U.S. patent application number 16/682773 was filed with the patent office on 2020-09-17 for novel anti-il13 antibodies and uses thereof.
This patent application is currently assigned to Genentech, Inc.. The applicant listed for this patent is Genentech, Inc.. Invention is credited to Sek Chung FUNG, Dan HUANG, Mason LU, Matthew MOYLE, Sanjaya SINGH, Changning YAN.
Application Number | 20200291106 16/682773 |
Document ID | / |
Family ID | 1000004869748 |
Filed Date | 2020-09-17 |
![](/patent/app/20200291106/US20200291106A1-20200917-D00001.png)
![](/patent/app/20200291106/US20200291106A1-20200917-D00002.png)
![](/patent/app/20200291106/US20200291106A1-20200917-D00003.png)
![](/patent/app/20200291106/US20200291106A1-20200917-D00004.png)
![](/patent/app/20200291106/US20200291106A1-20200917-D00005.png)
![](/patent/app/20200291106/US20200291106A1-20200917-D00006.png)
![](/patent/app/20200291106/US20200291106A1-20200917-D00007.png)
![](/patent/app/20200291106/US20200291106A1-20200917-D00008.png)
![](/patent/app/20200291106/US20200291106A1-20200917-D00009.png)
![](/patent/app/20200291106/US20200291106A1-20200917-D00010.png)
![](/patent/app/20200291106/US20200291106A1-20200917-D00011.png)
View All Diagrams
United States Patent
Application |
20200291106 |
Kind Code |
A1 |
FUNG; Sek Chung ; et
al. |
September 17, 2020 |
Novel Anti-IL13 Antibodies and Uses Thereof
Abstract
The present invention relates to anti-IL13 antibodies that bind
specifically and with high affinity to both glycosylated and
non-glycosylated human IL13, does not bind mouse IL13, and
neutralize human IL13 activity at an approximate molar ratio of 1:2
(MAb:IL13). The invention also relates to the use of these
antibodies in the treatment of IL13-mediated diseases, such as
allergic disease, including asthma, allergic asthma, non-allergic
(intrinsic) asthma, allergic rhinitis, atopic dermatitis, allergic
conjunctivitis, eczema, urticaria, food allergies, chronic
obstructive pulmonary disease, ulcerative colitis, RSV infection,
uveitis, scleroderma, and osteoporosis.
Inventors: |
FUNG; Sek Chung;
(Gaithersburg, MD) ; MOYLE; Matthew; (Redmond,
WA) ; LU; Mason; (Houston, TX) ; YAN;
Changning; (Houston, TX) ; SINGH; Sanjaya;
(Sandy Hook, CT) ; HUANG; Dan; (Short Hills,
NJ) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Genentech, Inc. |
South San Francisco |
CA |
US |
|
|
Assignee: |
Genentech, Inc.
South San Francisco
CA
|
Family ID: |
1000004869748 |
Appl. No.: |
16/682773 |
Filed: |
November 13, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15721570 |
Sep 29, 2017 |
|
|
|
16682773 |
|
|
|
|
15434045 |
Feb 15, 2017 |
|
|
|
15721570 |
|
|
|
|
13971394 |
Aug 20, 2013 |
9605065 |
|
|
15434045 |
|
|
|
|
13275658 |
Oct 18, 2011 |
8734797 |
|
|
13971394 |
|
|
|
|
10583927 |
Jan 29, 2009 |
8067199 |
|
|
PCT/US2004/043501 |
Dec 23, 2004 |
|
|
|
13275658 |
|
|
|
|
60532130 |
Dec 23, 2003 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 2317/24 20130101;
C07K 16/244 20130101; C07K 2317/73 20130101; C07K 2317/565
20130101; C07K 2317/34 20130101; A61K 2039/505 20130101; C07K
2317/56 20130101; C07K 2317/92 20130101; C07K 2317/567 20130101;
C07K 2317/76 20130101; A61K 2039/55522 20130101 |
International
Class: |
C07K 16/24 20060101
C07K016/24 |
Claims
1.-61. (canceled)
62. A method for treating atopic dermatitis in a patient,
comprising administering to a patient in need thereof an effective
amount of an anti-IL-13 antibody that specifically binds human
IL-13.
63. The method of claim 62, wherein the anti-IL-13 antibody
comprises a heavy chain variable region comprising complementarity
determining regions CDRH1, CDRH2 and CDRH3 having the amino acid
sequences of SEQ ID NO: 117, SEQ ID NO: 123, and SEQ ID NO: 135,
respectively; and wherein the anti-IL-13 antibody comprises a light
chain variable region comprising complementarity determining
regions CDRL1, CDRL2 and CDRL3 having the amino acid sequences of
SEQ ID NO: 99, SEQ ID NO: 104, and SEQ ID NO: 115,
respectively.
64. The method of claim 62, wherein the anti-IL-13 antibody
comprises a light chain variable region having the amino acid
sequence of SEQ ID NO:142, and a heavy chain variable region having
the amino acid sequence of SEQ ID NO:143.
65. The method of claim 62, wherein the anti-IL-13 antibody is an
IgG1, an IgG2, an IgG3 or an IgG4 antibody.
66. The method of claim 62, wherein the anti-IL-13 antibody is
humanized.
67. A method for treating allergic rhinitis in a patient,
comprising administering to a patient in need thereof an effective
amount of an anti-IL-13 antibody that specifically binds human
IL-13.
68. The method of claim 67, wherein the anti-IL-13 antibody
comprises a heavy chain variable region comprising complementarity
determining regions CDRH1, CDRH2 and CDRH3 having the amino acid
sequences of SEQ ID NO: 117, SEQ ID NO: 123, and SEQ ID NO: 135,
respectively; and wherein the anti-IL-13 antibody comprises a light
chain variable region comprising complementarity determining
regions CDRL1, CDRL2 and CDRL3 having the amino acid sequences of
SEQ ID NO: 99, SEQ ID NO: 104, and SEQ ID NO: 115,
respectively.
69. The method of claim 67, wherein the anti-IL-13 antibody
comprises a light chain variable region having the amino acid
sequence of SEQ ID NO:142, and a heavy chain variable region having
the amino acid sequence of SEQ ID NO:143.
