O-Mannosyltransferase Deficient Filamentous Fungal Cells and Methods of Use Thereof

Abstract

The present disclosure relates to compositions and methods useful for the production of heterologous proteins with reduced O-mannosylation in filamentous fungal cells, such as Trichoderma cells. More specifically, the invention provides a PMT-deficient filamentous fungal cell comprising a) at least a first mutation that reduces an endogenous protease activity compared to a parental filamentous fungal cell which does not have said first mutation, and, b) at least a second mutation in a PMT gene that reduces endogenous O-mannosyltransferase activity compared to a parental filamentous fungal cell which does not have said second mutation, wherein said filamentous fungal cell is selected from the group consisting of Trichoderma, Neurospora, Myceliophthora or Chrysosporium cell.

Description

FIELD OF THE INVENTION

[0001] The present disclosure relates to compositions and methods useful for the production of heterologous proteins in filamentous fungal cells.

BACKGROUND

[0002] Posttranslational modification of eukaryotic proteins, particularly therapeutic proteins such as immunoglobulins, is often necessary for proper protein folding and function. Because standard prokaryotic expression systems lack the proper machinery necessary for such modifications, alternative expression systems have to be used in production of these therapeutic proteins. Even where eukaryotic proteins do not have posttranslational modifications, prokaryotic expression systems often lack necessary chaperone proteins required for proper folding. Yeast and fungi are attractive options for expressing proteins as they can be easily grown at a large scale in simple media, which allows low production costs, and yeast and fungi have posttranslational machinery and chaperones that perform similar functions as found in mammalian cells. Moreover, tools are available to manipulate the relatively simple genetic makeup of yeast and fungal cells as well as more complex eukaryotic cells such as mammalian or insect cells (De Pourcq et al., Appl Microbiol Biotechnol, 87(5):1617-31).

[0003] However, posttranslational modifications occurring in yeast and fungi may still be a concern for the production of recombinant therapeutic protein. In particular, O-mannosylation is one of the biggest hurdles to overcome in the production of biopharmaceuticals for human applications in fungi. More specifically, yeasts like Pichia pastoris and Saccharomyces cerevisiae tend to hyper-mannosylate heterologously expressed biopharmaceuticals, thereby triggering adverse effects when applied to humans.

[0004] O-mannosylation to Serine and Threonine residues includes in mammals GalNAc based oligosaccharides or GlcNAc/N-acetyllactosamine comprising O-linked mannose glycans. In fungi O-mannosylation occurs as hexose monomers or oligomers. In yeasts, there are typically several protein(/polypeptide) O-mannosyltransferases, which often function as complexes. Part of the knock-outs are harmfull, at least for cell structures and stability and not all yeast knock-outs or combinations are tolerated (for a review, see Goto 2007, Biosci. Biotechnol. Biochem. 71(6), 1415-1427).

[0005] There have been reports of knock-outs of yeast O-mannosyltransferase genes, aiming to reduce the O-mannosylation levels, and even multiple knock-out mutants involving two or three pmt genes in S. cerevisiae (WO/1994/004687). Pmt1 or pmt2 knock-out of S. cerevisiae reduced the level of O-mannosylation of antifreeze glycoprotein III to about 30% of the proteins and the residual mannosylated protein contains numerous mannose residues per protein, apparently also oligosaccharides (WO/2004/057007).

[0006] WO/2010/034708 reports no significant level of O-mannosylation of recombinant hydrophobin Trichoderma protein when expressed in pmt1 knock-out of S. cerevisiae host cell. Such O-mannosylation appears to be artificial yeast glycosylation of the original non-mannosylated filamentous fungal protein.

[0007] WO/2010/128143 further reports single chain antibody-albumin fusion construct in yeast S. cerevisiae pmt1 and/or pmt4 knock-out strains.

[0008] Pmt1, pmt2, and pmt3 single gene knock-outs, double, and triple knock-outs of Aspergillus species (Aspergillus nidulans, Aspergillus fumigatus, and/or Aspergillus awamori) are described in Goto et al, 2009 (Eukaryotic cell 2009, 8(10):1465); Mouyna et al, 2010 (Molecular Microbiology 2010, 76(5), 1205-1221); Zhou et al, 2007 (Eukaryotic cell 2007, 6(12):2260); Oka et al, 2004 (Microbiology 2004, 150, 1973-1982); Kriangkripipat et al, 2009; Fang et al, 2010 (Glycobiology, 2010, vol. 20 pp 542-552); and Oka et al, 2005 (Microbiology 2005, 151, 3657-3667).

[0009] Despite numerous reports on knock out of pmt homologues in filamentous fungi, there is no description of a filamentous fungal cell with reduced O-mannosylation and useful as a host cell for the production of recombinant glycoprotein.

[0010] In particular, Gorka-Niec et al (2008, Acta Biochimica Polonica, Vol. 55 No 2/2008, 251-259) reported the deletion of pmt1 gene in Trichoderma reesei. PMT1 protein showed the highest identity to Pmt4p of S. cerevisiae (51%) but functionally complement pmt2.DELTA. S. cerevisiae mutant (Gorka-Niec et al, 2007, Biochimica et Biophysica Acta 1770, 2007, 774-780). However, the authors reported that disruption of the pmt1 gene caused a decrease of protein secretion but did not alter O- and N-glycosylation of secreted protein. Zakrzewska et al (Curr Genet 2003 43: 11-16) further reported that Trichoderma reesei pmt1 gene did not functionally complement pmt4.DELTA. S. cerevisiae mutant.

[0011] In fact, deletions of the PMT genes in yeasts or filamentous fungi appears to either result in no phenotype at all or lethality or severely impaired vital functions of the cells, which would not be suitable for recombinant production of heterologous proteins, especially mammalian glycoproteins. For this reason, alternative methods such as the use of pmt inhibitors have been proposed as an alternative to pmt knock out strains (WO2009/143041).

[0012] Thus, a need remains for improved filamentous fungal cells, such as Trichoderma fungus cells, that can stably produce heterologous proteins with no or reduced O-mannosylation, such as immunoglobulins, preferably at high levels of expression.

SUMMARY

[0013] The present invention relates to improved methods for producing proteins with no or reduced O-mannosylation in filamentous fungal expression systems, and more specifically, glycoproteins, such as antibodies or related immunoglobulins or fusion proteins which may be O-mannosylated when produced in filamentous fungal expression systems.

[0014] The present invention is based in part on the surprising discovery that filamentous fungal cells, such as Trichoderma cells, can be genetically modified to reduce or suppress O-mannosylation activity, without adversely affecting viability and yield of produced glycoproteins.

[0015] Accordingly, in a first aspect, the invention relates to a PMT-deficient filamentous fungal cell comprising [0016] a) a first mutation that reduces or eliminates an endogenous protease activity compared to a parental filamentous fungal cell which does not have said first mutation, and, [0017] b) a second mutation in a PMT gene that reduces endogenous O-mannosyltransferase activity compared to a parental filamentous fungal cell which does not have said second mutation, wherein said filamentous fungal cell is selected from the group consisting of Trichoderma, Neurospora, Myceliophthora and Chrysosporium cell.

[0018] In one embodiment, said PMT-deficient cell further expresses a heterologous protein containing serine and/or threonine residues. The expressed heterologous protein with serine and/or threonine residues has reduced O-mannosylation due to said mutation in said PMT gene. For example, the O-mannosylation level of the heterologous protein expressed in a PMT-deficient cell of the invention is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or at least 90% lower as compared to the O-mannosylation level of the heterologous protein when expressed in the parental filamentous fungal cell which does not have said second PMT-deficient mutation.

[0019] In another embodiment, said second mutation that reduces endogenous O-mannosyltransferase activity is a deletion or a disruption of a PMT gene encoding an endogenous protein O-mannosyltransferase activity.

[0020] In another embodiment, said second PMT-deficient mutation in a PMT gene may be a mutation (such as a deletion or disruption) in either: [0021] a) PMT1 gene comprising the polynucleotide of SEQ ID NO:1, [0022] b) a functional homologous gene of PMT1 gene, which functional gene is capable of restoring parental O-mannosylation level by functional complementation when introduced into a T. reesei strain having a disruption in said PMT1 gene, or, [0023] c) a polynucleotide encoding a polypeptide having at least 50%, at least 60%, at least 70%, at least 90%, or at least 95% identity with SEQ ID NO:2, said polypeptide having O-mannosyltransferase activity.

[0024] In another embodiment that may be combined with the precedent embodiments, said PMT-deficient cell has a third mutation that reduces or eliminates the level of expression of an ALG3 gene compared to the level of expression in a parental cell which does not have such third mutation. In a specific embodiment, said PMT-deficient cell further comprises a first polynucleotide encoding N-acetylglucosaminyltransferase I catalytic domain and a second polynucleotide encoding N-acetylglucosaminyltransferase catalytic domain.

[0025] In another embodiment that may be combined with the preceding embodiments, said PMT-deficient cell further comprises one or more polynucleotides encoding a polypeptide selected from the group consisting of: [0026] a) .alpha.1,2 mannosidase, [0027] b) N-acetylglucosaminyltransferase I catalytic domain, [0028] c) .alpha. mannosidase II, and [0029] d) N-acetylglucosaminyltransferase catalytic domain.

[0030] In another embodiment that may be combined with the preceding embodiments, said PMT-deficient cell further comprises one or more polynucleotides encoding a .beta.1,4 galactosyltransferase and/or a fucosyltransferase.

[0031] In one specific embodiment, said PMT-deficient cell is a Trichoderma cell comprising at least a mutation that reduces or eliminates the protein O-mannosyltransferase activity of Trichoderma pmt1, and, optionally, further comprising mutations in at least one or more other PMT genes that reduces or eliminates the protein O-mannosyltransferase activity selected from the group consisting of pmt2 and pmt3.

[0032] In one embodiment that may be combined with the preceding embodiments, the PMT deficient cells comprise mutations that reduce or eliminate the activity of at least two, or at least three endogenous proteases. Typically, said cell may be a Trichoderma cell and may comprise mutations that reduce or eliminate the activity of [0033] a) the three endogenous proteases pep1, tsp1 and slp1, [0034] b) the three endogenous proteases gap1, slp1 and pep1, [0035] c) three endogenous proteases selected from the group consisting of pep1, pep2, pep3, pep4, pep5, pep8, pep11, pep12, tsp1, slp1, slp2, slp3, slp7, gap1 and gap2, [0036] d) three to six proteases selected from the group consisting of pep1, pep2, pep3, pep4, pep5, tsp1, slp1, slp2, slp3, gap1 and gap2, or, [0037] e) seven to ten proteases selected from the group consisting of pep1, pep2, pep3, pep4, pep5, pep7, pep8, tsp1, slp1, slp2, slp3, slp5, slp6, slp7, slp8, tpp1, gap1 and gap2.

[0038] In one embodiment that may be combined with the precedent embodiments, the filamentous fungal cell of the invention does not comprise a deletion or disruption of an endogenous gene encoding a chaperone protein. In particular, said filamentous fungal cell of the invention expresses functional endogenous chaperone protein Protein Disulphide Isomerase (PDI).

[0039] In another aspect, the invention relates to a method for producing a protein having reduced O-mannosylation, comprising: [0040] a) providing a PMT-deficient filamentous fungal cell, having a mutation in a PMT gene that reduces endogenous O-mannosyltransferase activity as compared to parental strain which does not have such mutation, and further comprising a polynucleotide encoding a protein with serine or threonine residue, [0041] b) culturing said PMT-deficient filamentous fungal cell to produce said protein with reduced O-mannosylation, wherein said filamentous fungal cell is selected from the group consisting of Trichoderma, Neurospora, Myceliophthora and Chrysosporium cell.

[0042] According to one specific embodiment of the method, said mutation in a PMT gene is a mutation, such as a deletion or disruption, in either: [0043] a) PMT1 gene comprising the polynucleotide of SEQ ID NO:1, [0044] b) a functional homologous gene of PMT1 gene, which gene is capable of restoring parental O-mannosylation level by functional complementation when introduced into a T. reesei strain having a disruption in said PMT1 gene, or, [0045] c) a polynucleotide encoding a polypeptide having at least 50%, at least 60%, at least 70%, at least 90%, or at least 95% identity with SEQ ID NO:2, said polypeptide having protein O-mannosyltransferase activity.

[0046] In another embodiment of the method, said PMT-deficient cell is a Trichoderma reesei cell and said mutation is a deletion or a disruption of T. reesei PMT1 gene.

[0047] In other embodiments of the method, said PMT-deficient cell is a PMT-deficient cell of the invention as described above.

[0048] In a specific embodiment, said polynucleotide encoding a protein is a recombinant polynucleotide encoding a heterologous protein. Typically, said heterologous protein may be a mammalian protein selected from the group consisting of [0049] a) an immunoglubulin, such as IgG, [0050] b) a light chain or heavy chain of an immunoglobulin, [0051] c) a heavy chain or alight chain of an antibody, [0052] d) a single chain antibody, [0053] e) a camelid antibody, [0054] f) a monomeric or multimeric single domain antibody, [0055] g) a FAb-fragment, a FAb2-fragment, and, [0056] h) their antigen-binding fragments.

[0057] In one embodiment of the method, that may be combined with the preceding embodiments, said polynucleotide encoding said protein further comprises a polynucleotide encoding CBH1 catalytic domain and linker as a carrier protein and/or cbh1 promoter.

[0058] In another embodiment, said polynucleotide encodes a protein with serine or threonine, which may be O-mannosylated in a PMT functional parental strain, and further comprising at least one N-glycan.

[0059] The invention also relates to a method for producing an antibody having reduced O-mannosylation, comprising: [0060] a) providing a PMT-deficient filamentous fungal cell having [0061] i. a mutation that reduces endogenous protein O-mannosyltransferase activity as compared to parental strain which does not have such mutation and [0062] ii. a polynucleotide encoding a light chain antibody and a polynucleotide encoding a heavy chain antibody, [0063] b) culturing the cell to produce said antibody, consisting of heavy and light chains, having reduced O-mannosylation, [0064] wherein said filamentous fungal cell is selected from the group consisting of Trichoderma, Neurospora, Myceliophthora and Chrysosporium cell.

[0065] In a specific method for producing antibody, said PMT-deficient cell is a Trichoderma reesei cell and said mutation is a deletion or a disruption of T. reesei PMT1 gene.

[0066] In one embodiment of the method for producing antibody, at least 70%, 80%, 90%, 95%, or 100% of the produced antibody is not O-mannosylated.

[0067] The invention also relates to the protein composition or antibody composition obtainable or obtained by the methods of the invention as described above. In one embodiment, at least 70%, 80%, 90%, 95%, or 100% of the antibodies as obtained or obtainable the methods of the invention are not O-mannosylated.

[0068] In one specific embodiment, such protein (e.g. a glycoprotein) or antibody composition with reduced O-mannosylation comprises, as a major glycoform, either, [0069] Man.alpha.3[Man.alpha.6(Man.alpha.3)Man.alpha.6]Man.beta.4GlcNA.beta.4Glc- NAc (Man5 glycoform); [0070] Man.alpha.6(Man.alpha.3)Man.beta.4GlcNA.beta.4GlcNAc (Man3 glycoform); [0071] hybrid or complex type N-glycans such as glycoforms selected from the subgroup consisting of GlcNAcMan3, G0, hybrid glycan, or GlcNAcMan5, or galactosylated derivatives, such as GalGlcNAcMan3, G1, G2; or, GalGlcNAcMan5 glycoform.

[0072] In one specific embodiment, when the core of the glycan consists of Man3, then the composition essentially lacks Man5 glycoforms.

[0073] In an embodiment that may be combined with one or more of the preceding embodiments less than 0.1%, 0.01%, 0.001% or 0% of the N-glycans and/or O-glycans of the protein composition comprises Neu5Gc and/or Gal.alpha.- structure. In an embodiment that may be combined with the preceding embodiments, less than 0.1%, 0.01%, 0.001% or 0% of the N-glycans and/or O-glycans of the antibody composition comprises Neu5Gc and/or Gal.alpha.- structure.

[0074] In an embodiment that may be combined with one or more of the preceding embodiments, less than 0.1%, 0.01%, 0.001%, or 0% of the N-glycan of the glycoprotein composition comprises core fucose structures. In an embodiment that may be combined with the preceding embodiments, less than 0.1%, 0.01%, 0.001%, or 0% of the N-glycan of the antibody composition comprises core fucose structures.

[0075] In an embodiment that may be combined with one or more of the preceding embodiments, less than 0.1%, 0.01%, 0.001%, or 0% of N-glycan of the glycoprotein composition comprises terminal galactose epitopes Gal.beta.3/4GlcNAc. In an embodiment that may be combined with the preceding embodiments, less than 0.1%, 0.01%, 0.001%, or 0% of the N-glycan of the antibody composition comprises terminal galactose epitopes Gal.beta.3/4GlcNAc.

[0076] In an embodiment that may be combined with one or more of the preceding embodiments, less than 1.0%, 0.5%, 0.1%, 0.01%, 0.001%, or 0% of the glycoprotein composition comprises glycation structures. In an embodiment that may be combined with the preceding embodiments, less than 1.0%, 0.5%, 0.1%, 0.01%, 0.001%, or 0% of the antibody composition comprises glycation structures.

[0077] In another embodiment that may be combined with one or more of the preceding embodiments, the glycoprotein composition, such as an antibody is devoid of one, two, three, four, five, or six of the structures selected from the group of Neu5Gc, terminal Gal.alpha.3Gal.beta.4GlcNAc, terminal Gal.beta.4GlcNAc, terminal Gal.beta.3GlcNAc, core linked fucose and glycation structures.

[0078] The invention also relates to a method of reducing O-mannosylation level of a recombinant glycoprotein composition produced in a filamentous fungal cell, for example, Trichoderma cell, typically, Trichoderma reesei, said method consisting of using a filamentous fungal cell having a mutation in a PMT gene wherein said PMT gene is either: [0079] i. PMT1 gene comprising the polynucleotide of SEQ ID NO:1, [0080] ii. a functional homologous gene of PMT1 gene, which gene is capable of restoring parental O-mannosylation level by functional complementation when introduced into a T. reesei strain having a disruption in said PMT1 gene, or, [0081] iii. a polynucleotide encoding a polypeptide having at least 50%, at least 60%, at least 70%, at least 90%, or at least 95% identity with SEQ ID NO:2, said polypeptide having protein O-mannosyltransferase activity.

DESCRIPTION OF THE FIGURES

[0082] FIG. 1 depicts results for Southern analyses of Trichoderma reesei pmt1 deletion strains expressing antibody MAB01. A) A 5.7 kb signal is expected from parental strains M124 and M304 with pmt1 ORF probe after SpeI+XbaI digestion. No signal is expected from pure pmt1 deletion strains. B) A 3.5 kb signal is expected for pmt1 5'flank probe from deletion strains after SpeI+AscI digestion. C) A 1.7 kb signal is expected for pmt1 3'flank probe from deletion strains after AscI+XbaI digestions. AscI does not cut intact pmt1 locus in close distance, therefore signals of over 16 kb (B) and 10 kb (C) are expected from parental strains M124 or M304. A 4.1 kb signal is expected from PmeI digested plasmid pTTv185 used as a control in hybridisations with both flank probes (B, C).

[0083] FIG. 2 depicts a spectra of light chain of flask cultured parental T. reesei strain M317 (pyr4.sup.- of M304) (A) and .DELTA.pmt1 disruptant clone 26-8A (B), day 7.

[0084] FIG. 3 depicts results for Western analyses of Trichoderma reesei pmt1 deletion strain M403 from fed-batch fermentation. Upper panel: MAB01 light chain, lower panel: MAB01 heavy chain. 0.1 .mu.l of supernatant was loaded on each lane.

[0085] FIG. 4 depicts a spectrum of light chain of fermenter cultured T. reesei strain M403 (pmt1 deletion strain of MAB01 antibody producing strain, clone 26-8A), day 7.

[0086] FIG. 5 depicts a phylogeny of PMTs of selected filamentous fungi.

[0087] FIG. 6 depicts a partial sequence alignment of the results of the PMT BLAST searches.

DETAILED DESCRIPTION

Definitions

[0088] As used herein, an "expression system" or a "host cell" refers to the cell that is genetically modified to enable the transcription, translation and proper folding of a polypeptide or a protein of interest, typically of mammalian protein.

[0089] The term "polynucleotide" or "oligonucleotide" or "nucleic acid" as used herein typically refers to a polymer of at least two nucleotides joined together by a phosphodiester bond and may consist of either ribonucleotides or deoxynucleotides or their derivatives that can be introduced into a host cell for genetic modification of such host cell. For example, a polynucleotide may encode a coding sequence of a protein, and/or comprise control or regulatory sequences of a coding sequence of a protein, such as enhancer or promoter sequences or terminator. A polynucleotide may for example comprise native coding sequence of a gene or their fragments, or variant sequences that have been optimized for optimal gene expression in a specific host cell (for example to take into account codon bias).

[0090] As used herein, the term, "optimized" with reference to a polynucleotide means that a polynucleotide has been altered to encode an amino acid sequence using codons that are preferred in the production cell or organism, for example, a filamentous fungal cell such as a Trichoderma cell. Heterologous nucleotide sequences that are transfected in a host cell are typically optimized to retain completely or as much as possible the amino acid sequence originally encoded by the original (not optimized) nucleotide sequence. The optimized sequences herein have been engineered to have codons that are preferred in the corresponding production cell or organism, for example the filamentous fungal cell. The amino acid sequences encoded by optimized nucleotide sequences may also be referred to as optimized.

[0091] As used herein, a "peptide" or a "polypeptide" is an amino acid sequence including a plurality of consecutive polymerized amino acid residues. The peptide or polypeptide may include modified amino acid residues, naturally occurring amino acid residues not encoded by a codon, and non-naturally occurring amino acid residues. As used herein, a "protein" may refer to a peptide or a polypeptide or a combination of more than one peptide or polypeptide assembled together by covalent or non-covalent bonds. Unless specified, the term "protein" may encompass one or more amino acid sequences with their post-translation modifications, and in particular with either O-mannosylation or N-glycan modifications.

[0092] As used herein, the term "glycoprotein" refers to a protein which comprises at least one N-linked glycan attached to at least one asparagine residue of a protein, or at least one mannose attached to at least one serine or threonine resulting in O-mannosylation.

[0093] The terms "O-mannosylation" or "O-mannosyltransferase activity" are used herein to refer to the covalent linkage of at least one mannose to one specific amino acid via one oxygen (typically from serine or threonine). O-mannosyltransferase protein typically adds mannose to hydroxyl groups such as hydroxyl of serine or threonine residues.

[0094] In particular, O-mannosyltransferase activity may refer to the specificity of O-mannosyltransferase activity of fungal PMT gene encoding enzymes, and more specifically with the same specificity of T. reesei PMT1.

[0095] As used herein, "glycan" refers to an oligosaccharide chain that can be linked to a carrier such as an amino acid, peptide, polypeptide, lipid or a reducing end conjugate. In certain embodiments, the invention relates to N-linked glycans ("N-glycan") conjugated to a polypeptide N-glycosylation site such as -Asn-Xaa-Ser/Thr- by N-linkage to side-chain amide nitrogen of asparagine residue (Asn), where Xaa is any amino acid residue except Pro. The invention may further relate to glycans as part of dolichol-phospho-oligosaccharide (Dol-P-P-OS) precursor lipid structures, which are precursors of N-linked glycans in the endoplasmic reticulum of eukaryotic cells. The precursor oligosaccharides are linked from their reducing end to two phosphate residues on the dolichol lipid. For example, 3-mannosyltransferase Alg3 modifies the Do-P-P-oligosaccharide precursor of N-glycans. Generally, the glycan structures described herein are terminal glycan structures, where the non-reducing residues are not modified by other monosaccharide residue or residues.

[0096] As used throughout the present disclosure, glycolipid and carbohydrate nomenclature is essentially according to recommendations by the IUPAC-IUB Commission on Biochemical Nomenclature (e.g. Carbohydrate Res. 1998, 312, 167; Carbohydrate Res. 1997, 297, 1; Eur. J. Biochem. 1998, 257, 29). It is assumed that Gal (galactose), Glc (glucose), GlcNAc (N-acetylglucosamine), GalNAc (N-acetylgalactosamine), Man (mannose), and Neu5Ac are of the D-configuration, Fuc of the L-configuration, and all the monosaccharide units in the pyranose form (D-Galp, D-Glcp, D-GlcpNAc, D-GalpNAc, D-Manp, L-Fucp, D-Neup5Ac). The amine group is as defined for natural galactose and glucosamines on the 2-position of GalNAc or GlcNAc. Glycosidic linkages are shown partly in shorter and partly in longer nomenclature, the linkages of the sialic acid SA/Neu5X-residues .alpha.3 and .alpha.6 mean the same as .alpha.2-3 and .alpha.2-6, respectively, and for hexose monosaccharide residues .alpha.1-3, .alpha.1-6, .beta.1-2, .beta.1-3, .beta.1-4, and .beta.1-6 can be shortened as 3, .alpha.6, .beta.2, .beta.3, .beta.4, and .beta.6, respectively. Lactosamine refers to type II N-acetyllactosamine, Gal.beta.4GlcNAc, and/or type I N-acetyllactosamine. Gal.beta.3GlcNAc and sialic acid (SA) refer to N-acetylneuraminic acid (Neu5Ac), N-glycolylneuraminic acid (Neu5Gc), or any other natural sialic acid including derivatives of Neu5X. Sialic acid is referred to as NeuNX or Neu5X, where preferably X is Ac or Gc. Occasionally Neu5Ac/Gc/X may be referred to as NeuNAc/NeuNGc/NeuNX.

[0097] The sugars typically constituting N-glycans found in mammalian glycoprotein, include, without limitation, N-acetylglucosamine (abbreviated hereafter as "GlcNAc"), mannose (abbreviated hereafter as "Man"), glucose (abbreviated hereafter as "Glc"), galactose (abbreviated hereafter as "Gal"), and sialic acid (abbreviated hereafter as "Neu5Ac"). N-glycans share a common pentasaccharide referred to as the "core" structure Man.sub.3GlcNAc.sub.2 (Man.alpha.6(Man.alpha.3)Man.beta.4GlcNA4GlcNAc, referred to as Man3). In some embodiments Man3 glycan or its derivative Man.alpha.6(GlcNAc.beta.2Man.alpha.3)Man4GlcNA4GlcNAc is the major glycoform. When a fucose is attached to the core structure, preferably .alpha.6-inked to reducing end GlcNAc, the N-glycan or the core of N-glycan, may be represented as Man.sub.3GlcNAc.sub.2(Fuc). In an embodiment the major N-glycan is Man.alpha.3[Man.alpha.6(Man.alpha.3)Man.alpha.6]Man4GlcNA4GlcNAc (Man5).

[0098] Preferred hybrid type N-glycans comprise GlcNAc.beta.2Man.alpha.3[Man.alpha.6(Man.alpha.3)Man.alpha.6]Man.beta.4Gl- cNA.beta.4GlcNAc ("GlcNAcMan5"), or b4-galactosylated derivatives thereof Gal.beta.4GlcNAcMan3, G1, G2, or GalGlcNAcMan5 glycoform.

[0099] A "complex N-glycan" refers to a N-glycan which has at least one GlcNAc residue, optionally by GlcNAc.beta.2-residue, on terminal 1,3 mannose arm of the core structure and at least one GlcNAc residue, optionally by GlcNAc.beta.2-residue, on terminal 1,6 mannose arm of the core structure.

[0100] Such complex N-glycans include, without limitation, GlcNAc.sub.2Man.sub.3GlcNAc.sub.2 (also referred as G0 glycoform), Gal.sub.1GlcNAc.sub.2Man.sub.3GlcNAc.sub.2 (also referred as G1 glycoform), and Gal.sub.2GlcNAc.sub.2Man.sub.3GlcNAc.sub.2 (also referred as G2 glycoform), and their core fucosylated glycoforms FG0, FG1 and FG2, respectively GlcNAc.sub.2Man.sub.3GlcNAc.sub.2(Fuc), Gal.sub.1GlcNAc.sub.2Man.sub.3GlcNAc.sub.2(Fuc), and Gal.sub.2GlcNAc.sub.2Man.sub.3GlcNAc.sub.2(Fuc).

[0101] "Increased" or "Reduced activity of an endogenous enzyme": The filamentous fungal cell may have increased or reduced levels of activity of various endogenous enzymes. A reduced level of activity may be provided by inhibiting the activity of the endogenous enzyme with an inhibitor, an antibody, or the like. In certain embodiments, the filamentous fungal cell is genetically modified in ways to increase or reduce activity of various endogenous enzymes. "Genetically modified" refers to any recombinant DNA or RNA method used to create a prokaryotic or eukaryotic host cell that expresses a polypeptide at elevated levels, at lowered levels, or in a mutated form. In other words, the host cell has been transfected, transformed, or transduced with a recombinant polynucleotide molecule, and thereby been altered so as to cause the cell to alter expression of a desired protein.

[0102] "Genetic modifications" which result in a decrease or deficiency in gene expression, in the function of the gene, or in the function of the gene product (i.e., the protein encoded by the gene) can be referred to as inactivation (complete or partial), knock-out, deletion, disruption, interruption, blockage, silencing, or down-regulation, or attenuation of expression of a gene. For example, a genetic modification in a gene which results in a decrease in the function of the protein encoded by such gene, can be the result of a complete deletion of the gene (i.e., the gene does not exist, and therefore the protein does not exist), a mutation in the gene which results in incomplete (disruption) or no translation of the protein (e.g., the protein is not expressed), or a mutation in the gene which decreases or abolishes the natural function of the protein (e.g., a protein is expressed which has decreased or no enzymatic activity or action). More specifically, reference to decreasing the action of proteins discussed herein generally refers to any genetic modification in the host cell in question, which results in decreased expression and/or functionality (biological activity) of the proteins and includes decreased activity of the proteins (e.g., decreased catalysis), increased inhibition or degradation of the proteins as well as a reduction or elimination of expression of the proteins. For example, the action or activity of a protein can be decreased by blocking or reducing the production of the protein, reducing protein action, or inhibiting the action of the protein. Combinations of some of these modifications are also possible. Blocking or reducing the production of a protein can include placing the gene encoding the protein under the control of a promoter that requires the presence of an inducing compound in the growth medium. By establishing conditions such that the inducer becomes depleted from the medium, the expression of the gene encoding the protein (and therefore, of protein synthesis) could be turned off. Blocking or reducing the action of a protein could also include using an excision technology approach similar to that described in U.S. Pat. No. 4,743,546. To use this approach, the gene encoding the protein of interest is cloned between specific genetic sequences that allow specific, controlled excision of the gene from the genome. Excision could be prompted by, for example, a shift in the cultivation temperature of the culture, as in U.S. Pat. No. 4,743,546, or by some other physical or nutritional signal.

[0103] In general, according to the present invention, an increase or a decrease in a given characteristic of a mutant or modified protein (e.g., enzyme activity) is made with reference to the same characteristic of a parent (i.e., normal, not modified) protein that is derived from the same organism (from the same source or parent sequence), which is measured or established under the same or equivalent conditions. Similarly, an increase or decrease in a characteristic of a genetically modified host cell (e.g., expression and/or biological activity of a protein, or production of a product) is made with reference to the same characteristic of a wild-type host cell of the same species, and preferably the same strain, under the same or equivalent conditions. Such conditions include the assay or culture conditions (e.g., medium components, temperature, pH, etc.) under which the activity of the protein (e.g., expression or biological activity) or other characteristic of the host cell is measured, as well as the type of assay used, the host cell that is evaluated, etc. As discussed above, equivalent conditions are conditions (e.g., culture conditions) which are similar, but not necessarily identical (e.g., some conservative changes in conditions can be tolerated), and which do not substantially change the effect on cell growth or enzyme expression or biological activity as compared to a comparison made under the same conditions.

[0104] Preferably, a genetically modified host cell that has a genetic modification that increases or decreases (reduces) the activity of a given protein (e.g., an O-mannosyltransferase or protease) has an increase or decrease, respectively, in the activity or action (e.g., expression, production and/or biological activity) of the protein, as compared to the activity of the protein in a parent host cell (which does not have such genetic modification), of at least about 5%, and more preferably at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55 60%, 65%, 70%, 75 80%, 85 90%, 95%, or any percentage, in whole integers between 5% and 100% (e.g., 6%, 7%, 8%, etc.).

[0105] In another aspect of the invention, a genetically modified host cell that has a genetic modification that increases or decreases (reduces) the activity of a given protein (e.g., an O-mannosyltransferase or protease) has an increase or decrease, respectively, in the activity or action (e.g., expression, production and/or biological activity) of the protein, as compared to the activity of the wild-type protein in a parent host cell, of at least about 2-fold, and more preferably at least about 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 75-fold, 100-fold, 125-fold, 150-fold, or any whole integer increment starting from at least about 2-fold (e.g., 3-fold, 4-fold, 5-fold, 6-fold, etc.).

[0106] As used herein, the terms "identical" or percent "identity," in the context of two or more nucleic acid or amino acid sequences, refers to two or more sequences or subsequences that are the same. Two sequences are "substantially identical" if two sequences have a specified percentage of amino acid residues or nucleotides that are the same (i.e., 29% identity, optionally 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity over a specified region, or, when not specified, over the entire sequence), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. Optionally, the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200, or more amino acids) in length.

[0107] For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. When comparing two sequences for identity, it is not necessary that the sequences be contiguous, but any gap would carry with it a penalty that would reduce the overall percent identity. For blastn, the default parameters are Gap opening penalty=5 and Gap extension penalty=2. For blastp, the default parameters are Gap opening penalty=11 and Gap extension penalty=1.

[0108] A "comparison window," as used herein, includes reference to a segment of any one of the number of contiguous positions including, but not limited to from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman (1981), by the homology alignment algorithm of Needleman and Wunsch (1970) J Mol Biol 48(3):443-453, by the search for similarity method of Pearson and Lipman (1988) Proc Natl Acad Sci USA 85(8):2444-2448, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection [see, e.g., Brent et al., (2003) Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (Ringbou Ed)].

[0109] Two examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1997) Nucleic Acids Res 25(17):3389-3402 and Altschul et al. (1990) J. Mol Biol 215(3)-403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) or 10, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix [see Henikoff and Henikoff, (1992) Proc Natl Acad Sci USA 89(22):10915-10919] alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.

[0110] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, (1993) Proc Natl Acad Sci USA 90(12):5873-5877). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.

[0111] "Functional variant" or "functional homologous gene" as used herein refers to a coding sequence or a protein having sequence similarity with a reference sequence, typically, at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% identity with the reference coding sequence or protein, and retaining substantially the same function as said reference coding sequence or protein. A functional variant may retain the same function but with reduced or increased activity. Functional variants include natural variants, for example, homologs from different species or artificial variants, resulting from the introduction of a mutation in the coding sequence. Functional variant may be a variant with only conservatively modified mutations.

[0112] "Conservatively modified mutations" as used herein include individual substitutions, deletions or additions to an encoded amino acid sequence which result in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the disclosure. The following eight groups contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (1), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).

Filamentous Fungal Cells

[0113] As used herein, "filamentous fungal cells" include cells from all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK). Filamentous fungal cells are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.

[0114] Preferably, the filamentous fungal cell is not adversely affected by the transduction of the necessary nucleic acid sequences, the subsequent expression of the proteins (e.g., mammalian proteins), or the resulting intermediates. General methods to disrupt genes of and cultivate filamentous fungal cells are disclosed, for example, for Penicillium, in Kopke et al. (2010) Appl Environ Microbiol. 76(14):4664-74. doi: 10.1128/AEM.00670-10, for Aspergillus, in Maruyama and Kitamoto (2011), Methods in Molecular Biology, vol. 765, DOI10.1007/978-1-61779-197-0_27; for Neurospora, in Collopy et al. (2010) Methods Mol Biol. 2010; 638:33-40. doi: 10.1007/978-1-60761-611-5_3; and for Myceliophthora or Chrysosporium PCT/NL2010/000045 and PCT/EP98/06496.

[0115] Examples of suitable filamentous fungal cells include, without limitation, cells from an Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Scytalidium, Thielavia, Tolypocladium, or Trichoderma/Hypocrea strain.

[0116] In certain embodiments, the filamentous fungal cell is from a Trichoderma sp., Acremonium, Aspergillus, Aureobasidium, Cryptococcus, Chrysosporium, Chrysosporium lucknowense, Filibasidium, Fusarium, Gibberella, Magnaporthe, Mucor, Myceliophthora, Myrothecium, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Schizophyllum, Talaromyces, Thermoascus, Thielavia, or Tolypocladium strain.

[0117] In some embodiments, the filamentous fungal cell is a Myceliophthora or Chrysosporium, Neurospora or Trichoderma strain.

[0118] Aspergillus fungal cells of the present disclosure may include, without limitation, Aspergillus aculeatus, Aspergillus awamori, Aspergillus clavatus, Aspergillus flavus, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, or Aspergillus terreus.

[0119] Neurospora fungal cells of the present disclosure may include, without limitation, Neurospora crassa.

[0120] Myceliophthora fungal cells of the present disclosure may include, without limitation, Myceliophthora thermophila.

[0121] In a preferred embodiment, the filamentous fungal cell is a Trichoderma fungal cell. Trichoderma fungal cells of the present disclosure may be derived from a wild-type Trichoderma strain or a mutant thereof. Examples of suitable Trichoderma fungal cells include, without limitation, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, Trichoderma atroviride, Trichoderma virens, Trichoderma viride; and alternative sexual form thereof (i.e., Hypocrea).

[0122] In a more preferred embodiment, the filamentous fungal cell is a Trichoderma reesei, and for example, strains derived from ATCC 13631 (QM 6a), ATCC 24449 (radiation mutant 207 of QM 6a), ATCC 26921 (QM 9414; mutant of ATCC 24449), VTT-D-00775 (Selinheimo et al., FEBS J., 2006, 273: 4322-4335), Rut-C30 (ATCC 56765), RL-P37 (NRRL 15709) or T. harzianum isolate T3 (Wolffhechel, H., 1989).

[0123] The invention described herein relates to a PMT deficient filamentous fungal cell, for example selected from Trichoderma, Neurospora, Myceliophthora or a Chrysosporium cells, such as Trichoderma reesei fungal cell, comprising: [0124] a. at least a first mutation that reduces or eliminates an endogenous protease activity compared to the parental filamentous fungal cell which does not have said first mutation (i.e. a protease-deficient mutation), and, [0125] b. at least a second mutation in a PMT gene that reduces or eliminates an endogenous O-mannosyltransferase activity compared to a parental filamentous fungal cell which does not have said second mutation (i.e. a PMT-deficient mutation). Proteases with Reduced Activity

[0126] It has been found that reducing protease activity enables to increase substantially the production of heterologous mammalian protein. Indeed, such proteases found in filamentous fungal cells that express a heterologous protein normally catalyse significant degradation of the expressed recombinant protein. Thus, by reducing the activity of proteases in filamentous fungal cells that express a heterologous protein, the stability of the expressed protein is increased, resulting in an increased level of production of the protein, and in some circumstances, improved quality of the produced protein (e.g., full-length instead of degraded).

[0127] Proteases include, without limitation, aspartic proteases, trypsin-like serine proteases, subtilisin proteases, glutamic proteases, and sedolisin proteases. Such proteases may be identified and isolated from filamentous fungal cells and tested to determine whether reduction in their activity affects the production of a recombinant polypeptide from the filamentous fungal cell. Methods for identifying and isolating proteases are well known in the art, and include, without limitation, affinity chromatography, zymogram assays, and gel electrophoresis. An identified protease may then be tested by deleting the gene encoding the identified protease from a filamentous fungal cell that expresses a recombinant polypeptide, such a heterologous or mammalian polypeptide, and determining whether the deletion results in a decrease in total protease activity of the cell, and an increase in the level of production of the expressed recombinant polypeptide. Methods for deleting genes, measuring total protease activity, and measuring levels of produced protein are well known in the art and include the methods described herein.

Aspartic Proteases

[0128] Aspartic proteases are enzymes that use an aspartate residue for hydrolysis of the peptide bonds in polypeptides and proteins. Typically, aspartic proteases contain two highly-conserved aspartate residues in their active site which are optimally active at acidic pH. Aspartic proteases from eukaryotic organisms such as Trichoderma fungi include pepsins, cathepsins, and renins. Such aspartic proteases have a two-domain structure, which is thought to arise from ancestral gene duplication. Consistent with such a duplication event, the overall fold of each domain is similar, though the sequences of the two domains have begun to diverge. Each domain contributes one of the catalytic aspartate residues. The active site is in a cleft formed by the two domains of the aspartic proteases. Eukaryotic aspartic proteases further include conserved disulfide bridges, which can assist in identification of the polypeptides as being aspartic acid proteases.

[0129] Nine aspartic proteases have been identified in Trichoderma fungal cells: pep1 (tre74156); pep2 (tre53961); pep3 (tre121133); pep4 (tre77579), pep5 (tre81004), and pep7 (tre58669), pep8 (tre122076), pep11 (121306), and pep12 (tre119876).

[0130] Examples of suitable aspartic proteases include, without limitation, Trichoderma reesei pep1 (SEQ ID NO: 22), Trichoderma reesei pep2 (SEQ ID NO: 18), Trichoderma reesei pep3 (SEQ ID NO: 19); Trichoderma reesei pep4 (SEQ ID NO: 20), Trichoderma reesei pep5 (SEQ ID NO: 21) and Trichoderma reesei pep7 (SEQ ID NO:23), Trichoderma reesei EGR48424 pep8 (SEQ ID NO:134), Trichoderma reesei EGR49498 pep11 (SEQ ID NO:135), Trichoderma reesei EGR52517 pep12 (SEQ ID NO:35), and homologs thereof. Examples of homologs of pep1, pep2, pep3, pep4, pep5, pep7, pep8, pep11 and pep12 proteases identified in other organisms are also described in PCT/EP/2013/050186, the content of which being incorporated by reference.

Trypsin-Like Serine Proteases

[0131] Trypsin-like serine proteases are enzymes with substrate specificity similar to that of trypsin. Trypsin-like serine proteases use a serine residue for hydrolysis of the peptide bonds in polypeptides and proteins. Typically, trypsin-like serine proteases cleave peptide bonds following a positively-charged amino acid residue. Trypsin-like serine proteases from eukaryotic organisms such as Trichoderma fungi include trypsin 1, trypsin 2, and mesotrypsin. Such trypsin-like serine proteases generally contain a catalytic triad of three amino acid residues (such as histidine, aspartate, and serine) that form a charge relay that serves to make the active site serine nucleophilic. Eukaryotic trypsin-like serine proteases further include an "oxyanion hole" formed by the backbone amide hydrogen atoms of glycine and serine, which can assist in identification of the polypeptides as being trypsin-like serine proteases.

[0132] One trypsin-like serine protease has been identified in Trichoderma fungal cells: tsp1 (tre73897). As discussed in PCT/EP/2013/050186, tsp1 has been demonstrated to have a significant impact on expression of recombinant glycoproteins, such as immunoglobulins.

[0133] Examples of suitable tsp1 proteases include, without limitation, Trichoderma reesei tsp1 (SEQ ID NO: 24) and homologs thereof. Examples of homologs of tsp1 proteases identified in other organisms are described in PCT/EP/2013/050186.

Subtilisin Proteases

[0134] Subtilisin proteases are enzymes with substrate specificity similar to that of subtilisin. Subtilisin proteases use a serine residue for hydrolysis of the peptide bonds in polypeptides and proteins. Generally, subtilisin proteases are serine proteases that contain a catalytic triad of the three amino acids aspartate, histidine, and serine. The arrangement of these catalytic residues is shared with the prototypical subtilisin from Bacillus licheniformis. Subtilisin proteases from eukaryotic organisms such as Trichoderma fungi include furin, MBTPS1, and TPP2. Eukaryotic trypsin-like serine proteases further include an aspartic acid residue in the oxyanion hole.

[0135] Seven subtilisin proteases have been identified in Trichoderma fungal cells: slp1 (tre51365); slp2 (tre123244); slp3 (tre123234); slp5 (tre64719), slp6 (tre121495), slp7 (tre123865), and slp8 (tre58698). Subtilisin protease slp7 resembles also sedolisin protease tpp1.

[0136] Examples of suitable slp proteases include, without limitation, Trichoderma reesei slp1 (SEQ ID NO: 25), slp2 (SEQ ID NO: 26); slp3 (SEQ ID NO: 27); slp5 (SEQ ID NO: 28), slp6 (SEQ ID NO: 29), slp7 (SEQ ID NO: 30), and slp8 (SEQ ID NO: 31), and homologs thereof. Examples of homologs of slp proteases identified in other organisms are described in PCT/EP/2013/050186.

Glutamic Proteases

[0137] Glutamic proteases are enzymes that hydrolyse the peptide bonds in polypeptides and proteins. Glutamic proteases are insensitive to pepstatin A, and so are sometimes referred to as pepstatin insensitive acid proteases. While glutamic proteases were previously grouped with the aspartic proteases and often jointly referred to as acid proteases, it has been recently found that glutamic proteases have very different active site residues than aspartic proteases.

[0138] Two glutamic proteases have been identified in Trichoderma fungal cells: gap1 (tre69555) and gap2 (tre106661).

[0139] Examples of suitable gap proteases include, without limitation, Trichoderma reesei gap1 (SEQ ID NO: 32), Trichoderma reesei gap2 (SEQ ID NO: 33), and homologs thereof. Examples of homologs of gap proteases identified in other organisms are described in PCT/EP/2013/050186.

Sedolisin Proteases and Homologs of Proteases

[0140] Sedolisin proteases are enzymes that use a serine residue for hydrolysis of the peptide bonds in polypeptides and proteins. Sedolisin proteases generally contain a unique catalytic triad of serine, glutamate, and aspartate. Sedolisin proteases also contain an aspartate residue in the oxyanion hole. Sedolisin proteases from eukaryotic organisms such as Trichoderma fungi include tripeptidyl peptidase.

[0141] Examples of suitable tpp1 proteases include, without limitation, Trichoderma reesei tpp1 tre82623 (SEQ ID NO: 34) and homologs thereof. Examples of homologs of tpp1 proteases identified in other organisms are described in PCT/EP/2013/050186.

[0142] As used in reference to protease, the term "homolog" refers to a protein which has protease activity and exhibit sequence similarity with a known (reference) protease sequence. Homologs may be identified by any method known in the art, preferably, by using the BLAST tool to compare a reference sequence to a single second sequence or fragment of a sequence or to a database of sequences. As described in the "Definitions" section, BLAST will compare sequences based upon percent identity and similarity.

[0143] Preferably, a homologous protease has at least 30% identity with (optionally 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity over a specified region, or, when not specified, over the entire sequence), when compared to one of the protease sequences listed above, including T. reesei pep1, pep2, pep3, pep4, pep5, pep7, pep8, pep11, pep12, tsp1, slp1, slp2, slp3, slp5, slp6, slp7, slp8, tpp1, gap1 and gap2. Corresponding homologous proteases from N. crassa and M. thermophila are shown in SEQ ID NO: 136-169.

Reducing the Activity of Proteases in the Filamentous Fungal Cell of the Invention

[0144] The filamentous fungal cells according to the invention have reduced activity of at least one endogenous protease, typically 2, 3, 4, 5 or more, in order to improve the stability and production of the protein with reduced O-mannosylation in said filamentous fungal cell, preferably in a PMT-deficient Trichoderma cell.

[0145] The activity of proteases found in filamentous fungal cells can be reduced by any method known to those of skill in the art. In some embodiments reduced activity of proteases is achieved by reducing the expression of the protease, for example, by promoter modification or RNAi.

[0146] In further embodiments, the reduced or eliminated expression of the proteases is the result of anti-sense polynucleotides or RNAi constructs that are specific for each of the genes encoding each of the proteases. In one embodiment, an RNAi construct is specific for a gene encoding an aspartic protease such as a pep-type protease, a trypsin-like serine proteases such as a tsp1, a glutamic protease such as a gap-type protease, a subtilisin protease such as a slp-type protease, or a sedolisin protease such as a tpp1 or a slp7 protease. In one embodiment, an RNAi construct is specific for the gene encoding a slp-type protease. In one embodiment, an RNAi construct is specific for the gene encoding slp2, slp3, slp5 or slp6. In one embodiment, an RNAi construct is specific for two or more proteases. In one embodiment, two or more proteases are any one of the pep-type proteases, any one of the trypsin-like serine proteasess, any one of the slp-type proteases, any one of the gap-type proteases and/or any one of the sedolisin proteases. In one embodiment, two or more proteases are slp2, slp3, slp5 and/or slp6. In one embodiment, RNAi construct comprises any one of the following nucleic acid sequences (see also PCT/EP/2013/050186).

TABLE-US-00001 RNAi Target sequence GCACACTTTCAAGATTGGC (SEQ ID NO: 15) GTACGGTGTTGCCAAGAAG (SEQ ID NO: 16) GTTGAGTACATCGAGCGCGACAGCATTGTGCACACCATGCTTCCCCTC GAGTCCAAGGACAGCATCATCGTTGAGGACTCGTGCAACGGCGAGACG GAGAAGCAGGCTCCCTGGGGTCTTGCCCGTATCTCTCACCGAGAGACG CTCAACTTTGGCTCCTTCAACAAGTACCTCTACACCGCTGATGGTGGT GAGGGTGTTGATGCCTATGTCATTGACACCGGCACCAACATCGAGCAC GTCGACTTTGAGGGTCGTGCCAAGTGGGGCAAGACCATCCCTGCCGGC GATGAGGACGAGGACGGCAACGGCCACGGCACTCACTGCTCTGGTACC GTTGCTGGTAAGAAGTACGGTGTTGCCAAGAAGGCCCACGTCTACGCC GTCAAGGTGCTCCGATCCAACGGATCCGGCACCATGTCTGACGTCGTC AAGGGCGTCGAGTACG (SEQ ID NO: 17)

[0147] In other embodiments, reduced activity of proteases is achieved by modifying the gene encoding the protease. Examples of such modifications include, without limitation, a mutation, such as a deletion or disruption of the gene encoding said endogenous protease activity.

[0148] Accordingly, the invention relates to a filamentous fungal cell, such as a PMT-deficient Trichoderma cell, which has a first mutation that reduces or eliminates at least one endogenous protease activity compared to a parental filamentous fungal cell which does not have such protease deficient mutation, said filamentous fungal cell further comprising at least a second mutation in a PMT gene that reduces endogenous protein O-mannosyltransferase activity compared to a parental Trichoderma cell which does not have said second PMT-deficient mutation.

[0149] Deletion or disruption mutation includes without limitation knock-out mutation, a truncation mutation, a point mutation, a missense mutation, a substitution mutation, a frameshift mutation, an insertion mutation, a duplication mutation, an amplification mutation, a translocation mutation, or an inversion mutation, and that results in a reduction in the corresponding protease activity. Methods of generating at least one mutation in a protease encoding gene of interest are well known in the art and include, without limitation, random mutagenesis and screening, site-directed mutagenesis, PCR mutagenesis, insertional mutagenesis, chemical mutagenesis, and irradiation.

[0150] In certain embodiments, a portion of the protease encoding gene is modified, such as the region encoding the catalytic domain, the coding region, or a control sequence required for expression of the coding region. Such a control sequence of the gene may be a promoter sequence or a functional part thereof, i.e., a part that is sufficient for affecting expression of the gene. For example, a promoter sequence may be inactivated resulting in no expression or a weaker promoter may be substituted for the native promoter sequence to reduce expression of the coding sequence. Other control sequences for possible modification include, without limitation, a leader sequence, a propeptide sequence, a signal sequence, a transcription terminator, and a transcriptional activator.

[0151] Protease encoding genes that are present in filamentous fungal cells may also be modified by utilizing gene deletion techniques to eliminate or reduce expression of the gene. Gene deletion techniques enable the partial or complete removal of the gene thereby eliminating their expression. In such methods, deletion of the gene may be accomplished by homologous recombination using a plasmid that has been constructed to contiguously contain the 5' and 3' regions flanking the gene.

[0152] The protease encoding genes that are present in filamentous fungal cells may also be modified by introducing, substituting, and/or removing one or more nucleotides in the gene, or a control sequence thereof required for the transcription or translation of the gene. For example, nucleotides may be inserted or removed for the introduction of a stop codon, the removal of the start codon, or a frame-shift of the open reading frame. Such a modification may be accomplished by methods known in the art, including without limitation, site-directed mutagenesis and peR generated mutagenesis (see, for example, Botstein and Shortie, 1985, Science 229: 4719; Lo et al., 1985, Proceedings of the National Academy of Sciences USA 81: 2285; Higuchi et al., 1988, Nucleic Acids Research 16: 7351; Shimada, 1996, Meth. Mol. Bioi. 57: 157; Ho et al., 1989, Gene 77: 61; Horton et al., 1989, Gene 77: 61; and Sarkar and Sommer, 1990, BioTechniques 8: 404).

[0153] Additionally, protease encoding genes that are present in filamentous fungal cells may be modified by gene disruption techniques by inserting into the gene a disruptive nucleic acid construct containing a nucleic acid fragment homologous to the gene that will create a duplication of the region of homology and incorporate construct nucleic acid between the duplicated regions. Such a gene disruption can eliminate gene expression if the inserted construct separates the promoter of the gene from the coding region or interrupts the coding sequence such that a nonfunctional gene product results. A disrupting construct may be simply a selectable marker gene accompanied by 5' and 3' regions homologous to the gene. The selectable marker enables identification of transformants containing the disrupted gene.

[0154] Protease encoding genes that are present in filamentous fungal cells may also be modified by the process of gene conversion (see, for example, Iglesias and Trautner, 1983, Molecular General Genetics 189:5 73-76). For example, in the gene conversion a nucleotide sequence corresponding to the gene is mutagenized in vitro to produce a defective nucleotide sequence, which is then transformed into a Trichoderma strain to produce a defective gene. By homologous recombination, the defective nucleotide sequence replaces the endogenous gene. It may be desirable that the defective nucleotide sequence also contains a marker for selection of transformants containing the defective gene.

[0155] Protease encoding genes of the present disclosure that are present in filamentous fungal cells that express a recombinant polypeptide may also be modified by established anti-sense techniques using a nucleotide sequence complementary to the nucleotide sequence of the gene (see, for example, Parish and Stoker, 1997, FEMS Microbiology Letters 154: 151-157). In particular, expression of the gene by filamentous fungal cells may be reduced or inactivated by introducing a nucleotide sequence complementary to the nucleotide sequence of the gene, which may be transcribed in the strain and is capable of hybridizing to the mRNA produced in the cells. Under conditions allowing the complementary anti-sense nucleotide sequence to hybridize to the mRNA, the amount of protein translated is thus reduced or eliminated.

[0156] Protease encoding genes that are present in filamentous fungal cells may also be modified by random or specific mutagenesis using methods well known in the art, including without limitation, chemical mutagenesis (see, for example, Hopwood, The Isolation of Mutants in Methods in Microbiology (J. R. Norris and D. W. Ribbons, eds.) pp. 363-433, Academic Press, New York, 25 1970). Modification of the gene may be performed by subjecting filamentous fungal cells to mutagenesis and screening for mutant cells in which expression of the gene has been reduced or inactivated. The mutagenesis, which may be specific or random, may be performed, for example, by use of a suitable physical or chemical mutagenizing agent, use of a suitable oligonucleotide, subjecting the DNA sequence to peR generated mutagenesis, or any combination thereof. Examples of physical and chemical mutagenizing agents include, without limitation, ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), N-methyl-N'-nitrosogaunidine (NTG) O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues. When such agents are used, the mutagenesis is typically performed by incubating the filamentous fungal cells, such as Trichoderma cells, to be mutagenized in the presence of the mutagenizing agent of choice under suitable conditions, and then selecting for mutants exhibiting reduced or no expression of the gene.

[0157] In certain embodiments, the at least one mutation or modification in a protease encoding gene of the present disclosure results in a modified protease that has no detectable protease activity. In other embodiments, the at least one modification in a protease encoding gene of the present disclosure results in a modified protease that has at least 25% less, at least 50% less, at least 75% less, at least 90%, at least 95%, or a higher percentage less protease activity compared to a corresponding non-modified protease.

[0158] The filamentous fungal cells or Trichoderma fungal cells of the present disclosure may have reduced or no detectable protease activity of at least three, or at least four proteases selected from the group consisting of pep1, pep2, pep3, pep4, pep5, pep8, pep11, pep12, tsp1, slp1, slp2, slp3, slp5, slp6, slp7, gap1 and gap2. In preferred embodiment, a filamentous fungal cell according to the invention is a PMT-deficient filamentous fungal cell which has a deletion or disruption in at least 3 or 4 endogenous proteases, resulting in no detectable activity for such deleted or disrupted endogenous proteases and further comprising another mutation in a PMT gene that reduces endogenous protein O-mannosyltransferase activity compared to a parental Trichoderma cell which does not have said mutation.

[0159] In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in pep1, tsp1, and slp1. In other embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in gap1, slp1, and pep1. In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in slp2, pep1 and gap1. In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in slp2, pep1, gap1 and pep4. In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in slp2, pep1, gap1, pep4 and slp1. In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in slp2, pep1, gap1, pep4, slp1, and slp3. In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in slp2, pep1, gap1, pep4, slp1, slp3, and pep3. In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in slp2, pep1, gap1, pep4, slp1, slp3, pep3 and pep2. In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in slp2, pep1, gap1, pep4, slp1, slp3, pep3, pep2 and pep5. In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in slp2, pep1, gap1, pep4, slp1, slp3, pep3, pep2, pep5 and tsp1. In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in slp2, pep1, gap1, pep4, slp1, slp3, pep3, pep2, pep5, tsp1 and slp7. In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in slp2, pep1, gap1, pep4, slp1, slp3, pep3, pep2, pep5, tsp1, slp7 and slp8. In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in slp2, pep1, gap1, pep4, slp1, slp3, pep3, pep2, pep5, tsp1, slp7, slp8 and gap2. In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in at least three endogenous proteases selected from the group consisting of pep1, pep2, pep3, pep4, pep5, pep8, pep11, pep12, tsp1, slp2, slp3, slp7, gap1 and gap2. In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in at least three to six endogenous proteases selected from the group consisting of pep1, pep2, pep3, pep4, pep5, tsp1, slp1, slp2, slp3, gap1 and gap2. In certain embodiments, the PMT-deficient filamentous fungal cell or Trichoderma cell, has reduced or no detectable protease activity in at least seven to ten endogenous proteases selected from the group consisting of pep1, pep2, pep3, pep4, pep5, pep7, pep8, tsp1, slp1, slp2, slp3, slp5, slp6, slp7, slp8, tpp1, gap1 and gap2.

[0160] In one embodiment that may be combined with the precedent embodiments, the filamentous fungal cell of the invention does not comprise a deletion or disruption of an endogenous gene encoding a chaperone protein. In particular, said filamentous fungal cell of the invention expresses functional endogenous chaperone protein Protein Disulphide Isomerase (PDI).

Endogenous O-Mannosyltransferase in Filamentous Fungal Cells

[0161] O-mannosyltransferases are encoded by pmt genes in yeasts and filamentous fungi, which can be divided into three subfamilies, based on sequence homologies: PMT1, PMT2 and PMT4.

[0162] For example, in yeast S. cerevisiae, 7 different PMTs have been characterized: ScPMT1, ScPMT5 and ScPMT7 belong to the PMT1 subfamily. ScPMT2, ScPMT3 and ScPMT6 belong to the PMT2 subfamily and ScPMT4 belongs to the PMT4 subfamily. Such O-mannosyltransferases and their coding sequences may be identified and isolated from filamentous fungal cells and tested to determine whether reduction in their activity enables the reduction of O-mannosylation on secreted O-mannosylated recombinant protein preferably not affecting the production of such recombinant polypeptide from the filamentous fungal cell. Methods for identifying and isolating PMTs are well known in the art. An identified O-mannosyltransferase may then be tested by deleting the gene encoding the identified O-mannosyltransferase from a filamentous fungal cell that expresses a recombinant O-mannosylated protein, such a heterologous or mammalian O-mannosylated protein, and determining whether the deletion results in a decrease in total O-mannosyltransferase activity of the cell, preferably not affecting the level of production of the expressed recombinant protein. Methods for deleting genes and measuring levels of produced protein are well known in the art and include the methods described herein.

[0163] Three O-mannosyltransferases have been identified in Trichoderma fungal cells: pmt1, pmt2 and pmt3, belonging respectively based on sequence homologies to the PMT4, PMT1 and PMT2 subfamily.

[0164] Examples of suitable O-mannosyltransferase include, without limitation, Trichoderma reesei pmt1 (SEQ ID NO: 2), Trichoderma reesei pmt2 (SEQ ID NO: 3), Trichoderma reesei pmt3 (SEQ ID NO: 4) and homologs thereof. FIG. 5 shows phylogeny of pmt homologs in selected filamentous fungi and FIG. 6 shows an alignment of pmt1 conserved domains among different species.

[0165] In a preferred embodiment, said PMT-deficient filamentous fungal cell, e.g., a Trichoderma cell, has at least one mutation in a PMT gene selected from the group consisting of: [0166] a) PMT1 gene comprising the polynucleotide of SEQ ID NO:1, [0167] b) a functional homologous gene of PMT1 gene, which functional homologous gene is capable of restoring parental O-mannosylation level by functional complementation when introduced into a T. reesei strain having a disruption in said PMT1 gene, and, [0168] c) a polynucleotide encoding a polypeptide having at least 50%, at least 60%, at least 70%, at least 90%, or at least 95% identity with SEQ ID NO:2, said polypeptide having protein O-mannosyltransferase activity.

[0169] More preferably, said PMT-deficient filamentous fungal cell, e.g., a Trichoderma cell, has at least one mutation in a PMT gene which [0170] a) has a polynucleotide encoding a polypeptide having at least 50%, at least 60%, at least 70%, at least 90%, or at least 95% identity with SEQ ID NO:2, and, [0171] b) is capable of restoring, at least 50%, preferably about 100% of parental O-mannosylation level by functional complementation when introduced into a T. reesei strain having a disruption in a T. reesei PMT1 gene.

[0172] Methods for disrupting PMT1 gene in T. reesei are disclosed in the Examples below.

[0173] Sequences of homologs of pmt1 in filamentous fungi can be found in the databases using sequence alignment search tools, such as BLAST algorithm. It includes without limitation, A. oryzae gi391865791, EIT75070.1 (SEQ ID NO:5), A. niger gi317036343, XP_001398147.2 (SEQ ID NO:6), A. nidulans gi67522004, XP_659063.1 (SEQ ID NO:7), T. virens gi358379774, EHK17453.1 (SEQ ID NO:8), T. atroviride gi358400594, EHK49920.1 (SEQ ID NO:9), F. oxysporum gi342879728, EGU80965.1 (SEQ ID NO:10), G. zeae gi46107450, XP_380784.1 (SEQ ID NO:11), M. thermophila gi367020262, XP_003659416.1 (SEQ ID NO:12), N. crassa gi164423013, XP_963926.2 (SEQ ID NO:13), and P. chrysogenum gi255953619, XP_002567562.1 (SEQ ID NO:14).

Reducing Endogenous Protein O-Mannosyltransferase Activity in Filamentous Fungal Cell of the Invention

[0174] The PMT-deficient filamentous fungal cells according to the invention have reduced activity of at least one O-mannosyltransferase activity, in order to reduce or decrease O-mannosylation in said filamentous fungal cell, preferably Trichoderma cell.

[0175] The activity of said O-mannosyltransferases found in filamentous fungal cells can be reduced by any method known to those of skill in the art. In some embodiments reduced activity of O-mannosyltransferases is achieved by reducing the expression of the O-mannosyltransferases, for example, by promoter modification or RNAi.

[0176] In other embodiments, reduced activity of O-mannosyltransferases is achieved by modifying the gene encoding the O-mannosyltransferase. Examples of such modifications include, without limitation, a mutation, such as a deletion or disruption of the gene encoding said endogenous O-mannosyltransferase activity.

