 0.016 Example 16 Compound 1e 0.024 Example 44-A
Compound 43e-B 0.002 Example 17 Compound 1e 0.075 Example 44-B
Compound 43e-A 0.002 Example 21 Compound 1e 0.48 Example 45-A
Compound 45e-B 0.41 or Compound 45e-A Example 22 Compound 1e 0.42
Example 46-A Compound 45e-A 0.039 or Compound 45e-B Example 23
Compound 1e 0.42 Example 46-B Compound 45e-B 0.18 or Compound 45e-A
Example 25 Compound 1e 0.018 Example 47-A Compound 47e-A 0.36 or
Compound 47e-B Example 26 Compound 1e 0.042 Example 47-B Compound
47e-B 0.41 or Compound 47e-A Example 27 Compound 1e 0.11 Example
48-A Compound 47e-A 0.11 or Compound 47e-B Example 28 Compound 1e
0.084 Example 48-B Compound 47e-B 0.053 or Compound 47e-A Example
29 Compound 1e 0.009
Example 51
In Vivo Antiviral Efficacy of Example 43-A in AAV-HBV Mouse
Model
Animal Model
[0668] 4-6 week old male C57BL/6 mice, specific pathogen free, were
purchased from Shanghai Laboratory Animal Center of Chinese Academy
of Sciences (SLAC) and housed in an animal care facility in
individually ventilated cages under controlled temperature and
light conditions following the Institutional Animal Care
guidelines. AAV-HBV virus was purchased from Beijing FivePlus
Molecular Medicine Institute (Beijing, China). The recombinant
virus carries 1.3 copies of the HBV genome packaged into AAV
serotype 8 (AAV8) capsids. C57BL/6 mice were injected with 2004, of
the recombinant virus diluted in saline buffer through tail vein.
On day 14, the mice were bled to measure HBV surface antigen
(HBsAg) and HBV genomic DNA in the serum, and animals were then
randomized into groups according to these HBV biomarkers.
Measurement of HBV Biomarkers
[0669] Serum HBsAg and HBeAg were measured using CLIA kits (Autobio
Diagnostics Co., Ltd., Zhengzhou, China) according to the
manufacturer's instructions. The lower limit of detection for HBsAg
was 0.05 IU/mL. Serum dilution of 500-fold was used to obtain
values within the linear range of the standard curve.
[0670] Serum HBV DNA was extracted using a MagNA Pure 96 DNA and
Viral NA Small Volume Kit (Roche) following the manufacturer's
instructions. The DNA samples were analyzed by real-time
quantitative PCR (qPCR) using a HBV-specific primer and probe set
for specific amplification and detection of a 128 bp HBV genome
region from the nucleotide 2969 to 3096. The sequences of the
primers and probe are:
TABLE-US-00003 Forward primer: AAGAAAAACCCCGCCTGTAA; Reverse
primer: CCTGTTCTGACTACTGCCTCTCC; HBV-Probe:
5'TAMRA-CCTGATGTGATGTTCTCCATGTTCAGC-BHQ2-3'.
[0671] Anti-HBs in the serum was tested using Anti-HBs CLIA kits
(Autobio Diagnostics Co., Ltd., Zhengzhou, China) and mouse
anti-IgG conjugated with Biotin (0.5 mg/mL) from a Mabtech B
Elispot kit. The anti-IgG Biotin was diluted in PBS with a final
concentration of 1 .mu.g/mL. 25 .mu.L of mouse anti-IgG were mixed
with serum samples in wells of the plate in the Anti-HBs CLIA kit
for 1-hour incubation. Then wash the plate and add Streptavidin-HRP
for 1-hour incubation at room temperature. After repeating the
washing step, mix substrate A and B from the CLIA kit and add 50
.mu.L of the mixture in each well. After 5-min incubation at room
temperature, the plate was read on an Envision Plate Reader
(PerkinElmer) to measure luminecence.
Study Design and Results
[0672] The mouse model with high level expression of both HBV DNA
and HBsAg was generated by injecting C57BL/6 mice with a
recombinant adeno-associated virus (AAV) carrying a replicable HBV
genome (AAV-HBV). With long-lasting HBV viremia and fully competent
immune system, the AAV-HBV mouse model was utilized to evaluate the
antiviral efficacy of the TLR7 agonists following the study design
as shown in Table 3.
