U.S. patent application number 16/629150 was filed with the patent office on 2020-09-17 for method for detecting a mutation in a microsatellite sequence.
This patent application is currently assigned to Institut Curie. The applicant listed for this patent is INSTITUT CURIE, INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE, UNIVERSITE DE VERSAILLES SAINT-QUENTIN-EN-YVELINES. Invention is credited to Francois-Clement BIDARD, Amanda BORTOLINI SILVEIRA, Amelie KASPEREK, Charlotte PROUDHON, Marc-Henri STERN.
Application Number | 20200291466 16/629150 |
Document ID | / |
Family ID | 1000004882009 |
Filed Date | 2020-09-17 |
![](/patent/app/20200291466/US20200291466A1-20200917-D00001.png)
![](/patent/app/20200291466/US20200291466A1-20200917-D00002.png)
![](/patent/app/20200291466/US20200291466A1-20200917-D00003.png)
![](/patent/app/20200291466/US20200291466A1-20200917-D00004.png)
![](/patent/app/20200291466/US20200291466A1-20200917-D00005.png)
![](/patent/app/20200291466/US20200291466A1-20200917-D00006.png)
United States Patent
Application |
20200291466 |
Kind Code |
A1 |
PROUDHON; Charlotte ; et
al. |
September 17, 2020 |
Method for Detecting a Mutation in a Microsatellite Sequence
Abstract
The invention relates to a method for detecting a mutation in a
microsatellite sequence locus of a target fragment from a DNA
sample, comprising subjecting said DNA sample to a digital
polymerase chain reaction (PCR) in the presence of a PCR solution
comprising: a pair of primers for amplifying said target fragment
of the DNA sample including said microsatellite sequence; a first
MS oligonucleotide (MS) hydrolysis probe, labeled with a first
fluorophore, wherein said first MS oligonucleotide probe is
complementary to a wild-type sequence including the microsatellite
sequence; a second oligonucleotide reference (REF) hydrolysis
probe, labeled with a second fluorophore, wherein said second
oligonucleotide REF probe is complementary to a wild-type sequence
of said target DNA fragment which does not include said
microsatellite sequence. The invention also encompasses methods for
the diagnosis and prognosis of cancer and a method for determining
the efficacy of a cancer treatment.
Inventors: |
PROUDHON; Charlotte;
(Pantin, FR) ; KASPEREK; Amelie; (Paris, FR)
; BORTOLINI SILVEIRA; Amanda; (Paris, FR) ;
BIDARD; Francois-Clement; (Paris, FR) ; STERN;
Marc-Henri; (Paris, FR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
INSTITUT CURIE
INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE
UNIVERSITE DE VERSAILLES SAINT-QUENTIN-EN-YVELINES |
Paris
Paris
Versailles |
|
FR
FR
FR |
|
|
Assignee: |
Institut Curie
Paris
FR
Institut National de la Sante et de la Recherche
Medicale
Paris
FR
Universite de Versailles Saint-Quentin-en-Yvelines
Versailles
FR
|
Family ID: |
1000004882009 |
Appl. No.: |
16/629150 |
Filed: |
July 11, 2018 |
PCT Filed: |
July 11, 2018 |
PCT NO: |
PCT/EP2018/068760 |
371 Date: |
January 7, 2020 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 21/6428 20130101;
C12Q 1/6858 20130101; G01N 2021/6439 20130101; C12Q 1/6886
20130101; C12Q 2600/156 20130101 |
International
Class: |
C12Q 1/6858 20060101
C12Q001/6858; C12Q 1/6886 20060101 C12Q001/6886; G01N 21/64
20060101 G01N021/64 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 12, 2017 |
EP |
17305920.5 |
Claims
1. A method for detecting a mutation in a microsatellite sequence
locus of a target fragment from a DNA sample, comprising a step of
subjecting said DNA sample to a digital polymerase chain reaction
(dPCR) in the presence of a PCR solution comprising: a pair of
primers suitable for amplifying said target fragment of the DNA
sample including said microsatellite sequence; a first MS
oligonucleotide (MS) hydrolysis probe, labeled with a first
fluorophore, wherein said first MS oligonucleotide probe is
complementary to a wild-type sequence including the microsatellite
sequence; a second oligonucleotide reference (REF) hydrolysis
probe, labeled with a second fluorophore, wherein said second
oligonucleotide REF probe is complementary to a wild-type sequence
of said target DNA fragment located outside of said microsatellite
sequence.
2. The method according to claim 1, wherein the target fragment of
the DNA sample is constitutional genomic DNA.
3. The method according to claim 1, wherein the target fragment of
the DNA sample is genomic tumor DNA.
4. The method according to claim 1, wherein the microsatellite
sequence locus is selected from the group comprising BAT-25,
BAT-26, BAT-34c4, BAT-40, NR21, NR24, MONO-27, D2S123, D5S346,
D175250, ACVR2A, DEFB105A, DEFB105B, RNF43, DOCK3, GTF2IP1,
LOC100093631, PIP5K1A, MSH3, TRIM43B, PPFIA1 and TDRD1.
5. The method according to claim 1, wherein the DNA sample is
selected from the group consisting of tumor tissue, disseminated
cells, feces, blood cells, blood plasma, serum, lymph nodes, urine,
saliva, semen, stool, sputum, cerebrospinal fluid, tears, mucus,
pancreatic juice, gastric juice, amniotic fluid, cerebrospinal
fluid, serous fluids.
6. The method according to claim 1 further comprising a step of
measuring the fluorescence signals associated with the REF and MS
probes, wherein the maximal fluorescence intensity signal
associated with both the REF and MS probes indicates the presence
of a wild-type microsatellite sequence in the target DNA fragment,
while a shift in the fluorescence intensity signal associated with
the MS probe indicates the presence of a mutation in the
microsatellite sequence of the target DNA fragment
7. A method for the detecting cancers, diseases associated with
mutations in mismatch repair (MMR) genes or familial tumor
predisposition in a subject, comprising the detection of a mutation
in a microsatellite sequence locus of a target DNA from a DNA
sample according to claim 1, wherein the target fragment is
originating from a tumor.
8. A method for prognosis of cancers comprising the detection of a
mutation in a microsatellite sequence locus of a target fragment
from a DNA sample according to claim 1, wherein the target fragment
is originating from a tumor.
9. A method for predicting the efficacy of a treatment in a subject
suffering from a cancer, comprising the detection of a mutation in
a microsatellite sequence locus of a target fragment from a DNA
sample according to claim 1, wherein the target fragment is
originating from a tumor and wherein the treatment is preferably
immune therapy such as immune checkpoint therapy.
10. A method of treatment of a cancer in a subject in need thereof
comprising: the detection of a mutation in a microsatellite
sequence locus of a target fragment from a DNA sample according to
claim 1, and the administration to the subject of an immunotherapy
if a mutation is identified in a microsatellite sequence locus of
the target fragment, wherein the target fragment of the DNA sample
originates from a tumor.
11. A method for the monitoring of a patient diagnosed with a tumor
associated with impaired DNA mismatch repair (MMR), or having
suffered from such tumor, comprising the detection of a mutation in
a microsatellite sequence locus of a target fragment from a DNA
sample, wherein the target fragment of the DNA sample originates
from a tumor.
12. A kit for identifying a mutation in a microsatellite sequence
region of a target fragment from a DNA sample comprising: a pair of
primers suitable for amplifying said target fragment from the DNA
sample including said microsatellite sequence; a first
oligonucleotide hydrolysis probe (MS), labeled with a first
fluorophore, wherein said first oligonucleotide probe is
complementary to a wild-type sequence including the microsatellite
sequence; a second oligonucleotide hydrolysis probe (REF), labeled
with a second fluorophore, wherein said second oligonucleotide
probe is complementary to a wild-type sequence of said amplified
DNA fragment located outside of said microsatellite sequence; a
thermostable polymerase.
Description
SEQUENCE LISTING SUBMISSION VIA EFS-WEB
[0001] A computer readable text file, entitled
"SequenceListing.txt," created on or about Jan. 6, 2020 with a file
size of about 4 kb contains the sequence listing for this
application and is hereby incorporated by reference in its
entirety.
INTRODUCTION
[0002] Microsatellites (MS) are tandem repeats of short DNA
sequences that are abundant throughout the human genome. Owing to
their high mutation rates, microsatellite sequences have been
widely used as polymorphic markers in population genetics and
forensics. Microsatellite instability (MSI) is a hypermutator
phenotype that occurs in tumors with impaired DNA mismatch repair
(MMR) and is characterized by widespread length polymorphisms of
microsatellite repeats due to DNA polymerase slippage as well as by
elevated frequency of single-nucleotide variants (SNVs). MSI is
caused by inactivation of MMR genes (for example, MLH1, MSH2, MSH3,
MSH6 and PMS2) through somatic mutations, with increased risk of
cancer for those with inherited germline mutations (that is, Lynch
syndrome). MSI also occurs by epigenetic inactivation of MMR genes
(for example hypermethylation of the MLH1 and MSH2 promoters
associated with the somatic BRAF V600E mutation or deletion in the
3' end of Ep-CAM), or downregulation of MMR genes by microRNAs. MSI
events within coding regions can alter the reading frame, leading
to truncated functionally-impaired proteins (see also
Cortes-Ciriano et al., Nat Commun. 2017 Jun. 6; 8:15180 and Copija
et al., Int J Mol Sci. 2017 Jan. 6; 18(1). pii: E107). The MSI
phenotype has been largely used as a molecular diagnostic tool for
gastrointestinal, endometrial and colorectal tumors, where it has
important implications for disease prognosis and rational planning
of treatment (Boland and Goel, Gastroenterology 2010 June;
138(6):2073-2087.e3, Copija et al., Int J Mol Sci. 2017 Jan. 6;
18(1). pii: E107). MSI positive tumors are known to display unique
histopathological and clinical features including specific
location, poor differentiation, high lymphocytic infiltration and
better prognosis associated with low frequency of distant
metastasis (Boland and Goel, Gastroenterology 2010;
138(6):2073-2087.e3).
[0003] Recent analyses have also identified MSI across several
additional cancer types, such as urinary tract, ovarian, prostate,
lung, head and neck, liver and glioblastomas, suggesting a
potential broader application of MSI screening in clinical practice
(Hause et al., Nat Med. 2016 November; 22(11):1342-1350,
Cortes-Ciriano et al., Nat Commun. 2017 Jun. 6; 8:15180).
[0004] Indeed, MSI has recently emerged as the first pan-tumor
biomarker likely to predict clinical benefit from immune-checkpoint
blockade therapy (Le et al., N Engl J Med. 2015 Jun. 25;
372(26):2509-20; Le et al., Science 2017 Jun 8. pii: eaan6733).
Remarkably, via an Accelerated Approval process, the FDA has
recently granted the use of anti-PD-1 blockade therapy for the
treatment of adult and pediatric patients with undetectable or
metastatic MSI positive or MMR-deficient solid tumors.
[0005] Molecular diagnosis of MSI is currently done by examining
PCR products of a few informative microsatellite loci of DNA
extracted from tumor samples (Bather et al., Disease Markers 2004,
237-250). Disadvantages of this method include the requirement of
capillary electrophoresis for detection of shifts in allele size
and the limited sensitivity of the technique, which requires a
minimum tumor cellularity of 20% to achieve reliable and robust
results (Shi and Washington, Am J Clin Pathol 2012 137:847-859).
Recently, next generation sequencing methods (NGS) have been used
for higher sensitivity and better precision in MSI detection
(Salipante et al., Clin Chem 2014 Jun. 30 60 (9), 1192-1199; Hause
et al., Nat Med. 2016 November; 22(11):1342-1350, Cortes-Ciriano et
al., Nat Commun. 2017 Jun. 6; 8:15180). Although clearly an
improvement over the method currently used in clinics, the
sensitivity of 1% obtained by NGS still remains above the
sensitivity of PCR-based assays.