[0177] Deletion or disruption mutation can be performed as described in the above sections, in particular in relation to deletion or disruption of genes encoding proteases. These includes without limitation knock-out mutation, a truncation mutation, a point mutation, a missense mutation, a substitution mutation, a frameshift mutation, an insertion mutation, a duplication mutation, an amplification mutation, a translocation mutation, or an inversion mutation, and that results in a reduction in the corresponding O-mannosyltransferase activity.

[0178] In certain embodiments, the mutation or modification in an O-mannosyltransferase (PMT) encoding gene of the present disclosure results in a modified O-mannosyltransferase that has no detectable O-mannosyltransferase activity. In other embodiments, the at least one modification in a O-mannosyltransferase encoding gene of the present disclosure results in a modified O-mannosyltransferase that has at least 25% less, at least 50% less, at least 75% less, at least 90%, at least 95%, or a higher percentage less O-mannosyltransferase activity compared to a corresponding non-modified O-mannosyltransferase.

[0179] In preferred embodiment, a mutation that reduces endogenous protein O-mannosyltransferase activity in a PMT-deficient filamentous fungal cell, e.g. Trichoderma cell, is a PMT-deficient cell which has a deletion or disruption of a PMT gene encoding said O-mannosyltransferase activity, resulting in no detectable expression for such deleted or disrupted PMT gene.

[0180] One specific embodiment of the present invention is a PMT-deficient Trichoderma reesei cell, comprising [0181] a. at least a first mutation that reduces an endogenous protease activity compared to a parental Trichoderma cell which does not have said first mutation, and, [0182] b. at least a disruption or deletion of PMT1 gene of T. reesei. [0183] c. optionally, said cell further express a heterologous protein with serine or threonine, which has reduced O-mannosylation due to said mutation in said PMT gene.

[0184] The reduction (or decrease) of O-mannosyltransferase activity may be determined by comparing the O-mannosylation level of a heterologous protein in PMT-deficient filamentous fungal cell according to the invention, with the O-mannosylation level of a heterologous protein in the parental cell which does not have said PMT-deficient mutation.

[0185] In specific embodiments, the PMT-deficient filamentous fungal cell according to the invention expresses a heterologous protein which has reduced O-mannosylation due to said mutation in said PMT gene and the O-mannosylation level on the expressed heterologous protein is at least 20%, 40%, 50%, 60%, 70%, 80%, or 90% lower than the O-mannosylation level of the heterologous protein when expressed in the parental filamentous fungal cell which does not have said second PMT-deficient mutation.

[0186] O-mannosylation level may also be determined as mole % of O-mannosylated polypeptide per total polypeptide as produced by the host cell of the invention. Analytical methods, such as MALDI TOF MS analysis may be used to determine O-mannosylation level as described in detail in the Example 1 below, section entitled "Analyses of Dpmt1 strains M403, M404, M406 and M407. In brief, a polypeptide as produced by the PMT-deficient filamentous fungal cell is purified to determine its O-mannoslyation level. Non O-mannosylated, and O-mannosylated structure of the polypeptide are separated and quantified by MALDI-TOF MS analysis. For example, the quantification of O-mannosylation level may be performed by determining area values or intensity of the different peaks of MALDI-TOF MS spectrum. An O-mannosylation level of 5% as determined by such method, using area values or intensity, reflects that about 95% (mol %) of the analysed polypeptides in the composition are not O-mannosylatedln specific embodiments, the PMT-deficient filamentous fungal cell expresses a heterologous protein which has reduced O-mannosylation due to said mutation in said PMT gene, and the O-mannosylation level on the expressed heterologous protein (for example, as defined above by determining area or intensity values of MALDI TOF MS spectrum peaks) is reduced to less than 25%, 20%, 17%, 15%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%, or 0.5% (as mole % of mannose residues per polypeptide chain).

[0187] In an embodiment, the heterologous protein with reduced O-mannosylation is selected from the group consisting of: [0188] a) an immunoglubulin, such as IgG, [0189] b) a light chain or heavy chain of an immunoglobulin, [0190] c) a heavy chain or alight chain of an antibody, [0191] d) a single chain antibody, [0192] e) a camelid antibody, [0193] f) a monomeric or multimeric single domain antibody, [0194] g) a FAb-fragment, a FAb2-fragment, and, [0195] h) their antigen-binding fragments.

[0196] In a specific embodiment, a mutation that reduces endogenous O-mannosyltransferase activity is a deletion or a disruption of a PMT gene encoding said engogenous protein O-mannosyltransferase activity. For example in Trichoderma cell, a mutation that reduces endogenous O-mannosyltransferase activity is a deletion or a disruption of a PMT1 gene.

Filamentous Fungal Cell for Producing Glycoproteins with Reduced O-Mannosylation and Mammalian-Like N-Glycans

[0197] The filamentous fungal cells according to the present invention may be useful in particular for producing heterologous glycoproteins with reduced O-mannosylation and mammalian-like N-glycans, such as complex N-glycans.

[0198] Accordingly, in one aspect, the filamentous fungal cell is further genetically modified to produce a mammalian-like N-glycan, thereby enabling in vivo production of glycoprotein with no or reduced O-mannosylation and with mammalian-like N-glycan as major glycoforms.

[0199] In certain embodiments, this aspect includes methods of producing glycoproteins with mammalian-like N-glycans in a Trichoderma cell.

[0200] In certain embodiment, the glycoprotein comprises, as a major glycoform, the mammalian-like N-glycan having the formula [(Gal.beta.4).sub.xGlcNAc.beta.2].sub.zMan.alpha.3([(Gal.beta.4).sub.yGlc- NAc.beta.2].sub.wMan.alpha.6)Man{.beta.4GlcNAc.beta.GlcNAc, where ( ) defines a branch in the structure, where [ ] or { } define a part of the glycan structure either present or absent in a linear sequence, and where x, y, z and w are 0 or 1, independently. In an embodiment w and z are 1.

[0201] In certain embodiments, the glycoprotein comprises, as a major glycoform, mammalian-like N-glycan selected from the group consisting of: [0202] i. Man.alpha.3[Man.alpha.6(Man.alpha.3)Man.alpha.6]Man.beta.4GlcNA.beta.4Glc- NAc (Man5 glycoform); [0203] ii. GlcNAc.beta.2Man.alpha.3[Man.alpha.6(Man.alpha.3)Man.alpha.6]Man.beta.4Gl- cNA.beta.4GlcNAc (GlcNAcMan5 glycoform); [0204] iii. Man.alpha.6(Man.alpha.3)Man.beta.4GlcNA.beta.4GlcNAc (Man3 glycoform); [0205] iv. Man.alpha.6(GlcNAc.beta.2Man.alpha.3)Man.beta.4GlcNA.beta.4GlcNAc (GlcNAcMan3) or, [0206] v. complex type N-glycans selected from the G0, G1, or G2 glycoform.

[0207] In an embodiment, the glycoprotein composition with mammalian-like N-glycans, preferably produced by an alg3 knock-out strain, include glycoforms that essentially lack or are devoid of glycans Man.alpha.3[Man.alpha.6(Man.alpha.3)Man.alpha.6]Man.beta.4GlcNA.beta.4Glc- NAc (Man5). In specific embodiments, the filamentous fungal cell produces glycoproteins with, as major glycoform, the trimannosyl N-glycan structure Man.alpha.3[Man.alpha.6]Man.beta.4GlcNAc.beta.4GlcNAc. In other embodiments, the filamentous fungal cell procudes glycoproteins with, as major glycoform, the G0 N-glycan structure GlcNAc.beta.2Man.alpha.3[GlcNAc.beta.2Man.alpha.6]Man.beta.4GlcNAc.beta.4- GlcNAc.

[0208] In certain embodiments, the PMT-deficient filamentous fungal cell of the invention produces glycoprotein composition with a mixture of different N-glycans.

[0209] In some embodiments, Man3GlcNAc2 N-glycan (i.e. Man.alpha.3[Man.alpha.6]Man.beta.4GlcNAc.beta.4GlcNAc) represents at least 10%, at least 20%, at least at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more of total (mol %) neutral N-glycans of a heterologous protein with reduced O-mannosylation, as expressed in a filamentous fungal cells of the invention.

[0210] In other embodiments, GlcNAc2Man3 N-glycan (for example G0 GlcNAc.beta.2Man.alpha.3[GlcNAc.beta.2Man.alpha.6]Man.beta.4GlcNAc.beta.4- GlcNAc) represents at least 10%, at least 20%, at least at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more of total (mol %) neutral N-glycans of a heterologous protein with reduced O-mannosylation, as expressed in a filamentous fungal cells of the invention.

[0211] In other embodiments, GalGlcNAc2Man3GlcNAc2 N-glycan (for example G1 N-glycan) represents at least 10%, at least 20%, at least at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more of total (mol %) neutral N-glycans of a heterologous protein with reduced O-mannosylation, as expressed in a filamentous fungal cells of the invention.

[0212] In other embodiments, Gal2GlcNAc2Man3GlcNAc2 N-glycan (for example G2 N-glycan) represents at least 10%, at least 20%, at least at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more of total (mol %) neutral N-glycans of a heterologous protein with reduced O-mannosylation, as expressed in a filamentous fungal cells of the invention.

[0213] In other embodiments, complex type N-glycan represents at least 10%, at least 20%, at least at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more of total (mol %) neutral N-glycans of a heterologous protein with reduced O-mannosylation, as expressed in a filamentous fungal cells of the invention.

[0214] In other embodiments, hybrid type N-glycan represents at least 10%, at least 20%, at least at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more of total (mol %) neutral N-glycans of a heterologous protein with reduced O-mannosylation, as expressed in a filamentous fungal cells of the invention.

[0215] In other embodiments, less than 0.5%, 0.1%, 0.05%, or less than 0.01% of the N-glycan of the glycoprotein composition produced by the host cell of the invention, comprises galactose. In certain embodiments, none of N-glycans comprise galactose.

[0216] The Neu5Gc and Gal.alpha.- (non-reducing end terminal Gal.alpha.3Gal.beta.4GlcNAc) structures are known xenoantigenic (animal derived) modifications of antibodies which are produced in animal cells such as CHO cells. The structures may be antigenic and, thus, harmful even at low concentrations. The filamentous fungi of the present invention lack biosynthetic pathways to produce the terminal Neu5Gc and Gal.alpha.- structures. In an embodiment that may be combined with the preceding embodiments less than 0.1%, 0.01%, 0.001% or 0% of the N-glycans and/or O-glycans of the glycoprotein composition comprises Neu5Gc and/or Gal.alpha.- structure. In an embodiment that may be combined with the preceding embodiments, less than 0.1%, 0.01%, 0.001% or 0% of the N-glycans and/or O-glycans of the antibody composition comprises Neu5Gc and/or Gal.alpha.- structure.

[0217] The filamentous fungal cells of the present invention lack genes to produce fucosylated heterologous proteins. In an embodiment that may be combined with the preceding embodiments, less than 0.1%, 0.01%, 0.001%, or 0% of the N-glycan of the glycoprotein composition comprises core fucose structures. In an embodiment that may be combined with the preceding embodiments, less than 0.1%, 0.01%, 0.001%, or 0% of the N-glycan of the antibody composition comprises core fucose structures.

[0218] The terminal Gal.beta.4GlcNAc structure of N-glycan of mammalian cell produced glycans affects bioactivity of antibodies and Gal.beta.3GlcNAc may be xenoantigen structure from plant cell produced proteins. In an embodiment that may be combined with one or more of the preceding embodiments, less than 0.1%, 0.01%, 0.001%, or 0% of N-glycan of the glycoprotein composition comprises terminal galactose epitopes Gal.beta.3/4GlcNAc. In an embodiment that may be combined with one or more of the preceding embodiments, less than 0.1%, 0.01%, 0.001%, or 0% of the N-glycan of the antibody composition comprises terminal galactose epitopes Gal.beta.3/4GlcNAc.

[0219] Glycation is a common post-translational modification of proteins, resulting from the chemical reaction between reducing sugars such as glucose and the primary amino groups on protein. Glycation occurs typically in neutral or slightly alkaline pH in cell cultures conditions, for example, when producing antibodies in CHO cells and analysing them (see, for example, Zhang et al. (2008) Unveiling a glycation hot spot in a recombinant humanized monoclonal antibody. Anal Chem. 80(7):2379-2390). As filamentous fungi of the present invention are typically cultured in acidic pH, occurrence of glycation is reduced. In an embodiment that may be combined with the preceding embodiments, less than 1.0%, 0.5%, 0.1%, 0.01%, 0.001%, or 0% of the glycoprotein composition comprises glycation structures. In an embodiment that may be combined with the preceding embodiments, less than 1.0%, 0.5%, 0.1%, 0.01%, 0.001%, or 0% of the antibody composition comprises glycation structures.

[0220] In one embodiment, the glycoprotein composition, such as an antibody is devoid of one, two, three, four, five, or six of the structures selected from the group of Neu5Gc, terminal Gal.alpha.3Gal.beta.4GlcNAc, terminal Gal.beta.4GlcNAc, terminal Gal.beta.3GlcNAc, core linked fucose and glycation structures.

[0221] In certain embodiments, such glycoprotein protein with mammalian-like N-glycan and reduced O-mannosylation, as produced in the filamentous fungal cell of the invention, is a therapeutic protein. Therapeutic proteins may include immunoglobulin, or a protein fusion comprising a Fc fragment or other therapeutic glycoproteins, such as antibodies, erythropoietins, interferons, growth hormones, albumins or serum albumin, enzymes, or blood-clotting factors and may be useful in the treatment of humans or animals. For example, the glycoproteins with mammalian-like N-glycan and reduced O-mannosylation as produced by the filamentous fungal cell according to the invention may be a therapeutic glycoprotein such as rituximab.

[0222] Methods for producing glycoproteins with mammalian-like N-glycans in filamentous fungal cells are also described for example in WO2012/069593.

[0223] In one aspect, the filamentous fungal cell according to the invention as described above, is further genetically modified to mimick the traditional pathway of mammalian cells, starting from Man5 N-glycans as acceptor substrate for GnTI, and followed sequentially by GnT1, mannosidase II and GnTII reaction steps (hereafter referred as the "traditional pathway" for producing G0 glycoforms). In one variant, a single recombinant enzyme comprising the catalytic domains of GnTI and GnTII, is used.

[0224] Alternatively, in a second aspect, the filamentous fungal cell according to the invention as described above is further genetically modified to have alg3 reduced expression, allowing the production of core Man.sub.3GlcNAc.sub.2 N-glycans, as acceptor substrate for GnTI and GnTII subsequent reactions and bypassing the need for mannosidase .alpha.1,2 or mannosidase II enzymes (the reduced "alg3" pathway). In one variant, a single recombinant enzyme comprising the catalytic domains of GnTI and GnTII, is used.

[0225] In such embodiments for mimicking the traditional pathway for producing glycoproteins with mammalian-like N-glycans, a Man.sub.5 expressing filamentous fungal cell, such as T. reesei strain, may be transformed with a GnTI or a GnTII/GnTI fusion enzyme using random integration or by targeted integration to a known site known not to affect Man5 glycosylation. Strains that synthesise GlcNAcMan5 N-glycan for production of proteins having hybrid type glycan(s) are selected. The selected strains are further transformed with a catalytic domain of .alpha. mannosidase II-type mannosidase capable of cleaving Man5 structures to generate GlcNAcMan3 for production of proteins having the corresponding GlcNAcMan3 glycoform or their derivative(s). In certain embodiments, mannosidase II-type enzymes belong to glycoside hydrolase family 38 (cazy.org/GH38_all.html). Characterized enzymes include enzymes listed in cazy.org/GH38_characterized.html. Especially useful enzymes are Golgi-type enzymes that cleaving glycoproteins, such as those of subfamily .alpha.-mannosidase II (Man2A1;ManA2). Examples of such enzymes include human enzyme AAC50302, D. melanogaster enzyme (Van den Elsen J. M. et al (2001) EMBO J. 20: 3008-3017), those with the 3D structure according to PDB-reference 1HTY, and others referenced with the catalytic domain in PDB. For cytoplasmic expression, the catalytic domain of the mannosidase is typically fused with an N-terminal targeting peptide (for example as disclosed in the above Section) or expressed with endogenous animal or plant Golgi targeting structures of animal or plant mannosidase II enzymes. After transformation with the catalytic domain of .alpha. mannosidase II-type mannosidase, strains are selected that produce GlcNAcMan3 (if GnTI is expressed) or strains are selected that effectively produce GlcNAc2Man3 (if a fusion of GnTI and GnTII is expressed). For strains producing GlcNAcMan3, such strains are further transformed with a polynucleotide encoding a catalytic domain of GnTII and transformant strains that are capable of producing GlcNAc2Man3GlcNAc2 are selected.

[0226] In such embodiment for mimicking the traditional pathway, the filamentous fungal cell is a PMT-deficient filamentous fungal cell as defined in previous sections, and further comprising one or more polynucleotides encoding a polypeptide selected from the group consisting of: [0227] i) .alpha.1,2 mannosidase, [0228] ii) N-acetylglucosaminyltransferase I catalytic domain, [0229] iii) .alpha. mannosidase II, [0230] iv) N-acetylglucosaminyltransferase II catalytic domain, [0231] v) .beta.1,4 galactosyltransferase, and, [0232] vi) fucosyltransferase.

[0233] In embodiments using the reduced alg3 pathway, the filamentous fungal cell, such as a Trichoderma cell, has a reduced level of activity of a dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase compared to the level of activity in a parent host cell. Dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase (EC 2.4.1.130) transfers an alpha-D-mannosyl residue from dolichyl-phosphate D-mannose into a membrane lipid-linked oligosaccharide. Typically, the dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase enzyme is encoded by an alg3 gene. In certain embodiments, the filamentous fungal cell for producing glycoproteins with mammalian-like N-glycans has a reduced level of expression of an alg3 gene compared to the level of expression in a parent strain.

[0234] More preferably, the filamentous fungal cell comprises a mutation of alg3. The ALG3 gene may be mutated by any means known in the art, such as point mutations or deletion of the entire alg3 gene. For example, the function of the alg3 protein is reduced or eliminated by the mutation of alg3. In certain embodiments, the alg3 gene is disrupted or deleted from the filamentous fungal cell, such as Trichoderma cell. In certain embodiments, the filamentous fungal cell is a T. reesei cell. SEQ ID NOs: 36 and 37 provide, the nucleic acid and amino acid sequences of the alg3 gene in T. reesei, respectively. In an embodiment the filamentous fungal cell is used for the production of a glycoprotein, wherein the glycan(s) comprise or consist of Man.alpha.3[Man.alpha.6]Man.beta.4GlcNAc.beta.4GlcNAc, and/or a non-reducing end elongated variant thereof.

[0235] In certain embodiments, the filamentous fungal cell has a reduced level of activity of an alpha-1,6-mannosyltransferase compared to the level of activity in a parent strain. Alpha-1,6-mannosyltransferase (EC 2.4.1.232) transfers an alpha-D-mannosyl residue from GDP-mannose into a protein-linked oligosaccharide, forming an elongation initiating alpha-(1->6)-D-mannosyl-D-mannose linkage in the Golgi apparatus. Typically, the alpha-1,6-mannosyltransferase enzyme is encoded by an och1 gene. In certain embodiments, the filamentous fungal cell has a reduced level of expression of an och1 gene compared to the level of expression in a parent filamentous fungal cell. In certain embodiments, the och1 gene is deleted from the filamentous fungal cell.

[0236] The filamentous fungal cells used in the methods of producing glycoprotein with mammalian-like N-glycans may further contain a polynucleotide encoding an N-acetylglucosaminyltransferase I catalytic domain (GnTI) that catalyzes the transfer of N-acetylglucosamine to a terminal Man.alpha.3 and a polynucleotide encoding an N-acetylglucosaminyltransferase II catalytic domain (GnTII), that catalyses N-acetylglucosamine to a terminal Man.alpha.6 residue of an acceptor glycan to produce a complex N-glycan. In one embodiment, said polynucleotides encoding GnTI and GnTII are linked so as to produce a single protein fusion comprising both catalytic domains of GnTI and GnTII.

[0237] As disclosed herein, N-acetylglucosaminyltransferase I (GlcNAc-TI; GnTI; EC 2.4.1.101) catalyzes the reaction UDP-N-acetyl-D-glucosamine+3-(alpha-D-mannosyl)-beta-D-mannosyl-R<=&gt- ;UDP+3-(2-(N-acetyl-beta-D-glucosaminyl)-alpha-D-mannosyl)-beta-D-mannosyl- -R, where R represents the remainder of the N-linked oligosaccharide in the glycan acceptor. An N-acetylglucosaminyltransferase I catalytic domain is any portion of an N-acetylglucosaminyltransferase I enzyme that is capable of catalyzing this reaction. GnTI enzymes are listed in the CAZy database in the glycosyltransferase family 13 (cazy.org/GT13_all). Enzymatically characterized species includes A. thaliana AAR78757.1 (U.S. Pat. No. 6,653,459), C. elegans AAD03023.1 (Chen S. et al J. Biol. Chem 1999; 274(1):288-97), D. melanogaster AAF57454.1 (Sarkar & Schachter Biol Chem. 2001 February; 382(2):209-17); C. griseus AAC52872.1 (Puthalakath H. et al J. Biol. Chem 1996 271(44):27818-22); H. sapiens AAA52563.1 (Kumar R. et al Proc Natl Acad Sci USA. 1990 December; 87(24):9948-52); M. auratus AAD04130.1 (Opat As et al Biochem J. 1998 Dec. 15; 336 (Pt 3):593-8), (including an example of deactivating mutant), Rabbit, O. cuniculus AAA31493.1 (Sarkar M et al. Proc Natl Acad Sci USA. 1991 Jan. 1; 88(1):234-8). Amino acid sequences for N-acetylglucosaminyltransferase I enzymes from various organisms are described for example in PCT/EP2011/070956. Additional examples of characterized active enzymes can be found at cazy.org/GT13_characterized. The 3D structure of the catalytic domain of rabbit GnTI was defined by X-ray crystallography in Unligil U M et al. EMBO J. 2000 Oct. 16; 19(20):5269-80. The Protein Data Bank (PDB) structures for GnTI are 1FO8, 1FO9, 1FOA, 2AM3, 2AM4, 2AM5, and 2APC. In certain embodiments, the N-acetylglucosaminyltransferase I catalytic domain is from the human N-acetylglucosaminyltransferase I enzyme (SEQ ID NO: 38) or variants thereof. In certain embodiments, the N-acetylglucosaminyltransferase I catalytic domain contains a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to amino acid residues 84-445 of SEQ ID NO: 38. In some embodiments, a shorter sequence can be used as a catalytic domain (e.g. amino acid residues 105-445 of the human enzyme or amino acid residues 107-447 of the rabbit enzyme; Sarkar et al. (1998) Glycoconjugate J 15:193-197). Additional sequences that can be used as the GnTI catalytic domain include amino acid residues from about amino acid 30 to 445 of the human enzyme or any C-terminal stem domain starting between amino acid residue 30 to 105 and continuing to about amino acid 445 of the human enzyme, or corresponding homologous sequence of another GnTI or a catalytically active variant or mutant thereof. The catalytic domain may include N-terminal parts of the enzyme such as all or part of the stem domain, the transmembrane domain, or the cytoplasmic domain.

[0238] As disclosed herein, N-acetylglucosaminyltransferase II (GlcNAc-TII; GnTII; EC 2.4.1.143) catalyzes the reaction UDP-N-acetyl-D-glucosamine+6-(alpha-D-mannosyl)-beta-D-mannosyl-R<=&gt- ;UDP+6-(2-(N-acetyl-beta-D-glucosaminyl)-alpha-D-mannosyl)-beta-D-mannosyl- -R, where R represents the remainder of the N-linked oligosaccharide in the glycan acceptor. An N-acetylglucosaminyltransferase II catalytic domain is any portion of an N-acetylglucosaminyltransferase II enzyme that is capable of catalyzing this reaction. Amino acid sequences for N-acetylglucosaminyltransferase II enzymes from various organisms are listed in WO2012069593. In certain embodiments, the N-acetylglucosaminyltransferase II catalytic domain is from the human N-acetylglucosaminyltransferase II enzyme (SEQ ID NO: 39) or variants thereof. Additional GnTII species are listed in the CAZy database in the glycosyltransferase family 16 (cazy.org/GT16_all). Enzymatically characterized species include GnTII of C. elegans, D. melanogaster, Homo sapiens (NP_002399.1), Rattus norvegicus, Sus scrofa (cazy.org/GT16_characterized). In certain embodiments, the N-acetylglucosaminyltransferase II catalytic domain contains a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to amino acid residues from about 30 to about 447 of SEQ ID NO: 39. The catalytic domain may include N-terminal parts of the enzyme such as all or part of the stem domain, the transmembrane domain, or the cytoplasmic domain.

[0239] In embodiments where the filamentous fungal cell contains a fusion protein of the invention, the fusion protein may further contain a spacer in between the N-acetylglucosaminyltransferase I catalytic domain and the N-acetylglucosaminyltransferase II catalytic domain. In certain embodiments, the spacer is an EGIV spacer, a 2.times.G4S spacer, a 3.times.G4S spacer, or a CBHI spacer. In other embodiments, the spacer contains a sequence from a stem domain.

[0240] For ER/Golgi expression the N-acetylglucosaminyltransferase I and/or N-acetylglucosaminyltransferase II catalytic domain is typically fused with a targeting peptide or a part of an ER or early Golgi protein, or expressed with an endogenous ER targeting structures of an animal or plant N-acetylglucosaminyltransferase enzyme. In certain preferred embodiments, the N-acetylglucosaminyltransferase I and/or N-acetylglucosaminyltransferase II catalytic domain contains any of the targeting peptides of the invention as described in the section entitled "Targeting sequences". Preferably, the targeting peptide is linked to the N-terminal end of the catalytic domain. In some embodiments, the targeting peptide contains any of the stem domains of the invention as described in the section entitled "Targeting sequences". In certain preferred embodiments, the targeting peptide is a Kre2/Mnt1 targeting peptide. In other embodiments, the targeting peptide further contains a transmembrane domain linked to the N-terminal end of the stem domain or a cytoplasmic domain linked to the N-terminal end of the stem domain. In embodiments where the targeting peptide further contains a transmembrane domain, the targeting peptide may further contain a cytoplasmic domain linked to the N-terminal end of the transmembrane domain.

[0241] The filamentous fungal cells may also contain a polynucleotide encoding a UDP-GlcNAc transporter. The polynucleotide encoding the UDP-GlcNAc transporter may be endogenous (i.e., naturally present) in the host cell, or it may be heterologous to the filamentous fungal cell.

[0242] In certain embodiments, the filamentous fungal cell may further contain a polynucleotide encoding a .alpha.-1,2-mannosidase. The polynucleotide encoding the .alpha.-1,2-mannosidase may be endogenous in the host cell, or it may be heterologous to the host cell. Heterologous polynucleotides are especially useful for a host cell expressing high-mannose glycans transferred from the Golgi to the ER without effective exo-.alpha.-2-mannosidase cleavage. The .alpha.-1,2-mannosidase may be .alpha. mannosidase I type enzyme belonging to the glycoside hydrolase family 47 (cazy.org/GH47_all.html). In certain embodiments the .alpha.-1,2-mannosidase is an enzyme listed at cazy.org/GH47_characterized.html. In particular, the .alpha.-1,2-mannosidase may be an ER-type enzyme that cleaves glycoproteins such as enzymes in the subfamily of ER .alpha.-mannosidase I EC 3.2.1.113 enzymes. Examples of such enzymes include human .alpha.-2-mannosidase 1B (AAC26169), a combination of mammalian ER mannosidases, or a filamentous fungal enzyme such as .alpha.-1,2-mannosidase (MDS1) (T. reesei AAF34579; Maras M et al J Biotech. 77, 2000, 255, or Trire 45717). For ER expression, the catalytic domain of the mannosidase is typically fused with a targeting peptide, such as HDEL, KDEL, or part of an ER or early Golgi protein, or expressed with an endogenous ER targeting structures of an animal or plant mannosidase I enzyme.

[0243] In certain embodiments, the filamentous fungal cell may also further contain a polynucleotide encoding a galactosyltransferase. Galactosyltransferases transfer .beta.-linked galactosyl residues to terminal N-acetylglucosaminyl residue. In certain embodiments the galactosyltransferase is a .beta.-1,4-galactosyltransferase. Generally, .beta.-1,4-galactosyltransferases belong to the CAZy glycosyltransferase family 7 (cazy.org/GT7_all.html) and include .beta.-N-acetylglucosaminyl-glycopeptide .beta.-1,4-galactosyltransferase (EC 2.4.1.38), which is also known as N-acetylactosamine synthase (EC 2.4.1.90). Useful subfamilies include .beta.4-GalT1, .beta.4-GalT-I, -III, -IV, -V, and -VI, such as mammalian or human .beta.4-GalTI or .beta.4GalT-II, -III, -IV, -V, and -VI or any combinations thereof. .beta.4-GalT1, .beta.4-GalTII, or .beta.4-GalTIII are especially useful for galactosylation of terminal GlcNAc.beta.2-structures on N-glycans such as GlcNAcMan3, GlcNAc2Man3, or GlcNAcMan5 (Guo S. et al. Glycobiology 2001, 11:813-20). The three-dimensional structure of the catalytic region is known (e.g. (2006) J. Mol. Biol. 357: 1619-1633), and the structure has been represented in the PDB database with code 2FYD. The CAZy database includes examples of certain enzymes. Characterized enzymes are also listed in the CAZy database at cazy.org/GT7_characterized.html. Examples of useful .beta.4GalT enzymes include .beta.4GalT1, e.g. bovine Bos taurus enzyme AAA30534.1 (Shaper N. L. et al Proc. Natl. Acad. Sci. U.S.A. 83 (6), 1573-1577 (1986)), human enzyme (Guo S. et al. Glycobiology 2001, 11:813-20), and Mus musculus enzyme AAA37297 (Shaper, N. L. et al. 1998 J. Biol. Chem. 263 (21), 10420-10428); .beta.4GalTII enzymes such as human .beta.4GalTII BAA75819.1, Chinese hamster Cricetulus griseus AAM77195, Mus musculus enzyme BAA34385, and Japanese Medaka fish Oryzias latipes BAH36754; and .beta.4GaTIII enzymes such as human .beta.4GaTIII BAA75820.1, Chinese hamster Cricetulus griseus AAM77196 and Mus musculus enzyme AAF22221.

[0244] The galactosyltransferase may be expressed in the plasma membrane of the host cell. A heterologous targeting peptide, such as a Kre2 peptide described in Schwientek J. Biol. Chem 1996 3398, may be used. Promoters that may be used for expression of the galactosyltransferase include constitutive promoters such as gpd, promoters of endogenous glycosylation enzymes and glycosyltransferases such as mannosyltransferases that synthesize N-glycans in the Golgi or ER, and inducible promoters of high-yield endogenous proteins such as the cbh1 promoter.

[0245] In certain embodiments of the invention where the filamentous fungal cell contains a polynucleotide encoding a galactosyltransferase, the filamentous fungal cell also contains a polynucleotide encoding a UDP-Gal 4 epimerase and/or UDP-Gal transporter. In certain embodiments of the invention where the filamentous fungal cell contains a polynucleotide encoding a galactosyltransferase, lactose may be used as the carbon source instead of glucose when culturing the host cell. The culture medium may be between pH 4.5 and 7.0 or between 5.0 and 6.5. In certain embodiments of the invention where the filamentous fungal cell contains a polynucleotide encoding a galactosyltransferase and a polynucleotide encoding a UDP-Gal 4 epimerase and/or UDP-Gal transporter, a divalent cation such as Mn2+, Ca2+ or Mg2+ may be added to the cell culture medium.

[0246] Accordingly, in certain embodiments, the filamentous fungal cell of the invention, for example, selected among Neurospora, Trichoderma, Myceliophthora or Chrysosporium cell, and more preferably Trichoderma reesei cell, may comprise the following features: [0247] a) a mutation in at least one endogenous protease that reduces or eliminates the activity of said endogenous protease, preferably the protease activity of two or three or more endogenous proteases is reduced, for example, pep1, tsp1, gap1 and/or slp1 proteases, in order to improve production or stability of a heterologous protein to be produced, [0248] b) a mutation in a PMT gene, for example T. reesei pmt1 gene, that reduces or eliminates endogenous O-mannosyltransferase activity compared to a parental Trichoderma cell which does not have said second mutation, [0249] c) a polynucleotide encoding a protein having at least one serine or threonine, preferably a heterologous glycoprotein, such as an immunoglobulin, an antibody, or a protein fusion comprising Fc fragment of an immunoglobulin. [0250] d) optionally, a deletion or disruption of the alg3 gene, [0251] e) optionally, a polynucleotide encoding N-acetylglucosaminyltransferase I catalytic domain and a polynucleotide encoding N-acetylglucosaminyltransferase catalytic domain, [0252] f) optionally, a polynucleotide encoding .beta.1,4 galactosyltransferase, [0253] g) optionally, a polynucleotide or polynucleotides encoding UDP-Gal 4 epimerase and/or transporter.

Targeting Sequences

[0254] In certain embodiments, recombinant enzymes, such as .alpha.1,2 mannosidases, GnTI, or other glycosyltransferases introduced into the filamentous fungal cells, include a targeting peptide linked to the catalytic domains. The term "linked" as used herein means that two polymers of amino acid residues in the case of a polypeptide or two polymers of nucleotides in the case of a polynucleotide are either coupled directly adjacent to each other or are within the same polypeptide or polynucleotide but are separated by intervening amino acid residues or nucleotides. A "targeting peptide", as used herein, refers to any number of consecutive amino acid residues of the recombinant protein that are capable of localizing the recombinant protein to the endoplasmic reticulum (ER) or Golgi apparatus (Golgi) within the host cell. The targeting peptide may be N-terminal or C-terminal to the catalytic domains. In certain embodiments, the targeting peptide is N-terminal to the catalytic domains. In certain embodiments, the targeting peptide provides binding to an ER or Golgi component, such as to .alpha. mannosidase enzyme. In other embodiments, the targeting peptide provides direct binding to the ER or Golgi membrane.

[0255] Components of the targeting peptide may come from any enzyme that normally resides in the ER or Golgi apparatus. Such enzymes include mannosidases, mannosyltransferases, glycosyltransferases, Type 2 Golgi proteins, and MNN2, MNN4, MNN6, MNN9, MNN10, MNS1, KRE2, VAN1, and OCH1 enzymes. Such enzymes may come from a yeast or fungal species such as those of Acremonium, Aspergillus, Aureobasidium, Cryptococcus, Chrysosporium, Chrysosporium lucknowense, Filobasidium, Fusarium, Gibberella, Humicola, Magnaporthe, Mucor, Myceliophthora, Myrothecium, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, and Trichoderma. Sequences for such enzymes can be found in the GenBank sequence database.

[0256] In certain embodiments the targeting peptide comes from the same enzyme and organism as one of the catalytic domains of the recombinant protein. For example, if the recombinant protein includes a human GnTII catalytic domain, the targeting peptide of the recombinant protein is from the human GnTII enzyme. In other embodiments, the targeting peptide may come from a different enzyme and/or organism as the catalytic domains of the recombinant protein.

[0257] Examples of various targeting peptides for use in targeting proteins to the ER or Golgi that may be used for targeting the recombinant enzymes, include: Kre2/Mnt1 N-terminal peptide fused to galactosyltransferase (Schwientek, J B C 1996, 3398), HDEL for localization of mannosidase to ER of yeast cells to produce Man5 (Chiba, J B C 1998, 26298-304; Callewaert, FEBS Lett 2001, 173-178), OCH1 targeting peptide fused to GnTI catalytic domain (Yoshida et al, Glycobiology 1999, 53-8), yeast N-terminal peptide of Mns1 fused to .alpha.2-mannosidase (Martinet et al, Biotech Lett 1998, 1171), N-terminal portion of Kre2 linked to catalytic domain of GnTI or .beta.4GalT (Vervecken, Appl. Environ Microb 2004, 2639-46), various approaches reviewed in Wildt and Gerngross (Nature Rev Biotech 2005, 119), full-length GnTI in Aspergillus nidulans (Kalsner et al, Glycocon. J 1995, 360-370), full-length GnTI in Aspergillus oryzae (Kasajima et al, Biosci Biotech Biochem 2006, 2662-8), portion of yeast Sec12 localization structure fused to C. elegans GnTI in Aspergillus (Kainz et al 2008), N-terminal portion of yeast Mnn9 fused to human GnTI in Aspergillus (Kainz et al 2008), N-terminal portion of Aspergillus Mnn10 fused to human GnTI (Kainz et al, Appl. Environ Microb 2008, 1076-86), and full-length human GnTI in T. reesei (Maras et al, FEBS Lett 1999, 365-70).

[0258] In certain embodiments the targeting peptide is an N-terminal portion of the Mnt1/Kre2 targeting peptide having the amino acid sequence of SEQ ID NO: 40 (for example encoded by the polynucleotide of SEQ ID NO:41). In certain embodiments, the targeting peptide is selected from human GNT2, KRE2, KRE2-like, Och1, Anp1, Van1 as shown in the Table 1 below:

TABLE-US-00002 TABLE 1 Amino acid sequence of targeting peptides Protein TreID Amino acid sequence human -- MRFRIYKRKVLILTLVVAACGFVLWSSNG GNT2 RQRKNEALAPPLLDAEPARGAGGRGGDHP (SEQ ID NO: 42) KRE2 21576 MASTNARYVRYLLIAFFTILVFYFVSNSK YEGVDLNKGTFTAPDSTKTTPK (SEQ ID NO: 43) KRE2- 69211 MAIARPVRALGGLAAILWCFFLYQLLRPS like SSYNSPGDRYINFERDPNLDPTG (SEQ ID NO: 44) Och1 65646 MLNPRRALIAAAFILTVFFLISRSHNSES ASTS (SEQ ID NO: 45) Anp1 82551 MMPRHHSSGFSNGYPRADTFEISPHRFQP RATLPPHRKRKRTAIRVGIAVVVILVLVL WFGQPRSVASLISLGILSGYDDLKLE (SEQ ID NO: 46) Van1 81211 MLLPKGGLDWRSARAQIPPTRALWNAVTR TRFILLVGITGLILLLWRGVSTSASE (SEQ ID NO: 47)

[0259] Further examples of sequences that may be used for targeting peptides include the targeting sequences as described in WO2012/069593.

[0260] Uncharacterized sequences may be tested for use as targeting peptides by expressing enzymes of the glycosylation pathway in a host cell, where one of the enzymes contains the uncharacterized sequence as the sole targeting peptide, and measuring the glycans produced in view of the cytoplasmic localization of glycan biosynthesis (e.g. as in Schwientek JBC 1996 3398), or by expressing a fluorescent reporter protein fused with the targeting peptide, and analysing the localization of the protein in the Golgi by immunofluorescence or by fractionating the cytoplasmic membranes of the Golgi and measuring the location of the protein.

Methods for Producing a Protein Having Reduced O-Mannosylation

[0261] The filamentous fungal cells as described above are useful in methods for producing a protein having reduced O-mannosylation.

[0262] Accordingly, in another aspect, the invention relates to a method for producing a protein having reduced O-mannosylation, comprising: [0263] a) providing a PMT-deficient Trichoderma cell having a mutation in a PMT gene that reduces endogenous protein O-mannosyltransferase activity as compared to parental strain which does not have such mutation, and further comprising a polynucleotide encoding a protein with serine or threonine, which may be O-mannosylated, [0264] b) culturing said PMT-deficient Trichoderma cell to produce said protein having reduced O-mannosylation.

[0265] In such method, the produced protein has reduced O-mannosylation due to said mutation in said PMT gene as described in the previous sections. The PMT-deficient Trichoderma cell may optionally have reduced endogenous protease activity as described in the previous sections.

[0266] The filamentous fungal cells and methods of the invention are useful for the production of protein with serine or threonine which may be O-mannosylated. For example, it is particularly useful for the production of protein which are O-mannosylated when produced in a parental PMT-functional filamentous fungal host cell, for example, in at least one Trichoderma cell which is wild type for PMT1 gene, such as SEQ ID NO:1.

[0267] In methods of the invention, certain growth media include, for example, common commercially-prepared media such as Luria-Bertani (LB) broth, Sabouraud Dextrose (SD) broth or Yeast medium (YM) broth. Other defined or synthetic growth media may also be used and the appropriate medium for growth of the particular host cell will be known by someone skilled in the art of microbiology or fermentation science. Culture medium typically has the Trichoderma reesei minimal medium (Penttila et al., 1987, Gene 61, 155-164) as a basis, supplemented with substances inducing the production promoter such as lactose, cellulose, spent grain or sophorose. Temperature ranges and other conditions suitable for growth are known in the art (see, e.g., Bailey and Ollis 1986). In certain embodiments the pH of cell culture is between 3.5 and 7.5, between 4.0 and 7.0, between 4.5 and 6.5, between 5 and 5.5, or at 5.5. In certain embodiments, to produce an antibody the filamentous fungal cell or Trichoderma fungal cell is cultured at a pH range selected from 4.7 to 6.5; pH 4.8 to 6.0; pH 4.9 to 5.9; and pH 5.0 to 5.8.

[0268] In some embodiments, the protein which may be O-mannosylated is a heterologous protein, preferably a mammalian protein. In other embodiments, the heterologous protein is a non-mammalian protein.

[0269] In certain embodiments, the protein which may be O-mannosylated is a glycoprotein with N-glycan posttranslational modifications.

[0270] In certain embodiments, a mammalian protein which may be O-mannosylated is selected from an immunoglobulin, immunoglobulin or antibody heavy or light chain, a monoclonal antibody, a Fab fragment, an F(ab')2 antibody fragment, a single chain antibody, a monomeric or multimeric single domain antibody, a camelid antibody, or their antigen-binding fragments.

[0271] A fragment of a protein, as used herein, consists of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 consecutive amino acids of a reference protein.

[0272] As used herein, an "immunoglobulin" refers to a multimeric protein containing a heavy chain and a light chain covalently coupled together and capable of specifically combining with antigen. Immunoglobulin molecules are a large family of molecules that include several types of molecules such as IgM, IgD, IgG, IgA, and IgE.

[0273] As used herein, an "antibody" refers to intact immunoglobulin molecules, as well as fragments thereof which are capable of binding an antigen. These include hybrid (chimeric) antibody molecules (see, e.g., Winter et al. Nature 349:293-99225, 1991; and U.S. Pat. No. 4,816,567 226); F(ab')2 molecules; non-covalent heterodimers; dimeric and trimeric antibody fragment constructs; humanized antibody molecules (see e.g., Riechmann et al. Nature 332, 323-27, 1988; Verhoeyan et al. Science 239, 1534-36, 1988; and GB 2,276,169); and any functional fragments obtained from such molecules, as well as antibodies obtained through non-conventional processes such as phage display or transgenic mice. Preferably, the antibodies are classical antibodies with Fc region. Methods of manufacturing antibodies are well known in the art.

[0274] In further embodiments, the yield of the mammalian glycoprotein is at least 0.5, at least 1, at least 2, at least 3, at least 4, or at least 5 grams per liter.

[0275] In certain embodiments, the mammalian glycoprotein is an antibody, optionally, IgG1, IgG2, IgG3, or IgG4. In further embodiments, the yield of the antibody is at least 0.5, at least 1, at least 2, at least 3, at least 4, or at least 5 grams per liter. In further embodiments, the mammalian glycoprotein is an antibody, and the antibody contains at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% of a natural antibody C-terminus and N-terminus without additional amino acid residues. In other embodiments, the mammalian glycoprotein is an antibody, and the antibody contains at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% of a natural antibody C-terminus and N-terminus that do not lack any C-terminal or N-terminal amino acid residues.

[0276] In certain embodiments where the mammalian glycoprotein is purified from cell culture, the culture containing the mammalian glycoprotein contains polypeptide fragments that make up a mass percentage that is less than 50%, less than 40%, less than 30%, less than 20%, or less than 10% of the mass of the produced polypeptides. In certain preferred embodiments, the mammalian glycoprotein is an antibody, and the polypeptide fragments are heavy chain fragments and/or light chain fragments. In other embodiments, where the mammalian glycoprotein is an antibody and the antibody purified from cell culture, the culture containing the antibody contains free heavy chains and/or free light chains that make up a mass percentage that is less than 50%, less than 40%, less than 30%, less than 20%, or less than 10% of the mass of the produced antibody. Methods of determining the mass percentage of polypeptide fragments are well known in the art and include, measuring signal intensity from an SDS-gel.

[0277] In certain embodiments, where the protein with reduced O-mannosylation, e.g. an antibody, is purified from cell culture, the culture contains at least 70%, 80%, 90%, 95% or 100% of the proteins that is not O-mannosylated (mol %, as determined for example by MALDI TOF MS analysis, and measuring area or intensity of peaks as described in the Example 1 below).

[0278] In certain embodiments where the protein with at least one serine or threonine residue which may be O-mannosylated is purified from cell culture, and where the strain is a Trichoderma cell genetically engineered to produce complex N-glycans, the culture further comprises at least 5%, 10%, 15%, 20%, 25%, 30% of secreted complex neutral N-glycans (mol %) compared to total secreted neutral N-glycans (as measured for example as described in WO2012069593).

[0279] In other embodiments, the heterologous protein with reduced O-mannosylation, for example, the antibody, comprises the trimannosyl N-glycan structure Man.alpha.3[Man.alpha.6]Man.beta.4GlcNAc.beta.4GlcNAc. In some embodiments, the Man.alpha.3[Man.alpha.6]Man.beta.4GlcNAc.beta.4GlcNAc structure represents at least 20%, 30%; 40%, 50%; 60%, 70%, 80% (mol %) or more, of the total N-glycans of the heterologous protein with reduced O-mannosylation. In other embodiments, the heterologous protein with reduced O-mannosylation comprises the G0 N-glycan structure GlcNAc.beta.2Man.alpha.3[GlcNAc.beta.2Man.alpha.6]Man.beta.4GlcNAc.beta.4- GlcNAc. In other embodiments, the non-fucosylated G0 glycoform structure represents at least 20%, 30%; 40%, 50%; 60%, 70%, 80% (mol %) or more, of the total N-glycans of the heterologous protein with reduced O-mannosylation. In other embodiments, galactosylated N-glycans represents less (mol %) than 0.5%, 0.1%, 0.05%, 0.01% of total N-glycans of the culture, and/or of the heterologous protein with reduced O-mannosylation, for example an antibody. In certain embodiments, the culture or the heterologous protein, for example an antibody, comprises no galactosylated N-glycans.

[0280] In certain embodiments, the heterologous (purified) protein is an antibody, a light chain antibody, a heavy chain antibody or a Fab, that comprises Man3, GlcNAcMan3, Man5, GlcNAcMan5, G0, core G0, G1, or G2 N-glycan structure as major glycoform and less than 35%, 20%, 17%, 15%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%, or less than 0.5% of O-mannosylation level (as mole % as determined for example by MALDI TOF MS analysis, and measuring area or intensity of peaks as described in Example 1).

[0281] In a specific embodiment, the invention therefore relates to a method for producing an antibody having reduced O-mannosylation, comprising: [0282] a. providing a PMT-deficient Trichoderma cell having [0283] i. a mutation that reduces endogenous protein O-mannosyltransferase activity as compared to parental strain which does not have such mutation and [0284] ii. a polynucleotide encoding a light chain antibody and a polynucleotide encoding a heavy chain antibody, [0285] b. culturing the cell to produce said antibody, consisting of heavy and light chains, having reduced O-mannosylation.

[0286] In such specific embodiments of the methods related to the production of antibody, at least 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100% of the produced antibody is not O-mannosylated (mol %, as determined for example by MALDI TOF MS analysis, and measuring area or intensity of peaks as described in Example 1.

[0287] In certain embodiments of any of the disclosed methods, the method includes the further step of providing one or more, two or more, three or more, four or more, or five or more protease inhibitors. In certain embodiments, the protease inhibitors are peptides that are co-expressed with the mammalian polypeptide. In other embodiments, the inhibitors inhibit at least two, at least three, or at least four proteases from a protease family selected from aspartic proteases, trypsin-like serine proteases, subtilisin proteases, and glutamic proteases.

[0288] In certain embodiments of any of the disclosed methods, the filamentous fungal cell or Trichoderma fungal cell also contains a carrier protein. As used herein, a "carrier protein" is portion of a protein that is endogenous to and highly secreted by a filamentous fungal cell or Trichoderma fungal cell. Suitable carrier proteins include, without limitation, those of T. reesei mannanase I (Man5A, or MANI), T. reesei cellobiohydrolase II (Cel6A, or CBHII) (see, e.g., Paloheimo et al Appl. Environ. Microbiol. 2003 December; 69(12): 7073-7082) or T. reesei cellobiohydrolase I (CBHI). In some embodiments, the carrier protein is CBH1. In other embodiments, the carrier protein is a truncated T. reesei CBH1 protein that includes the CBH1 core region and part of the CBH1 linker region. In some embodiments, a carrier such as a cellobiohydrolase or its fragment is fused to an antibody light chain and/or an antibody heavy chain. In some embodiments, a carrier-antibody fusion polypeptide comprises a Kex2 cleavage site. In certain embodiments, Kex2, or other carrier cleaving enzyme, is endogenous to a filamentous fungal cell. In certain embodiments, carrier cleaving protease is heterologous to the filamentous fungal cell, for example, another Kex2 protein derived from yeast or a TEV protease. In certain embodiments, carrier cleaving enzyme is overexpressed. In certain embodiments, the carrier consists of about 469 to 478 amino acids of N-terminal part of the T. reesei CBH1 protein GenBank accession No. EGR44817.1.

[0289] In certain embodiments, the filamentous fungal cell of the invention overexpress KEX2 protease. In an embodiment the heterologous protein is expressed as fusion construct comprising an endogenous fungal polypeptide, a protease site such as a Kex2 cleavage site, and the heterologous protein such as an antibody heavy and/or light chain. Useful 2-7 amino acids combinations preceding Kex2 cleavage site have been described, for example, in Mikosch et al. (1996) J. Biotechnol. 52:97-106; Goller et al. (1998) Appl Environ Microbiol. 64:3202-3208; Spencer et al. (1998) Eur. J. Biochem. 258:107-112; Jalving et al. (2000) Appl. Environ. Microbiol. 66:363-368; Ward et al. (2004) Appl. Environ. Microbiol. 70:2567-2576; Ahn et al. (2004) Appl. Microbiol. Biotechnol. 64:833-839; Paloheimo et al. (2007) Appl Environ Microbiol. 73:3215-3224; Paloheimo et al. (2003) Appl Environ Microbiol. 69:7073-7082; and Margolles-Clark et al. (1996) Eur J Biochem. 237:553-560.

[0290] The invention further relates to the protein composition, for example the antibody composition, obtainable or obtained by the method as disclosed above.

[0291] In specific embodiment, such antibody composition obtainable or obtained by the methods of the invention, comprises at least 70%, 80%, 90%, 95%, or 100% of the antibodies that are not O-mannosylated (mol %, as determined for example by MALDI TOF MS analysis, and measuring area or intensity of peaks as described in Example 1). In other specific embodiments, such antibody composition further comprises as 50%, 60%, 70% or 80% (mole % neutral N-glycan), of the following glycoform: [0292] (i) Man.alpha.3[Man.alpha.6(Man.alpha.3)Man.alpha.6]Man.beta.4GlcNA.beta.- 4GlcNAc (Man5 glycoform); [0293] (ii) GlcNAc.beta.2Man.alpha.3[Man.alpha.6(Man.alpha.3)Man.alpha.6]Man.beta.4Gl- cNA.beta.4GlcNAc, or .beta.4-galactosylated variant thereof; [0294] (iii) Man.alpha.6(Man.alpha.3)Man.beta.4GlcNA.beta.4GlcNAc; [0295] (iv) Man.alpha.6(GlcNAc.beta.2Man.alpha.3)Man.beta.4GlcNA.beta.4GlcNAc, or .beta.4-galactosylated variant thereof: or, [0296] (v) complex type N-glycans selected from the G0, G1 or G2 glycoform.

[0297] In some embodiments the N-glycan glycoform according to iii-v comprises less than 15%, 10%, 7%, 5%, 3%, 1% or 0.5% or is devoid of Man5 glycan as defined in i) above.

[0298] The invention also relates to a method of reducing O-mannosylation level of a recombinant glycoprotein composition produced in a Trichoderma cell, said method consisting of using a Trichoderma cell having a mutation in a PMT gene wherein said PMT gene is either: [0299] a. PMT1 gene comprising the polynucleotide of SEQ ID NO:1, [0300] b. a functional homologous gene of PMT1 gene, which gene is capable of restoring parental O-mannosylation level by functional complementation when introduced into a T. reesei strain having a disruption in said PMT1 gene, or, [0301] c. a polynucleotide encoding a polypeptide having at least 50%, at least 60%, at least 70%, at least 90%, or at least 95% identity with SEQ ID NO:2, said polypeptide having protein O-mannosyltransferase activity.

[0302] In one specific embodiment of such method, said Trichoderma cell is Trichoderma reesei.

[0303] In another specific embodiment of such method, said recombinant glycoprotein comprises at least a light chain antibody or its fragments comprising at least one serine or threonine residue and with at least one N-glycan.

EXAMPLES

[0304] As more specifically exemplified in Example 2, after deletion of pmt1, almost 95% of purified mAb and 70% of Fab molecules no longer contained any O-mannose residues. In contrast, as exemplified in Examples 3 to 4, O-mannosylation level analysis performed on pmt2 and pmt3 deletion strains did not exhibit any appreciable reduction in O-mannosylation. Together with the titer and growth analysis set forth in Example 2, these results demonstrate that filamentous fungal cells, such as Trichoderma cells, can be genetically modified to reduce or suppress O-mannosylation activity, without adversely affecting viability and yield of produced glycoproteins. As such, pmt1 is identified a valuable target to reduce O-mannosylation of secreted proteins and to improve product quality of biopharmaceuticals produced by Trichoderma reesei.

Example 1: Pmt1 Deletion in a Trichoderma reesei Strain

[0305] This example demonstrates that pmt1 is a valuable target to reduce O-mannosylation of secreted proteins and to improve product quality of biopharmaceuticals produced by Trichoderma reesei.

Generation of Pmt1 Deletion Plasmids

[0306] Three different deletion plasmids (pTTv36, pTTv124, pTTv185) were constructed for deletion of the protein O-mannosyltransferase gene pmt1 (TreD75421). All the plasmids contain the same 5' and 3' flanking regions for correct integration to the pmt1 locus. The difference between the three plasmids is the marker used in the selection; pTTv36 contains a gene encoding acetamidase of Aspergillus nidulans (amdS), pTTv124 contains a loopout version (blaster cassette) of the amdS marker and pTTv185 a loopout version (blaster cassette) of a gene encoding orotidine-5'-monophosphate (OMP) decarboxylase of T. reesei(pyr4).

[0307] The third deletion construct, pTTv185, for the protein O-mannosyltransferase gene pmt1 (TreID75421) was designed to enable removal of the selection marker from the Trichoderma reesei genome after successful integration and thereby recycling of the selection marker for subsequent transformations. In this approach, the recycling of the marker, i.e. removal of pyr4 gene from the deletion construct, resembles so called blaster cassettes developed for yeasts (Hartl, L. and Seiboth, B., 2005, Curr Genet 48:204-211; and Alani, E. et al., 1987, Genetics 116:541-545). Similar blaster cassettes have also been developed for filamentous fungi including Hypocrea jecorina (anamorph: T. reesei) (Hartl, L. and Seiboth, B., 2005, Curr Genet 48:204-211).

[0308] The TreID number refers to the identification number of a particular protease gene from the Joint Genome Institute Trichoderma reesei v2.0 genome database. Primers for construction of deletion plasmids were designed either manually or using Primer3 software (Primer3 website, Rozen and Skaletsky (2000) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, N.J., pp 365-386).

[0309] The principle of the blaster cassette using pyr4 as the marker gene is as follows: pyr4, encoding orotidine-5'-monophosphate (OMP) decarboxylase of T. reesei (Smith, J. L., et al., 1991, Current Genetics 19:27-33) is needed for uridine synthesis. Strains deficient for OMP decarboxylase activity are unable to grow on minimal medium without uridine supplementation (i.e. are uridine auxotrophs). The utilisation of 5-fluoroorotic acid (5-FOA) in generation of mutant strains lacking OMP decarboxylase activity (pyr4.sup.- strains) is based on the conversion of 5-FOA to a toxic intermediate 5-fluoro-UMP by OMP decarboxylase. Therefore, cells which have a mutated pyr4 gene are resistant to 5-FOA, but in addition are also auxotrophic for uridine. The 5-FOA resistance can in principle result also from a mutation in another gene (pyr2, orotate phosphoribosyltransferase), and therefore the spontaneous mutants obtained with this selection need to be verified for the pyr4-genotype by complementing the mutant with the pyr4 gene. Once mutated, the pyr4 gene can be used as an auxotrophic selection marker in T. reesei. In our blaster cassette pyr4 is followed by a 310 bp direct repeat of pyr4 5' untranslated region (5'UTR) and surrounded by 5' and 3' flanking regions of the gene to be deleted. Integration of the deletion cassette is selected via the pyr4 function. Removal of the pyr4 marker is then forced in the presence of 5-FOA by recombination between the two homologous regions (direct repeat of 5'UTR) resulting in looping out of the selection marker and enabling the utilisation of the same blaster cassette (pyr4 loopout) in successive rounds of gene deletions. After looping out, only the 310 bp sequence of 5'UTR remains in the locus.

[0310] Thus, the pyr4 selection marker and the 5' direct repeat (DR) fragment (310 bp of pyr4 5'UTR) were produced by PCR using plasmid containing a genomic copy of T. reesei pyr4 as a template. Both fragments contained 40 bp overlapping sequences needed to clone the plasmid with the loopout cassette using homologous recombination in yeast (see below). To enable possible additional cloning steps, an AscI digestion site was placed between the pyr4 marker and the 5' direct repeat and NotI sites to surround the complete blaster cassette.

[0311] 1100 bp of 5' and 1000 bp of 3' flanking regions were selected as the basis of the pmt1 deletion plasmids. The flanking region fragments were produced by PCR using a T. reesei wild type strain QM6a (ATCC13631) as the template. For the yeast homologous recombination system used in cloning (see below), overlapping sequences for the vector and the selection marker were placed to the appropriate PCR-primers. To enable marker switch in the construct, NotI restriction sites were introduced between the flanking regions and the selection marker. PmeI restriction sites were placed between the vector and the flanking regions for removal of vector sequence prior to transformation into T. reesei. Vector backbone pRS426 was digested with restriction enzymes (EcoRI and XhoI).

[0312] First deletion plasmid for pmt1 (plasmid pTTv36, Table 2) used amdS, a gene encoding acetamidase of Aspergillus nidulans, as the marker. The marker cassette was digested from an existing plasmid pHHO1 with NotI. All fragments used in cloning were separated with agarose gel electrophoresis and correct fragments were isolated from the gel with a gel extraction kit (Qiagen) using standard laboratory methods.

[0313] To construct the first deletion plasmid pTTv36, the vector backbone and the appropriate marker and flanking region fragments were transformed into Saccharomyces cerevisiae (strain H3488/FY834). The yeast transformation protocol was based on the method for homologous yeast recombination described in the Neurospora knockouts workshop material of Colot and Collopy, (Dartmouth Neurospora genome protocols website), and the Gietz laboratory protocol (University of Manitoba, Gietz laboratory website). The plasmid DNA from the yeast transformants was rescued by transformation into Escherichia coli. A few clones were cultivated, plasmid DNA was isolated and digested to screen for correct recombination using standard laboratory methods. A few clones with correct insert sizes were sequenced and stored.

[0314] To clone the second pmt1 deletion plasmid (pTTv124, Table 2), the amdS marker was removed from the deletion plasmid pTTv36 with NotI digestion and replaced by another variant of the blaster cassette, amdS loopout cassette containing the amdS selection marker gene, followed by AscI restriction site and a 300 bp direct repeat of amdS 5'UTR. The amdS blaster cassette functions in a similar manner to the pyr4 blaster cassette. The clones containing the amdS blaster cassette are able to grow on acetamide as sole nitrogen source. On medium containing 5-fluoroacetamide (5-FAA) a functional amdS gene will convert 5-FAA to a toxic fluoroacetate and therefore, in the presence of 5-FAA, removal of amdS gene is beneficial to the fungus. Removal of amdS blaster cassette is enhanced via the 300 bp DRs in the cassette like in the pyr4 blaster cassette, which enables the amdS gene to loop out via single crossover between the two DRs. Resulting clones are resistant to 5-FAA and unable to grow on acetamide as the sole nitrogen source.

[0315] The fragments needed for the amdS blaster cassette were produced by PCR using a plasmid .beta.3SR2 (Hynes M. J. et al, 1983, Mol. Cell. Biol. 3:1430-1439) containing a genomic copy of the amdS gene as the template. For the yeast homologous recombination system used in cloning (see above), overlapping sequences were placed to the appropriate PCR-primers. To enable marker switch in the construct, NotI restriction sites were kept between the flanking regions and the blaster cassette. Additional restriction sites FseI and AsiSI were introduced to the 5' end of amdS and an AscI site between amdS and amdS 5'DR. The plasmid pTTv124 was constructed using the yeast recombination system described above. The plasmid DNA from the yeast transformants was rescued by transformation into Escherichia coli. A few clones were cultivated, plasmid DNA was isolated and digested to screen for correct recombination using standard laboratory methods. A few clones with correct insert sizes were sequenced and stored.

[0316] To clone the third pmt1 deletion plasmid (pTTv185, Table 2), the amdS marker was removed from the deletion plasmid pTTv36 with NotI digestion and replaced by the pyr4 blaster cassette described above. The pyr4 blaster cassette was obtained from another plasmid with NotI digestion, ligated to NotI cut pTTv36 and transformed into E. coli using standard laboratory methods. A few transformants were cultivated, plasmid DNA isolated and digested to screen for correct ligation and orientation of the pyr4 blaster cassette using standard laboratory methods. One clone with correct insert size and orientation was sequenced and stored.

[0317] These deletion plasmids for pmt1 (pTTv36, pTTv124 and pTTv185) result in 2465 bp deletion in the pmt1 locus and cover the complete coding sequence of PMT1.

TABLE-US-00003 TABLE 2 Primers for generating deletion plasmids pTTv36, pTTv124 and pTTv185 for protein O-mannosyltransferase 1 (pmt1, TreID75421) Primer Sequence Deletion plasmid pTTv36 for pmt1 (TreID75421), vector backbone pRS426 75421_5'F CGATTAAGTTGGGTAACGCCAGGGT TTTCCCAGTCACGACGGTTTAAACG CTGCAGGGCGTACAGAACT (SEQ ID NO: 48) 75421_5'R ATCTCTCAAAGGAAGAATCCCTTCA GGGTTGCGTTTCCAGTGCGGCCGCG GCTCTAAAATGCTTCACAG (SEQ ID NO: 49) 75421_3'F CGGTTCTCATCTGGGCTTGCTCGGT CCTGGCGTAGATCTAGCGGCCGCAC GATGATGATGACAGCCAG (SEQ ID NO: 50) 75421_3'R GTGGAATTGTGAGCGGATAACAATT TCACACAGGAAACAGCGTTTAAACC GTCCAGCTCCCGCAGCGCC (SEQ ID NO: 51) Deletion plasmid pTTv124 for pmt1 (TreID75421), vector backbone pTTv36 T282_75421_amds_5for ATCGCTAACTGCTTTCTCTTCTGTG AAGCATTTTAGAGCCGCGGCCGCGG CCGGCCGCGATCGCCTAGATCTACG CCAGGACCG (SEQ ID NO: 52) T283_amds_3rev_loop CGGTCCTGGCGTAGATCTAGGGCGC GCCACTGGAAACGCAACCCTGAA (SEQ ID NO: 53) T284_amds_loop_5for TTCAGGGTTGCGTTTCCAGTGGCGC GCCCTAGATCTACGCCAGGACCG (SEQ ID NO: 54) T287_75421_loop_3rev AGCATCATGACCGCCCCCTTCTGGC TGTCATCATCATCGTGCGGCCGCGA TTATTGCACAAGCAGCGA (SEQ ID NO: 55) Deletion plasmid pTTv185 for pmt1 (TreID75421), vector backbone pTTv36 no new primers, pTTv36 digested with NotI and ligated with pyr4-loopout fragment obtained from another plasmid

Generation of Pmt1 Deletion Strains M403, M404, M406 and M407

[0318] To generate a pyr4 negative target strain suitable for the deletion of pmt1 using plasmid pTTv185, the MAB01 antibody producing strain M304 was subjected to selection in the presence of 5-fluoro-orotic acid in order to select for strains containing impaired pyr4 genes. The generation of the strain M304 is described in the International Patent Application No. PCT/EP2013/05012. T. reesei strain M304 comprises MAB01 light chain fused to T. reesei truncated CBH1 carrier with NVISKR Kex2 cleavage sequence, MAB01 heavy chain fused to T. reesei truncated CBH1 carrier with AXE1 [DGETVVKR] Kex2 cleavage sequence, .DELTA.pep1.DELTA.tsp1.DELTA.slp1, and overexpresses T. reesei KEX2.

