Transgenic Plant Of The Species Solanum Tuberosum With Resistance To Phytophthora

STAHL; Jurgen Dietmar ;   et al.

Patent Application Summary

U.S. patent application number 16/936886 was filed with the patent office on 2020-11-05 for transgenic plant of the species solanum tuberosum with resistance to phytophthora. This patent application is currently assigned to KWS SAAT SE & CO. KGAA. The applicant listed for this patent is KWS SAAT SE & CO. KGAA. Invention is credited to Jurgen Dietmar STAHL, Nora TEMME.

Application Number20200347400 16/936886
Document ID /
Family ID1000004970160
Filed Date2020-11-05

View All Diagrams
United States Patent Application 20200347400
Kind Code A1
STAHL; Jurgen Dietmar ;   et al. November 5, 2020

TRANSGENIC PLANT OF THE SPECIES SOLANUM TUBEROSUM WITH RESISTANCE TO PHYTOPHTHORA

Abstract

The present invention concerns a transgenic plant of the species Solanum tuberosum with a resistance to an oomycete of the genus Phytophthora, transgenic parts of such a plant, a method for its manufacture and to a composition for external application to plants. On the one hand, nucleotide sequences in accordance with SEQ ID NOS: 1-43 are provided from Phytophthora in a host plant-induced gene silencing strategy in potato plants; on the other hand, a fungicide for plant treatment is provided.


Inventors: STAHL; Jurgen Dietmar; (Einbeck, DE) ; TEMME; Nora; (Munster, DE)
Applicant:
Name City State Country Type

KWS SAAT SE & CO. KGAA

Einbeck

DE
Assignee: KWS SAAT SE & CO. KGAA
Einbeck
DE

Family ID: 1000004970160
Appl. No.: 16/936886
Filed: July 23, 2020

Related U.S. Patent Documents

Application Number Filing Date Patent Number
16027855 Jul 5, 2018 10760094
16936886
14420106 Feb 6, 2015 10030251
PCT/DE2013/000446 Aug 6, 2013
16027855

Current U.S. Class: 1/1
Current CPC Class: C12N 15/113 20130101; C12N 15/8282 20130101; C12N 2310/141 20130101; C12N 2310/14 20130101
International Class: C12N 15/82 20060101 C12N015/82; C12N 15/113 20060101 C12N015/113

Foreign Application Data

Date Code Application Number
Aug 8, 2012 DE 102012016009.7

Claims



1-14. (canceled)

15. A transgenic plant of the species Solanum tuberosum or a part thereof comprising a stably integrated first double-stranded DNA and a stably integrated second double-stranded DNA, wherein the nucleotide sequences of the coding strands of the first and second DNA are reverse complements of each other, so that a transcript of the first DNA and a transcript of the second DNA are capable of hybridizing to form a double-stranded RNA and whereby the plant expressing said double-stranded RNA is resistant to an oomycete of the genus Phytophthora, wherein the coding strand of the first DNA comprises: (a) at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17, or (b) a nucleotide sequence which is complementary to at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17, or a nucleotide sequence which hybridizes under stringent conditions to at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17 or to a nucleotide sequence which is complementary to at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17.

16. The transgenic plant or the part thereof of claim 15, wherein the plant exhibits a resistance against Phytophthora infestans.

17. The transgenic plant or the part thereof of claim 15, wherein the double-stranded RNA is miRNA or siRNA.

18. The transgenic plant or the part thereof of claim 15, wherein the first DNA and the second DNA are operatively linked to at least one promoter.

19. The part of the transgenic plant of claim 15, wherein the part is a seed or a cell.

20. A method for producing a transgenic plant of the species Solanum tuberosum which plant exhibits a resistance to an oomycete of the genus Phytophthora, comprising the following steps: (i) producing a transformed first parent plant comprising a first double-stranded DNA which is stably integrated into the genome of said first parent plant and which has a coding strand which comprises: (a) at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17, or (b) a nucleotide sequence which is complementary to at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17, or (c) a nucleotide sequence which hybridizes under stringent conditions to at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17 or to a nucleotide sequence which is complementary to at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17; (ii) producing a transformed second parent plant comprising a second double-stranded DNA which is stably integrated into the genome of said second parent plant, wherein the nucleotide sequences of the coding strands of the first and second DNA are reverse complements of each other, so that a transcript of the first DNA and a transcript of the second DNA are capable of hybridizing to form a double-stranded RNA and whereby the plant expressing said double-stranded RNA becomes resistant to an oomycete of the genus Phytophthora; (ii) crossing the first parent plant with the second parent plant; and selecting a plant in the genome of which both the first double-stranded DNA and the second double-stranded DNA have been stably integrated.

21. The method of claim 20, wherein the resistance is resistance to Phytophthora infestans.

22. The method of claim 20, wherein the double-stranded RNA is miRNA or siRNA.

23. A composition for external application to plants comprising a double-stranded RNA, wherein a strand of said RNA corresponds to a transcript of a double-stranded DNA comprising a coding strand which comprises: at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17, or a nucleotide sequence which is complementary to at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17, or a nucleotide sequence which hybridizes under stringent conditions to at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17 or to a nucleotide sequence which is complementary to at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17.

24. A method for conferring resistance against an oomycete of the genus Phytophthora in a plant or a plant part, said method comprising administering to said plant or plant part the composition of claim 23.

25. The method of claim 24, wherein the oomycete of the genus Phytophthora is Phytophthora infestans.

26. An isolated nucleic acid sequence comprising a double-stranded first DNA and a double-stranded second DNA, wherein the nucleotide sequences of the coding strands of the first and second DNA are reverse complements of each other, so that a transcript of the first DNA and a transcript of the second DNA are capable of hybridizing to form a double-stranded RNA, wherein the first DNA comprises: a. at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17, or b. a nucleotide sequence which is complementary to at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17, or c. a nucleotide sequence which hybridizes under stringent conditions to at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17 or to a nucleotide sequence which is complementary to at least 15 successive nucleotides of the nucleotide sequence of SEQ ID NO: 17.

27. A vector comprising the nucleic acid sequence of claim 26.

28. An Agrobacterium comprising the nucleic acid sequence of claim 26.
Description



CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is a Divisional Application of U.S. patent application Ser. No. 14/420,106, filed Feb. 6, 2015, which is a U.S. National Phase Application under 35 U.S.C. .sctn. 371 of International Patent Application No. PCT/DE2013/000446, filed Aug. 6, 2013, which claims priority to German Patent Application No. 10 2012 016 009.7, filed Aug. 8, 2012. The International Application was published on Feb. 13, 2014 as International Publication No. WO 2014/023285 under PCT Article 21(2). The entire contents of these applications are hereby incorporated by reference.

SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jul. 5, 2018, is named 245761000009_SL.txt and is 100,249 bytes in size.

BACKGROUND OF THE INVENTION

[0003] The present invention relates to a transgenic plant of the species Solanum tuberosum with a resistance to an oomycete of the genus Phytophthora, to transgenic parts a plant of this type, to a method for its manufacture and to a means for external application to plants.

[0004] Even now, potato late blight caused by Phytophthora infestans is still the most prevalent and most economically important potato disease.

[0005] Throughout the globe, the pathogen results in loss of earnings, with harvest losses of more than 20 percent. This means that expensive chemical plant protection means have to be used, because the natural defence mechanisms of the potato with the help of which P. infestans is combatted or with which propagation can be slowed down and restricted is not sufficient or not permanent.

[0006] Natural plant defence mechanisms, such as the hypersensitive reaction at the infection site, lignification of the cell wall, the production of PR (pathogenesis-related) proteins and the synthesis of phytoalexins are indeed known to contribute to augmenting resistance, but they are always accompanied by an energy loss and thus a loss of earnings for affected plants.

[0007] Natural defence mechanisms in plants also include the expression of so-called resistance genes (R genes), the gene products of which interact with microbial avirulence genes (Avr genes) (gene for gene hypothesis) and thus induce a specific defence reaction. This resistance can, however, be interrupted if a pathogen such as P. infestans can dispense with the synthesis of the Avr gene and recognition of the pathogen and thus the subsequent specific defence reaction in the plant host does not occur.

[0008] Fire et al. (1998) have already demonstrated that double stranded RNA (dsRNA) can result in the sequence-specific degradation of homologous RNA. Starting from these results, transgenic plants have been developed in the meantime which, with the aid of RNA interference (RNAi) by means of host plant-induced silencing of conserved and essential genes, for example from nematodes or Lepidoptera- and Coleroptera species, can exhibit resistance to these pests in vitro as well as in vivo.

[0009] In addition, the host plant-phytopathogenic fungus interaction can constitute an application of the concept of host-induced gene silencing (HIGS) to induce resistance (EP 1 716 238).

[0010] Van West et al. (1999) initially used the gene silencing method in Phytophthora, in order to carry out functional analyses of these oomycete-specific genes.

[0011] In WO 2006/070227, the use of RNA interference to control fungal pathogens based on contact of dsRNA with fungal cells outside the fungal cell was described for the first time. It proposes a method for the manufacture of a pathogen-resistant plant. In this manner, the RNA interference can be directed against one or more genes of a pathogen as well as several pathogens. Phytophthora infestans is mentioned as a possible fungal pathogen and potato as a possible host plant.

[0012] Previous studies have given rise to the hypothesis that host plant-induced gene silencing does not work for every gene and choice of the target gene is essential for functional silencing. Thus, for example, the plasma membrane H+-ATPase PnMA1 in Phytophthora parasitica could not be reduced sufficiently by host plant-induced gene silencing to deliver efficient protection against a pathogen (Zhang et al. 2011). According to this, selection of the target genes is also decisive for effective pathogen defense (Yin et al. 2011).

[0013] Recently, a screening system was proposed which was supposed to facilitate the selection of suitable parasitic genes for silencing constructs for the production of pathogen-resistant plants (US 2010/0257634). The identification of appropriate test constructs to induce phytoresistance in potato was also proposed by the authors. In this regard, target genes were defined based on bioinformatic analyses of genome sequences or based on sequence homologies to essential genes or virulence factors from known model organisms. That document does not contain any indications of the genes disclosed in the present invention for the generation of a resistance against an oomycete of the genus Phytophthora.

[0014] A method for producing a broad spectrum resistance in transgenic plants against multiple fungi is described in WO 2009/112270. In one implementation of the method of that invention, the broad spectrum resistance is directed against Uncinula necator, Plasmopora viticola, Uromyces spec., Phakopsora pachyrhizi, Erysiphe sp. and also P. infestans.

[0015] Furthermore, the development of Phytophthora infestans-resistant potato plants through RNAi-induced silencing is disclosed in WO 2006/047495. On the one hand, plants were generated which carry gene sequences of the rRNA gene from Phytophthora infestans for RNA interference. The silencing construct described in WO 2006/047495 directed against the rRNA gene of Phytophthora infestans comprises base pairs 1-600 of Accession number AJ854293 and with it 32 bp of the coding region of the 18S rRNA as well as the complete coding region of the 5.8 S rRNA gene of the blight pathogen. When selecting the target genes for HIGS strategies, with a view to applicability, it is vital that it has as short as possible or preferably no homologies extending over more than 17 sequential base pairs to the gene sequences of non-target organisms, as if there were, gene expression of the non-target organisms in the case of consumption of the transgenic plant or its harvest product could be destroyed ("off-target" effect). However, the sequence described in in WO 2006/047495 comprises 32 bp of the P. infestans 18S rRNA, which has 100% identity with the homologous sequence of the 18S rRNA gene from man (Homo sapiens), pigs (Sus scrofa) and cattle (Bos taurus). Human potato consumption in Asia in 2005 was 26 kg, in North America it was 58 kg and in Europe it was 96 kg per person (FAOSTAT). In the light of the high human and animal consumption of potatoes, the rRNA sequences from Phytophthora infestans described in WO 2006/047495 as HIGS target genes are unsuitable for consumers on safety grounds.

[0016] On the other hand, in WO 2006/047495, plants were produced that carry gene sequences for the cathepsin B gene from Myzus persicae and the elicitin gene INF1 from P. infestans for RNA interference and thus exhibit resistance to two plant pathogens. The target gene INF1 used therein codes for an elicitor. A resistance based on an elicitor as a pathogenicity factor is a disadvantage because the elicitin gene INF1 is not always necessary for an infection of potatoes by Phytophthora infestans (Kamoun et al. 1998).

BRIEF SUMMARY OF THE INVENTION

[0017] The aim of the present invention is thus to provide a transgenic plant of the species Solanum tuberosum which is pathogen-resistant to an oomycete of the genus Phytophthora and in particular is suitable for consumption.

[0018] In accordance with the invention, this aim is accomplished by the fact that a double-stranded first and second DNA are stably integrated into the transgenic plant, wherein the first DNA comprises (a) a nucleotide sequence in accordance with SEQ ID NOS: 1-43, or (b) a fragment of at least 15 successive nucleotides of a nucleotide sequence in accordance with SEQ ID NOS: 1-43, or (c) a nucleotide sequence which is complementary to one of the nucleotide sequences of (a) or (b), or (d) a nucleotide sequence which hybridizes with one of the nucleotide sequences of (a), (b) or (c) under stringent conditions.

[0019] Surprisingly, it has been found that a first DNA of this type is particularly suitable for conferring a pathogen resistance in potato plants via a host-induced gene silencing strategy.

[0020] The first and the second DNA are integrated in a stable manner into the genome of a transgenic plant of the species Solanum tuberosum. Preferably, the DNAs are integrated in a stable manner into a chromosome of the plant. However, they can also be integrated into an extra-chromosomal element. The advantage of stable integration is that the DNA can be passed on to subsequent generations of the transgenic plant.

[0021] The double-stranded DNA is composed of a coding and a non-coding strand.

[0022] Furthermore, the nucleotide sequence of the coding strand of the second DNA is the reverse complement of the nucleotide sequence of the coding strand of the first DNA. The term "reverse complement" with respect to a nucleotide sequence in the 5'-3' direction should be understood to mean a nucleotide sequence in the 3'-5' direction wherein, in accordance with the base pairing rules, the bases correspond to the bases of the first DNA and are in a reverse/mirrored sequence. If the nucleotide sequence of the coding strand of the first DNA is atggttc, for example, then the reverse complementary nucleotide sequence of the coding strand of the second DNA is gaaccat. This is also known as sense and corresponding antisense (reverse complementary) orientation of the nucleotide sequences.

[0023] In particular, the nucleotide sequence of the coding strand of the second DNA can be the reverse complement of the nucleotide sequence of the coding strand of the first DNA over the whole length of the sequence. However, it can also be only partially reverse complementary, i.e. reverse complementary over a limited length. The nucleotide sequence of the coding strand of the second DNA can also be reverse complementary in more than one region, for example in two or three regions of its nucleotide sequence to the nucleotide sequence of the coding strand of the first DNA.

[0024] Starting from the completely or partially reverse complementary nucleotide sequences for the coding strand of the first and second DNA, a double-stranded RNA is produced. The double-stranded structure of the RNA arises by the formation of bridging hydrogen bonds between complementary nucleotides. Double-stranded RNA regions may be formed over a single nucleic acid strand which is partially complementary to itself, or over two different, discontinuous complementary nucleic acid strands. The bridging hydrogen bond formation may thus be intramolecular as well as intermolecular.

[0025] In accordance with the invention, the first DNA comprises a nucleotide sequence in accordance with SEQ ID NOS: 1-43, wherein these sequences are nucleotide sequences from selected target genes from Phytophthora infestans. The group formed by these target genes comprises essential genes for primary metabolism as well as for amino acid synthesis, in particular the biosynthesis of aliphatic amino acids (valine, leucine, isoleucine) as well as for glutamate biosynthesis, genes for cell regulation and signal transduction as well as redox regulation, calcium signalling, G-protein signalling, MAP-kinase signalling and transcription factors, as well as genes for translation components, gene with RNA processing functions, genes which code for developmental and differentiation proteins such as, for example, with cell wall formation functions, as well as genes which code for transporters, channelling and membrane proteins. A summary of these target genes from Phytophthora which are used for designing the host-induced gene silencing is set out in Table 1.

TABLE-US-00001 TABLE 1 Target ID gene_ID Function Category identification 1 PITG_03410 Acetolactate synthase Amino acid biosynthesis A 2 PITG_00375 Haustorium-specific membrane Development/differentiation D protein (Pihmp1) 3 PITG_13490 Urokanase Glutamate biosynthesis C 4 PITG_00146 Glucose-6-P-dehydrogenase Primary metabolism C 5 PITG_00561 Ubiquinone- biosynthesis protein Primary metabolism B COQ9 6 PITG_06732 Acyl-CoA-dehydrogenase Primary metabolism B 7 PITG_07405 Pyruvate kinase Primary metabolism B 8 PITG_12228 NADH-cytochrome B5 reductase Primary metabolism B 9 PITG_15476 Malate dehydrogenase Primary metabolism B 10 PITG_18076 Phosphoglycerate mutase Primary metabolism B 11 PITG_19736 Alcohol dehydrogenase Primary metabolism B 12 PITG_20129/ Acyl-CoA-dehydrogenase Primary metabolism B 13 PITG_00221 Tryptophan synthase Amino acid biosynthesis A 14 PITG_05318 N-(5'-phosphoribosyl)anthranilate- Amino acid biosynthesis C isomerase 15 PITG_13139 Threonine synthase Amino acid biosynthesis C 16 PITG_00578 Imidazolone propionase Glutamate biosynthesis C 17 PITG_15100 Histidine ammonium lyase Glutamate biosynthesis A 18 PITG_11044 Protein phosphatase Signal transduction B 19 PITG_21987 Protein phosphatase 2C Signal transduction B 20 PITG_01957 Calcineurin-like catalytic subunit A Calcium signalling C 21 PITG_02011 Calcineurin-subunit B Calcium signalling C 22 PITG_16326 Calcineurin-like catalytic subunit A Calcium signalling C 23 PITG_00708 Thioredoxin Redox regulation C 24 PITG_00715 Thioredoxin Redox regulation C 25 PITG_00716 Thioredoxin Redox regulation C 26 PITG_09348 Glutaredoxin Redox regulation C 27 PITG_08393 PsGPR11 G-protein coupled G-Protein signalling D receptor 28 PITG_10447 SAPK homologue MAP Kinase signalling D 29 PITG_06748 Myb-like DNA-binding protein Transcription factor A 30 PITG_19177 C2H2-transcription factor Transcription factor D (PsCZF1-homologue) 31 PITG_06873 Aspartyl-tRNA-synthetase Translation B 32 PITG_09442 40S Ribosomal protein S21 Translation B 33 PITG_16015 Ribonuclease RNA-processing B 34 PITG_09306 PnMas2- homologue Development/differentiation D 35 PITG_03335 Callose synthase (Fks1/2- Cell wall formation D homologue) 36 PITG_05079 Glycosyl transferase (Fks1/2- Cell wall formation D Homologue) 37 PITG_18356 Beta-glucane synthesis-associated Cell wall formation D protein (KRE6-homologue) 38 PITG_09193 Aquaporin Channel B 39 PITG_00562 Mitochondrial tricarboxylate Transporter B carrier 40 PITG_08314 ABC superfamily protein Transporter B 41 PITG_12289 ATPase H- or Na-translocating Transporter B F-type 42 PITG_12999 MFS superfamily transporter Transporter B 43 PITG_16478 Acyl-CoA-dehydrogenase Primary metabolism B

DETAILED DESCRIPTION OF THE INVENTION

[0026] The term "gene silencing" or silencing describes processes for switching genes off. Silencing can, for example, be transcriptional or post-transcriptional. Gene silencing also includes antisense technology, RNAi, or dsRNA.

[0027] The expression of a nucleotide sequence of a target gene in Phytophthora infestans is selectively inhibited by gene silencing. A target nucleotide sequence can in this case also be a non-processed RNA molecule, an mRNA or a ribosomal RNA sequence.

[0028] The target genes were identified by (i) publically available expression studies such as microarray data regarding oomycete differentiation or infection processes, for example, and publically available data on the investigation of metabolic processes during oomycete differentiation or infection (Grenville-Briggs et al. 2005, Judelson et al. 2009a, Judelson et al. 2009b) (A), (ii) comparative bioinformatic studies coupled with pedantic analysis (BioMax Bioinformatic Framework) (B), (iii) analyses of metabolic pathways coupled with pedantic analysis (C) as well as (iv) evaluations of publically available data regarding the characterization of homologous genes in eukaryotic organisms (Roemer et al. 1994, Inoue et al. 1995, Mazur et al. 1995, Lesage et al. 2004, Avrova et al. 2008, Wang et al. 2009, Li et al. 2010, Wang et al. 2010) (D).

[0029] When selecting the target genes, care was taken that the nucleotide sequence of these genes was specific for P. infestans in order to exclude unwanted silencing of plant and human genes. To this end, the selected target genes were compared as regards their proteins (BlastX) with the proteome of Solanum tuberosum and Solanum lycopersicum. At the same time, the target gene sequences were compared as regards their nucleotides (BlastN) with the genome of Solanum tuberosum, Solanum lycopersicum and a general BlastN (criteria: BlastN; database: human genomic+transcript; optimize for: somewhat similar sequences (blastn)). Target genes were considered to be highly suitable when they exhibited no nucleotide homologies with Solanum tuberosum and Solanum lycopersicum and no or only partial homologies in general BlastN in only short sequence regions (<17 nts), so that an interaction with endogenous plant nucleotide sequences was inhibited or did not occur.

[0030] In accordance with the invention, the nucleotide sequences used may have different lengths. Thus, the nucleotide sequences of one of SEQ ID NOS: 1-43 may, for example, have a length of between 501 and 735 nucleotides.

[0031] The nucleotide sequences used may also be one or more fragments of one or more nucleotide sequences of SEQ ID NOS: 1-43. In this regard, the fragments comprise at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200 or 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400 or 2500 successive nucleotides of one or more of the nucleotide sequences of SEQ ID NOS: 1-43. A particularly suitable fragment is a fragment of the nucleotide sequence of SEQ ID NO: 1 with 290 nucleotides.

[0032] In a preferred embodiment of the invention, combinations of two, three, four, five, six, seven, eight, nine, ten or more fragments of the same nucleotide sequence as that of SEQ ID NO: 1 or different nucleotide sequences such as those of SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 or 43 are used. A preferred combination comprises fragments of the nucleotide sequences of SEQ ID NOS: 4, 23, 27 and 28, the genes of which are involved with signal transduction. A further preferred combination comprises fragments of nucleotide sequences of SEQ ID NOS: 3, 16 and 17; these are genes for glutamate biosynthesis from P. infestans. Further advantageous combinations comprise nucleotide sequences or fragments of nucleotide sequences from genes for cell wall formation (SEQ ID NOS: 25, 36, 37), calcium signalling (SEQ ID NOS: 20, 21, 22), primary metabolism genes (SEQ ID NOS: 5, 6, 7), redox regulation genes (SEQ ID NOS: 24, 25, 26), or comprise several nucleotide sequences or fragments of nucleotide sequences from transporter genes in accordance with SEQ ID NOS: 39, 40, 41, 42. Further preferred combinations comprise nucleotide sequences or fragments of nucleotide sequences of different target gene groups such as, for example, genes for G-protein signalling, MAP kinase signalling, primary metabolism and redox regulation (SEQ ID NOS: 27, 28, 4, 23). Combining several target genes means that the possibility that the resistance of the transgenic plant could be disrupted by a natural mutation in the oomycete is avoided.

[0033] The double-stranded first DNA introduced into the potato plant of the invention may comprise a nucleotide sequence which hybridizes under stringent conditions with one of the following nucleotide sequences: (a) a nucleotide sequence in accordance with SEQ ID NOS: 1-43, or (b) a fragment of at least 15 successive nucleotides of a nucleotide sequence in accordance with SEQ ID NOS: 1-43, or (c) a nucleotide sequence which is complementary to one of the nucleotide sequences of (a) or (b), or (c). Examples of stringent conditions are: hybridizing in 4.times.SSC at 65.degree. C. and then washing several times in 0.1.times.SSC at 65.degree. C. for approximately 1 hour in total. The term "stringent hybridization conditions" as used here can also mean: hybridization at 68.degree. C. in 0.25 M sodium phosphate, pH 7.2 7% SDS, 1 mM EDTA and 1% BSA for 16 hours and subsequently washing twice with 2.times.SSC and 0.1% SDS at 68.degree. C.

[0034] The present invention also in particular encompasses such fragments of nucleotide sequences which have a few, for example 1 or 2 nucleotides, which are not complementary to the target gene sequence from Phytophthora infestans. Sequence variations which, for example, occur in oomycetes, which are based on a genetic mutation, for example by addition, deletion or substitution or a polymorphism in a Phytophthora infestans strain and which result in wrong pairing over a region of 1, 2 or more nucleotides, can be tolerated as long as the RNA formed by the transgenic potato plant can still interfere with the target gene RNA formed by the oomycete.

[0035] In accordance with the invention, the transgenic plant of the species Solanum tuberosum confers a pathogen resistance to an oomycete of the genus Phytophthora. To determine the resistance, the transgenic potato plant is compared with a control plant which ideally has the identical genotype to the transgenic plant and has been grown under identical conditions, but which does not contain the DNA which has been introduced into the transgenic plant. The resistance can be determined using an optical score, wherein scores of 0 (not susceptible) to 100 (very susceptible) are awarded. Preferably, the transgenic plants of the invention confer a resistance which, compared with a control plant, results in a reduced propagation of infection over the plant surface of at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 percent (see the conditions under "measuring the resistance in transgenic potato plants under outdoor conditions).

[0036] The genus Phytophthora comprises various species, for example the species alni, cactorum, capsici, cinnamomi, citrophthora, clandestina, fragariae, hedraiandra, idaei, infestans, ipomoeae, iranica, kernoviae, mirabilis, megakarya, nicotianae, palmivora, parasitica, phaseoli, ramorum, pseuodotsugae, quercina, sojae or tentaculata.

[0037] In a preferred embodiment of the invention, the transgenic potato plant exhibits a resistance to Phytophthora infestans.

[0038] Already the inhibition of the biosynthesis of the aliphatic amino acids valine, leucine and isoleucine by a construct directed against acetolactate synthase from P. infestans results in a substantial reduction in blight infestation and a drastic increase in leaf resistance under laboratory and field conditions. By combining several target genes such as, for example, genes from G protein signalling, MAP kinase signalling, primary metabolism, amino acid biosynthesis and redox regulation in one construct, the resistance effect can be increased still further, since the pathogen is inhibited by the multiple action of the combination construct on the use of alternative signalling and metabolic pathways.

