U.S. patent application number 16/991455 was filed with the patent office on 2020-12-03 for generation of neural stem cells and motor neurons.
The applicant listed for this patent is EXOSTEM BIOTEC LTD.. Invention is credited to Chaya BRODIE.
Application Number | 20200377854 16/991455 |
Document ID | / |
Family ID | 1000005022877 |
Filed Date | 2020-12-03 |
View All Diagrams
United States Patent
Application |
20200377854 |
Kind Code |
A1 |
BRODIE; Chaya |
December 3, 2020 |
GENERATION OF NEURAL STEM CELLS AND MOTOR NEURONS
Abstract
A method of generating a population of cells useful for treating
a brain disorder in a subject is disclosed. The method comprises
contacting mesenchymal stem cells (MSCs) with at least one
exogenous miRNA having a nucleic acid sequence at least 90%
identical to a sequence selected from the group consisting of SEQ
ID NOs: 15-19 and 27-35, thereby generating a population of cells
and/or generating neurotrophic factors that may provide important
signals to damaged tissues or locally residing stem cells. MSCs
differentiated by miRs may also secrete miRs and deliver them to
adjacent cells and therefore provide important signals to
neighboring endogenous normal or malignant cells.
Inventors: |
BRODIE; Chaya; (Southfield,
MI) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
EXOSTEM BIOTEC LTD. |
Tel Aviv |
|
IL |
|
|
Family ID: |
1000005022877 |
Appl. No.: |
16/991455 |
Filed: |
August 12, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15794137 |
Oct 26, 2017 |
10752883 |
|
|
16991455 |
|
|
|
|
14380165 |
Aug 21, 2014 |
9803175 |
|
|
PCT/IB2013/051429 |
Feb 21, 2013 |
|
|
|
15794137 |
|
|
|
|
61601596 |
Feb 22, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 2600/178 20130101;
C12N 2506/1392 20130101; C12N 2506/1369 20130101; C12N 2501/41
20130101; C12N 2501/998 20130101; A61K 35/28 20130101; A61P 35/00
20180101; C12N 2506/1384 20130101; C12N 2320/11 20130101; C12N
2506/08 20130101; C12N 2501/115 20130101; C12N 2330/10 20130101;
C12N 2501/11 20130101; C12N 5/0623 20130101; C12Q 1/6876 20130101;
C12N 2510/00 20130101; C12N 2501/65 20130101; C12N 2501/91
20130101; C12Q 2600/158 20130101; C12N 2501/13 20130101; C12N
2310/141 20130101; C12N 2501/385 20130101; C12N 2506/1353 20130101;
C12N 5/0619 20130101; C12N 2506/025 20130101; C12N 2501/999
20130101; C12N 15/113 20130101 |
International
Class: |
C12N 5/0797 20060101
C12N005/0797; C12N 5/0793 20060101 C12N005/0793; A61K 35/28
20060101 A61K035/28; C12Q 1/6876 20060101 C12Q001/6876 |
Claims
1. A method of promoting mesenchymal stem cell (MSC)
differentiation toward a neuronal stem cell, the method comprising:
(i) culturing a MSC in a medium supporting neuronal stem cell
growth and differentiation; (ii) contacting said MSC with an
exogenous agent that down-regulates an amount, activity or both of
Related to testis-specific, vespid and pathogenesis protein 1
(RTVP-1); and (iii) confirming increased expression at least one
neuronal marker selected from the group consisting of nestin and
Sox2 by detecting expression of said marker on said MSC, thereby
promoting differentiation of the MSC into the neuronal stem
cell.
2. The method of claim 1, wherein said contacting comprises
introducing into said MSC a microRNA (miR) or siRNA that
down-regulates RTVP-1.
3. The method of claim 2, wherein said miR is miR-137.
4. The method of claim 2, wherein said siRNA comprises the
nucleotide sequence provided in SEQ ID NO: 481.
5. The method of claim 2, wherein said introducing comprises any
one of: (i) transfecting said MSCs with an expression vector which
comprises a polynucleotide sequence which encodes a pre-miRNA of
said miR; (ii) transfecting said MSCs with an expression vector
which comprises a polynucleotide sequence which encodes said miR;
(iii) transfecting said MSCs with an expression vector which
comprises a polynucleotide sequence which encodes an shRNA
comprising said siRNA; and (iv) transfecting said MSCs with an
expression vector which comprises a polynucleotide sequence which
encodes said siRNA.
6. The method of claim 1, further comprising introducing into said
MSC an exogenous molecule selected from miR-218, miR-504, miR-9,
miR-125 and a miR-31 antagomir before said confirming.
7. The method of claim 6, comprising introducing into said MSC
exogenous miR-218.
8. The method of claim 6, wherein said introducing comprises any
one of: (i) transfecting said MSCs with an expression vector which
comprises a polynucleotide sequence which encodes a pre-miRNA of
said miR; and (ii) transfecting said MSCs with an expression vector
which comprises a polynucleotide sequence which encodes said
miR.
9. A method of promoting mesenchymal stem cell (MSC)
differentiation toward a neuronal stem cell, the method comprising:
(i) culturing a MSC in a medium supporting neuronal stem cell
growth and differentiation; (ii) contacting said MSC with an
exogenous agent that down-regulates an amount, activity or both of
Related to testis-specific, vespid and pathogenesis protein 1
(RTVP-1); and (iii) confirming expression of at least one neuronal
stem cell marker selected from the group consisting of nestin and
Sox2, wherein said expressing results in at least 50% of the MSCs
expressing said neuronal stem cell marker, thereby promoting
differentiation of the MSC into the neuronal stem cell.
10. The method of claim 9, wherein said contacting comprises
introducing into said MSC a microRNA (miR) or siRNA that
down-regulates RTVP-1.
11. The method of claim 10, wherein said miR is miR-137.
12. The method of claim 10, wherein said siRNA comprises the
nucleotide sequence provided in SEQ ID NO: 481.
13. The method of claim 10, wherein said introducing comprises any
one of: (i) transfecting said MSCs with an expression vector which
comprises a polynucleotide sequence which encodes a pre-miRNA of
said miR; (ii) transfecting said MSCs with an expression vector
which comprises a polynucleotide sequence which encodes said miR;
(iii) transfecting said MSCs with an expression vector which
comprises a polynucleotide sequence which encodes an shRNA
comprising said siRNA; and (iv) transfecting said MSCs with an
expression vector which comprises a polynucleotide sequence which
encodes said siRNA.
14. The method of claim 9, further comprising introducing into said
MSC an exogenous molecule selected from miR-218, miR-504, miR-9,
miR-125 and a miR-31 antagomir before said confirming.
15. The method of claim 14, comprising introducing into said MSC
exogenous miR-218.
16. The method of claim 14, wherein said introducing comprises any
one of: (i) transfecting said MSCs with an expression vector which
comprises a polynucleotide sequence which encodes a pre-miRNA of
said miR; and (ii) transfecting said MSCs with an expression vector
which comprises a polynucleotide sequence which encodes said
miR.
17. A method of treating a subject suffering from a brain cancer,
the method comprising administering to said subject an MSC
differentiated toward a neuronal stem cell by the method of claim
1, thereby treating a subject suffering from a brain cancer.
18. The method of claim 17, wherein said brain cancer is a
glioma.
19. A method of treating a subject suffering from a brain cancer,
the method comprising administering to said subject an MSC
differentiated toward a neuronal stem cell by the method of claim
9, thereby treating a subject suffering from a brain cancer.
20. The method of claim 17, wherein said brain cancer is a glioma.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 15/794,137 filed on Oct. 26, 2017, which is a
continuation-in-part of U.S. patent application Ser. No. 14/380,165
filed on Aug. 21, 2014 and titled "Generation of Neural Stem Cells
and Motor Neurons" and Issued as U.S. Pat. No. 9,803,175 on Oct.
31, 2017, which is a national phase of PCT Patent Application No.
PCT/IB2013/051429 filed on Feb. 21, 2013, which claims the benefit
of priority of U.S. Provisional Patent Application No. 61/601,596
filed on Feb. 22, 2012. The contents of the above applications are
all incorporated by reference as if fully set forth herein in their
entirety.
FIELD AND BACKGROUND OF THE INVENTION
[0002] The present invention, in some embodiments thereof, relates
to methods of ex vivo differentiating mesenchymal stem cells
towards neural stem cells and motor neurons using microRNAs
(miRNAs).
[0003] Mesenchymal stem cells (MSCs) are a heterogeneous population
of stromal cells that can be isolated from multiple species,
residing in most connective tissues including bone marrow, adipose,
placenta, umbilical cord and perivascular tissues. MSCs can also be
isolated from the placenta, amniotic fluid and cord's Wharton's
jelly.
[0004] The concentration of MSCs in all tissues, including bone
marrow and adipose tissue is very low but their number can be
expanded in vitro. Typically, expansion of MSCs using up to 15
passages does not result in mutations indicating genetic stability.
MSC can differentiate into cells of the mesenchymal lineage, such
as bone, cartilage and fat but, under certain conditions, have been
reported to acquire the phenotype of cells of the endodermal and
neuroectodermal lineage, suggesting some potential for
"trans-differentiation".
[0005] Within the bone marrow compartment, these cells are tightly
intermingled with and support hematopoiesis and the survival of
hematopoietic stem cells in acquiescent state (7). In addition,
after expansion in culture, MSCs retain their ability to modulate
innate and adaptive immunity (8). Furthermore, MSCs migrate
actively to sites of inflammation and protect damaged tissues,
including the CNS, properties that supported their use as new
immunosuppressive or rather immunoregulatory or anti-inflammatory
agents for the treatment of inflammatory and immune-mediated
diseases including autoimmune disorders (9). These features of MSCs
merited their use to control life-threatening
graft-versus-host-disease (GVHD) following allogeneic bone marrow
transplantation, thus controlling one of the most serious
complications of allogenic bone marrow transplantation, helping to
lower transplant-related toxicity and mortality associated with
multi-system organ injury (10).
[0006] Several studies have shown that MSCs following exposure to
different factors in vitro, change their phenotype and demonstrate
neuronal and glial markers [Kopen, G. C., et al., Proc Natl Acad
USA. 96(19):10711-6, 1999; Sanchez-Ramos, et al. Exp Neurol.
164(2):247-56. 2000; Woodbury, D., J Neurosci Res. 61(4):364-70,
2000; Woodbury, D., et al., J Neurosci Res. 69(6):908-17, 2002;
Black, I. B., Woodbury, D. Blood Cells Mol Dis. 27(3):632-6, 2001;
Kohyama, J., et al. Differentiation. 68(4-5):235-44, 2001; Levy, Y.
S. J Mol Neurosci. 21(2):121-32, 2003].
[0007] Accordingly, MSCs (both ex-vivo differentiated and
non-differentiated) have been proposed as candidates for cell
replacement therapy for the treatment of various neurological
disorders including multiple sclerosis, Parkinson's disease, ALS,
Alzheimer's disease, spinal cord injury and stroke.
[0008] Motor neurons in the spinal cord innervate skeletal muscles,
and originate from neuroepithelial cells in a restricted area of
the developing spinal cord (neural tube). During embryonic
development, motor neurons extend their processes (nerves) to the
periphery to innervate skeletal muscles that are adjacent to the
spinal cord. In an adult human body, however, motor neuron's axons
are projected large distances away from the cell bodies in the
spinal cord to reach their target muscles. Because of this, motor
neurons have a higher metabolic rate compared to smaller neurons,
and this renders them more susceptible to genetic, epigenetic, and
environmental changes. Motor neurons cannot renew themselves and
therefore their loss or degeneration are generally associated with
fatal neurological conditions including paralysis and disorders
such as pediatric spinal muscular atrophy (SMA) and adult onset
amyotrophic lateral sclerosis (ALS).
[0009] Roy et al., 2005 [Exp Neural. 2005; 196:224-234]; Zhang et
al., 2006 [Stem Cells. 2006; 24:434-442]; Bohl et al., 2008 [Stem
Cells. 2008; 26:2564-2575]; and Dimos et al., 2008 [Science. 2008;
321:1218-1221] the contents of which are incorporated by reference
teach genetic modification of different stem cells to induce
differentiation into motor neurons.
SUMMARY OF THE INVENTION
[0010] According to an aspect of some embodiments of the present
invention there is provided a method of predisposing mesenchymal
stem cells to differentiate into neural stem cells, the method
comprising up-regulating a level of at least one exogenous miRNA
selected from the group consisting of miR-1275, miR-891a, miR-154,
miR-1202, miR-572, miR-935a, miR302b, miR-371, miR-134, miR-219,
miR-155, miR-32, miR-33, miR-126, miR-127, miR-132, let-7c,
miR-665, miR-4258, miR-361-3p, miR-374a-star, miR-892b, miR-361-5p,
miR-181a, miR-16, miR-636, miR-4284, miR-1208, miR-1274b,
miR-30c-2-star, miR-501-3p, hsa-miR-92a, miR-378b, miR-1287,
miR-425-star, miR-324-5p, miR-3178, miR-219-1-3p, miR-197,
miR-181b, miR-500-star, miR-106b, miR-502-3p, miR-30c, miR-1275,
miR-422a, miR-93, miR-181d, miR-1307, miR-1301, miR-99a,
miR-505-star, miR-1202, miR-12, miR-532-5p, miR-195, miR-532-3p,
miR-106a, miR-17, miR-1271, miR-769-3p, miR-15b, miR-324-3p,
miR-20a, miR-501-5p, miR-330-3p, miR-874, miR-500, miR-25,
miR-769-5p, miR-125b-2-star, miR-130b, miR-504, miR-181a-2-star,
miR-885-3p, miR-1246, miR-92b, miR-362-5p, miR-572, miR-4270,
miR-378c, miR-93-star, miR-149, miR-363, miR-9, miR-18a, miR-346,
miR-497, miR-378, miR-1231, miR-139-5p, miR-3180-3p, miR-935 and
miR-20b in the mesenchymal stem cells (MSCs), thereby predisposing
the MSCs to differentiate into the neural stem cells.
[0011] According to an aspect of some embodiments of the present
invention there is provided a method of predisposing MSCs to
differentiate into neural stem cells, the method comprising
down-regulating an expression of at least one miRNA selected from
the group consisting of miR-4317, miR-153, miR-4288, miR-409-5p,
miR-193a-5p, miR-lOb, miR-142-3p, miR-131a, miR-125b, miR-181a,
miR-145, miR-143, miR-214, miR-199a-3p, miR-199a-5p, miR-199b-3p,
miR-138, miR-31, miR-21, miR-193a-5p, miR-224-star, miR-196a,
miR-487b, miR-409-5p, miR-193b-star, miR-379, miR-21-star,
miR-27a-star, miR-27a, miR-4317, miR-193b, miR-27b, miR-22, 574-3p,
miR-4288, miR-23a, miR-221-star, miR-2113, let-7i, miR-24, miR-23b,
miR-299-3p, miR-518c-star, miR-221, miR-431-star, miR-523,
miR-4313, miR-559, miR-614, miR-653, miR-2278, miR-768-5p,
miR-154-star, miR-302a-star, miR-3199 and miR-3137 in the
mesenchymal stem cells by up-regulating a level of at least one
polynucleotide agent that hybridizes and inhibits a function of the
at least one miRNA thereby predisposing the MSCs to differentiate
into the neural stem cells.
[0012] According to an aspect of some embodiments of the present
invention there is provided a method of predisposing MSCs to
differentiate into neural stem cells, the method comprising
up-regulating a level of exogenous miR-124 in the mesenchymal stem
cells (MSCs) and down-regulating a level of miR-let-7 in the MSCs,
thereby predisposing the MSCs to differentiate into the neural stem
cells.
[0013] According to an aspect of some embodiments of the present
invention there is provided a method of predisposing MSCs to
differentiate into neural stem cells, the method comprising
contacting the mesenchymal stem cells (MSCs) with an agent that
down-regulates an amount and/or activity of Related to
testis-specific, vespid and pathogenesis protein 1 (RTVP-1),
thereby predisposing MSCs to differentiate into the neural stem
cells.
[0014] According to an aspect of some embodiments of the present
invention there is provided a method of predisposing neural stem
cells to differentiate into motor neurons, the method comprising
up-regulating a level of at least one exogenous miRNA selected from
the group consisting of miR-368, miR-302b, miR-365-3p, miR-365-5p,
miR-Let-7a, miR-Let-7b, miR-218, miR-134, miR-124, miR-125a, miR-9,
miR-154, miR-20a and miR-130a in neural stem cells (NSCs), thereby
predisposing NSCs to differentiate into the motor neurons.
[0015] According to an aspect of some embodiments of the present
invention there is provided a method of predisposing MSCs to
differentiate into motor neurons, the method comprising
up-regulating a level of at least one exogenous miRNA selected from
the group consisting of miR-648, miR-368, miR-365, miR-500,
miR-491, miR-218, miR-155, miR-192, let-7b, miR-16, miR-210,
miR-197, miR-21, miR-373, miR-27a, miR-122, miR-17, miR-494,
miR-449, miR-503, miR-30a, miR-196a, miR-122, miR-7, miR-151-5p,
miR-16, miR-22, miR-31, miR-424, miR-1, miR-29c, miR-942, miR-100,
miR-520, miR-663a, miR-562, miR-449a, miR-449b-5p, miR-520b,
miR-451, miR-532-59, miR-605, miR-504, miR-503, miR-155, miR-34a,
miR-16, miR-7b, miR-103, miR-124, miR-1385p, miR-16, miR-330,
miR-520, miR-608, miR-708, miR-107, miR-137, miR-132, miR-145,
miR-204, miR-125b, miR-224, miR-30a, miR-375, miR-101, miR-106b,
miR-128, miR-129-5p, miR-153, miR-203, miR-214, miR-338-3p,
miR-346, miR-98, miR-107, miR-141, miR-217, miR-424, miR-449,
miR-7, miR-9, miR-93, miR-99a, miR-100, miR-1228, miR-183, miR-185,
miR-190, miR-522, miR-650, miR-675, miR-342-3p, miR-31 in the
mesenchymal stem cells (MSCs), thereby predisposing MSCs to
differentiate into the motor neurons.
[0016] According to an aspect of some embodiments of the present
invention there is provided a method of predisposing NSCs to
differentiate into motor neurons, the method comprising
down-regulating an expression of at least one miRNA selected from
the group consisting of miR-372, miR-373, miR-141, miR-199a,
miR-32, miR-33, miR-221 and miR-223 by up-regulating a level of at
least one polynucleotide agent that hybridizes and inhibits a
function of the at least one miRNA in the NSCs thereby predisposing
NSCs to differentiate into the motor neurons.
[0017] According to an aspect of some embodiments of the present
invention there is provided a method of predisposing MSCs to
differentiate into motor neurons, the method comprising
down-regulating an expression of at least one miRNA selected from
the group consisting of miR-372, miR-373, miR-942, miR-2113,
miR-199a-3p, miR-199a-5p, miR-372, miR-373, miR-942, miR-2113,
miR-301a-3p, miR-302c, miR-30b-5p, miR-30c, miR-326, miR-328,
miR-331-3p, miR-340, miR-345, miR-361-5p, miR-363, miR-365a-3p,
miR-371a-3p, miR-3'73-3p, miR-374a, miR-423-3p, miR-449b-5p,
miR-451a, miR-494, miR-504, miR-515-3p, miR-516a-3p, miR-519e,
miR-520a-3p, miR-520c-3p, miR-520g, miR-532-5p, miR-559, miR-562,
miR-572, miR-590-5p, miR-605, miR-608, miR-626, miR-639,
miR-654-3p, miR-657, miR-661, miR-708-5p, miR-942, miR-96,
miR-99amo and miR-194 by up-regulating a level of at least one
polynucleotide agent that hybridizes and inhibits a function of the
at least one miRNA in the MSCs thereby predisposing MSCs to
differentiate into the motor neurons.
[0018] According to an aspect of some embodiments of the present
invention there is provided a genetically modified isolated
population of cells which comprise at least one exogenous miRNA
selected from the group consisting of miR302b, miR-371, miR-134,
miR-219, miR-154, miR-155, miR-32, miR-33, miR-126, miR-127,
miR-132 and miR-137 and/or which comprise at least one
polynucleotide agent that hybridizes and inhibits a function of at
least one miRNA selected from the group consisting of miR-10b,
miR-142-3p, miR-131a, miR-125b, miR-153 and miR-181a, wherein the
cells have a neural stem cell phenotype.
[0019] According to an aspect of some embodiments of the present
invention there is provided a genetically modified isolated
population of cells which comprise at least one exogenous miRNA
selected from the group consisting of miR-368, miR-302b,
miR-365-3p, miR-365-5p, miR-Let-7a, miR-Let-7b, miR-218, miR-134,
miR-124, miR-125a, miR-9, miR-154, miR-20a, miR-130a and/or which
comprise at least one polynucleotide agent that hybridizes and
inhibits a function of at least one miRNA selected from the group
consisting of miR-372, miR-373, miR-141, miR-199a, miR-32, miR-33,
miR-221 and miR-223, wherein the cells have a motor neuron
phenotype.
[0020] According to an aspect of some embodiments of the present
invention there is provided a method of treating a brain disease or
disorder in a subject in need thereof, the method comprising
administering to the subject a therapeutically effective amount of
the isolated population of cells of claim 33, thereby treating the
brain disease or disorder.
[0021] According to an aspect of some embodiments of the present
invention there is provided a pharmaceutical composition comprising
the isolated population of cells described herein and a
pharmaceutically acceptable carrier.
[0022] According to an aspect of some embodiments of the present
invention there is provided a method of selecting a miRNA which may
be regulated for the treatment of a motor neuron disease
comprising:
[0023] (a) differentiating a population of neural stem cells
towards a motor neuron phenotype; and
[0024] (b) analyzing a change in expression of a miRNA in the
population of MSCs prior to and following the differentiating of
the MSCs towards a motor neuron phenotype, wherein a change of
expression of a miRNA above or below a predetermined level is
indicative that the miRNA may be regulated for the treatment of the
motor neuron disease.
[0025] According to an aspect of some embodiments of the present
invention there is provided a method of treating a motor neuron
disease in a subject in need thereof, the method comprising
administering to the subject a therapeutically effective amount of
the isolated population of cells of claim 35, thereby treating the
brain disease or disorder.
[0026] According to an aspect of some embodiments of the present
invention there is provided a genetically modified isolated
population of cells which comprise at least one exogenous miRNA
selected from the group consisting of miR-1275, miR-891a, miR-154,
miR-1202, miR-572 and miR-935a and/or which comprise at least one
polynucleotide agent that hybridizes and inhibits a function of at
least one miRNA selected from the group consisting of miR-4317,
miR-153, miR-4288, miR-409-5p, miR-193a-5p, wherein said cells have
a neural stem cell phenotype.
[0027] According to an aspect of some embodiments of the present
invention there is provided a genetically modified isolated
population of cells which comprise at least one exogenous miRNA
selected from the group consisting of miR-648, miR-368, miR-365,
miR-500 and miR-491 and/or which comprise at least one
polynucleotide agent that hybridizes and inhibits a function of at
least one miRNA selected from the group consisting of miR-372,
miR-373, miR-942, miR-2113, miR-199a-3p and miR-199a-5p, wherein
said cells have a motor neuron phenotype.
[0028] According to some embodiments of the invention, the at least
one exogenous miRNA is selected from the group consisting of
miR-1275, miR-891a, miR-154, miR-1202, miR-572 and miR-935a.
[0029] According to some embodiments of the invention, the at least
one exogenous miRNA is selected from the group consisting of
miR-20b, miR-925, miR-891 and miR-378.
[0030] According to some embodiments of the invention, the at least
one miRNA is selected from the group consisting of miR-4317,
miR-153, miR-4288, miR-409-5p, and miR-193a-5p.
[0031] According to some embodiments of the invention, the at least
one miRNA is selected from the group consisting of miR-138,
miR-214, miR-199a and miR-199b.
[0032] According to some embodiments of the invention, the at least
one miRNA is miR-138, the method further comprises:
[0033] (i) down-regulating an expression of miR-891 using a
polynucleotide agent that hybridizes and inhibits the function of
miR-891;
[0034] (ii) up-regulating a level of exogenous miR20b; or
[0035] (iii) up-regulating a level of exogenous miR378.
[0036] According to some embodiments of the invention, the miRNA is
selected from the group consisting of miR-648, miR-368, miR-365,
miR-500 and miR-491.
[0037] According to some embodiments of the invention, the miRNA is
selected from the group consisting of miR-372, miR-373, miR-942,
miR-2113, miR-199a-3p and miR-199a-5p.
[0038] According to some embodiments of the invention, the at least
one miRNA comprises each of miR Let-7a, miR-124, miR-368 and
miR-154.
[0039] According to some embodiments of the invention, the at least
one miRNA comprises each of miR-125a, miR-9 and miR-130a.
[0040] According to some embodiments of the invention, the at least
one miRNA comprises each of miR-218, miR-134 and miR-20a.
[0041] According to some embodiments of the invention, the method
further comprises down-regulating each of miR-141, miR-32, miR-33,
miR-221, miR-223 and miR-373.
[0042] According to some embodiments of the invention, the NSCs are
generated by ex vivo differentiating MSCs.
[0043] According to some embodiments of the invention, the ex vivo
differentiating is affected according to any of the methods
described herein.
[0044] According to some embodiments of the invention, the MSCs are
isolated from a tissue selected from the group consisting of bone
marrow, adipose tissue, placenta, cord blood and umbilical
cord.
[0045] According to some embodiments of the invention, the MSCs are
autologous to the subject.
[0046] According to some embodiments of the invention, the MSCs are
non-autologous to the subject.
[0047] According to some embodiments of the invention, the MSCs are
semi-allogeneic to the subject.
[0048] According to some embodiments of the invention, the
up-regulating comprises introducing into the MSCs the at least one
miRNA.
[0049] According to some embodiments of the invention, the
up-regulating is affected by transfecting the MSCs with an
expression vector which comprises a polynucleotide sequence which
encodes a pre-miRNA of the at least one miRNA.
[0050] According to some embodiments of the invention, the
up-regulating is affected by transfecting the MSCs with an
expression vector which comprises a polynucleotide sequence which
encodes the at least one miRNA.
[0051] According to some embodiments of the invention, the method
further comprises analyzing an expression of at least one marker
selected from the group consisting of nestin and Sox2 following the
generating.
[0052] According to some embodiments of the invention, the method
further comprises analyzing an expression of at least one marker
selected from the group consisting of Islet1, HB9 and the neuronal
markers neurofilament and tubulin following the generating.
[0053] According to some embodiments of the invention, the method
is effected in vivo. According to some embodiments of the
invention, the method is effected ex vivo.
[0054] According to some embodiments of the invention, at least 50%
of the populatio of cells express at least one marker selected from
the group consisting of nestin and Sox2.
[0055] According to some embodiments of the invention, the at least
50% of the population of cells express at least one marker selected
from the group consisting of Islet1, HB9 and the neuronal markers
neurofilament and tubulin.
[0056] According to some embodiments of the invention, the isolated
population of cells is for use in treating a brain disease or
disorder.
[0057] According to some embodiments of the invention, the isolated
population of cells is for brain disease or disorder is a
neurodegenerative disorder.
[0058] According to some embodiments of the invention, the
neurodegenerative disorder is selected from the group consisting of
multiple sclerosis, Parkinson's, epilepsy, amyotrophic lateral
sclerosis (ALS), stroke, Rett Syndrome, autoimmune
encephalomyelitis, spinal cord injury, cerebral palsy, stroke,
Alzheimer's disease and Huntingdon's disease.
[0059] According to some embodiments of the invention, the isolated
population is for use in treating a motor neuron disease.
[0060] According to some embodiments of the invention, the motor
neuron disease is selected from the group consisting of amyotrophic
lateral sclerosis (ALS), primary lateral sclerosis (PLS),
pseudobulbar palsy and progressive bulbar palsy.
[0061] According to some embodiments of the invention, the nerve
disease or disorder is a neurodegenerative disorder.
[0062] According to some embodiments of the invention, the
neurodegenerative disorder is selected from the group consisting of
multiple sclerosis, Parkinson's, epilepsy, amyotrophic lateral
sclerosis (ALS), stroke, Rett Syndrome, autoimmune
encephalomyelitis, spinal cord injury, cerebral palsy, stroke,
Alzheimer's disease and Huntingdon's disease.
[0063] Unless otherwise defined, all technical and/or scientific
terms used herein have the same meaning as commonly understood by
one of ordinary skill in the art to which the invention pertains.
Although methods and materials similar or equivalent to those
described herein can be used in the practice or testing of
embodiments of the invention, exemplary methods and/or materials
are described below. In case of conflict, the patent specification,
including definitions, will control. In addition, the materials,
methods, and examples are illustrative only and are not intended to
be necessarily limiting.
BRIEF DESCRIPTION OF THE DRAWINGS
[0064] Some embodiments of the invention are herein described, by
way of example only, with reference to the accompanying drawings
and images. With specific reference now to the drawings in detail,
it is stressed that the particulars shown are by way of example and
for purposes of illustrative discussion of embodiments of the
invention. In this regard, the description taken with the drawings
makes apparent to those skilled in the art how embodiments of the
invention may be practiced.
[0065] In the drawings:
[0066] FIGS. 1A-B are photographs and graphs illustrating that
mesenchymal stem cells (MSCs) may be induced to differentiate to
neural stem cell (NSC)-like cells and express NSC markers. MSCs
were plated in neurosphere medium on bacteria dishes as described
in Methods. The MSC-derived spheroids were characterized by
immunofluorescence (FIG. 1A) and real-time PCR (FIG. 1 B).
[0067] FIG. 2 is a bar graph illustrating exemplary miRNAs
associated with stem cell signature and self renewal that were
up-regulated during NSC differentiation.
[0068] FIG. 3 is a bar graph illustrating exemplary miRNAs
associated with hematopoiesis that were up-regulated during NSC
differentiation.
[0069] FIGS. 4A-D are bar graphs illustrating exemplary miRNAs
associated with a neuronal signature and self renewal that were
up-regulated (FIGS. 4A-C) or down-regulated (FIG. 4D) during NSC
differentiation.
[0070] FIGS. 4E-F are photographs illustrating bone marrow MSCs
transfected with antagomiR-138 and miR-891 using a nestin promoter
reporter assay.
