U.S. patent application number 16/840314 was filed with the patent office on 2020-10-15 for dna ligation on rna template.
The applicant listed for this patent is AFFYMETRIX, INC.. Invention is credited to John E. BLUME, Xin MIAO, Eugeni A. NAMSARAEV.
Application Number | 20200325530 16/840314 |
Document ID | / |
Family ID | 1000004917968 |
Filed Date | 2020-10-15 |
United States Patent
Application |
20200325530 |
Kind Code |
A1 |
NAMSARAEV; Eugeni A. ; et
al. |
October 15, 2020 |
DNA LIGATION ON RNA TEMPLATE
Abstract
Disclosed are methods and compositions for detection and
amplification of nucleic acids, wherein two DNA strands hybridized
to an RNA strand are ligated. In one aspect, the disclosed methods
include removal of an energy source, such as ATP, upon charging a
ligase to form an enzyme-AMP intermediate, and then adding
substrate, which results in one complete round of RNA-templated DNA
ligation. In another aspect, the ligation reaction is accomplished
by use of a mixture of at least two different ligase enzymes. The
disclosed methods and compositions for RNA-templated DNA ligation
may be particularly useful for detection of RNA sequence variants,
for example RNA splice variants, and for quantitative expression
analysis.
Inventors: |
NAMSARAEV; Eugeni A.;
(Sunnyvale, CA) ; MIAO; Xin; (Menlo Park, CA)
; BLUME; John E.; (Sunnyvale, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
AFFYMETRIX, INC. |
Carlsbad |
CA |
US |
|
|
Family ID: |
1000004917968 |
Appl. No.: |
16/840314 |
Filed: |
April 3, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15798238 |
Oct 30, 2017 |
10648021 |
|
|
16840314 |
|
|
|
|
14313211 |
Jun 24, 2014 |
|
|
|
15798238 |
|
|
|
|
12690101 |
Jan 19, 2010 |
8790873 |
|
|
14313211 |
|
|
|
|
61145466 |
Jan 16, 2009 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6837
20130101 |
International
Class: |
C12Q 1/6837 20060101
C12Q001/6837 |
Claims
1. A method for detecting a plurality of target nucleic acids from
a nucleic acids from a nucleic acid sample, comprising: a)
contacting a DNA array-bound probe with: (i) a DNA interrogation
probe, and (ii) a nucleic acid sample comprising at least one RNA
target nucleic acid, wherein the array-bound probe and the
interrogation probe hybridize to the target nucleic acid such that
the 3' end of the array-bound probe and the 5' end of the
interrogation probe are directly adjacent to one another and
ligatable by DNA ligase, and wherein the interrogation probe
contains a detectable label; b) adding an effective amount of ATP
to a solution of DNA ligase, thereby charging the DNA ligase to
form a DNA ligase-AMP intermediate, c) depleting ATP from the
solution of DNA ligase-AMP intermediate; d) adding the solution of
DNA ligase-AMP intermediate to step a), thereby ligating the 3' end
of the array-bound probe to the 5' end of the interrogation probe;
and e) detecting the ligated product.
2. The method according to claim 1, wherein ATP depletion is
accomplished by adding an effective amount of apyrase in conditions
which allow apyrase to catalytically convert ATP in solution to ADP
and/or AMP.
3. The method according to claim 1, wherein ATP depletion is
accomplished by adding an effective amount of hexokinase in
conditions which allow hexokinase to catalytically convert ATP in
solution to ADP and/or AMP.
4. The method according to claim 1, wherein the DNA ligase is T4
DNA ligase.
5. The method according to claim 2, wherein there is about 10 mU
apyrase per .mu.l of ATP depletion mix.
6. The method according to claim 3, wherein there is about 0.4 U
hexokinase per .mu.l of ATP depletion mix.
7. The method of claim 1 wherein the concentration of ATP in the
ligase charging mix is between 200 and 500 mM.
8. (canceled)
9. (canceled)
10. (canceled)
11. A method of detecting a plurality of target nucleic acids from
a nucleic acid sample, comprising: a) contacting an open circle DNA
probe with an RNA nucleic acid sample comprising at least one
target nucleic acid, wherein the open circle probe comprises a 5'
end and a 3' end, and wherein the open circle probe contains a
detectable label; b) adding an effective amount of ATP to a
solution of DNA ligase, thereby charging the DNA ligase to form a
DNA ligase-AMP intermediate, c) depleting ATP from the solution of
DNA ligase-AMP intermediate; d) adding the solution of DNA
ligase-AMP intermediate to step a), thereby ligating the 5' end of
the open circle probe to the 3' end of the open circle probe; and
e) detecting the ligated product.
12. The method according to claim 11, wherein ATP depletion is
accomplished by adding an effective amount of apyrase in conditions
which allow apyrase to catalytically convert ATP in solution to ADP
and/or AMP.
13. The method according to claim 11, wherein ATP depletion is
accomplished by adding an effective amount of hexokinase in
conditions which allow hexokinase to catalytically convert ATP in
solution to ADP and/or AMP.
14. The method according to claim 11, wherein the DNA ligase is T4
DNA ligase.
15. The method according to claim 12, wherein the effective amount
of apyrase is about 10 mU apyrase per .mu.L.
16. The method according to claim 13, wherein the effective amount
of hexokinase is about 0.4 U hexokinase per .mu.l.
17. The method of claim 1 wherein the concentration of ATP in the
ligase charging mix is between 200 and 500 mM.
18. The method of claim 11 wherein the concentration of ATP in the
ligase charging mix is between 100 and 1000 mM.
19. The method of claim 11 wherein the concentration of ATP in the
ligase charging mix is between 0.1 and 200 mM.
20. The method of claim 11 wherein the concentration of ATP in the
ligase charging mix is between 10 and 100 mM.
Description
RELATED APPLICATIONS
[0001] This application is a division of U.S. application Ser. No.
15/798,238 filed Oct. 30, 2017, which is a division of U.S.
application Ser. No. 14/313,211 fled Jun. 24, 2014 now abandoned,
which is a continuation of U.S. application Ser. No. 12/690,101
filed on Jan. 19, 2010 now U.S. Pat. No. 8,790,873 issued on Jul.
29, 2014 which claims the priority of U.S. Provisional Application
No. 61/145,466 filed Jan. 16, 2009 the disclosure of each of which
is incorporated herein by reference in their entirety for all
purposes.
FIELD OF THE INVENTION
[0002] Disclosed are methods related generally to ligation-mediated
nucleic acid detection and analysis. Such methods may be performed
on a solid support. Disclosed are also methods of gene expression
profiling and methods of sequencing of RNA, mediated by ligase
enzymes. The methods do not require an intermediate step of
generating a cDNA copy of the sequenced RNA by RT-PCR.
REFERENCE TO SEQUENCE LISTING
[0003] The Sequence Listing submitted electronically is hereby
incorporated by reference. The file is named 3865_1_ST25.txt, the
file is 1.68 KB and the date of creation is Jan. 19, 2010.
BACKGROUND OF THE INVENTION
[0004] Tools for high-throughput nucleic acid analysis are becoming
increasingly important in light of recent advancements in
availability of nucleic acid sequence information and genomic data
for humans and other organisms. The techniques of ligation-mediated
detection of nucleic acids, coupled with hybridization of nucleic
acids on arrays are widely used form the basis of genomics
applications such as oligonucleotide ligation assay (OLA)
(Landegren et al., Science, 241:1077 (1998)), ligase chain reaction
(Barany, Proc. Natl. Acad. Sci. USA, 88:189 (1991)), and ligation
of padlock or open circle probes (Nilsson et al., Science, 265:2085
(1994)). Ligation-mediated nucleic acid detection methodology
relies on the ability of ligases to accurately discriminate between
highly homologous nucleotide sequences, differing in some instances
only at the terminal nucleotide position. Thus far, most ligation
applications involve DNA-templated DNA ligation by a DNA ligase,
where both the target nucleic acid and the oligonucleotide probes
consist of deoxyribonucleotide polymers. Such applications are
particularly useful for generating genomic sequence data and SNP
profiling.
