U.S. patent application number 16/930945 was filed with the patent office on 2020-11-19 for microfluidic devices and methods for use thereof in multicellular assays of secretion.
This patent application is currently assigned to The University of British Columbia. The applicant listed for this patent is The University of British Columbia. Invention is credited to Daniel J. Da Costa, Carl L. G. Hansen, Kevin Albert HEYRIES, Veronique LECAULT, Kathleen Lisaingo, Brad NELSON, Julie NIELSEN, Oleh PETRIV, Marketa RICICOVA, Anupam Singhal, Hans ZAHN.
Application Number | 20200363401 16/930945 |
Document ID | / |
Family ID | 1000004991619 |
Filed Date | 2020-11-19 |
United States Patent
Application |
20200363401 |
Kind Code |
A1 |
RICICOVA; Marketa ; et
al. |
November 19, 2020 |
Microfluidic Devices and Methods for Use Thereof in Multicellular
Assays of Secretion
Abstract
Methods and devices are provided herein for identifying a cell
population comprising an effector cell that exerts an extracellular
effect. In one embodiment the method comprises retaining in a
microreactor a cell population comprising one or more effector
cells, wherein the contents of the microreactor further comprise a
readout particle population comprising one or more readout
particles, incubating the cell population and the readout particle
population within the microreactor, assaying the cell population
for the presence of the extracellular effect, wherein the readout
particle population or subpopulation thereof provides a direct or
indirect readout of the extracellular effect, and determining,
based on the results of the assaying step, whether one or more
effector cells within the cell population exerts the extracellular
effect on the readout particle. If an extracellular effect is
measured, the cell population is recovered for further analysis to
determine the cell or cells responsible for the effect.
Inventors: |
RICICOVA; Marketa;
(Vancouver, CA) ; HEYRIES; Kevin Albert;
(Vancouver, CA) ; ZAHN; Hans; (Munich, DE)
; PETRIV; Oleh; (Richmond, CA) ; LECAULT;
Veronique; (Vancouver, CA) ; Singhal; Anupam;
(Mississauga, CA) ; Da Costa; Daniel J.; (Pitt
Meadows, CA) ; Hansen; Carl L. G.; (Vancouver,
CA) ; NELSON; Brad; (Victoria, CA) ; NIELSEN;
Julie; (Victoria, CA) ; Lisaingo; Kathleen;
(Port Moody, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The University of British Columbia |
Vancouver |
|
CA |
|
|
Assignee: |
The University of British
Columbia
Vancouver
CA
|
Family ID: |
1000004991619 |
Appl. No.: |
16/930945 |
Filed: |
July 16, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14773244 |
Sep 4, 2015 |
10725024 |
|
|
PCT/CA2014/000304 |
Mar 28, 2014 |
|
|
|
16930945 |
|
|
|
|
61806329 |
Mar 28, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 5/0634 20130101;
B01L 2300/0627 20130101; B01L 3/502738 20130101; C07K 2317/14
20130101; G01N 33/54313 20130101; C07K 2317/21 20130101; G01N
35/0099 20130101; C07K 16/40 20130101; B01L 3/50273 20130101; B01L
2300/14 20130101; B01L 2300/04 20130101; B01L 2300/0838 20130101;
C07K 16/00 20130101; B01L 2300/0887 20130101; B01L 2300/0877
20130101; B01L 2200/0647 20130101; C07K 2317/70 20130101; B01L
3/502761 20130101; G01N 33/6845 20130101; C12N 5/0635 20130101;
B01L 2200/12 20130101; C07K 16/1018 20130101; G01N 33/5047
20130101; B01L 3/502715 20130101; C12Q 1/6888 20130101; G01N
33/6854 20130101 |
International
Class: |
G01N 33/50 20060101
G01N033/50; B01L 3/00 20060101 B01L003/00; C07K 16/40 20060101
C07K016/40; G01N 33/543 20060101 G01N033/543; C07K 16/10 20060101
C07K016/10; C07K 16/00 20060101 C07K016/00; C12N 5/078 20060101
C12N005/078; C12N 5/0781 20060101 C12N005/0781; C12Q 1/6888
20060101 C12Q001/6888; G01N 33/68 20060101 G01N033/68; G01N 35/00
20060101 G01N035/00 |
Claims
1-218. (canceled)
219. A method of identifying an antibody secreting cell (ASC) that
secretes a virus neutralizing antibody, comprising: retaining in a
plurality of microreactors a plurality of cell populations, wherein
individual cell populations of the plurality comprise one or more
ASCs, wherein the contents of individual microreactors of the
plurality of microreactors each comprise a readout particle
population comprising one or more readout particles, and wherein
the individual cell populations are retained in the individual
microreactors; introducing a plurality of accessory particle
populations into the individual microreactors, wherein individual
accessory particle populations of the plurality comprise a
plurality of virus particles and the individual accessory particle
populations are retained in individual microreactors; incubating
the individual cell populations, the readout particle populations
and the accessory particle populations within the individual
microreactors to provide secreted antibodies; assaying the
individual microreactors for the presence of a virus neutralizing
antibody, determining, based on the results of the assaying step,
whether one or more of the cell populations comprises an ASC that
secretes a virus neutralizing antibody.
220. The method of claim 219, wherein the readout particle
population comprises a homogeneous population of readout
particles.
221. The method of claim 219, wherein the readout particle
population comprises a heterogeneous population of readout
particles.
222. The method of claim 220, wherein the homogeneous population of
readout particles comprises a homogeneous population of readout
cells.
223. The method of claim 221, wherein the heterogeneous population
of readout particles comprises a heterogeneous population of
readout cells.
224. The method of claim 219, wherein the readout particle
population or subpopulation thereof is immobilized on a surface of
the individual microreactors.
225. The method of claim 219, further comprising maintaining the
individual cell populations in substantially a single plane.
226. The method of claim 219, further comprising maintaining the
readout particle populations in substantially a single plane.
227. The method of claim 219, wherein the plurality of accessory
particles further comprise a fluorescent substrate, fluorophore, a
secondary antibody, or a combination thereof.
228. The method of claim 219, wherein the individual accessory
particle populations of the plurality are heterogeneous accessory
particle populations.
229. The method of claim 219, wherein the plurality of virus
particles is engineered to include a fluorescent protein expressed
by a readout cell following virus infection of the readout
cell.
230. The method of claim 219, wherein assaying the individual
microreactors comprises assaying the morphology of the readout
particle populations.
231. The method of claim 219, wherein assaying the individual
microreactors comprises assaying binding of the secreted antibodies
to the virus particles.
232. The method of claim 219, wherein assaying the individual
microreactors comprises assaying the expression of fluorescent
proteins within the readout particle populations that are
upregulated during viral infection.
233. The method of claim 219, wherein assaying the individual
microreactors comprises assaying the death of the readout particle
populations.
234. The method of claim 219, further comprising substantially
isolating the individual microreactors from their surrounding
environments.
235. The method of claim 219, wherein if a cell population
comprises an ASC that secretes a virus neutralizing antibody, the
method further comprises recovering the cell population comprising
the ASC that secretes the virus neutralizing antibody or a portion
thereof to obtain a recovered cell population.
236. The method of claim 230, wherein the recovering step comprises
positioning the open end of a microcapillary in a microreactor
comprising the cell population comprising the ASC that secretes the
virus neutralizing antibody and aspirating the microreactor's
contents or a portion thereof to obtain a recovered aspirated cell
population.
237. The method of claim 236, wherein the microcapillary is mounted
on a robotic micromanipulation system on a microscope or the
microcapillary is controlled robotically.
238. The method of claim 235, further comprising, retaining a
plurality of cell subpopulations originating from the recovered
cell population in a plurality of vessels, wherein each cell
subpopulation is present in an individual vessel, lysing the
individual cell subpopulations to provide lysed cell
subpopulations, and amplifying one or more nucleic acids within
each of the lysed cell populations.
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This is a divisional of U.S. application Ser. No.
14/773,244, filed Sep. 4, 2015, which is the national stage entry
of PCT/CA2014/000304, filed Mar. 28, 2014, which claims priority
from U.S. Provisional Application Ser. No. 61/806,329, filed Mar.
28, 2013, the disclosure of each of which is incorporated by
reference in their entirety for all purposes.
BACKGROUND OF THE INVENTION
[0002] The cell is the fundamental unit of life and no two cells
are identical. For example, differences in genotype, phenotype
and/or morphological property can contribute to cellular
heterogeneity. Indeed, "seemingly identical" clonal populations of
cells have been shown to display phenotypic differences among cells
within the population. Cellular differences exist across all levels
of life, ranging from bacterial cells to partially differentiated
cells (for example, adult stem and progenitor cells) to highly
differentiated mammalian cells (for example, immune cells).
Differences in cellular state, function and responses can arise
from a variety of mechanisms including different histories,
different differentiation states, epigenetic variations, cell cycle
effects, stochastic variations, differences in genomic sequence,
gene expression, protein expression and differing cell interaction
effects.
[0003] Conventional bulk cellular analyses, including measurements
of expressed proteins or RNA, are performed by averaging very large
numbers of cells, typically greater than 1000 cells per individual
assay). This averaging of a cellular population masks the
heterogeneity that exists within a cell population and obscures the
underlying biological features of the individual cells within the
population. There are many examples where such averaged
measurements are inadequate. For example, measuring a cellular
process in a cell population may be complicated by the responses of
individual cells, which may be asynchronous, thus blurring the
dynamics of the process. For example, the presence of dominant, yet
phenotypically distinct subpopulations of cells can result in a
population measurement that poorly reflects the internal states of
the majority of cells in the population. See, e.g., Altschuler and
Wu. (2010). Cell 141, pp. 559-563.
[0004] Existing methods for isolating populations of unique cell
types are often limited in the purity of the population that is
achievable. For example, enriched populations of primary
multipotent stem cells rarely achieve better than 50% functional
purity and are often well below 10% pure, so that the molecular
signatures of these cells are obscured by large, and often
overwhelming contamination from other cell types. Many cell types
interact with each other, both through direct contact and through
secreted factors, to promote survival, death, differentiation or
some other function, and these interactions are difficult to
isolate and study in a mixture comprising a large number of cells.
Additionally, cells may have differences in their genomic sequences
and/or cellular state that result in different levels or types of
expressed mRNA or proteins. If analyzed in a bulk population, the
particular cell with a unique cellular state or having the
expressed mRNA or protein of interest, although of high value for
industrial purposes, is very difficult or impossible to isolate
from the population.
[0005] To overcome the deficiencies of bulk population cell
analysis, single cell assay platforms have been developed. For
example, microfluidic devices have been used to study single cells
in the past (Lecault et al. (2012). Curr. Opin. Chem. Biol. 16, pp.
381-390). Ma et al. (Nat Med, 17, pp. 738-743 (2011)) applied a
single cell barcode chip to simultaneously measure multiple
cytokines (e.g., IL-10, TNF-.beta., IFN-.gamma.) from human
macrophages and cytotoxic T lymphocytes (CTLs) obtained from both
healthy donors and a metastatic melanoma patient. Microfabricated
chamber arrays have also been used to screen and select B cells
secreting antigen-specific antibodies from both immunized humans
and mice (Story et al. (2009). Proc. Natl. Acad. Sci. U.S.A. 105,
pp. 17902-17907; Jin et al. (2009). Nat. Med. 15, pp. 1088-1092).
In this approach, single B cells were arrayed on a surface
containing tens of thousands of microfabricated wells
(.about.10-100 .mu.m deep), where the well surfaces were
functionalized with capture antibodies. After incubation of cells
on the well surfaces for less than 3 hours, the surfaces were
washed with fluorescently labeled antigen and scanned in order to
identify antigen-specific B cells. These cells were then manually
recovered from the arrays by a microcapillary in order to amplify,
sequence, and clone the antibody-encoding genes from these
cells.
[0006] Two-phase microfluidic devices have also been applied to the
analysis of secreted proteins from single immune cells by
encapsulating them in sub-nanoliter aqueous droplets separated by a
stream of oil (Konry et al. (2011). Biosens. Bioelectron. 26, pp.
2702-2710). These droplets can be analyzed in a flow-through format
similar to FACS, and thus provide an opportunity for ultra-high
throughput detection of secreted proteins from single cells.
Water-in-oil emulsions have also been used to study cellular
paracrine signaling by co-encapsulating cells in
microfluidic-generated agarose beads (Tumarkin et al. (2011).
Integr. Biol. 3, pp. 653-662). Microfluidic droplet generation also
has been used for drug screening and development by enabling
viability analysis of encapsulated single cells exposed to
different compositions (Brouzes et al. (2009). Proc. Natl. Acad.
Sci. U.S.A. 106, pp. 14195-14200).
[0007] Antibodies are molecules naturally produced by the immune
system of humans or animals to fight off infection and disease.
This is achieved by the unique ability of the immune system to
generate an immense diversity of antibodies, each with the ability
to recognize and bind a specific target (e.g., protein, virus,
bacteria). This unmatched specificity is also what makes antibodies
extremely potent and low side-effect drugs with clinically approved
therapies for a wide array of conditions including cancer,
autoimmune disorders, inflammation, neurology, and infection. In
comparison to conventional small molecule drugs, antibodies offer
several advantages including superior pharmacokinetics, fewer side
effects, improved tolerability, and much higher success rates in
clinical trials (27% vs. 7% for small molecules). (Reichert (2009).
Mabs 1, pp. 387-389.) It is for this reason that antibodies are
also by far the fastest growing class of drugs, with a total global
market that was $50B in 2012 and that is growing at a rate of 9%
per year. (Nelson et al. (2010). Nat. Rev. Drug Disc. 9(10), pp.
767-774.)
[0008] The discovery of antibodies with optimal therapeutic
properties, and in particular antibodies that target surface
receptors, remains a serious bottleneck in drug development. In
response to immunization, an animal can make millions of different
monoclonal antibodies (mAbs). Each mAb is produced by a single cell
called an antibody-secreting cell (ASC), and each ASC makes only
one type of mAb. Accordingly, antibody analysis, for example, for
drug discovery purposes lends itself to single cell analyses.
However, even if an ASC is analyzed individually, and not within a
bulk population of cells, because a single ASC generates only a
minute amount of antibody, when analyzed in the volume of
conventional assay formats, the antibody is too dilute, making it
completely undetectable. Accordingly, new methods for studying
individual ASCs and their secreted antibodies are needed. The
present invention addresses this and other needs.
SUMMARY OF THE INVENTION
[0009] The present invention provides a microfluidic platform for
the analysis of an extracellular effect attributable to single
effector cell. The effector cell, in one embodiment, is a cell that
secretes a biological factor, for example, an antibody (an ASC). In
a further embodiment, microfluidic analysis of the effector cell is
an extracellular effect assay carried out on a cell population
comprising the single effector cell.
[0010] In one aspect, a method of identifying a cell population
comprising an effector cell having an extracellular effect is
provided. In one embodiment, the method comprises retaining in a
microreactor a cell population comprising one or more effector
cells, wherein the contents of the microreactor further comprise a
readout particle population comprising one or more readout
particles, incubating the cell population and the one or more
readout particles within the microreactor, assaying the cell
population for the presence of the extracellular effect, wherein
the readout particle population or subpopulation thereof provides a
direct or indirect readout of the extracellular effect, and
determining, based on the results of the assaying step, whether one
or more effector cells within the cell population exhibits the
extracellular effect. In a further embodiment, the microreactor is
a microfluidic chamber. In even a further embodiment, the
microfluidic chamber is part of a microfluidic structure that
includes membrane valves.
[0011] In this aspect, the effector cell is a cell that secretes a
biological factor, e.g., an antibody. It is not necessary that the
specific effector cell or effector cells, having the particular
extracellular effect be initially identified so long as the
presence of the extracellular effect is detected within a
particular microreactor. That is, some or all of the cells in the
microreactor where the effect is measured can be recovered if
desired for further characterization to identify the specific cells
providing the extracellular effect.
[0012] In one embodiment, if it is determined that a cell
population comprising one or more effector cells exhibit the
extracellular effect, the cell population or portion thereof is
recovered to obtain a recovered cell population. Recovery, in one
embodiment, comprises piercing the microfluidic chamber comprising
the cell population comprising the one or more cells that exhibit
the extracellular effect, with a microcapillary and aspirating the
chamber's contents or a portion thereof to obtain a recovered
aspirated cell population.
[0013] In one embodiment, if it is determined that a cell
population comprising one or more effector cells exhibit the
extracellular effect, the cell population or portion thereof is
recovered to obtain a recovered cell population, and the recovered
cell population is further analyzed as cell subpopulations. The
method, in one embodiment comprises retaining a plurality of cell
subpopulations originating from the recovered cell population in
separate chambers of a microfluidic device, wherein each of the
separate chambers comprises a readout particle population
comprising one or more readout particles, incubating the individual
cell subpopulations and the readout particle population within the
chambers, and assaying the individual cell subpopulations for the
presence of a second extracellular effect. The readout particle
population or a subpopulation thereof provide a readout of the
second extracellular effect and the second extracellular effect is
the same extracellular effect or a different extracellular effect
as the extracellular effect measured on the recovered cell
population. Once the cell subpopulations are incubated and assayed,
the method further comprises identifying, based on the results of
the assaying step, a cell subpopulation from amongst the plurality
that comprises one or more cells that exhibit the second
extracellular effect on the readout particle population, or a
subpopulation thereof.
[0014] In another aspect, the present invention relates to a method
of identifying a cell population displaying a variation in an
extracellular effect. In one embodiment, the method comprises,
retaining a plurality of individual cell populations in separate
microfluidic chambers, wherein at least one of the individual cell
populations comprises one or more effector cells and the contents
of the separate microfluidic chambers further comprise a readout
particle population comprising one or more readout particles,
incubating the individual cell populations and the readout particle
population within the microfluidic chambers, assaying the
individual cell populations for the presence of the extracellular
effect, wherein the readout particle population or subpopulation
thereof provides a readout of the extracellular effect. Once the
cell populations are incubated and assayed, the method comprises
identifying, based on the results of the assay, a cell population
from amongst the plurality that exhibits a variation in the
extracellular effect, as compared to one or more of the remaining
cell populations of the plurality. In a further embodiment, the one
or more effector cells comprise an antibody secreting cell. In
another embodiment, the one or more effector cells comprise a
plasma cell, B cell, plasmablast, a cell generated through the
expansion of memory B cell, a hybridoma cell, a T cell, CD8+ T
cell, and CD4+ T cell, a recombinant cell engineered to produce
antibodies, a recombinant cell engineered to express a T cell
receptor, or a combination thereof.
[0015] One or more cell populations exhibiting the extracellular
effect or variation in the extracellular effect, in one embodiment,
are recovered to obtain one or more recovered cell populations.
Recovery, for example, is carried out with a microcapillary. Once
one or more individual cell populations are identified and
recovered, the one or more individual cell populations are further
analyzed to determine the cell or cells responsible for the
observed extracellular effect. In one embodiment, the method
comprises retaining a plurality of cell subpopulations originating
from the one or more recovered cell populations in separate
chambers of a microfluidic device. Each of the separate chambers
comprises a readout particle population comprising one or more
readout particles. The individual cell subpopulations are incubated
with the readout particle population within the chambers. The
individual cell subpopulations are assayed for a variation of a
second extracellular effect, wherein the readout particle
population or subpopulation thereof provides a readout of the
second extracellular effect. The second extracellular effect is the
same extracellular effect or a different extracellular effect as
the extracellular effect measured on the recovered cell population.
Based on the second extracellular effect assay, one or more
individual cell subpopulations are identified that exhibit a
variation in the second extracellular effect. The one or more
individual cell subpopulations in one embodiment are then recovered
for further analysis. Extracellular effect assays are described
throughout.
[0016] In one embodiment, cells from a recovered cell population or
recovered cell subpopulation are retained in a plurality of vessels
as cell subpopulations or sub-subpopulations, and each cell
subpopulation or cell sub-subpopulation is present in an individual
vessel. The individual subpopulations or sub-subpopulations are
lysed to provide and one or more nucleic acids within each lysed
cell subpopulation or lysed cell sub-subpopulation are amplified.
In a further embodiment, the one or more nucleic acids comprise an
antibody gene.
[0017] In one embodiment of the methods described herein, the
incubating step includes exchanging the medium in the respective
microreactors (e.g., microfluidic chambers) comprising the
individual cell populations or subpopulations. Medium exchange is
carried out, for example, to maintain the viability of the cells in
the chamber or to provide reagents for carrying out an
extracellular effect assay, or to perform multiple extracellular
effect assays in a serial manner.
[0018] Incubating, in one embodiment, comprises incubating the cell
populations or cell subpopulations with a plurality of accessory
particles. The plurality of accessory particles is provided, for
example, as additional reagents for the extracellular effect assay
or to maintain cell viability. In one embodiment, the plurality of
accessory particles comprises sphingosine-1-phosphate,
lysophosphatidic acid, growth factor, cytokine, chemokine,
neurotransmitter, virus particle, secondary antibody, fluorescent
particle, a fluorescent substrate, a complement pathway inducing
factor, a virus particle or an accessory cell. The accessory cell,
in one embodiment, is a fibroblast cell, natural killer (NK) cell,
killer T cell, antigen presenting cell, dendritic cell, recombinant
cell, or a combination thereof.
[0019] The extracellular effect measured by the methods and devices
described herein in one embodiment, is binding of an effector cell
or molecule secreted by an effector cell to a cell surface protein,
antagonism of a cell surface receptor, or agonism of a cell surface
receptor present on a readout cell (a type of readout particle). In
a further embodiment, the cell surface receptor is a receptor
tyrosine kinase (RTK), a G-protein coupled receptor (GPCR),
receptor serine-threonine kinase, receptor tyrosine phosphatase or
a receptor guanylyl cyclase. The GPCR is not limited by class or
species. For example, the GPCR, in one embodiment, is a GPCR
provided in Table 3A or 3B, herein.
[0020] In another embodiment, the extracellular effect measured by
the methods and devices described herein, is binding of an effector
cell or molecule secreted by an effector cell to an ion channel,
antagonism of an ion channel, or agonism of an ion channel. The ion
channel, in one embodiment, is a GABAA, Glycine (GlyR), serotonin
(5-HT), nicotinic acetylcholine (nAChR), zinc-activated ion
channel, ionotropic glutamate, AMPA, kainite, NMDA receptor or an
ATP gated channel
[0021] Where the extracellular effect is binding, agonism or
antagonism of a cell surface receptor or ion channel, the effect in
one embodiment is measured by detection of an increase in
intracellular cAMP or calcium, expression of a protein reporter, or
localization of a protein within a readout cell expressing the cell
surface receptor or ion channel.
[0022] The extracellular effect in another embodiment, is a binding
interaction between a molecule secreted by the one or more effector
cells or a subset thereof, to one or more readout particles or one
or more accessory particles, modulation of apoptosis, modulation of
cell proliferation, a change in a morphological appearance of the
readout particle, a change in localization of a protein within the
readout particle, expression of a protein by the readout particle,
neutralization of an accessory particle operable to affect the
readout particle or a combination thereof.
[0023] In some embodiments, the extracellular effect is an effect
of a cell product, secreted by an effector cell. The extracellular
effect is binding interaction between a protein produced by an
effector cell and either a readout particle or accessory particle.
For example, the effector cell in one embodiment is an antibody
secreting cell (ASC), and the readout or accessory particle
comprises an epitope or an antigen. The binding interaction, in one
embodiment, is a measure of one or more of antigen-antibody binding
specificity, antigen-antibody binding affinity, and
antigen-antibody binding kinetics. In another embodiment, the
effector cell is an activated T cell that secretes a cytokine, and
the readout particle includes one or more antibodies to capture the
secreted cytokines.
[0024] The above methods and devices may be used to screen or
select for cells are that may be rare, e.g. less than 1% of the
cells in the population, or from about 1% to about 10% or from
about 5% to about 10% of the cells being screened or selected.
[0025] In another aspect, functional antibodies and receptors
discoverable by the methods herein are provided. In one embodiment
of this aspect, the nucleic acid of an effector cell responsible
for an extracellular effect is amplified and sequenced. The nucleic
acid is a gene encoding for an secreted biomolecule (e.g.,
antibody, or fragment thereof), or a gene encoding a cell receptor
or fragment thereof, for example a T-cell receptor. The antibody or
fragment thereof or cell receptor or fragment thereof can be cloned
and/or sequenced by methods known in the art.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] FIG. 1 a process flow diagram for one embodiment of a
microfluidic approach for single effector cell identification and
selection based on a microfluidic multicellular assay. Single cells
are obtained from any animal and are optionally enriched for an
effector cell population. High-throughput microfluidic analysis is
used to perform functional screens on antibodies secreted from
single effector cells, in some cases, present in heterogeneous cell
populations. After one or multiple rounds of microfluidic analysis,
cells are recovered and antibody variable region genes are
amplified for sequencing (Vh/Vl) and cloning into cell lines. This
process allows for the screening of over 100,000 cells in a single
day, with sequences recovered on week later.
[0027] FIG. 2 is a process flow diagram for one embodiment of a
microfluidic effector cell enrichment method. Effector cells are
first loaded at an average concentration of 25 cells per chamber
and incubated to create polyclonal mixtures of antibodies.
Screening of polyclonal mixtures is used to identify chambers
having a variation in an extracellular effect (e.g., binding,
affinity, or functional activity). Forty positive chambers are then
recovered to achieve an enriched population with .about.4% of
effector cells making antibodies of interest. The effector cells of
the enriched population are then analyzed in a second array at
limiting dilution to select a single ASC(s) having the variation in
the extracellular effect. The time required for enrichment is about
4 hours and total screening throughput is 100,000 cells per run.
Enrichment process may be performed twice if needed, and may use
the same or different properties for each screen.
[0028] FIG. 3 shows top and cross-sectional view schematic diagrams
of a method of identifying the presence of an effector cell that
produces a biomolecule capable of specifically binding a target
readout particle according to an embodiment of the invention.
[0029] FIG. 4 shows top and cross-sectional view schematic diagrams
of a method of identifying the presence of at least one effector
cell that produces a biomolecule (e.g. antibody) that binds
specifically to malignant cells but not normal cells.
[0030] FIG. 5 shows top and cross-sectional view schematic diagrams
according to one embodiment of the invention of a method of
identifying the presence of an effector cell that produces a
biomolecule that binds to a readout cell where a subpopulation of
effector cells are functionalized to also act as readout cells.
[0031] FIG. 6 is a schematic diagram of an antibody tetramer.
[0032] FIG. 7 shows top and cross-sectional view schematic diagrams
of a method of screening for a target epitope/molecule to which an
known biomolecule binds according to an embodiment of the
invention.
[0033] FIG. 8 shows top and cross-sectional view schematic diagrams
of a method of identifying the presence of an effector cell which
produces an antibody that specifically binds a target
epitope/antigen according to an embodiment of the invention.
[0034] FIG. 9 shows top and cross-sectional view schematic diagrams
of a method of quantifying cell lysis.
[0035] FIG. 10 shows top and cross-sectional view schematic
diagrams of a method of identifying the presence of an effector
cell which produces an antibody that specifically binds a target
epitope/antigen according to an embodiment of the invention.
[0036] FIG. 11 shows top and cross-sectional view schematic
diagrams of a method of quantifying cell lysis.
[0037] FIG. 12 shows top and cross-sectional view schematic
diagrams of a method of identifying the presence of an effector
cell which produces a biomolecule that induces growth of readout
cells.
[0038] FIG. 13 shows top and cross-sectional view schematic
diagrams of a method of identifying the presence of an effector
cell which produces a biomolecule that stimulates readout cells to
undergo apoptosis.
[0039] FIG. 14 shows top and cross-sectional view schematic
diagrams of a method of identifying the presence of an effector
cell which produces a biomolecule that stimulates autophagy in
readout.
[0040] FIG. 15 shows top and cross-sectional view schematic
diagrams of a method of identifying the presence of an effector
cell which produces a biomolecule that neutralizes a cytokine of
interest.
[0041] FIG. 16 shows top and cross-sectional view schematic
diagrams of a method of identifying the presence of an effector
cell which produces a biomolecule that inhibits the ability of a
virus to infect a cell.
[0042] FIG. 17 shows top and cross-sectional view schematic
diagrams of a method of identifying the presence of an effector
cell which produces a biomolecule that inhibits the function of a
target enzyme according to an embodiment of the invention.
[0043] FIG. 18 shows top and cross-sectional view schematic of a
method of identifying presence of an effector cell that displays a
molecule that elicits the activation of a second type of effector
cell, which in turn secretes molecules that have an effect on a
readout particle.
[0044] FIG. 19 shows top and cross-sectional view schematic
diagrams of a method of identifying presence of an effector cell
that secretes a molecule that elicits the activation of a second
type of effector cell, which in turn secretes molecules that have
an effect on a readout particle.
[0045] FIG. 20 shows top and cross-sectional view schematic
diagrams of a method to detect the presence of at least one
effector cell secreting an antibody with high affinity from a
heterogeneous population of cells containing cells that secrete an
antibody for the same antigen but with lower affinity.
[0046] FIG. 21 shows top and cross-sectional view schematic
diagrams of a method of screening for antibodies with increased
specificity for an antigen according to an embodiment of the
invention in which readout particles displaying different epitopes
are distinguishable by different optical characteristics.
[0047] FIG. 22 shows top and cross-sectional view schematic
diagrams of a method of simultaneously identifying the presence of
a cell secreting a biomolecule in a homogeneous or heterogeneous
population of effector cells and analyzing one or more
intracellular compounds affected by the molecule.
[0048] FIG. 23 is a top view schematic diagram of a method of
evaluating the extracellular effect of an effector cell on multiple
sets of readout particles simultaneously.
[0049] FIG. 24 is an alignment of the extracellular domain for
PDGFRa across human, rabbit, mouse and rat. (Top) Ribbon diagram
showing structure of extracellular domain (ECD) of two PDGFR.beta.
in complex with a dimer of PDGFBB (from Shim et al. (2010). Proc.
Natl. Acad. Sci. U.S.A. 107, pp. 11307-11312, incorporated by
reference herein in its entirety). Note, a PDGFR.beta. is shown
since a similar structure for PDGFR.alpha. is expected but was not
available. (Bottom) Alignment of ECD for PDGFR.alpha. across human
(SEQ ID NO. 79), mouse (SEQ ID NO. 80), rabbit (SEQ ID NO. 81), rat
(SEQ ID NO. 82). Regions of variation from the human isoform are
denoted by lighter shading and "*". The substantial variation
indicates there are numerous epitopes available for antibody
recognition, with rabbit having the most variation from human.
[0050] FIG. 25 provides images showing various aspects of
multilayer soft lithography microfluidics. (A) Optical micrograph
of a valve made using MSL. Two crossing microfabricated channels,
one "flow channel" for the active fluids (vertical) and one control
channel for valve actuation (horizontal), create a valve structure.
The flow channel is separated from the control channels by a thin
elastomeric membrane to create a "pinch valve". Pressurization of
the control channel deflects the membrane to close off the flow
channel. (B) Section of a device integrating multiple valves
(filled with green and blue food dye). (C) Section of a device
fabricated at UBC having a total of 16,000 valves, 4000 chambers,
and over 3000 layer-layer interconnects (arrow). (D) Example of a
microfluidic device with penny for scale.
[0051] FIG. 26 is a schematic of one device of the invention. (A)
Schematic showing the structure of a microfluidic device for
antibody selection from single antibody-secreting cells. (B) Array
of 4,032 analysis chambers. Each chamber is isolated during
incubation and media can be exchanged within minutes. (C) Close up
of an individual chamber. Cells, readout particles and reagents are
injected sequentially, settling down by gravity. Imaging is
performed using automated brightfield/fluorescence microscopy.
[0052] FIG. 27 is a schematic of the layers that are assembled
during one embodiment of device fabrication.
[0053] FIG. 28 (A) Top view and side view of inflatable chamber
design. Chambers have a circular geometry, with a larger circular
"lip" at the top, and are overlaid by a recess separated by a thin
membrane. Valve connecting chambers to a flow channel is sealed and
cells are loaded down the flow channel. (B) Valves to chambers are
opened and pressure is applied to inflate the chambers, causing
cells to enter the tops of chambers. (C) Valves are closed to seal
chambers, and cells fall to the chamber floor. Channel is flushed
with fresh medium. (D) Valves are opened and pressure is released,
causing chambers to "deflate" back to their original volume.
Repetition of this process may be used to exchange medium and/or
add soluble factors.
[0054] FIG. 29 is a schematic diagram of a microfluidic chamber
having a cell fence according to an embodiment of the invention
illustrating the use of laminar flow to direct particles to one
side of the cell fence.
[0055] FIG. 30 is a schematic diagram of a microfluidic chamber
having a cell fence according to an embodiment of the invention
illustrating the use of a restriction upstream of the chamber inlet
to preferentially direct particles to the one side of the inlet
channel.
[0056] FIG. 31 is a schematic depiction of a reusable mold made
from multiple layers of photoresist on a silicon wafer substrate,
which is used for PDMS microfluidic device fabrication.
[0057] FIG. 32 is a schematic diagram of a microfluidic chamber
having a cell fence according to an embodiment of the invention
illustrating the use of a cell fence that selectively separates
particles based on particle size.
[0058] FIG. 33 is a top view of a chamber embodiment with a series
of intersecting cell fences forming an array of wells, defining
multiple effector and readout zones, on the lower surface of the
chamber (overall chamber dimensions are 300 .mu.m.times.160
.mu.m).
[0059] FIG. 34 is a drawing of particle trap embodiment (grid pitch
is 2 .mu.m) for a chamber having two perpendicular cell fences
connected by a generally circular portion defining a particle
trap.
[0060] FIG. 35 is a schematic diagram of a microfluidic chamber
according to an embodiment of the invention illustrating the use of
micro-fabricated structures positioned at the outlet to retain
particles of a certain size in the chamber.
[0061] FIG. 36 is a side view schematic diagram of a microfluidic
chamber comprising dead-end cups at the bottom of the chamber.
[0062] FIG. 37 is a side view schematic diagram of a chamber
according to an embodiment of the invention in which structural
elements are positioned in the flow channel to retain effector
cells and readout particles.
[0063] FIG. 38 is a side view schematic diagram of a chamber
according to an embodiment of the invention in which structural
elements are positioned sequentially in a chamber to segregate and
retain particles on the basis of size.
[0064] FIG. 39 is a top view schematic diagram of a serial, flow
through arrangement of microfluidic chambers in which a porous
membrane is used to separate effector cells from readout
particles.
[0065] FIG. 40 is a top view schematic diagram of a serial, flow
through arrangement of microfluidic chambers in which a layer of
non-functionalized beads is used to separate effector cells from
readout particles.
[0066] FIG. 41 is a schematic diagram of a microfluidic chamber
according to an embodiment of the invention illustrating the use of
a magnetic field to position particles within the chamber.
[0067] FIG. 42 is a schematic diagram of a method of separating
particles according to an embodiment of the invention using a
magnetic field to direct one type of particle to which magnetic
particles are coupled to a position within a chamber while having
little or no effect on particles to which the magnetic particles
are not coupled.
[0068] FIG. 43 is a cross-sectional view of a chamber embodiment
with cell fence, where the chamber has been tipped to facilitate
readout particle (bead) loading into the readout zone.
[0069] FIG. 44 is a schematic diagram of a microfluidic chamber
having a cell fence according to an embodiment of the invention
illustrating the use of rotation of the chamber to preferentially
direct particles to the one side of the fence.
[0070] FIG. 45 is a schematic diagram of a method of separating
effector cells and readout particles according to an embodiment of
the invention using differential density of the effector cell and
readout particle.
[0071] FIG. 46 is a schematic diagram of a microfluidic chamber
comprising an integrated electrode according to an embodiment of
the invention illustrating the use of a dielectric field to
position particles within the chamber.
[0072] FIG. 47 shows a top view schematic diagram of a chamber
according to an embodiment of the invention in which effector cells
and readout particles are introduced to the chamber via separate
inlets.
[0073] FIG. 48 is a top view schematic diagram of a compound
chamber according to an embodiment of the invention in which an
effector zone subchamber and a readout zone sub chamber may be
placed in fluid communication with each other.
[0074] FIG. 49 is a schematic diagram of a method of separating
effector cells and readout particles using surface
functionalization to confine anchorage-dependent readout cells in a
readout zone at the chamber ceiling and gravity to confine
suspension effector cells on the bottom of the chamber.
[0075] FIG. 50 is a top view schematic diagram of a chamber
functionalized to maintain adherent cells on only one side while
suspension cells are segregated to the opposite side by
gravity.
[0076] FIG. 51 is a top view schematic diagram of a chamber
functionalized with two types of antibodies in order to segregate
particles displaying different types of antibodies on their
surface.
[0077] FIG. 52 is a top view schematic diagram of a serial,
"flow-through" arrangement of microfluidic chambers in which each
chamber is isolated from its neighbour by a valve positioned
between the chambers.
[0078] FIG. 53 is a top view schematic diagram of a serial,
"flow-through" arrangement of microfluidic chambers in which each
chamber may be isolated from a flow channel shared by neighboring
chambers by a "lid" structure.
[0079] FIGS. 54 and 55 are top view schematic diagrams of parallel,
"flow-through" arrangements of microfluidic chambers in which
neighboring chambers may share a common inlet channel and outlet
bus channel.
[0080] FIG. 56 is top and side view schematic diagrams of a
"dead-end" filled chamber for used in a parallel arrangement of
microfluidic chambers.
[0081] FIG. 57 is a schematic diagram of a parallel arrangement of
dead-end filled chambers which can provide compound chamber
functionality.
[0082] FIG. 58 are images of a microfluidic instrument for cell
recovery and an image sequence during cell recovery. Top: From left
to right. Optical micrograph of image sequence during cell recovery
with cells in chamber, capillary piercing chamber roof (far left),
empty chamber following aspiration, and capillary dispensing cells
into tube (far right). Bottom left: Image of custom-built
microfluidic screening instrument including (i) Microcapillary
mounted on robotic micromanipulator, (ii) digital pneumatics for
nanoliter flow aspiration/dispensing, (iii) X-Y translation mount,
(iv) incubator insert with mounts for recovery tubes, (v) scanning
X-Y stage for image acquisition across the array, (vi) inverted
microscope, (vii) cooled Hamamatzu CCD camera for high-sensitivity
fluorescent imaging, (viii) control solenoids for capillary
operation. Bottom right: Close up of microfluidic device mounted
beneath incubator insert with capillary positioned for cell
recovery. (C) Optical micrograph of image sequence during cell
recovery with cells in chamber (top left), capillary piercing
chamber roof (top right), empty chamber following aspiration
(bottom left), and capillary dispensing cells into tube (bottom
right). (D) Performance of cell recovery. When operating in Mode I,
multiple chambers are aspirated before dispensing. This is used for
two-step screening (enrichment) of cells or for recovery of pools
of cells. Recovery from each chamber takes approximately 3 seconds.
When operating in Mode II, the contents of a single chamber are
aspirated and dispensed followed by 4 washing steps to ensure no
carryover between single cells.
[0083] FIG. 59 is a schematic of single cell HV/LV approach using
template-switching. Single cells are deposited into microfuge tubes
and cDNA is generated from multiplexed gene-specific primers
targeting the constant region of heavy and light chains.
Template-switching activity of MMLV enzyme is used to append the
reverse complement of a template-switching oligo onto the 3' end of
the resulting cDNA. Semi-nested PCR, using multiplexed primers that
anneal to the constant region of heavy and light chain and a
universal primer complementary to the copied template switching
oligo, is used to amplify cDNA and introduce indexing sequences
that are specific to each single cell amplicon. Amplicons are then
pooled and sequenced.
[0084] FIG. 60 is a schematic of the traditional hybridoma
approach. Splenocytes from immunized mice are fused with myeloma
cells. At a low efficiency, these fusions create viable
"hybridomas" that can secrete mAbs and can be grown in culture.
Pools of hybridomas are grown and assayed to detect presence of
antigen-specific cells, which are then subcloned and expanded to
generate sufficient mAbs for functional screening. This approach
requires a suitable fusion partner and is largely restricted to use
with mice or rats, although a proprietary hybridoma technology has
also been developed for rabbits. Typical fusions result in less
than 100 stable hybridomas and require .about.9 weeks for culture
and subcloning.
[0085] FIG. 61 is an image showing a cross-section view of the
microfluidic chamber array contained within a thin membrane with
labels indicating cell culture chamber, valves, and channel
connecting chambers.
[0086] FIG. 62 is a schematic of the chamber of the microfluidic
device shown in FIG. 61.
[0087] FIG. 63 shows a photograph of a microfluidic device having
8,192 chambers arranged in 4 sub-arrays of 2,048. The microfluidic
chamber array is located directly under the osmotic bath reservoir
within a 300-micron thick layer of elastomer.
[0088] FIG. 64 is a schematic of the microfluidic device shown in
FIG. 62.
[0089] FIG. 65 is a schematic depiction of a microfluidic device
that enables the segregation of effector and target cells.
[0090] FIG. 66 is a schematic depiction of a single unit cell of
the microfluidic device from FIG. 65.
[0091] FIG. 67 is a micrograph of a cross-section taken along the
vertical dashed line of FIG. 66.
[0092] FIG. 68 is a micrograph of a cross-section taken along the
horizontal dashed line of FIG. 66.
[0093] FIG. 69 is a series of schematic diagrams showing an
embodiment for a cytokine neutralization assay.
[0094] FIG. 70A is a top view light microscopy image of a chamber
embodiment with five effector cells shown in the right end of the
effector zone (top) and four readout particles in the readout zone
(bottom).
[0095] FIG. 70B is a top view fluorescence microscopy image of the
chamber embodiment shown in FIG. 70A with some fluorescence
associated with the effector cells at the right end of the effector
zone and fluorescence associated with the four readout particles in
the readout zone.
[0096] FIG. 70C is a top view light microscopy image of a chamber
embodiment with one effector cell shown in the effector zone (left)
and one readout particle in the readout zone (right).
[0097] FIG. 70D is a top view fluorescence microscopy image of the
chamber embodiment shown in FIG. 70C with fluorescence associated
with the readout particle in the readout zone.
[0098] FIG. 70E is a top view light microscopy image of a chamber
embodiment with two effector cells in the effector zone (left) and
six readout particles in the readout zone (right).
[0099] FIG. 70F is a top view fluorescence microscopy image of the
chamber embodiment shown in FIG. 70E with some fluorescence
associated with the readout particles in the readout zone.
[0100] FIG. 71 is a schematic of the workflow for the capture and
detection of antibodies from antibody-secreting cells.
[0101] FIG. 72 Example of fluorescent and bright field images from
the bead immunocapture assay followed by time-lapse imaging of the
clone for 4.5 days.
[0102] FIG. 73 demonstrate robust cell culture of CHO
antibody-secreting cells in the microfluidic array compared to
batch shake flasks and single cells seeded in 96-multiwell
plates.
[0103] FIG. 74A is a light micrograph of a microfluidic chamber
into which a HyHEL5 hybridoma cell secreting an anti-lysozyme
antibody has been loaded (top panel) and a microfluidic chamber
into which the HyHEL5 hybridoma cell has not been loaded (bottom
panel).
[0104] FIG. 74B is a light micrograph of the chambers shown in FIG.
74A into which 4B2 hybridoma cells secreting "background"
antibodies that do not bind lysozyme have been loaded in addition
to HyHEL5 cells.
[0105] FIG. 74C is a fluorescence micrograph of the chambers shown
in FIG. 74B after incubation with fluorescent lysozyme.
[0106] FIG. 74D is a fluorescence micrograph of the chambers shown
in FIG. 18C after incubation with fluorescent anti IgG
antibodies.
[0107] FIG. 74E is a graph showing kinetics of antibody
accumulation and release for the chambers depicted in FIG. 74C.
[0108] FIG. 74F is a graph of the fluorescence of 600 chambers
containing a mix of HyHEL5 and 4B2 hybridoma cells incubated in the
presence of Protein A and 10 nM lysozyme in the growth media
recorded over time.
[0109] FIG. 75A shows three representative examples of the lack of
signal in chambers containing antibody secreting cells but no cell
secreting antibodies against an antigen of interest.
[0110] FIG. 75B shows three representative examples of chambers in
which a single cell secreting an antibody against an antigen of
interest is detected among a background of multiple cells secreting
antibodies that are not specific to the antigen of interest.
[0111] FIG. 75C shows a histogram of the fluorescent signal in all
chambers containing only hybridoma cells that do not secrete
antibodies against the antigen of interest.
[0112] FIG. 75D shows a histogram of the fluorescent signal in
chambers containing a mixture of HyHEL5 hybridoma cells producing
antibodies against an antigen of interest (hen-egg lysozyme) and
DMS-1 hybridoma cells producing an antibody against a different
antigen.
[0113] FIG. 76A is a schematic of a single hybridoma cell (4B2)
secreting an antibody against human CD45 on fixed K562 cells. Cells
and beads are stained with a detection antibody following
incubation.
[0114] FIG. 77B shows the mean fluorescence intensity of readout
cells and beads measured by automated image analysis for empty
chambers and chambers containing a single hybridoma.
[0115] FIG. 77C, from left to right: Chamber with a single
hybridoma cell. Bright field, fluorescent and merged images of
anti-CD45 antibody staining in the same chamber following an
overnight incubation with target fixed K562 cells and a 2-hour
incubation period with protein A beads.
[0116] FIG. 77A is a schematic of an immunization and binding
assays. Mice were immunized with live cells from an ovarian cancer
cells (TOV21G). Antibody-secreting cells were sorted using FACS and
were then injected in the microfluidic device and incubated with
readout cells (fixed and live TOV21G cells) stained with CFSE.
Antibody binding is visualized using a secondary labeled
antibody.
[0117] FIG. 77B shows plasma and readout cells (live and fixed)
after loading on chip. Readout cells are stained with CFSE for
identification. Antibody binding on the cell surface of live and
fixed cells is visualized with a secondary labeled antibody. Far
right shows a negative chamber with very low signal on the readout
cells.
[0118] FIG. 78 is an image showing cell survival and
antibody-secretion by ELISPOT of (A) mouse ASCs grown for 8 days,
and (B) human ASCs grown for 5 days. The number of cells plated per
well is indicated.
[0119] FIG. 79 shows ASC selection from mice immunized with ovarian
carcinoma cells. (A) Plot showing fluorescence-activated cell
sorting of mouse spleen cells stained with PE anti-mouse CD138.
Gating shows CD138+ population. (B) ELISPOT showing antibody
secretion from unsorted spleen control, CD138- control, and CD138+
population. The number of cells plated per well is indicated. (C)
Graph showing ELISPOT counts as % spots per cells plated for each
population.
[0120] FIG. 80 shows ASC selection from rabbits immunized with
influenza. (A) Plot showing fluorescence-activated cell sorting of
rabbit PBMCs using ER-Tracker and mouse anti-rabbit IgG. Gating
shows selection of ER.sup.highIgG.sup.low population. (B) ELISPOT
showing antibody secretion from unsorted PBMCs control,
ER.sup.highIgG.sup.low population, and no cell control. The number
of cells plated per well is indicated. (C) Graph showing ELISPOT
counts as % spots per cells plated for unsorted PBMCs control and
ER.sup.highIgG.sup.low population.
[0121] FIG. 81A shows a representative example of bright field
(top) and fluorescent (bottom) images from an antigen-specific
positive chamber before enrichment.
[0122] FIG. 81B shows cells in a multiwell plate after culture and
recovery overnight.
[0123] FIG. 81C shows a representative example of bright field
(top) and fluorescent (bottom) images of an antigen-specific
positive chamber loaded at single-cell dilution after
enrichment.
[0124] FIG. 81D the frequencies of H1N1- and H3N2-positive chambers
before and after enrichment.
[0125] FIG. 82 is a light microscopy image showing 2 chambers, one
containing multiple effector cells with at least one of them
secreting an antibody (top) and another chamber without any
effector cell (bottom). The readout particles form aggregates when
secreted antibodies present (top) and remain dispersed in the
absence of antibody-secreting effector cell (bottom).
[0126] FIG. 83 is a fluorescence microscopy image showing the two
chambers in 16G, one containing multiple effector cells with at
least one of them secreting an antibody (top) and another chamber
without any effector cell (bottom). Both chambers contain readout
particles (protein A beads) that have been stained with a
fluorescently labelled anti-human antibody to determine the
presence of an extracellular effect.
[0127] FIG. 84A is a diagram of the experiment depicted in Example
13.
[0128] FIG. 84B are optical micrographs of microfluidic chambers
having different concentrations of labeled antigen.
[0129] FIG. 84C is a graph of bead fluorescent intensities at
different concentrations of labeled antigen (hen-egg lysozyme)
after incubation with single hybridoma cells (HyHEL5 and D1.3)
secreting antibodies with different affinities.
[0130] FIG. 84D is a graph showing the bead fluorescent intensities
corresponding to images in FIG. 84B after incubation with single
D1.3 and HyHEL5 cells secreting antibodies with different
affinities and after labeling with different concentrations of
antigen (hen egg lysozyme).
[0131] FIG. 85 show a section of a microfluidic array containing
human plasma cells secreting antibodies against H3N2 after
incubation with a closed valve that maintained each chamber
isolated.
[0132] FIG. 86 show a section of a microfluidic array containing
human plasma cells secreting antibodies against H3N2 after
incubation without using the isolation valve, allowing chambers to
remain connected by the flow channels.
[0133] FIG. 87 shows representative examples of affinity
measurements obtained by microfluidic screening for two single
primary mouse plasma cells producing antibodies against hen-egg
lysozyme.
[0134] FIG. 88 is a bar graph indicating that the remaining
fluorescence level of beads in HyHEL5-positive chambers is higher
than in the rest of the chambers at the end of the wash.
[0135] FIG. 89A is a top view light microscopy example of a chamber
containing a heterogeneous population of cells (erythrocytes and
human B cells).
[0136] FIG. 89B is a top view light microscopy example of a chamber
containing a heterogeneous population of cells and a population of
readout particles (protein A beads).
[0137] FIG. 89C is a top view fluorescence microscopy example of a
chamber showing that at least one cell in the heterogeneous
population secretes human IgG antibodies. The antibody was captured
by the readout particles, which were stained with
Dylight594-conjugated anti-human antibodies.
[0138] FIG. 89D is a top view light microscopy example of a chamber
with a heterogeneous population of cells and a population of
readout particles after flowing the H1N1 antigen into the
chamber.
[0139] FIG. 89E is a top view fluorescence microscopy example of a
heterogeneous population of cells in conjunction with a population
of readout particles (protein A beads) after flowing the H1N1
antigen into the chamber. The H1N1 antigen was conjugated to
Dylight 488 so as to differentiate antigen-specific staining from
whole IgG staining.
[0140] FIG. 89F is a top view light microscopy example of a chamber
after recovery of the cells.
[0141] FIG. 90 shows an example of a chemiluminescent signaling
assay using PathHunter.RTM. eXpress CCR4 CHO-K1 .beta.-Arrestin
GPCR Assay in multiwell plates.
[0142] FIG. 91 is a schematic representation of the experiment.
Human volunteers were immunized with the seasonal flu vaccine
Peripheral blood mononuclear cells (PBMCs) were recovered and
sorted with flow cytometry to enrich for plasma cells. The cells
were injected in the microfluidic device and assayed for H1N1 and
H3N2 specificity.
[0143] FIG. 92 is an example of a single human plasma cell in a
chamber with protein A beads. The secreted antibody captured on the
beads binds to both H1N1 and H3N2 labeled antigens and is therefore
cross-reactive. Labeled anti-human IgG allows visualization of
total IgG secretion.
[0144] FIG. 93 shows an example of a primary human
antibody-secreting cell (top left) identified as producing an
antibody against influenza using a bead assay (bottom left) and
having divided during an overnight incubation in the microfluidic
device (top right).
[0145] FIG. 94 is a picture of a Size Select.RTM. 2% agarose gel of
antibody heavy and light chain gene specific PCR products after
single cell screening in a microfluidic device. Lanes i to iv show
the products of heavy chain PCR amplification of samples 3 to 6,
respectively. Lane v shows the nucleic acid ladder. Lanes vi to
viii show kappa chain PCR amplification of samples 3, 5, and 6,
respectively. Lane ix shows lambda chain PCR amplification of
sample 4.
[0146] FIG. 95A is a gel showing the amplification of both heavy
and light chains from two single cells secreting antibodies against
influenza.
[0147] FIG. 95B shows the variable heavy and light amino acid
sequences from 2 cells secreting antibodies (Hs7 antibody and Hs15
antibody) against H1N1 and H3N2. Hs7 heavy chain amino acid
sequence: SEQ ID NO: 10, Hs7 light chain amino acid sequence: SEQ
ID NO: 12; Hs15 heavy chain amino acid sequence: SEQ ID NO: 14,
Hs15 light chain amino acid sequence: SEQ ID NO: 16.
[0148] FIG. 95C is the functional validation of recombinant human
mAbs that cross-react with both H1N1 and H3N2.
[0149] FIG. 96A shows an example of a chamber with a heterogeneous
population of rabbit plasma cells containing at least one effector
cell secreting an antibody against H1N1 detected by a fluorescent
signal on readout capture beads.
[0150] FIG. 96B shows an example of a chamber with a heterogeneous
population of rabbit plasma cells containing at least one effector
cell secreting an antibody against H3N2 detected by a fluorescent
signal on readout capture beads.
[0151] FIG. 97A shows bright field images of 4 chambers loaded with
a plurality of enriched rabbit plasma cells
[0152] FIG. 97B shows fluorescent images of the chambers in FIG.
123A after H1N1 detection. All chambers are negative and do not
contain cells secreting antibodies against H1N1.
[0153] FIG. 97C shows fluorescent images of the chambers in FIG.
123C after H3N2 detection. Chambers exhibit variable bead
intensities but all of them are positive and contain at least one
cell secreting antibodies against H3N2.
[0154] FIG. 97D is a gel showing the heavy and light chains
amplified from rabbit cells after recovery from the H3N2-positive
microfluidic chambers in FIG. 123C.
[0155] FIG. 98 shows an image of the capillary loaded with
recovered cells approaching the injection port immediately before
re-injection for enrichment
[0156] FIG. 99 shows an example of the validation of human antibody
sequences by cloning, expression and characterization of the
antibodies
[0157] FIG. 100 is a gel showing bands from RT-PCR amplification of
hybridoma single cells recovered from a microfluidic device.
[0158] FIG. 101 is a graph that compares the affinities of anti-hen
egg lysozyme antibodies produced by hybridomas (D1.3 and HyHEL5)
and recombinant expression of the sequences retrieved from single
D1.3 and HyHEL5 hybridoma cells screened in a microfluidic device.
Anti-mouse antibody capture beads were incubated with cell
supernatants from hybridomas or recombinant HEK293 cells expressing
D1.3 and HyHEL5 antibodies, washed and incubated with different
concentrations of the labeled antigen. Fluorescent measurements
were normalized to the maximum bead intensity at the highest
antigen concentration to validate the binding properties of the
recombinantly produced antibodies.
[0159] FIG. 102 is a graph that shows the fluorescent intensity of
beads incubated with the supernatant from HEK293 cells (control) or
HEK293 cells transiently expressing the antibody R05C14, followed
by labeled hen-egg lysozyme (10 nM). The binding of a novel mouse
antibody to hen-egg lysozyme was confirmed after the sequence
R05C14 was obtained from a primary mouse plasma cell identified as
antigen-specific in a microfluidic screen.
[0160] FIG. 103A is an image of a PCR gel showing the amplicons
produced by the methods described in Example 25 using a gradient of
RT temperatures ranging from 60.degree. C. to 40.degree. C.
[0161] FIG. 103B shows the results of Sanger sequencing of the band
from 400 to 600 bp shown in FIG. 103A. The sequence was aligned and
confirmed to match the variable region sequence of the heavy chain
of D1.3.
[0162] FIG. 104A-C are schematic representations of a method for
the functional interpretation of the IgG repertoire based on
next-generation sequencing.
[0163] FIG. 105A is a schematic of antigen detection multiplexing
using beads of different fluorescent intensities
[0164] FIG. 105B is a bright field image of three types of readout
beads loaded in microfluidic chambers.
[0165] FIG. 105C is a fluorescent image of three types of readout
beads with different intensities and antigens in microfluidic
chambers.
[0166] FIG. 105D is a fluorescent image of three types of readout
beads after detection with a rabbit anti-H1N1 antibody and a
secondary anti-rabbit antibody, with only H1N1-coated beads
(arrows) displaying a signal.
[0167] FIG. 105E shows the signal after H1N1 detection on three
types of beads coated with different influenza strains and
distinguished based on their fluorescent intensities.
[0168] FIG. 106A shows the toxicity response of L929 cells in the
presence of actinomycin-D as a function of TNF-.alpha.
concentration.
[0169] FIG. 106B shows an apoptosis and necrosis assay using L929
cells cultured in a microfluidic device in the presence of
TNF-.alpha. and actinomycin-D.
[0170] FIG. 107A shows time-lapse fluorescence microscopy images
from TNF.alpha. functional assay. (A) Upper panel: In the absence
of TNF.alpha. ligand fluorescence localization is cytoplasmic.
Middle panel: Upon activation by TNF.alpha. ligand 10 ng/mL, a
change in fluorescence from cytoplasmic to nuclear is observed.
Lower panel: In the presence of cell supernatant containing an
antibody that neutralizes TNF.alpha. ligand in addition to
TNF.alpha. ligand 10 ng/mL, the fluorescence localization remains
cytoplasmic.
[0171] FIG. 107B is a plot showing frequency of activated cells
exhibiting nuclear fluorescence localization. The number of cells
quantified is indicated, n.
[0172] FIG. 108 shows optical micrographs at 0 days, 1 day and 3
days of SKBR3 cell populations in an individual microfluidic
chambers. SKBR3 cells included an LC3-GFP reporter.
[0173] FIG. 109A shows a bright field image of a chamber containing
a population of peripheral blood mononuclear cells incubated in the
presence of IFN.gamma. capture beads after activation with CEF
peptides.