[0039] Surprisingly, the defensive power of the potato plants of the invention against isolates of P. infestans of varying aggressivity is changed in a manner such that a resistance is obtained which protects the plants efficiently and permanently against this most important of pathogens.

[0040] It was also surprisingly discovered that the resistance has no great energetic disadvantages or negative changes in the agronomic properties of the potato plant. The cultivation trials under near-field conditions did not have any deleterious effects on the quality of the plants. Careful selection of the target genes of P. infestans which excludes any homology extending over 17 successive base pairs with genes from non-target organisms (potato, human, pig, cattle) means that there are no restrictions on using the plants as a feed or foodstuff and no restrictions as regards sowing, cultivation, harvesting or processing the crop. The plants can freely be used as agricultural, food or feed plants.

[0041] In accordance with a preferred embodiment, the double-stranded RNA is miRNA or siRNA.

[0042] MiRNA describes small interfering RNA and includes naturally produced miRNAs and synthetic miRNAs which, for example, can be produced by recombinant or chemical synthesis or by processing primary miRNA.

[0043] SiRNA describes small interfering RNA and includes naturally produced siRNAs and synthetic siRNAs which, for example, can be produced by recombinant or chemical synthesis or by processing dsRNAs.

[0044] The transgenic plant produces dsRNA from the introduced double-stranded DNA which is processed by endogenous RNAi or silencing mechanisms to form siRNAs and miRNAs.

[0045] In order to obtain dsRNA, a double-stranded first DNA with a nucleotide sequence in accordance with one of SEQ ID NOS: 1-43 or a fragment thereof in the sense orientation and a double-stranded second DNA in the antisense orientation can be used which are separated by an intron which has no similarity with the target genes in question. As an example, the DNA may be orientated with a nucleotide sequence of SEQ ID NO: 1 against the acetolactate synthase gene from Phytophthora infestans. Upon expression in a plant cell, an RNA transcript is formed which, because of the homology between the sense and antisense sequence regions, can coalesce to form a dsRNA. Because the missing base pairs in the region of the intron, the dsRNA forms a hairpin structure. A dsRNA with a hairpin structure can also be prepared by means of one double-stranded DNA with a nucleotide sequence in accordance with one of SEQ ID NOS: 1-43 in the sense orientation and a second in the antisense orientation with a different length. In this respect, the nucleotide sequence in the sense orientation may be about 190 nucleotides longer than the nucleotide sequence in the antisense orientation, or vice versa.

[0046] Defined sequence regions for the selected nucleotide sequences of the target genes are amplified by PCR and cloned both in the sense and in the antisense direction into a vector which is suitable for the synthesis of hairpin structures. In this regard, several fragments with sequence regions of different target genes can be cloned into a vector in order to construct a combination hairpin construct. The vectors can be introduced into a plant cell using transformation methods which are known in plant biotechnology. The skilled person will be aware that, for example, a selected nucleotide sequence of a target gene can also be cloned into one vector in the sense orientation and the nucleotide sequence of the target gene can be cloned into a second vector in the antisense orientation and then introduced into a plant cell by co-transformation, for example.

[0047] The silencing mechanism arises from dsRNA such as, for example, hairpin RNA structures or gene duplexes. The dsRNA will produce small dsRNAs by means of a dsRNA-specific endonuclease (dicer), which are processed by means of longer nucleotide sequences into small dsRNAs preferably of 21-25 base pairs, a process which is similar for both "stem-loop" (primary miRNA) and also for long complementary dsRNA precursors. Argonaut proteins, as central components of the RNA-induced silencing complexes (RISC), bind and unwind siRNA and miRNA so that the lead strand of the duplex binds specifically by base pairing to the mRNA and leads to its degradation. By means of miRNA, RNAi behaves in a comparatively similar process, with the difference that the miRNA produced also comprises partial regions which are not identical to the target genes.

[0048] After infestation of a host plant with Phytophthora infestans, an exchange of RNA formed in the plant which is directed against one or more Phytophthora-specific target sequences can occur between the host plant and the oomycetes. In the oomycetes, these RNAs can lead to sequence-specific gene silencing of one or more target genes. Proteins and protein complexes such as dicers, RISC (RNA-induced silencing complex) as well as RNA-dependent RNA polymerase (RdRP), can participate in this process.

[0049] The siRNA effect is known to be continued in plants when the RdRP synthesises new siRNAs from the degraded mRNA fragments. This secondary or transitive RNAi can reinforce silencing and also result in silencing of different transcripts when they share these highly conserved sequences.

[0050] In a preferred embodiment, the first DNA and the second DNA are operatively linked with at least one promoter.

[0051] A "promoter" is a non-translated DNA sequence, typically upstream of a coding region which contains the binding site for the RNA polymerase and initiates transcription of the DNA. A promoter contains special elements which function as regulators for gene expression (for example cis-regulatory elements). The term "operatively linked" means that the DNA which comprises the integrated nucleotide sequence is linked to a promoter in a manner such that it allows expression of this nucleotide sequence. The integrated nucleotide sequence may be linked with a terminator signal downstream as a further component.

[0052] The promoter can be of plant, animal or microbial origin, or it may be of synthetic origin and can, for example, be selected from one of the following groups of promoters: constitutive, inducible, development-specific, cell type-specific, tissue-specific or organospecific. While constitutive promoters are active under most conditions, inducible promoters exhibit expression as a result of an inducing signal which, for example, may be issued by biotic stressors such as pathogens or abiotic stressors such as cold or dryness or chemicals.

[0053] Examples of promoters are the constitutive CaMV 35S promoter (Benfey et al., 1990) as well as the C1 promoter which is active in green tissue (Stahl et al., 2004).

[0054] The first and second DNA may also, however, be operatively linked to a double promoter such as, for example, the bidirectionally active TR1'and TR2'promoter (Saito et al., 1991).

[0055] Furthermore, the first and the second DNA may each be operatively linked to a promoter.

[0056] The use of two promoters, which each flank the 3' end and the 5' end of the nucleic acid molecule, enables expression of the respective individual DNA strand, wherein two complementary RNAs are formed which hybridize and form a dsRNA. In addition, the two promoters can be deployed such that one promoter is directed towards the transcription of a selected nucleotide sequence and the second promoter is directed towards the transcription of a nucleotide sequence which is complementary to the first nucleotide sequence. As long as both nucleotide sequences are transcribed, a dsRNA is formed.

[0057] Further, a bidirectional promoter can be deployed which allows the expression of two nucleotide sequences in two directions, wherein one nucleotide sequence is read off in the 3' direction and a second nucleotide sequence is read off in the 5' direction. As long as both nucleotide sequences are complementary to each other, a dsRNA can be formed.

[0058] The present invention also concerns parts of a transgenic plant of the species Solanum tuberosum.

[0059] In the context of this application, the term "parts" of the transgenic plant in particular means seeds, roots, leaves, flowers as well as cells of the plant of the invention. In this regard, the term "cells" should be understood to mean, for example, isolated cells with a cell wall or aggregates thereof, or protoplasts. "Transgenic parts" of the transgenic plant also means those which can be harvested, such as potato tubers, for example.

[0060] Furthermore, the present invention concerns a method for the manufacture of a transgenic plant of the species Solanum tuberosum which exhibits a resistance against an oomycete of the genus Phytophthora.

[0061] Suitable methods for the transformation of plant cells are known in plant biotechnology. Each of these methods can be used to insert a selected nucleic acid, preferably in a vector, into a plant cell in order to obtain a transgenic plant in accordance with the present invention. Transformation methods can include direct or indirect methods for transformation and can be used for dicotyledenous plants and primarily also for monocotyledenous plants. Suitable direct transformation methods include PEG-induced DNA uptake, liposome-induced transformation, biolistic methods by means of particle bombardment, electroporation or microinjection. Examples of indirect methods are Agrobacterium-induced transformation techniques or viral infection by means of viral vectors.

[0062] A preferred method which is employed is Agrobacterium-induced DNA transfer using binary vectors. After transformation of the plant cells, the cells are selected on one or more markers which were transformed in the plant with the DNA of the invention and comprise genes which preferably induce antibiotic resistance such as, for example, the neomycin phosphotransferase II gene NPTII, which induces kanamycin resistance, or the hygromycin phosphotransferase II gene HPTII, which induces hygromycin resistance.

[0063] Next, the transformed cells are regenerated into complete plants. After DNA transfer and regeneration, the plants obtained may, for example, be examined by quantitative PCR for the presence of the DNA of the invention. Resistance tests on these plants against Phytophthora infestans in vitro and in the greenhouse are next. Routine further phenotypic investigations can be carried out by appropriately trained personnel in the greenhouse or outdoors. These transformed plants under investigation can be cultivated directly.

[0064] The method of the invention for the manufacture of a transgenic plant of the species Solanum tuberosum which exhibit a resistance against an oomycete of the genus Phytophthora comprises the following steps:

[0065] (i) producing a transformed first parent plant containing a double-stranded first DNA which is stably integrated into the genome of the parent plant and which comprises (a) a nucleotide sequence in accordance with SEQ ID NOS: 1-43, or (b) a fragment of at least 15 successive nucleotides of a nucleotide sequence in accordance with SEQ ID NOS: 1-43, or (c) a nucleotide sequence which is complementary to one of the nucleotide sequences of (a) or (b), or (d) a nucleotide sequence which hybridizes with one of the nucleotide sequences of (a), (b) or (c) under stringent conditions;

[0066] (ii) producing a transformed second parent plant containing a double-stranded second DNA which is stably integrated into the genome of the parent plant, wherein the nucleotide sequences for the coding strand of the first and second DNA are partially or completely reverse complementary with respect to each other;

[0067] (iii) crossing the first parent plant with the second parent plant;

[0068] (iv) selecting a plant in the genome of which a double-stranded first DNA and a double-stranded second DNA has been stably integrated in order to confer a pathogen resistance against an oomycete of the genus Phytophthora so that a double-stranded RNA can be produced therefrom.

[0069] In accordance with the invention, it is a nucleotide sequence or a fragment of a nucleotide sequence in accordance with SEQ ID NOS: 1-43 from Phytophthora infestans.

[0070] In a preferred embodiment of the invention, the double-stranded RNA can be miRNA or siRNA.

[0071] The invention also concerns a composition for external application to plants.

[0072] This composition is prepared for external application to plants. It contains double-stranded RNA, wherein one strand of this RNA corresponds to the transcript of a double-stranded DNA comprising (a) a nucleotide sequence in accordance with SEQ ID NOS: 1-43, or (b) a fragment of at least 15 successive nucleotides of a nucleotide sequence in accordance with SEQ ID NOS: 1-43, or (c) a nucleotide sequence which is complementary to one of the nucleotide sequences of (a) or (b), or (d) a nucleotide sequence which hybridizes with one of the nucleotide sequences of (a), (b) or (c) under stringent conditions.

[0073] Double-stranded RNA for the manufacture of the composition in accordance with the invention can be produced in vitro using methods known to the skilled person. As an example, the double-stranded RNA can be synthesized by forming the RNA directly in vitro. The double-stranded RNA can also be synthesized from a double-stranded DNA by formation of an mRNA transcript which then forms a hairpin structure, for example.

[0074] The composition in accordance with the invention can be used as a fungicide for a plant or its seed. In this regard, the composition is used to control the growth of the pathogen, for containing the propagation of the pathogen or for the treatment of infected plants. As an example, the composition can be used as a fungicide for spraying in the form of a spray, or other routine ways which are familiar to the skilled person for external application to the plant tissue or by spraying or mixing with the cultivation substrate before or after the plants have sprouted.

[0075] In a further application, the composition in accordance with the invention is used as a pre-treatment for seed. In this regard, the composition is initially mixed with a carrier substrate and applied to the seeds in a combination which comprises the double-stranded RNA and the carrier substrate, whereby the carrier substrate has an RNA-stabilizing effect, for example. Thus, the RNA stability and thus its action on the selected target genes of Phytophthora infestans can be increased, for example by chemical modifications such as the exchange of ribose for a hexose. Liposomes which encapsulate the RNA molecules can also be used as RNA stabilizers.

[0076] Ideally, the plants treated with the composition are those of the species Solanum tuberosum. The discussion above regarding the plant of the invention and the method of the invention also apply to this composition.

[0077] The present invention will now be described with reference to the figures and sequences:

BRIEF DESCRIPTION OF THE DRAWINGS

[0078] FIG. 1: Plasmid pRNAi as an exemplary representation of a vector which can be used for the formation of hairpin constructs against a target gene. This vector contains a CaMV 35S promoter, a multiple cloning site, an intron from the gene AtAAP6 which codes for an amino acid permease in Arabidopsis thaliana, a further multiple cloning site as well as a CaMV 35S terminator.

[0079] FIG. 2: Plasmid pRNAi_PITG_03410 as an exemplary representation of a vector which contains a sense-intron-antisense fragment for the formation of dsRNA against a target gene (here PITG_03410). This vector additionally contains a CaMV 35S promoter, a multiple cloning site, an intron from the gene AtAAP6 which codes for an amino acid permease in Arabidopsis thaliana, a further multiple cloning site as well as a CaMV 35S terminator.

[0080] FIG. 3: Plasmid pRNAi_HIGS_CoA as an exemplary representation of a vector which contains various defined sequences in the sense-intron-antisense fragment, which should lead to the formation of dsRNA against various target genes. This vector additionally contains a CaMV 35S promoter, a multiple cloning site, an intron from the gene AtAAP6 which codes for an amino acid permease in Arabidopsis thaliana, a further multiple cloning site as well as a CaMV 35S terminator.

[0081] FIG. 4: Plasmid pGBTV/EcoRI_kan. Binary Ti plasmid which was used as a cloning vector.

[0082] FIG. 5: Plasmid pGBTV/EcoRI_kan_PITG_03410. Binary Ti plasmid which was used for Agrobacterium-induced transformation.

[0083] FIG. 6: Plasmid pAM, which was used as a cloning vector.

[0084] FIG. 7: Plasmid pAM_HIGS_CoA, as an example of a plasmid which was used as a cloning vector.

[0085] FIG. 8: Plasmid p95P-Nos. Binary Ti plasmid which was used as a cloning vector.

[0086] FIG. 9: Plasmid p95N_HIGS_CoA. Binary Ti plasmid which was used for Agrobacterium-induced transformation.

[0087] FIG. 10: Plasmid p95N_HIGS_dPRNAi_PITG_03410 as an exemplary representation of a binary vector for the formation of dsRNA against a target gene (here PITG_03410) using two CaMV 35S promoters which each flank the 3'- and the 5' end of the nucleic acid molecule.

[0088] FIG. 11: Transgenic potato shoot on selection medium after transformation in the regeneration stage.

[0089] FIG. 12: Diagnostic PCR for testing the transgenicity of potatoes (PR-H4) after transformation with the binary vector pGBTV/EcoRI_kan_PITG_03410.

[0090] Detection of sense fragment (370 bp) (primer S334 5'-ATCCCACTATCCTTCGCAAG-3' (SEQ ID NO: 44).times.S1259 5'-TTGATATCGCGGAAGGCGAGAGACATCG-3' (SEQ ID NO: 45)) and antisense fragment (450 bp) (S 329 5'-CTAAGGGTTTCTTATATGCTCAAC-3' (SEQ ID NO: 46).times.S1259 5'-TTGATATCGCGGAAGGCGAGAGACATCG-3' (SEQ ID NO: 45)). Mix: PCR-MasterMix, PCR monitoring. Marker: Tracklt.TM. 1 Kb DNA Ladder.

[0091] FIG. 13A: Detection of siRNAs in transgenic potato plants after transformation with the binary vector pGBTV/EcoRI_kan_PITG_03410. Detection was carried out by hybridization of the Northern Blot with the radioactively labelled probe dsRNA_. Multiple applications of various samples from the lines PR-H4_T007 and T011.

[0092] FIG. 13B: Detection of siRNAs in transgenic potato plants after transformation with the binary vector p95N HIGS_PITG_00375. Detection was carried out by hybridization of the Northern Blot with the radioactively labelled probe dsRNA_PITG00375. Single application of the samples from the lines PR-H2_T040, T045, T047 and T049.

[0093] FIG. 14A: Plasmid pABM-70Sluci_dsRNA.PITG_00375 as an exemplary representation of a vector which contains a fusion construct consisting of the luciferase reporter gene and the test HIGS target fragment PITG_00375. The vector additionally contains a double CaMV 35S promoter, a multiple cloning site, the coding sequence for the luc gene from Photinus pyralis, which codes for a luciferase, separated from a modified intron PIV2 from the potato gene St-LS1 (Eckes et al. 1986, Vancanneyt et al. 1990), a further multiple cloning site as well as a Nos terminator from the nopalin synthase gene from Agrobacterium tumefaciens.

[0094] FIG. 14B: Plasmid pABM-70Sluci_dsRNA.PITG_03410 as an exemplary representation of a vector which contains a fusion construct consisting of a luciferase reporter gene and the test HIGS target gene fragment PITG_03410.

[0095] FIG. 15A: Relative luciferase activity in transgenic potato lines of the genotype Baltica with stable integration of the HIGS_RNAi construct against the PITG_03410 gene from P. infestans after bombardment with the vector pABM-70Sluci_dsRNA.PITG_03410. B: Baltica (non-transgenic control), T003, T005 transgenic HIGS potato lines.

[0096] FIG. 15B: Relative sporangia production from P. infestans on transgenic HIGS lines. The potato lines of the variety Baltica were transformed with an RNAi construct in order to form dsRNA against the P. infestans gene PITG_03410. After infection with P. infestans in the detached leaf assay, these lines exhibited a reduced sporangia production compared with the non-transgenic variety Baltica (mean of 4 biological repetitions). B: Baltica (non-transgenic control), T003, T005: transgenic HIGS potato lines.

[0097] FIG. 16A: Relative Luciferase activity in transgenic potato lines of the genotype Hermes with stable integration of the HIGS RNAi construct against the PITG_03410 gene from P. infestans after bombardment with the vector pABM-70Sluci_dsRNA.PITG_03410. H: Hermes (non-transgenic control), T004, T011: transgenic HIGS potato lines.

[0098] FIG. 16B: Relative sporangia production of P. infestans on transgenic HIGS lines. The potato lines of the variety Hermes were transformed with an RNAi construct in order to form dsRNA against the P. infestans gene PITG_03410. After infection with P. infestans in the detached leaf assay, these lines exhibited a reduced sporangia production compared with the non-transgenic variety Baltica (mean of 4 biological repetitions). H: Hermes (non-transgenic control), T004, T011: transgenic HIGS potato lines.

[0099] FIG. 17A: Relative luciferase activity in transgenic potato lines of the genotype Desiree with stable integration of the HIGS_RNAi construct against the PITG_03410 gene from P. infestans after bombardment with the vector pABM-70Sluci_dsRNA.PITG_03410. D: Desiree (non-transgenic control), T098: transgenic HIGS potato line.

[0100] FIG. 17B: Relative sporangia production of P. infestans on transgenic HIGS lines. The potato lines of the variety Desiree were transformed with an RNAi construct in order to form dsRNA against the P. infestans gene PITG_03410. After infection with P. infestans in the detached leaf assay, these lines exhibited a reduced sporangia production compared with the non-transgenic variety Baltica (mean of 4 biological repetitions). D: Desiree, (non-transgenic control), T098: transgenic HIGS potato line.

[0101] FIG. 18A: Relative Luciferase activity in transgenic potato lines of the genotype Desiree with stable integration of the HIGS_RNAi construct against the PITG_00375 gene from P. infestans after bombardment with the vector pABM-70Sluci_dsRNA.PITG_00375. D: Desiree, (non-transgenic control), T042, T044 T047, T049: transgenic HIGS potato lines.

[0102] FIG. 18B: Relative sporangia production of P. infestans on transgenic HIGS lines. The potato lines of the variety Desiree were transformed with a RNAi construct in order to form dsRNA against the P. infestans gene PITG_00375. After infection with P. infestans in the detached leaf assay, these lines exhibited a reduced sporangia production compared with the non-transgenic variety Baltica (mean of 4 biological repetitions). D: Desiree, (non-transgenic control), T042, T044 T047, T049: transgenic HIGS potato lines.

[0103] FIG. 19A: Level of infection in transgenic potato lines of the genotype Hermes with stable integration of the HIGS_RNAi construct against the PITG_03410 gene from P. infestans after infection of the plants under outdoor-like conditions with P. infestans. Grey lines with triangle: Baltica, Desiree, and Russet Burbank (non-transgenic controls), Black lines with square: plants of the genotype Hermes: solid line: Hermes (non-transgenic control), dashed line: PR-H-4-7 & dotted line: PR-H-4-11: transgenic HIGS potato lines.

[0104] FIG. 19B: Photographic documentation of the degree of infection of the transgenic potato lines PR-H-4-7 and PR-H-4-11 of the genotype Hermes with stable integration of the HIGS_RNAi construct against the PITG_03410 gene from P. infestans after infection of the plants under outdoor-like conditions with P. infestans compared with the non-transgenic control Hermes. Photographs taken 32 days post-infection.

[0105] FIG. 20: Relative sporangia production of P. infestans on transgenic HIGS lines. The potato lines of the variety Russet Burbank were transformed with a RNAi construct in order to form dsRNA against the P. infestans gene PITG_03410. After infection with P. infestans in the detached leaf assay, these lines exhibited a reduced sporangia production compared with the non-transgenic variety Russet Burbank (mean of 3 biological repetitions). Russet Burbank (non-transgenic control); H-4-T084, H-4-T096: transgenic HIGS potato lines.

[0106] FIG. 21: Relative sporangia production of P. infestans on transgenic HIGS lines. The potato lines of the variety Hermes were transformed with a RNAi construct in order to form dsRNA by means of a double promoter construct HIGS_dPRNAi_PITG_03410 against the P. infestans gene PITG_03410. After infection with P. infestans in the detached leaf assay, these lines exhibited a reduced sporangia production compared with the non-transgenic variety Hermes (mean of 3 biological repetitions). Hermes (non-transgenic control); H-23-T0003, H-23-T026, H-23-T038, H-23-T062, H-23-T063, H-23-T066: transgenic HIGS potato lines.

[0107] FIG. 22: Relative sporangia production of P. infestans on transgenic HIGS lines. The potato lines of the variety Russet Burbank were transformed with an RNAi construct HIGS_CoA in order to form dsRNA against the genes PITG_00146, PITG_08393, PITG_10447 and PITG_00708 from P. infestans. After infection with P. infestans in the detached leaf assay, these lines exhibited a reduced sporangia production compared with the non-transgenic variety Russet Burbank (mean of 3 biological repetitions). Russet Burbank (non-transgenic control); H-13-T050, H-13-T053, H-13-T036, H-13-T032: transgenic HIGS potato lines.

[0108] FIG. 23: Relative sporangia production of P. infestans on transgenic HIGS lines. The potato lines of the variety Russet Burbank were transformed with a RNAi construct in order to form dsRNA against the P. infestans gene PITG_06748. After infection with P. infestans in the detached leaf assay, these lines exhibited a reduced sporangia production compared with the non-transgenic variety Russet Burbank (mean of 3 biological repetitions). Russet Burbank (non-transgenic control); H-15-T008, H-15-T010: transgenic HIGS potato lines.

[0109] FIG. 24: Relative sporangia production of P. infestans on transgenic HIGS line. The potato line of the variety Russet Burbank were transformed with an RNAi construct in order to form dsRNA against the P. infestans gene PITG_09306. After infection with P. infestans in the detached leaf assay, these lines exhibited a reduced sporangia production compared with the non-transgenic variety Russet Burbank (mean of 3 biological repetitions). Russet Burbank (non-transgenic control); H-10-T111: transgenic HIGS potato line.

[0110] FIG. 25: Relative sporangia production of P. infestans on transgenic HIGS lines. The potato lines of the variety Russet Burbank were transformed with an RNAi construct in order to form dsRNA against the P. infestans gene PITG_09193. After infection with P. infestans, in the detached leaf assay, these lines exhibited a reduced sporangia production compared with the non-transgenic variety Russet Burbank (mean of 3 biological repetitions). Russet Burbank (non-transgenic control); H-12-T194, H-12-T195, H-12-T222, H-12-T239: transgenic HIGS potato lines.

[0111] FIG. 26: Relative sporangia production of P. infestans on transgenic HIGS lines. The potato lines of the variety Desiree were transformed with an RNAi construct in order to form dsRNA against the P. infestans gene PITG_09193. After infection with P. infestans, in the detached leaf assay, these lines exhibited a reduced sporangia production compared with the non-transgenic variety Desiree (mean of 3 biological repetitions). Desiree (non-transgenic control); H-12-T187, H-12-T216, H-12-T237, H-12-T245: transgenic HIGS potato lines.

[0112] FIG. 27: Relative sporangia production of P. infestans on transgenic HIGS lines. The potato lines of the variety Russet Burbank were transformed with an RNAi construct in order to form dsRNA against the P. infestans gene PITG_19177. After infection with P. infestans, in the detached leaf assay, these lines exhibited a reduced sporangia production compared with the non-transgenic variety Russet Burbank (mean of 3 biological repetitions). Russet Burbank (non-transgenic control); H-9-T271, H-9-T305, H-9-T308: transgenic HIGS potato lines.

[0113] FIG. 28: Relative sporangia production of P. infestans on transgenic HIGS line. The potato line of the variety Desiree were transformed with an RNAi construct in order to form dsRNA against the P. infestans gene PITG_19177. After infection with P. infestans in the detached leaf assay, these lines exhibited a reduced sporangia production compared with the non-transgenic variety Desiree (mean of 3 biological repetitions). Desiree (non-transgenic control); H-9-T280: transgenic HIGS potato line.

[0114] FIG. 29: Plasmid p95_RNAi_PITG_06748 as an exemplary representation of a vector which contains a sense-intron-antisense fragment in order to form dsRNA against a target gene (here PITG_06748). This vector additionally contains a CaMV 35S promoter, a multiple cloning site, an intron from the gene AtAAP6 which codes for an amino acid permease in Arabidopsis thaliana, a further multiple cloning site as well as a CaMV 35S terminator.

[0115] FIG. 30: Plasmid p95N_RNAi_PITG_09306 as an exemplary representation of a vector which contains a sense-intron-antisense fragment in order to form dsRNA against a target gene (here PITG_09306). This vector additionally contains a CaMV 35S promoter, a multiple cloning site, an intron from the gene AtAAP6 which codes for an amino acid permease in Arabidopsis thaliana, a further multiple cloning site as well as a CaMV 35S terminator.