70. The method of claim 67, wherein the anti-IL-13 antibody is an
IgG1, an IgG2, an IgG3 or an IgG4 antibody.
71. The method of claim 67, wherein the anti-IL-13 antibody is
humanized.
72. A method for treating allergic conjunctivitis in a patient,
comprising administering to a patient in need thereof an effective
amount of an anti-IL-13 antibody that specifically binds human
IL-13.
73. The method of claim 72, wherein the anti-IL-13 antibody
comprises a heavy chain variable region comprising complementarity
determining regions CDRH1, CDRH2 and CDRH3 having the amino acid
sequences of SEQ ID NO: 117, SEQ ID NO: 123, and SEQ ID NO: 135,
respectively; and wherein the anti-IL-13 antibody comprises a light
chain variable region comprising complementarity determining
regions CDRL1, CDRL2 and CDRL3 having the amino acid sequences of
SEQ ID NO: 99, SEQ ID NO: 104, and SEQ ID NO: 115,
respectively.
74. The method of claim 72, wherein the anti-IL-13 antibody
comprises a light chain variable region having the amino acid
sequence of SEQ ID NO:142, and a heavy chain variable region having
the amino acid sequence of SEQ ID NO:143.
75. The method of claim 72, wherein the anti-IL-13 antibody is an
IgG1, an IgG2, an IgG3 or an IgG4 antibody.
76. The method of claim 72, wherein the anti-IL-13 antibody is
humanized.
77. A method for treating urticaria in a patient, comprising
administering to a patient in need thereof an effective amount of
an anti-IL-13 antibody that specifically binds human IL-13.
78. The method of claim 77, wherein the anti-IL-13 antibody
comprises a heavy chain variable region comprising complementarity
determining regions CDRH1, CDRH2 and CDRH3 having the amino acid
sequences of SEQ ID NO: 117, SEQ ID NO: 123, and SEQ ID NO: 135,
respectively; and wherein the anti-IL-13 antibody comprises a light
chain variable region comprising complementarity determining
regions CDRL1, CDRL2 and CDRL3 having the amino acid sequences of
SEQ ID NO: 99, SEQ ID NO: 104, and SEQ ID NO: 115,
respectively.
79. The method of claim 77, wherein the anti-IL-13 antibody
comprises a light chain variable region having the amino acid
sequence of SEQ ID NO:142, and a heavy chain variable region having
the amino acid sequence of SEQ ID NO:143.
80. The method of claim 77, wherein the anti-IL-13 antibody is an
IgG1, an IgG2, an IgG3 or an IgG4 antibody.
81. The method of claim 77, wherein the anti-IL-13 antibody is
humanized.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 15/721,570, filed on Sep. 29, 2017, which is a
continuation of U.S. patent application Ser. No. 15/434,045, filed
on Feb. 15, 2017, now abandoned, which is a continuation of U.S.
patent application Ser. No. 13/971,394, filed on Aug. 20, 2013, now
U.S. Pat. No. 9,605,065, issued on Mar. 28, 2017, which is a
continuation of U.S. patent application Ser. No. 13/275,658, filed
on Oct. 18, 2011, now U.S. Pat. No. 8,734,797, issued on May 27,
2014, which is a division of U.S. patent application Ser. No.
10/583,927, filed on Jan. 29, 2009, now U.S. Pat. No. 8,067,199,
issued on Nov. 29, 2011, which is a U.S. National Stage Application
under 35 U.S.C. .sctn. 371 of International Patent Application No.
PCT/US2004/043501, filed on Dec. 23, 2004, which claims the benefit
of priority to U.S. Provisional Application No. 60/532,130, filed
on Dec. 23, 2003, the content of each of which is incorporated by
reference herein in its entirety.
SEQUENCE LISTING
[0002] This application incorporates by reference the Computer
Readable Form (CRF) of a Sequence Listing in ASCII text format
submitted via EFS-Web. The Sequence Listing text file submitted via
EFS-Web, entitled 2019-11-12_01240-0001-08US_Seq_List.txt, was
created on Nov. 11, 2019, and is 90,112 bytes in size.
BACKGROUND OF INVENTION
[0003] The interleukin (IL)-13 is a pleiotropic T helper cell
subclass 2 (Th2) cytokine. Like IL4, IL13 belongs to the family of
type I cytokines sharing the tertiary structure defined by a
4.alpha.-helical hydrophobic bundle core. IL13 has approximately
30% amino acid sequence homology with IL4 and shares many of the
properties of IL4 (Wynn, Ann. Rev. Immunol., 21: 425 (2003)). The
functional similarity of IL4 and IL13 is attributed to the fact
that IL13 can bind IL4 receptor alpha chain (IL4R-.alpha.)
subsequent to its binding to IL13 receptor alpha chain-1 (IL
13R.alpha.1) (Hershey, J. Allergy Clin. Immunol., 111: 677 (2003)).
IL4R.alpha. is activated by IL4 and IL13 resulting in
Jak1-dependent STAT6 phosphorylation. Both IL4 and IL13 promote
B-cell proliferation and induce class switching to IgG4 and IgE in
combination with CD40/CD40L costimulation (Punnonen et al., Proc.
Natl. Acad. Sci. USA, 90: 3730 (1993), Oettgen et al., J. Allergy
Clin. Immunol., 107: 429 (2001)).
[0004] However, unlike IL4, IL13 is not involved in the
differentiation of naive T cells into Th2 cells (Zurawski et al.,
Immunol. Today, 15: 19 (1994)). IL13 up-regulates Fc.epsilon.RI and
thus helps in IgE priming of mast cells (de Vries, Allergy Clin.
Immunol. 102: 165 (1998). In monocytes/macrophages, IL13
up-regulates expression of CD23 and MHC class I and class II
antigens, down-regulate the expression of Fc.gamma. and CD14, and
inhibit antibody-dependent cytotoxicity (de Waal Malefyt et al., J.
Immunol., 151: 6370 (1993), Chomarat et al., Int. Rev. Immunol.,
17: 1 (1998)). IL13, but not IL4, promotes eosinophil survival,
activation, and recruitment (Horie et al., Intern. Med., 36: 179
(1997), Luttmann et al., J. Immunol. 157: 1678 (1996), Pope et al.,
J. Allergy Clin. Immunol., 108: 594 (2001). IL13 also manifests
important functions on nonhematopoietic cells, such as smooth
muscle cells, epithelial cells, endothelial cells and fibroblast
cells. IL13 enhances proliferation and cholinergic-induced
contractions of smooth muscles (Wills-Karp, J. Allergy Clin.