TABLE-US-00004 TABLE 3 In vivo efficacy test of Example 43-A in
AAV-HBV mouse model Dose Animal group Test article (mg/kg) Route
Frequency Treatment 1 Vehicle 0 PO QOD 42 days 2 Example 43-A 10 PO
QOD 42 days 3 10 PO QW 42 days
[0673] Specifically, groups 2 and 3 were orally dosed with Example
43-A at 10 mg/kg every other day (QOD) and once weekly (QW),
respectively, and the control group 1 received only Vehicle. At the
dosing volume of 10 mL/kg, Example 43-A (1 mg/mL) was formulated as
an inclusion complex with 2% Klucel LF, 0.5% TPGS, 0.09%
Methylparabens, 0.01% Propylparabens in water. The animals were
treated for a total of 42 days, and were submandibularly bled twice
per week for serum collection throughout the study. The serum
samples were subjected to analysis of HBV biomarkers.
[0674] As shown in FIG. 4, the treatment of Example 43-A at 10
mg/kg QOD resulted in a dramatic reduction in HBV DNA (>3 log)
and HBsAg (>2.8 log). At the end of the 42-day treatment, the
levels of these viral markers became undetectable and below the
lower limit of quantification (LLOQ). Even with the less frequent
QW dosing, Example 43-A significantly reduced both HBV DNA (>2
log) and HBsAg (>2.8 log). Moreover, the treatment of Example
43-A at 10 mg/kg, regardless of QOD and QW dosing, induced a
considerable level of anti-HBsAg antibody. In conclusion, Example
43-A demonstrated good in vivo anti-HBV activity by reducing HBV
viral markers and promoting the production of HBV-specific
antibody.
Example 52
In Vivo Antiviral Efficacy of Example 41-A in AAV-HBV Mouse
Model
[0675] The antiviral efficacy of Example 41-A was evaluated in the
same AAV-HBV model following the study design in Table 4 with the
same methods to measure HBV biomarkers as described in Example
51.
TABLE-US-00005 TABLE 4 In vivo efficacy test of Example 41-A in
AAV-HBV mouse model Animal Dose group Test article (mg/kg) Route
Frequency Treatment 1 Vehicle 0 PO QOD 42 days 2 Example 41-A 1 PO
QOD 42 days 3 3 PO QOD 42 days 4 10 PO QOD 42 days 5 10 PO QW 42
days
[0676] Specifically, groups 2, 3 and 4 were orally dosed with
Example 41-A at 1, 3 and 10 mg/kg QOD respectively. Group 5 was
treated with 10 mg/kg QW, while group 1 with only Vehicle. At the
dosing volume of 10 mL/kg, Example 41-A (0.1, 0.3, and 1 mg/mL) was
formulated as an inclusion complex with 2% Klucel LF, 0.5% TPGS,
0.09% Methylparabens, 0.01% Propylparabens in water. The animals
were treated for a total of 42 days, and were submandibularly bled
twice per week for serum collection throughout the study. The serum
samples were subjected to analysis of HBV biomarkers.
[0677] As shown in FIG. 5, the treatment of Example 41-A at 1, 3,
10 mg/kg QOD dose-dependently reduced HBV DNA and HBsAg. All three
doses managed to reduce these viral markers below or close to the
LLOQ at the end of the 42-day treatment. Even with the less
frequent QW dosing, Example 41-A at 10 mg/kg also reduced HBV DNA
and HBsAg to undetectable levels at the treatment end. Moreover,
Example 41-A induced significantly higher levels of antibody
against-HbsAg than Vehicle post treatment. In conclusion, Example
41-A demonstrated good in vivo anti-HBV activity by reducing HBV
viral markers and promoting the production of HBV-specific
antibody.
Example 53
In Vivo Antiviral of Example 42-A Efficacy in AAV-HBV Mouse
Model
[0678] The antiviral efficacy of Example 42-A was evaluated in the
same AAV-HBV model following the study design in Table 5 with the
same methods to measure HBV biomarkers as described in Example
51.