[0005] RNA-templated DNA ligation is an attractive method for
detection of RNA, determination of RNA sequence identity,
expression monitoring and transcript analysis. Direct detection of
RNA target-DNA probe duplexes (without first converting RNA to cDNA
by reverse transcription) has been challenging because a majority
of tested DNA ligases fail to ligate nicked DNA on an RNA template.
The exception to this is T4 DNA ligase, which is able to ligate
nicked DNA hybridized to a RNA strand at a depressed rate.
[0006] T4 DNA ligase is an enzyme belonging to the DNA ligase
family of enzymes (E.C. 6.5.1.1) which catalyzes the formation of a
covalent phosphodiester bond from a free 3' hydroxyl group on one
DNA molecule and a free 5' phosphate group of a second, separate
DNA molecule, thus covalently linking the two DNA strands together
to form a single DNA strand. This activity may also be applied to
RNA and is especially useful in molecular genetics where sticky (or
blunt) ends of double-stranded DNA (dsDNA) may be fused together
with other dsDNA molecules, both products of a restriction enzyme
cut, for instance. DNA ligases play critical roles in cell
division, in a process called lagging strand DNA replication, as
well as cell recovery in the dsDNA break repair mechanism. DNA
ligases also play critical roles in normal cellular processes used
to generate diversity in the immune system pathways, i.e. during
V(D)J recombination. Commercially exploited DNA ligases include the
bacteriophage T4 DNA ligase. T4 DNA ligase possesses the basic
activity of catalyzing formation of covalent phosphodiester bonds,
as described above, but only operates on double-stranded molecules,
i.e. DNA/DNA, DNA/RNA hybrids, and RNA/RNA. Like many ligases, T4
DNA ligase activity requires adenosine triphosphate (ATP) as a
cofactor. Recombinant T4 DNA ligase, and various mutants thereof,
is commercially available.
[0007] The ligation reaction catalyzed by DNA ligase occurs in
three general steps. First, the ligase enzyme is activated by
charging with ATP. Addition of ATP to ligase enzyme causes
formation of an intermediate AMP-enzyme species concomitant with
hydrolysis of ATP to yield AMP. Second, the charged AMP-enzyme
intermediate binds to the dsDNA (or dsRNA, or RNA/DNA complex) and
transfers the AMP moiety to the free 5' terminal phosphate, to form
a high energy 5'-5' phosphate bond. Third, the enzyme provides the
appropriate environment in which the 3' hydroxyl group of the
second strand of DNA (or RNA) is able to attach the high energy
5'-5' phosphate bond, thereby forming a covalent phosphodiester
bond as a product and releasing ligase enzyme and AMP. Free enzyme
does not bind the intermediate high energy 5'-5' phosphate bond
species to an appreciable amount. Thus, if the ligase prematurely
releases from the duplex after formation of the high energy 5'-5'
phosphate bond, the reaction will typically end and the
intermediate will not proceed to the final ligated product.
[0008] Methods are disclosed herein that provide for efficient
RNA-templated DNA ligation.
SUMMARY OF THE INVENTION
[0009] Methods for detection of nucleic acids involving ligation of
DNA strands hybridized to an RNA strand are disclosed. Such methods
are particularly useful, for example, in detection of RNA sequence
variants and for quantitative expression analysis. Other plausible
non-limiting uses include analysis of viral and ribosomal RNA.
[0010] The present methods involve charging T4 DNA ligase with ATP
to form an AMP-enzyme intermediate complex. Excess ATP is then
removed. Removal of free ATP after the charging step prevents
premature cycling of T4 DNA ligase and the accumulation of 5'
adenylated (unligatable) product. That is, during RNA-templated DNA
ligation, under conditions where ATP is present, T4 DNA ligase will
charge, as above, forming the AMP-enzyme complex, then bind the
RNA-DNA complex. This is typically followed by premature release of
the ligase from the nicked DNA, yielding DNA having a high energy
5'-5' phosphate bond on its free 5' end, which is not a substrate
for the DNA ligase reaction. The remaining AMP on the 5' end of the
DNA nick prevents any further ligation attempts, since the high
energy 5'-5' phosphate bond is not an efficient substrate for the
ligase enzyme. The cofactor ATP may be removed by either apyrase or
hexokinase treatment. Charging of the ligase in this manner, and
addition of near stoichiometric quantities of charged enzyme,
allows the DNA ligase enzyme to prepare the RNA-DNA complex for
later RNA-templated ligation in an ATP-depleted solution.
[0011] Other methods disclosed herein rely on the use of a mixture
of two DNA ligase enzymes in the presence of ATP. The first ligase
may be, for instance, T4 DNA ligase, or any ligase which produces
high energy 5'-5' phosphate bonds at the end of a nicked DNA
molecule. The second ligase may be selected from ligase enzymes, or
mutants thereof, which are capable of performing only the final
step of ligation. In one aspect, the second ligase is a non-native
enzyme.
BRIEF DESCRIPTION OF THE FIGURES
[0012] FIG. 1 illustrates the differences in DNA vs. RNA-templated
ligation using DNA ligase. DNA ligase is capable of efficiently
ligating DNA-DNA hybridized complexes. In contrast. DNA ligase
often prematurely releases from an RNA-DNA complex after formation
of a high energy 5'-5' phosphate bond on the substrate, thus
terminating the reaction for that intermediate.
[0013] FIGS. 2A and 2B provide a schematic diagram outlining two
methods for efficient RNA-templated DNA ligation, as disclosed in
the present invention. FIG. 2A illustrates a method wherein ligase
is first charged with ATP, to form a ligase-AMP species, ATP is
then removed and the RNA-templated DNA introduced into the
reaction, allowing for completion of one round of RNA-templated
ligation. FIG. 2B illustrates a similar method in which
RNA-templated DNA ligation is achieved using a mixture of two
different ligase enzymes.
[0014] FIG. 3 illustrates a step-by-step outline of a method
wherein RNA-templated ligation of padlock probes is followed by
PCR.
DETAILED DESCRIPTION OF THE INVENTION
[0015] Reference will now be made in detail to exemplary
embodiments. While the disclosed methods and compositions will be
described in conjunction with the exemplary embodiments, it will be
understood that these exemplary embodiments are not intended to
limit the invention. On the contrary, the disclosed methods and
compositions are intended to encompass alternatives, modifications
and equivalents, which may be included within the spirit and scope
of the present application.
[0016] The present methods and compositions relate to diverse
fields impacted by the nature of molecular interaction, including
chemistry, biology, medicine and diagnostics. Methods disclosed
herein are advantageous in fields, such as those in which genetic
information is required quickly, as in clinical diagnostic
laboratories or in large-scale undertakings such as the Human
Genome Project.
[0017] The present methods and compositions have many embodiments
and rely on many patents, applications and other references for
details known to those of the art. Therefore, when a patent,
application, or other reference is cited or repeated below, it
should be understood that the entire disclosure of the document
cited is incorporated by reference in its entirety for all purposes
as well as for the proposition that is recited. All documents,
i.e., publications and patent applications, cited in this
disclosure, including the foregoing, are incorporated herein by
reference in their entireties for all purposes to the same extent
as if each of the individual documents were specifically and
individually indicated to be so incorporated herein by reference in
its entirety.
[0018] As used in this application, the singular form "a," "an,"
and "the" include plural references unless the context clearly
dictates otherwise. For example, the term "an agent" includes a
plurality of agents, including mixtures thereof.
[0019] An individual is not limited to a human being but may also
be other organisms including but not limited to mammals, plants,
bacteria, or cells derived from any of the above.