[0071] FIGS. 5A-D are graphs and photographs illustrating that
RTVP-1 plays a role in differentiation of MSCs towards NSCs. RTVP-1
is expressed in high levels in BM-MSCs, similar to some glioma
cells that are considered as the cells that expressed the highest
levels of this protein, as determined by Western blot analysis (A).
A diagram showing the mesenchymal lineage differentiation of MSCs
(B). Silencing of RTVP-1 in BM-MSCs using siRNA duplexes decreases
the osteogenic differentiation of these cells (C). Silencing of
RTVP-1 in BM-MSCs decreases the expression of the different
mesenchymal markers (D).
[0072] FIG. 5E is a bar graph illustrating the expression of RTVP-1
in MSCs and MSCs differentiated to NSCs.
[0073] FIG. 5F is a bar graph illustrating the effect of silencing
of RTVP-1 on nestin expression in MSCs.
[0074] FIGS. 6A-D are photographs and graphs illustrating the
effect of transfection of Olig2 and differentiation medium on
placenta-derived MSCs. After 12 days in culture the cells were
analyzed for the expression of motor neuron progenitor (FIG. 6C)
and motor neuron markers (FIG. 6D) using real time PCR. FIG. 6A
illustrates undifferentiated MSCs. FIG. 6B illustrates
differentiated MSCs.
[0075] FIGS. 7A-B are graphs and photographs illustrating that NSCs
may be induced to differentiate into motor neuron cells. The human
neural progenitor cells (Lonza) were grown as spheroids and then
plated on laminin and treated with the different factors as
described in the methods. Following 12-14 days, the cells were
analyzed for morphological appearance and for the different markers
using real time PCR.
[0076] FIG. 8 is a bar graph illustrating exemplary miRNAs
associated with stem cell signature and self renewal that were
up-regulated during motor neuron differentiation.
[0077] FIG. 9 is a bar graph illustrating exemplary miRNAs
associated with hematopoiesis that were up-regulated during motor
neuron differentiation.
[0078] FIG. 10 is a bar graph illustrating exemplary miRNAs
associated with a neuronal signature and self-renewal that were
up-regulated during motor neuron differentiation.
[0079] FIG. 11 is a bar graph illustrating Islet1 and HB9 mRNA
expression in control MSCs and MSCs trans-differentiated toward a
motor neuron cell.
[0080] FIG. 12 is a bar graph illustrating nestin mRNA expression
in control MSCs, MSCs with RTVP-1 silencing, and MSCs with RTVP-1
silencing and miR/antimiR transfection.
[0081] FIG. 13 is a bar graph illustrating the average score on the
Basso, Beattie and Bresnahan (BBB) locomotor scale of rats with and
without spinal cord injury and with injury treated with MSCs
trans-differentiated toward a motor neuron cell.
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
[0082] The present invention, in some embodiments thereof, relates
to methods of ex vivo differentiating mesenchymal stem cells
towards neural progenitor cells and motor neurons using
microRNAs.
[0083] Before explaining at least one embodiment of the invention
in detail, it is to be understood that the invention is not
necessarily limited in its application to the details set forth in
the following description or exemplified by the Examples. The
invention is capable of other embodiments or of being practiced or
carried out in various ways.
[0084] Neural stem cells (NSCs) have been isolated from embryonic
and fetal mammalian and human brains and propagated in vitro in a
variety of culture systems (Doetsch et al., 1999, Subventricular
zone astrocytes are neural stem cells in the adult mammalian brain.
Cell 97:703-16, Johansson et al., 1999, Cell 96:25-34, Svendsen et
al., 1998, J Neurosci Methods 85:141-52). A system for
proliferating human neural stem cells (hNSCs) in serum-free culture
medium containing human bFGF and human EGF also has been reported
(Kim et al., 2002, Proc Natl Acad Sci USA 99: 4020-4025, Qu et al.,
2001, NeuroReport 12: 1127-1132). Further, transplantation of hNSCs
into experimental animals has been described (Qu et al., 2001, Id.;
Qu et al., 2005, 35th Annual Meeting in Washington, D.C., November
2005).
[0085] However, challenges existed in the art of stem cell
therapies using stem cells derived from embryonic/fetal tissue
sources. Stem cell therapies using embryonic sources face
challenges such as ethical issues, technical difficulties in cell
isolation, and the need for long-term immunosuppressant
administration to transplant recipients; the limitations of using
fetal tissue sources have been set forth above. These challenges
have hindered the applicability of hNSCs for human use.
[0086] Bone marrow (BM) contains stem cells involved not only in
hematopoiesis but also for production of a variety of
nonhematopoietic tissues. A subset of stromal cells in bone marrow,
mesenchymal stem cells (MSCs), is capable of self-renewing and
producing multiple mesenchymal cell lineages, including bone,
cartilage, fat tendons, and other connective tissues (Majumdar et
al., 1998, J Cell Physiol. 176:57-66, Pereira et al., 1995, Proc
Natl Acad Sci USA. 92: 4857-61, Pittenger et al., 1999, Science
284: 143-7). Bone marrow mesenchymal stem cells normally are not
committed to the neural lineage in differentiation. Although adult
stem cells continue to possess some degrees of multipotency, cell
types produced from adult stem cells are thought to be limited by
their tissue-specific character. To overcome this barrier, it is
necessary to alter the cell lineage of these adult stem cells.
[0087] Whilst reducing the present invention to practice, the
present inventors have found that out of a vast number of potential
micro RNAs (miRNAs), only particular miRNAs may be regulated in
order to induce neural stem cell differentiation of mesenchymal
stem cells (MSCs) and propose that such differentiated MSCs may be
used to treat patients with brain diseases or disorders.
[0088] Further, the present inventors identified particular
combinations of miRNAs whose regulation was found to
synergistically increase the differentiation towards NSCs, as
measured by nestin and SOX-2 expression.
[0089] Whilst further reducing the present invention to practice
the present inventors uncovered that upon manipulation of the miRNA
expression of NSCs, cells expressing motor neurons markers may be
generated.
[0090] Thus, the present inventors showed that up-regulation of at
least one of miR-368, miR-302b, miR-365-3p, miR-365-5p, miR-Let-7a,
miR-Let-7b, miR-218, miR-134, miR-124, miR-125a, miR-9, miR-154,
miR-20a, miR-130a in neural stem cells (NSCs), induced a motor
neuron phenotype, whilst down-regulation of at least one of
miR-372, miR-373, miR-141, miR-199a, miR-32, miR-33, miR-221 and
miR-223 in NSCs also induced a motor neuron phenotype.
[0091] Further, the present inventors identified particular
combinations of miRNAs whose regulation was found to
synergistically increase the differentiation towards motor neurons,
as measured by expression of motor neuron markers including isletl,
HB9 and the neuronal markers neurofilament and tubulin.
[0092] Thus, according to one aspect of the present invention there
is provided a method of predisposing mesenchymal stem cells to
differentiate into neural stem cells, the method comprising
up-regulating a level of at least one exogenous miRNA selected from
the group consisting of miR302b, miR-371, miR-134, miR-219,
miR-154, miR-155, miR-32, miR-33, miR-126, miR-127, miR-132,
miR-137, miR-572, miR-935a, miR-891a, miR-1202, miR-1275, let-7c,
miR-665, miR-4258, miR-361-3p, miR-374a-star, miR-892b, miR-361-5p,
miR-181a, miR-16, miR-636, miR-4284, miR-1208, miR-1274b,
miR-30c-2-star, miR-501-3p, hsa-miR-92a, miR-378b, miR-1287,
miR-425-star, miR-324-5p, miR-3178, miR-219-1-3p, miR-197,
miR-181b, miR-500-star, miR-106b, miR-502-3p, miR-30c, miR-1275,
miR-422a, miR-93, miR-181d, miR-1307, miR-1301, miR-99a,
miR-505-star, miR-1202, miR-12, miR-532-5p, miR-195, miR-532-3p,
miR-106a, miR-17, miR-1271, miR-769-3p, miR-15b, miR-324-3p,
miR-20a, miR-501-5p, miR-330-3p, miR-874, miR-500, miR-25,
miR-769-5p, miR-125b-2-star, miR-130b, miR-504, miR-181a-2-star,
miR-885-3p, miR-1246, miR-92b, miR-362-5p, miR-572, miR-4270,
miR-378c, miR-93-star, miR-149, miR-363, miR-9, miR-18a, miR-891a,
miR-346, miR-124, miR-497, miR-378, miR-1231, miR-139-5p,
miR-3180-3p, miR-9-star, miR-935 and miR-20b in mesenchymal stem
cells (MSCs), thereby predisposing mesenchymal stem cells to
differentiate into the neural stem cells.
[0093] As used herein, the phrase "predisposing MSCs to
differentiate into neural stem cells (NSCs)" refers to causing the
MSCs to differentiate along the NSC lineage. The generated cells
may be fully differentiated into NSCs, or partially differentiated
into NSCs.
[0094] The phrase "at least one" as used in the specification
refers to one, two, three four, five six, seven, eight, nine, ten
or more miRNAs. Examples of particular combinations of miRNAs are
provided herein below.
[0095] Mesenchymal stem cells give rise to one or more mesenchymal
tissues (e.g., adipose, osseous, cartilaginous, elastic and fibrous
connective tissues, myoblasts) as well as to tissues other than
those originating in the embryonic mesoderm (e.g., neural cells)
depending upon various influences from bioactive factors such as
cytokines. Although such cells can be isolated from embryonic yolk
sac, placenta, umbilical cord, fetal and adolescent skin, blood and
other tissues, their abundance in the easily accessible fat tissue
and BM far exceeds their abundance in other tissues and as such
isolation from BM and fat tissue is presently preferred.
[0096] Methods of isolating, purifying and expanding mesenchymal
stem cells (MSCs) are known in the arts and include, for example,
those disclosed by Caplan and Haynesworth in U.S. Pat. No.
5,486,359 and Jones E. A. et al., 2002, Isolation and
characterization of bone marrow multipotential mesenchymal
progenitor cells, Arthritis Rheum. 46(12): 3349-60.
[0097] Mesenchymal stem cells may be isolated from various tissues
including but not limited to bone marrow, peripheral blood, blood,
chorionic and amniotic placenta (e.g. fetal side of the placenta),
cord blood, umbilical cord, amniotic fluid, placenta and from
adipose tissue.
[0098] A method of isolating mesenchymal stem cells from peripheral
blood is described by Kassis et al [Bone Marrow Transplant. 2006
May; 37(10):967-76]. A method of isolating mesenchymal stem cells
from placental tissue is described by Zhang et al [Chinese Medical
Journal, 2004, 117 (6):882-887]. Methods of isolating and culturing
adipose tissue, placental and cord blood mesenchymal stem cells are
described by Kern et al [Stem Cells, 2006; 24:1294-1301].
[0099] According to a preferred embodiment of this aspect of the
present invention, the mesenchymal stem cells are human.
[0100] According to another embodiment of this aspect of the
present invention, the mesenchymal stem cells are isolated from
placenta and umbilical cord of newborn humans.
[0101] Bone marrow can be isolated from the iliac crest of an
individual by aspiration. Low-density BM mononuclear cells (BMMNC)
may be separated by a FICOL-PAQUE density gradient or by
elimination of red blood cells using Hetastarch (hydroxyethyl
starch). Preferably, mesenchymal stem cell cultures are generated
by diluting BM aspirates (usually 20 ml) with equal volumes of
Hank's balanced salt solution (HBSS; GIBCO Laboratories, Grand
Island, N.Y., USA) and layering the diluted cells over about 10 ml
of a Ficoll column (Ficoll-Paque; Pharmacia, Piscataway, N.J.,
USA). Following 30 minutes of centrifugation at 2,500.times.g, the
mononuclear cell layer is removed from the interface and suspended
in HBSS. Cells are then centrifuged at 1,500.times.g for 15 minutes
and resuspended in a complete medium (MEM, a medium without
deoxyribonucleotides or ribonucleotides; GIBCO); 20% fetal calf
serum (FCS) derived from a lot selected for rapid growth of MSCs
(Atlanta Biologicals, Norcross, Ga.); 100 units/ml penicillin
(GIBCO), 100 .mu.g/ml streptomycin (GIBCO); and 2 mM L-glutamine
(GIBCO). Resuspended cells are plated in about 25 ml of medium in a
10 cm culture dish (Corning Glass Works, Corning, N.Y.) and
incubated at 37.degree. C. with 5% humidified CO2. Following 24
hours in culture, non-adherent cells are discarded, and the
adherent cells are thoroughly washed twice with phosphate buffered
saline (PBS). The medium is replaced with a fresh complete medium
every 3 or 4 days for about 14 days. Adherent cells are then
harvested with 0.25% trypsin and 1 mM EDTA (Trypsin/EDTA, GIBCO)
for 5 min at 37.degree. C., re-plated in a 6-cm plate and cultured
for another 14 days. Cells are then trypsinized and counted using a
cell counting device such as for example, a hemocytometer (Hausser
Scientific, Horsham, Pa.). Cultured cells are recovered by
centrifugation and resuspended with 5% DMSO and 30% FCS at a
concentration of 1 to 2.times.106 cells per ml. Aliquots of about 1
ml each are slowly frozen and stored in liquid nitrogen.
[0102] Adipose tissue-derived MSCs can be obtained by liposuction
and mononuclear cells can be isolated manually by removal of the
fat and fat cells, or using the Celution System (Cytori
Therapeutics) following the same procedure as described above for
preparation of MSCs.
[0103] According to one embodiment the populations are plated on
polystyrene plastic surfaces (e.g. in a flask) and mesenchymal stem
cells are isolated by removing non-adherent cells. Alternatively,
mesenchymal stem cell may be isolated by FACS using mesenchymal
stem cell markers.
[0104] Preferably the MSCs are at least 50% purified, more
preferably at least 75% purified and even more preferably at least
90% purified.
[0105] To expand the mesenchymal stem cell fraction, frozen cells
are thawed at 37.degree. C., diluted with a complete medium and
recovered by centrifugation to remove the DMSO. Cells are
resuspended in a complete medium and plated at a concentration of
about 5,000 cells/cm". Following 24 hours in culture, non-adherent
cells are removed and the adherent cells are harvested using
Trypsin/EDT A, dissociated by passage through a narrowed Pasteur
pipette, and preferably re-plated at a density of about 1.5 to
about 3.0 cells/cm". Under these conditions, MSC cultures can grow
for about 50 population doublings and be expanded for about 2000
fold [Colter D C., et al. Rapid expansion of recycling stem cells
in cultures of plastic-adherent cells from human bone marrow. Proc
Natl Acad Sci USA. 97: 3213-3218, 2000].
[0106] MSC cultures utilized by some embodiments of the invention
preferably include three groups of cells which are defined by their
morphological features: small and agranular cells (referred to as
RS-1, herein below), small and granular cells (referred to as RS-2,
herein below) and large and moderately granular cells (referred to
as mature MSCs, herein below). The presence and concentration of
such cells in culture can be assayed by identifying a presence or
absence of various cell surface markers, by using, for example,
immunofluorescence, in situ hybridization, and activity assays.
[0107] When MSCs are cultured under the culturing conditions of
some embodiments of the invention they exhibit negative staining
for the hematopoietic stem cell markers CD34, CD11B, CD43 and CD45.
A small fraction of cells (less than 10%) are dimly positive for
CD31 and/or CD38 markers. In addition, mature MSCs are dimly
positive for the hematopoietic stem cell marker, CD11 7 (c-Kit),
moderately positive for the osteogenic MSCs marker, Stro-1
[Simmons, P. J. & Torok-Storb, B. (1991). Blood 78, and
positive for the thymocytes and peripheral T lymphocytes marker,
CD90 (Thy-1). On the other hand, the RS-1 cells are negative for
the CD117 and Strol markers and are dimly positive for the CD90
marker, and the RS-2 cells are negative for all of these
markers.
[0108] The mesenchymal stem cells of the present invention may be
of autologous, syngeneic or allogeneic related (matched siblings or
haploidentical family members) or unrelated fully mismatched
source, as further described herein below.
[0109] Culturing of the mesenchymal stem cells can be performed in
any media that supports neural stem cell differentiation (or at
least does not prevent neural stem cell differentiation) such as
those described in U.S. Pat. No. 6,528,245 and by Sanchez-Ramos et
al. (2000); Woodburry et al. (2000); Woodburry et al. (J. Neurisci.
Res. 96:908-917, 2001); Black and Woodbury (Blood Cells Mol. Dis.
27:632-635, 2001); Deng et al. (2001), Kohyama et al. (2001), Reyes
and Verfatile (Ann. N.Y. Acad. Sci. 30 938:231-235, 2001) and Jiang
et al. (Nature 418:47-49, 2002).
[0110] The differentiating media may be 05, neurobasal medium, DMEM
or DMEM/F12, OptiMEM.TM. or any other medium that supports neuronal
growth.
[0111] As mentioned, the mesenchymal stem cells are contacted
(either ex vivo or in vivo) with at least one of the following
miRNAs in order to induce differentiation into neural stem
cells--miR302b, miR-371, miR-134, miR-219, miR-154, miR-155,
miR-32, miR-33, miR-126, miR-127, miR-132, miR-137, miR-572,
miR-935a, miR-891a, miR-1202, miR-1275, let-7c, miR-665, miR-4258,
miR-361-3p, miR-374a-star, miR-892b miR-361-5p, miR-181a, miR-16,
miR-636, miR-4284, miR-1208, miR-1274b, miR-30c-2-star, miR-501-3p,
hsa-miR-92a, miR-378b, miR-1287, miR-425-star, miR-324-5p,
miR-3178, miR-219-1-3p, miR-197, miR-181b, miR-500-star, miR-106b,
miR-502-3p, miR-30c, miR-1275, miR-422a, miR-93, miR-181d,
miR-1307, miR-1301, miR-99a, miR-505-star, miR-1202, miR-12,
miR-532-5p, miR-195, miR-532-3p, miR-106a, miR-17, miR-1271,
miR-769-3p, miR-15b, miR-324-3p, miR-20a, miR-501-5p, miR-330-3p,
miR-874, miR-500, miR-25, miR-769-5p, miR-125b-2-star, miR-130b,
miR-504, miR-181a-2-star, miR-885-3p, miR-1246, miR-92b,
miR-362-5p, miR-572, miR-4270, miR-378c, miR-93-star, miR-149,
miR-363, miR-18a, miR-891a, miR-346, miR-497, miR-378, miR-1231,
miR-139-5p, miR-3180-3p, miR-935 and miR-20b.
[0112] According to a particular embodiment, the miRNA is selected
from the group consisting of miR302b, miR-371, miR-134, miR-219,
miR-154, miR-155, miR-32, miR-33, miR-126, miR-127, miR-132.
[0113] According to another embodiment, the miRNA is selected from
the group consisting of miR-20b, miR-925, miR-891 and miR-378.
[0114] The present invention also contemplates differentiation of
mesenchymal stem cells towards a neural stem cell phenotype by
down-regulation of particular miRNAs--namely miR-10b, miR-142-3p,
miR-131a, miR-125b, miR-153 and miR-181a.
[0115] The present invention contemplates down-regulation of
additional miRNAs for the differentiation of MSCs towards a neural
stem cell phenotype. These miRNAs include miR-409-5p, miR-193a-5p,
miR-4317, miR-4288, miR-145, miR-143, miR-214, miR-199a-3p,
miR-199a-5p, miR-199b-3p, miR-138, miR-31, miR-21, miR-193a-5p,
miR-224-star, miR-196a, miR-487b, miR-409-5p, miR-193b-star,
miR-379, miR-21-star, miR-27a-star, miR-27a, miR-4317, miR-193b,
miR-27b, miR-22, 5'74-3p, miR-30 4288, miR-23a, miR-221-star,
miR-2113, let-7i, miR-24, miR-23b, miR-299-3p, miR-518c-star,
miR-221, miR-431-star, miR-523, miR-4313, miR-559, miR-614,
miR-653, miR-2278, miR-768-5p, miR-154-star, miR-302a-star,
miR-3199 and miR-3137.
[0116] According to a particular embodiment, the miRNA which is to
be downregulated is selected from the group consisting of miR-138,
miR-214, miR-199a and miR-199b.
[0117] Down-regulating such miRNAs can be affected using a
polynucleotide which is hybridizable in cells under physiological
conditions to the miRNA.
[0118] According to a particular embodiment, the cell population is
generated by up-regulating an expression of miR-124 in mesenchymal
stem cells (MSCs) whilst simultaneously down-regulating an
expression of miR-let-7 in the population of MSCs.
[0119] According to a particular embodiment, the cell population is
generated by down-regulating an expression of miR-891 in
mesenchymal stem cells (MSCs) whilst simultaneously down-regulating
an expression of miR-138 in the population of MSCs.
[0120] According to a particular embodiment, the cell population is
generated by up-regulating an expression of miR-20b in mesenchymal
stem cells (MSCs) whilst simultaneously down-regulating an
expression of miR-138 in the population of MSCs.
[0121] According to a particular embodiment, the cell population is
generated by up-regulating an expression of miR-378 in mesenchymal
stem cells (MSCs) whilst simultaneously down-regulating an
expression of miR-138 in the population of MSCs.
[0122] As used herein, the term "hybridizable" refers to capable of
hybridizing, i.e., forming a double strand molecule such as
RNA:RNA, RNA:DNA and/or DNA:DNA molecules. "Physiological
conditions" refer to the conditions present in cells, tissue or a
whole organism or body. Preferably, the physiological conditions
used by the present invention include a temperature between
34-40.degree. C., more preferably, a temperature between
35-38.degree. C., more preferably, a temperature between 36 and
37.5.degree. C., most preferably, a temperature between 37 to
37.5.degree. C.; salt concentrations (e.g., sodium chloride NaCl)
between 0.8-1%, more preferably, about 0.9%; and/or pH values in
the range of 6.5-8, more preferably, 6.5-7.5, most preferably, pH
of 7-7.5.
[0123] As mentioned, the present inventors have also uncovered that
upon manipulation of particular miRNAs in neural stem cells, cells
expressing motor neurons markers may be generated.
[0124] Thus, according to another aspect of the present invention
there is provided a method of predisposing neural stem cells to
differentiate into motor neurons comprising up-regulating a level
of at least one exogenous miRNA selected from the group consisting
of miR-368, miR-302b, miR-365-3p, miR-365-5p, miR-Let-7a,
miR-Let-7b, miR-218, miR-134, miR-124, miR-125a, miR-9, miR-154,
miR-20a, miR-130a in neural stem cells (NSCs).
[0125] The neural stem cells of this aspect of the present
invention may be non-committed neural stem cells that are not
committed to any particular type of neural cell such as but not
limited to neuronal and glial cell types. Preferably these cells
have a potential to commit to a neural fate. Alternatively, the
neural stem cells may be committed to a particular neural cell
type, such as a motor neuron, but do not express/secrete markers of
terminal differentiation e.g. do not secrete neurotransmitters.
[0126] According to a particular embodiment, the neural stem cells
express at least one of nestin and/or SOX-2. Additional markers
include SOXl, SOX3, PSA-NCAM and MUSASHI-1.
[0127] Methods of confirming expression of the markers are provided
herein below. Formation of "neural rosettes" is another morphologic
marker of neural stem cell formation.
[0128] According to one embodiment, the neural stem cells have been
generated by ex vivo differentiation of mesenchymal stem cells or
embryonic stem cells (or induced embryonic stem cells).
[0129] Mesenchymal stem cells have been described herein above.
Numerous methods are known in the art for differentiating MSCs
towards a neural stem cell fate including genetic modification
and/or culturing in a medium which promotes differentiation towards
that fate. The medium typically comprises growth factors and/or
cytokines including, but not limited to epidermal growth factor
(EGF), basic fibroblast growth factor (bFGF). Typically, the
differentiation is affected in serum free medium, or serum
replacements.
[0130] According to a particular embodiment, NSCs are generated by
genetically modifying the MSCs to express an exogenous miRNA, as
described herein above.
[0131] The phrase "embryonic stem cells" refers to embryonic cells
which are capable of differentiating into cells of all three
embryonic germ layers (i.e., endoderm, ectoderm and mesoderm), or
remaining in an undifferentiated state. The phrase "embryonic stem
cells" may comprise cells which are obtained from the embryonic
tissue formed after gestation (e.g., blastocyst) before
implantation of the embryo (i.e., a pre-implantation blastocyst),
extended blastocyst cells (EBCs) which are obtained from a
post-implantation/pre-gastrulation stage blastocyst (see
W02006/040763) and embryonic germ (EG) cells which are obtained
from the genital tissue of a fetus any time during gestation,
preferably before 10 weeks of gestation.
[0132] Induced pluripotent stem cells (iPS; embryonic-like stem
cells), are cells obtained by de-differentiation of adult somatic
cells which are endowed with pluripotency (i.e., being capable of
differentiating into the three embryonic germ cell layers, i.e.,
endoderm, ectoderm and mesoderm). According to some embodiments of
the invention, such cells are obtained from a differentiated tissue
(e.g., a somatic tissue such as skin) and undergo
de-differentiation by genetic manipulation which re-program the
cell to acquire embryonic stem cells characteristics. According to
some embodiments of the invention, the induced pluripotent stem
cells are formed by inducing the expression of Oct-4, Sox2, Kfl4
and c-Myc in a somatic stem cell.
[0133] The embryonic stem cells of some embodiments of the
invention can be obtained using well-known cell-culture methods.
For example, human embryonic stem cells can be isolated from human
blastocysts. Human blastocysts are typically obtained from human in
vivo pre-implantation embryos or from in vitro fertilized (IVF)
embryos. Alternatively, a single cell human embryo can be expanded
to the blastocyst stage. For the isolation of human ES cells the
zona pellucida is removed from the blastocyst and the inner cell
mass (ICM) is isolated by immunosurgery, in which the trophectoderm
cells are lysed and removed from the intact ICM by gentle
pipetting. The ICM is then plated in a tissue culture flask
containing the appropriate medium which enables its outgrowth.
Following 9 to 15 days, the ICM derived outgrowth is dissociated
into clumps either by a mechanical dissociation or by an enzymatic
degradation and the cells are then re-plated on a fresh tissue
culture medium. Colonies demonstrating undifferentiated morphology
are individually selected by micropipette, mechanically dissociated
into clumps, and re-plated. Resulting ES cells are then routinely
split every 4-7 days. For further details on methods of preparation
human ES cells see Thomson et al., [U.S. Pat. No. 5,843,780;
Science 282: 1145, 1998; Curr. Top. Dev. Biol. 38: 133, 1998; Proc.
Natl. Acad. Sci. USA 92: 7844, 1995]; Bongso et al., [Hum Reprod 4:
706, 30 1989]; and Gardner et al., [Fertil. Steril. 69: 84,
1998].
[0134] It will be appreciated that commercially available stem
cells can also be used with this aspect of some embodiments of the
invention. Human ES cells can be purchased from the NIH human
embryonic stem cells registry (www.escr.nih.gov). Non-limiting
examples of commercially available embryonic stem cell lines are
BGOl, BG02, BG03, BG04, CY12, CY30, CY92, CYlO, TE03 and TE32.
[0135] In addition, ES cells can be obtained from other species as
well, including mouse (Mills and Bradley, 2001), golden hamster
[Doetschman et al., 1988, Dev Biol. 127: 224-7], rat [Iannaccone et
al., 1994, Dev Biol. 163: 288-92] rabbit [Giles et al. 1993, Mol
Reprod Dev. 36: 130-8; Graves & Moreadith, 1993, Mol Reprod
Dev. 1993, 36: 424-33], several domestic animal species [Notarianni
et al., 1991, J Reprod Fertil Suppl. 43: 255-60; Wheeler 1994,
Reprod Fertil Dev. 6: 563-8; Mitalipova et al., 2001, Cloning. 3:
59-67] and non-human primate species (Rhesus monkey and marmoset)
[Thomson et al., 1995, Proc Natl Acad Sci USA. 92: 7844-8; Thomson
et al., 1996, Biol Reprod. 55: 254-9].
[0136] Induced pluripotent stem cells (iPS) (embryonic-like stem
cells) can be generated from somatic cells by genetic manipulation
of somatic cells, e.g., by retroviral transduction of somatic cells
such as fibroblasts, hepatocytes, gastric epithelial cells with
transcription factors such as Oct-3/4, Sox2, c-Myc, and KLF4
[Yamanaka S, Cell Stem Cell. 2007, 1(1):39-49; Aoi T, et al.,
Generation of Pluripotent Stem Cells from Adult Mouse Liver and
Stomach Cells. Science. 2008 Feb. 14. (Epub ahead of print); I H
Park, Zhao R, West J A, et al. Reprogramming of human somatic cells
to pluripotency with defined factors. Nature 2008; 451:141-146; K
Takahashi, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem
cells from adult human fibroblasts by defined factors. Cell 2007;
131:861-872]. Other embryonic-like stem cells can be generated by
nuclear transfer to oocytes, fusion with embryonic stem cells or
nuclear transfer into zygotes if the recipient cells are arrested
in mitosis.
[0137] Methods of generating neural stem cells from ESCs or iPS
cells are known in the art and include for example those which
induce differentiation via embryoid bodies and those which induce
differentiation via adherent culture. Particular protocols for
differentiating ESCs towards a neuronal fate are reviewed in Dhara
et al., Journal of Cellular Biochemistry 105:633-640 (2008), the
contents of which are incorporated herein by reference. It will be
appreciated that many other methods are known for differentiating
ESC, iPSCs and MSCs towards neuronal stem cells and the present
application contemplates use of all these methods.
[0138] The neuronal stem cells of the present invention may be of
autologous, syngeneic or allogeneic related (matched siblings or
haploidentical family members) or unrelated fully mismatched
source.
[0139] Culturing of neuronal stem cells can be performed in any
media that supports neural stem cell differentiation, examples of
which are described herein above.
[0140] As mentioned, the neuronal stem cells are contacted (either
ex vivo or in vivo) with at least one of the following miRNAs in
order to induce differentiation towards the motor neuron
lineage--miR-368, miR-302b, miR-365-3p, miR-365-5p, miR-Let-7a
miR-Let-7b, miR-218, miR-134, miR-124, miR-125a, miR-9, miR-154,
miR-20a and miR-130a.
[0141] The present invention also contemplates differentiation of
neuronal stem cells towards motor neuron phenotype by
down-regulation of particular miRNAs--namely miR-372, miR-373,
miR-141, miR-199a, miR-32, miR-33, miR-221 and miR-223.