TABLE-US-00006 TABLE 5 In vivo efficacy test of Example 42-A in
AAV-HBV mouse model Animal Dose group Test article (mg/kg) Route
Frequency Treatment 1 Vehicle 0 PO QOD 42 days 2 Example 1 PO QOD
42 days 3 42-A 3 PO QOD 42 days 4 10 PO QOD 42 days
[0679] Specifically, groups 2, 3, and 4 were orally dosed with
Example 42-A at 1, 3, and 10 mg/kg QOD respectively, while group 1
with only Vehicle. At the dosing volume of 10 mL/kg, Example 42-A
(0.1, 0.3, and 1 mg/mL) was formulated as an inclusion complex with
2% Klucel LF, 0.5% TPGS, 0.09% Methylparabens, 0.01% Propylparabens
in water. The animals were treated for a total of 42 days, and were
submandibularly bled twice per week for serum collection throughout
the study. The serum samples were subjected to analysis of HBV
biomarkers.
[0680] As shown in FIG. 6, the treatment of Example 42-A at 1, 3,
10 mg/kg QOD were all effective to reduce HBV DNA and HBsAg. While
the higher doses led to faster clearance of HBV DNA and HBsAg, all
three doses managed to reduce these viral markers below or close to
the LLOQ at the end of the 42-day treatment. All the groups treated
with Example 42-A developed significantly higher levels of
anti-HBsAg antibody. In conclusion, Example 42-A demonstrated good
in vivo anti-HBV activity by reducing HBV viral markers and
promoting the production of HBV-specific antibody.
Example 54
In Vivo Antiviral Efficacy of Example 41-B in AAV-HBV Mouse
Model
[0681] The antiviral efficacy of Example 41-B was evaluated in the
same AAV-HBV model following the study design in Table 6 with the
same methods to measure HBV biomarkers as described in Example
51.
TABLE-US-00007 TABLE 6 In vivo efficacy test of Example 41-B in
AAV-HBV mouse model Animal Dose group Test article (mg/kg) Route
Frequency Treatment 1 Vehicle 0 PO QOD 42 days 2 Example 1 PO QOD
42 days 3 41-B 3 PO QOD 42 days 4 10 PO QOD 42 days
[0682] Specifically, groups 2, 3, and 4 were orally dosed with
Example 41-B at 1, 3, and 10 mg/kg QOD, respectively, while group 1
with only Vehicle. At the dosing volume of 10 mL/kg, Example 41-B
(0.1, 0.3, and 1 mg/mL) was formulated as an inclusion complex with
2% Klucel LF, 0.5% TPGS, 0.09% Methylparabens, 0.01% Propylparabens
in water. The animals were treated for a total of 42 days, and were
submandibularly bled twice per week for serum collection throughout
the study. The serum samples were subjected to analysis of HBV
biomarkers.
[0683] As shown in FIG. 7, the treatment of Example 41-B at 1, 3,
10 mg/kg QOD were all effective to reduce HBV DNA and HBsAg. All
three doses managed to reduce these viral markers below the LLOQ at
the end of the 42-day treatment. All the groups treated with
Example 41-B also developed high levels of anti-HBsAg antibody than
the Vehicle group. In conclusion, Example 41-B demonstrated in vivo
anti-HBV activity by reducing HBV viral markers and promoting the
production of HBV-specific antibody.
Example 55
Single Dose PK Study in Male Wister-Han Rats
[0684] The single dose PK in Male Wister-Han Rats was performed to
assess pharmacokinetic properties of tested compounds. Two groups
of animals were dosed via Gavage (POE) of the respective compound.
Blood samples (approximately 20 .mu.L) were collected via Jugular
vein or an alternate site at 15 min, 30 min, 1H, 2 h, 4 h, 7 h and
24 h post-dose groups. Blood samples were placed into tubes
containing EDTA-K2 anticoagulant and centrifuged at 5000 rpm for 6
min at 4.degree. C. to separate plasma from the samples. After
centrifugation, the resulting plasma was transferred to clean tubes
for bioanalysis of both prodrug and active form on LC/MS/MS. In the
groups that prodrug were dosed, the concentration of prodrugs in
the plasma samples was under the detection limit. The "tested
compound" in Table 8 was used as the internal standard for testing
the metabolite (active form) of "dose compound" in vivo. The
pharmacokinetic parameters were calculated using non-compartmental
module of WinNonlin.RTM. Professional 6.2. The peak concentration
(C.sub.max) was recorded directly from experimental observations.
The area under the plasma concentration-time curve (AUC.sub.0-t)
was calculated using the linear trapezoidal rule up to the last
detectable concentration.