[0174] FIG. 109B shows a fluorescent image of a chamber containing
at least one activated T cell secreting IFN.gamma. after activation
with CEF peptides.
[0175] FIG. 109C shows a bright field image of a chamber containing
a T cell clone cultured for 5 days after activation with CEF
peptides.
[0176] FIG. 109D shows a higher sensitivity using the microfluidic
assay compared to ELISPOT to measure number of antigen-specific T
cells in a population of peripheral blood mononuclear cells
stimulated with CEF peptides.
[0177] FIG. 110 are fluorescence microscopy images of chambers from
3 subarrays from a cell survival PDGFR.alpha. functional
extracellular effect assay, showing YFP fluorescence readout in
BaF3 clone expressing PDGFR.alpha. and histone 2B-YFP in the
presence of (A) no ligand or (B) PDGF-AA 25 ng/mL for T=48 hours.
Insets show close-up of individual microfluidic chambers. FIG. 110C
shows micrographs of a population of enriched mouse splenocytes (2
cells, black arrow) co-cultured with a population of live readout
cells (BaF3 overexpressing PDGFRA, white arrows) and containing at
least one effector antibody-secreting cell after 12, 24, 36 and 48
hours of culture in a microfluidic device.
[0178] FIG. 111 shows fluorescent images obtained from a
plate-based assay in which PathHunter.RTM. eXpress CCR4 CHO-K1
.beta.-Arrestin GPCR reporter cells were incubated with different
concentrations of the agonist CCL22, followed by different
concentrations of the substrate C.sub.12FDG. Activation of the GPCR
CCR4 caused complementation of the .beta.-galactosidase enzyme,
which in turn cleaved the substrate into a fluorescent product.
[0179] FIG. 112A shows bright field and fluorescent images of a
microfluidic-based GPCR signaling assay in which in which
PathHunter.RTM. eXpress CCR4 CHO-K1 .beta.-Arrestin GPCR reporter
cells were loaded in a microfluidic device, incubated with the
C.sub.12FDG substrate for 90 minute, followed by incubation with
different concentrations of the agonist CCL12 for 90 min.
Activation of the GPCR CCR4 by the agonist caused complementation
of the .beta.-galactosidase enzyme, which in turn cleaved the
substrate into a fluorescent product.
[0180] FIG. 112B is a graph representing the fluorescent intensity
measurements of PathHunter.RTM. eXpress CCR4 CHO-K1 .beta.-Arrestin
GPCR reporter cells incubated with the substrate C.sub.12GDF and
different concentrations of the agonist CCL12, as shown in FIG.
112A.
DETAILED DESCRIPTION OF THE INVENTION
[0181] As used herein, the singular forms "a", "an" and "the"
include plural referents unless the context clearly dictates
otherwise. Thus, for example, reference to "a thing" includes more
than one such thing. Citation of references herein is not an
admission that such references are prior art to the present
invention.
[0182] "Readout," as used herein, refers to the method by which an
extracellular effect is reported. A "readout particle population"
can comprise one or more readout particles, as described
herein.
[0183] "Extracellular effect," as used herein, is a direct or
indirect effect on a readout particle that is extracellular of an
effector cell, including but not limited to increased cellular
proliferation, decreased growth, apoptosis, lysis, differentiation,
infection, binding (e.g., binding to a cell surface receptor or an
epitope), morphology change, induction or inhibition of a signaling
cascade, enzyme inhibition, viral inhibition, cytokine inhibition,
activation of complement. As provided herein, the extracellular
effect in one embodiment is the binding of a biomolecule of
interest, secreted by an effector cell, to a readout particle. In
another embodiment, the extracellular effect is a response such as
apoptosis of a readout cell or accessory cell.
[0184] The methods provided herein are used to identify an effector
cell or cell population comprising an effector cell(s) that
displays a variation in an extracellular effect. The variation in
the extracellular effect is a variation compared to a control
(negative or positive control), or a variation compared to one or
more of other cell populations.
[0185] A "heterogeneous population" as referred to herein,
particularly with respect to a heterogeneous population of
particles or cells, means a population of particles or cells that
includes at least two particles or cells that have a differing
feature. For example, the feature in one embodiment is morphology,
size, type of fluorescent reporter, a different cell species,
phenotype, genotype, cell differentiation type, the sequence of one
or more expressed RNA species or a functional property.
[0186] A "subpopulation," as referred to herein, means a fraction
of a greater population of particles (cells). A population of cells
in one embodiment is divided into subpopulations, for example, by
isolating individual subpopulations in individual microfluidic
chambers. Additionally, an individual subpopulation can be
partitioned into further subpopulations, for example, in a
plurality of microfluidic chambers or other reaction vessels. A
subpopulation may also be a fraction of particles within a greater
population, located in the same microfluidic chamber. A
subpopulation contains one or more particles, and where a plurality
of particles are present in a subpopulation, the individual
particles within the plurality can be homogeneous or heterogeneous
with respect to one another.
[0187] A "cell retainer" in one embodiment, defines at least one
effector zone and at least one readout zone either continuously or
intermittently. The retainer may be a structural element such as a
valve, a cell fence, the orientation in an external field or field
gradient (e.g., gravitational, magnetic, electromagnetic,
acceleration, etc.), the orientation and/or localization of a
locally generated field by an electrode or optical component or
magnetic probe, surface modifications (for example texturing,
coatings, etc.) that facilitate or inhibit cell adhesion, or by the
specific gravity of a solution within the chamber, or may be
achieved by a combination of one or more of the preceding.
[0188] "Coating" as used herein may be any addition to the chamber
surface, which either facilitates or inhibits the ability of an
effector cell or a readout particle to adhere to a surface of the
chamber. The coating may be selected from one or more of the
following: a cell; a polymer brush; a polymer hydrogel; self
assembled monolayers (SAM), photo-grafted molecules, a protein or
protein fragment having cell binding properties (for example, a
cell binding domain from actin, fibronectin, integrin, protein A,
protein G, etc.). More generally
Arginine-glycine-aspartate-(serine) (RGD(S)) peptide sequence motif
are used. Poly-L-Lysine is also widely used as a polymer coating
with PDMS to enhance cell adhesion via electrostatic interactions;
a phospholipid having cell binding properties, a cholesterol having
cell binding properties, a glycoprotein having cell binding
properties and a glycolipid having cell binding properties. In
addition PDMS surface functionalization using biotinylated
biomolecules is a simple, highly attractive and yet flexible
approach. It is widely known that bovine serum albumin (BSA) due to
hydrophobic domains readily adsorbs via hydrophobic effect on
hydrophobic PDMS surfaces enabling further direct coupling of
streptavidin based conjugates in the chambers (protein, DNA,
polymers, fluorophores). Polyethylene glycol based polymers are
also known for their bio-fouling properties and can be coated on
PDMS surface (adsorption, covalent grafting), preventing cell
adhesion. Poly(paraxyxlylene), e.g., parylene C can also be
deposited using chemical vapor deposition (CDV) on PDMS surfaces
and prevent cellular adhesion.
[0189] "Isolated," as used herein, refers the circumstances under
which a given chamber does not permit substantial contamination of
an effector cell and/or readout particle being analyzed with a
particle(s) or biomolecule(s) of another chamber of the
microfluidic device. Such isolation may be achieved, for example,
by sealing a chamber or a set of chambers in the case of compound
chambers, by limiting fluid communication between chambers or by
restricting fluid flow between chambers.
[0190] An "inlet" or an "outlet," as used herein, includes any
aperture whereby fluid flows into and out of a chamber. Fluid flow
may be restricted through the inlet or outlet or both to isolate a
chamber from its surrounding environment. There may be one or more
valves to control flow, or flow may be controlled by restricting
the fluid channels, which lead to the inlets and outlets with a
layer which prevents flow (for example, a control layer or
isolation layer). Alternatively, flow may be regulated by the rate
at which fluids are passed through the device. The inlet or outlet
may also provide fluid flow to the device for the delivery of an
effector cell or readout particle, or other components carried in
the flow as needed during analysis. In some embodiments, the inlet
and outlet may be provided by a single aperture at the top of the
chamber over which fluid flows from an inlet side to an outlet
side.
[0191] A "magnet," as used herein, includes any ferromagnetic or
paramagnetic material. "Ferromagnetic" as used herein is meant to
include materials which may be comprised of iron, nickel, chromium,
or cobalt or combinations thereof and various alloys, such that the
magnetic material is attracted to a magnet or is a magnet itself.
For example, a magnetic material may be made from ferromagnetic
stainless steel or may be made from a rare earth magnet or a
stainless steel having magnetic properties. A magnet may also be
made by use of a ferrofluid in a defined shape or orientation. A
magnet may also be implemented using a coil or other electrically
actuated device designed to generate a magnetic field when
energized with electrical current.
[0192] An "array of wells," as used herein, refers to any array of
structures within a chamber that may limit the movement of an
effector cell and/or a readout particle by localizing one or the
other to a particular readout zone or effector zone, whereby a zone
(i.e., either effector or readout) may be defined by what type of
particle resides within it. For example, one embodiment of an array
of wells is shown in FIG. 33, where a series of intersecting cell
fences form an array of wells on a surface of the chamber.
[0193] A "particle trap," as used herein, refers to a structure
that is capable of spatially confining an effector cell or a
readout particle(s) (bead(s)) to a specific spatial position to
limit movement during an assay. A "cell fence" is one type of
"particle trap." In one embodiment, a particle trap is used to
confine effector cells, in which case it may be referred to as an
"effector cell trap." In some embodiments, a particle trap will be
used to confine readout particles, in which case it may be referred
to as a "readout particle trap", or a "readout cell trap", as the
case may be. A "particle trap," in one embodiment, allows for the
particle being trapped to have a fixed position. Having a fixed
position may simplify imaging and image analysis. Having a fixed
position for a readout particle or particles may also have the
advantage of limiting or controlling the diffusion distance between
an effector cell and a readout particle. Having a fixed position
may also prevent interaction of effector cells and readout
particles.
[0194] A "textured surface," as used herein, may be any type of
surface modification that would promote or reduce cell adhesion to
the chamber surface. For example, the surface may be textured with
one or more of: bumps, indentations, roughness, protrusions, hooks,
pegs, wells, grooves, ridges, grain, weave, web, hydrophobicity,
hydrophillicity, etc.
[0195] The human body makes millions to billions of different types
of antibodies at any given time, each produced by a different
single plasma cell called an "antibody secreting cell" or "ASC."
Each ASC has a diameter of from about 7 .mu.m about 15 .mu.m,
depending on source, a diameter approximately 1/10.sup.th the width
of a human hair, and generates only a minute amount of antibody. Of
the billions of different ASCs in the human body, only a very rare
few make an antibody that is suitable to be used as a therapeutic.
When analyzed in the volume of conventional formats this small
amount of antibody is too dilute, making it completely
undetectable. For this reason antibody discovery currently requires
that each ASC be isolated, fused to an immortal cancer cell to
create a hybridoma and "grown," ultimately generating many
thousands of identical cells that can produce enough antibody to be
measured (see FIG. 60). For example, see McCullough and Spier
(1990). Monoclonal Antibodies in Biotechnology: Theoretical and
Practical Aspects, Chapter 2, Cambridge University Press,
incorporated by reference herein in its entirety). This process is
not only incredibly inefficient (99.9% of the starting immune cells
are lost) but also very slow and expensive, requiring at minimum 3
months of labor before therapeutic function can be tested. As a
result, the discovery of antibodies with optimal therapeutic
properties is a major and unresolved bottleneck in drug
development.
[0196] ASCs are terminally differentiated cells that cannot be
directly expanded in culture. Existing methods for overcoming this
issue as set forth above (e.g., the hybridoma method, see FIG. 60)
are very inefficient, capturing only a tiny fraction of the
antibody diversity (typically <0.1%). These approaches are also
restricted to use with rodents and are very slow and expensive,
requiring months of labor before therapeutic function can be
tested. As explained below, the present invention overcomes these
limitations by allowing for direct functional assays on antibodies
and ASCs, regardless of source.
[0197] A variety of technologies have been advanced to increase the
speed and throughput of antibody screening, but these technologies
do so at the expense of information. Specifically, existing
technologies are restricted to the selection of antibodies based on
binding, affinity and specificity. While sufficient for research
applications, many therapeutic applications require high affinity
antibodies that do more than just bind to the target. Rather,
therapeutic applications require antibodies that induce the desired
biological response (e.g., agonists/antagonists of cell signaling;
activation of immune responses; induction of apoptosis; inhibition
of cellular growth or differentiation). Presently, all
high-throughput antibody discovery technologies require that this
functional characterization be performed downstream, after binding
of a target is assessed, using methods that are cumbersome, costly,
and low-throughput, even as compared to the hybridoma approach. For
this reason the hybridoma method, developed over 40 years ago, is
still a mainstay in therapeutic antibody discovery.
[0198] The present invention in one aspect, harnesses the small
reaction volumes and massively parallel assay capabilities of a
microfluidic platform in order to screen cell populations for a
property of interest, referred to herein as an "extracellular
effect." Each cell population optionally comprises one or more
effector cells. The extracellular effect is not limited to a
particular effect; rather, it may be a binding property
(specificity, affinity) or a functional property, for example
agonism or antagonism of a cell surface receptor. In one
embodiment, the extracellular effect is an effect exerted by a
secretion product of a particular effector cell.
[0199] The integrated microfluidic devices and methods provided
herein are based in part on the concept that small is
sensitive--each device comprises many thousands of nanoliter volume
cell analysis chambers, each approximately 100,000 times smaller
than conventional plate-based assays. In these small nanoliter
chambers, each single effector cell produces high concentrations of
secreted biomolecule within minutes. For example, each sing ASC
produces high concentrations of antibodies within minutes. This
concentration effect, in one embodiment, is harnessed to implement
cell-based screening assays that identify antibodies, made by
single primary ASCs, with a specific functional property(ies), such
as the modulation (e.g., agonism or antagonism) of cell surface
receptor activity. Functional assays amenable for use with the
methods and devices provided herein are described in detail below.
Importantly, the in the screening methods provided herein, it is
not necessary that a specific effector cell or subpopulation of
effector cells, having the particular property be identified so
long as the presence of the extracellular effect is detected within
a particular microfluidic chamber comprising a cell population.
Some or all of the cells within the chamber where the effect is
measured can be recovered for further characterization to identify
the specific cell or cells responsible for the extracellular
effect. By completely eliminating the need for cell culture prior
to screening, the single-cell approach provided herein enables, for
the first time, the direct selection of functional antibodies from
any species, in only days, and at a throughput of greater than
100,000 cells per run (FIG. 1).
[0200] The microfluidic devices and methods provided herein provide
advantages over currently available strategies for assessing an
extracellular effect of a single cell, for example, an
extracellular effect of an antibody secreted by a single ASC. For
example, the devices described herein are scalable, enable reduced
reagent consumption and increased throughput to provide a large
single cell assay platform for studies that would otherwise be
impractical or prohibitively expensive. Moreover, currently
available single cell assay platforms analyses require multiple
cell handling and processing steps in conventional tubes in order
to generate products needed for downstream analysis, for example
qPCR. The inclusion of microfluidic cell handling and processing as
described herein thus offers important avenues to improved
throughput and cost, while also improving precision and sensitivity
through small-volume confinement.
[0201] Without wishing to be bound by theory, the concentration
enhancement and rapid diffusive mixing afforded by the nanoliter
microfluidic chambers provided herein, along with precise cellular
handling and manipulation (e.g., spatio-temporal control of medium
conditions) enables the single cell analysis of effector cells such
as immune cells (e.g., B cells, T cells, and macrophages) whose
primary functions include the secretion of different effector
proteins such as antibodies and cytokines.
[0202] Embodiments described herein provide microfluidic systems
and methods capable of performing multicellular assays of secreted
products from cell populations comprising one or more effector
cells, followed by recovery of the cell populations for subsequent
analysis. In some embodiments, the cell populations are
heterogeneous cell populations. That is, two or more cells in a
population differ in genotype, phenotype or some other property.
Moreover, where cell populations are assayed in parallel on one
device, at least two of the populations are heterogeneous with
respect to one another (e.g., different number of cells, cell type,
etc.). In the assays described herein, a readout particle
population comprising one or more readout particles, which serve as
detection reagents (e.g., readout cells expressing a cell receptor,
readout bead, sensor, soluble enzyme, etc.) are exposed to a cell
population comprising one or more effector cells, and secreted
products from the one or more effector cells, at a sufficient
concentration for a readout signal (e.g., a fluorescent signal) to
be detected. In some embodiments, the readout signal reports a
biological response/functional effect (e.g., apoptosis) induced by
one or more the effector cells in the population on one or more
readout particles (e.g., readout cells). For example, for an
antibody produced from a given ASC, the ASC or a cell population
comprising one or more ASCs, along with readout particle(s) and
optionally accessory detection reagents are sequestered in a small
volume so on a device, and the assay is carried out (chambers
having a volume of about 100 .mu.L to about 50 nL, e.g. about 1 nL
to about 5 nL). Importantly, because effector cells in one
embodiment are rare cells, not all cell populations assayed by the
methods described herein will initially contain an effector cell.
For example, where thousands of cell populations are assayed on a
single device, in one embodiment, only a fraction of the chambers
will comprise an effector cell. The methods provided herein allow
for the identification of the chambers with the effector cell.
[0203] The present invention takes a different approach than
previously described microfluidic methods. The latter take the
approach of loading single cells at a density to maximize the
number of single cells in individual chambers (for example, where
droplets or microwells are used). This is accomplished by isolating
single cells by limiting dilution followed by analysis of the
fraction of chambers or volumes that contain a single cell. Such a
strategy sacrifices throughput because the optimal single cell
loading is achieved at approximately 1 cell per well average
density. Similarly, the geometries described for these methods
usually do not allow for more than a few cells in a chamber and in
many cases are designed to physically accommodate only a single
cell. Besides a decreased throughput, a number of technical
challenges result from the approach of isolating and assaying a
single cell in a single microfluidic chamber. For example,
achieving sufficient cell concentrations to achieve a meaningful
readout from heterogeneous populations, keeping individual cells
alive due to nutrient depletion, the need for aeration, unwanted
vapor permeation effects, poorly controlled medium conditions, and
the need for waste removal, can pose serious problems for achieving
a reliable reproducible single cell microfluidic assay. In many
functional assays, like cell growth inhibition, it is necessary to
keep both the effector cells and the readout cells alive for
several days. Such an assay is not feasible in microwell based
systems and droplets. However, as discussed herein, the present
invention provides a robust platform for assays spanning days.
[0204] The devices and assays described herein provide single cell
assays whereby one or more effector cells are present in individual
cell populations, in single microfluidic chambers. The cell
populations are assayed for their respective ability to exert an
extracellular effect in each chamber, thereby providing a higher
total throughput than previously described methods. Importantly,
effects of a single effector cell can be detected within a larger
cell population, for example a heterogeneous cell population. By
taking the multicellular assay approach within a single
microfluidic chamber, the embodiments described herein can operate
at greater than or equal to 100 times the throughput reported
previously. Once a cell population is identified that an
extracellular effect on a readout particle, or a variation in an
extracellular effect as compared to another population, the cell
population, in one embodiment, is recovered and further assayed as
individual cell subpopulations (e.g., the recovered cell population
is assayed at limiting dilution) to determine which effector
cell(s) within the population is responsible for the extracellular
effect.
[0205] Methods and apparatuses known in the art which are designed
to accommodate more than a single cell have limitations that make
them unsuitable for the types of assays described herein, for
example, maintaining cells in a viable state, the inability to
selectively recover effector cells of interest, evaporation within
a device, pressure variability, cross-contamination, device
architecture that limits imaging capabilities (e.g., by providing
particles in different focal planes, reduced resolution) and lack
of throughput (WO 2012/072822 and Bocchi et al. (2012), each
incorporated by reference in their entireties).
[0206] Embodiments described herein relate in part to functional
effector cell assays (also referred to herein as extracellular
effect assays) that allow for the detection of a single effector
cell of interest present in an individual microfluidic chamber in a
heterogeneous cell population. Specifically, in the case where a
chamber contains a heterogeneous cell population, where each cell
of the population secretes antibodies (i.e., a heterogeneous ASC
population within a single microfluidic chamber), or only a
fraction of the cells in the population secrete antibodies, whereby
only one effector cell or a subpopulation of effector cells
secretes an antibody that produces a desired extracellular effect
on a readout particle(s), the embodiments described herein provide
a method for measuring and detecting the desired extracellular
effect. Once a chamber is identified that comprises a cell
population exhibiting the effect, the population is recovered for
downstream analysis, for example, by splitting the cell population
into subpopulations at limiting dilution. As described below, in
one embodiment, one or more heterogeneous populations of cells
displaying an extracellular effect, are recovered and subjected to
further screening at limiting dilution (e.g., from 1 to about 25
cells per assay), to determine which cell the extracellular effect
is attributable to.
[0207] In one embodiment, a microfluidic assay is carried out on a
plurality of cell populations, present in individual microfluidic
chambers, to determine whether an effector cell within one of the
populations secretes an antibody or other biomolecule that inhibits
the growth of a readout cell. In this embodiment, even in the
presence a heterogeneous cell population comprising a plurality of
ASCs that secrete antibodies which do not affect the growth of the
readout cell, the readout cell growth is still equally inhibited
and the microfluidic chamber is identifiable as containing the
desired effector cell and secretion product. The chamber's contents
can then be recovered for further microfluidic analysis, or
benchtop analysis, for example, at limiting dilution of the
effector cells to determine which effector cell displays the
effect. Antibody sequences can also be recovered by methods known
to those of skill in the art.
[0208] In one embodiment, novel antibodies are provided by the
methods described herein. For example, one or more ASCs can be
identified by the methods described herein, recovered, and their
antibody genes sequenced and cloned.
[0209] Where single cells are loaded into individual chambers at a
density of approximately 1 cell per chamber, the devices provided
herein allow for the screening of approximately 1000 single cells
(e.g., ASCs) per experiment. One or more of the single cells can be
ASCs or a different type of effector cell. Although approximately
10-fold higher than hybridoma methods, it is desirable in many
instances to screen tens of thousands, or even hundreds of
thousands of cells. Examples of this include when ASCs cannot be
obtained at high purity (e.g., for species for which ASC
markers/antibodies are not available or cases of poor immune
response), or when antibodies that bind are frequent but those with
desired properties are exceedingly rare (such as blocking of a
receptor). However, after identifying a cell population(s) that
contain one or more effector cells displaying the extracellular
effect of interest, the cell population(s), in one embodiment, are
analyzed again, but at limiting dilution, e.g., as single cells in
individual microfluidic chambers, or smaller populations in
individual chambers (as compared to the first screen), in order to
determine the identity of the individual effector cell(s)
responsible for the extracellular effect. One embodiment of this
two step screening method is shown in FIG. 2. Once the effector
cell(s) is identified, its genetic information can be amplified and
sequenced. In one embodiment, the genetic information comprises a
novel antibody gene.
[0210] In the embodiment shown in FIG. 2, a microfluidic array is
loaded at a density of approximately 25 cells per chamber,
resulting in a total of approximately 100,000 cells in a single
device. The chambers are then isolated and incubated, generating
unique polyclonal mixtures of antibodies in each chamber. These
antibodies are then screened to identify chambers that exhibit the
desired extracellular effect, e.g., antigen binding, high binding
affinity, antigen specificity or one or more functional properties.
The contents of each positive chamber are then recovered. In one
embodiment, recovery of each population is with a single
microcapillary and the chamber contents are pooled in the
microcapillary, and reloaded at limiting dilution onto the same
device, or a different microfluidic device. In the embodiment shown
in FIG. 2, the cells from array one are reloaded in different
chambers at a density of approximately 1 cell per chamber. The
cells from the recovered population(s) are then rescreened for the
same extracellular effect, or for a different extracellular effect.
The contents of the positive chambers from the second array are
then recovered to identify antibody sequences of interest, e.g., by
next generation sequencing and/or PCR. The antibody sequences, in
one embodiment, are sequenced and cloned and therefore, in one
embodiment, the methods provided herein allow for the discovery of
novel antibody genes.
[0211] In another embodiment, cell populations displaying the
extracellular effect are recovered using an integrated system
microfluidic valves that allow chambers to be individually
addressed (e.g., Singhal et al. (2010). Anal. Chem. 82, pp.
8671-8679, incorporated by reference herein in its entirety).
Notably, the present invention is not limited to the type of
extracellular effect assay carried out on the contents of the
positive chambers of "array 1" (FIG. 2). For example, in some
embodiments, it is desirable to further assay the contents of the
positive chambers from "Array 1" via a benchtop method, rather than
a second microfluidic array. Benchtop methods include, for example,
RT-PCR and next generation sequencing.
[0212] With respect to the single cell and multicellular
microfluidic assays described herein, reference is made herein to a
"chamber" in which a cell population optionally comprising one or
more effector cells is assayed for an extracellular effect, for
example, a functional effect or a binding effect. However, one of
ordinary skill in the art will recognize that the devices provided
herein provide a massively parallel system that incorporates tens
of thousands of chambers, and that assays are carried out in
parallel in all or substantially all of the chambers, or all of the
chambers in a subarray on one device, on a plurality of individual
cell populations each optionally comprising an effector cell or a
plurality of effector cells. Because of the rarity of some effector
cells, not all cell populations will comprise an effector cell when
present in a microfluidic chamber. Fluidic architectures to address
multiple chambers individually or together, such as multiplexers,
are described below.
[0213] Some of the embodiments described herein provide one or more
of the following features:
[0214] The ability to load and concentrate a cell population
comprising one or more effector cells into a microfluidic chamber
having a small volume to assay the effector cell products, and to
co-localize into within the chamber a readout particle (readout
bead, readout cell, etc.) used to detect the presence of an
individual effector cell product (e.g., secreted protein) having a
desired property.
[0215] The ability to maintain the viability and/or growth of a
cell population, assisted by the osmotic bath described herein as
well as the ability to exchange medium around individual cells, at
concentrations that have been reported previously to result in poor
cell survival or growth using conventional culture methods or
previously described microfluidic devices.
[0216] The ability to concentrate effector cell products within a
chamber in a time sufficient to measure a desired effector cell
product property prior to the effector cell becoming unhealthy or
outgrowing its respective microfluidic chamber.
[0217] The ability to selectively exchange medium contents or add
detection reagents to clusters of cells while maintaining
populations of cells in the microfluidic chambers.
[0218] The ability to addressably recover a selected cell
population using one or more microfluidic structures, a manual
method or a robotic method.
[0219] The ability to transfer recovered populations of cells into
a secondary lower-throughput screen that enables the analysis of an
effector cell product from each single cell in the heterogeneous
population, or a clone or plurality of clones generated from each
single cell in the heterogeneous population.
[0220] The ability to directly analyze the aggregate genetic
material from recovered heterogeneous populations of single cells
and then use this information or genetic material to identify the
genes associated with the cells of interest.
[0221] In some embodiments, a method of enriching for effector
cells exhibiting an extracellular effect from a starting population
of cells that includes one or more effector cells that exhibit the
extracellular effect is provided. In one embodiment, the method
includes retaining the starting population of cells in a plurality
of microfluidic chambers to obtain a plurality of cell
subpopulations. An average number of effector cells per chamber is
greater than Y, the total number of cells in the population is
greater than X and an expected fraction of effector cells in the
population is 1/X. The cell subpopulations in the microfluidic
chambers are subjected to an extracellular effect assay to identify
one or more chambers containing one or more effector cells
exhibiting the extracellular effect. Based on the results of the
extracellular effect assay, one or more chambers are then
identified as comprising one or more effector cells exhibiting the
extracellular effect. The contents of the identified chamber(s) are
then recovered to provide an enriched population of cells. The
enriched population of cells enriched for the effector cells has a
fraction of effector cells of 1/Y. In a further embodiment, 1/X is
less than 0.05, or less than 0.01, or less than 0.001. The
extracellular effect can be one or more of the extracellular
effects described herein. In one embodiment, the starting
population of cells are peripheral blood mononuclear cells (PBMCs)
isolated from an animal that has been immunized or exposed to an
antigen. In another embodiment, the starting population of cells is
a population of B-cells isolated from an animal that has been
immunized or exposed to an antigen. In yet another embodiment, the
source of the starting population of cells is whole blood from the
animal that has been immunized or exposed to an antigen.
[0222] As provided herein, in one aspect, the devices and methods
of the invention are used to assay a cell population optionally
comprising one or more effector cells for the presence of an
extracellular effect. In another aspect, the devices and methods
provided herein allow for identification of a cell population
displaying a variation in an extracellular effect compared to other
cell populations. In this aspect, a plurality of individual cell
populations are retained in separate microfluidic chambers, wherein
at least one of the individual cell populations comprises one or
more effector cells and the separate microfluidic chambers further
comprise a readout particle population comprising one or more
readout particles. The cell populations are assayed for the
presence of the extracellular effect, whereby the readout particle
population or subpopulation thereof provides a readout of the
extracellular effect. A cell population from amongst the plurality
can then be identified that exhibits a variation in the
extracellular effect, as compared to one or more of the remaining
cell populations of the plurality. Once a cell population is
identified that displays the variation in the extracellular effect,
the population is recovered and may be further assayed at limiting
dilution to identify the cell or cells within the population
responsible for the extracellular effect.
[0223] Cell populations that can be analyzed herein are not limited
to a specific type. For example, in one embodiment a starting
population of cells partitioned into individual cell populations in
microreactors may be peripheral blood mononuclear cells (PBMCs)
isolated from an animal that has been immunized or exposed to an
antigen. The starting population of cells in another embodiment are
B-cells isolated from an animal that has been immunized or exposed
to an antigen. The source of the starting population of cells may
be whole blood from the animal that has been immunized or exposed
to an antigen.
[0224] An "effector cell," as used herein, refers to a cell that
has the ability to exert an extracellular effect. The extracellular
effect is a direct or indirect effect on a readout particle, as
described in detail below. The extracellular effect is attributable
to the effector cell, or a molecule secreted by the effector cell,
for example a signaling molecule, metabolite, an antibody,
neurotransmitter, hormone, enzyme, cytokine. In one embodiment, the
effector cell is a cell that secretes or displays a protein (e.g.,
T cell receptor). In embodiments described herein, the
extracellular effect is characterized via the use of a readout
particle, e.g., a readout cell or a readout bead, or a readout
particle population or subpopulation. For example, in one
embodiment described herein, the extracellular effect is the
agonizing or antagonizing of a cell surface receptor, ion channel
or ATP binding cassette (ABC) transporter, present on a readout
cell or readout bead. In one embodiment, the effector cell is an
antibody secreting cell (ASC). An ASC, as used herein, refers to
any cell type that produces and secretes an antibody. Plasma cells
(also referred to as "plasma B cells," "plasmocytes" and "effector
B cells") are terminally differentiated, and are one type of ASC.
Other ASCs that qualify as "effector cells" for the purposes of the
present invention include plasmablasts, cells generated through the
expansion of memory B cells, cell lines that express recombinant
monoclonal antibodies, hybridoma cell lines. In another embodiment,
the effector cell is a cell that secretes a protein. Other cell
types that qualify as effector cells include T cells (e.g., CD8+ T
cell, and CD4+ T cell), hematopoietic cells, cell lines derived
from humans and animals, recombinant cell lines, e.g., a
recombinant cell line engineered to produce antibodies, a
recombinant cell line engineered to express a T cell receptor.
[0225] Individual cell populations optionally comprising one or
more effector cells are assayed to determine whether the respective
cell populations comprise an effector cell that exhibits an
extracellular effect, or a variation in an extracellular effect as
compared to another individual cell population or a plurality
thereof. As stated above, when cell populations are assayed in
parallel on one device, not all cell populations will comprise an
effector cell, and the methods described herein allow for the
identification of a cell population that contains one or more
effector cells. Additionally, a cell population comprising an
effector cell need not include multiple effector cells, or be a
population of only effector cells. Rather, non-effector cells, in
embodiments described herein, are included in the population. The
non-effector cells can be a majority or minority of the population.
A heterogeneous population comprising an effector cell need not
include multiple effector cells. Rather, a heterogeneous cell
population is heterogeneous as long as two cells are heterogeneous
with respect to one another. A cell population can comprise zero
effector cells, one effector cell or a plurality of effector cells.
Similarly, a cell subpopulation can comprise zero effector cells,
one effector cell or a plurality of effector cells.
[0226] The extracellular effect in one embodiment is the binding
interaction with an antigen, or a functional effect. For example,
in one embodiment, the extracellular effect is agonism or
antagonism of a cell surface receptor, agonism or antagonism of an
ion channel or agonism or antagonism of an ABC transporter,
modulation of apoptosis, modulation of cell proliferation, a change
in a morphological appearance of a readout particle, a change in
localization of a protein within a readout particle, expression of
a protein by a readout particle, neutralization of the biological
activity of an accessory particle, cell lysis of a readout cell
induced by an effector cell, cell apoptosis of a readout cell
induced by the effector cell, cell necrosis of the readout cell,
internalization of an antibody by a readout cell, internalization
of an accessory particle by a readout cell, enzyme neutralization
by the effector cell, neutralization of a soluble signaling
molecule, or a combination thereof.
[0227] The presence and identification of an effector cell that
secretes a biomolecule (e.g., antibody) that binds a target of
interest (e.g., antigen) is readily ascertained in embodiments
where the effector cell is present in a heterogeneous cell
population comprising a plurality of effector cells that secrete
antibodies that are not specific to the target of interest. In one
embodiment, this is achieved in an individual microfluidic chamber
by first capturing in the chamber, all or substantially all of the
secreted antibodies of the population on a readout particle(s)
(e.g., bead) functionalized to capture antibodies (for example,
functionalized with protein G or protein A), addition of
fluorescently labeled antigen into the chamber and imaging of the
particle(s) to detect the presence or absence of an increase in
fluorescence due to binding of the antigen to immobilized
antibody(ies). An estimate of minimum number of antibodies captured
on a bead that is required for reliable detection may be obtained
by performing experiments to measure antibody secretion from single
cells. In one embodiment, it is possible to detect antigen-specific
antibodies secreted from a single ASC in a heterogeneous population
of approximately 500 cells. In the case of the present invention, a
cell population present in an individual microfluidic chamber can
comprise from about two to about 500 cells, for example, about two
to about 250 ASCs. As stated above, a cell population can contain
cells other than effector cells and not all cell populations will
contain an effector cell. This is particularly true when
conventional enrichment protocols (e.g., FACS) are not able to be
used to obtain a substantially pure cell population of the same
cell type.
[0228] With respect to a heterogeneous cell population, all of the
cells not be heterogeneous with respect to each other, provided
that there are at least two cells in the population that are
heterogeneous with respect to each other, for example, an effector
cell and a non-effector cell. A heterogeneous cell population may
consist of as few as two cells. A cell population or cell
subpopulation may consist of a single cell. In principle, a
heterogeneous cell population may include any number of cells that
can be maintained in a viable state for the required duration of
the extracellular effect assay, e.g., one of the extracellular
effect assays provided herein. In one embodiment, the number of
cells in a cell population is from 1 cell to about 500 cells per
chamber. In one embodiment, where the imaging of individual cells
or readout particles is required, the number of cells in a
population is chosen to be insufficient to cover the floor of the
chamber, so that the cells being imaged are arranged in a
monolayer. Alternatively, the cell population includes a number of
cells that is insufficient to form a bilayer covering a surface of
the chamber.
[0229] In some embodiments, larger populations of cells can be
present in a population within a single microfluidic chamber or
microreactor, without inhibiting the detection of an effect that
stems from a single effector cell or a small number of effector
cells within the particular population. For example, in one
embodiment, the number of cells in a cell population is from two to
about 900, or from about 10 to about 900, or from about 100 to
about 900. In another embodiment, the number of cells in a cell
population is from two to about 800, or from about 10 to about 800,
or from about 100 to about 800. In another embodiment, the number
of cells in a cell population is from two to about 700, or from
about 10 to about 700, or from about 100 to about 700. In another
embodiment, the number of cells in a cell population is from two to
about 600, or from about 10 to about 600, or from about 100 to
about 600. In another embodiment, the number of cells in a cell
population is from two to about 500, or from about 10 to about 500,
or from about 100 to about 500. In another embodiment, the number
of cells in a cell population is from two to about 400, or from
about 10 to about 400, or from about 100 to about 400. In another
embodiment, the number of cells in a cell population is from two to
about 300, or from about 10 to about 300, or from about 100 to
about 300. In another embodiment, the number of cells in a cell
population is from two to about 200, or from about 10 to about 200,
or from about 100 to about 200. In another embodiment, the number
of cells in a cell population is from two to about 100, or from
about 10 to about 100, for from about 50 to about 100. In another
embodiment, the number of cells in a cell population is from two to
about 90, or from about 10 to about 90, or from about 50 to about
900. In yet another embodiment, the number of cells in a cell
population is from two to about 80, or from 10 to about 80, or from
two to about 70, or from about 10 to about 70, or from about two to
about 60, or from about 10 to about 60, or from about two to about
50, or from about 10 to about 50, or from about two to about 40, or
from about 10 to about 40, or from two to about 30, or from about
10 to about 20, or from two to about 10. In some embodiments, the
majority of cells in a cell population are effector cells.
[0230] In one aspect of the invention, a cell or cell population
analyzed by the methods provided herein comprises one or more
effector cells, e.g., an antibody secreting cell (ASC) or a
plurality of ASCs. Cells, in one embodiment, are separated into a
plurality of cell populations in thousands of microfluidic
chambers, and individual cell populations comprising one or more
effector cells (i.e., within single microfluidic chambers) are
assayed for an extracellular effect. One or more individual cell
populations are identified and recovered if an effector cell within
the one or more populations exhibits the extracellular effect or a
variation in an extracellular effect. The extracellular effect is
determined by the user and in one embodiment, is a binding
interaction with an antigen, cell surface receptor, ABC transporter
or an ion channel.
[0231] Although the methods provided herein can be used to identify
a single effector cell (alone or within a heterogeneous population)
based on a binding interaction, e.g., antigen affinity and
specificity, the invention is not limited thereto. Rather,
identification of a cell population, in one embodiment, is carried
out via the implementation of a direct functional assay.
Accordingly, one aspect of the invention includes methods and
devices that enable the direct discovery of an ASC within a cell
population that secretes a "functional antibody," without the need
to initially screen the "functional antibody" for binding
properties such as affinity and selectivity to an antigen
target.
[0232] Along these lines, in one aspect, functional antibodies and
receptors discoverable by the methods herein are provided. In one
embodiment of this aspect, the nucleic acid of an effector cell
responsible for an extracellular effect is amplified and sequenced.
The nucleic acid is a gene encoding for a secreted biomolecule
(e.g., antibody, or fragment thereof), or a gene encoding a cell
receptor or fragment thereof, for example a T-cell receptor. The
antibody or fragment thereof or cell receptor or fragment thereof
can be cloned and/or sequenced by methods known in the art. For
example, in one embodiment, an ASC that secretes a functional
antibody discoverable by the methods and devices provided herein is
one that modulates cell signaling by binding to a targeted cell
surface protein, such as an ion-channel receptor, ABC transporter,
a G-protein coupled receptor (GPCR), a receptor tyrosine kinase
(RTK) or a receptor with intrinsic enzymatic activity such as
intrinsic guanylate cyclase activity.
[0233] In one aspect of the invention, a cell population comprising
one or a plurality of effector cells is identified in a
microreactor, e.g., microfluidic chamber, based on the result of an
extracellular effect assay carried out in the chamber. If an
extracellular effect or variation in extracellular effect is
measured in the microreactor, the cell population is recovered and
analyzed to determine the effector cell or effector cells within
the population responsible for the effect (see, e.g., FIG. 2). In
embodiments where the effector cell secretes antibodies, the DNA
sequence that encodes the antibody produced by the ASC or ASCs can
then be determined and subsequently cloned. In one embodiment, the
antibody DNA sequences are cloned and expressed in cell lines to
provide an immortal source of monoclonal antibody for further
validation and pre-clinical testing.
[0234] As described herein, a heterogeneous cell population
typically includes populations of cells having numbers ranging from
2 to about 1000, or from 2 to about 500, or from about 2 to about
250, or from about 2 to about 100. A heterogeneous cell population
describes a population of cells that contains at least two cells
with a fundamental difference in genotype, protein expression, mRNA
expression or differentiation state where at least one of the cells
is an effector cell. In particular, a heterogeneous cell
population, in one embodiment, include two or more effector cells
(e.g., from about to about 250 cells) that contain or express
different immunoglobulin genes, that contain or express different
genes derived from immunoglobin genes, that contain or express
different genes derived from T cell receptor genes, secrete
different immunoglobulin proteins, secrete different proteins
derived from immunoglobulin proteins, secrete different proteins or
express different proteins derived from T cell receptor
proteins.
[0235] In one embodiment, a cell population comprises a population
of cells genetically engineered to express libraries of molecules
that may bind a target epitope, cells genetically engineered to
express genes or fragments of genes derived from cDNA libraries of
interest, cells genetically engineered with reporters for various
biological functions, and cells derived from immortalized lines or
primary sources. Notably, clones originating from a single cell, in
one embodiment, are heterogeneous with respect to one another due
to for example, gene silencing, differentiation, altered gene
expression, changes in morphology, etc. Additionally, cells derived
from immortalized lines or primary sources are not identical clones
of a single cell and are considered heterogeneous with respect to
one another. Rather, a clonal population of cells has originated
from a single cell and has not been modified genetically,
transduced with RNA, transduced with DNA, infected with viruses,
differentiated, or otherwise manipulated to make the cells
different in a significant functional or molecular way. Cells
derived from a single cell, but which naturally undergo somatic
hypermutation or are engineered to undergo somatic hypermutation
(e.g., by inducing expression of activation-induced cytidine
deaminase, etc.), are not considered clones and therefore these
cells, when present together, are considered a heterogeneous cell
population.
[0236] As provided throughout, in one aspect, methods and
apparatuses are provided for assaying a plurality of individual
cell populations each optionally comprising one or more effector
cells, in order identify one or more of the cell populations that
includes at least one effector cell having an extracellular effect
on a readout particle population or subpopulation thereof, e.g.,
secretion of a biomolecule having a desired property. Once the cell
population(s) is identified, in one embodiment, it is selectively
recovered to obtain a recovered cell population. If multiple cell
populations are identified, in one embodiment, they are recovered
and pooled, to obtain a recovered cell population. The recovered
cell population is enriched for effector cells, compared to the
starting population of cells originally loaded onto the device in
that the former has a larger percentage of effector cells as
compared to the latter.
[0237] Subpopulations of the recovered cell population are assayed
for the presence of a second extracellular effect on a readout
particle population, wherein the readout particle population or
subpopulation thereof provides a readout of the second
extracellular effect. The extracellular effect can be the same
effect that was assayed, on the identified cell population, or a
different extracellular effect. In a further embodiment, the
subpopulations of the identified population each comprise from
about 1 to about 10 cells. In even a further embodiment, the
subpopulations of the identified population comprise an average of
1 cell each. One or more of the subpopulations displaying the
extracellular effect are then identified and recovered to obtain a
recovered subpopulation, which in one embodiment, is enriched for
effector cells. If multiple cell subpopulations are identified, in
one embodiment, they are recovered and pooled, to obtain a
recovered cell subpopulation. The genetic information from the
recovered cell subpopulation can then be isolated, amplified and/or
sequenced.
[0238] The present invention is not limited by the type of effector
cell or cell population that can be assayed according to the
methods of the present invention. Examples of types of effector
cells for use with the present invention are provided above, and
include primary antibody secreting cells from any species (e.g.,
human, mouse, rabbit, etc.), primary memory cells (e.g., can assay
IgG, IgM, IgD or other immunoglobins displayed on surface of cells
or expand/differentiate into plasma cells), T-cells, hybridoma
fusions either after a selection or directly after fusion, a cell
line that has been transfected (stable or transient) with one or
more libraries of monoclonal antibodies (mAbs) (e.g., for affinity
maturation of an identified mAb using libraries of mutants in fab
regions or effector function optimization using identified mAbs
with mutations in Fc regions or cell lines transfected with heavy
chain (HC) and light chain (LC) combinations from amplified HC/LC
variable regions obtained from a person/animal/library or
combinations of cells expressing mAbs (either characterized or
uncharacterized to look for synergistic effects, etc.).
[0239] Plasma cells (also referred to as "plasma B cells,"
"plasmocytes" and "effector B cells") are terminally
differentiated, and are one type of effector cell (ASC) that can be
assayed with the devices and methods of the invention. Other ASCs
that qualify as "effector cells" for the purposes of the present
invention include plasmablasts, cells generated through the
expansion of memory B cells, cell lines that express recombinant
monoclonal antibodies, primary hematopoietic cells that secrete
cytokines, T cells (e.g., CD4+ and CD8+ T-cells), dendritic cells
that display protein or peptides on their surface, recombinant cell
lines that secrete proteins, hybridoma cell lines, a recombinant
cell engineered to produce antibodies, a recombinant cell
engineered to express a T cell receptor.
[0240] It will be appreciated that the cell populations for use
with the invention are not limited by source, rather, they may be
derived from any animal, including human or other mammal, or
alternatively, from in vitro tissue culture. Cells may be analyzed
directly, for example, analyzed directly after harvesting from a
source, or after enrichment of a population having a desired
property (such as the secretion of antibodies that bind a specific
antigen) by use of various protocols that are known in the art,
e.g., flow cytometry. Prior to harvesting from an animal source, in
one embodiment, the animal is subject to one or more immunizations.
In one embodiment, flow cytometry is used to enrich for effector
cells prior to loading onto one of the devices provided herein, and
the flow cytometry is fluorescence activated cell sorting (FACS).
Where a starting cell population is used that has been enriched for
effector cells, e.g., ASCs, and retained as individual cell
populations in individual microfluidic chambers, the individual
cell populations need not be comprised entirely of effector cells.
Rather, other cell types may be present as a majority or minority.
Additionally, one or more of the individual cell populations may
contain zero effector cells.
[0241] There are several methods for the enrichment of ASCs derived
from animals known to those of skill in the art, which can be used
to enrich a starting population of cells for analysis by the
methods and devices provided herein. For example, in one
embodiment, FACS is used to enrich for human ASCs using surface
markers CD19.sup.+CD20.sup.lowCD27.sup.hiCD38.sup.hi (Smith et al.
(2009). Nature Protocols 4, pp. 372-384, incorporated by reference
herein in its entirety). In another embodiment, a cell population
is enriched by magnetic immunocapture based positive or negative
selection of cells displaying surface markers. In another
embodiment, a plaque assay (Jerne et al. (1963). Science 140, p.
405, incorporated by reference herein in its entirety), ELISPOT
assay (Czerkinsky et al. (1983). J. Immunol. Methods 65, pp.
109-121, incorporated by reference herein in its entirety), droplet
assay (Powel et al. (1990). Bio/Technology 8, pp. 333-337,
incorporated by reference herein in its entirety), cell surface
fluorescent-linked immunosorbent assay (Yoshimoto et al. (2013),
Scientific Reports, 3, 1191, incorporated by reference herein in
its entirety) or a cell surface affinity matrix assay (Manz et al.
(1995). Proc. Natl. Acad. Sci. U.S.A. 92, pp. 1921-1925,
incorporated by reference herein in its entirety) is used to enrich
for ASCs prior to performing one of the methods provided herein or
prior to loading a starting cell population onto one of the devices
provided herein.
[0242] In various embodiments, two or more effector cells within a
cell population produce and secrete cell products, e.g., antibodies
that have a direct or indirect effect on a readout particle
population or subpopulation thereof. With respect to the devices
provided herein, it is noted that not all chambers on the device
necessarily include a cell population and/or a readout particle
population, e.g., empty chambers or partially filled chambers may
be present. Additionally, as provided throughout, within an
individual chamber it may be only a subset of the cells within the
cell population, or an individual cell within a population that
produces and secretes antibodies. In some embodiments, cell
populations in the microfluidic chambers do not comprise an
effector cell. These chambers are identifiable by running one or
more extracellular effect assays on each of the cell
populations.
[0243] In some embodiments, it is desirable to have one or more
accessory particles, which can include one or more accessory cells
present in the microreactors, e.g., microfluidic chambers, to
support the viability and/or function of one or more cells in the
cell populations or to implement an extracellular effect assay. For
example, in one embodiment an accessory cell, or plurality of
accessory cells comprise a fibroblast cell, natural killer (NK)
cell, killer T cell, antigen presenting cell, dendritic cell,
recombinant cell, or a combination thereof.
[0244] An accessory particle or cells, or a population comprising
the same, in one embodiment, is delivered to microreactors, e.g.,
microfluidic chambers together with the cell population. In other
words, accessory cells in one embodiment are part of cell
populations delivered to microfluidic chambers. Alternatively or
additionally, the accessory particle(s) or accessory cell(s) are
delivered to a chamber prior to, or after, the loading of the
heterogeneous population of cells comprising an effector cell or
plurality of effector cells to the microreactor or plurality of
microreactors (e.g., microfluidic chamber or plurality of
microfluidic chambers).
[0245] "Accessory particle" as referred to herein means any
particle, including but not limited to a protein, protein fragment,
cell, that (i) supports the viability and/or function of an
effector cell, (ii) facilitates an extracellular effect, (iii)
facilitates the measurement of an extracellular effect, or (iv)
detection of an extracellular effect of an effector cell.
[0246] Accessory particles include but are not limited to proteins,
peptides, growth factors, cytokines, neurotransmitters, lipids,
phospholipids, carbohydrates, metabolites, signaling molecules,
amino acids, monoamines, glycoproteins, hormones, virus particles
or a combination thereof. In one embodiment, one or more accessory
particles comprises sphingosine-1-phosphate, lysophosphatidic acid
or a combination thereof.
[0247] As an example of an accessory cell, in one embodiment, a
population of fibroblast cells (that do not secrete antibodies) is
included within a cell population enriched for effector cells
(e.g., ASCs) in order to enhance the viability of the effector
cell(s) (e.g., ASC(s)) within the population. In another
embodiment, a population of NK cells may be added as accessory
particles to implement an antibody-dependent cell-mediated
cytotoxicity assay, where the NK cells will attack and lyse the
target cells upon binding of an antibody on their surface. In
embodiments where functional cellular assays are carried out on one
or more cell populations, it will be appreciated that the effector
cell(s) within the one or more cell populations will need to stay
viable for an extended period of time while within a chamber of the
microfluidic device. To this end, accessory particles and/or
accessory cells, in one embodiment, are used to sustain the
viability of the cell population that optionally comprises one or
more effector cells. As explained below, accessory particles, e.g.,
accessory cells can also be used to sustain or enhance the
viability of a readout cell population or subpopulation thereof,
either of which can be a single readout cell.
[0248] One advantage of embodiments described herein is that the
analysis of more than one effector cell within a single
microreactor (e.g., microfluidic chamber), and/or the analysis of
single or a few effector cells in the presence of other cells,
allows for much greater assay throughput and hence the
identification and selection of desired effector cells that would
otherwise be too rare to detect efficiently. This is advantageous
in many instances where there are limited methods to enrich for a
desired cell type or where such enrichment has deleterious effects
such as the reduction of viability of the cells being assayed. One
embodiment of the invention that has been built features an array
of 3500 cell analysis chambers. When this device is operated with
an average of 30 cells per chamber, the total assay throughput is
105,000 cells per experiment. This throughput may be used for the
selection of tens or hundreds of effector cells that are present at
less than, for example, 1% of the total cell population.
[0249] For example, antibody secreting cells may be identified and
isolated without the need for enrichment based on surface markers.
In B-cells isolated from peripheral mononuclear blood cells (PBMCs)
following immunization, the frequency of ASCs may be between 0.01%
and 1%. At a throughput of 105,000 cells per device run, it is
possible to directly select for hundreds of ASCs without further
purification. This is particularly important, since FACS
purification of ASCs can reduce cell viability. This is also
important because appropriate reagents for the enrichment of ASCs
may not be available for a host species of interest. Indeed,
following immunization, the frequency of antibody secreting cells
in peripheral blood mononuclear cells (PBMCs) may be between 0.01
and 1% and is thus detectable by using the microfluidic arrays
provided herein, for example, a microfluidic array of 3500 chambers
loaded at an average density of 30 cells per chamber. Thus, since
the isolation of peripheral blood mononuclear cells (PBMCs) may be
performed on any species without specific capture reagents, some of
the present methods provide for the rapid and economical selection
of cells secreting antibodies of interest from any species.
[0250] ASCs from basal levels in humans, in one embodiment, are
identified by the methods and devices provided herein. While
animals can be immunized to generate new antibodies against most
antigens, the same procedure cannot be performed widely in humans
except for approved vaccines. However, humans that have been
naturally exposed to an antigen, or vaccinated at some point in
their lifespan, typically possess low basal levels of
antibody-secreting cells for the antigen. The present invention can
be used to identify and isolate extremely rare effector cells
secreting specific antibodies from a large number of cells (e.g.,
greater than 100,000 per device run). Such methods are used herein
for the discovery of functional antibodies, e.g., as therapeutics
for autoimmune diseases and cancers where autoantibodies may be
present.
[0251] As provided throughout, the present invention relates in
part to extracellular effect carried out in a massively parallel
fashion in single microfluidic chambers. The assays are carried out
to measure and detect an extracellular effect exerted by an
effector cell, or plurality thereof, present in a cell population.
A population of readout particles or subpopulation thereof provides
a readout of the extracellular effect. For example, the methods
described herein allow for the identification of a heterogeneous
cell population which contains an effector cell that exerts the
extracellular effect, e.g., secretion of an antibody specific to a
desired antigen, in a background of up to about 250 cells that do
not exert the extracellular effect.
[0252] "Readout particle," as used herein, means any particle,
including a bead or cell, e.g., a functionalized bead or a cell
that reports a functionality or property, or is used in an assay to
determine an extracellular effect (e.g., functionality or property)
of an effector cell, or a product of an effector cell such as an
antibody. As described herein, a "readout particle" can be present
as a single readout particle or within a homogeneous or
heterogeneous population of readout particles within a single
microfluidic chamber. In one embodiment, a readout particle is a
bead functionalized to bind one or more biomolecules secreted by an
effector cell (e.g., one or more antibodies), or released by an
effector or accessory cell upon lysis. A single readout particle
may be functionalized to capture one or more different types of
biomolecules, for instance a protein and/or nucleic acid, or one or
more different monoclonal antibodies. In one embodiment, the
readout particle is a bead or a cell that is capable of binding
antibodies produced by an effector cell that produces and/or
secretes antibodies. In some embodiments, an effector cell may also
be a readout particle, e.g., where a secretion product of one
effector cell in a population has an effect on a larger, or
different, sub-population of the effector cells or, alternatively,
where the secretion product of one effector cell is captured on the
same cell for readout of the capture.
[0253] A "readout cell," as used herein, is a type of readout
particle that exhibits a response in the presence of a single
effector cell or a cell population comprising one or more effector
cells, for example one or more effector cells that secrete
antibodies. In various embodiments, the readout cell is a cell that
displays a surface antigen or a receptor (e.g., GPCR or RTK)
specific to a secreted molecule. In one embodiment, the binding of
the secreted molecule to a readout cell is the extracellular
effect. The readout cell may be fluorescently labeled and/or
possess fluorescent reporters that are activated upon binding.
[0254] As described above, in some embodiments, a cell population
subjected to the methods described herein comprises an ASC or a
plurality of ASCs, and the readout particle population or
subpopulation thereof displays a target epitope or a plurality of
target epitopes. The readout particle population in one embodiment
is a population of beads functionalized to capture antibodies by a
particular epitope or epitopes. Alternatively or additionally, the
readout particle population is specific for an antibody's Fc
region, and therefore, does not discriminate between antibodies
having different epitopes. The readout particle population or
subpopulation thereof, in one embodiment is labeled with a
fluorescently-conjugated molecule containing the target epitope,
for example to perform an ELISA assay. Fluorescent based antibody
and cytokine bead assays are known in the art, see, e.g., Singhal
et al. (2010). Anal. Chem. 82, pp. 8671-8679, Luminex.RTM. Assays
(Life Technologies), BD.TM. Cytometric Bead Array, the disclosures
of which are incorporated by reference in their entireties. These
methods can be used herein to determine whether an effector cell
has an extracellular effect on a readout particle.
[0255] Moreover, as described herein, individual microreactors
(e.g., microfluidic chambers) are structured so that reagent
exchange within the individual chambers is possible, whereby
cross-contamination is eliminated or substantially eliminated
between chambers. This allows for the detection of multiple
extracellular effects in a single chamber, for example, multiple
antigen binding effects and/or functional effects in a single
chamber, for example, by exchanging antigens and secondary
antibodies to label the respective binding complexes, followed by
imaging. In these serial detection embodiments, the assays can be
carried out with the same fluorophores, as each reaction is
performed serially after a wash step. Alternatively, different
fluorophores can be used to detect different extracellular effects
in a serial manner, or in parallel, in one microreactor (e.g.,
microfluidic chamber).
[0256] In another embodiment, the readout particle population is a
readout cell population wherein at least some of the readout cells
display a target epitope on their surfaces. In one embodiment, the
readout cell population, or a subpopulation thereof, is alive and
viable. In another embodiment, the readout cell population or a
subpopulation thereof is fixed. As will be recognized from the
discussion above, where antibody binding is assayed for, "antibody
binding" is considered the extracellular effect of an effector cell
or plurality of effector cells. Antibody binding can be detected
by, for example, staining of the cell with one or more
fluorescently labeled secondary antibodies. In another embodiment,
binding of an antibody to the target epitope on a readout particle
or readout cell causes the death of a readout cell, or some other
readout cell response as discussed herein (e.g., secretion of
biomolecule, activation or inhibition of a cell signaling
pathway).
[0257] Readout cells in a population may be distinguished, e.g., by
features such as morphology, size, surface adhereance, motility,
fluorescent response. For example, in one embodiment, a population
of readout cells is labeled on their surfaces, or intracellulary,
in order to determine whether the readout cells exhibit a response
as chosen by the user of assay. For example, a calcein,
carboxyfluorescein succinymyl ester reporter (CFSE), GFP/YFP/RFP
reporters can be used to label one or more reporter cells,
including extracellular receptors and intracellular proteins and
other biomolecules.
