U.S. patent application number 16/912469 was filed with the patent office on 2020-10-08 for nucleic acid probe and method of detecting genomic fragments.
The applicant listed for this patent is Vanadis Diagnostics. Invention is credited to CARL OSCAR FREDRIK DAHL, OLOF JOHN ERICSSON.
Application Number | 20200318186 16/912469 |
Document ID | / |
Family ID | 1000004915706 |
Filed Date | 2020-10-08 |
![](/patent/app/20200318186/US20200318186A1-20201008-D00001.png)
![](/patent/app/20200318186/US20200318186A1-20201008-D00002.png)
![](/patent/app/20200318186/US20200318186A1-20201008-D00003.png)
![](/patent/app/20200318186/US20200318186A1-20201008-D00004.png)
![](/patent/app/20200318186/US20200318186A1-20201008-D00005.png)
![](/patent/app/20200318186/US20200318186A1-20201008-D00006.png)
![](/patent/app/20200318186/US20200318186A1-20201008-D00007.png)
United States Patent
Application |
20200318186 |
Kind Code |
A1 |
DAHL; CARL OSCAR FREDRIK ;
et al. |
October 8, 2020 |
Nucleic Acid Probe and Method of Detecting Genomic Fragments
Abstract
Provided herein, among other things, is a method of processing a
nucleic acid sample. In some embodiments, the method comprises a)
hybridizing a sample comprising a target fragment to a nucleic acid
probe comprising: i. a head sequence and a tail sequence, wherein
the head and tail sequences are at the ends of a first
oligonucleotide molecule; and ii. a splint sequence comprising, in
order: an upstream flanking sequence that is complementary to the
head sequence; a target complementary sequence that is
complementary to the target fragment; and a downstream flanking
sequence that is complementary to the tail sequence; thereby
producing a hybridization product in which the ends of the target
fragment are ligatably adjacent to the ends of the head and tail
sequences in the first oligonucleotide molecule; and b) ligating
the ends of the target fragment to the ends of the head and tail
sequences of the first oligonucleotide molecule, thereby producing
a cyclic product that comprises the target fragment and the head
and tail sequences. Probes and kits for performing the method are
also provided.
Inventors: |
DAHL; CARL OSCAR FREDRIK;
(SIGTUNA, SE) ; ERICSSON; OLOF JOHN; (UPPSALA,
SE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Vanadis Diagnostics |
Sollentuna |
|
SE |
|
|
Family ID: |
1000004915706 |
Appl. No.: |
16/912469 |
Filed: |
June 25, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16250892 |
Jan 17, 2019 |
10731214 |
|
|
16912469 |
|
|
|
|
15035466 |
May 9, 2016 |
10240198 |
|
|
PCT/IB2014/003061 |
Nov 26, 2014 |
|
|
|
16250892 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6816 20130101;
C12Q 1/6876 20130101 |
International
Class: |
C12Q 1/6876 20060101
C12Q001/6876; C12Q 1/6816 20060101 C12Q001/6816 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 2, 2013 |
GB |
1321191.7 |
Claims
1-73. (canceled)
74. A kit comprising: a first set of at least 1,000 targeting
oligonucleotides, each comprising: (i) an internal
target-complementary sequence that is in the range of 10 to 100
nucleotides in length and complementary to a sequence in human
chromosome 21, wherein the different members of the first set have
different internal target-complementary sequences, (ii) an upstream
flanking sequence of at least 10 nucleotides that is not
complementary to human genomic DNA, and (iii) a downstream flanking
sequence of at least 10 nucleotides that is not complementary to
human genomic DNA.
75. The kit of claim 74, further comprising: a second
oligonucleotide, wherein the second oligonucleotide comprises a
head sequence at that is complementary to the upstream flanking
sequence of (i) and a tail sequence that is complementary to the
downstream flanking sequence of (ii).
76. The kit of claim 75, wherein the second oligonucleotide
comprises a custom sequence between the head and tail sequences,
wherein the custom sequence is not complementary to human genomic
DNA.
77. The kit of claim 74, wherein the internal target-complementary
sequence is in the range of 10 to 50 nucleotides in length.
78. The kit of claim 74, wherein the upstream and downstream
flanking sequences of (ii) and (iii) are independently in the range
of 10 to 40 nucleotides in length.
79. The kit of claim 74, wherein the first set of targeting
oligonucleotides comprises at least 5,000 targeting
oligonucleotides.
80. The kit of claim 74, further comprising a second set of at
least 1,000 targeting oligonucleotides, each comprising: (i) an
internal target-complementary sequence that is in the range of 10
to 100 nucleotides in length and complementary to a sequence in the
human genome that is not in human chromosome 21, wherein the
different members of the second set have different internal
target-complementary sequences (ii) the upstream flanking sequence,
and (iii) the downstream flanking sequence.
81. The kit of claim 80, wherein the internal target-complementary
sequences of the second set are complementary to a sequences in
human chromosome 13 or 18.
Description
CROSS-REFERENCING
[0001] This application claims the benefit of UK Application No:
1321191.7, filed on Dec. 2, 2013, which application is incorporated
by reference herein.
FIELD OF THE INVENTION
[0002] The present disclosure relates to probes for detecting
specific nucleic acid sequences in biological samples, especially
probes for use in multiplex methods of detecting multiple specific
sequences in parallel, and to methods in which such probes are used
for detecting fragments of nucleic acid. In particular, the present
disclosure relates to targeting DNA fragments from specific
chromosomes for downstream analysis.
BACKGROUND
[0003] The human haploid genome contains 3 billion base pairs
packaged in 23 chromosomes, and the diploid genome has 6 billion
base pairs in 23 pairs of chromosomes. The rapidity and convenience
of modern sequencing technology enables many diagnostic questions
to be approached using high-throughput sequencing of an
individual's entire genome or of the full quantity of DNA in a
sample. However, for many DNA diagnostics applications, it is only
necessary to investigate a subset of the genome, focussing on the
region or regions known to be associated with the particular
disorders under investigation.
[0004] A number of techniques have been described for reducing the
complexity of the genome before analysis. Where only a single,
short region of the genome is required to be analysed, this may be
done using straightforward PCR to amplify the sequence using
primers to known regions on either side. However, when it is
desired to amplify many regions of a genomic sample for analysis,
amplification artefacts can arise as a result of performing
multiple different amplifications together in the same reaction
mixture.
[0005] WO2003/044216 (Parallele Bioscience, Inc.) and
US20090004701A1 (Malek Faham) described a method of multiplex
amplification of target nucleic acids, in which common
oligonucleotide primers were ligated to sites internal to
single-stranded nucleic acid fragments. The common priming sites
were appended to each of a plurality of different target sequences
to allow their stoichiometric amplification.
[0006] WO2005/111236 (Olink AB) also described a method of
identifying sequences in the human genome by amplifying specific
target sequences. The method involved fragmenting the genomic
sample into fragments having at least one defined end sequence.
Selector constructs, all comprising a primer pair motif, were
brought in contact with the fragments. After ligation, the selected
target sequences were amplified in parallel using a primer-pair
specific for the primer-pair motif common to the selectors. The
selector constructs described in WO2005/111236 had a long
oligonucleotide hybridised to a short oligonucleotide, each
selector construct having one or two protruding ends complementary
to a defined end sequence of a fragment containing the target
sequence. Contacting the selectors with the target fragments
resulted in hybridisation of the target fragment between protruding
ends of the selector or selectors. In the case of a single selector
with two protruding ends this hybridisation produced a circularised
construct. In the case of a pair of selectors each with one
protruding end this formed a linear construct. Ligation and
sequencing of the selector constructs containing the target
fragments allowed the target sequence to be determined. Since the
selector constructs hybridise only to the end portions of the
fragment containing the target sequence (or to one end portion and
one internal portion), the method allowed selection of target
sequences that differed in the non-hybridising portions, so that
each selector molecule could hybridise to a variety of different
target sequences. The identity of the exact target was then
determined by amplifying and sequencing the constructs.
WO2005/111236 proposed using the selectors in methods of analysing
genetic variability or for DNA copy number measurements.
[0007] GB2492042 described a variation of the selector method, in
which the fragments were contacted with a partially double-stranded
probe comprising a selector oligonucleotide and at least one vector
oligonucleotide. The selector oligonucleotide contained two
non-adjacent regions specific for the target fragment and a
non-target specific region which comprised at least two binding
sites for the vector oligonucleotide. The vector oligonucleotide
was not complementary to the target sequence, and included a
nucleotide sequence complementary to the vector-binding site on the
selector oligonucleotide. The vector oligonucleotide also contained
elements for detection/enrichment. In the method, complementary
portions of the probe oligonucleotides were hybridised to the
target fragment, followed by ligating the vector oligonucleotide(s)
and target to produce a probe-target fragment hybrid, which was
then detected.
[0008] A development of the selector technology was described in
WO2011/009941 (Olink Genomics AB), describing ligation of one end
of a fragment of digested genomic DNA to a probe. Compared with the
earlier selector probes, which involved binding to two regions of
the target fragment and where the sequence to be isolated was
typically bounded by two regions of known sequence, the probes in
WO2011/009941 were described for use where there was only one known
region of sequence. Some embodiments of the probes in WO2011/009941
contained elements for immobilisation to a solid phase. Ligation of
the target nucleic acid fragment to the probe resulted in a stable
capture of the target fragment and allowed the use of highly
stringent washing steps to remove non-ligated fragments, resulting
in a high specificity.
[0009] Also known are padlock probes. Padlock probes are linear
oligonucleotides with target complementary sequences at the ends
and a non-target complementary sequence in between. When hybridised
to the correct target DNA sequence, the two ends of the probe are
brought together head to tail and can be joined by DNA ligase.
Ligation is inhibited by mismatches at the ligation junction, so
successful ligation of the padlock probe depends on highly specific
hybridisation to the target sequence, allowing the probe to
distinguish between highly similar target sequences and selectively
padlock its exact target. As a consequence of the helical nature of
double stranded DNA, the circularised probe molecule is catenated
to the target DNA strand.
[0010] It was known to amplify the circularised padlock probes
using rolling circle replication, also known as rolling circle
amplification. Rolling circle replication was described in U.S.
Pat. No. 5,854,033 (Lizardi). Rolling circle replication is an
amplification of a circular nucleic acid molecule using a strand
displacing DNA polymerase, resulting in large DNA molecules
containing tandem repeats of the amplified sequence. The DNA
polymerase catalyses primer extension and strand displacement in a
processive rolling circle polymerisation reaction that proceeds as
long as desired. It results in an amplification of the circularised
probe sequence orders of magnitude higher than a single cycle of
PCR replication and other amplification techniques in which each
cycle is limited to a doubling of the number of copies of a target
sequence. Additional amplification can be obtained using a cascade
of strand displacement reactions.
[0011] Fredriksson et al. (Nucleic Acids Res. 35(7):e47 2007)
described "Gene-Collector", a method for multiplex amplification of
nucleic acids using collector probes which contain adjacent
sequences complementary to the cognate primer end sequences of
desired PCR products, so that binding of the collector probes to
the PCR products brings the ends of the PCR products together to
form a DNA circle. Universal amplification is then performed using
rolling circle amplification to generate a final product of
concatamers of target sequences. This method allows the correct
amplicons in a multiplex PCR reaction to be selectively detected,
because the end sequences of the correct amplicons are a cognate
primer pair and are circularised by the collector probe, whereas
PCR artefacts combining a primer from one pair with a primer from
another pair are not circularised.
SUMMARY OF THE INVENTION
[0012] The present disclosure provides improved methods and probes
for analysing nucleic acid fragments, such as fragmented genomic
DNA. Some embodiments of the invention relate to probes and to
their use in methods of testing samples for the presence of a
target single stranded nucleic acid fragments. Some embodiments of
the invention relate to probes which comprise
[0013] a targeting oligonucleotide containing a
target-complementary sequence which is the complement of the target
fragment and a flanking sequence adjacent to the
target-complementary sequence, and
[0014] an oligonucleotide sequence having a free 5' or 3' end,
[0015] wherein hybridisation between the fragment and the probe
templates the target fragment for ligation to the free 5' or 3' end
of the oligonucleotide sequence.
[0016] Some embodiments of the invention further relate to probes
which hybridise along the length of a single stranded nucleic acid
fragment and ligate to each end of the fragment. Such probes
comprise an oligonucleotide sequence having a free 5' end and an
oligonucleotide sequence having a free 3' end, for ligation to each
end of the target fragment. The ligation product is then detected,
allowing a highly specific targeting and detection of the defined
nucleic acid fragments.
[0017] A method according to some embodiments of the invention may
comprise digesting DNA to fragments with defined sequence,
denaturing the resulting DNA fragments to single stranded fragments
(targets) and mixing the targets with probes as described herein.
Hybridisation of the targets to the probes produces templates for
ligation to specifically connect the target to a corresponding
probe to generate either a circle or a linear ligation product. The
ligation products may then be enriched, for example by exonucleases
or solid-phase chemistry, and optionally amplified by rolling
circle amplification, PCR, or other DNA amplification methods.
[0018] A key advantage of some embodiments of the present invention
lies in the analysis of a multitude of DNA fragments in parallel. A
multitude of DNA fragments may be specifically targeted and
selected for downstream analysis. This is particularly useful for
the non-invasive prenatal testing (NIPT) of cell-free foetal DNA in
the maternal bloodstream, where counting of thousands of
chromosome-specific DNA fragments produces a very precise
quantification.
[0019] In one aspect, a method of testing a sample for the presence
of a target nucleic acid is provided. The method typically involves
generating defined target nucleic acid fragments, contacting the
sample with a probe that hybridises along the length of the target
fragment and provides ligatable junctions in both the 3' and 5' end
of the fragment, ligating the target fragment to the probe at both
the 3' and 5' end, and then detecting the new nucleic acid molecule
formed by the double ligation event.
[0020] One aspect provides a method of testing a sample for the
presence of a target nucleic acid, comprising:
(i) providing a sample of fragmented nucleic acid (ii) providing
denaturing conditions under which the target fragment is single
stranded (iii) contacting the sample with a nucleic acid probe
comprising
[0021] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0022] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream and downstream flanking sequences respectively,
(iv) providing annealing conditions under which the head and tail
sequences hybridise to the flanking sequences, and the target
fragment, if present, hybridises to the target-complementary
sequence, thereby positioning the ends of the target fragment in
juxtaposition with the 5' end of the head sequence and the 3' end
of the tail sequence (v) providing conditions for ligation so that,
if the target fragment is present, the 3' end of the target
fragment is ligated to the 5' end of the head sequence to form a
first ligation junction, and the 5' end of the target fragment is
ligated to the 3' end of the tail sequence to form a second
ligation junction, producing a product of double ligation
comprising a continuous strand of nucleic acid comprising the head
and tail sequences and the target fragment, and (vi) detecting
whether the product of double ligation is present,
[0023] wherein detecting the product of double ligation indicates
the presence of the target fragment in the sample.
[0024] In contrast with most other DNA selection and detection
approaches, the present method may be particularly useful when the
entire nucleic acid fragment is pre-defined or pre-determined--that
is, when the sequence of the target fragment is known in advance.
In some implementations of the present method, the target fragment
is the product of a specific fragmentation of nucleic acid, rather
than a random fragmentation such as may be produced by physical
means such as shearing or sonication. Specific fragmentation of
nucleic acid may be achieved using restriction enzymes, PCR, or
other sequence directed fragment end definition.
[0025] It is desirable for the targeting oligonucleotide to contact
the entire target fragment, to ensure specific binding of the
precise target sequence. This contrasts with earlier approaches
where probes were designed to hybridise with an end or ends of the
fragment and/or to an internal region but not to bind along the
length of the target fragment. Indeed, limited binding to the
target fragment was a deliberate design feature in many earlier
probes, since it allowed fragments to be targeted and detected when
their sequence was only partly known. By specifically targeting
fragments of known sequence--subject to the possibility of slight
sequence variability resulting from different alleles in a
population, where applicable--the probes and methods of the present
method may allow precise binding and detection of the desired
target fragment with very low risk of false-positive results.