[0685] C.sub.max and AUC.sub.0-last are two critical PK parameters
related to the in vivo efficacy of the tested compound. Compounds
with higher C.sub.max and AUC.sub.0-last will lead to the better in
vivo efficacy. Results of PK parameters following oral
administration of active forms and competitor compounds are given
in Table 7. The PK parameters of prodrugs are tabulated in Table
8.
[0686] Following oral administration of prodrugs, the active forms
were observed in plasma and therefore tested. The exemplified
prodrugs of present invention (Example 41-B, 42-A, 42-B, 43-A, 45-A
and 45-B) surprisingly showed much improved C.sub.max (5-175 folds
increase) and AUC.sub.0-last (2.5-56 folds increase) comparing with
reference compounds (GS9620, S-2 and S-3) and compounds mentioned
in present invention (Compound 41c-A, 41c-B and 43e-A) which are
all active forms. The results clearly demonstrated the unexpected
superiority of prodrugs over active forms on PK parameters which
led to better in vivo efficacy.
TABLE-US-00008 TABLE 7 The mean plasma concentration and PK
parameters of active forms after 5 mg/kg oral dosing Dose Compound
compound GS9620 S-2 S-3 41c-A Time (h) Mean plasma concentration
(nM) 0.25 56.3 9.49 8.89 16.75 0.5 33.2 16.74 9.99 27.48 1 83.4
19.33 10.16 32.33 2 136 24.89 8.40 27.34 4 16.7 47.55 11.54 27.38
8* 9.49 52.72 8.17 18.02 24 ND 4.90 ND 5.60 C.sub.max (nM) 164
52.72 11.54 32.33 AUC.sub.0-last (nM h) 316 748 95 242.5 Dose
Compound Compound Compound Compound compound 41c-B 43e-A 45e-A
45e-B Time (h) Mean plasma concentration (nM) 0.25 3.41 12.60 64.6
42.8 0.5 0.75 15.22 80.0 52.2 1 2.04 13.01 58.1 37.6 2 5.46 11.98
42.5 24.2 4 2.52 8.20 77.8 53.9 8* 1.21 6.31 34.6 29 24 ND ND 8.6
5.7 C.sub.max (nM) 5.46 15.22 80.0 53.9 AUC.sub.0-last (nM h) 55.8
77 767 568 *7 hrs for Compound 41c-A, Compound 41c-B and Compound
43e-A
TABLE-US-00009 TABLE 8 PK parameters of prodrugs after 5 mg/kg oral
dosing Dose compound Tested compound C.sub.max (nM) AUC.sub.0-last
(nM h) Example 41-B Compound 41c-A 1315 3658 Example 42-A Compound
41c-A 1742 4867 Example 42-B Compound 41c-B 956 3148 Example 43-A
Compound 43e-A 77 229 Example 45-A Compound 45e-B 922 1914 Example
45-B Compound 45e-A 1436 2619
Example 56
LYSA Solubility Study
[0687] LSA study is used to determine the aqueous solubility of
tested compounds. Samples were prepared in duplicate from 10 mM
DMSO stock solution. After evaporation of DMSO with a centrifugal
vacuum evaporator, the compounds were dissolved in 0.05 M phosphate
buffer (pH 6.5), stirred for one hour and shaken for two hours.
After one night, the solutions were filtered using a microtiter
filter plate. Then the filtrate and its 1/10 dilution were analyzed
by HPLC-UV. In addition, a four-point calibration curve was
prepared from the 10 mM stock solutions and used for the solubility
determination of the compounds. The results were in .mu.g/mL. In
case the percentage of sample measured in solution after
evaporation divided by the calculated maximum of sample amount was
bigger than 80%, the solubility was reported as bigger than this
value.
[0688] Results of LYSA were shown in Table 9. It was clear that the
solubility of active forms were surprisingly improved by 10 to over
200 folds when converted to various prodrugs.