[0258] In some embodiments, the readout particle population is a
heterogeneous readout particle population, which can be a
heterogeneous readout cell population. Where, for example, an ASC
or plurality of ASCs are present in a cell population, the
individual readout particles in the population may display
different target epitopes, or display two different cell receptors
(e.g., a GPCR or RTK or a combination thereof). Accordingly, the
specificity of the extracellular effect, e.g., the specificity of
an antibody for a target epitope, or the inhibition of a specific
cell surface receptor, can be assessed. In another embodiment, an
effector cell within a cell population is an ASC, and the readout
particle population comprises a heterogeneous bead population that
non-selectively capture all antibodies (e.g., Fc region specific)
and a bead population that is specific for a unique target
epitope.
[0259] In one embodiment, accessory particles are provided to
facilitate the measurement of an extracellular effect, or to
facilitate the readout of an extracellular effect. As described
throughout, an extracellular effect includes an effect that is
exhibited by an effector cell secretion product (e.g., antibody).
For example, in one embodiment, a natural killer (NK) cell is
provided as an accessory particle, to facilitate the measurement of
lysis of a readout cell. In this embodiment, the extracellular
effect includes lysis of a readout cell that binds to a specific
epitope or cell receptor, by the natural killer (NK) cell, when an
antibody secreted by an effector cell binds to the aforementioned
readout cell.
[0260] In some embodiments, accessory particles include proteins,
protein fragments, peptides, growth factors, cytokines,
neurotransmitters (e.g., neuromodulators or neuropeptides), lipids,
phospholipids, amino acids, monoamines, glycoproteins, hormones,
virus particles, or a factor required to activate the complement
pathway, upon binding of an effector cell secretion product to a
readout cell or a combination thereof. In one embodiment, one or
more accessory particles sphingosine-1-phosphate, lysophosphatidic
acid or a combination thereof. Various extracellular effects that
are measurable with the devices and methods provided herein,
including lysis of the readout cell that binds the antibody, are
discussed in detail below.
[0261] For example, cytokines that can be used as accessory
particles include chemokines, interferons, interleukins,
lymphokines, tumor necrosis factors. In some embodiments the
accessory particles are produced by readout cells. In some
embodiments, a cytokine is used as an accessory particle and is one
or more of the cytokines provided in Table 1, below. In another
embodiment, one or more of the following cytokines is used as an
accessory particle: interleukin (IL)-1a, IL-1(3, IL-1RA, IL18,
IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11,
IL-12, IL-13, IL-14, IL-15, IL-16, IL17, IL-18, IL-19, IL-20,
granulocyte colony-stimulating factor (G-CSF), granulocyte
macrophage-colony stimulating factor (GM-CSF), leukemia inhibitor
factor, oncostatin M, interferon (IFN)-.alpha., IFN-.beta.,
IFN-.gamma., CD154, lymphotoxin beta (LTB), tumor necrosis factor
(TNF)-.alpha., TNF-.beta., transforming growth factor (TGF)-.beta.,
erythropoietin, megakaryocyte growth and development factor (MGDF),
Fms-related tyrosine kinase 3 ligand (Flt-3L), stem cell factor,
colony stimulating factor-1 (CSF-1), macrophage stimulating factor,
4-1BB ligand, a proliferation-inducing ligand (APRIL), cluster of
differentiation 70 (CD70), cluster of differentiation 153 (CD153),
cluster of differentiation 178 (CD17)8, glucocorticoid induced TNF
receptor ligand (GITRL), LIGHT (also referred to as TNF ligand
superfamily member 14, HVEM ligand, CD258), OX40L (also referred to
as CD252 and is the ligand for CD134), TALL-1, TNF related
apoptosis inducing ligand (TRAIL), tumor necrosis factor weak
inducer of apoptosis (TWEAK), TNF-related activation-induced
cytokine (TRANCE) or a combination thereof
TABLE-US-00001 TABLE 1 Representative cytokines and their
receptors. Cytokine Receptor(s)(Da) and Name Synonym(s) Amino Acids
Chromosome Molecular Weight Form Receptor Location(s) Interleukins
IL-1.alpha. hematopoietin-1 271 2q14 30606 CD121a, CDw121b 2q12,
2q12-q22 IL-1.beta. catabolin 269 2q14 20747 CD121a, CDw121b 2q12,
2q12-q22 IL-1RA IL-1 receptor antagonist 177 2q14.2 20055 CD121a
2q12 IL-18 interferon-.gamma. inducing 193 11q22.2-q22.3 22326
IL-18R.alpha., .beta. 2q12 factor Common g chain (CD132) IL-2 T
cell growth factor 153 4q26-q27 17628 CD25, 122,132 10p15-p14,
22q13.1, Xq13.1 IL-4 BSF-1 153 5q31.1 17492 CD124,213a13, 132
16p11.2-12.1, X, Xq13.1 IL-7 177 8q12-q13 20186 CD127, 132 5p13,
Xq13.1 IL-9 T cell growth factor P40 144 5q31.1 15909 IL-9R, CD132
Xq28 or Yq12, Xq13.1 IL-13 P600 132 5q31.1 14319 CD213a1, 213a2, X,
Xq13.1-q28, CD1243, 132 16p11.2-12.1, Xq13.1 IL-15 162 4q31 18086
IL-15Ra, CD122, 132 10p14-p14, 22q13.1, Xq13.1 Common b chain
(CD131) IL-3 multipotential CSF, 152 5q31.1 17233 CD123, CDw131
Xp22.3 or Yp11.3, MCGF 22q13.1 IL-5 BCDF-1 134 5q31.1 15238,
homodimer CDw125, 131 3p26-p24, 22q13.1 Also related GM-CSF CSF-2
144 5q31.1 16295 CD116, CDw131 Xp22.32 or Yp11.2, 22q13.1 IL-6-like
IL-6 IFN-.beta.2, BSF-2 212 7p21 23718 CD126, 130 1q21, 5q11 IL-11
AGIF 199 19q13.3-13.4 21429 IL-11Ra, CD130 9p13, 5q11 Also related
G-CSF CSF-3 207 17q11.2-q12 21781 CD114 1p35-p34.3 IL-12 NK cell
stimulatory 219/328 3p12-p13.2/ 24844/37169 CD212 19p13.1, 1p31.2
factor 5q31.1-q33.1 heterodimer LIF leukemia inhibitory factor 202
22q12.1-q12.2 22008 LIFR, CD130 5p13-p12 OSM oncostatin M 252
22q12.1-q12.2 28484 OSMR, CD130 5p15.2-5p12 IL-10-like IL-10 CSIF
178 1q31-q32 20517, homodimer CDw210 11q23 IL-20 176 2q32.2 20437
IL-20R.alpha., .beta. ? Others IL-14 HMW-BCGF 498 1 54759 IL-14R ?
IL-16 LCF 631 15q24 66694, homotetramer CD4 12pter-p12 IL-17 CTLA-8
155 2q31 17504, homodimer CDw217 22q11.1 Interferons IFN-.alpha.
189 9p22 21781 CD118 21q22.11 IFN-.beta. 187 9p21 22294 CD118
21q22.11 IFN-.gamma. 166 12q14 19348, homodimer CDw119 6q23-q24 TNF
CD154 CD40L, TRAP 261 Xq26 29273, homotrimer CD40 20q12-q13.2
LT-.beta. 244 6p21.3 25390, heterotrimer LT.beta.R 12p13
TNF-.alpha. cachectin 233 6p21.3 25644, homotrimer CD120a, b
12p13.2, 1p36.3-p36.2 TNF-.beta. LT-.alpha. 205 6p21.3 22297,
heterotrimer CD120a, b 12p13.2, 1p36.3-p36.2 4-1BBL 254 19p13.3
26624, trimer? CDw137 (4-1BB) 1p36 APRIL TALL-2 250 17p13.1 27433,
trimer? BCMA, TACI 16p13.1, 17p11.2 CD70 CD27L 193 19p13 21146,
trimer? CD27 12p13 CD153 CD30L 234 9q33 26017, trimer? CD30 1p36
CD178 FasL 281 1q23 31485, trimer? CD95 (Fas) 10q24.1 GITRL 177
1q23 20307, trimer? GITR 1p36.3 LIGHT 240 16p11.2 26351, trimer?
LTbR, HVEM 12p13, 1p36.3-p36.2 OX40L 183 1q25 21050, trimer? OX40
1p36 TALL-1 285 13q32-q34 31222, trimer? BCMA, TACI 16p13.1,
17p11.2 TRAIL Apo2L 281 3q26 32509, trimer? TRAILR1-4 8p21 TWEAK
Apo3L 249 17p13.3 27216, trimer? Apo3 1p36.2 TRANCE OPGL 317 13q14
35478, trimer? RANK, OPG 18q22.1, 8q24 TGF-.beta. TGF-.beta.1
TGF-.beta. 390 19q13.1 44341, homodimer TGF-.beta.R1 9q22
TGF-.beta.2 414 1q41 47747, homodimer TGF-.beta.R2 3p22 TGF-.beta.3
412 14q24 47328, homodimer TGF-.beta.R3 1p33-p32 Miscellaneous
hematopoietins Epo erythropoietin 193 7q21 21306 EpoR 19p13.3-p13.2
Tpo MGDF 353 3q26.3-q27 37822 TpoR 1p34 Flt-3L 235 19q13.1 26416
Flt-3 13q12 SCF stem cell factor, c-kit 273 12q22 30898, homodimer
CD117 4q11-q12 ligand M-CSF CSF-1 554 1p21-p13 60119, homodimer
CD115 5q33-q35 MSP Macrophage stimulating 711 3p21 80379 CDw136
3p21.3 factor, MST-1 Adapted from Cytokines, Chemokines and Their
Receptors. Madame Curie Bioscience Database. (Landes
Biosceince)
[0262] In one embodiment, an accessory particle is a cytokine or
other factor operable to stimulate a response of the readout cell.
For example, readout cells may be incubated with an effector cell
or plurality thereof and pulsed with a cytokine that is operable to
affect the readout cell. Alternatively or additionally,
cytokine-secreting cells operable to affect the readout particles
are provided to the chamber as accessory cells. Neutralization of
the secreted cytokines by an effector cell secretion product in one
embodiment, are detected by the absence of the expected effect of
the cytokine on the readout cell. In another embodiment, an
accessory particle is provided and is a virus operable to infect
one or more readout cells, and neutralization of the virus is
detected as the reduced infection of readout cells by the
virus.
[0263] Notably, and as should be evident by the discussion provided
above regarding accessory particles, the extracellular effect
measurable and detectable by the devices and methods provided
herein is not limited to the binding of an antibody to a target
epitope. Rather an extracellular effect as described herein, in one
embodiment, is a functional effect. The functional effect, in one
embodiment is apoptosis, modulation of cell proliferation, a change
in a morphological appearance of the readout particle, a change in
aggregation of multiple readout particles, a change in localization
of a protein within the readout particle, expression of a protein
by the readout particle, secretion of a protein by the readout
particle, triggering of a cell signaling cascade, readout cell
internalization of a molecule secreted by an effector cell,
neutralization of an accessory particle operable to affect the
readout particle.
[0264] Once an extracellular effect is identified in a microreactor
(e.g., microfluidic chamber) comprising a cell population, the
population is recovered and a downstream assay can be performed on
subpopulations of the recovered cell population, to determine which
effector cell(s) is responsible for the measured extracellular
effect. The downstream assay in one embodiment is a microfluidic
assay. In a further embodiment, the downstream assay is carried out
on the same device as the first extracellular effect assay.
However, in another embodiment, the downstream assay is carried out
in a different microfluidic device, or via a non-microfluidic
method, for example, a benchtop single cell reverse transcriptase
(RT)-PCR reaction. Antibody gene sequences of identified and
recovered effector cells in one embodiment are isolated, cloned and
expressed to provide novel functional antibodies.
[0265] Although functional effects of single ASCs are measurable by
the methods and devices provided herein, affinity, binding and
specificity can also be measured as the "effect" of an effector
cell, e.g., an effect of an effector cell secretion product. For
example, the binding assay provided by Dierks et al. (2009). Anal.
Biochem. 386, pp. 30-35, incorporated by reference herein in its
entirety, can be used in the devices provided herein to determine
whether an ASC secretes an antibody that binds to a specific
target.
[0266] In another embodiment, the extracellular effect is affinity
for an antigen or cell receptor, and the method described by
Singhal et al. (2010). Anal. Chem. 82, pp. 8671-8679, incorporated
by reference herein for all purposes, is used to assay the
extracellular effect.
[0267] In one embodiment, parallel analyses of multiple
extracellular effects are carried out in one microreactor (e.g.,
microfluidic chamber) by employing multiple types of readout
particles. Alternatively or additionally, parallel analyses of
multiple functional effects are carried out on a single
microfluidic device by employing different readout particles in at
least two different chambers.
[0268] In one embodiment, the readout particle is an enzyme that is
present as a soluble molecule, or that is tethered to the
microfluidic chamber surface or to another physical support in the
readout zone of the chamber. In this case, the binding of an
antibody that inhibits the enzymatic activity of the readout
particle, in one embodiment, is detected by reduced signal that
reports on the enzymatic activity, including a fluorescent signal
or colorometric signal or precipitation reaction.
[0269] In various embodiments, determining whether an effector cell
or multiple effector cells within a cell population have an
extracellular effect on a population of readout particles or
subpopulation thereof involves light and/or fluorescence microscopy
of the microfluidic chamber containing the cell population.
Accordingly, one embodiment of the invention involves maintaining
the readout particle population in a single plane so as to
facilitate imaging of the particles by microscopy. In one
embodiment, a readout particle population in a chamber is
maintained in a single plane that is imaged through the device
material, or portion thereof (e.g., glass or PDMS) to generate one,
or many, high-resolution images of the chamber. In one embodiment,
a high-resolution image is an image comparable to what is achieved
using standard microscopy formats with a comparable optical
instrument (lenses and objectives, lighting and contrast
mechanisms, etc.).
[0270] According to one aspect of the invention, a method is
provided for identifying a cell population comprising one or more
effector cells that displays a variation in an extracellular
effect. In one embodiment, the method comprises retaining a
plurality of individual cell populations in separate microreactors
(e.g., microfluidic chambers), wherein at least one of the
individual cell populations comprises one or more effector cells
and the contents of the separate microfluidic chambers further
comprise a readout particle population comprising one or more
readout particles. The cell populations and the readout particle
populations are incubated within the microreactor, and the cell
populations are assayed for the presence of the extracellular
effect. The readout particle population or a subpopulation thereof
provides a direct or indirect readout of the extracellular effect.
Based on the results of the assay, it is determined whether a cell
population from amongst the plurality comprising one or more
effector cells that exhibit the extracellular effect.
[0271] In some embodiments, one or more of the individual cell
populations and the readout particle populations are positioned in
an "effector zone" and "readout zone" of a microreactor,
respectively. However, the invention is not limited thereto. When
effector zones and readout zones are employed, in one embodiment,
each are essentially defined by the nature of the cells or
particles positioned within it. That is, the one or more effector
cells are segregated into the effector zone and the one or more
readout particles are segregated into the readout zone. The
effector zone is in fluid communication with the readout zone.
Accordingly, in some embodiments, where a cell population and
readout particles are provided to a chamber at low densities, e.g.,
less than two effector cells and readout particles per chamber,
physical separation of the readout particles from an effector cell
is accomplished. It will be recognized however, that the invention
need not be practiced with discrete zones within a chamber. As
should be evident by the present description, such a separation is
not necessary to carry out the extracellular effect assays set
forth herein.
[0272] The cell population and readout particle population can be
loaded simultaneously into a microreactor (e.g., through different
inlet ports or in one mixture through a single inlet port.
Alternatively, the effector cells and readout particles are loaded
serially into a microreactor (e.g., microfluidic chamber). A person
skilled in the art will understand that the cell population can be
provided to a microreactor prior to (or after) the loading of the
readout particle(s) to the chamber. However, it is possible that
the readout particle population and cell population be provided
together as a mixture.
[0273] The devices and methods disclosed herein provide robust
platforms for carrying out one or more extracellular effect assays
on a plurality of cell populations, for example, to identify a cell
population from the plurality displaying a variation in an
extracellular effect. The variation is attributable to one or more
effector cells present in the cell population. Each cell population
is confined to a single microfluidic chamber, and the effector cell
assay performed in each chamber of a device can be the same (e.g.,
all cell toxicity assays, all binding assays, etc.) or different
(e.g., one binding assay, one apoptosis assay). The addressability
of specific chambers on the device, for example with different
readout particles and reagents for performing effector cell assays,
makes diverse analyses methods possible.
[0274] The microfluidic devices described herein comprise a
plurality of chambers, and each of the plurality has the capability
for housing a cell population and a readout particle population, to
determine whether any effector cell(s) in the cell population
demonstrate an extracellular effect on a readout particle
population or a subpopulation thereof. A readout particle
population may consist of a single readout particle. As provided
below, devices provided herein are designed and fabricated to assay
a plurality of cell populations on one device, for example, where
hundreds to thousands of cell populations are assayed on one device
in order to identify one or more of the cell populations displaying
a variation in the extracellular effect. At least a portion of the
cell populations are heterogeneous with respect to one another. The
variation, for example, is a variation compared to the
extracellular effect displayed by other populations of the
plurality. For example, in one embodiment, a method is provided for
identifying a cell population(s) from among a plurality of cell
populations, wherein the selected population(s) has a variation in
an extracellular effect, as compared to the remaining cell
populations. The variation in the extracellular effect is
detectable for example, by a difference in fluorescence intensity
of one of the chambers compared to the remaining plurality or a
subplurality thereof.
[0275] According to one aspect of the invention, a method is
provided for identifying a cell population from amongst a plurality
of cell populations that displays a variation in an extracellular
effect, wherein the extracellular effect is induced by the binding
of one or more soluble factors secreted from an effector cell(s) to
a readout particle population or subpopulation thereof. The readout
particle population can be a homogeneous or a heterogeneous
population. In one embodiment, a method provided herein involves
retaining individual readout particle populations within different
chambers of a microfluidic device. The number of readout particles
analyzed can vary and will be determined according to
considerations analogous to those for cell populations as outlined
above.
[0276] An individual readout particle population and cell
population are retained in a single chamber of one of the
microfluidic devices provided herein. Optionally, the chamber is
substantially isolated from other chambers of the microfluidic
device that also comprise individual cell populations and a readout
particle population, for example, to minimize contamination between
chambers. However, isolation is not necessary to practice the
methods provided herein. In one embodiment, where isolation is
desired, isolation comprises fluidic isolation, and fluidic
isolation of chambers is achieved by physically sealing them, e.g.,
by using valves surrounding the chambers. However, isolation in
another embodiment is achieved without physically sealing the
chamber, by limiting fluid communication between chambers so as to
preclude contamination between one chamber and another chamber of
the microfluidic device.
[0277] Once a chamber or plurality of chambers each comprising a
cell population which optionally comprise one or more effector
cells, and a readout particle population is isolated, the chamber
or chambers, and specifically the cell population with the chamber
(or chambers) is incubated. It will be appreciated that an initial
incubation step can occur prior to the addition of readout
particles, and/or after readout particles are added to a chamber
comprising a cell population.
[0278] For example, an incubation step can include a medium
exchange to keep the cell population healthy, or a cell wash step.
Incubation can also comprise addition of accessory particles used
to carry out an extracellular effect assay.
[0279] An incubating step, in one embodiment, includes controlling
one or more of properties of the chamber, e.g., humidity,
temperature and/or pH to maintain cell viability (effector cell,
accessory cell or readout cell) and/or maintain one or more
functional properties of the a cell in the chamber, such as
secretion, surface marker expression, gene expression, signaling
mechanisms, etc. In one embodiment, an incubation step includes
flowing a perfusing fluid through the chamber. The perfusing fluid
is selected depending on type of effector cell and/or readout cell
is in the particular chamber. For example, a perfusing liquid in
one embodiment, is selected to maintain cell viability, e.g., to
replenish depleted oxygen or remove waste productions, or to
maintain cellular state, e.g., to replenish essential cytokines, or
to assist in assaying the desired effect, e.g., to add fluorescent
detection reagents. Perfusion can also be used to exchange
reagents, for example, to assay for multiple extracellular effects
in a serial manner.
[0280] In another embodiment, incubating a cell population includes
flowing a perfusing fluid through the chamber to induce a cellular
response of a readout particle (e.g., readout cell). For example,
the incubating step in one embodiment comprises adding a fluid
comprising signaling cytokines to a chamber comprising the cell
population. The incubating step can be periodic, continuous, or a
combination thereof. For example, flowing a perfusing fluid to a
microfluidic chamber or chambers is periodic or continuous, or a
combination thereof. In one embodiment, the flow rate of an
incubating fluid (e.g., perfusing fluid) is controlled by
integrated microfluidic micro-valves and micro-pumps. In another
embodiment, the flow of an incubating liquid is pressure driven,
for example by using compressed air, syringe pumps or gravity to
modulate the flow.
[0281] Once individual chambers within a device are provided with a
cell population and a readout particle population, a method is
carried out to determine whether a cell within the population
exhibits an extracellular effect on the readout particle population
or subpopulation thereof. The cell population and, readout particle
population and/or subpopulation thereof, as appropriate, is then
examined to determine whether or not a cell(s) within a population
exhibits the extracellular effect, or if compared to other cell
populations, a variation in the extracellular effect. It is not
necessary that the specific cell or cells exhibiting the
extracellular effect or variation thereof be identified within the
chamber, so long as the presence and/or variation is detected
within the chamber. In one embodiment, once a cell population is
identified as exhibiting an extracellular effect or variation of
the extracellular effect, the cell population is recovered for
further characterization to identify the specific effector cell(s)
responsible for the extracellular effect or variation thereof. In
another embodiment, once the cell population is identified as
exhibiting the extracellular effect or variation in extracellular
effect, it is recovered and the nucleic acid from the cell
population is amplified and sequenced.
[0282] The extracellular effect in one embodiment is a binding
interaction between the protein produced by an effector cell(s) and
a readout particle, e.g., a bead or a cell. In one embodiment, one
or more of the effector cells in the population is an antibody
producing cell, and the readout particle includes an antigen having
a target epitope. The extracellular effect in one embodiment is the
binding of an antibody to an antigen and the variation, for
example, is greater binding as compared to a control chamber or
other populations of the plurality. Alternatively, the variation in
the extracellular effect is the presence of an effector cell that
secretes an antibody with a modulated affinity for a particular
antigen. That is, the binding interaction is a measure of one or
more of antigen-antibody binding specificity, antigen-antibody
binding affinity, and antigen-antibody binding kinetics.
Alternatively or additionally, the extracellular effect is a
modulation of apoptosis, modulation of cell proliferation, a change
in a morphological appearance of a readout particle, a change in
localization of a protein within a readout particle, expression of
a protein by a readout particle, neutralization of the biological
activity of an accessory particle, cell lysis of a readout cell
induced by the effector cell, cell apoptosis of the readout cell
induced by the effector cell, readout cell necrosis,
internalization of an antibody, internalization of an accessory
particle, enzyme neutralization by the effector cell,
neutralization of a soluble signaling molecule or a combination
thereof. In some embodiments, at least two different types of
readout particles are provided to a chamber in which one of the
types of readout particles does not include the target epitope.
[0283] Different types of readout particles may be distinguished by
one or more characteristics such as by fluorescence labeling,
varying levels of fluorescence intensity, morphology, size, surface
staining and location in the chamber.
[0284] Once incubated with a cell population comprising an effector
cell(s), the readout particle population or subpopulation thereof
is examined to determine whether one or more cells within the cell
population exhibits an extracellular effect on one or more readout
particles, whether direct or indirect, or a variation in the
extracellular effect. Cell populations are identified that have a
variation in the extracellular effect assayed for, and then
recovered for downstream analysis. Importantly, as provided
throughout, it is not necessary that the specific effector cell(s),
having the particular extracellular effect on the one or more
readout particles be identified so long as the presence of the
extracellular effect is detected within a particular microreactor
(e.g., microfluidic chamber).
[0285] In some embodiments, the one or more effector cells within
the cell population secretes defined biomolecules, e.g.,
antibodies, and the extracellular effect of these factors is
evaluated on a readout particle or a plurality of readout particles
(e.g., readout cells) in order to detect a cell population that
demonstrates the extracellular effect. The extracellular effect,
however, is not limited to an effect of a secreted biomolecule. For
example, in one embodiment, the extracellular effect is an effect
of a T-cell receptor, for example, binding to an antigen.
[0286] In one embodiment, a readout particle population is a
heterogeneous population of readout cells and comprises readout
cells engineered to express a cDNA library, whereby the cDNA
library encodes for cell surface proteins. The binding of antibody
to these cells is used to recover, and possibly to analyze, cells
that secrete antibodies that bind to a target epitope.
[0287] In some embodiments, methods for measuring an extracellular
effect on a readout particle population or subpopulation thereof
includes the addition of one or more accessory particles to the
chamber where the effect is being measured. For example, at least
one factor required to activate complement on binding of an
antibody to the readout cells may be provided as an accessory
particle. As provided above, a natural killer cell or plurality
thereof, in one embodiment, is added to a chamber as an accessory
cell in cases where cell lysis is being measured. One of skill in
the art will be able to determine what accessory particles are
necessary, based on the assay being employed.
[0288] In some embodiments, where one or more readout particles
include a readout cell displaying or expressing a target antigen, a
natural killer cell, or a plurality thereof is provided to the
chamber as an "accessory cell(s)" that facilitates the functional
effect (lysis) being measured. The accessory cell can be provided
to the chamber with the cell population, the readout particle(s),
prior to the readout particle(s) being loaded, or after the readout
particle(s) is loaded into the chamber. In embodiments where a
natural killer cell is employed, the natural killer cell targets
one or more readout cells to which an antibody produced by an
effector cell has bound. The extracellular effect may thus include
lysis of the one or more readout cells by the natural killer cell.
Lysis can be measured by viability dyes, membrane integrity dyes,
release of fluorescent dyes, enzymatic assays, etc.
[0289] In some embodiments, the extracellular effect is
neutralization of an accessory particle (or accessory reagent)
operable to affect the readout particle, e.g. a cytokine (accessory
particle) operable to stimulate a response of the at least one
readout cell. For example, cytokine-secreting cells operable to
affect the readout particle cells may further be provided to the
chamber. Neutralization of the secreted cytokines by an effector
cell may be detected as the absence of the expected effect of the
cytokine on the readout cell, e.g. proliferation. In another
embodiment, the accessory particle is a virus operable to infect
the readout cell(s), and neutralization of the virus is detected as
the reduced infection of readout cells by the virus.
[0290] In some embodiments, the extracellular effect of one
effector cell type may induce activation of a different type of
effector cells (e.g., secretion of antibodies or cytokine) which
can then elicit a response in the at least one readout cell.
[0291] As provided throughout, the methods and devices provided
herein are used to identify an effector cell that exhibits a
variation in an extracellular effect on a readout particle. The
effector cell can be present as a single effector cell in a
microfluidic chamber, or in a cell population within a single
chamber. The extracellular effect, for example, can be an
extracellular effect of a secretion product of the effector cell.
In the case where the effector cell is present in a larger cell
population, the extracellular effect is first attributed to the
cell population, and the population is isolated and subpopulations
of the isolated population are analyzed to determine the cellular
basis for the extracellular effect. Subpopulation(s) displaying the
extracellular effect can then be isolated and further analyzed at
limiting dilution, for example as single cells, or subjected to
nucleic acid analysis. In one embodiment, a subpopulation of an
isolated cell population contains a single cell.
[0292] In one embodiment, the cell population comprises an ASC that
secretes a monoclonal antibody. In one embodiment, a readout bead
based assay is used in a method of detecting the presence of an
effector cell secreting the antibody amid a background of one or
more additional cells not secreting the antibody. For example, a
bead based assay is employed in one embodiment, in a method of
detecting an ASC within a cell population, whose antibody binds a
target epitope of interest, in the presence of one or more
additional ASCs that secrete antibodies that do not bind the target
epitope of interest.
[0293] In another embodiment, the ability of an antibody to bind
specifically to a target cell is assessed. Referring to FIG. 3, the
assay includes at least two readout particles, e.g., readout cells
181 and 186, in addition to at least one effector cell 182 (ASC).
Readout cell 181 expresses a known target epitope of interest,
i.e., target epitope 183, on its surface (either naturally or
through genetic engineering) while readout cell 186 does not. The
two types of readout cells 181 and 186 may be distinguishable from
themselves and the effector cell 182 by a distinguishable
fluorescent marker, other stain or morphology. Effector cell 182
secretes antibody 184 in the same chamber as readout cells 181 and
186. Antibody 184 secreted by effector cell 182 binds to readout
cell 181 via target epitope 183, but does not bind to readout cell
186. A secondary antibody is used to detect the selective binding
of antibody 184 to readout cell 181. The microfluidic chamber is
then imaged to determine if antibody 184 binding to the readout
cell 181 and/or readout cell 186 has occurred.
[0294] Such an assay may also be used to assess the location of
antibody binding on or inside the readout cell(s) using high
resolution microscopy. In this embodiment, the readout particles
include different particle types (e.g., cell types) or
particles/cells prepared in different ways (for example, by
permeabilization and fixation) to assess binding specificity and/or
localization. For instance, such an assay could be used to identify
antibodies that bind the natural conformation of a target on live
cells and the denatured form on fixed cells. Such an assay may
alternatively be used to determine the location of an epitope on a
target molecule by first blocking other parts of the molecule with
antibodies against known epitopes, with different populations of
readout particles having different blocked epitopes.
[0295] In another embodiment, individual heterogeneous readout
particle populations, (e.g., a readout cell population comprising
malignant and normal cells) and individual cell populations,
wherein at least one of the individual cell populations comprises
an effector cell, are provided to a plurality of microfluidic
chambers (e.g., greater than 1000 chambers) of one of the devices
provided herein. For example, referring to FIG. 4, binding to one
or more malignant readout cells 425 and absence of binding to
healthy readout cells 426 in the population of readout cells is
used to identify a cell population of interest containing one or
more effector cells producing an antibody of interest, i.e.,
effector cell 427 producing antibody 428 specific to one or more of
the malignant cells in the population. The two types of readout
cells 425 and 426 within a chamber are distinguishable by at least
one property, for example, fluorescence labeling, varying levels of
fluorescence intensity, morphology, size, surface staining and
location in the microfluidic chamber. The cells are then incubated
within the individual chambers and imaged to determine if one or
more of the chambers includes a cell population that exerts the
extracellular effect, i.e., an ASC that secretes an antibody that
binds to a malignant readout cell but not a healthy readout
cell.
[0296] If present within a chamber, the cell population containing
the one or more ASCs that secretes an antibody that binds a
malignant readout cell 425, but not the healthy readout cells 426,
can then be recovered to retrieve the sequences of the antibodies
within the chamber, or to perform other downstream assays on the
individual cells within the population, for example, an assay to
determine which effector cell in the population has the desired
binding property. Accordingly, novel functional antibodies are
provided that are discovered by one or more of the methods
described herein. The epitope on the malignant readout cell 425 may
be known or unknown. In the later case, the epitope for the
antibody can be identified by the method described below.
[0297] In one embodiment, a single cell type can serve as both an
effector cell and a readout cell. Referring to FIG. 5, this assay
is performed with a heterogeneous subpopulation of cells of a
single cell type, i.e., effector cell 430 and readout cell 431,
both functionalized to capture a molecule of interest 432 on their
surfaces, for instance using tetrameric antibodies 433 directed
against a surface marker and the molecule of interest 432, or an
affinity-matrix on the cell to bind biotinylated antibodies.
Referring to FIG. 6, a tetrameric antibody complex consists of an
antibody (A) 435 that binds the cells and an antibody (B) 436 that
binds antibodies secreted from the cells, wherein antibodies A and
B are connected by two antibodies 437 that bind the Fc portion of
antibodies A and B. Such tetrameric antibody complexes have been
described in the art (Lansdorp et al. (1986). European Journal of
Immunology 16, pp. 679-683, incorporated by reference herein in its
entirety for all purposes) and are commercially available (Stemcell
Technologies, Vancouver Canada). Using these tetramers, the
secreted antibodies are captured and linked onto the surface of the
cells, thus making the effector cells also function as readout
particles. Once bound on the surface of cells these antibodies can
be assayed for binding, for instance by the addition of
fluorescently labeled antigen. For example, in the case where one
is attempting to identify chambers that contain cells that secrete
a monoclonal antibody that binds to a specific target, the
antibodies that are secreted from effector cells can be captured on
the surface of these effector cells, and others in the chamber,
using appropriate capture agents. Referring again to FIG. 5, it is
thus understood that effector cell 430 can also function as a
readout cell, i.e., that the effector cell secreting a molecule of
interest 432 may more efficiently capture the molecule of interest
than readout cell 431.
[0298] In one embodiment, an extracellular effect assay is
performed in parallel in a plurality of microfluidic chambers with
a heterogeneous population of readout particles (e.g., a
heterogeneous readout cell population) and a substantially
homogeneous population of cells in each chamber, where the
individual effector cells within the substantially homogeneous
population each produces the same antibody. In a further
embodiment, the readout particles are readout cells genetically
engineered to express a library of proteins or protein fragments in
order to determine the target epitope of the antibody secreted by
the effector cells. Referring to FIG. 7, one embodiment of the
assay includes a plurality of effector cells 190 secreting antibody
191. The assay further includes a heterogeneous readout cell
population comprising readout cells 192, 193, 194, and 195
displaying epitopes 196, 197, 198, and 199, respectively. Effector
cells 190 secrete antibodies 191 which diffuse toward readout cells
192, 193, 194, and 195. Antibodies 191 bind to readout cell 194 via
target epitope 198, but do not bind to readout cells 192, 193, or
195. A secondary antibody may be used to detect the selective
binding of antibodies 191 to readout cell 194.
[0299] Cell populations that include antibodies 191 that bind
readout cell 194 (or another epitope) can then be recovered from
the device and subjected to a further assay.
[0300] In one embodiment, a functional assay is provided to
determine whether an individual ASC within a cell population
activates cell lysis of a target cell, i.e., activates
antibody-dependent cell-mediated cytotoxicity (ADCC). ADCC is a
mechanism of cell-mediated immune defense whereby an effector cell
of the immune system lyses a target cell, whose membrane-surface
antigens have been bound by specific antibodies, i.e., antibodies
secreted by an ASC within a particular microfluidic chamber
provided herein. Classical ADCC is mediated by natural killer (NK)
cells. However, macrophages, neutrophils and eosinophils can also
mediate ADCC, and can be provided herein as accessory cells to be
used in an ADCC extracellular effect assay.
[0301] One embodiment of an ADCC assay provided herein includes a
cell population comprising an effector cell or plurality thereof, a
readout cell population (having an epitope of interest on their
surfaces) and NK cells as accessory cells. The assay is run to
determine if an ASC from the cell population induces the NK cells
to attack the target cells and lyse them. Referring to FIG. 8, the
illustrated embodiment includes cell population comprising ASCs 200
and 201 that secrete antibodies 202 and 203, respectively. The
illustrated embodiment further includes a heterogeneous readout
cell population comprising readout cells 204 and 205 displaying
epitopes 206 and 207, respectively. ASCs 200 and 201 secrete
antibodies 202 and 203 which diffuse toward readout cells 204 and
205. Antibodies 202 bind to readout cell 205 via target epitope
207, but do not bind to readout cell 204. Antibodies 203 do not
bind to either of readout cells 204 and 205. NK cell 208 detects
that readout cell 205 has been bound by antibodies 202 and proceeds
to kill readout cell 205, while leaving unbound readout cell 204
alone.
[0302] A person skilled in the art will understand that the NK
cells may be added to the chamber during or after the incubation of
the effector cells with the readout cells, provided that they are
added to the chamber in a manner that facilitates access to the
readout cells. The NK cells may be from a heterogeneous population
of accessory cells, for instance peripheral blood mononuclear
cells. The NK cells may be from an animal- or human-derived cell
line, and engineered to increase ADCC activity. A person skilled in
the art will further understand that this assay could be performed
with other hematopoietic cell types capable of mediating ADCC such
as macrophages, eosinophils or neutrophils. In this case,
macrophages, eosinophils or neutrophils are the accessory cells in
the assay. Cell types capable of mediating ADCC can also be animal-
or human-derived cell lines engineered to increase ADCC activity or
to report signal upon binding antibodies on target cells. In the
latter, the target cells are accessory particles while the cells
mediating ADCC are the readout particles.
[0303] An ADCC extracellular effect assay can be performed on a
single effector cell, a homogeneous cell population, or a
heterogeneous cell population as depicted in FIG. 8. Similarly, an
ADCC assay can be performed with a single readout cell, a
homogeneous readout cell population, or a heterogeneous readout
cell population, as depicted in FIG. 8. However, in many instances
it is desirable to perform an ADCC assay with a plurality of
readout cells to avoid the detection of false positives resulting
from the random death of a readout cell.
[0304] Cell lysis, in one embodiment, is quantified by a clonogenic
assay, by the addition of a membrane integrity dye, by the loss of
intracellular fluorescent molecules or by the release of
intracellular molecules in solution. The released biomolecules are
measurable directly in solution or captured onto readout particles
for measurement. In some cases, additional accessory molecules are
added, such as a substrate for a redox assay or a substrate for an
enzymatic assay. Referring to FIG. 9, for example, a cell
population comprising effector cell 500 secreting first biomolecule
502 and a second effector cell 501 that does not secrete first
biomolecule 502, is incubated in the presence of a heterogeneous
readout particle population, including readout cell 503 and readout
particle 504, and an accessory particle (e.g., natural killer cell
505). Binding of first biomolecule 502 to readout cell 503 elicits
the recruitment of natural killer cell 505 that causes readout cell
503 to lyse. Upon cell lysis, second biomolecule 506 is released
from readout cell 503 and captured on readout particle 504, a
different type of readout particle that is functionalized to
capture second biomolecules 506, e.g., via molecule 507. Molecule
507, in one embodiment, is a protein, an antibody, an enzyme, a
reactive group and/or a nucleic acid. Captured second biomolecule
506 can be any molecule present in readout cell 503 such as a
protein, enzyme, carbohydrate or a nucleic acid. Binding of the
second biomolecule 506 to readout particle 504, in one embodiment,
is quantified using a fluorescence assay, a colorimetric assay, a
bioluminescence assay or a chemoluminescence assay. The assay is
performed directly on readout particle 504 or indirectly in the
surrounding solution, for example, if captured biomolecule 506 is
an enzyme that converts a substrate into a product with different
optical properties. The assay is carried out in multiple chambers
of one of the devices provided herein to determine if any of the
chambers comprises an effector cell that secretes a biomolecule
that induces cell lysis.
[0305] ADCC assays are known in the art and components are
commercially available. For example, the Guava Cell Toxicity Kit
for Flow Cytometry (Millipore), the ADCC Reporter Bioassay Core Kit
(Promega), the ADCC Assay (GenScript), the LIVE/DEAD Cell Mediated
Cytotoxicity Kit (Life Technologies) and the DELFIA cell toxicity
assays can be utilized in the devices provided herein.
[0306] In another embodiment, the extracellular effect assay is a
complement-dependent cytotoxicity (CDC) assay. In one CDC
embodiment, a method is provided for identifying the presence of an
ASC (or secreted antibody of an ASC) within a cell population that
binds to a readout cell in the presence of soluble factors
necessary and/or sufficient to induce lysis of the readout cell via
the classic complement pathway. Accordingly, the assay is to
determine whether an antibody secreted by an ASC stimulates lysis
of one or more target cells by the classic complement pathway.
[0307] A CDC assay includes at least one effector cell and at least
one readout cell, and one CDC embodiment is depicted in FIG. 10.
The embodiment includes a cell population that includes effector
cell 210 and effector cell 211 secreting antibodies 212 and 213,
respectively. The illustrated embodiment further includes a
heterogeneous readout cell population comprising readout cell 214
and readout cell 215 displaying epitopes 216 and 217, respectively.
Effector cells 210 and 211 secrete antibodies 212 and 213 which
diffuse toward readout cells 214 and 215. Antibodies 212 bind to
readout cell 215 via target epitope 217, but do not bind to readout
cell 214. Antibodies 213 do not bind to either of readout cells 214
and 215. Enzyme C1 218, an accessory particle, and one of the
soluble factors necessary to induce lysis of cells via the classic
complement pathway, binds to the complex of readout cell 215 with
antibody 212 while leaving unbound readout cell 214 alone. Binding
of enzyme C1 208 to the complex of readout cell 215 with antibody
212 triggers the classic complement pathway involving additional
soluble factors necessary to induce lysis of cells via the class
complement pathway (not shown), leading to the rupture and death of
readout cell 215.
[0308] The soluble factors necessary to induce lysis of the readout
cells (i.e., the accessory particles necessary for the assay) are
added during or after the incubation of the effector cells with the
readout cells, provided that they are added to the chamber in a
manner that facilitates access to the readout cells. CDC assays
provided herein can be performed on a single effector cell, a
homogeneous effector cell population, or a heterogeneous cell
population as depicted in FIG. 8. Similarly, the CDC assay can be
performed with a single readout cell, a homogeneous readout cell
population or a heterogeneous readout cell population, as depicted
in FIG. 8. However, it is desirable in many instances to perform
the CDC assay with a readout cell population to avoid the detection
of false positives resulting from the random death of a readout
cell.
[0309] Cell lysis by the complement pathway is quantified according
to methods known to those of skill in the art. For example, cell
lysis is quantified by a clonogenic assay, by the addition of a
membrane integrity dye, by the loss of intracellular fluorescent
molecules or by the release of intracellular molecules in solution.
The released biomolecules are measured directly in solution or
captured onto readout particles. In some cases, additional
accessory molecules may be added such as a substrate for a redox
assay or a substrate for an enzymatic assay. Referring to FIG. 11,
for example, a cell population, including an effector cell 510
secreting a first biomolecule 512 and a second effector cell 511
that does not secrete first biomolecule 512, is incubated in the
presence of one or more heterogeneous readout particles, e.g.,
readout cell 513 and readout particle 514, in the presence of
accessory particle 515 (e.g., complement proteins). Binding of
biomolecule 512 to readout cell 513 in the presence of accessory
particles 515 causes readout cell 513 to lyse. Upon cell lysis,
second biomolecule 516 is released and captured on a readout
particle 514, a second type of readout particle that is
functionalized to capture biomolecule 516, e.g., via molecules 517.
Molecules 517 may be one or more types of molecule such a protein,
an antibody, an enzyme, a reactive group and/or a nucleic acid.
Captured biomolecule 516 is not limited to type. Rather, captured
biomolecule 516 can be any molecule present in readout cell 513
such as protein, enzyme, dye, carbohydrate or nucleic acid. Binding
of the second biomolecule 516 to readout particle 514 is quantified
using a fluorescence assay, a colorimetric assay, a bioluminescence
assay or a chemoluminescence assay. It is understood that the assay
may be performed directly on readout particle 514 or indirectly in
the surrounding solution, for instance if captured biomolecule 516
is an enzyme that converts a substrate into a product with
different optical properties.
[0310] In another embodiment, an assay is provided to determine
whether an effector cell, alone or within a cell population
modulates cell growth. Specifically, the assay is used to determine
whether the effector cell secretes a biomolecule, e.g., a cytokine
or antibody that modulates the growth rate of readout cells.
Referring to FIG. 12, the illustrated embodiment includes a cell
population comprising effector cell 220 and effector cell 221
secreting biomolecules 222 and 223, respectively. The illustrated
embodiment further includes a homogeneous readout cell population
comprising readout cell 224. Effector cells 220 and 221 secrete
biomolecules 222 and 223 which diffuse toward readout cells 224.
Biomolecule 222 binds to readout cell 224 to induce growth of
readout cell 224 (represented by perforated lines), whereas
biomolecule 223 do not bind to readout cell 224. Microscopic
imaging of the chamber is used to assess the growth of the readout
cells 224 relative to cells in other chambers which are not exposed
to the biomolecules.
[0311] A cell growth modulation assay can be performed using a cell
population that optionally comprises one or more effector cells. As
noted above, in some embodiments, not all cell populations will
contain effector cells because of their rarity and/or difficulty to
be enriched for in a starting population that is initially loaded
onto one of the devices provided herein. The present invention
allows for the identification of these rare cells by identifying
cell populations that comprise one or more effector cells.
[0312] The cell growth modulation assay can also be performed with
a single readout cell, or a heterogeneous readout cell population
in a single chamber. However, in many instances, it is desirable to
perform the cell growth modulation assay with a homogeneous readout
cell population to permit a more accurate measurement of growth
rate.
[0313] The cell growth modulation assay, in one embodiment, is
adapted to screen for cells producing biomolecules that inhibit
cell growth. In another embodiment, the method is adapted to screen
for cells producing molecules that modulate, i.e., increase or
decrease, proliferation rates of readout cells. Growth rate, in one
embodiment, is measured by manual or automated cell count from
light microscopy images, total fluorescence intensity of cell
expressing a fluorescence, average fluorescence intensity of cells
labeled with a dilutive dye (e.g. CFSE), nuclei staining or some
other method known to those of skill in the art.
[0314] Commercially available assay to measure proliferation
include the alamarBlue.RTM. Cell Viability Assay, the CellTrace.TM.
CFSE Cell Proliferation Kit and the CellTrace.TM. Violet Cell
Proliferation Kit (all from Life Technologies), each of which can
be used with the methods and devices described herein.
[0315] In another embodiment, an apoptosis functional assay is
provided to select a cell population comprising one or more
effector cells that induces apoptosis of another cell, i.e., a
readout cell or an accessory cell. In one embodiment, the method is
used to identify the presence of an effector cell that secretes a
biomolecule, e.g., a cytokine or an antibody that induces apoptosis
of a readout cell or accessory cell. Referring to FIG. 13, the
illustrated embodiment includes a cell population comprising
effector cell 230 and effector cell 231 secreting biomolecule 232
and biomolecule 233, respectively. The illustrated embodiment
further includes a homogeneous readout cell population comprising
readout cell 234. Effector cell 230 and effector cell 231 secrete
biomolecules 232 and 233, which diffuse toward readout cells 234.
Biomolecule 232 binds to readout cell 234 and induces apoptosis of
readout cell 234, whereas biomolecule 233 does not bind to the
readout cell. Microscopic imaging of the chamber, in one
embodiment, is used to assess apoptosis using, potentially with the
inclusion of stains and other markers of apoptosis that are known
in the art (e.g., Annexin 5, terminal deoxynucleotidyl transferase
(TdT)-mediated dUTP nick end labeling, mitochondrial membrane
potential disruption, etc.). In one embodiment, cell death rather
than apoptosis using commercially available dyes or kits is
measured, for example with propidium iodide (PI), LIVE/DEAD.RTM.
Viability/Cytotoxicity Kit (Life Technologies) or LIVE/DEAD.RTM.
Cell-Mediated Cytotoxicity Kit (Life Technologies).
[0316] An apoptosis assay, in one embodiment, is performed on a
cell population comprising a single effector cell, a cell
population optionally comprising one or more effector cells or a
cell population comprising one or more effector cells. In one
embodiment, the apoptosis assay is performed with a single readout
cell, or a heterogeneous readout cell population. However, in many
instances, it is desirable to perform the apoptosis assay with a
homogeneous readout cell population to permit a more accurate
assessment of apoptosis.
[0317] In another embodiment, the microfluidic devices provided
herein are used to select an effector cell that secretes a
biomolecule, e.g., a cytokine or antibody that induces autophagy of
a readout cell. One embodiment of this method is shown in FIG. 14.
Referring to FIG. 14, the illustrated embodiment includes a cell
population comprising effector cell 441 and effector cell 442,
wherein effector cell 441 secretes biomolecule 443. The illustrated
embodiment further includes a heterogeneous readout cell population
including first readout cell 444 displaying a target epitope 449
and second type of readout cell 445 lacking the target epitope.
Effector cell 441 secretes biomolecules 443, which diffuses toward
first type of readout cell 444 and second type of readout cell 445.
Biomolecule 443 binds to first type of readout cell 444 and induces
autophagy of first type of readout cell 444, whereas biomolecules
443 does not bind to the second type of readout cell 445.
Microscopic imaging of the chamber, in one embodiment, is used to
assess autophagy using cell lines engineered with autophagy
reporters that are known in the art (e.g., FlowCellect.TM. GFP-LC3
Reporter Autophagy Assay Kit (U205) (EMD Millipore), Premo.TM.
Autophagy Tandem Sensor RFP-GFP-LC3B Kit (Life Technologies)).
[0318] In one embodiment, an autophagy assay is performed on a cell
population comprising a single effector cell, a cell population
optionally comprising one or more effector cells or a cell
population comprising one or more effector cells. In one
embodiment, an autophagy assay is performed with a single readout
cell, or a heterogeneous readout cell population, or a homogeneous
readout cell population. The assay, in one embodiment, is performed
with a homogeneous readout cell population.
[0319] In another embodiment, a method is provided for identifying
the presence of an effector cell or to select an effector cell that
secretes a biomolecule, e.g., an antibody, that interferes with the
ability of a known biomolecule, e.g., a cytokine, to induce a
readout cell to undergo a response. The response is not limited by
type. For example, the response in one embodiment is selected from
cell death, cell proliferation, expression of a reporter, change in
morphology, or some other response selected by the user of the
method. One embodiment of the method is provided in FIG. 15.
Referring to FIG. 15, the illustrated embodiment includes a cell
population comprising effector cell 240 and effector cell 241
secreting biomolecules 242 and 243, respectively. The illustrated
embodiment further includes a homogeneous readout cell population
comprising readout cell 244. Effector cells 240 and 241 secrete
antibodies 242 and 243, which diffuse into the medium within the
chamber. The chamber is pulsed with cytokines 245, which normally
have a known effect on readout cells 244. Antibodies 242 bind to
cytokines 245, and thereby prevent them from binding to readout
cells 244. Accordingly, the expected response is not observed,
indicating that one of effector cell 240 and 241 is secreting an
antibody capable of neutralizing the ability of cytokine 245 to
stimulate the readout cells 244 to undergo a response.
[0320] In one embodiment, a cytokine neutralization assay is used
to identify the presence of an effector cell that produces a
biomolecule targeting a receptor for the cytokine, present on the
readout cell. In this case, binding of an antibody, e.g., antibody
242 to receptors 246 for cytokine 245 on readout cells 244 blocks
the interaction of the cytokine and the receptor, so that no
response would be stimulated. The cytokine receptor, in another
embodiment, is "solublized" or "stabilized," for example, is a
cytokine receptor that has been engineered via the Heptares
StaR.RTM. platform.
[0321] The response to the cytokine, in one embodiment, is
ascertained by microscopic measurements of the associated signaling
as known in the art including, but not limited to cell death, cell
growth, the expression of a fluorescent reporter protein, the
localization of a cellular component, a change in cellular
morphology, motility, chemotaxis, cell aggregation, etc. In one
embodiment, the response of chambers with effector cells are
compared to chambers lacking effector cells to determine whether
the response is inhibited. If a response is inhibited, the effector
cells within the chamber are harvested for further analysis.
[0322] In one embodiment, a cytokine assay is performed within an
individual microreactor on a cell population comprising a single
effector cell, a cell population optionally comprising one or more
effector cells or a cell population comprising one or more effector
cells. Of course, the method can be carried out in parallel in a
plurality of microchambers on a plurality of cell populations. In
one embodiment, the cytokine assay is performed with a single
readout cell, or a heterogeneous readout cell population. In one
embodiment, the method is carried out with a homogeneous readout
cell population to permit a more accurate assessment of
stimulation, or rather lack thereof, of the readout cells.
[0323] Examples of commercially available cytokine-dependent or
cytokine-sensitive cell lines for such assays include, but are not
limited to TF-1, NR6R-3T3, CTLL-2, L929 cells, A549, HUVEC (Human
Umbilical Vein Endothelial Cells), BaF3, BW5147.G.1.4.OUAR.1, (all
available from ATCC), PathHunter.RTM. CHO cells (DiscoveRx) and
TANGO cells (Life Technologies). A person skilled in the art will
understand that primary cells (e.g., lymphocytes, monocytes) may
also be used as readout cells for a cytokine assay.
[0324] In one embodiment, a signaling assay is used to identify a
cell population comprising one or more effector cells that secretes
a molecule (e.g., an antibody or a cytokine) that has agonist
activity on a receptor of a readout cell. Upon binding to the
receptor, the effect on the readout cell population may include
activation of a signaling pathway visualized by expression of a
fluorescent reporter, translocation of a fluorescent reporter
within a cell, a change in growth rate, cell death, a change in
morphology, differentiation, a change in the proteins expressed on
the surface of the readout cell, etc.
[0325] Several engineered reporter cell lines are commercially
available and can be used to implement such an assay. Examples
include PathHunter cells.RTM. (DiscoverRx), TANGO.TM. cells (Life
Technologies) and EGFP reporter cells (ThermoScientific).
[0326] In one embodiment, a virus neutralization assay is carried
out to identify and/or select a cell population comprising one or
more effector cells that secretes a biomolecule, e.g., an antibody
that interferes with the ability of a virus to infect a target
readout cell or target accessory cell. One embodiment of this
method is shown in FIG. 16. Referring to FIG. 16, the illustrated
embodiment includes a cell population comprising effector cell 250
and effector cell 251 secreting biomolecules, e.g., antibodies 252
and 253, respectively. The illustrated embodiment further includes
a homogeneous readout cell population comprising readout cell 254.
Effector cells 250 and 251 secrete biomolecules, e.g., antibodies
252 and 253, which diffuse into the medium within the chamber. The
chamber is then pulsed with virus 255 (accessory particle), which
normally infects readout cells 254. Antibody 252 or 253 binds to
virus 255, and thereby prevents the virus from binding to readout
cell 254. Accordingly, the expected infection is not observed,
indicating that one of effector cells 250 or 251 secretes an
antibody capable of neutralizing virus 255.
[0327] A virus neutralization assay is also amenable for
identifying the presence of an effector cell that produces a
biomolecule which binds a receptor for the virus on the readout
cell. In this case, binding of an antibody, e.g., antibody 252 to
receptor 256 of virus 255 on readout cell 254 blocks the
interaction of the virus and the receptor, so that no infection
would be observed.
[0328] Assessment of viral infection may be done using methods
known in the art. For example, the virus can be engineered to
include fluorescent proteins that are expressed by the readout cell
following infection, the expression of fluorescent proteins within
the readout cell that are upregulated during viral infection, the
secretion of proteins from a readout cell or accessory cell, which
are captured and measured on readout particles that are increased
during viral infection, the death of the of a readout cell or
accessory cell, the change in morphology of a readout cell or
accessory cell, and/or the agglutination of readout cells.
[0329] In one embodiment, within an individual microreactor, a
virus neutralization assay is performed on a cell population
comprising a single effector cell, a cell population optionally
comprising one or more effector cells or a cell population
comprising one or more effector cells. In one embodiment, the virus
neutralization assay is performed with a single readout cell, or a
heterogeneous readout cell population. In one embodiment, the
method is carried out with a homogeneous readout cell population to
permit a more accurate assessment of the stimulation, or rather
lack thereof, of the readout cells to undergo the response. Of
course, the method can be carried out in parallel in a plurality of
microchambers on a plurality of cell populations.
[0330] For example, commercially available cell lines for virus
neutralization assays are MDCK cells (ATCC) and CEM-NKR-CCR5 cells
(NIH Aids Reagent Program) can be used with the methods and devices
described herein.
[0331] In another embodiment, an enzyme neutralization assay is
performed to determine whether an effector cell displays or
secretes a biomolecule that inhibits a target enzyme. One
embodiment of the method is provided in FIG. 17. Referring to FIG.
17, the illustrated embodiment includes a cell population
comprising effector cell 280 and effector cell 281 secreting
biomolecules, e.g., proteins 282 and 283, respectively. The
illustrated embodiment further includes a homogeneous readout
particle population, e.g., beads 284, to which a target enzyme 285
is conjugated. However, in another embodiment, the target enzyme
285 is linked to the surface of the device, or is soluble. Proteins
282 and 283 diffuse through the medium and protein 282 binds to
target enzyme 285, thereby inhibiting its activity, whereas protein
283 does not bind to the target enzyme. Detection of the enzymatic
activity, or rather lack thereof, on a substrate present in the
chamber, in one embodiment, is assessed by methods known in the art
including but not limited to fluorescent readouts, colorometric
readouts, precipitation, etc.
[0332] In another embodiment, an enzyme neutralization assay is
performed on a cell population comprising a single effector cell, a
cell population optionally comprising one or more effector cells or
a cell population comprising one or more effector cells, per
individual chamber. In one embodiment, the enzyme neutralization
assay is performed with a single readout particle in an individual
chamber. In one embodiment, an enzyme neutralization assay is
carried out on a plurality of cell populations to identify a cell
population having a variation in a response of the assay.
[0333] In another embodiment, an assay method is provided for
identifying the presence of an effector cell that displays or
secretes a molecule that elicits the activation of a second type of
effector particle, which in turn secretes a molecule that has an
effect on a readout particle. Accordingly, in this embodiment, a
cell population is provided to individual microfluidic chambers.
One embodiment of this method is provided in FIG. 18. Referring to
FIG. 18, the illustrated embodiment includes a cell population that
includes one effector cell 460 that displays a molecule 461 on its
surface (e.g., an antibody, a surface receptor, a major
histocompatibility complex molecule, etc.), which activates an
adjacent effector cell of different type, in this case effector
cell 462, which induces the secretion of another type of molecule
463 (e.g., cytokine, antibody) that is captured by the readout
particle 464. In this example, the readout particles 464 are
functionalized with an antibody 465 or receptor specific to the
secreted molecule 463.
[0334] In another embodiment, the effector cell, upon activation by
an accessory particle, may exhibit changes in phenotype such as
proliferation, viability, morphology, motility or differentiation.