[0006] Thus the development of a sensitive MSI diagnostic method
usable on circulating tumor DNA obtained from liquid biopsies
remains of high clinical and therapeutic importance.
SUMMARY OF THE INVENTION
[0007] The authors have designed a digital PCR diagnostic method
for detecting microsatellite instability, which can be performed on
a DNA sample containing a very low concentration of target DNA.
[0008] The authors have indeed demonstrated that the achieved limit
of detection (i.e., the lowest concentration likely to be reliably
distinguished from the limit of blank and at which the detection is
feasible), is 250 fold lower than the minimum cellularity threshold
(i.e. at least 20% cellularity) required to determine the MSI
status by the pentaplex assay currently applied in clinical
practice (see Bather et al 2004, Disease Markers 20:237-250, see
also Shi and Washington, Am J Clin Pathol 2012 137:847-859).
According to the results as shown herein the present new MSI
detection assay is both highly specific and sensitive, as
sensitivity could reach values, at least in theory, approaching
0.1%. This innovative approach also offers several other advantages
including the simplicity of blood tests and reduced time of
analysis. Taken together, the MSI diagnostic method of the
invention promises better diagnostic accuracy and the unprecedented
use of a MSI biomarker in liquid biopsies for diagnosis and
monitoring of disease treatment and disease progression.
[0009] A similar technique has been previously used for the
detection of BRAF status in colorectal cancer (see Bidshahri et
al., The Journal of Molecular Diagnostic 2016, 18(2):190-204).
However, the use of such a technique has never been envisioned for
the detection of a mutated microsatellite sequence. Indeed, due to
the size and more particularly to the extreme repetitive nature of
the microsatellite sequence, it would be expected that the probe
covering the microsatellite (MS probe, see below) would slip over
the repeat sequence such that efficient or reliable hybridization
of the probe could not be obtained.
[0010] Dietmaier et al. (Laboratory Investigation, 2001) describe a
technique for the detection of a microsatellite sequence by RT-PCR
and by analyzing the melting point, using hybridization probes of
specific sequences of the targeted markers. The Light Cycler
HybProbes hybridization probes used in this document are not
capable of discriminating WT and mutant microsatellite sequences.
Therefore additional melting point analyses are required after real
time PCR amplification for identification of mutated
microsatellites. Besides, the probes of Dietmaier et al. are not
regarded as hydrolysis probes and are not relevant in the context
of a digital PCR reaction.
[0011] The method of the invention is based on a single reaction
with two hydrolysis probes located within the same amplicon. The
first one covers the full WT microsatellite sequence (MS probe).
The second one is a reference probe (REF) located in a non-variable
region, which does not include the microsatellite sequence (MS)
locus and is used to quantify droplets with amplifiable DNA.
Therefore, wild-type (WT) sequences will display a double positive
fluorescence signal coming from the hybridization of both the REF
and MS probes, while droplets containing mutated microsatellite
alleles will present a shifted signal that results from the
hybridization of the REF probe only.
[0012] The present invention therefore relates to a method for
detecting a mutation in a microsatellite sequence locus of a target
fragment from a DNA sample, comprising a step of subjecting said
DNA sample to a digital polymerase chain reaction (dPCR) in the
presence of a PCR solution comprising: [0013] a pair of primers
suitable for amplifying said target fragment of the DNA sample
including said microsatellite sequence; [0014] a first
oligonucleotide microsatellite (MS) hydrolysis probe, labeled with
a first fluorophore, wherein said first MS oligonucleotide probe is
complementary to a wild-type sequence including the microsatellite
sequence; [0015] a second oligonucleotide reference (REF)
hydrolysis probe, labeled with a second fluorophore, wherein said
second oligonucleotide REF probe is complementary to a wild-type
sequence of said target DNA fragment, which does not include said
microsatellite sequence.
[0016] Preferably, the digital PCR (dPCR) is digital droplet PCR
(ddPCR).
[0017] The target fragment of the DNA sample can be constitutional
genomic DNA or genomic tumor DNA or circulating DNA.
[0018] The microsatellite sequence locus can be selected from the
group comprising BAT-25, BAT-26, BAT-34c4, BAT-40, NR21, NR24,
MONO-27, D2S123, D5S346, D175250, ACVR2A, DEFB105A, DEFB105B,
RNF43, DOCK3, GTF2IP1, LOC100093631, PIP5K1A, MSH3, TRIM43B, PPFIA1
and TDRD1. In addition, microsatellite sequences located in regions
of the genome frequently amplified in cancer (e.g. chr8q region of
the human genome) can be selected to increase sensitivity.
[0019] Typically, the DNA sample is selected from the group
consisting of tumor tissue, disseminated cells, feces, blood cells,
blood plasma, serum, lymph nodes, urine, saliva, semen, stool,
sputum, cerebrospinal fluid, tears, mucus, pancreatic juice,
gastric juice, amniotic fluid, cerebrospinal fluid, serous
fluids.
[0020] The present invention also relates to a method according to
any of the preceding claims further comprising a step of measuring
the fluorescence signals associated with the REF and MS probes,
wherein: the maximal fluorescence intensity signal associated with
both the REF and MS probes indicates the presence of a wild-type
microsatellite sequence in the target DNA fragment, while a shift
in the fluorescence intensity signal associated with the MS probe
indicates the presence of a mutation in the microsatellite sequence
of the target DNA fragment
[0021] The present invention also relates to a method for the
diagnostic of cancers, diseases associated with mutations in
mismatch repair (MMR) genes or familial tumor predisposition in a
subject, comprising the detection of a mutation in a microsatellite
sequence locus of a target DNA from a DNA sample as described
above, wherein the target fragment originates from a tumor.
[0022] The present invention also relates to a method for the
prognosis of cancers comprising the detection of a mutation in a
microsatellite sequence locus of a target fragment from a DNA
sample as described above, wherein the target fragment originates
from a tumor.
[0023] The present invention also relates to a method for
predicting the efficacy of a treatment in a subject suffering from
a cancer, comprising the detection of a mutation in a
microsatellite sequence locus of a target fragment from a DNA
sample as described above, wherein the target fragment is
originating from a tumor and wherein the treatment is preferably
immunotherapy such as immune checkpoint therapy.
[0024] The present invention also relates to a method of treatment
of a cancer in a subject in need thereof comprising: [0025] the
detection of a mutation in a microsatellite sequence locus of a
target fragment from a DNA sample as described above, and [0026]
the administration to the subject of an immunotherapy if a mutation
is identified in a microsatellite sequence locus of the target
fragment,
[0027] wherein the target fragment of the DNA sample originates
from a tumor.
[0028] The present invention also relates to a method for the
monitoring of a patient diagnosed with a tumor associated with
impaired DNA mismatch repair (MMR), or having suffered from such
tumor, comprising the detection of a mutation in a microsatellite
sequence locus of a target fragment from a DNA sample as described
above, [0029] wherein the target fragment of the DNA sample
originates from a tumor.
[0030] Lastly, the present invention also encompasses a kit for
identifying a mutation in a microsatellite sequence region of a
target fragment from a DNA sample comprising: [0031] a pair of
primers suitable for amplifying said target fragment from the DNA
sample including said microsatellites sequence; [0032] a first
oligonucleotide hydrolysis probe (MS), labeled with a first
fluorophore, wherein said first oligonucleotide hydrolysis probe is
complementary to a wild-type sequence including the microsatellite
sequence; [0033] a second oligonucleotide hydrolysis probe (REF),
labeled with a second fluorophore, wherein said second
oligonucleotide hydrolysis probe is complementary to a wild-type
sequence of said amplified DNA fragment, which does not include
said microsatellite sequence; [0034] a thermostable polymerase.
DETAILED DESCRIPTION
[0035] A--Definitions
[0036] The following definitions are intended to assist in
providing a clear and consistent understanding of the scope and
detail of the following terms, as used to describe and define the
present invention:
[0037] As used herein, the verb "comprise" as is used in this
description and in the claims and its conjugations are used in its
non-limiting sense to mean that items following the word are
included, but items not specifically mentioned are not excluded. In
addition, reference to an element by the indefinite article "a" or
"an" does not exclude the possibility that more than one of the
elements are present, unless the context clearly requires that
there is one and only one of the elements. The indefinite article
"a" or "an" thus usually means "at least one."
[0038] As used herein a "tumor" or a "neoplasm" (both terms can be
used interchangeably) is an abnormal new growth of cells. The cells
in a neoplasm usually grow more rapidly than normal cells and will
continue to grow if not treated. As they grow, neoplasms can
impinge upon and damage adjacent structures. The term neoplasm can
refer to benign (usually curable) or malignant (cancerous)
growths.
[0039] A benign tumor, or neoplasm, is usually localized, and does
not spread to other parts of the body. Most benign tumors respond
well to treatment. However, if left untreated, some benign tumors
can grow large and lead to serious disease because of their size.
Benign tumors can also mimic malignant tumors, and so for this
reason are sometimes treated. Malignant tumors are cancerous
growths. They are often resistant to treatment, may spread to other
parts of the body (i.e. metastasis) and they sometimes recur after
they were removed.
[0040] The term "cancer" is used herein for a malignant tumor.
[0041] "Allele", as used herein, refers to one of several
alternative forms of a gene or DNA sequence at a specific
chromosomal location (locus). At each autosomal locus an individual
possesses two alleles, one inherited from the father and one from
the mother.
[0042] "DNA polymorphism", as used herein, refers to the existence
of two or more alleles for a given locus in the population. "Locus"
or "genetic locus", as used herein, refers to a unique chromosomal
location defining the position of an individual gene or DNA
sequence. "Locus-specific primer", as used herein, refers to a
primer that specifically hybridizes with a portion of the stated
locus or its complementary strand, at least for one allele of the
locus, and does not hybridize efficiently with other DNA sequences
under the conditions used in the amplification method.
[0043] "Microsatellite sequence Locus" or "microsatellite sequence"
are used interchangeably and refer to a region of genomic DNA that
contains short, repetitive sequence elements of one (1) to seven
(7), typically one (1) to five (5), notably one (1) to four (4)
base pairs in length. Each sequence repeated at least once within a
microsatellite locus is referred to herein as a "repeat unit". Each
microsatellite locus typically includes at least seven repeat
units, notably at least ten repeat units, and preferably at least
twenty repeat units.
[0044] "Microsatellite Instability" (hereinafter, "MSI"), as used
herein, refers to a form of genetic instability in which alleles of
genomic DNA obtained from certain tissue, cells, or bodily fluids
of a given subject are mutated at a microsatellite locus.
[0045] Mutations at microsatellite locus commonly typically include
deletion(s), addition(s) or substitution of at least one repeat
unit at a microsatellite locus. Typically, MSI results in a change
in length at a microsatellite locus, due to addition(s) or most
frequently deletion(s).
[0046] As used herein, a "primer/probe set" refers to a grouping of
a pair of oligonucleotide primers and two oligonucleotide probes
that each hybridizes to a specific target nucleotide sequence. Said
oligonucleotide set consists of: (a) a forward discriminatory
primer that hybridizes to a first location of a nucleic acid
sequence; (b) a reverse discriminatory primer that hybridizes to a
second location of the nucleic acid sequence downstream of the
first location and (c) two probes, which hybridizes to a target
sequence between the primers. In other words, a primer/probe set
consists of a pair of specific oligos that anneal to opposite
strands of a nucleic acid sequence (typically including a
microsatellite sequence locus) so as to form an amplicon specific
to the nucleic acid sequence during the PCR reaction, and two
probes, preferably fluorescent, which hybridize to (i.e., which are
complementary to) a specific target sequence of the amplicon.