[0026] The double ligation of the target fragment further may
contribute to the high specificity of the method. The probe becomes
ligated to the target sequence at each end, i.e., to the 5' and 3'
ends of the single stranded fragment of nucleic acid. Thus, the
ends of the target which were specifically generated by
fragmentation may be specifically detected by sequence-specific
ligation to the head and tail sequences. The sequence-specific
nature of the ligation is achieved through the requirement for
hybridisation of both the target fragment and the head and tail
sequences to the targeting oligonucleotide, and through the
sensitivity of DNA ligase which is inhibited by base pair
mismatches. Hybridisation of the target fragment to the targeting
oligonucleotide contributes to the specificity of the binding but,
in contrast with the ligation reactions which provides highest
selectivity with respect to mismatches at the 3' and 5' ends of the
target fragment, the hybridisation is destabilised the most by
internal mismatches in the central part of the target.
[0027] The targeting oligonucleotide acts to template ligation of
the target fragment to the head and tail sequences. The head and
tail sequences hybridise to the flanking sequences, defining a gap
between the 5' end of the head sequence and the 3' end of the tail
sequence. The target fragment hybridises to the
target-complementary sequence in the gap, thereby positioning the
ends of the target fragment in juxtaposition with the 5' end of the
head sequence and the 3' end of the tail sequences. Preferably, the
annealing of the target fragment and the head and tail sequences to
the probe generates two perfectly matched ligatable junctions. The
product of double ligation is then a continuous strand of nucleic
acid comprising the head and tail sequences and the target
fragment.
[0028] A number of possible designs of the probe are contemplated.
For example, the 5' and 3' ends for ligation to the target fragment
may be provided by head and tail sequences on two separate backbone
oligonucleotides, or by head and tail sequences at respective ends
of a single backbone oligonucleotide which loops to position the
target fragment between the 5' and 3' ends.
[0029] In the first case (two separate backbone oligonucleotides),
ligation of the target fragment to the two backbone
oligonucleotides produces a linear strand of nucleic acid
comprising the target fragment between the head and tail
sequences.
[0030] In the second case (single looped backbone oligonucleotide),
ligation of the target fragment produces a circle of nucleic acid
comprising the target sequence between the head and tail
sequences.
[0031] In further versions, one or both of the head and tail
sequences may be provided on the targeting oligonucleotide itself,
so that the targeting oligonucleotide forms a looped structure
under annealing conditions. Depending on the design, the product of
double ligation in such cases may either be a linear or a circular
nucleic acid molecule.
[0032] Detection of the product is dependent on successful ligation
of the target fragment to the head and tail sequences to form a
continuous strand of nucleic acid. In general, the product of
double ligation is detected using an approach that requires both
ligation events to occur in order to generate a signal. For
example, detection may comprise amplification across both ligation
junctions (e.g., by PCR or, for circularising embodiments of the
probe, rolling circle replication), or capturing the continuous
nucleic acid strand at one end and detecting its other end. The
covalent attachment of the target fragment to the probe by ligation
forms a strong bond, so stringent washing may be used to remove
non-ligated nucleic acids in which the head and tail sequences are
not covalently attached, their mutual hybridisation to the
targeting oligonucleotide being disrupted by the washing.
[0033] These features of the method and the probe enable a highly
specific selection of target fragments. When the methods are
applied for multiplex detection of a plurality of target fragments
in parallel, a very precise detection and quantification of the
target nucleic acid is possible. As a result of its high
specificity, the present method may be especially suitable for
diagnostic use in small samples and/or for detecting very small
differences in relative amounts of different target nucleic acids,
for example in diagnosing aneuploidies in foetal chromosomes from a
sample of maternal blood or in detecting the presence of trace
amounts of tumour DNA in a sample of normal tissue from a patient
or detection of nucleic acid fragments from infectious agents.
[0034] Having a highly specific target fragment recognition enables
use of a relatively high probe concentration without generating
false positive signals, thereby increasing the yield and efficiency
of the reaction. This may be of high importance in diagnostic
applications where low variability is important and targets may be
present in low numbers for example in NIPT by analysis of cell free
DNA, detection of cell free circulating cancer DNA and detection of
DNA from infectious agents. Some embodiments of the present method
enables highly specific analysis of short DNA fragments, which is
of importance in applications for analysis of fragmented DNA like
cell free DNA in blood, or formalin fixed paraffin embedded
DNA.
[0035] With reference to FIGS. 3 and 4, provided herein, among
other things, is a method of processing a nucleic acid sample. In
some embodiments, the method may comprise: a) hybridizing a sample
(e.g., a sample that has been digested with a restriction enzyme)
comprising a target fragment (a "DNA target") to a nucleic acid
probe comprising: i. a head sequence and a tail sequence, wherein
the head and tail sequences are at the ends of a first
oligonucleotide molecule; and ii. a splint sequence (where the term
"splint sequence" is intended to refer to a sequence in an
oligonucleotide that, when hybridized to two or more other
polynucleotides, acts as a "splint" to position the polynucleotides
next to one another so that they can be ligated together, as
illustrated in FIGS. 3 and 4). As shown in FIGS. 3 and 4, the
splint sequence (which is referred to as a "targeting
oligonucleotide" in some cases) used in this method contains an
upstream flanking sequence that is complementary to the head
sequence; a target complementary sequence that is complementary to
the target fragment; and a downstream flanking sequence that is
complementary to the tail sequence. This hybridization step
produces a hybridization product in which the ends of the target
fragment are ligatably adjacent to the ends of the head and tail
sequences in the first oligonucleotide molecule, where the term
"ligatably adjacent" in the context of two sequences that are
ligatably adjacent to one another, means that there are no
intervening nucleotides between two oligonucleotides and they can
be ligated to one another using a ligase. The next step of the
method comprises b) ligating the ends of the target fragment to the
ends of the head and tail sequences of the first oligonucleotide
molecule, thereby producing a cyclic product that comprises the
target fragment and the head and tail sequences. This ligation step
is illustrated in FIG. 1 (although, as illustrated in FIGS. 3 and
4, the method may be implemented a variety of different ways and,
as such, the nucleic acid probe used in the first step of the
method can be composed of one or two oligonucleotides).
[0036] Circularlized products provide a significant advantage for
detection because they can be amplified by rolling circle
amplification (RCA). RCA produces hundreds or thousands of copies
of a circularized product in a single molecule, thereby effectively
amplifying the circularized product and making it relatively easy
to detect using, e.g., labeled oligonucleotides that hybridize to a
motif in the product.
[0037] As illustrated in FIG. 1, the method may further comprise
amplifying the cyclic product by rolling circle amplification using
a primer that hybridizes to a sequence in the nucleic acid probe
(e.g., a head sequence, a tail sequence, or a sequence
therebetween). In these embodiments, the method may further
comprise quantifying the number of rolling circle amplification
products produced, thereby providing an estimate of the amount of
said target fragment in the sample. In these embodiments, the
products may be amplified by rolling circle amplification using
primer that is complementary to a sequence somewhere in the cyclic
product) to produce a plurality of RCA products, e.g., product
corresponding to a single, "cloned" fragment. The number of rolling
circle amplification products can be estimated by, e.g.,
distributing the RCA products on the surface of a support (a
slide), hybridizing the RCA products using labelled
oligonucleotides (e.g., fluorescently labelled oligonucleotides)
and then counting the number of discrete signals in an area of the
support by microscopy, e.g., fluorescence microscopy. The labelling
can be done before or after the products have been distributed on
the support and, because each RCA product contains thousands of
copies of the same sequences, there should be thousands of binding
sites for the labelled oligonucleotides, thereby increasing the
signal. In multiplex embodiments (e.g., in which RCA products
corresponding to two different chromosomes are being counted), the
RCA products corresponding to one chromosome can be labelled with
one fluorophore and the RCA products corresponding to another
chromosome can be labelled with a different fluorophore, thereby
allowing the different RCA products to be separately counted.
[0038] Quantifying signals from individual RCA products is
significant because, in many applications (e.g., non-invasive
pre-natal diagnosis by analysis of cell free DNA), the number of
fragments corresponding to particular chromosomes (e.g., chromosome
21) needs to be determined quire accurately and without bias.
Typical analysis methods use PCR which, as is well known, is a very
biased procedure in that some sequences are amplified much higher
efficiencies than others. This makes PCR-based strategies
impractical for many diagnostic efforts.
[0039] In alternative embodiments and as illustrated in FIG. 1, the
target fragment may be amplified by PCR and quantified. As would be
apparent, the flanking sequences that are added to the target
fragment and/or the PCR primers may be compatible with use in,
e.g., Illumina's reversible terminator method, Roche's
pyrosequencing method (454), Life Technologies' sequencing by
ligation (the SOLiD platform) or Life Technologies' Ion Torrent
platform. Examples of such methods are described in the following
references: Margulies et al (Nature 2005 437: 376-80); Ronaghi et
al (Analytical Biochemistry 1996 242: 84-9); Shendure (Science 2005
309: 1728); Imelfort et al (Brief Bioinform. 2009 10:609-18); Fox
et al (Methods Mol Biol. 2009; 553:79-108); Appleby et al (Methods
Mol Biol. 2009; 513:19-39) and Morozova (Genomics. 2008 92:255-64),
which are incorporated by reference for the general descriptions of
the methods and the particular steps of the methods, including all
starting products, reagents, and final products for each of the
steps. In these embodiments, the cyclic products may be amplified
and sequenced, and the abundance of the fragments in the sample can
be estimated by counting the number of sequence reads corresponding
to the fragments.
[0040] In certain embodiments and as illustrated in FIG. 3, the
splint sequence may in a different molecule to the head and tail
sequences, i.e., a "second" oligonucleotide molecule. As such, the
the nucleic acid probe used at the beginning of the method may be
composed of two oligonucleotides (a "backbone" and a "targeting"
oligonucleotide, as illustrated in FIG. 3).
[0041] In other embodiments and as illustrated in FIG. 4, the
splint sequence may be in the same molecule as the head and tail
sequences, i.e., in the "first" oligonucleotide molecule. As such,
the nucleic acid probe used at the beginning of the method may be
composed of a single oligonucleotide.
[0042] The target-complementary sequence may be of any length,
depending on the length of the target complementary sequence in the
nucleic acid probe. In some embodiments, the target-complementary
sequence is 10 to 100, e.g., 10 to 50 or 10 to 30 nucleotides in
length. As noted below, the target-complementary sequence contains
one or more mismatches (e.g., 1, 2, 3, 4, 5 or 6 or more, up to 10
or more) to the target fragment and, in certain cases, the reverse
complement of the target-complementary sequence may be at least
80%, at least 90% or at least 95% identical to the target
fragment.
[0043] The flanking sequences may be of any length, depending on
design. In some embodiments, the flanking sequences are 10 and 40
nucleotides, e.g., 10 and 30 nucleotides, in length.
[0044] In some embodiments, the sample may contain fragments of
genomic DNA, e.g., genomic DNA from virtually any organism,
including, but not limited to, plants, animals (e.g., reptiles,
mammals, insects, worms, fish, etc.), tissue samples, bacteria,
fungi (e.g., yeast), phage, viruses, cadaveric tissue,
archaeological/ancient samples, etc. In certain embodiments, the
genomic DNA used in the method may be derived from a mammal, where
in certain embodiments the mammal is a human. In exemplary
embodiments, the genomic sample may contain genomic DNA from a
mammalian cell, such as, a human, mouse, rat, or monkey cell. The
sample may be made from cultured cells or cells of a clinical
sample, e.g., a tissue biopsy, scrape or lavage or cells of a
forensic sample (i.e., cells of a sample collected at a crime
scene). In particular embodiments, the nucleic acid sample may be
obtained from a biological sample such as cells, tissues, bodily
fluids, and stool. Bodily fluids of interest include but are not
limited to, blood, serum, plasma, saliva, mucous, phlegm, cerebral
spinal fluid, pleural fluid, tears, lactal duct fluid, lymph,
sputum, cerebrospinal fluid, synovial fluid, urine, amniotic fluid,
and semen. In particular embodiments, a sample may be obtained from
a subject, e.g., a human. In some embodiments, the sample analyzed
may be a sample of cell-free DNA obtained from blood, e.g., from
the blood of a pregnant female. In certain embodiments, the genomic
DNA may be amplified, e.g., using a whole genome amplification
method, prior to fragmentation.
[0045] In embodiments, in which the splint sequence is in a second
oligonucleotide molecule (as shown in FIG. 3), the second
oligonucleotide may additionally comprise a capture moiety that can
be employed to enrich for the cyclic product. In these embodiments,
the method may comprise: c) immobilizing the cyclic product by
binding the capture moiety to a solid phase; and d) washing the
solid phase to remove unligated nucleic acid and other reaction
components; thereby enriching for the cyclic product. For example,
the second oligonucleotide may contain a biotin moiety, e.g.,
biotin or a biotin analogue such as desthiobiotin, oxybiotin,
2'-iminobiotin, diaminobiotin, biotin sulfoxide, biocytin, etc.,
with or without a linker, e.g., -LC-biotin, -LC-LC-Biotin,
-SLC-Biotin or -PEGn-Biotin where n is 3-12, and the cyclic
products can be enriched using a substrate that is coupled to
streptavidin. Biotin binds to streptavidin with an affinity of at
least 10.sup.-8M.
[0046] For non-invasive pre-natal testing embodiments, the target
fragment may be from human chromosome 21, 13 or 18.
[0047] In some embodiments, the method comprises hybridizing the
sample with a set of at least 50 (e.g., at least 100, at least 200,
at least 500, at least 1,000, at least 2,000 or at least 5,000) of
said probes, wherein said probes target different fragments on the
same chromosome (e.g., human chromosome 21, 13 or 18), and wherein
the method results in a plurality of cyclic products that comprises
the target fragments. The number of cyclic products produced can be
quantified by, e.g., amplifying them using RCA and counting the
number of RCA products, as described above.
[0048] In some embodiments, the method comprises hybridizing the
sample with a first set and a second set of said sets of nucleic
acid probes, wherein the first and second sets of probes target
(i.e., hybridize to fragments of and ligate to produce cyclic
products, as described above) a first chromosome in the sample and
a second chromosome in the sample, respectively, amplifying the
cyclic products by rolling circle amplification (RCA) and comparing
the number of RCA products corresponding to the first chromosome to
the number of RCA products corresponding to the first chromosome,
thereby providing an estimate of the relative amounts of DNA from
the chromosomes in the sample.
[0049] In some embodiments, the method comprises hybridizing the
sample with a first set and a second set of said sets of nucleic
acid probes, wherein the first and second sets of probes target
(i.e., hybridize to fragments of and ligate to produce cyclic
products, as described above) a first region and a second region of
a chromosome in the sample, respectively, amplifying the cyclic
products by rolling circle amplification (RCA) and comparing the
number of RCA products corresponding to the first chromosomal
region to the number of RCA products corresponding to the second
chromosomal region, thereby providing an estimate of the relative
amounts of DNA from the chromosomal regions in the sample. This
embodiment may be used to identify, e.g., deletions or
duplications, for example.
[0050] Also provided herein is composition comprising a nucleic
acid probe comprising: i. a head sequence and a tail sequence,
wherein the head and tail sequences are at opposite ends of a first
oligonucleotide molecule; and ii. a splint sequence comprising, in
order: an upstream flanking sequence that is complementary to the
head sequence, a target complementary sequence that is
complementary to a target fragment in the human genome; and a
downstream flanking sequence that is complementary to the tail
sequence; wherein the probe is designed so that, when the first
oligonucleotide, the splint sequence, and the target fragment are
hybridized to one another, the ends of the target fragment are
ligatably adjacent to the ends of the head and tail sequences in
the first oligonucleotide molecule. In certain embodiments, the
composition may comprise a first set of at least 50 (e.g., at least
100, at least 200, at least 500, at least 1,000, at least 2,000 or
at least 5,000) of the nucleic acid probes, wherein the target
complementary sequences of the probes are complementary to
different target fragments of a first human chromosome (e.g.,
chromosome is 21, 13 or 18).
[0051] In certain embodiments, the composition may comprise a
second set of at least 50 (e.g., at least 100, at least 200, at
least 500, at least 1,000, at least 2,000 or at least 5,000) of
said nucleic acid probes, wherein the target complementary
sequences of the probes in the second set of probes are
complementary to different target fragments of a second human
chromosome. In some embodiments, the first human chromosome may be
chromosome 21 and the second human chromosome may be chromosome 13
or 18. In some cases, the second human chromosome is not chromosome
21, 13 or 18.