In this case the effector cell is also a readout particle. This
effect can be caused by the accessory particles and/or by autocrine
secretion of proteins by the activated effector cells.
[0335] Referring to FIG. 19, the illustrated embodiment includes a
cell population comprising effector cell 470 that secretes a
molecule 471 (e.g., antibody, cytokine, etc.), which activates a
second effector cell of different type, in this case effector cell
472. Effector cell 472, once activated, secretes another type of
molecule 473 (e.g., cytokine, antibody) that is captured by readout
particles 474. In this example, the readout particles 474 are
functionalized with an antibody 475 or receptor specific to the
secreted molecule 473.
[0336] As provided herein, monoclonal antibodies with low off-rates
are detectable in the presence of a large background (in the same
chamber) of monoclonal antibodies that are also specific to the
same antigen but which have faster off-rates. However, affinity is
also measurable with the devices and methods provided herein, and
therefore, on-rate can also be measured. These measurements depend
on the sensitivity of the optical system as well as the binding
capacity of the capture reagents (e.g., beads). To assay for
specificity, the capture reagents (readout particles) may be
designed to present the epitope of interest so that it only binds
antibodies with a desired specificity.
[0337] Referring to FIG. 20, the illustrated embodiment includes a
homogeneous cell population secreting antibodies specific for the
same antigen but with different affinities. This assay is used to
identify an effector cell within a population containing at least
one effector cell producing an antibody with high affinity.
Effector cells 450 and 451 secrete antibodies 453 and 454 with low
affinities for a target epitope (not shown) while effector cell 452
secretes antibodies 455 with higher affinity for the target
epitope. Antibodies 453, 454, and 455 are captured by a homogeneous
readout particle population comprising readout bead 456. The
readout beads are then incubated with a fluorescently labeled
antigen (not shown), which binds to all antibodies. Upon washing
with a non-labeled antigen (not shown), the fluorescently labeled
antigen remains only if readout beads display high-affinity
antibody 455 on their surfaces.
[0338] Referring to FIG. 21, another illustrated embodiment
includes effector cells 260 secreting biomolecules, e.g., antibody
261. The illustrated embodiment further includes a heterogeneous
readout particle population that optically distinguishable readout
particles, e.g., beads 262 and 263 displaying different target
epitopes 264 and 265, respectively. Antibody 261 diffuses in the
chamber, where it binds to epitope 264, but not 265. Preferential
binding of antibody 261 to epitope 264 in one embodiment, is
observed in terms of fluorescence of bead 262 but not bead 263.
[0339] In the illustrated embodiment, beads 262 and 263 are
optically distinguishable by shape in order to assess
cross-reactivity. However, readout particles are also be
distinguishable by other means, e.g., one or more characteristics
such as fluorescence labeling (including different fluorescence
wavelengths), varying levels of fluorescence intensity (e.g., using
Starfire.TM. beads with different fluorescence intensities,
morphology, size, surface staining and location in the microfluidic
chamber).
[0340] In one embodiment, beads 262 and 263 are optically
distinguishable when segregated into separate readout zones, e.g.,
by a cell fence. Alternatively, different color fluorophores can be
used to optically distinguish readout beads.
[0341] Alternatively, specificity may be measured by inclusion of
another antibody that competes with the secreted antibody to bind
the target epitope. For instance, in one embodiment the presence a
secreted antibody bound to a readout particle displaying the
antigen is identified with a fluorescently labeled secondary
antibody. The subsequent addition of a non-labeled competing
antibody generated from a different host and known to bind a known
target epitope on the antigen results in decreased fluorescence due
to displacement of the secreted antibody only if the secreted
antibody is bound to the same target epitope as the competing
antibody. Alternatively, specificity is measured by adding a
mixture of various antigens that compete with binding of the
secreted antibody to the target epitope if the secreted antibody
has low specificity. Alternatively, specificity is measured by
capturing secreted antibody on a bead and then using differentially
labeled antigens to assess the binding properties of the secreted
antibody.
[0342] The specificity measurements described herein, when
conducted on a cell population that includes two or more effector
cells that secrete antibody that bind one of the targets, are
inherently polyclonal measurements.
[0343] In various embodiments of the invention, a method for
identifying the presence of an effector cell secreting a
biomolecule is coupled with the analysis of the presence or absence
of one or more intracellular compounds of the effector cell.
Referring to FIG. 22, a cell population comprising at least one
effector cell type 520 that secretes a biomolecule of interest 522
(e.g., an antibody, or a cytokine) and another effector cell type
521 that does not secrete the biomolecule of interest, is incubated
in the presence of a readout particle population comprising readout
particle 523 functionalized to capture the biomolecule of interest.
After an incubation period, the cell population including effector
cell types 520 and 521 is lysed to release the intracellular
contents of the cells in the population. Readout particles 523 are
also functionalized to capture an intracellular biomolecule of
interest 524 (e.g., a nucleic acid, a protein, an antibody, etc.).
Cell lysis can be achieved by different methods known to those of
skill in the art.
[0344] In one embodiment, methods are provided for identifying
polyclonal mixtures of secreted biomolecules with desirable binding
properties. Assays may be performed as with heterogeneous mixtures
of effector cells producing antibodies with known affinities for a
target epitope, target molecule, or target cell type. Binding of
the target in the context of the mixture can then be compared to
binding of the target in the context of the individual effector
cells alone to determine, for example, if mixtures provide enhanced
effects.
[0345] Multifunctional analysis that combines the binding and/or
functional assays described herein may be performed by having
multiple readout regions, multiple effector regions, multiple
readout particle types, or some combination thereof. For example,
perfusion steps can be carried out between extracellular effect
assays to exchange reagents for different functional
experiments.
[0346] One embodiment of a multifunctional assay is provided in
FIG. 23. Referring to FIG. 23, a microfluidic chamber for
simultaneously evaluating the extracellular effect of an effector
cell on three subsets of readout particles is shown generally at
410. Microfluidic chamber 410 includes cell fences 420 and 421
which divide the chamber into four zones. While cell fences 420 and
421 are depicted in this example as being at right angles to each
other, a person skilled in the art will understand that the precise
positioning of the fence could vary so long as four zones are
created. Moreover, a person skilled in the art will understand that
cell fences are not necessary to carry out a multifunctional assay
(either serially or in parallel). In one embodiment, a structure
other than a cell fence is included to result in the creation
zones, so long as the different zones are addressable in terms of
the delivery of cell populations and readout particles. In another
embodiment, the multifunctional assay is carried out without a cell
fence or structure. Rather, each assay is performed in the chamber
simultaneously or serially, for example, with fluorescent molecules
that emit light at different wavelengths.
[0347] In the embodiment depicted in FIG. 23, effector cells 411
and 422 secreting antibodies 419 and 423, respectively, are
delivered to the upper left region of chamber 410, thereby defining
effector zone 415. Readout particles 412, 413, and 414 are
delivered to the remaining regions, thereby defining readout zones
416, 417, and 418, respectively. Readout particles 412, 413, and
414, in one embodiment, make up a heterogeneous population of
readout particles. For example, in one embodiment, readout
particles 412 and 414 are beads of different sizes displaying
different epitopes of the same antigen, and readout particles 413
are cells displaying the antigen in the presence of a natural
killer cell 424. Accordingly, the presence or absence of an
effector cell that can selectively bind a given epitope and induce
the killing of readout cells by natural killer cells can be
evaluated simultaneously in a single chamber.
[0348] Alternatively, readout particles 412, 413, and 414 are
identical and allow for multiple independent measurements of an
extracellular effect conferred by a single set of effector cells in
a single chamber. Alternatively, particles 412 and 414 are
distinguishable and the assay is performed serially.
[0349] In one embodiment, the presence of one or more extracellular
effects is analyzed. Depending on the effect, one of skill in the
art will recognize that the presence or the absence of the combined
extracellular effects may be desired. Similarly, it is also
possible that the desired properties include the presence of one or
more types of extracellular effect and the absence of a different
type of extracellular effect. For instance, in one embodiment, a
multifunctional assay is used to identify an effector cell
secreting an antibody that binds to a receptor epitope on a readout
cell but that does not induce the activation of the corresponding
signaling pathway.
[0350] In one embodiment, a multifunctional assay is carried out in
a chamber comprising multiple effector zones, for example, by
introducing different effector cells, or combinations of effector
cells, into the different regions. For example, in one embodiment,
different cell populations producing antibodies of known affinity
for a target antigen are introduced into different effector zones
of a chamber. Binding of the target in the context of the mixtures
can then be compared to binding of the target in the context of the
individual effector cells alone. Accordingly, such use of multiple
effector zones allows for the screening of multiple combinations in
a single chamber.
[0351] In one embodiment of the assays provided herein, after
readout particles are incubated with a cell population in a
microfluidic chamber, a fluorescent measurement is taken to
determine if a cell within the population demonstrates an
extracellular effect. In this embodiment, the readout particle
population is fluorescently labeled and a change in fluorescence is
correlated with the presence and/or size of the extracellular
effect. The readout particle population can be fluorescently
labeled directly or indirectly. In some embodiments, as provided
throughout, accessory particles (e.g., accessory cells) are
provided to a chamber to aid in facilitating the fluorescent
readout. As will be appreciated by one of skill in the art, care is
taken to design assays that provide readout particles and effector
cells in one focal plane, to allow for accurate imaging and
fluorescent measurement.
[0352] In one embodiment, readout particle responses are monitored
using automated high resolution microscopy. For example, imaging
can be monitored by using a 20.times. (0.4 N.A.) objective on an
Axiovert 200 (Zeiss) or DMIRE2 (Leica) motorized inverted
microscope. Using the automated microscopy system provided herein
allows for complete imaging of a 4000 chamber array, including 1
bright-field and 3 fluorescent channels, in approximately 30
minutes. This platform can be adapted to various chip designs, as
described in Lecault et al. (2011). Nature Methods 8, pp. 581-586,
incorporated by reference herein in its entirety for all purposes.
Importantly, the imaging methods used herein achieve a sufficient
signal in effect positive chambers while minimizing photodamage to
cells.
[0353] In one embodiment, the effector cell assays provided herein
benefit from long-term cell culture, and therefore require that the
effector cells maintained in the device are viable and healthy
cells. It will be appreciated that in embodiments where readout
cells or accessory cells are used in an effector cell assay, that
they too be maintained in a healthy state and are viable and
healthy. The fluidic architectures provided herein enable careful
and precise control of medium conditions to maintain effector and
readout cell viability so that functional assays can be carried
out. For example, some cell types require autocrine or paracrine
factors that depend on the accumulation of secreted products. For
instance, CHO cell growth rates are highly dependent on seeding
density. Confining a single CHO cell in 4-nL chamber corresponds to
a seeding density of 250,000 cells/ml, which is comparable to
conventional macroscale cultures. As shown in FIG. 73, single CHO
cells have a higher growth rate in a microfluidic device than when
plated in a multiwell plate. Because they thrive at high seeding
densities, CHO cells may not require perfusion for multiple days.
However, other cell types, in particular those that are
cytokine-dependent (e.g. ND13 cells, BaF3 cells, hematopoietic stem
cells), typically do not reach high concentrations in macroscale
culture and may require frequent feeding in the microfluidic device
to prevent cytokine depletion. The cytokines may be added to the
medium or produced by feeder cells. For instance, bone marrow
derived stromal cells and eosinophils have been shown to support
the survival of plasma cells because of their production of IL-6
and other factors (Wols et al., (2002), Journal of Immunology 169,
pp. 4213-21; Chu et al. (2011), Nature Immunology, 2, pp. 151-159,
incorporated by reference herein in their entireties). In this case
the perfusion frequency can be modulated to allow sufficient
accumulation of paracrine factors while preventing nutrient
depletion.
[0354] In one aspect, the present invention provides a method for
determining whether a cell population optionally comprising one or
more effector cells exerts an extracellular effect a readout
particle (e.g., a cell comprising a cell surface receptor). The
effector cell can be present in a heterogeneous cell population, a
homogeneous population, or as a single cell. In one embodiment, the
effector cell is an antibody secreting cell. The one or more
extracellular properties, in one embodiment, comprise an
extracellular effect on a readout particle, for example, the
inhibition (antagonism) or activation (agonism) of a cell surface
receptor (e.g., the agonist and/or antagonist properties of an
antibody secreted by an antibody secreting cell) on a readout cell.
In a further embodiment, the extracellular effect is an agonist or
antagonist effect on a transmembrane protein, which in a further
embodiment is a G protein coupled receptor (GPCR), a receptor
tyrosine kinase (RTK), an ion channel or an ABC transporter. In a
further embodiment, the receptor is a cytokine receptor. An
extracellular effect on other metabotropic receptors besides GPCRs
and RTKs can be assessed, for example, an extracellular effect on a
guanylyl cyclase receptor can be assessed incubating a cell
population with a readout cell population expressing the guanylyl
cyclase receptor.
[0355] In embodiments where a readout cell is used, the readout
cell can be alive or fixed. With respect to a fixed readout cell,
the extracellular effect in one embodiment, is an effect on an
intracellular protein of the fixed readout cell. Extracellular
effects can also be measured on extracellular proteins of an alive
or fixed readout cell, or a secreted protein of an alive readout
cell.
[0356] In another embodiment, a readout cell expresses one of the
following types of cell receptors, and the extracellular effect
assay measures binding, agonism or antagonism of the cell receptor:
receptor serine/threonine kinase, histidine-kinase associated
receptor.
[0357] In embodiments where a particular receptor (e.g., receptor
serine/threonine kinase, histidine-kinase associated receptor or
GPCR) is an orphan receptor, that is, the ligand for activating the
particular receptor is unknown, the methods provided herein allow
for the discovery of a ligand for the particular orphan receptor by
performing an extracellular assay on readout cells expressing the
orphan receptor, and identifying a cell population or
subpopulations comprising an effector cell having a variation of an
extracellular effect on the readout cell expressing the orphan
receptor.
[0358] In one embodiment, the cell surface protein is a
transmembrane ion channel. In a further embodiment, the ion channel
is a ligand gated ion channel and the extracellular effect measured
in the microfluidic assay is modulation of the ion channel gating,
for example, opening of the ion channel by agonist binding or
closing/blocking of the ion channel by antagonist binding. The
antagonist or agonist can be for example, a biomolecule (e.g.,
antibody) secreted by one or more effector cells in the
heterogeneous population of cells comprising one or more effector
cells. Extracellular assays described herein can be used to measure
the extracellular effect of an effector cell on a cell expressing a
ligand gated ion channel in the Cys-loop superfamily, an ionotropic
glutamate receptor and/or an ATP gated ion channel. Specific
examples of anionic cys-loop ion gated channels include the GABAA
receptor and the glycine receptor (GlyR). Specific examples of
cationic cys-loop ion gated channels include the serotonin (5-HT)
receptor, nicotinic acetylcholine (nAChR) and the zinc-activated
ion channel. One or more of the aforementioned channels can be
expressed by a readout cell to determine whether an effector cell
has an extracellular effect on the respective cell by agonizing or
antagonizing the ion channel. Ion flux measurements typically occur
in short periods of time (i.e., seconds) and require precise
fluidic control for their implementation. Examples of commercially
available ion channel assays include Fluo-4-Direct Calcium Assay
Kit (Life Technologies), FLIPR Membrane Potential Assay Kit
(Molecular Devices). Ion-channel expressing cell lines are also
commercially available (e.g. PrecisION.TM. cell lines, EMD
Millipore).
[0359] In one embodiment, the cell surface protein is an
ATP-binding cassette (ABC) transporter, and the extracellular
effect measured is the transport of a substrate across a membrane.
The readout particles can be membrane vesicles derived from cells
expressing the protein (e.g., GenoMembrane ABC Transporter Vesicles
(Life Technologies)), which can be immobilized on beads. For
instance, the ABC transporter could be a permeability glycoprotein
(multidrug resistant protein) and the effect can be measured by the
fluorescence intensity of calcein in readout cells. The Vybrant.TM.
Multidrug Resistance Assay Kit (Molecular Probes) is commercially
available to implement such an assay.
[0360] An extracellular effect can also be assessed on a readout
cell expressing an ionotropic glutamate receptor such as the AMPA
receptor (class GluA), kainite receptor (class GluK) or NMDA
receptor (class GluN). Similarly, an extracellular effect can also
be assessed on a readout cell expressing an ATP gated channel or a
phosphatidylinositol 4-5-bisphosphate (PIP2)-gated channel.
[0361] As provided throughout, the present invention provides a
method of identifying a cell population displaying a variation in
an extracellular effect. In one embodiment, the method comprises,
retaining a plurality of individual cell populations in separate
microfluidic chambers, wherein at least one of the individual cell
populations comprises one or more effector cells and the contents
of the separate microfluidic chambers further comprise a readout
particle population comprising one or more readout particles,
incubating the individual cell populations and the readout particle
population within the microfluidic chambers, assaying the
individual cell populations for the presence of the extracellular
effect, wherein the readout particle population or subpopulation
thereof provides a readout of the extracellular effect. In one
embodiment, the extracellular effect is an effect on a receptor
tyrosine kinase (RTK), for example, binding to the RTK, antagonism
of the RTK, or agonism of the RTK. RTKs are high affinity cell
surface receptors for many polypeptide growth factors, cytokines
and hormones. To date, there have been approximately sixty receptor
kinase proteins identified in the human genome (Robinson et al.
(2000). Oncogene 19, pp. 5548-5557, incorporated by reference in
its entirety for all purposes). RTKs have been shown to regulate
cellular processes and to have a role in development and
progression of many types of cancer (Zwick et al. (2001). Endocr.
Relat. Cancer 8, pp. 161-173, incorporated by reference in its
entirety for all purposes).
[0362] Where the extracellular effect is an effect on an RTK, the
present invention is not limited to a specific RTK class or member.
Approximately twenty different RTK classes have been identified,
and extracellular effects on members of any one of these classes
can be screened for with the methods and devices provided herein.
Table 2 provides different RTK classes and representative members
of each class, each amenable for use herein when expressed on a
readout particle, e.g., readout cell or vesicle. In one embodiment,
a method is provided herein for screening a plurality of cell
populations in a parallel manner in order to identify one or more
populations comprising an effector cell having an extracellular
effect on an RTK of one of the subclasses provided in Table 2. In
one embodiment, the method further comprises isolating the one or
more cell populations comprising the ASC having the extracellular
effect to provide an isolated cell population and further
subjecting the isolated subpopulation to one or more additional
extracellular effect assay, at limiting dilution, to identify the
ASC having the extracellular effect. The additional extracellular
effect assay can be carried out via a microfluidic method provided
herein, or a benchtop assay. Alternatively, once a cell population
is identified that has a cell exhibiting an extracellular effect on
the RTK, the cell population is recovered, lysed and the nucleic
acid amplified. In a further embodiment, the nucleic acid is one or
more antibody genes.
[0363] In one embodiment, the present invention relates to the
identification of a cell population comprising an effector cell
that antagonizes or agonizes an RTK (i.e., the extracellular
effect), for example, via a secretion product, e.g., a monoclonal
antibody. The effector cell is present a lone effector cell, or is
present in a cell population comprising one or more effector
cells.
TABLE-US-00002 TABLE 2 RTK classes and representative members of
each class. Representative Representative Cellular RTK class
members Ligands Process(es) RTK class I ErbB-1 (epidermal epidermal
growth overexpression (epidermal growth factor factor (EGF)
implicated in growth factor receptor) transforming growth
turmorigenesis receptor factor .alpha. (TGF-.alpha.) (EGFR)
heparin-binding family, also EGF-like growth known as the factor
(HB-EGF) ErbB family) amphiregulin (AREG) betacellulin epigen
epiregulin ErbB-2 (human Monoclonal turmorigenesis epidermal growth
antibody (e.g., breast, factor receptor 2 trastuzumab ovarian,
stomach, (HER2)/ cluster of (Herceptin) uterine) differentiation
340 (CD340) / proto- oncogene Neu) Neuregulin 1 Proliferation and
ErbB-3 (human Proliferation differentiation epidermal growth
associated Oncogenesis factor receptor protein 2G4 (overexpression)
2 (HER3)) (PA2G4) (EBP1 or ErbB3 binding protein 1)
Phosphatidylinositol 3 kinase regulatory subunit alpha (PIK3R1)
Regulator of G protein signaling 4 (RGP4) ErbB-4 (human
heparin-binding Mutations in epidermal EGF-like growth the RTK have
been growth factor factor (HB- associated with receptor 2 (HER4))
EGF) betacellulin cancer epiregulin Neuregulin 1 Neuregulin 2
Neuregulin 3 Neuregulin 4 RTK class II Insulin receptor Insulin
inducing glucose (Insulin insulin-like growth uptake receptor
factor 1 (IGF-1) / family) somatomedin C insulin-like growth factor
2 (IGF-2) RTK class III PDGFR.alpha. PDGF A/B/C and D Fibrosis
(Platelet PDGFR.beta. PDGF A/B/C and D cancer derived Mast/stem
cell Stem cell factor Oncogenesis growth growth factor (SCF) /
c-kit Cell survival, factor receptor (SCFR) / ligand / steel factor
proliferation, (PDGF) c-Kit / CD117 differentiation receptor Colony
stimulating Colony stimulating Production, family) factor 1 factor
1 differentiation and receptor / (CD 115) / function of macrophage
colony- macrophages stimulating factor receptor (M-CSFR) Expressed
on Cluster of Flt3 ligand (FLT3L) surface of many differentiation
hematopoietic antigen progenitor cells 135 (CD 135) / Mutated in
acute Fms-like tyrosine myeloid leukemia kinase 3 (FLT-3) Cell
survival Proliferation differentiation RTK class IV Fibroblast
growth Fibroblast growth Wound healing (FGF receptor factor
receptor-1 factor 1-10 Embryonic family) (CD331) development
Fibroblast angiogenesis growth factor receptor-2 (CD332) Fibroblast
growth factor receptor-3 (CD333) Fibroblast growth factor
receptor-4 (CD334) Fibroblast growth factor receptor-6 RTK class V
VEGFR1 VEGF-A Mitogenesis (VEGF receptor VEGF-B Cell migration
family) VEGFR2 VEGF-A Vasculogenesis (membrane VEGF-C angiogenesis
bound VEGF-D or soluble VEGF-E depending on VEGFR3 VEGF-C
alternative VEGF-D splicing) RTK class VI Hepatocyte growth
Hepatocyte growth Deregulated in certain (Hepatocyte factor
receptor factor malignancies, leads to growth (GHFR) (encoded by
angiogenesis factor MET or MNNG HOS Stem cells and receptor
transforming gene). progenitor cells express family) Mitogenesis,
morphogenesis RTK class VII Tropomyosin- Neurotrophins Regulate
synaptic (Trk receptor receptor kinases Nerve growth factor
strength and family) (Trk) (TrkA) plasticity in TrkA Brain-derived
the mammalian TrkB neurotrophic factor nervous system TrkC (BDNF)
(TrkB) Neurotrophin-3 (NT3) (TrkC) RTK class VIII EphA Ephrin-A
Embryonic development (Ephrin (Eph) (1, 2, 3, 4, 5, 6,
(Ephrin-A1-5) Axon guidance receptor 7, 8, 9, 10) Ephrin-B (1-4
Formation of tissue family) EphB (1, 2, 3, and ephrin-B6)
boundaries 4, 5, 6) Retinopic mapping Cell migration Cell
segmentation Angiogenesis Cancer RTK class IX Tyrosine-protein
Tensin-like C1 epithelial-to- (AXL receptor kinase receptor domain
containing mesenchymal family) UFO (AXL) phosphatase
transition-induced (TENC1) regulator of breast cancer metastasis
Regulation of cell migration RTK class X Leukocyte receptor Insulin
receptor Apoptosis (Leukocyte tyrosine kinase substrate 1 (IRS-1)
Cell growth and receptor (LTK) Src homology 2 differentiation
tyrosine kinase domain containing (LTK) family) protein (Shc)
Phosphatidylinositol 3-kinase regulatory subunit alpha (PIK3R1) RTK
class XI Tyrosine kinase with Angiopoietin 1 Promotion of (TIE
receptor immunoglobulin-like (Tie2 agonist) angiogenesis TIE1 has
family) and EGF-like Angiopoietin 2 a proinflammatory domains (TIE)
1 (Tie2 antagonist) effect and may play a TIE 2 Angiopoietin 3 role
in atherosclerosis (Tie2 antagonist) (Chan et al. (2008).
Angiopoietin 4 Biochem. Biophys. (Tie2 agonist) Res. Commun. 371,
pp. 475-479. RTK class XII ROR-1 (neurotrophic Wnt ligands ROR-1
modulates (Receptor tyrosine kinase, (ROR-2) neurite growth
typrosine kinase- receptor-related 1 in the central like orphan
(NTRKR1) nervous system. receptors ROR-2 (ROR) family) RTK class
XIII DDR-1 (CD167a) Various types of DDR-1 is (discoidin DDR-2
collagen overexpressed in breast, domain ovarian, esophageal
receptor and pediatric (DDR) family) brain tumors RTK class XIV
Rearranged during Glial cell line- Loss of function (RET receptor
transfection derived associated with family) (RET) proto-
nuerotrophic Hirschsprung's disease oncogene 3 different factor
(GDNF) Gain of function isoforms (51, 43, 9) family ligands
mutations associated with various types of cancer (e.g., medullary
thyroid carcinoma, multiple endocrine neoplasias type 2A and 2D)
RTK class XV Tyrosine-protein No ligand has Development (KLG
receptor kinase-like 7 been identified Oncogenesis (colon family)
(PTK7) / CCK-4 cancer, melanoma, breast cancer, acute myeloid
leukemia) Wnt pathway regulation Angiogenesis RTK class XVI RYK
receptor Wnt ligands Stimulating (Related to (different Wnt
signaling receptor tyrosine isoforms due to pathways such
kinase(RYK) alternative splicing) as regulation of receptor family)
axon pathfinding RTK class XVII Muscle-Specific Agrin (nerve-
Formation of the (Muscle-Specific kinase (MuSK) derived
neuromuscular kinase (MuSK) receptor proteoglycan) junction
receptor family)
[0364] In one embodiment, the RTK is a platelet derived growth
factor receptor (PDGFR), e.g., PDGFR.alpha.. PDGFs are a family of
soluble growth factors (A, B, C, and D) that combine to form a
variety of homo- and hetero-dimers. These dimers are recognized by
two closely related receptors, PDGFR.alpha. and PDGFR.beta., with
different specificities. In particular, PDGF-.alpha. binds
selectively to PDGFR.alpha. and has been shown to drive
pathological mesenchymal responses in fibrotic diseases, including
pulmonary fibrosis, liver cirrhosis, scleroderma,
glomerulosclerosis, and cardiac fibrosis (see Andrae et al. (2008).
Genes Dev. 22, pp. 1276-1312, incorporated by reference herein in
its entirety). It has also been demonstrated that constitutive
activation of PDGFR.alpha. in mice leads to progressive fibrosis in
multiple organs (Olson et al. (2009). Dev. Cell 16, pp. 303-313,
incorporated by reference herein in its entirety). Thus therapies
that inhibit PDGFR.alpha. have high potential for the treatment of
fibrosis, a condition that complicates up to 40% of diseases, and
represents a huge unmet medical problem in the aging population.
Although antibodies (Imatinib and Nilotinib) have been explored as
inhibitors of PDGFR.alpha., each has significant off-target effects
on other central RTKs, including c-kit and Flt-3, resulting in
numerous side effects. Thus, while Imatinib and Nilotinib can
effectively inhibit PDGFR.alpha. and PDGFR.beta., their side
effects make them unacceptable in the treatment of fibrotic
diseases, highlighting the potential for highly specific antibody
inhibitors. The present invention overcomes this problem by
providing in one embodiment, antibodies with greater PDGFR.alpha.
specificity, as compared to Imatinib and Nilotinib.
[0365] PDGFR.alpha. has been previously established as a target for
the treatment of fibrosis. Two anti-human PDGFR.alpha. mAb
antagonists entering early clinical trials for the treatment of
cancer are in development (see, e.g., Shah et al (2010). Cancer
116, pp. 1018-1026, incorporated by reference herein in its
entirety). The methods provided herein facilitate the
identification of an effector cell secretion product that binds to
the PDGFR.alpha.. In a further embodiment, the secretion product
blocks the activity of both human and murine PDGFR.alpha. in both
cancer and fibrosis models.
[0366] One embodiment of the effector cell assay to determine
whether an effector cell secretion product binds to PDGFR.alpha. is
based on the use of suspension cell lines (e.g., 32D and Ba/F3)
that are strictly dependent on the cytokine IL-3 for survival and
growth, but can be cured of this "IL-3 addiction" through the
expression and activation of nearly any tyrosine kinase. This
approach was first used by Dailey and Baltimore to evaluate the
BCR-ABL fusion oncogene and has been used extensively for
high-throughput screening of small molecule tyrosine kinase
inhibitors (see, e.g., Warmuth et al. (2007). Curr. Opin. Oncology
19, pp. 55-60; Daley and Baltimore (1988). Proc. Natl. Acad. Sci.
U.S.A. 85, pp. 9312-9316, each incorporated by reference in their
entireties for all purposes). To monitor signaling, PDGFR.alpha.
and PDGFR.beta. (both human and mouse forms) are expressed in 32D
cells (readout cells), a murine hematopoietic cell line that does
not naturally express either receptor. This allows for separation
of each pathway, something that is otherwise difficult since both
receptors are often co-expressed. Expression of human
PDGFR.alpha./.beta. in 32D cells has been previously confirmed to
give a functional PDGF-induced mitogenic response (Matsui et al.
(1989). Proc. Natl. Acad. Sci. U.S.A. 86, pp. 8314-8318,
incorporated by reference in its entirety). In the absence of IL-3,
32D cells do not divide at all, but PDGF stimulation of the cells
expressing the RTK relieves the requirement for IL-3 and gives a
rapid mitogenic response that is detectable by microscopy. The
detectable response, in one embodiment, is cell proliferation, a
morphological change, increased motility/chemotaxis, or cell
death/apoptosis in the presence of an antagonist. An optical
multiplexing method, in one embodiment, is used to simultaneously
measure the inhibition/activation of both PDGFR.alpha. and
PDGFR.beta. responses in one of the devices provided herein. In
another embodiment, inhibition/activation of both PDGFR.alpha. and
PDGFR.beta. responses in one of the devices provided herein is
measured by two extracellular assays, carried out serially in the
same microfluidic chamber.
[0367] Full length cDNA for human/mouse PDGFR.alpha. and
PDGFR.beta. (Sino Biological), in one embodiment, is expressed in
32D cells (ATCC; CRL-11346) using modified pCMV expression vectors
that also include an IRES sequence with either GFP or RFP, thereby
making two types of "readout cells," each distinguishable by
fluorescent imaging. The readout cells are characterized to
optimize medium and feeding conditions, determine the dose response
to PDGF ligand, and to characterize the morphology and kinetics of
response. The use of suspension cells (such as 32D or Ba/F3)
provides the advantage that single cells are easily identified by
image analysis, and are also physically smaller (in projected area)
than adherent cells so that a single chamber can accommodate
.gtoreq.100 readout cells before reaching confluence. In another
embodiment, instead of 32D cells, Ba/F3 cells, another IL-3
dependent mouse cell line with similar properties to 32D are used
as readout cells. Both 32D and Ba/F3 cells are derived from bone
marrow, grow well in medium optimized for ASCs, and also secrete
IL-6 which is a critical growth factor for the maintenance of ASCs
(see, e.g., Cassese et al. (2003). J. Immunol. 171, pp. 1684-1690,
incorporated by reference in its entirety herein).
[0368] Preclinical models for evaluating the role of
PDGFR.quadrature..quadrature. in fibrosis have been developed.
Specifically, two models of cardiac fibrosis are provided herein.
The first is based on ischemic damage (isoproterenol-induced
cardiac damage; ICD) and the second is based on coronary artery
ligation-induced myocardial infarction (MI). Upon damage, the
fibrotic response is initiated by the rapid expansion of
PDGFR.alpha.+/Sca1+ positive progenitors, accounting for over 50%
of the cells proliferating in response to damage followed by
differentiation of these progeny into matrix producing PDGFR.alpha.
low/Sca1 low myofibroblasts. Gene expression by RT-qPCR
demonstrates expression of multiple markers related to fibrotic
matrix deposition, including .alpha.-smooth muscle actin (aSMA) and
collagen type I (Coll), which are detectable in (Sca1+)
progenitors, but are substantially up-regulated in the
differentiated population. In one embodiment, a cell population is
identified that comprises an effector cell that secretes a
monoclonal antibody that attenuates progenitor expansion leading to
reduced fibrosis. This extracellular effect assay is carried out by
monitoring two independent markers: early proliferation of
Sca1+/PDGFR.alpha.+ progenitors cells and Coll-driven GFP.
Specifically, following MI, fibrotic responses are characterized by
GFP expression first in PDGFR.alpha.+/Sca1+ progenitors, and later,
with increased intensity, in the emerging myofibroblast
population.
[0369] The present invention provides methods and devices for
screening a plurality of cell populations in a parallel manner to
identify one or more of the cell populations having an
extracellular effect, or a variation in an extracellular effect as
compared to another population in the plurality. The identified
cell population comprises one or more effector cells that are
responsible for the extracellular effect. The extracellular effect,
for example, is an extracellular effect on a GPCR, e.g., GPCR
binding, agonism or antagonism. As described herein, the
extracellular effect need not be attributable to every cell in the
population, or even multiple cells. Rather, the methods provided
herein allow for the detection of an extracellular effect of a
single effector cell, when the effector cell is present in a
heterogeneous population comprising tens to hundreds of cells
(e.g., from about 10 to about 500 cells, or from about 10 to about
100 cells), or comprising from about 2 to about 100 cells, e.g.,
from about 2 to about 10 cells.
[0370] GPCRs are a superfamily of seven transmembrane receptors
that includes over 800 members in the human genome. Each GPCR has
its amino terminus located on the extracellular face of the cell
and the C-terminal tail facing the cytosol. On the inside of the
cell GPCRs bind to heterotrimeric G-proteins. Upon agonist binding,
the GPCR undergoes a conformational change that leads to activation
of the associated G-protein. Approximately half of these are
olfactory receptors with the rest responding to a gamut of
different ligands that range from calcium and metabolites to
cytokines and neurotransmitters. The present invention, in one
embodiment, provides a method for selecting one or more ASCs that
have an extracellular effect on a GPCR. The GPCR is not limited
herein. Rather, screening methods for any GPCR are amenable for use
with the present invention.
[0371] The type of G-protein that naturally associates with the
specific GPCR dictates the cell signaling cascade that is
transduced. For Gq coupled receptors the signal that results from
receptor activation is an increase in intracellular calcium levels.
For Gs coupled receptors, an increase in intracellular cAMP is
observed. For Gi coupled receptors, which make up 50% of all GPCRs,
activation results in an inhibition of cAMP production. For
embodiments where the effector cell property is activation of a Gi
coupled GPCR, it is sometimes necessary to stimulate the readout
cell(s) with a nonspecific activator of adenylyl cyclase. In one
embodiment, the adenyl cyclase activator is forskolin. Thus,
activation of the Gi coupled receptor by one or more effector cells
will prevent forskolin induced increase in cAMP. Forskolin,
accordingly, can be used as an accessory particle in one or more
GPCR extracellular effect assays provided herein.
[0372] The present invention, in one embodiment, provides means for
determining whether an effector cell (e.g., an ASC) within a cell
population has an extracellular effect on a GPCR. The GPCR is
present on one or more readout particles in a microfluidic chamber
and the extracellular effect in one embodiment, is binding to the
GPCR, a demonstrated affinity or specificity, inhibition or
activation. The GPCR may be a stabilized GPCR, such as one of the
GPCRs made by the methods of Heptares Therapeutics (stabilized
receptor, StaR.RTM. technology). The effector cell (e.g., ASC), in
one embodiment, is present as a single cell, or in a homogeneous or
heterogeneous cell population within a microfluidic chamber. In one
embodiment, the methods and devices provided herein are used to
identify one or more cell populations each comprising one or more
ASCs that secrete one or more antibodies that demonstrate an
extracellular effect on one of the GPCRs set forth in Table 3A
and/or Table 3B, or one of the GPCRs disclosed in International PCT
Publication WO 2004/040000, incorporated by reference in its
entirety. For example, in one embodiment, the GPCR belongs to one
of the following classes: class A, class B, class C, adhesion,
frizzled.
[0373] In another embodiment, the extracellular effect is an effect
on an endothelial differentiation, G-protein-coupled (EDG)
receptor. The EDG receptor family includes II GPCRs (S1P1-5 and
LPA1-6) that are responsible for lipid signalling and bind
lysophosphandic acid (LPA) and sphingosine I-phosphate (SIP).
Signalling through LPA and SIP regulates numerous functions in
health and disease, including cell proliferation, immune cell
activation, migration, invasion, inflammation, and angiogenesis.
There has been little success in generating potent and specific
small molecule inhibitors to this family, making mAbs a very
attractive, alternative. In one embodiment, the EDG receptor is
S1P3 (EDG3), S1PR1 (EDG1), the latter of which has been shown to
activate NF-.kappa.B and STAT3 in several types of cancers
including breast, lymphoma, ovarian, and melanoma, and plays a key
role in immune cell trafficking and cancer metastasis (Milstien and
Spiegel (2006). Cancer Cell 9, pp. 148-15, incorporated by
reference in its entirety herein). A monoclonal antibody that
neutralizes the SIP ligand (Sonepcizumab) has recently entered
phase II trials for treatment of advanced solid tumours
(NCT00661414). In one embodiment, the methods and devices provided
herein are used to identify and isolate an ASC that secretes an
antibody with greater affinity than Sonepcizumab, or an antibody
that inhibits SIP to a greater extent than Sonepcizumab. In another
embodiment, the extracellular effect is an effect on the LPA2
(EDG4) receptor. LPA2 is overexpressed in thyroid, colon, stomach
and breast carcinomas, as well as many ovarian tumours, for which
LPA2 is the primary contributor to the sensitivity and deleterious
effects of LPA.
[0374] In one embodiment, cell populations are assayed for whether
they exhibit an extracellular effect on a chemokine receptor,
present on a readout particle. In a further embodiment, the
chemokine receptor is C-X-C chemokine receptor type 4 (CXCR-4),
also known as fusin or CD184. CXCR4 binds SDF1.alpha. (CXCL12), a
strong chemotactic for immune cell recruitment also known as C-X-C
motif chemokine 12 (CXCL12). DNA immunizations were used to
generate 92 hybridomas against this target, 75 of which exhibited
different chain usage and epitope recognition (Genetic Eng and
Biotech news, August 2013), indicating that hybridoma selections
capture only a small portion of available antibody diversity.
Signalling through the CXCR4/CXCL12 axis has been shown to play a
central role in tumour cell growth, angiogenesis, cell survival and
to be implicated in mediating the growth of secondary metastases in
CXCL12-producing organs like liver and bone marrow (Teicher and
Fricker (2010). Clin. Cancer Res. 16, pp. 2927-2931, incorporated
by reference herein in its entirety).
[0375] In another embodiment, cell populations are screened for
their ability to exert an effect on the chemokine receptor CXCR7,
which was recently found to bind SDF1.alpha.. Unlike CXCR4 which
signals through canonical G protein coupling, CXCR7 signals
uniquely through the 3-arrestin pathway.
[0376] In another embodiment, the GPCR is protease activated
receptors (PAR1, PAR3, and PAR4), which is a class of GPCRs
activated by thrombin-mediated cleavage of the exposed N-terminus
and are involved in fibrosis. In yet another embodiment, the GPCR
is one of the GPCRs in Table 3A or Table 3B, below.
[0377] In embodiments where an extracellular effect is an effect on
a GPCR, the invention is not limited to the particular GPCR. For
example, cell lines that express particular GPCRs, engineered to
provide a readout of binding, activation or inhibition, are
commercially available for example, from Life Technologies
(GeneBLAzer.RTM. and Tango.TM. cell lines), DiscoveRx, Cisbio,
Perkin Elmer, etc., and are amenable for use as readout cells
herein.
[0378] In one embodiment, a GPCR from one of the following receptor
families is expressed on one or more readout cells herein, and an
extracellular effect is measured with respect to one or more of the
following GPCRs: acetylcholine receptor, adenosine receptor, adreno
receptor, angiotensin receptor, bradykinin receptor, calcitonin
receptor, calcium sensing receptor, cannabinoid receptor, chemokine
receptor, cholecystokinin receptor, complement component (C5AR1),
corticotrophin releasing factor receptor, dopamine receptor,
endothelial differentiation gene receptor, endothelin receptor,
formyl peptide-like receptor, galanin receptor, gastrin releasing
peptide receptor, receptor ghrelin receptor, gastric inhibitory
polypeptide receptor, glucagon receptor, gonadotropin releasing
hormone receptor, histamine receptor, kisspeptin (KiSS1) receptor,
leukotriene receptor, melanin-concentrating hormone receptor,
melanocortin receptor, melatonin receptor, motilin receptor,
neuropeptide receptor, nicotinic acid, opioid receptor, orexin
receptor, orphan receptor, platelet activating factor receptor,
prokineticin receptor, prolactin releasing peptide, prostanoid
receptor, protease activated receptor, P2Y (purinergic) receptor,
relaxin receptor, secretin receptor, serotonin receptor,
somatostatin receptor, tachykinin receptor, vasopressin receptor,
oxytocin receptor, vasoactive intestinal peptide (VIP) receptor or
the pituitary adenylate cyclase activating polypeptide (PACAP)
receptor.
TABLE-US-00003 TABLE 3A GPCRs amenable for expression in Readout
Cells or as Part of a Stabilized Readout Particle. Human gene
Family symbol Human Gene Name Calcitonin receptors CALCR calcitonin
receptor Calcitonin receptors CALCRL calcitonin receptor-like
Corticotropin- CRHR1 corticotropin releasing releasing hormone
factor receptors receptor 1 Corticotropin- CRHR2 corticotropin
releasing releasing hormone factor receptors receptor 2 Glucagon
receptor GHRHR growth hormone family releasing hormone receptor
Glucagon receptor GIPR gastric inhibitory polypeptide family
receptor Glucagon receptor GLP1R glucagon-like family peptide 1
receptor Glucagon receptor GLP2R glucagon-like family peptide 2
receptor Glucagon receptor GCGR glucagon receptor family Glucagon
receptor SCTR secretin receptor family Parathyroid PTH1R
parathyroid hormone hormone receptors 1 receptor Parathyroid PTH2R
parathyroid hormone hormone receptors 2 receptor VIP and PACAP
ADCYAP1R1 adenylate cyclase activating receptors polypeptide 1
(pituitary) receptor type I VIP and PACAP VIPR1 vasoactive
intestinal receptors peptide receptor 1 VIP and PACAP VIPR2
vasoactive intestinal receptors peptide receptor 2 Adenosine ADORA1
Adenosine A1 receptor Adenosine ADORA2A Adenosine A2 receptor
Adenosine ADRB3 Adenosine 3 receptor Chemokine CXCR1 C-X-C
chemokine receptor 1 Chemokine CXCR2 C-X-C chemokine receptor 2
Chemokine CXCR3 C-X-C chemokine receptor 3 Chemokine CXCR4 C-X-C
chemokine receptor 4 Chemokine CXCR5 C-X-C chemokine receptor 5
Chemokine CXCR6 C-X-C chemokine receptor 6 Chemokine CXCR7 C-X-C
chemokine receptor 7 Chemokine CCR1 C-C chemokine receptor type 1
Chemokine CCR2 C-C chemokine receptor type 2 Chemokine CCR3 C-C
chemokine receptor type 3 Chemokine CCR4 C-C chemokine receptor
type 4 Chemokine CCR5 C-C chemokine receptor type 5 Chemokine CCR6
C-C chemokine receptor type 6 Chemokine CCR7 C-C chemokine receptor
type 7 Chemokine CMKLR1 Chemokine receptor-like 1 Complement C5AR1
Complement component AR1 component receptor Lysophospholipid LPAR1
lysophosphatidic acid (LPL) receptor receptor 1 Lysophospholipid
LPAR2 lysophosphatidic acid (LPL) receptor receptor 2
Lysophospholipid LPAR3 lysophosphatidic acid (LPL) receptor
receptor 3 Lysophospholipid LPAR4 lysophosphatidic acid (LPL)
receptor receptor 4 Lysophospholipid LPAR5 lysophosphatidic acid
(LPL) receptor receptor 5 Lysophospholipid LPAR6 lysophosphatidic
acid (LPL) receptor receptor 6 Lysophospholipid SIPR1
sphingosine-1- (LPL) receptor phosphate receptor 1 Lysophospholipid
SIPR2 sphingosine-1- (LPL) receptor phosphate receptor 2
Lysophospholipid SIPR3 sphingosine-1- (LPL) receptor phosphate
receptor 3 Lysophospholipid SIPR4 sphingosine-1- (LPL) receptor
phosphate receptor 4 Lysophospholipid SIPR5 sphingosine-1- (LPL)
receptor phosphate receptor 5
TABLE-US-00004 TABLE 3B GPCRs amenable for expression in Readout
Cells or as Part of a Stabilized Readout Particle. GPCR (Gene
symbol) Ligand(s) 5-hydroxytryptamine 5-hydroxytryptamine 1A
receptor (HTR1A) 5-hydroxytryptamine 5-hydroxytryptamine 1B
receptor (HTR1B) 5-hydroxytryptamine 5-hydroxytryptamine 1D
receptor (HTR1D) 5-hydroxytryptamine 5-hydroxytryptamine 1e
receptor (HTR1E) 5-hydroxytryptamine 1F 5-hydroxytryptamine
receptor (HTR1F) 5-hydroxytryptamine 2A 5-hydroxytryptamine
receptor (HTR2A) 5-hydroxytryptamine 2B 5-hydroxytryptamine
receptor (HTR2B) 5-hydroxytryptamine 2C 5-hydroxytryptamine
receptor (HTR2C) 5-hydroxytryptamine 4 5-hydroxytryptamine receptor
(HTR4) 5-hydroxytryptamine 5a 5-hydroxytryptamine receptor (HTR5A)
5-hydroxytryptamine 5b 5-hydroxytryptamine receptor (HTR5BP)
5-hydroxytryptamine 5-hydroxytryptamine 6 receptor (HTR6)
5-hydroxytryptamine 7 5-hydroxytryptamine receptor (HTR7)
Acetylcholine M1 acetylcholine receptor (CHRA11) Acetylcholine M2
acetylcholine receptor (CHR1142) Acetylcholine M3 acetylcholine
receptor (CHRI143) Acetylcholine M4 acetylcholine receptor
(CHRI144) Acetylcholine M5 acetylcholine receptor (CHRI145)
Adenosine Al receptor adenosine (ADORA1) Adenosine A2A receptor
(ADORA2A) adenosine Adenosine A2B receptor (ADORA2B) adenosine
Adenosine A3 receptor adenosine (ADORA3)
.alpha..sub.1A-adrenoceptor Adrenaline, noradrenaline (ADRA1A)
agonists cirazoline, desvenlafaxine, etilefrine, metaraminol,
methoxamine, midodrine, naphazoline, oxymetrazoline, phenylephrine,
synephrine, tetrahydrozoline, xylometazoline antagonists alfuzosin,
arotinolol, carvedilol, doxazosin, indoramin, labetalol, moxislyte,
phenoxybenzamine, phentolamine, prazosin, quetiapine, risperidone,
silodosin, tamsulosin, terazosin, tolazoline, trimazosin
.alpha..sub.1B-adrenoceptor Adrenaline, noradrenaline (ADRA1B)
.alpha..sub.1D-adrenoceptor Adrenaline (ADRA1D)
.alpha..sub.2A-adrenoceptor Adrenaline (ADRA2A)
.alpha..sub.2C-adrenoceptor Adrenaline, noradrenaline (ADRA2B)
agonists salbutamol, bitolterol mesylate, isoproteronol,
levosalbutamol, metaproterenol, formoterol, salmeterol,
terbutaline, clenbuterol, ritodrine antagonists butoxamine, Beta
blockers a.sub.2C-adrenoceptor Adrenaline, noradrenaline (ADRA2C)
.beta..sub.1-adrenoceptor Adrenaline, noradrenaline (ADRB1)
nitrosamine 4- (methylnitrosamino)- 1-(3-pyridyl)-1-butanone (NNK)
agonists denopamine, dobutamine, xamoterol antagonists acebutol,
atenolol, betaxolol, bisoprolol, esmolol, metoprolol, nebivolol,
vortioxetine .beta..sub.2-adrenoceptor Adrenaline (ADRB2)
.beta..sub.3-adrenoceptor (ADRB3) Adrenaline Angiotensin recptor 1
Angiotensisn I, angiotensin II, (AT.sub.1) (AGTR1) angiotensin III
Angiotensin recptor 2 Angiotensisn II, angiotensin III (AT.sub.2)
(AGTR2) Angiotensin recptor 4 Angiotensisn IV (angiotensin II
metabolite) Apelin receptor (APLNR) Apelin-13, apelin-17, apelin-36
Bile acid receptor Chenodeoxycholic acid, (GPBAR1) cholic acid,
deoxycholic acid, lithocholic acid Bombesin receptor BB.sub.1
(NMBR) Gastrin-releasing peptide, neuromedin B Bombesin receptor
BB.sub.2 Gastrin-releasing peptide, (GRPR) neuromedin B Bombesin
receptor BB.sub.3 (BRS3) Bradykinin recpetor B1 bradykinin
Bradykinin recpetor B2 bradykinin Calcium sensing Calcium receptor
(CaSR) Magnesium G-protein coupled receptor family C group 6 member
A (GPRC6A) Cannabinoid CB.sub.1 receptor 2-arachidonoylglycerol
(CNR1) anandamide Cannabinoid CB.sub.2 receptor
2-arachidonoylglycerol (CNR2) anandamide C-X-C chemokine receptor
Interleukin 8 type 4 (CXCR2) Growth-related oncogene- alpha
(GRO-.alpha.) C-X-C chemokine receptor Stromal cell-derived type 4
(CXCR4) factor-1 (SDF1) Cholecystokinin A receptor Cholecystokinin
peptide (CCKAR or CCK1) hormones (CCK) Cholecystokinin B receptor
Cholecystokinin peptide (CCKAR or CCK2) hormones(CCK) Gastrin
Cholecystokinin recptor CCK-33, CCK-4, CCK-8, CCK1 (CCKAR)
gastrin-17 Cholecystokinin recptor CCK-33, CCK-4, CCK-8, CCK2
(CCKBR) gastrin-17 endothelin receptor A (ETA) Endothelin-1
endothelin receptor B1 Endothelin-1 (ETB1) Endothelin-3 endothelin
receptor B2 Endothelin-1 (ETB2) Endothelin-3 endothelin receptor C
(ETC) Endothelin-1 Frizzled 1 (FZD1) Wnt-1, Wnt-2, Wnt-3a, Wnt-5a,
Wnt-7b Frizzled 2 (FZD2) Wnt-5a Frizzled 3 (FZD3) Wnt protein
ligand Frizzled 4 (FZD4) Wnt protein ligand Frizzled 5 (FZD5) Wnt
protein ligand Frizzled 6 (FZD6) Wnt-3a, Wnt-4, Wnt-5a Frizzled 7
(FZD7) Wnt protein ligand Frizzled 8 (FZD8) Wnt protein ligands
Frizzled 9 (FZD9) Wnt protein ligands Frizzled 10 (FZD10) Wnt
protein ligands GABA.sub.B1 Receptor Agonist GABA.sub.B2 Receptor
GABA, Baclofen, gamma- (B1 and B2 assemble as hydroxybutyrate,
phenibut, heterodimer) 3-aminopropylphosphinic acid, lesogaberan,
SKF-97541, CGP-44532 Allosteric modulator CGP-7930, BHFF,
Fendiline, BHF-177, BSPP, GS-39783 Antagonists 2-OH-saclofen,
saclofen, phaclofen, SCH-50911, CGP-35348, CGP-52432, SGS-742,
CGP-55845 Gastrin-releasing peptide Gastrin releasing peptide
receptor (GRPR), also referred to as BB.sub.2 G protein-coupled
estrogen Oestrogen receptor 30 (GPR30) Luteinizing hormone/
Luteinizing hormone choriogonadotropin receptor Chroinic
gonadotropins (LHCGR), also referred to as Lutenizing hormone
receptor (LHR) and lutropin/ choriogonadotroptin receptor (LCGR)
Lysophosphatidic acid Lysophosphatidic acid receptor 1 (LPA1)
Lysophosphatidic acid Lysophosphatidic acid receptor 2 (LPA2)
Lysophosphatidic acid Lysophosphatidic acid receptor 3 (LPA3)
Melanocortin 1 receptor Melanocortins (pituitary (MC1R), also
referred peptide hormones) including o as melanocyte-
adrenocorticotropic hormone stimulating hormone (ACTH) and
melanocyte- receptor (MSHR), melanin- stimulating hormone (MSH)
activating peptide receptor and melanotropin receptor Neuromedin B
receptor Neuromedin B Prostaglandin E2 Prostaglandin E2 receptor
EP2 Prostaglandin E2 Prostaglandin E2 receptor EP4
Protease-activated receptor 1 Thrombin Protease-activated receptor
2 Trypsin Protease-activated receptor 3 Thrombin Protease-activated
receptor 4 Thrombin Smoothened Sonic hedgehog Thyrotropin receptor
Thyrotropin (TSH receptor) Metabotropic glutamate L-glutamic acid
receptor 1(GRM1) Metabotropic glutamate L-glutamic acid receptor 2
(GRM2) Metabotropic glutamate L-glutamic acid receptor 3 (GRM3)
Metabotropic glutamate L-glutamic acid receptor 4 (GRM4)
Metabotropic glutamate L-glutamic acid receptor 5 (GRM5)
Metabotropic glutamate L-glutamic acid receptor 6 (GRM6)
Metabotropic glutamate L-glutamic acid receptor 7 (GRM7)
Metabotropic glutamate L-glutamic acid receptor 8 (GRM8) G
protein-coupled receptor 56 (GPR56) G protein-coupled receptor 64
(GPR64) G protein-coupled receptor 97 (GPR97) G protein-coupled
receptor 98 (GPR98) G protein-coupled receptor 110 (GPR110) G
protein-coupled receptor 111 (GPR111) G protein-coupled receptor
112 (GPR112) G protein-coupled receptor 113 (GPR113) G
protein-coupled receptor 114 (GPR114) G protein-coupled receptor
115 (GPR115) G protein-coupled receptor 116 (GPR116) G
protein-coupled receptor 123 (GPR123) G protein-coupled receptor
124 (GPR124) G protein-coupled receptor 125 (GPR125) G
protein-coupled receptor 126 (GPR126) G protein-coupled receptor
128 (GPR128)
G protein-coupled receptor 133 (GPR133) G protein-coupled receptor
144 (GPR144) latrophilin 1 (LPHN1) latrophilin 2 (LPHN2)
latrophilin 3 (LPHN3)
[0379] In one embodiment, an effector cell is assayed for an
extracellular effect on a readout cell expressing a GPCR by one or
more of the assays provided in Table 4, below. In another
embodiment, a readout particle population comprises a vesicle or a
bead functionalized with a membrane extracts (available from
Integral Molecular), or a stabilized solubilized GPCR (e.g.,
Heptares).
[0380] GPCRs can be phosphorylated and interact with proteins
called arrestins. The three major ways to measure arrestin
activation are: (i) microscopy--using a fluorescently labeled
arrestin (e.g., GFP or YFP); (ii) using enzyme complementation;
(iii) using the TANGO.TM. Reporter system (.beta.-lactamase)
(Promega). In one embodiment, the TANGO.TM. Reporter system is
employed in a readout cell or plurality of readout cells. This
technology uses a GPCR linked to a transcription factor through a
cleavable linker. The arrestin is fused to a crippled protease.
Once the arrestin binds to the GPCR, the high local concentration
of the protease and the linker result in cleavage of the linker,
releasing the transcription factor into the nucleus to activate
transcription. The .beta.-lactamase assay can be run on live cells,
does not require cell lysis, and can be imaged in as little as
6-hours of agonist incubation.
[0381] In one embodiment, a .beta.-arrestin GPCR assay that can be
universally used for the detection of antagonists and agonists of
GPCR signaling is used in the methods and devices provided herein
to identify and an effector cell that secretes a biomolecule that
binds to a GPCR (Rossi et al. (1997). Proc. Natl. Acad. Sci. U.S.A.
94, pp. 8405-8410, incorporated by reference in its entirety for
all purposes). This assay is based on a .beta.-galactosidase
(.beta.-Gal) enzyme-complementation technology, now commercialized
by DiscoveRx. The GPCR target is fused in frame with a small
N-terminal fragment of the .beta.-Gal enzyme. Upon GPCR activation,
a second fusion protein, containing .beta.-arrestin linked to the
N-terminal sequences of .beta.-Gal, binds to the GPCR, resulting in
the formation of a functional .beta.-Gal enzyme. The .beta.-Gal
enzyme then rapidly converts non-fluorescent substrate
Di-.beta.-D-Galactopyranoside (FDG) to fluorescein, providing large
amplification and excellent sensitivity. In this embodiment,
readout cells (with GPCRs) are preloaded, off chip, with
cell-permeable pro-substrate (acetylated FDG) which is converted to
cell-impermeable FDG by esterase cleavage of acetate groups.
Although fluorescein is actively transported out of live cells, by
implementing this assay within a microfluidic chamber the
fluorescent product is concentrated, providing greatly enhanced
sensitivity over plate-based assays. DiscoveRx has validated this
assay strategy, used in microwell format, across a large panel of
GPCRs.
[0382] In one embodiment, activation of a GPCR by an effector cell
is determined in a microfluidic format by detecting the increase in
cytosolic calcium in one or more readout cells. In a further
embodiment, the increase in cytosolic calcium is detected with one
or more calcium sensitive dyes. Calcium sensitive dyes have a low
level of fluorescence in the absence of calcium and undergo an
increase in fluorescent properties once bound by calcium. The
fluorescent signal peaks at about one minute and is detectable over
a 5 to 10 minute window. Thus, to detect activity using fluorescent
calcium the detection and addition of the agonist are closely
coupled. In order to achieve this coupling, the effector cell is
exposed simultaneously to the population of readout cells and the
one or more calcium sensitive dyes. In one embodiment, the one or
more calcium sensitive dyes are one provided in a FLIPR.TM. calcium
assay (Molecular Devices).