[0047] An "amplicon" refers to a nucleic acid fragment formed as a
product of natural or artificial amplification events or
techniques. Typically, the amplicon is produced by Polymerase chain
reaction (PCR). "Amplifying", as used herein, refers to a process
whereby multiple copies are made of one particular locus of a
nucleic acid (i.e. a target sequence as mentioned above), such as
genomic DNA. Amplification is accomplished using PCR (Saiki et al.,
1985 Science 230: 1350-1354).
[0048] A "target (DNA) fragment", or a "target (DNA) region" used
interchangeably herein relates to the fragment of the DNA sample
that is amplified by a pair of primers of a primer/probe set.
According to the invention, such target fragment includes a MS
locus. A "target sequence", or "target DNA sequence" used
interchangeably refers to a DNA sequence which is complementary to
the first or the second oligonucleotide probe.
[0049] As used herein, "digital FOR" refers to an assay that
provides an end-point measurement that provides the ability to
quantify nucleic acids without the use of standard curves, as is
used in real-time PCR (see Sykes et al., 1992 Quantitation of
targets for PCR by use of limiting dilution. BioTechniques
13,444-449, Vogelstein and Kinzler 1999 Digital PCR. Proc Natl Acad
Sci USA, 96:9236-9241 and Pohl and Shihle 2004 Principle and
applications of digital PCR. Expert Rev Mol Diagn, 4:41-47, see
also Monya Baker 2012 Nature Methods 9, 541-544).
[0050] In a typical digital PCR experiment, a PCR solution is made
similarly to a classical TaqMan probe assay, which typically
comprises the DNA sample, fluorescence-quencher probes (i.e.,
hydrolysis probes), primers, and a PCR master mix, which generally
contains DNA polymerase, dNTPs, MgCl.sub.2, and reaction buffers at
optimal concentrations. The PCR solution is then randomly
distributed into discrete (i.e. individual) partitions or
compartments, such that some contain no target DNA and others
contain one or more target DNA copies, most preferably one target
DNA copy. Thus, in these conditions, the reference signal
associated with the presence of the target DNA in the DNA sample in
a given partition or compartment should be theoretically 0 or 1.
Obviously due to biological variability for a population of
partition or compartment, clouds are observed corresponding
respectively to the theoretic values 0 or 1.
[0051] The partitions are individually amplified to the terminal
plateau phase of PCR (or end-point) and then read for fluorescence,
to determine the fraction of positive partitions.
[0052] If the partitions are of uniform volume, the number of
target DNA molecules present may be calculated from the fraction of
positive end-point reactions using Poisson statistics, according to
the following equation:
.lamda.=-ln(1-p) (1)
[0053] wherein .lamda. is the average number of target DNA
molecules per replicate reaction and p is the fraction of positive
end-point reactions. From .lamda., together with the volume of each
replicate PCR and the total number of replicates analyzed, an
estimate of the absolute target DNA concentration is
calculated.
[0054] Micro well plates, capillaries, oil emulsion, and arrays of
miniaturized chambers with nucleic acid binding surfaces can be
used to partition the samples in distinct compartments or droplets.
Thus digital PCR as used herein includes a variety of formats,
including droplet digital PCR (ddPCR), BEAMing (beads, emulsion,
amplification, and magnetic), and microfluidic chips.
[0055] "Droplet digital FOR" (ddPCR) refers to a digital PCR assay
that measures absolute quantities by counting nucleic acid
molecules encapsulated in discrete, volumetrically defined,
water-in-oil droplet partitions that support PCR amplification
(Hinson et al., 2011, Anal. Chem. 83 :8604-8610; Pinheiro et al.,
2012, Anal. Chem. 84: 1003-1011). A single ddPCR reaction may be
comprised of at least 20,000 partitioned droplets per well.
[0056] A "droplet" refers to an individual partition of the PCR
solution in a droplet digital PCR assay. In the following of the
present application, digital PCR will be described in reference to
droplet digital (or digital droplet PCR, used interchangeably),
however, as mentioned previously individual partition of the PCR
solution according to the principle of digital PCR can be obtained
according to a variety of techniques. Therefore, the method of the
invention as described below in reference to droplet digital PCR is
not limited to this digital PCR technique and may be applied in a
similar fashion to other digital PCR techniques.
[0057] Techniques available for digital PCR include PCR
amplification on a microfluidic chip (Warren et al., 2006
Transcription factor profiling in individual hematopoietic
progenitors by digital RT-PCR. Proc Natl Acad Sci USA 103,
17807-17812; Ottesen et al., 2006 Microfluidic digital PCR enables
multigene analysis of individual environmental bacteria. Science
314, 1464-1467; Fan and Quake 2007 Detection of aneuploidy with
digital polymerase chain reaction. Anal Chem 79, 7576-7579). Other
systems involve separation onto microarrays (Morrison et al., 2006
Nanoliter high-throughput quantitative PCR. Nucleic Acids Res 34,
e123) or spinning microfluidic discs (Sundberg et al., 2010
Spinning disk platform for microfluidic digital polymerase chain
reaction. Anal Chem 82, 1546-1550) and droplet techniques based on
oil-water emulsions (Hindson, Benjamin et al., 2011 High-Throughput
Droplet Digital PCR System for Absolute Quantitation of DNA Copy
Number. Analytical Chemistry 83 (22): 8604-8610). Typically,
digital PCR is selected from droplet digital PCR (ddPCR), BEAMing
(beads, emulsion, amplification, and magnetic), and microfluidic
chips. Preferably, the digital PCR is droplet digital PCR.
[0058] A droplet supports PCR amplification of template molecule(s)
using homogenous assay chemistries and workflows similar to those
widely used for real-time PCR applications (Hinson et al., 2011,
Anal. Chem. 83:8604-8610; Pinheiro et al., 2012, Anal. Chem. 84:
1003-1011). Once droplets are generated, they can be transferred on
a PCR plate and emulsified PCR reactions can be run on a thermal
cycler under a classical program such as for example described in
the Biorad's Guideline for ddPCR
(http://www.bio-rad.com/webroot/web/pdf/Isr/literature/Bulletin_6407.pdf)-
.
[0059] Droplet digital PCR may be performed using any platform that
performs a digital PCR assay that measures absolute quantities by
counting nucleic acid molecules encapsulated in discrete,
volumetrically defined, water-in-oil droplet partitions that
support PCR amplification. The strategy for droplet digital PCR may
be summarized as follows: The PCR solution containing the DNA
sample is diluted and partitioned into thousands to millions of
separate reaction chambers (water-in-oil droplets) so that each
contains one or no copies of the nucleic acid molecule of
interest.
[0060] The number of "positive" droplets detected, which contain
the target amplicon (i.e., target DNA fragment) (i.e., according to
the present invention REF positive droplets), versus the number of
"negative" droplets, which do not contain the target amplicon
(i.e., REF negative droplets), may be used to determine the number
of copies of the nucleic acid molecule of interest that were in the
original sample.
[0061] Examples of droplet digital PCR systems include the
QX100.TM. Droplet Digital PCR System by Bio-Rad, which partitions
samples containing nucleic acid template into 20,000
nanoliter-sized droplets; and the RainDrop.TM. digital PCR system
by RainDance, which partitions samples containing nucleic acid
template into 1,000,000 to 10,000,000 picoliter-sized droplets.
[0062] The benefits of dPCR and more particularly ddPCR technology
include: [0063] Absolute quantification, as ddPCR technology
provides an absolute count of target DNA copies per input sample
without the need for running standard curves. [0064] Unparalleled
precision, as the massive sample partitioning afforded by ddPCR
enables the reliable measurement of small fold differences in
target DNA sequence copy numbers among samples. [0065] Increased
signal-to-noise ratio: high-copy templates and background are
diluted, effectively enriching template concentration in
target-positive partitions, allowing for the sensitive detection of
rare targets. [0066] Removal of PCR bias, as error rates are
reduced by removing the amplification efficiency reliance of qPCR,
enabling the detection of small (1.2-fold) differences. [0067]
Simplified quantification, since neither calibration standards nor
a reference required for absolute quantification. [0068] Reduced
consumable costs, as reaction volumes are in the pico- to nanoliter
ranges, reducing reagent use and the sample quantity required for
each data point. [0069] Lower equipment costs, as the
emulsion-based reaction system means that the PCR reactions can be
performed in a standard thermal cycler without complex chips or
microfluidics. [0070] Superior partitioning, since ddPCR technology
yields 20,000 droplets per 20 .mu.l sample, nearly two million
partitioned PCR reactions in a 96-well plate, whereas chip-based
digital PCR systems produce only hundreds or thousands of
partitions. The greater number of partitions also yields higher
accuracy.
[0071] The term "melting temperature" or "Tm" refers to the
temperature at which a polynucleotide dissociates from its
complementary sequence. Generally the Tm may be defined as the
temperature at which one-half of the Watson-Crick base pairs in a
duplex nucleic acid molecule are broken or dissociated (i.e. are
"melted") while the other half of the Watson-Crick base pair remain
intact in a double stranded conformation. In other words, the Tm is
defined as the temperature at which 50% of the nucleotides of two
complementary sequences are annealed (double strands) and 50% of
the nucleotides are denatures (single strands). The Tm can be
estimated by a number of methods, such as for example by a
nearest-neighbor calculation as per Wetmur 1991 (Wetmur 1991 DNA
probes: applications of the principles of nucleic acid
hybridization. Crit Rev Biochem Mol Biol 26: 227-259, hereby
incorporated by reference) or by commercial programs including
Oligo.TM. Primer Design and programs available on the internet.
Alternatively, the Tm can be determined through actual
experimentation. For example, double-stranded DNA binding or
intercalating dyes, such as ethidium bromide or SYBR-green
(Molecular Probes) can be used in a melting curve assay to
determine the actual Tm of the nucleic acid.
[0072] As used herein, the term "critical denaturation temperature"
or "Tc" refers to a temperature below the Tm of the wild type
sequence, at which temperature a duplex of the wild-type sequence
and the mutant sequence will melt. (In some instances, this
temperature may be one at which a homoduplex of the mutant
sequences also melts).
[0073] The critical denaturing temperature (Tc) is the temperature
below which PCR efficiency drops abruptly for a given nucleic acid
sequence.
[0074] B--Method for Identifying a Mutation in a Microsatellite
Sequence Locus of a DNA Sample
[0075] The present invention relates to a method for the detection
of a mutation in a target microsatellite sequence (MS) locus of
target fragment from a DNA sample, comprising a step of subjecting
said DNA sample to a polymerase chain reaction (PCR) in the
presence of: [0076] a pair of primers suitable for amplifying said
target fragment of the DNA sample including the said MS locus;
[0077] a first MS oligonucleotide probe, labeled with a first
fluorophore, wherein said first MS oligonucleotide probe is
complementary to a first wild-type target sequence including the
microsatellite sequence; [0078] a second oligonucleotide reference
(REF) probe, labeled with a second fluorophore, wherein said second
oligonucleotide REF probe is complementary to a second wild-type
target sequence of said amplified DNA fragment which does not
include the said microsatellite sequence.
[0079] The DNA from the DNA sample and in particular the target DNA
(or target DNA fragment), can be genomic DNA or DNA issued from
reverse RNA transcription. The genomic DNA may be constitutional
DNA, DNA originating from a tumor (i.e. tumor genomic DNA), notably
a malignant tumor. Typically also, the target DNA fragment is
cell-free DNA, such as circulating DNA. In particular, the target
DNA fragment can be cell-free tumor DNA, notably circulating tumor
DNA, or cell-free fetal DNA (i.e., fetal DNA circulating in the
maternal blood stream).
[0080] The method uses a primer/probe set as previously
defined.
[0081] Preferably, the primer pair is typically designed so as to
have a Tm lower than the Tc of the reaction. The pair of primer can
be designed using available computer programs.
[0082] Typically, the probes according to the invention are
hydrolysis probes (also named TaqMan probes). Hydrolysis probes
have a fluorophore covalently attached to their 5'-end of the
oligonucleotide probe and a quencher.