[0319] Spores of M304 were spread onto minimal medium plates containing 20 g/l glucose, 2 g/l proteose peptone, 5 mM uridine and 1.5 g/l 5-FOA, pH 4.8. Some 5-FOA resistant colonies were streaked after 5-7 days onto plates described above with 1 ml/l Triton X-100 supplementation. A few clones were further purified to single cell clones via consecutive purification platings: a small piece of mycelia was picked to 0.8% NaCl-0.025% Tween 20-20% glycerol, suspended thoroughly by vortexing and filtrated through a cotton-filled pipette tip. Purified clones were sporulated on plates containing 39 g/l potato dextrose agarose. These clones were tested for uridine auxotrophy by plating spores onto minimal medium plates (20 g/l glucose, 1 ml/l Triton X-100, pH 4.8) with and without 5 mM uridine supplementation. No growth was observed on plates without uridine indicating the selected clones were putative pyr4.sup.-. Clones were stored for future use and one of them was designated with strain number M317.

[0320] Pmt1 was deleted from M317 (pyr4.sup.- of the strain M304) using the pmt1 deletion cassette from plasmid pTTv185 described above. To remove the vector sequence, plasmid pTTv185 (.DELTA.pmt1-pyr4) was digested with PmeI+XbaI and the correct fragment was purified from an agarose gel using QAquick Gel Extraction Kit (Qiagen). Approximately 5 .mu.g of the pmt1 deletion cassette was used to transform strain M317. Preparation of protoplasts and transformation for pyr4 selection were carried out essentially according to methods in Penttila et al. (1987, Gene 61:155-164) and Gruber et al (1990, Curr. Genet. 18:71-76).

[0321] 100 colonies were picked as selective streaks. 40 transformants were screened by PCR using the primers in Table 3 for the correct integration of the deletion cassette using standard laboratory methods. 12 putative deletion clones were purified to single cell clones. Purified clones were rescreened for integration and for deletion of pmt1 ORF using primers on Table 5. Four clones (in duplicate) were pure disruptants (i.e. no signal with ORF primers).

TABLE-US-00004 TABLE 3 Primers for screening integration of deletion cassette pTTv185 and for deletion of protein O-mannosyltransferase 1 (pmt1, TreID75421) from M317. Primer Sequence T296_75421_5int TATGGCTTTAGATGGGGACA (SEQ ID NO: 56) T027_Pyr4_orf_start_rev TGCGTCGCCGTCTCGCTCCT (SEQ ID NO: 57) T061_pyr4_orf_screen_2F TTAGGCGACCTCTTTTTCCA (SEQ ID NO: 58) T297_75421_3int CCTGTATCGTCCTGTTCC (SEQ ID NO: 59) T359_pmt1_orf_for GCGCCTGTCGAGTCGGCATT (SEQ ID NO: 60) T360_pmt1_orf_rev CACCGGCCATGCTCTTGCCA (SEQ ID NO: 61) T756_pmt1_orf_for2 CAAGGTGCCCTATGTCGC (SEQ ID NO: 62) T757_pmt1_orf_rev2 GATCGGGTCAGGACGGAA (SEQ ID NO: 63)

[0322] Deletion of pmt1 was verified by Southern analyses. DNA for Southern analyses was extracted with Easy-DNA kit for genomic DNA isolation (Invitrogen) essentially according to the manufacturer's instructions.

[0323] Southern analyses were essentially performed according to the protocol for homologous hybridizations in Sambrook et al. (1989, Molecular Cloning: A laboratory manual. 2.sup.nd Ed., Cold Spring Harbor Laboratory Press) using radioactive labeling (.sup.32P-dCTP) and DecaLabel Plus kit (Fermentas). Southern digestion schemes were designed using Geneious Pro software (Geneious website). Fragments for probes were produced by PCR using the primers listed in Table 4 using a T. reesei wild type strain QM6a (ATCC13631) as the template. PCR products were separated with agarose gel electrophoresis and correct fragments were isolated from the gel with a gel extraction kit (Qiagen) using standard laboratory methods.

TABLE-US-00005 TABLE 4 Primers for production of probe fragments used in Southern analyses of protein O-mannosyltransferase 1 (pmt1, TreID75421) deletion strains. Primer Sequence T635_pmt1_5f_for AGCCTGTCTGAGGGACGG (SEQ ID NO: 64) T636_pmt1_5f_rev CAAGGTCGAGATTCGGCA (SEQ ID NO: 65) T637_pmt1_3f_for CAGAAGGGGGCGGTCAT (SEQ ID NO: 66) T638_pmt1_3f_rev GTCCCAGCTCCCGCTCT (SEQ ID NO: 67) T359_pmt1_orf_for GCGCCTGTCGAGTCGGCATT (SEQ ID NO: 68) T360_pmt1_orf_rev CACCGGCCATGCTCTTGCCA (SEQ ID NO: 69)

[0324] None of the clones hybridised with pmt1 ORF probe (FIG. 1A) indicating successful deletion of pmt1. Analyses using 5' and 3' flank probes revealed that four of the clones were single integrants (FIGS. 1B and 1C; 26-8A and B, 26-21A and B). Four clones gave additional signals and thus indicated multiple integration of the deletion cassette. Four pure clones (with and without additional copies of the deletion cassette) have been stored for future use (M403; 26-8A, M404; 26-19A, M406; 26-16B and M407; 26-198).

Example 2 Analyses of .DELTA.Pmt1 Strains M403, M404, M406 and M407

[0325] Shake flask cultivation of T. reesei M304 and eight pmt1 deletion strains (26-8A (M403), 26-8B, 26-16A, 26-16B (M406), 26-19A (M404), 26-19B (M407), 26-21A, 26-21B) was carried out in Trichoderma minimal medium with 40 g/l lactose, 20 g/l spent grain extract, 100 mM PIPPS, 9 g/l casamino acids, pH 5.5 at +28.degree. C., 200 rpm. Samples were collected on days 3, 5, 7 and 10 by vacuum filtration. Supernatant samples were stored to -20.degree. C. (antibody and glycan analyses) or used in pH determinations. Mycelia for cell dry weight determinations were rinsed once with DDIW and dried at +100.degree. C. for 20-24 h. Mycelia for genomic DNA extraction were rinsed once with DDIW and stored to -20.degree. C.

[0326] O-mannosylation status analysis was performed to shake flask cultivations of T. reesei M304, eight pmt1 disruptants (pTTv185: 26-8A, 26-8B, 26-16A, 26-16B, 26-19A, 26-19B, 26-21A, 26-21B). All were cultivated in TrMM--40 g/l lactose--20 g/l SGE--100 mM PIPPS--9 g/l casamino acids, pH 5.5 at +28.degree. C. and samples were taken on time point days 3, 5, 7 and 10.

[0327] MAB01 antibody from each sample from day 7 was purified from supernatants using Protein G HP MultiTrap 96-well plate (GE Healthcare) according to manufacturer's instructions. The antibody was eluted with 0.1 M citrate buffer, pH 2.6 and neutralized with 2 M Tris, pH 9. The concentration was determined via UV absorbance in spectrophotometer against MAB01 standard curve. For O-mannosylation analysis, 10 .mu.g of protein was incubated in 6 M Guanidinium HCl for 30 minutes at +60.degree. C. after which 5 .mu.l of fresh 0.1 M DTT was added and incubated again as above. The samples were purified using Poros R1 96-well plate and the resulting light chains were analysed using MALDI-TOF MS. All were made as duplicates.

[0328] In flask cultures the O-mannosylation status in pmt1 disruptants was remarkably changed; all .DELTA.pmt1 disruptants looked the same--nearly complete loss of O-mannosylation in MAB01 LC (FIG. 2: Spectra of light chain of flask cultured parental T. reesei strain M317 (pyr4.sup.- of M304) (A) and .DELTA.pmt1 disruptant clone 26-8A (B), day 7).

Fermentation of .DELTA.Pmt1 Strain M403

[0329] Fermentation was carried out with .DELTA.pmt1 strain M403 (clone 26-8A; pTTv185 in M317). Fermentation culture medium contained 30 g/l glucose, 60 g/l lactose, 60 g/l whole spent grain at pH 5.5. Lactose feed was started after glucose exhaustion. Growth temperature was shifted from +28.degree. C. to +22.degree. C. after glucose exhaustion. Samples were collected by vacuum filtration. Supernatant samples were stored to -20.degree. C.

[0330] In FIG. 3 is shown the Western analyses of supernatant samples. MAB01 heavy and light chains were detected from supernatant after day three. Despite the deletion of pmt1, that could also reduce O-mannosylation of the linker and thus aid KEX2 cleavage, substantial amount of light chain remains attached to the carrier in the early days of the fermentation. At later stages, the cleavage is more complete but the yield may be affected by the degradation of the heavy chain. Results on antibody titres (Table 7 below) indicate fairly steady expression between days 7 to 10. In this fermentation the pmt1 deletion strain produced approximately equal antibody levels as the parental strain. Higher titres were obtained when the same strain was fermented using a different fermenter.

[0331] M403 (clone 26-8A) was cultivated in fermenter in TrMM, 30 g/l glucose, 60 g/l lactose, 60 g/l spent grain, pH 5.5 with lactose feed. Samples were harvested on days 2, 3 and 5-11. O-mannosylation level analysis was performed as to flask cultures. The O-mannosylation status was greatly decreased also in fermenter culture (FIG. 4, Table 5).

[0332] The O-mannosylation level was calculated from average of area and intensity (Table 5). Area (Table 6) seems to give more commonly higher rate of non-O-glycosylated LC than intensity (Table 7). In all time points the O-mannosylation level was below 5%.

TABLE-US-00006 TABLE 5 O-mannosylation status of T. reesei strain M403 (pmt1 deletion strain of MAB01 antibody producing strain, clone 26-8A) from fermenter culture. Percentages calculated from area and intensity of single charged signals. In time point d 9 both samples gave 100% to LC, LC + Hex1 being practically absent. 3 d 5 d 6 d 7 d d 8 d 9 d 10 d 11 Average Average Std Average Std Average Std Average Average Average Std Average Std LC 95.8 96.8 0.30 97.5 0.29 97.4 0.36 97.3 100.0 96.6 0.2 95.5 0.11 LC + Hex 4.2 3.2 0.30 2.5 0.29 2.6 0.36 2.7 0.0 3.4 0.2 4.5 0.11

TABLE-US-00007 TABLE 6 The percentages of area values of three parallel samples from fermenter cultured M403 from day 7. Area average Std LC 98.5 0.15 LC + Hex 1.5 0.15

TABLE-US-00008 TABLE 7 The percentages of intensity values of three parallel samples from fermenter cultured M403 from day 7. Intensity average Std LC 96.3 0.57 LC + Hex 3.7 0.57

[0333] No negative effects of strain growth characteristic and secretion capacity were observed. The strain M403 grew well and produced increased amount of antibody in function of time in fermenter culture. The best titer was obtained from day 10 (Table 8). On day 11 the titer is decreased.

TABLE-US-00009 TABLE 8 Titers from fermenter cultured MAB01 producing strain M403. The antibody was purified using Protein G 96-well plate. Time point Days cultured Titer g/l 54:30 hours 2 0.04 71:50 hours 3 0.04 77:45 hours 3 0.07 126:20 hours 5 0.91 148:20 hours 6 1.23 168:20 hours 7 1.47 192:00 hours 8 1.50 217:15 hours 9 1.35 241:00 hours 10 1.52 275:20 hours 11 1.06

[0334] Deletion of pmt1 diminished dramatically MAB01 O-mannosylation; the amount of O-mannosylated LC was .about.61% in parental strain, 3% in the best .DELTA.pmt1 clone in shake flask culture and practically 0% in fermenter culture in time point day 9.

Deletion of Pmt1 in a Fab Expressing Trichoderma reesei Strain

[0335] The pmt1 disruption cassette (pmt1 amdS) was released from its backbone vector pTTv124 described above by restriction digestion and purified through gel extraction. Using protoplast transformation the deletion cassette was introduced to T. reesei strains M304 (3-fold protease deletion strain expressing MAB01) and M307 (4-fold protease deletion strain .DELTA.pep1 .DELTA.tsp1 .DELTA.slp1 .DELTA.gap1, also described in PCT/EP2013/050126 that has been transformed to express a Fab). Transformants were plated to acetamidase selective medium (minimal medium containing acetamide as the sole carbon source).

[0336] Transformants were screened by PCR for homologous integration of the acetamidase marker to the pmt1 locus using a forward primer outside the 5' flanking region fragment of the construct and the reverse primer inside the AmdS selection marker (5' integration) as well as a forward primer inside the AmdS selection marker and a reverse primer outside the 3' flanking region fragment (3' integration). Three independent transformants of each transformation (MAB01 and Fab expressing strains), which gave PCR results displaying correct integration of the construct to the pmt1 locus were selected for single spore purification to obtain uninuclear clones. Proper integration of the disruption cassette was reconfirmed by PCR using the same primer combinations as described above and the absence of the pmt1 gene was verified by using a primer combination targeted to the pmt1 open reading frame. Correct integration of the disruption cassette was additionally verified for all clones applying Southern hybridization. Digested genomic DNA of the three clones as well as the parental strain were probed against the 5' and 3' flanks of the pmt1 gene to confirm modification of the pmt1 locus as expected. Furthermore, the blotted DNA was hybridized with a probe specific to the pmt1 open reading frame in order to substantiate the absence of pmt1.

MAB01 and Fab Expression for O-Mannosylation Analysis

[0337] To evaluate the impact of pmt1 deletion on O-mannosylation levels of mAb and Fab molecules, strains were grown in batch fermentations for 7 days, in media containing 2% yeast extract, 4% cellulose, 4% cellobiose, 2% sorbose, 5 g/L KH2PO4, and 5 g/L (NH4)2SO4. Culture pH was controlled at pH 5.5 (adjusted with NH4OH). The starting temperature was 30.degree. C., which was shifted to 22.degree. C. after 48 hours. mAb fermentations (strains M304, M403, M406 and M407) were carried out in 4 parallel 2 L glass reactor vessels (DASGIP) with a culture volume of 1 L and the Fab fermentation (TR090 #5) was done in a 15 L steel tank reactor (Infors) with a culture volume of 6 L. Fab strains (TR090 #5, TR090 #3, TR090 #17) were additionally cultured in shake flasks for 4 days at 28.degree. C. Main media components were 1% yeast extract, 2% cellobiose, 1% sorbose, 15 g/L KH2PO4 and 5 g/L (NH4)2SO4 and the pH was uncontrolled (pH drops from 5.5 to <3 during a time course of cultivation). Culture supernatant samples were taken during the course of the runs and stored at -20.degree. C. Samples were collected daily from the whole course of these cultivations, and production levels were analyzed by affinity liquid chromatography. Samples with maximum production levels were subject to purification and further O-mannosylation analysis.

Analysis of O-Mannosylation on Fab and mAb

[0338] O-mannosylation was analyzed on mAb and Fab molecules expressed from both, the pmt1 deletion and parental strains. The mAb and Fab was purified from culture supernatants using Lambda Select Sure and CaptureSelect Fab Lambda (BAC) affinity chromatography resin, respectively, applying conditions as described by the manufactures protocols. Both purified molecules including, the purified mAb and Fab were subjected to RP-LC-QTOF-MS either as intact and/or reduced/alkylated samples.

[0339] For intact analysis, an equivalent of 20 .mu.g protein was injected onto the column. For reduced/alkylated analyses of mAb, an equivalent of 100 .mu.g protein was deglycosylated using PNGase-F enzyme, reduced using DTT and alkylated using iodoacetamide prior to LC-MS analysis. For reduced/alkylated analyses of Fab, an equivalent of 100 .mu.g protein was reduced with DTT and alkylated with iodoacetamide prior to LC-MS analysis. 6 .mu.g of the reduced/alkylated sample were injected onto the column. Reversed-phase chromatography separation was carried out on a 2.1.times.150 mm Zorbax C3 column packed with 5 .mu.m particles, 300 .ANG. pore size the eluents were: eluent A 0.1% TFA in water and eluent B 0.1% TFA in 70% IPA, 20% ACN, 10% water. The column was heated at 75.degree. C. and the flo rate was 200 .mu.L/min. The gradient used for the sample separation is shown in Table 9.

TABLE-US-00010 TABLE 9 HPLC gradient used for intact and reduced/ alkylated samples Flow Time % B (mL/min) 0 10 0.1 0.1 10 0.2 2 10 0.2 4 28 0.2 30 36.4 0.2 31 100 0.2 34 100 0.2 35 10 0.2 40 10 0.2

[0340] The HPLC was directly coupled with a Q-TOF Ultima mass spectrometer (Waters, Manchester, UK). The ESI-TOF mass spectrometer was set to run in positive ion mode. The data evaluation of intact and reduced/alkylated analyses was performed using MassLynx analysis software (Waters, Manchester, UK). The deconvolution of the averaged mass spectra from the main UV signals was carried out using the MaxEnt algorithm, a part of the MassLynx analysis software (Waters, Manchester, UK). The deconvolution parameters were the following: "max numbers of iterations" are 8; resolution is 0.1 Da/channel; Uniform Gaussian--width at half height is 1 Da for intact and 0.5 for the reduced chains and minimum intensity ratios are left 30% and right 30%. The estimated level of O-mannosylation (%) was determined using the peak signal height after deconvolution. The observed O-mannosylation levels (%) of mAbs and Fabs from independent pmt1 deletion strains are compared to the ones of the respective parental wild-type strains in Tables 10 and 11.

TABLE-US-00011 TABLE10 O-mannosylation level [%] of Fabs from different strains Strain Parental Sample M307 TR090#5 TR090#3 TR090#17 Intact Fab 70.1 34.2 34.3 34.7 LC 58.8 10.4 10.1 10.8 HC 42.9 26.1 25.9 25.8

TABLE-US-00012 TABLE 11 O-mannosylation level [%] of MAB01 from different pmt1 deficient strains M403, M406 and M407. Parental strain is M304 Strain in yeast extract medium Sample Parental M403 M406 M407 LC 50.7 5.7 5.8 5.8 HC 4.8 Not Not Not detected detected detected

[0341] The O-mannosylation level was found to be 70% on intact Fab derived from the parental strain and reduced to .about.34% in all three pmt1 deletion strains. The transfer of mannoses was more efficiently diminished on the Fab light chains (10% of residual O-mannosylation on light chains obtained from pmt1 deletion strains vs. 59% for the parental strain), as compared to the heavy chains, for which it decreased from 43% to .about.26%.

[0342] The O-mannosylation level was found to be 50% on the light chain of mAb derived from parental strains and reduced to 5.7-5.8% in all three pmt1 deletion strains. The O-mannosylation level was found to be 4.8% on the heavy chain of mAb derived from parental strains and was completely reduced (below the limit of detection by LC-MS) in all three pmt1 deletion strains.

[0343] In conclusion, after deletion of pmt1, almost 95% of purified mAb and 70% of Fab molecules did no longer contain any O-mannose residues. Therefore, pmt1 is a valuable target to reduce O-mannosylation of secreted proteins and to improve product quality of biopharmaceuticals produced by Trichoderma reesei.

Example 3: Pmt2 Deletion in a Trichoderma reesei Strain

Generation of Pmt2 Deletion Plasmids

[0344] Three different deletion plasmids (pTTv34, pTTv122, pTTv186) were constructed for deletion of the protein O-mannosyltransferase gene pmt2 (TreD22005). All the plasmids contain the same 5' and 3' flanking regions for correct integration to the pmt2 locus. The difference between the three plasmids is the marker used in the selection; pTTv34 contains a gene encoding acetamidase of Aspergillus nidulans (amdS), pTTv122 contains a loopout version (blaster cassette) of the amdS marker and pTTv186 a loopout version (blaster cassette) of a gene encoding orotidine-5'-monophosphate (OMP) decarboxylase of T. reesei (pyr4).

[0345] 1100 bp of 5' and 1000 bp of 3' flanking regions were selected as the basis of the second protein O-mannosyltransferase gene, pmt2 (TreID22005), deletion plasmids. The construction of the first plasmid for this gene was carried out essentially as described for pmt1 in Example 1. As for pmt1, the first deletion plasmid for pmt2 (plasmid pTTv34, Table 12) used amdS, a gene encoding acetamidase of Aspergillus nidulans, as the selection marker.

[0346] Like for pmt1 in Example 1, to clone the second deletion plasmid, pTTv122 (Table 12), the amdS marker was removed from the deletion plasmid pTTv34 with NotI digestion and replaced by amdS blaster cassette for which the fragments were produced by PCR (see Example 1 above for details). The plasmid pTTv122 was constructed using the yeast recombination system described in Example 1. The plasmid DNA from the yeast transformants was rescued by transformation into Escherichia coli. A few clones were cultivated, plasmid DNA was isolated and digested to screen for correct recombination using standard laboratory methods. A few clones with correct insert sizes were sequenced and stored.

[0347] The third deletion plasmid for pmt2, pTTv186 (Table 12) was cloned like the third plasmid for pmt1; the amdS blaster cassette was removed from the deletion plasmid pTTv122 with NotI digestion and replaced by the pyr4 blaster cassette described in Example 1. The pyr4 blaster cassette was obtained from another plasmid with NotI digestion, ligated to NotI cut pTTv122 and transformed into E. coli using standard laboratory methods. A few transformants were cultivated, plasmid DNA isolated and digested to screen for correct ligation and orientation of the pyr4 blaster cassette using standard laboratory methods. One clone with correct insert size and orientation was sequenced and stored. These deletion plasmids for pmt2 (pTTv34, pTTv122 and pTTv186, Table 12) result in 3186 bp deletion in the pmt2locus and cover the complete coding sequence of PMT2.

TABLE-US-00013 TABLE 12 Primers for generating deletion plasmids pTTv34, pTTv122 and pTTv186 for protein O-mannosyltransferase 2 (pmt2, TreID22005). Primer Sequence Deletion plasmid pTTv34 for pmt2 (TreID22005), vector backbone pRS426 22005_5'F CGATTAAGTTGGGTAACGCCAGGGTT TTCCCAGTCACGACGGTTTAAACGTT TCAGGTACCAACACCTG (SEQ ID NO: 70) 22005_5'R ATCTCTCAAAGGAAGAATCCCTTCAG GGTTGCGTTTCCAGTGCGGCCGCGGC GAAGAGTCTGGCGGGGA (SEQ ID NO: 71) 22005_3'F CGGTTCTCATCTGGGCTTGCTCGGTC CTGGCGTAGATCTAGCGGCCGCAAGA GGATGGGGGTAAAGCT (SEQ ID NO: 72) 22005_3'R GTGGAATTGTGAGCGGATAACAATTT CACACAGGAAACAGCGTTTAAACGAG GAGGACTCGTGAGTTAT (SEQ ID NO: 73) Deletion plasmid pTTv122 for pmt2 (TreID22005), vector backbone pTTv34 T280_22005_amds_5for GCGCCCTTCCGCCTCGACAATCCCCG CCAGACTCTTCGCCGCGGCCGCGGCC GGCCGCGATCGCCTAGATCTACGCCA GGACCG (SEQ ID NO: 74) T283_amds_3rev_loop CGGTCCTGGCGTAGATCTAGGGCGCG CCACTGGAAACGCAACCCTGAA (SEQ ID NO: 75) T284_amds_loop_5for TTCAGGGTTGCGTTTCCAGTGGCGCG CCCTAGATCTACGCCAGGACCG (SEQ ID NO: 76) T285_22005_loop_3rev GAGCTGGCCAGAAAAGACCAAGCTTT ACCCCCATCCTCTTGCGGCCGCGATT ATTGCACAAGCAGCGA (SEQ ID NO: 77) Deletion plasmid pTTv186 for pmt2 (TreID22005), vector backbone pTTv122 no new primers, pTTv122 digested with NotI and ligated with pyr4-loopout fragment from another plasmid

Generation of Pmt2 Deletion Strains M338, M339 and M340

[0348] To remove vector sequence plasmid pTTv122 (.DELTA.pmt2-amdS) was digested with PmeI+XbaI and the 5.2 kb fragment purified from agarose gel using QAquick Gel Extraction Kit (Qiagen). Approximately 5 .mu.g of the pmt2 deletion cassette was used to transform the strain M124 (M124 strain is described in WO2012/069593). Protoplast preparation and transformation were carried out essentially according to Penttila et al., 1987, Gene 61:155-164 and Gruber et al, 1990, Current Genetics 18:71-76 for amdS selection.

[0349] 120 colonies were picked as selective streaks. 10 transformants were screened by PCR using the primers in Table 13 for the correct integration of the deletion cassette using standard laboratory methods. Five putative deletion clones were purified to single cell clones. Purified clones (two parallel from each) were rescreened for correct integration and for deletion of pmt2 ORF (primers on Table 13). Five clones were selected for Southern analyses.

TABLE-US-00014 TABLE 13 Primers for screening integration of deletion cassette pTTv122 and for deletion of protein O-mannosyltransferase 2 (pmt2, TreID22005) from M124. Primer Sequence T288_22005_5int ACGAGTTGTTTCGTGTACCG (SEQ ID NO: 78) T020_Amds_rev2 CTTTCCATTCATCAGGGATGG (SEQ ID NO: 79) T021_amds_end_fwd GGAGACTCAGTGAAGAGAGG (SEQ ID NO: 80) T289_22005_3int ATGTTGCAGTTGCGAAAG (SEQ ID NO: 81) T290_22005_5orf CCCTCGTCGCAGAAAAGATG (SEQ ID NO: 82) T291_22005_3orf AGCCTCCTTGGGAACCTCAG (SEQ ID NO: 83)

[0350] Deletion of pmt2 was verified by Southern analyses. DNA for Southern analyses was extracted with Easy-DNA kit for genomic DNA isolation (Invitrogen) essentially according to the manufacturer's instructions.

[0351] Southern analyses were essentially performed as described in Example 1. Fragments for probes were produced by PCR using the primers listed in Table 14 using a T. reesei strain M124 as the template for the ORF probe and plasmid pTTv122 for the 5' and 3' flank probes. PCR products were separated with agarose gel electrophoresis and correct fragments were isolated from the gel with a gel extraction kit (Qiagen) using standard laboratory methods.

TABLE-US-00015 TABLE 14 Primers for production of probe fragments used in Southern analyses of protein O-mannosyltransferase 2 (pmt2, TreID22005) deletion strains. Primer Sequence T639_22005 5' flank CTTAGTGCGGCTGGAGGGCG probe F (SEQ ID NO: 84) T640_22005 5' flank GGCCGGTTCGTGCAACTGGA probe R (SEQ ID NO: 85) T641_22005 3' flank GGCCGCAAGAGGATGGGGGT probe F (SEQ ID NO: 86) T642_22005 3' flank TCGGGCCAGCTGAAGCACAAC probe R (SEQ ID NO: 87) T643_22005 orf 5' probe TTGAGGAACGGCTGCCTGCG (SEQ ID NO: 88) T644_22005 orf 3' probe CGATGGCTCCGTCATCCGCC (SEQ ID NO: 89)

[0352] Three of the clones did not hybridise with pmt2 ORF probe (Data not shown) indicating successful deletion of pmt2. Analyses using 5' and 3' flank probes revealed that the same three clones were single integrants (Data not shown). The two other clones (19-35A and 19-40B) gave signals corresponding to parental strain M124. Three pure clones have been stored for future use (M338; 19-7B, M339; 19-22B and M340; 19-39B).

[0353] Analyses of .DELTA.pmt2 strains M338, M339 and M340 Shake flask cultivation of T. reesei strain M124 and the pmt2 deletion strains (19-7B/M338, 19-22B/M339 and 19-39B/M340) was carried out in Trichoderma minimal medium with 40 g/l lactose, 20 g/l spent grain extract, 100 mM PIPPS, pH 5.5 with and without 1 M sorbitol as osmotic stabiliser at +28.degree. C., 200 rpm. Samples were collected on days 3, 5 and 7 by vacuum filtration. Supernatant samples were stored to -20.degree. C. (antibody and glycan analyses) or used in pH determinations. Mycelia for cell dry weight determinations were rinsed once with DDIW and dried at +100.degree. C. for 20-24 h. Mycelia for genomic DNA extraction were rinsed once with DDIW and stored to -20.degree. C.

Generation of Pmt2 Deletion Strains M452, M453 and M454

[0354] Generation of M317 is described in Example 1 above.

[0355] To remove vector sequence plasmid pTTv186 (.DELTA.pmt2-pyr4) was digested with PmeI+XbaI and the 4.1 kb fragment purified from agarose gel using QIAquick Gel Extraction Kit (Qiagen). Approximately 5 .mu.g of the pmt2 deletion cassette was used to transform M317.

[0356] Protoplast preparation and transformation were carried out essentially according to Penttila et al., 1987, Gene 61:155-164 and Gruber et al, 1990, Current Genetics 18:71-76 for pyr4 selection.

[0357] 100 colonies were picked as selective streaks. 20 transformants were screened by PCR using the primers in Table 15 for the correct integration of the deletion cassette using standard laboratory methods. Nine putative deletion clones were purified to single cell clones. Purified clones were rescreened for 5' integration and for deletion of pmt2 ORF (primers on Table 14). Three clones were pure deletants (i.e. no signal with ORF primers).

TABLE-US-00016 TABLE 15 Primers for screening integration of deletion cassette pTTv186 and for deletion of protein O-mannosyltransferase 2 (pmt2, TreID22005) from M317. Primer Sequence T288_22005_5int ACGAGTTGTTTCGTGTACCG (SEQ ID NO: 90) T027_Pyr4_orf_start_rev TGCGTCGCCGTCTCGCTCCT (SEQ ID NO: 91) T061_pyr4_orf_screen_2F TTAGGCGACCTCTTTTTCCA (SEQ ID NO: 92) T289_22005_3int ATGTTGCAGTTGCGAAAG (SEQ ID NO: 93) T290_22005_5orf CCCTCGTCGCAGAAAAGATG (SEQ ID NO: 94) T291_22005_3orf AGCCTCCTTGGGAACCTCAG (SEQ ID NO: 95)

[0358] Deletion of pmt2 was verified by Southern analyses. DNA for Southern analyses was extracted with Easy-DNA kit for genomic DNA isolation (Invitrogen) essentially according to the manufacturer's instructions.

[0359] Southern analyses were essentially performed as described in Example 1. Fragments for probes were produced by PCR using the primers listed in Table 16 using a T. reesei wild type strain QM6a (ATCC13631) as the template for pmt2 ORF probe and plasmid pTTv186 for 5' and 3' flank probes. PCR products were separated with agarose gel electrophoresis and correct fragments were isolated from the gel with a gel extraction kit (Qiagen) using standard laboratory methods.

TABLE-US-00017 TABLE 16 Primers for production of probe fragments used in Southern analyses of protein O-mannosyltransferase 2 (pmt2, TreID22005) deletion clones. Primer Sequence T639_22005 5' flank CTTAGTGCGGCTGGAGGGCG probe F (SEQ ID NO: 96) T640_22005 5' flank GGCCGGTTCGTGCAACTGGA probe R (SEQ ID NO: 97) T641_22005 3' flank GGCCGCAAGAGGATGGGGGT probe F (SEQ ID NO: 98) T642_22005 3' flank TCGGGCCAGCTGAAGCACAAC probe R (SEQ ID NO: 99) T290_22005_5orf CCCTCGTCGCAGAAAAGATG (SEQ ID NO: 100) T291_22005_3orf AGCCTCCTTGGGAACCTCAG (SEQ ID NO: 101)

[0360] None of the clones hybridised with pmt2 ORF probe (Data not shown) indicating successful deletion of pmt2. Analyses using 5' and 3' flank probes revealed that two of the clones were single integrants (Data not shown). One clone gave additional signal from the 3'flank probing (Data not shown) and thus indicated partial or multiple integration of the deletion cassette. Three pure clones (with and without additional copies of the deletion cassette) have been stored for future use (M452; 27-10A, M453; 27-17A and M454: 27-18B).

Analyses of .DELTA.Pmt2 Strains M452, M453 and M454

[0361] Shake flask cultivation of T. reesei strain M304 and three pmt2 deletion strains (27-10A/M452, 27-17A/M453 and 27-18B/M454) was carried out in Trichoderma minimal medium with 40 g/l lactose, 20 g/l spent grain extract, 100 mM PIPPS, 9 g/l casamino acids, pH 5.5 at +28.degree. C., 200 rpm. Samples were collected on days 3, 5, 7 and 10 by vacuum filtration. Supernatant samples were stored to -20.degree. C. (antibody and glycan analyses) or used in pH determinations. Mycelia for cell dry weight determinations were rinsed once with DDIW and dried at +100.degree. C. for 20-24 h. Mycelia for genomic DNA extraction were rinsed once with DDIW and stored to -20.degree. C.

[0362] O-mannosylation level analysis was performed to pmt2 deletion strains as to flask cultures of pmt1 deletion strains. No difference was observed in O-mannosylation compared to parental strain M304.

Example 4: Pmt3 Deletion in a Trichoderma reesei Strain

Generation of Pmt3 Deletion Plasmids

[0363] Three different deletion plasmids (pTTv35, pTTv123, pTTv187) were constructed for deletion of the protein O-mannosyltransferase gene pmt3 (TreD22527). All the plasmids contain the same 5' and 3' flanking regions for correct integration to the pmt3 locus. The difference between the three plasmids is the marker used in the selection; pTTv35 contains a gene encoding acetamidase of Aspergillus nidulans (amdS), pTTv123 contains a loopout version (blaster cassette) of the amdS marker and pTTv187 a loopout version (blaster cassette) of a gene encoding orotidine-5'-monophosphate (OMP) decarboxylase of T. reesei (pyr4).

[0364] 1100 bp of 5' and 1000 bp of 3' flanking regions were selected as the basis of the third protein O-mannosyltransferase gene, pmt3 (TreID22527), deletion plasmids. The construction of the first plasmid for this gene was carried out essentially as described for pmt1 in Example 1. As for pmt1, the first deletion plasmid for pmt3 (plasmid pTTv35, Table 17) used amdS, a gene encoding acetamidase of Aspergillus nidulans, as the selection marker.

[0365] Like for pmt1 in Example 1, to clone the second deletion plasmid, pTTv123 (Table 16), the amdS marker was removed from the deletion plasmid pTTv35 with NotI digestion and replaced by amdS blaster cassette for which the fragments were produced by PCR (see Example 1 above for details). The plasmid pTTv123 was constructed using the yeast recombination system described in Example 1. The plasmid DNA from the yeast transformants was rescued by transformation into Escherichia coli. A few clones were cultivated, plasmid DNA was isolated and digested to screen for correct recombination using standard laboratory methods. A few clones with correct insert sizes were sequenced and stored.

[0366] The third deletion plasmid for pmt3, pTTv187 (Table 17) was cloned like the third plasmid for pmt1; the amdS blaster cassette was removed from the deletion plasmid pTTv123 with NotI digestion and replaced by the pyr4 blaster cassette described in Example 1. The pyr4 blaster cassette was obtained from another plasmid with NotI digestion, ligated to NotI cut pTTv123 and transformed into E. coli using standard laboratory methods. A few transformants were cultivated, plasmid DNA isolated and digested to screen for correct ligation and orientation of the pyr4 blaster cassette using standard laboratory methods. One clone with correct insert size and orientation was sequenced and stored. These deletion plasmids for pmt3 (pTTv35, pTTv123 and pTTv187, Table 17) result in 2495 bp deletion in the pmt3locus and cover the complete coding sequence of PMT3.

TABLE-US-00018 TABLE 17 Primers for generating deletion plasmids pTTv35, pTTv123 and pTTv187 for protein O-mannosyltransferase 3 (pmt3, TreID22527). Primer Sequence Deletion plasmid pTTv35 for pmt3 (TreID22527), vector backbone pRS426 22527_5'F CGATTAAGTTGGGTAACGCCAGGGTTT TCCCAGTCACGACGGTTTAAACGTGTT TAAATTTGATGAGGC (SEQ ID NO: 102) 22527_5'R ATCTCTCAAAGGAAGAATCCCTTCAGG GTTGCGTTTCCAGTGCGGCCGCGGTCT CAGAGACAGCCTTCT (SEQ ID NO: 103) 22527_3'F CGGTTCTCATCTGGGCTTGCTCGGTCC TGGCGTAGATCTAGCGGCCGCACTCGG CTTCTTTGTCCGAG (SEQ ID NO: 104) 22527_3'R GTGGAATTGTGAGCGGATAACAATTTC ACACAGGAAACAGCGTTTAAACTCCTC GTCGGCAACAAGGCC (SEQ ID NO: 105) Deletion plasmid pTTv123 for pmt3 (TreID22527), vector backbone pTTv35 T281_22527_amds_5for GCAGATCTGGGGGAGGAATCAGAAGGC TGTCTCTGAGACCGCGGCCGCGGCCGG CCGCGATCGCCTAGATCTACGCCAGGA CCG (SEQ ID NO: 106) T283_amds_3rev_loop CGGTCCTGGCGTAGATCTAGGGCGCGC CACTGGAAACGCAACCCTGAA (SEQ ID NO: 107) T284_amds_loop_5for TTCAGGGTTGCGTTTCCAGTGGCGCGC CCTAGATCTACGCCAGGACCG (SEQ ID NO: 108) T286_22527_loop_3rev AAAGTGGGCGAGCTGAGATACTCGGAC AAAGAAGCCGAGTGCGGCCGCGATTAT TGCACAAGCAGCGA (SEQ ID NO: 109) Deletion plasmid pTTv187 for pmt3 (TreID22527), vector backbone pTTv123 no new primers, pTTv123 digested with NotI and ligated with pyr4-loopout fragment from another plasmid.

Generation of Pmt3 Deletion Strains M341 and M342

[0367] To remove vector sequence plasmid pTTv123 (.DELTA.pmt3-amdS) was digested with PmeI+XbaI and the 5.2 kb fragment purified from agarose gel using QIAquick Gel Extraction Kit (Qiagen). Approximately 5 .mu.g of the pmt3 deletion cassette was used to transform the strain M124. Protoplast preparation and transformation were carried out essentially according to Penttila et al., 1987, Gene 61:155-164 and Gruber et al, 1990, Current Genetics 18:71-76 for amdS selection.

[0368] 120 colonies were picked as selective streaks. 10 transformants were screened by PCR using the primers in Table 18 for the correct integration of the deletion cassette using standard laboratory methods. Three putative deletion clones were purified to single cell clones. Purified clones (three parallel from each) were rescreened for correct integration and for deletion of pmt3 ORF (primers on Table 18). Three clones were selected for Southern analyses.

TABLE-US-00019 TABLE 18 Primers for screening integration of deletion cassette pTTv123 and for deletion of protein O-mannosyltransferase 3 (pmt3, TreID22527) from M124. Primer Sequence T292_22527_5int ACGGGAGATCTCGGAAAA (SEQ ID NO: 110) T020_Amds_rev2 CTTTCCATTCATCAGGGATGG (SEQ ID NO: 111) T021_amds_end_fwd GGAGACTCAGTGAAGAGAGG (SEQ ID NO: 112) T293_22527_3int ATGAAGCTCAGCCTGTGG (SEQ ID NO: 113) T294_22527_5orf GGGGACGGCTTGAGGAAG (SEQ ID NO: 114) T295_22527_3orf CTGCTTGCTGCTTCCAGTCA (SEQ ID NO: 115)

[0369] Deletion of pmt3 was verified by Southern analyses. DNA for Southern analyses was extracted with Easy-DNA kit for genomic DNA isolation (Invitrogen) essentially according to the manufacturer's instructions.

[0370] Southern analyses were essentially performed as described in Example 1. Fragments for probes were produced by PCR using the primers listed in Table 19 using a T. reesei strain M124 as the template for the ORF probe and plasmid pTTv123 for the 5' and 3' flank probes. PCR products were separated with agarose gel electrophoresis and correct fragments were isolated from the gel with a gel extraction kit (Qiagen) using standard laboratory methods.

TABLE-US-00020 TABLE 19 Primers for production of probe fragments used in Southern analyses of protein O-mannosyltransferase 3 (pmt3, TreID22527) deletion strains. Primer Sequence T645_22527 5' flank TGGCAGATGCCGAAAGGCGG probe F (SEQ ID NO: 116) T646_22527 5' flank TGGCAACCAGCTGTGGCTCC probe R (SEQ ID NO: 117) T647_22527 3' flank CGGCCGCACTCGGCTTCTTT probe F (SEQ ID NO: 118) T648_22527 3' flank GAGTGGGCTAGGCGCAACGG probe R (SEQ ID NO: 119) T649_22527 orf 5' probe GGATCGGCCACTGCCACCAC (SEQ ID NO: 120) T650_22527 orf 3' probe GCCCACTTCTCTGCGCGTGT (SEQ ID NO: 121)

[0371] Two of the clones did not hybridise with pmt3 ORF probe (Data not shown) indicating successful deletion of pmt3. Analyses using 5' and 3' flank probes revealed that the same two clones were single integrants (Data not shown). One clone (20-32C) gave signals corresponding to parental strain M124. Two clones have been stored for future use (M341; 20-34C and M342; 20-35B).

Analyses of .DELTA.Pmt3 Strains M341 and M342

[0372] Shake flask cultivation of T. reesei strain M124 and the pmt3 deletion strains (20-34C/M341 and 20-35B/M342) was carried out in Trichoderma minimal medium with 40 g/l lactose, 20 g/l spent grain extract, 100 mM PIPPS, pH 5.5 with and without 1 M sorbitol as osmotic stabiliser at +28.degree. C., 200 rpm. Samples were collected on days 3, 5 and 7 by vacuum filtration. Supernatant samples were stored to -20.degree. C. (antibody and glycan analyses) or used in pH determinations. Mycelia for cell dry weight determinations were rinsed once with DDIW and dried at +100.degree. C. for 20-24 h. Mycelia for genomic DNA extraction were rinsed once with DDIW and stored to -20.degree. C.

Generation of Pmt3 Deletion Strains M522 and M523

[0373] Generation of M317 is described in Example 1 above.

[0374] To remove vector sequence plasmid pTTv187 (.DELTA.pmt3-pyr4) was digested with PmeI+XbaI and the 4.1 kb fragment purified from agarose gel using QIAquick Gel Extraction Kit (Qiagen). Approximately 5 .mu.g of the pmt3 deletion cassette was used to transform M317. Protoplast preparation and transformation were carried out essentially according to Penttila et al., 1987, Gene 61:155-164 and Gruber et al, 1990, Current Genetics 18:71-76 for pyr4 selection.

[0375] 200 colonies were picked as selective streaks. 59 transformants were screened by PCR using the primers in Table 20 for the correct integration of the deletion cassette using standard laboratory methods. Three putative deletion clones were purified to single cell clones. Purified clones were rescreened for correct integration and for deletion of pmt3 ORF (primers on Table 19). Two clones (several parallels) were pure deletants (i.e. no signal with ORF primers).

TABLE-US-00021 TABLE 20 Primers for screening integration of deletion cassette pTTv187 and for deletion of protein O-mannosyltransferase 3 (pmt3, TreID22527) from M317. Primer Sequence T292_22527_5int ACGGGAGATCTCGGAAAA (SEQ ID NO: 122) T026_Pyr4_orf_5rev2 CCATGAGCTTGAACAGGTAA (SEQ ID NO: 123) T061_pyr4_orf_screen_2F TTAGGCGACCTCTTTTTCCA (SEQ ID NO: 124) T293_22527_3int ATGAAGCTCAGCCTGTGG (SEQ ID NO: 125) T649_22527 orf 5' GGATCGGCCACTGCCACCAC probe (SEQ ID NO: 126) T650_22527 orf 3' GCCCACTTCTCTGCGCGTGT probe (SEQ ID NO: 127)

[0376] Deletion of pmt3 was verified by Southern analyses. DNA for Southern analyses was extracted with Easy-DNA kit for genomic DNA isolation (Invitrogen) essentially according to the manufacturer's instructions.

[0377] Southern analyses were essentially performed as described in Example 1. Fragments for probes were produced by PCR using the primers listed in Table 21 using a T. reesei wild type strain QM6a (ATCC13631) as the template for the ORF probe and plasmid pTTv187 for the 5' and 3' flank probes. PCR products were separated with agarose gel electrophoresis and correct fragments were isolated from the gel with a gel extraction kit (Qiagen) using standard laboratory methods.

TABLE-US-00022 TABLE 21 Primers for production of probe fragments used in Southern analyses of protein O-mannosyltransferase 3 (pmt3, TreID22527) deletion strains. Primer Sequence T645_22527 5' flank TGGCAGATGCCGAAAGGCGG probe F (SEQ ID NO: 128) T646_22527 5' flank TGGCAACCAGCTGTGGCTCC probe R (SEQ ID NO: 129) T647_22527 3' flank CGGCCGCACTCGGCTTCTTT probe F (SEQ ID NO: 130) T648_22527 3' flank GAGTGGGCTAGGCGCAACGG probe R (SEQ ID NO: 131) T874_pmt3_orf_f3 CTCTGCGCGTGTTGTGG (SEQ ID NO: 132) T875_pmt3_orf_r3 TAAGGGTGCGGATTCGG (SEQ ID NO: 133)

[0378] Eight of the clones did not hybridise with pmt3 ORF probe (Data not shown) indicating successful deletion of pmt3. One clone (33-37K) hybridised with pmt3 ORF probe even though the signal size did not correspond to those from parental strains suggesting rearrangement in the pmt3locus. Analyses using 5' and 3' flank probes revealed that the eight .DELTA.pmt3 clones were single integrants (Data not shown). One clone (33-37K) gave incorrect or additional signals suggesting rearrangements in the pmt3 locus and multiple integrations of the deletion cassette. Two pure clones have been stored for future use (M522; 33-34A and M523; 33-188A-a).

Analyses of .DELTA.pmt3 strains M522 and M523

[0379] 24-well plate cultivation of T. reesei strain M304 and eight pmt3 deletion strains (33-34S/M522, 33-34T, 33-34U, 33-340, 33-188A-a/M523, 33-188B-a, 33-188C-a and 33-188D-a) was carried out in Trichoderma minimal medium with 40 g/l lactose, 20 g/l spent grain extract, 100 mM PIPPS, 9 g/l casamino acids, pH 5.5 at +28.degree. C., 800 rpm with humidity control. Samples were collected on days 3, 5 and 6 by centrifugation. Supernatant samples were stored to -20.degree. C. Mycelia for cell dry weight determinations were rinsed once with DDIW and dried at +100.degree. C. for 20-24 h. Mycelia for genomic DNA extraction were rinsed twice with DDIW and stored to -20.degree. C.

[0380] O-mannosylation level analysis was performed to pmt3 deletion strains as to flask cultures of pmt1 deletion strains. No difference was observed in O-mannosylation compared to parental strain M304.

Example 5--Pmt Homologs

[0381] T. reesei pmt Homologs were Identified from Other Organisms.

[0382] BLAST searches were conducted using the National Center for Biotechnology Information (NCBI) non-redundant amino acid database using the Trichoderma reesei PMT amino acid sequences as queries. Sequence hits from the BLAST searches were aligned using the ClustalW2 alignment tool provided by EBI. Phylogenetic trees were generated using average distance with BLOSUM62 after aligning the sequences in the Clustal Omega alignment tool.

[0383] A phylogenetic tree and a partial sequence alignment of the results of the PMT BLAST searches are depicted in FIGS. 5 and 6, respectively.

Sequence CWU 1

1

19712322DNATrichoderma reesei 1atggctcgaa gtccaacgcc gcagggcagc ctgcgacagc ggaacgttgc gtccaagcag 60gcgcctgtcg agtcggcatt cgttcccgag gtcgagctcg acaagctctc caaggccgct 120ctgtcgtcgc gccgaaacat ccagagaggc gagctcgagc acaagcttgc cctgacgctg 180gtgacgatcc tcggctttgt cacgcgattc tggggcatca gccaccccga cgaggtcgtc 240tttgacgagg tgcattttgg aaagttcgcc tcctactacc tccagcgaac ctacttcttc 300gacgtccacc cccctttcgc caagctgctc ttcgccttcg ttggctggct ggttggctac 360gacggtcact tccacttcga caacattggc gactcctacg tggccaacaa ggtgccctat 420gtcgccttcc gagccttgcc cgccttcctc ggcgcattga ctgtgtcggt cacatacctc 480atcatgtggg agtctggcta tagtgtgccg gcttgccttg tcgcgaccgg cctgatcctc 540ctggacaatg cgcacattgg ccagacccgc ctcattctgc tcgacgccac cctggtgctc 600gccatggcct gcagtctctt gttctacatc aagttctaca agctgcggca cgagcccttt 660agccgcaagt ggtggaagtg gctcatcctg accggctttg cgctgtcgtg cgacatctcg 720accaagtatg tcggtctctt tgcctttgtc accattggct ccgccgtcat cattgatctg 780tgggatcttt tggatatcaa gcgccgctat ggagccatca gcatgccaga gtttggaaag 840cactttgcag cccgcgcctt tggcctcatc atcttgccct tcctcttcta cctcttctgg 900ttccaggtgc acttttccgt cctgacccga tccggtcccg gcgacgactt catgactccc 960gagttccagg agacgttgag cgacaacgtc atgctggcaa gcgccgtcga catccagtac 1020tacgatacca tcaccatcag gcacaaggag accaaggcgt atcttcacag ccacaccgac 1080acctaccctc tgcgatatga cgacggccgc atctccagcc aaggccaaca ggtcaccggc 1140tacccccaca acgacaccaa caactactgg cagatcctcc ctgccgacaa tgaccagaag 1200ctcggccgta acgttaagaa tcaagacttg gtgcgacttc gacacattgt cacggacaag 1260atcctgctct cccatgatgt cgcctcgccc tactacccta ccaaccagga gttcacctgt 1320gtgacccccg aggaagcatt cggcgagcgc caaaacgaca ctctgttcga gatccggatt 1380gagggaggca agaccggcca ggacttcaag accgttgcca gccacttcaa gctcattcac 1440ttccccagca aggtggccat gtggactcat accacgcccc ttcccgagtg ggcctacagg 1500cagcaggaaa tcaacggcaa caagcaaatc actcccagct ccaacgtctg gattgccgaa 1560gacattcctt cgctcccgga agacgacgct cgccgccaca aggagcagcg caaggtcaag 1620tcgctgccgt tcctccgcaa gtggtttgag ctgcagaggt ccatgttcta ccacaacaac 1680aagctgacca gcagccaccc ctactccagc cagccctacc actggccatt cctcctccgc 1740ggagtgagct tctggacgca gaatgacaca cgccagcaaa tctactttgt gggcaacccc 1800atcggctggt ggcttgccag cagtctgctg gctgtgtttg ccggcatcat tggagctgat 1860caggtctcgc tgcgccgagg catcgatgct ctggatcacc gcacccgctc ccgactgtac 1920aactctaccg gcttcttctt ccttgcctgg gccacccact acttcccctt tttcctcatg 1980ggtcgtcagc tgttcttgca tcactacttg cctgcccatt tggcgtcctg cctggtcacg 2040ggctccctcg tcgagttcat ctttaacacg gacccggcag acgaggagcc ttcgcgatcc 2100aaaaacccca aggctactgg tcctcggaga cacatcacgg ctcgcgagcg gtttgctggc 2160aagagcatgg ccggtgcctg gatcgcttgc tttgtgattc tcgctgccgc cgcggctagc 2220tggtacttct tcttgccgtt gacgtatggc taccccggac tgtctgttga ggaggttctc 2280aggagaaagt ggcttggata tgatcttcac tttgccaagt ag 23222773PRTTrichoderma reesei 2Met Ala Arg Ser Pro Thr Pro Gln Gly Ser Leu Arg Gln Arg Asn Val1 5 10 15Ala Ser Lys Gln Ala Pro Val Glu Ser Ala Phe Val Pro Glu Val Glu 20 25 30Leu Asp Lys Leu Ser Lys Ala Ala Leu Ser Ser Arg Arg Asn Ile Gln 35 40 45Arg Gly Glu Leu Glu His Lys Leu Ala Leu Thr Leu Val Thr Ile Leu 50 55 60Gly Phe Val Thr Arg Phe Trp Gly Ile Ser His Pro Asp Glu Val Val65 70 75 80Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr Leu Gln Arg 85 90 95Thr Tyr Phe Phe Asp Val His Pro Pro Phe Ala Lys Leu Leu Phe Ala 100 105 110Phe Val Gly Trp Leu Val Gly Tyr Asp Gly His Phe His Phe Asp Asn 115 120 125Ile Gly Asp Ser Tyr Val Ala Asn Lys Val Pro Tyr Val Ala Phe Arg 130 135 140Ala Leu Pro Ala Phe Leu Gly Ala Leu Thr Val Ser Val Thr Tyr Leu145 150 155 160Ile Met Trp Glu Ser Gly Tyr Ser Val Pro Ala Cys Leu Val Ala Thr 165 170 175Gly Leu Ile Leu Leu Asp Asn Ala His Ile Gly Gln Thr Arg Leu Ile 180 185 190Leu Leu Asp Ala Thr Leu Val Leu Ala Met Ala Cys Ser Leu Leu Phe 195 200 205Tyr Ile Lys Phe Tyr Lys Leu Arg His Glu Pro Phe Ser Arg Lys Trp 210 215 220Trp Lys Trp Leu Ile Leu Thr Gly Phe Ala Leu Ser Cys Asp Ile Ser225 230 235 240Thr Lys Tyr Val Gly Leu Phe Ala Phe Val Thr Ile Gly Ser Ala Val 245 250 255Ile Ile Asp Leu Trp Asp Leu Leu Asp Ile Lys Arg Arg Tyr Gly Ala 260 265 270Ile Ser Met Pro Glu Phe Gly Lys His Phe Ala Ala Arg Ala Phe Gly 275 280 285Leu Ile Ile Leu Pro Phe Leu Phe Tyr Leu Phe Trp Phe Gln Val His 290 295 300Phe Ser Val Leu Thr Arg Ser Gly Pro Gly Asp Asp Phe Met Thr Pro305 310 315 320Glu Phe Gln Glu Thr Leu Ser Asp Asn Val Met Leu Ala Ser Ala Val 325 330 335Asp Ile Gln Tyr Tyr Asp Thr Ile Thr Ile Arg His Lys Glu Thr Lys 340 345 350Ala Tyr Leu His Ser His Thr Asp Thr Tyr Pro Leu Arg Tyr Asp Asp 355 360 365Gly Arg Ile Ser Ser Gln Gly Gln Gln Val Thr Gly Tyr Pro His Asn 370 375 380Asp Thr Asn Asn Tyr Trp Gln Ile Leu Pro Ala Asp Asn Asp Gln Lys385 390 395 400Leu Gly Arg Asn Val Lys Asn Gln Asp Leu Val Arg Leu Arg His Ile 405 410 415Val Thr Asp Lys Ile Leu Leu Ser His Asp Val Ala Ser Pro Tyr Tyr 420 425 430Pro Thr Asn Gln Glu Phe Thr Cys Val Thr Pro Glu Glu Ala Phe Gly 435 440 445Glu Arg Gln Asn Asp Thr Leu Phe Glu Ile Arg Ile Glu Gly Gly Lys 450 455 460Thr Gly Gln Asp Phe Lys Thr Val Ala Ser His Phe Lys Leu Ile His465 470 475 480Phe Pro Ser Lys Val Ala Met Trp Thr His Thr Thr Pro Leu Pro Glu 485 490 495Trp Ala Tyr Arg Gln Gln Glu Ile Asn Gly Asn Lys Gln Ile Thr Pro 500 505 510Ser Ser Asn Val Trp Ile Ala Glu Asp Ile Pro Ser Leu Pro Glu Asp 515 520 525Asp Ala Arg Arg His Lys Glu Gln Arg Lys Val Lys Ser Leu Pro Phe 530 535 540Leu Arg Lys Trp Phe Glu Leu Gln Arg Ser Met Phe Tyr His Asn Asn545 550 555 560Lys Leu Thr Ser Ser His Pro Tyr Ser Ser Gln Pro Tyr His Trp Pro 565 570 575Phe Leu Leu Arg Gly Val Ser Phe Trp Thr Gln Asn Asp Thr Arg Gln 580 585 590Gln Ile Tyr Phe Val Gly Asn Pro Ile Gly Trp Trp Leu Ala Ser Ser 595 600 605Leu Leu Ala Val Phe Ala Gly Ile Ile Gly Ala Asp Gln Val Ser Leu 610 615 620Arg Arg Gly Ile Asp Ala Leu Asp His Arg Thr Arg Ser Arg Leu Tyr625 630 635 640Asn Ser Thr Gly Phe Phe Phe Leu Ala Trp Ala Thr His Tyr Phe Pro 645 650 655Phe Phe Leu Met Gly Arg Gln Leu Phe Leu His His Tyr Leu Pro Ala 660 665 670His Leu Ala Ser Cys Leu Val Thr Gly Ser Leu Val Glu Phe Ile Phe 675 680 685Asn Thr Asp Pro Ala Asp Glu Glu Pro Ser Arg Ser Lys Asn Pro Lys 690 695 700Ala Thr Gly Pro Arg Arg His Ile Thr Ala Arg Glu Arg Phe Ala Gly705 710 715 720Lys Ser Met Ala Gly Ala Trp Ile Ala Cys Phe Val Ile Leu Ala Ala 725 730 735Ala Ala Ala Ser Trp Tyr Phe Phe Leu Pro Leu Thr Tyr Gly Tyr Pro 740 745 750Gly Leu Ser Val Glu Glu Val Leu Arg Arg Lys Trp Leu Gly Tyr Asp 755 760 765Leu His Phe Ala Lys 7703944PRTTrichoderma reesei 3Met Ala Lys Ala Thr Ala Arg Gly Arg Ser Pro Gln Pro Pro Leu Val1 5 10 15Ala Glu Lys Met Pro Val Ala Val Thr Ala Pro Val Ala Ser Ser Lys 20 25 30Ser Lys Ala Ala Lys Lys Asn Ser Ser Tyr Arg Ser Asp Gly Val Ala 35 40 45Asp Asn Asp Val Phe Leu Leu Pro Gly Ala Asp Tyr Val Ala Ala Leu 50 55 60Gly Val Thr Val Leu Ala Thr Ile Val Arg Leu Phe Lys Ile Tyr Thr65 70 75 80Pro Thr Ser Val Val Phe Asp Glu Val His Phe Gly Gly Phe Ala Ser 85 90 95Lys Tyr Ile Lys Gly Arg Phe Phe Met Asp Val His Pro Pro Leu Ala 100 105 110Lys Met Leu Ile Ala Leu Thr Gly Trp Leu Ala Gly Phe Asp Gly Asn 115 120 125Phe Asp Phe Lys Asp Ile Gly Lys Asp Tyr Leu Glu Pro Gly Val Pro 130 135 140Tyr Val Ala Met Arg Met Phe Pro Ala Val Cys Gly Ile Leu Leu Ala145 150 155 160Pro Phe Met Phe Phe Thr Leu Lys Ala Val Gly Cys Arg Thr Thr Thr 165 170 175Ala Ile Leu Gly Ala Ser Phe Ile Ile Phe Glu Asn Gly Leu Leu Thr 180 185 190Gln Ala Arg Leu Ile Leu Leu Asp Ser Pro Leu Val Ala Ala Thr Ala 195 200 205Phe Thr Ala Met Ser Phe Asn Cys Phe Thr Asn Gln His Glu Gln Gly 210 215 220Pro Asp Lys Ala Phe Ser Leu Ser Trp Trp Phe Trp Leu Ala Met Thr225 230 235 240Gly Leu Gly Leu Gly Ile Thr Ser Ser Ile Lys Trp Val Gly Leu Phe 245 250 255Thr Ile Ala Trp Val Gly Ser Leu Thr Leu Val Gln Leu Trp Val Leu 260 265 270Leu Gly Asp Ser Lys Asn Val Ser Met Arg Leu Trp Phe Lys His Phe 275 280 285Met Ala Arg Val Phe Cys Leu Ile Ile Ile Pro Leu Thr Phe Tyr Leu 290 295 300Ser Met Phe Ala Ile His Phe Leu Cys Leu Thr Asn Pro Gly Glu Gly305 310 315 320Asp Gly Phe Met Ser Ser Glu Phe Gln Ala Thr Leu Asn Ser Lys Gly 325 330 335Met Lys Asp Val Pro Ala Asp Val Val Phe Gly Ser Arg Val Thr Ile 340 345 350Arg His Val Asn Thr Gln Gly Gly Tyr Leu His Ser His Pro Leu Met 355 360 365Tyr Pro Thr Gly Ser Leu Gln Gln Gln Ile Thr Leu Tyr Pro His Lys 370 375 380Asp Glu Asn Asn Ile Trp Ile Met Glu Asn Gln Thr Gln Pro Leu Gly385 390 395 400Val Asp Gly Gln Pro Ile Asn Gly Thr Glu Ala Trp Asp Ala Leu Pro 405 410 415Glu Val His His Val Val Asp Gly Ser Val Ile Arg Leu Tyr His Lys 420 425 430Pro Thr Phe Arg Arg Leu His Ser His Asp Val Arg Pro Pro Val Thr 435 440 445Glu Ala Glu Trp Gln Asn Glu Val Ser Ala Tyr Gly Tyr Glu Gly Phe 450 455 460Glu Gly Asp Ala Asn Asp Leu Phe Arg Val Glu Ile Val Lys Lys Gln465 470 475 480Ser Lys Gly Pro Leu Ala Lys Glu Arg Leu Arg Thr Ile Glu Thr Lys 485 490 495Phe Arg Leu Ile His Val Met Thr Gly Cys Ala Leu Phe Ser His Lys 500 505 510Val Lys Leu Pro Glu Trp Ala Ser Glu Gln Gln Glu Val Thr Cys Ala 515 520 525Arg Gly Gly Ser Leu Pro Asn Ser Ile Trp Tyr Ile Glu Tyr Asn Glu 530 535 540His Pro Leu Leu Gly Asp Asp Val Glu Lys Val Asn Tyr Ala Asn Pro545 550 555 560Gly Phe Phe Gly Lys Phe Trp Glu Leu His Lys Val Met Trp Lys Thr 565 570 575Asn Ala Gly Leu Thr Asp Ser His Ala Trp Asp Ser Arg Pro Pro Ser 580 585 590Trp Pro Ile Leu Arg Arg Gly Ile Asn Phe Trp Gly Lys His His Met 595 600 605Gln Val Tyr Leu Leu Gly Asn Pro Phe Ile Trp Trp Ser Ser Thr Ala 610 615 620Ala Val Ala Ile Trp Val Ile Phe Lys Gly Val Ala Ile Leu Arg Trp625 630 635 640Gln Arg Gly Cys Asn Asp Tyr Ala Ser Ser Thr Phe Lys Arg Phe Asp 645 650 655Tyr Glu Ile Gly Thr Ser Val Leu Gly Trp Ala Leu His Tyr Phe Pro 660 665 670Phe Tyr Leu Met Glu Arg Gln Leu Phe Leu His His Tyr Phe Pro Ala 675 680 685Leu Tyr Phe Ala Ile Leu Ala Leu Cys Gln Met Phe Asp Phe Ala Thr 690 695 700Val Arg Ile Pro Ala Ala Leu Gly Tyr Arg Ser Thr Leu Ile Asn Arg705 710 715 720Val Gly Thr Val Ser Leu Leu Val Ile Ser Ala Ala Val Phe Thr Leu 725 730 735Phe Ala Pro Leu Ala Tyr Gly Thr Pro Trp Thr Lys Ala Glu Cys Asn 740 745 750Arg Val Lys Leu Phe Asp Lys Trp Asp Phe Asp Cys Asn Thr Phe Leu 755 760 765Asp Asp Tyr Lys Ser Tyr Thr Leu Thr Ser Leu Ala Pro Ser Ser Ile 770 775 780Ala Pro Ser Pro Pro Ala Ala Asn Val Pro Val Val Asn Gln Glu Gln785 790 795 800Lys Pro Leu Ala Lys Gln Pro Glu Pro Val Ile Ser Gln Ala Ala Val 805 810 815Pro Gln Glu Pro Gln Ile Leu Ser Lys Glu Glu Lys Ile Glu Tyr Arg 820 825 830Asp Gln Asp Gly Asn Leu Leu Asn Asp Glu Gln Val Lys Ala Leu Gln 835 840 845Gly Lys Val Glu Phe Lys Thr Lys Tyr Glu Thr Lys Thr Arg Val Val 850 855 860Asp Ala Gln Gly His Glu Ile Pro Val Pro Glu Gly Gly Trp Pro Asp865 870 875 880Asp Met Ile Ala Gly Val Ala Pro Pro His Pro Asp Val Glu Gly Val 885 890 895Asp Lys Glu Thr Pro Lys Val Glu Ser Ala Glu Val Pro Lys Glu Ala 900 905 910Ala Ala Ser Arg Asp Gly Glu Val Glu Ala Glu Asn Leu Lys Ala Lys 915 920 925Pro Ala Ser Glu Gly Gln Glu Val Glu Ala Thr Val Gln Glu Glu Leu 930 935 9404740PRTTrichoderma reesei 4Met Ala Ala Asp Lys Ala Ala Leu Ala Ser Gly Ala Asp Leu Gly Asp1 5 10 15Gly Leu Arg Lys Arg Gln Ala Ala Ser Gln Ala Val Pro Ser Phe Ile 20 25 30Pro Ala Gln Thr Glu Asp Thr Lys Lys Leu Ala Lys Lys Asp Lys Thr 35 40 45Phe Val Gln Val Leu Ala Asp Trp Glu Ser Val Leu Ala Pro Leu Ile 50 55 60Phe Thr Ala Val Ala Ile Phe Thr Arg Leu Tyr Lys Ile Gly Leu Ser65 70 75 80Asn Ile Val Thr Trp Asp Glu Ala His Phe Gly Lys Phe Gly Ser Tyr 85 90 95Tyr Ile Lys His Glu Tyr Tyr Phe Asp Val His Pro Pro Leu Gly Lys 100 105 110Met Leu Val Gly Leu Ser Gly Val Leu Ala Gly Tyr Asn Gly Ser Phe 115 120 125Glu Phe Lys Ser Gly Glu Gln Tyr Pro Glu Asp Val Asn Tyr Thr Phe 130 135 140Met Arg Ala Phe Asn Ala Ala Phe Gly Ile Ala Cys Ile Pro Met Ala145 150 155 160Tyr Phe Thr Ala Lys Glu Leu Lys Leu Thr Arg Pro Ala Val Trp Phe 165 170 175Val Thr Leu Met Val Leu Cys Glu Asn Ser Tyr Thr Thr Ile Ser Arg 180 185 190Phe Ile Leu Leu Asp Ser Met Leu Leu Cys Gly Thr Phe Ala Thr Thr 195 200 205Leu Cys Trp Ala Lys Phe His Asn Gln Arg His Asn Ser Phe Glu Pro 210 215 220Glu Trp Phe Phe Trp Leu Phe Met Thr Gly Leu Ser Ile Gly Cys Val225 230 235 240Cys Ser Val Lys Leu Val Gly Leu Phe Val Thr Ala Leu Val Gly Leu 245 250 255Tyr Thr Ile Glu Asp Leu Trp Arg Lys Tyr Gly Asp Arg Lys Met Pro 260 265 270Ile Pro Val Leu Ala Ala His Phe Ser Ala Arg Val Val Gly Leu Ile 275 280 285Ile Val Pro Phe Leu Ile Tyr Met Leu Ser Phe Ala Leu His Phe Ala 290 295 300Ile Leu Asp His Ser Gly Pro Gly Asp Ala Gln Met Ser Ser Leu Phe305 310 315 320Gln Ala Asn Leu Lys Gly Thr Glu Val Gly Lys Asn Ser Pro Leu Glu 325 330 335Ile Ala Leu Gly Ser Arg Ala Thr Ile Lys Asn Met Gly Tyr Gly Gly 340 345 350Gly Leu Leu His Ser His Val Gln Thr Tyr Pro Glu Gly Ser Gly Gln