[0142] Down-regulating such miRNAs can be affected using a
polynucleotide which is hybridizable in cells under physiological
conditions to the miRNA molecule.
[0143] According to a particular embodiment, the cell population is
generated by up-regulating an expression of each of miR Let-7a,
miR-124, miR-368 and miR-154 in the neural stem cells.
[0144] According to a particular embodiment, the cell population is
generated by up-regulating an expression of each of miR-125a, miR-9
and miR-130a in the neural stem cells.
[0145] According to still another embodiment, the cell population
is generated by up-regulating an expression of each of each of
miR-218, miR-134 and miR-20a.
[0146] The present inventors further contemplate down-regulating
each of miR-141, miR-32, miR-33, miR-221, miR-223 and miR-373 in
addition to any of the methods described herein above to enhance
the differentiation towards the motor neuron phenotype.
[0147] Mesenchymal stem cells were differentiated into motor
neurons by overexpressing Olig2 and HB9. The present inventors
performed a miRNA array analysis on the differentiated and
non-differentiated cells and found a number of miRNAs that were
overexpressed in a statistically significant manner (more than 3
fold) and a number of miRNAs that were downregulated in a
statistically significant manner (more than 3 fold). The present
inventors contemplate that the miRNAs whose expression was
increased in the differentiated cells may be candidates for
overexpression in order to generate motor neurons from MSCs. The
present inventors contemplate that the miRNAs whose expression was
decreased in the differentiated cells are candidates for
downregulation in order to generate motor neurons from MSCs.
[0148] Thus, according to still another aspect of the present
invention there is provided a method of predisposing MSCs to
differentiate into motor neurons, the method comprising
up-regulating a level of at least one exogenous miRNA selected from
the group consisting of miR-368, miR-365, miR-500, miR-648,
miR-491, miR-218, miR-155, miR-192, let-7b, miR-16, miR-210,
miR-197, miR-21, miR-373, miR-27a, miR-122, miR-17, miR-494,
miR-449, miR-503, miR-30a, miR-196a, miR-122, miR-7, miR-151-5p,
miR-16, miR-22, miR-31, miR-424, miR-1, miR-29c, miR-942, miR-100,
miR-520, miR-663a, miR-562, miR-449a, miR-449b-5p, miR-520b,
miR-451, miR-532-59, miR-605, miR-504, miR-503, miR-155, miR-34a,
miR-16, miR-7b, miR-103, miR-124, miR-1385p, miR-16, miR-330,
miR-520, miR-608, miR-708, miR-107, miR-137, miR-132, miR-145,
miR-204, miR-125b, miR-224, miR-30a, miR-375, miR-101, miR-106b,
miR-128, miR-129-5p, miR-153, miR-203, miR-214, miR-338-3p,
miR-346, miR-98, miR-107, miR-141, miR-217, miR-424, miR-449,
miR-7, miR-9, miR-93, miR-99a, miR-100, miR-1228, miR-183, miR-185,
miR-190, miR-522, miR-650, miR-675, miR-342-3p, miR-31 in the
mesenchymal stem cells (MSCs).
[0149] According to yet another aspect of the present invention
there is provided a method of predisposing MSCs to differentiate
into motor neurons, the method comprising down-regulating an
expression of at least one miRNA selected from the group consisting
of miR-199a, miR-372, miR-373, miR-942, miR-2113, miR-301a-3p,
miR-302c, miR-30b-5p, miR-30c, miR-326, miR-328, miR-331-3p,
miR-340, miR-345, miR-361-5p, miR-363, miR-365a-3p, miR-371a-3p,
miR-373-3p, miR-374a, miR-423-3p, miR-449b-5p, miR-451a, miR-494,
miR-504, miR-515-3p, miR-516a-3p, miR-519e, miR-520a-3p,
miR-520c-3p, miR-520g, miR-532-5p, miR-559, miR-562, miR-572,
miR-590-5p, miR-605, miR-608, miR-626, miR-639, miR-654-3p,
miR-657, miR-661, miR-708-5p, miR-942, miR-96, miR-99arno and
miR-194 by up-regulating a level of at least one polynucleotide
agent that hybridizes and inhibits a function of said at least one
miRNA in the MSCs thereby predisposing MSCs to differentiate into
the motor neurons.
[0150] The term "microRNA", "miRNA", and "miR" are synonymous and
refer to a collection of non-coding single-stranded RNA molecules
of about 19-28 nucleotides in length, which regulate gene
expression. miRNAs are found in a wide range of organisms and have
been shown to play a role in development, homeostasis, and disease
etiology.
[0151] Below is a brief description of the mechanism of miRNA
activity.
[0152] Genes coding for miRNAs are transcribed leading to
production of a miRNA precursor known as the pri-miRNA. The
pri-miRNA is typically part of a polycistronic RNA comprising
multiple pri-miRNAs. The pri-miRNA may form a hairpin with a stem
and loop. The stem may comprise mismatched bases.
[0153] The hairpin structure of the pri-miRNA is recognized by
Drosha, which is an RNase III endonuclease. Drosha typically
recognizes terminal loops in the pri-miRNA and cleaves
approximately two helical turns into the stem to produce a 60-70 nt
precursor known as the pre-miRNA. Drosha cleaves the pri-miRNA with
a staggered cut typical of RNase III endonucleases yielding a
pre-miRNA stem loop with a 5' phosphate and -2 nucleotide 3'
overhang. It is estimated that approximately one helical turn of
stem (-10 nucleotides) extending beyond the Drosha cleavage site is
essential for efficient processing. The pre-miRNA is then actively
transported from the nucleus to the cytoplasm by Ran-OTP and the
export receptor exportin-5.
[0154] The double-stranded stem of the pre-miRNA is then recognized
by Dicer, which is also an RNase III endonuclease. Dicer may also
recognize the 5' phosphate and 3' overhang at the base of the stem
loop. Dicer then cleaves off the terminal loop two helical turns
away from the base of the stem loop leaving an additional 5'
phosphate and -2 nucleotide 3' overhang. The resulting siRNA-like
duplex, which may comprise mismatches, comprises the mature miRNA
and a similar-sized fragment known as the miRNA*. The miRNA and
miRNA* may be derived from opposing arms of the pri-miRNA and
pre-miRNA. miRNA* sequences may be found in libraries of cloned
miRNAs but typically at lower frequency than the miRNAs.
[0155] Although initially present as a double-stranded species with
miRNA *, the miRNA eventually become incorporated as a
single-stranded RNA into a ribonucleoprotein complex known as the
RNA-induced silencing complex (RISC). Various proteins can form the
RISC, which can lead to variability in specificity for miRNA/miRNA
* duplexes, binding site of the target gene, activity of miRNA
(repress or activate), and which strand of the miRN A/miRNA* duplex
is loaded in to the RISC.
[0156] When the miRNA strand of the miRNA:miRNA* duplex is loaded
into the RISC, the miRNA* is removed and degraded. The strand of
the miRNA:miRNA* duplex that is loaded into the RISC is the strand
whose 5' end is less tightly paired. In cases where both ends of
the miRNA:miRNA * have roughly equivalent 5' pairing, both miRNA
and miRNA* may have gene silencing activity.
[0157] The RISC identifies target nucleic acids based on high
levels of complementarity between the miRNA and the mRNA,
especially by nucleotides 2-7 of the miRNA.
[0158] A number of studies have looked at the base-pairing
requirement between miRNA and its mRNA target for achieving
efficient inhibition of translation (reviewed by Bartel 2004, Cell
116-281). In mammalian cells, the first 8 nucleotides of the miRNA
may be important (Doench & Sharp 2004 GenesDev 2004-504).
However, other parts of the microRNA may also participate in mRNA
binding. Moreover, sufficient base pairing at the 3' can compensate
for insufficient pairing at the 5' (Brennecke et al, 2005 PLoS
3-e85). Computation studies, analyzing miRNA binding on whole
genomes have suggested a specific role for bases 2-7 at the 5' of
the miRNA in target binding but the role of the first nucleotide,
found usually to be "A" was also recognized (Lewis et at 2005 Cell
120-15). Similarly, nucleotides 1-7 or 2-8 were used to identify
and validate targets by Krek et al (2005, Nat Genet 37-495).
[0159] The target sites in the mRNA may be in the 5' UTR, the 3'
UTR or in the coding region. Interestingly, multiple miRNAs may
regulate the same mRNA target by recognizing the same or multiple
sites. The presence of multiple miRNA binding sites in most
genetically identified targets may indicate that the cooperative
action of multiple RISCs provides the most efficient translational
inhibition.
[0160] miRNAs may direct the RISC to down-regulate gene expression
by either of two mechanisms: mRNA cleavage or translational
repression. The miRNA may specify cleavage of the mRNA if the mRNA
has a certain degree of complementarity to the miRNA. When a miRNA
guides cleavage, the cut is typically between the nucleotides
pairing to residues 10 and 11 of the miRNA. Alternatively, the
miRNA may repress translation if the miRNA does not have the
requisite degree of complementarity to the miRNA. Translational
repression may be more prevalent in animals since animals may have
a lower degree of complementarity between the miRNA and binding
site.
[0161] It should be noted that there may be variability in the 5'
and 3' ends of any pair of miRNA and miRNA*. This variability may
be due to variability in the enzymatic processing of Drosha and
Dicer with respect to the site of cleavage. Variability at the 5'
and 3' ends of miRNA and miRNA* may also be due to mismatches in
the stem structures of the pri-miRNA and pre-miRNA. The mismatches
of the stem strands may lead to a population of different hairpin
structures. Variability in the stem structures may also lead to
variability in the products of cleavage by Drosha and Dicer.
[0162] The term "microRNA mimic" refers to synthetic non-coding
RNAs that are capable of entering the RNAi pathway and regulating
gene expression. miRNA mimics imitate the function of endogenous
microRNAs (miRNAs) and can be designed as mature, double stranded
molecules or mimic precursors (e.g., or pre-miRNAs). miRNA mimics
can be comprised of modified or unmodified RNA, DNA, RNA-DNA
hybrids, or alternative nucleic acid chemistries (e.g., LNAs or
2'-0,4'-C-ethylene-bridged nucleic acids (ENA)). Other
modifications are described herein below. For mature, double
stranded miRNA mimics, the length of the duplex region can vary
between 13-33, 18-20 24 or 21-23 nucleotides. The miRNA may also
comprise a total of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39 or 40 nucleotides. The sequence of the
miRNA may be the first 13-33 nucleotides of the pre-miRNA. The
sequence of the miRNA may also be the last 13-33 nucleotides of the
pre-miRNA. The sequence of the miRNA may comprise any of the
sequences described herein, or variants thereof.
[0163] It will be appreciated from the description provided herein
above, that contacting mesenchymal stem cells may be affected in a
number of ways:
[0164] 1. Transiently transfecting the mesenchymal stem cells with
the mature miRNA (or modified form thereof, as described herein
below). The miRNAs designed according to the teachings of the
present invention can be generated according to any oligonucleotide
synthesis method known in the art, including both enzymatic
syntheses and solid-phase syntheses. Equipment and reagents for
executing solid-phase synthesis are commercially available from,
for example, Applied Biosystems. Any other means for such synthesis
may also be employed; the actual synthesis of the oligonucleotides
is well within the capabilities of one skilled in the art and can
be accomplished via established methodologies as detailed in, for
example: Sambrook, J. and Russell, D. W. 5 (2001), "Molecular
Cloning: A Laboratory Manual"; Ausubel, R. M. et al., eds. (1994,
1989), "Current Protocols in Molecular Biology," Volumes I-III,
John Wiley & Sons, Baltimore, Md.; Perbal, B. (1988), "A
Practical Guide to Molecular Cloning," John Wiley & Sons, New
York; and Gait, M. J., ed. (1984), "Oligonucleotide Synthesis";
utilizing solid-phase chemistry, e.g. cyanoethyl phosphoramidite
followed by deprotection, desalting, and purification by, for
example, an automated trityl-on method or HPLC.
[0165] 2. Stably, or transiently transfecting the mesenchymal stem
cells with an expression vector which encodes the mature miRNA or
with miRNA mimic.
[0166] 3. Stably, or transiently transfecting the mesenchymal stem
cells with an expression vector which encodes the pre-miRNA. The
pre-miRNA sequence may comprise from 45-90, 60-80 or 60-70
nucleotides. The sequence of the pre-miRNA may comprise a miRNA and
a miRNA* as set forth herein. The sequence of the pre-miRNA may
also be that of a pri-miRNA excluding from 0-160 nucleotides from
the 5' and 3' ends of the pri-miRNA. The sequence of the pre-miRNA
may comprise the sequence of the miRNA, or variants thereof.
[0167] 4. Stably, or transiently transfecting the mesenchymal stem
cells with an expression vector which encodes the pri-miRNA. The
pri-miRNA sequence may comprise from 45-30,000, 50-25,000,
100-20,000, 1,000-1,500 or 80-100 nucleotides. The sequence of the
pri-miRNA may comprise a pre-miRNA, miRNA and miRNA*, as set forth
herein, and variants thereof. Preparation of miRNAs mimics can be
affected by chemical synthesis methods or by recombinant
methods.
[0168] miRNA antagonists may be introduced into cells using
transfection protocols known in the art using either siRNAs or
expression vectors such as Anatgomirs.
[0169] As mentioned herein above, the polynucleotides which
down-regulate the miRNAs described herein above may be provided as
modified polynucleotides using various methods known in the
art.
[0170] For example, the oligonucleotides (e.g. miRNAs) or
polynucleotides of the present invention may comprise heterocylic
nucleosides consisting of purines and the pyrimidines bases, bonded
in a 3'-to-5' phosphodiester linkage.
[0171] Preferably used oligonucleotides or polynucleotides are
those modified either in backbone, internucleoside linkages, or
bases, as is broadly described herein under.
[0172] Specific examples of preferred oligonucleotides or
polynucleotides useful according to this aspect of the present
invention include oligonucleotides or polynucleotides containing
modified backbones or non-natural internucleoside linkages.
Oligonucleotides or polynucleotides having modified backbones
include those that retain a phosphorus atom in the backbone, as
disclosed in U.S. Pat. Nos. 4,469,863; 4,476,301; 5,023,243;
5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717;
5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677;
5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253;
5,571,799; 5,587,361; and 5,625,050.
[0173] Preferred modified oligonucleotide or polynucleotide
backbones include, for example: phosphorothioates; chiral
phosphorothioates; phosphorodithioates; phosphotriesters;
aminoalkyl phosphotriesters; methyl and other alkyl phosphonates,
including 3'-alkylene phosphonates and chiral phosphonates;
phosphinates; phosphoramidates, including 3'-amino phosphoramidate
and aminoalkylphosphoramidates; thionophosphoramidates;
thionoalkylphosphonates; thionoalkylphosphotriesters; and
boranophosphates having normal 3'-5' linkages, 2'-5' linked
analogues of these, and those having inverted polarity wherein the
adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or
2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms of
the above modifications can also be used.
[0174] Alternatively, modified oligonucleotide or polynucleotide
backbones that do not include a phosphorus atom therein have
backbones that are formed by short-chain alkyl or cycloalkyl
internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl
internucleoside linkages, or one or more short-chain heteroatomic
or heterocyclic internucleoside linkages. These include those
having morpholino linkages (formed in part from the sugar portion
of a nucleoside); siloxane backbones; sulfide, sulfoxide, and
sulfone backbones; formacetyl and thioformacetyl backbones;
methylene formacetyl and thioformacetyl backbones;
alkene-containing backbones; sulfamate backbones; methyleneimino
and methylenehydrazino backbones; sulfonate and sulfonamide
backbones; amide backbones; and others having mixed N, O, S and CH2
component parts, as disclosed in U.S. Pat. Nos. 5,034,506;
5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562;
5,264,564; 5,405,938; 5,434,257; 5,466,677, 5,470,967; 5,489,677;
5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240;
5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360;
5,677,437; and 5,677,439.
[0175] Other oligonucleotides or polynucleotides which may be used
according to the present invention are those modified in both sugar
and the internucleoside linkage, i.e., the backbone of the
nucleotide units is replaced with novel groups. The base units are
maintained for complementation with the appropriate polynucleotide
target. An example of such an oligonucleotide mimetic includes a
peptide nucleic acid (PNA). A PNA oligonucleotide refers to an
oligonucleotide where the sugar-backbone is replaced with an
amide-containing backbone, in particular an aminoethylglycine
backbone. The bases are retained and are bound directly or
indirectly to aza-nitrogen atoms of the amide portion of the
backbone. United States patents that teach the preparation of PNA
compounds include, but are not limited to, U.S. Pat. Nos.
5,539,082; 5,714,331; and 5,719,262; each of which is herein
incorporated by reference. Other backbone modifications which may
be used in the present invention are disclosed in U.S. Pat. No.
6,303,374.
[0176] Oligonucleotides or polynucleotides of the present invention
may also include base modifications or substitutions. As used
herein, "unmodified" or "natural" bases include the purine bases
adenine (A) and guanine (G) and the pyrimidine bases thymine (T),
cytosine (C), and uracil (U). "Modified" bases include but are not
limited to other synthetic and natural bases, such as:
5-methylcytosine (5-me-C); 5-hydroxymethyl cytosine; xanthine;
hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives
of adenine and guanine; 2-propyl and other alkyl derivatives of
adenine and guanine; 2-thiouracil, 2-thiothymine, and
2-thiocytosine; 5-halouracil and cytosine; 5-propynyl uracil and
cytosine; 6-azo uracil, cytosine, and thymine; 5-uracil
(pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-thiol,
8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and
guanines; 5-halo, particularly 5-bromo, 5-trifluoromethyl, and
other 5-substituted uracils and cytosines; 7-methylguanine and
7-methyladenine; 8-azaguanine and 8-azaadenine; 7-deazaguanine and
7-deazaadenine; and 3-deazaguanine and 3-deazaadenine. Additional
modified bases include those disclosed in: U.S. Pat. No. 3,687,808;
Kroschwitz, J. I., ed. (1990), "The Concise Encyclopedia Of Polymer
Science And Engineering," pages 858-859, John Wiley & Sons;
Englisch et al. (1991), "Angewandte Chemie," International Edition,
30, 613; and Sanghvi, Y. S., "Antisense Research and Applications,"
Chapter 15, pages 289-302, S. T. Crooke and B. Lebleu, eds., CRC
Press, 1993. Such modified bases are particularly useful for
increasing the binding affinity of the oligomeric compounds of the
invention. These include 5-substituted pyrimidines,
6-azapyrimidines, and N-2, N-6, and 0-6-substituted purines,
including 2-aminopropyladenine, 5-propynyluracil, and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C.
(Sanghvi, Y. S. et al. (1993), "Antisense Research and
Applications," pages 276-278, CRC Press, Boca Raton), and are
presently preferred base substitutions, even more particularly when
combined with 2'-0-methoxyethyl sugar modifications.
[0177] To express miRNAs or polynucleotide agents which regulate
miRNAs in mesencyhymal stem cells or neural stem cells, a
polynucleotide sequence encoding the miRNA (or pre-miRNA, or
pri-miRNA, or polynucleotide which down-regulates the miRNAs) is
preferably ligated into a nucleic acid construct suitable for
mesenchymal stem cell (or neural stem cell) expression. Such a
nucleic acid construct includes a promoter sequence for directing
transcription of the polynucleotide sequence in the cell in a
constitutive or inducible manner.
[0178] It will be appreciated that the nucleic acid construct of
some embodiments of the invention can also utilize miRNA homologues
which exhibit the desired activity (e.g. motor neuron or neural
stem cell differentiating ability). Such homologues can be, for
example, at least 80%, at least 81%, at least 82%, at least 83%, at
least 84%, at least 85%, at least 86%, at least 87%, at least 88%,
at least 89%, at least 90%, at least 91%, at least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at
least 98%, at least 99% or 100% identical to any of the sequences
described herein above, as determined using the BestFit software of
the Wisconsin sequence analysis package, utilizing the Smith and
Waterman algorithm, where gap weight equals 50, length weight
equals 3, average match equals 10 and average mismatch equals
-9.
[0179] In addition, the homologues can be, for example, at least
60%, at least 61%, at least 62%, at least 63%, at least 64%, at
least 65%, at least 66%, at least 67%, at least 68%, at least 69%,
at least 70%, at least 71%, at least 72%, at least 73%, at least
74%, at least 75%, at least 76%, at least 77%, at least 78%, at
least 79%, at least 80%, at least 81%, at least 82%, at least 83%,
at least 84%, at least 85%, at least 86%, at least 87%, at least
88%, at least 89%, at least 90%, at least 91%, at least 92%, at
least 93%, at least 94%, at least 95%, at least 96%, at least 97%,
at least 98%, at least 99% or 100% identical to the sequences
described herein above, as determined using the BestFit software of
the Wisconsin sequence analysis package, utilizing the Smith and
Waterman algorithm, where gap weight equals 50, length weight
equals 3, average match equals 10 and average mismatch equals
-9.
[0180] Constitutive promoters suitable for use with some
embodiments of the invention are promoter sequences which are
active under most environmental conditions and most types of cells
such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV).
Inducible promoters suitable for use with some embodiments of the
invention include for example tetracycline-inducible promoter
(Zabala M, et al., Cancer Res. 2004, 64(8): 2799-804).
[0181] Eukaryotic promoters typically contain two types of
recognition sequences, the TATA box and upstream promoter elements.
The TATA box, located 25-30 base pairs upstream of the
transcription initiation site, is thought to be involved in
directing RNA polymerase to begin RNA synthesis. The other upstream
promoter elements determine the rate at which transcription is
initiated.
[0182] Preferably, the promoter utilized by the nucleic acid
construct of some embodiments of the invention is active in the
specific cell population transformed--i.e. mesenchymal stem cells
or neural stem cells.
[0183] Enhancer elements can stimulate transcription up to 1,000
fold from linked homologous or heterologous promoters. Enhancers
are active when placed downstream or upstream from the
transcription initiation site. Many enhancer elements derived from
viruses have a broad host range and are active in a variety of
tissues. For example, the SV40 early gene enhancer is suitable for
many cell types. Other enhancer/promoter combinations that are
suitable for some embodiments of the invention include those
derived from polyoma virus, human or murine cytomegalovirus (CMV),
the long term repeat from various retroviruses such as murine
leukemia virus, murine or Rous sarcoma virus and HIV. See,
Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold
Spring Harbor, N.Y. 1983, which is incorporated herein by
reference.
[0184] In the construction of the expression vector, the promoter
is preferably positioned approximately the same distance from the
heterologous transcription start site as it is from the
transcription start site in its natural setting. As is known in the
art, however, some variation in this distance can be accommodated
without loss of promoter function.
[0185] In addition to the elements already described, the
expression vector of some embodiments of the invention may
typically contain other specialized elements intended to increase
the level of expression of cloned nucleic acids or to facilitate
the identification of cells that carry the recombinant DNA. For
example, a number of animal viruses contain DNA sequences that
promote the extra chromosomal replication of the viral genome in
permissive cell types. Plasmids bearing these viral replicons are
replicated episomally as long as the appropriate factors are
provided by genes either carried on the plasmid or with the genome
of the host cell.
[0186] The vector may or may not include a eukaryotic replicon. If
a eukaryotic replicon is present, then the vector is amplifiable in
eukaryotic cells using the appropriate selectable marker. If the
vector does not comprise a eukaryotic replicon, no episomal
amplification is possible. Instead, the recombinant DNA integrates
into the genome of the engineered cell, where the promoter directs
expression of the desired nucleic acid.
[0187] Examples for mammalian expression vectors include, but are
not limited to, pcDNA3, pcDNA3.1(+/-), pGL3, pZeoSV2(+/-),
pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5,
DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from
Invitrogen, pCI which is available from Promega, pMbac, pPbac,
pBK-RSV and pBK-CMV which are available from Strategene, pTRES
which is available from Clontech, and their derivatives. Other
expression vectors are available from SBI or Sigma.
[0188] Expression vectors containing regulatory elements from
eukaryotic viruses such as retroviruses can be also used. SV40
vectors include pSVT7 and pMT2. Vectors derived from bovine
papilloma virus include pBV-lMTHA, and vectors derived from Epstein
Bar virus include pHEBO, and p205. Other exemplary vectors include
pMSG, pAV009/A+, pMTOlO/A+, pMAMneo-5, baculovirus pDSVE, and any
other vector allowing expression of proteins under the direction of
the SV-40 early promoter, SV-40 later promoter, metallothionein
promoter, murine mammary tumor virus promoter, Rous sarcoma virus
promoter, polyhedrin promoter, or other promoters shown effective
for expression in eukaryotic cells.
[0189] As described above, viruses are very specialized infectious
agents that have evolved, in many cases, to elude host defense
mechanisms. Typically, viruses infect and propagate in specific
cell types. The targeting specificity of viral vectors utilizes its
natural specificity to specifically target predetermined cell types
and thereby introduce a recombinant gene into the infected cell.
Thus, the type of vector used by some embodiments of the invention
will depend on the cell type transformed. The ability to select
suitable vectors according to the cell type transformed is well
within the capabilities of the ordinary skilled artisan and as such
no general description of selection consideration is provided
herein. For example, bone marrow cells can be targeted using the
human T cell leukemia virus type I (HTLV-1) and kidney cells may be
targeted using the heterologous promoter present in the baculovirus
Autographa californica nucleopolyhedrovirus (AcMNPV) as described
in Liang C Y et al., 2004 (Arch Virol. 149: 51-60).
[0190] According to one embodiment, a lentiviral vector is used to
transfect the mesenchymal stem cells or neural stem cells.
[0191] Various methods can be used to introduce the expression
vector of some embodiments of the invention into mesenchymal stem
cells. Such methods are generally described in Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Cold Springs Harbor
Laboratory, New York (1989, 1992), in Ausubel et al., Current
Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md.
(1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor,
Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor
Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and
Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at.
[Biotechniques 4 (6): 504-512, 1986] and include, for example,
stable or transient transfection, lipofection, electroporation and
infection with recombinant viral vectors. In addition, see U.S.
Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection
methods.
[0192] Introduction of nucleic acids by viral infection offers
several advantages over other methods such as lipofection and
electroporation, since higher transfection efficiency can be
obtained due to the infectious nature of viruses.
[0193] Other vectors can be used that are non-viral, such as
cationic lipids, polylysine, and dendrimers.
[0194] The miRNAs, miRNA mimics and pre-miRs can be transfected
into cells also using nanoparticles such as gold nanoparticles and
by ferric oxide magnetic NP--see for example Ghosh et al.,
Biomaterials. 2013 January; 34(3):807-16; Crew E, et al., Anal
Chem. 2012 Jan. 3; 84(1):26-9.
[0195] Other modes of transfection that do not involved integration
include the use of minicircle DNA vectors or the use of PiggyBac
transposon that allows the transfection of genes that can be later
removed from the genome.
[0196] As mentioned hereinabove, a variety of prokaryotic or
eukaryotic cells can be used as host-expression systems to express
the miRNAs or polynucleotide agent capable of down-regulating the
miRNA of some embodiments of the invention. These include, but are
not limited to, microorganisms, such as bacteria transformed with a
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression
vector containing the coding sequence; yeast transformed with
recombinant yeast expression vectors containing the coding
sequence; plant cell systems infected with recombinant virus
expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco
mosaic virus, TMV) or transformed with recombinant plasmid
expression vectors, such as Ti plasmid, containing the coding
sequence. Mammalian expression systems can also be used to express
the miRNAs of some embodiments of the invention.
[0197] Examples of bacterial constructs include the pET series of
E. coli expression vectors [Studier et al. (1990) Methods in
Enzymol. 185:60-89).
[0198] In yeast, a number of vectors containing constitutive or
inducible promoters can be used, as disclosed in U.S. Pat. No.
5,932,447. Alternatively, vectors can be used which promote
integration of foreign DNA sequences into the yeast chromosome.
[0199] The conditions used for contacting the mesenchymal stem
cells or neural stem cells are selected for a time
period/concentration of cells/concentration of miRNA/ratio between
cells and miRNA which enable the miRNA (or inhibitors thereof) to
induce differentiation thereof. The present invention further
contemplates incubation of the stem cells with a differentiation
factor which promotes differentiation towards a motor neuron or
neural stem cell lineage. The incubation with such differentiation
factors may be affected prior to, concomitant with or following the
contacting with the miRNA. Examples of such agents are provided in
the Examples section herein below.
[0200] Alternatively, or additionally, the mesenchymal stem cells
may be genetically modified so as to express such differentiation
factors, using expression constructs such as those described herein
above. Further, the mesenchymal stem cell can be genetically
modified using the CRISPR/Cas9 system, or an equivalent system, to
no long express a target which is being silenced/down-regulated,
such as for example RTVP-1.
[0201] During or following the differentiation step the stem cells
may be monitored for their differentiation state. Cell
differentiation can be determined upon examination of cell or
tissue-specific markers which are known to be indicative of
differentiation.
[0202] For example, the neural stem cells may express at least one
of nestin and SOX-2. Additional markers include SOX1, SOX3,
PSA-NCAM and MUSASHI-1.
[0203] Below is a list of markers that may be used to confirm
differentiation into motor neurons: ChAT (choline
acetyltransferase), ChoxlO, Enl, Even-skipped (Eve) transcription
factor, Evxl/2, Fibroblast growth factor-1 (FGFl or acidic FGF),
HB9, Isll (lslet-1), Isl2, Islet1/2, Lim3, p75(NTR) (p75
neurotrophin receptor), REG2, Siml, SMI32 (SMI-32) and Zfhl.
[0204] Tissue/cell specific markers can be detected using
immunological techniques well known in the art [Thomson J A et al.,
(1998). Science 282: 1145-7]. Examples include, but are not limited
to, flow cytometry for membrane-bound markers, immunohistochemistry
for extracellular and intracellular markers and enzymatic
immunoassay, for secreted molecular markers.
[0205] It will be appreciated that the cells obtained according to
the methods described herein may be enriched for a particular cell
type--e.g. progenitor cell type or mature cell type. Thus for
example, the time of differentiation may be selected to obtain an
earlier progenitor type (e.g. one that expresses at least one of
the following markers nestin, olig2 and Sox2) or a later mature
cell type (e.g. one that expresses at least one of the following
markers ChAT, isletl, HB9 and J33 tubulin).
[0206] Further enrichment of a particular cell type may be affected
using cell sorting techniques such as FACS and magnetic
sorting.