TABLE-US-00010 TABLE 9 Solubility data of particular compounds LYSA
of LYSA of Active Prodrugs Corresponding Active Forms Prodrugs
(.mu.g/mL) Forms (.mu.g/mL) Example 1 290 Compound 1e 21 Example
1-A 315 Compound 1e-A 56 Example 1-B 200 Compound 1e-B 50 Example 2
615 Compound 1e 21 Example 2-A >600 Compound 1e-B 50 Example 2-B
>590 Compound 1e-A 56 Example 3 240 Compound 1e 21 Example 4 695
Compound 1e 21 Example 5 >595 Compound 1e 21 Example 6 140
Compound 1e 21 Example 7 615 Compound 1e 21 Example 8 620 Compound
1e 21 Example 9 >520 Compound 1e 21 Example 10 120 Compound 1e
21 Example 11 >618 Compound 1e 21 Example 12 120 Compound 1e 21
Example 13 155 Compound 1e 21 Example 14 225 Compound 1e 21 Example
15 405 Compound 1e 21 Example 16 205 Compound 1e 21 Example 17 190
Compound 1e 21 Example 25 >670 Compound 1e 21 Example 26 >690
Compound 1e 21 Example 27 >380 Compound 1e 21 Example 28 695
Compound 1e 21 Example 29 395 Compound 1e 21 Example 32 125
Compound 1e 21 Example 36-A 168 Compound 36g-A 6 Example 36-B 209
Compound 36g-B 11 Example 41-A 260 Compound 41c-B 5 Example 41-B
250 Compound 41c-A 1 Example 42-A 225 Compound 41c-A 1 Example 42-B
335 Compound 41c-B 5 Example 43-A 203 Compound 43e-A 13 Example
43-B 170 Compound 43e-B 13 Example 45 172 Compound 45e 152 Example
45-A >560 Compound 45e-A or 90 or 115 Compound 45e-B Example
45-B 420 Compound 45e-B 115 or 90 Or Compound 45e-A Example 46-A
205 Compound 45e-A 90 or 115 Or Compound 45e-B Example 46-B >580
Compound 45e-B 115 or 90 Or Compound 45e-A Example 47-A 154
Compound 47e-A or <1.0 or <1.0 Compound 47e-B Example 47-B
128 Compound 47e-B or <1.0 or <1.0 Compound 47e-A Example
48-A 305 Compound 47e-A or <1.0 or <1.0 Compound 47e-B
Example 48-B 275 Compound 47e-B or <1.0 or <1.0 Compound
47e-A
Example 57
Portal Vein Study
[0689] The objective of this study was to understand whether
prodrug remains unchanged as it was absorbed through the intestine
into the portal circulation and demonstrate the primary site of
conversion.
Surgical Procedure for Portal Vein Cannulation (PVC) and Carotid
Artery Cannulation (CAC)
[0690] Surgery was performed under pentobarbital/isoflurane
anesthesia. Briefly, after disinfecting the abdominal area with
betadine and 70% isopropyl alcohol, a small abdominal mid-line
incision was made. The cecum was pulled out and mesenteric vein was
identified and isolated for about 5 mm vessel. A loose ligature was
placed proximally and distal end of the vein was ligated. Make a
small incision (just enough to allow the insertion of the catheter)
on isolated vein and insert the PU catheter towards liver for
appropriate length. The catheter was secured in place by tying the
loose ligature around the cannulated vessel. The cecum was replaced
into abdominal cavity. A hole was made in the right abdominal wall
to make the end of catheter pass freely. The catheter was secured
by suture on the abdominal wall. The abdominal muscle incision was
closed with suture. A small incision was made in the scapular area
to serve as the exit site of the catheter. The catheter was
subcutaneously tunneled and exteriorized through the scapular
incision. A fixed suture was placed in the scapular region. The
patency of the catheter was checked and then exteriorized from the
subcutaneous space to the dorsal neck region. After gently wiping
the area, the abdominal cavity was sutured. The left carotid artery
was then cannulated by inserting a PESO catheter. Both the
exteriorized catheters were tied firmly on the dorsal neck region
and fixed. The animals was then allowed to recover in its cage and
used for study at least 3 days after surgery. All catheters were
flushed once daily with heparinized saline to maintain patency.
Oral PK Study in PVC/CAC Dual Cannulated Rat
[0691] Animals were fasted overnight (n=3) and administered vial
oral gavage (10 mg/kg, 10 mL/kg). Blood samples (60 .mu.L) were
collected simultaneously from the portal and carotid artery
catheters at 0.083, 0.25, 0.5, 1, 2, 4, 7, 24 h. All blood samples
will be transferred into microcentrifuge tubes containing 2 .mu.L
of K.sub.2EDTA (0.5M) as anti-coagulant and placed on wet ice. Then
blood samples will be processed for plasma by centrifugation at
approximately 4.degree. C., 3000 g within half an hour of
collection. Plasma samples will be stored in polypropylene tubes,
quick frozen over dry ice and kept at -70.+-.10.degree. C. until
LC/MS/MS analysis.