BRIEF DESCRIPTION OF THE DRAWINGS
[0052] The skilled artisan will understand that the drawings,
described below, are for illustration purposes only. The drawings
are not intended to limit the scope of the present teachings in any
way.
[0053] FIG. 1 schematically illustrates one embodiment of the
subject method in which a circular DNA molecule is formed and
amplified by RCA or PCR.
[0054] FIG. 2 schematically illustrates one embodiment of the
subject method in which a linear ligation product is formed and
enriched with solid-phase reagents.
[0055] FIG. 3 shows a probe comprising a circularised backbone
oligonucleotide bound to its target fragment. The probe is
illustrated in two versions, A and B.
[0056] FIG. 4 shows a circularised single oligonucleotide probe
with bound target fragment.
[0057] FIG. 5 shows a circularised double looped probe composed of
a targeting oligonucleotide and a looped backbone oligonucleotide,
with bound target fragment.
[0058] FIG. 6 shows a linear looped probe composed of a targeting
oligonucleotide and a linear backbone oligonucleotide, with bound
target fragment.
[0059] FIG. 7 shows a linear probe comprising two backbone
oligonucleotides, with bound target fragment.
[0060] FIG. 8 is an image of a gel showing the specificity of the
method described herein.
[0061] FIG. 9 is a graph showing the precision of the method
described herein.
[0062] FIG. 10 panel A shows an image of labeled RCA products on
the surface of a slide; panel B shows how ratios of fragments from
different chromosomes can be accurately determined by counting
individual RCA products.
DETAILED DESCRIPTION
The Target Nucleic Acid Fragment
[0063] The target fragment which is bound by the probe is a single
stranded fragment of nucleic acid. In some embodiments, the present
methods bind target fragments whose sequence is pre-defined. The
sequence of the entire fragment including the ends may be known.
Known fragments of pre-defined sequence can be produced by
specific, rather than random, fragmentation of nucleic acid.
Specific fragmentation methods include digestion with restriction
enzymes, PCR (e.g., multiplex PCR), and other methods of sequence
directed fragment end definition, including other enzymes,
ribozymes, or a combination of such techniques.
[0064] One method of fragmentation is digestion with a restriction
endonuclease or a combination of two or more restriction
endonucleases. Thus, the sample of fragmented nucleic acid may be a
restriction enzyme digest and the target fragment may be a
restriction fragment.
[0065] A variety of specific nucleic acid cleaving enzymes are
known and any suitable enzyme may be used in the present invention,
including enzymes which cleave at a pre-defined position within a
specific nucleic acid sequence, or endonucleolytic enzymes which
cleave either after or before a specific nucleic acid recognition
sequence and nicking enzymes. Catalytic nucleic acids, such as
ribozymes, can be used as well for DNA fragmentation. The enzymes
may cleave double stranded nucleic acid to produce a blunt end or a
sticky end, or may cleave a single strand of nucleic acid. Various
types of restriction enzymes are known, including Type I, Type II,
Type III, Type IV and Type V. Suitable enzymes or combinations of
enzymes can be selected for use in the method as desired. For
example, nucleic acid in a sample (e.g. 10 ng of DNA) may be
digested with restriction enzyme (e.g. 1 U) in corresponding
compatible restriction enzyme buffer. The reaction may be incubated
under suitable conditions (e.g. 37.degree. C. for 1 hour), followed
by enzymatic deactivation (e.g. at 80.degree. C. for 20
minutes).
[0066] Another convenient method of providing the fragmented
nucleic acid is to use primers for amplification of specific linear
sequences from the nucleic acid. Multiplex PCR can be used,
treating the nucleic acid with multiple specific primer pairs to
amplify multiple specific fragments. In this case, the ends of the
target fragment correspond to the sequences of the pair of
primers.
[0067] For many diagnostic and other applications, the sample is a
sample of fragmented chromosomes (e.g., human chromosomes or
microbial chromosomes). The target fragment may be a genome
fragment specific to one chromosome of an organism's genome. In
other words, the target fragment may be found only in one
chromosome of the genome and not in other chromosomes of that
genome. Commonly, the method will be used for analysis of the human
genome, in which case the target fragment may be a fragment
specific to one human chromosome, i.e., found in that chromosome
and not in other human chromosomes. For example, the fragment may
be specific to chromosome 21.
[0068] The target fragment may be specific to one locus of a
chromosome. Accordingly, it may be found in that chromosomal locus
and not in other loci of the same chromosome or other chromosomes
of the same genome. For example, the fragment may be specific to
one locus of a human chromosome.
[0069] A given species of nucleic acid in a sample may encompass
some variability, for example a sample may comprise chromosomes of
different individuals, such as nucleic acid obtained from maternal
blood which contains maternal DNA and foetal DNA. Here the species
of interest may be a particular chromosome, but it is convenient to
detect all copies of that chromosome whether of foetal or maternal
origin. Thus, a species of interest may be one chromosome or
chromosomal locus, and the target sequences are found in that
chromosome or locus in both maternal and foetal copies of the
chromosome or chromosomal locus.
[0070] Samples of nucleic acid may be provided in any suitable way,
for example as samples of biological tissue or fluid from patients.
Samples may be blood samples, whole blood, plasma, or serum, tissue
samples, e.g., formalin fixed paraffin embedded samples of tissue,
or may be samples of nucleic acid extracted from blood or
tissue.
[0071] The sample may be any sample that contains nucleic acid. The
nucleic acid contained in the sample may be DNA and/or RNA. The
sample may be complex, e.g. whole genomic DNA, or cDNA from a whole
organism, tissue or cell population, or a fraction thereof. In this
regard it may, for example, be a direct product of a nucleic acid
isolation procedure, or of a cell lysis procedure, or it may be
further be fractionated or purified in some way, e.g. it may
contain nucleic acids which have been partially or fully separated
in some way, or treated in any way, e.g. RNA to produce cDNA. The
sample may be from any eukaryotic or prokaryotic or viral source,
e.g. may be microbial (for example bacterial or fungal), plant, or
animal. Preferably the sample is of human origin, e.g., human
genomic DNA. The sample may be a tissue or blood sample from an
animal, where the nucleic acid to be detected is microbial, e.g.,
bacterial, viral or fungal. For methods relating to non-invasive
prenatal diagnostics, the sample is derived from the blood of a
pregnant woman and comprises foetal DNA. In other examples, the
nucleic acid to be detected or quantified is tumour associated
DNA.
[0072] Usually, the method may be performed on the samples in
vitro. Accordingly, the methods generally do not include diagnosis
carried out in vivo on the human or animal body or methods of
treatment of the human or animal body by surgery or therapy.
Nevertheless, the results of the in vitro diagnostic methods may be
used to inform the subsequent treatment of patients.
Denaturing the Target Nucleic Acid
[0073] The probe recognises and binds the target nucleic acid in
single stranded form, through hybridisation between the single
stranded fragment and the target-complementary sequence of the
targeting oligonucleotide. Therefore, if the target fragment in the
sample is not already single stranded, denaturing conditions should
be provided to separate the single stranded target fragment from
its complementary nucleic acid strand.
[0074] The denaturing conditions may be a sufficiently high
temperature to separate the target fragment from its complementary
sequence. Denaturing conditions may be incubation at 95.degree. C.
for a suitable time, e.g. 10 minutes. Alternatively chemical
denaturation may be performed.
Complementarity
[0075] A method of testing a sample for the presence of a target
fragment may comprise contacting the sample with a nucleic acid
probe, wherein the probe comprises
[0076] a targeting oligonucleotide containing a
target-complementary sequence, which is the complement of the
target fragment, and a flanking sequence adjacent to the
target-complementary sequence and
[0077] an oligonucleotide sequence having a free 5' or 3' end,
wherein the oligonucleotide sequence is complementary to the
flanking sequence.
[0078] Suitable concentrations of probes may be determined based on
the concentration (or expected concentration) of the target
fragment or target fragments in the sample. As illustrated in the
Examples, probes may be added to the sample at a concentration of
10 pM per probe. Where a sample is contacted with multiple probes
(e.g. a set of probes), concentrations of the individual probes may
be 10 pM. Preferably, probes are used in excess of the expected
concentration of the nucleic acid species of interest to be
detected or quantified. Use of excess probe should ensure that all
copies of target sequences present in the sample are recognised.
This maximises the sensitivity of detection. Also, where methods
involve quantification, it ensures that the detection of the
ligation products or cumulative signal from a set of probes is
proportional to the quantity of target sequences in the sample.
[0079] Under annealing conditions, the target fragment (if present)
hybridises to the target complementary sequence of the targeting
strand and the oligonucleotide sequence hybridises to the flanking
sequence, so that the free 5' or 3' end of the oligonucleotide
sequence is in juxtaposition with the 3' or 5' end of the target
fragment respectively. Thus, the targeting oligonucleotide
templates the target fragment for ligation to the oligonucleotide
sequence. The 3' end of the target fragment may be ligated to a 5'
end of a head sequence and the 5' end of the target fragment may be
ligated to a 3' end of a tail sequence in a double ligation
event.
[0080] In probes according to the present invention, maximum
specificity for the target fragment is achieved if the
target-complementary sequence is the exact complement of the target
fragment, so that there is perfect hybridisation between them.
However, this is not essential in all cases, and a small degree of
mismatching may be accepted, for example to allow detection of
fragments which exhibit allelic variation where it is desired to
detect the fragment regardless of the exact allele present in the
sample. Alternatively, multiple probes can be designed for variant
sequences. This can enable both detection and discrimination of
different alleles or mutations. Probes according to the present
invention are most advantageously used in multiplex methods where
large numbers of different probes are included in a reaction.
Within such a plurality of probes, it is envisaged that the
majority of probes will have perfect complementarity for their
target fragments but some probes may bind targets with minor
mismatches.
[0081] Preferably, the target-complementary sequence has fewer than
5 base pair mismatches with the target fragment. There may
optionally be one, two, three or four base pair mismatches between
the target fragment and the target-complementary sequence. A
mismatch may be a point at which a corresponding base is absent
from one sequence, so that the complementary sequence forms a loop
at the mismatched point, or may occur where a non-complementary
nucleotide is present in one sequence and so does not pair with the
base at the corresponding position of the other sequence. Where
there is an incorrect base pairing, i.e., a pairing of A or T with
C or G, hydrogen bonding does not take place between the bases of
the two strands, although hybridisation will still take place
between the target fragment and the target complementary sequence
of the targeting oligonucleotide due to base-pairing between the
nucleotides neighbouring the mismatch. Mismatches may be wobble
bases. A wobble base would normally correspond to a position in the
target complementary sequence that pairs with a position of known
genetic variation in the target fragment. The probe may be
synthesised by adding one or several dideoxynucleotides during the
specific synthesis cycle for the wobble base position. This is
typically the case for traditional oligonucleotide synthesis.
Alternatively multiple separate probes may be produced, one for
each genetic variant. This is typically the case if probes are
synthesised using microarray based synthesis. A wobble base may
correspond to single nucleotide differences between codons, where
the different codons encode the same amino acid.
[0082] In general, longer target-complementary sequences for
hybridising longer target fragments may tolerate a higher number of
mismatches compared with shorter target-complementary sequences.
The target-complementary sequence may, for example, have at most 1
in 8, 1 in 9 or 1 in 10 base pair mismatches with the target
fragment. Any such mismatches should be restricted to the internal
region of the target complementary sequence and target fragment, so
that they do not inhibit ligation or sequence specific target
fragmentation by e.g. restriction enzyme digestion. Accordingly,
preferably there is perfect complementarity between the target
fragment and the target complementary sequence in the terminal 6 to
8 nucleotides, preferably the terminal 10 nucleotides at each end
of the target fragment.
[0083] Generally, the target fragment and the target-complementary
sequence are of the same length. The full length of the target
fragment is thus bound by the target complementary sequence.
Hybridisation of the target fragment to the targeting
oligonucleotide represents a single binding event between the two
nucleic acid molecules, contrasting with probes which bind the two
ends of a target molecule or to two non-adjacent regions of the
target.
[0084] The target-complementary sequence may have a length of at
least 10 nucleotides, for example at least 15 nucleotides. It may
be up to 20, 25, 30, 35 or 40 nucleotides long. Preferred ranges
include 10-20 nucleotides, 10-30 nucleotides, and 10-40
nucleotides. Such relatively short target-complementary sequences
are suitable for binding correspondingly short fragments. The short
sequence contributes to the specificity of the double ligation
reaction, since DNA ligase is sensitive to base pair mismatches and
will preferentially ligate perfectly matched sequences. Where
mismatches are present in the footprint of DNA ligase bound to the
double stranded sequence, the sequences may not be ligated, which
provides an additional proofreading step ensuring high specificity
in detecting the target fragment in preference to fragments of
different but similar sequence. DNA ligase typically has a
footprint of 6 to 8 bases on each side of the nick. Therefore, if
the fragment is 20 bases, 12 to 16 of the bases will be covered by
ligase specificity.
[0085] The probe hybridisation will discriminate against mismatches
especially in the central part of the hybridised sequence while the
ligation will discriminate against mismatches at the ends of the
target fragment. Together this generates a highly specific fragment
detection.
[0086] The targeting oligonucleotide is longer than the target
fragment since it includes the flanking sequences as well as the
target-complementary sequence, and it may further include one or
more custom sequences. A custom sequence is not complementary to
other regions of the probe or to the target fragment--in other
words it does not hybridise to other regions of the probe (outside
the custom sequence) or to the target fragment under annealing
conditions. The upstream flanking region is upstream of or 5' of
the target-complementary sequence in the targeting oligonucleotide.
The downstream flanking region is downstream of or 3' of the
target-complementary sequence in the targeting oligonucleotide.
Accordingly, the target-complementary sequence is internal to the
targeting oligonucleotide and does not include an end of the
targeting oligonucleotide, since it is flanked by the upstream and
downstream flanking sequences.
[0087] The double stranded sequence produced by hybridisation of
the target fragment and the target-complementary sequence may be
considered a hybrid double stranded sequence, since it is a hybrid
of the target and the probe. Typically the double stranded sequence
adopts a double helical conformation, in which the target fragment
is one strand and the targeting oligonucleotide is the other strand
of the double helix. The hybrid double stranded sequence is flanked
by the upstream and downstream flanking sequences of the targeting
oligonucleotide, which in turn hybridise to the head and tail
sequences to produce double stranded sequences. Again, these
typically adopt the normal double helical conformation of double
stranded nucleic acid.
[0088] The upstream and downstream flanking sequences are
preferably different from each other, i.e., preferably have
different sequences. It is preferred that the head sequence is
complementary to the upstream flanking sequence but not to the
downstream flanking sequence, and that the tail sequence is
complementary to the downstream flanking sequence but not to the
upstream flanking sequence. This ensures that the head and tail
sequences hybridise only to the upstream and downstream flanking
sequences respectively.
[0089] The head sequence will usually be the same length as the
upstream flanking sequence. The tail sequence will usually be the
same length as the downstream flanking sequence.
[0090] Normal lengths for the flanking sequences are between 10 and
40 nucleotides, for example 10-20 or 10-30 nucleotides. The
flanking sequences may be the same length as each other. One or
both flanking sequences may be the same length as the
target-complementary sequence. The upstream and/or downstream
flanking sequence may thus have a length of at least 10
nucleotides, for example at least 15 nucleotides. It may be up to
20, 25, 30, 35 or 40 nucleotides long.
[0091] Preferably, the head sequence is the complement of the
upstream sequence. Preferably, the tail sequence is the complement
of the downstream sequence. Perfect matching of the sequences is
desirable for optimum binding of the probe so that the head and
tail sequences are correctly positioned for ligation to the target
fragment. Optionally, however, there may be one, two three or four
base pair mismatches between the head sequence and the upstream
flanking sequence, and/or between the tail sequence and the
downstream flanking sequence. Preferably, there are fewer than 5
base pair mismatches.