Immunol., 107: 9 (2001). In epithelial cells IL13 is a potent
inducer of chemokine production (Li et al., J. Immunol., 162: 2477
(1999), alters mucociliary differentiation (Laoukili et al., J.
Clin. Invest., 108: 1817 (2001), decreases ciliary beat frequency
of ciliated epithelial cells (Laoukili et al., J. Clin. Invest.,
108: 1817 (2001), and results in goblet cell metaplasia (Zhu et
al., J. Clin. Invest., 103: 779 (1999), Grunig et al., Science,
282: 2261 (1998)). In endothelial cells IL13 is a potent inducer of
vascular cell adhesion molecule 1 (VCAM-1) which is important for
recruitment of eosinophils (Bochner et al., J. Immunol., 154: 799
(1995)). In human dermal fibroblasts IL13 induces type 1 collagen
synthesis in human dermal fibroblasts (Roux et al., J. Invest.
Dermatol., 103: 444 (1994)).
[0005] Although IL13 and IL4 share certain functional similarities,
studies in animal models of disease and gene-knockout mice
demonstrated that IL13 possesses unique effector functions distinct
from IL4 and provides compelling evidence that IL13, independent of
other Th2 cytokines, is necessary and sufficient to induce all
features of allergic asthma (Wills-Karp et al. Science, 282: 2258
(1998), Walter et al. J. Immunol. 167: 4668 (2001)). IL13 may play
a more significant role than other Th2 cytokines in effector
functions associated with the symptoms of asthma (Corry, Curr.
Opin. Immunol., 11: 610 (1999)). This contention is supported in
human disease by a strong association between IL13 levels and
genetic polymorphisms in the IL13 gene and disease correlates
(Wills-Karp. et al. Respir. Res. 1: 19 (2000); Vercelli et al.,
Curr. Opin. Allergy Clin. Immunol., 2: 389 (2002); He et al., Genes
Immunol., 4: 385 (2003), Arima et al., J. Allergy Clin. Immunol.,
109: 980 (2003), Liu et al., J. Clin. Allergy Immunol., 112: 382
(2003)). Emerging data suggest that IL13 induces features of the
allergic response via its actions on mucosal epithelium and smooth
muscle cells, rather than through the traditional pathways
involving eosinophils and IgE-mediated events (Wills-Karp et al.,
Sci., 282: 2258 (1998)).
[0006] Asthma is described as a chronic pulmonary disease that
involves airway inflammation, hyperresponsiveness and obstruction.
Physiologically, airway hyperresponsiveness is documented by
decreased bronchial airflow after bronchoprovocation with
methacholine or histamine. Other triggers that provoke airway
obstruction include cold air, exercise, viral upper respiratory
infection, cigarette smoke, and respiratory allergens. Bronchial
provocation with allergen induces a prompt early phase
immunoglobulin E (IgE)-mediated decrease in bronchial airflow
followed in many patients by a late-phase IgE-mediated reaction
with a decrease in bronchial airflow for 4-8 hours. The early
response is caused by acute release of inflammatory substances,
such as histamine, PGD2, leukotriene, tryptase and platelet
activating factor (PAF), whereas the late response is caused by de
novo synthesized pro-inflammatory cytokines (e.g. TNF.alpha., IL4,
IL13) and chemokines (e.g. MCP-1 and MIP-1.alpha.) (Busse et al.
In: Allergy: Principles and Practice, Ed. Middleston, 1173 (1998)).
In chronic asthmatic patients, persistent pulmonary symptoms are
mediated by the heightened response of Th2 cells. Th2 cytokines are
believed to play a vital role in the disease (Larche et al., J.
Allergy Clin. Immunol., 111: 450 (2003)), in particular, IL13 and
IL4 produced by Th2 cells with NK phenotype (NKT) in the airway as
indicated in a model of asthma in rodents (Akbari et al., Nature
Med., 9: 582 (2003)). The gross pathology of asthmatic airways
displays lung hyperinflation, smooth muscle hypertrophy, lamina
reticularis thickening, mucosal edema, epithelial cell sloughing,
cilia cell disruption, and mucus gland hypersecretion.
Microscopically, asthma is characterized by the presence of
increased numbers of eosinophils, neutrophils, lymphocytes, and
plasma cells in the bronchial tissues, bronchial secretions, and
mucus. Initially, there is recruitment of leukocytes from the
bloodstream to the airway by activated CD4+ T-lymphocytes. The
activated T-lymphocytes also direct the release of inflammatory
mediators from eosinophils, mast cells, and lymphocytes. In
addition, the Th2 cells produce IL4, IL5, IL9 and IL13. IL4, in
conjunction with IL13, signals the switch from IgM to IgE
antibodies.
[0007] Cross-linking of membrane-bound IgE molecules by allergen
causes mast cells to degranulate, releasing histamine,
leukotrienes, and other mediators that perpetuate the airway
inflammation. IL5 activates the recruitment and activation of
eosinophils. The activated mast cells and eosinophils also generate
their cytokines that help to perpetuate the inflammation. These
repeated cycles of inflammation in the lungs with injury to the
pulmonary tissues followed by repair may produce long-term
structural changes ("remodeling") of the airways.
[0008] Moderate asthma is currently treated with a daily inhaled
anti-inflammatory-corticosteroid or mast cell inhibitor such as
cromolyn sodium or nedocromil plus an inhaled beta2-agonist as
needed (3-4 times per day) to relieve breakthrough symptoms or
allergen- or exercise-induced asthma. Cromolyn sodium and
nedocromil block bronchospasm and inflammation, but are usually
effective only for asthma that is associated with allergens or
exercise and typically, only for juvenile asthmatics. Inhaled
corticosteroids improve inflammation, airways hyperreactivity, and
obstruction, and reduce the number of acute exacerbations. However,
it takes at least a month before effects are apparent and up to a
year for marked improvement to occur. The most frequent side
effects are hoarseness and oral fungal infection, i.e.,
candidiasis. More serious side effects have been reported, e.g.,
partial adrenal suppression, growth inhibition, and reduced bone
formation, but only with the use of higher doses. Beclomethasone,
triamcinolone, and flunisolide probably have a similar potency;
whereas budesonide and fluticasone are more potent and reportedly
have fewer systemic side effects.