[0083] Oligonucleotide probes are detectably labeled with a
fluorescent label which can be selected, for example, from the
group consisting of FAM (5- or 6-carboxyfluorescein), VIC, NED,
Fluorescein, FITC, IRD-700/800, CY3, CY5, CY3.5, CY5.5, HEX, TET
(5-tetrachloro-fluorescein), TAMRA, JOE, ROX, BODIPY TMR, Oregon
Green, Rhodamine Green, Rhodamine Red, Texas Red, Yakima Yellow,
Alexa Fluor PET, Biosearch Blue.TM., Marina Blue.RTM., Bothell
Blue.RTM., Alexa Fluor.RTM., 350 FAM.TM., SYBR.RTM. Green 1,
Fluorescein, EvaGreen.TM., Alexa Fluor.RTM. 488 JOE.TM., 25
VIC.TM., HEX.TM., TET.TM., CAL Fluor.RTM.Gold 540, Yakima
Yellow.RTM., ROXTM, CAL Fluor.RTM. Red 610, Cy3.5.TM., Texas
Red.RTM., Alexa Fluor.RTM. 568 Cry5.TM., Quasar.TM. 670,
LightCycler Red640.RTM., Alexa Fluor 633 Quasar.TM. 705,
LightCycler Red705.RTM., Alexa Fluor.RTM. 680, SYTO.RTM.9, LC
Green.RTM., LC Green.RTM. Plus+, and EvaGreen.TM.. Preferably, the
detectable label is selected from 6-carboxyfluorescein, FAM, or
tetrachlorofluorescein, (acronym: TET), Texas Red, Cyanin 5,
Cyanine 3, or VIC.TM..
[0084] The quencher may be an internal quencher or a quencher
located in the 3' end of the probe. Typical quenchers are
tetramethylrhodamine, TAMRA , Black Hole Quencher or nonfluorescent
quencher. Hydrolysis probes usable according to the invention are
well-known in the field (see notably
http://www.sigmaaldrich.com/technical-documents/articles/biology/-
quantitative-per-and-digital-per-detection-methods.html). The
quencher molecule quenches the fluorescence emitted by the
fluorophore when excited by the cycler's light source typically via
FRET (Forster Resonance Energy Transfer). As long as the
fluorophore and the quencher are in proximity, quenching inhibits
any fluorescence signals. Such probes are designed such that they
anneal within the target region amplified by a specific set of
primers. As the Taq polymerase extends the primer and synthesizes
the nascent strand, the 5'-3' exonuclease activity inherent in the
Taq DNA polymerase then separates the 5' reporter from the 3'
quencher, which provides a fluorescent signal that is proportional
to the amplicon yield.
[0085] The first and second probes according to the invention are
located within the same amplicon. The probes are designed according
to the well-established practice in the art to preferably minimize
PCR artifact and to specifically hybridize with the sequences as
defined below. The first and second probes are labeled with
distinct fluorophores in order to allow separate detection of their
respective signal.
[0086] In some embodiments, the hydrolysis probes according to the
invention include a minor groove binder (MGB) moiety at their 3'
end. Such MGB typically increases the melting temperature (Tm) of
the probe and stabilizes probe--target hybrids.
[0087] The oligonucleotide probes have a nucleotide sequence length
of about 10 to about 50. Preferably, the oligonucleotide probes
(and in particular the MS probe) have a nucleotide sequence length
of about 15 to 40, or 25 to 50 or notably 15 to 35.
[0088] Preferably, the oligonucleotide probes (and in particular
the MS probe) have a nucleotide sequence length of about 20 to 40,
or 30 to 50 or notably 30 to 40.
[0089] The first probe according to the invention (also named MS
probe) hybridizes with a first wild-type target sequence of the
amplified target DNA fragment, which includes a microsatellite
sequence locus. Preferably the probe covers the full wild-type
microsatellite sequence and extends further a few nucleotides on
each extremity (typically 1 to 10 nucleotides, notably 2 to 8,
preferably 2 to 6, most preferably 2 to 5 or 2 to 4) to confer both
its ability to bind properly and the resulting destabilization in
case of microsatellite instability. In other words, the probe size
is designed to confer its ability to bind properly to the wild-type
microsatellite sequence, while preventing hybridization of the MS
probes in the presence of a mutation in the microsatellite
sequence.
[0090] The second probe of the invention (also named REF probe)
hybridizes with a second wild-type target sequence of said
amplified DNA fragment, which does not include the said
microsatellite sequence. In particular, said second probe may
partially overlap with the said microsatellite sequence or be
located outside of the said microsatellite sequence. Preferably the
second probe according to the invention is located outside of the
said microsatellite sequence.
[0091] Various microsatellite sequence loci can be targeted in the
first wild-type target sequence according to the invention.
Microsatellite sequence loci or markers than can be targeted
according to the invention are notably described in Bather et al.,
2004 Disease Markers 20, 237-250, as well as in Hause et al., 2016
Nat Medicine November 22(11):1342-1350). Preferably, targeted
microsatellite sequence loci (or microsatellite markers) are
selected from microsatellites found to be highly associated with
MSI positive tumors, based on their frequency of instability in
colon, endometrial, rectal and stomach adenocarcinomas. Preferably,
targeted microsatellite sequence loci are located in regions
frequently amplified in tumors.
[0092] For example, a targeted microsatellite sequence locus can be
selected from BAT-25, BAT-26, BAT-34c4, BAT-40, NR21, NR24,
MONO-27, D2S123, D5S346, D175250, ACVR2A, DEFB105A, DEFB105B,
RNF43, DOCK3, GTF2IP1, LOC100093631, PIP5K1A, MSH3, TRIM43B, PPFIA1
and TDRD1.
[0093] In one embodiment, the target microsatellite sequence locus
may also be selected among the Bethesda panel, which comprises
BAT-25, BAT-26, D2S123, D5S346 and D17S250.
[0094] Mononucleotide repeat loci have been shown to be very
susceptible to alteration in tumors with dysfunctional DNA mismatch
repair systems (Parsons, 1995 supra), making such loci particularly
useful for the detection of cancer and other diseases associated
with dysfunctional DNA mismatch repair systems, such that
mononucleotides MSI markers may be preferred.
[0095] In one embodiment of the invention, a targeted
microsatellite sequence locus is BAT-26 and/or ACVR2A and/or
DEFB105A and DEFB105B.
[0096] More generally, appropriate microsatellite sequence loci
that can be targeted according to the invention are short
microsatellite sequences (typically comprising 8 to 30, notably 8
to 25, preferably, 8 to 20, most preferably 8 to 15 or 8 to 12
nucleotides) such as the target microsatellite sequence locus
exemplified in the group consisting of D2S123, D5S346, D17S250,
ACVR2A, DEFB105A, DEFB105B, RNF43, DOCK3, GTF2IP1, LOC100093631,
PIP5K1A, MSH3, TRIM43B, PPFIA1 and TDRD1.
[0097] Depending on the microsatellite locus, probes of various
sizes and G/C content may also be used. For example, probes of more
than 30 nucleotides and/or with a G/C content of less than 30% may
be used. This is notably the case with BAT-26. As a matter of
example an MS probe of SEQ ID No.:4, which hybridize with a
sequence including the BAT-26 microsatellite sequence can be used.
Primers of sequences SEQ ID No: 1-2 as well as REF probe and MS
probe of respectively SEQ ID No: 3 and 4 represent an illustrative
set of primer/probe that can be used according to the
invention.
[0098] According to the present invention, amplification of the
target DNA fragment occurs with a digital PCR technique. Typically,
in such a technique, the PCR solution is divided in multiple
compartments or droplets, which are made to run PCR individually.
Typically also most of the compartments or droplets contain either
0 or 1 copy of the target DNA fragment which is to be
amplified.
[0099] To circumvent the technical challenges associated to the
amplification of low complexity sequence such as the microsatellite
sequence, a series of modifications may be provided to Biorad's
Guideline for ddPCR as mentioned above, in order to achieve proper
hybridization of the MS probe to WT alleles. Reaction annealing
temperature and/or extension time may be increased. Typical
annealing temperature according to Biorad's Guidelines is
55.degree. C. Said annealing temperature may be advantageously
increased from 3 to 15.degree. C.
[0100] Thermal cycling is performed to endpoint. Thus after
multiple PCR amplification cycles (i.e. after completing PCR
cycles), the raw PCR data are then collected by measuring the
fluorescence signal associated with both the REF and MS probes for
each droplet. Droplets containing WT target fragments display a
double positive fluorescence signal coming from the hybridization
of both the REF and MS probes (REF+/MS+ droplets). The
non-hybridization (or inefficient hybridization) of the MS probe in
droplets containing mutated microsatellite alleles leads to a shift
of the droplet cloud on the 2D graph, toward a single REF positive
(REF+) population, which is proportional to the fraction of
droplets containing mutant microsatellite alleles.
[0101] Typically, raw dPCR (or ddPCR) data are collected after PCR
cycling by reading or measuring the fluorescence signal associated
with the REF and MS probes for each droplet.
[0102] The PCR data collection step is typically performed in an
optical detector (for example the Bio-Rad QX-100 droplet reader can
be used in ddPCR). Preferably at least a two-color detection system
is used (for example to detect FAM and either HEX or VIC
fluorescent labels). Droplets clouds can typically be established
on 2D graphs by plotting the fluorescence level for each probe per
droplet. In some embodiments, analysis may be achieved with
appropriate software (such as the QuantaSoft v1.7.4 software for
ddPCR or the ddPCR package on R
[https://cran.r-project.org/web/packages/ddper/index.html].
Quantasoft allows manual assignment of the droplets to the single
REF positive or the double REF/MS positive population (i.e. or
clouds). The R package defines thresholds in an automatic way to
avoid bias that might be introduced by manual assignment.
[0103] The number of droplets that are positive for the reference
probe (REF probe) can be used to quantify the total number of
target DNA fragments in the sample. The fraction of positive
droplets can then be fitted to a Poisson distribution to determine
the absolute initial copy number of the target DNA fragment in the
input reaction mixture in units of copies/.mu.l.
[0104] In droplets containing a wild-type target DNA (no mutation
in the targeted MS sequence), a maximum fluorescence signal is
observed for both the REF and the MS probes. At the contrary, in
droplets containing a mutated sequence in the amplified target DNA
fragment (i.e. a mutation in the microsatellite sequence), a shift
in the fluorescence intensity is observed for the signal associated
with the MS probe.
[0105] Most preferably, the digital PCR reaction is designed to
ensure that most droplets contain either 0 or 1 copy of targeted
DNA fragment (notably depending on the quantity of DNA loaded in
the reaction. In these conditions, an optimal separation of the WT
(REF+/MS+signals) vs. mutated microsatellite (or MSI) clouds
(single REF+ signal) can be observed. It must be noted that due to
biological variability that droplets classified in the single REF+
signal may include a residual (i.e., non-significant) MS signal. A
threshold, under which a MS signal is considered as "a residual MS
signal" can be determined by the one skilled in the art according
to classical signal analysis techniques. Said threshold can be
typically set using the R package as mentioned previously.
[0106] Typically mutant allele frequency can be determined from
droplet counts through manual assignment of WT and mutated
microsatellite droplet clouds. As mentioned above, identification
of a droplet population with a single signal from the REF probe
indicates the presence of a mutated microsatellite sequence in the
DNA sample.
[0107] Mutant allele frequency which can be determined as mentioned
above can be compared with a control mutated allele frequency
obtained from a control DNA sample. The control DNA sample may be a
wild-type sample or a sample or cell line collected in a subject,
diagnosed with a MSI positive tumor or with a disease associated
with a mutation in the DNA mismatch repair, at a prior time point,
during the time-course of the disease and/or during the time course
of the treatment.