[0383] The recombinant expressed jellyfish photoprotein, aequorin,
in one embodiment, is used in a functional GPCR screen, i.e., an
extracellular effect assay where the extracellular effect is the
modulation of a GPCR. Aequorin is a calcium-sensitive reporter
protein that generates a luminescent signal when a coelenterazine
derivative is added. Engineered cell lines with GPCRs expressed
with a mitochondrially targeted version of apoaequorin are
available commercially (Euroscreen). In one embodiment, the one or
more of the cell lines available from Euroscreen is used as a
population of readout cells in a method of assessing an
extracellular effect of an effector cell, or a variation in an
extracellular effect.
[0384] In one embodiment, an extracellular effect on a GPCR is
measured by using one of the ACTOne cell lines (Codex
Biosolutions), expressing a GPCR and a cyclic nucleotide-gated
(CNG) channel, as a population of readout cells. In this
embodiment, the extracellular effect assay works with cell lines
that contain an exogenous Cyclic Nucleotide-Gated (CNG) channel.
The channel is activated by elevated intracellular levels of cAMP,
which results in ion flux (often detectable by calcium-responsive
dyes) and cell membrane depolarization which can be detected with a
fluorescent membrane potential (MP) dye. The ACTOne cAMP assay
allows both end-point and kinetic measurement of intracellular cAMP
changes with a fluorescence microplate reader.
[0385] A reporter gene assay, in one embodiment, is used to
determine whether an effector cell modulates a particular GPCR. In
this embodiment, the modulation of the GPCR is the extracellular
effect being assessed. A reporter gene assay, in one embodiment, is
based on a GPCR second messenger such as calcium (AP1 or NFAT
response elements) or cAMP (CRE response element) to activate or
inhibit a responsive element placed upstream of a minimal promoter,
which in turn regulates the expression of the reporter protein
chosen by the user. Expression of the reporter, in one embodiment,
is coupled to a response element of a transcription factor
activated by signaling through a GPCR. For example, reporter gene
expression can be coupled to a responsive element for one of the
following transcription factors: ATF2/ATF3/AFT4, CREB, ELK1/SRF,
FOS/JUN, MEF2, GLI, FOXO, STAT3, NFAT, NF.kappa.B. In a further
embodiment, the transcription factor is NFAT. Reporter gene assays
are available commercially, for example from SA Biosciences
[0386] Reporter proteins are known in the art and include, for
example, .beta.-galactosidase, luciferase (see, e.g., Paguio et al.
(2006). "Using Luciferase Reporter Assays to Screen for GPCR
Modulators," Cell Notes Issue 16, pp. 22-25; Dual-Glo.TM.
Luciferase Assay System Technical Manual #TM058; pGL4 Luciferase
Reporter Vectors Technical Manual #TM259, each incorporated by
reference in their entireties for all purposes), GFP, YFP, CFP,
.beta.-lactamase. Reporter gene assays for measuring GPCR signaling
are available commercially and can be used in the methods and
devices described herein. For example, the GeneBLAzer.RTM. assay
from Life Technologies is amenable for use with the present
invention.
[0387] In one embodiment, overexpression of a G protein in a
reporter cell is carried out to force a cAMP coupled GPCR to signal
through calcium. This is referred to as force coupling.
[0388] In one embodiment, a Gq coupled cell line is used as a
readout cell line in the methods described herein. In one
embodiment, the Gq coupled cell line reports GPCR signaling through
.beta.-lactamase. For example, one of the cell-based GPCR reporter
cell lines (GeneBLAzer.RTM., Life Technologies). The reporter cell
line can be division arrested or include normal dividing cells.
[0389] cAMP responsive element-binding protein (CREB) is a
transcription factor as mentioned above, and is used in one
embodiment for a Gs and/or Gi coupled GPCR. In a further
embodiment, forskolin is utilized as an accessory particle. The CRE
reporter is available in plasmid or lentiviral form to drive GFP
expression from SA Biosciences, and is amenable for use with the
methods and devices described herein. For example, the assay system
available from SA Biosciences in one embodiment is employed herein
to produce a readout cell (world-wide-website:
sabiosciences.com/reporter assayproduct/HTML/CCS-002G.html). Life
Technologies also has CRE-responsive cell lines that express
specific GPCRs, and these can be used in the methods described
herein as well as readout cells.
[0390] In one embodiment, one or more effector cells present in a
cell population are assayed for the ability to activate or
antagonize a GPCR present on one or more readout cells by detecting
the increase or decrease in cAMP levels inside the one or more
readout cells. ELISA based assays, homogeneous time-resolved
fluorescence (HTRF) (see Degorce et al. (2009). Current Chemical
Genomics 3, pp. 22-32, the disclosure of which is incorporated by
reference in its entirety), and enzyme complementation can all be
used with the microfluidic devices and assays provided herein to
determine cAMP levels in readout cells. Each of these cAMP
detection methods requires cell lysis to liberate the cAMP for
detection, as it is the cyclic AMP that is actually measured.
[0391] Assays for measuring cAMP in whole cells and for measuring
adenyl cyclase activity in membranes are commercially available
(see, e.g., Gabriel et al. (2003). Assay Drug Dev. Technol. 1, pp.
291-303; Williams (2004). Nat. Rev. Drug Discov. 3, pp. 125-135,
each incorporated by reference in their entireties), and are
amenable for use in the devices and methods provided herein. That
is, cell populations in one or more microfluidic chambers can be
assayed according to these methods.
[0392] Cisbio International (Codolet, France) has developed a
sensitive high-throughput homogenous cAMP assay (HTRF, see Degorce
et al. (2009). Current Chemical Genomics 3, pp. 22-32, the
disclosure of which is incorporated by reference in its entirety)
based on time resolved fluorescence resonance energy transfer
technology and can be used herein to screen for an effector cell
exhibiting an effect on a GPCR. The method is a competitive
immunoassay between native cAMP produced by cells and a
cAMP-labeled dye (cAMP-d2). The cAMP-d2 binding is visualized by a
MaB anti-cAMP labeled with Cryptate. The specific signal (i.e.,
energy transfer) is inversely proportional to the concentration of
cAMP in the sample, in this case, the amount of cAMP activated in a
readout cell by an effector cell or an effector cell secretion
product. As cAMP is being measured, readout cells are first lysed
to free the cAMP for detection. This assay has been validated for
both G.sub.s-(.beta..sub.2-adrenergic, histamine H2, melanocortin
MC4, CGRP and dopamine D.sub.1) and G.sub.i/o-coupled (histamine
H.sub.3) receptors.
[0393] cAMP assay kits based on fluorescence polarization are also
commercially, e.g., from Perkin Elmer, Molecular Devices and GE
Healthcare, and each is amenable for use as an effector cell assay
in the methods and devices provided herein. Accordingly, one
embodiment of the present invention comprises selecting an effector
cell and/or cell population comprising one or more effector cells
based on the result of a cAMP fluorescence polarization assay. The
method is used in one embodiment to determine whether the effector
cell activates (agonism) or inhibits (antagonism) on a particular
GPCR.
[0394] In one embodiment, the AlphaScreen.TM. cAMP assay from
Perkin Elmer, a sensitive bead-based chemiluminescent assay
requiring laser activation, is used in the devices provided herein
to screen for an effector cell having an effect on a readout cell,
specifically, the activation or inhibition of a GPCR.
[0395] DiscoveRx (world-wide-website: discoverx.com) offers a
homogenous high-throughput cAMP assay kit called HitHunter.TM.
based on a patented enzyme (.beta.-galactosidase) complementation
technology using either fluorescent or luminescent substrates
(Eglen and Singh (2003). Comb Chem. High Throughput Screen 6, pp.
381-387; Weber et al. (2004). Assay Drug Dev. Technol. 2, pp.
39-49; Englen (2005). Comb. Chem. High Throughput Screen 8, pp.
311-318, each incorporated by reference in their entireties). This
assay can be implemented herein to detect an effector cell having
an extracellular effect or a variation in an extracellular effect
on a readout cell expressing a GPCR.
[0396] Cellular events that result from GPCR receptor activation or
inhibition can also be detected to determine an effector cell's
property(ies) (e.g., an antibody producing cell's ability to
activate or antagonize) on a readout cell. For example, in the case
of the Gq coupled receptors, when the GPCR is activated, the Gq
protein is activated, which results in the phospholipase C cleavage
of membrane phospholipids. This cleavage results in the generation
of inositol triphosphates 3 (IP3). Free IP3 binds to its target at
the surface of the endoplasmic reticulum causing a release of
calcium. The calcium activates specific calcium responsive
transcription vectors such as nuclear factor of activated T-cells
(NFAT). Thus, by monitoring NFAT activity or expression, an
indirect readout of the GPCR in a readout cell is established. See.
e.g., Crabtree and Olson (2002). Cell 109, pp. S67-S79,
incorporated by reference herein in its entirety.
[0397] Once activated more than 60% of all GPCRs are internalized.
Utilizing a tagged GPCR (typically done with a C-terminal GFP tag)
the distribution of the receptor in one embodiment, is imaged in
the presence and absence of ligand. Upon ligand stimulation a
normally evenly distributed receptor will often appear as
endocytosed puncta.
TABLE-US-00005 TABLE 4 GPCR functional assays for use with the
present invention. Biological Reagents (accessory Assay
measurements particles) Basis Endpoint Notes Europium-
Membrane-based Europium-GTP Binding of Time-resolved Proximal to
GTP .TM. GPCR europium- fluorescence receptor binding (Perkin
mediated labeled GTP to activation, Elmer) Guanine receptor
activated nonradioactive. nucleotide G proteins exchange
AlphaScreen .TM. Cell-based cAMP MAb cAMP competes Luminescence
High sensitivity, (Perkin Elmer) cAMP conjugated with biotinyl-cAMP
homogeneous, accumulation acceptor bead, binding to high- amenable
to streptavidin-coated affinity streptavidin- automation, donor
beads with coated donor beads, broad chemoluminescence loss of
signal due to linear compound, reduced proximity of range of
biotinyl-cAMP acceptor-donor bead detection Fluorescence Cell- or
cAMP MAb, cAMP competes with Fluorescence Homogeneous, polarization
membrane-based fluorescent Fluor-cAMP polarization amenable to
(Perkin cAMP cAMP binding to cAMP automation Elmer, accumulation
MAb, loss of Molecular signal due to Devices, GE decrease in
rotation Healthcare) and polarization HTRF cAMP Cell-based, cAMP
MAb cAMP competes Time-resolved Broad linear (Cisbio) cAMP
conjugated with acceptor-labeled fluorescence range, accumulation
with eurocryptate, cAMP binding to high signal- acceptor molecule
europium-conjugated to-noise, labeled cAMP cAMP MAb, loss of
homogenous, signal due to reduced amenable to europium-acceptor
automation molecule proximity HitHunter .TM. Cell-based, cAMP MAb,
ED- cAMP competes with Fluorescence or Low compound (DiscoveRx)
cAMP cAMP (enzyme ED-cAMP for luminescence interference,
accumulation fragment dono- complementation of high cAMP conjugate)
.beta.-Gal activity with sensitivity, conjugated peptide, binding
of acceptor homogeneous, acceptor protein, peptide, loss of
amenable to lysis buffer signal as enzyme automation
complementation is reduced IP.sub.1 .TM. (Cisbio) Cell-based
IP.sub.1 Europium- Loss of signal Time-resolved Homogeneous,
accumulation conjugated IP.sub.1 as IP.sub.1 competes fluorescence
can be used for MAb, acceptor for binding of constitutively labeled
IP.sub.1 acceptor-labeled active Gq- IP.sub.1 binding to coupled
GPCRs europium-MAb FLIPR .TM. Cell-based, Caldium Increased
Fluorescence Sensitive, (Molecular increases in sensitive dye;
fluorescence as homogeneous, Devices) intracellular caldium-3
intracellular dye amenable to calcium binds calcium automation
AequoScreen .TM. Cell-based, Cell lines Calcium-sensitive
Luminescence Sensitive, (EuroScreen) increases in expressing
aequorin generates homogeneous, intracellular select GPCRs a
luminescent amenable to calcium along with signal when a automation
promiscuous coelenterazine or chimeric derivative G proteins and a
is added mitochondrially targeted version of apoaequorin Reporter
gene Cell-based, Several promoter GPCR changes Fluorescence,
Homogeneous, increases in plasmids and in secondary luminescence,
amplification reporter reporters messengers alter absorbance of
gene expression expression signal due to increases of a selected in
second reporter gene messengers activated by GPCR binding
Melanophore Cell-based, Melanosomes Absorbance Sensitive, (Arena
changes in aggregate homogeneous, Pharmaceuticals) pigment with
inhibition no cell lysis, dispersion of PKA disperse amenable to
with activation of automation PKA or PKC Adapted from Thomsen et
al. (2005). Current Opin. Biotechnol. 16, pp. 655-665, incorporated
by reference herein in its entirety for all purposes.
[0398] One embodiment of a work flow for a single cell antibody
secreting cell (ASC)/antibody selection pipeline is shown in FIG.
1. In this embodiment, a host animal is immunized with a target
antigen and cells are obtained from spleen, blood, lymph nodes
and/or bone marrow one week following a final immunization boost.
These samples are then optionally enriched for ASCs by flow
cytometry (e.g., FACS) or magnetic bead purification using
established surface markers (if available) or using microfluidic
enrichment. The resulting ASC enriched population is then loaded
into a microfluidic array of nanoliter volume chambers, with a
loading concentration chosen to achieve from about one to about 500
cells per chamber, or from about one to about 250 cells per
chamber. Depending on the pre-enrichment step, individual chambers
will comprise multiple ASCs, single ASCs or zero ASCs. Chambers are
then isolated by closing microvalves and incubated to allow for
antibodies to be secreted in the small chamber volume. Because ASCs
typically secrete antibodies at a rate of 1000 antibody molecules
per second, and the volume of individual chambers provided herein
are on the order of 2 nL, a concentration of about 10 nM of each
secreted monoclonal antibody is provided in about 3 hours (each ASC
secretes a unique monoclonal antibody). In a further embodiment,
integrated microfluidic control is then used for delivery and
exchange of reagents in order to implement image-based effector
cell assays, which are read out using automated microscopy and
real-time image processing. Individual ASCs or cell population
comprising one or more ASCs that secrete antibodies with desired
properties (e.g., binding, specificity, affinity, function) are
then recovered from individual chambers. Further analysis of the
recovered cell populations at limiting dilution is then carried
out. In the case that an individual ASC is provided to a chamber
and recovered, further analysis of the individual ASC can also be
carried out. For example, in one embodiment, the further analysis
includes single cell RT-PCR to amplify paired HV and LV for
sequence analysis and cloning into cell lines.
[0399] In another embodiment, after an animal is immunized and
cells are obtained from spleen, blood, lymph nodes and/or bone
marrow, the cells make up a starting population that are loaded
directly into individual chambers of a microfluidic device provided
herein, i.e., as a plurality of cell populations, wherein
individual cell populations are present in each microfluidic
chamber. An extracellular effect assay is then carried out in the
individual chambers on the individual cell populations to determine
if any of the individual cell populations comprise one or more
effector cells responsible for an extracellular effect.
[0400] Although a host animal can be immunized with a target
antigen prior to microfluidic analysis, the invention is not
limited thereto. For example, in one embodiment, cells are obtained
from spleen, blood, lymph nodes or bone marrow from a host
(including human) followed by an enrichment for ASCs.
Alternatively, no enrichment step takes place and cells are
directly loaded into chambers of a device provided herein, i.e., as
a plurality of cell populations, where individual cell populations
are present in each chamber.
[0401] The methods provided herein allow for the selection of
antibodies from any host species. This provides two key advantages
for the discovery of therapeutic antibodies. First, the ability to
work in species other than mice and rats allows for the selection
of mAbs to targets with high homology to mouse proteins, as well as
mAbs to human proteins that cross-react with mice and can thus be
used in easily accessible pre-clinical mouse models. Second, mouse
immunizations often result in responses that feature
immunodominance to a few epitopes, resulting in a low diversity of
antibodies generated; expanding to other species thus greatly
increases the diversity of antibodies that recognize different
epitopes. Accordingly, in embodiments described herein, mice rats
and rabbits are used for immunizations, followed by the selection
of ASCs from these immunized animals. In one embodiment, a rabbit
is immunized with an antigen, and ASCs from the immunized rabbit
are selected for with the methods and devices provided herein. As
one of skill in the art will recognize, rabbits offer advantages of
a distinct mechanism of affinity maturation that uses gene
conversion to yield greater antibody diversity, larger physical
size (more antibody diversity), and greater evolutionary distance
from humans (more recognized epitopes).
[0402] The immunization strategy, in one embodiment is a protein,
cellular, and/or DNA immunization. For example, for PDGFR.alpha.,
the extracellular domain obtained from expression in a mammalian
cell line, or purchased from a commercial source (Calixar) is used
to immunize an animal. For CXCR4, in one embodiment, virus-like
particle (VLP) preparations, a nanoparticle having a high
expression of GPCR in native conformation, from a commercial source
(Integral Molecular) is used. Cell-based immunization is performed
by overexpression of full-length proteins in a cell line (e.g.,
32D-PDGFR.alpha. cells for mice/rats, and a rabbit fibroblast cell
line (SIRC cells) for rabbits; including protocols in which a new
cell line is used in the final boost to enrich for specific mAbs. A
variety of established DNA immunization protocols are also amenable
for use with the present invention. DNA immunization has become the
method of choice for complex membrane proteins since it 1)
eliminates the need for protein expression and purification, 2)
ensures native conformation of the antigen, 3) reduces the
potential for non-specific immune responses to other cell membrane
antigens, and 4) has been proven effective for challenging targets
(Bates et al. (2006). Biotechniques 40, pp. 199-208; Chambers and
Johnston (2003). Nat. Biotechnol. 21, pp. 1088-1092; Nagata et al.
(2003). J. Immunol. Methods 280, pp. 59-72; Chowdhury et al.
(2001). J. Immunol Methods 249, pp. 147-154; Surman et al. (1998).
J. Immunol. Methods 214, pp. 51-62; Leinonen et al. (2004). J.
Immunol. Methods 289, pp. 157-167; Takatasuka et al. (2011). J.
Pharmacol. and Toxicol. Methods 63, pp. 250-257, each incorporated
by reference in their entireties for all purposes). All
immunizations are performed in accordance with animal care
requirements and established protocols.
[0403] Anti-PDGFR.alpha. antibodies have been previously produced
in rats, mice, and rabbits, and comparison of the extracellular
domain of PDGFR.alpha. shows several sites of substantial variation
(FIG. 24). Thus it is expected that a good immune response is
obtainable from this antigen. Anti-CXCR4 mAbs have also been
previously generated using both lipoparticles and DNA
immunizations, so that this target is likely to yield a good immune
response. If needed, we will investigate using the co-expression of
GroEl or GM-CSF (either co-expressed or as a fusion) as a molecular
adjuvant, as well as testing of different adjuvants and
immunization schedules (Takatsuka et al. (2011). J. Pharmacol. and
Toxicol. Methods 63, pp. 250-257 Fujimoto et al. (2012). J.
Immunol. Methods 375, pp. 243-251, incorporated by reference in
their entireties for all purposes).
[0404] The devices provided herein are based on Multilayer Soft
Lithography (MSL) microfluidics (Unger et al. (2000). Science 7,
pp. 113-116, incorporated by reference in its entirety). MSL is a
fabrication method that provides for increased sensitivity through
small volume reactions; high scalability and parallelization;
robust cell culture; flexibility and fluid handling control needed
for complex assays; and greatly reduced cost and reagent
consumption.
[0405] The number of effector cells isolated per device run (i.e.,
number of cells in each chamber of a device) is a function of the
concentration of cells in a cell suspension loaded onto a device,
the frequency in the cell suspension of the specific effector cells
being selected for, and the total number of chambers on a device.
Devices with arrays up to and greater than 40,000 effector cell
assay chambers are contemplated.
[0406] Amongst all microfluidics technologies, MSL is unique in its
rapid and inexpensive prototyping of devices having thousands of
integrated microvalves (Thorsen et el. (2002). Science 298, pp.
58-584, incorporated by reference in its entirety). These valves
can be used to build higher-level fluidic components including
mixers, peristaltic pumps (Unger et al. (2000). Science 7, pp.
113-116) and fluidic multiplexing structures (Thorsen et el.
(2002). Science 298, pp. 58-584; Hansen and Quake (2003). Curr.
Opin. Struc. Biol. 13, pp. 538-544, incorporated by reference in
their entireties herein) thus enabling high levels of integration
and on-chip liquid handling (Hansen et al. (2004). Proc. Natl.
Acad. Sci. U.S.A. 101, pp. 14431-1436; Maerkl and Quake (2007).
Science 315, pp. 233-237, each incorporated by reference in their
entireties). (FIG. 25).
[0407] FIG. 25A shows an optical micrograph of a valve made by MSL.
Two crossing microfabricated channels, one "flow channel" for the
active fluids (vertical) and one control channel for valve
actuation (horizontal), create a valve structure. The flow channel
is separated from the control channels by a thin elastomeric
membrane to create a "pinch valve." Pressurization of the control
channel deflects the membrane to close off the flow channel. FIG.
25B shows a section of an MSL device integrating multiple valves
(filled with green and blue food dye). FIG. 25C is a section of a
device having a total of 16,000 valves, 4000 chambers, and over
3000 layer-layer interconnects (arrow). FIG. 25D shows an example
of a microfluidic device with penny for scale. Devices shown are
for illustration of the MSL fabrication technology.
[0408] The assay chambers of a device, in one embodiment has an
average volume of from about 100 .mu.L to about 100 nL. For
example, in one embodiment, one or more properties of an effector
cell is assayed within a microfluidic chamber comprising a cell
population wherein the volume of the microfluidic chamber is about
100 .mu.L, about 200 .mu.L, about 300 .mu.L, about 400 .mu.L, about
500 .mu.L, about 600 .mu.L, about 700 .mu.L, about 800 .mu.L, about
900 .mu.L or about 1 nL. In another embodiment, the volume of the
microfluidic chamber is about 2 nL. In another embodiment, the
volume of the microfluidic chamber for assaying a property of an
effector cell in a cell population is from about 100 .mu.L to about
100 nL, from about 100 .mu.L to about 50 nL, from about 100 .mu.L
to about 10 nL, from about 100 .mu.L to about 1 nL, from about 50
.mu.L to about 100 nL, from about 50 .mu.L to about 50 nL, from
about 50 .mu.L to about 10 nL or from about 50 .mu.L to about 1 nL.
In even another embodiment, the volume of the microfluidic chamber
for assaying a property of an effector cell in a cell population is
about 10 nL, about 20 nL, about 30 nL, about 40 nL, about 50 nL,
about 60 nL, about 70 nL, about 80 nL, about 90 nL or about 100
nL.
[0409] The MSL fabrication process takes advantage of
well-established photolithography techniques and advances in
microelectronic fabrication technology. The first step in MSL is to
draw a design of flow and control channels using computer drafting
software, which is then printed on high-resolution masks. Silicon
(Si) wafers covered in photoresist are exposed to ultraviolet
light, which is filtered out in certain regions by the mask.
Depending on whether the photoresist is negative or positive,
either areas exposed (negative) or not (positive) crosslinks and
the resist will polymerize. The unpolymerized resist is soluble in
a developer solution and is subsequently washed away. By combining
different photoresists and spin coating at different speeds,
silicon wafers are patterned with a variety of different shapes and
heights, defining various channels and chambers. The wafers are
then used as molds to transfer the patterns to polydimethylsiloxane
(PDMS). In one embodiment, prior to molding with PDMS and after
defining photoresist layers, molds are parylene coated (chemical
vapor deposited poly(p-xylylene) polymers barrier) to reduce
sticking of PDMS during molding, enhance mold durability and enable
replication of small features
[0410] In MSL, stacking different layers of PDMS cast from
different molds on top of each other is used to create channels in
overlapping "flow" and "control" layers. The two (or more) layers
are bound together by mixing a potting prepolymer component and a
hardener component at complementary stoichiometric ratios to
achieve vulcanization. In order to create a simple microfluidic
chip, a "thick" layer (e.g., between from about 200-2000 pins) is
cast from the mold containing the flow layer, and the "thin" layer
(e.g., between from about 25 to about 300 .mu.ms) is cast from the
mold containing the control layer. After partial vulcanization of
both layers, the flow layer is peeled off its mold, and aligned to
the control layer (while still present on its mold, by visual
inspection. The control and flow layers are allowed to bond, for
example at 80.degree. C. for about 15-60 minutes. The double slab
is then peeled from the control mold, and inlet and outlet holes
are punched and the double slab is bonded to a blank layer of PDMS
(i.e., a flat layer of PDMS with no structural features). After
allowing more time to bond, the completed device is mounted on a
glass slide. Fluid flow in the device is controlled using off-chip
computer programmable solenoids which actuate the pressure applied
to fluid in the channels of the control layer. When pressure is
applied to these control channels, the flexible membrane between
the overlapping orthogonal control and flow lines deflects into the
flow channel, effectively valving the flow. Different combinations
of these valves can be used to create peristaltic pumps,
multiplexer controls and isolate different regions of the chip
[0411] With respect to the flow layer, assay chambers and channels
for controlling fluidic flow to and from the assay chambers are
defined by the photoresist layers. As will be appreciated by one of
skill in the art, the thickness of a photoresist layer can be
controlled in part by the speed of spin coating and the particular
photoresist selected for use. The bulk of the assay chambers, in
one embodiment, are defined by an SU-8 100 feature which sits
directly on the Si wafer. As known to those of skill in the art,
SU-8 is a commonly used epoxy-based negative photoresist.
Alternatively, other photoresists known to those of skill in the
art can be used to define assay chambers with the heights described
above. In some embodiments, the assay chambers have a height and
width of 50-500 .mu.M and 50-500 .mu.M, respectively, as defined by
the SU-8 features.
[0412] MSL fabrication techniques allow for a wide range of device
densities, and chamber volumes to be fabricated. For the devices
provided herein, in one embodiment, from about 2000 to about 10,000
effector cell analysis chambers are provided in a single integrated
device. The effector cell analysis chambers, in one embodiment,
have an average volume of from about 1 nL to about 4 nL, for
example, from about 1 nL to about 3 nL, or from about 2 nL to about
4 nL. The effector cell analysis chambers, in one embodiment, are
connected in a serial format, as depicted in FIG. 26. By way of
illustration, a device with 4032 individual analysis chambers
(average volume of 2.25 nL) connected in serial format achieve a
screening throughput of approximately 100,000 cells per run (FIG.
8). The integrated microfluidic valves harnessed in the devices
provided herein allow for chamber isolation, and programmable
washing with reagents selected from a plurality of inlets, for
example from 2 to about 32 inlets, 2 to about 20 inlets, 2 to about
15 inlets, 2 to about 10 inlets, or from 2 to about 9 inlets, or
from 2 to about 8 inlets, or from 2 to about 7 inlets or from 2 to
about 6 inlets. Additional inlets are provided to control valve
pressure (FIG. 26).
[0413] The devices provided herein harness a gravity-based
immobilization of cells and/or particles. Gravity based
immobilization allows for perfusion of non-adherent cell types, and
in general, buffer and reagent exchange within chambers. Each
chamber has a cubic geometry with an access channel passing over
the top (FIG. 26). For example, a chamber provided herein, in one
embodiment, has the following dimensions: 50-250 .mu.m.times.50-250
.mu.m.times.50-250 .mu.m; l.times.w.times.h, e.g., 150
.mu.m.times.100 .mu.m.times.150 .mu.m; l.times.w.times.h. During
loading, particles (e.g., cells or beads) follow streamlines and
pass over tops of chambers, but fall to the bottom of the chambers
when the flow is stopped. Due to the laminar flow profile, the flow
velocity is negligible near the chamber bottom. This allows for
perfusion of the chamber array, and the exchange of reagents via
combined convection/diffusion, without disturbing the location of
non-adherent cells (or beads) in the chambers.
[0414] Importantly, the devices provided herein allow for the long
term culture and maintenance of cells, whether effector, accessory
or of the readout variety. Microfluidic arrays of chambers are
fabricated within a thick membrane (e.g., from about 150 .mu.m to
about 500 .mu.m thick, about 200 .mu.m thick, about 300 .mu.m
thick, about 400 .mu.m thick or about 500 .mu.m thick) of PDMS
elastomer that is overlaid a reservoir of medium, for example 1 mL
of medium as described previously (Lecault et al. (2011). Nature
Methods 8, pp. 581-586, incorporated by reference herein in its
entirety for all purposes). The proximity of the medium reservoir
(osmotic bath) to the cell chambers effectively blocks evaporation
(through the gas-permeable PDMS material) and ensures robust cell
viability and where cells are not fully differentiated, growth over
several days, and is critical for achieving long-term culture in nL
volumes with growth rates and cellular responses that are identical
to .mu.L volume formats. FIG. 27 shows a schematic of the layers of
the devices used herein.
[0415] The membrane design of the devices provided herein also
enables the selective recovery of cells from any chamber by
piercing the upper membrane with a microcapillary.
[0416] The device architectures provided herein are designed so
that the soluble secretion products of effector cells are not
washed away from a chamber when additional components, e.g.,
accessory particles or cell signaling ligands are added to the
chamber. Additionally, the devices provided herein allow for the
addition of components to a chamber without the introduction of
cross-contamination of secretion products (e.g., antibodies)
between individual chambers of a device. In embodiments where
chambers are connected in serial, medium exchange requires flushing
the entire array. Flushing the entire array, in one embodiment,
results in the loss of antibody from each chamber and introduces
cross-contamination to downstream chambers. However, where
secretion products bind to a surface of a chamber or a readout
particle bound to a surface, cross-contamination and/or loss of
secretion products is not a significant problem, as secretion
products are immobilized.
[0417] In one embodiment, cross-contamination and/or loss of
secretion product is minimized by using an "inflatable chamber"
design as shown in FIG. 28A-D. Each chamber has a single inlet, and
are connected to a common channel through a short "access channel"
controlled by a microvalve. The top of each chamber is overlaid by
a recess, separated from the chamber by a thin (.about.10 pin)
membrane, thus allowing for significant volume expansion when the
chamber is pressurized. In one embodiment, chambers are inflatable
to 2.times. volume, e.g., for 2 nL to 4 nL or 1 nL to 2 nL or 2.5
nL to 5 nL. In another embodiment, chambers are inflatable to
1.5.times. volume, e.g., for 2 nL to about 3.5 nL by application.
Particles (cells or beads), in one embodiment, are loaded into
inflatable chambers by inflating the chamber, allowing the particle
to settle under gravity, and then deflating chamber. Similarly, a
process of sequential inflation, diffusive mixing, and deflation,
allows for washing of the chamber contents and/or exchange of
medium. This approach enables the addition of soluble ligand
without losing secretion products, as they are only diluted by less
than 50%. Inflatable chambers also eliminate the potential for
cross-contamination since the chambers are not connected in serial.
The simplicity of this architecture allows for the integration of
dense arrays, and in one embodiment, is applicable in devices
having 10,000 chambers on an area of just over one square inch.
[0418] In one embodiment, the microfluidic devices provided herein
are operated in flow conditions that suppress inertial effects and
are dominated by viscosity. This fluid flow regime is characterized
by a low Reynolds number Re=.rho.du/.eta., where .rho. is the
density of the fluid, d is the characteristic length scale of the
channel, u is the characteristic velocity of the flow, and .eta. is
the viscosity of the fluid. At low Re the fluid flow streamlines
become predictable and can be designed for the desired effect.
Referring to FIGS. 29 and 30, for instance, if the goal is to load
effector cells 40 only on the left side of the chamber 41, the
device in one embodiment, is designed with a restriction upstream,
e.g., formed by deflector 42 in FIG. 30, of the chamber that
preferentially directs effector cells to the left side of the inlet
channel 43. As effector cells 40 enter into the chamber 41 under
flow, they continue into the left side of the chamber, following
the streamlines of the flow, provided that the time of transport is
chosen such that the effector particles do not diffuse
substantially across streamlines. Similarly, readout particles, in
one embodiment, are directed to the right of the chamber by use of
an auxiliary channel connected to the inlet channel that results in
the positioning of the readout particles in the right side of the
inlet channel. In another embodiment, the readout particles are
introduced through a different channel that accesses the chamber,
including the outlet channel. It will be understood by those of
skill in the art that the design of laminar flow profiles provides
great flexibility in the direction of particles to a specific
region of the chamber, if specific placement within a chamber is
desired.
[0419] Segregation of effector cells from readout particles in a
particular chamber can also be achieved via the use of a structural
element, by manipulating the flow within a flow channel or channels
of the device, stochastic loading, a magnetic field, an electric
field or dielectric field, a gravitational field, a modification to
a surface of the microfluidic chamber that affects adhesion, and
relative buoyancy of the effector cells and the readout particles,
or a combination thereof.
[0420] In one embodiment, effector cells and/or readout cells are
confined to a chamber or a portion of a chamber (e.g., an effector
zone or readout zone) using a structural element within the
chamber.
[0421] "Effector zone" as used herein, is a region of a
microfluidic chamber in which an effector cell, a population of
effector cells (or subpopulation thereof), is retained.
[0422] "Readout zone" as used herein, is a region of a microfluidic
chamber in which a readout particle is kept segregated from
effector cells, and in which a functionality of the effector
cell(s) may be detected. For example, when an "effector zone" and a
"readout zone" are three dimensional regions of a microfluidic
device, they may be individual chambers (for example, a compound
chamber), where the chambers are in fluid communication with one
another.
[0423] As described herein, in one embodiment, one or more
structural elements are used for the distribution of effector cells
and/or readout particles within one or more chambers. In a further
embodiment, the one or more structural elements are used for the
retaining of effector cells and/or readout particles within defined
regions of a chamber, e.g., an effector zone and/or readout zone.
In some embodiments, the use of such structural elements is coupled
with the use of a field (e.g., gravity, dielectric, magnetic, etc.)
to achieve a retaining function. For example, in one embodiment, a
cell fence is utilized to trap cells (effector or readout) at a
certain chamber location. Cell fences have been described
previously in PCT Application Publication No. 2012/162779, and the
disclosure of which is incorporated by reference in its entirety
for all purposes. "Cell fence," as used herein, refers to any
structure which functions to restrict the movement of cells and
readout particles, but which may permit the movement of other cell
products, within a microfluidic chamber.
[0424] In embodiments where cell fences are utilized, each fence is
defined by a thinner SU-8 2010 feature which sits on top of the
SU-8 100 feature. Such a structure is depicted schematically in
FIG. 31. Fabrication of cell fences have been described previously
in PCT Application Publication No. 2012/162779, the disclosure of
which is incorporated by reference in its entirety. In one
embodiment where a cell fence is utilized to capture an effector
cell or a population of cells optionally comprising one or more
effector cells, microfluidic chambers are defined using SU-8 100
negative photoresist (typically 160 .mu.m in height) following
standard protocols, except that the final step, development is
omitted. Specifically, a Si wafer spun with SU-8 100 photoresist is
cooled after the post-exposure bake, and instead of developing the
photoresist, SU-8 2010 is spun on top of the undeveloped SU-8 100,
typically at a height 10-20 um. The thickness of the SU-8 2010
determines the height of the fence. The depth of each chamber was
the combined height of both photoresist layers.
[0425] In alternative cell fence embodiments, the SU-8 100 layer is
fully developed, and the wafer is coated with an additional layer
of SU-8 100 which is higher than the first layer, the difference
becoming the height of the fence.
[0426] Structural elements described herein may provide for the
retention of effector cells and readout particles on different
sides of a chamber by use of gravity; in this case gravity is
directed towards the floor of the chamber and provides a force that
impedes the cell from rising over the fence. It should be noted
that microscopic particles may be subject to Brownian motion that
may cause them to "diffuse" over a fence in a stochastic manner.
However, the probability that a particle will spontaneously rise
over the fence by Brownian motion is determined by the Boltzmann
distribution and is proportional to the Boltzmann factor where E is
the potential energy of rising the particle to a height equal to
the height of the fence (E=volume of particle.times.the difference
between the density of the particle and the density of the
liquid.times.gravity.times.the height of the fence), K is the
Boltzmann constant, and T is the temperature of the liquid. Thus,
one of skill in the art can design and fabricate the height of a
fence such that the probability of a particle spontaneously
"diffusing" over the fence is negligibly small. It will also be
appreciated by one of skill in the art that a fence of a given
height presents a barrier to some particles (e.g., beads or cells),
depending on the potential energy required to pass over the fence,
but will not present a barrier to particles having appropriately
low apparent mass in the liquid. For example, a fence having a
height of about 20 .mu.m does not allow for a cell to spontaneously
pass by diffusion, but presents essentially no barrier to the
diffusion of proteins. In one embodiment, gravity used in
conjunction with a structural element for retaining cells. However,
other forces such as magnetic gradient forces, dielectric forces,
centrifugal forces, flow forces, or optical forces, may be
similarly used.
[0427] Structural elements may also be effective in retaining
effector cells or readout particles by providing a mechanical
barrier to passage. For instance, the use of a fence that reaches
to within a gap of the roof of a chamber, where `d` is smaller than
the diameter of all effector cells or readout particles, acts as a
barrier without the need for application of another force. Such a
structure may also be designed to selectively partition effector
cells or particles on different sides of a chamber by designing the
gap to allow for one type of particle to pass but not the other.
Referring to FIG. 32, for example, in one embodiment, effector
cells 120 have a diameter of 10 microns, and a mixture of the
effector cells and readout particles 121 (having a diameter of 1
micron) are loaded into one side of a chamber that is separated
from the other side by a fence 122 having a 5 micron gap (as
measured to the roof of the chamber). By tipping the device
appropriately, the 1 micron readout particles 121 are transferred
to the other side of the chamber, while leaving the effector cells
120 on the other side. In such a manner, the effector cells are
positioned in the effector zone of a chamber while the readout
particles are partitioned in the readout zone.
[0428] Wells within a chamber can also be used to sequester assay
reagents, effector cells and/or readout cells. For example,
representative device geometries are shown in FIGS. 33 and 34. In
one embodiment, a chamber is designed with an array of wells,
whereby small wells are defined at the bottom of a chamber (FIG.
33). Wells may be any shape, and are designed based on the effector
cell or readout particle they are designed to associate with. Both
square and circular shaped wells are amenable for use with the
devices described herein, and generally, any polygon shaped well is
amenable for use in a chamber. Various prototypes were fabricated
with square and circular wells, as well as square and circular
`posts.` Effector cells and readout particles are loaded into the
device at concentration such that each well within a chamber
contains a subpopulation of cells or readout particles. For
example, in one embodiment, each well within a chamber is addressed
to contain one or zero effector cells. Such a design can spatially
constrain the particles/cells. In embodiments where discrete
"effector zones" and "readout zones" are utilized, an effector cell
defines the well in which it resides as an "effector zone" and a
readout particle defines the well in which it resides as a "readout
zone".
[0429] FIG. 34 shows a "bead trap" embodiment that can be used in
the devices of the present invention. This design spatially
confines a plurality of readout particles (e.g., a plurality of
beads or readout cells) or cell population to a specific spatial
position within a chamber. Such a design overcomes problems that
can be associated with beads or particles that otherwise move
during an assay, thereby simplifying downstream imaging and image
analysis. Having a fixed position for the readout particle is also
advantages due to the diffusion distance between effector cell and
readout particle being better controlled.
[0430] The operation of a bead trap (shown in FIG. 34), in one
embodiment, occurs as follows: readout particles are loaded into a
chamber and then allowed to settle by gravity to the bottom of the
chambers, while the chamber is tipped toward the upper right corner
(i.e., the zone enclosed by the perpendicular cell fences and
generally circular particle trap opening toward the upper right
quadrant). After the readout particle or particles have settled to
the bottom of the chamber, the device could be tipped in the
opposite direction (along the same axis) so that the readout
particle or particles slide or roll along the bottom of the chamber
and into the circular `trap` feature in the center of the chamber.
As mentioned above the same method and device may be employed to
sequester effector cells.
[0431] In one embodiment, effector cells and readout particles are
positioned within a chamber into an effector zone and readout zone
using micro-fabricated structures that are designed to retain one
or more types of particles (e.g., cells). For example, in one
embodiment, the flow of effector cells or readout particles may be
designed to intersect with micro-fabricated cup structures that are
designed to retain particles but which allow the flow to pass
through. Such structures can be designed such that they can
accommodate only a fixed number of particles or cells, or a defined
size range of particles or cells, making the structures selective
for different particle types. Such traps may be positioned
substantially in the chamber or at the inlet and outlets of the
chambers.
[0432] In another embodiment, referring to FIG. 35, effector cells
81 are provided at the bottom of a chamber using gravitation, while
readout particles 82 are positioned at the outlet 83 of the chamber
using a trap structure 84 that is fabricated in the outlet
channel.
[0433] According to one embodiment of the invention, one or more
recesses (also referred to herein as "cups") at the bottom of a
chamber are provided to segregate effector cells from readout
particles. Referring to FIG. 36, for example, dead-end cups 361 are
provided at the bottom of a chamber 362 which have a width smaller
than the average diameter of the effector cell 363 but greater than
the diameter of the readout particle 364. In this configuration,
readout particles 364 sink to the bottom of the cups 361 while
effector cells 363 are retained above the cup entrance. In some
embodiments, the bottom of the cup 361 is accessed through a porous
membrane and channel structures beneath, to augment fluidic access
to the readout particles in dead-end cups that are covered with
effector cells.
[0434] In one embodiment, structural elements are positioned in a
flow channel or chamber to retain one or more particles or cells.
Referring to FIG. 37, structural elements 371 (or functionalized
surface patches, etc) may be positioned in the flow channel (not
necessarily a microwell) to retain one or more effector cells 372
and/or one or more readout particles 373. For example, trap
structures may be designed to retain particles or cells with
specific physical properties (e.g. size) or may be non-specific
(random distribution of effector cell and readout particle). Valves
374 can be used to separate adjacent chambers.
[0435] In an extension of the design described above (e.g., FIG.
37), structural elements in the flow channel are designed to retain
effector cells and readout particles in close proximity to one
another. Referring to FIG. 38, in one embodiment, one unit includes
an effector cell trap 381 to trap an effector cell 382, and
microstructure 383 to retain one or more readout particles 384.
Readout particles with a diameter smaller than the gap of the cell
trap pass the cell trap and are retained in the microstructure 383
located downstream of effector cell trap 331. Effector cells with a
diameter larger than gap 385 in the effector cell trap 381 are
retained, as discussed above. In another embodiment,
microstructures are designed so that the distance and location of
different types of readout particles (or effector cells) are well
defined.
[0436] In addition to barriers such as fences between effector
cells and readout particles, porous membranes may also function as
a barrier and therefore, are amenable for use with the present
invention. For example, referring to FIG. 39, in one embodiment, a
porous membrane 391 (also referred to as a diffusion channel) is
fabricated between effector cell chambers 392 holding effector
cells 395 and readout particle chambers 393 holding readout
particles 394, providing a horizontal arrangement. In such
horizontal arrangements, the porous membrane 391, in one
embodiment, is substituted by a sieve valve or a fluidic channel
with a cross-section smaller than the diameter of the effector
cells or readout particles. Sieve valves have previously been
described in U.S. Patent Application Publication No. 2008/0264863,
the disclosure of which is incorporated by reference in its
entirety for all purposes.
[0437] In another embodiment, a porous membrane is fabricated
between PDMS layers to provide a vertical arrangement. In this
embodiment, an effector zone is provided in one PDMS layer and the
readout zone is provided in the second PDMS layer. One advantage of
a vertical arrangement is that the spacing between the effector
zone and the readout zone is well-defined.
[0438] Porous membranes incorporated within PDMS devices have been
reported previously, for example, by Aran et al. (2010). Lab Chip
10, pp. 548-552; Cheuh et al. (2007). Anal. Chem. 79, pp.
3504-3508, the disclosure of which is incorporated by reference in
its entirety herein for all purposes. In one embodiment, a porous
membrane is fabricated according to one of the following
embodiments. In another embodiment, a PDMS layer is made porous by
adding an immiscible fluid to the uncured components of the PDMS.
During the baking step, the immiscible fluid evaporates. In yet
another embodiment, a PDMS membrane is perforated following curing
using laser ablation or another removal technique. In even another
embodiment, a PDMS membrane is cast on one or more microstructures
with a height exceeding the thickness of the membrane in order to
make the PDMS membrane porous.
[0439] In one embodiment, a structure that retains one or more
effector cells and/or readout particles is a temporary structure
and/or removable. In one embodiment, as illustrated in FIG. 40,
readout particles 401 (e.g., beads) are stacked against a sieve
valve 402 (a valve that blocks only part of the channel
cross-section). A layer of non-functional beads 403 are then
stacked against the readout particles 401, providing a barrier. A
layer of effector cells 404 are then provided, and stacked against
the layer of non-functional beads 403. As will be understood from
FIG. 40, effector cells 404, in one embodiment, are provided
through the feed channel 405. Effector cell assays measuring the
effect of one or more effector cells 404 on one or more readout
particles 401, in one embodiment, are carried out using the lower
bus channel 406. One advantage of temporary structures is that
chamber contents are recoverable, and in some embodiments,
selectively recoverable, through the lower bus channel by opening
one or multiple of the sieve valves.
[0440] In addition to microfabricated retention methods or fields,
hydrogels such as agarose are amenable for use in order to localize
effector cells and/or readout particles. For example, in one
embodiment, readout particles and/or effector cells can be loaded
in liquid agarose, for example, photosensitive agaraose, which
solidifies on-chip. As such, the movement of effector cells or
readout particles is restricting, which simplifies the imaging
process while still allowing diffusive transport. Upon re-melting
of the agarose, in one embodiment, selective remelting, effector
cells are recovered using microfluidic methods discussed herein. In
another embodiment, immobilized cells are selectively recovered
using a micromanipulator or a robotic method.
[0441] In one embodiment, segregation of effector cells and readout
particles in a particular zone within a chamber, or a particular
chamber, in one embodiment, is achieved by a specific flow profile,
stochastic loading, a magnetic field, an electric field or
dielectric field, a gravitational field, a modification to a
surface of the microfluidic chamber, and selecting a particular
relative buoyancy of the effector cells and the readout particles,
or a combination thereof. For example, in one embodiment, either
the cell population is labeled with magnetic particles or the
readout particles are magnetic, such that provision of a magnetic
field to the top surface of a particular chamber draws the cell
population or readout particles upward, and away from either the
readout particles, in the case that the cells are magnetically
labeled, or the cell population, in the case where readout
particles are magnetically labeled. In another embodiment, the
specific gravity of the fluid in which the cell population and
readout particles are incubated can be chosen to facilitate
separation of the effector cells and readout particles based on
their relative buoyancy. Certain particle and cell sequestration
methods are discussed in greater detail below.
[0442] Effector cells and readout particles, in one embodiment, are
distributed within a chamber by functionalizing one or more walls
of the chamber. In one embodiment, the surface functionalization is
performed by graft, covalently linking, adsorbing or otherwise
attaching one or more molecules to the surface of the chamber, or
modifying the surface of the chamber, such that the adherence of
cells or particles to the chamber surface is altered. Nonexclusive
examples of such functionalizations for use herein are the
non-specific adsorption of proteins, the chemical coupling of
proteins, the non-specific adsorption of polymers, the
electrostatic adsorption of polymers, the chemical coupling of
small molecules, the chemical coupling of nucleic acids, the
oxidization of surfaces, etc. PDMS surface functionalization has
been described previously, and these methods can be used herein to
functionalize surfaces of the devices provided herein (see, e.g.,
Zhou et al. (2010). Electrophoresis 31, pp. 2-16, incorporated by
reference herein for all purposes). Surface functionalizations
described herein, in one embodiment, selectively bind one type of
effector cell (e.g., an effector cell present in a cell
population), or selectively bind one type of readout particle. In
another embodiment, the surface functionalization is used to
sequester all readout particles present in a chamber.
[0443] In yet another embodiment, a surface functionalization or a
plurality of different surface functionalizations are spatially
defined within a chamber of a device. Alternatively, a surface
functionalization or plurality of surface functionalizations covers
the entire chamber. Both of these embodiments are useful for the
distribution of effector cells are readout particles into distinct
locations within a microfluidic chamber. For instance, in
embodiments where the entire chamber is functionalized with a
molecule that binds all types of introduced readout particles, the
particles are directed to different regions of the device, using
the methods described above, where they become immobilized on the
surface. In another embodiment, the entire chamber may be
functionalized to bind only one specific type of readout particle.
In this case, all particles, in one embodiment, are first directed
to one region using one of the methods described herein, causing a
subset of particles to adhere to the chamber surface in the
functionalized region, followed by exerting a force towards a
different region that displaces only the particles that do not bind
the functionalized surface or surfaces. In yet another embodiment,
regions of the device (e.g., different chambers or regions within a
single chamber) are functionalized with different molecules that
selectively bind different subsets of effector cells and/or readout
particles, such that inducing the interaction of the effector cells
and/or readout particles with substantially the entire chamber
surface results in the partitioning of different particle or cell
types in different regions. As described herein, it is intended
that surface functionalization may be used in isolation or in
combination with the other methods described herein for effector
cell and readout particle manipulation. Multiple combinations of
particle and cell sequestration methods, together with multiple
fluidic geometries are possible.
[0444] In another embodiment, effector cells and/or readout
particles are positioned within a chamber by the use of a magnetic
field. It will be understood that to manipulate and position an
effector cell(s) and/or a readout cell(s) magnetically, the
effector cell(s) and/or a readout cell(s) are first functionalized
with or exposed to magnetic particles that bind to them. In one
embodiment, the magnetic field is externally created, i.e., by the
use of a magnet outside of the microfluidic device, using a
permanent magnetic, an electromagnet, a solenoid coil, or of other
means. In another embodiment, referring to FIG. 41, the magnetic
field is generated locally by a magnetic structure 90 integrated
into, or separate from, the device. The magnetic field, in one
embodiment is applied at different times, and in one embodiment,
the magnetic field is applied in conjunction with particle loading,
to influence the position of effector cells and/or readout
particles that respond to a magnetic field.
[0445] It will be appreciated by those skilled in the art that
commercially available beads or nanoparticles that are used in the
separation and or purification of biological samples can be used in
the devices and methods provided herein. For example, "Dynabeads"
(Life Technologies) are superparamagnetic, monosized and spherical
polymer particles, and in one embodiment, are used in the devices
and methods provided herein as readout particles. Magnetic
particles conjugated with molecules that specifically bind
different target epitopes or cell types are well-known in the art,
and are also amenable for use with the devices and methods provided
herein. When in the presence of a magnetic field having a
non-uniform property, such magnetic particles are subjected to a
force that is directed towards the gradient of the magnetic field.
This gradient force, in one embodiment, is applied to position
particles within a chamber.
[0446] Referring to the embodiment depicted in FIG. 42, it will be
appreciated that a gradient force may be used to specifically apply
a force to a subset of particles in order to preferentially direct
one subtype, i.e., particles 100, within a chamber. In one
embodiment, this gradient force is applied before particles enter
the chamber in order to position them at a given position of the
inlet channel, thereby resulting in particle loading to a specific
region of the chamber. In another embodiment, the gradient force is
applied prior to, during, or after the loading of particles into
the chambers.
[0447] In addition to flow forces, a cell or particle (e.g.,
effector particle or readout particle) in the flow may be subject
to "body forces" that are derived from the action of an external
field. The orientation of the microfluidic devices provided herein,
within a gravitational field may be used to direct effector cells
and readout particles to a specific region of a device chamber. As
illustrated in FIG. 43, one such method involves physically tilting
the entire microfluidic device and sample holder along the axis of
a fence, and waiting for a sufficient time period for the
respective particles to settle by gravity to either side of the
fence. In one embodiment, the tilt angle is from about 30 to about
50 degrees, for example from about 30 degrees to about 45 degrees.
However, it should be understood that this angle can be adjusted
depending on the cell or particle loaded, the flow rate, and the
viscosity of the solution. It will be appreciated that the tipping
of a device in different orientations may be used to direct
multiple sets of particles to multiple distinct regions, depending
on the timing of the tipping and the introduction of the
particles.
[0448] A person skilled in the art will understand that the use of
gravity to direct particles within a chamber can be accomplished in
multiple steps. Referring to FIG. 44, by way of example, a device
is turned substantially upside down, and the particles 51 are
directed to one side of a chamber roof by tipping the device. Next,
the device is rotated back to the upright position quickly, such
that the particles do not move far during the process of returning
the device to the upright position. The particles then settle to
the floor of the chamber, but remain on the right side of the
chamber due to the presence of fence 50. In this way, features on
the roof of the chamber can be used to segregate particle types,
followed by transfer of the particles to the floor of the
respective chamber without substantially changing the lateral
positioning of the particles within the chamber. It will be
understood by those in the art that the time for flipping the
device in order to localize particles as described above is
dependent in part on the velocity at which the particles fall
through the liquid and the maximum displacement that can be
accepted for accurate positioning. The velocity of a particle
falling through a fluid is in the direction of the gravitational
field and can be calculated according to the following equation,
which is known to those of skill in the art:
U=V.sub.particle*(.rho..sub.particle-.rho..sub.liquid)*g*.gamma..sup.-1
Where V.sub.particle defines the volume of the particle, g is the
acceleration of gravity, and .gamma. is the drag coefficient of the
particle. For a spherical particle, .gamma. is well approximated by
the Stokes drag equation as:
.gamma..sub.sphere=6.pi..eta.r
[0449] In some embodiments of the invention where gravity is used
to position particles within a chamber, the effective size and/or
density of the particles are manipulated by using smaller particles
that bind on the particles surface. For example, the effector cell
may be exposed to ferromagnetic microbeads that are functionalized
to bind the effector cell, thereby causing the effector cell to
have a much higher effective density and to have a slightly larger
drag coefficient, the net effect of which is to make the cell fall
faster through the gravitational field.
[0450] Also within the scope of the invention, and related to the
use of gravity for the positioning of particles, is the use of
buoyancy of the particles within the fluid in order to direct fluid
flow and effector cell and readout particle positioning. Referring
to FIG. 45, for example, in one embodiment, effector cell 74 and
readout particle 73 have different densities, such that the density
of effector cell 74 is greater than that of the liquid in the
chamber 77, and the density of the readout particle is less than
that of the liquid, and the device is placed within a gravitational
field such that the gravitational field is directed downwards in
the chamber from the roof 75 to the floor 76, the effector cell and
the readout particle are partitioned to the floor and the roof of
the device, respectively, thereby defining the effector and readout
regions of the chamber 77. In one embodiment, this effect is
controlled by the addition of components to the liquid that change
the density and/or by modification of the particles, or selection
of the readout particle 73 and effector cell 74, such that they
have the appropriate density differences. It should be noted that
by exchanging medium in the chamber the partitioning of particles
may be reversibly modulated. Such an exchange is within the scope
of the present invention.
[0451] Effector cells and/or readout particles, in one embodiment,
are partitioned to different regions of a chamber by the use of an
electrostatic field and/or dielectric field that impart a force to
the particles. These fields, in one embodiment, are generated
externally to the device. In another embodiment, the electrostatic
and/or dielectric field is generated locally using one or more
micro-fabricated electrodes within the microfluidic device. Such
electrodes can be defined in a metal film on the substrate the
device is mounted on, integrated into a separate layer of the
device, or defined by filling microfluidic channels with a
conducting liquid. There are many examples of the integration of
electrodes within microfluidic devices and various geometries and
methods for integration will be apparent to those skilled in the
art. For example, the electrodes disclosed by Li et al. (2006).
Nano Letters 6, pp. 815-819, incorporated by reference herein in
its entirety), are amenable for use with the present invention.
[0452] In one embodiment, a dielectric field is applied to one of
the devices described herein, and the dielectric field is designed
with a frequency that results in a differential force on particles
having differential properties, which results in the separation of
the particles by differential properties. An example of using
dielectric fields to position effector cells and readout particles
within a chamber using a dielectric field produced by an integrated
electrode is shown in FIG. 46. In this embodiment, effector cells
110 are loaded into a chamber having a fence structure 111 at the
bottom, through an inlet channel 112 situated on the top of the
device. On loading the effector cells 110, an electrode 113 is used
to generate a dielectric field with a gradient that results in a
force on the effector cells 110. This force, directed towards one
side of the chamber, causes the effector cells 110 to selectively
fall (under the influence of gravity) into the effector region of
the chamber. Repeating this process with readout particles, an
electrode on the other side (readout zone) of the chamber may then
be used to load the readout particles into the readout zone. Such
dielectric manipulations provide a force that may be used in a
variety of configurations or processes for the purpose of
partitioning effector cells and readout particles.
[0453] In yet another embodiment, acoustic waves, such as acoustic
standing waves, are used to trap, position and/or retain effector
cells and/or readout particles.
[0454] In yet another embodiment, effector cells and/or readout
particles are stochastically loaded into the effector and readout
zones of a microfluidic chamber with high efficiency by appropriate
design of the chamber geometry and the loading density. For
example, FIG. 33 shows a microfluidic chamber having an array of 45
microwells that are fabricated at the bottom of the chamber having
a volume of approximately 2 nanoliters. The loading of effector
cells and readout particles into the microwells of the microfluidic
chamber, in one embodiment, is achieved using gravity as described
above. If the number of effector cells and readout particles is
maintained sufficiently low there is a low probability that two
effector cells and/or readout particles are positioned within the
same microwell within the microfluidic chamber.