355 360 365Gln Gln Val Thr Cys Tyr His His Lys Asp Ala Asn Asn Asp Trp Phe 370 375 380Phe Tyr Pro Asn Arg His Glu Pro Asp Tyr Asp Pro Glu Gly Glu Leu385 390 395 400Arg Phe Ile Gly Asp Gly Ser Val Ile Arg Leu Ile His Ala Gln Thr 405 410 415Gly Arg Asn Leu His Ser His Asp Ile Asp Ala Pro Ile Thr Lys Ser 420 425 430His Arg Glu Val Ser Ser Tyr Gly Asn Leu Thr Val Gly Asp Glu Lys 435 440 445Asp His Trp Lys Ile Glu Val Val Arg Asp Ala Ala Ser Arg Asp Arg 450 455 460Ser Arg Ile Arg Thr Leu Thr Thr Ala Phe Arg Leu Lys His Thr Val465 470 475 480Leu Gly Cys Tyr Leu Arg Ala Gly Asn Val Asn Leu Pro Gln Trp Gly 485 490 495Phe Lys Gln Ile Glu Val Thr Cys Asp Lys Gln Asn Asn Pro Arg Asp 500 505 510Thr Tyr Thr His Trp Asn Val Glu Ala His Trp Asn Asp Arg Leu Pro 515 520 525Pro Ser Asp Pro Gly Val Tyr Lys Ser Pro Phe Ile His Asp Phe Ile 530 535 540His Leu Asn Val Ala Met Met Thr Ser Asn Asn Ala Leu Val Pro Asp545 550 555 560Pro Asp Lys Gln Asp Asp Leu Ala Ser Gln Trp Trp Gln Trp Pro Ile 565 570 575Leu His Val Gly Leu Arg Met Cys Ser Trp Asp Asp Asn Ile Val Lys 580 585 590Tyr Phe Leu Leu Gly Asn Pro Phe Val Tyr Trp Ala Ser Thr Ala Ser 595 600 605Leu Gly Ala Val Ala Leu Val Ile Ala Trp Tyr Val Val Arg Trp Gln 610 615 620Arg Gly Phe Lys Glu Leu Ser Asn Ser Glu Val Asp Gln Ile His Tyr625 630 635 640Ala Gly Ile Tyr Pro Val Ile Gly Trp Phe Leu His Tyr Leu Pro Phe 645 650 655Val Ile Met Ala Arg Val Thr Tyr Val His His Tyr Tyr Pro Ala Leu 660 665 670Tyr Phe Ala Ile Leu Ser Leu Gly Phe Leu Val Asp Trp Val Leu Arg 675 680 685Asn Arg Ala Ala Val Val Gln Gly Val Ala Tyr Gly Ile Leu Tyr Thr 690 695 700Val Val Ile Gly Leu Tyr Ile Leu Phe Met Pro Ile Cys Trp Gly Met705 710 715 720Thr Gly Ser Ser Lys Gln Tyr Ser Tyr Leu Lys Trp Phe Asp Asn Trp 725 730 735Arg Ile Ser Asp 7405775PRTAspergillus oryzae 5Met Ser Gln Ser Pro Ser Pro Ser Leu Arg Lys Arg Gly Gly Lys Lys1 5 10 15Glu Ala Ser Pro Gly Pro Ser Glu Val Ser Ser Pro Tyr Pro Thr Asn 20 25 30Gln Gly Ala Thr Pro Lys Pro Gln Ser Glu Trp Asp Tyr Arg Leu Ala 35 40 45Ile Thr Val Leu Thr Val Leu Ala Phe Ile Thr Arg Phe Tyr Arg Ile 50 55 60Ser Tyr Pro Asp Glu Val Val Phe Asp Glu Val His Phe Gly Lys Phe65 70 75 80Ala Ser Tyr Tyr Leu Gln Arg Thr Tyr Phe Phe Asp Val His Pro Pro 85 90 95Phe Gly Lys Leu Leu Phe Ala Ala Val Gly Trp Leu Ile Gly Tyr Asp 100 105 110Gly His Phe Leu Phe Glu Asn Ile Gly Asp Ser Tyr Ile Asp Asn Lys 115 120 125Val Pro Tyr Val Ala Phe Arg Ala Leu Pro Ala Thr Leu Gly Ala Leu 130 135 140Thr Val Pro Val Val Phe Leu Ile Met Trp Glu Ser Gly Tyr Ser Leu145 150 155 160Pro Ala Cys Val Leu Ala Ala Gly Leu Val Leu Phe Asp Asn Ala His 165 170 175Ile Gly Glu Asp Arg Leu Ile Leu Leu Asp Ala Thr Leu Val Ile Thr 180 185 190Met Ala Leu Ser Ile Leu Cys Tyr Val Arg Phe Tyr Lys Leu Arg His 195 200 205Glu Pro Phe Gly Arg Lys Trp Trp Lys Trp Leu Leu Leu Thr Gly Val 210 215 220Ser Leu Ser Cys Val Ile Ser Thr Lys Tyr Val Gly Val Phe Thr Phe225 230 235 240Val Thr Ile Gly Ala Ala Val Met Val Asp Leu Trp Asn Leu Leu Asp 245 250 255Ile Arg Arg Pro Ala Gly Ala Leu Ser Met Met Glu Trp Thr Lys His 260 265 270Phe Ala Ala Arg Gly Phe Ala Leu Ile Val Val Pro Phe Phe Phe Tyr 275 280 285Leu Phe Trp Phe Gln Val His Phe Ala Ile Leu Thr Arg Ser Gly Pro 290 295 300Gly Asp Asp Phe Met Thr Pro Glu Phe Gln Glu Thr Leu Ser Asp Asn305 310 315 320Ala Leu Ala Ala Glu Ser Ile Gly Ile Gln Tyr Tyr Asp Ala Ile Thr 325 330 335Ile Arg His Lys Asp Thr Lys Val Phe Leu His Ser His Trp Glu Arg 340 345 350Tyr Pro Leu Arg Tyr Asp Asp Gly Arg Ile Ser Ser Gln Gly Gln Gln 355 360 365Val Thr Gly Tyr Pro Phe Asn Asp Thr Asn Asn Gln Trp Gln Ile Leu 370 375 380Pro Thr Val Pro Leu Glu Asp Asn Glu Gly Gln Gly His Ser Val Lys385 390 395 400Asn Gly Asp Leu Val Gln Leu Leu His Leu Gly Thr Asp Ser Ile Leu 405 410 415Leu Thr His Asp Val Ala Ser Pro Phe Tyr Pro Thr Asn Gln Glu Phe 420 425 430Thr Thr Val Thr Lys Asp Val Ala Ser Gly Glu Arg His Asn Glu Thr 435 440 445Leu Phe Glu Ile Lys Ile Glu Asn Gly Lys Ala Gly Gln Glu Phe Arg 450 455 460Thr Leu Ser Ser His Phe Lys Leu Ile His Tyr Pro Thr Arg Val Ala465 470 475 480Met Trp Thr His Thr Thr Pro Leu Pro Glu Trp Gly Phe Lys Gln Ala 485 490 495Glu Ile Asn Gly Asn Lys Asn Val Leu Gln Thr Ser Asn Leu Trp Tyr 500 505 510Ala Glu Ser Ile Glu Ser Leu Glu Glu Asp Ser Pro Arg Lys Gln Lys 515 520 525Glu Glu Arg Lys Val Lys Gln Leu Pro Phe Leu Arg Lys Tyr Leu Glu 530 535 540Leu Gln Arg Ala Met Phe Phe His Asn Asn Ala Leu Thr Ser Ser His545 550 555 560Pro Tyr Ala Ser Glu Pro Phe Gln Trp Pro Phe Leu Leu Arg Gly Val 565 570 575Ser Phe Trp Thr Lys Asn Asp Thr Arg Glu Gln Ile Tyr Phe Leu Gly 580 585 590Asn Pro Ile Gly Trp Trp Ile Ala Ser Ser Leu Leu Ala Val Phe Ala 595 600 605Gly Val Ile Gly Ala Asp Gln Leu Ser Leu Arg Arg Gly Val Asp Ala 610 615 620Val Glu Glu Ile Trp Gly Pro Gly Ala Arg Ser Arg Leu Tyr Asn Ser625 630 635 640Thr Gly Phe Leu Phe Leu Cys Trp Gly Ala His Tyr Phe Pro Phe Trp 645 650 655Leu Met Gly Arg Gln Arg Phe Leu His His Tyr Leu Pro Ala His Leu 660 665 670Ala Ser Cys Leu Val Thr Gly Ala Leu Ile Glu Phe Ile Phe Asn Leu 675 680 685Gln Pro Val Gln Ala Val Ile Asp Ser Glu Val Asp Pro Ser Gly Lys 690 695 700Ser Lys Ser Ile Arg Pro Arg His Phe Val Thr Ala Lys Glu Arg Met705 710 715 720Ser Arg Lys Ser Leu Val Ala Cys Trp Ile Ala Thr Leu Ser Ile Leu 725 730 735Ala Val Thr Val Trp Gly Phe Trp Phe Tyr Ala Pro Leu Thr Tyr Gly 740 745 750Thr Pro Gly Leu Asp Val Ala Gly Val Asn Ala Arg Arg Trp Leu Gly 755 760 765Tyr Asp Leu His Phe Ala Lys 770 7756775PRTAspergillus niger 6Met Ser Ser Ser Pro Ser Pro Ser Leu Arg Lys Arg Gly Gly Lys Lys1 5 10 15Glu Ser Thr Pro Val Pro Ala Asp Asn Phe Ser Ser Pro Leu Ser Lys 20 25 30Ala Ser Ala Pro Arg Ser Glu Trp Asp Tyr Trp Leu Ala Ile Ser Ile 35 40 45Leu Thr Val Leu Ala Phe Val Thr Arg Phe Tyr Lys Ile Ser Tyr Pro 50 55 60Asn Glu Val Val Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr65 70 75 80Tyr Leu Gln Arg Thr Tyr Phe Phe Asp Val His Pro Pro Phe Gly Lys 85 90 95Leu Leu Phe Ala Phe Met Gly Trp Leu Val Gly Tyr Asp Gly His Phe 100 105 110Leu Phe Asp Asn Ile Gly Asp Ser Tyr Ile Glu His Gln Val Pro Tyr 115 120 125Val Ala Leu Arg Ala Met Pro Ala Thr Leu Gly Ala Leu Thr Val Pro 130 135 140Val Val Phe Leu Ile Met Trp Glu Ser Gly Tyr Ser Leu Pro Ala Cys145 150 155 160Val Leu Ser Ala Gly Leu Val Leu Phe Asp Asn Ala His Ile Gly Glu 165 170 175Asp Arg Leu Ile Leu Leu Asp Ala Ser Leu Val Leu Thr Met Ala Leu 180 185 190Ser Ile Leu Cys Tyr Ile Arg Phe Tyr Lys Leu Arg His Glu Ala Phe 195 200 205Gly Arg Lys Trp Trp Lys Trp Leu Leu Leu Thr Gly Val Ser Leu Ser 210 215 220Cys Val Ile Ser Thr Lys Tyr Val Gly Val Phe Thr Phe Val Thr Ile225 230 235 240Gly Ser Ala Val Met Val Asp Leu Trp Asn Leu Leu Asp Ile Arg Arg 245 250 255Arg Gly Gly Ala Leu Thr Met Phe Gln Trp Gly Gln His Phe Val Ala 260 265 270Arg Ala Phe Ala Leu Ile Ile Val Pro Phe Phe Phe Tyr Leu Phe Trp 275 280 285Phe Gln Val His Phe Ala Ile Leu Thr Arg Ser Gly Pro Gly Asp Asp 290 295 300Phe Met Thr Pro Glu Phe Gln Glu Thr Leu Ser Asp Asn Val Leu Ser305 310 315 320Ala Gln Ser Ile Gly Ile Glu Tyr Tyr Asp Thr Ile Thr Met Lys His 325 330 335Lys Asp Thr Lys Val Tyr Leu His Ser His Leu Glu Arg Tyr Pro Leu 340 345 350Arg Tyr Asp Asp Gly Arg Ile Ser Ser Gln Gly Gln Gln Val Thr Gly 355 360 365Tyr Pro Tyr Asn Asp Thr Asn Asn Gln Trp Gln Ile Ile Pro Thr Val 370 375 380Pro Leu Asp Val Thr Asp Thr Ser Gly His Lys Val Arg Asn Gly Asp385 390 395 400Val Val Gln Leu Arg His Met Gly Thr Asp Thr Ile Leu Leu Thr His 405 410 415Asp Val Ala Ser Pro Tyr Tyr Pro Thr Asn Gln Glu Phe Thr Thr Val 420 425 430Ser His Glu Val Ala Asn Gly Asp Arg His Asn Asp Thr Leu Phe Glu 435 440 445Ile Lys Ile Glu Asn Gly Lys Pro His Gln Glu Phe Arg Thr Leu Ser 450 455 460Ser His Phe Lys Leu Ile His Met Pro Thr Arg Val Ala Met Trp Thr465 470 475 480His Thr Thr Pro Leu Pro Asp Trp Ala Phe Lys Gln Ala Glu Ile Asn 485 490 495Gly Asn Lys Asn Ile Leu Gln Thr Ser Asn Leu Trp Phe Val Glu Ser 500 505 510Ile Glu Ser Leu Glu Glu Asp Ser Pro Arg Leu Val Lys Glu Glu Arg 515 520 525Gln Val Lys His Leu Pro Phe Phe Arg Lys Tyr Leu Glu Leu Gln Arg 530 535 540Ala Met Phe Phe His Asn Asn Ala Leu Thr Ser Ser His Pro Tyr Ala545 550 555 560Ser Glu Pro Phe Gln Trp Pro Phe Leu Leu Arg Gly Val Ser Phe Trp 565 570 575Thr Lys Asn Asp Thr Arg Glu Gln Ile Tyr Phe Leu Gly Asn Pro Val 580 585 590Gly Trp Trp Ile Ala Ser Ser Leu Leu Ala Val Phe Ala Gly Val Ile 595 600 605Gly Ala Asp Gln Leu Ser Leu Arg Arg Gly Val Asp Ala Val Glu Glu 610 615 620Ile Trp Gly Gln Gly Ser Arg Ser Arg Leu Tyr Asn Ser Met Gly Phe625 630 635 640Leu Phe Leu Cys Trp Ala Ala His Tyr Phe Pro Phe Trp Leu Met Gly 645 650 655Arg Gln Arg Phe Leu His His Tyr Leu Pro Ala His Leu Ala Ser Ala 660 665 670Leu Val Ala Gly Ala Leu Ile Glu Phe Ile Phe Asn Leu Glu Pro Leu 675 680 685Ser Val Ile Gln Arg Val Arg Ser Glu Asp Asp Pro Ser Gly Lys Ala 690 695 700Lys Ala Ser Ala Ser Val Gly Arg Phe Val Thr Ala Lys Glu Arg Met705 710 715 720Gly Thr Lys Ser Leu Leu Ala Gly Trp Ile Ala Thr Leu Val Ile Leu 725 730 735Ala Gly Thr Ile Tyr Gly Phe Val Phe Tyr Ala Pro Leu Thr Tyr Gly 740 745 750Thr Pro Gly Leu Asp Val Pro Gly Ile Leu Ala Arg Lys Trp Leu Gly 755 760 765Tyr Asp Leu His Phe Ala Lys 770 7757773PRTAspergillus nidulans 7Met Ser Ser Ser Pro Ser Leu Arg Lys Arg Gly Gly Lys Arg Glu Asp1 5 10 15Thr Pro Val Pro Ser Asp Arg Ser Phe Ala Pro Ser Ala Ser Gln Leu 20 25 30Gly Ala Ala Ser Arg Ser Ser Glu Trp Asp Tyr Arg Leu Ala Ile Thr 35 40 45Ile Leu Thr Val Leu Ala Phe Ile Thr Arg Phe Tyr Lys Ile Ser Tyr 50 55 60Pro Asp Gln Val Val Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser65 70 75 80Tyr Tyr Leu Arg Arg Thr Tyr Phe Phe Asp Val His Pro Pro Phe Ala 85 90 95Lys Leu Leu Leu Ala Phe Thr Gly Trp Leu Val Gly Tyr Asp Gly His 100 105 110Phe Leu Phe Glu Asn Ile Gly Asp Ser Tyr Ile Asp Asn Lys Val Pro 115 120 125Tyr Val Ala Leu Arg Ala Met Pro Ala Val Leu Gly Ala Leu Thr Ile 130 135 140Pro Val Val Phe Leu Ile Met Trp Glu Ser Gly Tyr Ser Leu Pro Ala145 150 155 160Cys Val Leu Ala Ser Gly Leu Val Leu Phe Asp Asn Ala His Val Gly 165 170 175Glu Asp Arg Leu Ile Leu Leu Asp Ser Thr Leu Val Ile Thr Met Ala 180 185 190Leu Ser Ile Leu Cys Tyr Ile Arg Phe Tyr Lys Leu Arg His Glu Pro 195 200 205Phe Gly Arg Lys Trp Trp Lys Trp Leu Leu Leu Thr Gly Val Ser Leu 210 215 220Ser Cys Val Ile Ser Thr Lys Tyr Val Gly Val Phe Thr Phe Val Thr225 230 235 240Ile Gly Ser Ala Val Met Val Asp Leu Trp Asn Leu Leu Asp Ile Arg 245 250 255Arg Gln Gly Gly Ala Leu Thr Met Phe Glu Trp Thr Lys His Phe Ala 260 265 270Ala Arg Phe Phe Ser Leu Ile Val Val Pro Phe Phe Phe Tyr Leu Phe 275 280 285Trp Phe Gln Val His Phe Ala Ile Leu Thr His Ser Gly Pro Gly Asp 290 295 300Asp Phe Met Thr Pro Ala Phe Gln Glu Thr Leu Ser Asp Asn Ala Met305 310 315 320Ala Ala Gln Ser Val Ser Ile Glu Tyr Phe Asp Thr Ile Thr Met Arg 325 330 335His Lys Asp Thr Lys Val Phe Leu His Ser His Ser Asp Thr Tyr Pro 340 345 350Leu Arg Tyr Asp Asp Gly Arg Ile Ser Ser Gln Gly Gln Gln Val Thr 355 360 365Gly Tyr Pro Tyr Asn Asp Thr Asn Asn His Trp Gln Ile Ile Pro Thr 370 375 380Val Pro Leu Asp Glu Thr Asp Glu Lys Ser Arg Lys Val Arg Asn Gly385 390 395 400Asp Ile Val Gln Leu Arg His Val Ala Thr Asp Thr Ile Leu Leu Thr 405 410 415His Asp Val Ala Ser Pro Tyr Tyr Pro Thr Asn Gln Glu Phe Thr Thr 420 425 430Val Ser His Glu Leu Ala Asp Gly Lys Arg His Asn Asp Thr Leu Phe 435 440 445Glu Ile Arg Val Glu His Gly Lys Ser Lys Gln Glu Phe Arg Thr Leu 450 455 460Ser Ser Gln Phe Lys Leu Val His Val Pro Thr Lys Val Ala Met Trp465 470 475 480Thr His Thr Thr Pro Leu Pro Asp Trp Ala Tyr Lys Gln Ala Glu Ile 485 490 495Asn Gly Asn Lys Asn Val Leu Gln Ser Ser Asn Ile Trp Tyr Val Glu 500 505 510Ala Ile Glu Ser Leu Glu Glu Asp Ser Pro Arg Leu Lys Lys Glu Glu 515 520 525Arg Lys Val Lys His Leu Pro Phe Trp Arg Lys Tyr Ile Glu

Leu Gln 530 535 540Arg Ala Met Phe Phe His Asn Asn Ala Leu Thr Ser Ser His Pro Tyr545 550 555 560Ala Ser Glu Pro Phe Gln Trp Pro Phe Leu Leu Arg Gly Val Ser Phe 565 570 575Trp Thr Lys Ser Asp Thr Arg Glu Gln Ile Tyr Phe Leu Gly Asn Pro 580 585 590Val Gly Trp Trp Ile Ser Ser Ser Leu Leu Ala Val Phe Ala Gly Val 595 600 605Ile Gly Ala Asp Gln Leu Ser Leu Arg Arg Gly Val Asp Ala Val Glu 610 615 620Glu Ile Trp Gly Pro Gly Ser Arg Ser Arg Leu Tyr Asn Ser Thr Gly625 630 635 640Phe Leu Phe Leu Cys Trp Ala Ala His Tyr Phe Pro Phe Trp Leu Met 645 650 655Gly Arg Gln Arg Phe Leu His His Tyr Leu Pro Ala His Val Ala Ser 660 665 670Ala Leu Val Thr Gly Ala Leu Ile Glu Phe Ile Phe Asn Ile Gln Pro 675 680 685Ile Ser Val Pro Ala Thr Ile Pro Val Ala Ala Asp Asp Pro Thr Gly 690 695 700Lys Gly Lys Thr Arg Arg Phe Val Thr Ala Arg Glu Arg Met Gly Val705 710 715 720Lys Ser Ile Val Ala Gly Trp Ile Ala Ser Leu Thr Ile Leu Ala Ala 725 730 735Thr Ile Trp Gly Phe Trp Phe Phe Ala Pro Leu Thr Tyr Gly Thr Pro 740 745 750Gly Leu Asp Val Ala Gln Val Asn Ala Arg Lys Trp Leu Gly Tyr Asp 755 760 765Leu His Phe Ala Lys 7708774PRTTrichoderma virens 8Met Ala Arg Thr Pro Thr Pro Gln Pro Pro Ser Leu Arg Gln Arg Asn1 5 10 15Val Ala Ser Lys Gln Pro Val Ser Glu Ala Thr Phe Ala Pro Glu Val 20 25 30Glu Leu Asp Lys Leu Ser Lys Ala Ala Ala Ser Ser Arg Gln Asn Ile 35 40 45Gln Arg Gly Glu Thr Glu His Arg Val Ala Leu Thr Leu Val Thr Ile 50 55 60Leu Gly Phe Val Thr Arg Phe Trp Gly Ile Ser His Pro Asp Glu Val65 70 75 80Val Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr Leu Gln 85 90 95Arg Thr Tyr Phe Phe Asp Val His Pro Pro Phe Ala Lys Leu Leu Phe 100 105 110Ala Phe Val Gly Trp Leu Val Gly Tyr Asp Gly His Phe His Phe Glu 115 120 125Asn Ile Gly Asp Ser Tyr Ile Ala Asn Lys Val Pro Tyr Val Ala Phe 130 135 140Arg Ala Leu Pro Ala Phe Leu Gly Ala Leu Thr Val Ser Val Thr Tyr145 150 155 160Leu Ile Met Trp Glu Ser Gly Tyr Ser Val Pro Ala Cys Leu Val Ala 165 170 175Thr Gly Leu Ile Leu Leu Asp Asn Ala His Ile Gly Gln Thr Arg Leu 180 185 190Ile Leu Leu Asp Ala Thr Leu Val Leu Ala Met Ala Cys Ser Leu Leu 195 200 205Phe Tyr Ile Lys Phe Tyr Lys Leu Arg His Glu Pro Phe Ser Arg Lys 210 215 220Trp Trp Lys Trp Leu Val Leu Thr Gly Phe Ala Leu Ser Cys Asp Ile225 230 235 240Ser Thr Lys Tyr Val Gly Leu Phe Ala Phe Val Thr Ile Gly Ser Ala 245 250 255Val Ile Ile Asp Leu Trp Glu Leu Leu Asp Ile Arg Arg Pro Gly Gly 260 265 270Ala Ile Ser Leu Pro Leu Phe Gly Lys His Phe Ala Ala Arg Ala Val 275 280 285Gly Leu Ile Ile Leu Pro Phe Leu Phe Tyr Leu Phe Trp Phe Gln Val 290 295 300His Phe Ala Val Leu Thr Arg Ser Gly Pro Gly Asp Asp Phe Met Ser305 310 315 320Pro Glu Phe Gln Glu Thr Leu Ser Asp Asn Val Met Leu Ala Ser Ala 325 330 335Val Asp Ile Gln Tyr Tyr Asp Thr Ile Thr Ile Arg His Lys Glu Thr 340 345 350Lys Ala Tyr Leu His Ser His Leu Asp Thr Tyr Pro Leu Arg Tyr Asp 355 360 365Asp Gly Arg Ile Ser Ser Gln Gly Gln Gln Val Thr Gly Tyr Pro His 370 375 380Asn Asp Thr Asn Asn Tyr Trp Gln Ile Ile Pro Ala Ser Asn Asp Gln385 390 395 400Lys Leu Gly Arg Ile Val Arg Asn Gln Glu Leu Val Arg Leu Arg His 405 410 415Ile Val Thr Asp Lys Ile Leu Leu Ser His Asp Val Ala Ser Pro Tyr 420 425 430Tyr Pro Thr Asn Gln Glu Phe Thr Ala Val Ser Ala Glu Glu Ala Tyr 435 440 445Gly Asp Arg Leu Asn Asp Thr Leu Phe Glu Ile Arg Ile Glu Gly Gly 450 455 460Lys Pro Asn Gln Asp Phe Lys Thr Ile Ala Ser His Phe Lys Leu Ile465 470 475 480His Phe Pro Ser Lys Val Ala Met Trp Thr His Thr Thr Pro Leu Pro 485 490 495Glu Trp Ala Tyr Arg Gln Gln Glu Ile Asn Gly Asn Lys Gln Ile Thr 500 505 510Pro Ser Ser Asn Val Trp Ile Ala Glu Asp Ile Pro Ser Leu Pro Glu 515 520 525Asp His Ser Arg Arg Gln Lys Glu Glu Arg Lys Val Lys Ser Leu Pro 530 535 540Phe Leu Arg Lys Trp Phe Glu Leu Gln Arg Ser Met Phe Tyr His Asn545 550 555 560Asn Lys Leu Thr Ser Ser His Pro Tyr Ser Ser Gln Pro Tyr His Trp 565 570 575Pro Phe Leu Leu Arg Gly Val Ser Phe Trp Thr Gln Asn Asp Thr Arg 580 585 590Gln Gln Ile Tyr Phe Val Gly Asn Pro Ile Gly Trp Trp Leu Ala Ser 595 600 605Gly Leu Leu Ala Val Phe Ala Gly Ile Ile Gly Ala Asp Gln Val Ser 610 615 620Leu Arg Arg Gly Ile Asp Ala Leu Asp His Arg Thr Arg Ser Arg Leu625 630 635 640Tyr Asn Ser Thr Gly Phe Phe Trp Leu Ala Trp Ala Thr His Tyr Phe 645 650 655Pro Phe Phe Leu Met Gly Arg Gln Leu Phe Leu His His Tyr Leu Pro 660 665 670Ala His Leu Ala Ser Cys Leu Val Thr Gly Ser Leu Val Glu Phe Ile 675 680 685Phe Asn Thr Asp Pro Ala Asp Glu Glu Pro Ser Arg Ala Thr Asn Pro 690 695 700Arg Ala Ser Gly Pro Lys Arg His Ile Thr Ala Arg Glu Arg Phe Ala705 710 715 720Gly Lys Ser Met Ala Gly Ala Trp Ile Ala Cys Phe Val Ile Leu Thr 725 730 735Val Ala Ala Ala Ser Trp Tyr Phe Phe Leu Pro Leu Thr Tyr Gly Tyr 740 745 750Pro Gly Leu Ser Val Asp Glu Val Asn Arg Arg Lys Trp Leu Gly Tyr 755 760 765Asp Leu His Phe Ala Lys 7709771PRTTrichoderma atroviride 9Met Ala Arg Ala Ser Thr Pro Gln Gly Ser Leu Arg Gln Arg Gly Val1 5 10 15Ala Ser Lys Gln Thr Leu Ser Glu Ser Thr Phe Ala Pro Glu Val Glu 20 25 30Leu Asp Lys Leu Ser Lys Ala Ala Ala Ser Ser Arg Gln Asn Val Gln 35 40 45Arg Gly Glu Ile Glu His Lys Ile Ala Leu Thr Leu Val Thr Ile Leu 50 55 60Gly Phe Val Thr Arg Phe Trp Gly Ile Ser His Pro Asp Glu Val Val65 70 75 80Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr Leu Gln Arg 85 90 95Thr Tyr Phe Phe Asp Val His Pro Pro Phe Ala Lys Leu Leu Phe Ala 100 105 110Phe Val Gly Trp Leu Val Gly Tyr Asp Gly His Phe His Phe Glu Asn 115 120 125Ile Gly Asp Ser Tyr Val Ala Asn Lys Val Pro Tyr Val Ala Phe Arg 130 135 140Ala Leu Pro Ala Val Leu Gly Ala Leu Thr Val Ser Val Thr Tyr Leu145 150 155 160Ile Met Trp Glu Ser Gly Tyr Ser Leu Pro Ala Cys Leu Val Ala Thr 165 170 175Gly Leu Ile Leu Leu Asp Asn Ala His Ile Gly Gln Thr Arg Leu Ile 180 185 190Leu Leu Asp Ala Thr Leu Val Leu Ala Met Ala Cys Ser Leu Leu Phe 195 200 205Tyr Ile Lys Phe Tyr Lys Leu Arg His Glu Ala Phe Ser Arg Lys Trp 210 215 220Trp Lys Trp Leu Ile Leu Thr Gly Phe Ala Leu Ser Cys Asp Ile Ser225 230 235 240Thr Lys Tyr Val Gly Leu Phe Ala Phe Val Thr Ile Gly Ser Ala Val 245 250 255Ile Ile Asp Leu Trp Asp Leu Leu Asp Ile Lys Arg Arg Asn Gly Ala 260 265 270Ile Ser Leu Gln Leu Phe Gly Lys His Phe Ala Ala Arg Ala Ile Gly 275 280 285Leu Ile Val Leu Pro Phe Leu Phe Tyr Leu Phe Trp Phe Gln Val His 290 295 300Phe Ala Val Leu Thr Arg Ser Gly Pro Gly Asp Asp Phe Met Thr Pro305 310 315 320Glu Phe Gln Glu Thr Leu Ser Asp Asn Val Met Leu Ala Asn Ala Val 325 330 335Asp Ile His Tyr Tyr Asp Tyr Ile Thr Ile Arg His Lys Glu Thr Lys 340 345 350Ala Tyr Leu His Ser His Pro Asp Thr Tyr Pro Leu Arg Tyr Asp Asp 355 360 365Gly Arg Ile Ser Ser Gln Gly Gln Gln Ile Thr Gly Tyr Pro His Asn 370 375 380Asp Thr Asn Asn Tyr Trp Gln Val Leu Pro Ser Asp Asn Val His Asn385 390 395 400Thr Glu Arg Ile Val Arg Asn Phe Asp Leu Val Arg Leu Arg His Ile 405 410 415Val Thr Asp Lys Ile Leu Leu Ser His Asp Val Ala Ser Pro Tyr Phe 420 425 430Pro Thr Asn Gln Glu Phe Thr Ala Val Thr Ser Glu Glu Ala Phe Gly 435 440 445Glu Arg Gln Asn Asp Thr Leu Phe Glu Ile Arg Val Glu Thr Ala Lys 450 455 460Val Gly Ala Glu Phe Lys Thr Val Ala Ser His Phe Lys Leu Val His465 470 475 480Phe Pro Ser Lys Val Ala Met Trp Thr His Thr Thr Pro Leu Pro Glu 485 490 495Trp Gly Tyr Lys Gln Gln Glu Ile Asn Gly Asn Lys Gln Val Thr Val 500 505 510Ser Ser Asn Met Trp Ile Ala Glu Asp Ile Pro Ser Leu Pro Gln Asp 515 520 525Asp Ala Arg Arg Gln Lys Glu Gln Arg Gln Val Lys Ser Leu Pro Phe 530 535 540Leu Arg Lys Trp Phe Glu Leu Gln Arg Ser Met Phe Tyr His Asn Asn545 550 555 560Lys Leu Thr Ser Ser His Pro Tyr Ser Ser Gln Pro Tyr His Trp Pro 565 570 575Phe Leu Leu Arg Gly Val Ser Phe Trp Thr Gln Asn Asp Thr Arg Gln 580 585 590Gln Ile Tyr Phe Val Gly Asn Pro Ile Gly Trp Trp Ile Thr Ser Ser 595 600 605Leu Leu Ala Val Phe Ala Gly Ile Ile Ala Ala Asp Gln Ile Ser Leu 610 615 620Arg Arg Asn Ile Asp Ala Leu Asp His Arg Thr Arg Ser Arg Leu Tyr625 630 635 640Asn Ser Thr Gly Phe Phe Trp Leu Ala Trp Ala Thr His Tyr Phe Pro 645 650 655Phe Tyr Leu Met Gly Arg Gln Leu Phe Leu His His Tyr Leu Pro Ala 660 665 670His Leu Ala Ser Cys Leu Val Thr Gly Ala Leu Val Glu Phe Ile Phe 675 680 685Asn Ser Asp Ala Val Glu Glu Glu Ser Ser Lys Ser Gly Asn Arg Ser 690 695 700Ser Pro Lys Arg His Val Thr Ala Arg Glu Arg Phe Ala Gly Lys Ser705 710 715 720Met Leu Gly Ala Trp Ile Ala Cys Gly Val Ile Leu Ser Ala Ala Ala 725 730 735Ala Cys Trp Tyr Phe Phe Leu Pro Leu Thr Tyr Gly Tyr Pro Gly Leu 740 745 750Ser Val Glu Glu Val Val Arg Arg Lys Trp Leu Gly Tyr Asp Leu His 755 760 765Phe Ala Lys 77010770PRTFusarium oxysporum 10Met Ala Arg Ser Ser Thr Pro Gln Gly Ser Leu Arg Gln Arg Gly Ala1 5 10 15Pro Ser Lys Lys Pro Phe Glu Glu Asp Ser Phe Asp Pro Asn Ile Glu 20 25 30Leu Asp Lys Leu Ala Lys Ala Gly Ala Gln Arg Ala Ala Ala Gln Ser 35 40 45Glu Thr Glu Tyr Lys Ile Gly Leu Phe Leu Ile Thr Ile Leu Ser Phe 50 55 60Val Thr Arg Phe Trp Gly Ile Ser His Pro Asn Glu Val Val Phe Asp65 70 75 80Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr Leu Glu Arg Thr Tyr 85 90 95Phe Phe Asp Val His Pro Pro Phe Gly Lys Leu Leu Phe Ala Phe Val 100 105 110Gly Trp Leu Val Gly Tyr Asp Gly Asn Phe His Phe Glu Asn Ile Gly 115 120 125Asp Ser Tyr Ile Ala Asn Lys Val Pro Tyr Val Ala Tyr Arg Ala Leu 130 135 140Pro Ala Thr Leu Gly Ala Leu Thr Val Ser Val Thr Tyr Leu Ile Met145 150 155 160Trp Glu Ser Gly Tyr Ser Leu Pro Ala Cys Ile Leu Ala Ala Gly Leu 165 170 175Val Leu Leu Asp Asn Ala His Ile Gly Gln Thr Arg Leu Ile Leu Leu 180 185 190Asp Ala Thr Leu Val Leu Ala Met Ala Cys Ser Leu Leu Phe Tyr Ile 195 200 205Lys Trp Tyr Lys Leu Arg His Glu Pro Phe Ser Arg Lys Trp Trp Lys 210 215 220Trp Leu Ile Leu Thr Gly Phe Ala Leu Ser Cys Asp Ile Ser Val Lys225 230 235 240Tyr Val Gly Val Phe Ala Phe Val Thr Ile Gly Ser Ala Val Val Ile 245 250 255Asp Leu Trp Asp Leu Leu Asn Ile Asn Arg Pro Gly Gly Ala Ile Ser 260 265 270Leu Gln Glu Phe Thr Lys His Phe Ala Ala Arg Ala Phe Gly Leu Ile 275 280 285Ile Met Pro Phe Leu Phe Tyr Leu Phe Trp Phe Gln Val His Phe Ala 290 295 300Val Leu Tyr Arg Ser Gly Pro Gly Asp Asp Phe Met Thr Pro Glu Phe305 310 315 320Gln Glu Thr Leu Ser Asp Asn Val Met Leu Ala Asn Ser Ile Asp Ile 325 330 335Gln Tyr Tyr Asp Gln Ile Thr Ile Arg His Lys Glu Thr Lys Thr Tyr 340 345 350Leu His Ser His Glu Asp Arg Tyr Pro Leu Arg Tyr Asp Asp Gly Arg 355 360 365Val Ser Ser Gln Gly Gln Gln Ile Thr Gly Tyr Pro Tyr Asn Asp Thr 370 375 380Asn Asn Tyr Trp Glu Ile Leu Pro Ala Asn Asn Asp Lys Gln Ile Gly385 390 395 400Arg Ile Val Lys Asn His Glu Leu Val Arg Leu Arg His Val Gly Thr 405 410 415Asp Lys Ile Leu Leu Ser His Asp Val Ala Ser Pro Tyr Tyr Pro Thr 420 425 430Asn Gln Glu Phe Thr Ala Val Thr Pro Glu Glu Ala Phe Gly Lys Arg 435 440 445Glu Lys Asp Thr Leu Phe Glu Val Arg Ile Glu His Gly Lys Lys Asn 450 455 460Gln Asn Phe Lys Thr Val Ala Gly His Phe Lys Leu Ile His Asn Pro465 470 475 480Ser Lys Val Ala Met Trp Thr His Thr Lys Pro Leu Pro Glu Trp Gly 485 490 495Tyr Lys Gln Gln Glu Ile Asn Gly Asn Lys Gln Ile Ala Pro Ser Ser 500 505 510Asn Val Trp Ile Ala Glu Asp Ile Pro Ser Leu Pro Ala Asp His Pro 515 520 525Arg Arg Gln Lys Pro Glu Arg Lys Val Lys Ser Leu Pro Phe Leu Gln 530 535 540Lys Trp Phe Glu Leu Gln Arg Ala Met Phe Tyr His Asn Ser Lys Leu545 550 555 560Thr Ser Ser His Pro Tyr Ala Ser His Pro Tyr Gln Trp Pro Phe Leu 565 570 575Leu Arg Gly Val Ser Phe Trp Thr Gln Ser Glu Thr Arg Gln Gln Ile 580 585 590Tyr Phe Leu Gly Asn Pro Ile Gly Trp Trp Leu Ala Ser Ser Leu Leu 595 600 605Ala Val Tyr Ala Gly Ile Leu Leu Ala Asp Gln Val Ser Leu Arg Arg 610 615 620Gly Val Asp Ala Leu Asp Arg Arg Thr Arg Ser Arg Leu Tyr Asn Ser625 630 635 640Thr Gly Phe Phe Phe Leu Ala Trp Ala Thr His Tyr Phe Pro Phe Phe 645 650 655Leu Met Gly Arg Gln Leu Phe Leu His His Tyr Leu Pro Ala His Leu 660 665 670Ala Ser Cys Leu Val Ala Gly Ala Leu Leu Glu Phe Ile Phe Asn Ser 675

680 685Glu Ala Pro Glu Glu Val Thr Ile Lys Asp Lys Lys Gly Pro Val Ser 690 695 700Pro Arg His His Val Thr Ala Arg Glu Arg Phe Ala Gly Gln Ser Met705 710 715 720Leu Gly Ala Trp Ile Ala Cys Gly Val Ile Leu Ser Leu Ile Ile Ala 725 730 735Gly Trp Tyr Phe Phe Leu Pro Leu Thr Tyr Gly Tyr Pro Gly Leu Ser 740 745 750Val Asp Ala Ile Leu Arg Arg Lys Trp Leu Gly Tyr Asp Leu His Phe 755 760 765Ala Lys 77011788PRTGibberella zeae 11Met Ala Arg Ser Ser Ser Pro Ser Gln Gly Ser Leu Arg Gln Arg Gly1 5 10 15Ala Pro Ser Lys Lys Pro Ser Glu Glu Ser Phe Asn Pro Asn Pro Glu 20 25 30Leu Asp Lys Leu Ala Lys Ala Gly Ala Gln Arg Ala Ala Ala Gln Ser 35 40 45Glu Thr Glu His Lys Ile Gly Leu Ala Val Ile Thr Ile Leu Ser Phe 50 55 60Val Thr Arg Phe Trp Gly Ile Ser His Pro Asn Glu Val Val Phe Asp65 70 75 80Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr Leu Glu Arg Thr Tyr 85 90 95Phe Phe Asp Val His Pro Pro Phe Gly Lys Leu Leu Phe Ala Phe Val 100 105 110Gly Trp Leu Val Gly Tyr Asp Gly His Phe His Phe Asp Asn Ile Gly 115 120 125Asp Ser Tyr Ile Ala Asn Lys Ile Pro Tyr Val Ala Phe Arg Ala Leu 130 135 140Pro Ala Thr Leu Gly Ala Leu Thr Val Ala Val Thr Tyr Leu Ile Met145 150 155 160Trp Glu Ser Gly Tyr Ser Leu Pro Ala Cys Val Leu Ala Ala Gly Leu 165 170 175Leu Leu Leu Asp Asn Ala His Ile Gly Gln Thr Arg Leu Ile Leu Leu 180 185 190Asp Ala Thr Leu Val Leu Ala Met Ala Cys Ser Leu Leu Phe Tyr Ile 195 200 205Lys Trp Tyr Lys Leu Arg His Glu Pro Phe Ser Arg Lys Trp Trp Lys 210 215 220Trp Leu Ile Leu Thr Gly Phe Ala Leu Ser Cys Asp Ile Ser Val Lys225 230 235 240Tyr Val Gly Val Phe Ala Phe Val Thr Ile Gly Cys Ala Val Val Ile 245 250 255Asp Leu Trp Asp Leu Leu Asn Ile Asn Arg Pro Gly Gly Ala Ile Ser 260 265 270Met Gln Glu Phe Gly Lys His Phe Ala Ala Arg Ala Phe Gly Leu Ile 275 280 285Val Leu Pro Phe Leu Phe Tyr Leu Phe Trp Phe Gln Val His Phe Ala 290 295 300Val Leu Tyr Arg Ser Gly Pro Gly Asp Asp Phe Met Thr Pro Glu Phe305 310 315 320Gln Glu Thr Leu Ser Asp Asn Val Met Leu Ala Asn Ala Ile Asp Ile 325 330 335Gln Tyr Tyr Asp Ser Ile Thr Ile Arg His Lys Glu Thr Lys Thr Tyr 340 345 350Leu His Ser His Glu Asp Arg Tyr Pro Leu Arg Tyr Asp Asp Gly Arg 355 360 365Val Ser Ser Gln Gly Gln Gln Ile Thr Gly Tyr Pro Tyr Asn Asp Thr 370 375 380Asn Asn Tyr Trp Glu Ile Trp Pro Ala Asp Asn Asn Lys Thr Pro Gly385 390 395 400Arg Ile Val Lys Asn His Asp Leu Val Arg Leu Arg His Val Gly Thr 405 410 415Asp Lys Ile Leu Leu Ser His Asp Val Ala Ser Pro Tyr Tyr Pro Thr 420 425 430Asn Gln Glu Phe Thr Ala Val Thr Pro Glu Glu Ala Leu Gly Lys Arg 435 440 445Glu Lys Glu Thr Leu Phe Glu Val Arg Leu Glu His Gly Lys Lys Asn 450 455 460Gln Asn Phe Lys Ser Val Ala Gly His Phe Lys Leu Ile His Asn Pro465 470 475 480Ser Lys Val Ala Met Trp Thr His Thr Lys Pro Leu Pro Glu Trp Gly 485 490 495Tyr Lys Gln Gln Glu Ile Asn Gly Asn Lys Gln Ile Ala Pro Ser Ser 500 505 510Asn Val Trp Ile Ala Glu Asp Ile Ala Ser Leu Glu Ala Asp His Pro 515 520 525Arg Arg Gln Lys Pro Glu Arg Lys Val Lys Ser Leu Pro Phe Leu Gln 530 535 540Lys Trp Phe Glu Leu Gln Arg Ala Met Phe Tyr His Asn Ser Lys Leu545 550 555 560Thr Ser Ser His Pro Tyr Ala Ser His Pro Tyr Gln Trp Pro Phe Leu 565 570 575Leu Arg Gly Val Ser Phe Trp Thr Gln Ser Glu Thr Arg Gln Gln Ile 580 585 590Tyr Phe Leu Gly Asn Pro Val Gly Trp Trp Leu Ala Ser Ser Leu Leu 595 600 605Ala Val Tyr Ala Gly Ile Leu Leu Ala Asp Gln Val Ser Leu Arg Arg 610 615 620Gly Ile Asp Ala Leu Asp Arg Arg Lys Leu Met Leu Gln Ser Gln Leu625 630 635 640Met Asn Pro Thr Leu Thr Asn Ser Lys Gly Thr Arg Ser Arg Leu Tyr 645 650 655Asn Ser Thr Gly Phe Phe Phe Leu Ala Trp Ala Thr His Tyr Phe Pro 660 665 670Phe Phe Leu Met Gly Arg Gln Leu Phe Leu His His Tyr Leu Pro Ala 675 680 685His Leu Ala Ser Cys Leu Val Ala Gly Ala Leu Leu Glu Phe Ile Phe 690 695 700Asn Ser Glu Pro Ala Glu Glu Ile Thr Ile Lys Asp Lys Lys Gly Pro705 710 715 720Val Ser Pro Arg His His Val Thr Ala Arg Glu Arg Phe Ser Gly Gln 725 730 735Ser Met Ala Ser Ala Trp Ile Ala Cys Gly Val Val Leu Ala Leu Val 740 745 750Val Ala Gly Trp Tyr Phe Phe Leu Pro Leu Thr Tyr Gly Tyr Pro Gly 755 760 765Leu Ser Val Glu Ala Ile Leu Arg Arg Lys Trp Leu Gly Tyr Asp Leu 770 775 780His Phe Ala Lys78512775PRTMyceliophthora thermophila 12Met Ala Ser Thr Ser Thr Pro Gln Gly Thr Leu Arg Gln Arg Asn Val1 5 10 15Gly Val Ser Thr Lys Lys Pro Lys Asp Gly Ala Ser Ser Asp Val Glu 20 25 30Leu Asp Lys Leu Val Lys Ala Ala Ala Glu Lys Ser Ser Lys Asn Ser 35 40 45Glu Arg Asp Phe Lys Val Val Phe Val Val Met Thr Ala Leu Ala Phe 50 55 60Leu Thr Arg Phe Trp Gly Ile Ser His Pro Asn Glu Val Val Phe Asp65 70 75 80Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr Leu Glu Arg Thr Tyr 85 90 95Phe Phe Asp Val His Pro Pro Leu Gly Lys Leu Leu Phe Ala Phe Met 100 105 110Gly Trp Leu Val Gly Tyr Asp Gly His Phe His Phe Glu Asn Ile Gly 115 120 125Asp Ser Tyr Ile Val Asn Lys Val Pro Tyr Val Ala Phe Arg Ser Leu 130 135 140Pro Ala Ile Leu Gly Ala Leu Thr Val Ser Val Thr Tyr Leu Ile Met145 150 155 160Trp Glu Ser Gly Tyr Ser Leu Pro Ala Cys Ile Ile Ala Ala Gly Leu 165 170 175Ile Leu Leu Asp Asn Ala His Ile Gly Gln Thr Arg Leu Ile Leu Leu 180 185 190Asp Ala Thr Leu Val Phe Ala Met Ala Cys Ser Leu Leu Cys Tyr Ile 195 200 205Lys Phe Tyr Lys Leu Arg His Glu Pro Phe Ser Arg Lys Trp Trp Lys 210 215 220Trp Leu Ile Leu Thr Gly Phe Ala Leu Ser Cys Asp Ile Ser Thr Lys225 230 235 240Tyr Val Gly Leu Phe Ala Phe Ile Thr Ile Gly Ser Ala Val Val Ile 245 250 255Asp Leu Trp Asp Leu Leu Asp Ile Lys Arg Pro Gly Gly Ala Leu Thr 260 265 270Leu Ala Glu Phe Gly Lys His Phe Ala Ala Arg Ala Phe Gly Leu Ile 275 280 285Ile Met Pro Phe Leu Phe Tyr Leu Phe Trp Phe Gln Val His Phe Ser 290 295 300Ile Leu Thr Arg Ser Gly Pro Gly Asp Asp Phe Met Thr Pro Glu Phe305 310 315 320Gln Glu Thr Leu Ser Asp Asn Ile Met Leu Ala Asn Ala Val Thr Ile 325 330 335Asp Tyr Tyr Asp Thr Ile Leu Ile Lys His Lys Glu Thr Lys Val Tyr 340 345 350Leu His Ser His Pro Asp Arg Tyr Pro Leu Arg Tyr Asp Asp Gly Arg 355 360 365Val Ser Ser Gln Gly Gln Gln Val Thr Gly Tyr Pro Phe Asn Asp Thr 370 375 380Asn Asn Tyr Trp Gln Ile Leu Pro Gly Gly Ala Asp Asp Gln Lys Leu385 390 395 400Gly Arg His Val Arg Asn His Asp Leu Val Arg Leu Arg His Leu Gly 405 410 415Thr Asp Thr Ile Leu Leu Ser His Asp Val Ala Ser Pro Tyr Tyr Pro 420 425 430Thr Asn Gln Glu Phe Thr Thr Val Ser Ile Ala Asp Ala Tyr Gly Glu 435 440 445Arg Ala Ala Asp Thr Leu Phe Glu Ile Arg Ile Glu His Gly Lys Asp 450 455 460Gly Gln Glu Phe Lys Ser Val Ser Ser His Phe Lys Leu Ile His Asn465 470 475 480Pro Ser Lys Val Ala Met Trp Thr His Pro Lys Pro Leu Pro Asp Trp 485 490 495Gly Tyr Lys Gln Gln Glu Ile Asn Gly Asn Lys Gln Ile Ala Pro Ser 500 505 510Ser Asn Val Trp Leu Val Glu Asp Ile Val Ser Leu Pro Pro Asp His 515 520 525Lys Arg Arg Glu Lys Pro Glu Arg Lys Val Lys Thr Leu Pro Phe Leu 530 535 540Arg Lys Trp Phe Glu Leu Gln Arg Ser Met Phe Trp His Asn Asn Gln545 550 555 560Leu Thr Ala Ser His Pro Tyr Ala Ser Leu Pro Tyr Gln Trp Pro Phe 565 570 575Leu Leu Arg Gly Val Ser Phe Trp Thr Gln Asn Glu Thr Arg Gln Gln 580 585 590Ile Tyr Phe Leu Gly Asn Pro Val Gly Trp Trp Ile Ala Ser Ser Val 595 600 605Leu Ala Ile Tyr Ala Gly Ile Val Leu Ala Asp Gln Phe Ser Leu Arg 610 615 620Arg Gly Ile Asp Ala Leu Asp His Arg Ser Arg Ser Arg Leu Tyr Asn625 630 635 640Ser Thr Gly Phe Phe Phe Leu Ala Trp Ala Thr His Tyr Phe Pro Phe 645 650 655Tyr Val Met Gly Arg Gln Leu Phe Leu His His Tyr Leu Pro Ala His 660 665 670Leu Ala Ser Ala Leu Val Thr Gly Ala Ile Val Glu Phe Ile Phe Ala 675 680 685Gln Asp Ser Leu Glu His Glu Val Ala Tyr Gln Ala Ala Lys Ala Gly 690 695 700Lys Lys Thr Gly Val Gln Lys Arg His Leu Ser Ala Arg Glu Arg Phe705 710 715 720Ala Gly Gln Ser Met Val Ala Ser Trp Ile Ala Thr Val Val Ile Leu 725 730 735Ile Ala Val Ala Ala Ser Trp Tyr Phe Phe Leu Pro Leu Thr Tyr Gly 740 745 750Tyr Pro Gly Leu Ser Val Asp Gln Val Leu Arg Arg Lys Trp Leu Gly 755 760 765Tyr Asp Leu His Phe Ala Lys 770 77513774PRTNeurospora crassa 13Met Ala Ser Thr Thr Ala Thr Pro Glu Ala Thr Leu Arg Gln Arg Asn1 5 10 15Val Pro Ala Ser Ser Lys Lys Ala Lys Asn Gly Val Ser Ser Asp Val 20 25 30Glu Thr Asp Lys Val Pro Asp Ala Val Ala Pro Ala Lys Ser Gly Ser 35 40 45Glu Leu Glu Tyr Lys Leu Ala Leu Ile Leu Ile Thr Gly Leu Ala Phe 50 55 60Leu Thr Arg Phe Trp Gly Ile Ser His Pro Asp Glu Val Val Phe Asp65 70 75 80Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr Leu Glu Arg Thr Tyr 85 90 95Phe Phe Asp Val His Pro Pro Phe Gly Lys Leu Leu Phe Ala Phe Met 100 105 110Gly Trp Leu Val Gly Tyr Asp Gly His Phe His Phe Glu Asn Ile Gly 115 120 125Asp Ser Tyr Ile Arg Asn Lys Val Pro Tyr Val Ala Phe Arg Ser Leu 130 135 140Pro Ala Ile Leu Gly Ala Leu Thr Val Ser Val Val Tyr Met Ile Met145 150 155 160Trp Glu Ser Gly Tyr Ser Leu Pro Ala Cys Leu Ile Ala Ala Gly Leu 165 170 175Val Leu Leu Asp Asn Ala His Ile Gly Gln Thr Arg Leu Ile Leu Leu 180 185 190Asp Ala Thr Leu Val Phe Ala Met Ala Cys Ser Leu Leu Cys Tyr Ile 195 200 205Lys Phe His Lys Leu Arg His Glu Pro Phe Ser Arg Lys Trp Trp Lys 210 215 220Trp Leu Ile Leu Thr Gly Phe Ala Leu Ser Cys Asp Ile Ser Thr Lys225 230 235 240Tyr Val Gly Leu Phe Ala Phe Ile Thr Ile Gly Ser Ala Val Cys Ile 245 250 255Asp Leu Trp Asp Leu Leu Asp Ile Lys Arg Pro Gly Gly Ala Leu Thr 260 265 270Leu Pro Gln Phe Gly Lys His Phe Ala Ala Arg Ala Phe Gly Leu Ile 275 280 285Ile Met Pro Phe Ile Phe Tyr Leu Phe Trp Phe Gln Val His Phe Ser 290 295 300Ile Leu Thr Arg Ser Gly Pro Gly Asp Asp Phe Met Thr Pro Glu Phe305 310 315 320Gln Glu Thr Leu Ser Asp Asn Ile Met Leu Ala Asn Ala Val Thr Ile 325 330 335Asp Tyr Tyr Asp Thr Ile Ser Ile Arg His Lys Glu Thr Lys Ala Tyr 340 345 350Leu His Ser His Pro Asp Lys Tyr Pro Leu Arg Tyr Asp Asp Gly Arg 355 360 365Val Ser Ser Gln Gly Gln Gln Val Thr Gly Tyr Pro Phe Asn Asp Thr 370 375 380Asn Asn Tyr Trp Gln Ile Leu Pro Pro Gly Pro Asp Asp Gln Lys Leu385 390 395 400Gly His Pro Ile Lys Asn His Asp Leu Val Arg Leu Arg His Ile Val 405 410 415Thr Asp Thr Ile Leu Leu Ser His Asp Val Ala Ser Pro Tyr Tyr Pro 420 425 430Thr Asn Gln Glu Phe Thr Thr Val Ser Ile Gly Asp Ala Tyr Gly Asp 435 440 445Arg Ala Ala Asp Thr Leu Phe Glu Ile Arg Ile Glu His Gly Lys Ala 450 455 460Asn Gln Glu Phe Lys Ser Ile Ser Ser His Phe Lys Leu Ile His Asn465 470 475 480Pro Ser Lys Val Ala Met Trp Thr His Ser Lys Pro Leu Pro Glu Trp 485 490 495Gly His Lys Gln Gln Glu Ile Asn Gly Asn Lys Gln Leu Ala Gln Ser 500 505 510Ser Asn Val Trp Leu Val Glu Asp Ile Val Ser Leu Pro Ala Asp His 515 520 525Ala Arg Arg Glu Lys Pro Glu Lys Lys Val Lys Thr Leu Pro Phe Leu 530 535 540Arg Lys Trp Phe Glu Leu Gln Arg Ser Met Phe Trp His Asn Asn Gln545 550 555 560Leu Thr Ser Ser His Pro Tyr Ala Ser Leu Pro Tyr Gln Trp Pro Phe 565 570 575Leu Leu Arg Gly Val Ser Phe Trp Thr Gln Asn Asp Thr Arg Gln Gln 580 585 590Ile Tyr Phe Leu Gly Asn Pro Ile Gly Trp Trp Leu Ala Ser Ser Val 595 600 605Leu Ala Ile Tyr Ala Gly Ile Ile Leu Ala Asp Gln Phe Ser Leu Arg 610 615 620Arg Gly Leu Asp Ala Met Asp Arg Arg Thr Arg Ser Arg Leu Tyr Asn625 630 635 640Ser Thr Gly Phe Phe Phe Leu Ala Trp Ala Thr His Tyr Phe Pro Phe 645 650 655Phe Val Met Gly Arg Gln Leu Phe Leu His His Tyr Leu Pro Ala His 660 665 670Leu Ala Ser Ala Leu Val Thr Gly Ser Val Val Glu Phe Leu Phe Ser 675 680 685Thr Asp Ser Ala Glu Pro Glu Tyr Gln Pro Ser Lys Ser Gly Lys Lys 690 695 700Val Ala Pro Thr Thr Lys Arg Arg Leu Ser Ala Arg Glu Arg Leu Ala705 710 715 720Gly Gln Ser Met Ala Gly Ala Trp Ile Ala Thr Ala Val Ile Met Val 725 730 735Leu Val Ala Phe Gly Trp Tyr Phe Phe Leu Pro Leu Thr Tyr Gly Tyr 740 745 750Pro Gly Leu Thr Ala Pro Glu Val Asn Arg Arg Lys Trp Leu Gly Tyr 755 760 765Asp Leu His Phe Ala Lys 77014776PRTPenicillium chrysogenum 14Met Ser Ser Pro Ser Pro Ser Leu Arg Lys Arg Gly Gly Lys Lys Asp1 5 10 15Val Tyr Thr Ala Leu Pro Ser Asp Asp Thr Ser Thr Pro Val Ser Val 20 25 30Pro Val Lys Gln