[0108] As used herein, the term "sample" refers to anything which
may contain DNA and notably the DNA fragment to be amplified. In
some embodiment, the "sample" contains RNA and is therefore
submitted to a reverse transcription step. The sample may be a
biological sample, such as a biological fluid or a biological
tissue. Examples of biological fluids include urine, blood, plasma,
serum, saliva, semen, stool, sputum, cerebrospinal fluid, tears,
mucus, pancreatic juice, gastric juice amniotic fluid, serous
fluids such as pericardial fluid, pleural fluid or peritoneal
fluid.
[0109] Biological tissues are aggregate of cells, usually of a
particular kind together with their intercellular substance that
form one of the structural materials of a human, animal, plant,
bacterial, fungal or viral structure, including connective,
epithelium, muscle and nerve tissues. Examples of biological
tissues also include organs, tumor tissue, lymph nodes, arteries
and disseminated cell(s). The tissue can be fresh, freshly frozen,
or fixed, such as formalin-fixed paraffin-embedded (FFPE) tissues.
The sample can be obtained by any means, for example via a surgical
procedure, such as a biopsy, or by a less invasive method,
including, but not limited to, abrasion or fine needle aspiration.
Preferably, the DNA sample is selected from the group consisting
of: tumor tissue, disseminated cells, feces, blood cells, blood
plasma, serum, lymph nodes, urine, saliva, semen, stool, sputum,
cerebrospinal fluid, tears, mucus, pancreatic juice, gastric juice,
amniotic fluid, cerebrospinal fluid, serous fluids such as
pericardial fluid, pleural fluid or peritoneal fluid.
[0110] The DNA and notably the target DNA fragment can be genomic
DNA or DNA issued from reverse transcriptase. The genomic DNA can
be constitutional DNA, tumor DNA or fetal DNA. In some embodiments,
notably when the sample is a biological fluid, the DNA sample may
contain cell-free DNA (cfDNA), or circulating DNA. Early studies
have shown that tumor DNA is released into the circulation, and is
present in particularly high concentrations in plasma and serum in
a number of different types of cancer (Leon et al., 1977 Cancer Res
37:646-650; Stroun et al., 1989 Oncology 46:318-322). Thus, DNA
sample according to the invention can contain cell-free tumor DNA
or circulating tumor DNA. In another embodiment, the DNA sample
contains cell-free fetal DNA. Due to its high sensitivity, the
method of the invention can be used on plasma sample containing low
concentration of circulating, or cell-free target DNA such as
cell-free or circulating tumor DNA or fetal DNA. In some
embodiments of the present invention, the DNA can be obtained from
reverse transcription of an RNA sample.
[0111] Typically a DNA sample according to the invention is
obtained from a subject. The subject, or the patient (both terms
can be used interchangeably) of the invention is a mammal,
typically a primate, such as a human. In some embodiments, the
primate is a monkey or an ape. The subject can be male or female
and can be any suitable age, including infant, juvenile,
adolescent, adult, and geriatric subjects. In some embodiments, the
subject is a non-primate mammal, such as a rodent.
[0112] In some embodiments of the invention, the subject has a
cancer, is in remission of a cancer, or is at risk of suffering
from a cancer notably based on family history. In some embodiments
for example the subject has familial tumor predisposition.
[0113] In some embodiment, the subject is suffering from, is in
remission, or has familial cancer predisposition, notably the
subject is suffering from or is at risk of suffering from a disease
caused by mutations in mismatch repair (MMR) genes, such as
Constitutional mismatch repair deficiency syndrome (CMMRD syndrome)
or Lynch syndrome. The cancer may be a solid cancer or a "liquid
tumor" such as cancers affecting the blood, bone marrow and
lymphoid system, also known as tumors of the hematopoietic and
lymphoid tissues, which notably include leukemia and lymphoma.
Liquid tumors include for example acute myelogenous leukemia (AML),
chronic myelogenous leukemia (CML), acute lymphocytic leukemia
(ALL), and chronic lymphocytic leukemia (CLL), (including various
lymphomas such as mantle cell lymphoma or non-Hodgkins lymphoma
(NHL).
[0114] Solid cancers notably include cancers affecting one of the
organs selected from the group consisting of colon, rectum, skin,
endometrium, lung (including non-small cell lung carcinoma),
uterus, bones (such as Osteosarcoma, Chondrosarcomas, Ewing's
sarcoma, Fibrosarcomas, Giant cell tumors, Adamantinomas, and
Chordomas), liver, kidney, esophagus, stomach, bladder, pancreas,
cervix, brain (such as Meningiomas, Glioblastomas, Lower-Grade
Astrocytomas, Oligodendrocytomas, Pituitary Tumors, Schwannomas,
and Metastatic brain cancers), ovary, breast, head and neck region,
testis, prostate and the thyroid gland.
[0115] In some embodiments of the present invention the cancer is
the Constitutional mismatch repair deficiency syndrome (CMMRD
syndrome) or the Lynch syndrome
[0116] In the context of the present invention, a cancer (or a
tumor) associated with MSI is also named a MSI positive cancer (or
a MSI positive tumor) and relates to a cancer (or tumor) wherein
the genomic tumor DNA exhibits at least one mutation in a
microsatellite sequence. A MSI positive cancer may thus be any of
the cancers as listed above wherein the genomic tumor DNA exhibits
at least one mutation in a microsatellite sequence
Clinical Applications: Diagnostic and Prognosis Methods,
Therapeutic Treatment and Patient Monitoring.
[0117] The method for identifying a mutated microsatellite sequence
in a target DNA fragment as described above has several major and
direct clinical applications.
[0118] First, as previously mentioned, microsatellite instability
is a hypermutator phenotype that occurs in tumors associated with
impaired DNA mismatch repair (MMR). MSI has thus been associated
with a great variety of cancers such as but not limited to
colorectal cancers, gastric cancer, endometrium cancer, ovarian
cancer, urinary tract cancer, brain cancer, and breast cancer. MSI
is most prevalent as the consequence of colon cancers. MSI is
typically found the Constitutional mismatch repair deficiency
syndrome (CMMRD syndrome) or the Lynch syndrome.
[0119] Therefore, detection of a mutated microsatellite sequence
according to the method as previously described can be used in the
diagnostic of cancers as previously defined, in particular of
cancers (as previously defined), which are associated with impaired
DNA mismatch repair and notably of MSI positive cancers (or
tumors).
[0120] In one embodiment of the invention, detection of a mutated
microsatellite sequence according to the method can also be used in
the diagnostic of diseases which are caused by mutations in
mismatch repair (MMR) genes, such MSI positive tumors notably such
as Constitutional mismatch repair deficiency syndrome (CMMRD
syndrome) or Lynch syndrome, or in the diagnostic of familial tumor
predisposition in a subject.
[0121] Thus in one aspect, the present invention relates to a
method for the diagnostic of cancers, notably of diseases
associated with mutations in mismatch repair (MMR) genes, such as
MSI positive tumors, and/or of familial tumor predisposition to
cancer in a subject, comprising the detection of a mutation in a
microsatellite sequence locus of a target DNA from a DNA sample
according to the present invention. Typically the target DNA is
genomic DNA originating from a tumor. The sample can be obtained
from a subject as previously described. In one embodiment,
detection of a mutated microsatellite sequence in a DNA sample from
a subject indicates that the subject is suffering from a disease
caused by mutations in the MMR genes such as MSI positive tumors,
notably CMMRD or Lynch syndrome. Detection of a mutated
microsatellite sequence in a DNA sample from a subject may also
indicate that the subject has familial tumor predisposition such as
in the CMMRD or Lynch syndrome.
[0122] Mutations in MMR genes include addition, deletion or
substitution, in particular single nucleotide variations (SNVs), as
well as epimutations (such as DNA hypermethylation).
[0123] The prevalence of MSI positive tumors is higher in
colorectal cancers, gastric cancers, endometrium cancers. However,
MSI has been found at a lower prevalence in virtually all type of
cancers (see Hause et al., 2016 Nature Medicine), albeit with low
prevalence. As previously mentioned, the MSI phenotype of the
cancer (i.e. positive or negative) has important implications in
cancer prognosis and rational planning of treatment (Boland and
Goel, Gastroenterology 2010). Therefore even in the case of cancers
with low MSI positive prevalence, it remains of high relevance to
identify whether the patient is suffering from a MSI positive tumor
or a MSI negative tumor. The method of the present invention can
therefore be used in the prognosis of various cancers.
Identification of a positive MSI cancer is generally associated
with a better prognosis.
[0124] Thus, the present invention also relates to a method for the
prognosis of cancers (as previously defined) comprising the
detection of a mutation in a microsatellite sequence locus of a DNA
sample according to the present invention. In some embodiment,
identification of a mutated microsatellite sequence in the sample,
preferably a DNA sample originating from a tumor, indicates that
said tumor is MSI positive.
[0125] In the therapeutic contexts as above mentioned, the methods
of the invention are particularly useful as its great sensitivity
allows detection of microsatellite instability in DNA samples
containing very low concentrations of target DNA. The method of the
invention can therefore be routinely performed on biological
samples such as blood samples, plasma samples, urine or even feces.
Typically, the methods of the invention are performed on blood
sample or plasma sample and the target DNA is a cell-free DNA, such
as a circulating tumor DNA. This point is particularly relevant for
diseases such as CMMRD, which involve cerebral tumor with no biopsy
access.
[0126] The present invention also relates to a method for
predicting the efficacy of a treatment, as reports have shown for
example that colorectal cancer patients with MMR deficiency have
better responses to immunotherapy by PD-1 immune checkpoint
blockade and show improved progression-free survival. Therefore,
identification of patients suffering from cancer associated with
MSI (i.e. MSI positive cancer or tumor) is of high clinical
relevance for selection of an appropriate therapeutic strategy.
[0127] Thus, another aspect of the present invention concerns a
method for predicting the efficacy of a treatment in a subject
suffering from a cancer, wherein said method comprises the
detection of a mutation in a microsatellite sequence locus of a
target DNA fragment from a subject DNA sample as previously
described. Preferably, the target DNA fragment is originating from
a tumor. Typically the DNA sample is obtained from a subject
suffering from a tumor and/or having familial cancer
predisposition. The present invention also proposes a method of
treatment of a cancer in a subject in need thereof comprising the
detection of a mutation in a microsatellite sequence locus of a
target DNA fragment from a DNA sample according to the methods as
herein described. Typically the target DNA fragment is originating
from a tumor. Typically also the DNA sample is obtained from a
subject suffering from a tumor and/or having familial cancer
predisposition.
[0128] Preferably, the treatment is immunotherapy. Immunotherapy
includes but is not limited to immune checkpoint modulators (i.e.
inhibitors and/or agonists), monoclonal antibodies, cancer
vaccines.
[0129] Most preferably, the treatment comprises administration of
immune checkpoint modulators such as anti-PD-1 and/or anti-PDL-1
inhibitors.
[0130] Preferably, immunotherapy is administered to the subject if
a mutation in a microsatellite sequence locus of a target DNA
(notably a target tumor DNA) from a DNA sample is detected.
[0131] Furthermore, the method of the invention for detecting
microsatellite instability may also be used for the monitoring of a
subject diagnosed with a tumor associated with impaired DNA
mismatch repair. Preferably, said monitoring is performed during
the time course of the treatment. The method may also be used for
the monitoring of cancer relapse in a subject having suffered from
a tumor associated with impaired DNA mismatch repair. Thus, in
another aspect, the present invention also provides a method for
the monitoring of a patient diagnosed with a tumor associated with
impaired DNA mismatch repair, or having suffered from such a tumor,
comprising the detection of a mutation in a microsatellite sequence
locus of a target tumor DNA from a DNA sample selected from a
plasma or a serum sample obtained from a subject diagnosed with a
tumor associated with impaired DNA mismatch repair or having
suffered from a tumor associated with impaired DNA mismatch repair.
In patient having suffered from a tumor associated with impaired
DNA mismatch repair, detection of microsatellite instability in
circulating tumor DNA may be indicative of a relapse.