[0020] Throughout this disclosure, various aspects of the disclosed
methods and compositions may be presented in a range format. It
should be understood that when a description is provided in range
format, this is merely for convenience and brevity and should not
be construed as an inflexible limitation on the scope of the
claimed invention(s). Accordingly, the description of a range
should be considered to have specifically disclosed all the
possible sub-ranges as well as individual numerical values within
that range. For example, description of a range such as from 1 to 6
should be considered to have specifically disclosed sub-ranges such
as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6,
from 3 to 6, etc., as well as individual numbers within that range,
for example, 1, 2, 3, 4, 5, and 6. This understanding applies
regardless of the breadth of the range.
[0021] The present methods and compositions may employ, unless
otherwise indicated, conventional techniques and descriptions of
organic chemistry, polymer technology, molecular biology (including
recombinant techniques), cell biology, biochemistry, and
immunology, which are within the skill of one of skill in the art.
Such conventional techniques include polymer array synthesis,
hybridization, ligation, and detection of hybridization using a
detectable label. Specific illustrations of suitable techniques are
provided by reference to the example hereinbelow. However, other
equivalent conventional procedures may also be employed. Such
conventional techniques and descriptions may be found in standard
laboratory manuals, such as Genome Analysis: A Laboratory Manual
Series (Vols. I-IV), Using Antibodies: A Laboratory Manual, Cells:
A Laboratory Manual, PCR Primer: A Laboratory Manual, and Molecular
Cloning: A Laboratory Manual (all from Cold Spring Harbor
Laboratory Press), Stryer, L. (1995), Biochemistry, 4th Ed.,
Freeman, New York, Gait, Oligonucleotide Synthesis: A Practical
Approach, (1984), IRL Press, London, Nelson and Cox (2000),
Lehninger, Principles of Biochemistry, 3.sup.rd Ed., W.H. Freeman
Pub., New York, N.Y., and Berg et al. (2002), Biochemistry,
5.sup.th Ed., W.H. Freeman Pub., New York, N.Y. and Berg et al.
(2002) Biochemistry, 5.sup.th Ed., W.H. Freeman Pub., New York,
N.Y., all of which are herein incorporated in their entirety by
reference for all purposes.
[0022] The presently disclosed methods and compositions may employ
solid substrates, including arrays in some embodiments. Methods and
techniques applicable to polymer (including protein) array
synthesis have been described in U.S. Ser. No. 09/536,841
(abandoned), WO 00/58516, U.S. Pat. Nos. 5,143,854, 5,242,974,
5,252,743, 5,324,633, 5,384,261, 5,405,783, 5,424,186, 5,451,683,
5,482,867, 5,491,074, 5,527,681, 5,550,215, 5,571,639, 5,578,832,
5,593,839, 5,599,695, 5,624,711, 5,631,734, 5,795,716, 5,831,070,
5,837,832, 5,856,101, 5,858,659, 5,936,324, 5,968,740, 5,974,164,
5,981,185, 5,981,956, 6,025,601, 6,033,860, 6,040,193, 6,090,555,
6,136,269, 6,269,846 and 6,428,752, and in PCT Applications Nos.
PCT/US99/00730 (International Publication No. WO 99/36760) and
PCT/US01/04285 (International Publication No. WO 01/58593), which
are all incorporated herein by reference in their entirety for all
purposes.
[0023] Patents that describe synthesis techniques in specific
embodiments include U.S. Pat. Nos. 5,412,087, 6,147,205, 6,262,216,
6,310,189, 5,889,165, and 5,959,098. Nucleic acid arrays are
described in many of the above patents, but the same techniques are
applied to polypeptide arrays.
[0024] Nucleic acid arrays that are useful in the present methods
and compositions include, but are not limited to, those that are
commercially available from Affymetrix (Santa Clara, Calif.) under
the brand name GENECHIP. Example arrays are shown on the website at
affymetrix.com.
[0025] Many uses for polymers attached to solid substrates are
contemplated herein. These uses include, but are not limited to,
gene expression monitoring, profiling, library screening,
genotyping and diagnostics. Methods of gene expression monitoring
and profiling are described in U.S. Pat. Nos. 5,800,992, 6,013,449,
6,020,135, 6,033,860, 6,040,138, 6,177,248 and 6,309,822.
Genotyping and uses therefore are shown in U.S. patent application
Ser. No. 10/442,021 (abandoned) and U.S. Pat. Nos. 5,856,092,
6,300,063, 5,858,659, 6,284,460, 6,361,947, 6,368,799, 6,333,179,
and 6,872,529. Other uses are described in U.S. Pat. Nos.
5,871,928, 5,902,723, 6,045,996, 5,541,061, and 6,197,506.
[0026] Contemplated herein are embodiments employing various sample
preparation methods. Prior to, or concurrent with, genotyping, the
genomic sample may be amplified by a variety of mechanisms, some of
which may employ PCR. (See, for example, PCR Technology: Principles
and Applications for DNA Amplification, Ed. H. A. Erlich, Freeman
Press, NY, NY, 1992; PCR Protocols: A Guide to Methods and
Applications, Eds. Innis, et al., Academic Press, San Diego,
Calif., 1990; Mattila et al., Nucleic Acids Res., 19:4967, 1991;
Eckert et al., PCR Methods and Applications, 1:17, 1991; PCR, Eds.
McPherson et al., IRL Press, Oxford, 1991; and U.S. Pat. Nos.
4,683,202, 4,683,195, 4,800,159 4,965,188, and 5,333,675, each of
which is incorporated herein by reference in their entireties for
all purposes. The sample may also be amplified on the array. (See,
for example, U.S. Pat. No. 6,300,070 and U.S. patent application
Ser. No. 09/513,300 (abandoned), all of which are incorporated
herein by reference).
[0027] Other suitable amplification methods include the ligase
chain reaction (LCR) (see, for example, Wu and Wallace, Genomics,
4:560 (1989), Landegren et al., Science, 241:1077 (1988) and
Barringer et al., Gene, 89:117 (1990)), transcription amplification
(Kwoh et al., Proc. Natd. Acad. Sci. USA, 86:1173 (1989) and WO
88/10315), self-sustained sequence replication (Guatelli et al.,
Proc. Nat. Acad. Sci. USA. 87:1874 (1990) and WO 90/06995),
selective amplification of target polynucleotide sequences (U.S.
Pat. No. 6,410,276), consensus sequence primed polymerase chain
reaction (CP-PCR) (U.S. Pat. No. 4,437,975), arbitrarily primed
polymerase chain reaction (AP-PCR) (U.S. Pat. Nos. 5,413,909 and
5,861,245) and nucleic acid based sequence amplification (NABSA).
(See also, U.S. Pat. Nos. 5,409,818, 5,554,517, and 6,063,603, each
of which is incorporated herein by reference). Other amplification
methods that may be used are described in, for instance, U.S. Pat.
Nos. 6,582,938, 5,242,794, 5,494,810, and 4,988,617, each of which
is incorporated herein by reference.
[0028] Additional methods of sample preparation and techniques for
reducing the complexity of a nucleic sample are described in Dong
et al., Genome Research, 11:1418 (2001), U.S. Pat. Nos. 6,361,947,
6,391,592, 6,632,611, 6,872,529 and 6,958,225, and in U.S. patent
application Ser. No. 09/916,135 (abandoned).
[0029] Methods for conducting polynucleotide hybridization assays
have been well developed in the art. Hybridization assay procedures
and conditions will vary depending on the application and are
selected in accordance with known general binding methods,
including those referred to in Maniatis et al., Molecular Cloning:
A Laboratory Manual, 2.sup.nd Ed., Cold Spring Harbor, N.Y, (1989);
Berger and Kimmel, Methods in Enzmology, Guide to Molecular Cloning
Techniques, Vol. 152, Academic Press, Inc., San Diego, Calif.