Lys Ser Glu Trp Asp Tyr Trp Leu Ala Ile Val Ile 35 40 45Leu Thr Leu Leu Ala Phe Ala Thr Arg Phe Tyr Arg Leu Asp Tyr Pro 50 55 60Asn Glu Val Val Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr65 70 75 80Tyr Leu Gln Arg Thr Tyr Phe Phe Asp Val His Pro Pro Phe Gly Lys 85 90 95Leu Leu Phe Ala Leu Met Gly Trp Leu Val Gly Phe Asp Gly Ser Phe 100 105 110Leu Phe Glu Asn Ile Gly Asp Ser Tyr Ile Glu Asn Asn Val Pro Tyr 115 120 125Leu Ser Leu Arg Ala Met Pro Ala Thr Leu Gly Ala Leu Thr Ile Pro 130 135 140Val Val Phe Leu Ile Met Trp Glu Ser Gly Tyr Ser Leu Pro Ala Cys145 150 155 160Val Leu Ser Ala Gly Leu Met Val Phe Asp Asn Ala His Val Gly Glu 165 170 175Asp Arg Leu Ile Leu Leu Asp Ala Thr Leu Val Leu Ser Met Ala Leu 180 185 190Ser Ile Leu Cys Tyr Val Arg Phe Tyr Lys Leu Arg His Gln Pro Phe 195 200 205Gly Arg Lys Trp Trp Lys Trp Leu Leu Leu Thr Gly Phe Cys Met Ser 210 215 220Cys Val Ile Ser Thr Lys Tyr Val Gly Phe Phe Thr Phe Val Thr Ile225 230 235 240Gly Ala Ala Val Leu Ile Asp Leu Trp Asn Leu Leu Asp Ile Asn Arg 245 250 255Glu Gln Gly Ala Leu Ser Met Ile Ser Trp Gly Lys His Phe Ile Ala 260 265 270Arg Ala Val Gly Leu Val Ile Ile Pro Phe Met Phe Tyr Leu Phe Trp 275 280 285Phe Gln Val His Phe Ala Ile Leu Asn Arg Ser Gly Pro Gly Asp Asp 290 295 300Phe Met Thr Pro Glu Phe Gln Glu Thr Leu Ser Asp Asn Gln Met Thr305 310 315 320Ala Gln Ser Val Gly Ile Gln Tyr Phe Asp Thr Ile Thr Met Arg His 325 330 335Lys Asp Thr Lys Val Phe Leu His Ser His Trp Asp Lys Tyr Pro Leu 340 345 350Arg Tyr Asp Asp Gly Arg Ile Ser Ser Gln Gly Gln Gln Val Thr Gly 355 360 365Tyr Pro His Asn Asp Thr Asn Asn Gln Trp Gln Ile Leu Pro Ala Glu 370 375 380Pro Leu Ala Asp Ser Ser Glu Pro Lys Ser Val Arg Asn Gly Asp Ile385 390 395 400Ile Gln Leu Arg His Ile Gly Thr Glu Ser Tyr Leu Leu Thr His Asp 405 410 415Val Ala Ser Pro Phe Phe Pro Thr Asn Gln Glu Phe Thr Thr Val Ser 420 425 430Gln Glu Leu Ala Asp Gly Glu Arg His Asn Asp Thr Leu Phe Glu Leu 435 440 445Lys Ile Glu Ser Gly Lys Thr Ala Gln Glu Phe Arg Thr Leu Ala Ser 450 455 460Leu Phe Lys Leu Val His Val Pro Thr Arg Val Ala Leu Trp Thr His465 470 475 480Thr Thr Pro Leu Pro Glu Trp Gly Tyr Lys Gln Ala Glu Ile Asn Gly 485 490 495Asn Lys Asn Ile Leu Gln Ser Ser Asn Met Trp Tyr Val Glu Asn Ile 500 505 510Glu Asn Leu Ala Glu Asp Ser Pro Arg Leu Val Lys Glu Glu Arg Lys 515 520 525Val Lys Thr Leu Pro Phe Leu Arg Lys Tyr Phe Glu Leu Gln Gly Ala 530 535 540Met Phe His His Asn Asn Ala Leu Thr Ser Ser His Pro Tyr Ala Thr545 550 555 560Glu Pro Phe Gln Trp Pro Phe Leu Leu Arg Gly Val Ser Phe Trp Thr 565 570 575Lys Asn Asp Thr Arg Glu Gln Ile Tyr Phe Leu Gly Asn Pro Ile Gly 580 585 590Trp Trp Ile Ala Ser Ser Ile Leu Ala Val Phe Ala Gly Val Val Gly 595 600 605Ala Asp Gln Leu Ser Leu Arg Arg Gly Val Asp Ala Leu Glu Glu Ile 610 615 620Trp Gly Pro Gly Thr Arg Ser Arg Leu Tyr Asn Ser Thr Gly Phe Leu625 630 635 640Phe Leu Cys Trp Ala Ala His Tyr Phe Pro Phe Trp Leu Met Gly Arg 645 650 655Gln Arg Phe Leu His His Tyr Leu Pro Ser His Leu Ala Ser Thr Met 660 665 670Val Cys Gly Ala Leu Ile Glu Phe Ile Phe Asn Leu Gln Pro Leu Asp 675 680 685Pro Arg Thr Ala Leu Pro Pro Val Asp Asp Pro Ser Gly Lys Ser Lys 690 695 700Ala Arg Ser Leu Ser Ser Leu Arg Arg Phe Ile Thr Ala Lys Glu Arg705 710 715 720Met Gly Cys Arg Ser Leu Ile Ala Gly Trp Ile Ala Thr Leu Ile Ile 725 730 735Leu Ala Ala Thr Ile Trp Gly Phe Ile Phe Tyr Ala Pro Leu Thr Tyr 740 745 750Gly Thr Pro Gly Leu Asp Val Ala Gly Val Asn Ala Arg Lys Trp Leu 755 760 765Asn Tyr Asp Leu His Phe Ala Lys 770 7751519DNATrichoderma reesei 15gcacactttc aagattggc 191619DNATrichoderma reesei 16gtacggtgtt gccaagaag 1917448DNATrichoderma reesei 17gttgagtaca tcgagcgcga cagcattgtg cacaccatgc ttcccctcga gtccaaggac 60agcatcatcg ttgaggactc gtgcaacggc gagacggaga agcaggctcc ctggggtctt 120gcccgtatct ctcaccgaga gacgctcaac tttggctcct tcaacaagta cctctacacc 180gctgatggtg gtgagggtgt tgatgcctat gtcattgaca ccggcaccaa catcgagcac 240gtcgactttg agggtcgtgc caagtggggc aagaccatcc ctgccggcga tgaggacgag 300gacggcaacg gccacggcac tcactgctct ggtaccgttg ctggtaagaa gtacggtgtt 360gccaagaagg cccacgtcta cgccgtcaag gtgctccgat ccaacggatc cggcaccatg 420tctgacgtcg tcaagggcgt cgagtacg 44818399PRTTrichoderma reesei 18Met Gln Pro Ser Phe Gly Ser Phe Leu Val Thr Val Leu Ser Ala Ser1 5 10 15Met Ala Ala Gly Ser Val Ile Pro Ser Thr Asn Ala Asn Pro Gly Ser 20 25 30Phe Glu Ile Lys Arg Ser Ala Asn Lys Ala Phe Thr Gly Arg Asn Gly 35 40 45Pro Leu Ala Leu Ala Arg Thr Tyr Ala Lys Tyr Gly Val Glu Val Pro 50 55 60Lys Thr Leu Val Asp Ala Ile Gln Leu Val Lys Ser Ile Gln Leu Ala65 70 75 80Lys Arg Asp Ser Ala Thr Val Thr Ala Thr Pro Asp His Asp Asp Ile 85 90 95Glu Tyr Leu Val Pro Val Lys Ile Gly Thr Pro Pro Gln Thr Leu Asn 100 105 110Leu Asp Phe Asp Thr Gly Ser Ser Asp Leu Trp Val Phe Ser Ser Asp 115 120 125Val Asp Pro Thr Ser Ser Gln Gly His Asp Ile Tyr Thr Pro Ser Lys 130 135 140Ser Thr Ser Ser Lys Lys Leu Glu Gly Ala Ser Trp Asn Ile Thr Tyr145 150 155 160Gly Asp Arg Ser Ser Ser Ser Gly Asp Val Tyr His Asp Ile Val Ser 165 170 175Val Gly Asn Leu Thr Val Lys Ser Gln Ala Val Glu Ser Ala Arg Asn 180 185 190Val Ser Ala Gln Phe Thr Gln Gly Asn Asn Asp Gly Leu Val Gly Leu 195 200 205Ala Phe Ser Ser Ile Asn Thr Val Lys Pro Thr Pro Gln Lys Thr Trp 210 215 220Tyr Asp Asn Ile Val Gly Ser Leu Asp Ser Pro Val Phe Val Ala Asp225 230 235 240Leu Arg His Asp Thr Pro Gly Ser Tyr His Phe Gly Ser Ile Pro Ser 245 250 255Glu Ala Ser Lys Ala Phe Tyr Ala Pro Ile Asp Asn Ser Lys Gly Phe 260 265 270Trp Gln Phe Ser Thr Ser Ser Asn Ile Ser Gly Gln Phe Asn Ala Val 275 280 285Ala Asp Thr Gly Thr Thr Leu Leu Leu Ala Ser Asp Asp Leu Val Lys 290 295 300Ala Tyr Tyr Ala Lys Val Gln Gly Ala Arg Val Asn Val Phe Leu Gly305 310 315 320Gly Tyr Val Phe Asn Cys Thr Thr Gln Leu Pro Asp Phe Thr Phe Thr 325 330 335Val Gly Glu Gly Asn Ile Thr Val Pro Gly Thr Leu Ile Asn Tyr Ser 340 345 350Glu Ala Gly Asn Gly Gln Cys Phe Gly Gly Ile Gln Pro Ser Gly Gly 355 360 365Leu Pro Phe Ala Ile Phe Gly Asp Ile Ala Leu Lys Ala Ala Tyr Val 370 375 380Ile Phe Asp Ser Gly Asn Lys Gln Val Gly Trp Ala Gln Lys Lys385 390 39519452PRTTrichoderma reesei 19Met Glu Ala Ile Leu Gln Ala Gln Ala Lys Phe Arg Leu Asp Arg Gly1 5 10 15Leu Gln Lys Ile Thr Ala Val Arg Asn Lys Asn Tyr Lys Arg His Gly 20 25 30Pro Lys Ser Tyr Val Tyr Leu Leu Asn Arg Phe Gly Phe Glu Pro Thr 35 40 45Lys Pro Gly Pro Tyr Phe Gln Gln His Arg Ile His Gln Arg Gly Leu 50 55 60Ala His Pro Asp Phe Lys Ala Ala Val Gly Gly Arg Val Thr Arg Gln65 70 75 80Lys Val Leu Ala Lys Lys Val Lys Glu Asp Gly Thr Val Asp Ala Gly 85 90 95Gly Ser Lys Thr Gly Glu Val Asp Ala Glu Asp Gln Gln Asn Asp Ser 100 105 110Glu Tyr Leu Cys Glu Val Thr Ile Gly Thr Pro Gly Gln Lys Leu Met 115 120 125Leu Asp Phe Asp Thr Gly Ser Ser Asp Leu Trp Val Phe Ser Thr Glu 130 135 140Leu Ser Lys His Leu Gln Glu Asn His Ala Ile Phe Asp Pro Lys Lys145 150 155 160Ser Ser Thr Phe Lys Pro Leu Lys Asp Gln Thr Trp Gln Ile Ser Tyr 165 170 175Gly Asp Gly Ser Ser Ala Ser Gly Thr Cys Gly Ser Asp Thr Val Thr 180 185 190Leu Gly Gly Leu Ser Ile Lys Asn Gln Thr Ile Glu Leu Ala Ser Lys 195 200 205Leu Ala Pro Gln Phe Ala Gln Gly Thr Gly Asp Gly Leu Leu Gly Leu 210 215 220Ala Trp Pro Gln Ile Asn Thr Val Gln Thr Asp Gly Arg Pro Thr Pro225 230 235 240Ala Asn Thr Pro Val Ala Asn Met Ile Gln Gln Asp Asp Ile Pro Ser 245 250 255Asp Ala Gln Leu Phe Thr Ala Ala Phe Tyr Ser Glu Arg Asp Glu Asn 260 265 270Ala Glu Ser Phe Tyr Thr Phe Gly Tyr Ile Asp Gln Asp Leu Val Ser 275 280 285Ala Ser Gly Gln Glu Ile Ala Trp Thr Asp Val Asp Asn Ser Gln Gly 290 295 300Phe Trp Met Phe Pro Ser Thr Lys Thr Thr Ile Asn Gly Lys Asp Ile305 310 315 320Ser Gln Glu Gly Asn Thr Ala Ile Ala Asp Thr Gly Thr Thr Leu Ala 325 330 335Leu Val Ser Asp Glu Val Cys Glu Ala Leu Tyr Lys Ala Ile Pro Gly 340 345 350Ala Lys Tyr Asp Asp Asn Gln Gln Gly Tyr Val Phe Pro Ile Asn Thr 355 360 365Asp Ala Ser Ser Leu Pro Glu Leu Lys Val Ser Val Gly Asn Thr Gln 370 375 380Phe Val Ile Gln Pro Glu Asp Leu Ala Phe Ala Pro Ala Asp Asp Ser385 390 395 400Asn Trp Tyr Gly Gly Val Gln Ser Arg Gly Ser Asn Pro Phe Asp Ile 405 410 415Leu Gly Asp Val Phe Leu Lys Ser Val Tyr Ala Ile Phe Asp Gln Gly 420 425 430Asn Gln Arg Phe Gly Ala Val Pro Lys Ile Gln Ala Lys Gln Asn Leu 435 440 445Gln Pro Pro Gln 45020395PRTTrichoderma reesei 20Met Lys Ser Ala Leu Leu Ala Ala Ala Ala Leu Val Gly Ser Ala Gln1 5 10 15Ala Gly Ile His Lys Met Lys Leu Gln Lys Val Ser Leu Glu Gln Gln 20 25 30Leu Glu Gly Ser Ser Ile Glu Ala His Val Gln Gln Leu Gly Gln Lys 35 40 45Tyr Met Gly Val Arg Pro Thr Ser Arg Ala Glu Val Met Phe Asn Asp 50 55 60Lys Pro Pro Lys Val Gln Gly Gly His Pro Val Pro Val Thr Asn Phe65 70 75 80Met Asn Ala Gln Tyr Phe Ser Glu Ile Thr Ile Gly Thr Pro Pro Gln 85 90 95Ser Phe Lys Val Val Leu Asp Thr Gly Ser Ser Asn Leu Trp Val Pro 100 105 110Ser Gln Ser Cys Asn Ser Ile Ala Cys Phe Leu His Ser Thr Tyr Asp 115 120 125Ser Ser Ser Ser Ser Thr Tyr Lys Pro Asn Gly Ser Asp Phe Glu Ile 130 135 140His Tyr Gly Ser Gly Ser Leu Thr Gly Phe Ile Ser Asn Asp Val Val145 150 155 160Thr Ile Gly Asp Leu Lys Ile Lys Gly Gln Asp Phe Ala Glu Ala Thr 165 170 175Ser Glu Pro Gly Leu Ala Phe Ala Phe Gly Arg Phe Asp Gly Ile Leu 180 185 190Gly Leu Gly Tyr Asp Thr Ile Ser Val Asn Gly Ile Val Pro Pro Phe 195 200 205Tyr Gln Met Val Asn Gln Lys Leu Ile Asp Glu Pro Val Phe Ala Phe 210 215 220Tyr Leu Gly Ser Ser Asp Glu Gly Ser Glu Ala Val Phe Gly Gly Val225 230 235 240Asp Asp Ala His Tyr Glu Gly Lys Ile Glu Tyr Ile Pro Leu Arg Arg 245 250 255Lys Ala Tyr Trp Glu Val Asp Leu Asp Ser Ile Ala Phe Gly Asp Glu 260 265 270Val Ala Glu Leu Glu Asn Thr Gly Ala Ile Leu Asp Thr Gly Thr Ser 275 280 285Leu Asn Val Leu Pro Ser Gly Leu Ala Glu Leu Leu Asn Ala Glu Ile 290 295 300Gly Ala Lys Lys Gly Phe Gly Gly Gln Tyr Thr Val Asp Cys Ser Lys305 310 315 320Arg Asp Ser Leu Pro Asp Ile Thr Phe Ser Leu Ala Gly Ser Lys Tyr 325 330 335Ser Leu Pro Ala Ser Asp Tyr Ile Ile Glu Met Ser Gly Asn Cys Ile 340 345 350Ser Ser Phe Gln Gly Met Asp Phe Pro Glu Pro Val Gly Pro Leu Val 355 360 365Ile Leu Gly Asp Ala Phe Leu Arg Arg Tyr Tyr Ser Val Tyr Asp Leu 370 375 380Gly Arg Asp Ala Val Gly Leu Ala Lys Ala Lys385 390 39521426PRTTrichoderma reesei 21Met Lys Phe His Ala Ala Ala Leu Thr Leu Ala Cys Leu Ala Ser Ser1 5 10 15Ala Ser Ala Gly Val Ala Gln Pro Arg Ala Asp Glu Val Glu Ser Ala 20 25 30Glu Gln Gly Lys Thr Phe Ser Leu Glu Gln Ile Pro Asn Glu Arg Tyr 35 40 45Lys Gly Asn Ile Pro Ala Ala Tyr Ile Ser Ala Leu Ala Lys Tyr Ser 50 55 60Pro Thr Ile Pro Asp Lys Ile Lys His Ala Ile Glu Ile Asn Pro Asp65 70 75 80Leu His Arg Lys Phe Ser Lys Leu Ile Asn Ala Gly Asn Met Thr Gly 85 90 95Thr Ala Val Ala Ser Pro Pro Pro Gly Ala Asp Ala Glu Tyr Val Leu 100 105 110Pro Val Lys Ile Gly Thr Pro Pro Gln Thr Leu Pro Leu Asn Leu Asp 115 120 125Thr Gly Ser Ser Asp Leu Trp Val Ile Ser Thr Asp Thr Tyr Pro Pro 130 135 140Gln Val Gln Gly Gln Thr Arg Tyr Asn Val Ser Ala Ser Thr Thr Ala145 150 155 160Gln Arg Leu Ile Gly Glu Ser Trp Val Ile Arg Tyr Gly Asp Gly Ser 165 170 175Ser Ala Asn Gly Ile Val Tyr Lys Asp Arg Val Gln Ile Gly Asn Thr 180 185 190Phe Phe Asn Gln Gln Ala Val Glu Ser Ala Val Asn Ile Ser Asn Glu 195 200 205Ile Ser Asp Asp Ser Phe Ser Ser Gly Leu Leu Gly Ala Ala Ser Ser 210 215 220Ala Ala Asn Thr Val Arg Pro Asp Arg Gln Thr Thr Tyr Leu Glu Asn225 230 235 240Ile Lys Ser Gln Leu Ala Arg Pro Val Phe Thr Ala Asn Leu Lys Lys 245 250 255Gly Lys Pro Gly Asn Tyr Asn Phe Gly Tyr Ile Asn Gly Ser Glu Tyr 260 265 270Ile Gly Pro Ile Gln Tyr Ala Ala Ile Asn Pro Ser Ser Pro Leu Trp 275 280 285Glu Val Ser Val Ser Gly Tyr Arg Val Gly Ser Asn Asp Thr Lys Tyr 290 295 300Val Pro Arg Val Trp Asn Ala Ile Ala Asp Thr Gly Thr Thr Leu Leu305 310 315 320Leu Val Pro Asn Asp Ile Val Ser Ala Tyr Tyr Ala Gln Val Lys Gly 325 330 335Ser Thr Phe Ser Asn Asp Val Gly Met Met Leu Val Pro Cys Ala Ala 340 345 350Thr Leu Pro Asp Phe Ala Phe Gly Leu Gly Asn Tyr Arg Gly Val Ile 355 360

365Pro Gly Ser Tyr Ile Asn Tyr Gly Arg Met Asn Lys Thr Tyr Cys Tyr 370 375 380Gly Gly Ile Gln Ser Ser Glu Asp Ala Pro Phe Ala Val Leu Gly Asp385 390 395 400Ile Ala Leu Lys Ala Gln Phe Val Val Phe Asp Met Gly Asn Lys Val 405 410 415Val Gly Phe Ala Asn Lys Asn Thr Asn Val 420 42522407PRTTrichoderma reesei 22Met Gln Thr Phe Gly Ala Phe Leu Val Ser Phe Leu Ala Ala Ser Gly1 5 10 15Leu Ala Ala Ala Leu Pro Thr Glu Gly Gln Lys Thr Ala Ser Val Glu 20 25 30Val Gln Tyr Asn Lys Asn Tyr Val Pro His Gly Pro Thr Ala Leu Phe 35 40 45Lys Ala Lys Arg Lys Tyr Gly Ala Pro Ile Ser Asp Asn Leu Lys Ser 50 55 60Leu Val Ala Ala Arg Gln Ala Lys Gln Ala Leu Ala Lys Arg Gln Thr65 70 75 80Gly Ser Ala Pro Asn His Pro Ser Asp Ser Ala Asp Ser Glu Tyr Ile 85 90 95Thr Ser Val Ser Ile Gly Thr Pro Ala Gln Val Leu Pro Leu Asp Phe 100 105 110Asp Thr Gly Ser Ser Asp Leu Trp Val Phe Ser Ser Glu Thr Pro Lys 115 120 125Ser Ser Ala Thr Gly His Ala Ile Tyr Thr Pro Ser Lys Ser Ser Thr 130 135 140Ser Lys Lys Val Ser Gly Ala Ser Trp Ser Ile Ser Tyr Gly Asp Gly145 150 155 160Ser Ser Ser Ser Gly Asp Val Tyr Thr Asp Lys Val Thr Ile Gly Gly 165 170 175Phe Ser Val Asn Thr Gln Gly Val Glu Ser Ala Thr Arg Val Ser Thr 180 185 190Glu Phe Val Gln Asp Thr Val Ile Ser Gly Leu Val Gly Leu Ala Phe 195 200 205Asp Ser Gly Asn Gln Val Arg Pro His Pro Gln Lys Thr Trp Phe Ser 210 215 220Asn Ala Ala Ser Ser Leu Ala Glu Pro Leu Phe Thr Ala Asp Leu Arg225 230 235 240His Gly Gln Asn Gly Ser Tyr Asn Phe Gly Tyr Ile Asp Thr Ser Val 245 250 255Ala Lys Gly Pro Val Ala Tyr Thr Pro Val Asp Asn Ser Gln Gly Phe 260 265 270Trp Glu Phe Thr Ala Ser Gly Tyr Ser Val Gly Gly Gly Lys Leu Asn 275 280 285Arg Asn Ser Ile Asp Gly Ile Ala Asp Thr Gly Thr Thr Leu Leu Leu 290 295 300Leu Asp Asp Asn Val Val Asp Ala Tyr Tyr Ala Asn Val Gln Ser Ala305 310 315 320Gln Tyr Asp Asn Gln Gln Glu Gly Val Val Phe Asp Cys Asp Glu Asp 325 330 335Leu Pro Ser Phe Ser Phe Gly Val Gly Ser Ser Thr Ile Thr Ile Pro 340 345 350Gly Asp Leu Leu Asn Leu Thr Pro Leu Glu Glu Gly Ser Ser Thr Cys 355 360 365Phe Gly Gly Leu Gln Ser Ser Ser Gly Ile Gly Ile Asn Ile Phe Gly 370 375 380Asp Val Ala Leu Lys Ala Ala Leu Val Val Phe Asp Leu Gly Asn Glu385 390 395 400Arg Leu Gly Trp Ala Gln Lys 40523446PRTTrichoderma reesei 23Met Thr Leu Pro Val Pro Leu Arg Glu His Asp Leu Pro Phe Leu Lys1 5 10 15Glu Lys Arg Lys Leu Pro Ala Asp Asp Ile Pro Ser Gly Thr Tyr Thr 20 25 30Leu Pro Ile Ile His Ala Arg Arg Pro Lys Leu Ala Ser Arg Ala Ile 35 40 45Glu Val Gln Val Glu Asn Arg Ser Asp Val Ser Tyr Tyr Ala Gln Leu 50 55 60Asn Ile Gly Thr Pro Pro Gln Thr Val Tyr Ala Gln Ile Asp Thr Gly65 70 75 80Ser Phe Glu Leu Trp Val Asn Pro Asn Cys Ser Asn Val Gln Ser Ala 85 90 95Asp Gln Arg Phe Cys Arg Ala Ile Gly Phe Tyr Asp Pro Ser Ser Ser 100 105 110Ser Thr Ala Asp Val Thr Ser Gln Ser Ala Arg Leu Arg Tyr Gly Ile 115 120 125Gly Ser Ala Asp Val Thr Tyr Val His Asp Thr Ile Ser Leu Pro Gly 130 135 140Ser Gly Ser Gly Ser Lys Ala Met Lys Ala Val Gln Phe Gly Val Ala145 150 155 160Asp Thr Ser Val Asp Glu Phe Ser Gly Ile Leu Gly Leu Gly Ala Gly 165 170 175Asn Gly Ile Asn Thr Glu Tyr Pro Asn Phe Val Asp Glu Leu Ala Ala 180 185 190Gln Gly Val Thr Ala Thr Lys Ala Phe Ser Leu Ala Leu Gly Ser Lys 195 200 205Ala Glu Glu Glu Gly Val Ile Ile Phe Gly Gly Val Asp Thr Ala Lys 210 215 220Phe His Gly Glu Leu Ala His Leu Pro Ile Val Pro Ala Asp Asp Ser225 230 235 240Pro Asp Gly Val Ala Arg Tyr Trp Val Lys Met Lys Ser Ile Ser Leu 245 250 255Thr Pro Pro Pro Pro Ser Ser Ser Gly Ser Thr Asp Asp Asn Asn Asn 260 265 270Lys Pro Val Ala Phe Pro Gln Thr Ser Met Thr Val Phe Leu Asp Ser 275 280 285Gly Ser Thr Leu Thr Leu Leu Pro Pro Ala Leu Val Arg Gln Ile Ala 290 295 300Ser Ala Leu Gly Ser Thr Gln Thr Asp Glu Ser Gly Phe Phe Val Val305 310 315 320Asp Cys Ala Leu Ala Ser Gln Asp Gly Thr Ile Asp Phe Glu Phe Asp 325 330 335Gly Val Thr Ile Arg Val Pro Tyr Ala Glu Met Ile Arg Gln Val Ser 340 345 350Thr Leu Pro Pro His Cys Tyr Leu Gly Met Met Gly Ser Thr Gln Phe 355 360 365Ala Leu Leu Gly Asp Thr Phe Leu Arg Ser Ala Tyr Ala Val Phe Asp 370 375 380Leu Thr Ser Asn Val Val His Leu Ala Pro Tyr Ala Asn Cys Gly Thr385 390 395 400Asn Val Lys Ser Ile Thr Ser Thr Ser Ser Leu Ser Asn Leu Val Gly 405 410 415Thr Cys Asn Asp Pro Ser Lys Pro Ser Ser Ser Pro Ser Pro Ser Gln 420 425 430Thr Pro Ser Ala Ser Pro Ser Ser Thr Ala Thr Gln Lys Ala 435 440 44524259PRTTrichoderma reesei 24Met Ala Pro Ala Ser Gln Val Val Ser Ala Leu Met Leu Pro Ala Leu1 5 10 15Ala Leu Gly Ala Ala Ile Gln Pro Arg Gly Ala Asp Ile Val Gly Gly 20 25 30Thr Ala Ala Ser Leu Gly Glu Phe Pro Tyr Ile Val Ser Leu Gln Asn 35 40 45Pro Asn Gln Gly Gly His Phe Cys Gly Gly Val Leu Val Asn Ala Asn 50 55 60Thr Val Val Thr Ala Ala His Cys Ser Val Val Tyr Pro Ala Ser Gln65 70 75 80Ile Arg Val Arg Ala Gly Thr Leu Thr Trp Asn Ser Gly Gly Thr Leu 85 90 95Val Gly Val Ser Gln Ile Ile Val Asn Pro Ser Tyr Asn Asp Arg Thr 100 105 110Thr Asp Phe Asp Val Ala Val Trp His Leu Ser Ser Pro Ile Arg Glu 115 120 125Ser Ser Thr Ile Gly Tyr Ala Thr Leu Pro Ala Gln Gly Ser Asp Pro 130 135 140Val Ala Gly Ser Thr Val Thr Thr Ala Gly Trp Gly Thr Thr Ser Glu145 150 155 160Asn Ser Asn Ser Ile Pro Ser Arg Leu Asn Lys Val Ser Val Pro Val 165 170 175Val Ala Arg Ser Thr Cys Gln Ala Asp Tyr Arg Ser Gln Gly Leu Ser 180 185 190Val Thr Asn Asn Met Phe Cys Ala Gly Leu Thr Gln Gly Gly Lys Asp 195 200 205Ser Cys Ser Gly Asp Ser Gly Gly Pro Ile Val Asp Ala Asn Gly Val 210 215 220Leu Gln Gly Val Val Ser Trp Gly Ile Gly Cys Ala Glu Ala Gly Phe225 230 235 240Pro Gly Val Tyr Thr Arg Ile Gly Asn Phe Val Asn Tyr Ile Asn Gln 245 250 255Asn Leu Ala25882PRTTrichoderma reesei 25Met Val Arg Ser Ala Leu Phe Val Ser Leu Leu Ala Thr Phe Ser Gly1 5 10 15Val Ile Ala Arg Val Ser Gly His Gly Ser Lys Ile Val Pro Gly Ala 20 25 30Tyr Ile Phe Glu Phe Glu Asp Ser Gln Asp Thr Ala Asp Phe Tyr Lys 35 40 45Lys Leu Asn Gly Glu Gly Ser Thr Arg Leu Lys Phe Asp Tyr Lys Leu 50 55 60Phe Lys Gly Val Ser Val Gln Leu Lys Asp Leu Asp Asn His Glu Ala65 70 75 80Lys Ala Gln Gln Met Ala Gln Leu Pro Ala Val Lys Asn Val Trp Pro 85 90 95Val Thr Leu Ile Asp Ala Pro Asn Pro Lys Val Glu Trp Val Ala Gly 100 105 110Ser Thr Ala Pro Thr Leu Glu Ser Arg Ala Ile Lys Lys Pro Pro Ile 115 120 125Pro Asn Asp Ser Ser Asp Phe Pro Thr His Gln Met Thr Gln Ile Asp 130 135 140Lys Leu Arg Ala Lys Gly Tyr Thr Gly Lys Gly Val Arg Val Ala Val145 150 155 160Ile Asp Thr Gly Ile Asp Tyr Thr His Pro Ala Leu Gly Gly Cys Phe 165 170 175Gly Arg Gly Cys Leu Val Ser Phe Gly Thr Asp Leu Val Gly Asp Asp 180 185 190Tyr Thr Gly Phe Asn Thr Pro Val Pro Asp Asp Asp Pro Val Asp Cys 195 200 205Ala Gly His Gly Ser His Val Ala Gly Ile Ile Ala Ala Gln Glu Asn 210 215 220Pro Tyr Gly Phe Thr Gly Gly Ala Pro Asp Val Thr Leu Gly Ala Tyr225 230 235 240Arg Val Phe Gly Cys Asp Gly Gln Ala Gly Asn Asp Val Leu Ile Ser 245 250 255Ala Tyr Asn Gln Ala Phe Glu Asp Gly Ala Gln Ile Ile Thr Ala Ser 260 265 270Ile Gly Gly Pro Ser Gly Trp Ala Glu Glu Pro Trp Ala Val Ala Val 275 280 285Thr Arg Ile Val Glu Ala Gly Val Pro Cys Thr Val Ser Ala Gly Asn 290 295 300Glu Gly Asp Ser Gly Leu Phe Phe Ala Ser Thr Ala Ala Asn Gly Lys305 310 315 320Lys Val Ile Ala Val Ala Ser Val Asp Asn Glu Asn Ile Pro Ser Val 325 330 335Leu Ser Val Ala Ser Tyr Lys Ile Asp Ser Gly Ala Ala Gln Asp Phe 340 345 350Gly Tyr Val Ser Ser Ser Lys Ala Trp Asp Gly Val Ser Lys Pro Leu 355 360 365Tyr Ala Val Ser Phe Asp Thr Thr Ile Pro Asp Asp Gly Cys Ser Pro 370 375 380Leu Pro Asp Ser Thr Pro Asp Leu Ser Asp Tyr Ile Val Leu Val Arg385 390 395 400Arg Gly Thr Cys Thr Phe Val Gln Lys Ala Gln Asn Val Ala Ala Lys 405 410 415Gly Ala Lys Tyr Leu Leu Tyr Tyr Asn Asn Ile Pro Gly Ala Leu Ala 420 425 430Val Asp Val Ser Ala Val Pro Glu Ile Glu Ala Val Gly Met Val Asp 435 440 445Asp Lys Thr Gly Ala Thr Trp Ile Ala Ala Leu Lys Asp Gly Lys Thr 450 455 460Val Thr Leu Thr Leu Thr Asp Pro Ile Glu Ser Glu Lys Gln Ile Gln465 470 475 480Phe Ser Asp Asn Pro Thr Thr Gly Gly Ala Leu Ser Gly Tyr Thr Thr 485 490 495Trp Gly Pro Thr Trp Glu Leu Asp Val Lys Pro Gln Ile Ser Ser Pro 500 505 510Gly Gly Asn Ile Leu Ser Thr Tyr Pro Val Ala Leu Gly Gly Tyr Ala 515 520 525Thr Leu Ser Gly Thr Ser Met Ala Cys Pro Leu Thr Ala Ala Ala Val 530 535 540Ala Leu Ile Gly Gln Ala Arg Gly Thr Phe Asp Pro Ala Leu Ile Asp545 550 555 560Asn Leu Leu Ala Thr Thr Ala Asn Pro Gln Leu Phe Asn Asp Gly Glu 565 570 575Lys Phe Tyr Asp Phe Leu Ala Pro Val Pro Gln Gln Gly Gly Gly Leu 580 585 590Ile Gln Ala Tyr Asp Ala Ala Phe Ala Thr Thr Leu Leu Ser Pro Ser 595 600 605Ser Leu Ser Phe Asn Asp Thr Asp His Phe Ile Lys Lys Lys Gln Ile 610 615 620Thr Leu Lys Asn Thr Ser Lys Gln Arg Val Thr Tyr Lys Leu Asn His625 630 635 640Val Pro Thr Asn Thr Phe Tyr Thr Leu Ala Pro Gly Asn Gly Tyr Pro 645 650 655Ala Pro Phe Pro Asn Asp Ala Val Ala Ala His Ala Asn Leu Lys Phe 660 665 670Asn Leu Gln Gln Val Thr Leu Pro Ala Gly Arg Ser Ile Thr Val Asp 675 680 685Val Phe Pro Thr Pro Pro Arg Asp Val Asp Ala Lys Arg Leu Ala Leu 690 695 700Trp Ser Gly Tyr Ile Thr Val Asn Gly Thr Asp Gly Thr Ser Leu Ser705 710 715 720Val Pro Tyr Gln Gly Leu Thr Gly Ser Leu His Lys Gln Lys Val Leu 725 730 735Tyr Pro Glu Asp Ser Trp Ile Ala Asp Ser Thr Asp Glu Ser Leu Ala 740 745 750Pro Val Glu Asn Gly Thr Val Phe Thr Ile Pro Ala Pro Gly Asn Ala 755 760 765Gly Pro Asp Asp Lys Leu Pro Ser Leu Val Val Ser Pro Ala Leu Gly 770 775 780Ser Arg Tyr Val Arg Val Asp Leu Val Leu Leu Ser Ala Pro Pro His785 790 795 800Gly Thr Lys Leu Lys Thr Val Lys Phe Leu Asp Thr Thr Ser Ile Gly 805 810 815Gln Pro Ala Gly Ser Pro Leu Leu Trp Ile Ser Arg Gly Ala Asn Pro 820 825 830Ile Ala Trp Thr Gly Glu Leu Ser Asp Asn Lys Phe Ala Pro Pro Gly 835 840 845Thr Tyr Lys Ala Val Phe His Ala Leu Arg Ile Phe Gly Asn Glu Lys 850 855 860Lys Lys Glu Asp Trp Asp Val Ser Glu Ser Pro Ala Phe Thr Ile Lys865 870 875 880Tyr Ala26541PRTTrichoderma reesei 26Met Arg Ser Val Val Ala Leu Ser Met Ala Ala Val Ala Gln Ala Ser1 5 10 15Thr Phe Gln Ile Gly Thr Ile His Glu Lys Ser Ala Pro Val Leu Ser 20 25 30Asn Val Glu Ala Asn Ala Ile Pro Asp Ala Tyr Ile Ile Lys Phe Lys 35 40 45Asp His Val Gly Glu Asp Asp Ala Ser Lys His His Asp Trp Ile Gln 50 55 60Ser Ile His Thr Asn Val Glu Gln Glu Arg Leu Glu Leu Arg Lys Arg65 70 75 80Ser Asn Val Phe Gly Ala Asp Asp Val Phe Asp Gly Leu Lys His Thr 85 90 95Phe Lys Ile Gly Asp Gly Phe Lys Gly Tyr Ala Gly His Phe His Glu 100 105 110Ser Val Ile Glu Gln Val Arg Asn His Pro Asp Val Glu Tyr Ile Glu 115 120 125Arg Asp Ser Ile Val His Thr Met Leu Pro Leu Glu Ser Lys Asp Ser 130 135 140Ile Ile Val Glu Asp Ser Cys Asn Gly Glu Thr Glu Lys Gln Ala Pro145 150 155 160Trp Gly Leu Ala Arg Ile Ser His Arg Glu Thr Leu Asn Phe Gly Ser 165 170 175Phe Asn Lys Tyr Leu Tyr Thr Ala Asp Gly Gly Glu Gly Val Asp Ala 180 185 190Tyr Val Ile Asp Thr Gly Thr Asn Ile Glu His Val Asp Phe Glu Gly 195 200 205Arg Ala Lys Trp Gly Lys Thr Ile Pro Ala Gly Asp Glu Asp Glu Asp 210 215 220Gly Asn Gly His Gly Thr His Cys Ser Gly Thr Val Ala Gly Lys Lys225 230 235 240Tyr Gly Val Ala Lys Lys Ala His Val Tyr Ala Val Lys Val Leu Arg 245 250 255Ser Asn Gly Ser Gly Thr Met Ser Asp Val Val Lys Gly Val Glu Tyr 260 265 270Ala Ala Leu Ser His Ile Glu Gln Val Lys Lys Ala Lys Lys Gly Lys 275 280 285Arg Lys Gly Phe Lys Gly Ser Val Ala Asn Met Ser Leu Gly Gly Gly 290 295 300Lys Thr Gln Ala Leu Asp Ala Ala Val Asn Ala Ala Val Arg Ala Gly305 310 315 320Val His Phe Ala Val Ala Ala Gly Asn Asp Asn Ala Asp Ala Cys Asn 325 330 335Tyr Ser Pro Ala Ala Ala Thr Glu Pro Leu Thr Val Gly Ala Ser Ala 340 345 350Leu Asp Asp Ser Arg Ala Tyr Phe Ser Asn Tyr Gly Lys Cys Thr Asp 355 360 365Ile Phe Ala Pro Gly Leu Ser Ile Gln Ser Thr Trp Ile Gly Ser Lys 370 375 380Tyr Ala Val Asn Thr Ile Ser Gly Thr Ser Met Ala Ser Pro His Ile385 390 395

400Cys Gly Leu Leu Ala Tyr Tyr Leu Ser Leu Gln Pro Ala Gly Asp Ser 405 410 415Glu Phe Ala Val Ala Pro Ile Thr Pro Lys Lys Leu Lys Glu Ser Val 420 425 430Ile Ser Val Ala Thr Lys Asn Ala Leu Ser Asp Leu Pro Asp Ser Asp 435 440 445Thr Pro Asn Leu Leu Ala Trp Asn Gly Gly Gly Cys Ser Asn Phe Ser 450 455 460Gln Ile Val Glu Ala Gly Ser Tyr Thr Val Lys Pro Lys Gln Asn Lys465 470 475 480Gln Ala Lys Leu Pro Ser Thr Ile Glu Glu Leu Glu Glu Ala Ile Glu 485 490 495Gly Asp Phe Glu Val Val Ser Gly Glu Ile Val Lys Gly Ala Lys Ser 500 505 510Phe Gly Ser Lys Ala Glu Lys Phe Ala Lys Lys Ile His Asp Leu Val 515 520 525Glu Glu Glu Ile Glu Glu Phe Ile Ser Glu Leu Ser Glu 530 535 54027391PRTTrichoderma reesei 27Met Arg Leu Ser Val Leu Leu Ser Val Leu Pro Leu Val Leu Ala Ala1 5 10 15Pro Ala Ile Glu Lys Arg Ala Glu Pro Ala Pro Leu Leu Val Pro Thr 20 25 30Thr Lys His Gly Leu Val Ala Asp Lys Tyr Ile Val Lys Phe Lys Asp 35 40 45Gly Ser Ser Leu Gln Ala Val Asp Glu Ala Ile Ser Gly Leu Val Ser 50 55 60Asn Ala Asp His Val Tyr Gln His Val Phe Arg Gly Phe Ala Ala Thr65 70 75 80Leu Asp Lys Glu Thr Leu Glu Ala Leu Arg Asn His Pro Glu Val Asp 85 90 95Tyr Ile Glu Gln Asp Ala Val Val Lys Ile Asn Ala Tyr Val Ser Gln 100 105 110Thr Gly Ala Pro Trp Gly Leu Gly Arg Ile Ser His Lys Ala Arg Gly 115 120 125Ser Thr Thr Tyr Val Tyr Asp Asp Ser Ala Gly Ala Gly Thr Cys Ser 130 135 140Tyr Val Ile Asp Thr Gly Val Asp Ala Thr His Pro Asp Phe Glu Gly145 150 155 160Arg Ala Thr Leu Leu Arg Ser Phe Val Ser Gly Gln Asn Thr Asp Gly 165 170 175Asn Gly His Gly Thr His Val Ser Gly Thr Ile Gly Ser Arg Thr Tyr 180 185 190Gly Val Ala Lys Lys Thr Gln Ile Tyr Gly Val Lys Val Leu Asp Asn 195 200 205Ser Gly Ser Gly Ser Phe Ser Thr Val Ile Ala Gly Met Asp Tyr Val 210 215 220Ala Ser Asp Ser Gln Thr Arg Asn Cys Pro Asn Gly Ser Val Ala Asn225 230 235 240Met Ser Leu Gly Gly Gly Tyr Thr Ala Ser Val Asn Gln Ala Ala Ala 245 250 255Arg Leu Ile Gln Ala Gly Val Phe Leu Ala Val Ala Ala Gly Asn Asp 260 265 270Gly Val Asp Ala Arg Asn Thr Ser Pro Ala Ser Glu Pro Thr Val Cys 275 280 285Thr Val Gly Ala Ser Thr Ser Ser Asp Ala Arg Ala Ser Phe Ser Asn 290 295 300Tyr Gly Ser Val Val Asp Ile Phe Ala Pro Gly Gln Asp Ile Leu Ser305 310 315 320Thr Trp Pro Asn Arg Gln Thr Asn Thr Ile Ser Gly Thr Ser Met Ala 325 330 335Thr Pro His Ile Val Gly Leu Gly Ala Tyr Leu Ala Gly Leu Glu Gly 340 345 350Phe Ser Asp Pro Gln Ala Leu Cys Ala Arg Ile Gln Ser Leu Ala Asn 355 360 365Arg Asn Leu Leu Ser Gly Ile Pro Ser Gly Thr Ile Asn Ala Ile Ala 370 375 380Phe Asn Gly Asn Pro Ser Gly385 39028387PRTTricochoderma reesei 28Met Gly Leu Val Thr Asn Pro Phe Ala Lys Asn Ile Ile Pro Asn Arg1 5 10 15Tyr Ile Val Val Tyr Asn Asn Ser Phe Gly Glu Glu Ala Ile Ser Ala 20 25 30Lys Gln Ala Gln Phe Ala Ala Lys Ile Ala Lys Arg Asn Leu Gly Lys 35 40 45Arg Gly Leu Phe Gly Asn Glu Leu Ser Thr Ala Ile His Ser Phe Ser 50 55 60Met His Thr Trp Arg Ala Met Ala Leu Asp Ala Asp Asp Ile Met Ile65 70 75 80Lys Asp Ile Phe Asp Ala Glu Glu Val Ala Tyr Ile Glu Ala Asp Thr 85 90 95Lys Val Gln His Ala Ala Leu Val Ala Gln Thr Asn Ala Ala Pro Gly 100 105 110Leu Ile Arg Leu Ser Asn Lys Ala Val Gly Gly Gln Asn Tyr Ile Phe 115 120 125Asp Asn Ser Ala Gly Ser Asn Ile Thr Ala Tyr Val Val Asp Thr Gly 130 135 140Ile Arg Ile Thr His Ser Glu Phe Glu Gly Arg Ala Thr Phe Gly Ala145 150 155 160Asn Phe Val Asn Asp Asp Thr Asp Glu Asn Gly His Gly Ser His Val 165 170 175Ala Gly Thr Ile Gly Gly Ala Thr Phe Gly Val Ala Lys Asn Val Glu 180 185 190Leu Val Ala Val Lys Val Leu Asp Ala Asp Gly Ser Gly Ser Asn Ser 195 200 205Gly Val Leu Asn Gly Met Gln Phe Val Val Asn Asp Val Gln Ala Lys 210 215 220Lys Arg Ser Gly Lys Ala Val Met Asn Met Ser Leu Gly Gly Ser Phe225 230 235 240Ser Thr Ala Val Asn Asn Ala Ile Thr Ala Leu Thr Asn Ala Gly Ile 245 250 255Val Pro Val Val Ala Ala Gly Asn Glu Asn Gln Asp Thr Ala Asn Thr 260 265 270Ser Pro Gly Ser Ala Pro Gln Ala Ile Thr Val Gly Ala Ile Asp Ala 275 280 285Thr Thr Asp Ile Arg Ala Gly Phe Ser Asn Phe Gly Thr Gly Val Asp 290 295 300Ile Tyr Ala Pro Gly Val Asp Val Leu Ser Val Gly Ile Lys Ser Asp305 310 315 320Ile Asp Thr Ala Val Leu Ser Gly Thr Ser Met Ala Ser Pro His Val 325 330 335Ala Gly Leu Ala Ala Tyr Leu Met Ala Leu Glu Gly Val Ser Asn Val 340 345 350Asp Asp Val Ser Asn Leu Ile Lys Asn Leu Ala Ala Lys Thr Gly Ala 355 360 365Ala Val Lys Gln Asn Ile Ala Gly Thr Thr Ser Leu Ile Ala Asn Asn 370 375 380Gly Asn Phe38529409PRTTrichoderma reesei 29Met Ala Ser Leu Arg Arg Leu Ala Leu Tyr Leu Gly Ala Leu Leu Pro1 5 10 15Ala Val Leu Ala Ala Pro Ala Val Asn Tyr Lys Leu Pro Glu Ala Val 20 25 30Pro Asn Lys Phe Ile Val Thr Leu Lys Asp Gly Ala Ser Val Asp Thr 35 40 45Asp Ser His Leu Thr Trp Val Lys Asp Leu His Arg Arg Ser Leu Gly 50 55 60Lys Arg Ser Thr Ala Gly Val Glu Lys Thr Tyr Asn Ile Asp Ser Trp65 70 75 80Asn Ala Tyr Ala Gly Glu Phe Asp Glu Glu Thr Val Lys Gln Ile Lys 85 90 95Ala Asn Pro Asp Val Ala Ser Val Glu Pro Asp Tyr Ile Met Trp Leu 100 105 110Ser Asp Ile Val Glu Asp Lys Arg Ala Leu Thr Thr Gln Thr Gly Ala 115 120 125Pro Trp Gly Leu Gly Thr Val Ser His Arg Thr Pro Gly Ser Thr Ser 130 135 140Tyr Ile Tyr Asp Thr Ser Ala Gly Ser Gly Thr Phe Ala Tyr Val Val145 150 155 160Asp Ser Gly Ile Asn Ile Ala His Gln Gln Phe Gly Gly Arg Ala Ser 165 170 175Leu Gly Tyr Asn Ala Ala Gly Gly Asp His Val Asp Thr Leu Gly His 180 185 190Gly Thr His Val Ser Gly Thr Ile Gly Gly Ser Thr Tyr Gly Val Ala 195 200 205Lys Gln Ala Ser Leu Ile Ser Val Lys Val Phe Gln Gly Asn Ser Ala 210 215 220Ser Thr Ser Val Ile Leu Asp Gly Tyr Asn Trp Ala Val Asn Asp Ile225 230 235 240Val Ser Arg Asn Arg Ala Ser Lys Ser Ala Ile Asn Met Ser Leu Gly 245 250 255Gly Pro Ala Ser Ser Thr Trp Ala Thr Ala Ile Asn Ala Ala Phe Asn 260 265 270Lys Gly Val Leu Thr Ile Val Ala Ala Gly Asn Gly Asp Ala Leu Gly 275 280 285Asn Pro Gln Pro Val Ser Ser Thr Ser Pro Ala Asn Val Pro Asn Ala 290 295 300Ile Thr Val Ala Ala Leu Asp Ile Asn Trp Arg Thr Ala Ser Phe Thr305 310 315 320Asn Tyr Gly Ala Gly Val Asp Val Phe Ala Pro Gly Val Asn Ile Leu 325 330 335Ser Ser Trp Ile Gly Ser Asn Thr Ala Thr Asn Thr Ile Ser Gly Thr 340 345 350Ser Met Ala Thr Pro His Val Val Gly Leu Ala Leu Tyr Leu Gln Ala 355 360 365Leu Glu Gly Leu Ser Thr Pro Thr Ala Val Thr Asn Arg Ile Lys Ala 370 375 380Leu Ala Thr Thr Gly Arg Val Thr Gly Ser Leu Asn Gly Ser Pro Asn385 390 395 400Thr Leu Ile Phe Asn Gly Asn Ser Ala 40530555PRTTrichoderma reesei 30Met Arg Ala Cys Leu Leu Phe Leu Gly Ile Thr Ala Leu Ala Thr Ala1 5 10 15Ile Pro Ala Leu Lys Pro Pro His Gly Ser Pro Asp Arg Ala His Thr 20 25 30Thr Gln Leu Ala Lys Val Ser Ile Ala Leu Gln Pro Glu Cys Arg Glu 35 40 45Leu Leu Glu Gln Ala Leu His His Leu Ser Asp Pro Ser Ser Pro Arg 50 55 60Tyr Gly Arg Tyr Leu Gly Arg Glu Glu Ala Lys Ala Leu Leu Arg Pro65 70 75 80Arg Arg Glu Ala Thr Ala Ala Val Lys Arg Trp Leu Ala Arg Ala Gly 85 90 95Val Pro Ala His Asp Val Leu Thr Asp Gly Gln Phe Ile His Val Arg 100 105 110Thr Leu Ala Glu Lys Ala Gln Ala Leu Leu Gly Phe Glu Tyr Asn Ser 115 120 125Thr Leu Gly Ser Gln Thr Ile Ala Ile Ser Thr Leu Pro Gly Lys Ile 130 135 140Arg Lys His Val Met Thr Val Gln Tyr Val Pro Leu Trp Thr Glu Ala145 150 155 160Asp Trp Glu Glu Cys Lys Thr Ile Ile Thr Pro Ser Cys Leu Lys Arg 165 170 175Leu Tyr His Val Asp Ser Tyr Arg Ala Lys Tyr Glu Ser Ser Ser Leu 180 185 190Phe Gly Ile Val Gly Phe Ser Gly Gln Ala Ala Gln His Asp Glu Leu 195 200 205Asp Lys Phe Leu His Asp Phe Ala Pro Tyr Ser Thr Asn Ala Asn Phe 210 215 220Ser Ile Glu Ser Val Asn Gly Gly Gln Ser Pro Gln Gly Met Asn Glu225 230 235 240Pro Ala Ser Glu Ala Asn Gly Asp Val Gln Tyr Ala Val Ala Met Gly 245 250 255Tyr His Val Pro Val Arg Tyr Tyr Ala Val Gly Gly Glu Asn His Asp 260 265 270Ile Ile Pro Asp Leu Asp Leu Val Asp Thr Thr Glu Glu Tyr Leu Glu 275 280 285Pro Phe Leu Glu Phe Ala Ser His Leu Leu Asp Leu Asp Asp Asp Glu 290 295 300Leu Pro Arg Val Val Ser Ile Ser Tyr Gly Ala Asn Glu Gln Leu Phe305 310 315 320Pro Arg Ser Tyr Ala His Gln Val Cys Asp Met Phe Gly Gln Leu Gly 325 330 335Ala Arg Gly Val Ser Ile Val Val Ala Ala Gly Asp Leu Gly Pro Gly 340 345 350Val Ser Cys Gln Ser Asn Asp Gly Ser Ala Arg Pro Lys Phe Ile Pro 355 360 365Ser Phe Pro Ala Thr Cys Pro Tyr Val Thr Ser Val Gly Ser Thr Arg 370 375 380Gly Ile Met Pro Glu Val Ala Ala Ser Phe Ser Ser Gly Gly Phe Ser385 390 395 400Asp Tyr Phe Ala Arg Pro Ala Trp Gln Asp Arg Ala Val Gly Ala Tyr 405 410 415Leu Gly Ala His Gly Glu Glu Trp Glu Gly Phe Tyr Asn Pro Ala Gly 420 425 430Arg Gly Phe Pro Asp Val Ala Ala Gln Gly Val Asn Phe Arg Phe Arg 435 440 445Ala His Gly Asn Glu Ser Leu Ser Ser Gly Thr Ser Leu Ser Ser Pro 450 455 460Val Phe Ala Ala Leu Ile Ala Leu Leu Asn Asp His Arg Ser Lys Ser465 470 475 480Gly Met Pro Pro Met Gly Phe Leu Asn Pro Trp Ile Tyr Thr Val Gly 485 490 495Ser His Ala Phe Thr Asp Ile Ile Glu Ala Arg Ser Glu Gly Cys Pro 500 505 510Gly Gln Ser Val Glu Tyr Leu Ala Ser Pro Tyr Ile Pro Asn Ala Gly 515 520 525Trp Ser Ala Val Pro Gly Trp Asp Pro Val Thr Gly Trp Gly Thr Pro 530 535 540Leu Phe Asp Arg Met Leu Asn Leu Ser Leu Val545 550 55531388PRTTrichoderma reesei 31Met Ala Trp Leu Lys Lys Leu Ala Leu Val Leu Leu Ala Ile Val Pro1 5 10 15Tyr Ala Thr Ala Ser Pro Ala Leu Ser Pro Arg Ser Arg Glu Ile Leu 20 25 30Ser Leu Glu Asp Leu Glu Ser Glu Asp Lys Tyr Val Ile Gly Leu Lys 35 40 45Gln Gly Leu Ser Pro Thr Asp Leu Lys Lys His Leu Leu Arg Val Ser 50 55 60Ala Val Gln Tyr Arg Asn Lys Asn Ser Thr Phe Glu Gly Gly Thr Gly65 70 75 80Val Lys Arg Thr Tyr Ala Ile Gly Asp Tyr Arg Ala Tyr Thr Ala Val 85 90 95Leu Asp Arg Asp Thr Val Arg Glu Ile Trp Asn Asp Thr Leu Glu Lys 100 105 110Pro Pro Trp Gly Leu Ala Thr Leu Ser Asn Lys Lys Pro His Gly Phe 115 120 125Leu Tyr Arg Tyr Asp Lys Ser Ala Gly Glu Gly Thr Phe Ala Tyr Val 130 135 140Leu Asp Thr Gly Ile Asn Ser Lys His Val Asp Phe Glu Gly Arg Ala145 150 155 160Tyr Met Gly Phe Ser Pro Pro Lys Thr Glu Pro Thr Asp Ile Asn Gly 165 170 175His Gly Thr His Val Ala Gly Ile Ile Gly Gly Lys Thr Phe Gly Val 180 185 190Ala Lys Lys Thr Gln Leu Ile Gly Val Lys Val Phe Leu Asp Asp Glu 195 200 205Ala Thr Thr Ser Thr Leu Met Glu Gly Leu Glu Trp Ala Val Asn Asp 210 215 220Ile Thr Thr Lys Gly Arg Gln Gly Arg Ser Val Ile Asn Met Ser Leu225 230 235 240Gly Gly Pro Tyr Ser Gln Ala Leu Asn Asp Ala Ile Asp His Ile Ala 245 250 255Asp Met Gly Ile Leu Pro Val Ala Ala Ala Gly Asn Lys Gly Ile Pro 260 265 270Ala Thr Phe Ile Ser Pro Ala Ser Ala Asp Lys Ala Met Thr Val Gly 275 280 285Ala Ile Asn Ser Asp Trp Gln Glu Thr Asn Phe Ser Asn Phe Gly Pro 290 295 300Gln Val Asn Ile Leu Ala Pro Gly Glu Asp Val Leu Ser Ala Tyr Val305 310 315 320Ser Thr Asn Thr Ala Thr Arg Val Leu Ser Gly Thr Ser Met Ala Ala 325 330 335Pro His Val Ala Gly Leu Ala Leu Tyr Leu Met Ala Leu Glu Glu Phe 340 345 350Asp Ser Thr Gln Lys Leu Thr Asp Arg Ile Leu Gln Leu Gly Met Lys 355 360 365Asn Lys Val Val Asn Leu Met Thr Asp Ser Pro Asn Leu Ile Ile His 370 375 380Asn Asn Val Lys38532256PRTTrichoderma reesei 32Met Phe Ile Ala Gly Val Ala Leu Ser Ala Leu Leu Cys Ala Asp Thr1 5 10 15Val Leu Ala Gly Val Ala Gln Asp Arg Gly Leu Ala Ala Arg Leu Ala 20 25 30Arg Arg Ala Gly Arg Arg Ser Ala Pro Phe Arg Asn Asp Thr Ser His 35 40 45Ala Thr Val Gln Ser Asn Trp Gly Gly Ala Ile Leu Glu Gly Ser Gly 50 55 60Phe Thr Ala Ala Ser Ala Thr Val Asn Val Pro Arg Gly Gly Gly Gly65 70 75 80Ser Asn Ala Ala Gly Ser Ala Trp Val Gly Ile Asp Gly Ala Ser Cys 85 90 95Gln Thr Ala Ile Leu Gln Thr Gly Phe Asp Trp Tyr Gly Asp Gly Thr 100 105 110Tyr Asp Ala Trp Tyr Glu Trp Tyr Pro Glu Phe Ala Ala Asp Phe Ser 115 120 125Gly Ile Asp Ile Arg Gln Gly Asp Gln Ile Ala Met Ser Val Val Ala 130 135 140Thr Ser Leu Thr Gly Gly Ser Ala Thr Leu Glu Asn Leu Ser Thr Gly145 150 155 160Gln Lys Val Thr Gln Asn Phe Asn Arg Val Thr Ala Gly Ser Leu Cys 165 170 175Glu Thr Ser Ala Glu Phe Ile Ile Glu Asp Phe Glu Glu Cys Asn Ser 180 185 190Asn