[0092] Other than the target-complementary sequence, the probe
should usually not be complementary to the target fragment or to
other nucleic acids that may be present in the sample. This is to
avoid unwanted hybridisation of the probe to nucleic acid other
than the target. Thus, if the probe is for binding a fragment of
human genomic DNA, the probe may be designed so that sequences
other than the target-complementary sequence are not complementary
to human genomic DNA, so that the probe only hybridises to the
target fragment and not to other nucleic acid in the sample.
Annealing and Ligation
[0093] The target fragment is ligated in a highly specific reaction
at both ends. Since the target fragment is typically the product of
a specific fragmentation of nucleic acid, these ends will usually
have a specific, pre-determined sequence. In the ligation step,
these ends are specifically detected by sequence-dependent ligation
to the head and tail sequences respectively. Preferably, binding of
the target fragment to the probe creates two perfectly matched
ligatable junctions, one between the 3' end of the target fragment
and the 5' end of the head sequence and one between the 5' end of
the target fragment and the 3' end of the tail sequence.
[0094] Ligation of a 5' end of nucleic acid to a 3' end of nucleic
acid can occur when the two ends are base paired to adjacent
nucleotides of a complementary sequence. Base pairing of the
respective end nucleotides to the adjacent nucleotides forms a
nucleic acid strand containing a nick between the two ends.
Ligation of the two ends can be catalysed by DNA ligase. Providing
conditions for ligation will therefore usually comprise providing a
DNA ligase enzyme and reaction conditions under which the DNA
ligase ligates the two ends to form a continuous nucleic acid
strand, closing the nick. A number of ligase enzymes are
commercially available, such as Ampligase (Epicentre), for which
suitable conditions are to add 1 U enzyme and incubate at
55.degree. C. for 1 hour in ligase buffer.
[0095] The targeting oligonucleotide templates the target fragment
for ligation to the head and tail sequences, due to the location of
the target-complementary sequence between the flanking sequences.
Under annealing conditions in the presence of the target fragment,
the head and tail sequences hybridise to the flanking sequences,
defining a gap between the 5' end of the head sequence and the 3'
end of the tail sequence. The target fragment hybridises to the
target-complementary sequence in the gap. Thus, hybridisation of
the head and tail sequences and the target fragment to the
targeting oligonucleotide positions the 3' end of the target
fragment in juxtaposition with the 5' end of the head sequence, and
positions the 5' end of the target fragment in juxtaposition with
the 3' end of the tail sequence.
[0096] Positioning of two ends in juxtaposition provides a
substrate for DNA ligase to ligate the ends together. It is
preferable that the 5' end of the head sequence and the 3' end of
the target fragment hybridise to adjacent nucleotides of the
targeting oligonucleotide, and the 3' end of the tail sequence and
the 5' end of the target fragment hybridise to adjacent nucleotides
of the targeting oligonucleotide. Accordingly, the upstream
flanking sequence may be immediately adjacent to the
target-complementary sequence, with no intervening nucleotides.
Similarly, the downstream flanking sequence may be immediately
adjacent to the target-complementary sequence, with no intervening
nucleotides. Adjacent 3' and 5' ends can be directly ligated by DNA
ligase sealing the nick between them to form a continuous nucleic
acid strand.
[0097] The product of the double ligation, i.e., the product of
ligating both the head sequence and the tail sequence to the target
fragment, is a continuous strand of nucleic acid. It is continuous
in the sense that it contains no nicks or gaps, so all nucleotides
in the strand are covalently joined.
[0098] The probe may be designed so that the continuous strand of
nucleic acid comprising the head and tail sequences and the target
fragment is a circle of nucleic acid. The term circle here refers
to the topology of the strand being a closed loop, with no free
end.
[0099] Under annealing conditions in the presence of the target
fragment, the head and tail sequences hybridise to the flanking
sequences, defining a gap between the 5' end of the head sequence
and the 3' end of the tail sequence. The target fragment hybridises
to the target-complementary sequence in the gap, thereby
positioning the ends of the target fragment in juxtaposition with
the 5' end of the head sequence and the 3' end of the tail
sequences, and completing a circle of nucleic acid which comprises
the target fragment and the head and tail sequences.
[0100] The nucleic acid molecules which form the circle have their
ends in juxtaposition. Ligation of the ends produces the continuous
circular strand of nucleic acid comprising at least the head and
tail sequences and the target fragment.
[0101] Probes which form a circle of nucleic acid include probes in
which the head and tail sequences are provided on a single nucleic
acid molecule. For example, in addition to the targeting
oligonucleotide the probe may comprise a backbone oligonucleotide
having the head and tail sequences at its 5' end 3' ends
respectively, wherein the head and tail sequences of the backbone
oligonucleotide bind in trans to the flanking sequences of the
targeting oligonucleotide under the annealing conditions. The
backbone oligonucleotide may comprise a custom sequence between the
head and tail sequences. FIG. 3 illustrates embodiments of such
probes. Alternatively, the head and tail sequences of the backbone
oligonucleotide may be adjacent, with no custom sequence between
them.
[0102] In another example, the head and tail sequences may be at
ends of the targeting oligonucleotide and bind in cis to the
flanking sequences under the annealing conditions. The targeting
oligonucleotide may comprise a custom sequence between the
targeting oligonucleotide and the head and/or tail sequence. FIG. 4
illustrates an embodiment of such a probe.
[0103] Probes which form a circle of nucleic acid also include
probes in which the head and tail sequences are provided on
different nucleic acid molecules. In such cases, the circle of
nucleic acid which forms under the annealing conditions will
comprise at least three nucleic acid molecules--the target
fragment, the head sequence and the tail sequence. The ends of the
nucleic acid molecules will all be in juxtaposition, as previously
noted. More than two ligation reactions are required to form the
continuous circular strand of nucleic acid in such cases. An
example is where the tail sequence is the 3' end of the targeting
oligonucleotide, and the probe comprises a backbone oligonucleotide
having the head sequence at its 5' end. Under the annealing
conditions the tail sequence binds in cis to the downstream
flanking sequence of the targeting oligonucleotide, and the head
sequence of the backbone oligonucleotide binds in trans to the
upstream flanking sequence of the targeting oligonucleotide.
Binding in cis means that the binding takes place on the same
nucleic acid molecule, i.e., a single strand of nucleic acid forms
a three dimensional structure in which different regions are
brought together and hybridise. Binding in trans means that the
binding takes place between different nucleic acid molecules.
Optionally, the backbone oligonucleotide comprises a pair of
inverted repeat sequences which form a hairpin structure under
annealing conditions, thereby positioning the 3' end of the
backbone oligonucleotide in juxtaposition with the 5' end of the
targeting oligonucleotide. There is a nick between the two ends. A
probe of this type is illustrated in FIG. 5. When conditions for
ligation are provided, the 5' end of the targeting oligonucleotide
is ligated to the 3' end of the backbone oligonucleotide. The
product of double ligation is a circle of nucleic acid comprising
the targeting oligonucleotide, the target fragment and the backbone
oligonucleotide. Alternatively, where there is a gap between the 5'
end of the targeting oligonucleotide and the 3' end of the backbone
oligonucleotide, the probe shown in FIG. 5 will not be circularised
by ligation--instead the continuous strand of nucleic acid
comprising the head and tail sequences and the target fragment is a
linear strand of nucleic acid.
[0104] The probe may alternatively be arranged in the opposite
orientation so that the head sequence is at the 5' end of the
targeting oligonucleotide and the probe comprises a backbone
oligonucleotide having the tail sequence at its 3' end. In this
case, under the annealing conditions the head sequence binds in cis
to the upstream flanking sequence of the targeting oligonucleotide,
and the tail sequence of the backbone oligonucleotide binds in
trans to the downstream flanking sequence of the targeting
oligonucleotide. Again, the backbone oligonucleotide may comprise a
pair of inverted repeat sequences which form a hairpin structure
under annealing conditions to position the 5' end of the backbone
oligonucleotide in juxtaposition with the 3' end of the targeting
oligonucleotide. The 3' end of the targeting oligonucleotide is
then ligated to the 5' end of the backbone oligonucleotide so that
the product of double ligation is a circle of nucleic acid
comprising the targeting oligonucleotide, the target fragment and
the backbone oligonucleotide. Alternatively, as noted above, the
annealing may position the 5' end of the backbone oligonucleotide
near the 3' end of the targeting oligonucleotide but separated by a
gap of one or more nucleotides. The ligated product will then be a
continuous linear strand of nucleic acid comprising the head and
tail sequences and the target fragment.
[0105] The backbone oligonucleotide may comprise a custom sequence
between the inverted repeat sequence, so that under the annealing
conditions the backbone oligonucleotide forms a hairpin loop, as
illustrated in FIG. 5.
[0106] As noted, probes may be designed so that the continuous
strand of nucleic acid comprising the head and tail sequences and
the target fragment is a linear strand of nucleic acid. Under
annealing conditions in the presence of the target fragment, the
head and tail sequences hybridise to the flanking sequences,
defining a gap between the 5' end of the head sequence and the 3'
end of the tail sequence. The target fragment hybridises to the
target-complementary sequence in the gap, thereby positioning the
ends of the target fragment in juxtaposition with the 5' end of the
head sequence and the 3' end of the tail sequences, and completing
a strand of nucleic acid which comprises the target fragment and
the head and tail sequences. The nucleic acid molecules which form
the strand have their ends in juxtaposition. The term juxtaposition
has been discussed elsewhere. There is a nick between the ends to
be ligated. Ligation of the ends produces the continuous strand of
nucleic acid comprising at least the head and tail sequences and
the target fragment.
[0107] The probe may comprise a targeting oligonucleotide having
the tail sequence at its 3' end and a linear backbone
oligonucleotide having the head sequence at its 5' end. Under
annealing conditions, the tail sequence binds in cis to the
downstream flanking sequence of the targeting oligonucleotide, and
the head sequence of the backbone oligonucleotide binds in trans to
the upstream flanking sequence of the targeting oligonucleotide.
The targeting oligonucleotide may comprise a custom sequence
between the downstream flanking sequence and the tail sequence, so
that under the annealing conditions the targeting oligonucleotide
forms a hairpin loop. The linear strand of nucleic acid formed
under annealing conditions comprises the backbone oligonucleotide,
the target fragment and the targeting oligonucleotide. FIG. 6
illustrates this arrangement.
[0108] The probe may equally be arranged in the reverse
orientation, where the head sequence is at the 5' end of the
targeting oligonucleotide, and the probe comprises a backbone
oligonucleotide having the tail sequence at its 3' end. In this
case the head sequence binds in cis to the upstream flanking
sequence of the targeting oligonucleotide and the tail sequence of
the backbone oligonucleotide binds in trans to the downstream
flanking sequence of the targeting oligonucleotide.
[0109] Another form of probe which forms a linear nucleic acid
strand as the product of ligation is a probe comprising the head
and tail sequences on separate backbone oligonucleotides. Such a
probe may comprise a backbone oligonucleotide comprising a head
sequence having a free 5' end, and a backbone oligonucleotide
comprising a tail sequence having a free 3' end, wherein under the
annealing conditions the head and tail sequences bind in trans to
the flanking sequences of the targeting oligonucleotide. One or
both backbone oligonucleotides may further comprise a custom
sequence. FIG. 7 illustrates probes of this type.
[0110] Preferably, the oligonucleotides of the probe in its
unligated form are linear. So, preferably the targeting
oligonucleotide is a linear nucleic acid molecule. For probes
including one or more backbone oligonucleotides, these are also
preferably linear. This allows convenient differentiation between
ligated and unligated probes where a circle of DNA is formed only
as a result of successful ligation of the circularising embodiments
of the probe. Linear nucleic acid molecules are not amplified by
rolling circle replication.
Detection
[0111] After providing conditions under which the target fragment,
if present, is ligated to the probe, a detection step is performed
to determine whether or not such ligation has occurred. This
indicates whether or not the target fragment was present in the
sample. Thus, detection of product is dependent on successful
ligation of the target fragment to the head and tail sequences to
form the continuous strand of nucleic acid. The detection step
therefore generally involves detecting a signal that requires the
presence of both ligation junctions. For example, detection may
comprise amplification across both ligation junctions (e.g., by PCR
or, for circularising embodiments of the probe, rolling circle
replication), or capturing the continuous nucleic acid strand at
one end and detecting its other end.
[0112] Optionally, a method may include enriching the product of
double ligation before detection. Products may be enriched by
amplification and/or by solid phase chemistry. Circular nucleic
acid products may be selectively enriched by treating the sample
with exonuclease (e.g., Lambda exonuclease) to digest linear
nucleic acid products. In general, exonuclease degradation may be
used to enrich for ligation products when the ligation products are
protected from exonuclease degradation. Exonuclease should then be
deactivated (e.g. by heat) before any subsequent step involving
polymerisation, e.g. before rolling circle amplification. As
illustrated in Example 1, 1 U Exonuclease may be added to remove
non-reacted probes and fragments. Suitable conditions are
incubation at 37.degree. C. for 1 hour in corresponding exonuclease
buffer, followed by enzyme inactivation at 80.degree. C. for 20
minutes. Where capture/detect methods are used, ligation products
may be enriched by capturing the products on a solid phase via the
capture moiety. As illustrated in Example 2, a solution containing
linear ligation products may be mixed with 10 ml M-280 streptavidin
coated magnetic beads (Invitrogen) in Tris-HCl (pH 7.5), 3.5 mM
EDTA and 0.07% Tween-20 in a final volume of 200 ml, and incubated
at room temperature for 15 minutes. After incubation, the beads are
collected using a ring magnet and supernatant is removed. Other
ways of enriching for ligation products include specifically
size-selecting ligation products.
[0113] A convenient way to detect the product of double ligation to
provide conditions for amplification and to test for the presence
of the amplification product. Several amplification approaches are
possible, such as NASPA, LAMP, T7 amplification, PCR or, where the
continuous strand is a circle, rolling circle replication. The step
of detecting the product of double ligation may comprise providing
conditions for amplification across the first and second ligation
junctions of the continuous strand of nucleic acid, and detecting
whether an amplification product is present. Ligation products may
be amplified by clonal amplification. Suitable amplification
techniques include rolling circle amplification (see below), bridge
PCR (Adessi C, et al., Nucleic Acids Res. 2000 Oct. 15;
28(20):E87), emulsion PCR (digital PCR in emulsions was described
by Dressman et al., Proc Natl Acad Sci USA. 2003 Jul. 22;
100(15):8817-22. Epub 2003 Jul. 11) and digital PCR (Vogelstein
& Kinzler, Proc Natl Acad Sci USA. 1999 Aug. 3;
96(16):9236-41). Clonal localised amplification in gels was
described by Mitra & Church, Nucleic Acids Res. 1999 Dec. 15;
27(24): e34.
[0114] Where the product of double ligation is a circle of nucleic
acid, a convenient way to detect the product is to provide
conditions for rolling circle replication and to detect whether a
product of rolling circle replication is present. The product of
rolling circle replication is dependent on double ligation to
provide the circle of nucleic acid for amplification. Rolling
circle replication was described in U.S. Pat. No. 5,854,033
(Lizardi) and Fire & Xu, Proc Natl Acad Sci USA. 1995 May 9;
92(10):4641-5. Rolling circle replication is an amplification of a
circular nucleic acid molecule using a strand displacing DNA
polymerase, resulting in large DNA molecules containing tandem
repeats of the amplified sequence. The DNA polymerase catalyses
primer extension and strand displacement in a processive rolling
circle polymerisation reaction that proceeds as long as desired. It
results in an amplification of the circularised probe sequence
orders of magnitude higher than a single cycle of PCR replication
and other amplification techniques in which each cycle is limited
to a doubling of the number of copies of a target sequence.
Additional amplification can be obtained using a cascade of strand
displacement reactions. Rolling circle replication may be hyper
branched rolling circle replication. Hyperbranched RCA was
described by Lizardi et al., Nat Genet. 1998 July; 19(3):225-32.
Conditions for rolling circle replication are illustrated in the
Examples, for example incubation with 1 U of phi29 polymerase (New
England Biolabs) can be added in corresponding phi29 buffer and
nucleotides (dNTPs) at 37.degree. C. for 1 hour.