(1987); Young and Davism, Proc. Nat'l. Acad. Sci., 80:1194 (1983).
Methods and apparatus for performing repeated and controlled
hybridization reactions have been described in, for example, U.S.
Pat. Nos. 5,871,928, 5,874,219, 6,045,996, 6,386,749, and 6,391,623
each of which are incorporated herein by reference.
[0030] Presently contemplated are also methods and compositions
employing signal detection of hybridization between ligands. See
U.S. Pat. Nos. 5,143,854, 5,578,832; 5,631,734; 5,834,758;
5,936,324; 5,981,956; 6,025,601; 6,141,096; 6,185,030; 6,201,639;
6,218,803; and 6,225,625, in U.S. Ser. No. 10/389,194 and in PCT
Application PCT/US99/06097 (published as WO99/47964), each of which
also is hereby incorporated by reference in its entirety for all
purposes.
[0031] Methods and apparatus for signal detection and processing of
intensity data are disclosed in, for example, U.S. Pat. Nos.
5,143,854, 5,547,839, 5,578,832, 5,631,734, 5,800,992, 5,834,758;
5,856,092, 5,902,723, 5,936,324, 5,981,956, 6,025,601, 6,090,555,
6,141,096, 6,185,030, 6,201,639; 6,218,803; and 6,225,625, in U.S.
Ser. No. 10/389,194 (U.S. Patent Application Publication
20040012676), 60/493,495 and in PCT Application PCT/US99/06097
(published as WO99/47964), each of which also is hereby
incorporated by reference in its entirety for all purposes.
[0032] Embodiments may also employ conventional biology methods,
software and systems. Computer software products contemplated
herein typically include computer readable medium having
computer-executable instructions for performing the logic steps of
the presently disclosed methods. Suitable computer readable medium
include floppy disk, CD-ROM/DVD/DVD-ROM, hard-disk drive, flash
memory, ROM/RAM, magnetic tapes etc. The computer executable
instructions may be written in a suitable computer language or
combination of several languages. Basic computational biology
methods are described in, for example Setubal and Meidanis et al.,
Introduction to Computational Biology Methods (PWS Publishing
Company, Boston, 1997); Salzberg, Searles, Kasif, (Ed.),
Computational Methods in Molecular Biology, (Elsevier, Amsterdam,
1998); Rashidi and Buehler, Bioinformatics Basics: Application in
Biological Science and Medicine (CRC Press, London, 2000) and
Ouelette and Bzevanis Bioinformatics: A Practical Guide for
Analysis of Gene and Proteins (Wiley & Sons, Inc., 2.sup.nd
ed., 2001). See U.S. Pat. No. 6,420,108.
[0033] The presently disclosed methods may also make use of various
computer program products and software for a variety of purposes,
such as probe design, management of data, analysis, and instrument
operation. (See, U.S. Pat. Nos. 5,593,839, 5,795,716, 5,733,729,
5,974,164, 6,066,454, 6,090,555, 6,185,561, 6,188,783, 6,223,127,
6,229,911 and 6,308,170).
[0034] Additionally, encompassed herein are embodiments that may
include methods for providing genetic information over networks
such as the internet, as disclosed in, for instance, U.S. patent
application Ser. No. 10/197,621 (U.S. Patent Application
Publication No. 20030097222), Ser. No. 10/063,559 (U.S. Patent
Application Publication No. 20020183936, abandoned), Ser. No.
10/065,856 (U.S. Patent Application Publication No. 20030100995,
abandoned), Ser. No. 10/065,868 (U.S. Patent Application
Publication No. 20030120432, abandoned), Ser. No. 10/328,818 (U.S.
Patent Application Publication No. 20040002818, abandoned), Ser.
No. 10/328,872 (U.S. Patent Application Publication No.
20040126840, abandoned), Ser. No. 10/423,403 (U.S. Patent
Application Publication No. 20040049354, abandoned), and 60/482,389
(expired).
A. Definitions
[0035] The term "apyrase," as used herein, refers to one or more of
a calcium-activated enzyme which possesses ATP-diphosphohydrolase
activity and catalyzes the hydrolysis of the gamma phosphate from
ATP, and catalyzes the hydrolysis of the beta phosphate from ADP.
Apyrases are found in all eukaryotes and some prokaryotic
organisms, indicating a preserved role for these enzymes across
species. They a distinct phosphohydrolase activity, nucleotide
substrate specificity, divalent cation requirement, and sensitivity
to inhibitors. (See, Plesner, Int. Rev. Cytol., 158:141 (1995), and
Handa and Guidotti, Biochem. Biophys. Res. Commun., 218(3):916
(1996)). In mammals, apyrase is believed to function primarily as
an extracellular hydrolase specific for ATP and ADP, which function
is important in the inactivation of synaptic ATP molecules
following nerve stimulation. (See, Todorov et al., Nature,
387(6628):76 (1997)). Apyrase in mammals is also believed to be
important in the inhibition of ADP-induced platelet aggregation.
(See, Marcus et al., J. Clin. Invest., 99(6):1351 (1997)).
Recombinant apyrase is commercially available from New England
Biolabs.
[0036] The term "array" as used herein refers to an intentionally
created collection of molecules which can be prepared either
synthetically or biosynthetically. The molecules in the array can
be identical or different from each other. The array can assume a
variety of formats including, but not limited to, libraries of
soluble molecules, and libraries of compounds tethered to resin
beads, silica chips, or other solid supports.
[0037] The term "complementary" refers to the hybridization or
base-pairing between nucleotides or nucleic acids, such as, for
instance, that which occurs between the two strands of a double
stranded DNA molecule, or between an oligonucleotide primer and a
primer binding site on a single stranded nucleic acid to be
sequenced or amplified. Complementary nucleotides are pairs of
nucleotides having the following identities, generally, A and T (or
A and U), or C and G. Two single stranded RNA or DNA molecules are
said to be complementary when the nucleotides of one strand,
optimally aligned and compared, taking into consideration various
nucleotide insertions or deletions, if present, pair with at least
about 80% of the nucleotides of the other strand, usually at least
about 90% to 95%, and more preferably from about 98 to 100%.
Alternatively, complementarity exists when an RNA or DNA
polynucleotide will hybridize under selective (or stringent)
hybridization conditions to its complement. Typically, selective
hybridization will occur when there is at least about 65%
complementary over a stretch of at least 14 to 25 nucleotides,
preferably at least about 75%, more preferably at least about 90%,
or 95%, complementary.
[0038] The term "genome" as used herein includes all of the genetic
material in the chromosomes of an organism. DNA obtained from the
genetic material in the chromosomes of a particular organism is
genomic DNA. A genomic library is a collection of clones made from
a set of randomly generated overlapping DNA fragments representing
the entire genome of an organism.
[0039] The term "genotyping" refers to the determination of the
genetic information an individual carries at one or more positions
in the genome. For example, genotyping may comprise the
determination of which allele or alleles an individual carries for
a single SNP or the determination of which allele or alleles an
individual carries for a plurality of SNPs. For example, a
particular nucleotide in a genome may be an A in some individuals
and a C in other individuals. Those individuals who have an A at
the position have the A allele and those who have a C have the C
allele. In a diploid organism the individual will have two copies
of the sequence containing the polymorphic position. Thus, the
individual may have an A allele and a C allele or alternatively two
copies of the A allele or two copies of the C allele. Those
individuals who have two copies of the C allele are homozygous for
the C allele. Individuals who have two copies of the A allele are
homozygous for the A allele. Individuals who have one copy of each
allele are heterozygous. The array may be designed to distinguish
between each of these three possible outcomes. A polymorphic
location may have two or more possible alleles and the array may be
designed to distinguish between all possible combinations.