[0455] The number of effector cells and readout particles per
chamber can be selected such that the probability of having a
chamber without both a readout particle and an effector cell is
very low. As an example, in one embodiment, the concentrations of
effector cells and readout particles are chosen such that there is
an average of three of each type per chamber. Assuming a random
distribution of particles within the microwells the chance of
having k particles of either type in a given microwell of a chamber
is given by Poisson statistics as:
P(more than one in a microwell)=.lamda..sup.ke.sup.-.lamda./k!
where .lamda.=the average number of particles per micro-well of the
microfluidic chamber, which in this example is (3+3)/45=0.133.
Thus, the probability of having 0 or 1 particles in a microwell in
this embodiment is:
P(k=0)=e.sup.-0.133=87.5%, and P(k=1)=11.7%.
[0456] Thus, in this embodiment, the chance of having more than one
particle is given by P(k>1)=100%-87.5%-11.7%=0.83%. The chance
of having zero micro-wells within a given chamber containing more
than one particle may then be calculated according to binomial
statistics as:
P(no wells with more than one particle)=(1-0.0083).sup.45=69%.
[0457] Thus, in this example approximately 70% of the chambers will
have no microwell with more than one particle. It will be
appreciated that this analysis represents a lower bound to the
fraction of useful chambers since in chambers where some
micro-wells have more that one particle in at least one micro-well
a useful measurement will still be possible using the other
chambers.
[0458] It is further considered that the micro-wells may be
designed with a size such that they will not accommodate more than
one particle. In this case the tipping of the device after loading
may be used to ensure all particles are contained within a
micro-well of the device and that no micro-wells have more than one
particle. It is also understood that different types of particles,
including different effector or readout particles, may be loaded in
a sequential fashion or together depending on the design of the
assay. Finally, it is understood that this geometry, while using
microwells, maintains the advantages of chamber isolation since the
array of micro-wells is contained within a small chamber that may
have the capability for being isolated from other chambers.
[0459] As noted above, the one or more of the methods described
above, in one embodiment, are combined are used to achieve
segregation of a population of cells optionally comprising one or
more effector cells from a population of readout particles, in an
effector zone and readout zone of a microfluidic chamber,
respectively. Additionally, one or more of the methods described
above, in one embodiment, are used to achieve segregation of a cell
subpopulation from an original cell population, or to segregate a
subpopulation of readout particles from a population of readout
zones, for example, in specific regions of an effector zone or
readout zone of a microfluidic chamber.
[0460] Effector cells and readout particles, in one embodiment, are
delivered to a chamber using a common inlet and segregated upon
entry into the chamber. Alternatively, effector cells and readout
particles are introduced to the chamber via separate inlets
specific for the effector zone and readout zone. Referring to FIG.
47, a chamber 298 according to an embodiment of the invention is
shown. Effector cells 290 are introduced into effector zone 291 via
effector cell inlet 292, while readout particles 293 are introduced
into readout zone 294 of the chamber via readout particle inlet
295. In the illustrated embodiment, effector zone 291 and readout
zone 294 have respective outlets 296 and 297, however the invention
is not limited thereto. Specifically, the effector zone 291 and
readout zone 294, in another embodiment, have a common outlet.
[0461] In another embodiment, a compound chamber (i.e., a chamber
comprising a plurality of subchambers) is used to provide an
effector zone and readout zone. One embodiment of a compound
chamber 300 is shown at FIG. 48. In one embodiment, a cell
population comprising one or more effector cells 301 is delivered
to effector zone 302 defined by effector cell subchamber 303 of
compound chamber 300 via the cell inlet 304. Similarly, readout
particles 305 are delivered to readout zone 306 defined by readout
particle subchamber 307 of compound chamber 300 via readout
particle inlet 308. In the illustrated embodiment (FIG. 48),
effector cell subchamber 303 and readout particle subchamber 307
have respective outlets 309 and 310. Effector cell subchamber 303
and readout particle subchamber 307 are in fluid communication via
aperture 311. Valve 312, in one embodiment, is provided in aperture
311 to render the aperture reversibly sealable.
[0462] In one embodiment, adherence is used to separate effector
cells from readout particles in some embodiments. For example, the
skilled artisan is directed to the embodiment shown at FIG. 49. In
FIG. 49, chamber 480 is functionalized with a coating solution to
enable adhesion of anchorage-dependent readout cells. The chamber
is then inverted to load anchorage-dependent readout cells 481
until they adhere to top surface 482. The chamber 480 is then
inverted again to load a suspension of cells 483, which are allowed
to settle by gravity to bottom surface 484 of the chamber 480,
effectively separating the cell population and the
anchorage-dependent readout cells 481 into separate effector and
readout zones. The cell population, in one embodiment, comprises
one or more effector cells.
[0463] In the embodiment depicted in FIG. 50, a coating solution
530 promoting cell adhesion is introduced into half of chamber 531
by flowing the coating solution and a second solution 532, e.g.,
phosphate buffered saline, in T junction 533 with laminar flow.
Adherent readout ells 534 are then introduced into chamber 531, and
directed to the side with adherent coating 535 by gravity
(represented by arrow). After an attachment period, unbound readout
cells 534 are washed from the chamber 531. A cell population 536 is
then loaded in the chamber 531. The cell population 536 is
maintained on the opposite side 537 of the chamber 531 by gravity
while the adherent readout cells 534 stay on the side with adherent
coating 535. The cell population, in one embodiment, comprises one
or more effector cells.
[0464] Referring to the embodiment depicted in FIG. 51, two
solutions, e.g., solution A 540 comprising an antibody against
target A (anti-A antibody) and solution B 541 comprising an
antibody against target B (anti-B antibody), are loaded into
chamber 542 from different sides of T junction 543, and allowed to
coat the functionalized chamber 542 surface (e.g., protein-A coated
PDMS). Using laminar flow, the first half 544 of the chamber 542
becomes coated with the anti-A antibody while the second half 545
is coated with the anti-B antibody. Two different types of
particles, first particle 546 displaying antigen A on its surface
and second particle 547 displaying antigen B on its surface are
then introduced into chamber 542. Segregation of the two types of
particles can be achieved by tilting chamber 542 first on one side,
and then the other, so that once a particle reaches the section
coated with the antibody against its displayed antigen, it remains
on the proper side of the chamber.
[0465] Once a chamber is loaded with a cell population and a
readout particle or readout particle population, and optionally
additional reagent(s) for carrying out an assay on the cell
population, the chamber, in one embodiment, is fluidically isolated
from one or more remaining chambers of the microfluidic device. In
one embodiment, isolation of the chamber is achieved by physically
sealing it, e.g., using one or more valves to fluidically isolate
the chamber from its surrounding environment. As will be understood
by one of skill in the art, a valve as described herein is
controlled via a "control channel," and by applying sufficient
pressure to the control channel, a particular valve can be
actuated. In one embodiment, subsections (e.g., an effector zone
and a readout zone) of a given chamber, or one subchamber of a
compound chamber (i.e., a chamber comprising a plurality of
subchambers or wells), are isolated from one another by physically
sealing the subsections or subchambers, to fluidically isolate the
subsections and/or subchambers, e.g., by using one or more
valves.
[0466] In another embodiment, isolation of a chamber from its
surrounding environment is achieved without physically sealing the
chamber. Rather, isolation is achieved by limiting the fluid
communication between chambers to preclude significant
contamination between one chamber and another chamber of the
microfluidic device. For example, instead of using a one or more
valves, adjacent chambers are separated by the use of an immiscible
fluid phase, such as an oil, to block chamber inlets and/or
outlets. Alternatively, chambers are designed with inlets and
outlets such that the diffusion of molecules in and out of chambers
is sufficiently slow that it does not significantly impede the
analysis of effect of secreted products within particular
chambers.
[0467] Various chamber arrangements are described throughout.
[0468] FIG. 52 shows a chamber architecture for use with
embodiments of the invention. The architecture includes chambers
311 (fabricated in the "flow layer") arranged in a column with each
chamber isolated from its neighbor by a valve 312 ("control
channel" layer). In another embodiment, valves are located above
each chamber (a "lid chamber") as illustrated in FIG. 53, resulting
in a higher on-chip feature density than the column architecture.
In the embodiment depicted on the left of FIG. 53, the width of the
chambers 321 are less than the width of the rounded feed channel
323 (e.g., to deliver effector cells and/or readout particles), in
which case the valve 322 seals the perimeter of the chambers.
Rounded channels, as discussed in detail herein, are fabricated
with by molding PDMS on certain types of photoresist, such as
Megaposit SPR220 Series (Microchem) and AZ 40 XT (MicroChemicals).
In the embodiment depicted on the right of FIG. 53, the chamber 321
width exceeds the width of the feed channel. In this embodiment,
chambers are isolated by a single valve 322 that simultaneously
closes the inlet and outlet of each chamber.
[0469] Importantly, the microfluidic devices of the invention are
not limited to serially arranged chambers addressed in a
"flow-through" mode where chambers are arranged in columns in which
the outlet of one chamber connects to the inlet of an adjacent
downstream chamber. Rather, a number of different chamber
arrangements and filling modes are provided herein and encompassed
by the invention. For example, in one embodiment, chambers are
arranged in parallel such that multiple chambers are addressed
simultaneously through the same feed channel. In a further
embodiment, parallel chamber arrays are used in "dead-end" filling
mode (i.e., where the chambers do not comprise an outlet).
[0470] FIGS. 54 and 55 show various parallel chamber arrangement
embodiments of the invention. In these embodiments, each column of
chambers 331 (FIG. 54) and chambers 331 (FIG. 55) share a common
inlet channel 332 and outlet bus channel 333. In these
configurations, cross-contamination between chambers is prevented
using valves 334. FIG. 55 shows an embodiment where an effector
zone 335 of a chamber can be fluidically isolated from the readout
zone 336 of the same chamber 331. Specifically, as illustrated in
FIG. 55, the chamber 331, in one embodiment, comprises a compound
chamber in which an effector zone 335 is separated from a readout
zone 336 by sealable channel 337 (e.g., sealable with a valve 337).
Contamination between individual chambers, in one embodiment, is
reduced as secreted products from each chamber are not transported
through chambers located further downstream on the device.
Importantly, reagents in the feed channels can be replaced while
chambers remain isolated, eliminating the risk of gradient effects
that could occur in serially arranged chambers.
[0471] In some embodiments, for example, as illustrated in FIG. 56,
a single connection between a chamber and a channel, which may be
controlled by a valve, can function as both an inlet and an outlet
depending on the direction of the flow, into or out of the chamber.
Referring to FIG. 56, a chamber 341 is connected to a feed channel
342 via a single connecting channel 343 that is under the control
of a valve 344. In this case the chamber walls are made from an
elastic and gas permeable material. This allows for the chamber to
be "dead-end" filled through the connecting channel 343 by pushing
the air in the chamber 341 into the PDMS material. A top-down view
of this architecture is provided in the bottom left of FIG. 56,
where the chamber 341 is connected to the feed channel 342 through
a single connecting channel 343. A valve 344 can be actuated to
fluidically isolate the chamber 341 from the feed channel 342. The
top left drawing in FIG. 56 shows a cross section of the same
architecture.
[0472] Once the chamber 341 is filled, flow can still be directed
into (FIG. 56, top right) or out of (FIG. 56, bottom right) the
chamber 341 by modulating the pressure applied to the chamber,
which causes the chamber 341 to expand or compress in volume. The
ability to modulate and change the chamber volume is advantageous
in the assaying of particles 345 (e.g., cells) within the chamber
341. For example, in one embodiment, particles 345 are introduced
into the chamber 341 by bringing them into the feed channel 342, by
applying a pressure to the feed channel 342 that is higher than
that of the chamber 341, and then opening the valve 344 to the
chamber 341 to allow the flow to enter the chamber 341. In another
embodiment, the valve 344 is first opened and then the pressure of
the feed channel 342 increased. Once inside the chamber 341, the
particles 345, e.g., effector cells or readout particles, will fall
to the bottom of the chamber under the effect of gravity.
[0473] In a further embodiment, pressure of the feed channel 342 is
then reduced, causing the chamber 341 to relax back to its original
volume with the flow to be directed out of the chamber. Since the
particles 345 (e.g., effector cells and/or readout particles), are
at the bottom of the chamber 341, they are substantially removed
from the flow and remain in the chamber when the pressure is
reduced. Feed channel 342 pressure modulations may also be used to
periodically add fresh medium to the chamber 341 in order to
maintain the viability and growth of cells, whether effector cells
or readout cells. In this embodiment, the chamber 341 is inflated
with fresh medium which mixes with the medium already in the
chamber by diffusion. Once mixed, a portion of the fluid inside the
chamber 341 is removed and the process repeated as desired by the
user. Importantly, by flushing the feed channel 342 with the
chamber 341 closed to the feed channel between subsequent steps of
medium addition (e.g., by actuation of valve 344), the contents of
a chamber within an array do not contaminate other chambers in the
chamber array.
[0474] This same approach of feed channel pressure modulations, in
one embodiment, is used to add reagents to a chamber that are
required or sufficient to observe and measure the effect of one or
more effector cells on one or more readout particles within the
chamber. For instance, and described in detail below, a cell
population comprising one or more effector cells is assayed in one
embodiment, for the ability of the one or more of the effector
cells to neutralize a cytokine. In this case, a chamber may be
first loaded with the cell population, for example a cell
population comprising one or more effector cells that secrete
antibodies. The antibodies are tested within the chamber for their
ability to neutralize a cytokine. For example, in one embodiment,
the cytokine neutralization effect is measured by providing readout
particles to the chamber, whereby the readout particles comprise
cells that are responsive to the cytokine, for instance by
expression of a fluorescent protein. In one embodiment, individual
chambers are first isolated and incubated to allow for the
accumulation of a sufficient amount of the antibody. A volume of
medium containing the cytokine is then added to the chambers by
inflating them, thereby maintaining the antibodies in the chambers
and not allowing for cross-contamination between chambers. The
chambers, in a further embodiment, are then incubated with
additional volume exchanges as required to determine if the chamber
contains an effector cell that secretes an antibody that is capable
of neutralizing the cytokine.
[0475] The above strategy may also be achieved without the use of
mechanisms to modulate the volume of chambers. For example, a
chamber, in one embodiment, is constructed to have two separate
compartments (e.g., separate chambers, or subchambers or wells
within an individual chamber) that are independently flushed with
reagents, and which may also be isolated from other chambers on the
device. The exchange of medium with fresh medium, or medium
containing other components/reagents needed for a particular assay,
in one embodiment, is implemented by isolating one compartment of a
chamber, e.g., a "reagent compartment," from the other compartment,
where the "other compartment" contains the effector cells and
readout particles, flushing the reagent compartment, and then
reconnecting the compartments to allow for mixing by diffusion or
by another means such as pumping between the two compartments.
[0476] As discussed herein, an effector zone and readout zone of a
chamber, in one embodiment, are fluidically isolated from one
another via one or more valves. This architecture can be further
extended to chambers that are dead-end filled and in communication
with each other. As illustrated in FIG. 57, separating the effector
zone 351 and the read-out zone 352, e.g., by valves 353, offers the
advantage of individual addressability: reagents in each zone may
be exchanged independently and/or assays may be subsequently
performed on both the effector cells and read out particles. Note
that the dead end portion of the channel is not depicted in FIG.
57.
[0477] As provided throughout, in one aspect, the present invention
relates to a method of identifying a cell population comprising an
effector cell having an extracellular effect and in another aspect,
methods are provided for identifying a cell population having a
variation in an extracellular effect. Once it is determined that
the cell population demonstrates the extracellular effect, or a
variation of an extracellular effect, the cell population or
portion thereof is recovered to obtain a recovered cell population.
Recovery, in one embodiment, comprises piercing the microfluidic
chamber comprising the cell population comprising the one or more
cells that exhibit the extracellular effect, with a microcapillary
and aspirating the chamber's contents or a portion thereof to
obtain a recovered aspirated cell population.
[0478] The recovered cell population(s), once recovered, in one
embodiment, are subjected to further analysis, for example to
identify a single effector cell or a subpopulation of effector
cells from the recovered cell population that is responsible for
the variation in the extracellular effect. The recovered cell
population(s) can be analyzed in limiting dilution, as
subpopulations for a second extracellular effect, which can be the
same or different from the first extracellular effect. Cell
subpopulations having the second extracellular effect can then be
recovered for further analysis, for example for a third
extracellular effect on a microfluidic device, or by a benchtop
method, for example RT-PCR and/or next generation sequencing.
[0479] Various methods for the recovery of one or more cells from a
specific chamber(s) are amenable for use herein.
[0480] The PDMS membrane design of the devices provided herein
enables the selective recovery of cells from any chamber by
piercing the upper membrane with a microcapillary. In one
embodiment, cell recovery from a chamber is carried out based in
part on the methods set forth by Lecault et al. (2011). Nature
Methods 8, pp. 581-586, incorporated by reference herein in its
entirety for all purposes. The membrane above a particular chamber
is pierced with the microcapillary and cells are aspirated (FIG.
58, top). The same microcapillary can be used to recover multiple
cell populations on one device. Recovered cells can then be
deposited in microfuge tubes for further analysis, for example,
RT-PCR analysis or subjected to a further functional assay on the
same microfluidic device or a different microfluidic device.
[0481] In one embodiment, once effector cells from identified
chambers are recovered, they are reintroduced into the same device
at a different region, at limiting dilution (e.g., either a single
cell per chamber or smaller populations than the initial assay) to
determine which effector cell(s) is responsible for the variation
in the extracellular effect, i.e., by performing another
extracellular assay on the recovered cells (see, e.g., FIG. 2).
[0482] In one embodiment, one or more cell population are recovered
with a microcapillary by aspirating the contents of the chamber
containing the cell population to provide a recovered aspirated
cell population. In a further embodiment, recovered aspirated cell
population is reinjected into a microfluidic device with the
microcapillary, wherein the microcapillary pierces one wall of the
microfluidic device. Pressure is then applied to the microcapillary
to flow the recovered aspirated cell population into separate
chambers of the microfluidic device, and the microcapillary is
retracted to cause the wall of the microfluidic structure to
substantially re-seal.
[0483] Recovery, in one embodiment is automated and using a robotic
microcapillary instrument (FIG. 58, bottom). However, recovery can
also be accomplished manually with a microcapillary. The recovery
methods provided herein allow for the recovery from 100 chambers
with >95% efficiency in 15 minutes. Alternatively, the recovered
effector cells can be introduced into a second device or analyzed
via benchtop methods to determine the identity of particular
cell(s) responsible for the variation in the extracellular
effect.
[0484] A microcapillary, as stated above in one embodiment, is used
to recover one or more cell populations (or subpopulations,
depending on whether a microfluidic enrichment has taken place)
from a microfluidic chamber. and aspirating the chamber's contents
or a portion thereof to obtain a recovered aspirated cell
population. The cells in the one or more cell populations (or
subpopulations) are substantially recovered by aspirating the
chamber contents into the microcapillary, to provide a recovered
aspirated cell population (or subpopulation). The microcapillary in
one embodiment, has a diameter of from about 5 .mu.m to about 200
.mu.m. In a further embodiment, the microcapillary has a diameter
of from about 5 .mu.m to about 200 .mu.m, or from about 5 .mu.m to
about 150 .mu.m, or from about 5 .mu.m to about 100 .mu.m, or from
about 5 .mu.m to about 75 .mu.m, or from about 5 .mu.m to about 50
.mu.m, or from about 50 .mu.m to about 200 .mu.m, or from about 100
.mu.m to about 200 .mu.m, or from about 150 .mu.m to about 200
.mu.m.
[0485] In some embodiments, the microcapillary has a beveled tip.
In some embodiments, the microcapillary has an oval, square or
circular cross section. Additionally, as shown in FIG. 58, the
microcapillary in some embodiments is mounted on a robotic
micromanipulation system on a microscope to provide an automated
recovery apparatus.
[0486] In one embodiment, the microcapillary provided herein has a
single barrel. However, the microcappilary in other embodiments has
multiple barrels, for example a double barrel, a triple barrel, or
more than three barrels.
[0487] A cell or cells can also be selectively recovered by using
microfluidic valves to uniquely address the specified chamber and
to direct flow to flush the single cell or multiple cells from the
chamber to an outlet port for recovery. Cell adherence to the
device substrate, in one embodiment, can be minimized by methods
known to those of skill in the art, for example, purging or coating
the microfluidic substrate with Trypsin. In another embodiment, a
plurality of chambers comprising cells of interest are
simultaneously recovered through a single port, e.g., via the use
of addressable valve arrays to control fluid flow. In another
embodiment, cells from chambers that are not of interest are first
removed from the device, either by washing or lysis. The remaining
contents of the device including the cells of interest are then
recovered by flushing to a desired port.
[0488] In one embodiment, the contents of a chamber comprising an
effector cell displaying a variation in an extracellular effect are
recovered from the device by aspiration, for example, by using a
microcapillary fabricated to have an appropriate size and shape. In
some embodiments, the recovery method comprises piercing the top of
the chamber comprising the cell(s) of interest with the
microcapillary and aspirating the cell(s) of interest. In one
embodiment, the membrane reseals or substantially reseals after
piercing is complete. In another embodiment, recovery of the
contents of a chamber comprising an effector cell displaying a
variation in an extracellular effect (e.g., one or more ASCs) is
performed by first cutting a wall of the chamber to create an
access point and then extracting cells by aspiration using a
microcapillary. In yet another embodiment, the microfluidic device
used to assay the extracellular effect is fabricated such that the
chambers are exposed by peeling away the material on one wall,
thereby leaving an open micro-well array. Identified chambers
(i.e., chamber(s) comprising an effector cell displaying a
variation in an extracellular effect) are then aspirated from their
respective chambers. In order to facilitate the precise extraction
of microfluidic well contents, aspiration tools such as
microcapillary tubes, in one embodiment, are mounted on a robotic
micromanipulator, or a manual micromanipulator (FIG. 58). However,
aspiration in other embodiments is performed manually.
[0489] In some cases, it is desirable to extract a subset of cells
from a given chamber. For instance, methods provided herein allow
for the removal of cells from a specific region of a microfluidic
chamber, for example, a readout zone or an effector zone. In one
embodiment, the recovery method provided herein comprises
aspiration of individual single cells in a serial manner.
[0490] Recovery of one or more cells from one or more microfluidic
chambers, in one embodiment, comprises magnetic isolation/recovery.
For example, in one embodiment, a microfluidic chamber is exposed
to a magnetic particle (or plurality of magnetic particles) that
adheres to the one or more cells within the chamber. Adherence can
be either selective for a single cell, a subpopulation of the
population of cells in the well(s), or non-selective, i.e., the
magnet can adhere to all cells. In this case, instead of aspirating
cells into a microcapillary, cells labeled with magnetic particles
are drawn to a magnetic probe that creates a magnetic field
gradient. The probe, in one embodiment, is designed to enable the
magnetic field to be turned on and off, causing cells to adhere to
it for removal and then be released during deposition. (EasySep
Selection Kit, StemCell Technologies).
[0491] Single cells or a plurality of cells harvested from
chambers, in one embodiment, are deposited into one or more
receptacles for further analysis, for example, open micro-wells,
micro-droplets, tubes, culture dishes, plates, petri dishes,
enzyme-linked immunosorbent spot (ELISPOT) plates, a second
microfluidic device, the same microfluidic device (in a different
region), etc. The choice of receptacle is determined by one of
skill in the art, and is based on the nature of the downstream
analysis and/or storage.
[0492] In some embodiments, cell-derived products or intracellular
materials are recovered from microfluidic chambers of interest,
alternatively or in addition to the recovery of a single cell or
plurality cells. For example, if a microfluidic chamber is
identified as having a cell that demonstrates a variation in an
extracellular effect, in one embodiment, the secretion products
from the chamber are is recovered for downstream analysis (e.g.,
sequence analysis). In another embodiment, the cell or plurality of
cells is lysed on the microfluidic device, e.g., within the chamber
that the first assay is performed, and the lysate is recovered. In
one embodiment, the lysate is subjected to further on chip
processing, for example, to isolate protein, mRNA or DNA from the
cell or plurality of cells. The RNA of the cell or plurality of
cells within a single chamber, in one embodiment, is selectively
recovered by using microfluidic valves to flush through a specified
chamber using a reagent that causes the release of the RNA from the
cells. This material is then collected at the outlet port. In
another embodiment, the cells in all wells or a subset of wells are
lysed using a lysis reagent, and then the contents of a given
chamber or subset of chambers are recovered. In another embodiment,
the cells within a chamber of interest or chambers of interest are
lysed in the presence of beads that capture the RNA released from
the cells followed by recovery of the beads, for example, by using
the techniques described above for cell recovery. In this case the
RNA may also be converted to cDNA using a reverse transcriptase
enzyme prior to or subsequent recovery. One example of how to
accomplish on chip mRNA isolation, cDNA synthesis and recovery can
be found in Anal. Chem 78 (2006), pp. 3084-3089, the contents of
which are incorporated by reference in their entirety for all
purposes.
[0493] Following the recovery of cells or cell-derived materials
from a chamber or chambers of interest, these materials or cells
are analyzed to identify or characterize the isolate or the single
cell or plurality of cells. As mentioned above, further analysis
can be via a microfluidic assay (see, e.g., FIG. 2), or a benchtop
assay. The present invention allows for multiple rounds of
microfluidic analysis, for example to identify a cell subpopulation
from a recovered cell population that displays a second
extracellular effect, a third extracellular effect and or a fourth
extracellular effect. By repeating the extracellular effect assays
on recovered cell populations, the user of the method obtains
highly enriched cell populations for a functional feature of
interest, or multiple functional features of interest.
[0494] In one embodiment, one or more cell populations exhibiting
the extracellular effect or variation in the extracellular effect
are recovered to obtain one or more recovered cell populations.
Once one or more individual cell populations are identified and
recovered, the one or more individual cell populations are further
analyzed to determine the cell or cells responsible for the
observed extracellular effect. In one embodiment, the method
comprises retaining a plurality of cell subpopulations originating
from the one or more recovered cell populations in separate
chambers of a microfluidic device. Each of the separate chambers
comprises a readout particle population comprising one or more
readout particles. The individual cell subpopulations are incubated
with the readout particle population within the chambers. The
individual cell subpopulations are assayed for a variation of a
second extracellular effect, wherein the readout particle
population or subpopulation thereof provides a readout of the
second extracellular effect. The second extracellular effect is the
same extracellular effect or a different extracellular effect as
the extracellular effect measured on the recovered cell population.
Based on the second extracellular effect assay, one or more
individual cell subpopulations are identified that exhibit a
variation in the second extracellular effect. The one or more
individual cell subpopulations in one embodiment, are then
recovered for further analysis. The second extracellular effect
assay is one of the extracellular effect assays described
herein.
[0495] One or more individual cell subpopulations are recovered,
for example, with a microcapillary, as described in detail above.
The microcapillary, in one embodiment, is used to reinject
recovered cell subpopulations into the same microfluidic device, or
a different microfluidic device, to further enrich for a population
of cells displaying an extracellular effect. For example, a
plurality of cell subpopulations originating from the recovered
cell subpopulation, in one embodiment, are retained in separate
chambers of a microfluidic device, wherein each of the separate
chambers comprises a readout particle population comprising one or
more readout particles. The cell subpopulations are incubated with
the readout particle populations within the microfluidic chambers
and the cell subpopulations are assayed for the presence of a third
extracellular effect. The readout particle population or
subpopulation thereof provides a readout of the third extracellular
effect. Based on the results of the assaying step, it is determined
whether one or more cells within one or more of the cell
subpopulations exhibits the third extracellular effect. The one or
more cell subpopulations can then be recovered as described
herein.
[0496] In one embodiment, cells from a recovered cell population or
recovered cell subpopulation or plurality of cell populations or
subpopulations are retained in a plurality of vessels as cell
subpopulations. The term cell sub-subpopulation is meant to refer
to a subpopulation of an already recovered cell subpopulation.
However, one of skill in the art will recognize that a cell
subpopulation can be partitioned into further subpopulations, and
the use of the term "sub-subpopulation" is not necessary to make
this distinction. Each cell subpopulation is present in an
individual vessel. The individual subpopulations or
sub-subpopulations are lysed to provide and one or more nucleic
acids within each lysed cell subpopulation or lysed cell
sub-subpopulation are amplified. In a further embodiment, the one
or more nucleic acids comprise an antibody gene.
[0497] Several approaches including microfluidic analysis may be
used for this downstream analysis, depending on the nature of the
cells, the number of cells in the original screen, and the intent
of the analysis. In one embodiment, where a population effector
cells is recovered from a chamber, or a plurality of populations
are recovered from multiple chambers, each cell of the plurality is
isolated into an individual vessel (e.g. individual microfluidic
chamber) and analysis is performed on each effector cell
individually. The individual cell analysis can be a microfluidic
analysis (FIG. 2), or a benchtop analysis. In another embodiment,
where a population effector cells is recovered from a chamber, or a
plurality of populations are recovered from multiple chambers, the
cell populations are reintroduced onto the same microfluidic device
in a separate region (or a second device), and the cells are
isolated at a limiting dilution, i.e., as "cell subpopulations,"
for example, the cells are isolated at a density of a single cell
per chamber, or from about two to about ten cells per chamber and a
second extracellular effect assay is performed. The downstream
analysis (microfluidic or otherwise) may be on any size cell
subpopulations, for example, the same size as the initial
extracellular effect cell assay, or a smaller population size,
e.g., a single cell, two cells, from about two cells to about 20
cells, from about two cells to about 25 cells. Readout particles
are introduced into the chambers comprising the cell
subpopulations, and the second extracellular effect assay is
performed. The contents of chambers that comprise a cell
subpopulation displaying a variation in the extracellular effect
are harvested for further analysis. This further analysis can be
microfluidic analysis (e.g., by performing a third extracellular
effect assay, single cell PCR), or a benchtop analysis (e.g., PCR,
next generation sequencing).
[0498] In one embodiment, individual recovered effector cells are
expanded in culture by distributing the plurality of cells at
limiting dilution into a plurality of cell culture chambers in
order to obtain clones from the recovered cells. For example, in an
embodiment where a plurality of effector cells of a cell line
engineered to express a library of antibodies are present in a
chamber or chambers of interest, the cells from the chamber or
chambers are subjected to limiting dilution in order to isolate
single effector cells that were present in the chamber. The single
effector cells are then used to obtain clonal populations of each
respective effector cell. One or more of the clonal populations can
then be analyzed to asses which effector cell produces the antibody
of interest by measuring the properties of the antibodies secreted
(e.g., by ELISA or a functional assay).
[0499] Alternatively or additionally, cells are recovered from a
microfluidic chamber, isolated, e.g., by limiting dilution, and
expanded to obtain sufficient material for the sequencing or
amplification and purification of one or more genes of interest,
e.g., a gene that encodes an antibody of interest. In yet another
embodiment, cells are recovered from a microfluidic chamber,
isolated, e.g., by limiting dilution, and used for single-cell DNA
or mRNA amplification, e.g., by the polymerase chain reaction (PCR)
or reverse transcriptase (RT)-PCR, followed by sequencing, to
determine the sequence of one or more genes of interest. In even
another embodiment, cells of interest are recovered from one or
more microfluidic chambers, isolated, e.g., by limiting dilution,
and subsequently used for single-cell DNA or mRNA amplification of
the genes of interest, followed by the cloning of these genes into
another cell type for subsequent expression and analysis.
[0500] In one embodiment, the recovered cell population(s) or
subpopulation(s) may be isolated and used for an in vivo analysis,
for example by injecting them into an animal, or exapanded in
culture followed by subjecting the cells to one or more functional
assays previously carried out on the microfluidic device.
[0501] In one embodiment, a cell population or subpopulation is
recovered that displays a variation in an extracellular effect
(e.g., after a first or second microfluidic extracellular effect
assay) and one or more nucleic acids of the cells are subjected to
amplification. Amplification, in one embodiment, is carried out by
the polymerase chain reaction (PCR), 5'-Rapid amplification of cDNA
ends (RACE), in vitro transcription or whole transcriptome
amplification (WTA). In a further embodiment, amplification is
carried out by reverse transcription (RT)-PCR. RT-PCR can be on
single cells, or a plurality of cells of the population. Although
single cell RT-PCR is becoming common place as an analytical
method, the amplification of antibody genes presents a nontrivial
challenge due to multiple gene usage and variability. Two main
approaches for recovery of antibody genes from single cells include
RT-PCR using degenerate primers and 5' rapid amplification of cDNA
ends (RACE) PCR. In one embodiment, the RT-PCR method is based on
gene-specific template-switching RT, followed by semi-nested PCR
and next-generation amplicon sequencing.
[0502] One embodiment of an RT-PCR method for use with identified
effector cells having a variation in an extracellular effect is
shown at FIG. 59. The schematic shows a single cell HV/LV approach
using template switching reverse transcription and multiplexed
primers. In this embodiment, single cells are deposited into
microfuge tubes and cDNA is generated from multiplexed
gene-specific primers targeting the constant region of heavy and
light chains. Template-switching activity of MMLV enzyme is used to
append the reverse complement of a template-switching oligo onto
the 3' end of the resulting cDNA (Huber et al. 1989). J. Biol.
Chem. 264, pp. 4669-4678; Luo and Taylor (1990). J. Virology 64,
pp. 4321-4328; each incorporated by reference in their entireties
for all purposes). Semi-nested PCR (common 3' primers and
multiplexed nested primers positioned inside the RT primer region)
using multiplexed primers at constant region of heavy and light
chain, and a universal primer complementary to the copied template
switching oligo, is used to amplify cDNA and introduce indexing
sequences that are specific to each single cell amplicon. The
resulting single cell amplicons are pooled and sequenced.
[0503] In some cases, a recovered cell population, following
recovery from the microfluidic device, is not further isolated into
single cells. For example, if the plurality of cells isolated from
a chamber contain a cell that secretes an antibody of interest
(e.g., present in a population of one or more additional cells that
secrete other antibody(ies)), the plurality of cells, in one
embodiment, is expanded in culture to generate clonal populations
of the cells of the plurality, some of which make the desired
product (i.e., the antibody of interest). In another embodiment, a
plurality of cells isolated from a microfluidic well is lysed
(either on the microfluidic device or subsequent to recovery),
followed by amplification of the pooled nucleic acid population and
analysis by sequencing. In this case, a bioinformatics analysis of
the sequences obtained may be used to infer, possibly using
information from other sources, which of the sequences is likely to
encode for the protein of interest (for example, an antibody).
Importantly, the analysis method afforded by the present invention
is greatly simplified, as compared to bulk analysis of a large
numbers of cells, due to the limited number of cells that are
recovered. This limited number of cells provides a reduced
complexity of the genomic information within the population of
cells.
[0504] In one embodiment, the amplified DNA sequences of the
plurality of cells are used to create libraries of sequences that
are recombinantly expressed in an immortalized cell line, according
to methods known to those of skill in the art. This cell line may
then be analyzed, possibly by first isolating clones, to identify
the genes of interest. In some instances these libraries are used
to screen for combinations of genes that result in a protein
complex of interest. For example, in one embodiment, genes
expressed in cells of interest include both heavy and light chains
of antibody genes in order to identify gene pairings that have the
desired properties. The complexity of such analyses is greatly
reduced by the fact that the number of cells analyzed in the
original screen is small. For example, if there are 10 cells in the
original screen there are only 100 possible antibody heavy and
light chain pairings. By comparison, bulk samples typically have
thousands of different antibody sequences, corresponding to
millions of possible pairings.
[0505] In some instances, recovered cells may contain different
cell types that can be isolated using methods known to those of
skill in the art. For instance, if the microfluidic chamber
comprises both antibody secreting cells and fibroblasts, used to
maintain the antibody secreting cells, the antibody secreting cells
in one embodiment, are separated from the fibroblasts after
recovery using affinity capture methods.
EXAMPLES
[0506] The present invention is further illustrated by reference to
the following Examples. However, it should be noted that these
Examples, like the embodiments described above, are illustrative
and are not to be construed as restricting the scope of the
invention in any way.
Example 1--Fabrication of Microfluidic Devices
[0507] Microfluidic devices were fabricated using the protocol
described in Lecault et al. (2011). Nature Methods 8, pp. 581-586
or an adapted version of this protocol (e.g., modified baking times
or curing protocols) to obtain multiple layers including, from the
bottom glass slide to the top: a flow chambers, a control layer, a
membrane, and bath layer (FIG. 27). A cross-section of a device and
a corresponding 3D-schematic of the chambers, flow channels and
control channels are shown in FIG. 61 and FIG. 62, respectively. As
described herein, where a control channel crosses a flow channel, a
pinch valve is formed, and closed by pressurizing the control
channel. A cover layer was added in certain instances to close the
bath, or left omitted for an open bath such as the one shown in the
device on FIG. 63.
Example 2--Microfluidic Device for Cell Enrichment by Selection and
Reinjection
[0508] The microfluidic device shown in FIG. 63 was used to
implement an effector cell (antibody secreting cell) selection
assay with reinjection capabilities for enrichment. As shown in
FIG. 64, the device includes six inlet ports 1030, six control
ports 1031 for controlling each inlet, four reinjection ports, one
of which is 1032 and a single output port 1033. The device contains
an array of 8192 identical unit cells, one of which is depicted in
FIG. 2B and FIG. 61. Each unit cell contains a chamber which is 100
.mu.m in width, 160 .mu.m in length and 160 .mu.m in height. Each
chamber has a volume of about 2.6 nL. The device is divided into
four sub-arrays, one of which is indicated by 1032 (FIG. 64). Each
sub-array contains 2048 of the 8192 total unit cells. Each
sub-array has its own sub-array valve 1034, which allows each
sub-array to be fluidically addressed independently of the other
sub-arrays. Each sub-array has a single reinjection port 1035. The
reinjection ports are circular chambers having diameters of about
300 .mu.m, depths of about 160 .mu.m and volumes of about 11.3 nL.
The reinjection ports are pierced by a microcapillary in order to
inject reagents or particles into one or more of the four
sub-arrays.
Example 3--Microfluidic Device for Segregation of Effector and
Readout Cells
[0509] A microfluidic device was designed to permit readout cells
to be kept in separate, isolated chambers from effector cells and
to allow the contents of these chambers to be mixed on demand when
needed. This configuration is used to implement effector cell
assays, for example, cytokine neutralization assays. The
architecture is particularly useful to prevent an effector cell's
secretion product (e.g., antibody) from being completely washed
away when the chamber comprising the effector cell(s) is perfused
with a fluid, for example, when provided with fresh culture medium
to maintain viability over extended periods of time. This
configuration is also amenable if it is useful to limit the time
during which the effector cell(s) is exposed to the medium
conditions required for the extracellular effect assay (e.g., when
a toxic cytokine is used as an accessory particle).
[0510] As shown in FIG. 65, this device consists of six inlet ports
1040, nine control ports 1041 and 1042, two outlet ports 1043 and
1044, and an array of 396 unit cells, each identical to 1045 and
illustrated in more detail in FIG. 66. Each unit cell contains two
circular chambers. Each chamber has a diameter of 210 .mu.m, a
height of 180 .mu.m and a volume of 5.6 nL. Typically, one of these
chambers holds one or more effector cell and the other chamber
holds one or more readout cells. A flow channel connects the two
chambers. This flow channel can be closed with the "diffusion
valve" 1050. With the diffusion valve 1050 open, the contents of
the two chambers mix via diffusion. With the diffusion valve 1050
closed, the chambers are isolated from each other. Two flow
channels serially connect each unit cell to each other unit cell in
the device. One of these flow channels flows through chamber 1 and
the other flows through chamber 2. These two flow channels are
closed with "main valve 1" 1051 and "main valve 2" 1052 to isolate
the chambers of each unit cell from the chambers of each other unit
cell. These two valves are opened and closed independently,
permitting independent perfusion of chamber 1 or chamber 2. Cross
sections of the device in the vertical and horizontal planes
(dotted lines) from FIG. 66 are shown in FIG. 67 and FIG. 68,
respectively.
[0511] An example of how a cytokine neutralization functional assay
which can be implemented with the device is shown in FIG. 69. Panel
A shows the top chamber containing at least one effector cell and
the bottom chamber containing a plurality of readout cells. Both
chambers contain an equal concentration of cytokine, required to
maintain the viability of readout cells. All valves are closed.
Closed valves are illustrated shaded black and opened valves are
illustrated with horizontal hatched lines. Panel B shows that time
has passed and the at least one effector cell has secreted
antibodies. In the particular case that is illustrated, the
antibodies bind to the cytokines in the effector chamber,
neutralizing them. Panel C shows that the diffusion valve 1050 has
been opened. Free cytokines diffuse from the bottom chamber towards
the top chamber. Neutralized cytokines diffuse from the top chamber
towards the bottom chamber. Panel D shows that enough time has
passed such that the concentration of free and neutralized
cytokines in each chamber has substantially equalized. All valves
are then actuated and locked. The effective concentration of
cytokine in the bottom chambers comprising the readout cells is now
about half the initial concentration. Panel E shows that effector
cells have been perfused with fresh medium containing additional
cytokine. The perfusion has removed the neutralized cytokine from
the top chamber. The process is repeated every few hours,
eventually leading to a complete depletion of cytokine and death of
readout cells. In other cases, the effect of cytokine
neutralization on readout cells may include activation or
inhibition of a signaling pathway, growth arrest, differentiation,
or a change in morphology. The effect on the readout cells is then
measured by methods known to those of skill in the art.
Example 4--Integration of Cell Fence Chambers
[0512] Devices having cell fences for capture of a single effector
cell or a heterogeneous population of cells comprising one or more
effector cells were fabricated as follows.
[0513] PDMS devices with cell fences were fabricated by molding
from a reusable flow channel mold and reusable control channel. The
flow channel mold comprised multiple layers of photoresist on a
silicon wafer substrate. The bulk of the chambers in the devices
utilized herein were defined by an SU-8 100 feature which sits
directly on the Si wafer. Cell fences, when fabricated, were
defined by a thinner SU-8 2010 feature which sat on top of the SU-8
100 feature. This is depicted schematically in FIG. 31.
[0514] The majority of microfluidic chambers were fabricated using
SU-8 100 negative photoresist (typically 160 .mu.m in height)
following standard protocols, except that the final step,
development, was omitted. The wafers were cooled after the
post-exposure bake, and then SU-8 2010 was spun on top of the
undeveloped SU-8 100, typically at a height 10-20 .mu.m. The
thickness of the SU-8 2010 determined the height of the fence. The
depth of each chamber was the combined height of both photoresist
layers.
[0515] In alternative fabrication procedures, the SU-8 100 layer is
fully developed, and then the wafer is coated with an additional
layer of SU-8 100 which is higher than the first layer, the
difference in height becoming the height of the fence.
[0516] The molds were then parylene coated (chemical vapor
deposited poly(p-xylylene) polymers barrier) to reduce sticking of
PDMS during molding, enhance mold durability and enable replication
of small features that could not be produced with the
aforementioned parylene coating.
[0517] A number of prototype devices were fabricated to determine
feasible fence width-height combinations. A prototype flow layer
mold was fabricated in order to determine dimensions which could
successfully be fabricated. This mold consisted of multiple
chambers with fences, with the width of the fences being varied
across the same mold. Also, the height of the fence and of the
chamber could be varied during fabrication (by adjusting spin
speeds). The prototype molds contained only chambers for
fabrication testing.
[0518] Two photolithographic masks were required, one to define the
bulk of the chambers (SU-8 100) and the other to define the fences
(SU-8 2010). However, one physical mask could be used, containing
both sets of features.
[0519] A prototype fence chamber was fabricated where the full
width W of the chamber and was fixed at 300 .mu.m. The typical
width of chambers on most existing devices is 160 .mu.m. Initially,
each half of these chambers was made a similar size to allow a
separate inlet and outlet for each of the effector and readout
zones. L is the length of the chamber. For each unique value of X,
there were three chambers with L=160 .mu.m (length) and one more
with L=2000 .mu.m. The chamber with extended length was included in
order to allow the final PDMS mold to be easily cut perpendicular
to the fence, so that the cross-section could be imaged.
[0520] Initially a single mold was fabricated, providing data on a
single set of chamber and fence heights. Table 5 summarizes the
dimensions of the prototype mold:
TABLE-US-00006 TABLE 5 Prototype mold dimension summary W (design
value) 300 .mu.m L (design value) 160 / 2000 .mu.m SU-8 100 Height
(measured) 160 .+-. 5 .mu.m SU-8 2010 Height (measured) 17 .+-. 1
.mu.m
[0521] Table 6 lists the fence widths which were on the mold and
which ones were successfully fabricated:
TABLE-US-00007 TABLE 6 X (fence X (fence width) width) [.mu.m]
[.mu.m] Successful Design Measured PDMS Value Values Fabrication?
5.0 can't measure No 7.5 can't measure No 10 18 .+-. 2 No 12.5 21
.+-. 2 No 15 25 .+-. 2 No 17.5 29 .+-. 2 Yes 20 31 .+-. 2 Yes 25 37
.+-. 2 Yes 30 42 .+-. 2 Yes 35 48 .+-. 2 Yes
[0522] The table above shows that the actual fence widths turned
out larger than the design values.
[0523] Fabrication failures were not obvious until after PDMS
molding. For the smaller fence widths, it was difficult to
determine the quality of the photoresist mold by viewing it under
the microscope. Fences failed because the PDMS making up the fences
either stayed in the mold completely or partially ripped away from
the bottom of the chambers. For example, a fence having a width of
15 .mu.m failed. The minimum width which could be fabricated using
this particular design and the above described methods was 17.5
.mu.m.
[0524] It was observed during PDMS molding of the prototype devices
that the fence often tore apart from the chamber bottom. This
tearing appeared to begin at the 90 degree corner where the fence
met the wall of the chamber. This 90 degree corner is a stress
concentration. The design was modified to include 45 degree
chambers in order to reduce these stress concentrations and thereby
improve PMDS molding capability. This design change allowed the
fence width to be reduced below the 17.5 .mu.m width, which was the
largest size possible on the testing mold. The width of the fence
was reduced to a design value of 10 .mu.m. The actual measured
value, 12 .mu.m, was much closer to the design value than was
achieved on the prototype mold.
[0525] Fences in this example run parallel to the flow. However,
there is no inherent reason that fences cannot be fabricated to be
perpendicular to the flow or diagonal relative to the flow.
Similarly, chambers in this example are symmetric. However, the
invention is not limited thereto.
[0526] Individual microfluidic chambers having a cell fence, an
effector zone and a readout zone were loaded with a cell population
and readout particles using a tilting method to direct the effector
cells to the effector zone or the readout particles to the readout
zone.
[0527] FIGS. 70A, 70C, and 70E show light microscopy images of
microfluidic chambers having cell fences and FIGS. 70B, 70D, and
70F, show the equivalent chambers under fluorescence microscopy.
The beads (readout particles) in the readout zone show an
aggregation of effector cell product on the beads that is generally
uniform despite relative distance from the effector cells and the
effector zone.
Example 5--Robust Microfluidic Growth of Antibody-Secreting
Effector Cells
[0528] A plurality of recombinant Chinese Hamster Ovary (CHO) cells
(effector cells) producing a human IgG antibody was loaded in the
microfluidic device at a concentration of 2 M cells/mL. Secreted
antibodies were captured on protein A-coated beads (average
diameter: 4.9 .mu.m) during a 2 hour incubation followed by the
addition of Dylight 594-conjugated F(ab').sub.2 fragment of rabbit
anti-human IgG (H+L) and washing (FIG. 71). Bright field and
fluorescent images were taken to quantify antibody secretion and
capture. Cells were subsequently cultured in the device for 4.5
days to generate clonal populations and clones secreting high
amounts of antibody were recovered from the device for further
expansion.
[0529] FIG. 72 shows time-lapse imaging of a CHO clone after the
antibody detection effector cell assay was performed. The readout
beads are identified by the black arrow while the cells are
identified by the white arrow. FIG. 73 shows growth curves (error
bars, s.d.) of CHO cells cultivated in shake flasks (n=3
experiments in triplicate seeded at 2.5.times.10.sup.5 cells
m.sup.ml-1) as single cells in 96 well plates (n=3 experiments;
27-36 clones per plate) or in the microfluidic array (n=3
experiments; 50 clones tracked per experiment). CHO cells expanded
in the microfluidic array exhibited growth rates that were
comparable to batch shake flask cultures and superior to single
cells cultured in 96-multiwell plates (FIG. 73).
Example 6--Sensitivity of Single ASC Detection in the Presence of a
Heterogeneous Population of ASCs
[0530] Mathematical modeling was used to determine the total
efficiency of antibody capture on beads within a chamber having a
volume of 4.1 nL (160 .mu.M.times.160 .mu.M.times.160 .mu.M) as a
function of time and as a function of the number of beads. The
average secretion rate for this line of CHO cells was measured on
bulk samples to be approximately 300 proteins per second. This
secretion rate is comparable to the expected secretion rate from
primary antibody secreting cells which are estimated to secrete
between 100 and 2000 antibodies per second. Thus, based on these
measurements it was determined that the beads furthest away from
the cell are expected to capture approximately 4000 antibodies
during a two hour incubation, and is detected via fluorescence.
[0531] In the example shown in FIG. 74A to 74D, the target of
interest (antigen) is hen egg white lysozyme (HEL). A device was
loaded with effector cells derived from two hybridoma lines, HyHel5
and 4B2. HyHel5 hybridoma cells secrete a monoclonal antibody that
binds HEL and 4B2 hybridoma cells secrete a monoclonal antibody
that does not bind HEL. Referring to FIG. 74A, the top panel shows
a HyHel5 cell loaded into a chamber of a device having
approximately 700 assay chambers. HyHel5 cell were initially loaded
at a density that results in an average of approximately 1 cell
every 10 chambers. The bottom panel shows a chamber in which no
HyHel5 cells are loaded. The locations of the loaded HyHel5 cells
were recorded, once loaded into the device. Referring to FIG. 74B,
the 4B2 cells were loaded into the chambers at an average ratio of
the two cell lines loaded into the device at an average of 25 cells
per chamber, corresponding to 250 times the concentration of HyHel5
cells.
[0532] The device chambers were then washed and beads
functionalized with rabbit polyclonal anti-mouse IgG antibodies
(readout particles) were loaded into the chambers. The chambers
were then isolated and incubated, resulting in the capture of the
antibodies generated by the cells in each chamber on the beads in
that chamber. Referring to FIG. 74C, fluorescently labeled HEL (10
nM) was included in the medium during the incubation step and
fluorescent images were taken to identify the chambers having beads
with bound HyHel5 and to monitor the accumulation of HyHel5
antibodies on the beads. As can be seen in FIG. 74C, fluorescence
was only detected in the top panel, indicating that only chambers
having HyHel5 cells generate strong fluorescent signal on beads
when incubated with the fluorescently labeled HEL antigen.
Referring to FIG. 74D, the device was then incubated with
fluorescently labeled polyclonal anti-IgG antibodies to identify
chambers having beads with bound IgG, either secreted from HyHel5
cells or 4B2 cells. All chambers generated fluorescent signal when
exposed to fluorescently labeled anti-IgG antibody, indicating that
antibodies from both cell lines were captured in all chambers.
Following incubation with fluorescently labeled HEL, the chambers
were flushed with medium in the absence of labeled HEL antigen, and
images were taken to monitor the dissociation kinetics of the
HyHel5-HEL binding in the chambers, as shown in FIG. 74E. FIG. 74F
shows the fluorescence over time of 600 chambers containing a mix
of HyHEL5 and 4B2 hybridoma cells as described above, incubated in
the presence of Protein A beads and 10 nM lysozyme. Chambers
containing HyHEL5 cells were easily distinguishable by their
fluorescence above the baseline, demonstrating the ability of this
system to detect rare cells secreting an antigen-specific mAb.
[0533] In a different example, a population of HyHEL5 hybridoma
cells secreting antibodies against hen-egg lysozyme (HEL) was
loaded in the microfluidic device at limiting dilution. The device
was imaged to determine the presence of HyHEL5 cells in each of the
chambers. DMS-1 hybridoma cells secreting antibodies that do not
bind HEL were subsequently loaded at an average concentration of
approximately 5 cells per chamber in the same array. Cells were
incubated in the presence of readout antibody-capture beads
(Protein A beads coated with rabbit anti-mouse antibody) and the
secretion of lysozyme-specific antibodies was measured by washing
with a 1 nM solution of lysozyme labeled with Alexa-488. Bright
field images obtained after loading HyHeL5 cells (top), bright
field images taken after incubation with DMS-1 cells and beads
(middle), and corresponding fluorescent images (bottom) are shown
for three representative chambers containing DMS-1 cells only (FIG.
75A) or a mixture consisting of a single HyHEL5 cell and multiple
DMS-1 cells (FIG. 75B). The distribution of fluorescence intensity
is shown for chambers containing DMS-1 cells only (FIG. 75C) or
both HyHEL5 cells and DMS-1 cells (FIG. 75D). Cells secreting
antibodies against hen-egg lysozyme in the HyHEL5 population was
detected even in the presence of multiple DMS-1 cells secreting
non-antigen-specific antibodies.
Example 7--Selection of mAbs from Single Cells Using Bead- and
Cell-Based Binding Assays
[0534] Single hybridoma effector cells (4B2) were loaded into
individual chambers of a microfluidic device and binding of
secreted antibodies (IgG against anti-human CD45) was measured
using both a bead-based and cell-based readout binding assays.
Readout cells in this experiment were K562 cells endogenously
expressing the human CD45 membrane receptor and stained with
carboxyfluorescein succinimidyl ester (CFSE) prior to fixation so
as to distinguish them from the effector cells. Single effector
cells were provided to individual chambers of the device and
incubated with a plurality of readout K562 cells overnight. Next,
the effector cells were incubated with readout Protein A beads for
an additional 2 hours and then stained with a detection antibody
(fluorescently labeled anti-mouse IgG), which binds the secreted
IgG anti-human CD45 antibody. Fluorescence of individual chambers
was then measured. A schematic of the experiment is provided in
FIG. 76A
[0535] FIG. 76B is a graph of mean fluorescence intensity of
readout cells and readout beads measured by automated image
analysis for empty chambers and chambers containing a single
hybridoma effector cell. FIG. 76C (left to right) shows a single
chamber with a single hybridoma cell (left panel). The hybridoma
cell in this example divided overnight. The remaining panels show
fluorescent and merged images of anti-CD45 antibody staining in the
same chamber following an overnight incubation with target fixed
K562 cells and a 2-hour incubation period with protein A beads
(labeled with appropriate polyclonal anti-mouse IgG antibodies). A
person skilled in the art will understand that this assay can be
modified to be performed with live readout cells and/or different
species of readout cells.
Example 8--Cell-Based Immunization and Cell Binding Assays
[0536] Mice were immunized with fixed cells from a human ovarian
cancer cell line (TOV21G) (FIG. 77A). Antibody-secreting effector
cells were sorted using FACS and were then injected in the
microfluidic device and incubated with readout cells (fixed and
live TOV21G cells) stained with CFSE. Antibody binding was
visualized using a secondary labeled antibody. FIG. 77B shows the
results of this experiment. From left to right: plasma and readout
cells (live and fixed) after loading on chip. Readout cells were
stained with CFSE for identification. Antibody binding on the cell
surface of live and fixed cells was visualized with a secondary
labeled antibody (anti-mouse IgG). Far right shows a negative
chamber (no effector cells) with very low signal on the readout
cells.
Example 9--Maintenance of Cellular Viability and Secretion
[0537] Conditions were optimized for maintaining cellular viability
and secretion of ASC effector cells for 5-8 days. FIG. 78 shows
cell survival and antibody-secretion by ELISPOT from mouse ASCs
grown for 8 days (FIG. 78A), and human ASCs (FIG. 78B) grown for 5
days in complete RPMI with IL-6 10 ng/mL.
[0538] For immunization procedures, mice were subcutaneously
injected with hen egg-white lysozyme and Alhydrogel adjuvant
(Accurate Chemical & Scientific Corporation) 3 times at 2 week
intervals. Humans were immunized with influenza vaccine 1 week
prior to blood collection. Immunization procedures were performed
in accordance with approved protocols by the University of British
Columbia. Mouse spleen cells were isolated and stained with PE
anti-mouse CD138 (BD Pharmingen) and sorted by FACS for CD138+ cell
population (see Example 10 for a further description). Human
peripheral blood mononuclear cells (PBMCs) were isolated and
stained with markers as described in Wrammert et al. (2008), Nature
Letters 453, pp. 667-671, the disclosure of which is incorporated
by reference in its entirety for all purposes.
[0539] Enzyme-Linked-Immunospot (ELISPOT) assay was performed in
polyvinylidene fluoride (PVDF) membrane-lined 96-well microplates
(Millipore). The PVDF membrane was pre-wet with 70% ethanol and
washed with PBS. Plates were coated overnight with goat anti-mouse
IgG (H+L) (Jackson Immunoresearch) or rabbit anti-human IgG (H+L)
(Jackson Immunoresearch antibody (1:1000/100 pt/well) and washed
3-4 times with PBS. Cells were then added and incubated for 20 h at
37.degree. C. Cells were removed by washing 3-4 times with PBS
containing 0.1% Tween (PBS-Tween), and plates were incubated with
alkaline phosphatase-goat anti-mouse IgG (H+L) (Jackson
Immunoresearch) (1:1000/100 uL/well). After washing 3-4 times with
PBS-Tween, plates were incubated with BCIP/NBT chromogenic agent
(Sigma-Aldrich B6404-100ML). Spots were counted with the aid of an
upright microscope and CCD camera.
Example 10--Methods for Enriching Plasma Cells
[0540] Antibody-secreting cells were enriched in species with known
markers, specifically CD138 plasma cell marker in mice (FIG. 79).
First, mice were immunized intraperitoneally with 5.times.10.sup.6
ovarian carcinoma cells (TOV-21G) 3 times at one week intervals, in
accordance with approved animal care protocols. Mouse spleen cells
were stained with PE anti-mouse CD138 (BD Pharmingen) and sorted by
FACS for CD138+, and CD138- as a negative control (FIG. 79A).