[0116] FIG. 31: Plasmid p95N_RNAi_PITG_09193 as an exemplary representation of a vector which contains a sense-intron-antisense fragment in order to form dsRNA against a target gene (here PITG_09193). This vector additionally contains a CaMV 35S promoter, a multiple cloning site, an intron from the gene AtAAP6 which codes for an amino acid permease in Arabidopsis thaliana, a further multiple cloning site as well as a CaMV 35S terminator.

[0117] FIG. 32: Plasmid p95N_RNAi_PITG_19177 as an exemplary representation of a vector which contains a sense-intron-antisense fragment in order to form dsRNA against a target gene (here PITG_19177). This vector additionally contains a CaMV 35S promoter, a multiple cloning site, an intron from the gene AtAAP6 which codes for an amino acid permease in Arabidopsis thaliana, a further multiple cloning site as well as a CaMV 35S terminator.

EXEMPLARY EMBODIMENTS

Preparation of Constructs

[0118] Defined sequence regions of the selected target genes were amplified using PCR and cloned in both the sense and the antisense direction into a pRNAi vector which is suitable for the system of hairpin structures (FIG. 2). In this manner, several fragments with sequence regions from various target genes can be cloned into a vector in order to generate a combination hairpin construct (FIG. 3).

[0119] Starting from genomic DNA from Phytophthora infestans, a sequence region of 290 bp from the coding region of the gene PITG_03410 was amplified using PCR, cleaved via the restriction enzyme cleaving sites XhoI and SmaI inserted via the primer sequences and cloned into the pRNAi vector (primer 1: cgctcgaggctggatctcgcgctgaggt (SEQ ID NO: 47), primer 2: ttgatatcgcggaaggcgagagacatcg (SEQ ID NO: 45)). This vector contains a CaMV 35S promoter, a multiple cloning site, an intron from the gene AtAAP6 which codes for an amino acid permease in Arabidopsis thaliana, a further multiple cloning site as well as a CaMV 35S terminator. This was cleaved with XhoI and Ecl1136II and the 4.098 kb vector fraction was separated using agarose gel electrophoresis and then isolated. The ligation solution was transformed in E. coli strain XL1-blue (Stratagene, LaJolla, Calif.). The same PITG_03410 fragment was then cloned into the plasmid pRNAi_PITG_03410_sense in the antisense direction. To this end, the fragment was again amplified from genomic DNA from Phytophthora infestans using PCR, cleaved via the restriction enzyme cleaving sites XhoI and SmaI inserted via the primer sequences and then ligated into the vector pRNAi_PITG_03410_sense which had been cleaved with SmaI-SalI and then linearized (FIG. 1). The sense-intron-antisense (RNAi-PITG_03410) gene fragment was cleaved out of the pRNAi vector and cloned into the vector pGBTV/EcoRI_kan (FIG. 4). To this end, both pGBTV/EcoRI_kan and pRNAi_PITG_03410 were cleaved with HindIII and ligated so that the plasmid pGBTV/EcoRI_kan_PITG_03410 was generated (FIG. 5). Alternatively, HIGS-RNAi constructs such as HIGS-CoA were initially cloned into the vector pAM (DNA Cloning Service e.K., Hamburg) (FIG. 6). To this end, both pAM and pRNAi_PITG_03410 were cleaved with HindIII and ligated, so that the plasmid pAM_HIGS_CoA was generated (FIG. 7). From the vector pAM, the HIGS_CoA fragment was integrated into the vector p95P-Nos (DNA Cloning Service e.K., Hamburg) by SfiI digestion and ligation (FIG. 8), so that the plasmid p95_N_HIGS_CoA was generated (FIG. 9), which was used for potato transformation.

[0120] Alternatively to a vector as described above which is suitable for the synthesis of hairpin structures, a section of the coding target gene region in the potato plant can be caused to carry out expression with the aid of two oppositely (reverse) orientated promoters (FIG. 10). In addition, gene silencing can also be envisaged by means of artificial microRNA constructs (amiRNA) using the Web microRNA Designers (WMD3) protocol. Artificial miRNAs are 21-mer single stranded RNAs which can be synthesised in order to specifically negatively regulate desired genes in plants. Regulation happens--like with siRNAs--via mRNA cleavage. These RNAi constructs are then cloned into a binary vector and transformed by Agrobacterium tumefaciens-induced transformation in potatoes.

Transformation and Regeneration

[0121] Transformation of the potatoes was carried out in accordance with the modified protocol by Pel et al (2009) using the antibiotic kanamycin. The donor material was cultivated in 80 mL MS(D) (25.degree. C.; 16 h day/8 h night; 2000 lux) for 3-4 weeks. For transformation (C1), the internodes were cut out of the donor material in approximately 0.5 cm explants. These were cultivated in petri dishes with 10 mL MS(D) (15-20 Explants/dish) with 70 .mu.l of an Agrobacterium tumefaciens culture which had been cultivated overnight at 28.degree. C., which had earlier been transformed with the HIGS-RNAi construct as part of a binary vector such as, for example, p95N, incubated at 25.degree. C. for 2 days in the dark. Next, the explants were dried on filter paper and placed in petri dishes on MSW-Medium with selection antibiotic (400 mg/L timentin+75 kanamycin mg/L) which were hermetically sealed and cultivated for 2 weeks (25.degree. C.; 16 h day/8 h night; 2000 lux) (C2). This selection step was repeated every 2 weeks until the shoots had regenerated (from C3). Regenerated shoots (FIG. 11) were incubated on MS (30 g/L saccharose) with selection antibiotic (250 timentin mg/L+100 kanamycin mg/L) to cause rooting and tested by PCR for integration of the construct to be transformed and thus for the presence of the nucleic acids of the invention. The use of the primers Bo2299 (5'-GTGGAGAGGCTATTCGGTA-3' (SEQ ID NO: 48)) and Bo2300 (5'-CCACCATGATATTCGGCAAG-3' (SEQ ID NO: 49)) led to the amplification of a 553 bp DNA fragment from the bacterial NPTII gene, which codes for neomycin phosphotransferase. Furthermore, the sense and the antisense fragment were detected using PCR, in order to ensure that the construct was complete (FIG. 12). The PCR was carried out using 10 ng of genomic DNA, a primer concentration of 0.2 .mu.M at an annealing temperature of 55.degree. C. in Multicycler PTC-200 (MJ Research, Watertown, USA). Propagation of the shoots which tested positive in the PCR was carried out on MS+30 g/L saccharose+400 mg/L ampicillin.

Detection of Processed Double-Stranded RNA and SiRNAs

[0122] In the transformed plants, the expressed hairpin or double-stranded RNAs were processed over the natural plant RNAi mechanisms in a manner such that these RNA molecules were degraded into small single stranded RNAs. These siRNAs are deposited on the mRNA of the corresponding target gene in oomycetes and thus effect silencing of this gene. The plants are thus placed in the position of protecting themselves against attacking pathogens. By means of this concept, transgenic potato plants can be produced which have an increased resistance to P. infestans.

[0123] The transformation of potato plants with constructs for the expression of hairpin or double-stranded RNAs should result in the fact that the resulting dsRNAs are processed to siRNAs in preference to the natural plant RNAi mechanisms. In order to measure the fragmentation of the dsRNA, whole RNA was isolated from the transgenic plants using the trizol method (Chomczynski and Sacchi, 1987). 15 .mu.g of whole RNA/sample was supplemented with formamide, denatured and separated electrophoretically in a 1% agarose gel with 10% formaldehyde in 1.times.MOPS buffer (0.2 M MOPS (sodium salt), 0.05 M NaOAc, 0.01 M EDTA in DEPC dH.sub.2O. pH 7.0 with NaOH). The separated RNA was transferred from the gel onto a nylon membrane (positively charged) using the Northern Blot method into 20.times.SSC buffer (saline-sodium citrate buffer). This was hybridized with a radioactively labelled probe which was complementary to the sequence of the target gene fragment which was present in the sense or in the antisense direction in the construct transformed into the plants. In this manner, RNA fragments which are complementary to the sequence of the dsRNA fragment are labelled and detected by means of a phosphoimager.

[0124] The transformation of potato plants with constructs for the expression of hairpin or double-stranded RNAs should result in the fact that the resulting dsRNA are processed to siRNAs in preference to the natural plant RNAi mechanisms. In order to measure the fragmentation of the dsRNA into siRNAs, whole RNA was isolated from the transgenic plants using the trizol method (Chomczynski and Sacchi, 1987). 15 .mu.g of whole RNA/sample was supplemented with formamide, denatured and separated electrophoretically in a polyacrylamide gel with 15% Tris/boric acid/EDTA (TBE) and uric acid in 0.5.times.TBE. The separated RNA was transferred onto a nylon membrane (neutral) from the gel using the Tank Blot method in 0.5.times.TBE. This was hybridized with a radioactively labelled probe which was complementary to the sequence of the target gene fragment which was present in the sense or in the antisense direction in the construct transformed in the plants. In this manner, siRNAs which are complementary to the sections of sequence of the dsRNA fragment are labelled and detected by means of a phosphoimager.

[0125] In various transgenic potato lines such as, for example, PR-H4 lines or PR-H2 lines, such siRNAs could be detected (FIG. 13A, B). This shows that the constructs transformed in the plants are recognized and processed by plant RNAi mechanisms such that siRNAs against RIGS target genes from P. infestans can be formed which should carry out silencing of this gene in the pathogen.

Measurement of Resistance in Transgenic Potato Plants in the Detached Leaf Assay

[0126] To test the resistance of the transgenic potato leaves, the transgenic plants were cultivated from in vitro plants in the greenhouse in 5 L pots. After 6-8 weeks, 2 pinnae per plant were cut off and placed in a sealed plastic box on a moist Grodan pad such that the leaf stem was in the moist Grodan material. This ensured that the humidity was high. The boxes were incubated at 18.degree. C. using a day/night program (sunlight, February-September). The pinna leaflets were inoculated with drops of a zoospore suspension (10 .mu.L; 10.sup.4 zoospores/mL) of Phytophthora infestans. After 24 hours, the lid of the boxes was opened somewhat in order to allow a gentle circulation of air in the boxes. The optical scoring and quantification of the zoospores was carried out after 6 days. The optical scoring evaluated the degree of infection and the destruction of the pinna leaf by P. infestans. Counting the sporangia led to quantification of the reproductive ability of the pathogen in the plant. In this regard, the previously infected leaves of a pinna were incubated in 5 mL of water in Falcon tubes on a shaker for 2 h, so that the sporangia were loosened from the leaf. The sporangia were then counted with the aid of a Thoma counting chamber under a microscope.

[0127] In various HIGS potato lines which were generated by transformation of various potato genotypes, a reduced sporangia count could be determined after infection with P. infestans (6 dpi) (FIG. 15B-18B). This indicates that the reproductive ability of the pathogen on the transgenic plants has been restricted.

[0128] The gene PITG_03410 was tested as a target gene for HIGS in the genetic background of the potato varieties Baltica, Hermes and Desiree as well as the variety Russet Burbank using a vector as shown in FIG. 5. The detached leaf assay applied to these transgenic plants of the variety Russet Burbank showed that the reproductive ability of the pathogen on the transgenic plants was restricted compared with non-transgenic control plants (FIG. 20).

[0129] As an alternative to vectors which are suitable for the synthesis of hairpin structures, a vector as shown in FIG. 10 with the target gene PITG_03410 was introduced into potato plants of the variety Hermes and the transgenic lines were investigated in the detached leaf assay (FIG. 21). Here again, it was shown that the reproductive ability of P. infestans was limited on the transgenic plants compared with non-transgenic control plants.

[0130] Potato plants of the variety Russet Burbank which had been transformed with a combination vector against the genes PITG_00146, PITG_00708, PITG_10447 and PITG_08363 of FIG. 3 were also tested in the detached leaf assay. It was observed that the reproductive ability of P. infestans on these transgenic plants was restricted compared with non-transgenic control plants (FIG. 22).

[0131] Similarly, the detached leaf assay showed that the reproductive ability of P. infestans on transgenic plants of the variety Russet Burbank is restricted when transformed with a vector in accordance with FIG. 29, FIG. 30, FIG. 31 or FIG. 32 which is directed against the genes PITG_06748 (FIG. 23), PITG_09306 (FIG. 24), PITG_09193 (FIG. 25) or PITG_19177 (FIG. 27).

[0132] Even on transgenic plants of the variety Desiree which were transformed with a vector as shown in FIG. 31 or FIG. 32 which is directed against the gene PITG_09193 (FIG. 25) or PITG_19177 (FIG. 27), the detached leaf assay showed that the reproductive ability of P. infestans was restricted compared to non-transgenic control plants.

Transient Test System for RNAi Vectors in Potato Leaves

[0133] A transient test system in accordance with Birch et al. (2010) was developed to investigate the functionality of the RNAi vectors against selected target gene sequences of P. infestans. By means of co-bombardment, a RNAi vector targeting a target gene was expressed transiently in potato leaves together with a fusion construct consisting of a luciferase reporter gene and the test target fragment. If the dsRNA construct is processed in the RNAi vector, then the formation of dsRNA and the resulting formation of siRNAs should be ensured. These siRNAs should not only carry out the degradation of the target gene fragment transcript, but also give rise to the fused reporter gene transcript, so that with a functional RNAi construct, a reduction in the luciferase activity can be observed. The plasmid pABM-70Sluci comprises a double CaMV 35S promoter, a multiple cloning site, the coding sequence for the luc gene from Photinus pyralis, which codes for a luciferase, separated from a modified intron PIV2 from the potato gene St-LS1 (Eckes et al. 1986, Vancanneyt et al. 1990), a further multiple cloning site as well as a Nos terminator from the nopalin synthase gene from Agrobacterium tumefaciens. The PCR-amplified fragment of the coding sequence region, for example of the PITG_03410 gene, was cloned into this plasmid pABM-70Sluci, which was also cloned into the pRNAi vector to produce the dsRNA construct (FIG. 14A).

[0134] This transient test system can not only be used for validation of the general functionality of the RNAi construct, but also be used in order to investigate different sequence regions of a gene as regards its silencing effect and finally can select the best sequence regions of a gene for optimal silencing. In addition, the bombardment of transgenic plants stably transformed with a RNAi construct can serve to determine the silencing efficiency of the individual transgenic HIGS potato lines which, for example, can differ substantially depending on the integration site for the construct. In various transgenic HIGS potato lines which are obtained by transformations in various potato genotypes, and which show a reduced sporangia count after infection with P. infestans, a reduction in the luciferase activity could also be measured (FIG. 15A-18A). This shows the functionality of the HIGS constructs processed to siRNAs in relation to a silencing of the target gene sequence in the transgenic plants.

[0135] When the coding gene sequences which are to be silenced by a combination construct such as pRNAi_HIGS-CoA, for example (target genes: PITG_08393, PITG_00146, PITG_10447, PITG_00708), each cloned into the vector pABM_70Sluci behind the coding sequence for the luc gene from Photinus pyralis (pABM_70Sluci_PITG_08393, pABM_70Sluci_PITG_00146, pABM_70Sluci_PITG_10447, pABM_70Sluci_PITG_00708) and together with the vector pRNAi_HIGS_CoA, are to be transiently expressed in potato leaves, the silencing efficiency of the combination construct can be analysed on the various target genes. This is also possible by the bombardment of transgenic plants stably transformed with the RNAi combination construct with the individual fusion constructs consisting of the luciferase reporter gene and the test coding sequences of the various target genes.

[0136] The luciferase activity determinations were carried out with the aid of Dual Luciferase.RTM. Reporter Assays (Promega, Mannheim) (Schmidt et al. 2004).

Measurement of Resistance in Transgenic Potato Plants under Outdoor Conditions

[0137] For the resistance test for the transgenic potato plants under outdoor conditions, the transgenic plants were initially cultivated early in the year (March) from in vitro plants in the greenhouse for 3 weeks in multiport pads. Next, these plants were planted out into a greenhouse with a wire mesh roof in natural soil so that the plants were exposed to environmental conditions, for example temperature, sunlight, precipitation and humidity, which were comparable with field conditions. The plants were planted out in 3 plots each with 6 plants. After 8 weeks, one pinna from each of 2 plants in a plot was inoculated with P. infestans by spray inoculation (750 .mu.L; 10.sup.4 zoospores/mL). Plastic bags were placed over these pinnae to ensure that the humidity would be high and to promote infection. After two days, these plastic bags were removed. Proliferation of the blight by Phytophthora infestans in the greenhouse was scored optically and documented photographically every week. The criteria for scoring the infection was initially only on the infected pinna leaf (0: no infection, 1: slight infection (1/2 number of infected pinna leaves infected), 2: infection on more than 1/2 leaves of a pinna, 3: infection on all leaves of the pinna) and then the spread of the infection to the plant and the whole plot (4: infection also extends to some other leaves of the plant, 6: infection also extends to other plants, 8: infection also extends substantially to other plants, 10: 10% of the plants infected/destroyed, 20: 20% of plants infected/destroyed, 100: 100% of the plants infected/destroyed).

[0138] In various transgenic HIGS potato lines (PR-H-4-7, PR-H-4-11) which were obtained by transformations in the potato genotype Hermes, a greatly reduced degree of infection of these plants during the course of infection with Phytophthora infestans was determined compared with the transformation genotype Hermes which had been cultivated, planted out and infected as the control exactly as with the transgenic plants. The reduced degree of infection was initially reflected by a greatly reduced infection capability of the pathogen on the inoculated pinnae (scores 21 days post-infection: PR-H-4-7: 3.3; PR-H-4-11: 3.2; Hermes 7.6) and at later times by a substantially reduced propagation ability of the pathogen to these plants (scores 32 days post-infection: PR-H-4-7: 26; PR-H-4-11: 15; Hermes: 80) (FIG. 19 A, B).

[0139] By means of the tests described, not only could processing of the HIGS construct in transgenic potato plants to siRNAs be demonstrated, but also the functionality of these constructs in respect of silencing of the target gene sequence in these transgenic plants, and an increased resistance of these plants to P. infestans could be quantified by a reduced sporangia production of the pathogen on these host plants. Since the identification of functional HIGS target genes is not possible without careful testing of their functionality, these analyses as described in detail here are particularly suitable for defining genes which are effective in the HIGS construct and for generating resistant HIGS plants.

REFERENCES

[0140] Avrova A O, Boevink P C, Young V, Grenville-Briggs L J, van West P, Birch P R, Whisson S C (2008) A novel Phytophthora infestans haustorium-specific membrane protein is required for infection of potato. Cell Microbiol. 10(11):2271-84.

[0141] Birch R G, Shen B, Sawyer B J, Huttner E, Tucker W Q, Betzner A S (2010) Evaluation and application of a luciferase fusion system for rapid in vivo analysis of RNAi targets and constructs in plants. Plant Biotechnol J. May 1;8(4):465-75. Epub 2010 Jan. 19

[0142] Blackman L M, Arikawa M, Yamada S, Suzaki T, Hardham A R (2011) Identification of a mastigoneme protein from Phytophthora nicotianae. Protist. 162(1):100-14.

[0143] Benfey, P. N., Ren, L., and Chua, N.-H. (1990). Combinatorial and synergistic properties of CaMV 35S enhancer subdomains. EMBO J. (9), 1685-1696.

[0144] Chomczynski P, Sacchi N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162(1):156-9

[0145] Eckes P., Rosahl S., Schell J., Willmitzer L. (1986) Isolation and characterization of a light-inducible, organ-specific gene from potato and analysis of its expression after tagging and transfer into tobacco and potato shoots. Molecular and General Genetics 205 (1) 14-22, DOI: 10.1007/BF02428027

[0146] Fire A, Xu S, Montgomery M K, Kostas S A, Driver S E, Mello C C. (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature February 19;391(6669):806-11

[0147] Grenville-Briggs L J, Avrova A O, Bruce C R, Williams A, Whisson S C, Birch P R, van West P (2005) Elevated amino acid biosynthesis in Phytophthora infestans during appressorium formation and potato infection. Fungal Genet Biol. 42(3):244-56.

[0148] Inoue S B, Takewaki N, Takasuka T, Mio T, Adachi M, Fujii Y, Miyamoto C, Arisawa M, Furuichi Y, Watanabe T (1995) Characterization and gene cloning of 1,3-beta-D-glucan synthase from Saccharomyces cerevisiae. Eur J Biochem 231(3):845-54.

[0149] Judelson H S, Narayan R D, Ah-Fong A M, Kim K S (2009a) Gene expression changes during asexual sporulation by the late blight agent Phytophthora infestans occur in discrete temporal stages. Mol Genet Genomics. 281(2):193-206.

[0150] Judelson H S, Tani S, Narayan R D (2009b) Metabolic adaptation of Phytophthora infestans during growth on leaves, tubers and artificial media. Mol Plant Pathol. 10(6):843-55.

[0151] Kamoun S, van West P, Vleeshouwers V G, de Groot K E, Govers F. (1998). Resistance of nicotiana benthamiana to phytophthora infestans is mediated by the recognition of the elicitor protein INF1. Plant Cell. September; 10(9):1413-26.

[0152] Lesage G, Sdicu A M, Menard P, Shapiro J, Hussein S, Bussey H (2004) Analysis of beta-1,3-glucan assembly in Saccharomyces cerevisiae using a synthetic interaction network and altered sensitivity to caspofungin. Genetics. May; 167(1):35-49

[0153] Li A, Wang Y, Tao K, Dong S, Huang Q, Dai T, Zheng X, Wang Y (2010) PsSAK1, a Stress-Activated MAP Kinase of Phytophthora sojae, Is Required for Zoospore Viability and Infection of Soybean. Mol Plant Microbe Interact. 23(8):1022-31.

[0154] Mazur P, Morin N, Baginsky W, el-Sherbeini M, Clemas J A, Nielsen J B, Foor F (1995) Differential expression and function of two homologous subunits of yeast 1,3-beta-D-glucan synthase. Mol Cell Biol. 15(10):5671-81.

[0155] Pel M A, Foster S J, Park T H, Rietman H, van Arkel G, Jones J D G, Van Eck H J, Jacobsen E, Visser R G F, Van der Vossen E A G (2009) Mapping and cloning of late blight resistance genes from Solanum venturii using an interspecific candidate gene approach. MPMI 22:601-615

[0156] Roemer T, Paravicini G, Payton M A, Bussey H (1994) Characterization of the yeast (1-->6)-beta-glucan biosynthetic components, Kre6p and Skn1p, and genetic interactions between the PKC1 pathway and extracellular matrix assembly. J Cell Biol. 127(2):567-79.

[0157] Saito, K., Yamazaki, M., Kaneko, H., Murakoshi, I., Fukuda, Y., and van Montagu, M. (1991). Tissue-specific and stress-enhancing expression of the TR promoter for mannopine synthase in transgenic medicinal plants. Planta 184, 40-46.

[0158] Schmidt K., Heberle B., Kurrasch J., Nehls R., Stahl D. J. (2004) Suppression of phenylalanine ammonia lyase expression in sugar beet by the fungal pathogen Cercospora beticola is mediated at the core promoter of the gene. Plant Mol. Biol., 55: 835-852.

[0159] Stahl D. J., Kloos, D. U., and Hehl, R. (2004). A sugar beet chlorophyll a/b binding protein void of G-box like elements confer strong and leaf specific reporter gene expression in transgenic sugar beet. BMC Biotechnology 4;31: 12

[0160] Vancanneyt G., Schmidt R., O'Connor-Sanchez A., Willmitzer L., Rocha-Sosa M. (1990) Construction of an intron-containing marker gene: splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mediated plant transformation. Mol Gen Genet. 220(2):245-50

[0161] Van West P, Kamoun S, van 't Klooster J W, Govers F (1999) Internuclear gene silencing in Phytophthora infestans. Mol Cell. March; 3(3):339-48.

[0162] Wang Y, Dou D, Wang X, Li A, Sheng Y, Hua C, Cheng B, Chen X, Zheng X, Wang Y (2009) The PsCZF1 gene encoding a C2H2 zinc finger protein is required for growth, development and pathogenesis in Phytophthora sojae. Microb Pathog. 47(2):78-86.

[0163] Wang Y, Li A, Wang X, Zhang X, Zhao W, Dou D, Zheng X, Wang Y (2010) GPR11, a putative seven-transmembrane G protein-coupled receptor, controls zoospore development and virulence of Phytophthora sojae. Eukaryot Cell 9(2):242-50.

[0164] Yin C, Jurgenson J E, Hulbert S H (2011) Development of a Host-Induced RNAi System in the Wheat Stripe Rust Fungus Puccinia striiformis f. sp. Tritici. MPMI 24(5): 554-561. doi:10.1094/MPMI -10-10-0229. .COPYRGT.2011 The American Phytopathological Society

[0165] Zhang M, Wang Q, Xu K, Meng Y, Quan J, et al. (2011) Production of dsRNA Sequences in the Host Plant Is Not Sufficient to Initiate Gene Silencing in the Colonizing Oomyzete Pathogen Phytophthora parasitica. PLoS ONE 6(11): e28114.