[0009] Even patients with mild disease show airway inflammation,
including infiltration of the mucosa and epithelium with activated
T cells, mast cells, and eosinophils. T cells and mast cells
release cytokines that promote eosinophil growth and maturation and
the production of IgE antibodies, and these, in turn, increase
microvascular permeability, disrupt the epithelium, and stimulate
neural reflexes and mucus-secreting glands. The result is airways
hyperreactivity, bronchoconstriction, and hypersecretion,
manifested by wheezing, coughing, and dyspnea.
[0010] Traditionally, asthma has been treated with oral and inhaled
bronchodilators. These agents help the symptoms of asthma, but do
nothing for the underlying inflammation. Recognition during the
last 10 years of the importance of inflammation in the etiology of
asthma has led to the increased use of corticosteroids, but many
patients continue to suffer from uncontrolled asthma.
[0011] Because of the importance of treating inflammatory diseases
in humans, particularly asthma, new bioactive compounds having
fewer side effects are continually being sought. The development of
potent and specific inhibitors of IL13, which remain active when
administered long term to asthmatic airways, offers a novel
approach to the treatment of asthma, as well as in other IL13- and
IgE-mediated diseases.
SUMMARY OF INVENTION
[0012] The present invention relates at least in part to antibodies
that bind specifically and with high affinity to both glycosylated
and non-glycosylated human IL13; does not bind mouse IL13, and
neutralize human IL13 activity at an approximate molar ratio of 1:2
(MAb:IL13). Also included in the present invention are antibodies
comprising the antigen binding regions derived from the light
and/or heavy chain variable regions of said antibodies. The
antibodies of the invention may be monoclonal, and a monoclonal
antibody may be a human antibody, a chimeric antibody, or a
humanized antibody.
[0013] Examples of these antibodies are 228B/C-1, 228A-4, 227-26,
and 227-43. The hybridomas that produce these antibodies were
deposited on Nov. 20, 2003, with the American Type Culture
Collection, 10801 University Blvd., Manassas, Va. 20110-2209, under
Accession Numbers PTA-5657, PTA-5656, PTA-5654, and PTA-5655,
respectively.
[0014] The present invention includes antibodies which have a VL
sequence at least 95% homologous to that set forth in SEQ ID NO: 3,
and a VH sequence at least 95% homologous to that set forth in SEQ
ID NO: 4; antibodies which have a VL sequence at least 95%
homologous to that set forth in SEQ ID NO: 5, and a VH sequence at
least 95% homologous to that set forth in SEQ ID NO: 6; and
antibodies which have a VL sequence at least 95% homologous to that
set forth in SEQ ID NO: 7, and a VH sequence at least 95%
homologous to that set forth in SEQ ID NO: 8. The present invention
also includes a recombinant antibody molecule, or an IL13-binding
fragment thereof, comprising at least one antibody heavy chain, or
an IL13-binding fragment thereof, comprising non-human CDRs at
positions 31-35 (CDR1), 50-65 (CDR2) and 95-102 (CDR3) (Kabat
numbering) from a mouse anti-IL13 antibody, wherein positions 27-30
have the amino acid Gly 26, Phe 27, Ser 28, Leu 29, Asn 30, (SEQ ID
NO: 18); and at least one antibody light chain, or an IL13-binding
fragment thereof, comprising non-human CDRs at positions 24-34
(CDR1), 50-56 (CDR2) and 89-97 (CDR3) from a mouse anti-IL13
antibody, and framework regions from a human monoclonal
antibody.
[0015] The present invention includes human antigen-binding
antibody fragments of the antibodies of the present invention
including, but are not limited to, Fab, Fab' and F(ab')2, Fd,
single-chain Fvs (scFv), single-chain antibodies, disulfide-linked
Fvs (sdFv). The invention also includes single-domain antibodies
comprising either a VL or VH domain. On example of an scFv is
depicted in FIG. 21, having the sequence of SEQ ID NO 152.
[0016] The present invention includes humanized sequences of
monoclonal antibody 228B/C-1. These humanized recombinant antibody
molecules comprise a variable light chain region comprising an
amino acid sequence having the formula:
FRL1-CDRL1-FRL2-CDRL2-FRL3-CDRL3-FRL4, wherein FRL1 consists of any
one of SEQ ID Nos: 20-25; CDRL1 consists of any one of SEQ ID NOs:
99-103; FRL2 consists of SEQ ID NO: 29; CDRL2 consists of any one
of SEQ ID NOs: 104-114; FRL3 consists of any one of SEQ ID NOs:
30-56; CDRL3 consists of any of SEQ ID NOs: 115-116; and FRL4
consists of SEQ ID NO: 57-59; and comprising a variable heavy chain
region comprising an amino acid sequence having the formula:
FRH1-CDRH1-FRH2-CDRH2-FRH3-CDRH3-FRH4, wherein FRH1 consists of any
one of SEQ ID NOs: 60-66; CDRH1 consists of any one of SEQ ID NOs:
117-122; FRH2 consists of any one of SEQ ID NOs: 67-75; CDRH2
consists of any one of SEQ ID NOs: 123-134; FRH3 consists of any
one of SEQ ID NOs: 76-90; CDRH3 consists of any of SEQ ID NOs:
135-141; and FRH4 consists of SEQ ID NO: 91-92. The variable heavy
chain region may further comprise at least the CH1 domain of a
constant region or the CH1, CH2 and CH3 domains of a constant
region. The heavy chain constant region may comprise an IgG
antibody. wherein the IgG antibody is an IgG1 antibody, an IgG2
antibody, an IgG3 antibody, or an IgG4 antibody.
[0017] The present invention also includes recombinant antibody
molecules wherein the variable light chain is chosen from any one
of SEQ ID Nos: 3, 5, 7, 93, 95, 97, 142, 144, and 150, and a
variable heavy chain chosen from any one of SEQ ID Nos: 4, 6, 8,
94, 96, 98, 143, 145, 146, 147, 148, and 149. One particular
antibody comprises the variable light chain having the sequence set
forth in SEQ ID NO:142, and a variable heavy chain having the
sequence set forth in SEQ ID NO:143.