Gly Ser Asn Cys Gln Pro Val Pro Phe Ala Ser Phe Ser Pro Ala 195 200 205Ile Thr Phe Ser Ser Ala Thr Ala Thr Arg Ser Gly Arg Ser Val Ser 210 215 220Leu Ser Gly Ala Glu Ile Thr Glu Val Ile Val Asn Asn Gln Asp Leu225 230 235 240Thr Arg Cys Ser Val Ser Gly Ser Ser Thr Leu Thr Cys Ser Tyr Val 245 250 25533236PRTTrichoderma reesei 33Met Asp Ala Ile Arg Ala Arg Ser Ala Ala Arg Arg Ser Asn Arg Phe1 5 10 15Gln Ala Gly Ser Ser Lys Asn Val Asn Gly Thr Ala Asp Val Glu Ser 20 25 30Thr Asn Trp Ala Gly Ala Ala Ile Thr Thr Ser Gly Val Thr Glu Val 35 40 45Ser Gly Thr Phe Thr Val Pro Arg Pro Ser Val Pro Ala Gly Gly Ser 50 55 60Ser Arg Glu Glu Tyr Cys Gly Ala Ala Trp Val Gly Ile Asp Gly Tyr65 70 75 80Ser Asp Ala Asp Leu Ile Gln Thr Gly Val Leu Trp Cys Val Glu Asp 85 90 95Gly Glu Tyr Leu Tyr Glu Ala Trp Tyr Glu Tyr Leu Pro Ala Ala Leu 100 105 110Val Glu Tyr Ser Gly Ile Ser Val Thr Ala Gly Ser Val Val Thr Val 115 120 125Thr Ala Thr Lys Thr Gly Thr Asn Ser Gly Val Thr Thr Leu Thr Ser 130 135 140Gly Gly Lys Thr Val Ser His Thr Phe Ser Arg Gln Asn Ser Pro Leu145 150 155 160Pro Gly Thr Ser Ala Glu Trp Ile Val Glu Asp Phe Thr Ser Gly Ser 165 170 175Ser Leu Val Pro Phe Ala Asp Phe Gly Ser Val Thr Phe Thr Gly Ala 180 185 190Thr Ala Val Val Asn Gly Ala Thr Val Thr Ala Gly Gly Asp Ser Pro 195 200 205Val Ile Ile Asp Leu Glu Asp Ser Arg Gly Asp Ile Leu Thr Ser Thr 210 215 220Thr Val Ser Gly Ser Thr Val Thr Val Glu Tyr Glu225 230 23534612PRTTrichoderma reesei 34Met Ala Lys Leu Ser Thr Leu Arg Leu Ala Ser Leu Leu Ser Leu Val1 5 10 15Ser Val Gln Val Ser Ala Ser Val His Leu Leu Glu Ser Leu Glu Lys 20 25 30Leu Pro His Gly Trp Lys Ala Ala Glu Thr Pro Ser Pro Ser Ser Gln 35 40 45Ile Val Leu Gln Val Ala Leu Thr Gln Gln Asn Ile Asp Gln Leu Glu 50 55 60Ser Arg Leu Ala Ala Val Ser Thr Pro Thr Ser Ser Thr Tyr Gly Lys65 70 75 80Tyr Leu Asp Val Asp Glu Ile Asn Ser Ile Phe Ala Pro Ser Asp Ala 85 90 95Ser Ser Ser Ala Val Glu Ser Trp Leu Gln Ser His Gly Val Thr Ser 100 105 110Tyr Thr Lys Gln Gly Ser Ser Ile Trp Phe Gln Thr Asn Ile Ser Thr 115 120 125Ala Asn Ala Met Leu Ser Thr Asn Phe His Thr Tyr Ser Asp Leu Thr 130 135 140Gly Ala Lys Lys Val Arg Thr Leu Lys Tyr Ser Ile Pro Glu Ser Leu145 150 155 160Ile Gly His Val Asp Leu Ile Ser Pro Thr Thr Tyr Phe Gly Thr Thr 165 170 175Lys Ala Met Arg Lys Leu Lys Ser Ser Gly Val Ser Pro Ala Ala Asp 180 185 190Ala Leu Ala Ala Arg Gln Glu Pro Ser Ser Cys Lys Gly Thr Leu Val 195 200 205Phe Glu Gly Glu Thr Phe Asn Val Phe Gln Pro Asp Cys Leu Arg Thr 210 215 220Glu Tyr Ser Val Asp Gly Tyr Thr Pro Ser Val Lys Ser Gly Ser Arg225 230 235 240Ile Gly Phe Gly Ser Phe Leu Asn Glu Ser Ala Ser Phe Ala Asp Gln 245 250 255Ala Leu Phe Glu Lys His Phe Asn Ile Pro Ser Gln Asn Phe Ser Val 260 265 270Val Leu Ile Asn Gly Gly Thr Asp Leu Pro Gln Pro Pro Ser Asp Ala 275 280 285Asn Asp Gly Glu Ala Asn Leu Asp Ala Gln Thr Ile Leu Thr Ile Ala 290 295 300His Pro Leu Pro Ile Thr Glu Phe Ile Thr Ala Gly Ser Pro Pro Tyr305 310 315 320Phe Pro Asp Pro Val Glu Pro Ala Gly Thr Pro Asn Glu Asn Glu Pro 325 330 335Tyr Leu Gln Tyr Tyr Glu Phe Leu Leu Ser Lys Ser Asn Ala Glu Ile 340 345 350Pro Gln Val Ile Thr Asn Ser Tyr Gly Asp Glu Glu Gln Thr Val Pro 355 360 365Arg Ser Tyr Ala Val Arg Val Cys Asn Leu Ile Gly Leu Leu Gly Leu 370 375 380Arg Gly Ile Ser Val Leu His Ser Ser Gly Asp Glu Gly Val Gly Ala385 390 395 400Ser Cys Val Ala Thr Asn Ser Thr Thr Pro Gln Phe Asn Pro Ile Phe 405 410 415Pro Ala Thr Cys Pro Tyr Val Thr Ser Val Gly Gly Thr Val Ser Phe 420 425 430Asn Pro Glu Val Ala Trp Ala Gly Ser Ser Gly Gly Phe Ser Tyr Tyr 435 440 445Phe Ser Arg Pro Trp Tyr Gln Gln Glu Ala Val Gly Thr Tyr Leu Glu 450 455 460Lys Tyr Val Ser Ala Glu Thr Lys Lys Tyr Tyr Gly Pro Tyr Val Asp465 470 475 480Phe Ser Gly Arg Gly Phe Pro Asp Val Ala Ala His Ser Val Ser Pro 485 490 495Asp Tyr Pro Val Phe Gln Gly Gly Glu Leu Thr Pro Ser Gly Gly Thr 500 505 510Ser Ala Ala Ser Pro Val Val Ala Ala Ile Val Ala Leu Leu Asn Asp 515 520 525Ala Arg Leu Arg Glu Gly Lys Pro Thr Leu Gly Phe Leu Asn Pro Leu 530 535 540Ile Tyr Leu His Ala Ser Lys Gly Phe Thr Asp Ile Thr Ser Gly Gln545 550 555 560Ser Glu Gly Cys Asn Gly Asn Asn Thr Gln Thr Gly Ser Pro Leu Pro 565 570 575Gly Ala Gly Phe Ile Ala Gly Ala His Trp Asn Ala Thr Lys Gly Trp 580 585 590Asp Pro Thr Thr Gly Phe Gly Val Pro Asn Leu Lys Lys Leu Leu Ala 595 600 605Leu Val Arg Phe 61035477PRTTrichoderma reesei 35Met Arg Phe Val Gln Tyr Val Ser Leu Ala Gly Leu Phe Ala Ala Ala1 5 10 15Thr Val Ser Ala Gly Val Val Thr Val Pro Phe Glu Lys Arg Asn Leu 20 25 30Asn Pro Asp Phe Ala Pro Ser Leu Leu Arg Arg Asp Gly Ser Val Ser 35 40 45Leu Asp Ala Ile Asn Asn Leu Thr Gly Gly Gly Tyr Tyr Ala Gln Phe 50 55 60Ser Val Gly Thr Pro Pro Gln Lys Leu Ser Phe Leu Leu Asp Thr Gly65 70 75 80Ser Ser Asp Thr Trp Val Asn Ser Val Thr Ala Asp Leu Cys Thr Asp 85 90 95Glu Phe Thr Gln Gln Thr Val Gly Glu Tyr Cys Phe Arg Gln Phe Asn 100 105 110Pro Arg Arg Ser Ser Ser Tyr Lys Ala Ser Thr Glu Val Phe Asp Ile 115 120 125Thr Tyr Leu Asp Gly Arg Arg Ile Arg Gly Asn Tyr Phe Thr Asp Thr 130 135 140Val Thr Ile Asn Gln Ala Asn Ile Thr Gly Gln Lys Ile Gly Leu Ala145 150 155 160Leu Gln Ser Val Arg Gly Thr Gly Ile Leu Gly Leu Gly Phe Arg Glu 165 170 175Asn Glu Ala Ala Asp Thr Lys Tyr Pro Thr Val Ile Asp Asn Leu Val 180 185 190Ser Gln Lys Val Ile Pro Val Pro Ala Phe Ser Leu Tyr Leu Asn Asp 195 200 205Leu Gln Thr Ser Gln Gly Ile Leu Leu Phe Gly Gly Val Asp Thr Asp 210 215 220Lys Phe His Gly Gly Leu Ala Thr Leu Pro Leu Gln Ser Leu Pro Pro225 230 235 240Ser Ile Ala Glu Thr Gln Asp Ile Val Met Tyr Ser Val Asn Leu Asp 245 250 255Gly Phe Ser Ala Ser Asp Val Asp Thr Pro Asp Val Ser Ala Lys Ala 260 265 270Val Leu Asp Ser Gly Ser Thr Ile Thr Leu Leu Pro Asp Ala Val Val 275 280 285Gln Glu Leu Phe Asp Glu Tyr Asp Val Leu Asn Ile Gln Gly Leu Pro 290 295 300Val Pro Phe Ile Asp Cys Ala Lys Ala Asn Ile Lys Asp Ala Thr Phe305 310 315 320Asn Phe Lys Phe Asp Gly Lys Thr Ile Lys Val Pro Ile Asp Glu Met 325 330 335Val Leu Asn Asn Leu Ala Ala Ala Ser Asp Glu Ile Met Ser Asp Pro 340 345 350Ser Leu Ser Lys Phe Phe Lys Gly Trp Ser Gly Val Cys Thr Phe Gly 355 360 365Met Gly Ser Thr Lys Thr Phe Gly Ile Gln Ser Asp Glu Phe Val Leu 370 375 380Leu Gly Asp Thr Phe Leu Arg Ser Ala Tyr Val Val Tyr Asp Leu Gln385 390 395 400Asn Lys Gln Ile Gly Ile Ala Gln Ala Thr Leu Asn Ser Thr Ser Ser 405 410 415Thr Ile Val Glu Phe Lys Ala Gly Ser Lys Thr Ile Pro Gly Pro Ala 420 425 430Ser Thr Gly Asp Asp Ser Asp Asp Ser Ser Asp Asp Ser Asp Glu Asp 435 440 445Ser Ala Gly Ala Ala Leu His Pro Thr Phe Ser Ile Ala Leu Ala Gly 450 455 460Thr Leu Phe Thr Ala Val Ser Met Met Met Ser Val Leu465 470 475361263DNATrichoderma reesei 36atggcgtcac tcatcaaaac tgccgtggac attgccaacg gccgccatgc gctgtccaga 60tatgtcatct ttgggctctg gcttgcggat gcggtgctgt gcgggctgat tatctggaaa 120gtgccttata cggaaatcga ctgggtcgcc tacatggagc aagtcaccca gttcgtccac 180ggagagcgag actaccccaa gatggagggc ggcacagggc ccctggtgta tcccgcggcc 240catgtgtaca tctacacagg gctctactac ctgacgaaca agggcaccga catcctgctg 300gcgcagcagc tctttgccgt gctctacatg gctactctgg cggtcgtcat gacatgctac 360tccaaggcca aggtcccgcc gtacatcttc ccgcttctca tcctctccaa aagacttcac 420agcgtcttcg tcctgagatg cttcaacgac tgcttcgccg ccttcttcct ctggctctgc 480atcttcttct tccagaggcg agagtggacc atcggagctc tcgcatacag catcggcctg 540ggcgtcaaaa tgtcgctgct actggttctc cccgccgtgg tcatcgtcct ctacctcggc 600cgcggcttca agggcgccct gcggctgctc tggctcatgg tgcaggtcca gctcctcctc 660gccataccct tcatcacgac aaattggcgc ggctacctcg gccgtgcatt cgagctctcg 720aggcagttca agtttgaatg gacagtcaat tggcgcatgc tgggcgagga tctgttcctc 780agccggggct tctctatcac gctactggca tttcacgcca tcttcctcct cgcctttatc 840ctcggccggt ggctgaagat tagggaacgg accgtactcg ggatgatccc ctatgtcatc 900cgattcagat cgccctttac cgagcaggaa gagcgcgcca tctccaaccg cgtcgtcacg 960cccggctatg tcatgtccac catcttgtcg gccaacgtgg tgggactgct gtttgcccgg 1020tctctgcact accagttcta tgcatatctg gcgtgggcga ccccctatct cctgtggacg 1080gcctgcccca atcttttggt ggtggccccc ctctgggcgg cgcaagaatg ggcctggaac 1140gtcttcccca gcacgcctct tagctcgagc gtcgtggtga gcgtgctggc cgtgacggtg 1200gccatggcgt ttgcaggttc aaatccgcag ccacgtgaaa catcgaagcc gaagcagcac 1260taa 126337420PRTTrichoderma reesei 37Met Ala Ser Leu Ile Lys Thr Ala Val Asp Ile Ala Asn Gly Arg His1 5 10 15Ala Leu Ser Arg Tyr Val Ile Phe Gly Leu Trp Leu Ala Asp Ala Val 20 25 30Leu Cys Gly Leu Ile Ile Trp Lys Val Pro Tyr Thr Glu Ile Asp Trp 35 40 45Val Ala Tyr Met Glu Gln Val Thr Gln Phe Val His Gly Glu Arg Asp 50 55 60Tyr Pro Lys Met Glu Gly Gly Thr Gly Pro Leu Val Tyr Pro Ala Ala65 70 75 80His Val Tyr Ile Tyr Thr Gly Leu Tyr Tyr Leu Thr Asn Lys Gly Thr 85 90 95Asp Ile Leu Leu Ala Gln Gln Leu Phe Ala Val Leu Tyr Met Ala Thr 100 105 110Leu Ala Val Val Met Thr Cys Tyr Ser Lys Ala Lys Val Pro Pro Tyr 115 120 125Ile Phe Pro Leu Leu Ile Leu Ser Lys Arg Leu His Ser Val Phe Val 130 135 140Leu Arg Cys Phe Asn Asp Cys Phe Ala Ala Phe Phe Leu Trp Leu Cys145 150 155 160Ile Phe Phe Phe Gln Arg Arg Glu Trp Thr Ile Gly Ala Leu Ala Tyr 165 170 175Ser Ile Gly Leu Gly Val Lys Met Ser Leu Leu Leu Val Leu Pro Ala 180 185 190Val Val Ile Val Leu Tyr Leu Gly Arg Gly Phe Lys Gly Ala Leu Arg 195 200 205Leu Leu Trp Leu Met Val Gln Val Gln Leu Leu Leu Ala Ile Pro Phe 210 215 220Ile Thr Thr Asn Trp Arg Gly Tyr Leu Gly Arg Ala Phe Glu Leu Ser225 230 235 240Arg Gln Phe Lys Phe Glu Trp Thr Val Asn Trp Arg Met Leu Gly Glu 245 250 255Asp Leu Phe Leu Ser Arg Gly Phe Ser Ile Thr Leu Leu Ala Phe His 260 265 270Ala Ile Phe Leu Leu Ala Phe Ile Leu Gly Arg Trp Leu Lys Ile Arg 275 280 285Glu Arg Thr Val Leu Gly Met Ile Pro Tyr Val Ile Arg Phe Arg Ser 290 295 300Pro Phe Thr Glu Gln Glu Glu Arg Ala Ile Ser Asn Arg Val Val Thr305 310 315 320Pro Gly Tyr Val Met Ser Thr Ile Leu Ser Ala Asn Val Val Gly Leu 325 330 335Leu Phe Ala Arg Ser Leu His Tyr Gln Phe Tyr Ala Tyr Leu Ala Trp 340 345 350Ala Thr Pro Tyr Leu Leu Trp Thr Ala Cys Pro Asn Leu Leu Val Val 355 360 365Ala Pro Leu Trp Ala Ala Gln Glu Trp Ala Trp Asn Val Phe Pro Ser 370 375 380Thr Pro Leu Ser Ser Ser Val Val Val Ser Val Leu Ala Val Thr Val385 390 395 400Ala Met Ala Phe Ala Gly Ser Asn Pro Gln Pro Arg Glu Thr Ser Lys 405 410 415Pro Lys Gln His 42038445PRTHomo sapiens 38Met Leu Lys Lys Gln Ser Ala Gly Leu Val Leu Trp Gly Ala Ile Leu1 5 10 15Phe Val Ala Trp Asn Ala Leu Leu Leu Leu Phe Phe Trp Thr Arg Pro 20 25 30Ala Pro Gly Arg Pro Pro Ser Val Ser Ala Leu Asp Gly Asp Pro Ala 35 40 45Ser Leu Thr Arg Glu Val Ile Arg Leu Ala Gln Asp Ala Glu Val Glu 50 55 60Leu Glu Arg Gln Arg Gly Leu Leu Gln Gln Ile Gly Asp Ala Leu Ser65 70 75 80Ser Gln Arg Gly Arg Val Pro Thr Ala Ala Pro Pro Ala Gln Pro Arg 85 90 95Val Pro Val Thr Pro Ala Pro Ala Val Ile Pro Ile Leu Val Ile Ala 100 105 110Cys Asp Arg Ser Thr Val Arg Arg Cys Leu Asp Lys Leu Leu His Tyr 115 120 125Arg Pro Ser Ala Glu Leu Phe Pro Ile Ile Val Ser Gln Asp Cys Gly 130 135 140His Glu Glu Thr Ala Gln Ala Ile Ala Ser Tyr Gly Ser Ala Val Thr145 150 155 160His Ile Arg Gln Pro Asp Leu Ser Ser Ile Ala Val Pro Pro Asp His 165 170 175Arg Lys Phe Gln Gly Tyr Tyr Lys Ile Ala Arg His Tyr Arg Trp Ala 180 185 190Leu Gly Gln Val Phe Arg Gln Phe Arg Phe Pro Ala Ala Val Val Val 195 200 205Glu Asp Asp Leu Glu Val Ala Pro Asp Phe Phe Glu Tyr Phe Arg Ala 210 215 220Thr Tyr Pro Leu Leu Lys Ala Asp Pro Ser Leu Trp Cys Val Ser Ala225 230 235 240Trp Asn Asp Asn Gly Lys Glu Gln Met Val Asp Ala Ser Arg Pro Glu 245 250 255Leu Leu Tyr Arg Thr Asp Phe Phe Pro Gly Leu Gly Trp Leu Leu Leu 260 265 270Ala Glu Leu Trp Ala Glu Leu Glu Pro Lys Trp Pro Lys Ala Phe Trp 275 280 285Asp Asp Trp Met Arg Arg Pro Glu Gln Arg Gln Gly Arg Ala Cys Ile 290 295 300Arg Pro Glu Ile Ser Arg Thr Met Thr Phe Gly Arg Lys Gly Val Ser305 310 315 320His Gly Gln Phe Phe Asp Gln His Leu Lys Phe Ile Lys Leu Asn Gln 325 330 335Gln Phe Val His Phe Thr Gln Leu Asp Leu Ser Tyr Leu Gln Arg Glu 340 345 350Ala Tyr Asp Arg Asp Phe Leu Ala Arg Val Tyr Gly Ala Pro Gln Leu 355 360 365Gln Val Glu Lys Val Arg Thr Asn Asp Arg Lys Glu Leu Gly Glu Val 370 375 380Arg Val Gln Tyr Thr Gly Arg Asp Ser Phe Lys Ala Phe Ala Lys Ala385 390 395 400Leu Gly Val Met Asp Asp Leu Lys Ser Gly Val Pro Arg Ala Gly Tyr 405 410 415Arg Gly Ile Val Thr Phe Gln Phe Arg Gly Arg Arg Val His Leu Ala 420

425 430Pro Pro Leu Thr Trp Glu Gly Tyr Asp Pro Ser Trp Asn 435 440 44539447PRTHomo sapiens 39Met Arg Phe Arg Ile Tyr Lys Arg Lys Val Leu Ile Leu Thr Leu Val1 5 10 15Val Ala Ala Cys Gly Phe Val Leu Trp Ser Ser Asn Gly Arg Gln Arg 20 25 30Lys Asn Glu Ala Leu Ala Pro Pro Leu Leu Asp Ala Glu Pro Ala Arg 35 40 45Gly Ala Gly Gly Arg Gly Gly Asp His Pro Ser Val Ala Val Gly Ile 50 55 60Arg Arg Val Ser Asn Val Ser Ala Ala Ser Leu Val Pro Ala Val Pro65 70 75 80Gln Pro Glu Ala Asp Asn Leu Thr Leu Arg Tyr Arg Ser Leu Val Tyr 85 90 95Gln Leu Asn Phe Asp Gln Thr Leu Arg Asn Val Asp Lys Ala Gly Thr 100 105 110Trp Ala Pro Arg Glu Leu Val Leu Val Val Gln Val His Asn Arg Pro 115 120 125Glu Tyr Leu Arg Leu Leu Leu Asp Ser Leu Arg Lys Ala Gln Gly Ile 130 135 140Asp Asn Val Leu Val Ile Phe Ser His Asp Phe Trp Ser Thr Glu Ile145 150 155 160Asn Gln Leu Ile Ala Gly Val Asn Phe Cys Pro Val Leu Gln Val Phe 165 170 175Phe Pro Phe Ser Ile Gln Leu Tyr Pro Asn Glu Phe Pro Gly Ser Asp 180 185 190Pro Arg Asp Cys Pro Arg Asp Leu Pro Lys Asn Ala Ala Leu Lys Leu 195 200 205Gly Cys Ile Asn Ala Glu Tyr Pro Asp Ser Phe Gly His Tyr Arg Glu 210 215 220Ala Lys Phe Ser Gln Thr Lys His His Trp Trp Trp Lys Leu His Phe225 230 235 240Val Trp Glu Arg Val Lys Ile Leu Arg Asp Tyr Ala Gly Leu Ile Leu 245 250 255Phe Leu Glu Glu Asp His Tyr Leu Ala Pro Asp Phe Tyr His Val Phe 260 265 270Lys Lys Met Trp Lys Leu Lys Gln Gln Glu Cys Pro Glu Cys Asp Val 275 280 285Leu Ser Leu Gly Thr Tyr Ser Ala Ser Arg Ser Phe Tyr Gly Met Ala 290 295 300Asp Lys Val Asp Val Lys Thr Trp Lys Ser Thr Glu His Asn Met Gly305 310 315 320Leu Ala Leu Thr Arg Asn Ala Tyr Gln Lys Leu Ile Glu Cys Thr Asp 325 330 335Thr Phe Cys Thr Tyr Asp Asp Tyr Asn Trp Asp Trp Thr Leu Gln Tyr 340 345 350Leu Thr Val Ser Cys Leu Pro Lys Phe Trp Lys Val Leu Val Pro Gln 355 360 365Ile Pro Arg Ile Phe His Ala Gly Asp Cys Gly Met His His Lys Lys 370 375 380Thr Cys Arg Pro Ser Thr Gln Ser Ala Gln Ile Glu Ser Leu Leu Asn385 390 395 400Asn Asn Lys Gln Tyr Met Phe Pro Glu Thr Leu Thr Ile Ser Glu Lys 405 410 415Phe Thr Val Val Ala Ile Ser Pro Pro Arg Lys Asn Gly Gly Trp Gly 420 425 430Asp Ile Arg Asp His Glu Leu Cys Lys Ser Tyr Arg Arg Leu Gln 435 440 4454085PRTTrichoderma reesei 40Met Ala Ser Thr Asn Ala Arg Tyr Val Arg Tyr Leu Leu Ile Ala Phe1 5 10 15Phe Thr Ile Leu Val Phe Tyr Phe Val Ser Asn Ser Lys Tyr Glu Gly 20 25 30Val Asp Leu Asn Lys Gly Thr Phe Thr Ala Pro Asp Ser Thr Lys Thr 35 40 45Thr Pro Lys Pro Pro Ala Thr Gly Asp Ala Lys Asp Phe Pro Leu Ala 50 55 60Leu Thr Pro Asn Asp Pro Gly Phe Asn Asp Leu Val Gly Ile Ala Pro65 70 75 80Gly Pro Arg Met Asn 8541255DNATrichoderma reesei 41atggcgtcaa caaatgcgcg ctatgtgcgc tatctactaa tcgccttctt cacaatcctc 60gtcttctact ttgtctccaa ttcaaagtat gagggcgtcg atctcaacaa gggcaccttc 120acagctccgg attcgaccaa gacgacacca aagccgccag ccactggcga tgccaaagac 180tttcctctgg ccctgacgcc gaacgatcca ggcttcaacg acctcgtcgg catcgctccc 240ggccctcgaa tgaac 2554258PRTHomo sapiens 42Met Arg Phe Arg Ile Tyr Lys Arg Lys Val Leu Ile Leu Thr Leu Val1 5 10 15Val Ala Ala Cys Gly Phe Val Leu Trp Ser Ser Asn Gly Arg Gln Arg 20 25 30Lys Asn Glu Ala Leu Ala Pro Pro Leu Leu Asp Ala Glu Pro Ala Arg 35 40 45Gly Ala Gly Gly Arg Gly Gly Asp His Pro 50 554351PRTTrichoderma reesei 43Met Ala Ser Thr Asn Ala Arg Tyr Val Arg Tyr Leu Leu Ile Ala Phe1 5 10 15Phe Thr Ile Leu Val Phe Tyr Phe Val Ser Asn Ser Lys Tyr Glu Gly 20 25 30Val Asp Leu Asn Lys Gly Thr Phe Thr Ala Pro Asp Ser Thr Lys Thr 35 40 45Thr Pro Lys 504452PRTTrichoderma reesei 44Met Ala Ile Ala Arg Pro Val Arg Ala Leu Gly Gly Leu Ala Ala Ile1 5 10 15Leu Trp Cys Phe Phe Leu Tyr Gln Leu Leu Arg Pro Ser Ser Ser Tyr 20 25 30Asn Ser Pro Gly Asp Arg Tyr Ile Asn Phe Glu Arg Asp Pro Asn Leu 35 40 45Asp Pro Thr Gly 504533PRTTrichoderma reesei 45Met Leu Asn Pro Arg Arg Ala Leu Ile Ala Ala Ala Phe Ile Leu Thr1 5 10 15Val Phe Phe Leu Ile Ser Arg Ser His Asn Ser Glu Ser Ala Ser Thr 20 25 30Ser4684PRTTrichoderma reesei 46Met Met Pro Arg His His Ser Ser Gly Phe Ser Asn Gly Tyr Pro Arg1 5 10 15Ala Asp Thr Phe Glu Ile Ser Pro His Arg Phe Gln Pro Arg Ala Thr 20 25 30Leu Pro Pro His Arg Lys Arg Lys Arg Thr Ala Ile Arg Val Gly Ile 35 40 45Ala Val Val Val Ile Leu Val Leu Val Leu Trp Phe Gly Gln Pro Arg 50 55 60Ser Val Ala Ser Leu Ile Ser Leu Gly Ile Leu Ser Gly Tyr Asp Asp65 70 75 80Leu Lys Leu Glu4755PRTTrichoderma reesei 47Met Leu Leu Pro Lys Gly Gly Leu Asp Trp Arg Ser Ala Arg Ala Gln1 5 10 15Ile Pro Pro Thr Arg Ala Leu Trp Asn Ala Val Thr Arg Thr Arg Phe 20 25 30Ile Leu Leu Val Gly Ile Thr Gly Leu Ile Leu Leu Leu Trp Arg Gly 35 40 45Val Ser Thr Ser Ala Ser Glu 50 554869DNAArtificial SequencePrimer 48cgattaagtt gggtaacgcc agggttttcc cagtcacgac ggtttaaacg ctgcagggcg 60tacagaact 694969DNAArtificial SequencePrimer 49atctctcaaa ggaagaatcc cttcagggtt gcgtttccag tgcggccgcg gctctaaaat 60gcttcacag 695068DNAArtificial SequencePrimer 50cggttctcat ctgggcttgc tcggtcctgg cgtagatcta gcggccgcac gatgatgatg 60acagccag 685169DNAArtificial SequencePrimer 51gtggaattgt gagcggataa caatttcaca caggaaacag cgtttaaacc gtccagctcc 60cgcagcgcc 695284DNAArtificial SequencePrimer 52atcgctaact gctttctctt ctgtgaagca ttttagagcc gcggccgcgg ccggccgcga 60tcgcctagat ctacgccagg accg 845348DNAArtificial SequencePrimer 53cggtcctggc gtagatctag ggcgcgccac tggaaacgca accctgaa 485448DNAArtificial SequencePrimer 54ttcagggttg cgtttccagt ggcgcgccct agatctacgc caggaccg 485568DNAArtificial SequencePrimer 55agcatcatga ccgccccctt ctggctgtca tcatcatcgt gcggccgcga ttattgcaca 60agcagcga 685620DNAArtificial SequencePrimer 56tatggcttta gatggggaca 205720DNAArtificial SequencePrimer 57tgcgtcgccg tctcgctcct 205820DNAArtificial SequencePrimer 58ttaggcgacc tctttttcca 205918DNAArtificial SequencePrimer 59cctgtatcgt cctgttcc 186020DNAArtificial SequencePrimer 60gcgcctgtcg agtcggcatt 206120DNAArtificial SequencePrimer 61caccggccat gctcttgcca 206218DNAArtificial SequencePrimer 62caaggtgccc tatgtcgc 186318DNAArtificial SequencePrimer 63gatcgggtca ggacggaa 186418DNAArtificial SequencePrimer 64agcctgtctg agggacgg 186518DNAArtificial SequencePrimer 65caaggtcgag attcggca 186617DNAArtificial SequencePrimer 66cagaaggggg cggtcat 176717DNAArtificial SequencePrimer 67gtcccagctc ccgctct 176820DNAArtificial SequencePrimer 68gcgcctgtcg agtcggcatt 206920DNAArtificial SequencePrimer 69caccggccat gctcttgcca 207069DNAArtificial SequencePrimer 70cgattaagtt gggtaacgcc agggttttcc cagtcacgac ggtttaaacg tttcaggtac 60caacacctg 697169DNAArtificial SequencePrimer 71atctctcaaa ggaagaatcc cttcagggtt gcgtttccag tgcggccgcg gcgaagagtc 60tggcgggga 697268DNAArtificial SequencePrimer 72cggttctcat ctgggcttgc tcggtcctgg cgtagatcta gcggccgcaa gaggatgggg 60gtaaagct 687369DNAArtificial SequencePrimer 73gtggaattgt gagcggataa caatttcaca caggaaacag cgtttaaacg aggaggactc 60gtgagttat 697484DNAArtificial SequencePrimer 74gcgcccttcc gcctcgacaa tccccgccag actcttcgcc gcggccgcgg ccggccgcga 60tcgcctagat ctacgccagg accg 847548DNAArtificial SequencePrimer 75cggtcctggc gtagatctag ggcgcgccac tggaaacgca accctgaa 487648DNAArtificial SequencePrimer 76ttcagggttg cgtttccagt ggcgcgccct agatctacgc caggaccg 487768DNAArtificial SequencePrimer 77gagctggcca gaaaagacca agctttaccc ccatcctctt gcggccgcga ttattgcaca 60agcagcga 687820DNAArtificial SequencePrimer 78acgagttgtt tcgtgtaccg 207921DNAArtificial SequencePrimer 79ctttccattc atcagggatg g 218020DNAArtificial SequencePrimer 80ggagactcag tgaagagagg 208118DNAArtificial SequencePrimer 81atgttgcagt tgcgaaag 188220DNAArtificial SequencePrimer 82ccctcgtcgc agaaaagatg 208320DNAArtificial SequencePrimer 83agcctccttg ggaacctcag 208420DNAArtificial SequencePrimer 84cttagtgcgg ctggagggcg 208520DNAArtificial SequencePrimer 85ggccggttcg tgcaactgga 208620DNAArtificial SequencePrimer 86ggccgcaaga ggatgggggt 208721DNAArtificial SequencePrimer 87tcgggccagc tgaagcacaa c 218820DNAArtificial SequencePrimer 88ttgaggaacg gctgcctgcg 208920DNAArtificial SequencePrimer 89cgatggctcc gtcatccgcc 209020DNAArtificial SequencePrimer 90acgagttgtt tcgtgtaccg 209120DNAArtificial SequencePrimer 91tgcgtcgccg tctcgctcct 209220DNAArtificial SequencePrimer 92ttaggcgacc tctttttcca 209318DNAArtificial SequencePrimer 93atgttgcagt tgcgaaag 189420DNAArtificial SequencePrimer 94ccctcgtcgc agaaaagatg 209520DNAArtificial SequencePrimer 95agcctccttg ggaacctcag 209620DNAArtificial SequencePrimer 96cttagtgcgg ctggagggcg 209720DNAArtificial SequencePrimer 97ggccggttcg tgcaactgga 209820DNAArtificial SequencePrimer 98ggccgcaaga ggatgggggt 209921DNAArtificial SequencePrimer 99tcgggccagc tgaagcacaa c 2110020DNAArtificial SequencePrimer 100ccctcgtcgc agaaaagatg 2010120DNAArtificial SequencePrimer 101agcctccttg ggaacctcag 2010269DNAArtificial SequencePrimer 102cgattaagtt gggtaacgcc agggttttcc cagtcacgac ggtttaaacg tgtttaaatt 60tgatgaggc 6910369DNAArtificial SequencePrimer 103atctctcaaa ggaagaatcc cttcagggtt gcgtttccag tgcggccgcg gtctcagaga 60cagccttct 6910468DNAArtificial SequencePrimer 104cggttctcat ctgggcttgc tcggtcctgg cgtagatcta gcggccgcac tcggcttctt 60tgtccgag 6810569DNAArtificial SequencePrimer 105gtggaattgt gagcggataa caatttcaca caggaaacag cgtttaaact cctcgtcggc 60aacaaggcc 6910684DNAArtificial SequencePrimer 106gcagatctgg gggaggaatc agaaggctgt ctctgagacc gcggccgcgg ccggccgcga 60tcgcctagat ctacgccagg accg 8410748DNAArtificial SequencePrimer 107cggtcctggc gtagatctag ggcgcgccac tggaaacgca accctgaa 4810848DNAArtificial SequencePrimer 108ttcagggttg cgtttccagt ggcgcgccct agatctacgc caggaccg 4810968DNAArtificial SequencePrimer 109aaagtgggcg agctgagata ctcggacaaa gaagccgagt gcggccgcga ttattgcaca 60agcagcga 6811018DNAArtificial SequencePrimer 110acgggagatc tcggaaaa 1811121DNAArtificial SequencePrimer 111ctttccattc atcagggatg g 2111220DNAArtificial SequencePrimer 112ggagactcag tgaagagagg 2011318DNAArtificial SequencePrimer 113atgaagctca gcctgtgg 1811418DNAArtificial SequencePrimer 114ggggacggct tgaggaag 1811520DNAArtificial SequencePrimer 115ctgcttgctg cttccagtca 2011620DNAArtificial SequencePrimer 116tggcagatgc cgaaaggcgg 2011720DNAArtificial SequencePrimer 117tggcaaccag ctgtggctcc 2011820DNAArtificial SequencePrimer 118cggccgcact cggcttcttt 2011920DNAArtificial SequencePrimer 119gagtgggcta ggcgcaacgg 2012020DNAArtificial SequencePrimer 120ggatcggcca ctgccaccac 2012120DNAArtificial SequencePrimer 121gcccacttct ctgcgcgtgt 2012218DNAArtificial SequencePrimer 122acgggagatc tcggaaaa 1812320DNAArtificial SequencePrimer 123ccatgagctt gaacaggtaa 2012420DNAArtificial SequencePrimer 124ttaggcgacc tctttttcca 2012518DNAArtificial SequencePrimer 125atgaagctca gcctgtgg 1812620DNAArtificial SequencePrimer 126ggatcggcca ctgccaccac 2012720DNAArtificial SequencePrimer 127gcccacttct ctgcgcgtgt 2012820DNAArtificial SequencePrimer 128tggcagatgc cgaaaggcgg 2012920DNAArtificial SequencePrimer 129tggcaaccag ctgtggctcc 2013020DNAArtificial SequencePrimer 130cggccgcact cggcttcttt 2013120DNAArtificial SequencePrimer 131gagtgggcta ggcgcaacgg 2013217DNAArtificial SequencePrimer 132ctctgcgcgt gttgtgg 1713317DNAArtificial SequencePrimer 133taagggtgcg gattcgg 17134488PRTTrichoderma reesei 134Met Arg Ala Ser Pro Leu Ala Val Ala Gly Val Ala Leu Ala Ser Ala1 5 10 15Ala Gln Ala Gln Val Val Gln Phe Asp Ile Glu Lys Arg His Ala Pro 20 25 30Arg Leu Ser Arg Arg Asp Gly Thr Ile Asp Gly Thr Leu Ser Asn Gln 35 40 45Arg Val Gln Gly Gly Tyr Phe Ile Asn Val Gln Val Gly Ser Pro Gly 50 55

60Gln Asn Ile Thr Leu Gln Leu Asp Thr Gly Ser Ser Asp Val Trp Val65 70 75 80Pro Ser Ser Thr Ala Ala Ile Cys Thr Gln Val Ser Glu Arg Asn Pro 85 90 95Gly Cys Gln Phe Gly Ser Phe Asn Pro Asp Asp Ser Asp Thr Phe Asp 100 105 110Glu Val Gly Gln Gly Leu Phe Asp Ile Thr Tyr Val Asp Gly Ser Ser 115 120 125Ser Lys Gly Asp Tyr Phe Gln Asp Asn Phe Gln Ile Asn Gly Val Thr 130 135 140Val Lys Asn Leu Thr Met Gly Leu Gly Leu Ser Ser Ser Ile Pro Asn145 150 155 160Gly Leu Ile Gly Val Gly Tyr Met Asn Asp Glu Ala Ser Val Ser Thr 165 170 175Thr Arg Ser Thr Tyr Pro Asn Leu Pro Ile Val Leu Gln Gln Gln Lys 180 185 190Leu Ile Asn Ser Val Ala Phe Ser Leu Trp Leu Asn Asp Leu Asp Ala 195 200 205Ser Thr Gly Ser Ile Leu Phe Gly Gly Ile Asp Thr Glu Lys Tyr His 210 215 220Gly Asp Leu Thr Ser Ile Asp Ile Ile Ser Pro Asn Gly Gly Lys Thr225 230 235 240Phe Thr Glu Phe Ala Val Asn Leu Tyr Ser Val Gln Ala Thr Ser Pro 245 250 255Ser Gly Thr Asp Thr Leu Ser Thr Ser Glu Asp Thr Leu Ile Ala Val 260 265 270Leu Asp Ser Gly Thr Thr Leu Thr Tyr Leu Pro Gln Asp Met Ala Glu 275 280 285Glu Ala Trp Asn Glu Val Gly Ala Glu Tyr Ser Asn Glu Leu Gly Leu 290 295 300Ala Val Val Pro Cys Ser Val Gly Asn Thr Asn Gly Phe Phe Ser Phe305 310 315 320Thr Phe Ala Gly Thr Asp Gly Pro Thr Ile Asn Val Thr Leu Ser Glu 325 330 335Leu Val Leu Asp Leu Phe Ser Gly Gly Pro Ala Pro Arg Phe Ser Ser 340 345 350Gly Pro Asn Lys Gly Gln Ser Ile Cys Glu Phe Gly Ile Gln Asn Gly 355 360 365Thr Gly Ser Pro Phe Leu Leu Gly Asp Thr Phe Leu Arg Ser Ala Phe 370 375 380Val Val Tyr Asp Leu Val Asn Asn Gln Ile Ala Ile Ala Pro Thr Asn385 390 395 400Phe Asn Ser Thr Arg Thr Asn Val Val Ala Phe Ala Ser Ser Gly Ala 405 410 415Pro Ile Pro Ser Ala Thr Ala Ala Pro Asn Gln Ser Arg Thr Gly His 420 425 430Ser Ser Ser Thr His Ser Gly Leu Ser Ala Ala Ser Gly Phe His Asp 435 440 445Gly Asp Asp Glu Asn Ala Gly Ser Leu Thr Ser Val Phe Ser Gly Pro 450 455 460Gly Met Ala Val Val Gly Met Thr Ile Cys Tyr Thr Leu Leu Gly Ser465 470 475 480Ala Ile Phe Gly Ile Gly Trp Leu 485135761PRTTrichoderma reesei 135Met Arg Ser Thr Leu Tyr Gly Leu Ala Ala Leu Pro Leu Ala Ala Gln1 5 10 15Ala Leu Glu Phe Ile Asp Asp Thr Val Ala Gln Gln Asn Gly Ile Met 20 25 30Arg Tyr Thr Leu Thr Thr Thr Lys Gly Ala Thr Ser Lys His Leu His 35 40 45Arg Arg Gln Asp Ser Ala Asp Leu Met Ser Gln Gln Thr Gly Tyr Phe 50 55 60Tyr Ser Ile Gln Leu Glu Ile Gly Thr Pro Pro Gln Ala Val Ser Val65 70 75 80Asn Phe Asp Thr Gly Ser Ser Glu Leu Trp Val Asn Pro Val Cys Ser 85 90 95Lys Ala Thr Asp Pro Ala Phe Cys Lys Thr Phe Gly Gln Tyr Asn His 100 105 110Ser Thr Thr Phe Val Asp Ala Lys Ala Pro Gly Gly Ile Lys Tyr Gly 115 120 125Thr Gly Phe Val Asp Phe Asn Tyr Gly Tyr Asp Tyr Val Gln Leu Gly 130 135 140Ser Leu Arg Ile Asn Gln Gln Val Phe Gly Val Ala Thr Asp Ser Glu145 150 155 160Phe Ala Ser Val Gly Ile Leu Gly Ala Gly Pro Asp Leu Ser Gly Trp 165 170 175Thr Ser Pro Tyr Pro Phe Val Ile Asp Asn Leu Val Lys Gln Gly Phe 180 185 190Ile Lys Ser Arg Ala Phe Ser Leu Asp Ile Arg Gly Leu Asp Ser Asp 195 200 205Arg Gly Ser Val Thr Tyr Gly Gly Ile Asp Ile Lys Lys Phe Ser Gly 210 215 220Pro Leu Ala Lys Lys Pro Ile Ile Pro Ala Ala Gln Ser Pro Asp Gly225 230 235 240Tyr Thr Arg Tyr Trp Val His Met Asp Gly Met Ser Ile Thr Lys Glu 245 250 255Asp Gly Ser Lys Phe Glu Ile Phe Asp Lys Pro Asn Gly Gln Pro Val 260 265 270Leu Leu Asp Ser Gly Tyr Thr Val Ser Thr Leu Pro Gly Pro Leu Met 275 280 285Asp Lys Ile Leu Glu Ala Phe Pro Ser Ala Arg Leu Glu Ser Thr Ser 290 295 300Gly Asp Tyr Ile Val Asp Cys Asp Ile Ile Asp Thr Pro Gly Arg Val305 310 315 320Asn Phe Lys Phe Gly Asn Val Val Val Asp Val Glu Tyr Lys Asp Phe 325 330 335Ile Trp Gln Gln Pro Asp Leu Gly Ile Cys Lys Leu Gly Val Ser Gln 340 345 350Asp Asp Asn Phe Pro Val Leu Gly Asp Thr Phe Leu Arg Ala Ala Tyr 355 360 365Val Val Phe Asp Trp Asp Asn Gln Glu Val His Ile Ala Ala Asn Glu 370 375 380Asp Cys Gly Asp Glu Leu Ile Pro Ile Gly Ser Gly Pro Asp Ala Ile385 390 395 400Pro Ala Ser Ala Ile Gly Lys Cys Ser Pro Ser Val Lys Thr Asp Thr 405 410 415Thr Thr Ser Val Ala Glu Thr Thr Ala Thr Ser Ala Ala Ala Ser Thr 420 425 430Ser Glu Leu Ala Ala Thr Thr Ser Glu Ala Ala Thr Thr Ser Ser Glu 435 440 445Ala Ala Thr Thr Ser Ala Ala Ala Glu Thr Thr Ser Val Pro Leu Asn 450 455 460Thr Ala Pro Ala Thr Thr Gly Leu Leu Pro Thr Thr Ser His Arg Phe465 470 475 480Ser Asn Gly Thr Ala Pro Tyr Pro Ile Pro Ser Leu Ser Ser Val Ala 485 490 495Ala Ala Ala Gly Ser Ser Thr Val Pro Ser Glu Ser Ser Thr Gly Ala 500 505 510Ala Ala Ala Gly Thr Thr Ser Ala Ala Thr Gly Ser Gly Ser Gly Ser 515 520 525Gly Ser Gly Asp Ala Thr Thr Ala Ser Ala Thr Tyr Thr Ser Thr Phe 530 535 540Thr Thr Thr Asn Val Tyr Thr Val Thr Ser Cys Pro Pro Ser Val Thr545 550 555 560Asn Cys Pro Val Gly His Val Thr Thr Glu Val Val Val Ala Tyr Thr 565 570 575Thr Trp Cys Pro Val Glu Asn Gly Pro His Pro Thr Ala Pro Pro Lys 580 585 590Pro Ala Ala Pro Glu Ile Thr Ala Thr Phe Thr Leu Pro Asn Thr Tyr 595 600 605Thr Cys Ser Gln Gly Lys Asn Thr Cys Ser Asn Pro Lys Thr Ala Pro 610 615 620Asn Val Ile Val Val Thr Pro Ile Val Thr Gln Thr Ala Pro Val Val625 630 635 640Ile Pro Gly Ile Ala Ala Pro Thr Pro Thr Pro Ser Val Ala Ala Ser 645 650 655Ser Pro Ala Ser Pro Ser Val Val Pro Ser Pro Thr Ala Pro Val Ala 660 665 670Thr Ser Pro Ala Gln Ser Ala Tyr Tyr Pro Pro Pro Pro Pro Pro Glu 675 680 685His Ala Val Ser Thr Pro Val Ala Asn Pro Pro Ala Val Thr Pro Ala 690 695 700Pro Ala Pro Phe Pro Ser Gly Gly Leu Thr Thr Val Ile Ala Pro Gly705 710 715 720Ser Thr Gly Val Pro Ser Gln Pro Ala Gln Ser Gly Leu Pro Pro Val 725 730 735Pro Ala Gly Ala Ala Gly Phe Arg Ala Pro Ala Ala Val Ala Leu Leu 740 745 750Ala Gly Ala Val Ala Ala Ala Leu Leu 755 760136439PRTNeurospora crassa 136Met Val Ala Leu Thr Asn Leu Leu Leu Thr Thr Leu Leu Ala Ser Ala1 5 10 15Gly Leu Gly Ala Ala Leu Pro Pro Arg Ile Gly Ser Thr Val Ile Glu 20 25 30Ala Arg Glu Pro Glu Leu Pro Val Ser Gly Arg Lys Ile Thr Leu Pro 35 40 45Gln Gln Lys Asn Pro Arg Phe His Lys Phe Asn Gly Ala Leu Ser Val 50 55 60Tyr Lys Thr Tyr Leu Lys Tyr Gly Ala Pro Val Pro Asp His Leu Val65 70 75 80Gln Ala Val Ala Asn His Leu Gly Ile Ser Val Glu Glu Val His Asn 85 90 95Tyr Ala Asn Thr Thr Ala Asn Ala Arg Arg Asp Gln Gly Ser Ala Thr 100 105 110Ala Ala Pro Ile Asp Gln Ser Asp Ser Ala Tyr Ile Thr Pro Val Ser 115 120 125Ile Gly Thr Pro Ala Gln Thr Leu Asn Leu Asp Phe Asp Thr Gly Ser 130 135 140Ser Asp Leu Trp Val Phe Ser Asn Ser Leu Pro Ser Ser Gln Arg Ala145 150 155 160Gly His Thr Ile Tyr Asn Pro Ser Lys Ser Ser Thr Ala Lys Arg Val 165 170 175Asn Gly Ala Ser Trp Asp Ile Ser Tyr Gly Asp Gly Ser Ser Ser Lys 180 185 190Gly Gln Val Tyr Leu Asp Lys Val Thr Ile Gly Gly Leu Val Val Ser 195 200 205Asn Gln Ala Val Glu Thr Ala Gln Gln Val Ser Gln Ser Phe Thr Ala 210 215 220Glu Thr Ser Ile Asp Gly Leu Val Gly Leu Ala Phe Gly Ser Leu Asn225 230 235 240Thr Val Arg Pro Arg Gln Gln Lys Thr Trp Phe Glu Asn Ala Ile Gly 245 250 255Gln Leu Asp Gln Pro Leu Phe Ala Ala Asp Leu Lys Tyr Glu Ala Ser 260 265 270Gly Thr Tyr Asp Phe Gly Phe Ile Asp Pro Ala Lys His Thr Gly Asp 275 280 285Ile Thr Tyr Val Pro Val Asn Thr Asn Pro Gly Tyr Trp Thr Trp Thr 290 295 300Ser Thr Gly Tyr Gln Val Gly Ser Ser Pro Phe Val Ser Gln Ser Ile305 310 315 320Thr Asn Ile Ala Asp Thr Gly Thr Thr Leu Met Tyr Val Pro Asp Ser 325 330 335Ile Leu Arg Ala Tyr Tyr Gly Gln Ile Arg Gly Ala Thr Asn Ser Gln 340 345 350Ser Tyr Gly Gly Tyr Val Phe Pro Cys Ser Thr Glu Ala Pro Asp Phe 355 360 365Thr Phe Gly Val Thr Asp Glu Ala Thr Ile Thr Ile Pro Gly Arg Phe 370 375 380Ile Asn Tyr Gly Pro Val Thr Asp Asp Gly Glu Thr Cys Phe Gly Gly385 390 395 400Leu Gln Thr Ser Ser Asp Val Gly Ile Asn Ile Phe Gly Asp Val Ala 405 410 415Leu Lys Ala Ala Tyr Val Val Phe Lys Gly Gly Asp Ser Pro Ser Leu 420 425 430Gly Trp Ala Ser Lys Gln Leu 435137417PRTMyceliophthora thermophila 137Met His Leu Thr Pro Ala Leu Val Ala Ala Thr Cys Ala Val Glu Val1 5 10 15Cys Ala Gly Val Leu Pro Arg Ser Ser Ser Thr Pro Thr Thr Phe Gly 20 25 30Ser Gly Thr Leu Ser Leu Lys Gln Val Arg Asn Pro Asn Phe Val Arg 35 40 45Asn Gly Pro Val Gln Leu Ala Arg Ile Tyr His Lys Tyr Gly Val Pro 50 55 60Leu Pro His Asp Leu Arg Glu Ala Val Ala Arg Phe Arg Ala Glu Ile65 70 75 80Arg Lys Arg Ser Asn Gly Ser Thr Glu Thr Asn Pro Glu Thr Asn Asp 85 90 95Val Glu Tyr Leu Thr Pro Val Ser Ile Gly Thr Pro Pro Gln Val Leu 100 105 110Asn Leu Asp Phe Asp Thr Gly Ser Ser Asp Leu Trp Val Phe Ser Ser 115 120 125Glu Thr Arg Ser Ser Asp Val Gln Gly Gln Thr Ile Tyr Asp Pro Asn 130 135 140Glu Ser Ser Thr Ala Gln Lys Leu Gln Gly Tyr Ser Trp Gln Ile Ser145 150 155 160Tyr Gly Asp Gly Ser Ser Ser Ser Gly Asp Val Tyr Thr Asp Ala Val 165 170 175Thr Val Gly Gly Leu Thr Val Pro Ser Gln Ala Val Glu Val Ala Arg 180 185 190Arg Val Ser Asp Glu Phe Thr Ser Asp Pro Asn Asn Asp Gly Leu Leu 195 200 205Gly Leu Gly Phe Ser Ser Ile Asn Thr Val Gln Pro Val Pro Gln Lys 210 215 220Thr Phe Phe Asp Asn Ala Lys Ala Asp Leu Asp Ala Pro Ile Phe Thr225 230 235 240Ala Asp Leu Lys Ala Ser Ala Pro Gly Phe Phe Asn Phe Gly Tyr Ile 245 250 255Asp His Gly Ala Tyr Thr Gly Glu Ile Thr Tyr Met Pro Val Asp Ser 260 265 270Ser Asp Gly Phe Trp Ala Trp Thr Ser Pro Gly Tyr Ala Val Gly Ser 275 280 285Gly Ser Phe Lys Arg Thr Thr Ile Gln Gly Ile Ala Asp Thr Gly Thr 290 295 300Ser Leu Phe Leu Leu Pro Ser Ser Val Val Ser Ala Tyr Tyr Gly Gln305 310 315 320Ile Ser Gly Ala Lys Tyr Asp Ser Ile Gln Gly Gly Tyr Thr Leu Pro 325 330 335Cys Ser Gly Ser Val Pro Asp Phe Ala Phe Gly Ile Gly Asp Ser Asn 340 345 350Thr Thr Ile Ser Val Pro Gly Asp Tyr Val Arg Tyr Ala Ala Thr Asp 355 360 365Ser Ser Gly Ile Ile Cys Phe Gly Gly Ile Gln Ala Asn Thr Gly Ile 370 375 380Gly Phe Ser Ile Phe Gly Asp Val Ala Leu Lys Ala Ala Phe Val Val385 390 395 400Phe Asp Gly Ala Lys Gln Gln Leu Gly Trp Ala Ser Lys Pro Leu Pro 405 410 415Ser138434PRTNeurospora crassa 138Met Leu Leu Phe Pro Thr Ile Leu Thr Ala Ala Leu Ala Ala Thr Gly1 5 10 15Met Ala Ala Ala Ile Pro Ser Arg Asp Asp Thr Thr Ala Asn Lys Gly 20 25 30Thr Ala Ser Leu Leu Gln Val Arg Asn Pro Ser Phe Glu Phe Arg His 35 40 45Gly Pro Leu Ala Leu Ala Lys Ala Tyr Gln Lys Phe Gly Ala Pro Met 50 55 60Pro Glu Asp Leu Arg Ala Ala Ile Ala Arg Phe Arg Gln Asn Gln Lys65 70 75 80Arg Thr Thr Gly Thr Ile Ala Thr Asp Pro Glu Lys His Asp Val Glu 85 90 95Tyr Leu Thr Pro Ile Ser Val Gly Thr Pro Ser Gln Asp Leu Val Val 100 105 110Asp Phe Asp Thr Gly Ser Ser Asp Leu Trp Val Phe Ser Thr Glu Met 115 120 125Ser Thr Ser Asp Ile Lys Gly Gln Thr Val Tyr Asp Pro Asn Asn Ser 130 135 140Ser Thr Ser Glu Lys Val Gln Gly Ser Thr Trp Lys Ile Thr Tyr Gly145 150 155 160Asp Gly Ser Ser Ser Ser Gly Asp Val Tyr Leu Asp Thr Val Thr Ile 165 170 175Gly Asn Leu Thr Val Pro Ser Gln Ala Val Glu Ala Ala Lys Lys Val 180 185 190Ser Ser Glu Phe Thr Asp Asp Ser His Asn Asp Gly Leu Leu Gly Leu 195 200 205Gly Phe Ser Ala Ile Asn Ala Val Glu Pro Thr Pro Gln Asn Thr Phe 210 215 220Phe Asp Asn Ile Lys Gly Ser Leu Asp Ala Pro Leu Phe Thr Val Asp225 230 235 240Leu Lys His Gly Thr Pro Gly Ser Phe Asn Phe Gly Tyr Ile Asp Pro 245 250 255Ala Ala Tyr Ile Gly Asn Ile Ser Trp Thr Pro Val Asp Ser Ser Gln 260 265 270Gly Tyr Trp Gly Phe Thr Ser Pro Gly Tyr Ala Val Gly Thr Gly Ala 275 280 285Phe Arg Asn His Ser Ile Ser Gly Ile Ala Asp Thr Gly Thr Thr Leu 290 295 300Leu Leu Leu Pro Lys Ser Val Val Ser Ala Tyr Tyr Lys Glu Ile Gln305 310 315 320Gly Ala Gln Tyr Asp Ser Asp Gln Gly Gly Tyr Ile Phe Pro Cys Ser 325 330 335Pro Thr Pro Pro Asp Phe Val Phe Gly Val Asn Lys Gly Ile Val Thr 340 345 350Val Pro Gly Asp Met Val Ser Tyr Ala Pro Ala Asp Ser Ala Asn Gln 355 360 365Asn Cys Phe Gly Gly Ile Gln Thr Asp Thr Gly Ile Gly Phe Ser Ile 370 375 380Phe Gly Asp Val Ala Leu Lys Thr Ser Phe Val His Leu His Gly Ser385 390 395 400Ile Val Pro Gly Tyr Tyr Ala Asp Cys Ala Met Arg Phe Asn Arg Met

405 410 415Leu Arg Ser Tyr Ser Asn Asp Gln Leu Val Asp Phe Ser Ser Ser Gly 420 425 430Pro Leu139466PRTMyceliophthora thermophila 139Met Asp Ala Leu Phe Glu Thr His Ala Lys Leu Arg Lys Arg Met Ala1 5 10 15Leu Tyr Arg Val Arg Ala Val Pro Asn Gln Asn Tyr Gln Arg Asp Gly 20 25 30Thr Lys Ser Tyr Val Ser Val Leu Asn Arg Phe Gly Phe Gln Pro Thr 35 40 45Lys Pro Gly Pro Tyr Phe Gln Ile Phe Glu Glu Ser Glu Glu Ala Pro 50 55 60Ser Met Ser Ala Ala Pro Gly Val Lys Pro Gly His Val Trp Gln Gly65 70 75 80Leu Phe Lys Lys Leu Lys Asp Gln Glu Glu Pro Gly Glu Val Thr Ala 85 90 95Glu Asp Gln Gln Asn Asp Ser Glu Tyr Leu Cys Glu Val Met Ile Gly 100 105 110Thr Ala Trp Thr Ala Glu Arg Gln Ile Val Lys Met Asp Phe Asp Thr 115 120 125Gly Leu Ala Asp Phe Trp Val Ser Gln Lys Ser Phe Asp Pro Lys Lys 130 135 140Ser Val Thr Trp Gln Leu Ala Lys Asp Lys Ser Trp Lys Val Gln Tyr145 150 155 160Gly Asp Gly Ser Ser Ala Ser Gly Ile Val Gly His Asp Ile Leu Ile 165 170 175Ile Gly Gly Ile Gln Ile Lys Arg Gln Ala Ile Glu Ile Ala Thr Glu 180 185 190Met Ser Ala Gln Phe Ser Glu Gly Thr Met Asp Gly Ile Leu Gly Leu 195 200 205Ala Phe Ser Lys Leu Asn Thr Val Gln Thr Asp Gly Lys Pro Asp Pro 210 215 220Gln Arg Thr Val Val Asp Asn Met Met Ala Gln Asp Asp Ile Pro Pro225 230 235 240Glu Ala Glu Leu Phe Ser Thr Ala Leu Tyr Ser Asn Arg Glu Asp Asp 245 250 255Gln Arg Ser Phe Tyr Thr Phe Gly Trp Ile Asp Glu Asp Leu Val Lys 260 265 270Ala Ser Gly Glu Glu Ile Val Trp Thr Asp Val Asp Asn Ser Glu Gly 275 280 285Phe Trp Met Phe Ser Ser Glu His Val Thr Ile Asp Gly Gln Gln Val 290 295 300Arg Ile Glu Gly Asn Lys Ala Ile Ala Asp Thr Gly Thr Ser Leu Val305 310 315 320Leu Val Ser Asp Gln Val Cys Asp Ala Leu Tyr Ala His Ile Pro Ser 325 330 335Ala Glu Tyr Ser Glu Glu Tyr Gln Gly Trp Thr Phe Pro Gln Glu Thr 340 345 350Glu Val Asp Lys Leu Pro Glu Phe Ser Ile Ala Ile Gly Asp Lys Glu 355 360 365Phe Val Leu Gln Lys Glu Asp Leu Ile Phe Ala Pro Ala Asp Glu Arg 370 375 380Val Phe Tyr Gly Ser Val Gln Ser Arg Gly Glu Asn Pro Phe Asp Ile385 390 395 400Leu Gly Ile Ala Phe Leu Lys Ser Ile Tyr Ala Ile Trp Asp Gln Gly 405 410 415His Lys Arg Phe Gly Ala Val Pro Lys Met Glu Ala Phe Val Pro Pro 420 425 430Thr Lys Tyr Asp Arg Pro Arg Leu Thr Asp Gln Asp Arg Lys Asp Leu 435 440 445Gly Val Thr Ile Gly Tyr Gly Asp Ile Ser Ser Thr Phe Phe Glu Lys 450 455 460Arg Ala465140481PRTNeurospora crassa 140Met Gly Ser Met Tyr Gln Val Gln Ser Lys Leu Arg Gln Asp Leu Gly1 5 10 15Leu His Lys Val Gln Ala Val Arg Lys Pro Gly Arg Glu Leu Asn Gly 20 25 30Thr Lys Ala Tyr Val Ser Ala Met Ala Arg Tyr Gly Phe Asn Pro Thr 35 40 45Glu Glu Ser Arg Phe Phe His Leu Lys Lys Thr Asp Leu Thr Lys Glu 50 55 60Phe Gln Arg Arg Gly Tyr Ile Arg His Trp Glu Gln Leu Val Arg Thr65 70 75 80Pro Gln Glu Arg Pro Asp Asp Pro His Thr Asp Asn Glu Pro Val Pro 85 90 95Ala Glu Asp Gln Gln Tyr Asp Thr Gln Tyr Leu Cys Glu Ile Gly Ile 100 105 110Gly Thr Pro Gln Gln Lys Val Lys Leu Asp Phe Asp Thr Gly Ser Ala 115 120 125Asp Leu Trp Val Arg Cys Thr Asp Ser Ser Leu Leu His His Ala Asp 130 135 140Lys Lys Phe Asp Pro Lys Lys Ser Asp Thr Phe Gln Glu Ser Lys Thr145 150 155 160Asp Gln Thr Trp Lys Ile Gln Tyr Gly Asp Gly Ser Thr Ala Ser Gly 165 170 175Thr Val Gly Thr Asp Val Ile Thr Val Gly Gly Leu Gln Ile Lys Asn 180 185 190Gln Ala Ile Glu Leu Ala Lys Lys Val Ser Ser Ala Phe Ser Ser Gly 195 200 205Glu Ala Asp Gly Leu Leu Gly Leu Ala Phe Ser Thr Ile Asn Thr Ile 210 215 220Glu Ser Asp Gly Lys Pro Asp Pro Gln Pro Thr Pro Val Glu Asn Met225 230 235 240Ile Ser Gln Glu Asp Ile Pro Lys Glu Ala Glu Leu Phe Thr Ser Ala 245 250 255Phe Tyr Ser Ala Arg Asp Asp Lys Ser Glu Glu Lys Ser Phe Tyr Thr 260 265 270Phe Gly Trp Val Asp Glu Asp Leu Val Lys Ala Ser Gly Lys Asp Ile 275 280 285Thr Trp Thr Pro Ile Asp Asn Ser Glu Gly Phe Trp Lys Phe Pro Ser 290 295 300Glu Ser Ala Thr Val Asp Gly Asp Asn Val Ser Val Ser Gly Asn Thr305 310 315 320Ala Ile Ala Asp Thr Gly Thr Thr Leu Ala Leu Val Ser Asp Thr Val 325 330 335Cys Lys Ala Leu Tyr Ala Lys Ile Pro Gly Ser Lys Tyr Ser Tyr Arg 340 345 350Tyr Gln Gly Tyr Leu Ile Pro Ser Thr Ile Thr Ala Asp Gln Leu Pro 355 360 365Gln Leu Ser Val Ala Val Gly Gly Glu Gln Phe Val Ile Gln Asn Glu 370 375 380Asp Leu Leu Leu Ala Pro Ala Asp Asp Asp His Trp Tyr Gly Gly Val385 390 395 400Gln Ser Arg Gly Thr Met Pro Phe Asp Ile Leu Gly Asp Thr Phe Leu 405 410 415Lys Ser Ile Tyr Ala Ile Trp Asp Gln Gly Asn Asn Arg Phe Gly Ala 420 425 430Val Pro Lys Ile Glu Val Asn Gln His Thr Val Phe Pro Asp Thr Glu 435 440 445Pro Ser Pro Glu Ala Ser Ser Pro Glu Pro Ala Asp Lys Val Gly Asp 450 455 460Val Ser Pro Val Glu Gln Val Lys Gly Ala Val Lys Ser Leu Lys Val465 470 475 480Leu141397PRTMyceliophthora thermophila 141Met Lys Asp Ala Phe Leu Leu Thr Ala Ala Val Leu Leu Gly Ser Ala1 5 10 15Gln Gly Ala Val His Lys Met Lys Leu Gln Lys Ile Pro Leu Ser Glu 20 25 30Gln Leu Glu Ala Val Pro Ile Asn Thr Gln Leu Glu His Leu Gly Gln 35 40 45Lys Tyr Met Gly Leu Arg Pro Arg Glu Ser Gln Ala Asp Ala Ile Phe 50 55 60Lys Gly Met Val Ala Asp Val Lys Gly Asn His Pro Ile Pro Ile Ser65 70 75 80Asn Phe Met Asn Ala Gln Tyr Phe Ser Glu Ile Thr Ile Gly Thr Pro 85 90 95Pro Gln Ser Phe Lys Val Val Leu Asp Thr Gly Ser Ser Asn Leu Trp 100 105 110Val Pro Ser Val Glu Cys Gly Ser Ile Ala Cys Tyr Leu His Ser Lys 115 120 125Tyr Asp Ser Ser Ala Ser Ser Thr Tyr Lys Lys Asn Gly Thr Ser Phe 130 135 140Glu Ile Arg Tyr Gly Ser Gly Ser Leu Ser Gly Phe Val Ser Gln Asp145 150 155 160Thr Val Ser Ile Gly Asp Ile Thr Ile Gln Gly Gln Asp Phe Ala Glu 165 170 175Ala Thr Ser Glu Pro Gly Leu Ala Phe Ala Phe Gly Arg Phe Asp Gly 180 185 190Ile Leu Gly Leu Gly Tyr Asp Arg Ile Ser Val Asn Gly Ile Val Pro 195 200 205Pro Phe Tyr Lys Met Val Glu Gln Lys Leu Ile Asp Glu Pro Val Phe 210 215 220Ala Phe Tyr Leu Ala Asp Thr Asn Gly Gln Ser Glu Val Val Phe Gly225 230 235 240Gly Val Asp His Asp Lys Tyr Lys Gly Lys Ile Thr Thr Ile Pro Leu 245 250 255Arg Arg Lys Ala Tyr Trp Glu Val Asp Phe Asp Ala Ile Ser Tyr Gly 260 265 270Asp Asp Thr Ala Glu Leu Glu Asn Thr Gly Ile Ile Leu Asp Thr Gly 275 280 285Thr Ser Leu Ile Ala Leu Pro Ser Gln Leu Ala Glu Met Leu Asn Ala 290 295 300Gln Ile Gly Ala Lys Lys Ser Tyr Thr Gly Gln Tyr Thr Ile Asp Cys305 310 315 320Asn Lys Arg Asp Ser Leu Lys Asp Val Thr Phe Asn Leu Ala Gly Tyr 325 330 335Asn Phe Thr Leu Gly Pro Tyr Asp Tyr Val Leu Glu Val Gln Gly Ser 340 345 350Cys Ile Ser Thr Phe Met Gly Met Asp Phe Pro Ala Pro Thr Gly Pro 355 360 365Leu Ala Ile Leu Gly Asp Ala Phe Leu Arg Arg Tyr Tyr Ser Ile Tyr 370 375 380Asp Leu Gly Ala Asp Thr Val Gly Leu Ala Glu Ala Lys385 390 395142396PRTNeurospora crassa 142Met Lys Gly Ala Leu Leu Thr Ala Ala Met Leu Leu Gly Ser Ala Gln1 5 10 15Ala Gly Val His Thr Met Lys Leu Lys Lys Val Pro Leu Ala Glu Gln 20 25 30Leu Glu Ser Val Pro Ile Asp Val Gln Val Gln His Leu Gly Gln Lys 35 40 45Tyr Thr Gly Leu Arg Thr Glu Ser His Thr Gln Ala Met Phe Lys Ala 50 55 60Thr Asp Ala Gln Val Ser Gly Asn His Pro Val Pro Ile Thr Asn Phe65 70 75 80Met Asn Ala Gln Tyr Phe Ser Glu Ile Thr Ile Gly Thr Pro Pro Gln 85 90 95Thr Phe Lys Val Val Leu Asp Thr Gly Ser Ser Asn Leu Trp Val Pro 100 105 110Ser Ser Gln Cys Gly Ser Ile Ala Cys Tyr Leu His Asn Lys Tyr Glu 115 120 125Ser Ser Glu Ser Ser Thr Tyr Lys Lys Asn Gly Thr Ser Phe Lys Ile 130 135 140Glu Tyr Gly Ser Gly Ser Leu Ser Gly Phe Val Ser Gln Asp Arg Met145 150 155 160Thr Ile Gly Asp Ile Thr Ile Asn Asp Gln Leu Phe Ala Glu Ala Thr 165 170 175Ser Glu Pro Gly Leu Ala Phe Ala Phe Gly Arg Phe Asp Gly Ile Leu 180 185 190Gly Leu Gly Tyr Asp Arg Ile Ala Val Asn Gly Ile Thr Pro Pro Phe 195 200 205Tyr Lys Met Val Glu Gln Lys Leu Val Asp Glu Pro Val Phe Ser Phe 210 215 220Tyr Leu Ala Asp Gln Asp Gly Glu Ser Glu Val Val Phe Gly Gly Val225 230 235 240Asn Lys Asp Arg Tyr Thr Gly Lys Ile Thr Thr Ile Pro Leu Arg Arg 245 250 255Lys Ala Tyr Trp Glu Val Asp Phe Asp Ala Ile Gly Tyr Gly Lys Asp 260 265 270Phe Ala Glu Leu Glu Gly His Gly Val Ile Leu Asp Thr Gly Thr Ser 275 280 285Leu Ile Ala Leu Pro Ser Gln Leu Ala Glu Met Leu Asn Ala Gln Ile 290 295 300Gly Ala Lys Lys Ser Trp Asn Gly Gln Phe Thr Ile Asp Cys Gly Lys305 310 315 320Lys Ser Ser Leu Glu Asp Val Thr Phe Thr Leu Ala Gly Tyr Asn Phe 325 330 335Thr Leu Gly Pro Glu Asp Tyr Ile Leu Glu Ala Ser Gly Ser Cys Leu 340 345 350Ser Thr Phe Met Gly Met Asp Met Pro Ala Pro Val Gly Pro Leu Ala 355 360 365Ile Leu Gly Asp Ala Phe Leu Arg Lys Tyr Tyr Ser Ile Tyr Asp Leu 370 375 380Gly Ala Asp Thr Val Gly Ile Ala Thr Ala Lys Arg385 390 395143454PRTMyceliophthora thermophila 143Met Lys Phe Ala Ala Leu Ala Leu Ala Ala Ser Leu Val Ala Ala Ala1 5 10 15Pro Arg Val Val Lys Val Asp Pro Ser Asp Ile Lys Pro Arg Arg Leu 20 25 30Gly Gly Thr Lys Phe Lys Leu Gly Gln Ile His Asn Asp Leu Phe Arg 35 40 45Gln His Gly Arg Gly Pro Arg Ala Leu Ala Lys Ala Tyr Glu Lys Tyr 50 55 60Asn Ile Glu Leu Pro Pro Asn Leu Leu Glu Val Val Gln Arg Ile Leu65 70 75 80Lys Asp Leu Gly Ile Glu Pro His Ser Lys Lys Ile Pro Gly Ser Lys 85 90 95Ser Ser Tyr Gly Asn Gly Ala Pro Tyr Thr Asn Glu Thr Asp Asp Ser 100 105 110Gly Glu Val Ser Ala Ile Pro Gln Leu Phe Asp Val Glu Tyr Leu Ala 115 120 125Pro Val Gln Ile Gly Thr Pro Pro Gln Thr Leu Met Leu Asn Phe Asp 130 135 140Thr Gly Ser Ser Asp Leu Trp Val Phe Ser Ser Glu Thr Pro Ser Arg145 150 155 160Gln Gln Asn Gly Gln Lys Ile Tyr Lys Ile Glu Glu Ser Ser Thr Ala 165 170 175Arg Arg Leu Ser Asn His Thr Trp Ser Ile Gln Tyr Gly Asp Gly Ser 180 185 190Arg Ser Ala Gly Asn Val Tyr Leu Asp Thr Val Ser Val Gly Gly Val 195 200 205Asn Val Phe Asn Gln Ala Val Glu Ser Ala Thr Phe Val Ser Ser Ser 210 215 220Phe Val Thr Asp Ala Ala Ser Ser Gly Leu Leu Gly Leu Gly Phe Asp225 230 235 240Ser Ile Asn Thr Val Lys Pro Thr Lys Gln Lys Thr Phe Ile Ser Asn 245 250 255Ala Leu Glu Ser Leu Glu Met Gly Leu Phe Thr Ala Asn Leu Lys Lys 260 265 270Ala Glu Pro Gly Asn Tyr Asn Phe Gly Phe Ile Asp Glu Thr Glu Phe 275 280 285Val Gly Pro Leu Ser Phe Ile Asp Val Asp Ser Thr Asp Gly Phe Trp 290 295 300Gln Phe Asp Ala Thr Gly Tyr Ser Ile Gln Leu Pro Glu Pro Ser Gly305 310 315 320Asn Ile Thr Gly Thr Pro Phe Arg Ala Val Ala His Thr Ala Ile Ala 325 330 335Asp Thr Gly Thr Thr Leu Leu Leu Leu Pro Pro Gly Ile Ala Gln Ala 340 345 350Tyr Tyr Trp Gln Val Gln Gly Ala Arg Gln Ala Pro Glu Val Gly Gly 355 360 365Trp Val Met Pro Cys Asn Ala Ser Met Pro Asp Leu Thr Leu His Ile 370 375 380Gly Thr Tyr Lys Ala Val Ile Pro Gly Glu Leu Ile Pro Tyr Ala Pro385 390 395 400Val Asp Thr Asp Asp Met Asp Thr Ala Thr Val Cys Tyr Gly Gly Ile 405 410 415Gln Ser Ala Ser Gly Met Pro Phe Ala Ile Tyr Gly Asp Ile Phe Phe 420 425 430Lys Ala Gln Phe Thr Val Phe Asp Val Glu Asn Leu Lys Leu Gly Phe 435 440 445Ala Pro Lys Pro Glu Leu 450144489PRTMyceliophthora thermophila 144Met Ala Ile Pro Val Leu Phe Ser Ala Leu Val Leu Leu Val Ala Leu1 5 10 15Leu Cys Cys His Ala Thr Ala Ala Leu Gln Gln Leu Ala His Asp Val 20 25 30Gly Cys Val His Leu Pro Val Val His Ser Thr Lys Val Asp Arg Phe 35 40 45Ser Asp Lys Arg Gly Ile Gln Leu Gln Leu Ala Asn Arg Ser Asp Val 50 55 60Ala Tyr Tyr Ala Gln Leu Ser Ile Gly Thr Pro Pro Gln Pro Val Phe65 70 75 80Val Gln Leu Asp Thr Gly Ser Phe Glu Leu Trp Val Asn Pro Asp Cys 85 90 95Thr Thr Val Ser Gly Ser Asp Ala Val Phe Cys Glu Arg Ala Gly Arg 100 105 110Tyr Asp Val Thr Lys Ser Ser Thr Ala Thr Ser Leu Gly Thr Asn Arg 115 120 125Thr Leu Arg Tyr Gly Ile Gly Ala Ala Asn Ile Ser Tyr Phe Thr Asp 130 135 140Thr Ile Ser Leu Ala Gly Ser Pro Met Met Leu Gln Asp Val Gln Phe145 150 155 160Gly Val Ala Thr Ala Ser Glu Asp Ala Phe Ser Gly Ile Leu Gly Ile 165 170 175Gly Tyr Gly Lys Gly Ile Gly Thr Gly Tyr Pro Asn Phe Val Asp Gln 180 185 190Leu Trp Glu Gln Asn Val Thr Arg Val Lys Ala Tyr Thr Leu Ala Leu 195 200 205Gly Ser Lys Asp Ser Gln Glu Gly Val Ile Val Phe Gly Gly Val Asp 210 215 220Thr Ser Lys Phe Ala Gly Lys Leu Ala Arg Leu Pro Val Ile Pro Pro225 230 235