[0692] Pharmacokinetic parameters (mean.+-.SD, n=3) of prodrugs and
active forms in portal and carotid samples following oral
administration of prodrugs (10 mg/kg) in portal vein cannulated rat
were detected and analyzed. The test results of Example 1-B, 41-A,
41-B, 42-A and 43-A were summarized below.
TABLE-US-00011 TABLE 10 Pharmacokinetic parameters of Example 41-A
and its corresponding active form Compound 41c-B in portal and
carotid samples following oral administration of Example 41-A (10
mg/kg) in portal vein cannulated rat Prodrug Example 41-A
Corresponding Active Compound 41c-B Form Portal sampling Carotid
sampling PK parameter prodrug active form prodrug active form
T.sub.max (h) 0.14 0.4 0.19 0.42 C.sub.max (nM) 9703 2223 210 2185
AUC.sub.0-2 (nM h) 2188 2246 114 2108 AUC.sub.active/AUC.sub.total
51% 95%
TABLE-US-00012 TABLE 11 Pharmacokinetic parameters of Example 43-A
and its corresponding active form Compound 43-A in portal and
carotid samples following oral administration of Example 43e-A (10
mg/kg) in portal vein cannulated rat Prodrug Example 43-A
Corresponding Active Compound 43e-A Form Portal sampling Carotid
sampling PK parameter prodrug active form prodrug active form
T.sub.max (h) 0.28 0.33 0.22 0.28 C.sub.max (nM) 4110 818 191 691
AUC.sub.0-2 (nM h) 2067 679 124 564 AUC.sub.active/AUC.sub.total
25% 82%
TABLE-US-00013 TABLE 12 Pharmacokinetic parameters of Example 1-B
and its corresponding active form Compound 1e-A in portal and
systemic samples following oral administration of Example 1-B (10
mg/kg) in portal vein cannulated rat Prodrug Example 1-B
Corresponding Active Compound 1e-A Form Portal sampling Carotid
sampling PK parameter prodrug active form prodrug active form
T.sub.max (h) 0.083 0.25 0.083 0.5 C.sub.max (nM) 670 192 70 174
AUC.sub.0-2 (nM h) 266 164 40 184 AUC.sub.active/AUC.sub.total 38%
82%
TABLE-US-00014 TABLE 13 Pharmacokinetic parameters of Example 42-A
and its corresponding active form Compound 41c-A in portal and
carotid samples following oral administration of Example 42-A (10
mg/kg) in portal vein cannulated rat Prodrug Example 42-A
Corresponding Active Compound 41c-A Form Portal sampling Carotid
sampling PK parameter prodrug active form prodrug active form Tmax
(h) 0.19 0.42 0.22 0.36 Cmax (nM) 8917 3162 286 3326 AUC.sub.0-2
(nM h) 3461 3199 286 3326 AUC.sub.active/AUC.sub.total 48% 96%
TABLE-US-00015 TABLE 14 Pharmacokinetic parameters of Example 41-B
and its corresponding active form Compound 41c-A in portal and
carotid samples following oral administration of Example 41-B (10
mg/kg) in portal vein cannulated rat Prodrug Example 41-B
Corresponding Active Compound 41c-A Form Portal sampling Carotid
sampling PK parameter prodrug active form prodrug active form
T.sub.max (h) 0.19 0.5 0.25 0.5 C.sub.max (nM) 7068 3315 29.6 3432
AUC.sub.0-2 (nM h) 1444 3211 22.5 3301 AUC.sub.active/AUC.sub.total
69% 99%
[0693] Based on the above results, it was concluded that the
primary site of conversion of prodrug was liver rather than
intestine, because AUC.sub.active/AUC.sub.total was higher in
sampling from carotid artery compared to
AUC.sub.active/AUC.sub.total in sampling from portal vein.
Sequence CWU 1
1
3120DNAHepatitis B virus 1aagaaaaacc ccgcctgtaa 20223DNAHepatitis B
virus 2cctgttctga ctactgcctc tcc 23327DNAHepatitis B virus
3cctgatgtga tgttctccat gttcagc 27
* * * * *