[0040] The term "hexokinase" refers to a family of enzymes that
catalyze the phosphorylation of a six-carbon sugar, a hexose, to
yield a hexose phosphate as the product, in the presence of ATP.
Hexokinase enzymes are ubiquitously expressed in eukaryotes and
prokaryotes, with several isoforms of the enzyme often found within
a single species. The different hexokinase family members share a
common ATP-binding site core surrounded by variable domains that
determine substrate specificity and other functions, e.g.
subcellular localization. There are four mammalian hexokinases,
numbered I-IV. Mammalian hexokinase IV (glucokinase) plays a key
role in the regulation of glucose metabolism and homeostasis.
Hexokinase from S. cerevisiae is commercially available, for
example, from USB and Sigma-Aldrich.
[0041] The term "hybridization" as used herein refers to the
process in which two single-stranded polynucleotides bind
non-covalently to form a stable double-stranded polynucleotide;
triple-stranded hybridization is also theoretically possible. The
resulting (usually) double-stranded polynucleotide is a "hybrid."
Hybridizations are usually performed under stringent conditions,
for example, at a salt concentration of no more than 1 M and a
temperature of at least 25.degree. C. For example, conditions of
5.times.SSPE (750 mM NaCl, 50 mM sodium phosphate, 5 mM EDTA, pH
7.4) and a temperature of between 25.degree. C. and 30.degree. C.
are suitable for allele-specific probe hybridizations.
Hybridization conditions generally suitable for microarrays are
described in the Gene Expression Technical Manual, 2004, and the
GeneChip Mapping Assay Manual, 2004, available at
Affymetrix.com.
[0042] The term "label" as used herein refers to, but is not
limited to, a luminescent label, a light scattering label or a
radioactive label. Fluorescent labels include, inter alia, the
commercially available fluorescein phosphoramidites such as
Fluoreprime (Pharmacia), Fluoredite (Millipore) and FAM (ABI).
(See, U.S. Pat. No. 6,287,778, incorporated herein by
reference).
[0043] The term "DNA ligase," as used herein, refers to a family of
enzymes which catalyze the formation of a covalent phosphodiester
bond between two distinct DNA strands, i.e. a ligation reaction.
Two prokaryotic DNA ligases, namely the ATP-dependent T4 DNA ligase
(isolated from the T4 phage), and the NAD.sup.+-dependent DNA
ligase from E. coli, have become indispensable tools in molecular
biology applications. Both enzymes catalyze the synthesis of a
phosphodiester bond between the 3'-hydroxyl group of one
polynucleic acid, and the 5'-phosphoryl group, of a second
polynucleic acid, for instance at a nick between the two strands
which are both hybridized to a third DNA strand. The mechanism of
the ligation reaction catalyzed by this family of enzymes typically
requires three enzymatic steps. The initial step involves attack of
the .alpha.-phosphoryl group of either ATP or NAD.sup.+, resulting
in formation of a ligase-adenylate intermediate (AMP is covalently
linked to a lysine residue of the enzyme), and concurrent release
of either pyrophosphate (PP.sub.i) or nicotinamide mononucleotide
(NAD.sup.+). In the second step of the enzymatic reaction, AMP is
transferred to the 5' end of the free 5' phosphate terminus of one
DNA strand, to form an intermediate species of DNA-adenylate. In
the final step, ligase catalyzes the attack of the DNA-adenylate
intermediate species by the 3' hydroxyl group of the second DNA
strand, resulting in formation of a phosphodiester bond and sealing
of the nick between the two DNA strands, and concurrent release of
AMP. RNA ligases, which are a related family of enzymes, catalyze
the ligation of nicked RNA ends hybridized on to RNA or DNA in an
analogous fashion. T4 DNA ligase is commercially available from at
least USB and New England Biolabs.
[0044] The terms "mRNA" and "mRNA transcripts," as used herein,
include, but are not limited to, pre-mRNA transcript(s), transcript
processing intermediates, mature mRNA(s) ready for translation and
transcripts of the gene or genes, or nucleic acids derived from the
mRNA transcript(s). Transcript processing may include splicing,
editing and degradation. As used herein, a nucleic acid derived
from an mRNA transcript refers to a nucleic acid for whose
synthesis the mRNA transcript or a subsequence thereof has
ultimately served as a template. Thus, a cDNA reverse transcribed
from an mRNA, an RNA transcribed from that cDNA, a DNA amplified
from the cDNA, an RNA transcribed from the amplified DNA, etc., are
all derived from the mRNA transcript, and detection of such derived
products is indicative of the presence and/or abundance of the
original transcript in a sample. Thus, mRNA derived samples
include, but are not limited to, mRNA transcripts of the gene or
genes, cDNA reverse transcribed from the mRNA, cRNA transcribed
from the cDNA, DNA amplified from the genes, RNA transcribed from
amplified DNA, and the like.
[0045] The term "nucleic acid" as used herein refers to a polymeric
form of nucleotides of any length, either ribonucleotides,
deoxyribonucleotides or peptide nucleic acids (PNAs), that comprise
purine and pyrimidine bases, or other natural, chemically or
biochemically modified, non-natural, or derivatized nucleotide
bases. The backbone of the polynucleotide can comprise sugars and
phosphate groups, as may typically be found in RNA or DNA, or
modified or substituted sugar or phosphate groups. A polynucleotide
may comprise modified nucleotides, such as methylated nucleotides
and nucleotide analogs. The sequence of a nucleic acid may be
interrupted by non-nucleotide components. Thus the terms
nucleoside, nucleotide, deoxynucleoside and deoxynucleotide
generally include analogs such as those described herein. These
analogs may possess structural features that are common with a
naturally occurring nucleoside or nucleotide, such that when
incorporated into a nucleic acid or oligonucleoside sequence, the
analogs allow hybridization of the nucleic acid with a naturally
occurring nucleic acid sequence in solution. Typically, such
analogs are derived from naturally occurring nucleosides and
nucleotides by replacing and/or modifying the base, the ribose, or
the phosphodiester moiety. These changes incorporated into the
analogs can be specifically designed, and therefore function, to
stabilize or destabilize hybrid formation, or enhance the
specificity of hybridization with a complementary nucleic acid
sequence, as desired.
[0046] The terms "oligonucleotide" and "polynucleotide" as used
herein refer to a nucleic acid ranging from at least 2, preferably
at least 8, and more preferably at least 20 nucleotides in length
or a compound that specifically hybridizes to a polynucleotide.
Polynucleotides contemplated herein include sequences of
deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) which may be
isolated from natural sources, recombinantly produced or
artificially synthesized and mimetics thereof. Further examples of
such polynucleotides may be peptide nucleic acid (PNA). Also
contemplated are embodiments in which there is a nontraditional
base pairing such as Hoogsteen base pairing which has been
identified in certain tRNA molecules and postulated to exist in a
triple helix. "Polynucleotide" and "oligonucleotide" are used
interchangeably in this application.
[0047] The term "polymorphism" as used herein refers to the
occurrence of two or more genetically determined alternative
sequences or alleles in a population. A polymorphic marker or site
is the locus at which divergence occurs. Preferred markers have at
least two alleles, each occurring at frequency of greater than 1%,
and more preferably greater than 10% or 20% of a selected
population. A polymorphism may comprise one or more base changes,
an insertion, a repeat, or a deletion. A polymorphic locus may be
as small as one base pair. Polymorphic markers include restriction
fragment length polymorphisms, variable number of tandem repeats
(VNTR's), hypervariable regions, minisatellites, dinucleotide
repeats, trinucleotide repeats, tetranucleotide repeats, simple
sequence repeats, and insertion elements such as Alu. The first
identified allelic form is arbitrarily designated as the reference
form and other allelic forms are designated as alternative or
variant alleles. The allelic form occurring most frequently in a
selected population is sometimes referred to as the wild type form.