[0132] Multiplexed Assays for the Detection of a Mutation in a
Microsatellite Sequence Locus of a Target Dna from a Dna Sample
[0133] The power for detecting the presence of MSI in tissues
associated with a particular disease, such as cancerous tumors, can
be increased tremendously by multiplexing multiple markers. Thus,
in the context of the invention more than one set of primer/probe
as previously defined can be used in a multiplexed assay such that
more than one microsatellite sequence locus (i.e.; a panel
microsatellite sequence loci) as previously defined can be
targeted.
[0134] As a matter of example, microsatellite sequence loci of the
panel for multiplexed assays according to the invention can be
selected among the group consisting of BAT-25, BAT-26, BAT-34c4,
BAT-40, NR21, NR24, MONO-27, D2S123, D5S346, D17S250, ACVR2A,
DEFB105A, DEFB105B, RNF43, DOCK3, GTF2IP1, LOC100093631, PIP5K1A,
MSH3, TRIM43B, PPFIA1 and TDRD1 and in any of the groups as
previously defined.
[0135] Such multiplexed assay is particularly useful in the
clinical applications as previously described.
[0136] Preferably, in multiplexed assays, the primers pairs are
designed using available computer programs such that upon
amplification the resulting amplicons are predicted to have the
same melting temperature.
[0137] When in the digital range (where all compartments contain
either 0 or 1 target molecule) it is possible to multiplex qPCR
assays without concern for competition or cross reactivity, as each
target-containing reaction will proceed with the target binding to
its primers/probe specifically, whereas no reaction will occur in
compartments without targets. Having each molecule in a separate
reaction compartment allows both high and low abundance targets to
be counted in the same experiment without concern for "swamping
out" the low abundance target (since each compartment has at most 1
target, independent of its concentration in the average sample
volume). When more than one target is counted (e.g., in a duplex
assay format), ratios of the counts for one target relative to
another (e.g., mutant allele vs. wild type allele) enable "absolute
ratios" to be quantified, using one of the targets as an internal
normalizing reference (e.g., how many amplifiable genome
equivalents were loaded) that has gone through the identical
experiment as the other targets assayed.
[0138] In addition, since dPCR is performed as an endpoint reaction
(PCR is run to completion before measuring fluorescence), having
true single target molecules in isolation allows multiplexing based
on probe intensity (Zhong, Bhattacharya, et al., 2011 Multiplex
digital PCR: breaking the one target per color barrier of
quantitative PCR. Lab Chip, 11:2167-2174). By adding the
target-specific fluorescent assay at a limiting concentration, a
compartment with that target molecule will be PCR-positive, but
with a limited brightness at PCR endpoint. To count a second target
type, a different target-specific probe with the same "color" (i.e.
with the same fluorophore) is added at a different concentration. A
compartment with the second target will have a brighter signal at
PCR endpoint than a compartment with the first target, providing
separate clouds and thus enabling separate counts for each target.
Thus, combinations of both different color probes and different
concentration probes can be used to multiplex at higher levels.
[0139] Kits:
[0140] The present invention also encompasses kit for identifying a
mutation in a microsatellite sequence region of a DNA sample
comprising a primer/probe set comprising: [0141] a pair of primers
suitable for amplifying a target DNA fragment of said DNA sample
including the said microsatellites sequence; [0142] a first
oligonucleotide probe, labeled with a first fluorophore, wherein
said first oligonucleotide probe is complementary to a wild-type
sequence including the microsatellites sequence; [0143] a second
oligonucleotide probe, labeled with a second fluorophore, wherein
said second oligonucleotide probe is complementary to a wild-type
sequence of said amplified DNA fragment located outside of the said
microsatellite sequence; [0144] a thermostable DNA polymerase.
[0145] Thermostable DNA polymerases are typically described in
Newton and Graham 1994
[0146] In: PCR, BIOS Scientific Publishers, Ltd., Oxford, UK. 13.
Advantageously, the thermostable polymerase is the Taq
polymerase.
[0147] In one aspect, the kit comprises more than one primer/probe
set, wherein the primer/probe sets allows amplification and
detection of target DNA fragments comprising distinct
microsatellite sequences.
[0148] The kit as above mentioned can be used in the clinical
applications as previously described.
FIGURES
[0149] FIG. 1: A-C. 2-D fluorescence amplitude scatter plots of
BAT-26 ddPCR MSI assay using HCT-116 cell line DNA (MSI-H), PBMC
(WT) or a 10% dilution of HCT-116 in WT DNA. D-F. 2-D fluorescence
amplitude scatter plots of DEFB105A/B ddPCR MSI assay using HCT-116
cell line DNA (MSI-H), PBMC (WT) or a 10% dilution of HCT-116 in WT
DNA. G-I. 2-D fluorescence amplitude scatter plots of ACVR2A ddPCR
MSI assay using HCT-116 cell line DNA (MSI-H), PBMC (WT) or a 10%
dilution of HCT-116 in WT DNA. Droplets containing WT alleles are
positive for both FAM and VIC signals, while droplets containing
MSI alleles are positives for VIC signal only.
[0150] FIG. 2: Correlation curves obtained for BAT-26 (A),
DEFB105A/B (B) and ACVR2A (C) assays for observed versus expected
MAFs in reconstituted mutant serial dilutions (10%, 5%, 2.5%, 1.25,
0.63%, 0.31%, 0.16%, 0.08%, 0.04%, 0.02%, 0.01%). Dotted lines:
LOB, estimated as the upper 95% CI of false-positive calls in at
least 53 independent ddPCR reactions with WT DNA.
[0151] FIG. 3: Correlation between ctDNA fractions estimated by
BAT-26 (A), ACVR2A (B) or DEFB105A/B (C) ddPCR assays and a ddPCR
assay targeting specifically BRAF.sup.v600E mutation.
[0152] FIG. 4: 2-D fluorescence amplitude scatter plot illustrating
fluorescence signals obtained with a triplex assay targeting
simultaneously BAT-26, ACVR2A and DEFB105A/B microsatellite markers
using a 10% dilution of HCT-116 cell line in WT DNA. Results
obtained with annealing temperature and extension time at
63.degree. C. for 3min. Primers and probes concentrations were:
BAT-26: 0.2x; ACVR2A: 0.6x; DEFB105A/B: 1x.
RESULTS
MATERIALS AND METHODS
[0153] Primers and Probe Design
[0154] Primers and probes were designed with the support of
Primer3Plus Software (Whitehead Institute for Biomedical Research).
All primers were checked for non-specific binding using Primer
BLAST and absence of secondary structures. Primers were designed to
generate amplicons smaller than 140 bp for optimal amplification of
cell free DNA (cfDNA) and fragmented DNA extracted from
formalin-fixed paraffin-embedded (FFPE) tumor samples.
Oligonucleotide sequences used in this study are provided in Table
1. BAT-26 singleplex: SEQ IDs. 1-4; ACVR2A singleplex: SEQ IDs.
5-8; DEFB105A/B singleplex: SEQ IDs. 9-12; BRAF V600E singleplex:
SEQ ID. 13-16; BAT-26-ACVR2A-DEFB105A/B triplex: SEQ IDs.1-5, 7, 9,
11, 17-20. Desalted primers and HPLC-purified probes were
manufactured by Invitrogen and Applied Biosystems UK.
[0155] ddPCR Conditions
[0156] Droplet digital PCR (ddPCR) was performed using the Bio-Rad
QX100 system as instructed by the manufacturer. PCR reactions were
prepared in a 20 .mu.L volume containing 10 .mu.L of 2.times.
Supermix for Probes without dUTP (Bio-Rad ref. 1863024), 900 nM of
each primer, 250 nM of each TaqMan.RTM. probe and up to 16.5 ng of
DNA template, which is equivalent to 5,000 copies. The PCR reaction
was then transferred to a disposable droplet generator cassette
(Bio-Rad ref. 864008). 70 .mu.L of droplet generation oil (Bio-Rad
ref. 1863005) was added and the cassette loaded into the droplet
generator. Generated droplets (40 .mu.L) were transferred to a
96-well PCR plate (Eppendorf ref. 0030 128.575). Emulsified PCR
reactions were then run on a C1000 thermal cycler (Bio-Rad) under
the following cycling conditions: denaturation at 95.degree. C. for
10 min followed by 40 amplification cycles of 94.degree. C. for 30
sec, 61.degree. C. for 3 min (BAT-26) or 59.degree. C. for 3min
(DEFB105A/B) or 55.degree. C. for 3 min (ACVR2A) or 60.degree. C.
for 1 min (BRAFV600E); final hold at 98.degree. C. for 10min. Ramp
rate was set to 2.5.degree. C./sec. At each run, controls with no
DNA and controls containing 100% WT or 100% mutant DNA were
included. Cluster thresholding and quantification was performed
with the QuantaSoft v1.7.4 software (Bio-RAD). For the ddPCR MSI
assays, droplets were manually assigned as WT or MSI positive based
on their fluorescence amplitude: WT, VIC.sup.+/FAM.sup.+, MSI
positive (mutant), VIC.sup.+/FAM.sup.-/low. Droplets with no
template were assigned VIC.sup.-/FAM.sup.-. Assay optimization was
performed with genomic DNA (gDNA) of HCT-116 cell line (a MSI
positive colon cancer cell line) diluted or not in WT DNA obtained
from peripheral blood mononuclear cells (PBMC). From droplets
counts through manual assignment, mutant allele frequencies (MAF)
were determined.
[0157] LOB and LOD Calculations
[0158] The background signal or false-positive rate of each assay
was estimated using at least 53 replicates of WT DNA. The limit of
blank (LOB) was defined as the upper 95% confidence limit of the
mean false-positive measurements. The analytical sensitivity was
estimated using serial dilutions of HCT-116 cell line in WT DNA, in
mutant allele frequencies (MAF) ranging from 10% to 0.01% (1:2
serial dilutions). The total number of replicates per dilution
point ranged from 3 to 8 (10% and 5%, 3.times.; 2.5% and 1.25%,
4.times.; 0.63% to 0.16%, 6.times.; 0.08% to 0.01%, 8.times.) in
order to maximize the detection of rare events. The limit of
detection (LOD) was estimated as the lowest mutant concentration
likely to be reliably distinguished from the LOB.
[0159] Validation of the ddPCR MSI Assays in Patient Samples
[0160] Formalin-fixed paraffin-embedded (FFPE) tumor tissue, plasma
or serum samples of patients with predominantly colorectal cancer
(CRC) or endometrial carcinomas (EC) were used to validate the
ddPCR MSI assays. All samples were obtained from patients treated
and enrolled in clinical studies at the Institut Curie (Paris,
France), with approval from the Institution's Clinical Research
Ethical Board. Samples were selected from a pool of microsatellite
stable (MSS) or microsatellite instable (MSI-H) tumors, identified
by the pentaplex PCR method (Bather et al 2004) in association or
not with immunohistochemistry staining (IHC) of mismatch repair
(MMR) proteins (MLH1, MSH2, MHS6 and PMS2). gDNA from tumor tissues
was extracted using the Qiagen DNA FFPE Tissue Kit (Qiagen ref.
56404) according to the manufacturer's instructions and stored at
-20.degree. C. cfDNA was extracted from 0.5 to 1.8 mL of plasma or
serum using the QlAamp.RTM. Circulating Nucleic Acid Kit (Qiagen
ref. 55114), following the manufacturer's recommendations and
stored at -20.degree. C. DNA was quantified using Qubit dsDNA HS
assay and LINE-1 amplification (Rago et al 2007). ddPCR reactions
were performed as described above. Total DNA amount per reaction
varied from 2.5 ng to 10 ng for FFPE samples and from 1 ng to 10 ng
for plasma or serum samples.