240Ala Gln Ser Pro Asp Gly Val Pro Arg Phe Trp Val Glu Met Lys Ser 245 250 255Leu Ser Ile Thr Arg Pro Ser Gly Leu Asn Thr Val Tyr Asp Gly Gly 260 265 270Ala Met Pro Val Phe Leu Asp Ser Gly Ser Thr Met Thr Leu Leu Pro 275 280 285Ala Asn Leu Thr Met Ala Val Ala Arg Asp Phe Gly Ala Gln Ala Pro 290 295 300Asp Ala Asn Gly Phe Tyr Lys Ile Asp Cys Ala Leu Thr Ala Leu Asn305 310 315 320Gly Thr Leu Asp Phe Ala Phe Asp Gly Val Thr Val Arg Val Pro Tyr 325 330 335Lys Glu Leu Thr Arg Glu Val Ala Ser Asn Pro Pro Ser Cys Phe Leu 340 345 350Gly Ile Val Ala Ser Asp Arg Phe Thr Leu Leu Gly Asp Thr Phe Leu 355 360 365Arg Ser Ala Tyr Thr Val Phe Asp Leu Glu Thr Asp Ser Ile Trp Met 370 375 380Ala Pro Ala Val Asn Cys Gly Ser Ser Pro Ala Ala Leu Ser Asn Val385 390 395 400Gln Asp Leu Ser Ala Val Thr Gly Glu Cys Gly Val Arg Glu Ile Ala 405 410 415Glu Ser Thr Ser Ser Thr Gln Val Pro Ser Thr Gly Val Asp Asp Thr 420 425 430Glu Ala Gly Ala Val Pro Thr Ser Thr Thr Thr Val Val Ser Gln Pro 435 440 445Ser Gly Thr Thr Thr Gln Met Gly Ala Arg Pro Thr Leu Asp Asn Ala 450 455 460Ser Asn Pro Leu Gly Ala His Arg Leu Thr Trp Val Leu Val Ile Thr465 470 475 480Ala Ala Leu His Leu Phe Thr Gly Ile 485145518PRTNeurospora crassa 145Met Ala Ala Phe Pro Phe Leu Ser Ala Ser Phe Val Leu Leu Gln Leu1 5 10 15Ala Leu Thr Cys Leu Ala Gln His Leu Asn Leu Thr Thr Gly Pro Leu 20 25 30His Leu Thr Gly His Thr Pro Gly Asp Gly Cys Val His Leu Pro Ile 35 40 45Ile His Ser Thr Asn Thr Asp His Phe Ala Arg Arg Gly Ile Gln Leu 50 55 60Ala Leu Asn Asn Arg Ser Asp Val Ala Tyr Tyr Ala Gln Leu Glu Ile65 70 75 80Gly Thr Pro Pro Gln Thr Val Tyr Thr Gln Leu Asp Thr Gly Ser Phe 85 90 95Glu Leu Trp Val Asn Pro Asp Cys Thr Thr Val Ser Pro Ser Asp Ser 100 105 110Ser Phe Cys Asp His Ile Gly Phe Tyr Asn Ala Ser Leu Ser Ser Thr 115 120 125Ser Lys Ser Leu Gly Thr Ser Lys Thr Leu Arg Tyr Gly Ile Gly Ala 130 135 140Ala Asn Ile Ser Tyr Val Thr Asp Thr Ile Ser Leu Ser Gly Ser Ser145 150 155 160Thr Ser Leu Lys Asp Ile Gln Phe Gly Val Ala Thr Ser Ser Lys Asp 165 170 175Ala Phe Ser Gly Ile Leu Gly Ile Gly Tyr Gly Gln Gly Leu Ala Thr 180 185 190Lys Tyr Pro Asn Phe Ile Asp Gln Leu Tyr Ala Gln Lys Ile Thr Lys 195 200 205Val Lys Ala Tyr Thr Leu Ala Leu Gly Ser Lys Thr Ala Gln Gln Gly 210 215 220Ser Ile Val Phe Gly Gly Val Asp Thr Ser Lys Phe Ala Gly Pro Leu225 230 235 240Gly Arg Leu Pro Ile Ile Pro Ala Glu Asp Ser Pro Asp Gly Val Pro 245 250 255Arg Phe Trp Val Gln Met Asn Gly Ile Ser Leu Thr Pro Pro Ser Gly 260 265 270Gln Ser Met Gly Val Tyr Glu Gly Ser Lys Ile Pro Ala Phe Leu Asp 275 280 285Ser Gly Ser Thr Met Thr Ile Leu Pro Pro Ala Leu Ala Asn Lys Ile 290 295 300Ala Glu Asp Phe Gly Ser Pro Glu Met Asp Ala Asn Gly Phe Tyr Arg305 310 315 320Val Gly Cys Gly Tyr Val Glu Met Asn Gly Thr Met Asp Phe Glu Phe 325 330 335Val Gly Ala Gly Gln Lys Val Thr Val Arg Val Pro Tyr Lys Glu Met 340 345 350Ile Arg Glu Val Gly Gln Gly Glu Ser Lys Met Cys Phe Leu Gly Ile 355 360 365Met Gly Ser Glu Ser Phe Thr Leu Leu Gly Asp Thr Phe Leu Arg Ser 370 375 380Ala Tyr Ala Thr Ser Cys Gly Asn Thr Pro Ala Ala Leu Arg Asp Val385 390 395 400Thr Asp Leu Ser Arg Val Val Gly Asn Cys Gln Ile Gln Leu Gly Glu 405 410 415Lys Glu Ala Val Val Asp Val Val Ser Glu Thr Ser Ile Ala Pro Pro 420 425 430Thr Gly Ser Thr Gly Asp Thr Asp Gly Val Thr Gly Thr Gly Gly Asn 435 440 445Gly Ser Gly Asn Gly Gly Thr Arg Thr Ala Trp Gly Phe Val Thr Thr 450 455 460Thr Leu Ala Val Pro Met Ala Thr Gly Leu Ala Gly Val Gly Gly Ser465 470 475 480Gly Ser Gly Ser Met Ser Ala Thr Ala Leu Asp Ser Ser Gly Arg Ser 485 490 495Met Ala Gly Asp Val Val Leu Ser Ala Ala Val Ala Val Gly Ala Ala 500 505 510Val Leu Gly Ser Leu Leu 515146501PRTMyceliophthora thermophila 146Met Arg Gly Tyr Ala Ala Val Ala Phe Gly Ala Ile Leu Ala Gly Ala1 5 10 15Val His Ala Ser Ala Gly Asn Gly Val Val Gln Trp Asp Ile Arg Arg 20 25 30Thr Gln Arg Gln Glu Glu Leu Gln Arg Leu Asn Arg Arg Leu Arg Lys 35 40 45Arg Ala Asn Pro Val Leu Glu Val Ile Thr Asn Glu Lys Ile Arg Gly 50 55 60Gly Tyr Phe Ala Thr Cys Lys Ile Gly Thr Pro Gly Gln Asp Leu Thr65 70 75 80Leu Gln Leu Asp Thr Gly Ser Ser Asp Ile Trp Val Pro Asp Ser Ala 85 90 95Ala Gln Val Cys Arg Glu Ile Gly Thr Glu Gly Cys Ala Leu Gly Thr 100 105 110Phe Asn Pro Asn Arg Ser Ser Ser Phe Glu Val Ile Gly Glu Gly Gln 115 120 125Phe Asp Ile Glu Tyr Val Asp Gly Ser Ser Ser Lys Gly Asp Tyr Phe 130 135 140Thr Asp Val Phe Gln Ile Gly Asp Ile Ser Val Gln Asn Met Thr Met145 150 155 160Gly Leu Gly Leu His Thr Asp Ile Ala Tyr Gly Leu Val Gly Val Gly 165 170 175Tyr Ala Ile Asn Glu Ala Ile Val Ala Thr Thr Gln Ser Arg Asp Ser 180 185 190Val Tyr Pro Asn Leu Pro Val Gln Met Val Asp Gln Gly Leu Ile Asn 195 200 205Thr Val Ala Tyr Ser Leu Trp Leu Asn Asp Leu Asp Ala Ser Ser Gly 210 215 220Ser Ile Leu Phe Gly Gly Ile Asp Thr Glu Lys Tyr Gln Gly Glu Leu225 230 235 240Thr Arg Ile Asp Ile Tyr Pro Thr Ser Gln Gly Asp Phe Ser Ser Phe 245 250 255Val Val Ala Leu Thr Ser Leu Glu Ala Arg Ser Pro Ser Gly Gln Asp 260 265 270Thr Leu Thr Ser Gln Glu Phe Pro Ile Pro Val Val Leu Asp Ser Gly 275 280 285Thr Thr Leu Ser Tyr Leu Pro Thr Asp Leu Ala Thr Gln Ala Trp Lys 290 295 300Glu Val Gly Ala Phe Tyr Leu Pro Glu Val Gly Ala Ala Val Leu Pro305 310 315 320Cys Asp Met Glu Asn Ser Lys Gly Ser Phe Ser Phe Gly Phe Ala Gly 325 330 335Pro Asp Gly Pro Arg Ile Thr Val Gly Met Asp Glu Leu Val Leu Asp 340 345 350Met Thr Asp Gly Gln Ala Pro Gln Phe Leu Ser Gly Pro Tyr Lys Gly 355 360 365Arg Asp Val Cys Gln Phe Gly Ile Gln Asn Phe Thr Ser Ala Pro Phe 370 375 380Leu Leu Gly Asp Thr Phe Leu Arg Ser Ala Tyr Val Val Tyr Asp Leu385 390 395 400Val Asn Asn Gln Ile Gly Ile Ala Ala Thr Asp Phe Asn Ser Thr Asp 405 410 415Ser Asn Ile Val Pro Phe Pro Ser Met Gly Ala Pro Ile Pro Ser Ala 420 425 430Thr Val Ala Ala Asn Gln Arg Glu Val Thr Arg Val Pro Thr Val Thr 435 440 445Glu Pro Ala Tyr Ser Ala Ser Gln Gly Phe Met Glu Ser Ala Ser Gly 450 455 460Glu Glu Ser Leu Ala Pro Gly Met Pro Ala Ala Trp Gly Met Gly Gln465 470 475 480Leu Leu Val Val Gly Val Thr Met Ala Leu Thr Ala Leu Gly Ser Gly 485 490 495Leu Phe Phe Val Leu 500147492PRTNeurospora crassa 147Met Lys Gly Tyr Thr Ser Ser Ala Leu Leu Leu Gly Pro Ala Leu Leu1 5 10 15Ser Gln Leu Ala Leu Ala Gln Gln Ala Pro Asn Gly Val Val His Trp 20 25 30Gly Ile Gln Lys Arg His Ala Pro Asn Ala Pro Asn Arg Leu Leu Arg 35 40 45Arg Ala Gly Pro Thr His Gln Ala Ile Leu Gln Asn Glu Gln Ala Arg 50 55 60Gly Gly Tyr Phe Ala Thr Cys Ala Met Gly Thr Pro Gly Gln Lys Val65 70 75 80Thr Leu Gln Leu Asp Thr Gly Ser Ser Asp Val Trp Val Pro Asp Ser 85 90 95Thr Ala Ser Ile Cys Asn Lys Gly Ala Cys Asp Leu Gly Ser Trp Gln 100 105 110Gly Glu Phe Asp Ile Ser Tyr Val Asp Gly Ser Ser Ser Lys Gly Asp 115 120 125Tyr Phe Thr Asp Val Phe Asn Ile Gly Gly Thr Thr Val Thr Asn Leu 130 135 140Thr Met Gly Leu Gly Ala Gln Thr Asp Ile Ala Tyr Gly Leu Val Gly145 150 155 160Ile Gly Tyr Ala Ile Asn Glu Ala Ile Val Gly Asn Ser His Ser Leu 165 170 175Ser Ser Gln Tyr Pro Asn Leu Pro Val Ala Met Val Asp Asp Gly Leu 180 185 190Ile Asn Thr Ile Ala Tyr Ser Leu Trp Leu Asn Asp Leu Asp Ala Gly 195 200 205Glu Gly Ser Ile Leu Phe Gly Gly Ile Asp Thr Lys Lys Tyr Lys Gly 210 215 220Asp Leu Thr Arg Ile Arg Ile Tyr Pro Ser Ser Asn Gly Tyr Tyr Phe225 230 235 240Ser Phe Ile Val Ala Leu Thr Ser Leu Gln Ala Ile Ser Pro Ser Gly 245 250 255Asn Asp Thr Leu Thr Ser Gln Glu Phe Pro Ile Pro Val Val Leu Asp 260 265 270Ser Gly Thr Thr Leu Ser Tyr Leu Pro Gln Asp Ile Val Asp Gln Ile 275 280 285Trp Gln Glu Val Gly Ala Glu Tyr Ser Asp Arg Leu Glu Leu Ala Val 290 295 300Ile Pro Cys Ser Lys Lys Ser Ser Asn Gly Tyr Phe Ser Phe Gly Phe305 310 315 320Ala Gly Pro Asp Gly Pro Arg Ile Thr Val Arg Met Asp Glu Leu Val 325 330 335Leu Asp Leu Thr Ser Gly Asp Pro Pro Lys Tyr Thr Ser Gly Pro Asn 340 345 350Lys Gly Gln Asp Val Cys Glu Phe Gly Ile Gln Asn Ser Thr Ser Ala 355 360 365Pro Tyr Leu Leu Gly Asp Thr Phe Leu Arg Ser Ala Tyr Val Val Tyr 370 375 380Asp Leu Val Asn Asn Glu Ile Gly Leu Ala Glu Thr Asp Phe Asn Ser385 390 395 400Thr Glu Ser Asn Ile Val Ala Phe Ala Ser Met Ser Ala Thr Ile Pro 405 410 415Ser Ala Thr Gln Ala Pro Asn Gln Ala Ala Val Thr Asn Arg Pro Val 420 425 430Ala Thr Met Pro Ser Phe Ala Ala Ser Ser Gly Phe Ser Asp Thr Gly 435 440 445Gly Ser Gly Asn Asp Gly Lys Asp Glu Asn Ala Ser Ala Gly Met Pro 450 455 460Ser Ala Phe Gly Val Ala Gln Met Ser Val Met Gly Ile Ala Met Val465 470 475 480Phe Ala Met Val Gly Ser Gly Val Phe Val Leu Leu 485 490148668PRTMyceliophthora thermophila 148Met Ser Phe Ala Leu Tyr Ala Ala Ala Leu Leu Pro Val Ala Val Leu1 5 10 15Gly Ala Gly Leu Ser Val Pro Glu Asp Asn Arg Met Val Gln Gln Asp 20 25 30Gly Leu Leu Arg Tyr Pro Leu Met Pro Arg Leu Gly Asn Leu Leu Phe 35 40 45Gly Lys His Ala Asn Ile Thr Arg Arg Gln Ile Asp Thr Gly Ile Phe 50 55 60Asp Pro Leu Ser Gly Thr Leu Tyr Thr Ile Glu Leu Thr Leu Gly Thr65 70 75 80Pro Gly Gln Thr Val Pro Val Gln Phe Asp Thr Gly Ser Asp Met Leu 85 90 95Trp Val Asn Pro Val Cys Ser Lys Ala Ala Glu Pro Glu Phe Cys Ala 100 105 110Ala Gln Pro Arg Phe Thr Asp Ser Ser Thr Leu Val Asp Phe Gly Glu 115 120 125Gln Gly Asn Ile Thr Tyr Gly Thr Gly Tyr Ala Tyr Tyr Glu Tyr Val 130 135 140Ala Asp Tyr Val Ala Ile Gly Ser Ala Arg Ile Thr Gln Gln Val Phe145 150 155 160Gly Val Ala Leu Asp Ser Ala His Ala Asp Val Gly Ile Phe Gly Ala 165 170 175Gly Pro Asn Leu Asp Gly Trp Asp Ser Ala Tyr Pro Leu Val Val Asp 180 185 190Ser Leu Ala Gln Gln Gly Tyr Thr Ser Ser Arg Ala Phe Ser Met Asp 195 200 205Leu Lys Gly Phe Glu Ser Ala Arg Gly Ser Val Ile Phe Gly Gly Ile 210 215 220Asp Thr Lys Lys Tyr Arg Gly Ser Leu Ile Lys Arg Leu Ile Ile Pro225 230 235 240Ala Ala Glu Ser Pro Asp Gly Tyr Thr Arg Phe Trp Ile Tyr Leu Asp 245 250 255Gly Ile Ser Val Asn Gln Pro Asp Gly Asp Val Val Thr Val Phe Ser 260 265 270Thr Pro Asp Gly Gly Lys Gly Gln Pro Val Leu Leu Asp Ser Gly Tyr 275 280 285Thr Leu Ser Ala Leu Pro Arg Pro Ile Phe Gln Lys Leu Val Ala Ala 290 295 300Phe Pro Ser Ala Gln Tyr Val Ser Ser Ala Asp Val Tyr Val Val Asp305 310 315 320Cys Val Asp His Gly Glu Gly Gly Ser Leu Asp Phe Ile Phe Gly Gly 325 330 335Lys Thr Ile Asn Val Pro Tyr His Glu Phe Val Trp Ala Gln Pro Glu 340 345 350Ser Asn Thr Cys Val Leu Gly Ala Phe Glu Asp Asp Phe Pro Val Leu 355 360 365Gly Asp Thr Phe Leu Arg Ser Ala Tyr Val Val Tyr Asp Trp Asp Asn 370 375 380Arg Asn Ile Tyr Leu Ala Gln Ser Asp Asp Cys Gly Ser Asn Leu Val385 390 395 400Ala Ile Gly Ser Gly Pro Asp Ala Val Pro Ser Ile Val Gly Glu Cys 405 410 415Gly Lys Pro Lys Pro Thr Ser Thr Ser Thr Phe Ser Lys Thr Ser Ser 420 425 430Lys Thr Ser Thr Ala Ser Lys Thr Ser Ser Thr Ser Asp Ser Thr Ser 435 440 445Ser Ser Ser Ser His Val Thr Thr Ser Ser Ser Ser Thr Thr Ala Thr 450 455 460Thr Leu Ser Thr His Lys Pro Pro Phe Pro Thr Ala Ser Gly Asn Phe465 470 475 480Thr Thr Thr Arg Ser Pro Thr Thr Thr Thr Ala Ser Ser Thr Ile Ser 485 490 495Lys Ser Thr Leu Thr Ile Thr Ser Ala Thr Thr Tyr Thr Ile Thr Ser 500 505 510Cys Pro Pro Thr Val Thr Arg Cys Pro Ala His Glu Val Thr Thr Glu 515 520 525Ile Ile Thr Lys Thr Thr Ala Val Cys Pro Glu Thr Thr Ala Thr Tyr 530 535 540Thr Ile Pro Arg Thr Ile Thr Cys Pro Gly Ser Gly Gly Gly Asp Asp545 550 555 560Cys Pro Pro Gly Ala Thr Arg Thr Thr Thr Leu Thr Val Thr Leu Ser 565 570 575Pro Val Gly Pro Thr Asp Arg Thr Thr His Val Val Pro Gly Val Thr 580 585 590Thr Thr Thr Pro Thr Thr Ile Thr Ala Pro Pro Thr Gly Gln Thr Thr 595 600 605Thr Thr Leu Val Pro Ala Leu Pro Pro Thr Thr Thr Thr Met Ser Gly 610 615 620His Arg Gly Ile Asn Gly Thr Val Thr Ala Thr Ser Lys Pro Pro Ala625 630 635 640Val Thr Ala Gly Ser Ala Lys Val Gly Leu Val Ser Gly Ala Thr Ala 645 650 655Ile Val Ala Gly Val Met Ala Val Leu Met Ala Leu 660 665149551PRTNeurospora crassa 149Met Leu Pro Val Pro Leu Thr Thr Leu Ser Leu Tyr Val Val Ala Leu1 5 10 15Leu Ser Pro Pro Ala Ala Ala Gly Val Leu Ala Ser Ala Thr Thr Lys 20

25 30Leu Pro Ile Lys Leu Pro Ile Ser Pro Ala Gln Gly His Arg Ser Ser 35 40 45Thr Ala Ala Ser Pro Ser Leu Thr Ser Arg Ser Ser Ser Ser Gly Asn 50 55 60Gly Phe Ile Arg Ala Ser Val His Ala Ala His Gly Ala Pro Pro Lys65 70 75 80Leu Arg Arg Arg Gln Glu Asp Glu Gly Leu Lys Asn Gln Asn Leu Gly 85 90 95Thr Thr Tyr Thr Ile Asp Ile Asp Ile Gly Thr Pro Pro Gln Thr Val 100 105 110Thr Leu Ile Leu Asp Thr Gly Ser Pro Asp Leu Trp Val Asn Pro Gln 115 120 125Cys Glu Thr Ser Gly Gln Glu Lys Tyr Cys Asn Ser Phe Arg Gln Phe 130 135 140Asp Tyr Thr Lys Ser Lys Thr Ile Gln Asp Thr Gly Ala Ala Asp Ile145 150 155 160Leu Lys Tyr Gly Lys Gly Asn Val Thr Ile Glu Tyr Val Thr Asp Asp 165 170 175Val Ile Ile Gly Ser Ala Lys Ile Lys Ser Gln Ile Leu Gly Ile Gly 180 185 190Phe Glu Ser Ile Asp Ile Pro Leu Gly Ile Leu Gly Leu Ser Pro Ser 195 200 205Val Ser Pro Asp Gly Thr Ser Pro Tyr Pro Tyr Leu Leu Asp Ser Met 210 215 220Ala Ser Gln Gly Ile Ile Ser Ser Arg Ala Phe Ser Leu Asp Leu Arg225 230 235 240Ser Ile Asp Asn Pro Ser Gly Ala Ile Ile Phe Gly Gly Val Asp Leu 245 250 255Gly Lys Phe Ser Gly Ser Leu Ala Lys Leu Pro Met Leu Asp Pro Ser 260 265 270Gln Thr Pro Ala Gly Val Asp Arg Tyr Trp Ile Val Leu Ser Gly Val 275 280 285Gly Met Thr Tyr Pro Asp Gly Glu Glu Val Glu Ser Glu Glu Ile Gly 290 295 300Val Pro Val Phe Leu Asp Ser Gly Gly Thr Leu Ser Arg Leu Pro Glu305 310 315 320Thr Ile Phe Gln Ala Ile Gly Asp Ser Phe Pro Gly Ser Gln Tyr Asp 325 330 335Pro Glu Ser Gly Phe Tyr Ile Val Asp Cys Ala Val Ala Glu Gln Ala 340 345 350Gly Ser Val Asp Phe Ile Phe Gly Ser Ser Gly Ser Arg Ser Ser Lys 355 360 365Lys Ile Arg Val Pro Tyr Gly Asp Phe Val Trp Glu Val Gln Thr Gly 370 375 380Val Cys Val Val Gly Val Leu Pro Thr Asp Asp Glu Pro Val Phe Gly385 390 395 400Asp Ser Phe Leu Arg Ala Ala Tyr Val Val Phe Asp Gln Asp Asn Arg 405 410 415Asn Leu His Leu Ala Gln Ala Ala Asn Cys Gly Glu Gln Ile Val Glu 420 425 430Ile Gly Ser Gly Gln Asp Ala Val Pro Ser Ser Thr Gly Lys Cys Lys 435 440 445Asp Gly Ser Ala Gly Ser Thr Lys Thr Ala Gly Gly Gly Gly Leu Asp 450 455 460Val Thr Ala Thr Arg Ala Pro Thr Arg Thr Ala Gly Gly Ser Gly Pro465 470 475 480Ala Val Thr Asn Ser Asp Phe Gly Pro Gly Pro Ala Gly Thr Arg Val 485 490 495Ser Thr Gly Gly Ile Gly Leu Pro Thr Gly Thr Gly Gly Gly Gly Gly 500 505 510Ser Gly Asp Gly Asn Gly Asn Asn Asp Asp Asp Asp Ser Ala Ala Ser 515 520 525Gly Leu Asp Val Gly Val Thr Ala Ala Ala Val Leu Ala Gly Leu Asn 530 535 540Met Leu Ile Val Trp Leu Leu545 550150529PRTNeurospora crassa 150Met Lys Ser Thr Leu Ala Thr Leu Leu Ala Leu Ala Ser Val Ala Val1 5 10 15Ala Glu Asn Gly Val Val Asn Phe Pro Leu Asn Arg Gly Val Pro His 20 25 30Phe Arg Val Gly Asn Val Arg Gln Asn Val Lys Arg Asp Thr Tyr Ser 35 40 45Gln Ala Leu Ile Asn Asn Ile Thr Gly Gly Ala Tyr Tyr Ala Glu Val 50 55 60Thr Val Gly Thr Pro Gly Gln Lys Val Ser Val Val Leu Asp Thr Gly65 70 75 80Ser Ser Asp Leu Trp Val Val Ser Tyr Lys Ala Asp Leu Cys Thr Asp 85 90 95Pro Ser Ile Gln Arg Gln Trp Gly Asp Ser Cys Asp Lys Thr Tyr Asn 100 105 110Pro Thr Lys Ser Ser Ser Tyr Lys Val Leu Glu Glu Asp Ser Phe Glu 115 120 125Ile Arg Tyr Leu Asp Asn Ser Thr Ala Ala Gly Asp Tyr Ile Thr Asp 130 135 140Asp Leu Asn Ile Gly Gly Ala Thr Ile Lys Ser Leu Gln Met Gly Tyr145 150 155 160Ala Thr Lys Thr Val Arg Gly Ala Gly Ile Leu Gly Val Gly Tyr Ser 165 170 175Ser Asn Val Ala Ser Gln Gln Arg Tyr Pro Asn Leu Ile Asp Gln Phe 180 185 190Val Ala Gln Lys Leu Ile Thr Thr Lys Ala Tyr Ser Leu Tyr Leu Asn 195 200 205Asp Arg Arg Ser Asp Thr Gly Ser Ile Leu Phe Gly Gly Ile Asp Lys 210 215 220Asp Lys Phe Ile Gly Asp Leu Ser Ile Leu Pro Ile Tyr Leu Ala Lys225 230 235 240Gly Gln Ala Glu Pro Ile His Phe Glu Val Glu Met Gln Ser Val Ser 245 250 255Leu Ala Leu Thr Lys Asn Gly Lys Thr Thr Lys Ile Ile Ser Thr Asp 260 265 270Pro Ser Leu Ser Gln Thr Ser Thr Ile Ala Ile Leu Asp Ser Gly Thr 275 280 285Thr Leu Ser Tyr Leu Pro Ser Lys Ile Thr Asp Gln Ile His Thr Lys 290 295 300Leu Ser Val Tyr Val Asp Glu Ile Trp Thr Gly Leu Thr Phe Ile Asp305 310 315 320Cys Gln Tyr Leu Thr Ser Asn Pro Asp Leu Arg Leu Ser Phe Thr Phe 325 330 335Gly Ala Asn Ala Thr Ile Ser Val Pro Val Trp Glu Leu Val Leu Asp 340 345 350Leu Leu Gly Glu Ser Gln Ser Glu Leu Pro Phe Lys Met Pro Phe Lys 355 360 365Asn Ala Cys Ile Phe Gly Ile Gln Ser Thr Ala Gly Phe Gln Glu Asp 370 375 380Asn Phe Asp Glu Asp Trp Ala Leu Leu Gly Glu Thr Phe Leu Arg Ser385 390 395 400Ala Tyr Val Val Tyr Asp Leu Thr His His Gln Ile Gly Ile Ala Gln 405 410 415Ala Asn Leu Asn Ser Thr Thr Thr Asp Ile Val Glu Leu Ser Gly Ala 420 425 430Asp Gly Gly Leu Pro Thr Gly Leu Thr Gly Val Lys Glu Gln Gln Thr 435 440 445Ser Asn Asp Pro Ser Gly Asn Ala Gly Ser Gly Ser Gly Ser Ser Thr 450 455 460Asp Lys Asp Gly Ala Lys Glu Thr Glu Thr Val Thr Ala Gly Ser Thr465 470 475 480Ala Ala Thr Gly Thr Ala Ala Ser Gly Ala Lys Glu Thr Asp Ser Ala 485 490 495Ala Ala Gly Leu Ser Ala Arg Gly Gly Ala Val Gly Ala Leu Ala Val 500 505 510Ala Ser Leu Thr Gly Phe Leu Ala Leu Val Gly Gly Ala Val Val Ala 515 520 525Leu151566PRTMyceliophthora thermophila 151Met Lys Pro Ser Ser Ala Ile Leu Leu Ala Leu Ala Pro Gly Ser Ser1 5 10 15Ser Lys Asn Val Val Glu Phe Ser Val Ser Arg Gly Leu Pro Gly Asn 20 25 30Arg Thr Pro Leu Ser Phe Pro Pro Leu Thr Arg Arg Glu Thr Tyr Ser 35 40 45Glu Arg Leu Ile Asn Asn Ile Ala Gly Gly Gly Tyr Tyr Val Gln Val 50 55 60Gln Val Gly Thr Pro Pro Gln Asn Leu Thr Met Leu Leu Asp Thr Gly65 70 75 80Ser Ser Asp Ala Trp Val Leu Ser His Glu Ala Asp Leu Cys Ile Ser 85 90 95Pro Ala Leu Gln Asp Phe Tyr Gly Met Pro Cys Thr Asp Thr Tyr Asp 100 105 110Pro Ser Lys Ser Ser Ser Lys Lys Met Val Glu Glu Gly Gly Phe Lys 115 120 125Ile Thr Tyr Leu Asp Gly Gly Thr Ala Ser Gly Asp Tyr Ile Thr Asp 130 135 140His Phe Thr Ile Gly Gly Val Thr Val Gln Ser Leu Gln Met Ala Cys145 150 155 160Val Thr Lys Ala Val Arg Gly Thr Gly Ile Leu Gly Leu Gly Phe Ser 165 170 175Ile Ser Glu Arg Ala Ser Thr Lys Tyr Pro Asn Ile Ile Asp Glu Met 180 185 190Tyr Ser Gln Gly Leu Ile Lys Ser Lys Ala Phe Ser Leu Tyr Leu Asn 195 200 205Asp Arg Arg Ala Asp Ser Gly Thr Leu Leu Phe Gly Gly Ile Asp Thr 210 215 220Asp Lys Phe Ile Gly Pro Leu Gly Val Leu Pro Leu His Lys Pro Pro225 230 235 240Gly Asp Arg Asp Tyr Ser Ser Phe Glu Val Asn Phe Thr Ser Val Ser 245 250 255Leu Thr Tyr Thr Asn Gly Ser Arg His Thr Ile Pro Thr Ala Ile Leu 260 265 270Asn His Pro Ala Pro Ala Val Leu Asp Ser Gly Thr Thr Leu Ser Tyr 275 280 285Leu Pro Asp Glu Leu Ala Asp Pro Ile Asn Thr Ala Leu Asp Thr Phe 290 295 300Tyr Asp Asp Arg Leu Gln Met Thr Leu Ile Asp Cys Ser His Pro Leu305 310 315 320Leu Arg Thr Asp Pro Asp Phe His Leu Ala Phe Thr Phe Thr Pro Thr 325 330 335Thr Ser Ile Thr Val Pro Leu Gly Asp Leu Val Leu Asp Ile Leu Pro 340 345 350Pro Thr Tyr Pro Gln Ser Asn Ser Asn Asn Asn Asn Glu Val Glu Asp 355 360 365Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Lys Val Pro Pro 370 375 380Ala Thr Glu Arg Arg Trp Cys Val Phe Gly Ile Gln Ser Thr Thr Arg385 390 395 400Phe Ala Ala Ser Ser Gly Gln Ser Glu Ala Asn Phe Thr Leu Leu Gly 405 410 415Asp Thr Phe Leu Arg Ser Ala Tyr Val Val Tyr Asp Leu Ser His Tyr 420 425 430Gln Ile Gly Leu Ala Gln Ala Asn Leu Asn Ser Ser Ser Ser Ser Thr 435 440 445Asn Thr Asn Thr Ile Val Glu Leu Thr Ala Asp Asn His Asp Asp Gly 450 455 460Ala Ser Glu Arg Gly Glu Gly Ala Gly Ala Gly Ala Asp Ala Gly Thr465 470 475 480Arg Thr Val Ile Ala Gly Gly Leu Pro Ser Gly Leu Met Gly Val Glu 485 490 495Ala Gln Gln Thr Thr Phe Thr Pro Thr Ala Thr Ala Asn Gly His Pro 500 505 510Gly Tyr Gly Gly Gly Pro Gly Gly Ser Thr Arg Pro Gly Ser Glu Arg 515 520 525Asn Ala Ala Ala Gly Gly Phe Thr Ala Val Arg Thr Gly Leu Leu Gly 530 535 540Glu Leu Val Gly Val Ala Ala Val Thr Ala Leu Phe Ile Leu Leu Gly545 550 555 560Gly Ala Leu Ile Ala Val 565152897PRTMyceliophthora thermophila 152Met Val Arg Leu Asp Trp Ala Ala Val Leu Leu Ala Ala Thr Ala Val1 5 10 15Ala Lys Ala Val Thr Pro His Thr Pro Ser Phe Val Pro Gly Ala Tyr 20 25 30Ile Val Glu Tyr Glu Glu Asp Gln Asp Ser His Ala Phe Val Asn Lys 35 40 45Leu Gly Gly Lys Ala Ser Leu Arg Lys Asp Leu Arg Phe Lys Leu Phe 50 55 60Lys Gly Ala Ser Ile Gln Phe Lys Asp Thr Glu Thr Ala Asp Gln Met65 70 75 80Val Ala Lys Val Ala Glu Met Pro Lys Val Lys Ala Val Tyr Pro Val 85 90 95Arg Arg Tyr Pro Val Pro Asn His Val Val His Ser Thr Gly Asn Val 100 105 110Ala Asp Glu Val Leu Val Lys Arg Gln Ala Ala Gly Asn Asp Thr Phe 115 120 125Ser Thr His Leu Met Thr Gln Val Asn Lys Phe Arg Asp Ala Gly Ile 130 135 140Thr Gly Lys Gly Ile Lys Ile Ala Val Ile Asp Thr Gly Ile Asp Tyr145 150 155 160Leu His Glu Ala Leu Gly Gly Cys Phe Gly Pro Asp Cys Leu Val Ser 165 170 175Tyr Gly Thr Asp Leu Val Gly Asp Asp Phe Asn Gly Ser Asn Thr Pro 180 185 190Lys Pro Asp Pro Asp Pro Ile Asp Asn Cys Gln Gly His Gly Thr His 195 200 205Val Ala Gly Ile Ile Ala Ala Gln Thr Asn Asn Pro Phe Gly Ile Ile 210 215 220Gly Ala Ala Thr Asp Val Thr Leu Gly Ala Tyr Arg Val Phe Gly Cys225 230 235 240Asn Gly Asp Thr Pro Asn Asp Val Leu Ile Ala Ala Tyr Asn Met Ala 245 250 255Tyr Glu Ala Gly Ser Asp Ile Ile Thr Ala Ser Ile Gly Gly Pro Ser 260 265 270Gly Trp Ser Glu Asp Pro Trp Ala Ala Val Val Thr Arg Ile Val Glu 275 280 285Asn Gly Val Pro Cys Val Val Ser Ala Gly Asn Asp Gly Asp Ala Gly 290 295 300Ile Phe Tyr Ala Ser Thr Ala Ala Asn Gly Lys Lys Val Thr Ala Ile305 310 315 320Ala Ser Val Asp Asn Ile Val Thr Pro Ala Leu Leu Ser Asn Ala Ser 325 330 335Tyr Thr Leu Asn Gly Thr Asp Asp Phe Phe Gly Phe Thr Ala Gly Asp 340 345 350Pro Gly Ser Trp Asp Asp Val Asn Leu Pro Leu Trp Ala Val Ser Phe 355 360 365Asp Thr Thr Asp Pro Ala Asn Gly Cys Asn Pro Tyr Pro Asp Ser Thr 370 375 380Pro Asp Leu Ser Gly Tyr Ile Val Leu Ile Arg Arg Gly Thr Cys Thr385 390 395 400Phe Val Glu Lys Ala Ser Tyr Ala Ala Ala Lys Gly Ala Lys Tyr Val 405 410 415Met Phe Tyr Asn Asn Val Gln Gln Gly Thr Val Thr Val Ser Ala Ala 420 425 430Glu Ala Lys Gly Ile Glu Gly Val Ala Met Val Thr Ala Gln Gln Gly 435 440 445Glu Ala Trp Val Arg Ala Leu Glu Ala Gly Ser Glu Val Val Leu His 450 455 460Met Lys Asp Pro Leu Lys Ala Gly Lys Phe Leu Thr Thr Thr Pro Asn465 470 475 480Thr Ala Thr Gly Gly Phe Met Ser Asp Tyr Thr Ser Trp Gly Pro Thr 485 490 495Trp Glu Val Glu Val Lys Pro Gln Phe Gly Thr Pro Gly Gly Ser Ile 500 505 510Leu Ser Thr Tyr Pro Arg Ala Leu Gly Ser Tyr Ala Val Leu Ser Gly 515 520 525Thr Ser Met Ala Cys Pro Leu Ala Ala Ala Ile Tyr Ala Leu Leu Ile 530 535 540Asn Thr Arg Gly Thr Lys Asp Pro Lys Thr Leu Glu Asn Leu Ile Ser545 550 555 560Ser Thr Ala Arg Pro Asn Leu Phe Arg Leu Asn Gly Glu Ser Leu Pro 565 570 575Leu Leu Ala Pro Val Pro Gln Gln Gly Gly Gly Ile Val Gln Ala Trp 580 585 590Asp Ala Ala Gln Ala Thr Thr Leu Leu Ser Val Ser Ser Leu Ser Phe 595 600 605Asn Asp Thr Asp His Phe Lys Pro Val Gln Thr Phe Thr Ile Thr Asn 610 615 620Thr Gly Lys Lys Ala Val Thr Tyr Ser Leu Ser Asn Val Gly Ala Ala625 630 635 640Thr Ala Tyr Thr Phe Ala Asp Ala Lys Ser Ile Glu Pro Ala Pro Phe 645 650 655Pro Asn Glu Leu Thr Ala Asp Phe Ala Ser Leu Thr Phe Val Pro Lys 660 665 670Arg Leu Thr Ile Pro Ala Gly Lys Arg Gln Thr Val Thr Val Ile Ala 675 680 685Lys Pro Ser Glu Gly Val Asp Ala Lys Arg Leu Pro Val Tyr Ser Gly 690 695 700Tyr Ile Ala Ile Asn Gly Ser Asp Ser Ser Ala Leu Ser Leu Pro Tyr705 710 715 720Leu Gly Val Val Gly Ser Leu His Ser Ala Val Val Leu Asp Ser Asn 725 730 735Gly Ala Arg Ile Ser Leu Ala Ser Asp Asp Thr Asn Lys Pro Leu Pro 740 745 750Ala Asn Thr Ser Phe Val Leu Pro Pro Ala Gly Phe Pro Asn Asp Thr 755 760 765Ser Tyr Ala Asn Ser Thr Asp Leu Pro Lys Leu Val Val Asp Leu Ala 770 775 780Met Gly Ser Ala Leu Leu Arg Ala Asp Val Val Pro Leu Ser Gly Gly785 790 795 800Ala Ala Thr Ala Thr Ala Arg Leu Thr Arg Thr Val Phe Gly Thr Arg 805 810 815Thr Ile Gly Gln Pro Tyr Gly Leu Pro Ala Arg Tyr Asn Pro Arg Gly 820 825 830Thr Phe Glu Tyr Ala Trp Asp Gly Arg Leu Asp Asp Gly Ser Tyr Ala 835

840 845Pro Ala Gly Arg Tyr Arg Phe Ala Val Lys Ala Leu Arg Ile Phe Gly 850 855 860Asp Ala Lys Arg Ala Arg Glu Tyr Asp Ala Ala Glu Thr Val Glu Phe865 870 875 880Asn Ile Glu Tyr Leu Pro Gly Pro Ser Ala Lys Phe Arg Arg Arg Leu 885 890 895Phe153876PRTNeurospora crassa 153Met Val Arg Leu Gly Leu Ala Thr Thr Leu Leu Ala Ala Ala Ser Phe1 5 10 15Ala Gln Ala Ala His Gln Lys Ala Pro Ala Val Val Pro Gly Ala Tyr 20 25 30Ile Val Glu Tyr Glu Asp Ser His Asp Pro Thr Ser Ile Leu Ala Ser 35 40 45Ile Lys Gly Asp Ala Thr Ile Arg Lys Asp Ile Arg His Glu Leu Phe 50 55 60Lys Gly Ala Ser Phe Gln Phe Lys Asp Leu Asn Lys Ala Asp Asp Leu65 70 75 80Ala Ser Lys Val Ala Ala Met Ser Gly Val Lys Ala Leu Tyr Pro Val 85 90 95Arg Arg Tyr Ser Ile Pro Glu His Thr Val His Ser Thr Gly Ser Ala 100 105 110Val Gln Glu Val Val Ala Lys Arg Asp Thr Gly Asn Asp Thr Phe Ser 115 120 125Pro His Leu Met Thr Gln Val Asn Lys Phe Arg Asp Ser Gly Ile Thr 130 135 140Gly Lys Gly Ile Lys Ile Ala Val Ile Asp Thr Gly Val Asp Tyr Leu145 150 155 160His Pro Ala Leu Gly Gly Cys Phe Gly Pro Gly Cys Leu Val Ser Tyr 165 170 175Gly Thr Asp Leu Val Gly Asp Asp Phe Asn Gly Ser Asn Thr Pro Val 180 185 190Pro Asp Ser Asp Pro Met Asp Thr Cys Asn Gly His Gly Ser His Val 195 200 205Leu Gly Leu Leu Ser Ala Asn Thr Asn Asn Pro Tyr Gly Ile Ile Gly 210 215 220Ala Ala Pro Asp Val Thr Leu Gly Ala Tyr Arg Val Phe Gly Cys Ser225 230 235 240Gly Asp Val Gly Asn Asp Ile Leu Ile Glu Ala Tyr Leu Lys Ala Tyr 245 250 255Asp Asp Gly Ser Asp Ile Ile Thr Ala Ser Ile Gly Gly Ala Ser Gly 260 265 270Trp Pro Glu Asp Ser Trp Ala Ala Val Val Ser Arg Ile Val Glu Lys 275 280 285Gly Val Pro Cys Leu Val Ser Ala Gly Asn Asp Gly Ala Thr Gly Ile 290 295 300Phe Tyr Ala Ser Thr Ala Ala Asn Gly Lys Arg Val Thr Ala Val Ala305 310 315 320Ser Val Asp Asn Ile Leu Ala Pro Ala Leu Leu Ser Glu Ala Ser Tyr 325 330 335Ser Val Ala Asn Gly Ser Leu Ser Thr Phe Gly Phe Thr Ala Gly Ser 340 345 350Pro Ser Ala Trp Ala Asn Val Ser Leu Pro Val Trp Ser Val Asn Phe 355 360 365Asn Thr Ala Asp Ala Ala Asn Gly Cys Glu Ala Phe Pro Asp Asp Thr 370 375 380Pro Asp Leu Ser Lys Tyr Ile Val Leu Ile Arg Arg Gly Thr Cys Thr385 390 395 400Phe Val Gln Lys Ala Gln Asn Ala Ala Ala Lys Gly Ala Lys Tyr Ile 405 410 415Ile Tyr Tyr Asn Asn Ala Ser Gly Ser Thr Lys Val Asp Val Ser Ala 420 425 430Val Ala Asp Val Lys Ala Ala Ala Met Val Thr Ser Glu Thr Gly Ala 435 440 445Ala Trp Ile Lys Ala Leu Gln Ala Gly Thr Gln Val Thr Val Asn Met 450 455 460Ala Asp Pro Glu Thr Ala Pro Lys Asn Leu Asn Asn Phe Pro Asn Thr465 470 475 480Ala Thr Pro Gly Phe Leu Ser Thr Tyr Thr Ser Trp Gly Pro Thr Tyr 485 490 495Glu Val Asp Val Lys Pro Gln Ile Ser Ser Pro Gly Gly Met Ile Leu 500 505 510Ser Thr Tyr Pro Arg Ala Leu Gly Ser Tyr Ala Val Leu Ser Gly Thr 515 520 525Ser Met Ala Cys Pro Leu Ala Ala Ala Thr Trp Ala Leu Val Met Gln 530 535 540Lys Arg Gly Thr Lys Asp Pro Lys Val Leu Glu Asn Leu Phe Ser Ala545 550 555 560Thr Ala His Pro Asn Leu Phe Asn Asp Gly Thr Lys Thr Tyr Pro Met 565 570 575Leu Ala Pro Val Ala Gln Gln Gly Ala Gly Leu Ile Gln Ala Trp Asp 580 585 590Ala Ala Asn Ala Asn Ala Leu Leu Ser Val Ser Ser Ile Ser Phe Asn 595 600 605Asp Thr Glu His Phe Lys Pro Leu Gln Ser Phe Glu Val Thr Asn Thr 610 615 620Gly Lys Lys Ala Val Thr Tyr Gln Leu Gly His Thr Ser Ala Ala Thr625 630 635 640Ala Tyr Thr Phe Ala Asn Asp Thr Ser Ile Gly Pro Ala Ala Phe Pro 645 650 655Asn Glu Leu Val Asp Ala Lys Ala Thr Leu Val Leu Thr Pro Ala Lys 660 665 670Leu Thr Leu Asn Pro Gly Gln Lys Lys Thr Val Thr Val Leu Ala Ile 675 680 685Pro Pro Leu Gly Leu Asp Ala Lys Arg Leu Pro Val Tyr Ser Gly Tyr 690 695 700Ile Thr Leu Asn Gly Thr Asp Ser Thr Gly Tyr Ser Leu Pro Tyr Gln705 710 715 720Gly Val Val Gly Ser Met Arg Ser Val Thr Val Leu Asp Lys Gln Asn 725 730 735Ser Tyr Leu Ser Gln Ser Ser Asp Ala Thr Tyr Ala Pro Val Ala Ala 740 745 750Gly Thr Thr Phe Thr Leu Pro Pro Ala Gly Lys Ala Asn Asp Thr Leu 755 760 765Tyr Ala Thr Thr Val Tyr Pro Thr Ile Val Leu Thr Leu Ser Met Gly 770 775 780Ser Ala Glu Val His Ala Asp Val Val Asn Ser Lys Gly Lys Thr Ile785 790 795 800Gly Gln Val Leu Thr Phe Pro Ala Arg Trp Asn Pro Arg Gly Thr Phe 805 810 815Glu Trp Asn Trp Asp Gly Ala Leu Ser Asp Gly Thr Tyr Ala Pro Ala 820 825 830Asp Thr Tyr Lys Ile Thr Leu Lys Ala Leu Lys Ile Tyr Gly Asn Ser 835 840 845Lys Trp Pro Leu Asp Trp Glu Thr Gln Thr Thr Glu Pro Phe Thr Ile 850 855 860Lys Tyr Ala Ala Lys Ser Lys Arg Ala Phe Thr Ala865 870 875154534PRTMyceliophthora thermophila 154Met Arg Gly Leu Val Ala Phe Ser Leu Ala Ala Cys Val Ser Ala Ala1 5 10 15Pro Ser Phe Lys Thr Glu Thr Ile Asn Gly Glu His Ala Pro Ile Leu 20 25 30Ser Ser Ser Asn Ala Glu Val Val Pro Asn Ser Tyr Ile Ile Lys Phe 35 40 45Lys Lys His Val Asp Glu Ser Ser Ala Ser Ala His His Ala Trp Ile 50 55 60Gln Asp Ile His Thr Ser Arg Glu Lys Val Arg Gln Asp Leu Lys Lys65 70 75 80Arg Gly Gln Val Pro Leu Leu Asp Asp Val Phe His Gly Leu Lys His 85 90 95Thr Tyr Lys Ile Gly Gln Glu Phe Leu Gly Tyr Ser Gly His Phe Asp 100 105 110Asp Glu Thr Ile Glu Gln Val Arg Arg His Pro Asp Val Glu Tyr Ile 115 120 125Glu Arg Asp Ser Ile Val His Thr Met Arg Val Thr Glu Glu Thr Cys 130 135 140Asp Gly Glu Leu Glu Lys Ala Ala Pro Trp Gly Leu Ala Arg Ile Ser145 150 155 160His Arg Asp Thr Leu Gly Phe Ser Thr Phe Asn Lys Tyr Leu Tyr Ala 165 170 175Ala Glu Gly Gly Glu Gly Val Asp Ala Tyr Val Ile Asp Thr Gly Thr 180 185 190Asn Ile Glu His Val Asp Phe Glu Gly Arg Ala Lys Trp Gly Lys Thr 195 200 205Ile Pro Ala Gly Asp Ala Asp Val Asp Gly Asn Gly His Gly Thr His 210 215 220Cys Ser Gly Thr Ile Ala Gly Lys Lys Tyr Gly Val Ala Lys Lys Ala225 230 235 240Asn Val Tyr Ala Val Lys Val Leu Arg Ser Asn Gly Ser Gly Thr Met 245 250 255Ala Asp Val Val Ala Gly Val Glu Trp Ala Ala Lys Ser His Leu Glu 260 265 270Gln Val Gln Ala Ala Lys Asp Gly Lys Arg Lys Gly Phe Lys Gly Ser 275 280 285Val Ala Asn Met Ser Leu Gly Gly Gly Lys Thr Arg Ala Leu Asp Asp 290 295 300Thr Val Asn Ala Ala Val Ser Val Gly Ile His Phe Ala Val Ala Ala305 310 315 320Gly Asn Asp Asn Ala Asp Ala Cys Asn Tyr Ser Pro Ala Ala Ala Glu 325 330 335Lys Ala Val Thr Val Gly Ala Ser Ala Ile Asp Asp Ser Arg Ala Tyr 340 345 350Phe Ser Asn Tyr Gly Lys Cys Thr Asp Ile Phe Ala Pro Gly Leu Ser 355 360 365Ile Leu Ser Thr Trp Ile Gly Ser Lys Tyr Ala Thr Asn Thr Ile Ser 370 375 380Gly Thr Ser Met Ala Ser Pro His Ile Ala Gly Leu Leu Ala Tyr Tyr385 390 395 400Leu Ser Leu Gln Pro Ala Thr Asp Ser Glu Tyr Ser Val Ala Pro Ile 405 410 415Thr Pro Glu Lys Met Lys Ser Asn Leu Leu Lys Ile Ala Thr Gln Asp 420 425 430Ala Leu Thr Asp Ile Pro Asp Glu Thr Pro Asn Leu Leu Ala Trp Asn 435 440 445Gly Gly Gly Cys Asn Asn Tyr Thr Ala Ile Val Glu Ala Gly Gly Tyr 450 455 460Lys Ala Lys Lys Lys Thr Thr Thr Asp Lys Val Asp Ile Gly Ala Ser465 470 475 480Val Ser Glu Leu Glu Lys Leu Ile Glu His Asp Phe Glu Val Ile Ser 485 490 495Gly Lys Val Val Lys Gly Val Ser Ser Phe Ala Asp Lys Ala Glu Lys 500 505 510Phe Ser Glu Lys Ile His Glu Leu Val Asp Glu Glu Leu Lys Glu Phe 515 520 525Leu Glu Asp Ile Ala Ala 530155396PRTNeurospora crassa 155Met Lys Leu Ser Ala Val Leu Ala Leu Leu Pro Leu Ala Met Ala Ala1 5 10 15Pro Ser Ala Pro Ile Asp Lys Arg Ala Pro Ile Leu Glu Ala Arg Ala 20 25 30Gly Thr Gln Ala Val Pro Gly Lys Tyr Ile Val Lys Leu Arg Glu Thr 35 40 45Ala Ser Asp Asp Asp Leu Asp Lys Ala Val Lys Lys Leu Gly Asn Ser 50 55 60Lys Ala Asp His Val Tyr Lys His Ala Phe Arg Gly Phe Ala Gly Arg65 70 75 80Ile Asp Asp Lys Thr Leu Asp Asp Ile Arg Ser Leu Pro Glu Val Glu 85 90 95Tyr Val Glu Gln Glu Ala Val Phe Thr Ile Asn Thr Tyr Thr Ser Gln 100 105 110Ser Ser Val Pro Ser Trp Gly Leu Ala Arg Leu Ser Ser Lys Thr Thr 115 120 125Gly Lys Thr Thr Tyr Val Tyr Asp Ser Ser Ala Gly Ala Gly Thr Cys 130 135 140Ala Tyr Ile Ile Asp Thr Gly Ile Asn Thr Ala His Ser Asp Phe Gly145 150 155 160Gly Arg Ala Thr Trp Leu Ala Asn Tyr Ala Gly Asp Gly Ile Asn Ser 165 170 175Asp Gly Asn Gly His Gly Thr His Val Ala Gly Thr Val Gly Gly Thr 180 185 190Thr Tyr Gly Val Ala Lys Lys Thr Gln Leu Tyr Ala Val Lys Val Leu 195 200 205Asp Ser Asn Gly Ser Gly Ser Asn Ser Gly Val Ile Ala Gly Met Asn 210 215 220Phe Val Ala Gln Asp Ala Gln Ser Arg Asn Cys Pro Asn Gly Thr Val225 230 235 240Ala Asn Met Ser Leu Gly Gly Gly Tyr Ser Ala Ser Thr Asn Ser Ala 245 250 255Ala Ala Ala Met Val Arg Ala Gly Val Phe Leu Ala Val Ala Ala Gly 260 265 270Asn Asp Gly Ala Asn Ala Ala Asn Tyr Ser Pro Ala Ser Glu Pro Thr 275 280 285Val Cys Thr Val Gly Ala Thr Thr Ser Ala Asp Ala Ile Ala Tyr Tyr 290 295 300Ser Asn Tyr Gly Thr Ile Val Asp Ile Phe Ala Pro Gly Thr Ser Ile305 310 315 320Thr Ser Ala Trp Ile Gly Ser Thr Thr Ala Lys Asn Thr Ile Ser Gly 325 330 335Thr Ser Met Ala Thr Pro His Ile Thr Gly Leu Gly Ala Tyr Leu Leu 340 345 350Thr Leu Leu Gly Lys Lys Ser Pro Ala Ala Leu Cys Ser Tyr Ile Ala 355 360 365Ser Thr Ala Asn Ser Gly Val Ile Ser Gly Ile Pro Arg Gly Thr Val 370 375 380Asn Lys Leu Ala Phe Asn Gly Asn Pro Ser Ala Tyr385 390 395156392PRTMyceliophthora thermophila 156Met His Phe Ser Thr Ala Leu Leu Ala Phe Leu Pro Ala Ala Leu Ala1 5 10 15Ala Pro Thr Ala Glu Thr Leu Asp Lys Arg Ala Pro Ile Leu Thr Ala 20 25 30Arg Ala Gly Gln Val Val Pro Gly Lys Tyr Ile Ile Lys Leu Arg Asp 35 40 45Gly Ala Ser Asp Asp Val Leu Glu Ala Ala Ile Gly Lys Leu Arg Ser 50 55 60Lys Ala Asp His Val Tyr Arg Gly Lys Phe Arg Gly Phe Ala Gly Lys65 70 75 80Leu Glu Asp Asp Val Leu Asp Ala Ile Arg Leu Leu Pro Glu Val Glu 85 90 95Tyr Val Glu Glu Glu Ala Ile Phe Thr Ile Asn Ala Tyr Thr Ser Gln 100 105 110Ser Asn Ala Pro Trp Gly Leu Ala Arg Leu Ser Ser Lys Thr Ala Gly 115 120 125Ser Thr Thr Tyr Thr Tyr Asp Thr Ser Ala Gly Glu Gly Thr Cys Ala 130 135 140Tyr Val Ile Asp Thr Gly Ile Tyr Thr Ser His Ser Asp Phe Gly Gly145 150 155 160Arg Ala Thr Phe Ala Ala Asn Phe Val Asp Ser Ser Asn Thr Asp Gly 165 170 175Asn Gly His Gly Thr His Val Ala Gly Thr Ile Gly Gly Thr Thr Tyr 180 185 190Gly Val Ala Lys Lys Thr Lys Leu Tyr Ala Val Lys Val Leu Gly Ser 195 200 205Asp Gly Ser Gly Thr Thr Ser Gly Val Ile Ala Gly Ile Asn Phe Val 210 215 220Ala Asp Asp Ala Pro Lys Arg Ser Cys Pro Lys Gly Val Val Ala Asn225 230 235 240Met Ser Leu Gly Gly Ser Tyr Ser Ala Ser Ile Asn Asn Ala Ala Ala 245 250 255Ala Leu Val Arg Ser Gly Val Phe Leu Ala Val Ala Ala Gly Asn Glu 260 265 270Asn Gln Asn Ala Ala Asn Ser Ser Pro Ala Ser Glu Ala Ser Ala Cys 275 280 285Thr Val Gly Ala Thr Asp Arg Asn Asp Ala Lys Ala Ser Tyr Ser Asn 290 295 300Tyr Gly Ser Val Val Asp Ile Gln Ala Pro Gly Ser Asn Ile Leu Ser305 310 315 320Thr Trp Ile Gly Ser Thr Ser Ala Thr Asn Thr Ile Ser Gly Thr Ser 325 330 335Met Ala Ser Pro His Ile Ala Gly Leu Gly Ala Tyr Leu Leu Ala Leu 340 345 350Glu Gly Ser Lys Thr Pro Ala Glu Leu Cys Asn Tyr Ile Lys Ser Thr 355 360 365Gly Asn Ala Ala Ile Thr Gly Val Pro Ser Gly Thr Thr Asn Arg Ile 370 375 380Ala Phe Asn Gly Asn Pro Ser Ala385 390157433PRTNeurospora crassa 157Met Val Arg Phe Ser Val Ala Ala Ala Phe Leu Leu Ser Ala Leu Gly1 5 10 15Val Thr Ala Ala Pro Ser Gly Gly Arg His Asn His Gln Asn Thr Gln 20 25 30Asn Thr Gly Ala Thr Ala Gly Asn Ala Ala Gly Val Pro Val Ala Asn 35 40 45Ser Asp Ile Ser Asn Ile Ile Pro Gly Arg Tyr Ile Val Val Tyr Asn 50 55 60Asn Thr Phe Gly Glu Glu Ala Ile Asn Ala His Gln Ile Lys Val Thr65 70 75 80Ser Leu Val Ala Lys Arg Asn Leu Gly Lys Arg Asp Ala Lys Thr Gly 85 90 95Arg Ile Met Ser Pro Ser Val Lys Ala Phe Lys Met Gly Thr Trp Arg 100 105 110Ala Met Ala Leu Asp Ala Asp Asp Asp Met Ile Asn Asp Ile Asn Ser 115 120 125Ala Gln Glu Val Glu Tyr Ile Glu Ala Asp Gln Tyr Val Lys Leu Asn 130 135 140Ala Leu Thr Ser Gln Asn Ser Thr Thr Thr Gly Leu Ala Arg Leu Ser145 150 155 160His Ala Gly Pro Ser Lys Lys Ala Ala Pro Tyr Ile Phe Asp Ser Ser 165 170 175Ala Gly Glu Gly Ile Thr Ala Phe Val Val Asp Thr Gly Ile Arg Val 180 185 190Thr His Ser Glu Tyr Glu Gly Arg Ala Thr Phe Ala Ala Asn Phe Val 195