[0115] Following rolling circle replication, the amplified probe
sequences can be detected and quantified using any of the
conventional detection systems for nucleic acids such as detection
of fluorescent labels, enzyme-linked detection systems,
antibody-mediated label detection, and detection of radioactive
labels. Preferably, a rolling circle amplification product is
detected by hybridisation of a labelled detection oligonucleotide
to a motif in the RCA product, e.g. a motif in a custom sequence of
the probe. Because the amplified product is directly proportional
to the amount of target sequence present in a sample, quantitative
measurements reliably represent the amount of a target sequence in
a sample. Major advantages of this method are that the ligation
step can be manipulated to obtain allelic discrimination, the DNA
replication step is isothermal, and signals are strictly
quantitative because the amplification reaction is linear and is
catalysed by a highly processive enzyme. In multiplex assays, the
primer oligonucleotide used for the DNA polymerase reaction can be
the same for all probes.
[0116] For probes in which the head and tail sequences are on
separate nucleic acid molecules, it may be convenient to use
capture/detect methods. The product of double ligation contains the
head and tail sequences in a single nucleic acid molecule (the
continuous strand), whereas unligated probes do not. Accordingly,
the product of double ligation may be specifically detected by
capturing the nucleic acid molecule containing the head sequence,
washing to remove unligated probe nucleic acid, then detecting the
presence of the tail sequence in the captured fraction.
Alternatively, the product of double ligation may be detected by
capturing the nucleic acid molecule containing the tail sequence,
washing to remove unligated probe nucleic acid, then detecting the
presence of the head sequence in the captured fraction. Detection
is specific to the ligated probes, since the head and tail
sequences in the unligated probes are connected only by
hybridisation between the nucleic acids and are separated by
washing, whereas the ligated probes contain the head and tail
sequences in a continuous nucleic acid strand, i.e., covalently
joined.
[0117] A probe may be modified to carry a capture moiety. The
capture moiety may permit attachment to a solid substrate such as a
bead. A suitable capture moiety is biotin, which pairs with
streptavidin, allowing the modified probe nucleic acid to be
isolated on the solid substrate coated with streptavidin. Where a
probe comprises a backbone oligonucleotide containing either the
head or tail sequence, and a separate nucleic acid (targeting
oligonucleotide, or a second backbone oligonucleotide) containing
the tail or head respectively, either of these nucleic acid
molecules may carry a capture moiety, for example may be
biotinylated. It may be convenient to provide the probe with the
capture moiety before combining the probe with the sample.
Alternatively, the capture moiety may be introduced after the
ligation step.
[0118] Where one nucleic acid molecule in the probe carries a
capture moiety, the other may carry a label. It is possible to use
the nucleic acid sequence itself as a label, for example to
specifically detect the presence of the head sequence (where the
tail is captured) or the tail sequence (where the head is captured)
or to detect a custom sequence which is unique to the nucleic acid
molecule to be detected. A complementary oligonucleotide may be
used for detection. Alternatively the nucleic acid may carry a
heterogeneous label such as a fluorophore. The heterogeneous label
is not part of the nucleic acid itself. Other labels that can be
used include quantum dots, bioluminescence, signal generating
enzyme cascades like tyramide signal amplification, and radioactive
moieties. The method may then comprise detecting the presence of
the label, e.g., detecting fluorescence, detecting the quantum
dots, detecting bioluminescence, detecting the signal generated by
the enzyme, or detecting radioactivity, respectively.
[0119] As an example, the step of detecting whether the product of
double ligation is present may comprise capturing a backbone
oligonucleotide of the probe on a substrate via the capture moiety,
washing the substrate to remove unligated probes and retaining a
captured fraction comprising the substrate and captured backbone
oligonucleotide, and testing for the presence of the product of
double ligation in the captured fraction. Where the product of
double ligation carries a label, this may comprise testing for the
presence of the label in the captured fraction. The capture moiety
can be a biotin-molecule with affinity to a streptavidin substrate.
Other suitable affinity tags include polyhistidine tags with
affinity to immobilised metal ions, such as cobalt, nickel, copper
which can be used for the purification of histidine containing
sequences, e.g., backbone oligonucleotides. The capture moiety may
thus be part of the sequence to be captured, e.g. a His-tag
sequence, or it may be a heterogenous moiety which is not part of
the nucleic acid itself.
[0120] A suitable solid substrate is a bead, for example magnetic
beads to facilitate enrichment of the captured products using a
magnet. The substrate may be coated with a binding member for the
capture moiety, e.g. streptavidin coated magnetic beads may be used
with biotinylated probes.
[0121] An advantage of some embodiments of the present method is
that it do not rely on nucleic acid sequencing, nor PCR, which
causes biased results because some sequences amplify more
efficiently than others. Optionally though, detection may comprise
a step of validating the identity of the ligated fragment by
sequencing the product. One of the advantages of the present
invention is that, by incorporating the actual target fragment in
the product of double ligation, the product can be sequenced to
confirm that the probes reacted with the correct target. This is an
advantage compared with other approaches based on double ligation
such as US20130172212 (Ariosa).
Multiplexing
[0122] Multiple different target nucleic acid fragments may be
detected using a plurality of the probes in parallel. For example,
a sample of fragmented chromosomes may be contacted with a set of
probes for binding multiple fragments of a chromosome, wherein each
probe in the set is for binding a different target fragment
specific to that chromosome. The probes may share a common custom
sequence, which can be used as a barcode to identify the probes
that specifically bind that chromosome. Multiplexing can include
multiplex targeting oligonucleotides and one common backbone
oligonucleotide but also several sets of targeting oligonucleotides
where each subset hybridises to separate backbone
oligonucleotides.
[0123] Multiple probes can be used to provide a detectable signal,
where the magnitude of the signal is proportional to the number of
probes recognising their target fragments. Individual signals from
the plurality of probes are converted into a single cumulative
detectable signal, amplifying the individual signals through the
multiplex probing. Ten or more probes produce a signal
amplification of ten-fold or more. The generated signals depend on
correctly reacted probes upon target recognition, using sequence
specific hybridisation and ligation to generate the specific
products of double ligation from which the signal is obtained.
[0124] Each probe that recognises its target fragment generates a
ligation product, and the ligation products produced by each probe
hybridisation may be individually detectable, so that an individual
signal is obtainable from each. However, an elegant feature of the
present invention is that these individual signals need not be
individually detected, but instead are merged into a cumulative
signal and the cumulative signal is detected. The cumulative signal
is a combination of the individual signals and can thus be used to
detect and/or quantify the ligation products, representing the
presence or quantity of the nucleic acid species under
investigation. Some implementations of the present method allow an
earlier merging of the probe signals compared with methods
involving sequencing and microarrays, in which individual signals
are generated for multiple probes across a region and then the
signal is merged in the analysis to represent a region. The signal
can be merged before detection, so that individual signals are not
separately mapped or interrogated. This enables a simpler readout
format.
[0125] An individual signal may be obtainable from each product of
double ligation which is formed as a result of probe hybridisation
to each target fragment. So, for example, where a set of probes
comprises 10 different probes that recognise 10 target fragments of
a species of interest in a sample, there will be 10 ligation
products including ligation junctions, and a cumulative signal may
be detected, which is the combination of individual signals from
the 10 ligation products. Of course, in this example the actual
number of molecules probes, target fragments and ligation products
may be higher than 10 because there will usually be multiple copies
of each target fragment in a sample and the sample will be
contacted with multiple copies of each probe.
[0126] Method of signal amplification by multiplexing can be used
to detect nucleic acid species of interest in a sample, for example
where a nucleic acid species is a minor or trace component in a
complex nucleic acid sample. The amplification by multiplexing
enables reliable detection. This may be used for example to detect
microbial nucleic acid in samples, such as patient samples, for
diagnostic purposes. Samples may be probed with probes specific for
microbial nucleic acids of multiple species, to detect and identify
those present. This is useful for detection of agents of infectious
disease, such as bacteria, viruses and fungi. Specific nucleic acid
transcripts may be detected. Amplification by multiplexing may also
be used to quantify the nucleic acid species. By probing two or
more species of nucleic acid--one or more species of interest and
one or more reference nucleic acid species--the method enables
quantification of the relative amounts of the two species in the
sample. The method is especially useful when applied to the
detection or quantification of chromosomes or chromosomal loci, for
example for chromosomal copy number detection. An application of
particular value is the use of such methods for identifying
chromosomal defects, including for the diagnosis of cancers and
congenital aneuploidies. Use for non-invasive prenatal diagnosis
(NIPT) is specifically described.
[0127] A species of nucleic acid in a sample may be detected by
contacting the sample with a set of probes according to the present
invention, wherein each probe specifically recognises a distinct
target sequence in the species of nucleic acid to be detected. The
target sequences correspond to target fragments of the species of
nucleic acid. Recognition of each target sequence by each probe
generates a product of double ligation as described herein. A
cumulative signal can then be detected, this being a combination of
signals from the products. Detection of the signal indicates the
presence of the species of nucleic acid in the sample. The species
of nucleic acid may be quantified by quantifying the cumulative
signal to determine a signal level, wherein the signal level is
proportional to the quantity of the species of nucleic acid in the
sample, and thereby determining the quantity of the species of
nucleic acid in the sample. A first species of nucleic acid may be
quantified relative to a second or reference species of nucleic
acid by contacting the sample with a first set of probes and a
second set of probes, wherein the probes of the first set each
specifically recognise a distinct target sequence within the first
species of nucleic acid and wherein the probes of the second set
each specifically recognise a distinct target sequence within the
second or reference species of nucleic acid. First and second
cumulative signals are detected, the first cumulative signal being
a combination of individual signals from products generated by
probes of the first set recognising their target sequences, and the
second cumulative signal being a combination of individual signals
from products generated by probes of the second set recognising
their target sequences. The first and second signals are quantified
to determine first and second signal levels respectively, these
being proportional to the quantities of the first and second
species of nucleic acid in the sample. The relative quantities of
the first and second nucleic acid species in the sample may thus be
determined by comparing the first and second signal levels.
[0128] For example, the cumulative signal may be the summarised
enumeration of clonally amplified and/or labelled products of the
probes that recognise their target sequences, for example products
of rolling circle amplification, or a fluorescent signal emitted
from all the products where each product emits a fluorescent
signal. For quantifying relative amounts of multiple species of
nucleic acids, different signals are used for each species, for
example products of one set of probes may emit a different
wavelength or spectrum of fluorescence compared with products of
another set of probes.
[0129] A species of nucleic acid in a sample may be detected in a
method, comprising contacting the sample with a set of probes,
wherein each probe specifically recognises a distinct target
sequence within the species of nucleic acid to be detected,
providing denaturing conditions under which the target sequences in
the species of nucleic acid are single stranded, providing
conditions for annealing and ligation, under which conditions the
probes hybridise to their target sequences and generate ligation
products, and detecting a cumulative signal which is a combination
of individual signals from all ligation products, wherein detection
of the signal indicates the presence of the species of nucleic acid
in the sample.
[0130] Details of the sample, target nucleic acid, method steps
(e.g., denaturing, annealing, ligation) and probes are described
elsewhere herein. The method may comprise:
(i) providing a sample in which the species of nucleic acid is
fragmented into target fragments, (ii) providing denaturing
conditions under which the target fragments are single stranded
(iii) contacting the sample with a set of probes, wherein each
probe specifically recognises a distinct target sequence within the
species of nucleic acid to be detected, wherein the target
sequences are sequences of the target fragments, and wherein each
probe comprises
[0131] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0132] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream and downstream flanking sequences respectively,
(iv) providing annealing conditions under which the head and tail
sequences hybridise to the flanking sequences, and target
fragments, if present, hybridise to the target-complementary
sequence of the probes, thereby positioning the ends of the target
fragment in juxtaposition with the 5' end of the head sequence and
the 3' end of the tail sequence (v) providing conditions for
ligation so that, if a target fragment is present, the 3' end of
the target fragment is ligated to the 5' end of the head sequence
to form a first ligation junction, and the 5' end of the target
fragment is ligated to the 3' end of the tail sequence to form a
second ligation junction, producing a product of double ligation
comprising a continuous strand of nucleic acid comprising the head
and tail sequences and the target fragment, and (vi) detecting a
cumulative signal which is a combination of individual signals from
all the products,
[0133] wherein detection of the signal indicates the presence of
the species of nucleic acid in the sample.
[0134] The species of nucleic acid may be quantified by a method
comprising
[0135] (i) providing a sample in which the species of nucleic acid
is fragmented into target fragments
[0136] (ii) providing denaturing conditions under which the target
fragments are single stranded
[0137] (iii) contacting the sample with a set of probes, wherein
each probe specifically recognises a distinct target fragment of
the species of nucleic acid to be quantified, wherein each probe
comprises
[0138] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0139] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream and downstream flanking sequences respectively,
[0140] (iv) providing annealing conditions under which the head and
tail sequences hybridise to the flanking sequences, and target
fragments, if present, hybridise to the target-complementary
sequence of the probes, thereby positioning the ends of the target
fragment in juxtaposition with the 5' end of the head sequence and
the 3' end of the tail sequence
[0141] (v) providing conditions for ligation so that, if a target
fragment is present, the 3' end of the target fragment is ligated
to the 5' end of the head sequence to form a first ligation
junction, and the 5' end of the target fragment is ligated to the
3' end of the tail sequence to form a second ligation junction,
producing a product of double ligation comprising a continuous
strand of nucleic acid comprising the head and tail sequences and
the target fragment,
[0142] (vi) detecting a cumulative signal which is a combination of
individual signals from all ligation products, and
[0143] (vii) quantifying the cumulative signal to determine a
signal level, wherein the signal level is proportional to the
quantity of the species of nucleic acid in the sample, and
[0144] thereby determining the quantity of the species of nucleic
acid in the sample.
[0145] The method may be used to quantify a first species of
nucleic acid relative to a second species of nucleic acid in a
sample. The method may comprise:
[0146] (i) providing a sample in which the first and second species
of nucleic acid are fragmented into target fragments
[0147] (ii) providing denaturing conditions under which the target
fragments are single stranded
[0148] (iii) contacting the sample with a first set of probes and a
second set of probes, wherein the probes of the first set
specifically recognise distinct target fragments of the first
species of nucleic acid and wherein probes of the second set
specifically recognise distinct target fragments of the second
species of nucleic acid, wherein each probe comprises
[0149] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0150] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream and downstream flanking sequences respectively,
[0151] (iv) providing annealing conditions under which the head and
tail sequences hybridise to the flanking sequences, and target
fragments, if present, hybridise to the target-complementary
sequence of the probes, thereby positioning the ends of the target
fragment in juxtaposition with the 5' end of the head sequence and
the 3' end of the tail sequence
[0152] (v) providing conditions for ligation so that, if a target
fragment is present, the 3' end of the target fragment is ligated
to the 5' end of the head sequence to form a first ligation
junction, and the 5' end of the target fragment is ligated to the
3' end of the tail sequence to form a second ligation junction,
producing a product of double ligation comprising a continuous
strand of nucleic acid comprising the head and tail sequences and
the target fragment,
[0153] (vi) detecting a first cumulative signal which is a
combination of individual signals from the ligation products
generated by probes of the first set, and quantifying it to
determine a first signal level, wherein the first signal level is
proportional to the quantity of the first species of nucleic acid
in the sample,
[0154] (vii) detecting a second cumulative signal which is a
combination of individual signals from the ligation products
generated by probes of the second set, and quantifying it to
determine a second signal level, wherein the second signal level is
proportional to the quantity of the second species of nucleic acid
in the sample, and
[0155] (viii) comparing the first and second signal levels, thereby
determining the relative quantities of the first and second nucleic
acid species in the sample.
[0156] Generally, the number of probes will be at least ten for
each species of nucleic acid to be detected or quantified. The
number of course refers to the number of different probes, rather
than the absolute number of molecules of the probe. Accordingly,
the nucleic acid will contain at least ten different specific
target sequences, and the cumulative signal is a combination of
individual signals of at least ten unique probes, this cumulative
signal representing the one species of nucleic acid. High levels of
multiplex can be used to obtain correspondingly high levels of
signal amplification. For example, at least 100, at least 1,000, at
least 10,000 or even greater numbers of probes may be used for each
species of nucleic acid to be detected or quantified.