RESULTS
[0161] BAT-26, ACVR2A and DEFB105A/B MSI ddPCR Assays Reliably
Detect Allele Size Variations in the Microsatellites Located Inside
MSH2, ACVR2A and DEFB105A and B Genes, Respectively
[0162] We developed ddPCR assays capable of detecting allele size
variations for 3 mononucleotide poly(A) microsatellite (MS)
markers: BAT-26, a quasi-monomorphic long A.sub.27 repeat located
at the fifth intron of MSH2 gene, and two shorter A.sub.8 and
A.sub.9 repeats located in the tenth exon of ACVR2A and second
intron of DEFB105A/B paralogous genes, respectively (Table 1).
BAT-26 is one of the five microsatellite markers widely used to
determine the MSI status of colorectal and endometrial tumors in
clinical practice (Suraweera et al 2002). The microsatellites
located within ACVR2A and DEFB105A/B genes are novel discriminatory
markers recently identified from the analysis of TOGA exome
sequencing data as recurrently unstable in MSI-H tumors, as
compared to MSS tumors (Hause et al 2016; Maruvka et al 2017). The
three assays are based on the drop-off ddPCR strategy, which
identifies mutated alleles based on the absence of a WT signal
(Decraene et al 2018). For each microsatellite marker two Taqman
hydrolysis probes were designed within the same amplicon. A VIC
labelled reference probe (REF), which hybridizes to a non-variable
sequence upstream or downstream of the microsatellite region and a
FAM labelled drop-off probe (MS), which covers the entire poly-A
homopolymer plus 2 to 4 bases on either side to confer its ability
to bind properly and the resulting destabilization in case of
mutated alleles associated with microsatellite instability. While
the REF probe quantifies the total number of copies of the amplicon
(i.e. BAT-26, ACVR2A or DEFB105A/B DNA fragments), the MS probe
discriminates WT and MSI alleles due to inefficient hybridization
to mutant sequences. Therefore, with this type of assay 2-D scatter
plots of VIC and FAM fluorescence amplitude may show three possible
clusters of droplets: droplets with no template
(VIC.sup.-/FAM.sup.-), droplets containing WT alleles
(VIC.sup.+/FAM.sup.+) and droplets containing MSI positive alleles
(VIC.sup.+/FAM.sup.-/low) (FIGS. 1A to 1I).
[0163] Given the low complexity of the MS probe, adjustments to
standard ddPCR conditions (BioRAD guidelines) had to be made in
order to achieve specific hybridization to WT alleles. We observed
that a thermal cycling protocol with increased annealing
temperature and annealing/extension time improved significantly the
specificity of the MS probe to WT alleles and, accordingly,
improved the separation of the WT and MSI-positive clouds.
Optimized assays were able to specifically detect MSI alleles in
DNA extracted from HCT-116 MSI-H cell line while no instability
could be observed in WT DNA derived from peripheral blood
mononuclear cells (PBMC) (FIGS. 1A and 1B for BAT-26; 1D and 1E for
DEFB105A/B, 1G and 1H for ACVR2A). Moreover, the three assays were
able to accurately quantify MSI alleles in 1/10 dilutions of
HCT-116 cell line in a WT background (FIGS. 10, 1F, 1I).
[0164] BAT-26, ACVR2A and DEFB105A/B ddPCR Assays are Highly
Specific and Reach a Limit of Detection Below 0.1%
[0165] Analytical specificity of BAT-26, ACVR2A and DEFB105A/B
ddPCR MSI assays was evaluated by measuring false-positive MSI
calls in at least 53 individual ddPCR reactions of WT DNA derived
from PBMCs (average number of copies per reaction: 4520 for BAT-26;
3380 for ACVR2A and 3740 for DEFB105A/B). Mean false positive rates
were: 0.006908.+-.0.01366% for BAT-26 (MSI calls in 11/53
reactions), 0.006136.+-.0.01623% for ACVR2A (MSI calls in 7/55
reactions) and 0.005604.+-.0.01911% for DEFB105A/B (MSI calls in
5/55 reactions). The limit of blank (LOB) of each assay was
estimated at 0.01067% for BAT-26 (FIG. 2A), 0.01077% for DEFB105A/B
(FIG. 2B) and 0.01052% for ACVR2A (FIG. 2C). The analytical
sensitivity was estimated using serial dilutions of HCT-116 cell
line in WT PBMC DNA, in mutant allele frequencies (MAF) ranging
from 10% to 0.01% (1:2 serial dilutions). The total number of
replicates per dilution point ranged from 3 to 8 (10% and 5%,
3.times.; 2.5% and 1.25%, 4.times.; 0.63% to 0.16%, 6.times.; 0.08%
to 0.01%, 8.times.) in order to maximize the detection of rare
events. For the three assays, excellent linear correlations were
observed between the expected and observed MAF, indicating that the
three assays can accurately quantify MSI in a wide range of
frequencies, R.sup.2=0.9984 p<0.0001 for BAT-26 (FIG. 2A),
R.sup.2=0.9964 p<0.0001 for DEFB105A/B (FIG. 2B) and
R.sup.2=0.9955 p<0.0001 for ACVR2A (FIG. 2C). The limit of
detection (LOD), estimated as the lowest mutant concentration
likely to be accurately distinguished from the LOB was estimated at
0.04% for BAT-26 (FIG. 2A) and 0.08% for both DEFB105A/B (FIG. 2B)
and ACVR2A markers (FIG. 2C). We conclude that the three MSI ddPCR
assays are both highly sensitive and specific, promising better
diagnostic accuracy and the unprecedented use of a MSI biomarker in
liquid biopsies for diagnosis and monitoring of disease treatment
and progression.
[0166] ddPCR MSI Testing in Clinical Samples
[0167] We next evaluated the performance of the BAT-26, ACVR2A and
DEFB105A/B ddPCR MSI assays in 177 FFPE tumor samples obtained
predominantly from patients with colorectal or endometrial cancers
(Table 2). These samples had been previously characterized as MSI
positive (MSI-H, n=94) or MSI negative (MSS, n=83) using the
standard multiplex-PCR capillary electrophoresis method which
evaluates microsatellite instability in 5 microsatellite markers:
BAT-26, NR-21, BAT-25, MONO-27 and NR-24. Samples showing
instability for at least 2 of the 5 markers were considered MSI
positive (MSI-H), while samples showing no instability were
classified as MSI negative (MSS).
[0168] Importantly, ddPCR and following analyses were performed
blindly, without knowledge of the MSI status of samples. As shown
in Table 2, MSI ddPCR identified unstable alleles for BAT-26,
ACVR2A and DEFB105A/B markers in 92, 87 and 81 samples,
respectively. Noteworthy for BAT-26 concordant results between
capillary electrophoresis and ddPCR were obtained for 172 out of
the 177 samples tested. For 3 of the 5 discordant samples, BAT-26
status could not be determined by capillary electrophoresis, but
was defined as unstable by ddPCR. For the other 2 discordant
samples, BAT-26 was classified as unstable by capillary
electrophoresis but was reported as stable and undetermined by
ddPCR. Considering a sample as MSI-H if instability was found for
at least 2 out of the 3 ddPCR markers analyzed, MSI ddPCR could
correctly classify 100% (83/83) of the MSS samples as MSS and 94%
(88/94) of the MSI-H samples as MSI-H. Of note, most of the
discordant cases corresponded to endometrial tumor samples (4/6)
which are more difficult to classify than colorectal cancers and
more prone for false-negative results (Suraweera et al 2002; Wang
et al 2017).
[0169] Given the high sensitivity and specificity of the MSI ddPCR
assays, we next evaluated their performance on 22 plasma or serum
samples collected from 12 patients with stage IV MSI-H colorectal
or endometrial tumors. Notable MSI ddPCR assays were able to detect
microsatellite instability in all the samples tested, including
samples with low mutant allele frequencies, close to 0.2% (Table
3). Moreover, five of these 12 patients had BRAF mutated tumors
(BRAF V600E). Therefore, mutant allele frequencies reported by the
MSI ddPCR assays could be directly compared with the ones obtained
with a ddPCR assay that targets specifically BRAF V600E mutation.
Excellent correlations were obtained (R.sup.2=0.9852 p<0.0001
for BAT-26, R.sup.2=0.9603 p<0.0001 for ACVR2A and
R.sup.2=0.9275 p<0.0001 for DEFB105A/B), which further supports
the reliability of the ddPCR MSI assays for detection and
quantification of circulating tumor DNA (FIGS. 3A to 3C). Taken
together, these results demonstrate that the MSI ddPCR assays can
accurately detect MSI in patient samples and therefore, can be used
as an alternative method for MSI testing in tumor tissue and liquid
biopsies in clinical practice.
Development of a Multiplex Assay
[0170] We next aimed at developing a multiplex MSI ddPCR assay that
can simultaneously detect MSI status for BAT-26, ACVR2A and
DEFB105A/B markers in a single reaction. The multiplex strategy
consisted in varying the concentrations of primers and probes in
order to change end-point fluorescence so that WT and MSI-positive
clusters of droplets for the 3 markers could be distinguished from
each other (see Bio-Rad droplet digital PCR multiplexing
guideline). Different primers and probes as well as diverse
combinations of primer and probe concentration, annealing
temperature and extension time were tested, some of which generated
satisfactory results. One example, obtained with
annealing/extension temperature/time at 63.degree. C. for 3 min and
the following primer/probe combinations: BAT-26, SEQ IDs. 1-4,
0.2.times., ACVR2A, SEQ IDs. 5, 7, 17 and 18, 0.6.times. and
DEFB105A/B, SEQ IDs. 9, 11, 19 and 20, 1.times. is presented in
FIG. 4. These results, although preliminary, demonstrate the
feasibility of multiplexing ddPCR assays targeting diverse
microsatellite sequences in a single reaction.
TABLE-US-00001 TABLE 1 List of primers and probes BAT-26 Primer Fw
SEQ ID NO. 1 GACTTCAGCCAGTATATGAAATTGGATATTG BAT-26 Primer Rev SEQ
ID NO. 2 GTATATGTCAATGAAAACATTTTTTAACCATTCAAC BAT-26 Probe REF SEQ
ID NO. 3 VIC-AGCAGTCAGAGCCCTTAACCTTT-MGB-NFQ BAT-26 Probe MS SEQ ID
NO. 4 FAM- AGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAGG- MGB-NFQ ACVR2A Primer
Fw SEQ ID NO. 5 GAGGAGGAAATTGGCCAGCATC ACVR2A Primer Rv SEQ ID NO.
6 AGCTAACTGGATAACTTACAGCATG ACVR2A Probe REF SEQ ID NO. 7
VIC-ACTTCCTGCATGTCTTCAAGAG-MGB-NFQ ACVR2A Probe MS SEQ ID NO. 8
FAM-CCTCTTTTTTTTATGC-MGB-NFQ DEFB105A/B Primer Fw SEQ ID NO. 9
TTGAAAAATCTGGGCTGATTCTTGA DEFB105A/B Primer Rev SEQ ID NO. 10
TGAGGGAGCTTTCCAGGAAATG DEFB105A/B Probe REF SEQ ID NO. 11
VIC-CTTTGACATGTTCCCCATTTCTAG-MGB-NFQ DEFB105A/B Probe MS SEQ ID NO.
12 FAM-TCCCTTTTTTTTTGGT-MGB-NFQ BRAF Primer Fw SEQ ID NO. 13
TGAAGACCTCACAGTAAAAATAGGTGA BRAF Primer Fw SEQ ID NO. 14
ACTGATGGGACCCACTCCATC BRAF Probe WT SEQ ID NO. 15
VIC-TAGCTACAGTGAAAT-MGB-NFQ BRAF Probe V600E SEQ ID NO. 16
FAM-CTAGCTACAGAGAAAT-MGB-NFQ ACVR2A Primer Rv-1 SEQ ID NO. 17
CAGCATGTTTCTGCCAATAATCTC ACVR2A Probe MS-1 SEQ ID NO. 18
FAM-AGGCCTCTTTTTTTTATG-MGB-NFQ DEFB105A/B Primer Rev-1 SEQ ID NO.