Diploid organisms may be homozygous or heterozygous for allelic
forms. A biallelic polymorphism has two forms. A triallelic
polymorphism has three forms. Single nucleotide polymorphisms
(SNPs) are included in polymorphisms. Single nucleotide
polymorphisms (SNPs) are positions at which two alternative bases
occur at appreciable frequency (>1%) in a given population. SNPs
are the most common type of human genetic variation. A polymorphic
site is frequently preceded by and followed by highly conserved
sequences (e.g., sequences that vary in less than 1/100 or 1/1000
members of the populations).
[0048] A SNP may arise due to substitution of one nucleotide for
another at the polymorphic site. A transition is the replacement of
one purine by another purine or one pyrimidine by another
pyrimidine. A transversion is the replacement of a purine by a
pyrimidine or vice versa. SNPs can also arise from a deletion of a
nucleotide or an insertion of a nucleotide relative to a reference
allele.
[0049] The term "probe" as used herein refers to a
surface-immobilized or free-in-solution molecule that can be
recognized by a particular target. U.S. Pat. No. 6,582,908 provides
an example of arrays having all possible combinations of nucleic
acid-based probes having a length of 10 bases, and 12 bases or
more. In one embodiment, a probe may consist of an open circle
molecule, comprising a nucleic acid having left and right arms
whose sequences are complementary to the target, and separated by a
linker region. Open circle probes are described in, for instance,
U.S. Pat. No. 6,858,412, and Hardenbol et al., Nat. Biotechno.,
21(6):673 (2003). In another embodiment, a probe, such as a nucleic
acid, may be attached to a microparticle carrying a distinguishable
code. Encoded microparticles which can be used for in-solution
array assays are described in, for instance, International Patent
Application Publication No. WO 2007/081410, and U.S. patent
application Ser. No. 11/521,057 (U.S. Patent Application
Publication No. 2008/0038559). Examples of nucleic acid probe
sequences that may be investigated using the disclosed methods and
compositions include, but are not restricted to, those that are
complementary to genes encoding agonists and antagonists for cell
membrane receptors, toxins and venoms, viral epitopes, hormones
(for example, opioid peptides, steroids, etc.), hormone receptors,
peptides, enzymes, enzyme substrates, cofactors, drugs, lectins,
sugars, oligonucleotides, nucleic acids, oligosaccharides,
proteins, and monoclonal antibodies.
[0050] The term "solid support", "support", and "substrate" as used
herein are used interchangeably and refer to a material or group of
materials having a rigid or semi-rigid surface or surfaces. In many
embodiments, at least one surface of the solid support will be
substantially flat, although in some embodiments it may be
desirable to physically separate synthesis regions for different
compounds with, for example, wells, raised regions, pins, etched
trenches, or the like. According to other embodiments, the solid
support(s) will take the form of beads, resins, gels, microspheres,
or other geometric configurations. (See, U.S. Pat. No. 5,744,305
for exemplary substrates).
[0051] The term "target" as used herein refers to a molecule that
has an affinity for a given probe. Targets may be naturally
occurring or man-made, i.e. synthetic, molecules. Targets may be
employed in their unaltered state, or as aggregates with other
species. Targets may be attached, covalently or noncovalently, to a
binding member, either directly or via a specific binding
substance. Examples of targets which can be employed herein
include, but are not restricted to, antibodies, cell membrane
receptors, monoclonal antibodies and antisera reactive with
specific antigenic determinants (such as on viruses, cells or other
materials), drugs, oligonucleotides, nucleic acids, peptides,
cofactors, lectins, sugars, polysaccharides, cells, cellular
membranes, and cell organelles. Targets are sometimes referred to
in the art as anti-probes. As the term "targets" is used herein, no
difference in meaning between this term and the term "anti-probe"
is intended. A "probe-target complex" is formed when two
macromolecules have combined through molecular recognition to form
a complex.
B. RNA-Templated Ligation
[0052] Many disease states are characterized by differences in the
expression levels of various genes, either through transcriptional
regulation or through copy number changes at the level of genomic
DNA. A common method of monitoring gene expression is to detect and
quantitate specific RNA transcripts. This may be accomplished by
employing microarray technology. However, closely related RNA
sequences pose a challenge for expression analysis using microarray
technology because the expression of, and quantity of, mRNA of
different genes vary dramatically and under certain conditions, can
compete with each other for probe hybridization. In other words,
related RNA sequences that are not perfectly complementary to the
probe sequence, but which are expressed at a much higher level than
the target RNA, can potentially hybridize to the probe under
standard hybridization conditions, thereby skewing results of
hybridization-based assays. In addition to mRNA transcript
detection and analysis, the disclosed methods can be used for
detection of all ribonucleic acids from all sources (for example,
ribosomal RNA and viral RNA).
[0053] Further, it is clear that genotyping of polymorphisms in
RNA, such as single nucleotide polymorphisms (SNPs), provides
useful information in analysis of disease physiology and
progression. That is, alternative splicing at the mRNA level is
known to lead to different translation products that possess
different activities. These differences may correlate to various
disease symptoms. Thus, research is now being directed at detecting
various alternative splicing events. The ability to detect and
quantitate such alternative splicing events may be achieved through
the following methods and compositions. For instance, in one
embodiment, DNA probes may be immobile onto an array. The DNA
probes could be complementary to, for instance the last
(downstream-most) exon of an mRNA molecule. All mRNA transcripts
possessing that exon will hybridize to the immobilized DNA probe.
Following this hybridization, a second DNA probe may be added which
is complementary to one of several possible alternative splice
sequences in the mRNA, upstream of the sequence hybridized to the
immobilized probe. The mRNA transcript will now be hybridized to,
and serving as a template for, the two DNA probes, one of which is
immobilized. DNA polymerase may then be used to ligate the two
probes together, if the second DNA probe hybridizes to the mRNA
transcript. The second DNA probe could include a detectable label.
Ligation of the second probe to the first probe will therefore
leave a detectable label covalently bound to the array and after
washing steps, it will be detected, thus indicating the presence of
the alternative splice variant.
[0054] One of skill in the art will be familiar with such
methodologies and understand that many variations exist on this
type of assay. For instance, molecular inversion probes (MIPs) may
also be used in this manner to detect mRNA splice variants. Such
assays may even be performed directly on Formalin-Fixed,
Paraffin-Embedded (FFPE) samples or fresh-frozen samples.
[0055] DNA ligases are able to distinguish single nucleotide
variations among DNA sequences and therefore may be exploited in
such expression profiling analyses. DNA ligases are relatively
inefficient in ligating two nucleic acid sequences possessing
non-complementary termini. This property of the ligase enzyme has
been exploited in an assay termed the oligonucleotide ligation
assay (OLA). (See, Landegren et al., Science, 241:1077 (1998); Wu,
D. Y. & Wallace, R. B. Gene 76, 245-254 (1989); Luo, J.,
Bergstrom, D. E. & Barany, F., Nucleic Acids Res. 24, 3071-3078
(1996); and Tong, J., Cao, W. & Barany, F., Nucleic Acids Res.
27, 788-794 (1999)). Another method exploiting this property of the
ligase is termed the ligase chain reaction. (See, Barany, Proc.
Nat'l. Acad. Sci. USA, 88:189 (1991)). However, direct detection of
RNA target-DNA probe duplexes (without first converting RNA to cDNA
by reverse transcription) is difficult given that a majority of DNA
ligases fail to ligate nicked DNA hybridized to an RNA
template.
[0056] Presently, only T4 DNA ligase has been shown to catalyze the
ligation of DNA oligonucleotides hybridized to RNA templates.
However, this function of T4 DNA ligase is substantially reduced in
catalytic efficiency as compared to its catalyzation of
DNA-templated reactions. (See, Kleppe et al., Proc. Nat'l. Acad.
Sci. US4, 67:68 (1970), and Fareed et al., J. Biol. Chem., 246:925
(1971)).