[0207] In addition, cell differentiation can be also followed by
specific reporters that are tagged with GFP or RFP and exhibit
increased fluorescence upon differentiation.
[0208] By determining the targets of the miRNAs of the present
invention that are proposed for up-regulation, it will be
appreciated that the scope of the present invention may be
broadened to include down-regulation of the targets by means other
than contacting with miRNA. Correspondingly, by determining the
targets of the miRNAs of the present invention that are proposed
for down-regulation, it will be appreciated that the scope of the
present invention may be broadened to include up-regulation of the
targets.
[0209] For example, the present inventors have shown that one of
the targets of miR-137 is Related to testis-specific, vespid and
pathogenesis protein 1 (RTVP-1) Thus the present invention
contemplates that differentiation towards the neural stem cell
lineage may be affected by down-regulation of this protein.
[0210] Thus, according to another aspect of the invention, there is
provided a method of generating neural stem cells, the method
comprising contacting mesenchymal stem cells (MSCs) with an agent
that down-regulates an amount and/or activity of Related to
testis-specific, vespid and pathogenesis protein 1 (RTVP-1),
thereby generating the neural stem cells.
[0211] Related to testis-specific, vespid and pathogenesis protein
1 (RTVP-1) was cloned from human GBM cell lines by two groups and
was termed glioma pathogenesis-related protein-GLIPRl or RTVP-1
[Rich T, et al., Gene 1996; 180: 125-30], incorporated herein by
reference. RTVP-1 contains a putative signal peptide, a trans
membrane domain and a SCP domain, with a yet unknown function which
is also found in other RTVP-1 homologs including TPX-1, the venom
allergen antigen 5 and group 1 of the plant pathogenesis-related
proteins (PR-1).
[0212] Down-regulation of RTVP-1 (or any of the other miRNA targets
of the present invention) can be obtained at the genomic and/or the
transcript level using a variety of molecules which interfere with
transcription and/or translation (e.g., RNA silencing agents,
Ribozyme, DNAzyme and antisense), or on the protein level using
e.g., antagonists, enzymes that cleave the polypeptide and the
like.
[0213] Following is a list of agents capable of down-regulating
expression level and/or activity of RTVP-1.
[0214] One example of an agent capable of down-regulating RTVP-1 is
an antibody or antibody fragment capable of specifically binding
thereto. Preferably, the antibody is capable of being internalized
by the cell and entering the nucleus.
[0215] The term "antibody" as used in this invention includes
intact molecules as well as functional fragments thereof, such as
Fab, F(ab')2, and Fv that are capable of binding to macrophages.
These functional antibody fragments are defined as follows: (1)
Fab, the fragment which contains a monovalent antigen-binding
fragment of an antibody molecule, can be produced by digestion of
whole antibody with the enzyme papain to yield an intact light
chain and a portion of one heavy chain; (2) Fab', the fragment of
an antibody molecule that can be obtained by treating whole
antibody with pepsin, followed by reduction, to yield an intact
light chain and a portion of the heavy chain; two Fab' fragments
are obtained per antibody molecule; (3) (Fab')2, the fragment of
the antibody that can be obtained by treating whole antibody with
the enzyme pepsin without subsequent reduction; F(ab')2 is a dimer
of two Fab' fragments held together by two disulfide bonds; (4) Fv,
defined as a genetically engineered fragment containing the
variable region of the light chain and the variable region of the
heavy chain expressed as two chains; and (5) Single chain antibody
("SCA"), a genetically engineered molecule containing the variable
region of the light chain and the variable region of the heavy
chain, linked by a suitable polypeptide linker as a genetically
fused single chain molecule.
[0216] Down-regulation of RTVP-1 can be also achieved by RNA
silencing. As used herein, the phrase "RNA silencing" refers to a
group of regulatory mechanisms [e.g. RNA interference (RNAi),
transcriptional gene silencing (TGS), post-transcriptional gene
silencing (PTGS), quelling, co-suppression, and translational
repression] mediated by RNA molecules which result in the
inhibition or "silencing" of the expression of a corresponding
protein-coding gene. RNA silencing has been observed in many types
of organisms, including plants, animals, and fungi.
[0217] As used herein, the term "RNA silencing agent" refers to an
RNA which is capable of inhibiting or "silencing" the expression of
a target gene. In certain embodiments, the RNA silencing agent is
capable of preventing complete processing (e.g., the full
translation and/or expression) of an mRNA molecule through a
post-transcriptional silencing mechanism. RNA silencing agents
include non-coding RNA molecules, for example RNA duplexes
comprising paired strands, as well as precursor RNAs from which
such small non-coding RNAs can be generated. In one embodiment, the
RNA silencing agent is capable of inducing RNA interference. In
another embodiment, the RNA silencing agent is capable of mediating
translational repression.
[0218] RNA interference refers to the process of sequence-specific
post-transcriptional gene silencing in animals mediated by short
interfering RNAs (siRNAs). The corresponding process in plants is
commonly referred to as post-transcriptional gene silencing or RNA
silencing and is also referred to as quelling in fungi. The process
of post-transcriptional gene silencing is thought to be an
evolutionarily-conserved cellular defense mechanism used to prevent
the expression of foreign genes and is commonly shared by diverse
flora and phyla. Such protection from foreign gene expression may
have evolved in response to the production of double-stranded RNAs
(dsRNAs) derived from viral infection or from the random
integration of transposon elements into a host genome via a
cellular response that specifically destroys homologous
single-stranded RNA or viral genomic RNA.
[0219] The presence of long dsRNAs in cells stimulates the activity
of a ribonuclease III enzyme referred to as dicer. Dicer is
involved in the processing of the dsRNA into short pieces of dsRNA
known as short interfering RNAs (siRNAs). Short interfering RNAs
derived from dicer activity are typically about 21 to about 23
nucleotides in length and comprise about 19 base pair duplexes. The
RNAi response also features an endonuclease complex, commonly
referred to as an RNA-induced silencing complex (RISC), which
mediates cleavage of single-stranded RNA having sequence
complementary to the antisense strand of the siRNA duplex. Cleavage
of the target RNA takes place in the middle of the region
complementary to the antisense strand of the siRNA duplex.
[0220] Accordingly, the present invention contemplates use of dsRNA
to down-regulate protein expression from the mRNA.
[0221] According to one embodiment, the dsRNA is greater than 30
bp. The use of long dsRNAs (i.e. dsRNA greater than 30 bp) has been
very limited owing to the belief that these longer regions of
double stranded RNA will result in the induction of the interferon
and PKR response. However, the use of long dsRNAs can provide
numerous advantages in that the cell can select the optimal
silencing sequence alleviating the need to test numerous siRNAs;
long dsRNAs will allow for silencing libraries to have less
complexity than would be necessary for siRNAs; and, perhaps most
importantly, long dsRNA could prevent viral escape mutations when
used as therapeutics.
[0222] Various studies demonstrate that long dsRNAs can be used to
silence gene expression without inducing the stress response or
causing significant off-target effects--see for example [Strat et
al., Nucleic Acids Research, 2006, Vol. 34, No. 13 3803-3810;
Bhargava A et al. Brain Res. Protoc. 2004; 13:115-125; Diallo M.,
et al., Oligonucleotides. 2003; 13:381-392; Paddison P. J., et al.,
Proc. Natl Acad. Sci. USA. 2002; 99:1443-1448; Tran N., et al.,
FEBS Lett. 2004; 573:127-134].
[0223] In particular, the present invention also contemplates
introduction of long dsRNA (over 30 base transcripts) for gene
silencing in cells where the interferon pathway is not activated
(e.g. embryonic cells and oocytes) see for example Billy et al.,
PNAS 2001, Vol 98, pages 14428-14433. and Diallo et al,
Oligonucleotides, Oct. 1, 2003, 13(5): 381-392. doi:
10.1089/154545703322617069.
[0224] The present invention also contemplates introduction of long
dsRNA specifically designed not to induce the interferon and PKR
pathways for down-regulating gene expression. For example, Shinagwa
and Ishii [Genes & Dev. 17 (11): 1340-1345, 2003] have
developed a vector, named pDECAP, to express long double-strand RNA
from an RNA polymerase II (Pol II) promoter. Because the
transcripts from pDECAP lack both the 5'-cap structure and the
3'-poly(A) tail that facilitate dsRNA export to the cytoplasm, long
ds-RNA from pDECAP does not induce the interferon response.
[0225] Another method of evading the interferon and PKR pathways in
mammalian systems is by introduction of small inhibitory RNAs
(siRNAs) either via transfection or endogenous expression.
[0226] The term "siRNA" refers to small inhibitory RNA duplexes
(generally between 18-30 basepairs) that induce the RNA
interference (RNAi) pathway. Typically, siRNAs are chemically
synthesized as 21mers with a central 19 bp duplex region and
symmetric 2-base 3'-overhangs on the termini, although it has been
recently described that chemically synthesized RNA duplexes of
25-30 base length can have as much as a 100-fold increase in
potency compared with 21mers at the same location. The observed
increased potency obtained using longer RNAs in triggering RNAi is
theorized to result from providing Dicer with a substrate (27mer)
instead of a product (21mer) and that this improves the rate or
efficiency of entry of the siRNA duplex into RISC.
[0227] It has been found that position of the 3'-overhang
influences potency of an siRNA and asymmetric duplexes having a
3'-overhang on the antisense strand are generally more potent than
those with the 3'-overhang on the sense strand (Rose et al., 2005).
This can be attributed to asymmetrical strand loading into RISC, as
the opposite efficacy patterns are observed when targeting the
antisense transcript.
[0228] The strands of a double-stranded interfering RNA (e.g., an
siRNA) may be connected to form a hairpin or stem-loop structure
(e.g., an shRNA). Thus, as mentioned the RNA silencing agent of the
present invention may also be a short hairpin RNA (shRNA).
[0229] The term "shRNA", as used herein, refers to an RNA agent
having a stem-loop structure, comprising a first and second region
of complementary sequence, the degree of complementarity and
orientation of the regions being sufficient such that base pairing
occurs between the regions, the first and second regions being
joined by a loop region, the loop resulting from a lack of base
pairing between nucleotides (or nucleotide analogs) within the loop
region. The number of nucleotides in the loop is a number between
and including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to
11. Some of the nucleotides in the loop can be involved in
base-pair interactions with other nucleotides in the loop. Examples
of oligonucleotide sequences that can be used to form the loop
include 5'-UUCAAGAGA-3'; (Brummelkamp, T. R. et al. (2002) Science
296: 550) and 5'-UUUGUGUAG-3' (Castanotto, D. et al. (2002) RNA
8:1454). It will be recognized by one of skill in the art that the
resulting single chain oligonucleotide forms a stem-loop or hairpin
structure comprising a double-stranded region capable of
interacting with the RNAi machinery.
[0230] According to another embodiment the RNA silencing agent may
be a miRNA, as further described herein above.
[0231] Synthesis of RNA silencing agents suitable for use with the
present invention can be affected as follows. First, the miRNA
target mRNA sequence (e.g. CTGF sequence) is scanned downstream of
the AUG start codon for AA dinucleotide sequences. Occurrence of
each AA and the 3' adjacent 19 nucleotides is recorded as potential
siRNA target sites. Preferably, siRNA target sites are selected
from the open reading frame, as untranslated regions (UTRs) are
richer in regulatory protein binding sites. UTR-binding proteins
and/or translation initiation complexes may interfere with binding
of the siRNA endonuclease complex [Tuschl ChemBiochem. 2:239-245].
It will be appreciated though, that siRNAs directed at untranslated
regions may also be effective, as demonstrated for GAPDH wherein
siRNA directed at the 5' UTR mediated about 90% decrease in
cellular GAPDH mRNA and completely abolished protein level
(www.ambion.com/techlib/tn/91/912.html).
[0232] Second, potential target sites are compared to an
appropriate genomic database (e.g., human, mouse, rat etc.) using
any sequence alignment software, such as the BLAST software
available from the NCBI server (www.ncbi.nlm.nih.gov/BLAST/).
Putative target sites which exhibit significant homology to other
coding sequences are filtered out.
[0233] Qualifying target sequences are selected as template for
siRNA synthesis. Preferred sequences are those including low G/C
content as these have proven to be more effective in mediating gene
silencing as compared to those with G/C content higher than 55%.
Several target sites are preferably selected along the length of
the target gene for evaluation. For better evaluation of the
selected siRNAs, a negative control is preferably used in
conjunction. Negative control siRNA preferably include the same
nucleotide composition as the siRNAs but lack significant homology
to the genome. Thus, a scrambled nucleotide sequence of the siRNA
is preferably used, provided it does not display any significant
homology to any other gene.
[0234] The RNA silencing agents of the present invention may
comprise nucleic acid analogs that may have at least one different
linkage, e.g., phosphoramidate, phosphorothioate,
phosphorodithioate, or 0-methylphosphoroamidite linkages and
peptide nucleic acid backbones and linkages. Other analog nucleic
acids include those with positive backbones; non-ionic backbones,
and non-ribose backbones, including those described in U.S. Pat.
Nos. 5,235,033 and 5,034,506, which are incorporated by reference.
Nucleic acids containing one or more non-naturally occurring or
modified nucleotides are also included within one definition of
nucleic acids. The modified nucleotide analog may be located for
example at the 5'-end and/or the 3'-end of the nucleic acid
molecule. Representative examples of nucleotide analogs may be
selected from sugar- or backbone-modified ribonucleotides. It
should be noted, however, that also nucleobase-modified
ribonucleotides, i.e. ribonucleotides, containing a non-naturally
occurring nucleobase instead of a naturally occurring nucleobase
such as uridines or cytidines modified at the 5-position, e.g.
5-(2-amino) propyl uridine, 5-bromo uridine; adenosines and
guanosines modified at the 8-position, e.g. 8-bromo guanosine;
deaza nucleotides, e.g. 7-deaza-adenosine; 0- and N-alkylated
nucleotides, e.g. N6-methyl adenosine are suitable. The 2'-0H-group
may be replaced by a group selected from H, OR, R, halo, SH, SR,
NH2, NHR, NR2 or CN, wherein R is C1-C6 alkyl, alkenyl or alkynyl
and halo is F, Cl, Br or I. Modified nucleotides also include
nucleotides conjugated with cholesterol through, e.g., a
hydroxyprolinol linkage as described in Krutzfeldt et al., Nature
438:685-689 (2005), Soutschek et al., Nature 432:173-178 (2004),
and U.S. Patent Publication No. 20050107325, which are incorporated
herein by reference. Additional modified nucleotides and nucleic
acids are described in U.S. Patent Publication No. 20050182005,
which is incorporated herein by reference. Modifications of the
ribose-phosphate backbone may be done for a variety of reasons,
e.g., to increase the stability and half-life of such molecules in
physiological environments, to enhance diffusion across cell
membranes, or as probes on a biochip. The backbone modification may
also enhance resistance to degradation, such as in the harsh
endocytic environment of cells. The backbone modification may also
reduce nucleic acid clearance by hepatocytes, such as in the liver
and kidney. Mixtures of naturally occurring nucleic acids and
analogs may be made; alternatively, mixtures of different nucleic
acid analogs, and mixtures of naturally occurring nucleic acids and
analogs may be made.
[0235] In some embodiments, the RNA silencing agent provided herein
can be functionally associated with a cell-penetrating peptide." As
used herein, a "cell-penetrating peptide" is a peptide that
comprises a short (about 12-30 residues) amino acid sequence or
functional motif that confers the energy-independent (i.e.,
non-endocytotic) translocation properties associated with transport
of the membrane-permeable complex across the plasma and/or nuclear
membranes of a cell. The cell-penetrating peptide used in the
membrane-permeable complex of the present invention preferably
comprises at least one non-functional cysteine residue, which is
either free or derivatized to form a disulfide link with a
double-stranded ribonucleic acid that has been modified for such
linkage. Representative amino acid motifs conferring such
properties are listed in U.S. Pat. No. 6,348,185, the contents of
which are expressly incorporated herein by reference. The
cell-penetrating peptides of the present invention preferably
include, but are not limited to, penetratin, transportan, plsl,
TAT(48-60), pVEC, MTS, and MAP.
[0236] Another agent capable of down-regulating RTVP-1 is a DNAzyme
molecule capable of specifically cleaving an mRNA transcript or DNA
sequence of CTGF. DNAzymes are single-stranded polynucleotides
which are capable of cleaving both single and double stranded
target sequences (Breaker, R. R. and Joyce, G. Chemistry and
Biology 1995; 2:655; Santoro, S. W. & Joyce, G. F. Proc. Natl,
Acad. Sci. USA 1997; 943:4262) A general model (the "10-23" model)
for the DNAzyme has been proposed. "10-23" DNAzymes have a
catalytic domain of 15 deoxyribonucleotides, flanked by two
substrate-recognition domains of seven to nine deoxyribonucleotides
each. This type of DNAzyme can effectively cleave its substrate RNA
at purine:pyrimidine junctions (Santoro, S. W. & Joyce, G. F.
Proc. Natl, Acad. Sci. USA 20 199; for rev of DNAzymes see
Khachigian, L M [Curr Opin Mol Ther 4:119-21 (2002)].
[0237] Examples of construction and amplification of synthetic,
engineered DNAzymes recognizing single and double-stranded target
cleavage sites have been disclosed in U.S. Pat. No. 6,326,174 to
Joyce et al.
[0238] Down-regulation of RTVP-1 can also be obtained by using an
antisense polynucleotide capable of specifically hybridizing with
an mRNA transcript encoding RTVP-1.
[0239] Design of antisense molecules which can be used to
efficiently down-regulate RTVP-1 should take into consideration two
aspects important to the antisense approach. The first aspect is
delivery of the oligonucleotide into the cytoplasm of the
appropriate cells, while the second aspect is design of an
oligonucleotide which specifically binds the designated mRNA within
cells in a way which inhibits translation thereof.
[0240] The prior art teaches of a number of delivery strategies
which can be used to efficiently deliver oligonucleotides into a
wide variety of cell types [see, for example, Luft J Mol Med 76:
75-6 (1998); Kronenwett et al. Blood 91: 852-62 (1998); Rajur et
al. Bioconjug Chem 8: 935-40 (1997); Lavigne et al. Biochem Biophys
Res Commun 237: 566-71 (1997) and Aoki et al. (1997) Biochem
Biophys Res Commun 231: 540-5 (1997)].
[0241] In addition, algorithms for identifying those sequences with
the highest predicted binding affinity for their target mRNA based
on a thermodynamic cycle that accounts for the energetics of
structural alterations in both the target mRNA and the
oligonucleotide are also available [see, for example, Walton et al.
Biotechnol Bioeng 65: 1-9 (1999)].
[0242] Such algorithms have been successfully used to implement an
antisense approach in cells. For example, the algorithm developed
by Walton et al. enabled scientists to successfully design
antisense oligonucleotides for rabbit beta-globin (RBG) and mouse
tumor necrosis factor-alpha (TNF alpha) transcripts. The same
research group has more recently reported that the antisense
activity of rationally selected oligonucleotides against three
model target mRNAs (human lactate dehydrogenase A and B and rat gp
130) in cell culture as evaluated by a kinetic PCR technique proved
effective in almost all cases, including tests against three
different targets in two cell types with phosphodiester and
phosphorothioate oligonucleotide chemistries.
[0243] In addition, several approaches for designing and predicting
efficiency of specific oligonucleotides using an in vitro system
were also published (Matveeva et al., Nature Biotechnology 16:
1374-1375 (1998)].
[0244] Another agent capable of down-regulating RTVP-1 is a
ribozyme molecule capable of specifically cleaving an mRNA
transcript encoding RTVP-1. Ribozymes are being increasingly used
for the sequence-specific inhibition of gene expression by the
cleavage of mRNAs encoding proteins of interest [Welch et al., Curr
Opin Biotechnol. 9:486-96 (1998)]. The possibility of designing
ribozymes to cleave any specific target RNA has rendered them
valuable tools in both basic research and therapeutic
applications.
[0245] An additional method of regulating the expression of a
RTVP-1 gene in cells is via triplex forming oligonuclotides (TFOs).
Recent studies have shown that TFOs can be designed which can
recognize and bind to polypurine/polypirimidine regions in
double-stranded helical DNA in a sequence-specific manner. These
recognition rules are outlined by Maher III, L. J., et al.,
Science, 1989; 245:725-730; Moser, H. E., et al., Science, 1987;
238:645-630; Beal, P. A., et al, Science, 1992; 251:1360-1363;
Cooney, M., et al., Science, 1988; 241:456-459; and Hogan, M. E.,
et al., EP Publication 375408.
[0246] Modification of the oligonuclotides, such as the
introduction of intercalators and backbone substitutions, and
optimization of binding conditions (pH and cation concentration)
have aided in overcoming inherent obstacles to TFO activity such as
charge repulsion and instability, and it was recently shown that
synthetic oligonucleotides can be targeted to specific sequences
(for a recent review see Seidman and Glazer, J Clin Invest 2003;
112:487-94).
[0247] In general, the triplex-forming oligonucleotide has the
sequence correspondence:
TABLE-US-00001 oligo 3'--A G G T duplex 5'--A G C T duplex 3'--T C
G A
[0248] However, it has been shown that the A-AT and G-GC triplets
have the greatest triple helical stability (Reither and Jeltsch,
BMC Biochem, 2002, Septl2, Epub). The same authors have
demonstrated that TFOs designed according to the A-AT and G-GC rule
do not form non-specific triplexes, indicating that the triplex
formation is indeed sequence specific.
[0249] Triplex-forming oligonucleotides preferably are at least 15,
more preferably 25, still more preferably 30 or more nucleotides in
length, up to 50 or 100 bp.
[0250] Transfection of cells (for example, via cationic liposomes)
with TFOs, and formation of the triple helical structure with the
target DNA induces steric and functional changes, blocking
transcription initiation and elongation, allowing the introduction
of desired sequence changes in the endogenous DNA and resulting in
the specific down-regulation of gene expression. Examples of such
suppression of gene expression in cells treated with TFOs include
knockout of episomal supFG 1 and endogenous HPRT genes in mammalian
cells (Vasquez et al., Nucl Acids Res. 1999; 27:1176-81, and Puri,
et al, J Biol Chem, 2001; 276:28991-98), and the sequence- and
target specific down-regulation of expression of the Ets2
transcription factor, important in prostate cancer etiology
(Carbone, et al, Nucl Acid Res. 2003; 31:833-43) and the
pro-inflammatory ICAM-1 gene (Besch et al, J Biol Chem, 2002;
277:32473-79). In addition, Vuyisich and Beal have recently shown
that sequence specific TFOs can bind to dsRNA, inhibiting activity
of dsRNA-dependent enzymes such as RNA-dependent kinases (Vuyisich
and Beal, Nuc. Acids Res 2000; 28:2369-74).
[0251] Additionally, TFOs designed according to the abovementioned
principles can induce directed mutagenesis capable of effecting DNA
repair, thus providing both down-regulation and up-regulation of
expression of endogenous genes (Seidman and Glazer, J Clin Invest
2003; 112:487-94). Detailed description of the design, synthesis
and administration of effective TFOs can be found in U.S. Patent
Application Nos. 2003 017068 and 2003 0096980 to Froehler et al,
and 2002 0128218 and 2002 0123476 to Emanuele et al, and U.S. Pat.
No. 5,721,138 to Lawn.
[0252] The invention also contemplates silencing RTVP-1 by genetic
modification of the RTVP-1 locus. This modification can include
complete deletion of part or all of the coding region such that no
functional protein is produced. Modification can also include
mutation or deletion of the part or all of the promotor, such that
the coding region is not transcribed. In some embodiments,
silencing of RTVP-1 comprises introduction of CRISPR/Cas9 reagents
to genetically delete and/or modify the RTVP-1 genomic locus.
[0253] The conditions used for contacting the mesenchymal stem
cells are selected for a time period/concentration of
cells/concentration of RTVP-1 down-regulatory agent/ratio between
cells and RTVP-1 down-regulatory agent which enable the RTVP-1
down-regulatory agent to induce differentiation thereof.
[0254] Isolated cell populations obtained according to the methods
describe herein are typically non-homogeneous, although homogeneous
cell populations are also contemplated.
[0255] According to a particular embodiment, the cell populations
are genetically modified to express an exogenous miRNA or a
polynucleotide agent capable of down-regulating the miRNA.
[0256] The term "isolated" as used herein refers to a population of
cells that has been removed from its in-vivo location (e.g. bone
marrow, neural tissue). Preferably the isolated cell population is
substantially free from other substances (e.g., other cells) that
are present in its in-vivo location.
[0257] Cell populations may be selected such that more than about
50% (alternatively more than about 60%, more than about 70%, more
than about 80%, more than about 90% or even more than about 95%) of
the cells express at least one, at least two, at least three, at
least four, at least five of the markers for motor neurons or at
least one, at least two, at least three, at least four, at least
five of the markers for neural stem cells.
[0258] Isolation of particular subpopulations of cells may be
affected using techniques known in the art including fluorescent
activated cell sorting and/or magnetic separation of cells.
[0259] The cells of the populations of this aspect of the present
invention may comprise structural motor neuron or neural stem cell
phenotypes including a cell size, a cell shape, an organelle size
and an organelle number. These structural phenotypes may be
analyzed using microscopic techniques (e.g. scanning electro
microscopy). Antibodies or dyes may be used to highlight
distinguishing features in order to aid in the analysis.
[0260] The cells and cell populations of the present invention may
be useful for a variety of therapeutic purposes. Representative
examples of CNS diseases or disorders that can be beneficially
treated with the cells described herein include, but are not
limited to, a pain disorder, a motion disorder, a dissociative
disorder, a mood disorder, an affective disorder, a
neurodegenerative disease or disorder, psychiatric disorders and a
convulsive disorder.
[0261] More specific examples of such conditions include, but are
not limited to, Parkinson's, ALS, Multiple Sclerosis, Huntingdon's
disease, autoimmune encephalomyelitis, spinal cord injury, cerebral
palsy, diabetic neuropathy, glaucatomus neuropathy, macular
degeneration, action tremors and tardive dyskinesia, panic,
anxiety, depression, alcoholism, insomnia, manic behavior,
schizophrenia, autism-spectrum disorder, manic-depressive
disorders, Alzheimer's and epilepsy.
[0262] The use of differentiated MSCs may be also indicated for
treatment of traumatic lesions of the nervous system including
spinal cord injury and also for treatment of stroke caused by
bleeding or thrombosis or embolism because of the need to induce
neurogenesis and provide survival factors to minimize insult to
damaged neurons.
[0263] The motor neuron like cells of the present invention may be
useful for motor neuron diseases including, but not limited to
amyotrophic lateral sclerosis (ALS), primary lateral sclerosis
(PLS), pseudobulbar palsy and progressive bulbar palsy.
[0264] In any of the methods described herein the cells may be
obtained from an autologous, semi-allogeneic or non-autologous
(i.e., allogeneic or xenogeneic) human donor or embryo or
cord/placenta. For example, cells may be isolated from a human
cadaver or a donor subject.
[0265] The term semi-allogeneic refers to donor cells which are
partially-mismatched to recipient cells at a major
histocompatibility complex (MHC) class I or class II locus.
[0266] The cells of the present invention can be administered to
the treated individual using a variety of transplantation
approaches, the nature of which depends on the site of
implantation.
[0267] The term or phrase "transplantation", "cell replacement" or
"grafting" are used interchangeably herein and refer to the
introduction of the cells of the present invention to target
tissue. As mentioned, the cells can be derived from the recipient
or from an allogeneic, semi-allogeneic or xenogeneic donor.
[0268] The cells can be injected systemically into the circulation,
administered intrathecally or grafted into the central nervous
system, the spinal cord or into the ventricular cavities or
subdurally onto the surface of a host brain. Conditions for
successful transplantation include: (i) viability of the implant;
(ii) retention of the graft at the site of transplantation; and
(iii) minimum amount of pathological reaction at the site of
transplantation. Methods for transplanting various nerve tissues,
for example embryonic brain tissue, into host brains have been
described in: "Neural grafting in the mammalian CNS", Bjorklund and
Stenevi, eds. (1985); Freed et al., 2001; Olanow et al., 2003).
These procedures include intraparenchymal transplantation, i.e.
within the host brain (as compared to outside the brain or
extraparenchymal transplantation) achieved by injection or
deposition of tissue within the brain parenchyma at the time of
transplantation.
[0269] Intraparenchymal transplantation can be performed using two
approaches: (i) injection of cells into the host brain parenchyma
or (ii) preparing a cavity by surgical means to expose the host
brain parenchyma and then depositing the graft into the cavity.
[0270] Both methods provide parenchymal deposition between the
graft and host brain tissue at the time of grafting, and both
facilitate anatomical integration between the graft and host brain
tissue. This is of importance if it is required that the graft
becomes an integral part of the host brain and survives for the
life of the host.
[0271] Alternatively, the graft may be placed in a ventricle, e.g.
a cerebral ventricle or subdurally, i.e. on the surface of the host
brain where it is separated from the host brain parenchyma by the
intervening pia mater or arachnoid and pia mater. Grafting to the
ventricle may be accomplished by injection of the donor cells or by
growing the cells in a substrate such as 3% collagen to form a plug
of solid tissue which may then be implanted into the ventricle to
prevent dislocation of the graft. For subdural grafting, the cells
may be injected around the surface of the brain after making a slit
in the dura. Injections into selected regions of the host brain may
be made by drilling a hole and piercing the dura to permit the
needle of a microsyringe to be inserted. The microsyringe is
preferably mounted in a stereotaxic frame and three dimensional
stereotaxic coordinates are selected for placing the needle into
the desired location of the brain or spinal cord. The cells may
also be introduced into the putamen, nucleus basalis, hippocampus
cortex, striatum, substantia nigra or caudate regions of the brain,
as well as the spinal cord.
[0272] The cells may also be transplanted to a healthy region of
the tissue. In some cases the exact location of the damaged tissue
area may be unknown and the cells may be inadvertently transplanted
to a healthy region. In other cases, it may be preferable to
administer the cells to a healthy region, thereby avoiding any
further damage to that region. Whatever the case, following
transplantation, the cells preferably migrate to the damaged
area.
[0273] For transplanting, the cell suspension is drawn up into the
syringe and administered to anesthetized transplantation
recipients. Multiple injections may be made using this
procedure.