[0157] The method may comprise contacting a sample of fragmented
chromosomes with multiple sets of probes for binding multiple
fragments of two or more chromosomes, comprising:
[0158] a first set of probes for binding a plurality of target
fragments specific to a first chromosome, and
[0159] a second set of probes for binding a plurality of target
fragments specific to a second chromosome, and optionally
[0160] one or more further sets of probes for binding a plurality
of target fragments specific to one or more further
chromosomes.
[0161] Probes within a set can share a custom sequence which is
common to that set and differs from the custom sequences of probes
in other sets, allowing the probes from each set to be conveniently
identified. Each set of probes may contain at least 500, 600, 700,
800, 900 or at least 1,000 different probes for binding a plurality
of target fragments specific to the chromosome. For example, a
method may use 1,000 different targeting oligonucleotides to each
of chromosomes 21, 13 and 18, respectively, and three different
backbone oligonucleotides, one for each chromosome subset.
[0162] It is possible to determine the relative quantities of the
two or more chromosomes in a sample by detecting the products of
double ligation for each set of probes and detecting the relative
quantities of the custom sequences in said products.
[0163] Using probes where the targeting oligonucleotide and the
upstream and downstream oligonucleotides form a circle, motifs
encoding specific alleles and or loci can be incorporated in the
custom sequence in high multiplex.
Digital Karyotyping and Non-Invasive Pre-Natal Diagnostics
[0164] Some embodiments of the the present method can provides
particular advantages in fields where precise quantification of
target DNA is sought. This includes a number of nucleic acid based
diagnostic techniques. One such area is the analysis of cancer DNA
in a biological sample (e.g., blood) from a patient. Another such
area is non-invasive pre-natal diagnostics by analysis of cell free
DNA (NIPT).
[0165] A challenge with NIPT is that a large number of specific
genome fragments must be counted in order to achieve the
statistical confidence required to diagnose an abnormality
chromosomal aneuploidies (chromosome copy number differences).
Since the foetal DNA is mixed with the maternal DNA, making up
4-30% of the genetic material in a pregnant woman's bloodstream,
observing a chromosomal aneuploidy in the foetal DNA requires a
very precise measurement.
[0166] The probes described herein may be used for analysing free
circularising foetal DNA in samples of maternal blood. By using a
plurality of probes directed to different fragments of one
chromosome and a plurality of probes directed to different
fragments of a second chromosome, the probes enable an imbalance in
the relative number of the two chromosomes in the sample to be
determined with high confidence. This allows chromosomal
aneuploidies such as trisomy to be diagnosed from foetal DNA even
against the high background of the maternal DNA.
[0167] Probes described herein may be used for testing maternal
blood samples from pregnant women to detect foetal nucleic acid for
the diagnosis of chromosomal abnormalities such as trisomy, testing
patient samples for tumour DNA for the diagnosis or monitoring of
the presence of a tumour in the patient. Other uses include testing
samples of material for the presence of microbial nucleic acid,
where detection of the microbial nucleic acid indicates infection
of the material by the microbe, which may be an infectious agent
such as a bacterium, virus or fungus. The sample may be a tissue or
blood sample from a patient.
[0168] More generally, by using hundreds or thousands of different
probes, the present method can achieve high precision by detecting
hundreds or thousands of specific nucleic acid fragments, providing
advantages across a range of diagnostic applications. Detecting a
multitude of DNA fragments from the chromosome or chromosomal loci
associated with a particular disease enables the amount of that
chromosome or locus to be measured relative to a control chromosome
or locus, so that even slight differences in a sample can be
confidently detected.
[0169] By analysing short target fragments a large proportion of
the highly fragmented cell free DNA in maternal blood can be
analysed with high efficiency. This is important since very low
amounts of cell free DNA are available in maternal blood.
[0170] A method of quantifying a first chromosome or chromosomal
locus relative to a second chromosome or chromosomal locus in a
sample of nucleic acid obtained from an individual may comprise
[0171] (i) providing a sample in which the first and second
chromosomes or chromosomal loci are fragmented into target
fragments
[0172] (ii) providing denaturing conditions under which the target
fragments are single stranded
[0173] (iii) contacting the sample with a first set of probes and a
second set of probes, wherein the probes of the first set
specifically recognise distinct target fragments of the first
chromosome and wherein probes of the second set specifically
recognise distinct target fragments of the second chromosome,
wherein each probe comprises
[0174] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0175] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream and downstream flanking sequences respectively,
[0176] (iv) providing annealing conditions under which the head and
tail sequences hybridise to the flanking sequences, and target
fragments, if present, hybridise to the target-complementary
sequence of the probes, thereby positioning the ends of the target
fragment in juxtaposition with the 5' end of the head sequence and
the 3' end of the tail sequence
[0177] (v) providing conditions for ligation so that, if a target
fragment is present, the 3' end of the target fragment is ligated
to the 5' end of the head sequence to form a first ligation
junction, and the 5' end of the target fragment is ligated to the
3' end of the tail sequence to form a second ligation junction,
producing a product of double ligation comprising a continuous
strand of nucleic acid comprising the head and tail sequences and
the target fragment,
[0178] (vi) detecting a first cumulative signal which is a
combination of individual signals from the ligation products
generated by probes of the first set, and quantifying it to
determine a first signal level, wherein the first signal level is
proportional to the quantity of the first chromosome or chromosomal
locus in the sample,
[0179] (vii) detecting a second cumulative signal which is a
combination of individual signals from the ligation products
generated by probes of the second set, and quantifying it to
determine a second signal level, wherein the second signal level is
proportional to the quantity of the second chromosome or
chromosomal locus in the sample, and
[0180] (viii) comparing the first and second signal levels, thereby
determining the relative quantities of the first and second
chromosomes or chromosomal loci in the sample.
[0181] The method may be used for diagnosing aneuploidy (e.g.
trisomy) in a foetus, where the sample of nucleic acid is a sample
obtained from maternal blood and contains cell free foetal DNA
mixed with maternal DNA, and wherein an unequal ratio of the first
and second signal levels is indicative of aneuploidy (e.g.
trisomy).
Probes
[0182] Further aspects include probes suitable for use in the
present method. Examples of probes and their features have already
been described above. Some further features and examples are
described here.
[0183] The probe nucleic acid is preferably DNA. However, it may be
another nucleic acid, naturally occurring or not. The standard
bases of DNA are A, T, C and G, but probe nucleic acid may
optionally include non-standard nucleotides.
[0184] In general, a probe according to the present invention
comprises a targeting oligonucleotide and head and tail sequences.
The head and tail sequences may be part of the targeting
oligonucleotide, or one or both of them may be on a different
nucleic acid molecule. Optionally, the probe comprises the
targeting oligonucleotide, a backbone oligonucleotide comprising
the head sequence and a backbone oligonucleotide comprising the
tail sequence. A probe therefore may comprises one, two or three
nucleic acid molecules in its non-ligated form.
[0185] The targeting oligonucleotide is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide. The head and tail sequences have free 5' and 3'
ends respectively, and are complementary to the upstream and
downstream flanking sequences respectively. Under annealing
conditions in the presence of the target fragment, the head and
tail sequences hybridise to the flanking sequences, defining a gap
between the 5' end of the head sequence and the 3' end of the tail
sequence, wherein the target fragment hybridises to the
target-complementary sequence in the gap, thereby positioning the
ends of the target fragment in juxtaposition with the 5' end of the
head sequence and the 3' end of the tail sequences.
[0186] The probes may be designed so that hybridisation of the
target fragment in the gap completes a circle of nucleic acid, the
circle comprising the target fragment and the head and tail
sequences.
[0187] The head and/or tail sequence of the probe is preferably
joined to a custom sequence which is not complementary to other
regions of the probe or to the target fragment.
[0188] In some embodiments of the probe, a single nucleic acid
molecule comprises the head and tail sequences.
[0189] The head and tail sequences may be separate from the
targeting oligonucleotide so that they bind in trans to the
flanking sequences. For example, the head and tail sequences may be
at 5' and 3' ends respectively of a backbone oligonucleotide. A
custom sequence can be included between the head and tail sequences
of the backbone oligonucleotide. An example of such a probe is
shown in FIG. 1 and FIG. 3. Alternatively, the head and tail
sequences of the backbone oligonucleotide may be adjacent, with no
intervening nucleotide sequence. In such a case, the flanking
sequences of the targeting oligonucleotide hybridise along the full
length of the backbone oligonucleotide and may circularise it.
[0190] The probes may be designed so that the head sequence is a 5'
end of the targeting oligonucleotide and/or the tail sequence is a
3' end of the targeting oligonucleotide, so that hybridisation of
the target fragment in the gap completes a strand of nucleic acid
comprising the target fragment, the head and tail sequences, the
target complementary sequence and the flanking sequences. The head
and tail sequences may be at ends of the targeting oligonucleotide
and bind in cis to the flanking sequences. An example of such a
probe is shown in FIG. 4. In this version of the probe, the head
and tail sequences and the target complementary sequence all become
circularised with the target fragment. Custom sequences can be
positioned in the loops of the oligonucleotide. The probe nucleic
acid is relatively long but has the advantage of joining the
oligonucleotide structure into one molecule that is pre-assembled
and does not require hybridisation of different probe nucleic acid
molecules.
[0191] Probes can also be designed with a backbone oligonucleotide,
which is a separate molecule of nucleic acid from the targeting
oligonucleotide. The tail sequence can be a 3' end of the targeting
oligonucleotide and the head sequence a 5' end of a backbone
oligonucleotide. Alternatively the head sequence can be a 5' end of
the targeting oligonucleotide and the tail sequence a 3' end of a
backbone oligonucleotide. A custom sequence can be introduced in
the targeting oligonucleotide, for example to provide a loop
between the head or tail sequence and the flanking sequence. An
advantage with using this probe approach is that a detection
sequence can be introduced in the loop and is associated with the
target complementary sequence, which can be advantageous for
multiplex methods, especially higher multiplexes with high-plex
detection schemes. The backbone oligonucleotide can further
comprise a custom sequence. By providing the probe in two
oligonucleotides, the probe nucleic acid molecules are shorter than
the single oligonucleotide version but maintain the same
function.
[0192] Another design of the probe provides the head and tail
sequences on two backbone oligonucleotides. Thus, the probe
comprises
[0193] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide,
[0194] a backbone oligonucleotide comprising a head sequence having
a free 5' end, and
[0195] a backbone oligonucleotide comprising a tail sequence having
a free 3' end,
[0196] wherein the head and tail oligonucleotide sequences are
complementary to the upstream and downstream flanking sequences
respectively.
[0197] One backbone oligonucleotide may carry a capture moiety, in
which case the other backbone oligonucleotide is used for detection
and may carry a heterogeneous label. One or both backbone
oligonucleotides may further comprise a custom sequence.
Alternatively or additionally, the targeting oligonucleotide may
include a custom sequence.
[0198] Under annealing conditions in the presence of the target
fragment, the head and tail sequences hybridise to the flanking
sequences, defining a gap between the 5' end of the head sequence
and the 3' end of the tail sequence, wherein the target fragment
hybridises to the target-complementary sequence in the gap, thereby
positioning the ends of the target fragment in juxtaposition with
the 5' end of the head sequence and the 3' end of the tail
sequences. Hybridisation of the target fragment in the gap
completes a strand of nucleic acid comprising the target fragment
and the head and tail sequences. The strand carries the capture
moiety and the label, permitting detection using the capture/detect
methods described elsewhere herein.
Kits and Sets of Probes
[0199] A further aspect of this disclosure is set of probes for
binding single stranded target nucleic acid fragments, comprising a
plurality of probes, the probes having a plurality of different
target-complementary sequences for the binding multiple different
target fragments.
[0200] The set of probes may be for binding multiple fragments of a
human chromosome, wherein each probe in the set is for binding a
different target fragment specific to that chromosome. Such probes
may all include a common custom sequence, as part of the targeting
oligonucleotide or as part of a backbone oligonucleotide.
[0201] Multiple sets of probes can be provided for binding
different fragments of two or more human chromosomes,
comprising:
[0202] a first set of probes for binding a plurality of target
fragments specific to a first chromosome, and
[0203] a second set of probes for binding a plurality of target
fragments specific to a second chromosome, and optionally
[0204] one or more further sets of probes for binding a plurality
of target fragments specific to one or more further chromosomes.
The probes within a set can share a custom sequence which is common
to that set and differs from the custom sequences of probes in
other sets.
[0205] Kits can also be provided, comprising sets of probes in
solution in one or more containers.
Uses
[0206] The probes, sets of probes and kits described herein may be
used for testing samples for the presence of target nucleic acid
fragments. They may be used for identifying the presence of a
defined target fragment in a sample of fragmented nucleic acid in
vitro.
[0207] One aspect includes the use of a probe for testing a sample
for the presence of a target single stranded nucleic acid
fragment,
[0208] wherein the probe comprises a targeting oligonucleotide
containing a sequence which is the exact complement of the target
fragment, and head and tail oligonucleotide sequences which
hybridise adjacent to the target fragment on the targeting
oligonucleotide,
[0209] wherein hybridisation between the target fragment and the
probe templates the target fragment for ligation to the head and
tail sequences.
[0210] Examples of such probes and of their use in methods of
testing samples are described in more detail elsewhere herein. Uses
include testing maternal blood samples from pregnant women to
detect foetal nucleic acid for the diagnosis of chromosomal
abnormalities such as trisomy, and testing patient samples for
tumour DNA for the diagnosis or monitoring of the presence of a
tumour in the patient. Other uses include testing samples of
material for the presence of microbial nucleic acid, where
detection of the microbial nucleic acid indicates infection of the
material by the microbe, which may be an infectious agent such as a
bacterium, virus or fungus. The sample may be a tissue or blood
sample from a patient.
EXAMPLES
[0211] The following example is provided in order to demonstrate
and further illustrate certain embodiments and aspects of the
present invention and are not to be construed as limiting the scope
thereof.
Example 1
[0212] A protocol suitable for performing the method illustrated in
FIG. 1 is as follows: 1) 10 ng of DNA is digested with 1 unit of
restriction enzyme in corresponding compatible restriction enzyme
buffer. The reaction is incubated in 37 C for 1 h, followed by
enzymatic deactivation at 80 C for 20 min. 2) The DNA fragments are
denatured to single stranded fragments at 95 C for 10 min and mixed
with probes and ligase to form circles. The probe pool are added in
10 pM individual concentration along with 1 U of Ampligase
(Epicentre) and incubated at 55 C for 1 h in ligase buffer. 3) 1 U
Exonuclease is added to remove non-reacted probes and fragments. I
U of Lambda exonuclease (Epicentre) is added at 37 C for 1 h in
corresponding exonuclease buffer followed by enzyme inactivation at
80 C for 20 min. 4) The remaining circles are amplified by RCA. 1 U
of phi29 polymerase (New England Biolabs) is added in corresponding
phi29 buffer and nucleotides (dNTPs) at 37 C for 1 h.
Example 2
[0213] A protocol suitable for performing the method illustrated in
FIG. 2 is as follows: 1) 10 ng of DNA is digested with 1 unit of
restriction enzyme in corresponding compatible restriction enzyme
buffer. The reaction is incubated in 37 C for 1 h, followed by
enzymatic deactivation at 80 C for 20 min. 2) The DNA fragments are
denatured to single stranded fragments at 95 C for 10 min and mixed
with probes and ligase to form linear ligation products. The probe
pool are added in 10 pM individual concentration along with 1 U of
Ampligase (Epicentre) and incubated at 55 C for 1 h in ligase
buffer. 3) The ligation product is captured on magnetic
streptavidin beads. To remove non-reacted probes and fragments, the
solution is mixed with 10 ml M-280 streptavidin coated magnetic
beads (Invitrogen) in Tris-HCl (pH 7.5), 3.5 mM EDTA and 0.07%
Tween-20 in a final volume of 200 ml, and incubated at room
temperature for 15 min. After incubation, the beads are collected
using a ring magnet and supernatant removed.
Example 3
Materials and Methods
[0214] Sample Preparation:
[0215] 10 ml blood was collected from each subject into a cell-free
DNA tube (Streck, Omaha, Nebr.). Plasma was isolated from blood by
a double centrifugation protocol (1600 g for 10 min, followed by 16
000 g for 10 min, after a tube transfer following the first spin).
cfDNA was isolated by the Qiagen ccf nucleic acid kit (Qiagen,
Hilden, Germany) according to the manufacturer's protocol. The
resulting DNA was eluted in 50 ul of buffer (part of the Qiagen
kit).