[0166] EP 1716238 (Bayer S.A.S.) METHOD FOR MODIFYING GENE EXPRESSION OF A PHYTOPATHOGENIC FUNGUS

[0167] WO 2006/070227 (Devgen N.V.) METHOD FOR DOWN-REGULATING GENE EXPRESSION IN FUNGI

[0168] WO 2009/112270 (Leibniz-Institut fur Pflanzengenetik and Kulturpflanzenforschung) METHOD FOR CREATING BROAD-SPECTRUM RESISTANCE TO FUNGI IN TRANSGENIC PLANTS

[0169] US 2010/0257634 (Venganza Inc.) BIOASSAY FOR GENE SILENCING CONSTRUCTS

[0170] WO 2006/047495 (Venganza Inc.) METHODS AND MATERIALS FOR CONFERRING RESISTANCE TO PESTS AND PATHOGENS OF PLANTS

Sequence CWU 1

1

4911042DNAPhytophthora infestans 1cgtcaagatg ctgcggaggt ctgtgctgcc gttggcacgt cgtgccttcc cgcggtccgc 60ggctagccta gcgccgtcct gtgctgctcc caagtacttt tcacgtgcct tcagcgttgc 120ggagcagagt cagcggcatg tgatcgccgc gctggttgtc aaccagcctg gttgtctggc 180cgagatcgcc aacctcttcg ccgctcgagg taactatcga tacgcaaaga cgctggccac 240aggagatcct aaacatggtg tgatgcaggc tacaatattg acagtctggt tgtgggtcgc 300acggaggtcg aggagctctc ccgtatgacg gttgtcgtca acggcactgc gcagagtgtt 360gtcaacgtac gtatagtaat tacagagaca ggagcagtag gtgattgaca ctcaatgtgt 420ctttgcagat gaagaagcag ctcgaggatg tcgtgtatgt tgctgtggtc aatatcctga 480gcagtggcaa gaacgctgaa aagaactacg tcgagcgcga cctgatgctg gccaaggtgt 540ccacggccgg tacgtcggac gctgatctga taccctacca ccaccggaat tcgtgaacat 600ggacctgacg taaacatttg ctggtgtgtg tgctggctac agaggctgga tctcgcgctg 660aggtggtgga gcttgccaac ctgttcgacg ccaaggtgat tgacgtgcga ccgcaccagg 720ttatggtaca actggctggc acccctggtc gcattgaggc atttttggac ctgctaaagc 780cgctgggtat cacagagatc caccgcagtg gggtcattgc gatggctcgc agcaccagtg 840tgaccgacga cctgggcgat ctctcgacgt ttgagggcgc cacgcgaacg cttctggacg 900aggccgatga cgaagagttc gatgtctctc gccttccgcc tggataatat gttggtagag 960ttatgatcat gccatcacct ttttcttcga taggacttgt gcctgatgac aattgcagca 1020aggaacgtgc tagcgaagat tg 104223072DNAPhytophthora infestans 2atggtgctcc gagcggttcg gctgatcgtc caggcatctc tgctcctgca agtgctccag 60tgtggcgcct ccgtaactgg tgctcaagta aatgaaaact ttgagaacac tgagcttacc 120tcgaacgata aactgggaac agtggctccg gccgacatcc cgtcttcaca agacgagaat 180ctcaagaaac aggaagagcg tggcttcttt gactggtttg gcaatggcga cgacacgcct 240gccccggctg ctgacgacaa ctccggtaaa tatgcgacta cgacaccgat ccctggcacg 300gctgcgcggc cgtctacgag tagtctgatg tcaaagtatg gtagtatgct cggtgacttt 360actaaagaca cgacgccggc ctcggaagcc gatgagcgca caacgagcgc acgtagcgct 420gccacccgtg ccacctcgga ctcctcttca ggtagtacct ctggcagcgc ggcagcagaa 480gtcaagccga agagaaagaa gaccaagaag cctgtggttg ccgccgcgtc tgaaagcgga 540gagagtgcaa gtgacgacga tgccagcgag gcgagcgctt cgggcagtga ggcaaagccc 600aagaagagga caaccaagaa gacgaggaag ccggtcgtag ctgctgcgtc gacgtctgaa 660tccgaggatg cctcgacgtc tgaatccgag gatgcttcgg gcagtgaggc aaagcctaag 720aagaagacaa ccaagaagac tagaaggccg gtagcagctg ctgcatcgac gtctgaatcg 780gaggatgctt cgggcagctc ggacgagtcg ggaagcgacg atctgtcgga tctgctcggc 840agctcggcgg gttccggaag cgaagatgac atgtcggccc ttctcggtag cgcgggaggt 900tccgggactg acgacgcctt atcagctctg ctggggtcgg gagtcggtgg ctcgggtagt 960atgcttagtt tcgaagactt tatgaagaat tacggtagca tgttcggttc gggaagtagt 1020gctgtcgacc tgttcggaga cccgagcacg ccccagaaca acacgattga cgacgaagat 1080atcatcctcg gcgaactgta cggtggcaag gagcacggcg acgccttctc ggacatcagg 1140aacatcaagt ttggtcagat gatcctgaac attacagttc gcggtcaaga gcgcgtggat 1200tccattggta ttacagtgat gactcaagaa gctgttggta accttgtgca cggtggtgaa 1260ggtggtaccg aaggattcat tgaaccggag atgggtgaca ctattgatac cgtcgaagta 1320cactgggaca agaacaaggg caagacgtgc atcttctacc tcaagatggc gacttctggc 1380ggtaagacga ttgcgacggg aacgaagacg gccaacagcg ccgtcatcaa gccgcccaag 1440ggctaccagc ttgctggatt ccatggtcgt gccagtagtt ctggtatctt ttgtattggt 1500ggaatcttca ccaagcaaga cgcgacggat ctcgcagtca cggacgtgat ggccatctcc 1560agtaagggct ctcctgatat ctacaactac gacaccacca ttcgtaactg ggtgggacct 1620ctagagacag cgagtgacaa cgcctgttac cagaagagag tcgacgtcag cagcaaggga 1680atgtgtccgt cgggtttcaa caaggacgac gacaggtgca tcacccaatg tcctctcaac 1740taccccattg actgcttgat ggagtgcatg cctcaaaaca gtgactgcac ccagttgatt 1800gtcgctaagg tttccgccgt cgttgctgtc gctttaaatg ccgctacgat gggtatcttc 1860ggtacgctgg tggctgccta cagaaccgct aactttgctc tcacctgcgc catcaacgtt 1920gtgaacgctg tcaagtcgct gatttactac ctgcgttaca agcagacctt gatcccgact 1980acggacacgg agaagttgat ggacaaggcg ttccagctgc agattgtcat tcttgacttg 2040cctctggcta tctgttcttg cctgggcatc aagattcctc ctaagctcca gttctcggct 2100accattctgg ctgtcgtgtc ggccattgtc atgatggctg tcatggtcgg tgaggccctc 2160ttcgcgtcgt cgaacaacgt catgctcatg cttcgtgagt cgggcgcttt taacacttct 2220gctctgaacg gagacaccat tgagcttgat acgttcctca acaccaagaa cggcacgtgt 2280ggttacgaga tgagaactct cactaaccgc gtcatgggca aggtctacga aatccgtaac 2340aacacgccga atgctgatgc cgatgatgta cgtgttgagg tgagcaagtc gtccatcatt 2400acggatgaca tccccattgt gaccaaccac tgcatgggtg atatctggac caacaagacg 2460ggcgcgtcgt cgtacaagac gcgcaacctg ctgcgtaaga ccctcagtgt aattgttgac 2520cagctcgttg aggacggtac gaccgatatg ggtaagcatg tgaccaagaa ggagaaggct 2580ctcgaatact cgaatatggg tcttttcgtg ctgtccatgt tcgatccgac gggtattgcc 2640tggatggctt ccgagttcgt gcagcccatt tgtggaccca ctgagtacct gggtgagatc 2700gatgatggta cgctgtacga cgctctgggt ctaaacacgg tcgaccaggc gttcctggga 2760agctacggtg tgtggaagaa gaagggtgat ggctccgtca cggtttactt cgagagtgtt 2820gacaagttcc ctgtgtctgt ggtgatcacg tccggtggtg acaagctcaa ggaggtcaag 2880gtgcctgcta acggcaacgt cacgtggaca tctacggtgg aggagcttgg tgacaagact 2940ctttaccttg accgctggcg tcctggtctc tttggcctgc ctggtacggg cggtggttcg 3000ctactgatgt ggatcccgcg atcgtctgag ggtggccagc ttgttcttca tgctcgcttg 3060aatgttagct aa 307232405DNAPhytophthora infestansmodified_base(949)..(1048)a, c, t or g 3atgtcatccg tagacttgag tatcctgcgc aacggcatcc cggccgagct gccggcgcac 60ccgggcaacc accccgaccc gacgctgccc aaggctccgc accgcaacat cgacggtctg 120tccaaggacg atctcgtgct ggccgtgcag aacgcgttac ggtacttccc cgagaggttc 180cacgccactc tggctcccga gttcgcgcag gaactcaagg acgagggcca catctacatg 240caccgcttcc gtcccgtgca gtacgagatg aaggcgtacc ccattgacca atacccggcc 300aaatgcaaac aggcagctag tatcatgctt atgatcatga acaacctcga ccgtcgcgtt 360gcacagttcc ccaaccacct ggtcacttac ggtggcaacg gtagtgtctt ccagaactgg 420gcacagtact tggtggccat gcgctacctg tccgaactca cggaacagca gacgctcgtc 480atgtactctg gtcaccctat gggtttgttc cctagtcgtc ctgcagctcc acgtatggta 540gtgaccaacg gtctaatgat ccccaactac tccacacgcg ctcagtacga caaggcctac 600gctatgggta acacccagta cggtcagatg actgctggca gctactgcta cattggtccg 660cagggtattg tacacggtac gaccattact gtactgaaaa cctactgacg aggtctatgg 720cggttcagat gagagcaatc taccttcctt ctagaaaaat gctaaacaat tccagtggat 780gttgtatagg tcttgacaat caatattgcc ccctacgatt ttgtcaatat taacaatcag 840tttatttctt ccaatccctg attttacagt gaggatttcg agagtgggaa cgtggaaaca 900aaatcattgt caaatttgag cgagcctttc tcgccgatgc cagactggnn nnnnnnnnnn 960nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 1020nnnnnnnnnn nnnnnnnnnn nnnnnnnngc gtcatctccg gtgtcatctc cgtcactgca 1080gagatcgacg aatctgcagt gaagaagcgt cacgaacagg gctgggttga cgaggtcgtg 1140agcgacctgg acgcctgtgt cgttcgtatc cgtgaggcaa aagccaaggg cgaggtggtg 1200agcttggcgt accacggcaa cgtcgtcact ctttgggaac gtctcgccga cgaggctgaa 1260gctacgggcg agctgctcgt ggagctcggc tcggaccaga cttccctaca caacccgttc 1320aacggcggct actacccggt ccagttgtcg ttcgaggagt ctcagcgcgt catggctgaa 1380gacccggagc gcttccagga actggtacag gagtctctgc gtcgtcacgc tgtcgctatc 1440aaccgtctga cagccaaggg catgcggttc tgggactacg gtaactcgtt cctattggag 1500gcacaacgtg ccggcgcgga cgtgttgcgt cccggtgtta agcccgagga ggctgctgtc 1560tcgactactg cctttaagta ccctagttac gttcaggaca tcatgggcga cattttctcg 1620cttggtttcg gtccgttccg ctgggtctgt acgtcgggtg accacgcgga cctgcagaag 1680acagacgcca ttgctgcccg tgtgatgcgc gagctgctgg ccgaaccgga agtgccggac 1740cgggtcgcgg ctcagctgcg tgacaacttg cgctggattg aggctgcaga ggagaacaaa 1800ctggtcgtgg gatcggaggc gcgtatcctg tacgctgacc gtgtgggtcg cggcacgatc 1860gccatggcgt tcaacgccgc tgtggctagc ggcgagctct cggcacccgt cgtgctcagc 1920cgcgaccacc acgacgtcag cggcaccgac agtccgttcc gtgagacgtc gaatgtgacg 1980gacggctcgg ctttctgtgc cgatatggcg gtgcagaacg cgctgggcga cgccgctcgc 2040ggagctacgt ggatcgcact gcacaacggc ggcggtgtcg gctggggcga ggtcatgaac 2100ggtggcttcg gaatggtact ggacggctcg gatgacgcgc gcgagaaggc ggcgtgcatg 2160ctcggctggg acgtcaacaa cggcgtggca cgtcgtgcgt gggcgcgcaa cgccaacgcg 2220cgcttcgcta ttgagcgcga gatgaaggcg gaccctttgg tacgtttgtt tggttacgag 2280cttgagactt tggaagcgtt agattttaat gtgtgtgtat ctttgtggta ttgcagctga 2340cggtgacgct ggctaacgag gccgacgacg cgagcgtgcg tgacgctgtg agcaagctct 2400tctag 240541735DNAPhytophthora infestans 4atgctctcgc agcttaaacg cagattcacc ctgggacgac gttgtcagac cgaagaagaa 60gaccactcga ggatcaccat gagcctttcc aacagcaaca gtaccagctc cttgccccct 120gtggacgagc accacggctg tgagtacctg gatacggcgc tgacgatctt tgtaatcggc 180gcgtcgggcg atctggccaa gaagaagacg tatccgtcgc tctttgcgct ctacaccatg 240ggctacctgc ctgaacacgc ggtcatcgtg ggctacgctc gcagcgccaa gaatgatgcc 300gacttccgcg cgcaaattgc gccctggatc aagcctaaga cacccgaggc cgaggctcgc 360aaggaggcct tcctcaacaa gtgcatctac cgcagcggca aatacgactc aactgaagat 420gtgggcaagg taagcaagga gatggaggca ttggaagaag cccatggatc gcctgtggcc 480aaccgcctct tctacttcgc catcccgccc acagtcttcg tgcccatcgg cacgagcatc 540aagaaggcgg cactgaccac gcgtggttgg aaccgtctca tcgtcgagaa gccatttggc 600cacgatctcg actcgttcga caagttgtct caggacatgg gcgcgctgta cagcgaagac 660gagatctacc gtatcgatca ctacttgggc aaggaaatgg tgcagaactt gctcgtgttg 720cgcttcggca atgcaatctt cgagcccatt tggaaccgca actacgtgtc cagtgtgacc 780atcactttca aggaagacat cggcactcag ggccgcggtg gctacttcga ctcgttcggt 840atcatccgtg acgtcatgca gaaccacctg cttcaggtgc tgtcacttgt ggccatggag 900ccaccaatcc aagctgctgg tgacaactac tccaactata tccgtgatga gaaggtcaag 960gtgcttaact gcattgagcc tatcaagatc gagaacaccg tcctgggcca gtatgaaggc 1020agcaaggagc tcaacgagcc gggctacctc gaggacccga cggtgcccaa gggatcagtg 1080acccccacct tcgccacagc tgttatgtat gtcaacaacc cgcgttggtc tggtgttccg 1140ttcatcatga aggctggtaa ggccttgaac gaacgcaagg gtgagatccg tgtgcaattc 1200cgcccgcctc ctggagcgca gcacttgttc ccaggtgtca agatcccagt acaagagttg 1260gtgctgcgtc tacagccgga ggaagccgtc tacttgaaga tgaacgtcaa gagtcctggt 1320ctgcagaccc aggcgatctc aagcgagctg gacttgtcgt acgccgagcg ttacgagggt 1380gcagaggtgc cggacgccta cactcgcttg atcctggacg tgctgcgtgg taagcaggcc 1440gcattcgtgc gtgatgacga gctccgtgct gcatggaaga tcttcacgcc attgctgaac 1500gagattgaga cgcagaaggt gaagccgctg cagtatacgt tcggctcgcg tggccccaag 1560gagagcgacg agctggtgaa cagagctggc ttccagtacc accagggcga ataccagtgg 1620cagccgcgtg tgcgcactac cagtgcacta taggttgtct ctttggttga gcacaaagat 1680gcccggaagt ctggcataaa tatgatggtt gagccagcta gtcttcaata aggga 173551245DNAPhytophthora infestans 5gggagcttaa aagtgctaca ggaagtcgct atcatggcgt caagaagtct cgtccgccgc 60tcggcgcgtc tcgccactgc catcgctact aagcgcagct tcgttcgcgc cgcttccgcg 120tcggtgaacc tccagtgctt tcagacagca cccgccactc gccagacccg tcttcagagt 180acgcagacaa gctccagcga tgagccgccc aaaacggagt ccccagtaga cccagagcag 240ctcattctgg ccaaggctct ggaccatgtg atttcccacg ggtacgttat ggtttaagtg 300ctataaaagc gaagatatcc taggttgtaa cgctctcgaa tgcaaggtgg gccattgagg 360ctctagcagc tggcgccacg gatcttggct acccttcggt ggctcacggc atgttccagc 420gcggagctat tgatttggtg gattatttta tggactcgtg tctcgccaag ctacgcgaga 480cgctgattgt caacacggaa aagttgcagg ccatgacggt gactgaacgt ctcaagtttg 540gcgtctgcac gcgtctgcag atgctggagc ctgtgttggc tacatggcca caggctatgg 600ccattggcgc tctaccgcag aacgcacctg gtactgcaaa gagactggcc cagctctcgg 660atgaaatctg gtacttcgct ggtgacaagt ccacggatct atcatggtac accaagcgcg 720ctattctcac gggcatctac gctagcacgg agctgtttat gctgaatgac aagtcgccga 780acttccagga cacgtgggat ttcttggacc gccgtgtgga cgaaacgatc caactcggag 840aactgcctca gaacgtacgt gaagctgttt gagtctctta taaggcttag ctgttgacgt 900gactaactac ttgtgtgctg gtctgtgtct gagcagctga acgatgtggc tgggatggcc 960agtattgggc tgcagtcggt gttttcggct gtgacgtcgc ttgcgggtcc tctggccagt 1020cagatcatct cgaactcgcc tttgagtcaa gttccgaacc cgatttcagc tgtgggcagt 1080gtggttcctc cctcggttgt atcggctgtt gcctctggaa tgccatttag caatcctact 1140tctgctggac atgacggtat ggcgttcaag tcgaaggatc tggacgaaat taaccaagag 1200cttgagaagc tcggcggcct tgacgcgagt gaacgacgga actaa 124561461DNAPhytophthora infestans 6ccacgtccag ctcaagccaa ttgccatgct gtccgctact cgccgcctta cgcgatctct 60gcgtcgccct tctgcactgg gatgccgcct cgagtcctca ttcgctcccc tcactcagct 120atccgaggag gaaaccatgt tcaaggacac agtcgcccgg ttcgcggctg acgtggtagc 180tccgaatgtc cgcgccatgg acacagcggg ggagatggac catgctatca cacgaggact 240attcgagaat ggactgctgt cggtagagat cccagcagac tacggaggta gcgaggcctc 300gttcatgaac ctctgcttga ctattgagga gctgtccaaa gtggatcccg tcgtgggact 360gctcgtggat ctacagaaca cagttgtgaa caacgtcttc ctggtgagtg aagagtacga 420ttggtattct aaattctgta gctgaccatt gtgttgcagg tgcacggcac ggacgagcag 480aaagaaaagt acctgccgag actcagcgcg gacatggtgc gtgcatcaat atttggaaat 540attgtgataa tactaatatt gtacggtgtt gtagatcggc agtttctgtt tgtcagaggc 600tggatcaggt agtgacgcgt tcgcgctgaa gacacgggcg gaggcctcgc cggacgggag 660ctactactcc atcactggtc agaagatgtg gatctccaac gccgagtact ctggcgtgta 720cttggtgttc gccaatgtgg acccgtccaa gggctacaag ggtatcacgt gctttatcgt 780ggaccgagac atggaaggac tggagatcgg taagcccgaa gagaagctcg gcatccgcgc 840atcgtcgaca tgtcccgtca cactgacgga tgtgaaggtc ccgaaggaga acattctggg 900agagctgggc aagggataca agatcgcaat cagcacgttg aatgaaggac gcattggcat 960tgcgtcgcag atgctgggac tggctcaggg agtctacgac cagacgttgc cgtacttgtt 1020cgagcgccaa cagttcggct ctcccatcgg agagttccag gcgatgcagc accaatatgc 1080ggaggcagcg ctcgatatcg agacggcgcg tttgttggtg tataacgcag cgcgtctcaa 1140ggatgctggc caaccgttcg tcaaacaggc tgctatggcg aagcttcatg cctcgcgtgt 1200ggcagagaag acggcatcca agtgcatcga gctgcttgga ggcattggct ttaccaagta 1260cttgcttgcg gagaaattct atcgtgacgc aaagatcgga gctatctacg aaggaaccag 1320taacatgcag ctgacgacga ttgcgaagct tgtgtcggag gaatacaaga ggtaattgaa 1380tgtcgtgatc ctgtactcag acttgatcct tgtagcaaac caaacaagta acatttccgg 1440agaacgagcg ttagaaccag a 146171580DNAPhytophthora infestans 7atgctgcgtc gtcttgccct ccgtaccgtg aagccttctg tgcgcaactt cgcctccgcc 60tcggagctgt acaagaaccc gcgcagctcc aagttcagca tgaccaagat cgtggccact 120atcggccccg tgtcggagca gctggacatg ctacagaaga tcacggacga aggtttgcgt 180atcatgcgca ttaacttctc acacgccgag tacgacgagg ccttgctgcg cgtcactaac 240cttcgtgcct gtcgcggcgt gcacgccgag ggtcaggcca aattcaacct acgtgccgtg 300ctacacgaca ccaaaggacc cgagatccgt acgggtaaga tgcgtgacgg caagaaaatc 360acgttagaga gtggcaagtc ggtggtgctc acgaccgacc cggctttcga gcttgagggt 420accgccgaca agttctacgt tacgtatcag cagttagccg aaaccgttaa ggtgggcgat 480acagtgttac tatctgacgg ccttatccgt ctcacctgta cgtcagtggg taaggatgag 540attacgtgcc acatccacaa taccgaggaa atcggtaacc gtaagggtgt aaacctcccg 600ggtttgatcg tcgagttgcc tgctctatct gataaggaca aacgcgacct ggattggggt 660gtcgagcacg atatcgactt tatcgcggcc tcgttcatcc gtaaggccag cgacgtgaac 720tcgatccgtt cgttcgtggg agagtgcgtt aagaaacact ggggtaacca acctggttac 780attgccccta agatcatctc taagatcgag aacctcgaag gtatccagaa ctttgaggag 840atcctcgagg cctcggatgg catcatgtgt gcccgtggcg atttgggtgt cgaagtgccg 900gcacagaagg tcctgacata ccagaagatg atggtggacc gctgtaacgc cgtcggaaag 960ccggttattg tggcgacgca gatgctcgaa tccatgcaga acaacccgcg ccccacgcgt 1020gccgaagtgt cggatgtcgg caatgccgtg ctggacggcg cggactgcgt catgctcagt 1080ggcgagtcgg ctcagggcaa gtacccgatc gagtctgtgg ccacgatgaa cacggtgatc 1140aaggaggccg accagctcct actcaagcct aactaccagg ccaagttcca gttcgagccg 1200cccacgtcgg acgtcgagtc agccgtgtcg tcggcagtca agacggccaa cgagatgcac 1260gcgcagctcc tgattgtgct cacccgtacc ggttacacgg cccgaaaggt cgccaagtac 1320aaaccgactg tgccggtcat gtgcttcacc accgacctta aggtcggccg tcagctccag 1380atccaccgcg gtctgtaccc ggtggtgccg gactaccttg accgtgcccc gactaccgcg 1440gaggccatcg ctcacgccaa gaagatggga tggttgtctg ccggcgaccg tgtcgtcgtg 1500atcagcggcg acaagctgtc ggacgatctc ggccgggaaa tcctcatcgg cgtcgctgac 1560gtccagtaag acggagacaa 15808900DNAPhytophthora infestans 8atgtggtcga cgatgatcat gcggttccct acgcaggcca agtccgtgtc gcgcagcgcg 60cttgtggcgg caggtatggc tgcgttcgct gccttctcca gtgtttcctc tactcgctgc 120gaagaggaga agtccaaggt ggcgttgagc cccaaggagt tccgttcttt cactgtgcgt 180aaagttgaga ccgtgaacta caacacgaag cgcgtgacgt tcgctcttcc cacacccgag 240cacgagatgg gtctcacgac gcctagttgc cttatggctc gtgccaaggt agacggcaag 300acagtggtgc gcccctacac gcctgtcaac gtgaacgacg agaagggttt cttggagctc 360gtagtcaagg gttacccaca gggaaagctc agcaagcaca tcgtgcagct caaagaagga 420gactctcttg acatgaaagg tccctttccc aagttcaatt actaccccaa caggtacaag 480agcatcggca tgatcgctgg cggctccggt atcaccccca tgctgcagct catcaaggcc 540atttgccgca acccggagga ccgcaccgag atcacgctgc tgtactgcag tgtctcggaa 600gaagatatca tcctgcgtga agaagtggag gccatgatgt acctgtaccc gcagatctcc 660gtgatccacg tgctcagcaa cccgtccgcc gagtggaagg gtcttacagg cttcgtgtcc 720aaggagatga tcgaaaagta catgccggag ccgtcagacg acaacctcgt gtgtgtgtgc 780ggtcctccgc caatgatgta ccacgtctcg ggtgacaagg cgaaggacag gtctcagggc 840gaactgcaag gtctgctgaa agacatgaac tacacctcca ctcaagtgtt caagttttaa 90091245DNAPhytophthora infestans 9gtcgagcaca agaccaacac tcctgcacca tgactaccct caagatcgtc gtttccggcg 60ccgccggcca aattgcgtac tcgttgctgc ctctcagtac gtccgtctcc ttccctcttg 120tgtcttctcc ataccctaac gtctcaccat gttgcagtct gcatcggcca cgtcttcggc 180cccaaccagc gcgtggagct gcgcctgctg gacatcgaac ccgcccagga agcgcttgag 240ggcgtcaaga tggagctcca ggactgtgcc ttcaacctag tggacgctat catccccaca 300gccgatctgg agactgcttt caaggacgcg gacgtcgcaa tcctcgtggg cggcttcccg 360cgcaagcaag gcatgcagcg caaggatctg attgagaaga atgtagccat ttttaaggct 420cagggagctg ctatcgacca gttcgccagt cgcgacgtta aggtgcttgt tgtggccaat 480ccagccaata cgaactgcct cattgccatg gagaacgcac ccagcatccc gcggcgcaat 540ttctcggcac tgacgcgtct ggaccatgag cgtttgcgct cgttcctagt ggagaaggtc 600aacgagaccc aaagcccgaa agttacgtcg aaggacgtca acaaggtcgt gatctggggc 660aatcactcga gcacgcaagt gcccgacgtc acgaacgcag aagtgaaggg ccagccgctt 720gataagatcg tctcggacaa ggattgggct gagaagaagc tcgtcaagga cgtgcaggag 780cgcggtgcag ccatcattaa ggctcgcaag ctctcgagcg ccatgtcggc tgccgccgct 840atcggcgccc acctgcgcga ctggttcaat ggctccaagg acggcgagct cgtgtctatg 900gccatttgct cggacggcaa caagtacggt gtgcccgagg ggctcattta ctcgttccca 960gtcaagtgcg cgggcaacgg cgcgtacgag gtggtgaacg gtcttcccat ctcgccgcgt 1020atcgacgcaa tgatgaaagc cactgcgcag gagctgacag aggagaaggc cgacgctgtg