[0057] It has previously been reported that under low salt,
particularly monovalent cations, and low ATP concentrations, high
concentrations of T4 DNA ligase efficiently join DNA
oligonucleotides hybridized in juxtaposition on RNA target strands.
See, US Patent Pub. 20070225487, which is incorporated herein by
reference in its entirety.
[0058] It is also known that some of the ATP dependent DNA ligases
in eukaryotes and eucaryotic virus can use RNA as a template for
DNA ligation (see, Tomkinson, A. E. and Mackey, Z. B. Mutation Res.
407 1-9 (1998), Sekiguchi, J. and Shuman, S. Biochemistry 36
9073-9079 (1997), and Sriskanda, V. and Shuman, S. Nucleic Acids
Res. 26 3536-3541 (1998)). However, it is not know how efficient
the reaction is using these enzymes, and eukaryotic enzymes have
not been used for gene analytic assays. Also ATP-dependent DNA
ligases from thermophilic archeon such as Methanobacterium
thermoautotrophicum (Sriskanda, V., et al. Nucleic Acids Res 28
2221-2228. (2000)) can join DNA oligonucleotides. The general
features of the detection methods described herein should be
generally applicable for all DNA ligases.
[0059] RNA-templated ligation of DNA probes has been used to
generate molecules, amplifiable by PCR via general sequences
present at the remote ends of a pair of ligation probes (Hsuih, T.
C. H. et al. J. Clin. Microbiol. 34, 501-507 (1996). The method has
been applied to detect viral RNA extracted from clinical and
archival specimens with increased sensitivity compared to nested
RT-PCR (Park, Y. N. et al., Am. J Pathology 149, 1485-1491 (1996);
Miyauchi, I., Moriyama, M., Zhang, D. Y. & Abe, K., Path. Int.
48, 428-432 (1998)). RNA-templated ligation of RNA probes has been
used for detection of transcripts in experiments where ligation
products were amplified by the Qb replicase (Tyagi, S., Landegren,
U., Tazi, M., Lizardi, P. M. & Kramer, F. R., Proc. Natl. Acad.
Sci. USA 93, 5395-5400 (1996). RNA-templated ligation of either DNA
or RNA probes can thus substitute for a reverse transcription (RT)
step before amplification.
[0060] T4 DNA ligase catalyzes DNA ligation in three steps. First,
the enzyme is activated through ATP hydrolysis, resulting in
covalent addition of AMP to the enzyme. This intermediate enzyme
species then binds to a nicked DNA site. Second, after binding to
the nicked DNA site, the ligase transfers AMP to the phosphate at
the 5' end of the nick, forming an intermediate product possessing
a 5' to 5' pyrophosphate bond. Third, the ligase catalyzes
formation of a phosphodiester bond by attack of the intermediate 5'
to 5' pyrophosphate bond by the OH group of the 3' end of the
second strand of DNA, resulting in release of the ligase and
AMP.
[0061] In RNA-templated ligation, T4 DNA ligase will prematurely
release from the nicked DNA before the final step, leaving the 5'
to 5' pyrophosphate bond intermediate species. Released T4 DNA
ligase then re-charges itself using ATP, preventing the enzyme-AMP
intermediate species from completing the final step of the
reaction, ultimately yielding an accumulation of 5' to 5'
pyrophosphate bond intermediate product. It has been shown that
incubation of the substrate with T4 DNA ligase at a very low ATP
concentration improves the ligation efficiency of T4 DNA ligase,
but the reaction proceeds very slowly and requires relatively large
amounts of enzyme. (See, Nilsson et al., Nucleic Acids Res.,
29(2):578 (2001). Moreover, the longer (2 hour or more) incubation
period combined with the necessary determination of an optimum ATP
concentration can be an obstacle for a number of applications.
[0062] Although RNA-templated DNA ligation promises to be an
attractive method for expression monitoring and transcript
analysis, the poor ligation efficiency of T4 DNA ligase on RNA
templates has hampered the development of methodologies relying on
ligation-mediated detection and analysis of ribonucleic acids.
Methods are disclosed that provide for efficient RNA-templated DNA
ligation.
[0063] In one embodiment, as depicted in FIG. 2a, the disclosed
methods involve charging T4 DNA ligase with ATP to form the charged
enzyme-AMP species, followed by removal of excess or unused ATP to
prevent premature cycling of T4 DNA ligase and the accumulation of
the 5' to 5' pyrophosphate bond intermediate product. Removal of
free ATP by either addition of apyrase or hexokinase, under proper
buffer conditions, for instance, pushes the reaction in the
direction of a single round of T4 DNA ligase-mediated ligation. Of
course, any known method of ATP depletion may be employed for this
purpose. Depletion of ATP after charging of the enzyme, by any
means which does not further interfere with the ligation reaction,
will be suitable in the present method.
[0064] In another embodiment, depicted in FIG. 2b, the disclosed
methods may employ a mixture of at least two ligases in the
presence of ATP. In this embodiment, the first ligase may be, for
instance, T4 DNA ligase, or another ligase capable of producing 5'
to 5' pyrophosphate bond product intermediates. The second ligase
employed in this embodiment may be any of a number of mutant forms
of ligase which catalyze the final step of ligation, i.e. formation
of the desired phosphodiester bond between the two strands of DNA
template on the RNA molecule, by consumption of the 5' to 5'
pyrophosphate bond on the terminus of the first strand of DNA and
the terminal hydroxyl group from the second strand of DNA. Mutant
ligases that are unable to charge with AMP, i.e. form the
intermediate enzyme-AMP complex, but retain the catalytic activity
of formation of the covalent phosphodiester bond between the two
DNA strands have been described. Such mutant ligase enzymes
include, but are not limited to, several point mutants and
amino-terminal truncation mutants of the E. coli
NAD.sup.+-dependent DNA ligase. (See, Sriskanda and Shuman, J.
Biol. Chem., 277:9685 (2002)). In this embodiment, multiple
different ligases may be utilized for the second ligase, thus the
reaction may comprise as many as three different ligases, or four
different ligases, or five different ligases, or more. The number
of ligases utilized in the reaction mixture is not constrained, so
long as the ligases possess the activity required to complete the
reaction.
[0065] The following list of examples is provided for illustrative
purposes only. While the present disclosure is intended to
encompass these examples, it will be clear to one of skill in the
art that these are non-limiting examples and that many
modifications may be made to the examples while still maintaining
subject matter within the scope of the present application. For
instance, the following methods may be utilized in a series of
steps, comprising intermediate steps, steps before and after the
provided methods, which further treat and/or prepare the nucleic
acids utilized therein. For instance, nucleic acids used herein may
also be concurrently or subsequently utilized in microarray
analyses, further PCR or transformation reactions, etc. Therefore,
these examples are non-limiting.
[0066] Detection of ligation may be conducted by many means. For
instance, detectable labels may be added to substrate nucleotides.
The incorporation of these detectable labels into the ligated
product may be measured. Detectable labels may include, but are not
limited to, use of fluorescent labels, radioactive labels,
phosphorescent labels, etc. Ligation may also be measured by
detecting a shift in the substrate band in a gel-shift assay. There
exist many means of detecting such ligation events. One of skill in
the art will know how to modify and incorporate such means of
detection in the context of the present methods and reagents. Such
means of detection are incorporated herein for the purpose of
measuring the ligation event.
EXAMPLES
Example 1
RNA-Templated Ligation Using Hexokinase Treatment to Eliminate Free
ATP
[0067] Experimental design involves use of a padlock-type assay
where linearized DNA is annealed at two positions onto a linearized
RNA template. Padlock probe assays, design and methodologies are
disclosed in, for instance, U.S. Pat. Nos. 5,871,921, 6,235,472,
5,866,337, and Japanese patent JP 4-262799, the disclosures of
which are incorporated herein by reference in their entirety. Thus,
when DNA polymerase is added, and the assay is successful, the
enzyme ligates the two ends of the DNA, forming a circularized,
single-stranded DNA molecule which may be assayed by gel shift
assay or any other means.