[0216] Probe and Backbone Design:
[0217] The multiplexed probe technology herein described enables
specific and simultaneous amplification of thousands of chromosomal
fragments. Probes were designed to capture 2500-5000 fragments
(targets) from each of chromosomes 21, 18, and 13. Targets were
selected to have unique sequence in the genome, uniformed AT/GC
composition, not include known polymorphism nor CNVs in target
sequence, and a size between 18-35 bp. Probes targeting 2500
fragments from each chromosome 13 and 18 were pooled together with
5000 probes targeting fragments from chromosome 21 to create a
single oligo probe pool.
Example sequence of probes, "N" represents target complementary
sequence:
TABLE-US-00001 (SEQ ID NO: 1)
ATGTGACCCTTCCGTCTGTTGAGTTAGGCCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTCGTGCCTTGTCATTCGGGAGCACTAACTGCTG
[0218] The backbones, with head and tail sequences complementary to
the ends of the probe, were designed to include sequence motifs for
both sequencing and digital counting. Two backbones were used in
the experiments outlined in the result section; one complementary
to probes targeting chromosome 13 and 18:
(/5Phos/CGCACACGATTAAGGTCCAGTCACAGGCAGAGATCGGAAGAGCGTCGTGTAGGG
AAAGAGTGTNNNNNNNNNNGTGTAGATCTCGGTGGTCGCCGTATCATTTCATGCTGCTAAC
GGTCGAGTCGGACAGGTGGCTCCACTAAATAGACGCA); SEQ ID NO:2, and one
backbone targeting chromosome 21:
TABLE-US-00002 (/5Phos/GGCCTAACTCAACAGACGGAAGGGTCACATAGATCGGAAGAG
CGTCGTGTAGGGAAAGAGTGTNNNNNNNNNNGTGTAGATCTCGGTGGTCG
CCGTATCATTTCATGCTGCTAACGGTCGAGCAGTTAGTGCTCCCGAATGA CAAGGCACGA; SEQ
ID NO: 3).
[0219] Biochemistry Probe Protocol:
[0220] 50 ul of purified cfDNA was digested with 5 U of MseI (New
England Biolabs) in 1.times.NEB4 buffer (New England Biolabs) and
1.times.BSA in a total volume of 55 ul at 37 C in 30 min followed
by heat inactivation at 65 C in 20 min. The digested DNA was then
mix with ligation mix along with probes and backbones. The 55 ul of
digested DNA was mixed with probes (1 pM/probe), backbones (60 nM
each), 1.times. ligation buffer (Epicentre), 100 U of Ampligase
(Epicentre), 1 mM NAD, and 5 mM Mg.sup.2+ to a total volume of 70
ul. The digested fragments were first denatured to single stranded
DNA at 95 C in 5 min followed by 55 C hybridization and ligation in
16 h. The ligation mix was then treated with exonucleases to remove
any remaining linear DNA molecules. The ligation reaction was mixed
with 20 U of ExoI (NEB) and 5 U of ExoIII (NEB) and 1.times.BSA tot
total volume of 75 ul at 37 C for 60 min followed by heat
inactivation at 65 C for 10 min.
[0221] Analysis:
[0222] For sequencing analysis, the exo treated circles was
amplified with sequencing primers complementary to the Illumina
sequencing instrument and subsequently loaded on the Illumina Miseq
instrument according to manufacturers protocol.
[0223] For digital analysis, the exo treated reactions was
subjected to a rolling circle amplification reaction (RCA) to
generate discrete DNA objects of concatemeric copies of the circle.
37.5 ul of exo treated circles were mixed with 4 mM DTT, 3 U of
phi29 polymerase (NEB), 0.1 uM primer, 1 mM dNTP mix (NEB) and
1.times.BSA in a total volume in 50 ul, and incubated at 37 C for 1
h followed by a heat inactivation at 65 C for 10 min. The RCA
reaction was then labeled with fluorescently labeled
oligonucleotides complementary to the backbone sequence. 50 ul of
RCA products was mixed with 0.1% Tween 20 (Sigma), 5 nM labeled
oligonucleotides, and 2.times.SSC (Sigma) in a total volume of 100
ul. The labeled RCA-products were finally deposited on a microscope
slide coated with Poly-lysine (Sigma) and counted in a fluorescent
microscope.
Results
[0224] The probe method herein described was demonstrated on
Illumina sequencing and a digital counting system. To demonstrate
the performance of the probe method, a DNA sample with trisomy 21
was mixed with DNA extracted from normal plasma samples (3-5 ml
plasma) in different concentrations. The samples was then carried
through the probe method and evaluated by sequencing.
[0225] For the results shown in FIG. 8, 100 ng of cell line DNA was
subjected to the protocol described above. 10,000 probes were mixed
in a pool to specifically circularize 10,000 corresponding
chromosomal fragments from chromosome 13, 18, and 21. The 10,000
resulting circles were then amplified with Illumina-corresponding
PCR primers and analyzed on gel prior sequencing. Lane 1
corresponds to DNA ladder, lane 2 the DNA sample after digestion,
and lane 3 the PCR product with 10,000 amplified fragments.
[0226] For the results shown in FIG. 9, 12 normal plasma samples
were analyzed in parallel with samples carry DNA with trisomy 21 in
different concentrations. DNA were extracted and processed through
the 10K-plex probe protocol and finally sequenced on Illumina
sequencer. Using a confidence interval providing 99% specificity,
the positive samples are detected with a 90% sensitivity based on
the estimated normal distributions.
[0227] To demonstrate the principle of converting targeted
fragments to labeled DNA objects, 10% of DNA with trisomy 21 was
added to 20 ng normal cell line DNA and carried through the probe
method. The resulting labeled RCA-products were randomly deposited
on a microscope slide and counted. Probes targeting fragments
derived from chromosome 21 was labeled with one color and fragments
derived from Chr. 13 and 18 with a reference color. These results
are shown in FIG. 10. Panel (A) of FIG. 10 shows an image from a
microscope, showing labeled and detected RCA-products. By labeling
all fragments from chromosome 13 with one fluorophore and fragments
from a reference chromosome with a second fluorophore, a ratio
measurement can be achieve. Panel (B): 20 ng of DNA processed
through the 10K-plex probe protocol and converted to labeled
RCA-products. The RCA-products were analyzed in parallel with
samples carry a 10% addition of trisomy 21 DNA. 12 normal DNA
samples (sample #1-12) were analyzed in parallel with three
positive samples (sample #13-15).
FURTHER DESCRIPTION
[0228] The following clauses are part of the description.
1. A method of testing a sample for the presence of a target
nucleic acid fragment, comprising (i) providing a sample of
fragmented nucleic acid (ii) providing denaturing conditions under
which the target fragment is single stranded (iii) contacting the
sample with a nucleic acid probe comprising
[0229] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0230] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream and downstream flanking sequences respectively,
(iv) providing annealing conditions under which the head and tail
sequences hybridise to the flanking sequences, and the target
fragment, if present, hybridises to the target-complementary
sequence, thereby positioning the ends of the target fragment in
juxtaposition with the 5' end of the head sequence and the 3' end
of the tail sequence (v) providing conditions for ligation so that,
if the target fragment is present, the 3' end of the target
fragment is ligated to the 5' end of the head sequence to form a
first ligation junction, and the 5' end of the target fragment is
ligated to the 3' end of the tail sequence to form a second
ligation junction, producing a product of double ligation
comprising a continuous strand of nucleic acid comprising the head
and tail sequences and the target fragment, and (vi) detecting
whether the product of double ligation is present,
[0231] wherein detecting the product of double ligation indicates
the presence of the target fragment in the sample.
2. A method according to clause 1, wherein the sample of fragmented
nucleic acid is a restriction enzyme digest and the target fragment
is a restriction fragment. 3. A method according to clause 1 or
clause 2, wherein the 5' end of the head sequence and the 3' end of
the target fragment hybridise to adjacent nucleotides of the
targeting oligonucleotide, and the 3' end of the tail sequence and
the 5' end of the target fragment hybridise to adjacent nucleotides
of the targeting oligonucleotide. 4. A method according to any of
the preceding clauses, wherein the step of detecting the product of
double ligation comprises providing conditions for amplification
across the first and second ligation junctions of the continuous
strand of nucleic acid, and detecting whether an amplification
product is present. 5. A method according to any of the preceding
clauses, wherein the continuous strand of nucleic acid comprising
the head and tail sequences and the target fragment is a circle of
nucleic acid. 6. A method according to clause 5, wherein the step
of detecting the product of double ligation comprises providing
conditions for rolling circle replication and detecting whether a
product of rolling circle replication is present. 7. A method
according to clause 6, wherein the rolling circle replication is
hyper branched rolling circle replication. 8. A method according to
any of clauses 5 to 7, wherein the probe comprises the head and
tail sequences on one nucleic acid molecule. 9. A method according
to clause 8, wherein the probe comprises a backbone oligonucleotide
having the head and tail sequences at its 5' end 3' ends
respectively, wherein the head and tail sequences of the backbone
oligonucleotide bind in trans to the flanking sequences of the
targeting oligonucleotide under the annealing conditions. 10. A
method according to clause 9, wherein the backbone oligonucleotide
comprises a custom sequence between the head and tail sequences,
wherein the custom sequence is not complementary to other regions
of the probe or to the target fragment. 11. A method according to
clause 9, wherein the head and tail sequences of the backbone
oligonucleotide are adjacent. 12. A method according to any of
clauses 5 to 8, wherein the head and tail sequences are at ends of
the targeting oligonucleotide and bind in cis to the flanking
sequences under the annealing conditions. 13. A method according to
clause 12, wherein the targeting oligonucleotide comprises a custom
sequence between the targeting oligonucleotide and the head and/or
tail sequence, wherein the custom sequence is not complementary to
other regions of the probe or to the target fragment. 14. A method
according to any of clauses 1 to 7, wherein the tail sequence is at
the 3' end of the targeting oligonucleotide, and the probe
comprises a backbone oligonucleotide having the head sequence at
its 5' end,
[0232] wherein under the annealing conditions the tail sequence
binds in cis to the downstream flanking sequence of the targeting
oligonucleotide, and the head sequence of the backbone
oligonucleotide binds in trans to the upstream flanking sequence of
the targeting oligonucleotide.
15. A method according to clause 14, wherein the backbone
oligonucleotide comprises a pair of inverted repeat sequences,
wherein
[0233] under the annealing conditions the inverted repeat sequences
form a hairpin structure, thereby positioning the 3' end of the
backbone oligonucleotide in juxtaposition with the 5' end of the
targeting oligonucleotide, and wherein
[0234] under the conditions for ligation, the 5' end of the
targeting oligonucleotide is ligated to the 3' end of the backbone
oligonucleotide, so that the product of double ligation is a circle
of nucleic acid comprising the targeting oligonucleotide, the
target fragment and the backbone oligonucleotide.
16. A method according to any of clauses 1 to 7, wherein the head
sequence is at the 5' end of the targeting oligonucleotide, and the
probe comprises a backbone oligonucleotide having the tail sequence
at its 3' end,
[0235] wherein under the annealing conditions the head sequence
binds in cis to the upstream flanking sequence of the targeting
oligonucleotide, and the tail sequence of the backbone
oligonucleotide binds in trans to the downstream flanking sequence
of the targeting oligonucleotide.
17. A method according to clause 16, wherein the backbone
oligonucleotide comprises a pair of inverted repeat sequences,
wherein
[0236] under the annealing conditions the inverted repeat sequences
form a hairpin structure, thereby positioning the 5' end of the
backbone oligonucleotide in juxtaposition with the 3' end of the
targeting oligonucleotide, and wherein
[0237] under the conditions for ligation, the 3' end of the
targeting oligonucleotide is ligated to the 5' end of the backbone
oligonucleotide, so that the product of double ligation is a circle
of nucleic acid comprising the targeting oligonucleotide, the
target fragment and the backbone oligonucleotide.
18. A method according to any of clauses 14 to 17, wherein the
backbone oligonucleotide comprises a custom sequence between the
inverted repeat sequence, so that under the annealing conditions
the backbone oligonucleotide forms a hairpin loop. 19. A method
according to any of clauses 1 to 4, wherein the continuous strand
of nucleic acid comprising the head and tail sequences and the
target fragment is a linear strand of nucleic acid. 20. A method
according to clause 19, wherein the tail sequence is at the 3' end
of the targeting oligonucleotide, and the probe comprises a
backbone oligonucleotide having the head sequence at its 5'
end,
[0238] wherein under the annealing conditions the tail sequence
binds in cis to the downstream flanking sequence of the targeting
oligonucleotide, and the head sequence of the backbone
oligonucleotide binds in trans to the upstream flanking sequence of
the targeting oligonucleotide.
21. A method according to any of clauses 14, 15 or 20, wherein the
targeting oligonucleotide comprises a custom sequence between the
downstream flanking sequence and the tail sequence, so that under
the annealing conditions the targeting oligonucleotide forms a
hairpin loop. 22. A method according clause 19, wherein the head
sequence is at the 5' end of the targeting oligonucleotide, and the
probe comprises a backbone oligonucleotide having the tail sequence
at its 3' end,
[0239] wherein under the annealing conditions the head sequence
binds in cis to the upstream flanking sequence of the targeting
oligonucleotide, and the tail sequence of the backbone
oligonucleotide binds in trans to the downstream flanking sequence
of the targeting oligonucleotide.
23. A method according to any of clauses 16, 17 or 22, wherein the
targeting oligonucleotide comprises a custom sequence between the
head sequence and the upstream flanking sequence, so that under the
annealing conditions the targeting oligonucleotide forms a hairpin
loop. 24. A method according to any of clauses 14 to 18 or 20 to
23, wherein the backbone oligonucleotide carries a capture moiety.
25. A method according to clause 19, wherein the probe comprises a
backbone oligonucleotide comprising a head sequence having a free
5' end, and a backbone oligonucleotide comprising a tail sequence
having a free 3' end, wherein under the annealing conditions the
head and tail sequences bind in trans to the flanking sequences of
the targeting oligonucleotide. 26. A method according to clause 25,
wherein one or both backbone oligonucleotides further comprise a
custom sequence, wherein the custom sequence is not complementary
to other regions of the probe or to the target fragment. 27. A
method according to clause 25 or clause 26, wherein one of the
backbone oligonucleotides carries a capture moiety. 28. A method
according to clause 27, wherein the other backbone oligonucleotide
carries a heterogeneous label. 29. A method according to clause 28,
wherein the label is a fluorophore. 30. A method according to
clause 24 or any of clauses 27 to 29, wherein the step of detecting
whether the product of double ligation is present comprises
capturing the backbone oligonucleotide on a substrate via the
capture moiety, washing the substrate to remove unligated probes
and retaining a captured fraction comprising the substrate and
captured backbone oligonucleotide, and testing for the presence of
the product of double ligation in the captured fraction. 31. A
method according to clause 28 or clause 29, wherein the step of
detecting whether the product of double ligation is present
comprises capturing the backbone oligonucleotide on a substrate via
the capture moiety, washing the substrate to remove unligated
probes and retaining a captured fraction comprising the substrate
and captured backbone oligonucleotide, and testing for the presence
of the label in the captured fraction. 32. A method according to
clause 24 or any of clauses 27 to 31, wherein the capture moiety is
biotin. 33. A method according to any of the preceding clauses,
wherein the target-complementary sequence has a length of 10 to 30
nucleotides. 34. A method according to any of the preceding
clauses, wherein the target-complementary sequence has fewer than 5
base pair mismatches with the target fragment. 35. A method
according to clause 34, wherein the target-complementary sequence
is the exact complement of the target fragment. 36. A method
according to any of the preceding clauses, wherein the flanking
sequences each have a length of 10 to 30 nucleotides. 37. A method
according to any of the preceding clauses, wherein the upstream and
downstream flanking sequences are different from each other. 38. A
method according to any of the preceding clauses, wherein the head
sequence has fewer than 5 base pair mismatches with the upstream
flanking sequence and the tail sequence has fewer than 5 base pair
mismatches with the downstream flanking sequence. 39. A method
according to clause 38, wherein the head sequence is the exact
complement of the upstream flanking sequence and the tail sequence
is the exact complement of the downstream flanking sequence. 40. A
method according to any of the preceding clauses, wherein the
targeting oligonucleotide is linear. 41. A method according to any
of the preceding clauses, wherein the sample is a sample of
fragmented human chromosomes and the target fragment is a human
genome fragment specific to one chromosome. 42. A method according
to clause 41, wherein the target fragment is specific to one locus
of the human genome. 43. A method according to any of the preceding
clauses, wherein the probe nucleic acid is DNA. 44. A method
according to any of the preceding clauses, wherein the method
comprises multiplex testing for multiple different target nucleic
acid fragments using a plurality of the probes in parallel. 45. A
method according to clause 44, wherein the method comprises
contacting a sample of fragmented chromosomes with a set of probes
for binding multiple fragments of a chromosome, wherein each probe
in the set is for binding a different target fragment specific to
that chromosome. 46. A method according to clause 45, wherein the
probes share a common custom sequence. 47. A method according to
clause 44, wherein the method comprises contacting a sample of
fragmented chromosomes with sets of probes for binding multiple
fragments of two or more chromosomes, wherein the sets of probes
comprise:
[0240] a first set of probes for binding a plurality of target
fragments specific to a first chromosome, and
[0241] a second set of probes for binding a plurality of target
fragments specific to a second chromosome, and optionally
[0242] one or more further sets of probes for binding a plurality
of target fragments specific to one or more further
chromosomes.