[0018] The present invention includes the hybridoma cell lines that
produce the monoclonal antibodies 228B/C-1, 228A-4, 227-26, and
227-43. The present invention includes nucleic acids encoding the
monoclonal antibodies 228B/C-1, 228A-4, 227-26, and 227-43, cell
lines comprising a nucleic acid encoding these antibodies or chains
thereof, and vectors comprising the nucleic acid encoding these
antibodies or chains thereof.
[0019] The present invention also includes antibodies that bind the
same epitope as 228B/C-1. Exemplary polypeptides comprise all or a
portion of SEQ ID NO. 1 or variants thereof, or SEQ ID NO. 2,
wherein amino acid 13 is changed from glutamic acid to lysine. The
invention also relates to the epitope recognized by the antibodies
of the present invention. Epitope peptides include a peptide
comprising essentially or consisting of ESLINVSG (SEQ ID NO: 18) or
YCAALESLINVS (SEQ ID NO:19).
[0020] The present invention includes a composition comprising the
antibodies according to the claimed invention in combination with a
pharmaceutically acceptable carrier, diluent, excipient, or
stabilizer.
[0021] The present invention includes a method of treating a
subject suffering from asthmatic symptoms comprising administering
to a subject, e.g. a subject in need thereof, an amount of an
antibody according to the claimed invention effective to reduce the
asthmatic symptoms, wherein the antibody may down-regulate the
activity of IL13 in the patient, reduce bronchial
hyperresponsiveness in the patient, and/or reduce eosinophilia in
the lungs of the subject. The present invention also includes a
method of inhibiting the infection of respiratory syncytial virus
(RSV) comprising administering to a subject, e.g. a subject in need
thereof, an inhibiting amount of the antibody of the claimed
invention.
[0022] The antibody of the present invention may be administered by
one or more of the routes including intravenous, intraperitoneal,
inhalation, intramuscular, subcutaneous and oral routes. The
present invention includes an inhalation device that delivers to a
patient a therapeutically effective amount of an antibody according
to the claimed invention.
[0023] The present invention includes a method for detecting
interleukin-13 protein in a subject, e.g., a patient suffering from
an allergic disease, comprising, e.g., the steps of allowing the
antibody of the claimed invention to contact a sample; and
detecting the interleukin-13 through the occurrence of
immunoreaction. Also described are and methods for diagnosing
overexpression of IL13 in a subject, comprising the steps of (a)
obtaining a sample from the subject; (b) combining the sample with
an antibody according to the claimed invention under conditions
which would allow immunoreaction with IL13; and (c) determining
whether or not IL13 is overexpressed relative to a normal level of
expression of IL13.
[0024] The present invention includes a method for producing the
antibodies of the claimed invention, comprising the steps of: a)
producing an immunogenic compound comprising a glycosylated IL13
moiety and an immunogenic moiety; b) preparing an injectable
solution comprising said immunogenic compound in phosphate buffered
saline (PBS) and an adjuvant; c) immunizing a mouse with said
injectable solution by a combination of intravenous and
intraperitoneal injections, d) producing a hybridoma by fusing a
spleen cell from said immunized mouse with a myeloma cell; e)
selecting a hybridoma producing an antibody having the
characteristics of the antibody of the claimed invention; and f)
isolating said antibody.
[0025] The present invention includes a method for inhibiting IgE
antibody production in a patient, which comprises administrating to
the patient an effective amount of an IgE antibody production
inhibiting effective amount of an antibody according to the claimed
invention. The inhibition of IgE antibody production may prevent
bronchial asthma, allergic rhinitis, allergic dermatitis, and
anaphylaxis, and also treat bronchial asthma, allergic rhinitis,
uticaria, and atopic dermatitis.
[0026] The present invention includes a method of treating an
IL13-mediated disorder in a patient, comprising administering to
the patient an effective amount of an antibody or antigen-binding
fragment thereof according to the claimed invention, wherein said
antibody or antigen-binding fragment thereof inhibits binding of
IL13 to its receptor and inhibits one or more functions associated
with binding of the interleukin to said receptor.
[0027] The present invention includes a method of treating an
IgE-mediated disorder in a patient, comprising administering to the
patient an effective amount of an antibody or antigen-binding
fragment thereof according to the claimed invention, wherein said
antibody or antigen-binding fragment thereof inhibits binding of
IL13 to its receptor and inhibits one or more functions associated
with binding of the interleukin to said receptor.
[0028] The present invention includes a method for reducing the
severity of asthma in a mammal comprising administering to the
mammal a therapeutically effective amount of an anti-IL13
monoclonal antibody having at least one of the following
characteristics: the ability to bind human IL13 with a K.sub.D
between about 1.times.10.sup.10 to about 1.times.10.sup.12 M; the
ability to inhibit one or more functions associated with binding of
the interleukin IL13 to the IL13 receptor; and the inability of the
antibody does to bind to mouse IL13.
[0029] Diseases and/or conditions mediated by IL13 that are
contemplated by the invention include, but are not limited to,
allergic asthma, non-allergic (intrinsic) asthma, allergic
rhinitis, atopic dermatitis, allergic conjunctivitis, eczema,
urticaria, food allergies, chronic obstructive pulmonary disease,
ulcerative colitis, RSV infection, uveitis, scleroderma, and
osteoporosis.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1 depicts the binding of anti-IL13 monoclonal
antibodies to human IL13.
[0031] FIG. 2 depicts the binding of anti-IL13 monoclonal
antibodies mutant IL13-Fc.
[0032] FIG. 3 illustrates that there is no inhibition of MAb
228B/C-1 binding to human IL13 by MAb JES10-5A2 (Pharmingen).
[0033] FIG. 4 illustrates the effect of anti-IL13 monoclonal
antibodies on the proliferation of Hodgkin Lymphoma L-1236
cells.
[0034] FIG. 5 illustrates the effect of anti-IL13 monoclonal
antibodies on IL13-induced suppression of CD14 expression in human
monocytes.
[0035] FIG. 6 illustrates the effect of anti-IL13 monoclonal
antibodies on IL13-induced up-regulation of CD23 expression in
human monocytes.