1080gagatcctgt cgcgccagtg agcagtattc agctaatagc tggacgatgg caacgtcgtc 1140tacaccccat tcgatttttt tctcccatta tgagctgctt caatcgttta tttgaccatc 1200taaaccaatt aatttcttgt tattacgatt tcttattgaa aaaaa 1245101280DNAPhytophthora infestans 10atgtcgtctt cattttgtca gctatccaag cgcgtgctgc agtatcttcg acatgagcat 60ccacatcgtc tatttccctc catcggtcga agacgcaaac tcccaggcat aaacctcgac 120ggaagatctc agcggtgatg gcgcgtggtt agccgcaagg tgttccgatg cacaccacac 180actactcgcg aaaacgacca tacttctgtc ggccagggta acctctgggg agctgcacaa 240cggccgtctt tttagcttat tttagcgagc caacaggttg tgcctcattg gccacgtgtt 300cacgcacgta cgtcacgtgt gtgctcattt taatattaaa gatcccgttg aagacgaaaa 360gcttctttgc tggcatcatg cgcttccaga cgttgttgct cgtccttgtc gcactagtca 420tcgccccgtt tcaggccctg tctccaccca gcgagtccaa cgtgccgttc actcttcggt 480acgtcccggg cttctttaaa caaggtaccc cgtccgtgga gattccacct tcaaattcaa 540ggcatctcgg gctacttgac aacgtcacgt ggacggatgt agacgcctac attgctgcac 600gagccgctca aggcgtggac gtcaagttgt tcctcttctt acgtcatgga gaaggcctcc 660acaacgtcgc cgaagccact tacggcaccg aagcctggga cagattctac agcaaactag 720cgaaatatac tgacgccaag ttgacgaaac ttgggatgca acaggctgtc aaagcgtcgg 780aaaggatcga cgaggagctt aagagaggac tgagcctgga ggaagtcgtg gtttccccgt 840tggagcgtac actacatacg gcaatgatcg cgtgccagaa tcaccacgag atcccgaagc 900ggtcgatgga atggccccgc gagaccatcg gcgtctgcac gtgcgactta cgcggcacca 960tctccgccaa ggccgagctg tacccaagta tcgacttcag tgatatctgg agtgatgcag 1020acccgtggtg gacgcctgat catcgtgaga ccgagctgca catcaacgac cgcgctcgca 1080tcttcctgaa ccgcgtcttc tacggtcaca agtcagtgcg tgttggtgtg gtgacgcaca 1140gtggactaac caccgccgcg atgcgtgtca ttggccatcg taagtacagt gttgcgacgg 1200cggaagtgat accgttcctg cttgaagaca ccacggtgca cacgatcctg tcgatcttct 1260ctggtaaaga agacatgtag 1280111016DNAPhytophthora infestans 11atgtcgtcct atcgtgctgt ccaagttgta aagttgacta aggacttccg cgccgctacc 60agaatcgtga gtgtccccga actacccacc gctgggcccg acagcatcgt tgttaagaac 120cgcttcttgg gaattaactc gaccgacgtc aatcttacga atggcatgta tcatgacaag 180ctgccgtttc tcgcgggcgt tgaaggtgca ggtctcgtca ctgaggtcgg gagtaacgtc 240acgactgtga aagtgggcga cgctgtcatg taccagacgc tgggagccta tgcggactac 300gtacaagtgc ccgtgtcggc cgccatcaag atcccagagc tgtcgaagaa cgctctaccg 360gttgcagtgg gcggcgtctc tgcgtccatc tgccttgaat gtctcggtga gatgaagtcg 420aatgagaccg ttcttgtgac tgctgctgct gggggaaccg gacagtttgt cgtacagctc 480gccaaacttg ctggcaacca tgttatcggc actaccagct ctgacgagaa agtggaggct 540ttgacgaaac tgggctgcga ccgtgtaata aattacaaca aggagaatgt cggcgatgtg 600ctaaagaagg agtatccgaa tggagtagac atcgttttcg agtccattgg aggcgacatg 660ttccgtgctg ctgtcgataa cattgcagtc cgtggtcgta tcatcaagat tggcttcatc 720tcgcgagtat tggagaccaa agacaagacg actccccaag gccgcctccg ctgctatcgt 780gggaagcgaa caagaagatt ctgatgaagt ctgcttccat ccgagggctc ttcatgtatc 840actttgagga acacattcga gagcacacgg agcgattgct gaagctcatt agcgagggca 900cgttgaagcc tggcgttgac cccactacgt acaagaaatt cgagtccatt ccgaatgcaa 960tcgaccgcat gttcgcccgt gaaaatgtag gcaaactcat cgtagagctc gagtag 101612267DNAPhytophthora infestans 12atgggcaagc acacggagcg agccaaggag agtccattca agcagcagtc gatgatcctc 60gtgcctatgg acacaccagg cgtgcaggtc gtgaagccca tgcatgtctt tggctacgac 120gacgcaccgc acggacacat ggatatgctg ttcaaggacg tgcgtgtgcc gttcagcaac 180gtgttgctcg gtgaaggtcg cggctttgag atcgctcagg atcgtcttgg acctggccgt 240atccaccact gtatgcgagc catctga 267131147DNAPhytophthora infestans 13atgcgcaaaa tattgaatat tgattggtta aaacctggtc ttggcatcct tatgaccaat 60tacagttatt gagtgcttta agcggggcag acgtccacta cgtcacactc agaatctcca 120cacaagcaac agaccgacac aatgagcagg tgcgagtggc atcccagcaa cttcgtgcaa 180atttagcctt gttatattaa ttgtataacg tggcatgttg cagaccgacg atctcagagg 240ttatcgccga gcggaaggcc aacaacactg cggctttcat caccttcgtg ccctgcggct 300tcaagactaa ggctgacaca gtggacattc ttctgggact gcagcgcggc ggcgcgaaca 360tcatagaggt gggcattccg tactcggacc cacaggccga tggcccgacc atccagcgcg 420cacaccaggt gggcgtggac cagggcatca cgctgcatga cgtcctggcc acagtgagcg 480aggcgcgaac taagggcctt actacgcctg tggtgcttat gggctactac aacaacattt 540tgcagtacgg cgaagtcaaa atctgccccg acgcccagaa aggtacgcct gtaatcgacc 600acaggagaga tttgtgggct caaaaactga caataaacgt atttgtagct ggggtggacg 660gattcattat tgtggacctg ccgcctgagg aggcaaagac gctcagtgac gacgcagcta 720agcacggact tgcgtacatc ccgttggtgt ccccaacgac gacggaggag cgtatgaagc 780tcatcgactc ggtggcacat ggttttgtgt attgcgtgag tctcaccggt gtcacgggcg 840ctcgtaacga gctgcctccg aacctcgacg cgttcatggc caagagtaag ttgcttttcg 900cgctttagtt tattttaatt gtcgagctaa cgtggtccct tgattcgctg cagttcgtgc 960caacgtgaag caccctctcg ctcttggctt cggtctgtcg acccgccagc acttcgttca 1020agccagcgcg cttgcggacg gcgttgtgat cggctcgaag attgtcaaga tcatcgagga 1080cgcgcctgac acagccacgc gtgctgccaa tgtggaggca tttgccaaga gcatcgtgaa 1140cccttag 1147141917DNAPhytophthora infestans 14atgggtaaca tcctggagga gatcgcagcg cagcgccgtc tggacgtggc ggccgccaag 60caggtcatat ccgccgatga tctggccaag aagatcgagc acgcggaggt cgttttcggc 120tcgaccctgc ccgtgcttga ccgccttaac gcacccacgg tgcgtccggc agtgcaggga 180atctggagaa gaatctgcgt ctaacgcagc taccgctgta ctgtattttt tccttgtatt 240tatggcagag agaggggtgg tccgacgtgg ctctggctgc cgagtttaag cgtgcgagcc 300ccagcaaagg tgacatcgcc acggagctca atctgcgtga gcaagtgcag gcctacgcca 360acgcaggtgc cagtatgatc tccgtactga cagagcccaa gtggtttaag ggatcgctag 420acgacatgag ggcagcccgg gaggtggtcg agggcatgag tcagcgtcct gccatcctgc 480gcaaggattt catcatcgac gtgtaccagt tgctggaggc ccgcgcttac ggagcggatt 540gcgtgttgct catcgttgcg ctgctgtccc aggagcagct tatcgagctc attgacgtac 600gtcgccccgc ttgcactaca tgtagtgggt ttactgtaca ctgacaagcc tcttgttggt 660ttgtaggcca cccacaatct cggtatgtgc gctctggtcg aggtgaacag catccaggag 720ctggacatcg ctctggctgc gagggctcga ctcattggcg tcaacaaccg cgatctccgc 780acgtttaagg tagacatgaa cacgacggct cgcgttgcag acgctattcg tgagcgtggg 840ctttcgctgg gacgtgacgg cgttacgctc tttgctctca gtggcattcg ctcgcacgca 900gacgtggtca agtacgagaa gtgcggcgcc cggggcatct tggtgggcga gtacttgatg 960aagagtggtg atattgccgc gacggtgaag gatctcttgc agaatgtgac gcgtcacacc 1020gagtcgggcg aattcgcttt ggctcctccg cttgccaaag tgtgcggcgt cacgacagtg 1080gagtacgcgc tggcggcctt gcgtaatggt gccaatatga ttggtatcat catggcggaa 1140cactcacccc gctatgtcca agtggaggaa gccaaggcca ttgcccaggc tgtgtgggag 1200tatggggagc gcacgggccc tattctctca gacattgtgg agactcactt ggacggcaag 1260aacgactggt ttcatagaaa tgtccttgcg ttgcgtgaag cttgctcgcg tgcacctctc 1320gtggtcggag tgtttgtcaa caagacagct gccgagatga acgcgactgc aaaggaaatc 1380ggactggact tggtacagct acacggcgac gaggggtttc agatctgcag ggacattaag 1440taccccacca ttcgcgcgtt gcatctgccc gacaccacgc tctgcgacgg cgtggacgca 1500gaagccgttc tacagcaggt tcaggaaggc cttgccaact acattctgct tgatacgacc 1560gtgaagggtc agcagggcgg cactggcgtc acattcgact ggaagattgc agccatcttt 1620gcgcaggcac gacttccctg cctcatggct ggtggcctta cccctgagaa cgtggtgaag 1680gctctatcgg tcggtcaccc cgttggggtg gatgttagca gtggagtgga agtgaaaggt 1740tcacctggtg tgaaggatat ggacaaggtg actgcgttcc taaaggctgt gaaggattac 1800ctctcgattg ctacgcttaa gatcgaggag gagacggaaa cctagagaga gaccctcgga 1860gtgttctaat caatgagggc cactaatgaa gtgcttttac gttacgagct tggatgc 1917151494DNAPhytophthora infestans 15atggtgcact atcgtagtac tcgcggcggc gtccgcggcc ttagctttga gcaggcggtg 60ctgacgggct tggcttccga ccgtggcctg ctgatacccg aagctgacga gttccctacg 120cttccagctg atgcgctgga gaagtgggcg tctctttcgt accaggaatt ggccgtggag 180gtcatgcgcc ttttcattga cgaaagcgag atctcgcgtg accagctgcg tgagcttgtg 240accaagagtt acaacgcgac cacgttccgc tccgatgagg tggcgccggt ggtcaaggtg 300acggatcaaa tgctggtgct tgagctcttc catggcccca cgtttgcctt taaggatatc 360gctctccagt ttctaggcaa ccttttcgag tttttcttaa agcgcaagaa cgaggcgctg 420ccttctgacg ctcctaaaca ccagatcaca gtcgtgggcg ccacctcagg cgacaccggt 480agctcggcca tatacggtct ccgcggcaag gagaacgtcg aggtgttcat cctcttcccc 540gagggtcgtg tgagcgccat tcagcagcga cagatgacta ctgtattgga ccagaacatc 600cacaacgtgg ctgtgaaggg cacgttcgac gactgccagg ctatcgtcaa ggaccttttt 660gccaacgctg acttcaaggc caagtacaac ctaggtgccg tcaactcgat taactttgcg 720cgtatcttgg cgcagatcgt gtactacgtc tgggcctact tccgtgctca cgacgagggt 780gttagcggcg aggttgcctt ctccgtccca acaggcaact tcggtgacat ccttgccggt 840ttctacgcca agaagctcgg tgttcccatt ggcaagctga ttgtggctac caacgagaac 900gatatcctgc accgcttttt ctccacagga aaataccacc gccgcgacat cgagcacacg 960atttccccgt ccatggacat ttgcgtgtcg agtaactttg aacgttatct cttcgctctg 1020tccggcgaga accacgacat tctacgcggc tggatgcagg ctttcgagca gactaatgag 1080ctcacgatct cgggcgagct gctctccaag gcacaagacg agatggcatc gtatgcggtg 1140cttcaggagc aggtgcgctc cactattgcg gagtacaaaa cgatgcatca gtacctcttc 1200gacccgcaca gcgctattgg cgcagcagct gccatgcact ttgtccagga taaccttgca 1260gacaagccaa actcggcggt agttgtagtc ggcactgccc actacggcaa gttcctcccc 1320gtggtgtcga aggcactagg tgtcgctgag tcagagattg agcaacaccc gatcctcaag 1380gcgctggaat cactgcccac ccggctttcc gttgccagca actcgagtga aactgtggct 1440gagcatattc gcaagattat tgctgagaag aacgacgaag cctgtagtga ttga 1494161299DNAPhytophthora infestans 16atgagctcgt tccgtcttcg tattgccaac gcgcgccaga tcgttcaagt ttgtgcgaac 60ggcgagccgt ttaagaccgg cgcggcccaa aaggatctgg ctgtgctcga gaatgcgtca 120cttgtcgtgg acaaggcagg taagatcgcc ttcgttggtc ctgccgctga cgtagagaag 180tggctgagca cgcagctgca gcccgtgagc tttgagaagg acgtggacgc tcgtgacatg 240gtcgtactgc cgggttttgt ggatgcgcac acgcacccag tgtggagcgg caaccgtgtc 300aacgagtttg ccatgaagct ggctggcgct acctacatgg aagttcacga gagcggcggc 360ggcatcaaca acacggtgcg tcacaccaag aagagttcag aaactgagct gttggagctg 420ctgcgtacgc gactagaccg catgttgcgt agcggtacga cgcttatcga agcgaagagc 480ggatacggtc tcgagactga cactgagctc aagatgctgc gtgttttaca ctccgcatcg 540acgggtgaca acgcacaccc tgtggagatc gtgtccaact acctgggtgg tcactcggtt 600cctgacggca tgactgctgc tgaggccacg gaggatatca tcacgaagca gattcctgct 660cttgtgcagg ccaagaagga cggcaccatc tcgcccgaat tcatcgacgt gttctgcgag 720aagggtgtgt tcgagcacaa cgactctcac cgtattctag aggcaggcaa gaaggcggga 780ttggacatta acttccacgg tgatgagatg tgtccgatgc agtccggtac cttggcggca 840actctgggcg cccgtgcaat ctcgcactgt gagatgctga ctgctgagga tcttcaggct 900atggcagcgc acaagccaga gcctgtattc gccgtgcttc tgcctactac caagtatatc 960ctgaagctgc ccaatccgcc agcacgcgac atgatcgctg ccggtgttcc tgttgctctg 1020ggcagtgact acaacccgaa cgctcattgc ctttccatgg cactgaccat gaacatggca 1080tgtgtgctgt tcggtatgac catgaaggag gctcttgtag gcgccaccat caacgccgct 1140gcctccatca accggtcggc tactcacggc agtctcgagg tcggcaagca gggcgacttg 1200gtcctgatgc gtgctacgca gtgggagcag atcatctacg aaatgggcga ccctcctatt 1260gaacacgtag tgaagaaggg agttgtctac acgaagtag 1299171846DNAPhytophthora infestans 17gcaacgaaca agtctcttcg ttccacttcc gtttcacctc gtcgtcatgg ccatcgccaa 60ttcgaacacg aagtctgagc tcgttctgga cggcgagtct ctctgtgctg aagacctggt 120gcagctgtcc aagggagaca cgagaatctc gctaagtcaa gaagcctgga agcgcgtggc 180ttgtggccgt gaggtcgtgg acaatatcct caaggacaag actcgtgtgg cgtacggtat 240taacacgggc ttcggactct tctccaacgt cattatcggc cccgagaagc tcacagagtt 300gcaggaaaac ctcatccgct cgcactcgtc tggcacaggc gagccgttga cattcgctca 360gacgcgtatg ctgctcgcgc tgcgtatcaa tgtattggct aagggacact cggggatccg 420tgtgcacact ctggagcagc taatagacgc ctttaacgcc gactgtctgt ccgtggtgcc 480agccagaggc actgtgggcg cctcgggcga cttggctccg ctagcacacc ttgcactcgg 540tatgatgggt gaaggaccca tgtgggataa ggtggatggt cagttcgtca tcagcgaggc 600ctccaaggtc ctggccaagc acggactgaa gcctgttcag ctcggagcaa aggaaggtct 660ggctatgatc aacggcacac aactcatcac gtcggtgggt gctgaggcgg ttgtccgtgc 720tcagaacgtc gctaactgcg ctgatatcgc cgtcgcattg acactcgagg tgctctgcgg 780tactgtcaac gccttccacc cgcgtattca tgcagcccgt ccgcacactg gccagatgct 840cgttgcctcg cgtattcgca cactactacg tgctgacaac ccgtccgagc tgttccgtag 900ccacaactac gaaggaaagg tgcaggacgc ctacactcta cgttgtgcgc ctcaggtgca 960cggcattgtg cacgacacga tcaacttcgt acgtggtgtg ctggacgtcg agatgaacag 1020tgccacagac aaccccatgg tcttcacggg tagtgccgag gtcacgacgg atctgtctcc 1080ttcaattgac acgaatcaag tcaagcccaa catcgaacag gtagaacacg agatcacgga 1140tctgaatgac gccaaggagg agatcaagcg tcttaaggct cttgttgcac agaagcagaa 1200gcctgtggaa cacccggcgg cgggtatgaa gcgcacatcg gacacgttct accgtggcgg 1260cggtggcttt gtcatctctg gcggcaactt ccacggcgag tatccggcta aggtgctgga 1320ctacctggca attggtatcc acgagattgc tagcgttagt gagcgtcgta ttgagcgtct 1380agtgaaccca acgctcagca acctgccggc tttcctcgtg ccagagggcg gtctgaactc 1440gggttttatg attgctcact gtacggcagc cgctctggtt tcggagaaca aggtgctcac 1500acacccgtcg tcggtggact cgatctctac gagtggagcc aaggaggacc acgtgtcgat 1560gggaggcttt gctgctcgta aggcgcttac ggttgtggag catgtcgaga ctgtagttgc 1620tattgagatt ctggcagcgt gtcaagccct tgacttgctg cgtccgctgc gtacgacgga 1680ggctcttgaa gctgtccacg gactggtacg cacccgcgtg gctaggtttg acaaggatcg 1740cttcatgaag cccgacattg acgccgtgct ggacctcgtt cgtagtggag ctatctgcga 1800cgttgtagct ccgttcttgt caaaactgca cgtgtcagga ctttaa 1846181218DNAPhytophthora infestans 18ccgcacagag caactgccac taggcatcat gctgcaccga cttggccgcc gctcgactgc 60cacttccgcc cagcggtcac tgcgccgatc agccatgacg ccaccgcagc gccaatcctt 120tcatttcagc tcgtcagcac gcaagccggc atctttggat gctcagaacc gcgtagctgg 180tgctgcctcc tttttcctgg acgccaaggc cgtttgcaag ggcaagcgct gtgcattggg 240caagaacaac agcggtattg gagctaaccc ggccacatgc ggggaggatt cgttcttcct 300cacacctgac gtggtgggcg tggctgacgg cgtcggtggt tggaacgaga acggcgtgga 360tccaggcaag atatcgcgct cgctaatgcg caacgcggca ttatttgtgc agcagcagac 420ggccaatagc gagagtgcca ccacgcaaca ggttctggct cacggctaca agcaggcgct 480gctggatgac gaggtggagg cgggtagcac gacagcctgt atcgtgagac tgaagcagtc 540gtctgagggc aaacccgtgc ttgagtactc gaacctcgga gattctggct tcgtggtcat 600ccgcaacggc gagataatct tccgcagtaa atttcaggtt cgaattgact gttgggagtg 660acagtagaag agttactgac ggcgttgctt tagtattatg gacgtgctcc gtaccaactg 720gcaaagatcc ctctgcggtt taagcagtat ggtgctattg agaatcaccc tgatgatgta 780agtctgcttc gcatttggat actatttatg ctggagacag tacaatgcta acggttattg 840ctccaggcgg actcgggtga gattgacgtg caagacggag acctcgttgt actagccact 900gatggtgttt gggacaactt cgcccccgac ctccagaaag ctccttcgca gttcccggta 960agattcttta ccgccgtgtt cgagctacct gtaattactg actttgtttc tcgttattgt 1020ctgctatttc taccgtagcc gatgctctcc tggcgaagat attggtcagg tgaactcgca 1080tcttttgtgg atgttattgc agagaacccc gacaaggctg ccgaaaatat cgtcctggcc 1140tcgctccgcc acaaccttaa gcccgacgac atcactgtcg tcgtggcaaa ggtagtcgtg 1200atggcatcaa agctgtag 121819735DNAPhytophthora infestans 19atgaagcagt tactgcagcc gatctcgttc tctggtgctg cgagtgtgtt cgtcgtggtg 60gcaaagcaac gcaagaaacg ctgccgtgcc aatgacaagg aagatgacgc tgttaaggac 120gacgaagaga ctgagacagc agaggacgaa ctggacgagg aagaccaacc cacgcgactg 180tacgtggcca atgtgggcga ctgtcgagct gttttgtgca ctgcagacgc cttagcagtc 240gacatgacga cggatcacaa ggcgtcgcta ccggctgaac aggagcgtat cgaggcgtca 300ggtggcttcg tgcacaacgg ccgactggac ggcattctgc agatctcccg tggcttcggt 360gacttggcgc acaaacagga tggccacttg gtggtcacgc cagatgtggt ggagcatctc 420gtgaacccgt cggaccagtt cttgctgctt gcaagtgacg ggctcttcga cgtgttgacg 480tcgcagcaag ctgtcaactt tgtgctgcgt aaacttcaga cccatggaga cgtccaactc 540gcagctcagg agctggtgct caaggcgcaa gcttacttcg cacacgataa catcagtgtg 600gtcattgtgg cgttgaacca gaaaggtgac gcgtgaaatg aacagcggct tctattgact 660acggaagatc ggagaccgac gaagaagcag aaaacccgga gatcaagctc gagatccaag 720aaattatgaa caaga 735201845DNAPhytophthora infestans 20atgcgacgca aggagaccaa ggtgttgttg acgctcgaag aggtgcgcga ggccttcgag 60cagcagacgc cgctggccgt caaggacgcg ctgggtgtca ttcatgaggc gcagttcatc 120atgaacctgg agccgaacct tgtggccgtg cggcaaagag cttcaacata tgtttttgga 180gatatccatg gccagttcta cgacctgatg cagctgatgg acgccgttgg cgttgccgac 240ttggccgagc gtgatgtcca gctggtgttt ctgggagact acgtggaccg cggggccttc 300tcgtgcgaag tgatgctcta tctgctactg ctcaagatcc gattttccga caaagttgtt 360ctcctccgtg gcaatcacga gtgcgaatcg atttcatcct tctacggatt tcgcaacgag 420tgtaagggga agtacggcat ctcagcctac taccacttct tgtcctgttt ccaatcgatg 480ccagtggctg cgctgctgtc cacgtcgcgt gggcaagttc tgtgtgtgca cggtggcctc 540tcacccgagc tgaaaacaat cgaagacatt caaactatgg accgacggcg ggaaatccct 600accacggggc tgttatgcga ccttttatgg tcggacccga agacttcgca cactcgcgat 660gtggacgcag aggtggacac tcagccagga tgggagccca atcaggcccg tggatgctcc 720tactacttca attcggcggc attgttcgag tttttaggca ccaacaagct gctgtcgatg 780cttcgtgcac atgagttcga ggatgaaggc ttcacgtatc acttcaactc gcaggagtat 840caagagctgg atactcgagt ggacaagtcc atgcctccac tcattaccgt tttttcggcg 900ccgaactact gcgacagcta cggcaacacg gccgcctatt tgctcttccg gaatgaacct 960ttctcgtggg aaatccagca aattaactcc gcgggacatc cagccccacc gattgcgagc 1020gcagaacgag gatccgacat gtggcgacta ttcaatcaaa cgttgccatt cctcccagca 1080agcaaggaat tctttgagga agttttgtgg ttagcagaag gacgacgacg tcttacaagt 1140gaaatgcacc cacaagctat ccgaaagatg ttggatgacg aagtgaacaa atgggaattg 1200gtagaagaaa cgccaacgcg cagctcgggg ccagcgtctc ctcctcgaat ccaccgcaga 1260ccttctttga gtaatctgga cgagacccaa acggacgagc gtccaagtct gcttactccg 1320caagagatgg acacaattaa gctgatgttt tcattaatgg acacggatgg cagcttggaa 1380ctcagctcga ctaaagtgtc tcagttcatt ctcaatattc tgggtgaaaa aatcagcact 1440gcggacgcgg aggcttattt ggatgctttg gactacgacc gcaacggagt ggtggatttc 1500gcggatattc tgtcgtgggt tgccgtgatg aaggcgaatc gcaacaagca cgagtcgagc 1560cgactcctga gttggccaac tgtacagagc ggtgtgcgca tgttgactcg tgggattttt 1620tccagtaaag tcttgctatg gctcgcattc ggctgcttac tacgcgatat tatcgtccca 1680aagcagcgaa aagtgatcaa gtcgtcgtcg atccgagtgc tgggctcagc gtcgctagtc 1740ctgtacatgg tgggcgtatt gtcagggcga gagcgtggct ggctgcggct tttctctctg 1800caacgcgctg tcggaattat gacgcagcga ttcgtatcaa agtag 1845211489DNAPhytophthora infestans 21atgatgccgc ggggcttacc accacgaggc ccacctggca gtttcccacc tactagtgtt 60gcggctgtac cccctgcagg cggtgccgct gcagctcgtt tcggcaagct ctctgtgaag 120gtgttgcgtg cgtttgacct aaaaaagctg ggaatgctgg acactgcaga cccgtatgtg