ELISPOT was performed as described in Example 9 to detect
antibody-secretion from the sorted and unsorted cell populations
(FIG. 79B). A 20-fold increase in ASCs from the CD138+ population
compared to unsorted spleen cells was observed (FIG. 79C). Although
not performed here, enrichment can also be done using commercially
available magnetic-based enrichment kits (e.g., StemCell
Technologies, Miltenyi) alone or in combination with FACS
sorting.
[0541] Antibody-secreting cells were also enriched from species
lacking established markers for plasma cells by using the
ER-Tracker.TM. (Life Technologies) in rabbits (FIG. 80). Rabbits
were immunized with influenza vaccine intradermally 4 times at 1
week intervals, followed by boosts 1 week prior to blood
collection, in accordance with approved animal care protocols.
Rabbit PBMCs were stained with ER-Tracker (Life Technologies) and
mouse anti-rabbit IgG (Jackson Immunoresearch), and sorted by FACS
for ER.sup.highIgG.sup.low population (FIG. 80A). ELISPOT was
performed as described in Example 9 to detect antibody-secretion
from the ER.sup.highIgG.sup.low population and unsorted PBMCs
control (FIG. 80B). A 6-fold increase in antibody secretion from
the ER.sup.highIgG.sup.low population compared to unsorted PBMCs
was observed (FIG. 80C).
Example 11--Enrichment Using Influenza Human Systems
[0542] Peripheral blood mononuclear cells (PBMCs) were isolated
from the blood of a human patient 7 days following immunization
with the influenza trivalent vaccine. Cells were enriched based on
CD138 expression using a commercially available bead separation kit
(Stem Cell Technologies) and loaded in a microfluidic device at an
average density of 11 cells per chamber (i.e., heterogeneous cell
populations comprised on average 11 cells) for a total of
approximately 44,000 cells. Cells were incubated with Protein A
beads for 2 hours, and with fluorescently labeled H1N1 and H3N2 in
different colors. A total of 171 H1N1-positive chambers and 199
H3N2-positive chambers (e.g., FIG. 81A) representing
antigen-specific frequencies of 0.39% and 0.45%, respectively. The
contents of 24 of these chambers were recovered and cultured
overnight in a multiwell plate (FIG. 81B) and then introduced in a
second microfluidic device the next day. After enrichment, the
frequencies of H1N1-positive H3N2-positive chambers (FIG. 81C) were
7% and 6%, respectively, meaning that a 13- to 18-fold enrichment
was obtained (FIG. 81D).
Example 12--Bead Aggregation as an Indicator of Antibody
Secretion
[0543] Chambers of a microfluidic device were loaded with a mixture
of cells secreting human antibodies and non-antibody secreting
cells. Cells were incubated for 2 hours in the presence of
protein-A beads and then stained using secondary labelled
antibodies. The beads in chambers that contained antibody-secreting
cells formed aggregates (FIG. 82) while beads remained dispersed in
the absence of secreted antibodies (FIG. 83).
Example 13--Affinity Measurements for HEL-Specific Hybridomas
[0544] A population of hybridoma effector cells (HyHEL5) producing
an antibody with high affinity for hen-egg lysozyme (HEL) was first
introduced in a microfluidic device at limiting dilution. A picture
set was taken to identify chambers containing HyHEL 5 cells, and
then a second population of hybridoma cells (D1.3) secreting an
antibody with low affinity for HEL was loaded in the same device. A
second picture set was taken and chambers containing either one
HyHEL5 cell or one D1.3 cell were identified. Protein A beads
coated with a rabbit anti-mouse antibody were introduced in the
chambers and incubated with the cells for 2 hours. At the end of
the incubation period, labeled antigen was introduced in the device
at increasing concentrations between 100 fM and 10 nM in a
step-wise fashion. FIG. 84A shows a diagram of this experiment, and
micrographs of the chambers with different concentrations are shown
in FIG. 84B. The bead fluorescence intensity was measured at every
step, normalized to the background for every chamber. Chambers
containing HyHEL5 were distinguished from those containing D1.3
cells based on the affinity measurements (FIG. 84C). Example curves
from representative chambers containing single cells HyHEL5 and
D1.3 and the images from these same chambers are shown in FIG. 84D
and FIG. 84B, respectively. Affinities for HyHel5 and D1.3
antibodies are 30 .mu.M and 1.5 nM, respectively (Singhal et al.
(2010), Anal Chem 82, pp. 8671-8679, in corporate by reference
herein for all purposes).
Example 14--Identification of Antigen-Specific Cells with or
without Chamber Isolation
[0545] Human plasma cells were enriched from PBMCs obtained from
the blood of human patients one week after immunization with the
trivalent influenza vaccine. Cells were introduced in two different
microfluidic devices and incubated in the presence of Protein A
beads (readout beads) for 2 hours. In one device (FIG. 85),
individual chambers comprising heterogeneous cell populations and
readout beads were isolated from one another with a valve during
the incubation. In the second device (FIG. 86), the valve was left
open. Labeled antigens (H1N1 and H3N2) were introduced in the
device at the end of the incubation period for 15 minutes and then
the chambers were washed with media. FIG. 85 and FIG. 86 show a
plurality of chambers from a section of each array, with
H3N2-positive hits identified by white arrow. In the absence of
main valve isolation (FIG. 86), the background in surrounding
chambers was higher than with the main valve closed (FIG. 85).
However antibody-carryover did not prevent clear distinction
between negative and positive chambers. The direction of the flow
channels is indicated by black arrows.
Example 15--Selection of Novel Mouse Antibody Secreting Cells Based
on Affinity Measurements
[0546] Plasma cells were isolated from the bone marrow of a mouse
immunized with hen-egg lysozyme. Approximately 23,800 cells were
distributed across 3 sub-arrays containing 6,144 chambers in a
microfluidic device (average density: .about.4 cells/chamber).
Cells were incubated with Protein A beads coated with a rabbit
anti-mouse capture antibody for 2 hours, washed with 10 nM of
labeled hen-egg lysozyme and imaged. 117 antigen-specific chambers
were identified, the contents of which were recovered with a
microcapillary and reinjected at limiting dilution in a fourth
sub-array containing 2,048 chambers. The reinjected cells were
incubated with Protein A beads coated with a rabbit anti-mouse
capture antibody for 2 hours, and then exposed to increasing
concentrations of labeled antigen. Images were taken at each step
and the bead fluorescence intensity was measured. FIG. 87 shows an
example of binding curves from 2 single cells (labeled Mm20 and
Mm25) secreting antibodies with different affinities. These cells
were recovered as follows.
[0547] 117 chambers containing a total of 882 cells were identified
as containing at least one antibody-secreting cell. The contents of
all 117 chambers were recovered with a microcapillary, pooled and
immediately re-injected into the remaining 2,048 empty chambers of
the original device using the recovery robot shown in FIG. 58. FIG.
98 shows a picture of the microcapillary in proximity of the
injection port immediately before reinjecting the cells. The
recovery process took a total of 1 hour and 35 minutes, or 49
seconds per chamber. After re-injection, a total of 682 cells were
present in the analysis chambers, which represented 77% of the
initial population recovered (882 cells).
[0548] The re-injected cells were immediately assayed again for the
presence of one or more antibody secreting cells. 38 chambers were
identified as containing at least one antibody-secreting cell
(38/117=32%). Of these, 38 chambers, 19 contained single cells (16%
of 117). The contents of all 38 chambers, along with 10 control
chambers (5 no-cell and 5 non-secreting controls) were recovered
for RT-PCR. The recovery process took a total of 2 hours and 15
minutes, or 170 seconds per chamber. In 43 of 48 samples (90%), all
cells in the chambers were visually verified to have been recovered
by the capillary. In 5 of 48 samples, at least one cell was seen to
stick to the chamber bottom and was not recovered.
[0549] The following sequences were retrieved.
TABLE-US-00008 Mm20 (IGHV1-9*01) IGHD2-4*01, IGHD2-4*01, IGHD2-9*02
IGHJ2*01 heavy chain nucleic acid sequence (SEQ ID NO: 1):
ATGGAATGGACCTGGGTCTTTCTCTTCCTCCTGTCAGTAACTGCAGGTGT
CCACTCCCAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGATGAAGCCTG
GGGCCTCAGTGAAGATATCCTGCAAGGCAACTGGCTACACATTCAGAAAC
TACTGGATAGAGTGGATAAAGCAGAGGCCTGGACATGGCCTTGAGTGGAT
TGGAGAGATTTTACCTGAAAGTGGTAGTATTAATTACAATGAGAAATTCA
AGGGCAAGGCCACATTCACTGCAGATACATCCTCCAACACAGCCTACTTG
CAACTCCGCAGCCTGACATCTGAGGACTCTGCCGTCTATTATTGTTTTTA
TGATAATTACGTTTTTGACTACTGGGGCCAaggcacCACTctcAC Mm20 light chain
amino acid sequence (SEQ ID NO: 2): M E W T W V F L F L L S V T A G
V H S Q V Q L Q Q S G P E L M K P G A S V K I S C K A T G Y T F R N
Y W I E W I K Q R P G H G L E W I G E I L P E S G S I N Y N E K F K
G K A T F T A D T S S N T A Y L Q L R S L T S E D S A V Y Y C F Y D
N Y V F D Y W G Q G T T L Mm20 (IGKV4-59*01) IGKJ5*01 light chain
nucleic acid sequence (SEQ ID NO: 3):
ATGGATTCTCAAGTGCAGATTTTCAGCTTCCTGCTAATCAGTGCCTCGGT
CATACTATCCAGTGGACAAATTGTTCTCATCCAGTCTCCAACAATCATGT
CTGCATCTCCAGGGGAGAAGGTCACCATGACCTGCAGTGCCAACTCAAGT
TTCAGTTACATGCACTGGTACCAGCAGAAGTCAGGCACCTCCCCCAAAAG
ATGGATTTATGACACATCCAAACTGGCTTCTGGAGTCCCTGCTCGCTTCA
GTGGCAGTGGGTCTGGGACCTCTTACTCTCTCACAATTAGCAGCATGGAG
GCTGAAGATGCTGCCACTTATTACTGTCAGCAGTGGAGTAGAAACCCCAC
GTTCGGTGCtggacCaAGCtGa Mm20 light chain amino acid sequence (SEQ ID
NO: 4): M D S Q V Q I F S F L L I S A S V I L S S G Q I V L I Q S P
T I M S A S P G E K V T M T C S A N S S F S Y M H W Y Q Q K S G T S
P K R W I Y D T S K L A S G V P A R F S G S G S G T S Y S L T I S S
M E A E D A A T Y Y C Q Q W S R N P T F G A G T K L >Mm25
(IGHV2-9-1*01) IGHD2-3*01 IGHJ3*01 heavy chain nucleic acid
sequence (SEQ ID NO: 5):
ATGCAAGCAGTGGTATCAACGCAGAGTACGGGGAAGGAGTCAGGACCTGG
CTTGGTGGCGCCCTCACAGAGCATGTCCATCATGTGCACTGTCTCTGGGT
TTTCATTAAGCAACTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAG
GGTCTGGAGTGGCTGGGAGTAATTTGGGCTGGTGGAAACACAAATTATAA
TTCGGCTCTCATGTCCAGACTGAGCATCAGCAAAGACAAGTCCAAGAGTC
AAGTTTTCTTAAAAATGAACCGTCTGGAAACTGATGACACAGCCATGTAC
TATCTGTGCCAGTGTAGGATGGTTACCCCTTGCTTACTGGGCCAAGG Mm25 heavy chain
amino acid sequence (SEQ ID NO: 6): M Q A V V S T Q S T G K E S G P
G L V A P S Q S M S I M C T V S G F S L S N Y G V H W V R Q P P G K
G L E W L G V I W A G G N T N Y N S A L M S R L S I S K D K S K S Q
V F L K M N R L E T D D T A M Y Y L C Q C R M V T P C L L G Q
>Mm25 (IGKV6-17*01) IGKJ4*01 light chain nucleic acid sequence
(SEQ ID NO: 7): ATGGAGTCACAGATTCAGGTCTTTGTATTCGTGTTTCTCTGGTTGTCTGG
TGTTGACGGAGACATTGTGATGACCCAGTCTCACAAATTCATGTCCACAT
CAGTAGGAGACAGGGTCAGCATCACCTGCAAGGCCAGTCAGGATGTGAGT
ATTTCTGTAGCCTGGTATCAACAGAAACCAGGACAATCTCCTAAACTACT
GATTTACTCGGCATCCTACCGGTACACTGGAGTCCCTGATCGCTTCACTG
GCAGTGGATCTGGGACGGATTTCACTTTCACCATCCGCAGTGTGCAGGCT
GAAGACCTGGCAGTTTATTACTGTCAGCAACATTATAGTACTCCIITCAC
GTCGGCTcggGaCAAagTG Mm25 light chain amino acid sequence (SEQ ID
NO: 8): M E S Q I Q V F V F V F L W L S G V D G D I V M T Q S H K F
M S T S V G D R V S I T C K A S Q D V S I S V A W Y Q Q K P G Q S P
K L L I Y S A S Y R Y T G V P D R F T G S G S G T D F T F T I R S V
Q A E D L A V Y Y C Q Q H Y S T P F T S A R D K V
Example 16--K.sub.off Values for HyHEL5 Hybridoma Cells
[0550] A mixture of HyHEL5 hybridoma (low K.sub.off) and a
background of D1.3 hybridoma (high K.sub.off) cells were screened
in a microfluidic device according to an embodiment of the
invention. Chambers in which HyHEL5 hybridoma were present were
detected by fluorescence intensity associated with Ab secretion
(i.e., fluorescence accumulation on beads) before and antigen
release (for K.sub.off measurements) following a wash step for each
chamber. FIG. 88 shows a bar graph of the remaining fluorescence
level of beads in HyHEL5-positive wells is higher than in the rest
of the wells at the end of the wash.
Example 17--Detection of Rare Circulating Antibody-Secreting Cells
in Humans Against Specific Antigens
[0551] In one embodiment, the invention is used to screen for
extremely rare cells, for instance antigen-specific plasma B cells
that occur at basal level, i.e., without recent immunization or
infection with the antigen. FIG. 89A shows a population of
heterogeneous cells containing enriched B cells and erythrocytes
from a healthy patient. The population contained at least one
antibody secreting cell as measured by whole IgG staining on
readout bead particles (FIGS. 89B and 89C). In addition, this
population contained at least one effector cell secreting
antibodies specific to H1N1 as measured by the binding of a labeled
H1N1 antigen to the readout beads that had captured the antibody
(FIGS. 89D and 89E). The entire screen was performed using
.about.30 cells per chamber in an array of 1,600 chambers for a
total population of 48,000 cells. This allowed the detection of one
effector cell present at a frequency of 0.000625%. The cells of the
chamber were recovered (FIG. 89F) and the heavy and light chains
from that effector cell were amplified.
[0552] This assay can also be performed to find more abundant
cells, for instance after a natural infection or about one week
post-immunization with an antigen.
Example 18--Simultaneous Analysis of Extracellular and
Intracellular Biomolecules
[0553] The analysis of extracellular and intracellular components
was assessed in the context of a cell signaling readout assay. CHO
cells engineered to overexpress the GPCR CXCR4 with
beta-galactosidase fragment complementation (DiscoverX) were used
to quantify the binding of the ligand CCL22 to the receptor.
Activation of the receptor by the ligand caused intracellular
beta-galactosidate complementation, which was then measured by
lysing the cells in the presence of a beta-galactosidate substrate
that yields a chemiluminescent signal. An example of this assay
performed in multiwell plate is shown in FIG. 90. The assay was
performed following the protocol provided by the manufacturer
(DiscoverX). Three different concentrations for the agonist/ligand
CCL22 (100 nM, 1 nM, 0.01 nM) were incubated with the cells before
adding the lysis/chemilumiscent reagents. Light intensity
chemiluminescent signal was acquired using a Tecan M200 plate
reader from each well corresponding to a particular condition.
[0554] This assay can be used in conjunction with a cell binding
assay (e.g., the experiment shown at FIG. 77) to find antagonist
antibodies specific for a cell surface receptor. Implementation of
this lysis assay in the microfluidic chamber requires segregation
of the effector cell from the readout cell(s) if it is desired to
recover a live, viable effector cell. Such an assay could be
implemented in a device such as the one presented in Examples 1 and
2.
Example 19--Antibody Screening and Sequence Recovery from Human
Cells
[0555] Blood was collected 7 days after immunization from patients
that had received the seasonal flu vaccine (FIG. 91). PBMCs were
isolated using a commercially available kit (SepMate, StemCell
Technologies) and plasma cells were enriched using FACS based on
the markers described in Wrammert et al. (2008), Nature Letters,
453:667-671, incorporated by reference herein in its entirety.
Cells were then loaded in microfluidic devices at limiting dilution
and incubated for 2 hours with Protein A microspheres (4.9 .mu.m in
diameter, Bang Laboratories). H1N1 and H3N2 labeled antigens (two
different colors: 488 nm and 594 nm emission, respectively) were
introduced in the array, incubated for 15 minutes with the plasma
cells, and the contents of microfluidic chambers were washed with
media before imaging. After detection of chambers containing
antigen-specific antibodies, labeled anti-human antibody (Dylight
594) was introduced in the device, incubated for 15 minutes, and
then washed to determine the overall frequency of IgG secreting
cells. An example of a single plasma cell cross-reactive for both
H1N1 and H3N2 is shown in FIG. 92. Antigen-specific cells were
either recovered immediately or cultured overnight in the
microfluidic devices for next-day recovery. Cells remained viable
and in some cases underwent division (e.g., FIG. 93).
[0556] Referring to FIG. 94, cells from eight chambers positive for
H1N1 and/or H3N2 (flu specific), and IgG (i.e., not
antigen-specific) were recovered and lysed. The RNA from the lysed
cells was subjected to reverse transcription followed by antibody
heavy and light chain (Kappa/lambda) specific PCR. Four samples out
of eight provided a positive PCR amplification for both heavy and
light chains (50% efficiency with 100% pairing), with an expected
product size of .about.400 bp, namely samples 3 (H1N1 positive), 4
(H1N1/H3N2 positive), 5 (H1N1/H3N2 positive), and 6 (IgG positive,
but not antigen specific). The nucleic acid ladder shows 100 base
pair increments. Sanger sequencing from these purified PCR products
confirmed that the sequences were specific for heavy, kappa and
lambda human immunoglobulin.
[0557] Referring to FIG. 95, sequences of two human mAbs (Hs-7 and
Hs-15) that were amplified from single cells obtained from patients
immunized with seasonal flu vaccine. Cells were selected in a
microfluidic assay based on their ability to secrete mAbs having a
cross-reactivity to hemagglutinin subtypes H1N1 and H3N2.
Antibodies sequences were retrieved by RT-PCR and sequencing as
described herein (FIG. 95A). Both mAbs belong to the same clonotype
as apparent by shared gene usage, CDR length and junctional
sequences. Mutations are shown in lighter grey (FIG. 95B). Antibody
sequences were cloned and expressed in HEK293 cells to validate
their binding properties. Protein A beads were incubated with the
cell supernatant for 3 hours, washed, incubated with either
labelled H1N1 or H3N2 at different concentrations and then imaged
to measure the bead fluorescent intensity. Both mAbs cross-reacted
as expected but, consistent with single cell measurements, had
different affinities for H1N1 and H3N2 (FIG. 95C).
TABLE-US-00009 Hs7 (IGHV4-39*01) IGHD3-3*02 IGHJ3*02 Heavy chain
nucleic acid sequence (SEQ ID NO: 9):
ATGAAGCACCTGTGGTTCTTCCTCCTGCTGGTGGCGGCTCCCAGATGGGT
CCTGTCTCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGTCTT
CGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGACTCCATCACCAGC
AGTACTTACGACTGGGGCTGGATCCGTCAGCCCCCCGGGAAGGGCCTGGA
GTGGATTGGCAATGTCTATTATAGAGGGAGCACCTACTACAACCCGTCCC
TCAAGAGTCGAGTCACCATATCCGTAGACAGGTCCAGGACCCAGATCTCC
CTGAGGCTGAGCTCTGTGACCGCCGCTGACACGGCTCTGTATTTCTGTGC
GAGACACCCGAAACGTCTAACGGTTTTTGAAGTGGTCAACGCTTTTGATA
TCTGGGGCCAAGGGACAATGGTCACCGTCTTTTCAGCCTCCACCAAGGGC
CCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCAC
AGCGGCCCTGGGCTGCCTGGTCTGCTGACGAGGCACTGAGGACTG Hs7 Heavy chain amino
acid sequence (SEQ ID NO: 10): M K H L W F F L L L V A A P R W V L
S Q V Q L Q E S G P G L V K S S E T L S L T C T V S G D S I T S S T
Y D W G W I R Q P P G K G L E W I G N V Y Y R G S T Y Y N P S L K S
R V T I S V D R S R T Q I S L R L S S V T A A D T A L Y F C A R H P
K R L T V F E V V N A F D I W G Q G Q T M V T V F S A S T K G P S V
F P L A P S S K S T S G G T A Hs7 (IGLV2-14*01) IGLJ3*02 Light
chain nucleic acid sequence (SEQ ID NO: 11):
ATGGCCTGGGCTCTGCTACTCCTCACCCTCCTCACTCAGGGCACAGGGTC
CTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGCATCTCCTG
GACAGTCGATCACCATCTCCTGCACTGGAATCAGCAGTGACATTGGTGGT
TATAGCTCTGTCTCCTGGTACCAAGCGCACCCAGGCAAAGCCCCCAAACT
CATGATCTATGATGTCAATAATCGGCCCTCAGGCATTTCTAATCGCTTCT
CTGGTTCCAAGTCTGGCAACACGGCCTCCCTGGCCATCTCTGGGCTCCAG
gctgaGGACGAGGCAGATTATTACTGCAGCTTATATACAAGTATCAACGC
TTCCATAGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCA
AGGCTGCCCCCTCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAGCTTCAA GCCAACAAGGCCACA
Hs7 Light chain amino acid sequence (SEQ ID NO: 12): M A W A L L L
L T L L T Q G T G S W A Q S A L T Q P A S V S A S P G Q S I T I S C
T G I S S D I G G Y S S V S W Y Q A H P G K A P K L M I Y D V N N R
P S G I S N R F S G S K S G N T A S L A I S G L Q A E D E A D Y Y C
S L Y T S I N A S I V F G G G T K L T V L G Q P K A A P S V T L F P
P S S Hs15 (IGHV4-39*01) IGHD3-3*01 IGHJ3*02 Heavy chain nucleic
acid sequence (SEQ ID NO: 13):
ATGAAGCACCTGTGGTTCTTCCTTCTGCTGGTGGCGGCTCCCAGATGGGT
CCTGTCCCAGCTGCAACTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTT
CGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGACTCCATCAGCAGT
AGTACTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGAAAGGGGCTGGA
GTGGATTGCCTTTATCTTTTATAGCGGGAGCACCTTCTACAACCCGTCCC
TCAAGAGTCGAGTCACCGTCTCCGTAGACAGGTCCACGAACCAGTTCTCC
CTGAGGCTGAAGTCTGTGACCGCCGCAGACACGTCCAGATATTACTGTGC
GAGACACCCAAAACGTATCTCGATTTTTGAAGTGGTCAACGCTTTTGATA
TCtGGGGCCAGGGGACAATGGTCACCGTCTCTTCAGCCTCCACCAAGGGC
CCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCAC
AGCGGCCCTGGGCTGCCTGGTCTGCTGACGAGGCACTGAGGACTG Hs15 Heavy chain
amino acid sequence (SEQ ID NO: 14): M K H L W F F L L L V A A P R
W V L S Q L Q L Q E S G P G L V K P S E T L S L T C T V S G D S I S
S S T Y Y W G W I R Q P P G K G L E W I A F I F Y S G S T F Y N P S
L K S R V T V S V D R S T N Q F S L R L K S V T A A D T S R Y Y C A
R H P K R I S I F E V V N A F D I W G Q G T M V T V S S A S T K G P
S V F P L A P S S K S T S G G T A >Hs15 (IGLV2-14*01) IGLJ2*01
IGLJ3*01 Light chain nucleic acid sequence (SEQ ID NO: 15):
ATGGCCTGGACTCTGCTATTCCTCACCCTCCTCACTCAGGGCACAGGGTC
CTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTG
GACAGTCGATCACCATCACCTGCACTGGAATCAGCAGTGACGTTGGTGCT
TATAATTCTGTCTCCTGGTACCAGCAGTACCCAGGCAAATCCCCCAAGCT
CATGATTTATGATGTCAGTAATCGGTCCTCAGGGGTTTCTAATCGCTTCT
CTGGCTCCAAGTCTGACAACACGGCCTCCCTGACCATCTCTGGGCTCCAG
GCTGAGGACGAGGCTTCTTATTTCTGCAGCTTATATAGAAGCAGCACCAC
TTCCGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTACGTCAGCCCA
AGGCTGCCCCCTCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAGCTTCAA GCCAACAAGGCCACA
Hs15 Light chain nucleic acid sequence (SEQ ID NO: 16): M A W T L L
F L T L L T Q G T G S W A Q S A L T Q P A S V S G S P G Q S I T I T
C T G I S S D V G A Y N S V S W Y Q Q Y P G K S P K L M I Y D V S N
R S S G V S N R F S G S K S D N T A S L T I S G L Q A E D E A S Y F
C S L Y R S S T T S V V F G G G T K L T V L R Q P K A A P S V T L F
P P S S
Example 20--Antibody Screening and Sequence Recovery from a
Heterogeneous Population of Rabbit Cells
[0558] Rabbits were immunized with the seasonal flu vaccine.
Peripheral blood mononuclear cells (PBMCs) were recovered and
either screened directly or sorted with flow cytometry to enrich
for plasma cells. The cells were injected in the microfluidic
device and assayed for H1N1 and H3N2 specificity. Protein A-coated
beads used for fluorescence-based detection were also visible.
Cells were incubated with beads for 2 hours, then fluorescently
labeled antigen was introduced for 15 minutes and unbound antigen
was washed away with media. FIGS. 96A and 96B show examples of
H1N1- and H3N2-positive chambers, respectively.
[0559] FIG. 97A shows bright field images of several rabbit cells
in four microfluidic chambers that have been screened for
antigen-specific signal. FIG. 97B shows H1N1 antigen specific
antibody screening from rabbit antibody producing cells. The signal
was very low and therefore no cell seemed to express H1N1 specific
antibodies. FIG. 97C shows H3N2 antigen specific antibody binding
from rabbit antibody producing cells. Signal was variable from one
chamber to another, however all chambers are positive for H3N2
binding. After cell recovery from the microfluidic chambers using
an automated robot and microcapillary, heavy and light chain
antibody specific polymerase chain reaction (PCR) products were ran
on a 2% Egel (Invitrogen). Bands (.about.400/500 bp) were visible
for 3 out of 4 heavy chains and 4 out of 4 light chains for the 4
samples tested (FIG. 97D). Sanger sequencing revealed that two
heavy chain sequences were rabbit heavy chains (world-wide-website:
imgt.org) whereas one contains multiple peaks suggesting that more
than one cell in this chamber might have been an antibody-secreting
cell. Two light chains out of four were determined to be rabbit
light chains while the two others contained multiple peaks. Paired
heavy and light chains from chambers 1 and 3 showed that it is
possible to determine the sequence of a single effector cell from a
heterogeneous cell population. The sequences recovered for the
variable regions having single peaks were as follows:
TABLE-US-00010 Heavy 1 (SEQ ID NO: 17):
GCTAGCCACCATGGAGACTGGGCTGCGCTGGCTTCTCCTGGTCGCTGTGC
TCAAAGGTGTCCAGTGTCAGTCGGTGGAGGAGTCCGGGGGTCGCCTGGTC
ACGCCTGGGACACCCCTGACACTCACCTGCATAGTCTCTGGAATCGACCT
CAGTAGCTATGCAATGGGCTGGGTCCGCCAGGCTCCAGGAAAGGGGCTGG
AATACATCGGAATCATTAGTAGCAGTGGTATCACATACTACGCGAGCTGG
GCGAAAGGCCGATTCACCATCTCCAAAACCTCGTCGACCACGGTGACTCT
GACAATCACCGATCTGCAACCTTCAGACACGGGCACCTATTTCTGTGCCA
GAGGGTCTCGTTATAGTGCTTTTGGTGCTTTTGATACCTGGGGCCCAGGC
ACCCTGGTCACCGTCTCCTCAGCAAGCTTNAN Heavy 3 (SEQ ID NO: 18):
TTTGGCTAGCCACCATGGAGACTGGGCTGCGCTGGCTTCTCCTGGTCGCT
GTGCTCAAAGGTGTCCAGTGTCAGTCGGTGGAGGAGTCCGGGGGTCGCCT
GGTCACGCCTGGGACACCCCTGACACTCACCTGCACAGTCTCTGGATTCT
CCCTCAGTAGCTATGCAATGGGCTGGGTCCGCCAGGCTCCAGGGAAGGGG
CTGGAATGGATCGGAGTCATTAATAATAATGGTGACACATACTACGCGAG
CTGGCCGAAAGGCCGATTCACCATCTCCAAAACCTCGACCACGGTGGATC
TGAAAATCACCAGTCCGACAACCGAGGACACGGCCACCTATTTCTGTGCC
AGAGATCGTGGTAATAGTTATTACTTTGGATTGGACTACTTTAACTTGTG
GGGCCCAGGCACCCTGGTCACCGTCTCCTCAGCAAGCTTTATAN Light 1 (SEQ ID NO:
19): CTCTGCTGCTCTGGCTCCCAGGTGCCAGATGTGCCTTCGAATTGACCCAG
ACTCCATCCTCCGTGGAGGCAGCTGTGGGAGGCACAGTCACCATCAAGTG
CCAGGCCAGTCAGAGTATTAATAGTTGGTTATCCTGGTATCAGCAGAAAC
CAGGGCAGCCTCCCAAGCTCCTGATCTACAAGGCATCCAATCTGGCATCT
GGGGTCCCATCGCGGTTCAGAGGCAGTGGATCTGGGACAGAGTTCACTCT
CACCATCAGCGACCTGGAGTGTGNCGATGCTGCCACTTACTACTGTCAAA
GCNATTATGCTACTAGTAGTGTTGATTATNATGCTTTCGGCGGAAGGACC
GAGGTGGTGGTCAANACTGCGGCNGTANTANTNNN Light 3 (SEQ ID NO: 20):
TGCAGCTAGCCACCATGGACACGAGGGCCCCCATCAGCTGCTGGGGCTCC
TGCTGCTCTGGCTCCCAGGTGCCAGGTGTGCCCTTGTGATGACCCAGACT
CCAGCCTCTGTGGAGGTAGCTGTGGGAGGCACAGTCACCATCAAGTGCCA
GGCCAGTCAGAGCATTGATAGTTGGTTATCCTGGTATCAGCAGAAACCAG
GGCAGCGTCCCAGGCTCCTGATCTATTATGCATCCAATCTGGCATCTGGG
GTCTCATCGCGGTTCAAAGGCAGTGGATCTGGGACAGAATACACTCTCAC
CATCAGCGGCGTGGAGTGTGCCGATGCTGCCACTTACTACTGTCAAGAGG
GTTATAGTAGTGGTAATGTTGATAATGTTTTCGGCGGAGGGACCGAGGTG
GTGGTCAAAACTGCGNCCGCTATAN
Example 21--Expression and Validation of Antibodies from Human
Sequences
[0560] The expression of a human anti-MCP1 antibody was carried out
in HEK293 cells using liposome-based transfection. Expressed
antibody was precipitated from growth media on Protein A-coated
beads and tested with fluorescently labeled MCP-1 antigen. The
affinity of recombinant antibody was compared to the antibody of
the same amino-acid sequence produced by the commercially available
stable CHO cell line (ATCC.RTM. PTA-5308'.sup.M) (FIG. 99).
[0561] Clone Hu-11K2-3f2-H2. Heavy and light chain variable
sequences were synthesized and cloned into pFUSEss-CHIg-hG1 and
pFUSE2-CLIg-hk expression vectors respectively.
TABLE-US-00011 aMCP1-Heavy (SEQ ID NO: 21):
GAATTCCATGCAGGTGCAGCTGGTGCAGTCTGGCGCCGAAGTGAAGAAAC
CCGGCAGCAGCGTGAAGGTGTCCTGCAAGGCCAGCGGCCTGACCATCAGC
GACACCTACATGCACTGGGTGCGCCAGGCTCCAGGCCAGGGACTGGAATG
GATGGGCAGAATCGACCCCGCCAACGGCAACACCAAGTTCGACCCCAAGT
TCCAGGGCAGAGTGACCATCACCGCCGACACCAGCACCTCCACCGCCTAC
ATGGAACTGAGCAGCCTGCGGAGCGAGGACACCGCCGTGTACTATTGTGC
CAGAGGCGTGTTCGGCTTCTTCGACTACTGGGGCCAGGGCACCACCGTGA
CCGTGTCATCTGCTAGC aMCP1-Light (SEQ ID NO: 22):
ACCGGTGCCACCATGTACCGGATGCAGCTGCTGAGCTGTATCGCCCTGTC
TCTGGCCCTCGTGACGAATTCAGCCATGGACATCCAGATGACCCAGAGCC
CCAGCAGCCTGTCTGCCAGCGTGGGCGACAGAGTGACCATCACATGCAAG
GCCACCGAGGACATCTACAACCGGCTGGCCTGGTATCAGCAGAAGCCCGG
CAAGGCCCCCAAGCTGCTGATTAGCGGAGCCACCAGCCTGGAAACCGGCG
TGCCAAGCAGATTTTCCGGCAGCGGCTCCGGCAAGGACTACACCCTGACC
ATCAGCTCCCTGCAGCCCGAGGACTTCGCCACCTACTACTGCCAGCAGTT
TTGGAGCGCCCCCTACACCTTTGGCGGAGGCACCAAGGTGGAAATCAAGC GTACG
Example 22--Mouse Sequence Recovery from Single Cells Followed by
Cloning and Expression of Antibodies for Validation
[0562] D1.3 and HyHEL5 were loaded sequentially at limiting
dilution in a microfluidic device. A picture set was taken after
introducing each cell type in the device to record the position of
D1.3 and HyHEL5 cells. Cells were incubated with Protein-A beads
coated with rabbit anti-mouse capture antibodies and 10 nM of
labeled hen-egg lysozyme for 2 hours. Single antibody-secreting
cells were recovered with a microcapillary controlled by a robot,
transferred into a tube for RT-PCR, and then the antibody sequences
were recovered. Control chambers were recovered between each single
cell as negative control. FIG. 100 shows a gel heavy and light
chains from 2 single cells, with no signal in the controls.
Sequences of variable regions of heavy and light chains of HyHEL5
(high affinity) and D1.3 (low affinity) antibodies were synthesized
and cloned into pFUSEss-CHIg-mG1 and pFUSE2ss-CLIg-mk expression
vectors. Antibodies were produced in HEK293 cell line, captured on
Protein A-coated beads covered with Rabbit anti-mouse antibody. The
affinity was tested using increasing concentrations of
fluorescently labeled lysozyme (FIG. 101).
TABLE-US-00012 D1.3-Heavy (SEQ ID NO: 23):
ATGCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACA
GAGCCTGTCCATCACATGCACCGTCTCAGGGTTCTCATTAACCGGCTATG
GTGTAAACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGA
ATGATTTGGGGTGATGGAAACACAGACTATAATTCAGCTCTCAAATCCAG
ACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGA
ACAGTCTGCACACTGATGACACAGCCAGGTACTACTGTGCCAGAGAGAGA
GATTATAGGCTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTC AGCTAGC
D1.3-Light (SEQ ID NO: 24):
ATGGACATCCAGATGACTCAGTCTCCAGCCTCCCTTTCTGCGTCTGTGGG
AGAAACTGTCACCATCACATGTCGAGCAAGTGGGAATATTCACAATTATT
TAGCATGGTATCAGCAGAAACAGGGAAAATCTCCTCAGCTCCTGGTCTAT
TATACAACAACCTTAGCAGATGGTGTGCCATCAAGGTTCAGTGGCAGTGG
ATCAGGAACACAATATTCTCTCAAGATCAACAGCCTGCAGCCTGAAGATT
TTGGGAGTTATTACTGTCAACATTTTTGGAGTACTCCTCGGACGTTCGGT
GGAGGCACCAAGCTCGAG HyHEL5-Heavy (SEQ ID NO: 25):
ATGGAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGATGAAGCCAGGGGC
CTCAGTGAAGATATCCTGCAAAGCTTCTGGCTACACATTCAGTGACTACT
GGATAGAGTGGGTAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGA
GAGATTTTACCTGGAAGTGGTAGCACTAATTACCATGAGAGATTCAAGGG
CAAGGCCACATTCACTGCAGATACATCCTCCAGCACAGCCTACATGCAAC
TCAACAGCCTGACATCTGAAGACTCTGGCGTCTATTACTGCCTCCATGGT
AACTACGACTTTGACGGCTGGGGCCAAGGCACCACTCTCACAGTCTCCTC AGCTAGC
HyHEL5-Light (SEQ ID NO: 26):
ATGGATATCGTTCTCACACAGTCTCCAGCAATCATGTCTGCATCTCCAGG
GGAGAAGGTCACCATGACCTGCAGTGCCAGTTCAAGTGTAAATTACATGT
ACTGGTACCAGCAGAAGTCAGGCACTTCCCCCAAAAGATGGATTTATGAC
ACATCCAAACTGGCTTCTGGAGTCCCTGTTCGCTTCAGTGGCAGTGGGTC
TGGGACCTCTTACTCTCTCACAATCAGCAGCATGGAGACTGAAGATGCTG
CCACTTATTACTGCCAACAGTGGGGTCGTAACCCCACGTTCGGAGGGGGG ACCAAGCTCGAG
Example 23--Validation of Novel Mouse Antibody Sequences Obtained
from Microfluidic Screening
[0563] Splenocytes were isolated from a mouse immunized with
hen-egg lysozyme and screened for their antibody secretion in a
microfluidic device. The sequence from the antigen-specific cell
R05C14 was recovered, cloned and expressed in HEK293 cells. Antigen
binding was confirmed by capturing the antibody on Protein A beads
coated with rabbit anti-mouse antibody, incubating with 10 nM
labeled hen-egg lysozyme and measuring the fluorescence intensity
(FIG. 102).
TABLE-US-00013 R05C14-Heavy variable (SEQ ID NO: 27):
TGGAAGGTGGTGCACACTGCTGGACAGGGATCCAGAGTTCCAGGTCACTG
TCACTGGCTCAGGGAAATAGCCCTTGACCAGGCATCCCAGGGTCACCATG
GAGTTAGTTTGGGCAGCAGATCCAGGGGCCAGTGGATAGACAGATGGGGG
TGTCGTTTTGGCTGAGGAGACTGTGAGAGTGGTGCCTTGGCCCCAGCAGT
CCCCGTCCCAGTTTGCACAGTAATATGTGGCTGTGTCCTCAGGAGTCACA
GAAATCAACTGCAGGTAGCACTGGTTCTTGGATGTGTCTCGAGTGATAGA
GATTCGACCTTTGAGAGATGGATTGTAGTAAGTGCTACCACTGTAGCTTA
TGTACCCCATATACTCAAGTTTGTTCCCTGGGAATTTCCGGATCCAGCTC
CAGTAATCATTGGTGATGGAGTCGCCAGTGACAGAACAGGTGAGGGACAG
AGTCTGAGAAGGTTTCACGAGGCTAGGTCCAGACTCCTGCAGCTGCACCT CGAATTCCCA
R05C14-Light variable (SEQ ID NO: 28):
TTGGTCCCCCCTCCGAACGTGTACGGCCAGTTGTTACTCTGTTGACAGAA
ATACATTCCAAAATCTTCAGTCTCCACACTGATGATACTGAGAGTGAAAT
CCGTCCCTGATCCACTGCCACTGAACCTGGAGGGGATCCCAGAGATGGAC
TGGGAAGCATACTTGATGAGAAGCCTTGGAGACTCATGTGATTTTTGTTG
ATACCAGTGTAGGTTGTTGCTAATACTTTGGCTGGCCCTGCAGGAAAGAC
TGACGCTATCTCCTGGAGTCACAGACAGGGTGTCTGGAGACTGAGTTAGC
ACAATATCACCTCTGGAGGCTGAAATCCAGAAAAGCAAAAAA
Example 24--Sequence Recovery for Amplification of Effector Cell
Antibodies
[0564] The following protocol and primers was used to recover
antibody sequences from mouse, humans or rabbits.
[0565] Reagents for reverse transcription (RT) and polymerase chain
reaction (PCR) are provided in Table 7.
TABLE-US-00014 TABLE 7 Reverse transcription (RT) reaction PCR
reaction RNAseIn 2 U/.mu.L PCR buffer 1.times. RNAse inhibitor
Betaine 1M dNTPs 200 nM each First strand 1.times. MgCl.sub.2 1 mM
RT buffer DTT 2.5 mM Enzyme (KOD) 0.008 U/uL MgCl 2.9 mM Universal
600 nM TS primer RT enzyme 1 U/.mu.L Universal 500 nM (M-MLV) RT
primer Template 1.2 .mu.M Long gene- 100 nM Switching specific
primer primers RT primers 40 nM each
[0566] The following RT-PCR thermal cycling protocol was
followed:
[0567] RT: 3 min. at 72.degree. C., 90 min. at 42.degree. C., 10
min at 85.degree. C.
[0568] Hot start: 2 min. at 95.degree. C.; Denaturation: 15 sec. at
95.degree. C.; Elongation: 15 sec. at 72.degree. C.; Annealing: 15
sec. at the following temperatures: 72.degree. C. 3 cycles;
70.degree. C. 3 cycles; 68.degree. C. 3 cycles; 66.degree. C. 3
cycles; 64.degree. C. 3 cycles; 62.degree. C. 6 cycles; 60.degree.
C. 20-30 cycles.
[0569] The primers used in the RT-PCR experiments are provided in
Table 8, as follows:
TABLE-US-00015 TABLE 8 List of Primers Name Sequence SEQ ID NO:
Template switching primer GCAGTGGTATCAACGCAGAGTACG(r)G(r) SEQ ID
NO: 29 G(r) Universal primer TS GCAGTGGTATCAACGCAGAGTACG SEQ ID NO:
30 Universal primer RT AGACAGTCCTCAGTGCCTCGTCAGCAG SEQ ID NO: 31
Human RT primer HsRT-01 gtcctgaggactg SEQ ID NO: 32 Human RT primer
HsRT-02 tgctctgtgacac SEQ ID NO: 33 Human RT primer HsRT-03
ggtgtacaggtcc SEQ ID NO: 34 Human RT primer HsRT-04 cagagagcgtgag
SEQ ID NO: 35 Human RT primer HsRT-05 tcatgtagtagctgtc SEQ ID NO:
36 Human RT primer HsRT-06 ctcaggactgatgg SEQ ID NO: 37 Human RT
primer HsRT-07 gagtcctgagtactg SEQ ID NO: 38 Human RT primer
HsRT-08 gttgttgctttgtttg SEQ ID NO: 39 Human RT primer HsRT-09
ttgttgctctgtttg SEQ ID NO: 40 Long gene-specific primer
AGACAGTCCTCAGTGCCTCGTCAGCAGACCA SEQ ID NO: 41 HsN2U_01
GGCAGCCCAGGGC Long gene-specific primer
AGACAGTCCTCAGTGCCTCGTCAGCAGCAGT SEQ ID NO: 42 HsN2U_02
GTGGCCTTGTTGGCTTGAAGCTCC Long gene-specific primer
AGACAGTCCTCAGTGCCTCGTCAGCAGAGCA SEQ ID NO: 43 HsN2U_03
GGCACACAACAGAGGCAGTTCC Long gene-specific primer
AGACAGTCCTCAGTGCCTCGTCAGCAGGCCC SEQ ID NO: 44 HsN2U_04
AGAGTCACGGAGGTGGCATTG Long gene-specific primer
AGACAGTCCTCAGTGCCTCGTCAGCAGGCAT SEQ ID NO: 45 HsN2U_05
GCGACGACCACGTTCCCATCTTG Long gene-specific primer
AGACAGTCCTCAGTGCCTCGTCAGCAGGCAG SEQ ID NO: 46 HsN2U_06
CCAACGGCCACGCTG Long gene-specific primer
AGACAGTCCTCAGTGCCTCGTCAGCAGATGC SEQ ID NO: 47 HsN2U_07
CAGGACCACAGGGCTGTTATCCTTTG Long gene-specific primer
AGACAGTCCTCAGTGCCTCGTCAGCAGAGTG SEQ ID NO: 48 HsN2U_08
TGGCCTTGTTGGCTTGGAGCTC Long gene-specific primer
AGACAGTCCTCAGTGCCTCGTCAGCAGACCA SEQ ID NO: 49 HsN2U_09
CGTTCCCATCTGGCTGGGTG RT mouse primer MmRT_01 acagtcactgagct SEQ ID
NO: 50 RT mouse primer MmRT_02 ctttgacaaggcatc SEQ ID NO: 51 RT
mouse primer MmRT_03 ccacttgacattgatg SEQ ID NO: 52 RT mouse primer
MmRT_04 ctcttctccacagtg SEQ ID NO: 53 Long gene-specific mouse
AGACAGTCCTCAGTGCCTCGTCAGCagactg SEQ ID NO: 54 primer Mmn2_01
caggagagctgggaaggtgtg Long gene-specific mouse
AGACAGTCCTCAGTGCCTCGTCAGCaggaca SEQ ID NO: 55 primer Mmn2_02
gctgggaaggtgtgcacac Long gene-specific mouse
AGACAGTCCTCAGTGCCTCGTCAGCtcaaga SEQ ID NO: 56 primer Mmn2_03
agcacacgactgaggcacctcc Long gene-specific mouse
AGACAGTCCTCAGTGCCTCGTCAGCttgcct SEQ ID NO: 57 primer Mmn2_04
tccaggccactgtcacacc Long gene-specific mouse
AGACAGTCCTCAGTGCCTCGTCAGCatccag SEQ ID NO: 58 primer Mmn2_05
atgtgtcactgcagccagggac Long gene-specific mouse
AGACAGTCCTCAGTGCCTCGTCAGCAccttc SEQ ID NO: 59 primer Mmn2_06
cagtccactgtcaccacacctg RT rabbit primer OcRT_01 TGAAGCTCTGGAC SEQ
ID NO: 60 RT rabbit primer OcRT_02 CACACTCAGAGGG SEQ ID NO: 61 RT
rabbit primer OcRT_03 TTCCAGCTCACAC SEQ ID NO: 62 RT rabbit primer
OcRT_04 AGGAAGCTGCTG SEQ ID NO: 63 RT rabbit primer OcRT_05
ACACTGCTCAGC SEQ ID NO: 64 RT rabbit primer OcRT_06 TCACATTCAGAGGG
SEQ ID NO: 65 RT rabbit primer OcRT_07 GTCTTGTCCACTTTG SEQ ID NO:
66 RT rabbit primer OcRT_08 CTCTGTTGCTGTTG SEQ ID NO: 67 Long
rabbit gene-specific AGACAGTCCTCAGTGCCTCGTCAGgatcagg SEQ ID NO: 68
primer Oc-PCR-IgHA1A7-12 cagccgacgacc Long rabbit gene-specific
AGACAGTCCTCAGTGCCTCGTCAGgtgggaa SEQ ID NO: 69 primer Oc-PCR-IgKC1
gatgaggacagtaggtgc Long rabbit gene-specific
AGACAGTCCTCAGTGCCTCGTCAGagatggt SEQ ID NO: 70 primer
Oc-PCR-IgKC1KC2 gggaagaggaggacag Long rabbit gene-specific
AGACAGTCCTCAGTGCCTCGTCAGccttgtt SEQ ID NO: 71 primer
Oc-PCR-IgLC4L5L6 gtccttgagttcctcagagg Long rabbit gene-specific
AGACAGTCCTCAGTGCCTCGTCAGcggatca SEQ ID NO: 72 primer Oc-PCR-IgA2A6
ggcagccgatgac Long rabbit gene-specific
AGACAGTCCTCAGTGCCTCGTCAGcaggtca SEQ ID NO: 73 primer Oc-PCR-IgA4A5
gcgggaagatgatcg Long rabbit gene-specific
AGACAGTCCTCAGTGCCTCGTCAGcactgat SEQ ID NO: 74 primer
Oc-PCR-IgLC1C2C3 cagacacaccagggtgg Long rabbit gene-specific
AGACAGTCCTCAGTGCCTCGTCAGcaccgtg SEQ ID NO: 75 primer Oc-PCR-IgG
gagctgggtgtg Long rabbit gene-specific
AGACAGTCCTCAGTGCCTCGTCAGgatcagg SEQ ID NO: 76 primer Oc-PCR-IgA3A5
cagccggcgatc Long rabbit gene-specific
AGACAGTCCTCAGTGCCTCGTCAGggagacg SEQ ID NO: 77 primer Oc-PCR-IgM
agcgggtacagagttg Long rabbit gene-specific
AGACAGTCCTCAGTGCCTCGTCAGictgcag SEQ ID NO: 78 primer Oc-PCR-IgE
caggaggccaag
[0570] FIG. 103A shows a micrograph of PCR amplicons produced as
described above and testing a gradient of RT temperatures ranging
from 60.degree. C. to 40.degree. C. Template was 200 pg (.about.ten
cell equivalents) of RNA purified from hybridoma cells (D1.3). Far
right lane shows optimized condition using KOD polymerase. HV and
LV amplicons are expected within 450 to 550 bp where strong bands
are observed; this region also includes some non-specific products.
Referring to FIG. 103B, band from 400 to 600 bp was extracted and
Sanger sequenced using a primer that annealed to a constant region
on the heavy chain. The trace showed the junction made by MMLV
between template switching oligo and cDNA, joined by CCC that is
added by MMLV during cDNA synthesis. The sequence was aligned and
confirmed to match the variable region sequence of the heavy chain
of D1.3.
Example 25--NGS Sequencing of Single Cells Recovered from
Device
[0571] A different approach to retrieve antibody sequences combines
template-switching and next-generation sequencing. Referring to
FIG. 59, single cells are deposited into microfuge tubes and cDNA
is generated from multiplexed gene-specific primers targeting the
constant region of heavy and light chains. Template-switching
activity of MMLV enzyme is used to append the reverse complement of
a template-switching oligo onto the 3' end of the resulting cDNA.
Semi-nested PCR, using multiplexed primers that anneal to the
constant region of heavy and light chain and a universal primer
complementary to the copied template switching oligonucleotide, is
used to amplify cDNA and introduce indexing sequences that are
specific to each single cell amplicon. Amplicons are then pooled
and sequenced.
[0572] Another approach to recover sequences from heterogeneous
populations of cells couples microfluidic single cell antibody
analysis with Ig-Seq (FIG. 104A) Following immunization, ASCs are
collected from the animal; a fraction are analyzed on microfluidic
devices while the remaining are used for construction of a bulk
amplicon library for Ig-Seq. From the microfluidic device, a total
of 96 indexed single cell (SC) libraries and 96 indexed low
diversity (LD) libraries are pooled for sequencing on MiSeq.
Analysis of the bulk library is used to determine HV and LV
clonotypes present in the immune response, shown as clusters in
FIG. 104B. SC libraries provide paired chain HV and LV sequences of
mAbs from most abundant clonotypes that are confirmed to be antigen
specific. LD libraries provide additional identification of HV and
LV sequences that are antigen specific or that are not antigen
specific. LD libraries are also used to infer chain pairing by
analysis of co-occurrence of HV and LV sequences across LD
libraries, illustrated in FIG. 104C. Information on binding status
and chain pairing for specific sequences allows interpretation of
the bulk sample by assignment of binding status, represented as
stars (antigen-specific) and crosses (non-specific) in FIG. 104B,
and clonotype pairing.
Example 26--Multiplexed Bead Assay Using Optically Encoded
Beads
[0573] The multiplexed bead based assay in this example allows the
measurement of several different antigen specific antibodies in the
same chamber from antibody secreting cells. Fluorescence intensity
coded beads (e.g., Starfire Red.TM. dye beads, Bangs laboratories)
can be used to track different antigen specific antibodies by
labeling each subset of beads with a different antigen using a
traditional sulfo-NHS
(N-hydroxysulfosuccinimide)/1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide
hydrochloride (EDC) protein coupling strategy (Pierce). Starfire
Red.TM. (excitation from UV to red, emission max at 675 nm) and
antigen specific fluorescence signal can then be measured and
quantified.
[0574] Starfire Red.TM. dye beads (5.5 .mu.m diameter) containing 3
subsets of fluorescently coded beads were coated with different
2012-2013 seasonal flu specific antigens (FIG. 105A). Beads (from
the least intense to the most intense Starfire Red.TM. intensity
respectively) were coupled with H1N1 (A/California/7/2009 (H1N1)
pdm09-like strain), H3N2 (A/Victoria/361/2011 (H3N2)-like strain)
and B strain (B/Wisconsin/1/2010-like strain) antigens (Protein
Science Corp.).
[0575] Beads were mixed in a 1:1:1 ratio and were injected in a
microfluidic device (FIG. 105B). Starfire Red.TM. dye fluorescent
measurement reveals the positions of each particular subset of
beads and allows further subsequent tracking of antigen specific
antibody binding (FIG. 105C). Rabbit anti-H1N1 specific antibody
(Sino Biological) dissolved in media was then flown in the device
at a concentration of 400 pg/mL and incubated for 45 minutes.
Anti-rabbit IgG labeled with Dylight 488 (Jackson Immunoresearch)
was then sent in the device and fluorescent imaging was performed.
Positive signal is clearly visible on the H1N1 coated beads (least
bright Starfire Red.TM. beads represented by arrows) (FIG. 105D)
and no unspecific binding is detected on the beads labeled with
H3N2 and B strain specific antigens (FIG. 105E).
Example 27--Microfluidic Apoptosis Effector Assay
[0576] A functional extracellular effect assay was implemented to
find antibodies and effector cells that produce such antibodies,
that neutralize TNF-.alpha. or that block its receptor. To quantify
the effect of TNF-.alpha. on target L929 cells (readout cells), the
readout cells were stained with DiOC.sub.18 and incubated in the
presence of 1 .mu.g/mL of actinomycin-D and different
concentrations of TNF-.alpha. in multiwell plates. After 24 hours,
cells were counterstained with propidium iodide (PI) and cell
viability was measured by counting the fraction of PI-stained cells
from DiOC18-stained cells under a microscope. The dose response of
TNF-.alpha. on L929 cells is shown in FIG. 106A.
[0577] In a second experiment, L929 cells were stained with CFSE,
loaded in a microfluidic device and incubated in the presence of 10
.mu.g/mL of actinomycin-D and 10 ng/mL of TNF-.alpha. and tracked
by time-lapse imaging. Cells underwent rapid apoptosis, which was
confirmed by PI labeling at 24 hours (FIG. 106B).
Example 28--Microfluidic Cell Signaling Effector Assay
[0578] A TNF.alpha. functional assay based on nuclear or
cytoplasmic fluorescence localization was developed for the
function-based selection of antibodies against TNF.alpha.. The
readout cell line used was previously described in Tay et al.
(2010). Nature 466, pp. 267-71, incorporated by reference herein in
its entirety. Upon TNF.alpha.-induced activation, a
fluorescently-labeled NF-.kappa.B transcription factor subunit is
transported from the cytoplasm to the nucleus. FIG. 107A shows
time-lapse fluorescence images for the TNF.alpha. functional assay.
In the absence of TNF.alpha. ligand, fluorescence localization is
cytoplasmic (FIG. 107A, upper panels). Upon activation by
TNF.alpha. ligand (10 ng/mL), a change in fluorescence from
cytoplasmic to nuclear is observed (FIG. 107A, middle panels). In
the presence of cell supernatant containing an antibody that
neutralizes TNF.alpha. ligand in addition to TNF.alpha. ligand (10
ng/mL), the fluorescence localization remains cytoplasmic (FIG.
107A, lower panels), indicating that TNF.alpha. ligand has been
effectively neutralized by the antibody thus preventing NF.kappa.B
signaling. The fraction of activated cells for each condition is
shown in FIG. 107B.
Example 29--Microfluidic Proliferation and Autophagy Effector Cell
Assay
[0579] A human breast cancer cell line (SKBR3) overexpressing HER2
and engineered with an LC3-GFP autophagy reporter was loaded in a
microfluidic device and cultured for 3 days to determine the
feasibility of using this cell line as readout cells. (FIG. 108).
Individual SKBR3 cell populations were provided to individual
microfluidic chambers. Time-lapse imaging in bright field and
fluorescence showed an increase in the number of cells over time
(FIG. 108). The results indicated that the SKBR3 cells are suitable
to use as readout cells in extracellular effect assays that measure
an effector cell's ability/propensity to block the proliferation of
SKBR3 cells. Using the SKBR3cell line it is also possible to screen
for antibodies that modulate autophagy.
Example 30--Detection and Recovery of Antigen Specific T Cells
[0580] Referring to FIG. 109, peripheral blood mononuclear cells
(PBMCs) from a human patient were loaded in a microfluidic device
and stimulated with a pool of viral antigens derived from
Cytomegalovirus, Epstein-Barr Virus and Influenza Virus (CEF)
peptides at 10 .mu.g/mL overnight. FIG. 109A shows a bright field
image of a microfluidic chamber loaded with PBMCs and
interferon-.gamma. (IFN.gamma.) capture beads. Upon stimulation
with CEF peptides, IFN.gamma. secreted by activated
antigen-specific T cells was captured on functionalized beads
coated with anti-IFN.gamma. antibody and detected with a
fluorescently labeled secondary antibody. FIG. 109B is a
fluorescent image of the positive chamber from FIG. 109A containing
an activated antigen-specific T cell. Activated cells were expanded
with 100 U/mL of interleukin-2 (IL-2) for 5 days (FIG. 109C) and
were subsequently recovered. The frequency of CEF-specific T cells
in peripheral blood mononuclear cells from the same patient was
measured by ELISPOT and the microfluidic bead assay for comparison.
The sensitivity of the microfluidic assay allowed for the detection
of higher frequencies of antigen-specific T cells than ELISPOT
(FIG. 109D).