[0036] FIG. 7 illustrates the effect of anti-IL13 monoclonal
antibodies on IL13-induced STAT6 phosphorylation in THP-1
cells.
[0037] FIG. 8 depicts the amino acid sequence of the VH and VL
regions of monoclonal antibody 228B/C-1.
[0038] FIG. 9 depicts the amino acid sequence of the VH and VL
regions of monoclonal antibody 228A-4.
[0039] FIG. 10 depicts the amino acid sequence of the VH and VL
regions of monoclonal antibody 227-26.
[0040] FIGS. 11A-1, 11A-2, 11B-1, 11B-2, 11C-1, 11C-2, 11D-1, and
11D-2 depict the sequences of the light chain variable regions (VK)
for humanization of monoclonal antibody 228B/C-1. Clones B to R
represent clones tested with a human template 2 for VK and a murine
VH. HT2-NEW and HT2-DP27 clones were constructed with human
frameworks for both VK and VH. The amino acid sequences of
framework region (FR) 1 (FIGS. 11A-1 and 11C-1), FR2 (FIGS. 11A-2
and 11C-2), FR3 (FIGS. 11B-1 and 11D-1), and FR4 (FIGS. 11B-2 and
11D-2) of the VK of the indicated clones are depicted.
[0041] FIGS. 12A-1, 12A-2, 12B-1, 12B-2, 12C-1, 12C-2, 12C-3,
12C-4, 12D-1, 12D-2, 12D-3, and 12D-4 depict the corresponding
heavy chain variable region sequences of clones in FIG. 11. (i.e.,
11A-1, 11A-2, 11B-1, 11B-2, 11C-1, 11C-2, 11D-1, and 11D-2). The
amino acid sequences of FR1 (FIGS. 12A-1, 12C-1, and 12C-2), FR2
(FIGS. 12A-2, 12C-3, and 12C-4), FR3 (FIGS. 12B-1, 12D-1 and
12D-2), and FR4 (FIGS. 12B-2, 12D-3 and 12D-4) of the VH of the
indicated clones are depicted.
[0042] FIG. 13 A-D depict ELISA profiles for combinatorial
humanized candidates.
[0043] FIG. 14 A depicts ELISA profiles for 89 Vk/276G. FIG. 14B
depicts the ELISA results for construct 115Vk/73Vh FL.
[0044] FIG. 15 depicts the sequences of combinatorial library
candidates.
[0045] FIG. 16 depicts a competition profile for two candidates
(CL5 and CL-13) assayed demonstrated as compared with the chimeric
candidate (228 B/C #3) for binding to IL-13. The irrelevant Fab is
51, which demonstrates no ability to compete.
[0046] FIG. 17 depicts the sequences of three affinity matured
candidates.
[0047] FIG. 18 shows the alignment of IL13 protein sequences. The
amino acid sequence for the following species of IL-13 protein are
aligned: human (SEQ ID NO: 187), monkey (SEQ ID NO: 188), bovine
(SEQ ID NO: 189), dog (SEQ ID NO: 190), rat (SEQ ID NO: 191), mouse
(SEQ ID NO: 192), and gerbil (SEQ ID NO: 193). The majority
sequence (SEQ ID NO: 186) based on the alignment is depicted.
[0048] FIG. 19 depicts the binding epitope of Mab 228B/C-1. The
human (SEQ ID NO: 187), monkey (SEQ ID NO: 188) and mouse (SEQ ID
NO: 192) IL-13 amino acid sequences are depicted.
[0049] FIG. 20 depicts the CDR variants and their respective SEQ ID
Nos.
[0050] FIGS. 21A and 21B depict the variable light chain and
variable heavy chain sequences for select candidate recombinant
antibodies.
DETAILED DESCRIPTION
[0051] This invention is not limited to the particular methodology,
protocols, cell lines, vectors, or reagents described herein
because they may vary. Further, the terminology used herein is for
the purpose of describing particular embodiments only and is not
intended to limit the scope of the present invention. As used
herein and in the appended claims, the singular forms "a", "an",
and "the" include plural reference unless the context clearly
dictates otherwise, e.g., reference to "a host cell" includes a
plurality of such host cells.
[0052] Unless defined otherwise, all technical and scientific terms
and any acronyms used herein have the same meanings as commonly
understood by one of ordinary skill in the art in the field of the
invention. Although any methods and materials similar or equivalent
to those described herein can be used in the practice of the
present invention, the exemplary methods, devices, and materials
are described herein.
[0053] All patents and publications mentioned herein are
incorporated herein by reference to the extent allowed by law for
the purpose of describing and disclosing the proteins, enzymes,
vectors, host cells, and methodologies reported therein that might
be used with the present invention. However, nothing herein is to
be construed as an admission that the invention is not entitled to
antedate such disclosure by virtue of prior invention.
Immunogen
[0054] Recombinant IL13 was used to immunize mice to generate the
hybridomas that produce the monoclonal antibodies of the present
invention. Recombinant IL13 is commercially available from a number
of sources (see, e.g. R & D Systems, Minneapolis, Minn.,
PeproTech, Inc., NJ, and Sanofi Bio-Industries, Inc., Tervose,
Pa.). Alternatively, a gene or a cDNA encoding IL13 may be cloned
into a plasmid or other expression vector and expressed in any of a
number of expression systems according to methods well known to
those of skill in the art. Methods of cloning and expressing IL13
and the nucleic acid sequence for IL13 are well known (see, for
example, U.S. Pat. No. 5,652,123). Because of the degeneracy of the
genetic code, a multitude of nucleotide sequences encoding IL13
polypeptides may be produced. One may vary the nucleotide sequence
by selecting combinations based on possible codon choices. These
combinations are made in accordance with the standard triplet
genetic code as applied to the nucleotide sequence that codes for
naturally occurring IL13 polypeptide and all such variations are to
be considered. Any one of these polypeptides may be used in the
immunization of an animal to generate antibodies that bind to
IL13.