180aagctcacga tcggcacgca gaacgtacag actaaggtcc aagcaggcgg tggcaagacg 240cctgagttta atgagacctt cgacttcaat attgcaaccg agaaggagct cgtggtcgaa 300gtttgggacc aagaaaaagg aggacaagac cggttcatgg cgcaggcgaa ggtggagatc 360gtgtcgtggc tatcaaaggg tggctttgaa ggtgacgtcg agctacggga tcgcgagaac 420agccctgccg ggaagctggc gatcgttgcc aagttcacga agcccgaaat tggcgcgaca 480ggacccgtca aggctccacc catggcccct ccgatactct caggtcctgc agtggctccg 540ttgcccccag gagcgaatgc cgtatctgtt cctggtgcgc tgccattggc accgtccgaa 600ccgcctcgag acccgaacgg caagttcacc gacaaggaga ttctcgaggc atttaaagcc 660tttgatctgg atcacaataa ctatgtgggt gctgcggaaa tccgccatgt gctaataaat 720attggcgagg cgcctacaga cgaagaagta gatgaaatga tcaagatggt tgacaaggat 780ggcgatggcc aggtgagctt tgccgagttt tacgcgatgg ttacgaaagg gaagcagccc 840ccacccggat tgggtgtcac tacagctctt ccggagaaag ctgcagctcc tggaggtgca 900gtttcgggcg ctcaggccat tcagcttcgt aatcagcgca aaatggcgct ggaagagttt 960gcacgcgata acggtatcaa acccgagagt gtgaagaagg cgtacaagcg attccaagcc 1020acagataaag atggatcggg ccagatcgac tactcggagt tctgcgaggt gctgcaggtg 1080gatccatcgc cgcagtgcga gaaggtgttc cagttgttcg acaatgacaa gacgggtcgg 1140atcgacgtcc gggagttcat gattgcgttg tctaatttca cgggtgctga gaaggaggag 1200aaactaaagt tcgcgttcct cgtgtttgat gaagatggta acggtgtgat cacgcgacaa 1260gaactgatga agatcctgaa ggcgaaccac atggcctcta gcgaatcgga agttgcgcgc 1320aaggcggaca ctattatgtc ccaaggggat aaggacggcg acggagttat ctcgttcgac 1380gagttctcag ttgtgagcaa gaagtttcct aatattttgt tcccagccta cacgctaggt 1440acggccaaag attagaatac ccgatgaata caatatcctt atctctcgt 1489222862DNAPhytophthora infestans 22atggctagca agctcaacgc gttcctggcc gcggtgcctg cgaacgccaa cgtgcccagc 60ccgcccaaga cagcgccggc cgtgatggcg ttcccgcagc ttgagttcaa ggaagcgccc 120gagaacgtgg gcgcattcgc ccccaccacg ccgcagccgc ccgtggtgcg tcgtcgccag 180cgcaaaaata accccagcct caagctggag ctggactcga accaggaaca tgacagacct 240gaggatgatc gagatatgtc gcgtccttcc cctctaaaga gcttcatggc cgcccaagca 300gccgccgtta agctgaaggc acagacggag aagcacgata tcccaacacc agacttggcg 360cgcacaagca gcgggtccga gctggacgcc aagtcggagg cgggacccat gcgcatggcc 420agcgtacaag gctcgcacca ccgtcgcgtg tccaccgaca caacgctatt taaccggtat 480ctgcgtcaac aagcagacct ggatattagt cacgacacgg tgcagtattt cgcaaatgtc 540ccggtcatta ccgccactgc agctgccgtt gatgctctgg aatgcgaaat gagtgtggat 600aataacgccg acgaggagca cgcgatcatc gtacaggaac ccgaggagat ccttgctgtc 660ttccgactcg gaggcaccat ccctgtgtcc agtgcgctgg aaattgtacg acgagctacg 720aacctcatgg cactagagca gaacgtcatc tcgattcgtg cgccgtacac tctagtgggg 780gatctccacg gccagttcca ggacttgctc gaactcttcc gagtacacgg ctctcctgcc 840gtggacaacc cgttcttgtt cctaggtgac tatgtggacc gtggcgtgtc ttcgtgcgag 900ataatcttat tgctcttggc cttcaaagtg gctttcccgg acagtgtcca tttattgcga 960ggcaatcacg agtgtcggag tttgagtaca ttttacggtt tccgtgccga atgcctcaag 1020aagtacggac ctgtgctcta taaccgtatg atcaagtgtt tcgagagtat gccactggct 1080gcacgactcg agacagcgca cggcacgttc ctggctgtac atggcggact gtcgcccgat 1140attcagttcg tgggggacat taacggacaa gtgaaccgct ttatggagcc tgaaccaaac 1200ggagctctgt gcgacttgtt gtggtcagat cctgcgaagg gcgaagctca ggagcaggag 1260tgggcaccca atgggatgcg tggctgctcg ttcacattta atgaacgcgc ctgtcgcgaa 1320tttctgaagc gcaacaacct cctggccatt gtacgtgctc atgaactgga agaaaatggt 1380tataaggagc actttcgaca cgaaggagac cgcacagaag aagacgagga cgggaaactg 1440gctctacctg cggttgtgac ggtgttttca gctccggagt actgcaacac gaaccacaat 1500gtcggcgcga cgctgaaaat tccctgggaa agacaaaatg gtcgtctgct gcagtatcag 1560cagcataaac gcagtcaatg ttccgagttt gagttcacgc gagccagcga ggagacggcg 1620gccaaggcgt ttctggagga gaatttgccg ttcttgccga ttgactttta cgacttggtg 1680aatgtgtgtc ggcagctgcg gctcactctt gagagagcag cgagtatcac cccagcacct 1740gcttcagaac ctattcgcaa gctgtcgctt gtgtcgtcgc tgtgtgcgcc agcaactagt 1800ctggaaacga ggatcgagga ggaagaccca gagcttcccg tgtcgccacc tgcttctgca 1860ccagcaaatg aagtggagaa ggaagctaca gcaactctga aggcagtggg cgagtcgttg 1920caggattggg aacttgttga gacgaagagt gtcgaggttg acactaggaa ggtgaagaaa 1980gacaagaaga aggagaaaaa ggagaaaaaa ctgaaggaga agatcgaaaa gaagaagcaa 2040aaggacaaga agaagtggga tacgagtcga attgctagcg gttggaagct ctgccctggg 2100tttgtacgct tctacgaccg ctacttctca agagacagta tgaagaagag cgagccggag 2160atcacctcag ctcctggcca tctaggcaag cggccgtcgt ggatctcaaa ctacaaaaca 2220ccttttagac gctcgacttc gaccggcgag gcccccaccg acactgaaac tgtcgacacc 2280gtcttggact ctaccggtcc tgctcgacgg aagagtatga cggattggat gcccatgccg 2340tcgttcgagc aggtggcgca gctgacgaac acgcttcagg gtcacattcc cgtgcagtcg 2400aacggcgtca atgtattcac gaaggcacag tggcaagctc tgaagttgta cttctcgatc 2460ctggatctgg atggcaatgg cgttttgatg gaagagagct tcgttgttct cctcgcagag 2520caagacagcg gtgggttgag ttaaagtgaa gtgaggatgt gaatttgttg ctaatttaaa 2580ttgttgttgg tgttgtgtgc agatgcatac gcgactgaag acgaactgag tctgttgatg 2640gaagtcatgg actgcaacgc cgacaatatg atcactgagc aagatttctt gctattcgca 2700taccgagcct tactgcgatg gaaaaaagct ctacatggct ccgactagag tgtgcaggag 2760cggaatcgaa ctgacgtagc gaagtatgaa caatgccaga ttagaatcca cagtagcgcg 2820gcatatgccc ataatgaaga acgagaaatc tattagttga aa 286223984DNAPhytophthora infestans 23atgtccgcgc cgaccttcca tcgatcattc cgcaatttgc agcttccaag tcaacagtcc 60aagctccaaa ccgaaacaag agtgatgatc gcaatttcga cagctgagga tttccactct 120gccgtggccg ctgcgactca gaagccgttg gttgcctgtt tctccgcgcc gtggtgcggc 180ggttgcaagt tggtggcgcc caaggtggac aagctagccg aggagcttgc cgagaccgtc 240tcgtttgcca gggtgagtgc tgaggagcac gagacgttat gcgaagaagt ggaagtggac 300agcttcccgc acttccgcgt gtacagggac ggcaagattg tgggtgacta cacgagctcc 360aagttcgaca aggtggagtc ctttatccgc ggccatgtgg ctcctaatac tgtgcaggag 420accgaggaaa cacctgaagg cgaggttacg gaggaaacgg cggagaagga tgctgcgaaa 480gaggaggaag tgtcagctga ggctgcgacg gaaggctcaa agaagcgcca ggagcgtgaa 540gaggaggaga cgaatgacga gcaggtggct aagaaggcca agacggagga ggaggcgtcg 600acggaggctg agaaggctgc aactacggag ccagctgaga aggttgagga agcggcaacg 660gaggagaccg agacggctga aaaggattca tcagaagaga agatcgaagc tgctcccgtt 720gagaagtctg aaacggccgg gaaagacact gctccagtcg atgctgctgc tgcttaaacg 780acactgctct gctttgcatg atgtctaaat cgacggacat cttctgtggg ctagctgggg 840gctgattgat ccagctgaaa tcaagatgaa acaataaaaa aagaagtatt ttatggcgat 900tcttttgttt gtgcccgata tcctcgacat gttctgaata catgtacatg tgctctgcct 960tcttgtcaga acaatgtgga atgc 98424501DNAPhytophthora infestans 24caagcagtga agctaaggaa caacaagatc aaacaaacca tacacctatc tacgatgcct 60gtcgagatca acacccccga agagttcaac gccgctatcg gcgagaagaa gctgacggtc 120gtgcagttct ctgcgccgtg gtgcggcggc tgcaagatgg tggcccccaa ggtgaccaaa 180ctgatggagt cggacttcgc tgacgtcaag ttcctcaagg tgagcgcgga ggagctagag 240gatttctgcg aggagatcga cgtcgacagc ttcccaacgt tccgcgtgta caaggacggc 300gaagtggcgg cgtcttacgt gagctccaag tttgagaagg tagagcagtt catccgtgag 360aatgcgaagt aagcgtgacg gcgatttgcg accgtctatc aaagctcgcg catggtgatc 420tacaggcttg atgacctacg ctaagatggt ggagagcgag tgagtttggt ccccggcatt 480gcgtatcggc agtggactga a 50125734DNAPhytophthora infestans 25gacaagcagt gaagctaagg aacaacaaga tcaaacaaac catacaccca tctaagatgc 60ctgtcgagat caacaccccc gaagagttca acgccgctat cggcgagaag aagctgacgg 120tcgtgcagtt ctctgcgccg tggtgcggcg gctgcaagat ggtggccccc aaggtgacca 180aactgatgga gtcggacttc gctgacgtca agttcctcaa ggtgagcgcg gaggagctag 240aggatttctg cgaggagatc gacgtcgaca gcttcccaac gttccgcgtg tacaaggacg 300gcgaagtggc ggcgtcttac gtgagctcca agtttgagaa ggtagagcag ttcatccgtg 360agaatgcgaa gtaagcgtga cggcgatttg cgaccgtcta tcaaagctcg cgcatggtga 420tctacaagct tgatgaccta cgctaagatg gtggagagcg agtgagtttg gtccccggca 480ttgcgtatcg gcagtggact gaaggatgct actaatatat tgaaatagga aaccatttta 540acgaagaccc tgagcctcag gctcattctc aaccggaaat atagaccgca tgcggtccca 600ggaggacaaa tagagtcttc taattggctt acggggtagg tggtcgcatg cgacgaagtt 660cataaaaaga cgctcatgcg gcaatttgcc cgcatgcgct aaacttgccg cacagtagag 720tgtaggggtc gagt 734261448DNAPhytophthora infestans 26ctcgagccca agcgacaatg gcggcggtga ctggcagtgt ggtaagcgtt cagagtgtgg 60cgcagttcga cgaggcaacg gcgcgcgagt cgacgctatc cgtgagtttc ttctgggccg 120aatttcacga ggcctgccgt cccaatggac agctggacgt ggtggtgcgc cagctcgcga 180ctctgcaccc tcgcatccgc ttcctcaagg tggcggccga ggagattccg gagctctcgg 240agcgttttca gatcgccgta gtgcccactt tcgtcgtcgc acagggtcgc gccgtgctgg 300acaaactcga gggcgccaat gtggccgaac tggccaagcg cgtggatgtt ctgagcaaga 360gcgtggccaa gagcagctcc acatccgcgt ccacagccga ggacgccccg aaaccgctgg 420atgacgcgct cgaataccgt ctcaagaagc tcatcagcgc gtcacccgtc atgctcttca 480tgaagggcaa tccgacggag cccaagtgcg gctttagtcg acagatggtg gcgctgttga 540acgaagaaaa gatccaattc ggcacctttg acatcctcaa tgacgacgaa gtgcgtcaag 600gactcaagca gttttccaac tggcccactt accctcagct ctatgtgaat ggctcgctca 660ttggcggact ggacatcgtc aaggagatga agtccgaggg atccatcgtc gagcaactag 720gactcacgaa gaacgtcgag gaggctgaag ctgccttcca agagagtctc cgtgcactcg 780tcaactccgc tccagtgctg ctcttcatga aaggccatcc gtccgagccc aaatgcggct 840ttagcaagaa gacagtcaag ctcctacgtg accaccagat tggcttcagt tcgttcgaca 900tcttgagtga cgagcaggtg cgtcaaggtc ttaagaagtt ctccaactgg cctacgtacc 960cgcagctgta cgtcaagggc aaactcgttg gtgggctgga tatcctgaac gagatggcgg 1020aggacggcga cctcagtgaa cagcttggcg tggagaagaa ggccaagaag gagaacaaat 1080acgaacagct aatcaaccgc gctcgcgtca tgatcttcat caagggaacg ccccagcagc 1140cgcagtgtgg cttcagtcgc aagctcgtgg acatcctgga cgccgagggc ttcaagtacg 1200actactttga catcctcacg gacgacagcg tgcgtcaggg actgaaggag cactcgaact 1260ggcccacgtt cccgcagctt tacgtcaatg gcgagttgat cggcggactg gacatcgtgc 1320agcagctgca ggaggacgga gaactcgccg agctcaagga gtagacgacc aggtcatcct 1380tcgcgtaaaa cgaatacaga aaatcatttc tcttatcctg catgtgtatg ctgggtttga 1440tggtttaa 1448271106DNAPhytophthora infestans 27gtcggaagag gtcgtcggtc gtccatgcag ctgcagacgt tggcgtacgc catctccggc 60gccttcacgc tgctttccat tatcctttcg ggatggctca tctggacaca cttgctgtac 120aatccgtcag ccggcatccg caagcacgtg atccgcatcc tcatgatggt ccccatttac 180gcgctaacgt cctacatggc gctggtattc aacgagtcca aactgttgtt cgagactgtg 240cgcgatctgt acgaagcctt cgcgctctat tcgtttcact gcttcctggt cgagtatctg 300ggtggccaat ccgttctagc aagcaccatg cgctccaagc cgcagatgac acacgtcttc 360cctttctgct gtgtacagcc gtggtccatg ggcggcaagt tcctgcgtca aaccaccatc 420ggcatcttgc agtacattcc cattaagctg cttatgagca tcgtcatgct catcacgagc 480ttggcaggtg tatacggaga aggagagctc atgaaccccc tagtgagcta cggctacgtg 540tgctttatcc tcagtgcgtc gcagacgtgg gcactttact gtctgctgat attcttccac 600ggagctcacg aggagttgca gcccatgcgg ccatggccca agttcctggc cattaaggca 660attattttct ttacgtactg gcagtcgatc atgattagtg gacttgtaag tgtcggggtc 720atctcggaga agtggcatat cggctgtccg gactgctggg acgctcagaa aatcgcctcc 780gcactgaatg actttgtcat ctgcgtcgag atgctgggct ttgccattgc ccaccactac 840gccttcgcga ttgaagactt tttgtcgccg tcaggtacgg caggtgttag tgtgccgtct 900tcgaacgtca aggcaccact gctggccaat tttatggacg ctatcaacgt gacggacgtg 960tcgacagacc tcaagaactc ccggaacgag attctcacca agaaacaggc gctggctgcc 1020aagttcgagc gcatgaactc gacttcacct ggtggtggca tgttttaata gcgtcagtta 1080aaagggagcg atacagtaag cacacg 1106282007DNAPhytophthora infestans 28atgagctcac aggacggcgc tggtcgcgca tctgaggaca agaatggaga cggcgtgtac 60gtgacgaaga accgctcgct cttctccatg tggctgcacg gcaaggcgat tccaagccgt 120tctggtccgg ccgtggtgtt ccgctcggcc gacgtgatac aggaagggta tttgctcaag 180cagggcctgc gacttaaaat gtggtcccgc cgctacttta tactgcgact cgaggagcga 240cacatgactc tagggtatta taccagcaag gactctctga ctttatgctc cgagacgccc 300atcggaccag gacacttgtt gggacacgtc aacacgacca aatacccgcg tcgtctcgag 360ttgcgctgcg gtacaaaggt catggtactc gaggcggagg accaaaagtc gtatgaagcc 420tggaagaacg ccctccaaga agcgatacgc tggaaccacg ccatggtgcc ttcaaaagac 480ggcagttttg tcacgtacgg gaagcaagcg accgaggata taaaacaaga ggaacgcagt 540cgcgccgagg cggccaagaa gctgcgagag aagcagcgag cggacgaggc cgccgccgcc 600gccaacgccg ccaataaacc caaatatctg cccgcgacac gccccgggac gcaatgcttt 660atgacatcga atacaagatt tgagattccc tctcatttcg aatatgtcaa aaccatcggc 720tcgggcgcct acggagtcgt catctccgct acgagctcgc aaacaggcac cacggtggca 780attaagaaca tccagcgcgc gttcgacgac ctgacggacg ccaagcgcat tgtacgcgag 840attaagctca tgcgccactt gaaccacaag tgcgtgcttg gggtggagga cattttcgag 900cccgtggcgc tgtccaagtt cgaagacgtg tacattgtgt cccaattgat ggctacagat 960ctccaccgcg tcatctactc gagacacgcg ctgtcggacg aacacatcgc cttcttcatg 1020taccagatgc tgtgtgccat gaagtacgtg cactcggcca acgtgatcca ccgagacctg 1080aagccgtcca acgtcctggt gaacgccaac tgcgagctca agatctgcga cttcggactg 1140gcgagaggcg ttttccccga agaagagctg gaattgacag aatacgtagt cacaagatgg 1200taccgagcgc cggagatcat gctggggtgt atgaagtaca ctcgggaggt ggacgtctgg 1260tccatgggct gtatcttcgc cgagatgatg tcgcgcaagc ctcttttccc gggacaggac 1320tacattgatc agctgcatct catcatgaac gcgctggggg ctccaaacga ccaggatctc 1380tactttttga gcaacgcgcg tgctaggaag ttcatgaacg ccgagttcca gaagcgcgga 1440cccaacccga cgaagcctct ggcgcacatg ttcgcagatt cgcctccaga cgctctggat 1500ttactgcaga agatgctggt gattgacccg aataagcgga ttagtgtgga cgaggcgctg 1560gcccatccgt acttggctgc gatccggaat gtggaggacg agacgaccgc cacttcgagc 1620ttcgattttg actttgagaa cgagaaattg acgaaacccg tgctgcagag actgatctgg 1680gacgagatga ggcatttcca ccctgaagtg ggcgacgaga cagcgacgga gggagatgac 1740agcagtgtcg ctaccacgca ggcttctatc acacccgtga cacctgtgac ccccgctacg 1800gtagagcaag acacaacaga gacgacaagt gacagctcgg acgcccctgt caaggtatcg 1860acgccaacag cgtcagagga agccaagcca gaagacgaag acggggaaca acacagcacc 1920aatagcgaca agatccatag gacagacaaa ctgacagacg cacagacgcg acaagaggcc 1980ggcgaaccag ctcgggaagt cgcataa 2007292053DNAPhytophthora infestans 29gctcaagcca gagtccaaac gctcgttcaa cgcccattca acgctcgagc aacggctgat 60accgacatga accgtaagct ggagctcatg gagctggaca gcggcggcgc cagccctaac 120agcagcaaca gtggaagccc cagtccgact ctcgacctgc tgcatcgctc tgattcgagt 180agcagtaacc aggggggtga gatgcctctt gtcggggttg cccacaaccc agacgtacgt 240cgtctgcctt tctctatttg tagtgatagt attttcacgt agacgtttgt tacagctgag 300ttatttgagg gcaactgcaa cacatggagg cagcagcacg accagcagca agtatggcag 360ccccgaggag tcatttggtg aagaggacga ggacaacaac aagaagacgg cgcgtcgcaa 420gaccgactcc aacagcaagc gtccgtggac acgcgaggag aatgacaagc tcatgcaact 480cgtcaagcag tacggcgcca agcgctggtc tctcatcgcc atgcacctgc caggccgtgt 540cggtaagcaa tgccgtgaga gatggcacaa ccacttgaat ccgtcggtcc gcaaggacgc 600atggacggct gaagaggact atgtcatctt cgagtgccac aagaatgtgg gcaaccaatg 660ggccgagatt tccaagatgt tgcctggcag gacggacaat gccatcaaaa accgctacta 720ctcgaccatg cgtcgcatgc agaggcagtc aatccgcaaa aaaggtccca tgcgtgatgg 780caagagcatc cgcgtggcgt cagtcacgtc gtctcccgtg caaaacaaca accaaatggg 840tcctgctccc agccagcgat ctttgactgg catgcaacac cagttgccac cgcaacaaca 900gcttccgcac cgaggggtga gtttccaatc cacatatcaa cggctcttct cggaggcctc 960tggggacgcc gcacgcgtga gtcccgctgc ttcgaattaa ttggagagga tcgatactaa 1020ctattatggt gttgatatat aatgcaggat ggcaactcga tagtggactt tgaacgttca 1080aacatgatgt ccgcatcact acgacaaccc acgatggtct acccgctaaa cggaggtagc 1140ttttcaaacg ggatgaaccc ggactatagt cgtcccatgt ccatgacgtc gtctccctgc 1200tcggtgtccc ccgccgatga tctgaatcat aacagccaga acgagacctt tgactacgtt 1260ccgatgcaat cttcgatcca gcgtgtacgg tcatctagtc cggttgtgat gggcactcct 1320ccttcgacgt caataggcat gatgaactca ccttacggct cgcctgcaag tcacatccaa 1380cagcaacagc ctggcaacta catgatggca ggaaacccat attctaacaa caacgtgcgt 1440gggatgtact ttgggacgtc tgggcttgct cagcaatacc gtcctgatgc ccctgtaaac 1500gtcccacaca agcgcctcct cgacgtccag ggttcacaac gtgatatgtg gaagaatgat 1560agccctgtat cggtagcagc accgatattc cgcggtatgc cggcgacgca catgcagcaa 1620ggtcaagtca gcgaaccgat ggcattgcag cagtccaagc cagcttccat gccactgtat 1680aggcaagcgc cgaatatggg tcacttcaac agcatggagc aggtatggac ggatgatgca 1740tatctgtgat tggaccgcca ttgtggcatg ctcctgatag actgcatgaa acaaatttaa 1800agttattact taccaaagac agtggcttct cttactcttt acttggttaa cttttttcgc 1860ttgatctaca gcggtttcac gttaggtagc tgtagctcct gatcgagttg cttattaaat 1920agcaccactt gttgacaggg attgatatta aaatgaattt ttttcagact aatatattag 1980ctgatattac atgtaccaaa atgtcaaact aatagctgac tattagtttg aaaaaggcgc 2040caaaacaagc taa 2053301173DNAPhytophthora infestans 30atgcttggcg acgtagacag tttcggcggt ctgggtccca ttccgtccat gaacgcggtg 60ttggagaagc gcacgtcaag tcagttttcc attagctcgc tgctgccccc gtccgtgagt 120gtctcgagta ctggtgtgtt aaacacaact gttacacgga gcgagagcgc agtgacagat 180agtgttgaag caactaccga taatgaaggc caaggatctg caccaagggt gtctaccaca 240actgcagagg ggtctggtgg caacaccaag tacatggacc ccactacggg cgactacatg 300tacccggaca acgtcaagcc catgagcttc tacgacaaac aacgtcttgt gcagaagatt 360acgatgcttc ccagtcaata tctgcgtggc ctcatggacg tcatcagcaa gtaccagcca 420gatactgtac gtcagatcga cgacgatggc tacgcgttcg atctgggtca gatgaacgag 480aatactgtgt gggctatcag tgactacgta aaggactcga tgattgagct ggatggatac 540attaaatcac tcaaccaaac tgctattgac cttgctgccg gtgaggatcg acatggagaa 600actgttctga cggccgcaag tgcggctaca cccaccagca gtgcggttcg ccacttgacc 660gacactctgg cgatgaacac gtccaagatg tctgtcatca ctaataacga gaatcagaat 720aaattcctgg aacaggtgga gatgtattcc aaacccaaag tgaccaagtc gcgtgtaaag 780cccagcaaga agcaccagtg tccgacgtgt aacaagcaat tccgcggacg ctccgagctg 840cagaaccata tcagaactca cacaggcgag aagccactca aatgctcgta cgcgggatgc 900acgaagcgat atgcacacag ctcgaatctg cgtgcacacg agcgaacaca cgccggaata 960aagccgtata catgtcacta cgacggctgc gggaagagct tcgcccactc tgtatcactt 1020aaggaacata tttggatgca tgcaggattc cagccctacg tgtgtccgta cgagggatgc 1080cagaagaagt ttacgcaggt ctcaaatttt gcccgacaca agaagacgca cgagaaggaa 1140gacaacgaac actcgattga gagcgataat tag 117331754DNAPhytophthora infestans 31atgattaagc tcgcggccgg tgtgtccaag aaatccgtcg tcgatgtgta tgtcactctc 60agtgtgcccg acagccccgt acttagcacg gcacagaaga acgtggagct gaacgtcgag 120aagttcttcg tggtcagcaa gactctgcct gaattgcctt ccaggtagaa gacgctgccc 180gccccgacgc cttcgtcaag gcaacggatc ctcctacgtg aacgtcggtc tggaggatcg