19 GCCAAGAAAGAGCTGCTGAG DEFB105A/B Probe MS-1 SEQ ID NO. 20
FAM-AACTGTCCCTTTTTTTTTGGT-MGB-NFQ
TABLE-US-00002 TABLE 2 Instability patterns obtained by
pentaplex-PCR (*BAT-26, NR-21, BAT- 25, Mono-27 and NR-24) and
ddPCR MSI assays in FFPE tumor samples. Pentaplex ddPCR Tumor
Profile* Classification ACVR2A DEFB105 Classification colon ND++++
MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H +
+ - MSI-H colon +++++ MSI-H + - + MSI-H colon +++++ MSI-H + - +
MSI-H colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H + - + MSI-H
colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H colon
+++++ MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H colon +++++
MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H +
+ + MSI-H colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H + + +
MSI-H colon +++++ MSI-H + + + MSI-H colon ND++++ MSI-H + + + MSI-H
colon +++++ MSI-H + + + MSI-H colon ++-++ MSI-H + + + MSI-H colon
+++++ MSI-H + + + MSI-H colon +++-- MSI-H + + + MSI-H colon +++++
MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H +
+ + MSI-H colon ++++- MSI-H + + + MSI-H colon +++++ MSI-H + + +
MSI-H colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H
colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H colon
+++++ MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H colon +++++
MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H colon ++++- MSI-H +
+ + MSI-H colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H + + +
MSI-H colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H
colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H colon
+++++ MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H colon +++++
MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H +
+ + MSI-H colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H + + +
MSI-H colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H
colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H colon
+++++ MSI-H + + + MSI-H colon +-+++ MSI-H + + + MSI-H colon +++++
MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H +
+ + MSI-H colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H + + +
MSI-H colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H
colon +++++ MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H colon
+++++ MSI-H + + + MSI-H colon +++++ MSI-H + + + MSI-H endometrial
+--+- MSI-H + + - MSI-H endometrial +++++ MSI-H + + + MSI-H
endometrial ND++++ MSI-H ND + + MSI-H endometrial +++++ MSI-H + + +
MSI-H endometrial +--++ MSI-H + + - MSI-H endometrial ND++++ MSI-H
+ + - MSI-H endometrial +++++ MSI-H + - + MSI-H endometrial +-+-+
MSI-H + + - MSI-H endometrial +++++ MSI-H + + - MSI-H endometrial
+++++ MSI-H + + - MSI-H endometrial +-+-+ MSI-H + + + MSI-H
endometrial +++++ MSI-H + + + MSI-H endometrial +++++ MSI-H + + +
MSI-H endometrial +++++ MSI-H + + + MSI-H endometrial +++++ MSI-H +
+ + MSI-H endometrial +++++ MSI-H + + + MSI-H cholangiocarcinoma
+++++ MSI-H + + + MSI-H intestine +++++ MSI-H + + + MSI-H rectum
+++++ MSI-H + + + MSI-H rectum +++++ MSI-H + + + MSI-H sebaceome
+-++- MSI-H + + + MSI-H stomach +++++ MSI-H + + + MSI-H colon
ND+ND+- MSI-H ND - - MSS ovary ND-+++ MSI-H ND + - MSS endometrial
+++++ MSI-H ND + - MSS endometrial +++++ MSI-H + - - MSS
endometrial +-+-- MSI-H - - - MSS endometrial +++++ MSI-H + - - MSS
colon ----- MSS - - - MSS colon ----- MSS - - - MSS colon ----- MSS
- - - MSS colon ----- MSS - - - MSS colon ----- MSS - - - MSS colon
----- MSS - - - MSS colon ----- MSS - - - MSS colon ----- MSS - - -
MSS colon ----- MSS - - - MSS colon ----- MSS - - - MSS colon -----
MSS - - - MSS colon ----- MSS - - - MSS colon ----- MSS - - - MSS
colon ----- MSS - - - MSS colon ----- MSS - - - MSS colon ----- MSS
- - - MSS colon ----- MSS - - - MSS colon ----- MSS - - - MSS colon
----- MSS - - - MSS colon ----- MSS - - - MSS colon ----- MSS - - -
MSS colon ----- MSS - - - MSS colon ----- MSS - - - MSS colon -----
MSS - - - MSS colon ----- MSS - - - MSS colon ----- MSS - - - MSS
colon ----- MSS - - - MSS colon ----- MSS - - - MSS colon ----- MSS
- - - MSS colon ----- MSS - - - MSS colon ----- MSS - - - MSS colon
----- MSS - - - MSS colon ----- MSS - - - MSS colon ----- MSS - - -
MSS colon ----- MSS - - - MSS colon ----- MSS - - - MSS colon -----
MSS - - - MSS colon ----- MSS - - - MSS colon +---- MSS + - - MSS
colon +---- MSS + - - MSS colon +---- MSS + - - MSS endometrial
----- MSS - - - MSS endometrial ----- MSS - - - MSS endometrial
----- MSS - - - MSS endometrial ----- MSS - - - MSS endometrial
----- MSS - - - MSS endometrial ----- MSS - - - MSS endometrial
----- MSS - - - MSS endometrial ----- MSS - - - MSS endometrial
----- MSS - - - MSS endometrial ----- MSS - - - MSS endometrial
----- MSS - - - MSS endometrial ----- MSS - - - MSS endometrial
----- MSS - - - MSS endometrial ----- MSS - - - MSS endometrial
----- MSS - - - MSS endometrial ----- MSS - - - MSS endometrial
----- MSS - - - MSS endometrial ----- MSS - - - MSS endometrial
----- MSS - - - MSS endometrial ----- MSS - - - MSS endometrial
----- MSS - - - MSS endometrial ----- MSS - - - MSS endometrial
----- MSS - - - MSS endometrial ----- MSS - - - MSS endometrial
----- MSS - - - MSS endometrial ----- MSS - - - MSS endometrial
----- MSS - - - MSS endometrial ----- MSS - + - MSS ovary ----- MSS
- - - MSS ovary ----- MSS - - - MSS rectum ----- MSS - - - MSS
rectum ----- MSS - - - MSS rectum ----- MSS - - - MSS rectum -----
MSS - - - MSS rectum ----- MSS - - - MSS rectum ----- MSS - - - MSS
rectum ----- MSS - - - MSS rectum ----- MSS - - - MSS rectum -----
MSS - - - MSS pancreas ----- MSS - - - MSS pancreas ----- MSS - - -
MSS rectum ----- MSS - - - MSS ND: non determined
TABLE-US-00003 TABLE 3 Mutant allele frequencies obtained by ddPCR
MSI assays in body fluid samples collected from patients with stage
IV MSI-H colorectal or endometrial tumors. Patients with
BRAF.sup.V600E mutated tumors are marked by an asterisk MSI-ddPCR
MAF (%) Patient Primary tumor Sampling Sample BAT-26 DEFB105 ACVR2A
P-01* colon before treatment plasma 25.74 19.80 22.30 progression
plasma 0.35 0.32 0.43 P-02 colon pre-surgery serum 0.52 0.62 0.66
P-03 colon pre-surgery serum 0.23 -- -- 1.sup.st progression serum
4.20 2.88 -- 2.sup.nd progression serum -- 0.21 -- P-04* colon
before treatment plasma 62.00 50.88 53.10 treatment plasma 0.45
0.39 0.28 treatment plasma 2.80 2.10 2.60 progression plasma 1.70
-- 2.90 P-05* colon treatment plasma 2.09 1.40 1.90 treatment
plasma 6.80 4.07 5.30 treatment plasma 0.26 -- 0.23 P-06* colon
treatment plasma 11.40 -- 6.60 treatment plasma 13.10 -- 5.50 P-07
colon before treatment plasma 45.27 13.52 37.90 P-08* endometrium
treatment plasma 1.82 0.24 1.47 P-09 endometrium pre-surgery serum
5.70 1.05 1.60 P-10 endometrium pre-surgery plasma 0.65 -- P-11
endometrium pre-surgery serum 0.25 -- P-12 endometrium pre-surgery
serum 1.32 -- pre-surgery serum -- 0.31 --
REFERENCES
[0171] Hause R J, Pritchard C C, Shendure J, Salipante S J (2016)
Classification and characterization of microsatellite instability
across 18 cancer types. Nature Medicine 22(1):1342-1350 [0172] Rago
C, Huso D L, Diehl F, Karim B, Liu G, Papadopoulos N, Samuels Y,
Velculescu V E, Vogelstein B, Kinzler K W, Diaz L A Jr (2007)
Serial assessment of human tumor burdens in mice by the analysis of
circulating DNA. Cancer Research 67(19:9364-9370 [0173] Suraweera
N, Duval A, Reperant M, Vaurt C, Furlan D, Leroy K, Seruca R,
Lacopetta B, Hamelin R (2002) Evaluation of tumor microsatellite
instability using five quasimonomorphic mononucleotide repeats and
pentaplex PCR. Gastroenterology 123:1804-1811 [0174] Maruvka Y,
Mouw K W, Karlic R, Parasuraman P, Kamburov A, Polak P, Haradhvala
N J, Hess J M, Rheinbay E, Brody Y, Koren A, Braunstein L Z,
D'Andrea A, Lawrence M S, Bass A, Bernards A, Michor F, Getz G
(2017) Analysis of somatic microsatellite indels identifies driver
events in human tumors. Nature Biotechnology 35:951-959 [0175]
Decraene C, Silveira AB, Bidard FC, Vallee A, Michel M, Melaabi S,
Vincent-Salomon A, Saliou A, Houy A, Milder M, Lantz O, Ychou M,
Denis M G, Pierga J Y, Stern M H, Proudhon C (2018) Multiple
hotspot mutations scanning by single droplet digital PCR. Clinical
Chemistry 64:317-328 [0176] Wang Y, Shi C, Eisenberg R,
Vnencak-Jones C L (2017) Differences in microsatellite instability
profiles between endometrioid and colorectal cancers. The Journal
of Molecular Diagnostics 19:57-64
Sequence CWU 1
1
20131DNAArtificial Sequenceprimer 1gacttcagcc agtatatgaa attggatatt
g 31236DNAArtificial Sequenceprimer 2gtatatgtca atgaaaacat
tttttaacca ttcaac 36323DNAArtificial SequenceProbe 3agcagtcaga
gcccttaacc ttt 23433DNAArtificial SequenceProbe 4aggtaaaaaa
aaaaaaaaaa aaaaaaaaaa agg 33522DNAArtificial SequencePrimer
5gaggaggaaa ttggccagca tc 22625DNAArtificial SequencePrimer
6agctaactgg ataacttaca gcatg 25722DNAArtificial SequenceProbe
7acttcctgca tgtcttcaag ag 22816DNAartificial sequenceProbe
8cctctttttt ttatgc 16925DNAartificial sequencePrimer 9ttgaaaaatc
tgggctgatt cttga 251022DNAartificial sequencePrimer 10tgagggagct
ttccaggaaa tg 221124DNAartificial sequenceProbe 11ctttgacatg
ttccccattt ctag 241216DNAartificial sequenceProbe 12tccctttttt
tttggt 161327DNAartificial sequencePrimer 13tgaagacctc acagtaaaaa
taggtga 271421DNAartificial sequencePrimer 14actgatggga cccactccat
c 211515DNAartificial sequenceProbe 15tagctacagt gaaat
151616DNAartificial sequenceProbe 16ctagctacag agaaat
161724DNAartificial sequencePrimer 17cagcatgttt ctgccaataa tctc
241818DNAartificial sequenceProbe 18aggcctcttt tttttatg
181920DNAartificial sequencePrimer 19gccaagaaag agctgctgag
202021DNAartificial sequenceProbe 20aactgtccct ttttttttgg t 21
* * * * *
References