[0068] In the present experiment, RNA template was prepared from
linearized Tch2, H4 or H5 plasmid DNA by in vitro transcription
using Ambion's Megascript kit. The TCH2 gene is an Arabidopsis
thaliana gene encoding a calcium ion binding protein. Four padlock
probes (probe sequences may be found in Table 1) were designed,
having the sequences shown in Table 1. Thus, in the 5' to 3'
direction, the sequence for the first padlock would be as follows:
5'-probe 1b-bridge-probe 1a-3'. Probes 2-4 are similarly arranged
in sequence. As is customary in MIP probes, the bridging sequences
may comprise the following elements: a first universal PCR primer
site, a depyrimidination site (to invert and/or linearize the MIP
probe) including the sequence UUU as a uracil DNA glycosylase site,
a second universal PCR primer site, a detectably labeled nucleotide
for quantitation, a barcode/tag sequence, a DraI restriction site
(or any restriction site to release the barcode sequence).
TABLE-US-00001 TABLE 1 SEQ Probe ID # # NO. Sequences bp 1a 1
GGCCAGTGCTGGAGTTCGCACGCTATATTTAA 53 AAGCATCACCAGAAGAAACAG 1b 2
TAACGATGATGAAACAATTCGACCTGTCCACG 32 2a 3
GGCCAGTGCTGGAGTTCGCACGCTATATTTAA 53 ATCAACAATGTCATCGAAGAA 2b 4
AAATCTCCGTCGACGAGCTCGTCCACG 27 3a 5
GGCCAGTGCTGGAGTTCGCACGCTATATTTAA 53 AGGACGACATCAAAAAAGTCT 3b 6
TCCAACGATTCGACAAAAACGTCCACG 27 4a 7
GGCCAGTGCTGGAGTTCGCACGCTATATTTAA 53 AAAATCTCCGTCGACGAGCTC 4b 8
AAAGAAGTGATCCGCGCTCTGTCCACG 27
[0069] T4 DNA ligase was charged for 20 minutes at room temperature
in the presence of ATP. ATP depletion mix was added to the charging
mix and the reaction proceeded for another 30 minutes at 37.degree.
C. to remove remaining free ATP. In the meantime, RNA/probe mixes
were heated to 80.degree. C. for 3 minutes, cooled to 46.degree.
C., and then RNAse inhibitors were added followed by 20-minute
incubation at 46.degree. C. 5 .mu.l of RNA/probe mix was combined
with 5 .mu.l of charged ligase mix, and incubated at 37.degree. C.
for 30 minutes, 1 hour, or 2 hours. Ligation reactions were stopped
by adding an equal amount of formamide stop solution, and heating
to 95.degree. C. for 3 minutes, followed by cooling on ice. The
ligated samples were loaded onto an 8% sequencing gel, and resolved
ligation products were visualized by SYBR green or ethidium bromide
staining. Table 2 provides buffer compositions.
TABLE-US-00002 TABLE 2 ATP/Ligase Charging Mix ATP Depletion Mix
Vol Vol Ingredient (.mu.l) Ingredient (.mu.l) ATP (2 mM) 2.5
Hexokinase (10 U/.mu.l) 2 T4 DNA ligase (2000 U/.mu.l) 4 200 mM
glucose 25 H.sub.2O 2.5 RNAse inhibitor 2 10 X rxn buffer 1
H.sub.2O 6 10 X rxn buffer 5 Charging mix 10 Total 10 Total 50
RNA/Probe 1 Mix RNA/Probe 2 Mix Vol Vol Ingredient (.mu.l)
Ingredient (.mu.l) probe 1 (500 nM) 0.84 probe 2 (792 nM) 0.55 RNA
(5.3 uM) 0.63 RNA (5.3 uM) 0.63 RNAse inhibitor 3 RNAse inhibitor 3
H.sub.2O 15.43 H.sub.2O 15.74 Total 21 Total 21
Example 2
RNA-Templated Ligation Using Apyrase Treatment to Deplete Free
ATP
[0070] The experiment was conducted as described in Example 1,
except that the ATP depleting mix consisted of 1 .mu.l of apyrase
enzyme (500 mU/.mu.l), 5 .mu.l of 10.times. reaction buffer, and 34
.mu.l of distilled water instead of hexokinase enzyme. The ATP
depleting mix was added to 10 .mu.l of charging mix, as in Example
1, and incubated for 30 minutes at room temperature. The ATP
concentration in the charging mix was either 500 .mu.M or 200
.mu.M.
Example 3
RNA-Templated Ligation Using a Mixture of at Least Two Ligases
[0071] Charging of T4 ligase and ligation steps may be conducted as
described in Example 1, using RNA/probe mixes identical to those in
Example 1. Following a 1 hour ligation with T4 ligase in the
presence of ATP, NAD.sup.+-dependent mutant ligase and NAD.sup.+
may be added to the ligation reaction. For example, E. coli LigA
point mutants Y22A, D32A and D36A, may be generated from wild-type
LigA plasmid DNA by site-directed mutagenesis, using Stratagene's
QuickChange kit or a similar product. An amino-terminal truncated
LigA construct may also be generated using standard PCR and
subcloning approaches. One or more different mutants of LigA, as
described above, may be utilized in the present example as the
"NAD.sup.+-dependent mutant ligase." The ligation products will be
resolved and visualized as described in example 1.
Example 4
PCR of RNA-Templated Ligation of Padlock Probes
[0072] The experimental setup and timeline for the present Example
4 is illustrated in FIG. 3. This method uses padlock probes with
the same sequences as listed above. Probe and RNA target
concentrations in the annealing mix were 40 nM and 160 nM,
respectively. Probe concentrations relative to RNA concentrations
may be from 100:8, respectively to about 10:8, respectively.
Concentrations may be from pM to nM depending on the amount needed
for signal detection or visualization. Charging of ligase and ATP
removal by apyrase treatment was performed as described above in
Examples 1 and 2. Following 2 hours of ligation at 37.degree. C., a
sufficient amount of Exonuclease I (Exol) and Exonuclease III
(ExoIII), i.e. about 2 .mu.l, were added and the reaction was
further incubated at 37.degree. C. for 20 minutes, to digest
unligated probe. Following inactivation of Exol and ExoIII by
incubation at 80.degree. C. for 20 minutes, 5 .mu.l of uracil-DNA
glycosylase was added and the sample incubated at 37.degree. C. for
15 minutes, to cleave the ligated circular padlock probe, followed
by heat inactivation and 30 cycles of PCR.
Sequence CWU 1
1
8153DNAArtificial sequenceSynthetic 1ggccagtgct ggagttcgca
cgctatattt aaaagcatca ccagaagaaa cag 53232DNAArtificial
sequenceSynthetic 2taacgatgat gaaacaattc gacctgtcca cg
32353DNAArtificial sequenceSynthetic 3ggccagtgct ggagttcgca
cgctatattt aaatcaacaa tgtcatcgaa gaa 53427DNAArtificial
sequenceSynthetic 4aaatctccgt cgacgagctc gtccacg 27553DNAArtificial
sequenceSynthetic 5ggccagtgct ggagttcgca cgctatattt aaaggacgac
atcaaaaaag tct 53627DNAArtificial sequenceSynthetic 6tccaacgatt
cgacaaaaac gtccacg 27753DNAArtificial sequenceSynthetic 7ggccagtgct
ggagttcgca cgctatattt aaaaaatctc cgtcgacgag ctc 53827DNAArtificial
sequenceSynthetic 8aaagaagtga tccgcgctct gtccacg 27
* * * * *