240tctcaactcc cgtccgcttg acctgcatac acctgccaac cagtgtatca agcgcatcca 300ggccgctgtg ggccagctgt tccgtgcatt cctcatccag cgcgacttcg tggagaccca 360cacacccaag ctggtcgctg gcgcctcggg gagcggagcc aactgcttca cactcaagta 420cttcgattag gacgtcatct tggctcagag tccgcagaag tacaagcaga tggcgtgtgc 480tgctgctggt ctcgagcgcg tgttcgagat cggcccggtc ttctgtgctg agaactcgag 540cacgcaccgt cacatgtgcg agttcgtggg tctggatctg gagatgacta ttaaggagca 600ctaccacgag gtcctggagg tgttctcgga cctgtacatc tacattttcg atggcttgaa 660ggaacgttac gccaacgaat tggctactat caacaatcag tacccgttcg agccgctcaa 720gtacattaag ccgtcgctta tcatcaactt ctag 75432659DNAPhytophthora infestans 32gggctccatg tcatctgcga ctttggacgg agctctctat tgtagaattc aactgactct 60agacaagtaa ccatgcagaa cgaggccggc cagtcgatcg acatctacat cccgcgcaag 120tggtgcgtat tgcgctggtg actttaatac gctcagagct actggagcta actggtgctt 180gctattgtct gtcatcgtta tatagctcgt ggaccaaccg catcctggcg gccaaggacc 240acgcctcggt gcagatcaac gtcggccgcg tgaacgccaa cggcgtcttc acgggtgagt 300cggacacctt cgctcttgct ggctacattc gccaccacgg tgagggcgac atggccatca 360ccgagctggc tcgccaggcg gacgccaaga actaagcaga ccaagttgtc gtgatcgcgc 420gctgctgctg cgaagtggag tgtgcgttca tctacgtcta gctggcagtt caggaggctg 480gtgattacga tatgtatcaa cagatacgtc tgtgatcgct ggcaggaatt gcggtaccgt 540cgcttatgga gtcggttgtt tgcgggttcg acctcgcctt ttgatttgat cgggtgtagg 600cttagtattt aactctggcc aacggacgag caagaataaa gtagttcaaa cccgtcaga 659331049DNAPhytophthora infestans 33ctcgagcgca agacgatctc cgctatcgcc ccaccatgtt cgccagcttc gccactgccc 60tcatcgcttc cactctccgg ccctcgagcg cagccgccac caactatgcc ggtggctggc 120ttccgtcgga ccccaccaac cagtgtgtgg atatttgctc cgctccgtcc aagacgtgcc 180tcacttcgga cgctgcctgc ctcgccaagt cgatggtccc gggcgacttc gactatatgg 240tcctggagca gctcttcgtg ccgcagttct gccgtgacct gctaaagggt gtcgactcca 300ctatttcgca ccaaaacatc gatatgtacc cgaacggcac agcctgcgtg gagagtgtgg 360tcaagagtga gctcacgatt cacggtctgt ggcccaatta caacgatggc tacgtgagct 420gctgcaatcc gagctcagcg gtggccaacg acccttataa cgccgctgac ttcgctgccg 480cccaaagcag cctactcacc accatgggtg agaagtgggt ggacgctacg caagccacta 540cgtacgaatc gctatgcgag atctacaacc acgagttcca gaagcacggt ctctgctatg 600ccgctgacga cgctgattac atctcggctg ctgtcacgta cttcactgct acgctgagca 660cggcggaccg catcagttca gccaccgagc agatcaacaa gtgggcagct cagtcgacgc 720ctcagacgac tctggccgag attgaggctc tctacggcca cagtgtcatg gtgttgtgct 780cggctgtgga tggcaacaac caactgtcgg ctatccgtac gtgctacgag aagccgacaa 840acatcacgag cgagggagcg tccgcgcaga ttgactgcgc agccgcgacg gccacctcct 900cgttctccgt atgctccggt gactcgccga tcactctgac tgcatacaca gcccccacct 960cggcttcgat gcaataagct ccgacgatag agcgacggtg cagtctgcta gtataaagtt 1020caatgcacca gttacttaaa aatgtacca 1049341203DNAPhytophthora infestans 34atgaccaagt ggggggttgt agtggcacta acactgctgt tagcgacgcc tagtttagtg 60ctaggcgcct gccccaacaa gtgttccgga cacggcaaat gcggtctcaa tgacgtctgc 120caatgcatgc agaactgggt cggcggtgat tgctcgggtc ggcaatgtgc gttcactcgc 180gcgtggcaag atacagcaca gcgcgacgac gacgcacact accacgcaga atgtggcagc 240cgcggaacgt gtgatcgagc tactggagaa tgcacatgtg acgcaggatt catcggcagc 300ggctgtcgac gaatgcagtg tcccaatgac tgcagtggcc acggcacgtg tgagtttatt 360gaggaattgg cgacggatac ggcccacaag cggattgggg gagtggcagg tcgtaaatac 420acgctttggg accaagagaa gatcatgggc tgcgtatgtg acgccaacta cgaaggtcac 480gattgctcga tgcgctcgtg tcctagaggc gacgatcctc tgaccccgaa tcaatacgac 540atggtgcaag ctattattct tgataaggct ggcggtgagg ggtacttgac gtactatgat 600ccgtacggca atgcgtatac tacggagaaa atcacgcttg gtggaacgct gagtgtcgct 660tttcaaccaa cagacgatga taccacatgt gcaaacattc agaaggcgct ccgccgttta 720ccgaacaacg tgctcaacac agtcactgtg gtagctgttg acaggtttta tgccttcaag 780cgctctgacc caacggactc gttggggtat ggaacgttaa acaaaattgt aaatgacgac 840gctgcagcgt acgcaggaac cggaactcaa attaaagcga tgtgcgaggt gatttttacg 900tcggagccgg gcactacggg gtatcagaat ttgctggatt gcaatgttgc cgcgcatggc 960gatactaagg gccagcaccc gcttactact ggtgtaacgt ctggcacttg cgtcgttaaa 1020gaagtctatc cggtgacgct tggcacgagc aacatgcttg ccgaagatac tccagcgtat 1080cgtccattga ccgagctcac cgagtgtgct ggtcgcggca cctgcgacta cgacacagga 1140acatgcgagt gcttcgcggg ccacatgggc ttggcatgcc agaagcagga agcgctcgtc 1200tag 1203357947DNAPhytophthora infestans 35atggcgcgcg ctccggcaca attggcgcag cttttactag cggcgctgct gctgtcagcg 60atgtgtgagg cgttattgcc tatcacgaac gcgctgcagc gtgcccgcca aaacctcacg 120gccttgcagc ggcaatggat cgatccggac acggacccca agttctacaa catatcagtc 180cccaagggtg ccttcaactt cggtggcaac tcgagctaca acaacgagta caagctcatc 240ttctcggacg agtttaatag ctccaagcgc acgttcgagt cgggtttcga ctccaaatgg 300acggcagtca acctccgcga taccaccaac atggggcagc actacttttt gccccaggct 360gtgcagatcg acaagggcaa cctcatcatc acgacctcca agcccaaaca gcgctaccgt 420ggcactaagt acgtcagcgg tgctgtgcag acatggaaca agttctgtta caccggcggc 480tacgtcgagg taagggccat tctgcccggc aagtggggta tccccggcac gtggcctgct 540atctggatca tgggcaatat cggccgtgcg ccattcctcg gatcccagga cggtacgtgg 600ccgtggagct tcgactattg cgccccctac gtggagaagg ccgagaaggt caagcagaag 660atcaatgcct gtggcaatct gaccaacaaa cacgacaagg aatcgtatcc agagatgtac 720ggcttgaacc cctttcaggg tcgtggagcc acggaaatcg atgtgattga agcgcagatt 780cgtgctcgtg atgagcctgc attcatctcc acgtccctgc agatccgtcc cagtctgtac 840gatgatatgc gcccggcttc agagtcgctc cctgctcctg gacaatggta ccagggtctc 900aagtttggtg agttcacgaa aatcaatagc gactactacg gtgagatggg cctcgactcc 960atttcggctc tgacacagct cgagtccaat gcgttcaagt cgttccactt gttccgcctg 1020gactggtctc ctggtcccga aggttacatt cgatggtgga tggacaacag cttcgtgttc 1080gaaatccctg gatccgcgct gaataagtgg gtaggtgctg tcccccctcg ccagatcccc 1140gtggagccta gttatctcat tctgagtacg gctgtttcgg agaagttctc tccaccgtgc 1200gatgggcaga tttgtaactc gctatggccc tccaacttta cgatcgacta cgtacgcgtc 1260tatcaaggca acccgaaccg gtatacttcg gtgggatgca atccggaagc ctacccgacg 1320aaagattgga tctacgccca cccagtggaa tacggtctcc cgtggtatgt ttcactacgt 1380gtggacatcg gtctgctgca tcttttcgct gtggttaatg cgctgctggg tctcttcatg 1440gcgttccgtg gcacgtccca accgaagatg ttgtcagcgt acgccagctc gttgtggctg 1500actgcagcct tttatggagc tcttagttca agcgcccccg tagaccttgc ttggattcag 1560actgcgcttg cgtgtctgtg cgggctggta cttggcggtc tttgttgctt ggtgtacccg 1620gtttcgcttg gtgcaatgct tggactgtat ggcggggtga tagctagcca attcgtgcct 1680ttgctgtcta cgcgcgtgat cactgcatta ctggttggtg tgggaatcgc gctaggatct 1740gctccacaga tcgacacgaa gcacgttgtg attctgtcga cctctttgct tggtagtttg 1800gcgtttctgc tctctgtatc gctgtgggtg agtgaaggcg atattgctga gaatgcgtgg 1860aatctcgctg gcttcatttt caatggtaac aacgatgacc acgtgggttt ctgcacgaaa 1920tattgcctgg cgatgtatat tctgcttgtc gtactcagtg cggtgagcac tacgtatgga 1980tacctccgta tgcgtggcgt gacgctgcgc accaacccgc gtgaggccaa gttccccgcg 2040gtgtcagcaa gttctgacgc gcgggcttgg agacctgatg atgatgcggg cgtggagaag 2100actacggtga attttttctc gccatccaag ctgccgtaca acatgcagca gttcagtacc 2160atcttccgta tcgctgtgaa cgtgcagcgc tcgtttggct tccaacttga caacttccgc 2220aaccagacgg aacacgttgt ggtgcttctc accaacaact cgcgaaagag cggaaatcct 2280taccgcaagc tgcacgattt ggtgttttcc aactacaaca actggtgctg caagcttaag 2340atccagcctc tgaactgggg cgagcagcga ccaccgcagg gtggtctcac aatggtggac 2400gagatgtcgg tggacttgtg tctgttcttc tttatctggg gtgaggccag caacctgcgt 2460cactcgcctg agttcctgtg tttcctgttt cacaagatga aagaagagtt cccgtccgtc 2520cgtcactcag agcgcgaggc tggatacttt ttggatacgg tggtgacacc tgtctacggc 2580ttgctgaagg ctgagatgac ttcaaagtac gaccatgagg accgtcacaa ctacgacgac 2640ttcaacgagt tcttctggac gaagagatgt ctgaagtatg actacaaaca cgaagaggtc 2700attgatttgg cgtcacccaa tccggctatg atctacaaac agaagcagca gcaacgtcaa 2760ggtctgactg gccttggagc ccaaaaggct cgaggtggac tcaacggtgg ctcgaacggc 2820tccaacttgt tcaacaagcg tcaaagtatt gccgagggat tcaccgagtc tgccaagacg 2880ttcgttgaga agcgtacgtg gctgctaccg ctgcgcgctt tcaaccgtat cttcaacttc 2940cacgtcatcg cgttccactt cttggcaatg ctcgcgttcg cgaatgagca agagatggac 3000ttccaggacg cctgcaagat tatctcgagc actttgatat ctcacttctt gctggacatt 3060ttacgtgatg gactcgacat tttcgctgtt tacgacgagc accggaaagt attctcaatg 3120gcgcgttccg tgatgcgtgt gtttctgcat ctggctcttg tggtggtcac gtcgatgtta 3180tactggtatg cgtgggcgta cggtggtgcc tggtggcagt cgtactacgt gaccgcggtg 3240ctattccacg tgccaggcct gattaactgc gtcatgcaag tgatgcctgg tcttaccaac 3300tggacacggc gcacggcgtt tgctcctgtt gcatttatcc gtgacattgt gagtccgatg 3360aaccgcttat acgtgggtga caacgtgctg gatccggagt cgatgagcgt aggctaccag 3420ttcttctgga tgtcgctatt ggcttggaag ttatacttcg gctacgagtt tgagatctac 3480ccgcttgtgg tgccgagctt tctgctgtat gctgaccacg tggagaacaa cgtgagcatg 3540attacgacag tgttcctcat cttcctaaac tggatgccgt tcttcttggt gttctgcgtt 3600gacattacga tttggaactc gatctggatg gcattcacgg gtacgttcgt tggcttttcg 3660tcgcgcattg gtgagattcg caacttcacc cgcgttcgat ctgcgttcag tcgtgctgtg 3720gatgcattta acgcaaaggt gattgcgcga agctccaaga cgggacttca actctcggac 3780agcaatggca cgtcgtatgg atcgacatca gtaggtcacg aggtgcttga tcgtgttgcc 3840ggtggtgcgg atccgacgtc ccgcctcctg ttgcagcgcc ggacatcagc ccatgacgac 3900gagactccgt tactgtcttt ctcgcgtcgc aaacagacgc ctacggagcg ccaagctgct 3960cgtcgccgca agtggttctc gttctctgtg gcctgggaca ctatcatcga tagcatgcgc 4020gcggatgatt tgatctcaaa caaggagaaa tctctgcttc atttccaccg tcttgacggc 4080taccagcgcg aaatttacct gccgcagttc caacttgctg gttgcttcga gaactttacg 4140tcgcacattc ttgatattta ctcgtcgaac aacggcaagg tctcggagcg tgtgctgcaa 4200gacaaactac tggaaattct cagtgataac ccaatggtgg aggagtcact tgaagagata 4260tgggagcttg cgaactgggt gctggttaat gtgcttggtc cctgtcacgc gaatgatgtg 4320aagtacatca catgtgtgct caactcgtgg gccgctcgtg gtgtgttccg tgcgctgaac 4380ttgcaaaagg tggctccatg tggccgcgct ttggcgggtt tgatctcgct cttgaaggcc 4440aacgtccgag gatggaagag caacgccaag gttatccctg ttcgcaaaga cccatccgac 4500tacgcttcgt acgagtttcc gcaacagtct agctcctacc gtccttcgtc ggggcttact 4560aagtctgcaa gtacgacagg tctgtcgtcg ttgggtctcg aaccacctcg tcgtagtcgt 4620ggctctggtg ttgcgcgtat tgcacgtatg cagcagcaga cgcacaaacc agctgtcaac 4680aatggcaagc ttactcattc tatctccagc tctcacatca tgcagattcg cgagcgcgtg 4740cgtacgttcc tgaatcttgg aaaggagatt ctggcccacg tccacgagca agaccccgtg 4800ttcgctgaaa gcaagggaat ttcggatcgg ttgacgtgga ttcttacaca ggagcgtggt 4860tttatgtggg acgataatta tacgggtgaa caaatcactc tcacagcgtt tgagagccac 4920accgatgtgg tgttatcgca tctgcacgga cttttgacct tgcagaagat tgatgcggag 4980ccccagtcgt acgatgctcg tcgccgcttg ctgttcttcg tgaattcgct gttcatggac 5040atgccgcttg ctccgctgct cgaggaaatg aagtcgtgga gcgtcatcac tccgttctat 5100gccgaagacg ttctgtactc cagaaaggat ttggaaagca aacaggacgg tctggacgtg 5160cacacgctgt tgttcttgca gacgctgtac aagcgagact gggagaactt cttggagcgt 5220gtgaagccta agaagaacat ctggaaagac ccggagactg cgatcgagtt gcgtatgtgg 5280gcttctctgc gtggccagac actgtcacgt acggtgcagg gtatgatgta cggtgaagct 5340gccattcgtt tgctggctga gatcgaacaa gttccccaac agaaacttga ggagttgatc 5400aacacaaagt tcacgtacgt ggtggcctgc caaatttatg gacgtcagaa gaagaacaac 5460gacccgaagg cgagtgacat tgagtttttg ctgcaccgat tccctaactt gcgcgtggca 5520tacatcgatg aggtccgtgt gaactaccaa aaggaacagt catacttctc ggtgctcatc 5580aagggcggcg aggaactcgg ctcagttcac gagatctacc gcgtgcgtct gcctggcaat 5640cctatcttgg gcgagggcaa acctgagaac cagaacgcag ccattgtttt cactcgcggt 5700gaaaatctgc aggctatcga tatgaaccag gatggatatc ttgaagagaa cttgaagatg 5760cgaaacctac tcgaagagtt tgacaagggt acggcagacc ggccgtacac gatcgtgggt 5820atcccggagc acatattcac gggtagtgtg agctcgctgg caaactacat ggcgctgcag 5880gagacgtcgt ttgtgacgct aagtcaacgt acgttggcgc gtccgctgcg tagccgtctg 5940cactacggtc atcccgatgt gttcaacaaa cttttcttca taacgcgtgg cggtattagc 6000aaggccagta agggtatcaa cctcagtgaa gatatctttg ctggctacaa caattgtatg 6060cgtggcggtt ccgtgacttt cccggagtac accaagtgcg gcaagggacg tgatgtggga 6120atgcagcaga tctacaagtt cgaggcaaag ttagcgcagg gtgcagctga gcaatcgcta 6180tcgcgtgacg tgtaccgtat tagccagcgt ctcgactttt tcaagttgtt gtcgttctac 6240tacaaccatg tgggcttcta cctggcgatg tcaatcatca tctggactgt gtactttctg 6300ctgtactgca acttattgcg tgcactgctg tcggttgagg gtgttggcgg tcgtgaaccg 6360gtattgctaa gtaagctgca gttgatgctt ggatcggtgg cattcttcac tactgcgcca 6420ctgctggcga cgatttcagt cgagcgtggc tttaaggcgg cgttgaacga gatcattgtc 6480ctgttcgtga ctggaggccc gctgtacttc cttttccaca ttggcacgaa atggttctac 6540ttcggacaga cgattcttgc tggtggcgcc aagtatcgtg cgaccggccg tggattcgtg 6600acaaagcact cttcttttga tgagctttat cgtttctacg ctagcagcca cctctatgct 6660gcagtggaga ttgccattgg gctttccgtt tactacaagt tcacggtcgg caatcagtac 6720ttcgcgctga catggtcgct atggcttgtg ttcgtgtcat ggtactggtc gccgttctgg 6780ttcaacccac tggcgttcga atggtctgac gttatggagg acttccgtct atggttcaaa 6840tggatgcgtg gtgacggtgg taaccctgat caatcgtggg aggcgtggtt caaagaggag 6900aacgcgtact tttcgacgct tcgaccgtgg tccaaggcgt gcattacgat caagggcgtg 6960ctgttcgcgt tgatcgccgt ctctatctct tcgacgagtg acaaatatca ctcgatcttg 7020acggaaacca cgtggcttcc gctgcttatc tgcttatcga tggccgcggt gtatcttagt 7080gcagaggctg tcttcttcac ctcgtcgcgt tcgggcgaga ccgggcttgt tcgcttcctg 7140aagctccttc tggtgattgt gctgggcgct ggtctgattc tcgctttcat ctacgcggac 7200ggtatgtggc agatgctgct gagtatggga tatctcgctg cagctatggg ctgttgggcg 7260cttgtgatcc ttggtagcaa ctcgcgcttt gttggaacgc tttacttcgt tcatgacgcc 7320gtgctgggtt tggtttcgct gagtctcatt ctgttgctct cggcgctcta cgttccgggc 7380aagatccaga catggctact gtacaataat gctttgagtc gtggcgtggt gattgaagat 7440attctgcgag ccaactcgag caatgatgaa cgcgatgatg atctgtcagt gcagcagatg 7500cgctccatca tccttgagca gcagcgtttc atcaacgctc tgactgctag cggcagcgag 7560actgacatcc gcggtgctgg tcctgggaag aaagaagatc taatgcacgc tatgagcgac 7620aacacgctga acgcggtact gaggaatatg tcggagtcgg aactcagtgc gctgcaggac 7680tcgtcgattc gtctgcaggc catcatgtcg gaggaggagc gcaaggccgc acaacgcaag 7740cagcaacaag aagagcagag actcaccgag gcaggaatga actcgtcgtt gtcgcgcacg 7800cgtcgtgcct tctccacgag cgatttctcc gccatcccgc tgaatgctag cccctacagt 7860cttgctccta ctcaggatgg ttccgctgca cccgtcaacc gccccactaa cggttctgct 7920gctcacggag cttatcctga tgtgtag 7947366744DNAPhytophthora infestans 36atggccacga cgcccggcgg caagatggac cggcgccgcg ccggctccaa ctacttccag 60ctcgatgcgg accgcaagcg caacacgtcc aacaaccgca gcaactacgg cgacggccgt 120ggcaccttcg gagaccgctt gagcttgatg gaggtgcttc ctcccaacac acagggcggc 180aaccagatgc gcggcggtgg cttacagggc gactttgcgg acgaagtgtc gatcgatttt 240tgctgcgagg tactgtacaa caagttcggc ttccagtcag gcagtgtgga caaccagcgc 300gagcacgtgc tgctgctatt ggccaattcc aaggcgcgtg ccaagcccca ggaccctccg 360ggacaccacg tcgtcacgct gcacaaaaag ctcatgagca actacacgga atggtgccag 420ttcatcggcg ttcccagcat ctcgtactcg ggacagccac agggagacct caagaaccct 480ctgcacatgg acattatgct cttcctgttg ctatggggag aggctggtaa cttgaggcat 540atgcctgagt gcctctgcta cttgtaccac cagtcgctaa acttgctgaa ccaggacttc 600ctcggtcagc agaaagtacc tgaaggttgg tacttaaggc aggtggtgcg ccccatctgg 660aaggaggcgt ctaacatgca gaggaagaac agcttgggca agaacttgga gcacacccaa 720gtgcgcaact acgacgatat caacgagtat ttctggaaaa aatactgtct taacgtggat 780gtcacgcaga tcggcgagga gctgaccaag aagcacacca agacatacta cgagcaccgc 840agtatcttca cgctcgtact gaactactac cgtatttttc agttcaacat gatgttcatg 900atggtcctga tggcgatcgg ctttatctcg gccatctcgc ctagcggagg acagcagtgg 960ttcgctcagt tcgggtctat gggagaagtg gttgagcctt accagaaaca ggacgttaag 1020ctgacctacg tggggattgt gttcgccctc tcctcgatgg gattctgcaa gaccgtcctc 1080gaagcgtgtc acggatggca cttactcact gccagtgagt cgtcacagac gtcgtctcgt 1140tcgttcaact acggtggtgc ccttgtggtt cgaatgctct ggaatggcgc gttcgctggc 1200attttcggct tgatgatcta caccccgttg atcacgagca agaacacaga actgctcgat 1260aaggctgcac cggcgtctgt tgcctacatc ctgcctggcg cacttattat cgtcgtgcag 1320gcctttgctc catcggttgt aaccaaatcg tttgcggcca agtttatccg tgagggagaa 1380acgtgctacg ttggccgcaa catggcgcct ccactgagct accagctcaa gtacatcact 1440ttctggatca ttctgtgggc gctgaaggcg ttcgtctcat acttcattct agttcgccca 1500ttggttctcc cgtcgctggc catttacgag atggagctcg agtacggtag caatgttgtt 1560tcgttccaca acttcggagt catcgctgcg ctgtggctgc ctgtgatctt catcttcaac 1620tacgataccc agatttactt taccgtgttc caggctacac ttggtggcgt tcagggtctc 1680atcatgaaga ctggcgagat tcacggcatc aaggagatta ccaaggcttt ccgtgtggct 1740ccacaactct ttgaccagaa ggttgtgacc aatctggctc gctcgaacga cgctgcggct 1800gacggatctg ctgctgcata ccagtcgcaa atgatgctgc gcttcgtggt cgtctggaac 1860gagattgtca actcgttccg cgaaggtgac ctggtggacg acaaggaggc tgccatcctg 1920cagtatgaca tccagagctc gggcgacgtg ttcgaacctg tgttcctttc ggcgggtaaa 1980ctgatggaag ctctggacta cacggttaag attgccaagg aaggtaaggg cgactcgcag 2040cttcaagtgt acatggtgca gaaggattgt ctatcggctg tgcgcagctt cttcacagcc 2100agcatgtacg tgatggaggc tctgctgggc agtgacgatg cagacattct tgatgcgctg 2160cgtcaaatgg aggcgattgc tgcgaacagc agtttcatga gcacgtttga cgccaagagt 2220ctagtgcagc tgcgcacagt ctcgatggag ttcctggaag ctgtgatgga tctgcccgac 2280ccggatgcgc agtcctcgca catgacatcg tctcgagtgc acaccatggg agttgtgcgt 2340aacttcgtga ccaagatgga aaacctgctc aacgctattc gcattttcgc caaccgcccg 2400gagctcgctg ccaagttcag caactctaag ttctgctcga gcgccaacgg ctacgtgttt 2460gctgctcgtg gcctcgtgaa cctgttccac aacgacactg cgatgggtgc tgctacccgt 2520gcgtacctct tgatgtcgct cgagaaggcc gatgctatgc cccgtgtgcc tgaggctcaa 2580cgtcgtcttg gttttttcat gaagtctctt ttgatggaca tcccgcagtt gacgtctgtg 2640aaggagatgc actcgttctc cgtcgtgacg ccgttctaca gtgaaagtgt gttgatctca 2700ttgtcggagc tgaacgatcc gctggccaac cacccggtct tccagaaggt ggaggagaag 2760ggcaagaaca ttactattct gaagtatctg attaccatcc accccgagga gtgggagaac 2820tttttggaac gtattgatgt gagcactgca gaggaagcac aagccaacta cccgctggaa 2880atccgtctgt gggcgtcgta ccgtggtcaa accctggcac gtactgttca aggtatgatg 2940ctgtacgagg atgctatcaa gattcttcac tggcttgaga ttggttcaag tcccggcaag 3000tcggcggagc agaagcaggc tcaacttgag gacatggtgc gtctgaagtt ctcgtacatt 3060tgtgcgtgtc aggtgtacgg taagcatcgc gcagagggca aggcccaggc cgatgatatc 3120gactatctgc tcaagacgta cccgaacctg cgtgttgcct acgtcgacac catcgtgatg 3180gacggtggca agcagttcga cacggtgttg atcaagagtg aaggcaatga aattgccgaa 3240gtttaccgct acgagctgcc tggagacccg attcttggtg aaggtaagcc cgagaaccag 3300aacaacgcgc ttccattcac gcgtggcgaa tacctccaga cgattgatat gaaccagcag 3360cactacttcg aggagtgtct gaagatgccg