[0274] The cellular suspension procedure thus permits grafting of
the cells to any predetermined site in the brain or spinal cord, is
relatively non-traumatic, allows multiple grafting simultaneously
in several different sites or the same site using the same cell
suspension, and permits mixtures of cells from different anatomical
regions.
[0275] Multiple grafts may consist of a mixture of cell types,
and/or a mixture of transgenes inserted into the cells. Preferably
from approximately 104 to approximately 109 cells are introduced
per graft. Cells can be administered concomitantly to different
locations such as combined administration intrathecally and
intravenously to maximize the chance of targeting into affected
areas.
[0276] For transplantation into cavities, which may be preferred
for spinal cord grafting, tissue is removed from regions close to
the external surface of the central nerve system (CNS) to form a
transplantation cavity, for example as described by Stenevi et al.
(Brain Res. 114:1-20, 1976), by removing bone overlying the brain
and stopping bleeding with a material such a gelfoam. Suction may
be used to create the cavity. The graft is then placed in the
cavity. More than one transplant may be placed in the same cavity
using injection of cells or solid tissue implants. Preferably, the
site of implantation is dictated by the CNS disorder being treated.
Demyelinated MS lesions are distributed across multiple locations
throughout the CNS, such that effective treatment of MS may rely
more on the migratory ability of the cells to the appropriate
target sites.
[0277] Intranasal administration of the cells is also
contemplated.
[0278] MSCs typically down regulate MEW class 2 and are therefore
less immunogenic. Embryonal or newborn cells obtained from the cord
blood, cord's Warton's gelly or placenta are further less likely to
be strongly immunogenic and therefore less likely to be rejected,
especially since such cells are immunosuppressive and
immunoregulatory to start with.
[0279] Notwithstanding, since non-autologous cells may induce an
immune reaction when administered to the body several approaches
have been developed to reduce the likelihood of rejection of
non-autologous cells. Furthermore, since diseases such as multiple
sclerosis are inflammatory based diseases, the problem of immune
reaction is exacerbated. These include either administration of
cells to privileged sites, or alternatively, suppressing the
recipient's immune system, providing anti-inflammatory treatment
which may be indicated to control autoimmune disorders to start
with and/or encapsulating the non-autologous/semi-autologous cells
in immunoisolating, semipermeable membranes before
transplantation.
[0280] As mentioned herein above, the present inventors also
propose use of cord and placenta-derived MSCs that express very low
levels of MHCII molecules and therefore limit immune response.
[0281] The following experiments may be performed to confirm the
potential use of newborn's MSCs isolated from the cord I placenta
for treatment of neurological disorders:
[0282] 1) Differentiated MSCs (to various neural cells or neural
progenitor cells) may serve as stimulators in one-way mixed
lymphocyte culture with allogeneic T-cells and proliferative
responses in comparison with T cells responding against allogeneic
lymphocytes isolated from the same donor may be evaluated by 3H
Thymidine uptake to document hyporesponsiveness.
[0283] 2) Differentiated MSCs may be added/co-cultured to one-way
mixed lymphocyte cultures and to cell cultures with T cell mitogens
(phytohemmaglutinin and concanavalin A) to confirm the
immunosuppressive effects on proliferative responses mediated by T
cells.
[0284] 3) Cord and placenta cells cultured from Brown Norway rats
(unmodified and differentiated), may be enriched for MSCs and these
cells may be infused into Lewis rats with induced experimental
autoimmune encephalomyelitis (EAE). Alternatively, cord and
placenta cells cultured from BALB/c mice, (BALB/cxC57BL/6)F1 or
xenogeneic cells from Brown Norway rats (unmodified and
differentiated), may be enriched for MSCs and these cells may be
infused into C57BL/6 or SJL/j recipients with induced experimental
autoimmune encephalomyelitis (EAE). The clinical effects against
paralysis may be investigated to evaluate the therapeutic effects
of xenogeneic, fully MHC mismatched or haploidentically mismatched
MSCs. Such experiments may provide the basis for treatment of
patients with a genetic disorder or genetically proned disorder
with family member's haploidentical MSCs.
[0285] 4) BALB/c MSCs cultured from cord and placenta may be
transfused with pre-miR labeled with GFP or RFP, which will allow
the inventors to follow the migration and persistence of these
cells in the brain of C57BL/6 recipients with induced EAE. The
clinical effects of labeled MHC mismatched differentiated MSCs may
be evaluated by monitoring signs of disease, paralysis and
histopathology. The migration and localization of such cells may be
also monitored by using fluorescent cells from genetically
transduced GFP "green" or Red2 "red" donors.
[0286] As mentioned, the present invention also contemplates
encapsulation techniques to minimize an immune response.
[0287] Encapsulation techniques are generally classified as
microencapsulation, involving small spherical vehicles and
macroencapsulation, involving larger flat-sheet and hollow-fiber
membranes (Uludag, H. et al. Technology of mammalian cell
encapsulation. Adv Drug Deliv Rev. 2000; 42: 29-64).
[0288] Methods of preparing microcapsules are known in the arts and
include for example those disclosed by Lu M Z, et al., Cell
encapsulation with alginate and alpha
phenoxycinnamylidene-acetylated poly(allylamine). Biotechnol
Bioeng. 2000, 70: 479-83, Chang T M and Prakash S. Procedures for
microencapsulation of enzymes, cells and genetically engineered
microorganisms. Mol. Biotechnol. 2001, 17: 249-60, and Lu M Z, et
al., A novel cell encapsulation method using photosensitive
poly(allylamine alpha-cyanocinnamylideneacetate). J. Microencapsul.
2000, 17: 245-51.
[0289] For example, microcapsules are prepared by complexing
modified collagen with a per-polymer shell of 2-hydroxyethyl
methylacrylate (HEMA), methacrylic acid (MAA) and methyl
methacrylate (MMA), resulting in a capsule thickness of 2-5 um.
Such microcapsules can be further encapsulated with additional 2-5
um per-polymer shells in order to impart a negatively charged
smooth surface and to minimize plasma protein absorption (Chia, S.
M. et al. Multi-layered microcapsules for cell encapsulation
Biomaterials. 2002 23: 849-56).
[0290] Other microcapsules are based on alginate, a marine
polysaccharide (Sambanis, A. Encapsulated islets in diabetes
treatment. Diabetes Technol. Ther. 2003, 5: 665-8) or its
derivatives. For example, microcapsules can be prepared by the
polyelectrolyte complexation between the polyanions sodium alginate
and sodium cellulose sulphate with the polycation
poly(methylene-co-guanidine) hydrochloride in the presence of
calcium chloride.
[0291] It will be appreciated that cell encapsulation is improved
when smaller capsules are used. Thus, the quality control,
mechanical stability, diffusion properties, and in vitro activities
of encapsulated cells improved when the capsule size was reduced
from 1 mm to 400 um (Canaple L. et al., Improving cell
encapsulation through size control. J Biomater Sci Polym Ed. 2002;
13:783-96). Moreover, nanoporous biocapsules with well-controlled
pore size as small as 7 nm, tailored surface chemistries and
precise microarchitectures were found to successfully immunoisolate
microenvironments for cells (Williams D. Small is beautiful:
microparticle and nanoparticle technology in medical devices. Med
Device Technol. 1999, 10: 6-9; Desai, T. A. Microfabrication
technology for pancreatic cell encapsulation. Expert Opin Biol
Ther. 2002, 2: 633-46).
[0292] Examples of immunosuppressive agents include, but are not
limited to, methotrexate, cyclophosphamide, cyclosporine,
cyclosporin A, chloroquine, hydroxychloroquine, sulfasalazine
(sulphasalazopyrine), gold salts, D-penicillamine, leflunomide,
azathioprine, anakinra, infliximab (REMICADE.TM.), etanercept, TNF
alpha blockers, a biological agent that targets an inflammatory
cytokine, and Non-Steroidal Anti-Inflammatory Drug (NSAIDs).
Examples of NSAIDs include, but are not limited to acetyl salicylic
acid, choline magnesium salicylate, diflunisal, magnesium,
salicylate, salsalate, sodium salicylate, diclofenac, etodolac,
fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketorolac,
meclofenamate, naproxen, nabumetone, phenylbutazone, piroxicam,
sulindac, tolmetin, acetaminophen, ibuprofen, Cox-2 inhibitors and
tramadol.
[0293] In any of the methods described herein, the cells can be
administered either per se or, preferably as a part of a
pharmaceutical composition that further comprises a
pharmaceutically acceptable carrier.
[0294] As used herein a "pharmaceutical composition" refers to a
preparation of one or more of the cell compositions described
herein, with other chemical components such as pharmaceutically
suitable carders and excipients. The purpose of a pharmaceutical
composition is to facilitate administration of the cells to a
subject.
[0295] Hereinafter, the term "pharmaceutically acceptable earlier"
refers to a carrier or a diluent that does not cause significant
irritation to a subject and does not abrogate the biological
activity and properties of the administered compound. Examples,
without limitations, of carriers are propylene glycol, saline,
emulsions and mixtures of organic solvents with water.
[0296] Herein the term "excipient" refers to an inert substance
added to a pharmaceutical composition to further facilitate
administration of a compound. Examples, without limitation, of
excipients include calcium carbonate, calcium phosphate, various
sugars and types of starch, cellulose derivatives, gelatin,
vegetable oils and polyethylene glycols.
[0297] Techniques for formulation and administration of drugs may
be found in "Remington's Pharmaceutical Sciences," Mack Publishing
Co., Easton, Pa., latest edition, which is incorporated herein by
reference.
[0298] Suitable routes of administration include direct
administration into the circulation (intravenously or
intra-arterial), into the spinal fluid or into the tissue or organ
of interest. Thus, for example the cells may be administered
directly into the brain.
[0299] For any preparation used in the methods of the invention,
the therapeutically effective amount or dose can be estimated
initially from in vitro and cell culture assays. Preferably, a dose
is formulated in an animal model to achieve a desired concentration
or titer. Such information can be used to more accurately determine
useful doses in humans.
[0300] Toxicity and therapeutic efficacy of the active ingredients
described herein can be determined by standard pharmaceutical
procedures in vitro, in cell cultures or experimental animals. For
example, animal models of demyelinating diseases include shiverer
(shi/shi, MBP deleted) mouse, MD rats (PLP deficiency), Jimpy mouse
(PLP mutation), dog shaking pup (PLP mutation), twitcher mouse
(galactosylceramidase defect, as in human Krabbe disease), trembler
mouse (PMP-22 deficiency). Virus induced demyelination model
comprise use if Theiler's virus and mouse hepatitis virus.
Autoimmune EAE is a possible model for multiple sclerosis.
[0301] The data obtained from these in vitro and cell culture
assays and animal studies can be used in formulating a range of
dosage for use in human. The dosage may vary depending upon the
dosage form employed and the route of administration utilized. The
exact formulation, route of administration and dosage can be chosen
by the individual physician in view of the patient's condition,
(see e.g., Fingl, et al., 1975, in "The Pharmacological Basis of
Therapeutics", Ch. 1 p. 1). For example, a multiple sclerosis
patient can be monitored symptomatically for improved motor
functions indicating positive response to treatment.
[0302] For injection, the active ingredients of the pharmaceutical
composition may be formulated in aqueous solutions, preferably in
physiologically compatible buffers such as Hank's solution,
Ringer's solution, or physiological salt buffer.
[0303] Dosage amount and interval may be adjusted individually to
levels of the active ingredient which are sufficient to effectively
treat the brain disease/disorder. Dosages necessary to achieve the
desired effect will depend on individual characteristics and route
of administration. Detection assays can be used to determine plasma
concentrations.
[0304] Depending on the severity and responsiveness of the
condition to be treated, dosing can be of a single or a plurality
of administrations, with course of treatment lasting from several
days to several weeks or diminution of the disease state is
achieved.
[0305] The amount of a composition to be administered will, of
course, be dependent on the individual being treated, the severity
of the affliction, the manner of administration, the judgment of
the prescribing physician, etc. The dosage and timing of
administration will be responsive to a careful and continuous
monitoring of the individual changing condition. For example, a
treated multiple sclerosis patient will be administered with an
amount of cells which is sufficient to alleviate the symptoms of
the disease, based on the monitoring indications.
[0306] The cells of the present invention may be co-administered
with therapeutic agents useful in treating neurodegenerative
disorders, such as gangliosides; antibiotics, neurotransmitters,
neurohormones, toxins, neurite promoting molecules; and
antimetabolites and precursors of neurotransmitter molecules such
as L-DOPA.
[0307] As used herein the term "about" refers to +1-10%.
[0308] As used herein the term "method" refers to manners, means,
techniques and procedures for accomplishing a given task including,
but not limited to, those manners, means, techniques and procedures
either known to, or readily developed from known manners, means,
techniques and procedures by practitioners of the chemical,
pharmacological, biological, biochemical and medical arts.
[0309] As used herein, the term "treating" includes abrogating,
substantially inhibiting, slowing or reversing the progression of a
condition, substantially ameliorating clinical or aesthetical
symptoms of a condition or substantially preventing the appearance
of clinical or aesthetical symptoms of a condition.
[0310] Various embodiments and aspects of the present invention as
delineated hereinabove and as claimed in the claims section below
find experimental support in the following examples.
[0311] The terms "comprises", "comprising", "includes",
"including", "having" and their conjugates mean "including but not
limited to".
[0312] The term "consisting of" means "including and limited
to".
[0313] The term "consisting essentially of" means that the
composition, method or structure may include additional
ingredients, steps and/or parts, but only if the additional
ingredients, steps and/or parts do not materially alter the basic
and novel characteristics of the claimed composition, method or
structure.
[0314] As used herein, the singular form "a", "an" and "the"
include plural references unless the context clearly dictates
otherwise. For example, the term "a compound" or "at least one
compound" may include a plurality of compounds, including mixtures
thereof.
[0315] Throughout this application, various embodiments of this
invention may be presented in a range format. It should be
understood that the description in range format is merely for
convenience and brevity and should not be construed as an
inflexible limitation on the scope of the invention. Accordingly,
the description of a range should be considered to have
specifically disclosed all the possible subranges as well as
individual numerical values within that range. For example,
description of a range such as from 1 to 6 should be considered to
have specifically disclosed subranges such as from 1 to 3, from 1
to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as
well as individual numbers within that range, for example, 1, 2, 3,
4, 5, and 6. This applies regardless of the breadth of the
range.
[0316] Whenever a numerical range is indicated herein, it is meant
to include any cited numeral (fractional or integral) within the
indicated range. The phrases "ranging/ranges between" a first
indicate number and a second indicate number and "ranging/ranges
from" a first indicate number "to" a second indicate number are
used herein interchangeably and are meant to include the first and
second indicated numbers and all the fractional and integral
numerals there between.
[0317] It is noted that for each miR described herein the
corresponding sequence (mature and pre) is provided in the sequence
listing which should be regarded as part of the specification.
[0318] It is appreciated that certain features of the invention,
which are, for clarity, described in the context of separate
embodiments, may also be provided in combination in a single
embodiment. Conversely, various features of the invention, which
are, for brevity, described in the context of a single embodiment,
may also be provided separately or in any suitable subcombination
or as suitable in any other described embodiment of the invention.
Certain features described in the context of various embodiments
are not to be considered essential features of those embodiments,
unless the embodiment is inoperative without those elements.
[0319] Various embodiments and aspects of the present invention as
delineated hereinabove and as claimed in the claims section below
find experimental support in the following examples.
EXAMPLES
[0320] Reference is now made to the following examples, which
together with the above descriptions illustrate some embodiments of
the invention in a non-limiting fashion.
[0321] Generally, the nomenclature used herein and the laboratory
procedures utilized in the present invention include molecular,
biochemical, microbiological and recombinant DNA techniques. Such
techniques are thoroughly explained in the literature. See, for
example, "Molecular Cloning: A laboratory Manual" Sambrook et al.,
(1989); "Current Protocols in Molecular Biology" Volumes I-III
Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in
Molecular Biology", John Wiley and Sons, Baltimore, Md. (1989);
Perbal, "A Practical Guide to Molecular Cloning", John Wiley &
Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific
American Books, New York; Birren et al. (eds) "Genome Analysis: A
Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory
Press, New York (1998); methodologies as set forth in U.S. Pat.
Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057;
"Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E.,
ed. (1994); "Culture of Animal Cclls-e-A Manual of Basic Technique"
by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current
Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994);
Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition),
Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi
(eds), "Selected Methods in Cellular Immunology", W. H. Freeman and
Co., New York (1980); available immunoassays are extensively
described in the patent and scientific literature, see, for
example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578;
3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533;
3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and
5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984);
"Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds.
(1985); "Transcription and Translation" Hames, B. D., and Higgins
S. J., eds. (1984); "Animal Cell Culture" Freshney, R. I., ed.
(1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A
Practical Guide to Molecular Cloning" Perbal, B., (1984) and
"Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols:
A Guide To Methods And Applications", Academic Press, San Diego,
Calif. (1990); Marshak et al., "Strategies for Protein Purification
and Characterization=--A Laboratory Course Manual" CSHL Press
(1996); all of which are incorporated by reference as if fully set
forth herein. Other general references are provided throughout this
document. The procedures therein are believed to be well known in
the art and are provided for the convenience of the reader. All the
information contained therein is incorporated herein by
reference.
Example 1
Differentiation of Mesenchymal Stem Cells (MSCs) to Neural Stem
Cells (NSCs)
Methods
[0322] Mesenchymal stem cells (MSCs) from either bone marrow,
adipose, placenta or umbilical cord were plated in high density in
bacterial dishes in serum free medium supplemented with 10 mg/ml
EGF and bFGF for 10 days. The cells started to aggregate and after
4-5 days were disaggregated mechanically to promote their
detachment from the plates. The cells were then maintained for two
weeks after which they were analyzed for the expression of NSC
markers and for their ability to generate neurons, astrocytes and
oligodendrocytes when plated on laminin in low-serum (5%)
medium.
[0323] The cells were then subjected to miRNA microarray as
described.
Results
[0324] As illustrated in FIGS. 1A-B, the mesenchymal stem cells
expressed neuronal markers following neural stem cell
differentiation.
Example 2
Changes in miRNA Expression During NSC Differentiation
Materials and Methods
[0325] miRNAs have been shown to play a role in the differentiation
of various neural cells and neural stem cells. To analyze the
expression and function of specific miRNAs in MSC-derived NSCs, the
MSCs were differentiated towards NSCs as described in Example 1 and
miRNA array analysis was performed to the control and
differentiated cells. A qRT-PCR microarray was run that contained
96 miRNAs, all of which were related to stem cells and that were
divided into subgroups based on their known association with stem
cells, neural-related, hematopoietic and organ-related miRNAs.
[0326] For analyzing the differential expression of specific miRNA
in control and differentiated MSCs, the Stem cell microRNA qPCR
array was employed with quantiMiR from SBI company (catalog
#RA620A-1), according to the user protocol, the contents of which
are incorporated herein by reference. For the qPCR, the Applied
Biosystems Power SYBR master mix (cat #4367659) was used.
[0327] The system allows for the ability to quantitate fold
differences of 95 separate microRNAs between 2 separate
experimental RNA samples. The array plate also includes the U6
transcript as a normalization signal. All 95 microRNAs chosen for
the array have published implications with regard to potential
roles in stem cell self-renewal, hematopoiesis, neuronal
development and differentiated tissue identification.
[0328] The array plate also includes the U6 RNA as a normalization
signal.
[0329] Total RNA was isolated from 105-106 cells of control and
differentiated MSCs using miRneasy total RNA isolation kit from
Qiagen (catalog #217004) that isolate RNA fraction with sizes
<200 bp. 500 ng of total RNA was processed according to "SBI
Stem Cell MicroRNA qPCR Array with QuantiMir.TM." (Cat. #RA620A-1)
user protocol. For the qPCR, the Applied Biosystems Power SYBR
master mix (cat #4367659) was used.
[0330] For validation, sybr-green qPCR of the specific miRNA of
interest was performed on the same RNA samples processed according
to QIAGEN miScript System handbook (cat #218061 & 218073) Hu
hsa-miR MicroRNA Profiling Kit (System Biosciences) "SBI Stem Cell
MicroRNA qPCR Array with QuantiMir.TM." (Cat. #RA620A-1) which
detects the expression of 96 miRNAs, was used to profile the miRNAs
in unmodified BM-MSC compared with MSCs differentiated to
astrocytes. 500 ng of total RNA was tagged with poly(A) to its 3'
end by poly A polymerase, and reverse-transcribed with oligo-dT
adaptors by QuantiMir RT technology. Expression levels of the
miRNAs were measured by quantitative PCR using SYBR green reagent
and VIIA7, Real-Time PCR System (Applied Biosystems). All miRNAs
could be measured with miRNA specific forward primers and a
universal reverse primer (SBI). Expression level of the miRNAs was
normalized to U6 snRNA, using the comparative CT method for
relative quantification as calculated with the following equation:
2-[(CT astrocyte diff miRNA-CT astrocyte endogenous
control)-(CTDMEM miRNA-CT DMEM endogenous control).
[0331] In addition, an Affymetrix miRNA 3.0 array was used to
compare BM-MSCs and human NSCs and identify differentially
expressed miRNAs.
Results
[0332] As presented in FIGS. 2, 3 and 4A, there were significant
changes in the expression of specific miRNA of each group between
the control MSCs and the differentiated ones.
[0333] The results of the Affymetrix miRNA 3.0 array analysis are
detailed in Table 1 herein below.
[0334] Using a nestin promoter based reporter assay, the present
inventors confirmed that overexpression of miR-20b, miR-935,
miR-891 and miR-378 also induced differentiation of the MSCs into
NSCs (FIG. 4B).
[0335] Similarly, silencing of miR-138, miR-214, miR-199a and
miR-199b decreased the mesenchymal phenotypes of all the MSCs and
induced their NSC differentiation (FIG. 4C).
[0336] Co-transfection of the MSCs with combination of miR-20b or
miR-378 with antagomiR-138 further increased the differentiation of
the MSCs to nestin positive cells (FIG. 4D).
[0337] As presented in FIGS. 4E-F, overexpression of antagomiR-138
and miR-891 mimic induced a significant increase in the generation
of nestin positive cells in the transfected MSCs as demonstrated by
the increased fluorescence intensity of cells transduced with the
nestin-GFP reporter.
TABLE-US-00002 TABLE 1 MSCs/NSCs Up regulated MSCs/NSCs Down
regulated miRNA Fold change miRNA Fold change miRNA Fold change
hsa-miR- 1379.78 hsa-let- -1.53698 hsa-miR- -7.34456 145_st 7c_st
324-3p_st hsa-miR- 752.7381 hsa-miR- -1.58884 hsa-miR- -7.83858
143_st 665_st 20a_st hsa-miR- 552.6854 hsa-miR- -1.61841 hsa-miR-
-8.36351 214_st 4258_st 501-5p_st hsa-miR- 511.1263 hsa-miR-
-1.63684 hsa-miR- -8.71869 199a-3p_st 361-3p_st 330-3p_st hsa-miR-
362.5667 hsa-miR- -1.76218 hsa-miR- -9.13392 199a-5p_st
374a-star_st 874_st hsa-miR- 347.4311 hsa-miR- -1.85672 hsa-miR-
-9.68441 199b-3p_st 892b_st 500_st hsa-miR- 229.2463 hsa-miR-
-1.90874 hsa-miR- -9.86881 138_st 361-5p_st 25_st hsa-miR- 190.5331
hsa-miR- -1.93941 hsa-miR- -10.1382 31_st 181a_st 769-5p_st
hsa-miR- 59.83459 hsa-miR- -2.19583 hsa-miR- -10.3325 21_st 16_st
125b-2-star_st hsa-miR- 23.8986 hsa-miR- -2.27398 hsa-miR- -16.7436
193a-5p_st 636_st 130b_st hsa-miR- 21.60842 hsa-miR- -2.79417
hsa-miR- -16.9435 224-star_st 4284_st 504_st hsa-miR- 21.38142
hsa-miR- -3.00768 hsa-miR- -17.7877 196a_st 1208_st 181a-2-star_st
hsa-miR- 19.18475 hsa-miR- -3.01855 hsa-miR- -20.1501 487b_st
1274b_st 885-3p_st hsa-miR- 17.45522 hsa-miR- -3.46182 hsa-miR-
-21.0971 409-5p_st 30c-2-star_st 1246_st hsa-miR- 10.34438 hsa-miR-
-3.49025 hsa-miR- -22.8735 193b-star_st 501-3p_st 92b_st hsa-miR-
9.571106 hsa-miR- -3.7152 hsa-miR- -23.3686 379_st 92a_st 362-5p_st
hsa-miR- 8.401508 hsa-miR- -3.72739 hsa-miR- -23.3743 21-star_st
378b_st 572_st hsa-miR- 7.080883 hsa-miR- -3.87466 hsa-miR-
-24.4173 27a-star_st 1287_st 4270_st hsa-miR- 6.122331 hsa-miR-
-4.0524 hsa-miR- -26.6758 27a_st 425-star_st 378c_st hsa-miR-
5.715753 hsa-miR- -4.37339 hsa-miR- -28.4948 4317_st 324-5p_st
93-star_st hsa-miR- 4.920511 hsa-miR- -4.40631 hsa-miR- -28.7369
193b_st 3178_st 149_st hsa-miR- 4.889609 hsa-miR- -4.52146 hsa-miR-
-28.9968 27b_st 219-1-3p_st 363_st hsa-miR- 4.798265 hsa-miR-
-4.609 hsa-miR- -31.2283 22_st 197_st 9_st hsa-miR- 3.402782
hsa-miR- -4.61406 hsa-miR- -32.3908 574-3p_st 181b_st 18a_st
hsa-miR- 3.375774 hsa-miR- -4.72807 hsa-miR- -33.1912 4288_st
500-star_st 891a_st hsa-miR- 3.34163 hsa-miR- -4.96582 hsa-miR-
-38.7283 23a_st 106b_st 346_st hsa-miR- 3.09015 hsa-miR- -4.97984
hsa-miR- -50.7583 221-star_st 502-3p_st 124_st hsa-miR- 3.030064
hsa-miR- -5.17107 hsa-miR- -72.2314 2113_st 30c_st 497_st hsa-let-
2.551577 hsa-miR- -5.29365 hsa-miR- -73.6306 7i_st 1275_st 378_st
hsa-miR- 2.300083 hsa-miR- -5.54416 hsa-miR- -82.7066 24_st 422a_st
1231_st hsa-miR- 2.217338 hsa-miR- -5.6233 hsa-miR- -92.6078 23b_st
93_st 139-5p_st hsa-miR- 2.201907 hsa-miR- -5.74741 hsa-miR-
-94.3695 299-3p_st 181d_st 3180-3p_st hsa-miR- 2.197822 hsa-miR-
-5.82664 hsa-miR- -114.107 518c-star_st 1307_st 9-star_st hsa-miR-
2.186328 hsa-miR- -5.84397 hsa-miR- -140.688 221_st 1301_st 935_st
hsa-miR- 2.177192 hsa-miR- -5.88481 hsa-miR- -156.762 431-star_st
99a_st 20b_st hsa-miR- 2.116276 hsa-miR- -5.9383 523_st 505-star_st
hsa-miR- 1.937531 hsa-miR- -5.94177 4313_st 1202_st hsa-miR-
1.916531 hsa-miR- -6.05212 559_st 128_st hsa-miR- 1.894046 hsa-miR-
-6.11976 614_st 532-5p_st hsa-miR- 1.803374 hsa-miR- -6.5161 653_st
195_st hsa-miR- 1.675887 hsa-miR- -6.66014 2278_st 532-3p_st
v11_hsa- 1.647103 hsa-miR- -6.91155 miR-768- 106a_st 5p_st hsa-miR-
1.608659 hsa-miR- -6.91565 154-star_st 17_st hsa-miR- 1.598961
hsa-miR- -7.05548 302a-star_st 1271_st hsa-miR- 1.580479 hsa-miR-
-7.1367 3199_st 769-3p_st hsa-miR- 1.476948 hsa-miR- -7.31636
3137_st 15b_st
Example 3
miRNAs that Play a Role in the Differentiation of MSCs to NSCs
[0338] The present inventors further examined the role of the
specific miRNAs that were found to be altered in the miR microarray
on the differentiation of the MSCs to NSCs. These experiments were
performed by transfecting MSCs with either specific or combination
of mature miRNA mimics or miRNA inhibitors and then their ability
to generate neurospheres and express the markers nestin and Sox2
was examined.
Results
[0339] It was found that the inhibition of let-7 together with
expression of miR-124 increased NSC differentiation.
[0340] In addition, it was found that up-regulation of the
following miRNAs: miR302b, miR-371, miR-134, miR-219, miR-154,
miR-155, miR-32, miR-33, miR-126 and miR-127 and down-regulation of
the following miRs-miR-10b, miR-142-3p, miR-131a, miR-125b, miR-153
and miR-181a either alone or in various combinations induced
differentiation of the MSCs to NSCs albeit to different
degrees.
[0341] In addition to the miRNAs that were described in the miRNA
array, it was also found that transfection of the MSCs with miR-132
and miR-137 also increased the NSC differentiation.
Example 4
Additional Factors that Promote the Differentiation of MSCs to
NSCs
[0342] Related to testis-specific, vespid and pathogenesis protein
1 (RTVP-1) was cloned from human GBM cell lines by two groups and
was termed glioma pathogenesis-related protein-GLIPR1 or RTVP-1
[3]. RTVP-1 contains a putative signal peptide, a transmembrane
domain and a SCP domain, with a yet unknown function which is also
found in other RTVP-1 homologs including TPX-1 [4], the venom
allergen antigen 5 [5] and group 1 of the plant
pathogenesis-related proteins (PR-1). It has recently been reported
that RTVP-1 acts as a tumor promoter in gliomas. Thus, the
expression of RTVP-1 correlates with the degree of malignancy of
astrocytic tumors and over-expression of RTVP-1 increases cell
proliferation, invasion, migration and anchorage independent
growth. Moreover, silencing of RTVP-1 induces apoptosis in glioma
cell lines and primary glioma cultures [6]. Interestingly, RTVP-1
acts as a tumor suppressor in prostate cancer cells and adenovirus
mediated delivery of RTVP-1 has therapeutic effects in a mouse
prostate cancer model [7-9].
Results
[0343] Expression of RTVP-1 in MSCs is very high, as determined by
Western blot (FIG. 5A). Moreover, silencing of RTVP-1 in MSCs
abrogated their ability to differentiate to mesenchymal lineage
cells (FIGS. 5C-D).