200 205Asn Asn Val Asp Thr Asp Glu Asn Gly His Gly Ser His Val Ala Gly 210 215 220Thr Ile Ala Gly Ala Thr Phe Gly Val Ala Lys Lys Ala Lys Leu Val225 230 235 240Ala Val Lys Val Leu Asp Gly Ser Gly Ser Gly Ser Asn Ser Gly Val 245 250 255Leu Gln Gly Met Gln Phe Val Ala Asp Thr Ala Thr Ser Gln Lys Leu 260 265 270Gly Gly Lys Ala Val Leu Asn Met Ser Leu Gly Gly Gly Lys Ser Arg 275 280 285Ala Ile Asn Ser Ala Ile Asn Gln Ile Ala Ala Ala Gly Val Val Pro 290 295 300Val Val Ala Ala Gly Asn Glu Asn Gln Asp Thr Ala Asn Thr Ser Pro305 310 315 320Gly Ser Ala Pro Ala Ala Ile Thr Val Gly Ala Ile Asp Gln Arg Thr 325 330 335Asp Ala Arg Ala Ser Phe Ser Asn Phe Gly Ala Gly Val Asp Ile Phe 340 345 350Ala Pro Gly Val Asn Val Leu Ser Val Gly Ile Lys Ser Asp Thr Asp 355 360 365Thr Asp Thr Leu Ser Gly Thr Ser Met Ala Ser Pro His Val Ala Gly 370 375 380Leu Ala Ala Tyr Leu Met Ala Leu Glu Gly Leu Thr Asp Val Thr Ala385 390 395 400Val Gly Asn Arg Ile Lys Glu Leu Ala Gln Lys Thr Gly Ala Lys Val 405 410 415Thr Asn Asn Val Arg Gly Thr Thr Ser Leu Ile Ala Asn Asn Gly Asn 420 425 430Leu158420PRTMyceliophthora thermophila 158Met Ala Gly Arg Leu Leu Leu Cys Leu Thr Ala Ala Leu Ser Ala Leu1 5 10 15Gly Val Ser Ala Ala Pro Ala Pro Asp Ala Ser Gly Arg Pro Phe Ile 20 25 30Gly Val Pro Val Ser Asn Pro Gly Ile Ala Asn Ala Ile Pro Asn Arg 35 40 45Tyr Ile Val Val Tyr Asn Asn Thr Phe Asn Asp Glu Asp Ile Asp Leu 50 55 60His Gln Ser Asn Val Ile Lys Thr Ile Ala Lys Arg Asn Ile Ala Lys65 70 75 80Arg Ser Leu Thr Gly Lys Leu Leu Ser Thr Thr Val Asn Thr Tyr Lys 85 90 95Ile Asn Asn Trp Arg Ala Met Ala Leu Glu Ala Asp Asp Ala Thr Ile 100 105 110Asn Glu Ile Phe Ala Ala Lys Glu Val Ser Tyr Ile Glu Gln Asp Ala 115 120 125Val Ile Ser Leu Asn Val Arg Gln Met Gln Ser Gln Ala Thr Thr Gly 130 135 140Leu Ala Arg Ile Ser His Ala Gln Pro Gly Ala Arg Thr Tyr Ile Phe145 150 155 160Asp Ser Ser Ala Gly Glu Gly Ile Thr Ala Tyr Val Val Asp Thr Gly 165 170 175Ile Arg Val Thr His Glu Glu Phe Glu Gly Arg Ala Thr Phe Ala Ala 180 185 190Asn Phe Ile Asp Asp Val Asp Thr Asp Glu Gln Gly His Gly Ser His 195 200 205Val Ala Gly Thr Ile Gly Gly Lys Thr Phe Gly Val Ala Lys Lys Val 210 215 220Asn Leu Val Ala Val Lys Val Leu Gly Ala Asp Gly Ser Gly Ser Asn225 230 235 240Ser Gly Val Ile Ala Gly Met Gln Phe Val Ala Ser Asn Ala Thr Ala 245 250 255Met Gly Leu Lys Gly Arg Ala Val Met Asn Met Ser Leu Gly Gly Pro 260 265 270Ala Ser Arg Ala Val Asn Ser Ala Ile Asn Gln Val Glu Ala Ala Gly 275 280 285Val Val Pro Val Val Ala Ala Gly Asn Glu Ser Gln Asp Thr Ala Asn 290 295 300Thr Ser Pro Gly Ser Ala Glu Ala Ala Ile Thr Val Gly Ala Ile Asp305 310 315 320Gln Thr Asn Asp Arg Met Ala Ser Phe Ser Asn Phe Gly Glu Leu Val 325 330 335Asp Ile Phe Ala Pro Gly Val Asn Val Gln Ser Val Gly Ile Arg Ser 340 345 350Asp Thr Ser Thr Asn Thr Leu Ser Gly Thr Ser Met Ala Ser Pro His 355 360 365Val Ala Gly Leu Ala Ala Tyr Ile Met Ser Leu Glu Asn Ile Thr Gly 370 375 380Val Gln Ala Val Ser Asp Arg Leu Lys Glu Leu Ala Gln Ala Thr Gly385 390 395 400Ala Arg Ala Arg Gly Val Pro Arg Gly Thr Thr Thr Leu Ile Ala Asn 405 410 415Asn Gly Phe Ala 420159421PRTNeurospora crassa 159Met Val Gly Leu Lys Asn Val Ala Leu Phe Ala Ala Ser Ile Ile Leu1 5 10 15Pro Ala Ser Ile Thr Trp Ala Ala Pro Ile Ile Glu Val Glu Thr Lys 20 25 30Pro Ile Pro Glu Lys Tyr Ile Val Leu Leu Lys Pro His Ala Asp Leu 35 40 45Glu Gly His Leu Ser Trp Ala Lys Asp Val His Ala Arg Ser Leu Ser 50 55 60Arg Arg Asp Thr Ala Gly Val His Lys Ala Trp Ser Val Gly Ser Lys65 70 75 80Phe Lys Ala Tyr Ala Gly Glu Phe Asp Glu Glu Thr Leu Lys Ile Ile 85 90 95Gln Arg Asp Glu Arg Asn Val His Ser Ile Glu Pro Asp Lys Ser Trp 100 105 110Arg Leu Tyr Lys Ser Asn Lys Lys Asp Asn Asp Asp Ser Asn Ser Asp 115 120 125Asn Thr Thr Ile Ile Thr Gln Lys Gln Ala Pro Trp Gly Leu Gly Tyr 130 135 140Leu Ser His Lys Gly Lys Thr Ser Ser Asp Tyr Val Tyr Asn Ser Thr145 150 155 160Ala Gly Thr Gly Thr Tyr Ala Tyr Val Val Asp Thr Gly Cys Trp Lys 165 170 175Asp His Val Glu Phe Glu Gly Arg Val Gln Leu Gly Tyr Asn Ala Tyr 180 185 190Pro Asp Ser Pro Phe Ile Asp Met Asp Gly His Gly Thr His Val Thr 195 200 205Gly Thr Leu Ile Ser Lys Thr Tyr Gly Val Ala Lys Asn Ala Thr Val 210 215 220Ile Cys Val Lys Val Phe His Gly Gly Gly Ser Ala Asn Thr Ile Val225 230 235 240Met Asp Gly Phe Glu Trp Ala Val Lys Asp Ile Ile Ala Lys Lys Arg 245 250 255Gln Arg Asn Ser Val Ile Asn Met Ser Leu Gly Cys Asp Arg Ser Glu 260 265 270Ala Phe Asn Ala Ile Val Asp Ala Ala Tyr Asp Gln Gly Ile Leu Thr 275 280 285Val Val Ala Ala Gly Asn Glu Asn Gln Pro Ala Ala Leu Val Ser Pro 290 295 300Ala Ser Ser Ala Arg Ala Phe Ser Val Gly Ala Ile Asp Asn Lys Asn305 310 315 320Thr Arg Ala Tyr Phe Ser Asn Tyr Gly Ala Ile Val Asp Ile Phe Ala 325 330 335Pro Gly Val Asn Ile Val Ser Thr Tyr Ile Gly Lys Lys Asp Gly Asp 340 345 350Asn Asn Arg Thr Met Thr Met Ser Gly Thr Ser Met Ala Ser Pro His 355 360 365Val Ala Gly Leu Ala Leu Tyr Leu Lys Ser Leu Asp Pro Glu Lys Tyr 370 375 380Gly Asn Ser Ser Asp Ala His Ser Gly Leu Arg Ala Leu Gly Val Pro385 390 395 400Asp Lys Val Trp Asp Ala Gly Glu Met Ser Pro Asn Leu Val Ala Tyr 405 410 415Asn Gly Val Gln Gly 420160243PRTMyceliophthora thermophila 160Met Lys Leu Ala Val Leu Ile Ala Thr Thr Ala Gly Leu Ala Ala Ala1 5 10 15Leu Pro Gln Gly Val Ala Arg Arg Gly Val Gly Arg Pro Leu His His 20 25 30Ser Gly Pro Asn Ile Arg Asn Thr Thr Tyr Pro Gln Tyr Ser Ser Asn 35 40 45Trp Ala Gly Ala Val Gln Ile Gly Thr Gly Phe Thr Ser Val Tyr Gly 50 55 60Thr Ile Thr Val Pro Ser Val His Asp Arg Asn Pro Asn Ala Ala Ala65 70 75 80Ser Ala Trp Val Gly Ile Asp Gly Asp Thr Cys Gln Gln Ala Ile Leu 85 90 95Gln Thr Gly Val Ser Phe Tyr Gly Asp Gly Ser Phe Asp Ala Trp Tyr 100 105 110Glu Trp Ile Pro Asp Tyr Ala Tyr Ser Phe Ser Asn Phe Arg Leu Ser 115 120 125Ala Gly Asp Gln Ile Arg Met Ser Val Glu Ala Ser Ser Lys Arg Ala 130 135 140Gly Val Ala Thr Leu Glu Asn Leu Ser Thr Gly Gln Lys Val Ser His145 150 155 160Thr Phe Thr Ser Thr Pro Ser Thr Leu Cys Glu Thr Asn Ala Glu Trp 165 170 175Ile Val Glu Asp Phe Gln Glu Gly Ser Ser Leu Val Pro Phe Ala Asp 180 185 190Phe Gly Thr Val Thr Phe Thr Asp Ala Tyr Ala Thr Gly Ser Ser Gly 195 200 205Thr Val Thr Pro Ser Gly Ala Thr Ile Ile Asp Ile Lys Gln Gly Asn 210 215 220Glu Val Leu Thr Asn Cys Ala Thr Ser Gly Ser Asp Leu Thr Cys Ser225 230 235 240Tyr Thr Gly161288PRTNeurospora crassa 161Met Lys Leu Leu Ser Pro Ala Ile Ser Leu Leu Gly Val Ile Ser Gln1 5 10 15Pro Ile Leu Ala Gln Phe Thr Phe Thr Ser Thr Val Glu His Asn Gly 20 25 30Val Pro Val Pro Gln Ala Glu Thr Asp Leu Lys Pro Phe Lys Pro Gly 35 40 45Thr Leu Gly Arg Ile Arg Ser Arg Thr Asp Asp Asp Ser Gly Pro Glu 50 55 60Ile Gly Thr Thr Thr Leu Arg Arg Val Lys Arg Thr Asn Pro Thr Ala65 70 75 80Asn Ser Asn Asn Trp Cys Gly Ser Val Gln Ser Thr Thr Ser Ser Asn 85 90 95Gln Ile Lys Leu Val His Gly Thr Phe Gln His Pro Thr Cys Thr Gln 100 105 110Arg Pro Gly Val Thr Gln Tyr Pro Gln Ala Ala Ala Ala Trp Ile Gly 115 120 125Ile Asp Gly Asp Ser Trp Thr Ser Ala Leu Leu Gln Ala Gly Thr Val 130 135 140Cys Lys Ile Asn Asn Ser Thr Gly Ile Val Glu Asn Glu Val Trp Trp145 150 155 160Gln Trp Val Pro Asn Gly Ala Tyr Thr Ile Thr Asn Ile Pro Val Phe 165 170 175Ala Gly Asp Trp Phe Asp Ile Thr Ile Asn Thr Thr Ser Ser Thr Ala 180 185 190Ala Thr Ile Lys Ile Met Ser Asn Arg Gly Tyr Thr Tyr Ser Val Asn 195 200 205Ala Trp Gln Gly Ala Thr Leu Ala Arg Val Asp Ala Asp Trp Val Val 210 215 220Glu Arg Pro Tyr Tyr Gly Ser Thr Leu Ala Gly Phe Ala Gln Phe Thr225 230 235 240Gln Val Trp Phe Gln Asn Ala Tyr Ala Thr Leu Thr Ser Gly Thr Ser 245 250 255Ser Leu Gly Ile Thr Gly Ala Lys Gln Tyr Gln Ile Pro Gly Gly Cys 260 265 270Ala Ser Ala Glu Tyr Asp Asn Ser Lys Leu Tyr Ala Ala Val Ala Ala 275 280 285162285PRTMyceliophthora thermophila 162Met Trp Ser Ile Val Arg Ser Leu Ser Leu Ala Ser Leu Ile Ser Ser1 5 10 15Ala Cys Thr Val Thr Ala Gln Leu Ser Phe Val Ala Ser Val Lys Gln 20 25 30His Gly Lys Asp Val Asp Ala Ser Gly Leu Ser Phe Val Arg Ile Pro 35 40 45Pro Leu Glu His Arg Trp His Ala Ser Arg Pro Arg Arg Gly Gln Asn 50 55 60Asn Arg Thr Val Glu Arg Asp Ala Val Ser Tyr Ser Ala Asn Trp Cys65 70 75 80Gly Ala Ser Gln His Ala Ser Asp Ser Asp Gly Ile Lys Ser Val Leu 85 90 95Gly Tyr Phe Thr Ala Pro Asp Leu Thr Leu Arg Pro Gly Thr Pro Ala 100 105 110Pro Gln Phe Ala Ala Ala Trp Val Gly Ile Asp Gly Ala Ala Cys Asn 115 120 125Thr Thr Leu Leu Gln Ala Gly Val Thr Thr Ile Val Asn Ser Asp Gly 130 135 140Gly Gln Ser Ala Ser Ala Trp Trp Glu Trp Tyr Pro Glu Ala Ser Tyr145 150 155 160Thr Ile Ser Gly Leu Lys Val Lys Ala Gly Glu Trp Met Ser Val Asn 165 170 175Ile Thr Thr Lys Asp Ala Ser Ser Ala Ile Leu Val Ile Glu Asn Ala 180 185 190Asp Thr Gly Thr Ser Val Thr Leu Glu Leu Asn Asn Gly Pro Gln Leu 195 200 205Cys Arg Arg Asp Ala Glu Trp Ile Leu Glu Asp Phe Tyr Glu Ser Gly 210 215 220Lys Gln Val Ala Leu Ala Asn Phe Ala Asp Leu Trp Phe Val Asp Ser225 230 235 240Gly Ala Thr Thr Val Gly Gly Lys Asn Val Gly Phe Asp Gly Ala Thr 245 250 255Met Val His Leu Arg Asp Glu Asn Gly Asn Val Leu Cys Ser Pro Glu 260 265 270Pro Tyr Asp Asn Ser Asn Phe Val Val Val Ser Lys Pro 275 280 285163307PRTMyceliophthora thermophila 163Met Lys Pro Thr Val Leu Phe Thr Leu Leu Ala Ser Gly Ala Tyr Ala1 5 10 15Ala Ala Thr Pro Ala Ile Pro Gly Tyr Ser Pro Arg Thr Arg Gly Met 20 25 30Asn Pro His His His Ala Pro Leu Arg Leu Leu His Thr Phe Thr Pro 35 40 45Ile Ser Thr Ser Gly Lys Ser Phe Arg Leu Leu Ala Ser Ser Thr Glu 50 55 60Ser Thr Lys Gly Gly Ala Ile Leu Gly Leu Pro Asp Asn Asp Leu Ser65 70 75 80Thr Val Arg Thr Thr Ile Arg Ile Pro Ala Ala Lys Met Pro Thr Ala 85 90 95Gly Pro Thr Ala Asn Asn Thr Val Gly Glu Tyr Ala Ala Ser Phe Trp 100 105 110Val Gly Ile Asp Ser Ala Thr Asp Ala Cys Gly Ala Gly Gly Ser Leu 115 120 125Arg Ala Gly Val Asp Ile Phe Trp Asp Gly Thr Leu Gly Gly Gln Gln 130 135 140Thr Pro Phe Ala Trp Tyr Gln Gly Pro Gly Gln Ala Asp Val Val Gly145 150 155 160Phe Gly Gly Gly Phe Pro Val Gly Glu Gly Asp Leu Val Arg Leu Thr 165 170 175Leu Glu Ala Gly Pro Ala Gly Gly Glu Glu Ile Ala Val Val Ala Glu 180 185 190Asn Phe Gly Arg Asn Val Thr Arg Ala Asp Glu Gly Ala Val Pro Val 195 200 205Arg Lys Val Arg Lys Val Leu Pro Ala Glu Ala Gly Gly Gln Lys Leu 210 215 220Cys Arg Gly Glu Ala Ala Trp Met Val Glu Asp Phe Pro Leu Gln Gly225 230 235 240Arg Pro Glu Phe Pro Thr Ala Leu Ala Asn Phe Thr Ser Val Thr Phe 245 250 255Asn Thr Gly Ile Thr Leu Asp Asp Gly Thr Glu Lys Asp Leu Thr Gly 260 265 270Ala Glu Val Leu Asp Ile Gln Leu Glu Ala Gln Gly Gly Arg Leu Thr 275 280 285Ser Cys Glu Val Val Asp Asp Arg Asn Val Lys Cys Ala Arg Val Val 290 295 300Gly Asp Asn305164197PRTMyceliophthora thermophila 164Met Arg Trp Pro Leu Ala Ala Leu Leu Gly Ser Ala Leu Val Ala Arg1 5 10 15Gln Ala Leu Ala Glu Leu Thr Phe Thr Val Glu Ala Thr Arg Asn Gly 20 25 30Val Pro Ile Pro Ala Ser Glu Ile Arg Leu Glu Pro Phe Glu Pro Gly 35 40 45Arg Thr Arg Met Gly Ala Val Ala Glu Ala Pro Arg Ala Gln Arg Lys 50 55 60Thr Arg Arg Ser Asn Ala Gln Ala Asp Ser Ala Asn Trp Cys Gly Ser65 70 75 80Val Asn Met Ala Pro Thr Gly Thr Asn Ile Gln Leu Ala His Gly Ser 85 90 95Phe Gln His Pro Ser Cys Ser Ile Arg Pro Gly Tyr Thr Phe Pro Gln 100 105 110Ala Ala Ala Ser Trp Val Gly Ile Asp Gly Asp Ser Tyr Arg Asp Ala 115 120 125Leu Leu Gln Ala Gly Thr Val Cys Lys Ile Asp Asn Ser Thr Gly Val 130 135 140Val Arg His Glu Ala Trp Trp Gln Trp Val Pro Ser Ala Ala Phe Thr145 150 155 160Ile Thr Ser Met Pro Gly Gln Ser Asn Thr Thr Gly Phe Cys Ile Pro 165 170 175Tyr Ser Ala Pro Phe Val Ser Leu Cys Phe Phe Gly Arg Thr Arg Thr 180 185 190Cys Leu Phe Leu His 195165621PRTMyceliophthora thermophila 165Met Leu Arg Asn Ile Phe Leu Thr Ala Ala Leu Ala Ala Phe Gly Gln1 5 10 15Cys Gly Ser Thr Val Phe Glu Ser Val Pro Ala Lys Pro Arg Gly Trp 20 25 30Thr Arg Leu Gly Asp Ala Ser Ala Asp Gln Pro Leu Arg Leu Arg Ile 35 40 45Ala Leu Gln

Gln Pro Asn Glu Asp Leu Phe Glu Arg Thr Leu Tyr Glu 50 55 60Val Ser Asp Pro Ser His Ala Arg Tyr Gly Gln His Leu Ser Arg Asp65 70 75 80Glu Leu Ser Ala Leu Leu Ala Pro Arg Ala Glu Ser Thr Ala Ala Val 85 90 95Leu Asn Trp Leu Arg Asp Ala Gly Ile Pro Ser Asp Lys Ile Glu Glu 100 105 110Asp Gly Glu Trp Ile Asn Leu Arg Val Thr Val Arg Glu Ala Ser Glu 115 120 125Leu Leu Asp Ala Asp Phe Gly Val Trp Ala Tyr Glu Gly Thr Asn Val 130 135 140Lys Arg Val Arg Ala Leu Gln Tyr Ser Val Pro Glu Glu Ile Ala Pro145 150 155 160His Ile Arg Met Val Ala Pro Val Val Arg Phe Gly Gln Ile Arg Pro 165 170 175Glu Arg Ser Gln Val Phe Glu Val Val Glu Thr Ala Pro Ser Gln Val 180 185 190Lys Val Ala Ala Ala Ile Pro Pro Gln Asp Leu Asp Val Lys Ala Cys 195 200 205Asn Thr Ser Ile Thr Pro Glu Cys Leu Arg Ala Leu Tyr Lys Val Gly 210 215 220Ser Tyr Gln Ala Glu Pro Ser Lys Lys Ser Leu Phe Gly Val Ala Gly225 230 235 240Tyr Leu Glu Gln Trp Ala Lys Tyr Asp Gln Leu Glu Leu Phe Ala Ser 245 250 255Thr Tyr Ala Pro Tyr Ala Ala Asp Ala Asn Phe Thr Ser Val Gly Val 260 265 270Asn Gly Gly Glu Asn Asn Gln Gly Pro Ser Asp Gln Gly Asp Ile Glu 275 280 285Ala Asn Leu Asp Ile Gln Tyr Ala Val Ala Leu Ser Tyr Lys Thr Pro 290 295 300Ile Thr Tyr Tyr Ile Thr Gly Gly Arg Gly Pro Leu Val Pro Asp Leu305 310 315 320Asp Gln Pro Asp Pro Asn Asp Val Ser Asn Glu Pro Tyr Leu Glu Phe 325 330 335Phe Ser Tyr Leu Leu Lys Leu Pro Asp Ser Glu Leu Pro Gln Thr Leu 340 345 350Thr Thr Ser Tyr Gly Glu Asp Glu Gln Ser Val Pro Arg Pro Tyr Ala 355 360 365Glu Lys Val Cys Gln Met Ile Gly Gln Leu Gly Ala Arg Gly Val Ser 370 375 380Val Ile Phe Ser Ser Gly Asp Thr Gly Val Gly Ser Ala Cys Gln Thr385 390 395 400Asn Asp Gly Lys Asn Thr Thr Arg Phe Leu Pro Ile Phe Pro Gly Ala 405 410 415Cys Pro Tyr Val Thr Ser Ile Gly Ala Thr Arg Tyr Val Glu Pro Glu 420 425 430Gln Ala Ala Ala Phe Ser Ser Gly Gly Phe Ser Asp Ile Phe Lys Arg 435 440 445Pro Ala Tyr Gln Glu Ala Ala Val Ser Thr Tyr Leu His Lys His Leu 450 455 460Gly Ser Arg Trp Lys Gly Leu Tyr Asn Pro Gln Gly Arg Gly Phe Pro465 470 475 480Asp Val Ser Ala Gln Gly Val Ala Tyr His Val Phe Ser Gln Asp Lys 485 490 495Asp Ile Lys Val Ser Gly Thr Ser Ala Ser Ala Pro Leu Phe Ala Ala 500 505 510Leu Val Ser Leu Leu Asn Asn Ala Arg Leu Ala Gln Gly Arg Pro Pro 515 520 525Leu Gly Phe Leu Asn Pro Trp Leu Tyr Ser Glu Lys Val Gln Lys Ala 530 535 540Gly Ala Leu Thr Asp Ile Val His Gly Gly Ser Ser Gly Cys Thr Gly545 550 555 560Lys Asp Met Tyr Ser Gly Leu Pro Thr Pro Tyr Val Pro Tyr Ala Ser 565 570 575Trp Asn Ala Thr Pro Gly Trp Asp Pro Val Thr Gly Leu Gly Thr Pro 580 585 590Val Phe Asp Lys Leu Leu Glu Leu Ser Ser Pro Gly Lys Lys Leu Pro 595 600 605His Ile Gly Gly Gly His Gly His Gly Ala Gly Gly His 610 615 620166587PRTNeurospora crassa 166Met Leu Trp Ser Val Leu Leu Leu Ala Ala Gly Ala Ser Ala His Val1 5 10 15Lys Ser Ser Leu Pro Ser Val Pro Ser Gly Trp Lys Lys Val Arg Ala 20 25 30Ala Ser Ala Asp Glu Ser Val Ser Leu Lys Ile Ala Leu Pro Ala His 35 40 45Gln Pro Asp Ala Leu Glu Thr Ala Ile Leu Arg Val Ser Asp Pro Asn 50 55 60His His Glu Tyr Gly Met His Leu Ser Ser Glu Glu Val Arg Ser Leu65 70 75 80Val Ala Pro Ala Asp Glu Thr Thr Asp Ala Val Thr Ser Trp Leu Asn 85 90 95Arg Asn Gly Ile Lys Gly Lys Val Asp Asn Asp Trp Val Ser Phe Thr 100 105 110Thr Ser Val Ala Lys Ala Asn Asn Leu Leu Asn Thr Thr Phe Asp Trp 115 120 125Tyr Gln Gln Asp Gly Asp Lys Thr Gly Pro Lys Leu Arg Thr Leu Gln 130 135 140Tyr Ser Val Pro Asp Glu Leu Asp Ala His Val Asp Met Ile Gln Pro145 150 155 160Thr Thr Arg Phe Gly Lys Leu Ala Ala Lys Ala Ser Thr Ile Phe Glu 165 170 175Ile Phe Asp Glu Pro Glu Pro Lys Asn Ile Ala Asn Val Lys Val Gly 180 185 190Gly Asp His Pro Thr Cys Thr Gly Cys Ile Tyr Pro Asp Glu Ile Arg 195 200 205Ser Leu Tyr Asn Ile Lys Tyr Lys Pro Ser Ala Ser Asp Lys Asn Thr 210 215 220Ile Ala Phe Ala Ser Tyr Leu Glu Gln Tyr Ser Asn Tyr Asp Asp Phe225 230 235 240Thr Ser Phe Ala Lys Ala Phe Ile Pro Asp Ala Ala Asp Arg Asn Tyr 245 250 255Thr Val Lys Leu Val Lys Gly Gly Leu His Asp Gln Ser Pro Asp Lys 260 265 270Ile Gly Val Glu Ala Asn Leu Asp Leu Gln Tyr Ile Leu Ala Ile Ser 275 280 285Asn Pro Ile Pro Ile Arg Glu Tyr Ser Ile Gly Gly Arg Gly Pro Leu 290 295 300Val Pro Thr Ala Asn Gln Pro Gly Pro Glu Ile Ser Asn Glu Pro Tyr305 310 315 320Leu Asp Phe Phe Gln Tyr Leu Leu Ser Leu Lys Asn Ser Glu Leu Pro 325 330 335Ala Thr Leu Ser Thr Ser Tyr Gly Glu Glu Glu Gln Ser Val Pro Arg 340 345 350Glu Tyr Ala Leu Lys Val Cys Ser Met Ile Gly Gln Leu Gly Ala Arg 355 360 365Gly Val Ser Val Ile Phe Ser Ser Gly Asp Ser Gly Pro Gly Asp Ala 370 375 380Cys Ile Arg Asn Asp Gly Thr Asn Ser Thr Tyr Phe Glu Pro Thr Phe385 390 395 400Pro Gly Ala Cys Pro Trp Val Thr Ser Val Gly Gly Thr Tyr Gln Thr 405 410 415Gly Pro Glu Lys Ala Val Asp Phe Ser Ser Gly Gly Phe Ser Met Tyr 420 425 430His Lys Arg Pro Val Tyr Gln Glu Arg Val Val Lys Lys Tyr Leu Asp 435 440 445Lys Ile Gly Asp Thr Tyr Ser Asp Phe Phe Asp Glu Gln Gly Arg Gly 450 455 460Phe Pro Asp Val Ser Ala Gln Ala Ser Arg Tyr Ala Val Tyr Val Asp465 470 475 480Gly Arg Leu Val Gly Val Ser Gly Thr Ser Ala Ser Ala Pro Met Phe 485 490 495Ala Gly Leu Val Ala Leu Leu Asn Ala Ala Arg Lys Ser His Gly Leu 500 505 510Pro Ser Leu Gly Phe Ile Asn Pro Leu Leu Tyr Ala Ser Lys Asp Ala 515 520 525Phe Thr Asp Ile Val Asn Gly Ala Gly Thr Gly Cys Arg Gly Arg Pro 530 535 540Glu Phe Ala Gly Asp Val Gly Gly Thr Ala Lys Trp Asn Ala Thr Glu545 550 555 560Gly Trp Asp Pro Val Thr Gly Leu Gly Thr Pro Lys Phe Asp Lys Leu 565 570 575Leu Ala Leu Ala Ala Pro Gly Val Lys Asn Ala 580 585167720PRTMyceliophthora thermophila 167Met Arg Ile Arg His Ala Leu Val Gly Ile Ala Ser Leu Cys Cys Leu1 5 10 15Leu Gly Thr Ala Ser Gly Ala Arg Ile Ser Ser Arg Asp Met Leu Ser 20 25 30Arg Arg Val Val Pro Pro Ser His Thr Leu His Glu Arg His Glu Ala 35 40 45Gly Asn Val Glu Gly Trp Val Lys Arg Gly Leu Ala Asp Ala Glu Ser 50 55 60Thr Val Pro Val Arg Ile Gly Leu Lys Gln Ser Asn Val Asp Ala Ala65 70 75 80His Asp Leu Leu Met Asp Ile Ser Asp Pro Arg Ser Pro Asn Tyr Gly 85 90 95Lys His Leu Ser Arg Ser Glu Val Glu Asp Leu Phe Ala Pro Arg Glu 100 105 110His Ser Val Ala Lys Val Lys Arg Trp Leu Ala Ser Ala Gly Val Asp 115 120 125Glu Gly Arg Ile Ser Gln Ser Ala Asn Lys Gln Trp Ile Gln Phe Asp 130 135 140Ala Pro Val Tyr Glu Leu Glu Lys Leu Leu Leu Thr Arg Tyr His Ile145 150 155 160Phe Glu Asn Leu Glu Thr Gly Val Gln Asn Ile Ala Cys Ser Glu Tyr 165 170 175His Val Pro Arg Asp Val Ser His His Ile Asp Tyr Ile Thr Pro Gly 180 185 190Ile Lys Leu Met Ala Gly Gly Arg Glu Glu Arg Met Val Arg Trp Arg 195 200 205Lys Ala Asp Arg Arg Ser Leu Val Ala Gly Leu Ala Ser Gln Gly Arg 210 215 220Lys Gly Ala His Gly Met Gly His Gly Gly Gly Gly Gly Ser Arg Ser225 230 235 240Pro Asp Asp Pro Val Val Asp Asp Ser Pro Phe Arg Val Thr Gly Pro 245 250 255Cys Ser Ala Glu Ile Thr Pro Asn Cys Ile Arg Ala Gln Tyr Gln Leu 260 265 270Pro Asn Gly Thr Arg Ala Ala Ser Gly Asn Glu Leu Gly Ile Phe Gln 275 280 285Gly Leu Gly Gln His Tyr Ser Gln Glu Asp Leu Asp Asn Tyr Trp Lys 290 295 300Tyr Val Ala Pro Trp Val Pro Arg Gly Thr His Pro Glu Leu Arg Ser305 310 315 320Ile Asn Gly Ala Leu Gly Pro Ala Asn Asp Thr Leu Arg Ala Gly Glu 325 330 335Glu Ala Asp Leu Asp Phe Gln Ile Ala Ile Pro Leu Ile Trp Pro Gln 340 345 350Arg Thr Val Leu Phe Gln Thr Asp Asp Glu Trp Tyr Gln Gln Asp Gln 355 360 365Gln Arg Ala Asp Thr Lys Tyr Pro Gly Phe Phe Asn Thr Phe Phe Asp 370 375 380Ala Ile Asp Gly Ser Tyr Cys His Met Thr Ala Phe Asn Met Thr Gly385 390 395 400Asn Cys Val Thr Pro Glu Cys Arg Asp Pro Glu Tyr Pro Asn Pro Asn 405 410 415Ala Thr Pro Glu Gln Gly Gly Tyr Ala Gly Ala Leu Met Cys Gly Arg 420 425 430His Arg Pro Thr Ser Val Val Ser Val Ser Tyr Ser Gly Thr Glu Asp 435 440 445Ser Trp Pro Ala Ser Tyr Met Arg Arg Gln Cys Leu Glu Val Leu Lys 450 455 460Leu Ala Leu Gln Gly Val Thr Val Val Glu Ser Ser Gly Asp Phe Gly465 470 475 480Val Gly Gly Arg Pro Phe Asp Pro Arg Ala Gly Cys Leu Gly Pro Asp 485 490 495Arg Ala Val Phe Ser Pro Arg Val Met Ala Asn Cys Pro Tyr Val Leu 500 505 510Ser Val Gly Ala Thr Ala Leu Val Asp Pro Glu Gln Glu Gln Gln Gln 515 520 525Gln His Ala Asp Arg Gly Gly Ser Gly Lys Glu Pro Arg Leu Val Glu 530 535 540Val Ala Ala Arg Thr Phe Ala Ser Gly Gly Gly Phe Ser Asn Ile Phe545 550 555 560Gly Arg Pro Lys Trp Gln Asp Arg His Val Arg Glu Tyr Leu Arg Lys 565 570 575Thr Asn Leu Ser Glu Leu Gly Tyr Asp Asn Ala Ala Gly Met Ser Phe 580 585 590Asp Ser Leu Arg Pro Pro Pro Ala Gly Gly Lys Leu Phe Asn Arg Leu 595 600 605Gly Arg Gly Tyr Pro Asp Val Ala Ala Val Gly Gln Asn Phe Arg Val 610 615 620Val Leu Arg Gly Tyr Pro Asn Arg Met His Gly Thr Ser Ala Ala Ala625 630 635 640Pro Val Trp Ala Ser Ile Leu Thr Leu Ile Asn Glu Glu Arg Arg Ala 645 650 655Val Gly Lys Gly Pro Val Gly Phe Val His Gln Val Leu Tyr Gln His 660 665 670Pro Glu Val Phe Thr Asp Ile Thr Val Gly Ser Asn Pro Gly Cys Gly 675 680 685Thr Asp Gly Phe Pro Val Glu Glu Gly Trp Asp Pro Val Thr Gly Leu 690 695 700Gly Ser Pro Ile Tyr Pro Lys Leu Leu Lys Leu Phe Met Ser Leu Pro705 710 715 720168719PRTNeurospora crassa 168Met Phe Arg Phe His Leu Trp Thr Leu Leu Arg Leu Phe Ala Leu Leu1 5 10 15Ser Ser Leu Val Thr Ala Ser Arg Ile Val Leu Glu Glu Ala Gly His 20 25 30Leu Pro Ala Gly Trp Lys Val Glu Arg His Ala Thr Ala Ser Asp Arg 35 40 45Ile Gln Leu Ser Ile Ala Leu Lys Glu Pro Gly Ile Glu Glu Leu Lys 50 55 60Arg Arg Leu Leu Gln Gln Ser Thr Ser Asp Asp His Pro Asn Ser Arg65 70 75 80Gln Phe Thr Lys Glu Glu Val Glu Lys His Arg Gln Pro Asp Gln Arg 85 90 95Ser Val Thr Ala Val Gly Arg Trp Leu Gln Ser His Gly Ile Lys Ser 100 105 110Tyr Asn Ala Asp Asn Ser Trp Ile Thr Phe Lys Ala Thr Ala Ala Thr 115 120 125Val Gln Met Leu Phe Glu Ala Asp Leu Ala Tyr Tyr Ser Tyr Asn Gly 130 135 140Asp Pro Ser Thr Gln Ile Leu Arg Ser Arg Ser Tyr Thr Ile Pro Arg145 150 155 160Trp Leu Ser Asp Asp Ile Asp Phe Val His Pro Leu Thr Asn Phe Met 165 170 175Pro Pro Arg Asn Arg Asn Asp Gly Thr Leu Gly Ile Gly Arg Arg Gln 180 185 190Pro Ile Gln Pro Lys Leu Ser Ala Arg Glu Asp Phe Phe Ala Pro Pro 195 200 205Cys Trp Thr Gly Thr Phe Pro Gly Cys Ile Arg Lys Leu Tyr Asn Leu 210 215 220Thr Tyr Thr Pro Ser Pro Asp Phe Arg Ser Pro Ser Pro Val Arg Phe225 230 235 240Gly Ile Ala Ser Phe Leu Glu Gln Tyr Ile Thr His Arg Asp Val Thr 245 250 255Ser Phe Leu Ala Thr Tyr Ala Arg Glu Leu Leu Pro Leu Arg Pro Thr 260 265 270Pro Ser Arg Gly Gly Ser Gly Gly Ser Leu Thr Leu Pro Pro Val Thr 275 280 285Asn Thr Thr Ser Glu Pro Pro Tyr Asn Ile Thr Ile Thr Leu Leu Asn 290 295 300Asn Ala Thr Arg Trp Asp Pro His Ser Thr Asp Pro Ala Leu Ser Gly305 310 315 320Leu Glu Ala Asn Leu Asp Val Gln Tyr Ala Leu Ser Leu Gly His Pro 325 330 335Thr Arg Val Ile Tyr Tyr Ala Thr Gly Gly Arg Gly Thr Lys Leu Asp 340 345 350Ser Ser Gly Arg Pro Leu Pro Thr Asn Asp Pro Arg Ala Asn Asn Glu 355 360 365Pro Phe Leu Glu Phe Leu Gln Ala Leu Leu Ala Leu Pro Asp Asn Gln 370 375 380Ile Pro His Val Leu Ser Ile Ser Tyr Ala Asp Asp Glu Gln Ser Val385 390 395 400Pro Arg Lys Tyr Ala His Arg Val Cys Asp Leu Phe Ala Ala Val Ala 405 410 415Ala Arg Gly Thr Ser Val Leu Val Ala Thr Gly Asp Gly Gly Ala Ala 420 425 430Gly Ile Gly Phe Ser Ala Gly Gly Gly Asp Thr Cys Ile Lys Asn Asp 435 440 445Gly Ser Gly Arg Arg Ala Phe Val Pro Thr Phe Pro Ala Ser Cys Pro 450 455 460Trp Val Thr Ser Val Gly Ala Thr Asp Asn Thr Ala Leu Asn Leu Thr465 470 475 480Gly Ala Ala Phe Ser Ser Gly Gly Phe Ser Glu Tyr Phe Asp Arg Pro 485 490 495Leu Trp Gln Arg Ala Ala Val Asp Pro Tyr Val Ser Ser Leu Leu Arg 500 505 510Ser Arg Ser Ser Lys Pro Gly Gln Pro Ser Gln Pro Arg Asp Leu Lys 515 520 525Gly Val Tyr Phe Ser His Asn Gly Arg Gly Met Pro Asp Met Ala Ala 530 535 540Ile Gly Ser Gly Phe Gln Ile Ile His Arg Gly Glu Met Val Glu Val545 550 555 560Arg Gly Thr Ser Ala Ser Thr Pro Val Val Ala Ala Met Val Ala Leu 565 570 575Val Asn Asp Gln Arg Leu Arg Gln Gly Lys Arg Ser Leu Gly Trp Leu

580 585 590Asn Gly His Leu Tyr Leu Asp Pro Arg Val Arg Arg Val Leu Thr Asp 595 600 605Val Lys Trp Gly Arg Ser Glu Gly Cys Val Phe Pro Gly Glu Ala Leu 610 615 620Glu Glu Gly Arg Gly Lys Gly Lys Glu Lys Tyr Trp Arg His Ser Val625 630 635 640Val Glu Lys Arg Gln Gly Asn Ser Glu Glu Asp Gly Gly Thr His Gly 645 650 655Gly Asp Gly Glu Gly Lys Ala Asp Glu Glu Asp Trp Gly Gly Glu Gly 660 665 670Glu Val Gly Glu Gly Glu Gly Asp Gln Ser Glu Asn Val Ile Leu Gly 675 680 685Gly Trp Asp Ala Arg Lys Gly Trp Asp Pro Val Thr Gly Leu Gly Val 690 695 700Pro Gly Asp Phe Gln Glu Met Leu Lys Val Leu Gly Ser Val Trp705 710 715169454PRTNeurospora crassa 169Met Arg Ala Thr Leu Val Val Val Leu Cys His Leu Ser Leu Ala Phe1 5 10 15Ala Leu Ala Ile Ser Pro Ala Ala Ser His Trp Lys Arg Ser Ala Arg 20 25 30Leu Ala Ser Asp Gln Thr Ala Ser Glu Arg Tyr Ser Leu Pro Ser Arg 35 40 45Val Ala Arg Tyr Ile Asp Tyr Val Leu Pro Ala Pro Asp Pro Asp Pro 50 55 60Val Ser Ser Ala Pro Lys Ser Val Ala Val Gln Asp Pro Pro Thr Leu65 70 75 80Lys Gly Val Ile Gly Ala Arg Gln Thr Arg Asp Val Asp Cys Leu Gln 85 90 95Tyr Ile Ala Pro Gln Cys Leu Arg Gln Leu Ala Trp Leu Ala Glu Asp 100 105 110Leu Asp Met Phe Phe Gly Asp Phe Ala Pro Asp Leu Leu Thr Asn Phe 115 120 125Asn Leu Glu Pro Asn Leu Asp Tyr Lys Tyr Thr Met Ala Met Ala Lys 130 135 140Pro Ile Pro Val Thr Asn Ile Gln Val Gly Asp Phe Val Val Gln Gly145 150 155 160Asn Met Asn Ile Met Leu Ala Ala Phe Asn Ala His Tyr Cys Arg Thr 165 170 175Gly Leu Asp Pro Gln Phe Asp Pro Val Tyr Pro Asn Pro Ala Pro Gly 180 185 190Gly Tyr Asn Ala Ser Asp Cys Gly Thr His Val Pro Pro Arg Val Ile 195 200 205Ala Ile Met Tyr Ala Trp Asn Lys Ala Trp Tyr Ser Asp Ala Asp Phe 210 215 220Ala Ser Ile Phe Pro Ala Ser Asp Pro Trp Val Thr Ser Val Gly Gly225 230 235 240Thr Gln Phe Leu Pro Val Val Ser Asn Gly Ser Ser Ser Thr Thr Ala 245 250 255Ser Ser Gly Met Pro Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser 260 265 270Ser Ser Ser Ser Ser Ser Ser Ser Ser Leu Phe Pro Gly Glu Thr Ala 275 280 285Leu Asp Asp Asn Asn Thr Gly Ser Ser Gly Gly Ser Phe Ser Arg Leu 290 295 300Phe Pro Gly Pro Trp Tyr Gln Gly Asn Leu Thr Arg Glu Tyr Leu Ala305 310 315 320Ser Ala Pro Gly Ala Ala Glu Leu Ala Arg Gln Gly Tyr Phe Asn Gly 325 330 335Ser Gly Arg Gly Tyr Pro Asp Ile Ser Ala Met Ala Arg Ser Phe Leu 340 345 350Val Ala Leu His Gly Gly Tyr His Ala Val Ser Gly Thr Ser Ala Ser 355 360 365Thr Pro Val Val Ala Ala Met Val Ala Lys Ile Asn Asp Ala Arg Leu 370 375 380His Ala Gly Lys Ser Thr Val Gly Phe Leu Asn Pro Val Leu Tyr Ser385 390 395 400Ala Ala Ala Gly Lys Ala Gly Val Leu Arg Asp Val Pro Leu Gly Lys 405 410 415Asn His Asp Cys Gly Val Gly Glu Ala Phe Pro Ala Arg Arg Ala Trp 420 425 430Asp Ala Val Thr Gly Leu Gly Thr Pro Asp Phe Glu Lys Leu Lys Glu 435 440 445Leu Tyr Leu Gly Leu Pro 45017050PRTAspergillus niger 170Ile Val Thr Trp Asp Glu Ala His Phe Gly Lys Phe Gly Ser His Tyr1 5 10 15Leu Lys Arg Glu Phe Tyr Phe Asp Val His Pro Pro Leu Gly Lys Met 20 25 30Leu Val Gly Leu Ser Gly Phe Leu Ala Gly Tyr Asn Gly Ser Phe Glu 35 40 45Phe Lys 5017150PRTAspergillus oryzae 171Ile Val Thr Trp Asp Glu Ala His Phe Gly Lys Phe Gly Ser His Tyr1 5 10 15Leu Lys Arg Glu Phe Tyr Phe Asp Val His Pro Pro Leu Gly Lys Met 20 25 30Leu Val Gly Leu Ser Gly Tyr Leu Ala Gly Tyr Asn Gly Ser Phe Glu 35 40 45Phe Lys 5017250PRTAspergillus nidulans 172Ile Val Thr Trp Asp Glu Ala His Phe Gly Lys Phe Gly Ser His Tyr1 5 10 15Leu Lys Arg Glu Phe Tyr Phe Asp Val His Pro Pro Leu Gly Lys Met 20 25 30Leu Val Gly Leu Ser Gly Leu Leu Ala Gly Tyr Asn Gly Ser Phe Glu 35 40 45Phe Lys 5017350PRTMyceliophthora thermophila 173Ile Val Thr Trp Asp Glu Ala His Phe Gly Lys Phe Gly Ser His Tyr1 5 10 15Leu Lys Arg Glu Phe Tyr Phe Asp Val His Pro Pro Ala Gly Lys Leu 20 25 30Leu Val Gly Leu Ser Gly Tyr Leu Ala Gly Tyr Asn Gly Ser Phe Glu 35 40 45Phe Lys 5017450PRTNeurospora crassa 174Ile Val Thr Trp Asp Glu Ala His Phe Gly Lys Phe Gly Ser His Tyr1 5 10 15Leu Lys Arg Glu Phe Tyr Phe Asp Val His Pro Pro Ala Gly Lys Leu 20 25 30Leu Val Gly Leu Ser Gly Leu Leu Ala Gly Tyr Asn Gly Ser Phe Glu 35 40 45Phe Lys 5017550PRTTrichoderma virens 175Ile Val Thr Trp Asp Glu Ala His Phe Gly Lys Phe Gly Ser Tyr Tyr1 5 10 15Ile Lys His Glu Tyr Tyr Phe Asp Val His Pro Pro Leu Gly Lys Met 20 25 30Leu Val Gly Leu Ser Gly Val Leu Ala Gly Tyr Asn Gly Ser Phe Glu 35 40 45Phe Lys 5017650PRTTrichoderma reesei 176Ile Val Thr Trp Asp Glu Ala His Phe Gly Lys Phe Gly Ser Tyr Tyr1 5 10 15Ile Lys His Glu Tyr Tyr Phe Asp Val His Pro Pro Leu Gly Lys Met 20 25 30Leu Val Gly Leu Ser Gly Val Leu Ala Gly Tyr Asn Gly Ser Phe Glu 35 40 45Phe Lys 5017750PRTFusarium oxysporum 177Ile Val Thr Trp Asp Glu Ala His Phe Gly Lys Phe Gly Ser Tyr Tyr1 5 10 15Ile Lys His Glu Tyr Tyr Phe Asp Val His Pro Pro Leu Gly Lys Met 20 25 30Leu Val Gly Leu Ser Gly Val Leu Ala Gly Tyr Asn Gly Thr Phe Glu 35 40 45Phe Lys 5017850PRTNeurospora crassa 178Ser Val Val Phe Asp Glu Val His Phe Gly Gly Phe Ala Ser Lys Tyr1 5 10 15Ile Lys Gly Lys Phe Phe Met Asp Val His Pro Pro Leu Ala Lys Leu 20 25 30Met Ile Thr Leu Phe Gly Trp Leu Ala Gly Phe Asp Gly Ser Phe Asp 35 40 45Phe Lys 5017950PRTMyceliophthora thermophila 179Ser Val Val Phe Asp Glu Val His Phe Gly Gly Phe Ala Thr Lys Tyr1 5 10 15Ile Lys Gly Lys Phe Phe Met Asp Val His Pro Pro Leu Ala Lys Leu 20 25 30Met Ile Thr Leu Phe Gly Trp Leu Ala Gly Phe Lys Gly Asn Phe Asp 35 40 45Phe Lys 5018050PRTTrichoderma virens 180Ser Val Val Phe Asp Glu Val His Phe Gly Gly Phe Ala Ser Lys Tyr1 5 10 15Ile Lys Gly Lys Phe Phe Met Asp Val His Pro Pro Leu Ala Lys Met 20 25 30Leu Ile Ala Leu Thr Gly Trp Leu Ala Gly Phe Asp Gly Asn Phe Asp 35 40 45Phe Lys 5018150PRTTrichoderma atroviride 181Ser Val Val Phe Asp Glu Val His Phe Gly Gly Phe Ala Ser Lys Tyr1 5 10 15Ile Lys Gly Arg Phe Phe Met Asp Val His Pro Pro Leu Ala Lys Met 20 25 30Leu Ile Ala Leu Thr Gly Trp Leu Ala Gly Phe Asp Gly Asp Phe Asp 35 40 45Phe Lys 5018250PRTTrichoderma reesei 182Ser Val Val Phe Asp Glu Val His Phe Gly Gly Phe Ala Ser Lys Tyr1 5 10 15Ile Lys Gly Arg Phe Phe Met Asp Val His Pro Pro Leu Ala Lys Met 20 25 30Leu Ile Ala Leu Thr Gly Trp Leu Ala Gly Phe Asp Gly Asn Phe Asp 35 40 45Phe Lys 5018350PRTFusarium oxysporum 183Ser Val Val Phe Asp Glu Val His Phe Gly Gly Phe Ala Thr Lys Tyr1 5 10 15Ile Lys Gly Lys Phe Phe Met Asp Val His Pro Pro Leu Ala Lys Met 20 25 30Leu Ile Ala Leu Thr Gly Trp Leu Ala Gly Phe Asp Gly Ser Phe Asp 35 40 45Phe Lys 5018450PRTAspergillus nidulans 184Ser Val Val Phe Asp Glu Val His Phe Gly Gly Phe Ala Thr Lys Tyr1 5 10 15Ile Lys Gly Arg Phe Phe Met Asp Val His Pro Pro Leu Ala Lys Leu 20 25 30Leu Ile Thr Leu Ala Gly Trp Leu Ala Gly Phe Lys Gly Asp Phe Asp 35 40 45Phe Lys 5018550PRTAspergillus oryzae 185Ser Val Val Phe Asp Glu Val His Phe Gly Gly Phe Ala Ser Lys Tyr1 5 10 15Ile Lys Gly Arg Phe Phe Met Asp Val His Pro Pro Leu Ala Lys Leu 20 25 30Leu Ile Thr Leu Ala Gly Trp Leu Ala Gly Phe Asn Gly Asp Phe Asp 35 40 45Phe Lys 5018650PRTAspergillus niger 186Ser Val Val Phe Asp Glu Val His Phe Gly Gly Phe Ala Thr Lys Tyr1 5 10 15Ile Lys Gly Arg Phe Phe Met Asp Val His Pro Pro Leu Ala Lys Leu 20 25 30Leu Ile Thr Leu Ala Gly Trp Leu Ala Gly Phe Asp Gly Glu Phe Asp 35 40 45Phe Lys 5018750PRTPenicillium chrysogenum 187Ser Val Val Phe Asp Glu Val His Phe Gly Gly Phe Ala Ser Lys Tyr1 5 10 15Ile Lys Gly Lys Phe Phe Met Asp Val His Pro Pro Leu Ala Lys Leu 20 25 30Leu Leu Thr Leu Ala Gly Trp Leu Ala Gly Phe Asp Gly Asn Phe Asp 35 40 45Phe Lys 5018850PRTTrichoderma reesei 188Glu Val Val Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr1 5 10 15Leu Gln Arg Thr Tyr Phe Phe Asp Val His Pro Pro Phe Ala Lys Leu 20 25 30Leu Phe Ala Phe Val Gly Trp Leu Val Gly Tyr Asp Gly His Phe His 35 40 45Phe Asp 5018950PRTTrichoderma virens 189Glu Val Val Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr1 5 10 15Leu Gln Arg Thr Tyr Phe Phe Asp Val His Pro Pro Phe Ala Lys Leu 20 25 30Leu Phe Ala Phe Val Gly Trp Leu Val Gly Tyr Asp Gly His Phe His 35 40 45Phe Glu 5019050PRTFusarium oxysporum 190Glu Val Val Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr1 5 10 15Leu Glu Arg Thr Tyr Phe Phe Asp Val His Pro Pro Phe Gly Lys Leu 20 25 30Leu Phe Ala Phe Val Gly Trp Leu Val Gly Tyr Asp Gly Asn Phe His 35 40 45Phe Glu 5019150PRTGibberella zeae 191Glu Val Val Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr1 5 10 15Leu Glu Arg Thr Tyr Phe Phe Asp Val His Pro Pro Phe Gly Lys Leu 20 25 30Leu Phe Ala Phe Val Gly Trp Leu Val Gly Tyr Asp Gly His Phe His 35 40 45Phe Asp 5019250PRTMyceliophthora thermophila 192Glu Val Val Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr1 5 10 15Leu Glu Arg Thr Tyr Phe Phe Asp Val His Pro Pro Leu Gly Lys Leu 20 25 30Leu Phe Ala Phe Met Gly Trp Leu Val Gly Tyr Asp Gly His Phe His 35 40 45Phe Glu 5019350PRTNeurospora crassa 193Glu Val Val Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr1 5 10 15Leu Glu Arg Thr Tyr Phe Phe Asp Val His Pro Pro Phe Gly Lys Leu 20 25 30Leu Phe Ala Phe Met Gly Trp Leu Val Gly Tyr Asp Gly His Phe His 35 40 45Phe Glu 5019450PRTAspergillus nidulans 194Gln Val Val Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr1 5 10 15Leu Arg Arg Thr Tyr Phe Phe Asp Val His Pro Pro Phe Ala Lys Leu 20 25 30Leu Leu Ala Phe Thr Gly Trp Leu Val Gly Tyr Asp Gly His Phe Leu 35 40 45Phe Glu 5019550PRTAspergillus niger 195Glu Val Val Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr1 5 10 15Leu Gln Arg Thr Tyr Phe Phe Asp Val His Pro Pro Phe Gly Lys Leu 20 25 30Leu Phe Ala Phe Met Gly Trp Leu Val Gly Tyr Asp Gly His Phe Leu 35 40 45Phe Asp 5019650PRTAspergillus oryzae 196Glu Val Val Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr1 5 10 15Leu Gln Arg Thr Tyr Phe Phe Asp Val His Pro Pro Phe Gly Lys Leu 20 25 30Leu Phe Ala Ala Val Gly Trp Leu Ile Gly Tyr Asp Gly His Phe Leu 35 40 45Phe Glu 5019750PRTPenicillium chrysogenum 197Glu Val Val Phe Asp Glu Val His Phe Gly Lys Phe Ala Ser Tyr Tyr1 5 10 15Leu Gln Arg Thr Tyr Phe Phe Asp Val His Pro Pro Phe Gly Lys Leu 20 25 30Leu Phe Ala Leu Met Gly Trp Leu Val Gly Phe Asp Gly Ser Phe Leu 35 40 45Phe Glu 50

Claims

1-16. (canceled)

17. A Protein O-mannosyltransferase (PMT)-deficient filamentous fungal cell comprising a) a first mutation in a gene encoding an endogenous protease that eliminates an endogenous protease activity as compared to a parental filamentous fungal cell which does not have said first mutation; b) a second mutation in a PMT gene that reduces endogenous O-mannosyltransferase activity compared to a parental filamentous fungal cell which does not have said second mutation; and c) a polynucleotide encoding a light chain of an antibody and a polynucleotide encoding a heavy chain of an antibody; wherein: the antibody is secreted by the PMT-deficient filamentous fungal cell upon expression of the polynucleotides encoding the light chain and the heavy chain of the antibody; said antibody comprising reduced O-mannosylation on the light chain, said reduced O-mannosylation being less than about 10% that of a light chain secreted by said parental filamentous fungal cell which does not have said second mutation, O-mannosylation being defined as mole % of mannose residues per polypeptide chain; and said filamentous fungal cell is a Trichoderma or Myceliophthora cell.

18. The PMT-deficient filamentous fungal cell of claim 17, wherein said second mutation that reduces the endogenous O-mannosyltransferase activity is a deletion or a disruption of a PMT gene encoding the endogenous protein O-mannosyltransferase activity.

19. The PMT-deficient filamentous fungal cell of claim 17, wherein said second mutation in a PMT gene is a mutation in either: a) PMT1 gene comprising the polynucleotide of SEQ ID NO:1, b) a functional homologous gene of PMT1 gene, which functional homologous gene is capable of restoring parental O-mannosylation level by functional complementation when introduced into a T. reesei strain having a disruption in said PMT1 gene, or c) a polynucleotide encoding a polypeptide having at least 50% identity with SEQ ID NO:2, said polypeptide having O-mannosyltransferase activity.

20. The PMT-deficient filamentous fungal cell of claim 17, wherein the reduced endogenous O-mannosyltransferase activity results from a deletion or a disruption of a PMT1 gene encoding a polypeptide of SEQ ID NO:2 or SEQ ID NO:12.

21. The PMT-deficient filamentous fungal cell of claim 17, wherein said cell has a third mutation that reduces or eliminates the level of expression of a dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase (ALG3) gene compared to the level of expression in a parental cell which does not have such third mutation.

22. The PMT-deficient filamentous fungal cell of claim 17, further comprising one or more polynucleotides encoding a polypeptide selected from the group consisting of: a) .alpha.1,2 mannosidase; b) N-acetylglucosaminyltransferase I catalytic domain; c) .alpha. mannosidase II; d) N-acetylglucosaminyltransferase II catalytic domain; e) .beta.1,4 galactosyltransferase; and, f) fucosyltransferase.

23. The PMT-deficient filamentous fungal cell of claim 17, wherein said cell is a Trichoderma cell comprising a mutation that reduces or eliminates the protein O-mannosyltransferase activity of Trichoderma pmt1.

24. The PMT-deficient filamentous fungal cell of claim 17, wherein said cell is a Trichoderma reesei cell, and said cell comprises mutations that reduce or eliminate the activity of a) the three endogenous proteases pep1, tsp1 and slp1; b) the three endogenous proteases gap1, slp1 and pep1; c) the three endogenous proteases selected from the group consisting of pep1, pep2, pep3, pep4, pep5, pep8, pep11, pep12, tsp1, slp1, slp2, slp3, slp7, gap1 and gap2; d) three to six proteases selected from the group consisting of pep1, pep2, pep3, pep4, pep5, tsp1, slp1, slp2, slp3, gap1 and gap2; or e) seven to ten proteases selected from the group consisting of pep1, pep2, pep3, pep4, pep5, pep7, pep8, tsp1, slp1, slp2, slp3, slp5, slp6, slp7, slp8, tpp1, gap1 and gap2.

25. The PMT-deficient filamentous fungal cell of claim 17, wherein the O-mannosylation level on the expressed light chain of the antibody is reduced to 0%.

26. The PMT-deficient filamentous fungal cell of claim 17, wherein said produced antibody is a mammalian antibody selected from the group consisting of: a) an immunoglobulin, such as IgG, b) a light chain or heavy chain of an immunoglobulin, c) a heavy chain or a light chain of an antibody, d) a single chain antibody, e) a camelid antibody, f) a monomeric or multimeric single domain antibody, g) a Fab-fragment, a Fab.sub.2-fragment, and, h) their antigen-binding fragments.

27. A method for producing an antibody having reduced O-mannosylation, comprising: a) providing the PMT-deficient filamentous fungal cell of claim 17, and b) culturing the cell to produce said antibody, consisting of heavy and light chains, having reduced O-mannosylation.

28. The method of claim 27, wherein said produced antibody is a mammalian antibody selected from the group consisting of: a) an immunoglobulin, optionally IgG; b) a light chain or heavy chain of an immunoglobulin; c) a heavy chain or a light chain of an antibody; d) a single chain antibody; e) a camelid antibody; f) a monomeric or multimeric single domain antibody; g) a Fab-fragment, a Fab.sub.2-fragment; and, h) an antigen-binding fragment of one of a) through g).