cagcttctgg tgactgctga cctgcaccct 3420tccaagaaac ctgtgtccat tattggtatg cgtgagcaca ttttcacggg taacgcttca 3480tcgctgtcaa agtttaagtc gtggcaggag ctggtgttcg tgacgctgtc tcagcgtgtg 3540ctggccgacc cgctgtatgt tcgtatgcac tacggtcacc ccgatatttt cgacaagatc 3600attgctatgc ctcgtggtgg agtgtccaag gcttccaagg gcattaactt gtctgaggat 3660gtgttcgctg gttttaactc gacgcttcgt ggtggtgtgg tgacgcacgt ggagttcatg 3720cagtgtggta agggtcgtga tgtggctctg tcgcagattt ccatgttcga gggtaagctg 3780gctaacggtg ctggcgagac gtctctcgct cgtgaggctc atcgtatggg ccagttcatg 3840gacttcttcc gtctgaactc catgtactac tcgcacacgg gtttctactt cgccacgtgg 3900atgacaattg tcacgacctt cgtgtacatg tactgcaagg tgtacttggc tctagcgggt 3960gtgcagcagc agattgtgta cgatatgaac acgaccgctg tgatcaccga gaacatcgca 4020aacaacttcg acgggcgtgt gttcaccgat ctgaaggctg tgctgaacac gcagttctac 4080atccaagccg gtactttcct catgcttccg ctcatgtgtg tgtacttcgg tgaaggaggc 4140ttcgtgcgcg gtatgactcg attcatcgac atgatcatca cgctgggccc tgccttcttc 4200gtgttccagg tcggtacgac gatgcactac ttcgacaaca acatcgtgca cggtggcgcc 4260aagtatcagg ctacaggtcg tggcttcaag atttcccgtg agacgctggt gctgctgtac 4320aaggcgtatg caagctccca ctatcgaaag gcctgggagc tcatcgggtt gtgtcttgtg 4380tacatggcgt tcggtaattt ttacatctgt cggaccgatg cggctgccaa cgacaacact 4440tttgcgtccg actactgtga gactgctcag gcttacgggg tgcagacgtt ctcggtgtgg 4500ttcatctcca tcttgtgggt ggtgggtccg ttcctcttca acagtgacgg tctggactac 4560aggaaaacca aggtggatat ccagcagtgg tgcatgtgga tgtttgcccc cgaagactac 4620aaggacgacg acccggccaa caagggaggc tgggtaggct ggtggaaggg cgatctggag 4680cagctgcacg gctccaacat gatctcgcgc gtcacggtca tcctccgcga gtgtcgccac 4740ttcctgctca tgttctacgt ggctacactc gagacgtccg acgtcatgta cgtggcgtac 4800tcgttcggtg ctgcggtcgc gacgattgtt ctgcttggcg tgttccatgg ctttggtatg 4860ggcatgcgct ccatgagccc ggtgacgcgc gctgtgatct acatggggac cgtcgcagcc 4920atcgtgacgg cctacttctt ggccacttgg atcgtgctgg actggaaatt caagtacgcc 4980atgtcgctct ggttcgccta cgtggctgcg ctctacggta tcaacgagtg cttccgcatg 5040tggagtttcc caagctcgtc gatcgctggc attgctgtgt tccagcagct acagttcctc 5100ttcgacttta tcttctgcat tggtatgatc atcccgcttg tggtcatgtc gtgcatcccg 5160ttcctgaaca tcatccagac gcgtatgatg tacaacgaag gcttctccaa ggtcatgtct 5220gcttcttcgc agtatgcctt ctctctggca gccttcatgg gaatcctggg cggtatcggt 5280gtcggctggc tgttcaactt gctgtcaacg ctggagcagt ctgcgagttt cgcaagttac 5340gtcgtcacgt acgatggcgt cctaagtgga aacgtgggcg atggcaccac gacgtacatg 5400ctctacggtg cctgtgtggt gggtacgatc atcgctggct tcctcaactt cttcctgggt 5460cgtcgtctgg ctattgttgc gggtggtctc ttcagtacgc tcggtatggt ggctgtcagt 5520gccaacgacg atctccgttc gacgctgctg atgcctggta tcggtctgct tggagcctcg 5580tgcggtattc tgctaccgtc gttggccatc tacatcttcg agatctcgac caaggagatg 5640cgaggcaaag ccatgttgtt gctgggaatc ggcttcatca tcggcagttt gctgggcggc 5700attttcgcga ccgtgaacca gctgggatgg atctggcaga cgtttgctgc ctgcatcgtg 5760atcgccctgg tcacgccagt cgtcaatgtg ttcccagaga gtccgtactg ggtgctggat 5820cgcaagggct gggacgcctg tgaagcctgt ctcgttatcc tgcgtcgtaa acctgatgtc 5880caagaggagc tcaaggtcat gcgagaagag gaaacggcag atgaaggcgg cgccggcgcc 5940tacaagttcc tcatcggtct cttcctcatg ctcgtgtcct ctctgactac tggtttcctc 6000aacgccttca tcagctacaa gggagcgagc gagtacacgg accaagacca gctgttcgtg 6060aacgcgatgg cgctgcagat ctccggtgct gcgatcgcca tcttctacat cgacaagctg 6120gaccacaagt cgattctctt cggaacgttg atccctatcg ctatctgtgc tggcattctg 6180ggcttcaacg agaactcaga gatgctggga gacaaagagg gctcgggtct gtacctcagt 6240cttgtagtca tgctcatgta cttcttcatg gggctgggca cgagctctgc tctgtggtcc 6300gcatgcgtcg gcatgttcaa tactcgcggc cgcgcctcgt ccaccaccat gctgttcgct 6360atcttcttcc tggcggatat gggctacgtc tacttgcaca cggacgactc gatgatgcag 6420aacgaatatt cctatctcta cgccatcgca ggcttcagtg tcgtcgccct ggtgctgtta 6480atgggcgcag gcaccaagaa gaacggcgtc atctgtacca agtcagaagc tcagcgcgat 6540cgcgaccgta tcgctcgtat gcgtgccgaa cgtgcaagtc gcaacacgcg gacgcctgga 6600actgcgcgcc agcggaatct cagtcgcgtg cggtccaagt cgaacgctgg cggccagcgg 6660ggcaacgcgg cgcatggcgg tggctaccaa atgtacgaaa cacccgccaa cgctgcgccg 6720ccgctcatgc acgcgcgccc gtag 6744372462DNAPhytophthora infestans 37attcgagaga tttttcgaac tctgacatcg ttgcaaccat aacttgcctg cattaaggtg 60ctcctcaact gtacccatgc cgagcaccca tcgactctgc cagtacgatg cttcaccaaa 120gttttagtcc acaagaaaag ccgaaacgta catgtcgtaa cggaagccgt gcgacctttt 180accgttcgtg cgctggtctc acgtagcttc attctccttc ttccctagcc agcaaaggcg 240tctcccaaga tatcccagca attgtctatc ggttaagatc aaggagtaaa atgcactcgg 300cgctgttctc gtgctcaact ttggctttga tcacgagttt ggtctcctca gagcgtgccg 360actcgatgat caaatctcgg tctggattga gcccctgggt ggacgttgac acccccgaga 420gtgcactcaa cgtcacgtcg tcgcgtggag atacgtggac gttggtcatg agcgacgaat 480ttaacgttcc tgggcgtaat tttacgcccg gttcggatca catgtggacg gcgttagaaa 540tgcccgacgg tgtcaatgca gctctcgaat actacagctt caatatgacc gataccgtaa 600cggaatcgga cggtcgtggt gtcttccgga taaagattat ggaagaggac aacatcacct 660acacggtgtg gaacacgtac gctaagcctg cgggtttcga gacccatcac atgtactacc 720gagccggtat ggtgcaatcc tggaacaaat tctgtttcca aggaggaagg atggaagtgg 780tggctcaatt accagcaaca accagctcta gtaaccccga tatgggtgac atcaaaggtc 840gcgtcaagac gaacagcttc tatcccacgt ggcctggtat ttggcttcta ggaaatctag 900gacgagctct attctcccaa tcgaccagtc ggatgtggcc ttggagttac gacgaatgtg 960acgaaaaatt cgaatccagt caaagaatca gtgcgtgtga cggtaatcca ggaagtggat 1020tgaatgctca tcaaggacga ggagcgccgg aaatagatct actggaagga ggaggtgtag 1080ccatctccac aagtatccag gtcgctcctg gaatgcccga taaattccgt atcattgctc 1140ccacggatga taaaagtccc ttctgcgtct tcacggccga gtgtactact attggtgcta 1200actttcctgg gatcccagcc aaagcgtacg aagctcgaga ttatgaaagc tggtatcaag 1260gactacggta cgctccaaat actctttgta gcccagttgg cagcttgatg caagatccca 1320aaacggtgct tgcaaatgcc gagaaaggct tcacttctaa tacgtgtaaa ggagtcaatg 1380cgtgtccagc ttcgggtgac ggatactccg atttaggctt gatcgacggg aaagggcctg 1440attactgggg ggttaacaaa gaaggcggct gtatgccggt tattaacgga tacacgggag 1500ctttcctatg tgaccctgac agttccaaca aaaaatgttc ctctccgtta ggtgcggaag 1560aacccaagag taaagttatg gaaccattcg agtatcagat ggacgccctg tccgctaatt 1620ggccagttca gctcgcagca tatacaagtt atgtgaaata ccaagtcgaa tgggtcatgg 1680gctcacaagg ttacattcgc tggatggtcg aggatattgt gatttttgaa attccagccg 1740agtcggtcga gaatgttcca caagatgctg ccaagtccaa ccctaagaaa ctcatgttgg 1800aagaacccat gtacgtgatt ttcaacgtcg ctctgtcaac tagttggggt accacgccac 1860cgaatccagg gtcgccatgt cgtggagatg ggagcaatgc gcaacataac gctatttgtg 1920acggtttccc catgttcatg aagatcgact acattcgtat ctatcaggat ctctcttcca 1980actccacgat ggctatcggg tgtgacccgt ctactcatcc gactaaacaa tggatcgagg 2040atcacattga tgagtatgag acgacggaga ataaatggat tgaggttcac ggtggagcca 2100attgcaagac tgataacgac tgtacggtca gtacttctca cattttgacg gggaaatgta 2160gcaagaaaca tcgctgtaga tgcggatctt ccggtgcttg gggtggtcca cgttgcacaa 2220ctccactagc tgatacagcg aatggagaag gcttcggacc accaacagtt attacgagct 2280tggttggtgc attcgtcatt gtgcttttgg tctttgtggt gtacaagata atggaccaac 2340gcagcaagaa ggcgatggtg ggagctggga ttactcaacc agcaattctc tccaagatcg 2400agatggacga catcccacgt tcaaataaaa gccagagcgg ctcggaggat aaggtggtgt 2460ag 246238942DNAPhytophthora infestans 38atggctccac tgccatccgc aaccttgacc acacccgacg tggctcctgt cacagctacc 60accgcctcgc agcccttcga cgacctagtt gacaaggtcg agagtggcta tgcggctatg 120cctaccaccc caaaggcggt ggctcccttc ccaacctcca aaccgcaagg tctccagcgt 180ttcgccgttc agagcgtgca cctgcgcgag tgcttcgccg agttcctcgg caccttcgtc 240atgatcgtct tcggtatggg cgtcaacaac caagtgacca actcacacga cgccaacggc 300acgtggctca gcatcaatat gtgctggggg attggtgtac tcatcggcgt ctactgctcc 360gagggcatca gtggtgctaa cctcaacaca gccgtgacgt tggcacattg cgtgtacggc 420cgtctaccat ggtggaaagc acccggttac atgatctcac agctattggg cgccttctgt 480ggagctttca ttatctacgt catgcagtac cagaacctca acgtcattga cccgtatcgc 540gagaccacac agagcagctt ctcgacgtat ccgagcgaca acatctccaa ctacacagcc 600ttctacaccg agttcatcgg tactgctatg cttgtgctca gtatctacgc catcacggac 660aagcgcaaca gatctgccgg tctcgtgggt tctcccttcg ccttctgtct aatgatcatg 720gcgttgggca tggcctttgg catgaacacg ggctacgctg tgaaccctgc acgtgacttc 780ggcccccgca tcttcacggc catcgcgggc tggggctcca aggtctttac cactcggaac 840tactacttct ggatcccgat cgtggccgat tctatgggcg gaattgctgg tgctggactc 900tatcggctgc ttgtggagat ccaccaccca cccctctcgt ag 942391636DNAPhytophthora infestans 39atgtccgacg accaagtgcc accgttttcg ctcggtacga aacaccttac acgcatgacg 60tgcagcgcac agttcagaga tgactaactg gccatgctgc cgctacgtgt atttaccaga 120taagccgcgc cacgatactt cgacgtacgt cggtcggtgg cgtaagtttg cggagctcgt 180gtcgccaaag tacgtcaaac aaggtagacg atggaaaaag tgtggctcta aacatcatgc 240tggggcttta ggtggctctt tctaagctcg gagcagattc agcacgcgac gcagactctg 300gaggacttcc gcaacggtaa aatcgcccct ggtcagttca aggatgcgga actttggaat 360cttcgccagg gtacgaaaca atgcgacagg atggtaccaa cttgtggttt ttgctgacgt 420tttggtgata attgaatcga tatgtagcgt acgaggctgc cgtgcaccct cagactggcg 480agacagttcc ggctgtgttt cggctgtcgg ctttcgtgcc tgtgaacatt cccatttgcg 540ttggcatgct gctcgctcct gccacggtat gtaaagtctt gctgcacttg taacaatagc 600tttattttaa tttaaatgct cacttaaata tgcttacagt tgggaaacac gatcttctgg 660caatgggtta accagagcta cagcgccggt ttcaactacg ctaaccgcaa cgccagcagt 720gaacaggaca actccaccat cttcagtacg aagttctcga tgctaatggc cttctttcag 780cgttctaaca cggctctttg catcgtatca cagagtcgta cgctaccgcg acgctcgtgt 840cttgctcgac tgccgttggt ctgggtaaga tggtggagaa agccaagaga ctttctccca 900gcacgcgttc cttcctcgga aaggttaaaa ctgctaaatg ccgaatgctg tgctccttat 960gtgactgaat ttttgggctg caacttgatc agatggttcc tttcgttgct gtcgcgagcg 1020caggtgcttt caacgccgtg tcgatgcgct tcaacgagtt ccagtacgtg tagagtgtct 1080tgcactggaa atatgatgct gttgtgctca ttggagtgtg gtgatgcgtt acagagaggg 1140aattgatatc atggacgagc acggagatgt tcacgggcgt tcagttgccg ctggacgtca 1200gtcgcttggc caagtggcac tcacgcgtat tgcgctaccc atgcccagta cgtcctcgca 1260ttgacaagct cttcttgggt gaattatgtc taatattggt ggacttggac agttttgctg 1320ctcccgccgt acctgtatga gatcatgaag aaaaccaaca tcatgcccaa ggccaagtac 1380ccgaagcttg ctgcggagct cggtacgtgc attatttctg ccatagtccg cggtaatgag 1440ctaacttatt gcgtctctgc ctgcatctat gatagtcgtg ttaacgatgt gtctgtgggg 1500tgccatgccc agcgctgtgg cgctcttccc gcagttggga acgatttcgg ctgacagcgt 1560tgaggaggaa ttccgatctc gggtggatcg caacggccag cccattcgtc acttcatcta 1620caacaaggga atctga 163640960DNAPhytophthora infestans 40atgagcaccg ccaataaaga agcatctccc tttgtggagc ttcgccgtct taactttgcg 60ttcgccaaag ttactatcgg tggccaactc atcaatcgct tgcagcatga ccccgctact 120gctgacgcca tggaagacga cgatcgagtc ctgcgtgacg tgaatctaac gctgcagtct 180ggtcagcgcc tgttggtcgt gggtggtaat ggagctggca aaagcacgct actcagtatc 240ttggctggca agcacctgac ggctgacgac acggcgctga tcttcggtcg agacagcttc 300cgtgacacga cactcaacgc tttaaggact ttcgttagtg ccgactgggg gcagcgctcg 360gtggcgttcg caacgcacgc aatggcttac tcggctgaca tggcggtgga agaaatgatg 420acgaaactgc agagtgaaca cccggagcga cgccaaaagt tactgaaggt gttgcgtatt 480gacccaaagt ggcgtttaca tcgcctgtcg gacggtcaac gtcgccgcgt tcagctcttt 540ctggcgctac tgagaccttc gcagctcatc gtactggacg aagtgctggg aatgctcgac 600atcatctcgc gcgaaaacgt actggcattc ctaaaggagg aaacagagac tcgacaagcc 660acggtgttgc tagccacgca catcttcgat gggacggacg tctgggcatc tcatgtgctg 720tatattcgtc gcggtactgt tgggttctat ggtccgattc agcagtgtac tgatggaggg 780aagatcccga tgtataaggt ggtggaacac tggctacgtg aggaattggc cgacgacgac 840cgtgtggaat gcgaggcggt gggcccaagt ggtgagttcg acctgggcaa cgcgcagaac 900cgcgcaggag ggtatgccga cggtcgactg ggtggtgtcg atgtcaccac atcgttttaa 96041510DNAPhytophthora infestans 41atgagcgacg gtactaagct cattgccgtg atcggagacg aagacaccgt cacgggcttt 60atcctcgcgg gtgtcggcca tcgaacggcc gagggaacca actttctcgt cgtcaaaccc 120tgtgcgtcgg cattcccgaa aggatttttt taaagcttag attaactact aacacgcgtc 180acatacgacg gtgctgcagc tactccaatc tccgctattg aggccagttt ccggacgctc 240tcgagccgtg acgatatcgc aattatcctc atcaaccagc acgtacggca tcctagttag 300aacccactct gaggtataag cctttatgtt tttctcactc gcttgatatt attgtttggg 360caggttgctg aggagatccg tcaccttctc aacacgtacg acaagaccat tcccacggtg 420ctagagatcc cgagcaaaga ctcgccttac gacccagcta aggactatat catgaagcgc 480gtgaatctca tgcttggagg agagtcgtga 510421491DNAPhytophthora infestans 42atggtcgctg aagacgcggt gttcacggaa gcgaagacgc ccaaggccgg cgatgtccag 60gccggcagat ccgtcccgct ctcgccgacc ttctggttca gcctcgcggt gctgctcctg 120ctccccttcc agttcggctg gtcggtcggc cagctcaacc tcacgacctt caacgacgaa 180gacgagtgca acgcgcgacc tctagtcgac ggaacgtgcc tcatgtttcc cggtcatagc 240agcacggaat ggaccttgat cgtgaacgcg tggattgtag gcggtatgat cgggagtctc 300ggttgtggcg ttatctccga acgtttcggt cgcaagaagg tattgctggc gaacgccgtc 360gtcatgttgg ccggcgctgt cattcaagcg agtacgtcga gtatctcggt ttttatggtc 420gggcgtatcg tcgccggtat cgcgtcgggt tgtgcgacgg gtatggtggg tggctacatc 480agtgagatta cacccccgag tctccgtaac tcgtacggca cgttcatgca ggtatctctc 540tctgccggta tcttagtagt gaccatcagt tttttcttcg cggataccag tagcggctgg 600aggtacatcg ccgcatttcc cgttcttaac gccggtttct tcttggcgtt cgcaccgttc 660gttcttgtag agagtcccgc gtggcttttg gaaaagggcg accgggagca tgcggagcgg 720gagatcgcca gactttacgg cttcgatttc gtcccagtag cactgacgtg gatggaacca 780ggtatcaata ctgacctgga gtcagaggaa ctgtgcggcg aacagcacga aggcggcaca 840ttgtcgctgc tgttttcgcc gctctttatc aagcaactgc ttgtggctct tggtgtatca 900gctgcgcaac aacttacggg tatcaacgcg gtgtgctatt actcgtccga tatcttctcg 960gatgcaggga tgtcggatgg tcgtgtgggt ggcgtcatcg tgtacgtgct gatgttacta 1020ccgacgatgg ctgttgcgcg attgtcggag cgattcggca accgacggct tctgcttact 1080ggactggccg ggatgtttat tagtgctacg ggtataactt tggcgcttgc gttgtcggtc 1140gaggtactct ctatcgtctt catgggtaca ttcgttgcgt tcttctctgc gagcgtgggg 1200ccgcttatct agcctatcac ggccgcgctg ttcacggact cggtacgcgc cactgccgtc 1260tctatgtgca tctttatcaa ttgggtatgc aacttgatca ttggcgtctg cttcccgtac 1320gtctcggatg cgctagacga gtacaagttt gtccccttta tggtgaccac cgctgcgttt 1380ttcttcttca ctcagttttg gatcccggag actgcaggta agagcaccga ggagatccaa 1440gccacgttcc gatctaggaa agctcagaag ccggtggtgg tgttaagctg a 1491432462DNAPhytophthora infestans 43ttgtgctact cgagtgcctt cttctccatg acgcagcaag acgttcgcca ggcgctggac 60gcccccgcat tagcagccta catccactcg cgactgggtg catcgcacgg cgccatcgcg 120tccatccgtc agttccagca tggccagtcc aacccgacgt acctcttgac aatggccggc 180tcgaaagcca agtgggtgtt gcgtaagaag ccgcacggtc agatcctgcc gtcagctcac 240gccgtagagc gcgaatatcg tgttctagag gctctggagc actcggaggt gcccgttccc 300cgcgctgtgt tgctatgtga agaccccaaa gtcattggca cacctttcta cctcatggaa 360tacatacatg gtcgtatctt ccaagaccca tcgctgcctg gcattaaacc tatgtatcgc 420tacgccatgt acagctcggc agtagacgcg ttggttaagt tgcacgagct ggactacaag 480aagatcggac tggccgactt cggtcgcccc gagaagtact gccaccgtgt cgtgacgcgc 540tggagtcgac aagtccaaag tggccagaag gtctttagtg aagctggagt gaaggagaac 600ccgaagatga cgcagctgca acgttggctg gagcagaacg ccgacgacgc cgagaaggcc 660acgaccagtg ccgagggagc gagtatcgtc cacggagact tccgcattga caacatgatc 720ttccacccga cggagcctcg tgtgttggcc attctggact gggagctgtg tactatcggc 780aatccgttct cggatgtagc cacattggcg tcggcctaca gactgccact ggacaactcg 840aacacaatca tgacgcctgg tctctcggat gctccgttga agacactcgg catcccatcg 900gagagtgaat tgttgctagg ctactgtcgt cgtgccagac ggttccctct acccactcag 960acgtggcatt ttttcatggg gatgatcgta taccgcttcg cagccatctg ccacggtgta 1020tacgcccgcg cactgctcgg caacgcgtcg tcggccaacg cagcatgtgc caagacgacg 1080atggaccgac tcttggccat gagcgacgac atcatggacg catcggctga tatttacccg 1140gagccggagc tgacgcacat tctgccgttc ccgatccgtc ctcatgctct gcagatgtac 1200aagaagctgc taaagttttg ccagaaccga gtgtaccccg ctgagtccgt ccacattgct 1260cagatcgcca aggcgagaga agaaggacgg gagtggcaga gtgtgcctcc tgttattgaa 1320gagctcaaga cggaagccaa ggcgctggga ctctggaacc tcttcctgcc tcagtgtgtg 1380gtgccagctc tggatggcaa tggaccagac gtcaactacg gtggagacct gacgaatctc 1440gagtacggac tcatgtgtga ggtcatggga cgctccattg tgttggctcc ggaggttttc 1500aactgctcag cacccgatac cggcaacatg gagatcttga cgcggttctg cactgtggag 1560cagaagcatc agtggcttgt tcctcttctt caaggtgaga tccgatcgtg tttcgcgatg 1620acggagaagc gtgtggcttc gtcggatgcg acgaacatcg agacgcgcat tgtacgcgac 1680gaacagcgtc aagaatacgt catcaatggc cacaagttct acatctctgg agctggagac 1740ccacgatgca agatcattgt gctcatgggc aagcacacgg aacgagccaa ggagagtcca 1800ttcaagcagc agtcgatgat cctcgtgcct atggacacac ccggcgtgca ggtcgtgaag 1860cccatgcatg tctttggcta cgacgacgca ccgcacggac acatggagat gctgttcaag 1920gacgtgcgtg tgccgttcag caacgtgttg ctcggtgaag gtcgcggctt tgagatcgct 1980caggctcgtc ttggacctgg ccgtatccac cactgtatgc gagccatcgg agctgctgag 2040cgttgtcttg agctgatggt gcagcgagcc aagacacgca cagcgttcaa gcagctcctg 2100gccgagaatc cgctcgtgtg ttcgcagatt gccaagtcgc gttgtgaatt ggacagcgcg 2160cgcttgttga cgctccaggc tgcacatcag atggacaagc acggcaacaa ggtggcgcaa 2220caggccatcg ctatgatcaa gatcgtggcg cctaacatgg cactggacgt ctgcgaccga 2280gccatccaga tccacggcgc ttctggcgtg agtcaggact ttgtcctgtc ttacttgtac 2340gccgccctgc gcacgctacg tatcgccgac ggaccggatg aagtgcacat gcggaccatc 2400gcaaaactcg agctgagcca ctcgaagttg taagagaaat gtaaggcaaa agcaagcgtg 2460aa 24624420DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 44atcccactat ccttcgcaag 204528DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 45ttgatatcgc ggaaggcgag agacatcg 284624DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 46ctaagggttt cttatatgct caac 244728DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 47cgctcgaggc tggatctcgc gctgaggt 284819DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 48gtggagaggc tattcggta 194920DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 49ccaccatgat attcggcaag

20

* * * * *

Patent Diagrams and Documents
D00001
D00002
D00003
D00004
D00005
D00006
D00007
D00008
D00009
D00010
D00011
D00012
D00013
D00014
D00015
D00016
D00017
D00018
D00019
D00020
D00021
D00022
D00023
D00024
D00025
D00026
D00027
D00028
D00029
D00030
D00031
D00032
D00033
S00001
XML
US20200347400A1 – US 20200347400 A1

uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.

While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.

All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.

© 2024 USPTO.report | Privacy Policy | Resources | RSS Feed of Trademarks | Trademark Filings Twitter Feed