[0344] Further, silencing of RTVP-1 in MSCs increased the
expression of both nestin and Sox 2 and some levels of beta 3
tubulin (data not shown). Interestingly, it was found that RTVP-1
is a novel target of miR-137, suggesting that the positive effect
of miR-137 on the NSC differentiation of MSCs may be mediated by
RTVP-1.
[0345] To further examine the role of RTVP-1, its expression was
examined in MSCs, NSCs and in MSCs that were differentiated into
NSCs. Human NSCs did not express RTVP-1 at all (data not shown) and
the expression of RTVP-1 in MSCs was significantly higher than that
of MSCs differentiated to NSCs irrespective of the source of MSCs
that were examined (FIG. 5E).
[0346] The effect of RTVP-1 overexpression in human NSCs was
examined. It was found that these cells acquired mesenchymal
phenotypes and especially were predisposed to differentiate into
adipocytes (data not shown).
[0347] Silencing of RTVP-1 in the different MSCs examined increased
the expression of nestin in these cells (FIG. 5F).
[0348] To further analyze the effect of RTVP-1 on mesenchymal
transformation, gene array analysis was performed on BM-MSCs in
which the expression of RTVP-1 was silenced. Silencing of RTVP-1
decreased the expression of ALDH1A3 by 3.2-fold, VAV3 by 15 fold,
CD200 by 5 fold and the sternness markers Oct4, Nanog and Sox2 by
2.3, 3.4 and 4.2, respectively. Collectively these results indicate
that RTVP-1 decreases the proliferation and sternness signature of
these cells.
[0349] In contrast, RTVP-1 silencing increased the expression of
certain genes such as nestin (3.4 fold), NKX2.2 (4.7 fold) and
calcium channel, voltage dependent (3 fold).
[0350] Together, these results implicate RTVP-1 as a major
mesenchymal regulator and demonstrate that silencing of RTVP-1
induces differentiation of MSCs to cells with neural
phenotypes.
Example 5
Differentiation of Neural Progenitor Cells to Motor Neurons
Materials and Methods
[0351] Plates were coated with 20 .mu.g/ml laminin overnight and
were then washed twice with PBS. The NPC were plated in the
confluency of 50% and after 24 hr were incubated with priming
medium: NM medium with heparin (use 10 .mu.g/mL) and bFGF (100
.mu.g/mL) for 5 days. After day 5 the medium was changed to the
differentiation medium: F12 with 1 mL of B27 in 50 mL F12 (or 2%),
retinoic acid (RA, 1 .mu.M), and SHH (200 ng/mL). The RA was added
every other day. After 5 days GDNF and BDNF were added to the
medium (10 ng/mL).
Results
[0352] In the developing spinal cord, there is sequential
generation of motor neurons (MNs) and oligodendrocytes (OLPs).
There are common progenitors called pMN that first generate MN and
then oligodendrocytes. The basic helix-loop-helix (bHLH)
transcription factor Olig2, is expressed in the pMN domain and it's
one of the important transcription factors that play a role in the
development of both cell types. Over-expression of Olig2 in MSCs
that were grow in NM medium supplemented with 200 ng/ml recombinant
SHH, 20 ng/ml of each, GDNF, BDNF, CNTF and NT-3 and 1 mM retinoic
acid induced the expression of two specific markers of motor
neurons Hb9 and Islet1 (FIGS. 6A-D).
Example 6
Involvement of miRNAs in the Differentiation of NPCs to Motor
Neurons
Materials and Methods
[0353] To identify specific miRNAs involved with motor neuron
differentiation, the present inventors differentiated two types of
neural stem/progenitor cells into motor neurons at different stages
of development using the protocol described in Example 5. The
characterization of the cells as motor neurons was characterized by
the expression of the specific markers, isletl, HB9 and the
neuronal markers neurofilament and tubulin.
[0354] To analyze the expression and function of specific miRNAs in
motor neurons the neural progenitor cell system described herein
above was used. miRNA array analysis was performed on the control
and differentiated cells. A qRT-PCR microarray that contained 96
miRNAs, all of which were related to stem cells and that were
divided into subgroups based on their known association with stem
cells, neural-related, hematopoietic and organ-related miRNAs, as
described in Example 2.
Results
[0355] As illustrated in FIGS. 7A-B, neural stem cells may be
induced to differentiate into motor neurons.
[0356] As presented in FIGS. 8-10, there were significant changes
in the expression of specific miRNA of each group between the
control MSCs and the differentiated MSCs.
[0357] qRT-PCR studies were performed to validate the differences
in the miRNA expression that were observed between the control and
differentiated cells.
[0358] Similar to the results that were obtained with the
microarray data, the qRT-PCR results demonstrated a decrease in
miRs, 372, 373, 141, 199a, 32, 33, 221 and 223.
[0359] In contrast a significant increase was observed in all the
miRNAs that increased in the array and specifically the following
miRNAs: miR-368, 302b, 365-3p, 365-5p, Let-7a, Let-7b, 218, 134,
124, 125a, 9, 154, 20a, 130a.
[0360] The present inventors further examined the role of the
specific miRNAs in the differentiation of MSCs to motor neurons. It
was found that the combination of Let-7a and miR-124, 368 and
miR-154 increased the expression of Hb9 and Islet-1. Similarly,
transfection with combinations of miR-125a, 9, 130a and 218, 134
and 20a together and in combination with miRNA inhibitors of
miR-141, 32, 33, 221, 223 and miR373 also induced differentiation
of MSCs to either motor neuron progenitors or to immature motor
neurons.
Example 7
Sequences
TABLE-US-00003 [0361] TABLE 2 Sequence of Sequence of Name mature
miRNA premiRNA hsa-let-7a seq id no: 1 seq id no: 73 seq id no: 74
seq id no: 75 hsa-let-7b seq id no: 2 seq id no: 76 hsa-let-7c seq
id no: 3 seq id no: 77 hsa-let-7d seq id no: 4 seq id no: 78
hsa-let-7e seq id no: 5 seq id no: 79 hsa-let-7f seq id no: 6 seq
id no: 80 hsa-let-7g seq id no: 7 seq id no: 81 hsa-let-7i seq id
no: 8 seq id no: 82 hsa-mir-106a seq id no: 9 seq id no: 83
hsa-mir-106b seq id no: 10 seq id no: 84 hsa-mir-1294 seq id no: 11
seq id no: 85 hsa-mir-1297 seq id no: 12 seq id no: 86 hsa-mir-143
seq id no: 13 seq id no: 87 hsa-mir-144 seq id no: 14 seq id no: 88
hsa-mir-145 seq id no: 15 seq id no: 89 hsa-mir-17 seq id no: 16
seq id no: 90 miR-181a seq id no: 17 seq id no: 91 miR-181a seq id
no: 18 seq id no: 92 miR-181b seq id no: 19 seq id no: 93 miR-181b
seq id no: 20 seq id no: 94 miR-181c seq id no: 21 seq id no: 95
hsa-mir-181d seq id no: 22 seq id no: 96 hsa-mir-199a-3p seq id no:
23 seq id no: 97 hsa-mir-199b-3p seq id no: 24 seq id no: 98
hsa-mir-202 seq id no: 25 seq id no: 99 hsa-mir-20a seq id no: 26
seq id no: 100 hsa-mir-20b seq id no: 27 seq id no: 101
hsa-mir-2113 seq id no: 28 seq id no: 102 hsa-mir-25 seq id no: 29
seq id no: 103 hsa-mir-26a seq id no: 30 seq id no: 104 seq id no:
31 seq id no: 105 hsa-mir-26b seq id no: 32 seq id no: 106
hsa-mir-29a seq id no: 33 seq id no: 107 hsa-mir-29b seq id no: 34
seq id no: 108 seq id no: 109 hsa-mir-29c seq id no: 35 seq id no:
110 hsa-mir-3129-5p seq id no: 36 seq id no: 111 hsa-mir-3177-5p
seq id no: 37 seq id no: 112 hsa-mir-32 seq id no: 38 seq id no:
113 hsa-mir-326 seq id no: 39 seq id no: 114 hsa-mir-330-5p seq id
no: 40 seq id no: 115 hsa-mir-363 seq id no: 41 seq id no: 116
hsa-mir-3659 seq id no: 42 seq id no: 117 hsa-mir-3662 seq id no:
43 seq id no: 118 hsa-mir-367 seq id no: 44 seq id no: 119
hsa-mir-372 seq id no: 45 seq id no: 120 hsa-mir-373 seq id no: 46
seq id no: 121 hsa-mir-3927 seq id no: 47 seq id no: 122
hsa-mir-4262 seq id no: 48 seq id no: 123 hsa-mir-4279 seq id no:
49 seq id no: 124 hsa-mir-4458 seq id no: 50 seq id no: 125
hsa-mir-4465 seq id no: 51 seq id no: 126 hsa-mir-4500 seq id no:
52 seq id no: 127 hsa-mir-4658 seq id no: 53 seq id no: 128
hsa-mir-4724-3p seq id no: 54 seq id no: 129 hsa-mir-4742-3p seq id
no: 55 seq id no: 130 hsa-mir-4770 seq id no: 56 seq id no: 131
hsa-mir-519d seq id no: 57 seq id no: 132 hsa-mir-520a-3p seq id
no: 58 seq id no: 133 hsa-mir-520b seq id no: 59 seq id no: 134
hsa-mir-520c-3p seq id no: 60 seq id no: 135 hsa-mir-520d-3p seq id
no: 61 seq id no: 136 hsa-mir-520d-5p seq id no: 62 seq id no: 137
hsa-mir-520e seq id no: 63 seq id no: 138 hsa-mir-524-5p seq id no:
64 seq id no: 139 hsa-mir-642b seq id no: 65 seq id no: 140
hsa-mir-656 seq id no: 66 seq id no: 141 hsa-mir-767-5p seq id no:
67 seq id no: 142 hsa-mir-92a seq id no: 68 seq id no: 143 seq id
no: 69 seq id no: 144 hsa-mir-92b seq id no: 70 seq id no: 145
hsa-mir-93 seq id no: 71 seq id no: 146 hsa-mir-98 seq id no: 72
seq id no: 147
TABLE-US-00004 TABLE 3 Sequence of Sequence of Name mature premiRNA
hsa-mir-410 seq id no: 148 seq id no: 156 hsa-mir-3163 seq id no:
149 seq id no: 157 hsa-mir-148a seq id no: 150 seq id no: 158
hsa-mir-148b seq id no: 151 seq id no: 159 hsa-mir-152 seq id no:
152 seq id no: 160 hsa-mir-3121-3p seq id no: 153 seq id no: 161
hsa-mir-495 seq id no: 154 seq id no: 162 hsa-mir-4680-3p seq id
no: 155 seq id no: 163
TABLE-US-00005 TABLE 4 Sequence of Sequence of Name mature PMIR id
premiRNA miR-92ap seq id no: 164 MI0000093 seq id no: 269 seq id
no: 165 MI0000094 seq id no: 270 miR-21 seq id no: 166 MI0000077
seq id no: 271 miR-26a 5P seq id no: 167 MI0000083 seq id no: 272
seq id no: 168 MI0000750 seq id no: 273 miR-18a seq id no: 169
MI0000072 seq id no: 274 miR-124 seq id no: 170 MI0000445 seq id
no: 275 seq id no: 171 MI0000443 seq id no: 276 seq id no: 172
MI0000444 seq id no: 277 miR-99a seq id no: 173 MI0000101 seq id
no: 278 miR-30c seq id no: 174 MI0000736 seq id no: 279 MI0000254
seq id no: 280 miR-301a 3P seq id no: 175 MI0000745 seq id no: 281
miR-145-50 seq id no: 176 MI0000461 seq id no: 282 miR-143-3p seq
id no: 177 MI0000459 seq id no: 283 miR-373 3P seq id no: 178
MI0000781 seq id no: 284 miR-20b seq id no: 179 MI0001519 seq id
no: 285 miR-29c 3P seq id no: 180 MI0000735 seq id no: 286 miR-29b
3P seq id no: 181 MI0000105 seq id no: 287 MI0000107 seq id no: 288
miR-143 let-7g seq id no: 182 MI0000433 seq id no: 289 let-7a seq
id no: 183 MI0000060 seq id no: 290 MI0000061 seq id no: 291
MI0000062 seq id no: 292 let-7b seq id no: 184 MI0000063 seq id no:
293 miR-98 seq id no: 185 MI0000100 seq id no: 294 miR-30a* seq id
no: 186 MI0000088 seq id no: 295 miR-17 seq id no: 187 MI0000071
seq id no: 296 miR-1-1 seq id no: 188 MI0000651 seq id no: 297
miR-1-2 seq id no: 189 MI0000437 seq id no: 298 miR-192 seq id no:
190 MI0000234 seq id no: 299 miR-155 seq id no: 191 MI0000681 seq
id no: 300 miR-516-ap a1-5p-- seq id no: 192 MI0003180 seq id no:
301 a2-3p-- seq id no: 193 MI0003181 seq id no: 302 miR-31 seq id
no: 194 MI0000089 seq id no: 303 miR-181a seq id no: 195 MI0000289
seq id no: 304 seq id no: 196 MI0000269 seq id no: 305 miR-181b seq
id no: 197 MI0000270 seq id no: 306 seq id no: 198 MI0000683 seq id
no: 307 miR-181c seq id no: 199 MI0000271 seq id no: 308 miR-34-c
seq id no: 200 MI0000743 seq id no: 309 miR-34b* seq id no: 201
MI0000742 seq id no: 310 miR-103a seq id no: 202 MI0000109 seq id
no: 311 seq id no: 203 MI0000108 seq id no: 312 miR-210 seq id no:
204 MI0000286 seq id no: 313 miR-16 seq id no: 205 MI0000070 seq id
no: 314 seq id no: 206 MI0000115 seq id no: 315 miR-30a seq id no:
207 MI0000088 seq id no: 316 miR-31 seq id no: 208 MI0000089 seq id
no: 317 miR-222 seq id no: 209 MI0000299 seq id no: 318 miR-17 seq
id no: 210 MI0000071 seq id no: 319 miR-17* seq id no: 211
MI0000071 seq id no: 320 miR-200b seq id no: 212 MI0000342 seq id
no: 321 miR-200c seq id no: 213 MI0000650 seq id no: 322 miR-128
seq id no: 214 MI0000447 seq id no: 323 MI0000727 seq id no: 324
miR-503 seq id no: 215 MI0003188 seq id no: 325 miR-424 seq id no:
216 MI0001446 seq id no: 326 miR-195 seq id no: 217 MI0000489 seq
id no: 327 miR-1256 seq id no: 218 MI0006390 seq id no: 328
miR-203a seq id no: 219 MI0000283 seq id no: 329 miR-199 ??
hsa-miR-199a-3p_st seq id no: 220 MI0000242 seq id no: 330
hsa-miR-199a-5p_st seq id no: 221 MI0000242 seq id no: 331
hsa-miR-199b-3p_st seq id no: 222 MI0000282 seq id no: 332 miR-93
seq id no: 223 MI0000095 seq id no: 333 miR-98 seq id no: 224
MI0000100 seq id no: 334 miR-125-a seq id no: 225 MI0000469 seq id
no: 335 miR-133a seq id no: 226 MI0000450 seq id no: 336 MI0000451
seq id no: 337 miR-133b seq id no: 227 MI0000822 seq id no: 338
miR-126 seq id no: 228 MI0000471 seq id no: 339 miR-194 seq id no:
229 MI0000488 seq id no: 340 MI0000732 seq id no: 341 miR-346 seq
id no: 230 MI0000826 seq id no: 342 miR-15b seq id no: 231
MI0000438 seq id no: 343 miR-338-3p seq id no: 232 MI0000814 seq id
no: 344 miR-373 miR-205 seq id no: 233 MI0000285 seq id no: 345
miR-210 miR-125 miR-1226 seq id no: 234 MI0006313 seq id no: 346
miR-708 seq id no: 235 MI0005543 seq id no: 347 miR-449 seq id no:
236 MI0001648 seq id no: 348 miR-422 seq id no: 237 MI0001444 seq
id no: 349 miR-340 seq id no: 238 MI0000802 seq id no: 350 miR-605
seq id no: 239 MI0003618 seq id no: 351 miR-522 seq id no: 240
MI0003177 seq id no: 352 miR-663 seq id no: 241 MI0003672 seq id
no: 353 miR-130a seq id no: 242 MI0000448 seq id no: 354 miR-130b
seq id no: 243 MI0000748 seq id no: 355 miR-942 seq id no: 244
MI0005767 seq id no: 356 miR-572 seq id no: 245 MI0003579 seq id
no: 357 miR-520 miR-639 seq id no: 246 MI0003654 seq id no: 358
miR-654 seq id no: 247 MI0003676 seq id no: 359 miR-519 miR-204 seq
id no: 248 MI0000284 miR-224 seq id no: 249 MI0000301 seq id no:
360 miR-616 seq id no: 250 MI0003629 seq id no: 361 miR-122 seq id
no: 251 MI0000442 seq id no: 362 miR-299 3p- seq id no: 252
MI0000744 seq id no: 363 5p- seq id no: 253 seq id no: 364 miR-100
seq id no: 254 MI0000102 miR-138 seq id no: 255 MI0000476 seq id
no: 365 miR-140 seq id no: 256 MI0000456 seq id no: 366 miR-375 seq
id no: 257 MI0000783 seq id no: 367 miR-217 seq id no: 258
MI0000293 seq id no: 368 miR-302 seq id no: 369 miR-372 seq id no:
259 MI0000780 miR-96 seq id no: 260 MI0000098 seq id no: 370
miR-127-3p seq id no: 261 MI0000472 seq id no: 371 miR-449 seq id
no: 372 miR-135b seq id no: 262 MI0000810 miR-101 seq id no: 263
MI0000103 seq id no: 373 MI0000739 seq id no: 374 miR-326 seq id
no: 264 MI0000808 seq id no: 375 miR-3245p- seq id no: 265
MI0000813 seq id no: 376 3p- seq id no: 266 MI0000813 seq id no:
377 miR-335 seq id no: 267 MI0000816 seq id no: 378 miR-141 seq id
no: 268 MI0000457 seq id no: 379
TABLE-US-00006 TABLE 5 Sequence of Sequence of Name mature miRNA
premiRNA miR-1275 seq id no: 381 seq id no: 414 miR-891a seq id no:
382 seq id no: 415 miR-154 seq id no: 383 seq id no: 416 miR-1202
seq id no: 384 seq id no: 417 miR-572 seq id no: 385 seq id no: 418
miR-935a seq id no: 386 seq id no: 419 miR-4317 seq id no: 387 seq
id no: 420 miR-153 seq id no: 388 seq id no: 421 seq id no: 422
miR-4288 seq id no: 389 seq id no: 423 miR-409-5p seq id no: 390
seq id no: 424 miR-193a-5p seq id no: 391 seq id no: 425 miR-648
seq id no: 392 seq id no: 426 miR-368 miR-365 seq id no: 393 seq id
no: 427 miR-500 seq id no: 394 seq id no: 428 miR-491 seq id no:
395 seq id no: 429 hsa-miR-199a- seq id no: 396 seq id no: 430
3p_st seq id no: 397 seq id no: 431 hsa-miR-199a- seq id no: 398
seq id no: 432 5p_st seq id no: 399 seq id no: 433 miR-2113 seq id
no: 400 seq id no: 434 miR-372 seq id no: 401 seq id no: 435
miR-373 seq id no: 402 seq id no: 436 miR-942 seq id no: 403 seq id
no: 437 miR-1293 seq id no: 404 seq id no: 438 miR-18 seq id no:
405 seq id no: 439 miR-1182 seq id no: 406 seq id no: 440 miR-1185
seq id no: 407 seq id no: 441 seq id no: 442 miR-1276 seq id no:
408 seq id no: 443 miR-193b seq id no: 409 seq id no: 444 miR-1238
seq id no: 410 seq id no: 445 miR-889 seq id no: 411 seq id no: 446
miR-370 seq id no: 412 seq id no: 447 miR-548-d1 seq id no: 413 seq
id no: 448
TABLE-US-00007 TABLE 6 mir designation seq id no: hsa-miR-302b seq
id no: 449 hsa-miR-371 seq id no: 450 hsa-miR-134 seq id no: 451
hsa-miR-219 seq id no: 452 hsa-miR-154 seq id no: 453 hsa-miR-155
seq id no: 454 hsa-miR-32 seq id no: 455 hsa-miR-33 seq id no: 456
hsa-miR-126 seq id no: 457 hsa-miR-127 seq id no: 458 hsa-miR-132
seq id no: 459 hsa-miR-137 seq id no: 460 hsa-miR-10b seq id no:
461 hsa-miR-142-3p seq id no: 462 hsa-miR-131a hsa-miR-125b seq id
no: 463 hsa-miR-153 seq id no: 464 hsa-miR-181a seq id no: 465
hsa-miR-123 hsa-miR-let-7a seq id no: 466 hsa-miR-let-7b seq id no:
467 hsa-miR-368 seq id no: 468 hsa-miR-365-3p hsa-miR-365-5p
hsa-miR-218 seq id no: 469 hsa-miR-124 seq id no: 470 hsa-miR-125a
seq id no: 471 hsa-miR-9 seq id no: 472 hsa-miR-20a seq id no: 473
hsa-miR-130a seq id no: 474 hsa-miR-372 seq id no: 475 hsa-miR-373
seq id no: 476 hsa-miR-141 seq id no: 477 hsa-miR-199a seq id no:
478 hsa-miR-221 seq id no: 479 hsa-miR-223 seq id no: 480
Example 8
miRNAs that Play a Role in the Differentiation of MSCs to Motor
Neurons
Materials and Methods
[0362] Plates were coated with 20 .mu.g/ml laminin overnight and
were then washed twice with PBS. The MSCs were plated in the
confluency of 50% and after 24 hr were incubated with priming
medium: NM medium with heparin (use 10 .mu.g/mL) and bFGF (10
.mu.g/mL) for 5 days. After day 5 the medium was changed to the
differentiation medium: F12 with 1 mL of B27 in 50 .mu.L F12 (or
2%), retinoic acid (RA, 0.1-1 .mu.M), and SHH (200 ng/mL). The RA
was added every other day. After 5 days GDNF and BDNF were added to
the medium (10 ng/mL).
Results
[0363] Transfection of MSCs with various miRs and miR inhibitors to
induce trans-differentiation to motor neuron progenitors and
immature motor neurons was already discussed in Example 6, however,
further effective combinations are herein described. MSCs were
transfected with a control miR, miR-9, miR-218, miR-375, all three
miRs, all three miRs and an antagomir to miR-221, and all three
miRs and an antagomir to miR-373 and mRNA expression of the motor
neuron markers Islet1 and HB9 was measured (FIG. 11). Expression
was standardized to the control miR transfected MSCs, which was set
as 1, and the results are presented in Table 7. Each miR on its own
caused about a doubling in expression of Islet1 and HB9.
Unexpectedly, expression of all three miRs had a synergistic effect
on trans-differentiation and Islet1 was increased by more than 5
fold, while HB9 was increased by more than 6 fold. The three miR
combination was also transfected in combination with antagomirs
that knockdown expression of miR-221 or miR-373. These combinations
were even more effective, as 8-9 fold increases in Islet1 and HB9
were observed.
TABLE-US-00008 TABLE 7 (Relative mRNA expression/S12 mRNA) Islet1
HB9 Con miR 1 1 miR-9 1.8 2.12 miR-218 2.09 1.96 miR-375 2.43 2.39
miR-9 + 218 + 375 5.23 6.48 3 miRs + anti-miR-221 8.6 7.9 3 miRs +
anti-miR-373 9.2 8.45
Example 9
Combination RTVP-1 Silencing and miRNA Expression to Differentiate
MSCs to NSCs
[0364] Already having shown that RTVP-1 silencing alone was
sufficient to drive MSC trans-differentiation to NSCs as measured
by nestin mRNA expression, it was next investigated whether the
silencing in combination with miR expression could enhance the
levels of nestin expressed. MSCs were contacted with a control
siRNA, RTVP-1 silencing agent alone (an siRNA against RTVP-1, with
the sequence AAGACTGCGTTCGAATCCATA (SEQ ID NO: 481), or the agent
in combination with miR-218, miR-504, miR-9, miR-125 or anti-miR-31
(FIG. 12). As compared to the siRNA control cells, RTVP-1 knockdown
alone increased nestin mRNA expression by 3.9-fold. Addition of any
of the above enumerated miRs or anti-miRs further increased nestin
expression; and the addition of miR-504 or miR-9 more than doubled
nestin expression. Knockdown of miR-31 in combination with RTVP-1
silencing also had a very strong synergistic effect, although not
quite a doubling as compared to RTVP-1 silencing alone.
Example 10
Use of Motor Neuron-Differentiated MSCs to Treat ALS
[0365] SOD1G93A mice were used as a model for amyotrophic lateral
sclerosis (ALS). Placenta-derived MSCs were trans-differentiated to
motor neurons as described in Example 8 (transfection of miR-9,
miR-218 and miR-375) and these cells were administered
intrathecally (5.times.10 5-1.times.106 cells) to pre-symptomatic
mice (90 days old). Cells were subsequently re-administered 1 week
later. SOD1G93A mice were also administered placenta-derived MSCs
that had been transfected with control miRs and well as
administered PBS as a control. The mean survival of eight control
mice who received only PBS was 135.1. The mean survival of eight
control mice who received control MSCs was 132.5 days.
Administration of motor neuron differentiated MSCs resulted in a
statistically significant increase in the mean survival of the
eight test mice, as these mice survived, on average, 160.4
days.
Example 11
Use of Motor Neuron-Differentiated MSCs to Treat Spinal Cord
Injury
[0366] The ability of the motor neuron-differentiated MSCs to treat
nerve, and specifically spinal cord, injury was investigated.
Wild-type rats underwent spinal cord perfusion injury by blocking
the abdominal aorta below the left renal artery for 15 minutes. The
injured rats were then treated with PBS or motor
neuron-differentiated MSCs (1.times.10 7 cells) injected at the
L5-L6 segment of the spine. Four days later lower limb movement in
the rats was evaluated using the Basso, Beattie and Bresnahan (BBB)
locomotor scale method. Uninjured rats were also evaluated as a
control. The BBB scale is a well-established and discriminating
method for measuring behavioral outcome and for evaluating
treatments after spinal cord injury. The scale ranges from zero to
21, with a higher score indicating superior movement. The scoring
can be summarized by the following breakdown:
0-7: Isolated joint movements with little or no hindlimb movement.
8-13: Intervals of uncoordinated stepping. 14-21: Forelimb and
hindlimb coordination.
[0367] As can be seen in FIG. 13, uninjured mice had a nearly
perfect score of 20.6 on the BBB scale, whereas control injured
mice treated with only PBS scored in the lowest category with an
average score of 4.2. Mice treated with motor
neuron-transdifferentiated MSCs showed a strong improvement in
locomotion, with an average score of 11.8, which is the upper half
of the middle category, and were capable of uncoordinated
stepping.
Example 12
Use of NSC-Differentiated MSCs to Glioma
[0368] The ability of MSC transdifferentiated to NSCs by silencing
of RTVP-1 to treat gliomas was investigated. Glioma stem cell
(GSC)-derived xenografts were grown in immune-compromised mice, and
the mice were treated with either RTVP-1 silenced MSCs
transdifferentiated to NSCs (as described in Example 9), or MSCs
expressing control molecules. The transdifferentiated MSCs
decreased tumor growth by 59.7% as compared to the control MSC
where the decrease was only 41.1%. Further, glioma cells highly
express RTVP-1, indeed its other name is glioma
pathogenesis-related protein-GLIPR1, but normal healthy brain
tissue does not. After dissection of the GSC xenografts it was
found that RTVP-1 silenced MSCs greatly reduced RTVP-1 levels in
the tumor. Isolated exosomes from the transdifferentiated MSCs
contained high levels of the siRNA, suggesting that the decrease in
RTVP-1 in the tumor was likely a result of MSC-derived exosome
transfer of the siRNA to tumor cells.
[0369] Although the invention has been described in conjunction
with specific embodiments thereof, it is evident that many
alternatives, modifications and variations will be apparent to
those skilled in the art. Accordingly, it is intended to embrace
all such alternatives, modifications and variations that fall
within the spirit and broad scope of the appended claims.
[0370] All publications, patents and patent applications mentioned
in this specification are herein incorporated in their entirety by
reference into the specification, to the same extent as if each
individual publication, patent or patent application was
specifically and individually indicated to be incorporated herein
by reference. In addition, citation or identification of any
reference in this application shall not be construed as an
admission that such reference is available as prior art to the
present invention. To the extent that section headings are used,
they should not be construed as necessarily limiting.