Example 31--BAF3 PDGFR.alpha. Assay for Signaling
[0581] A cell survival assay was generated for the function-based
selection of antibodies against PDGFR.alpha.. A BaF3 suspension
cell line, dependent on the cytokine IL-3 for survival and growth,
was electroporated with human PDGFR.alpha. driven by a CMV promoter
(Origene) and stably expressing clones were generated. The
PDGFR.alpha. overexpressed in Ba/F3 cells substitutes for the
requirement of IL-3 signaling; in the absence of IL-3 BaF3 cells
arrest and die, but in the presence of PDGF ligand PDGFR.alpha.
signaling rescues these cells, giving a cell survival and mitogenic
response that is easily detected by microscopy, including
proliferation, morphological changes, and increased
motility/chemotaxis. As a fluorescence readout, BaF3 cells were
also stably expressing histone 2B fused to a yellow fluorescent
protein (YFP) to label cell nuclei. FIG. 110 shows validation of
cell survival PDGFR.alpha. functional assay, showing a BaF3 clone
expressing PDGFR.alpha. and histone 2B-YFP in the presence of no
ligand or PDGF-AA 25 ng/mL for T=48 hours. In the absence of
ligand, BaF3 cells undergo apoptosis and loss of YFP fluorescence
(likely a result of protein degradation upon apoptosis) (FIG.
110A). In the presence of PDGF-AA ligand, cell survival and growth
are rescued as shown by YFP fluorescence readout (FIG. 110B).
[0582] To test whether antibody-secreting cells could be kept
viable for the length of such an assay, mouse splenocytes were
enriched for plasma cells and co-incubated with BaF3 cells
overexpressing PDFGR.alpha. in a microfluidic device. Bright field
and fluorescent images were taken at the beginning of the
experiment to distinguish the effector cell population from the
readout cell population (containing H2B-YFP). Cells were cultured
in the presence of IL-3 and tracked by time-lapse imaging for 48
hours, at which point anti-mouse antibody capture beads were
introduced in the device for a 2-hour incubation. Chambers
containing antibody-secreting cells were identified using a
Dylight-594 labeled antibody. FIG. 110C shows an example of a
microfluidic chamber containing 2 splenocytes (black arrows) and 2
readout cells (white arrows) at the beginning of the experiment.
Readout cells proliferated to 22 cells while the effector cell
population kept secreting antibodies after 48 hours of culture.
Example 32--GPCR Response to Ligand Using DiscoveRx Cells
[0583] In the PathHunter.RTM. .beta.-Arrestin system from DiscoveRx
(www.discoverx.com), a small peptide is fused to the intracellular
sequence of a GPCR target of interest, and a complementing peptide
fragment is fused to another intracellular protein
(.beta.-arrestin). After binding to its specific ligand, the GPCR
recruits 0-arrestin, forcing the complementation of the two
peptides to produce a functional .beta.-galactosidase enzyme. In
the conventional non-microfluidic assay, the enzyme activity, and
thus the amount of ligand bound to the GPCR, is detected with a
single addition of a reagent cocktail to lyse the cells and produce
a chemiluminescent before being analyzed using a traditional plate
reader.
[0584] This assay was modified to adapt it to the microfluidic
format described herein by using a fluorescent based substrate.
5-Dodecanoylaminofluorescein Galactopyranoside (C.sub.12FDG) is a
chemically modified and non-fluorescent .beta.-galactosidase
substrate that becomes fluorescent after enzyme cleavage. It also
includes a lipophilic tail that allows the substrate to diffuse
inside the cell membrane and also promotes the retention inside the
cells after cleavage.
[0585] The CCR4/CCL22 GPCR-agonist pair (PathHunter.RTM. eXpress
CCR4 CHO-K1 .beta.-Arrestin GPCR Assay) was used as an example to
adapt the assay with the C12FDG substrate. Cells were incubated
with various concentrations of substrate and ligand before being
imaged using fluorescence.
[0586] The adapted assay was first tested in multiwell plates.
Cells were incubated in media for 90 minutes with various
concentrations of C.sub.12FDG substrate. The substrate diffused in
the cells and remained non fluorescent until it was cleaved. Then,
the ligand/agonist CCL22 was added at different concentrations and
incubated for 60 minutes for the complementation to occur inside
the cells, leading to the formation of .beta.-galactosidase and
cleavage of the substrate, producing a fluorescent product inside
the cells. Fluorescence-based microscopy was then used to image
each well corresponding to a particular condition (FIG. 111).
[0587] Cells were then loaded in a microfluidic device and
incubated with 33 .mu.M C.sub.12FDG substrate in cell culture
media. The substrate and the cells were incubated for 90 minutes in
order to allow diffusion and accumulation of the non-fluorescent
substrate inside the cells. Cells were washed with media for 10
minutes at the end of the incubation. CCL22 agonist/ligand was then
loaded at 4 different concentrations in 4 different sub-arrays of
the device (sub-array 1: 0.01 nM, sub-array 2: 1 nM, sub-array 3:
100 nM, sub array 4: no agonist). Fluorescence-based microscopy was
then used to image each chamber corresponding to a particular
condition (FIG. 112A). Image analysis was performed for each
chamber and average intensity was measured in the chambers.
Background subtraction was performed and the results were plotted
in FIG. 112B.
[0588] All, documents, patents, patent applications, publications,
product descriptions, and protocols which are cited throughout this
application are incorporated herein by reference in their
entireties for all purposes.
[0589] The embodiments illustrated and discussed in this
specification are intended only to teach those skilled in the art
the best way known to the inventors to make and use the invention.
Modifications and variation of the above-described embodiments of
the invention are possible without departing from the invention, as
appreciated by those skilled in the art in light of the above
teachings. It is therefore understood that, within the scope of the
claims and their equivalents, the invention may be practiced
otherwise than as specifically described.
Sequence CWU 1
1
861395DNAMus sp. 1atggaatgga cctgggtctt tctcttcctc ctgtcagtaa
ctgcaggtgt ccactcccag 60gttcagctgc agcagtctgg acctgagctg atgaagcctg
gggcctcagt gaagatatcc 120tgcaaggcaa ctggctacac attcagaaac
tactggatag agtggataaa gcagaggcct 180ggacatggcc ttgagtggat
tggagagatt ttacctgaaa gtggtagtat taattacaat 240gagaaattca
agggcaaggc cacattcact gcagatacat cctccaacac agcctacttg
300caactccgca gcctgacatc tgaggactct gccgtctatt attgttttta
tgataattac 360gtttttgact actggggcca aggcaccact ctcac 3952131PRTMus
sp. 2Met Glu Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala
Gly1 5 10 15Val His Ser Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu
Met Lys 20 25 30Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Thr Gly
Tyr Thr Phe 35 40 45Arg Asn Tyr Trp Ile Glu Trp Ile Lys Gln Arg Pro
Gly His Gly Leu 50 55 60Glu Trp Ile Gly Glu Ile Leu Pro Glu Ser Gly
Ser Ile Asn Tyr Asn65 70 75 80Glu Lys Phe Lys Gly Lys Ala Thr Phe
Thr Ala Asp Thr Ser Ser Asn 85 90 95Thr Ala Tyr Leu Gln Leu Arg Ser
Leu Thr Ser Glu Asp Ser Ala Val 100 105 110Tyr Tyr Cys Phe Tyr Asp
Asn Tyr Val Phe Asp Tyr Trp Gly Gln Gly 115 120 125Thr Thr Leu
1303372DNAMus sp. 3atggattctc aagtgcagat tttcagcttc ctgctaatca
gtgcctcggt catactatcc 60agtggacaaa ttgttctcat ccagtctcca acaatcatgt
ctgcatctcc aggggagaag 120gtcaccatga cctgcagtgc caactcaagt
ttcagttaca tgcactggta ccagcagaag 180tcaggcacct cccccaaaag
atggatttat gacacatcca aactggcttc tggagtccct 240gctcgcttca
gtggcagtgg gtctgggacc tcttactctc tcacaattag cagcatggag
300gctgaagatg ctgccactta ttactgtcag cagtggagta gaaaccccac
gttcggtgct 360ggaccaagct ga 3724124PRTMus sp. 4Met Asp Ser Gln Val
Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser1 5 10 15Val Ile Leu Ser
Ser Gly Gln Ile Val Leu Ile Gln Ser Pro Thr Ile 20 25 30Met Ser Ala
Ser Pro Gly Glu Lys Val Thr Met Thr Cys Ser Ala Asn 35 40 45Ser Ser
Phe Ser Tyr Met His Trp Tyr Gln Gln Lys Ser Gly Thr Ser 50 55 60Pro
Lys Arg Trp Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Val Pro65 70 75
80Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile
85 90 95Ser Ser Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln
Trp 100 105 110Ser Arg Asn Pro Thr Phe Gly Ala Gly Thr Lys Leu 115
1205347DNAMus sp. 5atgcaagcag tggtatcaac gcagagtacg gggaaggagt
caggacctgg cttggtggcg 60ccctcacaga gcatgtccat catgtgcact gtctctgggt
tttcattaag caactatggt 120gtacactggg ttcgccagcc tccaggaaag
ggtctggagt ggctgggagt aatttgggct 180ggtggaaaca caaattataa
ttcggctctc atgtccagac tgagcatcag caaagacaag 240tccaagagtc
aagttttctt aaaaatgaac cgtctggaaa ctgatgacac agccatgtac
300tatctgtgcc agtgtaggat ggttacccct tgcttactgg gccaagg
3476115PRTMus sp. 6Met Gln Ala Val Val Ser Thr Gln Ser Thr Gly Lys
Glu Ser Gly Pro1 5 10 15Gly Leu Val Ala Pro Ser Gln Ser Met Ser Ile
Met Cys Thr Val Ser 20 25 30Gly Phe Ser Leu Ser Asn Tyr Gly Val His
Trp Val Arg Gln Pro Pro 35 40 45Gly Lys Gly Leu Glu Trp Leu Gly Val
Ile Trp Ala Gly Gly Asn Thr 50 55 60Asn Tyr Asn Ser Ala Leu Met Ser
Arg Leu Ser Ile Ser Lys Asp Lys65 70 75 80Ser Lys Ser Gln Val Phe
Leu Lys Met Asn Arg Leu Glu Thr Asp Asp 85 90 95Thr Ala Met Tyr Tyr
Leu Cys Gln Cys Arg Met Val Thr Pro Cys Leu 100 105 110Leu Gly Gln
1157369DNAMus sp. 7atggagtcac agattcaggt ctttgtattc gtgtttctct
ggttgtctgg tgttgacgga 60gacattgtga tgacccagtc tcacaaattc atgtccacat
cagtaggaga cagggtcagc 120atcacctgca aggccagtca ggatgtgagt
atttctgtag cctggtatca acagaaacca 180ggacaatctc ctaaactact
gatttactcg gcatcctacc ggtacactgg agtccctgat 240cgcttcactg
gcagtggatc tgggacggat ttcactttca ccatccgcag tgtgcaggct
300gaagacctgg cagtttatta ctgtcagcaa cattatagta ctcctttcac
gtcggctcgg 360gacaaagtg 3698123PRTMus sp. 8Met Glu Ser Gln Ile Gln
Val Phe Val Phe Val Phe Leu Trp Leu Ser1 5 10 15Gly Val Asp Gly Asp
Ile Val Met Thr Gln Ser His Lys Phe Met Ser 20 25 30Thr Ser Val Gly
Asp Arg Val Ser Ile Thr Cys Lys Ala Ser Gln Asp 35 40 45Val Ser Ile
Ser Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro 50 55 60Lys Leu
Leu Ile Tyr Ser Ala Ser Tyr Arg Tyr Thr Gly Val Pro Asp65 70 75
80Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Arg
85 90 95Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln His
Tyr 100 105 110Ser Thr Pro Phe Thr Ser Ala Arg Asp Lys Val 115
1209545DNAHomo sapiens 9atgaagcacc tgtggttctt cctcctgctg gtggcggctc
ccagatgggt cctgtctcag 60gtgcagctgc aggagtcggg cccaggactg gtgaagtctt
cggagaccct gtccctcacc 120tgcactgtct ctggtgactc catcaccagc
agtacttacg actggggctg gatccgtcag 180ccccccggga agggcctgga
gtggattggc aatgtctatt atagagggag cacctactac 240aacccgtccc
tcaagagtcg agtcaccata tccgtagaca ggtccaggac ccagatctcc
300ctgaggctga gctctgtgac cgccgctgac acggctctgt atttctgtgc
gagacacccg 360aaacgtctaa cggtttttga agtggtcaac gcttttgata
tctggggcca agggacaatg 420gtcaccgtct tttcagcctc caccaagggc
ccatcggtct tccccctggc accctcctcc 480aagagcacct ctgggggcac
agcggccctg ggctgcctgg tctgctgacg aggcactgag 540gactg
54510169PRTHomo sapiens 10Met Lys His Leu Trp Phe Phe Leu Leu Leu
Val Ala Ala Pro Arg Trp1 5 10 15Val Leu Ser Gln Val Gln Leu Gln Glu
Ser Gly Pro Gly Leu Val Lys 20 25 30Ser Ser Glu Thr Leu Ser Leu Thr
Cys Thr Val Ser Gly Asp Ser Ile 35 40 45Thr Ser Ser Thr Tyr Asp Trp
Gly Trp Ile Arg Gln Pro Pro Gly Lys 50 55 60Gly Leu Glu Trp Ile Gly
Asn Val Tyr Tyr Arg Gly Ser Thr Tyr Tyr65 70 75 80Asn Pro Ser Leu
Lys Ser Arg Val Thr Ile Ser Val Asp Arg Ser Arg 85 90 95Thr Gln Ile
Ser Leu Arg Leu Ser Ser Val Thr Ala Ala Asp Thr Ala 100 105 110Leu
Tyr Phe Cys Ala Arg His Pro Lys Arg Leu Thr Val Phe Glu Val 115 120
125Val Asn Ala Phe Asp Ile Trp Gly Gln Gly Gln Thr Met Val Thr Val
130 135 140Phe Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala
Pro Ser145 150 155 160Ser Lys Ser Thr Ser Gly Gly Thr Ala
16511465DNAHomo sapiens 11atggcctggg ctctgctact cctcaccctc
ctcactcagg gcacagggtc ctgggcccag 60tctgccctga ctcagcctgc ctccgtgtct
gcatctcctg gacagtcgat caccatctcc 120tgcactggaa tcagcagtga
cattggtggt tatagctctg tctcctggta ccaagcgcac 180ccaggcaaag
cccccaaact catgatctat gatgtcaata atcggccctc aggcatttct
240aatcgcttct ctggttccaa gtctggcaac acggcctccc tggccatctc
tgggctccag 300gctgaggacg aggcagatta ttactgcagc ttatatacaa
gtatcaacgc ttccatagtg 360ttcggcggag ggaccaagct gaccgtccta
ggtcagccca aggctgcccc ctcggtcact 420ctgttcccgc cctcctctga
ggagcttcaa gccaacaagg ccaca 46512146PRTHomo sapiens 12Met Ala Trp
Ala Leu Leu Leu Leu Thr Leu Leu Thr Gln Gly Thr Gly1 5 10 15Ser Trp
Ala Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Ala Ser 20 25 30Pro
Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly Ile Ser Ser Asp Ile 35 40
45Gly Gly Tyr Ser Ser Val Ser Trp Tyr Gln Ala His Pro Gly Lys Ala
50 55 60Pro Lys Leu Met Ile Tyr Asp Val Asn Asn Arg Pro Ser Gly Ile
Ser65 70 75 80Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser
Leu Ala Ile 85 90 95Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Tyr
Cys Ser Leu Tyr 100 105 110Thr Ser Ile Asn Ala Ser Ile Val Phe Gly
Gly Gly Thr Lys Leu Thr 115 120 125Val Leu Gly Gln Pro Lys Ala Ala
Pro Ser Val Thr Leu Phe Pro Pro 130 135 140Ser Ser14513545DNAHomo
sapiens 13atgaagcacc tgtggttctt ccttctgctg gtggcggctc ccagatgggt
cctgtcccag 60ctgcaactgc aggagtcggg cccaggactg gtgaagcctt cggagaccct
gtccctcacc 120tgcactgtct ctggtgactc catcagcagt agtacttact
actggggctg gatccgccag 180cccccaggaa aggggctgga gtggattgcc
tttatctttt atagcgggag caccttctac 240aacccgtccc tcaagagtcg
agtcaccgtc tccgtagaca ggtccacgaa ccagttctcc 300ctgaggctga
agtctgtgac cgccgcagac acgtccagat attactgtgc gagacaccca
360aaacgtatct cgatttttga agtggtcaac gcttttgata tctggggcca
ggggacaatg 420gtcaccgtct cttcagcctc caccaagggc ccatcggtct
tccccctggc accctcctcc 480aagagcacct ctgggggcac agcggccctg
ggctgcctgg tctgctgacg aggcactgag 540gactg 54514168PRTHomo sapiens
14Met Lys His Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp1
5 10 15Val Leu Ser Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val
Lys 20 25 30Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Asp
Ser Ile 35 40 45Ser Ser Ser Thr Tyr Tyr Trp Gly Trp Ile Arg Gln Pro
Pro Gly Lys 50 55 60Gly Leu Glu Trp Ile Ala Phe Ile Phe Tyr Ser Gly
Ser Thr Phe Tyr65 70 75 80Asn Pro Ser Leu Lys Ser Arg Val Thr Val
Ser Val Asp Arg Ser Thr 85 90 95Asn Gln Phe Ser Leu Arg Leu Lys Ser
Val Thr Ala Ala Asp Thr Ser 100 105 110Arg Tyr Tyr Cys Ala Arg His
Pro Lys Arg Ile Ser Ile Phe Glu Val 115 120 125Val Asn Ala Phe Asp
Ile Trp Gly Gln Gly Thr Met Val Thr Val Ser 130 135 140Ser Ala Ser
Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser145 150 155
160Lys Ser Thr Ser Gly Gly Thr Ala 16515465DNAHomo sapiens
15atggcctgga ctctgctatt cctcaccctc ctcactcagg gcacagggtc ctgggcccag
60tctgccctga ctcagcctgc ctccgtgtct gggtctcctg gacagtcgat caccatcacc
120tgcactggaa tcagcagtga cgttggtgct tataattctg tctcctggta
ccagcagtac 180ccaggcaaat cccccaagct catgatttat gatgtcagta
atcggtcctc aggggtttct 240aatcgcttct ctggctccaa gtctgacaac
acggcctccc tgaccatctc tgggctccag 300gctgaggacg aggcttctta
tttctgcagc ttatatagaa gcagcaccac ttccgtggta 360ttcggcggag
ggaccaagct gaccgtccta cgtcagccca aggctgcccc ctcggtcact
420ctgttcccgc cctcctctga ggagcttcaa gccaacaagg ccaca
46516146PRTHomo sapiens 16Met Ala Trp Thr Leu Leu Phe Leu Thr Leu
Leu Thr Gln Gly Thr Gly1 5 10 15Ser Trp Ala Gln Ser Ala Leu Thr Gln
Pro Ala Ser Val Ser Gly Ser 20 25 30Pro Gly Gln Ser Ile Thr Ile Thr
Cys Thr Gly Ile Ser Ser Asp Val 35 40 45Gly Ala Tyr Asn Ser Val Ser
Trp Tyr Gln Gln Tyr Pro Gly Lys Ser 50 55 60Pro Lys Leu Met Ile Tyr
Asp Val Ser Asn Arg Ser Ser Gly Val Ser65 70 75 80Asn Arg Phe Ser
Gly Ser Lys Ser Asp Asn Thr Ala Ser Leu Thr Ile 85 90 95Ser Gly Leu
Gln Ala Glu Asp Glu Ala Ser Tyr Phe Cys Ser Leu Tyr 100 105 110Arg
Ser Ser Thr Thr Ser Val Val Phe Gly Gly Gly Thr Lys Leu Thr 115 120
125Val Leu Arg Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro
130 135 140Ser Ser14517432DNAOryctolagus
sp.misc_feature(430)..(430)n is a, c, g, or
tmisc_feature(432)..(432)n is a, c, g, or t 17gctagccacc atggagactg
ggctgcgctg gcttctcctg gtcgctgtgc tcaaaggtgt 60ccagtgtcag tcggtggagg
agtccggggg tcgcctggtc acgcctggga cacccctgac 120actcacctgc
atagtctctg gaatcgacct cagtagctat gcaatgggct gggtccgcca
180ggctccagga aaggggctgg aatacatcgg aatcattagt agcagtggta
tcacatacta 240cgcgagctgg gcgaaaggcc gattcaccat ctccaaaacc
tcgtcgacca cggtgactct 300gacaatcacc gatctgcaac cttcagacac
gggcacctat ttctgtgcca gagggtctcg 360ttatagtgct tttggtgctt
ttgatacctg gggcccaggc accctggtca ccgtctcctc 420agcaagcttn an
43218444DNAOryctolagus sp.misc_feature(444)..(444)n is a, c, g, or
t 18tttggctagc caccatggag actgggctgc gctggcttct cctggtcgct
gtgctcaaag 60gtgtccagtg tcagtcggtg gaggagtccg ggggtcgcct ggtcacgcct
gggacacccc 120tgacactcac ctgcacagtc tctggattct ccctcagtag
ctatgcaatg ggctgggtcc 180gccaggctcc agggaagggg ctggaatgga
tcggagtcat taataataat ggtgacacat 240actacgcgag ctggccgaaa
ggccgattca ccatctccaa aacctcgacc acggtggatc 300tgaaaatcac
cagtccgaca accgaggaca cggccaccta tttctgtgcc agagatcgtg
360gtaatagtta ttactttgga ttggactact ttaacttgtg gggcccaggc
accctggtca 420ccgtctcctc agcaagcttt atan 44419385DNAOryctolagus
sp.misc_feature(274)..(274)n is a, c, g, or
tmisc_feature(303)..(303)n is a, c, g, or
tmisc_feature(330)..(330)n is a, c, g, or
tmisc_feature(365)..(365)n is a, c, g, or
tmisc_feature(374)..(374)n is a, c, g, or
tmisc_feature(378)..(378)n is a, c, g, or
tmisc_feature(381)..(381)n is a, c, g, or
tmisc_feature(383)..(385)n is a, c, g, or t 19ctctgctgct ctggctccca
ggtgccagat gtgccttcga attgacccag actccatcct 60ccgtggaggc agctgtggga
ggcacagtca ccatcaagtg ccaggccagt cagagtatta 120atagttggtt
atcctggtat cagcagaaac cagggcagcc tcccaagctc ctgatctaca
180aggcatccaa tctggcatct ggggtcccat cgcggttcag aggcagtgga
tctgggacag 240agttcactct caccatcagc gacctggagt gtgncgatgc
tgccacttac tactgtcaaa 300gcnattatgc tactagtagt gttgattatn
atgctttcgg cggaaggacc gaggtggtgg 360tcaanactgc ggcngtanta ntnnn
38520425DNAOryctolagus sp.misc_feature(416)..(416)n is a, c, g, or
tmisc_feature(425)..(425)n is a, c, g, or t 20tgcagctagc caccatggac
acgagggccc ccatcagctg ctggggctcc tgctgctctg 60gctcccaggt gccaggtgtg
cccttgtgat gacccagact ccagcctctg tggaggtagc 120tgtgggaggc
acagtcacca tcaagtgcca ggccagtcag agcattgata gttggttatc
180ctggtatcag cagaaaccag ggcagcgtcc caggctcctg atctattatg
catccaatct 240ggcatctggg gtctcatcgc ggttcaaagg cagtggatct
gggacagaat acactctcac 300catcagcggc gtggagtgtg ccgatgctgc
cacttactac tgtcaagagg gttatagtag 360tggtaatgtt gataatgttt
tcggcggagg gaccgaggtg gtggtcaaaa ctgcgnccgc 420tatan
42521367DNAHomo sapiens 21gaattccatg caggtgcagc tggtgcagtc
tggcgccgaa gtgaagaaac ccggcagcag 60cgtgaaggtg tcctgcaagg ccagcggcct
gaccatcagc gacacctaca tgcactgggt 120gcgccaggct ccaggccagg
gactggaatg gatgggcaga atcgaccccg ccaacggcaa 180caccaagttc
gaccccaagt tccagggcag agtgaccatc accgccgaca ccagcacctc
240caccgcctac atggaactga gcagcctgcg gagcgaggac accgccgtgt
actattgtgc 300cagaggcgtg ttcggcttct tcgactactg gggccagggc
accaccgtga ccgtgtcatc 360tgctagc 36722405DNAHomo sapiens
22accggtgcca ccatgtaccg gatgcagctg ctgagctgta tcgccctgtc tctggccctc
60gtgacgaatt cagccatgga catccagatg acccagagcc ccagcagcct gtctgccagc
120gtgggcgaca gagtgaccat cacatgcaag gccaccgagg acatctacaa
ccggctggcc 180tggtatcagc agaagcccgg caaggccccc aagctgctga
ttagcggagc caccagcctg 240gaaaccggcg tgccaagcag attttccggc
agcggctccg gcaaggacta caccctgacc 300atcagctccc tgcagcccga
ggacttcgcc acctactact gccagcagtt ttggagcgcc 360ccctacacct
ttggcggagg caccaaggtg gaaatcaagc gtacg 40523357DNAMus sp.
23atgcaggtgc agctgaagga gtcaggacct ggcctggtgg cgccctcaca gagcctgtcc
60atcacatgca ccgtctcagg gttctcatta accggctatg gtgtaaactg ggttcgccag
120cctccaggaa agggtctgga gtggctggga atgatttggg gtgatggaaa
cacagactat 180aattcagctc tcaaatccag actgagcatc agcaaggaca
actccaagag ccaagttttc 240ttaaaaatga acagtctgca cactgatgac
acagccaggt actactgtgc cagagagaga 300gattataggc ttgactactg
gggccaaggc accactctca cagtctcctc agctagc 35724318DNAMus sp.
24atggacatcc agatgactca gtctccagcc tccctttctg cgtctgtggg agaaactgtc
60accatcacat gtcgagcaag tgggaatatt cacaattatt tagcatggta tcagcagaaa
120cagggaaaat ctcctcagct cctggtctat tatacaacaa ccttagcaga
tggtgtgcca 180tcaaggttca gtggcagtgg atcaggaaca caatattctc
tcaagatcaa cagcctgcag 240cctgaagatt ttgggagtta ttactgtcaa
catttttgga gtactcctcg gacgttcggt 300ggaggcacca agctcgag
31825357DNAMus sp. 25atggaggtcc agctgcagca gtctggagct gagctgatga
agccaggggc ctcagtgaag 60atatcctgca aagcttctgg ctacacattc agtgactact
ggatagagtg ggtaaagcag 120aggcctggac atggccttga gtggattgga
gagattttac
ctggaagtgg tagcactaat 180taccatgaga gattcaaggg caaggccaca
ttcactgcag atacatcctc cagcacagcc 240tacatgcaac tcaacagcct
gacatctgaa gactctggcg tctattactg cctccatggt 300aactacgact
ttgacggctg gggccaaggc accactctca cagtctcctc agctagc 35726312DNAMus
sp. 26atggatatcg ttctcacaca gtctccagca atcatgtctg catctccagg
ggagaaggtc 60accatgacct gcagtgccag ttcaagtgta aattacatgt actggtacca
gcagaagtca 120ggcacttccc ccaaaagatg gatttatgac acatccaaac
tggcttctgg agtccctgtt 180cgcttcagtg gcagtgggtc tgggacctct
tactctctca caatcagcag catggagact 240gaagatgctg ccacttatta
ctgccaacag tggggtcgta accccacgtt cggagggggg 300accaagctcg ag
31227510DNAMus sp. 27tggaaggtgg tgcacactgc tggacaggga tccagagttc
caggtcactg tcactggctc 60agggaaatag cccttgacca ggcatcccag ggtcaccatg
gagttagttt gggcagcaga 120tccaggggcc agtggataga cagatggggg
tgtcgttttg gctgaggaga ctgtgagagt 180ggtgccttgg ccccagcagt
ccccgtccca gtttgcacag taatatgtgg ctgtgtcctc 240aggagtcaca
gaaatcaact gcaggtagca ctggttcttg gatgtgtctc gagtgataga
300gattcgacct ttgagagatg gattgtagta agtgctacca ctgtagctta
tgtaccccat 360atactcaagt ttgttccctg ggaatttccg gatccagctc
cagtaatcat tggtgatgga 420gtcgccagtg acagaacagg tgagggacag
agtctgagaa ggtttcacga ggctaggtcc 480agactcctgc agctgcacct
cgaattccca 51028342DNAMus sp. 28ttggtccccc ctccgaacgt gtacggccag
ttgttactct gttgacagaa atacattcca 60aaatcttcag tctccacact gatgatactg
agagtgaaat ccgtccctga tccactgcca 120ctgaacctgg aggggatccc
agagatggac tgggaagcat acttgatgag aagccttgga 180gactcatgtg
atttttgttg ataccagtgt aggttgttgc taatactttg gctggccctg
240caggaaagac tgacgctatc tcctggagtc acagacaggg tgtctggaga
ctgagttagc 300acaatatcac ctctggaggc tgaaatccag aaaagcaaaa aa
3422926DNAArtificial SequenceTemplate switching
primermisc_feature(24)..(26)May be ribonucleic acid residues
29gcagtggtat caacgcagag tacggg 263024DNAArtificial
SequenceUniversal primer TS 30gcagtggtat caacgcagag tacg
243127DNAArtificial SequenceUniversal primer RT 31agacagtcct
cagtgcctcg tcagcag 273213DNAArtificial SequenceHuman RT primer
HsRT-01 32gtcctgagga ctg 133313DNAArtificial SequenceHuman RT
primer HsRT-02 33tgctctgtga cac 133413DNAArtificial SequenceHuman
RT primer HsRT-03 34ggtgtacagg tcc 133513DNAArtificial
SequenceHuman RT primer HsRT-04 35cagagagcgt gag
133616DNAArtificial SequenceHuman RT primer HsRT-05 36tcatgtagta
gctgtc 163714DNAArtificial SequenceHuman RT primer HsRT-06
37ctcaggactg atgg 143815DNAArtificial SequenceHuman RT primer
HsRT-07 38gagtcctgag tactg 153916DNAArtificial SequenceHuman RT
primer HsRT-08 39gttgttgctt tgtttg 164015DNAArtificial
SequenceHuman RT primer HsRT-09 40ttgttgctct gtttg
154144DNAArtificial SequenceLong gene-specific primer HsN2U_01
41agacagtcct cagtgcctcg tcagcagacc aggcagccca gggc
444255DNAArtificial SequenceLong gene-specific primer HsN2U_02
42agacagtcct cagtgcctcg tcagcagcag tgtggccttg ttggcttgaa gctcc
554353DNAArtificial SequenceLong gene-specific primer HsN2U_03
43agacagtcct cagtgcctcg tcagcagagc aggcacacaa cagaggcagt tcc
534452DNAArtificial SequenceLong gene-specific primer HsN2U_04
44agacagtcct cagtgcctcg tcagcaggcc cagagtcacg gaggtggcat tg
524554DNAArtificial SequenceLong gene-specific primer HsN2U_05
45agacagtcct cagtgcctcg tcagcaggca tgcgacgacc acgttcccat cttg
544646DNAArtificial SequenceLong gene-specific primer HsN2U_06
46agacagtcct cagtgcctcg tcagcaggca gccaacggcc acgctg
464757DNAArtificial SequenceLong gene-specific primer HsN2U_07
47agacagtcct cagtgcctcg tcagcagatg ccaggaccac agggctgtta tcctttg
574853DNAArtificial SequenceLong gene-specific primer HsN2U_08
48agacagtcct cagtgcctcg tcagcagagt gtggccttgt tggcttggag ctc
534951DNAArtificial SequenceLong gene-specific primer HsN2U_09
49agacagtcct cagtgcctcg tcagcagacc acgttcccat ctggctgggt g
515014DNAArtificial SequenceRT mouse primer MmRT_01 50acagtcactg
agct 145115DNAArtificial SequenceRT mouse primer MmRT_02
51ctttgacaag gcatc 155216DNAArtificial SequenceRT mouse primer
MmRT_03 52ccacttgaca ttgatg 165315DNAArtificial SequenceRT mouse
primer MmRT_04 53ctcttctcca cagtg 155452DNAArtificial SequenceLong
gene-specific mouse primer Mmn2_01 54agacagtcct cagtgcctcg
tcagcagact gcaggagagc tgggaaggtg tg 525550DNAArtificial
SequenceLong gene-specific mouse primer Mmn2_02 55agacagtcct
cagtgcctcg tcagcaggac agctgggaag gtgtgcacac 505653DNAArtificial
SequenceLong gene-specific mouse primer Mmn2_03 56agacagtcct
cagtgcctcg tcagctcaag aagcacacga ctgaggcacc tcc 535750DNAArtificial
SequenceLong gene-specific mouse primer Mmn2_04 57agacagtcct
cagtgcctcg tcagcttgcc ttccaggcca ctgtcacacc 505853DNAArtificial
SequenceLong gene-specific mouse primer Mmn2_05 58agacagtcct
cagtgcctcg tcagcatcca gatgtgtcac tgcagccagg gac 535953DNAArtificial
SequenceLong gene-specific mouse primer Mmn2_06 59agacagtcct
cagtgcctcg tcagcacctt ccagtccact gtcaccacac ctg 536013DNAArtificial
SequenceRT rabbit primer OcRT_01 60tgaagctctg gac
136113DNAArtificial SequenceRT rabbit primer OcRT_02 61cacactcaga
ggg 136213DNAArtificial SequenceRT rabbit primer OcRT_03
62ttccagctca cac 136312DNAArtificial SequenceRT rabbit primer
OcRT_04 63aggaagctgc tg 126412DNAArtificial SequenceRT rabbit
primer OcRT_05 64acactgctca gc 126514DNAArtificial SequenceRT
rabbit primer OcRT_06 65tcacattcag aggg 146615DNAArtificial
SequenceRT rabbit primer OcRT_07 66gtcttgtcca ctttg
156714DNAArtificial SequenceRT rabbit primer OcRT_08 67ctctgttgct
gttg 146843DNAArtificial SequenceLong rabbit gene-specific primer
Oc-PCR-IgHA1A7-12 68agacagtcct cagtgcctcg tcaggatcag gcagccgacg acc
436949DNAArtificial SequenceLong rabbit gene-specific primer
Oc-PCR-IgKC1 69agacagtcct cagtgcctcg tcaggtggga agatgaggac
agtaggtgc 497047DNAArtificial SequenceLong rabbit gene-specific
primer Oc-PCR-IgKC1KC2 70agacagtcct cagtgcctcg tcagagatgg
tgggaagagg aggacag 477151DNAArtificial SequenceLong rabbit
gene-specific primer Oc-PCR-IgLC4L5L6 71agacagtcct cagtgcctcg
tcagccttgt tgtccttgag ttcctcagag g 517244DNAArtificial SequenceLong
rabbit gene-specific primer Oc-PCR-IgA2A6 72agacagtcct cagtgcctcg
tcagcggatc aggcagccga tgac 447346DNAArtificial SequenceLong rabbit
gene-specific primer Oc-PCR-IgA4A5 73agacagtcct cagtgcctcg
tcagcaggtc agcgggaaga tgatcg 467448DNAArtificial SequenceLong
rabbit gene-specific primer Oc-PCR-IgLC1C2C3 74agacagtcct
cagtgcctcg tcagcactga tcagacacac cagggtgg 487543DNAArtificial
SequenceLong rabbit gene-specific primer Oc-PCR-IgG 75agacagtcct
cagtgcctcg tcagcaccgt ggagctgggt gtg 437643DNAArtificial
SequenceLong rabbit gene-specific primer Oc-PCR-IgA3A5 76agacagtcct
cagtgcctcg tcaggatcag gcagccggcg atc 437747DNAArtificial
SequenceLong rabbit gene-specific primer Oc-PCR-IgM 77agacagtcct
cagtgcctcg tcagggagac gagcgggtac agagttg 477843DNAArtificial
SequenceLong rabbit gene-specific primer Oc-PCR-IgE 78agacagtcct
cagtgcctcg tcagtctgca gcaggaggcc aag 4379528PRTHomo sapiens 79Met
Gly Thr Ser His Pro Ala Phe Leu Val Leu Gly Cys Leu Leu Thr1 5 10
15Gly Leu Ser Leu Ile Leu Cys Gln Leu Ser Leu Pro Ser Ile Leu Pro
20 25 30Asn Glu Asn Glu Lys Val Val Gln Leu Asn Ser Ser Phe Ser Leu
Arg 35 40 45Cys Phe Gly Glu Ser Glu Val Ser Trp Gln Tyr Pro Met Ser
Glu Glu 50 55 60Glu Ser Ser Asp Val Glu Ile Arg Asn Glu Glu Asn Asn
Ser Gly Leu65 70 75 80Phe Val Thr Val Leu Glu Val Ser Ser Ala Ser
Ala Ala His Thr Gly 85 90 95Leu Tyr Thr Cys Tyr Tyr Asn His Thr Gln
Thr Glu Glu Asn Glu Leu 100 105 110Glu Gly Arg His Ile Tyr Ile Tyr
Val Pro Asp Pro Asp Val Ala Phe 115 120 125Val Pro Leu Gly Met Thr
Asp Tyr Leu Val Ile Val Glu Asp Asp Asp 130 135 140Ser Ala Ile Ile
Pro Cys Arg Thr Thr Asp Pro Glu Thr Pro Val Thr145 150 155 160Leu
His Asn Ser Glu Gly Val Val Pro Ala Ser Tyr Asp Ser Arg Gln 165 170
175Gly Phe Asn Gly Thr Phe Thr Val Gly Pro Tyr Ile Cys Glu Ala Thr
180 185 190Val Lys Gly Lys Lys Phe Gln Thr Ile Pro Phe Asn Val Tyr
Ala Leu 195 200 205Lys Ala Thr Ser Glu Leu Asp Leu Glu Met Glu Ala
Leu Lys Thr Val 210 215 220Tyr Lys Ser Gly Glu Thr Ile Val Val Thr
Cys Ala Val Phe Asn Asn225 230 235 240Glu Val Val Asp Leu Gln Trp
Thr Tyr Pro Gly Glu Val Lys Gly Lys 245 250 255Gly Ile Thr Met Leu
Glu Glu Ile Lys Val Pro Ser Ile Lys Leu Val 260 265 270Tyr Thr Leu
Thr Val Pro Glu Ala Thr Val Lys Asp Ser Gly Asp Tyr 275 280 285Glu
Cys Ala Ala Arg Gln Ala Thr Arg Glu Val Lys Glu Met Lys Lys 290 295
300Val Thr Ile Ser Val His Glu Lys Gly Phe Ile Glu Ile Lys Pro
Thr305 310 315 320Phe Ser Gln Leu Glu Ala Val Asn Leu His Glu Val
Lys His Phe Val 325 330 335Val Glu Val Arg Ala Tyr Pro Pro Pro Arg
Ile Ser Trp Leu Lys Asn 340 345 350Asn Leu Thr Leu Ile Glu Asn Leu
Thr Glu Ile Thr Thr Asp Val Glu 355 360 365Lys Ile Gln Glu Ile Arg
Tyr Arg Ser Lys Leu Lys Leu Ile Arg Ala 370 375 380Lys Glu Glu Asp
Ser Gly His Tyr Thr Ile Val Ala Gln Asn Glu Asp385 390 395 400Ala
Val Lys Ser Tyr Thr Phe Glu Leu Leu Thr Gln Val Pro Ser Ser 405 410
415Ile Leu Asp Leu Val Asp Asp His His Gly Ser Thr Gly Gly Gln Thr
420 425 430Val Arg Cys Thr Ala Glu Gly Thr Pro Leu Pro Asp Ile Glu
Trp Met 435 440 445Ile Cys Lys Asp Ile Lys Lys Cys Asn Asn Glu Thr
Ser Trp Thr Ile 450 455 460Leu Ala Asn Asn Val Ser Asn Ile Ile Thr
Glu Ile His Ser Arg Asp465 470 475 480Arg Ser Thr Val Glu Gly Arg
Val Thr Phe Ala Lys Val Glu Glu Thr 485 490 495Ile Ala Val Arg Cys
Leu Ala Lys Asn Leu Leu Gly Ala Glu Asn Arg 500 505 510Glu Leu Lys
Leu Val Ala Pro Thr Leu Arg Ser Glu Leu Thr Val Ala 515 520
52580528PRTMus musculus 80Met Gly Thr Ser His Gln Val Phe Leu Val
Leu Ser Cys Leu Leu Thr1 5 10 15Gly Pro Gly Leu Ile Ser Cys Gln Leu
Leu Leu Pro Ser Ile Leu Pro 20 25 30Asn Glu Asn Glu Lys Ile Val Gln
Leu Asn Ser Ser Phe Ser Leu Arg 35 40 45Cys Val Gly Glu Ser Glu Val
Ser Trp Gln His Pro Met Ser Glu Glu 50 55 60Asp Asp Pro Asn Val Glu
Ile Arg Ser Glu Glu Asn Asn Ser Gly Leu65 70 75 80Phe Val Thr Val
Leu Glu Val Val Asn Ala Ser Ala Ala His Thr Gly 85 90 95Trp Tyr Thr
Cys Tyr Tyr Asn His Thr Gln Thr Asp Glu Ser Glu Ile 100 105 110Glu
Gly Arg His Ile Tyr Ile Tyr Val Pro Asp Pro Asp Met Ala Phe 115 120
125Val Pro Leu Gly Met Thr Asp Ser Leu Val Ile Val Glu Glu Asp Asp
130 135 140Ser Ala Ile Ile Pro Cys Arg Thr Thr Asp Pro Glu Thr Gln
Val Thr145 150 155 160Leu His Asn Asn Gly Arg Leu Val Pro Ala Ser
Tyr Asp Ser Arg Gln 165 170 175Gly Phe Asn Gly Thr Phe Ser Val Gly
Pro Tyr Ile Cys Glu Ala Thr 180 185 190Val Lys Gly Arg Thr Phe Lys
Thr Ser Glu Phe Asn Val Tyr Ala Leu 195 200 205Lys Ala Thr Ser Glu
Leu Asn Leu Glu Met Asp Ala Arg Gln Thr Val 210 215 220Tyr Lys Ala
Gly Glu Thr Ile Val Val Thr Cys Ala Val Phe Asn Asn225 230 235
240Glu Val Val Asp Leu Gln Trp Thr Tyr Pro Gly Glu Val Arg Asn Lys
245 250 255Gly Ile Thr Met Leu Glu Glu Ile Lys Leu Pro Ser Ile Lys
Leu Val 260 265 270Tyr Thr Leu Thr Val Pro Lys Ala Thr Val Lys Asp
Ser Gly Glu Tyr 275 280 285Glu Cys Ala Ala Arg Gln Ala Thr Lys Glu
Val Lys Glu Met Lys Arg 290 295 300Val Thr Ile Ser Val His Glu Lys
Gly Phe Val Glu Ile Glu Pro Thr305 310 315 320Phe Gly Gln Leu Glu
Ala Val Asn Leu His Glu Val Arg Glu Phe Val 325 330 335Val Glu Val
Gln Ala Tyr Pro Thr Pro Arg Ile Ser Trp Leu Lys Asp 340 345 350Asn
Leu Thr Leu Ile Glu Asn Leu Thr Glu Ile Thr Thr Asp Val Gln 355 360
365Lys Ser Gln Glu Thr Arg Tyr Gln Ser Lys Leu Lys Leu Ile Arg Ala
370 375 380Lys Glu Glu Asp Ser Gly His Tyr Thr Ile Ile Val Gln Asn
Glu Asp385 390 395 400Asp Val Lys Ser Tyr Thr Phe Glu Leu Ser Thr
Leu Val Pro Ala Ser 405 410 415Ile Leu Asp Leu Val Asp Asp His His
Gly Ser Gly Gly Gly Gln Thr 420 425 430Val Arg Cys Thr Ala Glu Gly
Thr Pro Leu Pro Glu Ile Asp Trp Met 435 440 445Ile Cys Lys His Ile
Lys Lys Cys Asn Asn Asp Thr Ser Trp Thr Val 450 455 460Leu Ala Ser
Asn Val Ser Asn Ile Ile Thr Glu Leu Pro Arg Arg Gly465 470 475
480Arg Ser Thr Val Glu Gly Arg Val Ser Phe Ala Lys Val Glu Glu Thr
485 490 495Ile Ala Val Arg Cys Leu Ala Lys Asn Asn Leu Ser Val Val
Ala Arg 500 505 510Glu Leu Lys Leu Val Ala Pro Thr Leu Arg Ser Glu
Leu Thr Val Ala 515 520 52581525PRTOryctolagus cuniculus 81Met Gly
Pro Ser Pro Pro Ala Phe Leu Val Leu Val Leu Gly Trp Leu1 5 10 15Leu
Ala Gly Pro Ser Leu Thr Arg Cys Gln Leu Pro Leu Pro Ser Ile 20 25
30Ser Pro Gly Asp Ser Glu Arg Val Val Pro Leu Asn Ser Ser Phe Thr
35 40 45Leu Arg Cys Ser Gly Glu Ser Glu Val Ser Trp Gln Tyr Pro Val
Ser 50 55 60Glu Asp Glu Gly Pro Arg Val Asp Val Arg Ser Glu Glu Asn
Asn Thr65 70 75 80Gly Tyr Phe Val Ala Val Leu Glu Val Gly Ser Ala
Thr Ala Ala His 85 90 95Thr Gly Leu Tyr Thr Cys Tyr Tyr Asn His Thr
Gln Thr Glu Asp Ser 100 105 110Asp Val Glu Gly Ser His Val Tyr Ile
Tyr Val Pro Asp Pro Asp Val 115 120 125Ala Phe Val Pro Leu Gly Met
Thr Asp Tyr Leu Val Ile Val Glu Asp 130 135 140Asp Asp Ser Ala Ile
Ile Pro Cys Arg Thr Thr Asp Pro Glu Thr Pro145 150 155 160Val Thr
Leu Arg Asn Ser Gln Gly Leu Val Pro Ala Ser Tyr Asp Ser 165 170
175Arg His Gly Phe Asn Gly Thr Phe Thr Met Gly Pro Tyr Val Cys Glu
180 185 190Ala Thr Val Arg Gly Lys Thr Val Gln Thr Ile Pro Phe Asn
Ile Tyr 195
200 205Ala Leu Lys Ala Thr Ser Glu Leu Asp Leu Glu Met Glu Ala Leu
Gln 210 215 220Thr Val Tyr Lys Ala Gly Glu Thr Ile Val Val Thr Cys
Ala Val Phe225 230 235 240Asn Asn Glu Val Val Asp Leu Gln Trp Thr
Tyr Pro Gly Glu Met Lys 245 250 255Gly Lys Gly Val Thr Met Leu Glu
Glu Ile Lys Val Pro Thr Leu Lys 260 265 270Leu Val Tyr Thr Leu Thr
Val Pro Arg Ala Thr Val Lys Asp Ser Gly 275 280 285Asp Tyr Glu Cys
Ala Ala Arg Gln Ala Thr Val Lys Glu Met Lys Lys 290 295 300Val Thr
Ile Ala Val His Glu Lys Gly Phe Val Glu Ile Lys Pro Thr305 310 315
320Phe Asn Gln Ser Glu Ala Val Asn Leu His Glu Val Lys His Phe Val
325 330 335Val Glu Val Arg Ala Tyr Pro Pro Pro Arg Ile Ser Trp Leu
Lys Asp 340 345 350Ser Arg Thr Leu Ile Glu Asn Leu Thr Glu Ile Thr
Thr Asp Val Glu 355 360 365Gln Val Gln Glu Thr Arg Leu Ser Ser Met
Cys Asn Arg Ser Ala Ala 370 375 380Cys Gly Lys Trp Asn Phe Leu Thr
Ser Val Glu Gln Gly Trp Gln Ile385 390 395 400Val Gln Cys Ser Ala
Trp Lys Ala Pro Leu Ala Val Pro Ala Thr Ile 405 410 415Leu Asp Leu
Val Asp Asp His His Pro Pro Gly Glu Lys Arg Val Arg 420 425 430Cys
Thr Ala Ala Gly Thr Pro Pro Asp Val Glu Trp Met Ile Cys Lys 435 440
445Asp Ile Lys Arg Cys Asn Asn Glu Thr Ser Trp Thr Leu Leu Ala Asn
450 455 460Asn Val Ser Asn Ile Val Thr Glu Thr His Pro Arg Gly Gly
Gly Ala465 470 475 480Val Glu Gly Arg Val Thr Phe Ala Lys Val Glu
Glu Thr Leu Ala Val 485 490 495Arg Cys Leu Ala Arg Asn Pro Leu Gly
Thr Glu Asn Arg Glu Leu Lys 500 505 510Leu Val Ala Pro Thr Leu Arg
Ser Glu Leu Thr Val Ala 515 520 52582527PRTRattus norvegicus 82Met
Gly Thr Ser Gln Ala Phe Leu Val Leu Ser Cys Leu Leu Thr Gly1 5 10
15Pro Ser Leu Ile Val Cys Gln Leu Leu Leu Pro Ser Ile Leu Pro Asn
20 25 30Glu Asn Glu Lys Ile Val Pro Leu Ser Ser Ser Phe Ser Leu Arg
Cys 35 40 45Phe Gly Glu Ser Glu Val Ser Trp Gln His Pro Met Ser Glu
Glu Glu 50 55 60Asp Pro Asn Val Glu Ile Arg Thr Glu Glu Asn Asn Ser
Ser Leu Phe65 70 75 80Val Thr Val Leu Glu Val Val Asn Ala Ser Ala
Ala His Thr Gly Trp 85 90 95Tyr Thr Cys Tyr Tyr Asn His Thr Gln Thr
Glu Glu Ser Glu Ile Glu 100 105 110Gly Arg His Ile Tyr Ile Tyr Val
Pro Asp Pro Asp Met Ala Phe Val 115 120 125Pro Leu Gly Met Thr Asp
Ser Leu Val Ile Val Glu Glu Asp Asp Ser 130 135 140Ala Ile Ile Pro
Cys Leu Thr Thr Asp Pro Asp Thr Glu Val Thr Leu145 150 155 160His
Asn Asn Gly Arg Leu Val Pro Ala Ser Tyr Asp Ser Arg Gln Gly 165 170
175Phe Asn Gly Thr Phe Ser Val Gly Pro Tyr Ile Cys Glu Ala Thr Val
180 185 190Arg Gly Arg Thr Phe Lys Thr Ser Glu Phe Asn Val Tyr Ala
Leu Lys 195 200 205Ala Thr Ser Glu Leu Asn Leu Glu Met Asp Thr Arg
Gln Thr Val Tyr 210 215 220Lys Ala Gly Glu Thr Ile Val Val Thr Cys
Ala Val Phe Asn Asn Glu225 230 235 240Val Val Asp Leu Gln Trp Thr
Tyr Pro Gly Glu Val Arg Asn Lys Gly 245 250 255Ile Thr Met Leu Glu
Glu Ile Lys Leu Pro Ser Ile Lys Leu Val Tyr 260 265 270Thr Leu Thr
Val Pro Lys Ala Thr Val Lys Asp Ser Gly Asp Tyr Glu 275 280 285Cys
Ala Ala Arg Gln Ala Thr Lys Glu Val Lys Glu Met Lys Thr Val 290 295
300Thr Ile Ser Val His Glu Lys Gly Phe Val Gln Ile Arg Pro Thr
Phe305 310 315 320Gly His Leu Glu Thr Val Asn Leu His Gln Val Arg
Glu Phe Val Val 325 330 335Glu Val Gln Ala Tyr Pro Thr Pro Arg Ile
Ser Trp Leu Lys Asp Asn 340 345 350Leu Thr Leu Ile Glu Asn Leu Thr
Glu Ile Thr Thr Asp Val Gln Arg 355 360 365Ser Gln Glu Thr Arg Tyr
Gln Ser Lys Leu Lys Leu Ile Arg Ala Lys 370 375 380Glu Glu Asp Ser
Gly His Tyr Thr Ile Ile Val Gln Asn Asp Asp Asp385 390 395 400Met
Lys Ser Tyr Thr Phe Glu Leu Ser Thr Leu Val Pro Ala Ser Ile 405 410
415Leu Glu Leu Val Asp Asp His His Gly Ser Gly Gly Gly Gln Thr Val
420 425 430Arg Cys Thr Ala Glu Gly Thr Pro Leu Pro Asn Ile Glu Trp
Met Ile 435 440 445Cys Lys Asp Ile Lys Lys Cys Asn Asn Asp Thr Ser
Trp Thr Val Leu 450 455 460Ala Ser Asn Val Ser Asn Ile Ile Thr Glu
Phe His Gln Arg Gly Arg465 470 475 480Ser Thr Val Glu Gly Arg Val
Ser Phe Ala Lys Val Glu Glu Thr Ile 485 490 495Ala Val Arg Cys Leu
Ala Lys Asn Asp Leu Gly Ile Gly Asn Arg Glu 500 505 510Leu Lys Leu
Val Ala Pro Ser Leu Arg Ser Glu Leu Thr Val Ala 515 520
52583168PRTHomo sapiens 83Met Lys His Leu Trp Phe Phe Leu Leu Leu
Val Ala Ala Pro Arg Trp1 5 10 15Val Leu Ser Gln Leu Gln Leu Gln Glu
Ser Gly Pro Gly Leu Val Lys 20 25 30Pro Ser Glu Thr Leu Ser Leu Thr
Cys Thr Val Ser Gly Asp Ser Ile 35 40 45Ser Ser Ser Thr Tyr Tyr Trp
Gly Trp Ile Arg Gln Pro Pro Gly Lys 50 55 60Gly Leu Glu Trp Ile Ala
Phe Ile Phe Tyr Ser Gly Ser Thr Phe Tyr65 70 75 80Asn Pro Ser Leu
Lys Ser Arg Val Thr Val Ser Val Asp Arg Ser Thr 85 90 95Asn Gln Phe
Ser Leu Arg Leu Lys Ser Val Thr Ala Ala Asp Thr Ser 100 105 110Arg
Tyr Tyr Cys Ala Arg His Pro Lys Arg Ile Ser Ile Phe Glu Val 115 120
125Val Asn Ala Phe Asp Ile Trp Gly Gln Gly Thr Met Val Thr Val Ser
130 135 140Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro
Ser Ser145 150 155 160Lys Ser Thr Ser Gly Gly Thr Ala
16584169PRTHomo sapiens 84Met Lys His Leu Trp Phe Phe Leu Leu Leu
Val Ala Ala Pro Arg Trp1 5 10 15Val Leu Ser Gln Val Gln Leu Gln Glu
Ser Gly Pro Gly Leu Val Lys 20 25 30Ser Ser Glu Thr Leu Ser Leu Thr
Cys Thr Val Ser Gly Asp Ser Ile 35 40 45Thr Ser Ser Thr Tyr Asp Trp
Gly Trp Ile Arg Gln Pro Pro Gly Lys 50 55 60Gly Leu Glu Trp Ile Gly
Asn Val Tyr Tyr Arg Gly Ser Thr Tyr Tyr65 70 75 80Asn Pro Ser Leu
Lys Ser Arg Val Thr Ile Ser Val Asp Arg Ser Arg 85 90 95Thr Gln Ile
Ser Leu Arg Leu Ser Ser Val Thr Ala Ala Asp Thr Ala 100 105 110Leu
Tyr Phe Cys Ala Arg His Pro Lys Arg Leu Thr Val Phe Glu Val 115 120
125Val Asn Ala Phe Asp Ile Trp Gly Gln Gly Gln Thr Met Val Thr Val
130 135 140Phe Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala
Pro Ser145 150 155 160Ser Lys Ser Thr Ser Gly Gly Thr Ala
16585146PRTHomo sapiens 85Met Ala Trp Thr Leu Leu Phe Leu Thr Leu
Leu Thr Gln Gly Thr Gly1 5 10 15Ser Trp Ala Gln Ser Ala Leu Thr Gln
Pro Ala Ser Val Ser Gly Ser 20 25 30Pro Gly Gln Ser Ile Thr Ile Thr
Cys Thr Gly Ile Ser Ser Asp Val 35 40 45Gly Ala Tyr Asn Ser Val Ser
Trp Tyr Gln Gln Tyr Pro Gly Lys Ser 50 55 60Pro Lys Leu Met Ile Tyr
Asp Val Ser Asn Arg Ser Ser Gly Val Ser65 70 75 80Asn Arg Phe Ser
Gly Ser Lys Ser Asp Asn Thr Ala Ser Leu Thr Ile 85 90 95Ser Gly Leu
Gln Ala Glu Asp Glu Ala Ser Tyr Phe Cys Ser Leu Tyr 100 105 110Arg
Ser Ser Thr Thr Ser Val Val Phe Gly Gly Gly Thr Lys Leu Thr 115 120
125Val Leu Arg Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro
130 135 140Ser Ser14586146PRTHomo sapiens 86Met Ala Trp Ala Leu Leu
Leu Leu Thr Leu Leu Thr Gln Gly Thr Gly1 5 10 15Ser Trp Ala Gln Ser
Ala Leu Thr Gln Pro Ala Ser Val Ser Ala Ser 20 25 30Pro Gly Gln Ser
Ile Thr Ile Ser Cys Thr Gly Ile Ser Ser Asp Ile 35 40 45Gly Gly Tyr
Ser Ser Val Ser Trp Tyr Gln Ala His Pro Gly Lys Ala 50 55 60Pro Lys
Leu Met Ile Tyr Pro Val Asn Asn Arg Pro Ser Gly Ile Ser65 70 75
80Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Ala Ile
85 90 95Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Leu
Tyr 100 105 110Thr Ser Ile Asn Ala Ser Ile Val Phe Gly Gly Gly Thr
Lys Leu Thr 115 120 125Val Leu Gly Gln Pro Lys Ala Ala Pro Ser Val
Thr Leu Phe Pro Pro 130 135 140Ser Ser145
* * * * *