48. A method according to clause 47, wherein each set of probes
comprises at least 500 different probes for binding a plurality of
target fragments specific to the chromosome. 49. A method according
to clause 47 or clause 48, wherein the probes within a set share a
custom sequence which is common to that subset and differs from the
custom sequences of probes in other sets. 50. A method according to
clause 49, comprising determining the relative quantities of the
two or more chromosomes in the sample by detecting the products of
double ligation for each set of probes and detecting the relative
quantities of the custom sequences in said products. 51. A method
according to any of clauses 45 to 50, wherein the chromosome or
chromosomes are human. 52. A nucleic acid probe for binding a
single stranded target nucleic acid fragment, wherein the probe
comprises
[0243] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0244] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream and downstream flanking sequences respectively
[0245] so that under annealing conditions in the presence of the
target fragment, the head and tail sequences hybridise to the
flanking sequences, defining a gap between the 5' end of the head
sequence and the 3' end of the tail sequence, wherein the target
fragment hybridises to the target-complementary sequence in the
gap, thereby positioning the ends of the target fragment in
juxtaposition with the 5' end of the head sequence and the 3' end
of the tail sequences, and wherein
[0246] hybridisation of the target fragment in the gap completes a
circle of nucleic acid, the circle comprising the target fragment
and the head and tail sequences.
53. A nucleic acid probe according to clause 52, wherein the head
and/or tail sequence is joined to a custom sequence, wherein the
custom sequence is not complementary to other regions of the probe
or to the target fragment. 54. A nucleic acid probe according to
clause 52 or clause 53, wherein a single nucleic acid molecule
comprises the head and tail sequences. 55. A probe according to
clause 52 or clause 53, wherein the head and tail sequences are
separate from the targeting oligonucleotide and bind in trans to
the flanking sequences. 56. A probe according to clause 55, wherein
the head and tail sequences are at 5' and 3' ends respectively of a
backbone oligonucleotide. 57. A probe according to clause 56,
wherein the backbone oligonucleotide comprises a custom sequence
between the head and tail sequences, wherein the custom sequence is
not complementary to other regions of the probe or to the target
fragment. 58. A probe according to clause 56, wherein the head and
tail sequences of the backbone oligonucleotide are adjacent. 59. A
nucleic acid probe for binding a single stranded target nucleic
acid fragment, wherein the probe comprises
[0247] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0248] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail oligonucleotide sequences
are complementary to the upstream and downstream flanking sequences
respectively
[0249] so that under annealing conditions in the presence of the
target fragment, the head and tail sequences hybridise to the
flanking sequences, defining a gap between the 5' end of the head
sequence and the 3' end of the tail sequence, wherein the target
fragment hybridises to the target-complementary sequence in the
gap, thereby positioning the ends of the target fragment in
juxtaposition with the 5' end of the head sequence and the 3' end
of the tail sequences, and wherein
[0250] the head sequence is a 5' end of the targeting
oligonucleotide and/or the tail sequence is a 3' end of the
targeting oligonucleotide, so that hybridisation of the target
fragment in the gap completes a strand of nucleic acid comprising
the target fragment, the head and tail sequences, the target
complementary sequence and the flanking sequences.
60. A probe according to clause 52 or clause 59, wherein the head
and tail sequences are at ends of the targeting oligonucleotide and
bind in cis to the flanking sequences. 61. A probe according to
clause 52 or clause 59, wherein the tail sequence is a 3' end of
the targeting oligonucleotide and the head sequence is a 5' end of
a backbone oligonucleotide separate from the targeting
oligonucleotide. 62. A probe according to clause 52 or clause 59,
wherein the head sequence is a 5' end of the targeting
oligonucleotide and the tail sequence is a 3' end of a backbone
oligonucleotide separate from the targeting oligonucleotide. 63. A
probe according to clause 61 or clause 62, wherein the backbone
oligonucleotide further comprises a custom sequence, wherein the
custom sequence is not complementary to other regions of the probe
or to the target fragment. 64. A nucleic acid probe for binding a
single stranded target nucleic acid fragment, wherein the probe
comprises
[0251] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide,
[0252] a backbone oligonucleotide comprising a head sequence having
a free 5' end, and
[0253] a backbone oligonucleotide comprising a tail sequence having
a free 3' end,
[0254] wherein the head and tail oligonucleotide sequences are
complementary to the upstream and downstream flanking sequences
respectively, and wherein
[0255] one backbone oligonucleotide carries a capture moiety and
the other backbone oligonucleotide carries a heterogeneous
label,
[0256] so that under annealing conditions in the presence of the
target fragment, the head and tail sequences hybridise to the
flanking sequences, defining a gap between the 5' end of the head
sequence and the 3' end of the tail sequence, wherein the target
fragment hybridises to the target-complementary sequence in the
gap, thereby positioning the ends of the target fragment in
juxtaposition with the 5' end of the head sequence and the 3' end
of the tail sequences, and wherein
[0257] hybridisation of the target fragment in the gap completes a
strand of nucleic acid comprising the target fragment and the head
and tail sequences, wherein the strand carries the capture moiety
and the label.
65. A probe according to clause 64, wherein the capture moiety is
biotin. 66. A probe according to clause 64 or clause 65, wherein
the label is a fluorophore. 67. A probe according to any of clauses
64 to 66, wherein one or both backbone oligonucleotides further
comprise a custom sequence, wherein the custom sequence is not
complementary to other regions of the probe or to the target
fragment. 68. A probe according to any of clauses 52 to 67, wherein
the targeting oligonucleotide further comprises a custom sequence
which is not complementary to other regions of the probe or to the
target fragment. 69. A probe according to any of the preceding
clauses, wherein the target-complementary sequence has a length of
10 to 30 nucleotides. 70. A probe according to any of the preceding
clauses, wherein the target-complementary sequence has fewer than 5
base pair mismatches with the target fragment. 71. A probe
according to clause 70, wherein the target-complementary sequence
is the exact complement of the target fragment. 72. A probe
according to any of clauses 52 to 71, wherein the flanking
sequences each have a length of 10 to 30 nucleotides. 73. A probe
according to any of clauses 52 to 72, wherein the upstream and
downstream flanking sequences of the targeting oligonucleotide are
different from each other. 74. A probe according to any of clauses
52 to 73, wherein the head sequence has fewer than 5 base pair
mismatches with the upstream flanking sequence and the tail
sequence has fewer than 5 base pair mismatches with the downstream
flanking sequence. 75. A probe according to clause 74, wherein the
head and tail sequences are the exact complement of the flanking
sequences. 76. A probe according to any of clauses 52 to 75,
wherein the targeting oligonucleotide is linear. 77. A probe
according to any of clauses 52 to 76, wherein the target fragment
is a restriction endonuclease fragment. 78. A probe according to
any of clauses 52 to 77, wherein the target fragment is a human
genome fragment. 79. A probe according to clause 78, wherein the
target fragment is a human genome fragment specific to one
chromosome. 80. A probe according to clause 79, wherein the target
fragment is specific to one locus of the human genome. 81. A probe
according to any of clauses 52 to 80, wherein the probe nucleic
acid is DNA. 82. A set of probes for binding single stranded target
nucleic acid fragments, comprising a plurality of probes according
to any of clauses 52 to 81, the probes having a plurality of
different target-complementary sequences for the binding multiple
different target fragments. 83. A set of probes according to clause
82 which is for binding multiple fragments of a human chromosome,
wherein each probe in the set is for binding a different target
fragment specific to that chromosome. 84. A set of probes according
to clause 83, wherein the probes share a common custom sequence.
85. Sets of probes for binding different fragments of two or more
human chromosomes, comprising:
[0258] a first set of probes for binding a plurality of target
fragments specific to a first chromosome, and
[0259] a second set of probes for binding a plurality of target
fragments specific to a second chromosome, and optionally
[0260] one or more further sets of probes for binding a plurality
of target fragments specific to one or more further
chromosomes.
86. Sets of probes according to clause 85, wherein the probes
within a set share a custom sequence which is common to that set
and differs from the custom sequences of probes in other sets. 87.
A kit comprising a set or sets of probes according to any of
clauses 82 to 86 in solution in one or more containers. 88. Use of
a probe according to any clauses 52 to 81, a set of probes
according to any of clauses 82 to 86, or a kit according to clause
87, for testing a sample for the presence of a target nucleic acid
fragment. 89. Use of a probe for testing a sample for the presence
of a target single stranded nucleic acid fragment,
[0261] wherein the probe comprises a targeting oligonucleotide
containing a sequence which is the exact complement of the target
fragment, and head and tail oligonucleotide sequences which
hybridise adjacent to the target fragment on the targeting
oligonucleotide,
[0262] wherein hybridisation between the target fragment and the
probe templates the target fragment for ligation to the head and
tail sequences.
90. Use according to clause 89, wherein the probe is as defined in
any of clauses 52 to 81.
[0263] An embodiment provides a method of processing a nucleic acid
sample, comprising: a) hybridizing a sample comprising a target
fragment to a nucleic acid probe comprising: i. a head sequence and
a tail sequence, wherein the head and tail sequences are at the
ends of a first oligonucleotide molecule; and ii. a splint sequence
comprising, in order: an upstream flanking sequence that is
complementary to the head sequence; a target complementary sequence
that is complementary to the target fragment; and a downstream
flanking sequence that is complementary to the tail sequence;
thereby producing a hybridization product in which the ends of the
target fragment are ligatably adjacent to the ends of the head and
tail sequences in the first oligonucleotide molecule; and b)
ligating the ends of the target fragment to the ends of the head
and tail sequences of the first oligonucleotide molecule, thereby
producing a cyclic product that comprises the target fragment and
the head and tail sequences.
[0264] In any embodiment, the method may further comprise
amplifying the cyclic product by rolling circle amplification using
a primer that hybridizes to the first oligonucleotide molecule or
the splint sequence. In these embodiments, the method may further
comprise quantify the number of rolling circle amplification
products produced, thereby providing an estimate of the amount of
said target fragment in the sample.
[0265] In some embodiments, the splint sequence may be in the first
oligonucleotide molecule.
[0266] In some embodiments, the splint sequence may be in a second
oligonucleotide molecule.
[0267] In any embodiment, the target-complementary sequence may be
10 to 30 nucleotides in length.
[0268] In any embodiment, the target-complementary sequence may
contains one or more mismatches to the target fragment.
[0269] In any embodiment, the flanking sequences may be 10 and 40
nucleotides in length.
[0270] In any embodiment, the sample may be digested with a
restriction enzyme.
[0271] In any embodiment, the sample may comprise genomic DNA,
e.g., human genomic DNA. In these embodiments, the sample may
comprise cell-free DNA isolated from blood. For example, in any
embodiment, the sample may comprise cell-free DNA isolated from the
bloodstream of a pregnant human.
[0272] In some embodiments, the splint sequence may be in a second
oligonucleotide molecule that comprises an capture moiety, e.g., a
biotin moiety. In these embodiments, the method may comprise: c)
immobilizing the cyclic product by binding the capture moiety to a
solid phase; and d) washing the solid phase to remove unligated
nucleic acid and other reaction components, thereby enriching for
the cyclic product.
[0273] In any embodiment, the target fragment may be from
chromosome 21, 13 or 18.
[0274] In some embodiments, the method may comprise hybridizing the
sample with a set of at least 50 of said probes, wherein said
probes target different fragments on the same chromosome, and
wherein the method results in a plurality of cyclic products that
comprise the target fragments.
[0275] In these embodiments, the method may comprise hybridizing
the sample with a first set and a second set of said sets of
probes, wherein the first and second sets target a first chromosome
and a second chromosome, respectively, amplifying the cyclic
products by rolling circle amplification (RCA) and comparing the
number of RCA products corresponding to the first chromosome to the
number of RCA products corresponding to the first chromosome.
[0276] In these embodiments, the method may comprise hybridizing
the sample with a first set and a second set of said sets of
probes, wherein the first and second sets target a first and second
regions on a chromosome, respectively, amplifying the cyclic
products by rolling circle amplification (RCA) and comparing the
number of RCA products corresponding to the first region to the
number of RCA products corresponding to the second region.
[0277] Also provided herein is a composition comprising a nucleic
acid probe, as described above. In some embodiments, the nucleic
acid probe may comprise: i. a head sequence and a tail sequence,
wherein the head and tail sequences are at opposite ends of a first
oligonucleotide molecule; and ii. a splint sequence comprising, in
order: an upstream flanking sequence that is complementary to the
head sequence; a target complementary sequence that is
complementary to a target fragment in the human genome; and a
downstream flanking sequence that is complementary to the tail
sequence; wherein the probe is designed so that, when the first
oligonucleotide, the splint sequence, and the target fragment are
hybridized to one another, the ends of the target fragment are
ligatably adjacent to the ends of the head and tail sequences in
the first oligonucleotide molecule.
[0278] In any composition embodiment, the composition may comprise
a first set of at least 50 of the nucleic acid probes, wherein the
target complementary sequences of said probes are complementary to
different target fragments of a first human chromosome, e.g., human
chromosome is 21, 13 or 18. In these embodiments, the composition
may optionally comprise a second set of at least 50 of said nucleic
acid probes, wherein the target complementary sequences of said
probes of the second set are complementary to different target
fragments of a second human chromosome, e.g., chromosomes 13 or 18
(if the first chromosome is chromosome 21).
Sequence CWU 1
1
3193DNAArtificial SequenceSynthetic
oligonucleotidemisc_feature(31)..(60)n is a, c, g or t and
positions 31 to 60 represent a target complementary sequence on
human chromosome 21. 1atgtgaccct tccgtctgtt gagttaggcc nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn 60tcgtgccttg tcattcggga gcactaactg ctg
932152DNAArtificial SequenceSynthetic
oligonucleotidemisc_feature(1)..(1)c has 5'
phosphatemisc_feature(64)..(73)n is a, c, g, or t 2cgcacacgat
taaggtccag tcacaggcag agatcggaag agcgtcgtgt agggaaagag 60tgtnnnnnnn
nnngtgtaga tctcggtggt cgccgtatca tttcatgctg ctaacggtcg
120agtcggacag gtggctccac taaatagacg ca 1523152DNAArtificial
SequenceSynthetic oligonucleotidemisc_feature(1)..(1)g has a 5'
phosphatemisc_feature(64)..(73)n is a, c, g, or t 3ggcctaactc
aacagacgga agggtcacat agatcggaag agcgtcgtgt agggaaagag 60tgtnnnnnnn
nnngtgtaga tctcggtggt cgccgtatca tttcatgctg ctaacggtcg
120agcagttagt gctcccgaat gacaaggcac ga 152
* * * * *