Sequence CWU 1
1
481122RNAHomo sapiens 1ugagguagua gguuguauag uu 22222RNAHomo
sapiens 2ugagguagua gguugugugg uu 22322RNAHomo sapiens 3ugagguagua
gguuguaugg uu 22422RNAHomo sapiens 4agagguagua gguugcauag uu
22522RNAHomo sapiens 5ugagguagga gguuguauag uu 22622RNAHomo sapiens
6ugagguagua gauuguauag uu 22722RNAHomo sapiens 7ugagguagua
guuuguacag uu 22822RNAHomo sapiens 8ugagguagua guuugugcug uu
22923RNAHomo sapiens 9aaaagugcuu acagugcagg uag 231021RNAHomo
sapiens 10uaaagugcug acagugcaga u 211122RNAHomo sapiens
11ugugagguug gcauuguugu cu 221217RNAHomo sapiens 12uucaaguaau
ucaggug 171322RNAHomo sapiens 13ggugcagugc ugcaucucug gu
221420RNAHomo sapiens 14uacaguauag augauguacu 201523RNAHomo sapiens
15guccaguuuu cccaggaauc ccu 231623RNAHomo sapiens 16caaagugcuu
acagugcagg uag 231723RNAHomo sapiens 17aacauucaac gcugucggug agu
231823RNAHomo sapiens 18aacauucaac gcugucggug agu 231923RNAHomo
sapiens 19aacauucauu gcugucggug ggu 232023RNAHomo sapiens
20aacauucauu gcugucggug ggu 232122RNAHomo sapiens 21aacauucaac
cugucgguga gu 222223RNAHomo sapiens 22aacauucauu guugucggug ggu
232322RNAHomo sapiens 23acaguagucu gcacauuggu ua 222422RNAHomo
sapiens 24acaguagucu gcacauuggu ua 222520RNAHomo sapiens
25agagguauag ggcaugggaa 202623RNAHomo sapiens 26uaaagugcuu
auagugcagg uag 232723RNAHomo sapiens 27caaagugcuc auagugcagg uag
232821RNAHomo sapiens 28auuugugcuu ggcucuguca c 212922RNAHomo
sapiens 29cauugcacuu gucucggucu ga 223022RNAHomo sapiens
30uucaaguaau ccaggauagg cu 223122RNAHomo sapiens 31uucaaguaau
ccaggauagg cu 223221RNAHomo sapiens 32uucaaguaau ucaggauagg u
213322RNAHomo sapiens 33uagcaccauc ugaaaucggu ua 223423RNAHomo
sapiens 34uagcaccauu ugaaaucagu guu 233522RNAHomo sapiens
35uagcaccauu ugaaaucggu ua 223622RNAHomo sapiens 36gcaguagugu
agagauuggu uu 223723RNAHomo sapiens 37uguguacaca cgugccaggc gcu
233822RNAHomo sapiens 38uauugcacau uacuaaguug ca 223920RNAHomo
sapiens 39ccucugggcc cuuccuccag 204023RNAHomo sapiens 40gcaaagcaca
cggccugcag aga 234122RNAHomo sapiens 41aauugcacgg uauccaucug ua
224221RNAHomo sapiens 42ugaguguugu cuacgagggc a 214324RNAHomo
sapiens 43gaaaaugaug aguagugacu gaug 244422RNAHomo sapiens
44aauugcacuu uagcaauggu ga 224523RNAHomo sapiens 45aaagugcugc
gacauuugag cgu 234623RNAHomo sapiens 46gaagugcuuc gauuuugggg ugu
234722RNAHomo sapiens 47cagguagaua uuugauaggc au 224817RNAHomo
sapiens 48gacauucaga cuaccug 174916RNAHomo sapiens 49cucuccuccc
ggcuuc 165019RNAHomo sapiens 50agagguaggu guggaagaa 195122RNAHomo
sapiens 51cucaaguagu cugaccaggg ga 225217RNAHomo sapiens
52ugagguagua guuucuu 175323RNAHomo sapiens 53gugagugugg auccuggagg
aau 235421RNAHomo sapiens 54guaccuucug guucagcuag u 215523RNAHomo
sapiens 55ucuguauucu ccuuugccug cag 235618RNAHomo sapiens
56ugagaugaca cuguagcu 185722RNAHomo sapiens 57caaagugccu cccuuuagag
ug 225822RNAHomo sapiens 58aaagugcuuc ccuuuggacu gu 225921RNAHomo
sapiens 59aaagugcuuc cuuuuagagg g 216022RNAHomo sapiens
60aaagugcuuc cuuuuagagg gu 226122RNAHomo sapiens 61aaagugcuuc
ucuuuggugg gu 226220RNAHomo sapiens 62cuacaaaggg aagcccuuuc
206321RNAHomo sapiens 63aaagugcuuc cuuuuugagg g 216422RNAHomo
sapiens 64cuacaaaggg aagcacuuuc uc 226522RNAHomo sapiens
65agacacauuu ggagagggac cc 226621RNAHomo sapiens 66aauauuauac
agucaaccuc u 216723RNAHomo sapiens 67ugcaccaugg uugucugagc aug
236822RNAHomo sapiens 68uauugcacuu gucccggccu gu 226922RNAHomo
sapiens 69uauugcacuu gucccggccu gu 227022RNAHomo sapiens
70uauugcacuc gucccggccu cc 227123RNAHomo sapiens 71caaagugcug
uucgugcagg uag 237222RNAHomo sapiens 72ugagguagua aguuguauug uu
227380RNAHomo sapiens 73ugggaugagg uaguagguug uauaguuuua gggucacacc
caccacuggg agauaacuau 60acaaucuacu gucuuuccua 807472RNAHomo sapiens
74agguugaggu aguagguugu auaguuuaga auuacaucaa gggagauaac uguacagccu
60ccuagcuuuc cu 727574RNAHomo sapiens 75gggugaggua guagguugua
uaguuugggg cucugcccug cuaugggaua acuauacaau 60cuacugucuu uccu
747683RNAHomo sapiens 76cggggugagg uaguagguug ugugguuuca gggcagugau
guugccccuc ggaagauaac 60uauacaaccu acugccuucc cug 837784RNAHomo
sapiens 77gcauccgggu ugagguagua gguuguaugg uuuagaguua cacccuggga
guuaacugua 60caaccuucua gcuuuccuug gagc 847887RNAHomo sapiens
78ccuaggaaga gguaguaggu ugcauaguuu uagggcaggg auuuugccca caaggaggua
60acuauacgac cugcugccuu ucuuagg 877979RNAHomo sapiens 79cccgggcuga
gguaggaggu uguauaguug aggaggacac ccaaggagau cacuauacgg 60ccuccuagcu
uuccccagg 798087RNAHomo sapiens 80ucagagugag guaguagauu guauaguugu
gggguaguga uuuuacccug uucaggagau 60aacuauacaa ucuauugccu ucccuga
878184RNAHomo sapiens 81aggcugaggu aguaguuugu acaguuugag ggucuaugau
accacccggu acaggagaua 60acuguacagg ccacugccuu gcca 848284RNAHomo
sapiens 82cuggcugagg uaguaguuug ugcuguuggu cggguuguga cauugcccgc
uguggagaua 60acugcgcaag cuacugccuu gcua 848381RNAHomo sapiens
83ccuuggccau guaaaagugc uuacagugca gguagcuuuu ugagaucuac ugcaauguaa
60gcacuucuua cauuaccaug g 818482RNAHomo sapiens 84ccugccgggg
cuaaagugcu gacagugcag auaguggucc ucuccgugcu accgcacugu 60ggguacuugc
ugcuccagca gg 8285142RNAHomo sapiens 85caccuaaugu gugccaagau
cuguucauuu augaucucac cgaguccugu gagguuggca 60uuguugucug gcauugucug
auauacaaca gugccaaccu cacaggacuc agugagguga 120aacugaggau
uaggaaggug ua 1428677RNAHomo sapiens 86uguuuaucuc uaggguugau
cuauuagaau uacuuaucug agccaaagua auucaaguaa 60uucaggugua gugaaac
7787106RNAHomo sapiens 87gcgcagcgcc cugucuccca gccugaggug
cagugcugca ucucugguca guugggaguc 60ugagaugaag cacuguagcu caggaagaga
gaaguuguuc ugcagc 1068886RNAHomo sapiens 88uggggcccug gcugggauau
caucauauac uguaaguuug cgaugagaca cuacaguaua 60gaugauguac uaguccgggc
accccc 868988RNAHomo sapiens 89caccuugucc ucacggucca guuuucccag
gaaucccuua gaugcuaaga uggggauucc 60uggaaauacu guucuugagg ucaugguu
889084RNAHomo sapiens 90gucagaauaa ugucaaagug cuuacagugc agguagugau
augugcaucu acugcaguga 60aggcacuugu agcauuaugg ugac 8491110RNAHomo
sapiens 91ugaguuuuga gguugcuuca gugaacauuc aacgcugucg gugaguuugg
aauuaaaauc 60aaaaccaucg accguugauu guacccuaug gcuaaccauc aucuacucca
11092110RNAHomo sapiens 92agaagggcua ucaggccagc cuucagagga
cuccaaggaa cauucaacgc ugucggugag 60uuugggauuu gaaaaaacca cugaccguug
acuguaccuu gggguccuua 11093110RNAHomo sapiens 93ccugugcaga
gauuauuuuu uaaaagguca caaucaacau ucauugcugu cgguggguug 60aacugugugg
acaagcucac ugaacaauga augcaacugu ggccccgcuu 1109489RNAHomo sapiens
94cugauggcug cacucaacau ucauugcugu cgguggguuu gagucugaau caacucacug
60aucaaugaau gcaaacugcg gaccaaaca 8995110RNAHomo sapiens
95cggaaaauuu gccaaggguu ugggggaaca uucaaccugu cggugaguuu gggcagcuca
60ggcaaaccau cgaccguuga guggacccug aggccuggaa uugccauccu
11096137RNAHomo sapiens 96guccccuccc cuaggccaca gccgagguca
caaucaacau ucauuguugu cgguggguug 60ugaggacuga ggccagaccc accgggggau
gaaugucacu guggcugggc cagacacggc 120uuaaggggaa uggggac
1379771RNAHomo sapiens 97gccaacccag uguucagacu accuguucag
gaggcucuca auguguacag uagucugcac 60auugguuagg c 7198110RNAHomo
sapiens 98ccagaggaca ccuccacucc gucuacccag uguuuagacu aucuguucag
gacucccaaa 60uuguacagua gucugcacau ugguuaggcu gggcuggguu agacccucgg
11099110RNAHomo sapiens 99cgccucagag ccgcccgccg uuccuuuuuc
cuaugcauau acuucuuuga ggaucuggcc 60uaaagaggua uagggcaugg gaaaacgggg
cggucggguc cuccccagcg 11010071RNAHomo sapiens 100guagcacuaa
agugcuuaua gugcagguag uguuuaguua ucuacugcau uaugagcacu 60uaaaguacug
c 7110169RNAHomo sapiens 101aguaccaaag ugcucauagu gcagguaguu
uuggcaugac ucuacuguag uaugggcacu 60uccaguacu 6910291RNAHomo sapiens
102uuuucaaagc aaugugugac agguacaggg acaaaucccg uuaauaagua
agaggauuug 60ugcuuggcuc ugucacaugc cacuuugaaa a 9110384RNAHomo
sapiens 103ggccaguguu gagaggcgga gacuugggca auugcuggac gcugcccugg
gcauugcacu 60ugucucgguc ugacagugcc ggcc 8410477RNAHomo sapiens
104guggccucgu ucaaguaauc caggauaggc ugugcagguc ccaaugggcc
uauucuuggu 60uacuugcacg gggacgc 7710584RNAHomo sapiens
105ggcuguggcu ggauucaagu aauccaggau aggcuguuuc caucugugag
gccuauucuu 60gauuacuugu uucuggaggc agcu 8410677RNAHomo sapiens
106ccgggaccca guucaaguaa uucaggauag guugugugcu guccagccug
uucuccauua 60cuuggcucgg ggaccgg 7710764RNAHomo sapiens
107augacugauu ucuuuuggug uucagaguca auauaauuuu cuagcaccau
cugaaaucgg 60uuau 6410881RNAHomo sapiens 108cuucaggaag cugguuucau
auggugguuu agauuuaaau agugauuguc uagcaccauu 60ugaaaucagu guucuugggg
g 8110981RNAHomo sapiens 109cuucuggaag cugguuucac augguggcuu
agauuuuucc aucuuuguau cuagcaccau 60uugaaaucag uguuuuagga g
8111088RNAHomo sapiens 110aucucuuaca caggcugacc gauuucuccu
gguguucaga gucuguuuuu gucuagcacc 60auuugaaauc gguuaugaug uaggggga
8811176RNAHomo sapiens 111guacuugggc aguaguguag agauugguuu
gccuguuaau gaauucaaac uaaucucuac 60acugcugccc aagagc 7611282RNAHomo
sapiens 112ccacgugcca uguguacaca cgugccaggc gcugucuuga gacauucgcg
cagugcacgg 60cacuggggac acguggcacu gg 8211370RNAHomo sapiens
113ggagauauug cacauuacua aguugcaugu ugucacggcc ucaaugcaau
uuagugugug 60ugauauuuuc 7011495RNAHomo sapiens 114cucaucuguc
uguugggcug gaggcagggc cuuugugaag gcggguggug cucagaucgc 60cucugggccc
uuccuccagc cccgaggcgg auuca 9511594RNAHomo sapiens 115cuuuggcgau
cacugccucu cugggccugu gucuuaggcu cugcaagauc aaccgagcaa 60agcacacggc
cugcagagag gcagcgcucu gccc 9411675RNAHomo sapiens 116uguugucggg
uggaucacga ugcaauuuug augaguauca uaggagaaaa auugcacggu 60auccaucugu
aaacc 7511799RNAHomo sapiens 117ucuacaagca gauacaagga ugcccuugua
cacaacacac gugcugcuug uauagacaug 60aguguugucu acgagggcau ccuugugucu
gugugugug 9911895RNAHomo sapiens 118uguguuuucc ucaacgcuca
caguuacacu ucuuacucuc aauccauuca uauugaaaau 60gaugaguagu gacugaugaa
gcacaaauca gccaa 9511968RNAHomo sapiens 119ccauuacugu ugcuaauaug
caacucuguu gaauauaaau uggaauugca cuuuagcaau 60ggugaugg
6812067RNAHomo sapiens 120gugggccuca aauguggagc acuauucuga
uguccaagug gaaagugcug cgacauuuga 60gcgucac 6712169RNAHomo sapiens
121gggauacuca aaaugggggc gcuuuccuuu uugucuguac ugggaagugc
uucgauuuug 60ggguguccc 6912271RNAHomo sapiens 122ugccaaugcc
uaucacauau cugccugucc uaugacaaac auggcaggua gauauuugau 60aggcauuggc
a 7112354RNAHomo sapiens 123gaaagcugca ggugcugaug uuggggggac
auucagacua ccugcagcag agcc 5412458RNAHomo sapiens 124ugcucugugg
agcugaggag cagauucucu cucucuccuc ccggcuucac cuccugag 5812575RNAHomo
sapiens 125gagcgcacag agguaggugu ggaagaaagu gaaacacuau uuuagguuuu
aguuacacuc 60ugcuguggug ugcug 7512670RNAHomo sapiens 126cauguguccc
cuggcacgcu auuugagguu uacuauggaa ccucaaguag ucugaccagg 60ggacacauga
7012776RNAHomo sapiens 127caggagagaa aguacugccc agaagcuaaa
guguagauca aacgcauaau ggcugaggua 60guaguuucuu gaacuu 7612865RNAHomo
sapiens 128gcugcccuuc acucagagca ucuacaccca cuaccgguga guguggaucc
uggaggaauc 60guggc 6512989RNAHomo sapiens 129acgcaaaaug aacugaacca
ggagugagcu ucguguacau uaucuauuag aaaaugaagu 60accuucuggu ucagcuaguc
ccugugcgu 8913085RNAHomo sapiens 130ucaggcaaag ggauauuuac
agauacuuuu uaaaauuugu uugaguugag gcagauuaaa 60uaucuguauu cuccuuugcc
ugcag 8513158RNAHomo sapiens 131gaguuauggg gucaucuauc cuucccuugg
aaaaugaucu gagaugacac uguagcuc 5813288RNAHomo sapiens 132ucccaugcug
ugacccucca aagggaagcg cuuucuguuu guuuucucuu aaacaaagug 60ccucccuuua
gaguguuacc guuuggga 8813385RNAHomo sapiens 133cucaggcugu gacccuccag
agggaaguac uuucuguugu cugagagaaa agaaagugcu 60ucccuuugga cuguuucggu
uugag 8513461RNAHomo sapiens 134cccucuacag ggaagcgcuu ucuguugucu
gaaagaaaag aaagugcuuc cuuuuagagg 60g 6113587RNAHomo sapiens
135ucucaggcug ucguccucua gagggaagca cuuucuguug ucugaaagaa
aagaaagugc 60uuccuuuuag aggguuaccg uuugaga 8713687RNAHomo sapiens
136ucucaagcug ugagucuaca aagggaagcc cuuucuguug ucuaaaagaa
aagaaagugc 60uucucuuugg uggguuacgg uuugaga 8713787RNAHomo sapiens
137ucucaagcug ugagucuaca aagggaagcc cuuucuguug ucuaaaagaa
aagaaagugc 60uucucuuugg uggguuacgg uuugaga 8713887RNAHomo sapiens
138ucuccugcug ugacccucaa gauggaagca guuucuguug ucugaaagga
aagaaagugc 60uuccuuuuug aggguuacug uuugaga 8713987RNAHomo sapiens
139ucucaugcug ugacccuaca aagggaagca cuuucucuug uccaaaggaa
aagaaggcgc 60uucccuuugg aguguuacgg uuugaga 8714077RNAHomo
sapiens
140gaguugggag guucccucuc caaauguguc uugauccccc accccaagac
acauuuggag 60agggacccuc ccaacuc 7714178RNAHomo sapiens
141cugaaauagg uugccuguga gguguucacu uucuauauga ugaauauuau
acagucaacc 60ucuuuccgau aucgaauc 78142109RNAHomo sapiens
142gcuuuuauau uguagguuuu ugcucaugca ccaugguugu cugagcaugc
agcaugcuug 60ucugcucaua ccccaugguu ucugagcagg aaccuucauu gucuacugc
10914378RNAHomo sapiens 143cuuucuacac agguugggau cgguugcaau
gcuguguuuc uguaugguau ugcacuuguc 60ccggccuguu gaguuugg
7814475RNAHomo sapiens 144ucaucccugg guggggauuu guugcauuac
uuguguucua uauaaaguau ugcacuuguc 60ccggccugug gaaga 7514596RNAHomo
sapiens 145cgggccccgg gcgggcggga gggacgggac gcggugcagu guuguuuuuu
cccccgccaa 60uauugcacuc gucccggccu ccggcccccc cggccc 9614680RNAHomo
sapiens 146cugggggcuc caaagugcug uucgugcagg uagugugauu acccaaccua
cugcugagcu 60agcacuuccc gagcccccgg 80147119RNAHomo sapiens
147aggauucugc ucaugccagg gugagguagu aaguuguauu guuguggggu
agggauauua 60ggccccaauu agaagauaac uauacaacuu acuacuuucc cuggugugug
gcauauuca 11914821RNAHomo sapiens 148aauauaacac agauggccug u
2114922RNAHomo sapiens 149uauaaaauga gggcaguaag ac 2215022RNAHomo
sapiens 150ucagugcacu acagaacuuu gu 2215122RNAHomo sapiens
151ucagugcauc acagaacuuu gu 2215221RNAHomo sapiens 152ucagugcaug
acagaacuug g 2115322RNAHomo sapiens 153uaaauagagu aggcaaagga ca
2215422RNAHomo sapiens 154aaacaaacau ggugcacuuc uu 2215521RNAHomo
sapiens 155ucugaauugu aagaguuguu a 2115680RNAHomo sapiens
156gguaccugag aagagguugu cugugaugag uucgcuuuua uuaaugacga
auauaacaca 60gauggccugu uuucaguacc 8015773RNAHomo sapiens
157uuccucaucu auaaaaugag ggcaguaaga ccuuccuucc uugucuuacu
acccccauuu 60uauagaugag gaa 7315868RNAHomo sapiens 158gaggcaaagu
ucugagacac uccgacucug aguaugauag aagucagugc acuacagaac 60uuugucuc
6815999RNAHomo sapiens 159caagcacgau uagcauuuga ggugaaguuc
uguuauacac ucaggcugug gcucucugaa 60agucagugca ucacagaacu uugucucgaa
agcuuucua 9916087RNAHomo sapiens 160uguccccccc ggcccagguu
cugugauaca cuccgacucg ggcucuggag cagucagugc 60augacagaac uugggcccgg
aaggacc 8716177RNAHomo sapiens 161aaaugguuau guccuuugcc uauucuauuu
aagacacccu guaccuuaaa uagaguaggc 60aaaggacaga aacauuu
7716282RNAHomo sapiens 162ugguaccuga aaagaaguug cccauguuau
uuucgcuuua uaugugacga aacaaacaug 60gugcacuucu uuuucgguau ca
8216366RNAHomo sapiens 163uauaagaacu cuugcagucu uagauguuau
aaaaauauau aucugaauug uaagaguugu 60uagcac 6616422RNAHomo sapiens
164uauugcacuu gucccggccu gu 2216522RNAHomo sapiens 165uauugcacuu
gucccggccu gu 2216622RNAHomo sapiens 166uagcuuauca gacugauguu ga
2216722RNAHomo sapiens 167uucaaguaau ccaggauagg cu 2216822RNAHomo
sapiens 168uucaaguaau ccaggauagg cu 2216923RNAHomo sapiens
169uaaggugcau cuagugcaga uag 2317020RNAHomo sapiens 170uaaggcacgc
ggugaaugcc 2017120RNAHomo sapiens 171uaaggcacgc ggugaaugcc
2017220RNAHomo sapiens 172uaaggcacgc ggugaaugcc 2017322RNAHomo
sapiens 173aacccguaga uccgaucuug ug 2217423RNAHomo sapiens
174uguaaacauc cuacacucuc agc 2317523RNAHomo sapiens 175cagugcaaua
guauugucaa agc 2317623RNAHomo sapiens 176guccaguuuu cccaggaauc ccu
2317722RNAHomo sapiens 177ggugcagugc ugcaucucug gu 2217823RNAHomo
sapiens 178gaagugcuuc gauuuugggg ugu 2317923RNAHomo sapiens
179caaagugcuc auagugcagg uag 2318022RNAHomo sapiens 180uagcaccauu
ugaaaucggu ua 2218123RNAHomo sapiens 181uagcaccauu ugaaaucagu guu
2318222RNAHomo sapiens 182ugagguagua guuuguacag uu 2218322RNAHomo
sapiens 183ugagguagua gguuguauag uu 2218422RNAHomo sapiens
184ugagguagua gguugugugg uu 2218522RNAHomo sapiens 185ugagguagua
aguuguauug uu 2218622RNAHomo sapiens 186cuuucagucg gauguuugca gc
2218723RNAHomo sapiens 187caaagugcuu acagugcagg uag 2318822RNAHomo
sapiens 188uggaauguaa agaaguaugu au 2218922RNAHomo sapiens
189uggaauguaa agaaguaugu au 2219021RNAHomo sapiens 190cugaccuaug
aauugacagc c 2119123RNAHomo sapiens 191uuaaugcuaa ucgugauagg ggu
2319223RNAHomo sapiens 192uucucgagga aagaagcacu uuc 2319318RNAHomo
sapiens 193ugcuuccuuu cagagggu 1819421RNAHomo sapiens 194aggcaagaug
cuggcauagc u 2119523RNAHomo sapiens 195aacauucaac gcugucggug agu
2319623RNAHomo sapiens 196aacauucaac gcugucggug agu 2319723RNAHomo
sapiens 197aacauucauu gcugucggug ggu 2319823RNAHomo sapiens
198aacauucauu gcugucggug ggu 2319922RNAHomo sapiens 199aacauucaac
cugucgguga gu 2220023RNAHomo sapiens 200aggcagugua guuagcugau ugc
2320123RNAHomo sapiens 201uaggcagugu cauuagcuga uug 2320223RNAHomo
sapiens 202agcagcauug uacagggcua uga 2320323RNAHomo sapiens
203agcagcauug uacagggcua uga 2320422RNAHomo sapiens 204cugugcgugu
gacagcggcu ga 2220522RNAHomo sapiens 205uagcagcacg uaaauauugg cg
2220622RNAHomo sapiens 206uagcagcacg uaaauauugg cg 2220722RNAHomo
sapiens 207uguaaacauc cucgacugga ag 2220821RNAHomo sapiens
208aggcaagaug cuggcauagc u 2120921RNAHomo sapiens 209agcuacaucu
ggcuacuggg u 2121023RNAHomo sapiens 210caaagugcuu acagugcagg uag
2321122RNAHomo sapiens 211acugcaguga aggcacuugu ag 2221222RNAHomo
sapiens 212uaauacugcc ugguaaugau ga 2221323RNAHomo sapiens
213uaauacugcc ggguaaugau gga 2321421RNAHomo sapiens 214ucacagugaa
ccggucucuu u 2121523RNAHomo sapiens 215uagcagcggg aacaguucug cag
2321622RNAHomo sapiens 216cagcagcaau ucauguuuug aa 2221721RNAHomo
sapiens 217uagcagcaca gaaauauugg c 2121822RNAHomo sapiens
218aggcauugac uucucacuag cu 2221922RNAHomo sapiens 219gugaaauguu
uaggaccacu ag 2222022RNAHomo sapiens 220acaguagucu gcacauuggu ua
2222123RNAHomo sapiens 221cccaguguuc agacuaccug uuc 2322222RNAHomo
sapiens 222acaguagucu gcacauuggu ua 2222323RNAHomo sapiens
223caaagugcug uucgugcagg uag 2322422RNAHomo sapiens 224ugagguagua
aguuguauug uu 2222524RNAHomo sapiens 225ucccugagac ccuuuaaccu guga
2422622RNAHomo sapiens 226uuuggucccc uucaaccagc ug 2222722RNAHomo
sapiens 227uuuggucccc uucaaccagc ua 2222822RNAHomo sapiens
228ucguaccgug aguaauaaug cg 2222922RNAHomo sapiens 229uguaacagca
acuccaugug ga 2223023RNAHomo sapiens 230ugucugcccg caugccugcc ucu
2323122RNAHomo sapiens 231uagcagcaca ucaugguuua ca 2223222RNAHomo
sapiens 232uccagcauca gugauuuugu ug 2223322RNAHomo sapiens
233uccuucauuc caccggaguc ug 2223422RNAHomo sapiens 234ucaccagccc
uguguucccu ag 2223523RNAHomo sapiens 235aaggagcuua caaucuagcu ggg
2323622RNAHomo sapiens 236uggcagugua uuguuagcug gu 2223722RNAHomo
sapiens 237acuggacuua gggucagaag gc 2223822RNAHomo sapiens
238uuauaaagca augagacuga uu 2223923RNAHomo sapiens 239uaaaucccau
ggugccuucu ccu 2324022RNAHomo sapiens 240aaaaugguuc ccuuuagagu gu
2224122RNAHomo sapiens 241aggcggggcg ccgcgggacc gc 2224222RNAHomo
sapiens 242cagugcaaug uuaaaagggc au 2224322RNAHomo sapiens
243cagugcaaug augaaagggc au 2224422RNAHomo sapiens 244ucuucucugu
uuuggccaug ug 2224520RNAHomo sapiens 245guccgcucgg cgguggccca
2024623RNAHomo sapiens 246aucgcugcgg uugcgagcgc ugu 2324722RNAHomo
sapiens 247uggugggccg cagaacaugu gc 2224822RNAHomo sapiens
248uucccuuugu cauccuaugc cu 2224921RNAHomo sapiens 249caagucacua
gugguuccgu u 2125022RNAHomo sapiens 250agucauugga ggguuugagc ag
2225122RNAHomo sapiens 251uggaguguga caaugguguu ug 2225222RNAHomo
sapiens 252uaugugggau gguaaaccgc uu 2225322RNAHomo sapiens
253ugguuuaccg ucccacauac au 2225422RNAHomo sapiens 254aacccguaga
uccgaacuug ug 2225523RNAHomo sapiens 255agcugguguu gugaaucagg ccg
2325622RNAHomo sapiens 256cagugguuuu acccuauggu ag 2225722RNAHomo
sapiens 257uuuguucguu cggcucgcgu ga 2225823RNAHomo sapiens
258uacugcauca ggaacugauu gga 2325923RNAHomo sapiens 259aaagugcugc
gacauuugag cgu 2326023RNAHomo sapiens 260uuuggcacua gcacauuuuu gcu
2326122RNAHomo sapiens 261ucggauccgu cugagcuugg cu 2226223RNAHomo
sapiens 262uauggcuuuu cauuccuaug uga 2326321RNAHomo sapiens
263uacaguacug ugauaacuga a 2126420RNAHomo sapiens 264ccucugggcc
cuuccuccag 2026523RNAHomo sapiens 265cgcauccccu agggcauugg ugu
2326620RNAHomo sapiens 266acugccccag gugcugcugg 2026723RNAHomo
sapiens 267ucaagagcaa uaacgaaaaa ugu 2326822RNAHomo sapiens
268uaacacuguc ugguaaagau gg 2226978RNAHomo sapiens 269cuuucuacac
agguugggau cgguugcaau gcuguguuuc uguaugguau ugcacuuguc 60ccggccuguu
gaguuugg 7827075RNAHomo sapiens 270ucaucccugg guggggauuu guugcauuac
uuguguucua uauaaaguau ugcacuuguc 60ccggccugug gaaga 7527172RNAHomo
sapiens 271ugucggguag cuuaucagac ugauguugac uguugaaucu cauggcaaca
ccagucgaug 60ggcugucuga ca 7227277RNAHomo sapiens 272guggccucgu
ucaaguaauc caggauaggc ugugcagguc ccaaugggcc uauucuuggu 60uacuugcacg
gggacgc 7727384RNAHomo sapiens 273ggcuguggcu ggauucaagu aauccaggau
aggcuguuuc caucugugag gccuauucuu 60gauuacuugu uucuggaggc agcu
8427471RNAHomo sapiens 274uguucuaagg ugcaucuagu gcagauagug
aaguagauua gcaucuacug cccuaagugc 60uccuucuggc a 7127587RNAHomo
sapiens 275ugagggcccc ucugcguguu cacagcggac cuugauuuaa ugucuauaca
auuaaggcac 60gcggugaaug ccaagagagg cgccucc 8727685RNAHomo sapiens
276aggccucucu cuccguguuc acagcggacc uugauuuaaa uguccauaca
auuaaggcac 60gcggugaaug ccaagaaugg ggcug 85277109RNAHomo sapiens
277aucaagauua gaggcucugc ucuccguguu cacagcggac cuugauuuaa
ugucauacaa 60uuaaggcacg cggugaaugc caagagcgga gccuacggcu gcacuugaa
10927881RNAHomo sapiens 278cccauuggca uaaacccgua gauccgaucu