[0055] The immunogen IL13 polypeptide may, when beneficial, be
expressed as a fusion protein that has the IL13 polypeptide
attached to a fusion segment. The fusion segment often aids in
protein purification, e.g., by permitting the fusion protein to be
isolated and purified by affinity chromatography. Fusion proteins
can be produced by culturing a recombinant cell transformed with a
fusion nucleic acid sequence that encodes a protein including the
fusion segment attached to either the carboxyl and/or amino
terminal end of the protein. Fusion segments may include, but are
not limited to, immunoglobulin Fc regions,
glutathione-S-transferase, .beta.-galactosidase, a poly-histidine
segment capable of binding to a divalent metal ion, and maltose
binding protein.
[0056] Exemplary polypeptides comprise all or a portion of SEQ ID
NO.1 or variants thereof, or SEQ ID NO. 2 wherein amino acid 13 is
Xaa and may be changed from the wt, e.g, glutamic acid to
lysine.
[0057] A fusion protein comprising a mutant form of human IL13 was
used to generate the antibodies of the present invention. This
mutant form of IL13 contained a single mutation resulting in an
inactive form of the protein (Thompson et al., J. Biol. Chem. 274:
2994 (1999)). In order to generate neutralizing antibodies with
high affinity, the fusion protein comprised the mutant IL13 protein
fused to an immunoglobulin Fc, specifically IgG1, and was expressed
in a mammalian cell line such that the recombinant protein was
naturally glycosylated. The Fc portion of the fusion protein may
have provided a conformational structure that exposed a key
epitope. The glycosylation may have increased the immunogenicity of
the epitope, allowing the generation of antibodies to this
particular epitope.
[0058] IL13 polypeptides expressed in E. coli lack glycosylation
and the commercially available antibodies tested were generated
using this protein. We tested these antibodies, e.g., R&D
Systems and Pharmingen, and found that antibodies generated with an
immunogen produced in E. coli do not cross react with the epitope
bound by the antibodies of the present invention.
Antibody Generation
[0059] The antibodies of the present invention may be generated by
any suitable method known in the art. The antibodies of the present
invention may comprise polyclonal antibodies. Methods of preparing
polyclonal antibodies are known to the skilled artisan (Harlow, et
al., Antibodies: a Laboratory Manual, (Cold spring Harbor
Laboratory Press, 2nd ed. (1988), which is hereby incorporated
herein by reference in its entirety).
[0060] For example, an immunogen as described above may be
administered to various host animals including, but not limited to,
rabbits, mice, rats, etc., to induce the production of sera
containing polyclonal antibodies specific for the antigen. The
administration of the immunogen may entail one or more injections
of an immunizing agent and, if desired, an adjuvant. Various
adjuvants may be used to increase the immunological response,
depending on the host species, and include but are not limited to,
Freund's (complete and incomplete), mineral gels such as aluminum
hydroxide, surface active substances such as lysolecithin, pluronic
polyols, polyanions, peptides, oil emulsions, keyhole limpet
hemocyanins, dinitrophenol, and potentially useful human adjuvants
such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
Additional examples of adjuvants which may be employed include the
MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose
dicorynomycolate). Immunization protocols are well known in the art
in the art and may be performed by any method that elicits an
immune response in the animal host chosen. Adjuvants are also well
known in the art.
[0061] Typically, the immunogen (with or without adjuvant) is
injected into the mammal by multiple subcutaneous or
intraperitoneal injections, or intramuscularly or through IV. The
immunogen may include an IL13 polypeptide, a fusion protein or
variants thereof. Depending upon the nature of the polypeptides
(i.e., percent hydrophobicity, percent hydrophilicity, stability,
net charge, isoelectric point etc.), it may be useful to conjugate
the immunogen to a protein known to be immunogenic in the mammal
being immunized. Such conjugation includes either chemical
conjugation by derivatizing active chemical functional groups to
both the immunogen and the immunogenic protein to be conjugated
such that a covalent bond is formed, or through fusion-protein
based methodology, or other methods known to the skilled artisan.
Examples of such immunogenic proteins include, but are not limited
to, keyhole limpet hemocyanin, ovalbumin, serum albumin, bovine
thyroglobulin, soybean trypsin inhibitor, and promiscuous T helper
peptides. Various adjuvants may be used to increase the
immunological response as described above.
[0062] The antibodies of the present invention comprise monoclonal
antibodies. Monoclonal antibodies may be prepared using hybridoma
technology, such as those described by Kohler and Milstein, Nature,
256:495 (1975) and U.S. Pat. No. 4,376,110, by Harlow, et al.,
Antibodies: A Laboratory Manual, (Cold spring Harbor Laboratory
Press, 2.sup.nd ed. (1988), by Hammerling, et al., Monoclonal
Antibodies and T-Cell Hybridomas (Elsevier, N.Y., (1981)), or other
methods known to the artisan. Other examples of methods which may
be employed for producing monoclonal antibodies include, but are
not limited to, the human B-cell hybridoma technique (Kosbor et
al., 1983, Immunology Today 4:72; Cole et al., 1983, Proc. Natl.
Acad. Sci. USA 80:2026-2030), and the EBV-hybridoma technique (Cole
et al., 1985, Monoclonal Antibodies And Cancer Therapy, Alan R.
Liss, Inc., pp. 77-96). Such antibodies may be of any
immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any
subclass thereof. The hybridoma producing the MAb of this invention
may be cultivated in vitro or in vivo.
[0063] Using typical hybridoma techniques, a host such as a mouse,
a humanized mouse, a mouse with a human immune system, hamster,
rabbit, camel or any other appropriate host animal, is typically
immunized with an immunogen to elicit lymphocytes that produce or
are capable of producing antibodies that will specifically bind to
IL13. Alternatively, lymphocytes may be immunized in vitro with the
antigen.
[0064] Generally, in making antibody-producing hybridomas, either
peripheral blood lymphocytes ("PBLs") are used if cells of human
origin are desired, or spleen cells or lymph node cells are used if
non-human mammalian sources are desired. The lymphocytes are then
fused with an immortalized cell line using a suitable fusing agent,
such as polyethylene glycol, to form a hybridoma cell (Goding,
Monoclonal Antibodies: Principles and Practice, Academic Press,
(1986), pp. 59-103). Immortalized cell lines are usually
transformed mammalian cells, particularly myeloma cells of rodent,
bovine or human origin. Typically, a rat or mouse myeloma cell line
is employed. The hybridoma cells may be cultured in a suitable
culture medium that preferably contains one or more substances that
inhibit the growth or survival of the unfused, immortalized cells.