uguggugaag uggaccgcac aagcucgcuu 60cuaugggucu gugucagugu g
8127989RNAHomo sapiens 279accaugcugu agugugugua aacauccuac
acucucagcu gugagcucaa gguggcuggg 60agaggguugu uuacuccuuc ugccaugga
8928072RNAHomo sapiens 280agauacugua aacauccuac acucucagcu
guggaaagua agaaagcugg gagaaggcug 60uuuacucuuu cu 7228186RNAHomo
sapiens 281acugcuaacg aaugcucuga cuuuauugca cuacuguacu uuacagcuag
cagugcaaua 60guauugucaa agcaucugaa agcagg 8628288RNAHomo sapiens
282caccuugucc ucacggucca guuuucccag gaaucccuua gaugcuaaga
uggggauucc 60uggaaauacu guucuugagg ucaugguu 88283106RNAHomo sapiens
283gcgcagcgcc cugucuccca gccugaggug cagugcugca ucucugguca
guugggaguc 60ugagaugaag cacuguagcu caggaagaga gaaguuguuc ugcagc
10628469RNAHomo sapiens 284gggauacuca aaaugggggc gcuuuccuuu
uugucuguac ugggaagugc uucgauuuug 60ggguguccc 6928569RNAHomo sapiens
285aguaccaaag ugcucauagu gcagguaguu uuggcaugac ucuacuguag
uaugggcacu 60uccaguacu 6928688RNAHomo sapiens 286aucucuuaca
caggcugacc gauuucuccu gguguucaga gucuguuuuu gucuagcacc 60auuugaaauc
gguuaugaug uaggggga 8828781RNAHomo sapiens 287cuucaggaag cugguuucau
auggugguuu agauuuaaau agugauuguc uagcaccauu 60ugaaaucagu guucuugggg
g 8128881RNAHomo sapiens 288cuucuggaag cugguuucac augguggcuu
agauuuuucc aucuuuguau cuagcaccau 60uugaaaucag uguuuuagga g
8128984RNAHomo sapiens 289aggcugaggu aguaguuugu acaguuugag
ggucuaugau accacccggu acaggagaua 60acuguacagg ccacugccuu gcca
8429080RNAHomo sapiens 290ugggaugagg uaguagguug uauaguuuua
gggucacacc caccacuggg agauaacuau 60acaaucuacu gucuuuccua
8029172RNAHomo sapiens 291agguugaggu aguagguugu auaguuuaga
auuacaucaa gggagauaac uguacagccu 60ccuagcuuuc cu 7229274RNAHomo
sapiens 292gggugaggua guagguugua uaguuugggg cucugcccug cuaugggaua
acuauacaau 60cuacugucuu uccu 7429383RNAHomo sapiens 293cggggugagg
uaguagguug ugugguuuca gggcagugau guugccccuc ggaagauaac 60uauacaaccu
acugccuucc cug 83294119RNAHomo sapiens 294aggauucugc ucaugccagg
gugagguagu aaguuguauu guuguggggu agggauauua 60ggccccaauu agaagauaac
uauacaacuu acuacuuucc cuggugugug gcauauuca 11929571RNAHomo sapiens
295gcgacuguaa acauccucga cuggaagcug ugaagccaca gaugggcuuu
cagucggaug 60uuugcagcug c 7129684RNAHomo sapiens
296gucagaauaa ugucaaagug cuuacagugc agguagugau augugcaucu
acugcaguga 60aggcacuugu agcauuaugg ugac 8429771RNAHomo sapiens
297ugggaaacau acuucuuuau augcccauau ggaccugcua agcuauggaa
uguaaagaag 60uauguaucuc a 7129885RNAHomo sapiens 298accuacucag
aguacauacu ucuuuaugua cccauaugaa cauacaaugc uauggaaugu 60aaagaaguau
guauuuuugg uaggc 85299110RNAHomo sapiens 299gccgagaccg agugcacagg
gcucugaccu augaauugac agccagugcu cucgucuccc 60cucuggcugc caauuccaua
ggucacaggu auguucgccu caaugccagc 11030065RNAHomo sapiens
300cuguuaaugc uaaucgugau agggguuuuu gccuccaacu gacuccuaca
uauuagcauu 60aacag 6530190RNAHomo sapiens 301ucucaggcug ugaccuucuc
gaggaaagaa gcacuuucug uugucugaaa gaaaagaaag 60ugcuuccuuu cagaggguua
cgguuugaga 9030290RNAHomo sapiens 302ucucagguug ugaccuucuc
gaggaaagaa gcacuuucug uugucugaaa gaaaagaaag 60ugcuuccuuu cagaggguua
cgguuugaga 9030371RNAHomo sapiens 303ggagaggagg caagaugcug
gcauagcugu ugaacuggga accugcuaug ccaacauauu 60gccaucuuuc c
71304110RNAHomo sapiens 304ugaguuuuga gguugcuuca gugaacauuc
aacgcugucg gugaguuugg aauuaaaauc 60aaaaccaucg accguugauu guacccuaug
gcuaaccauc aucuacucca 110305110RNAHomo sapiens 305agaagggcua
ucaggccagc cuucagagga cuccaaggaa cauucaacgc ugucggugag 60uuugggauuu
gaaaaaacca cugaccguug acuguaccuu gggguccuua 110306110RNAHomo
sapiens 306ccugugcaga gauuauuuuu uaaaagguca caaucaacau ucauugcugu
cgguggguug 60aacugugugg acaagcucac ugaacaauga augcaacugu ggccccgcuu
11030789RNAHomo sapiens 307cugauggcug cacucaacau ucauugcugu
cgguggguuu gagucugaau caacucacug 60aucaaugaau gcaaacugcg gaccaaaca
89308110RNAHomo sapiens 308cggaaaauuu gccaaggguu ugggggaaca
uucaaccugu cggugaguuu gggcagcuca 60ggcaaaccau cgaccguuga guggacccug
aggccuggaa uugccauccu 11030977RNAHomo sapiens 309agucuaguua
cuaggcagug uaguuagcug auugcuaaua guaccaauca cuaaccacac 60ggccagguaa
aaagauu 7731084RNAHomo sapiens 310gugcucgguu uguaggcagu gucauuagcu
gauuguacug uggugguuac aaucacuaac 60uccacugcca ucaaaacaag gcac
8431178RNAHomo sapiens 311uacugcccuc ggcuucuuua cagugcugcc
uuguugcaua uggaucaagc agcauuguac 60agggcuauga aggcauug
7831278RNAHomo sapiens 312uugugcuuuc agcuucuuua cagugcugcc
uuguagcauu caggucaagc agcauuguac 60agggcuauga aagaacca
78313110RNAHomo sapiens 313acccggcagu gccuccaggc gcagggcagc
cccugcccac cgcacacugc gcugccccag 60acccacugug cgugugacag cggcugaucu
gugccugggc agcgcgaccc 11031489RNAHomo sapiens 314gucagcagug
ccuuagcagc acguaaauau uggcguuaag auucuaaaau uaucuccagu 60auuaacugug
cugcugaagu aagguugac 8931581RNAHomo sapiens 315guuccacucu
agcagcacgu aaauauuggc guagugaaau auauauuaaa caccaauauu 60acugugcugc
uuuaguguga c 8131671RNAHomo sapiens 316gcgacuguaa acauccucga
cuggaagcug ugaagccaca gaugggcuuu cagucggaug 60uuugcagcug c
7131771RNAHomo sapiens 317ggagaggagg caagaugcug gcauagcugu
ugaacuggga accugcuaug ccaacauauu 60gccaucuuuc c 71318110RNAHomo
sapiens 318gcugcuggaa gguguaggua cccucaaugg cucaguagcc aguguagauc
cugucuuucg 60uaaucagcag cuacaucugg cuacuggguc ucugauggca ucuucuagcu
11031984RNAHomo sapiens 319gucagaauaa ugucaaagug cuuacagugc
agguagugau augugcaucu acugcaguga 60aggcacuugu agcauuaugg ugac
8432084RNAHomo sapiens 320gucagaauaa ugucaaagug cuuacagugc
agguagugau augugcaucu acugcaguga 60aggcacuugu agcauuaugg ugac
8432195RNAHomo sapiens 321ccagcucggg cagccguggc caucuuacug
ggcagcauug gauggaguca ggucucuaau 60acugccuggu aaugaugacg gcggagcccu
gcacg 9532268RNAHomo sapiens 322cccucgucuu acccagcagu guuugggugc
gguugggagu cucuaauacu gccggguaau 60gauggagg 6832382RNAHomo sapiens
323ugagcuguug gauucggggc cguagcacug ucugagaggu uuacauuucu
cacagugaac 60cggucucuuu uucagcugcu uc 8232484RNAHomo sapiens
324ugugcagugg gaaggggggc cgauacacug uacgagagug aguagcaggu
cucacaguga 60accggucucu uucccuacug uguc 8432571RNAHomo sapiens
325ugcccuagca gcgggaacag uucugcagug agcgaucggu gcucuggggu
auuguuuccg 60cugccagggu a 7132698RNAHomo sapiens 326cgaggggaua
cagcagcaau ucauguuuug aaguguucua aaugguucaa aacgugaggc 60gcugcuauac
ccccucgugg ggaagguaga aggugggg 9832787RNAHomo sapiens 327agcuucccug
gcucuagcag cacagaaaua uuggcacagg gaagcgaguc ugccaauauu 60ggcugugcug
cuccaggcag gguggug 87328119RNAHomo sapiens 328agucagccug uugaagcuuu
gaagcuuuga ugccaggcau ugacuucuca cuagcuguga 60aaguccuagc uaaagagaag
ucaaugcaug acaucuuguu ucaauagaug gcuguuuca 119329110RNAHomo sapiens
329guguugggga cucgcgcgcu ggguccagug guucuuaaca guucaacagu
ucuguagcgc 60aauugugaaa uguuuaggac cacuagaccc ggcgggcgcg gcgacagcga
11033071RNAHomo sapiens 330gccaacccag uguucagacu accuguucag
gaggcucuca auguguacag uagucugcac 60auugguuagg c 7133171RNAHomo
sapiens 331gccaacccag uguucagacu accuguucag gaggcucuca auguguacag
uagucugcac 60auugguuagg c 71332110RNAHomo sapiens 332ccagaggaca
ccuccacucc gucuacccag uguuuagacu aucuguucag gacucccaaa 60uuguacagua
gucugcacau ugguuaggcu gggcuggguu agacccucgg 11033380RNAHomo sapiens
333cugggggcuc caaagugcug uucgugcagg uagugugauu acccaaccua
cugcugagcu 60agcacuuccc gagcccccgg 80334119RNAHomo sapiens
334aggauucugc ucaugccagg gugagguagu aaguuguauu guuguggggu
agggauauua 60ggccccaauu agaagauaac uauacaacuu acuacuuucc cuggugugug
gcauauuca 11933586RNAHomo sapiens 335ugccagucuc uaggucccug
agacccuuua accugugagg acauccaggg ucacagguga 60gguucuuggg agccuggcgu
cuggcc 8633688RNAHomo sapiens 336acaaugcuuu gcuagagcug guaaaaugga
accaaaucgc cucuucaaug gauuuggucc 60ccuucaacca gcuguagcua ugcauuga
88337102RNAHomo sapiens 337gggagccaaa ugcuuugcua gagcugguaa
aauggaacca aaucgacugu ccaauggauu 60ugguccccuu caaccagcug uagcugugca
uugauggcgc cg 102338119RNAHomo sapiens 338ccucagaaga aagaugcccc
cugcucuggc uggucaaacg gaaccaaguc cgucuuccug 60agagguuugg uccccuucaa
ccagcuacag cagggcuggc aaugcccagu ccuuggaga 11933985RNAHomo sapiens
339cgcuggcgac gggacauuau uacuuuuggu acgcgcugug acacuucaaa
cucguaccgu 60gaguaauaau gcgccgucca cggca 8534085RNAHomo sapiens
340augguguuau caaguguaac agcaacucca uguggacugu guaccaauuu
ccaguggaga 60ugcuguuacu uuugaugguu accaa 8534185RNAHomo sapiens
341ugguucccgc ccccuguaac agcaacucca uguggaagug cccacugguu
ccaguggggc 60ugcuguuauc uggggcgagg gccag 8534295RNAHomo sapiens
342ggucucugug uugggcgucu gucugcccgc augccugccu cucuguugcu
cugaaggagg 60caggggcugg gccugcagcu gccugggcag agcgg 9534398RNAHomo
sapiens 343uugaggccuu aaaguacugu agcagcacau caugguuuac augcuacagu
caagaugcga 60aucauuauuu gcugcucuag aaauuuaagg aaauucau
9834467RNAHomo sapiens 344ucuccaacaa uauccuggug cugagugaug
acucaggcga cuccagcauc agugauuuug 60uugaaga 67345110RNAHomo sapiens
345aaagauccuc agacaaucca ugugcuucuc uuguccuuca uuccaccgga
gucugucuca 60uacccaacca gauuucagug gagugaaguu caggaggcau ggagcugaca
11034675RNAHomo sapiens 346gugagggcau gcaggccugg auggggcagc
ugggaugguc caaaagggug gccucaccag 60cccuguguuc ccuag 7534788RNAHomo
sapiens 347aacugcccuc aaggagcuua caaucuagcu ggggguaaau gacuugcaca
ugaacacaac 60uagacuguga gcuucuagag ggcaggga 8834891RNAHomo sapiens
348cuguguguga ugagcuggca guguauuguu agcugguuga auaugugaau
ggcaucggcu 60aacaugcaac ugcugucuua uugcauauac a 9134990RNAHomo
sapiens 349gagagaagca cuggacuuag ggucagaagg ccugagucuc ucugcugcag
augggcucuc 60ugucccugag ccaagcuuug uccucccugg 9035095RNAHomo
sapiens 350uuguaccugg ugugauuaua aagcaaugag acugauuguc auaugucguu
ugugggaucc 60gucucaguua cuuuauagcc auaccuggua ucuua 9535183RNAHomo
sapiens 351gcccuagcuu gguucuaaau cccauggugc cuucuccuug ggaaaaacag
agaaggcacu 60augagauuua gaaucaaguu agg 8335287RNAHomo sapiens
352ucucaggcug ugucccucua gagggaagcg cuuucuguug ucugaaagaa
aagaaaaugg 60uucccuuuag aguguuacgc uuugaga 8735393RNAHomo sapiens
353ccuuccggcg ucccaggcgg ggcgccgcgg gaccgcccuc gugucugugg
cggugggauc 60ccgcggccgu guuuuccugg uggcccggcc aug 9335489RNAHomo
sapiens 354ugcugcuggc cagagcucuu uucacauugu gcuacugucu gcaccuguca
cuagcagugc 60aauguuaaaa gggcauuggc cguguagug 8935582RNAHomo sapiens
355ggccugcccg acacucuuuc ccuguugcac uacuauaggc cgcugggaag
cagugcaaug 60augaaagggc aucggucagg uc 8235686RNAHomo sapiens
356auuaggagag uaucuucucu guuuuggcca uguguguacu cacagccccu
cacacauggc 60cgaaacagag aaguuacuuu ccuaau 8635795RNAHomo sapiens
357gucgaggccg uggcccggaa guggucgggg ccgcugcggg cggaagggcg
ccugugcuuc 60guccgcucgg cgguggccca gccaggcccg cggga 9535898RNAHomo
sapiens 358uggccgacgg ggcgcgcgcg gccuggaggg gcggggcgga cgcagagccg
cguuuagucu 60aucgcugcgg uugcgagcgc uguagggagc cugugcug
9835981RNAHomo sapiens 359ggguaagugg aaagauggug ggccgcagaa
caugugcuga guucgugcca uaugucugcu 60gaccaucacc uuuagaagcc c
81360110RNAHomo sapiens 360ggcuacaguc uuucuucaug ugacucgugg
acuucccuuu gucauccuau gccugagaau 60auaugaagga ggcugggaag gcaaagggac
guucaauugu caucacuggc 11036181RNAHomo sapiens 361gggcuuucaa
gucacuagug guuccguuua guagaugauu gugcauuguu ucaaaauggu 60gcccuaguga
cuacaaagcc c 8136297RNAHomo sapiens 362uuagguaauu ccuccacuca
aaacccuuca gugacuucca ugacaugaaa uaggaaguca 60uuggaggguu ugagcagagg
aaugaccugu uuuaaaa 9736385RNAHomo sapiens 363ccuuagcaga gcuguggagu
gugacaaugg uguuuguguc uaaacuauca aacgccauua 60ucacacuaaa uagcuacugc
uaggc 8536463RNAHomo sapiens 364aagaaauggu uuaccguccc acauacauuu
ugaauaugua ugugggaugg uaaaccgcuu 60cuu 6336580RNAHomo sapiens
365ccuguugcca caaacccgua gauccgaacu ugugguauua guccgcacaa
gcuuguaucu 60auagguaugu gucuguuagg 8036699RNAHomo sapiens
366cccuggcaug gugugguggg gcagcuggug uugugaauca ggccguugcc
aaucagagaa 60cggcuacuuc acaacaccag ggccacacca cacuacagg
99367100RNAHomo sapiens 367ugugucucuc ucuguguccu gccagugguu
uuacccuaug guagguuacg ucaugcuguu 60cuaccacagg guagaaccac ggacaggaua
ccggggcacc 10036864RNAHomo sapiens 368ccccgcgacg agccccucgc
acaaaccgga ccugagcguu uuguucguuc ggcucgcgug 60aggc 64369110RNAHomo
sapiens 369aguauaauua uuacauaguu uuugaugucg cagauacugc aucaggaacu
gauuggauaa 60gaaucaguca ccaucaguuc cuaaugcauu gccuucagca ucuaaacaag
11037067RNAHomo sapiens 370gugggccuca aauguggagc acuauucuga
uguccaagug gaaagugcug cgacauuuga 60gcgucac 6737178RNAHomo sapiens
371uggccgauuu uggcacuagc acauuuuugc uugugucucu ccgcucugag
caaucaugug 60cagugccaau augggaaa 7837297RNAHomo sapiens
372ugugaucacu gucuccagcc ugcugaagcu cagagggcuc ugauucagaa
agaucaucgg 60auccgucuga gcuuggcugg ucggaagucu caucauc
9737397RNAHomo sapiens 373cacucugcug uggccuaugg cuuuucauuc
cuaugugauu gcugucccaa acucauguag 60ggcuaaaagc caugggcuac agugaggggc
gagcucc 9737475RNAHomo sapiens 374ugcccuggcu caguuaucac agugcugaug
cugucuauuc uaaagguaca guacugugau 60aacugaagga uggca 7537579RNAHomo
sapiens 375acuguccuuu uucgguuauc augguaccga ugcuguauau cugaaaggua
caguacugug 60auaacugaag aaugguggu 7937695RNAHomo sapiens
376cucaucuguc uguugggcug gaggcagggc cuuugugaag gcggguggug
cucagaucgc 60cucugggccc uuccuccagc cccgaggcgg auuca 9537783RNAHomo
sapiens 377cugacuaugc cuccccgcau ccccuagggc auugguguaa agcuggagac
ccacugcccc 60aggugcugcu ggggguugua guc 8337883RNAHomo sapiens
378cugacuaugc cuccccgcau ccccuagggc auugguguaa agcuggagac
ccacugcccc 60aggugcugcu ggggguugua guc 8337994RNAHomo sapiens
379uguuuugagc gggggucaag agcaauaacg aaaaauguuu gucauaaacc
guuuuucauu 60auugcuccug accuccucuc auuugcuaua uuca 9438095RNAHomo
sapiens 380cggccggccc uggguccauc uuccaguaca guguuggaug gucuaauugu
gaagcuccua 60acacugucug guaaagaugg cucccgggug gguuc 9538117RNAHomo
sapiens 381gugggggaga ggcuguc 1738222RNAHomo sapiens 382ugcaacgaac
cugagccacu ga 2238322RNAHomo sapiens 383uagguuaucc guguugccuu cg
2238421RNAHomo sapiens 384gugccagcug caguggggga g 2138520RNAHomo
sapiens 385guccgcucgg cgguggccca 2038623RNAHomo sapiens
386ccaguuaccg cuuccgcuac cgc 2338717RNAHomo sapiens 387acauugccag
ggaguuu 1738822RNAHomo sapiens 388uugcauaguc acaaaaguga uc
2238917RNAHomo sapiens 389uugucugcug aguuucc 1739023RNAHomo sapiens
390agguuacccg agcaacuuug cau 2339122RNAHomo sapiens 391ugggucuuug
cgggcgagau ga 2239219RNAHomo sapiens 392aagugugcag ggcacuggu
1939322RNAHomo sapiens 393uaaugccccu aaaaauccuu au 2239423RNAHomo
sapiens 394uaauccuugc uaccugggug aga 2339522RNAHomo sapiens
395aguggggaac ccuuccauga gg 2239622RNAHomo sapiens 396acaguagucu
gcacauuggu ua 2239722RNAHomo sapiens 397acaguagucu gcacauuggu ua
2239823RNAHomo sapiens 398cccaguguuc agacuaccug uuc 2339923RNAHomo
sapiens 399cccaguguuc agacuaccug uuc 2340021RNAHomo sapiens
400auuugugcuu ggcucuguca c 2140123RNAHomo sapiens 401aaagugcugc
gacauuugag cgu 2340223RNAHomo sapiens 402gaagugcuuc gauuuugggg ugu
2340322RNAHomo sapiens 403ucuucucugu uuuggccaug ug 2240422RNAHomo
sapiens 404uggguggucu ggagauuugu gc 2240523RNAHomo sapiens
405uaaggugcau cuagugcaga uag 2340623RNAHomo sapiens 406gagggucuug
ggagggaugu gac 2340721RNAHomo sapiens 407agaggauacc cuuuguaugu u
2140820RNAHomo sapiens 408uaaagagccc uguggagaca 2040922RNAHomo
sapiens 409aacuggcccu caaagucccg cu 2241020RNAHomo sapiens
410cuuccucguc ugucugcccc 2041121RNAHomo sapiens 411uuaauaucgg
acaaccauug u 2141222RNAHomo sapiens 412gccugcuggg guggaaccug gu
2241322RNAHomo sapiens 413caaaaaccac aguuucuuuu gc 2241480RNAHomo
sapiens 414ccucugugag aaagggugug ggggagaggc ugucuugugu cuguaaguau
gccaaacuua 60uuuuccccaa ggcagaggga 8041579RNAHomo sapiens
415ccuuaauccu ugcaacgaac cugagccacu gauucaguaa aauacucagu
ggcacauguu 60uguugugagg gucaaaaga 7941684RNAHomo sapiens
416gugguacuug aagauagguu auccguguug ccuucgcuuu auuugugacg
aaucauacac 60gguugaccua uuuuucagua ccaa 8441783RNAHomo sapiens
417ccugcugcag aggugccagc ugcagugggg gaggcacugc cagggcugcc
cacucugcuu 60agccagcagg ugccaagaac agg
8341895RNAHomo sapiens 418gucgaggccg uggcccggaa guggucgggg
ccgcugcggg cggaagggcg ccugugcuuc 60guccgcucgg cgguggccca gccaggcccg
cggga 9541991RNAHomo sapiens 419ggcgggggcg cgggcggcag uggcgggagc
ggccccucgg ccauccuccg ucugcccagu 60uaccgcuucc gcuaccgccg ccgcucccgc
u 9142065RNAHomo sapiens 420aaaaggcgag acauugccag ggaguuuauu
uuguagcucu cuugauaaaa uguuuuagca 60aacac 6542190RNAHomo sapiens
421cucacagcug ccagugucau uuuugugauc ugcagcuagu auucucacuc
caguugcaua 60gucacaaaag ugaucauugg cagguguggc 9042287RNAHomo
sapiens 422agcgguggcc agugucauuu uugugauguu gcagcuagua auaugagccc
aguugcauag 60ucacaaaagu gaucauugga aacugug 8742367RNAHomo sapiens
423auggaggugg agagucauca gcagcacuga gcaggcagug uugucugcug
aguuuccacg 60ucauuug 6742479RNAHomo sapiens 424ugguacucgg
ggagagguua cccgagcaac uuugcaucug gacgacgaau guugcucggu 60gaaccccuuu
ucgguauca 7942588RNAHomo sapiens 425cgaggauggg agcugagggc
ugggucuuug cgggcgagau gagggugucg gaucaacugg 60ccuacaaagu cccaguucuc
ggcccccg 8842694RNAHomo sapiens 426aucacagaca ccuccaagug ugcagggcac
uggugggggc cggggcaggc ccagcgaaag 60ugcaggaccu ggcacuuagu cggaagugag
ggug 9442787RNAHomo sapiens 427accgcaggga aaaugaggga cuuuuggggg
cagauguguu uccauuccac uaucauaaug 60ccccuaaaaa uccuuauugc ucuugca
8742884RNAHomo sapiens 428gcucccccuc ucuaauccuu gcuaccuggg
ugagagugcu gucugaaugc aaugcaccug 60ggcaaggauu cugagagcga gagc
8442984RNAHomo sapiens 429uugacuuagc uggguagugg ggaacccuuc
caugaggagu agaacacucc uuaugcaaga 60uucccuucua ccuggcuggg uugg
8443071RNAHomo sapiens 430gccaacccag uguucagacu accuguucag
gaggcucuca auguguacag uagucugcac 60auugguuagg c 71431110RNAHomo
sapiens 431aggaagcuuc uggagauccu gcuccgucgc cccaguguuc agacuaccug
uucaggacaa 60ugccguugua caguagucug cacauugguu agacugggca agggagagca
11043271RNAHomo sapiens 432gccaacccag uguucagacu accuguucag
gaggcucuca auguguacag uagucugcac 60auugguuagg c 71433110RNAHomo
sapiens 433aggaagcuuc uggagauccu gcuccgucgc cccaguguuc agacuaccug
uucaggacaa 60ugccguugua caguagucug cacauugguu agacugggca agggagagca
11043491RNAHomo sapiens 434uuuucaaagc aaugugugac agguacaggg
acaaaucccg uuaauaagua agaggauuug 60ugcuuggcuc ugucacaugc cacuuugaaa
a 9143567RNAHomo sapiens 435gugggccuca aauguggagc acuauucuga
uguccaagug gaaagugcug cgacauuuga 60gcgucac 6743669RNAHomo sapiens
436gggauacuca aaaugggggc gcuuuccuuu uugucuguac ugggaagugc
uucgauuuug 60ggguguccc 6943786RNAHomo sapiens 437auuaggagag
uaucuucucu guuuuggcca uguguguacu cacagccccu cacacauggc 60cgaaacagag
aaguuacuuu ccuaau 8643871RNAHomo sapiens 438agguuguucu ggguggucug
gagauuugug cagcuuguac cugcacaaau cuccggacca 60cuuagucuuu a
7143971RNAHomo sapiens 439uguucuaagg ugcaucuagu gcagauagug
aaguagauua gcaucuacug cccuaagugc 60uccuucuggc a 7144097RNAHomo
sapiens 440gggacuuguc acugccuguc uccucccucu ccagcagcga cuggauucug
gaguccaucu 60agagggucuu gggagggaug ugacuguugg gaagccc
9744186RNAHomo sapiens 441uuugguacuu gaagagagga uacccuuugu
auguucacuu gauuaauggc gaauauacag 60ggggagacuc uuauuugcgu aucaaa
8644286RNAHomo sapiens 442uuugguacuu aaagagagga uacccuuugu
auguucacuu gauuaauggc gaauauacag 60ggggagacuc ucauuugcgu aucaaa
8644383RNAHomo sapiens 443ccccagcuag guaaagagcc cuguggagac
accuggauuc agagaacaug ucuccacuga 60gcacuugggc cuugauggcg gcu
8344483RNAHomo sapiens 444guggucucag aaucgggguu uugagggcga
gaugaguuua uguuuuaucc aacuggcccu 60caaagucccg cuuuuggggu cau
8344583RNAHomo sapiens 445gugaguggga gccccagugu gugguugggg
ccauggcggg ugggcagccc agccucugag 60ccuuccucgu cugucugccc cag
8344679RNAHomo sapiens 446gugcuuaaag aauggcuguc cguaguaugg
ucucuauauu uaugaugauu aauaucggac 60aaccauuguu uuaguaucc
7944775RNAHomo sapiens 447agacagagaa gccaggucac gucucugcag
uuacacagcu cacgagugcc ugcuggggug 60gaaccugguc ugucu 7544897RNAHomo
sapiens 448aaacaaguua uauuagguug gugcaaaagu aauugugguu uuugccugua
aaaguaaugg 60caaaaaccac aguuucuuuu gcaccagacu aauaaag
9744922RNAHomo sapiens 449acuuuaacau ggaagugcuu uc 2245023RNAHomo
sapiens 450aagugccgcc aucuuuugag ugu 2345122RNAHomo sapiens
451ugugacuggu ugaccagagg gg 2245221RNAHomo sapiens 452ugauugucca
aacgcaauuc u 2145322RNAHomo sapiens 453uagguuaucc guguugccuu cg
2245423RNAHomo sapiens 454uuaaugcuaa ucgugauagg ggu 2345522RNAHomo
sapiens 455uauugcacau uacuaaguug ca 2245621RNAHomo sapiens
456gugcauugua guugcauugc a 2145721RNAHomo sapiens 457cauuauuacu
uuugguacgc g 2145822RNAHomo sapiens 458ucggauccgu cugagcuugg cu
2245922RNAHomo sapiens 459uaacagucua cagccauggu cg 2246023RNAHomo
sapiens 460uuauugcuua agaauacgcg uag 2346123RNAHomo sapiens
461uacccuguag aaccgaauuu gug 2346223RNAHomo sapiens 462uguaguguuu
ccuacuuuau gga 2346322RNAHomo sapiens 463ucccugagac ccuaacuugu ga
2246422RNAHomo sapiens 464uugcauaguc acaaaaguga uc 2246523RNAHomo
sapiens 465aacauucaac gcugucggug agu 2346622RNAHomo sapiens
466ugagguagua gguuguauag uu 2246722RNAHomo sapiens 467ugagguagua
gguugugugg uu 2246821RNAHomo sapiens 468aacauagagg aaauuccacg u
2146921RNAHomo sapiens 469uugugcuuga ucuaaccaug u 2147020RNAHomo
sapiens 470uaaggcacgc ggugaaugcc 2047124RNAHomo sapiens
471ucccugagac ccuuuaaccu guga 2447223RNAHomo sapiens 472ucuuugguua
ucuagcugua uga 2347323RNAHomo sapiens 473uaaagugcuu auagugcagg uag
2347422RNAHomo sapiens 474cagugcaaug uuaaaagggc au 2247523RNAHomo
sapiens 475aaagugcugc gacauuugag cgu 2347622RNAHomo sapiens
476acucaaaaug ggggcgcuuu cc 2247722RNAHomo sapiens 477uaacacuguc
ugguaaagau gg 2247823RNAHomo sapiens 478cccaguguuc agacuaccug uuc
2347923RNAHomo sapiens 479agcuacauug ucugcugggu uuc 2348022RNAHomo
sapiens 480ugucaguuug ucaaauaccc ca 2248121DNAHomo sapiens
481aagactgcgt tcgaatccat a 21
* * * * *