For example, if the parental cells lack the enzyme hypoxanthine
guanine phosphoribosyl transferase (HGPRT or HPRT), the culture
medium for the hybridomas typically will include hypoxanthine,
aminopterin, and thymidine ("HAT medium"), substances that prevent
the growth of HGPRT-deficient cells.
[0065] Preferred immortalized cell lines are those that fuse
efficiently, support stable high level expression of antibody by
the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More preferred immortalized cell lines
are murine myeloma lines, which can be obtained, for instance, from
the Salk Institute Cell Distribution Center, San Diego, Calif. and
the American Type Culture Collection, Manassas, Va. Human myeloma
and mouse-human heteromyeloma cell lines may also be used for the
production of human monoclonal antibodies (Kozbor, J. Immunol.,
133:3001 (1984); Brodeur et al., Monoclonal Antibody Production
Techniques and Applications, Marcel Dekker, Inc., New York, (1987)
pp. 51-63).
[0066] The culture medium in which the hybridoma cells are cultured
can then be assayed for the presence of monoclonal antibodies
directed against the IL13. The binding specificity of monoclonal
antibodies produced by the hybridoma cells is determined by, e.g.,
immunoprecipitation or by an in vitro binding assay, such as
radioimmunoassay (RIA) or enzyme-linked immunoadsorbant assay
(ELISA). Such techniques are known in the art and within the skill
of the artisan. The binding affinity of the monoclonal antibody to
IL13 can, for example, be determined by a Scatchard analysis
(Munson et al., Anal. Biochem., 107:220 (1980)).
[0067] After the desired hybridoma cells are identified, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods (Goding, supra). Suitable culture media for this
purpose include, for example, Dulbecco's Modified Eagle's Medium
and RPMI-1640. The monoclonal antibodies secreted by the subclones
may be isolated or purified from the culture medium by conventional
immunoglobulin purification procedures such as, e.g., protein
A-sepharose, hydroxyapatite chromatography, gel exclusion
chromatography, gel electrophoresis, dialysis, or affinity
chromatography.
[0068] A variety of methods exist in the art for the production of
monoclonal antibodies and thus, the invention is not limited to
their sole production in hydridomas. For example, the monoclonal
antibodies may be made by recombinant DNA methods, such as those
described in U.S. Pat. No. 4,816,567. In this context, the term
"monoclonal antibody" refers to an antibody derived from a single
eukaryotic, phage, or prokaryotic clone. The DNA encoding the
monoclonal antibodies of the invention can be readily isolated and
sequenced using conventional procedures (e.g., by using
oligonucleotide probes that are capable of binding specifically to
genes encoding the heavy and light chains of murine antibodies, or
such chains from human, humanized, or other sources). The hydridoma
cells of the invention serve as a preferred source of such DNA.
Once isolated, the DNA may be placed into expression vectors, which
are then transformed into host cells such as NS0 cells, Simian COS
cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do
not otherwise produce immunoglobulin protein, to obtain the
synthesis of monoclonal antibodies in the recombinant host cells.
The DNA also may be modified, for example, by substituting the
coding sequence for human heavy and light chain constant domains in
place of the homologous murine sequences (U.S. Pat. No. 4,816,567;
Morrison et al, supra) or by covalently joining to the
immunoglobulin coding sequence all or part of the coding sequence
for a non-immunoglobulin polypeptide. Such a non-immunoglobulin
polypeptide can be substituted for the constant domains of an
antibody of the invention, or can be substituted for the variable
domains of one antigen-combining site of an antibody of the
invention to create a chimeric bivalent antibody.
[0069] The antibodies may be monovalent antibodies. Methods for
preparing monovalent antibodies are well known in the art. For
example, one method involves recombinant expression of
immunoglobulin light chain and modified heavy chain. The heavy
chain is truncated generally at any point in the Fc region so as to
prevent heavy chain cross-linking. Alternatively, the relevant
cysteine residues are substituted with another amino acid residue
or are deleted so as to prevent cross-linking.
[0070] Antibody fragments which recognize specific epitopes may be
generated by known techniques. For example, Fab and F(ab').sub.2
fragments of the invention may be produced by proteolytic cleavage
of immunoglobulin molecules, using enzymes such as papain (to
produce Fab fragments) or pepsin (to produce F(ab').sub.2
fragments). F(ab').sub.2 fragments contain the variable region, the
light chain constant region and the CH1 domain of the heavy
chain.
[0071] For some uses, including in vivo use of antibodies in humans
and in vitro detection assays, it may be preferable to use
chimeric, humanized, or human antibodies. A chimeric antibody is a
molecule in which different portions of the antibody are derived
from different animal species, such as antibodies having a variable
region derived from a murine monoclonal antibody and a human
immunoglobulin constant region. Methods for producing chimeric
antibodies are known in the art. See e.g., Morrison, Science
229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Gillies et
al., (1989) J. Immunol. Methods 125:191-202; U.S. Pat. Nos.
5,807,715; 4,816,567; and 4,816397, which are incorporated herein
by reference in their entirety.
[0072] Humanized antibodies are antibody molecules generated in a
non-human species that bind the desired antigen having one or more
complementarity determining regions (CDRs) from the non-human
species and framework (FR) regions from a human immunoglobulin
molecule. Often, framework residues in the human framework regions
will be substituted with the corresponding residue from the CDR
donor antibody to alter, preferably improve, antigen binding. These
framework substitutions are identified by methods well known in the
art, e.g., by modeling of the interactions of the CDR and framework
residues to identify framework residues important for antigen
binding and sequence comparison to identify unusual framework
residues at particular positions. (See, e.g., Queen et al., U.S.
Pat. No. 5,585,089; Riechmann et al., Nature 332:323 (1988), which
are incorporated herein by reference in their entireties).
Antibodies can be humanized using a variety of techniques known in
the art including, for example, CDR-grafting (EP 239,400; PCT
publication WO 91/09967; U.S. Pat. Nos. 5,225,539; 5,530,101; and
5,585,089), veneering or resurfacing (EP 592,106; EP 519,596;
Padlan, Molecular Immunology 28(4/5):489-498 (1991); Studnicka et
al., Protein Engineering 7(6):805-814 (1994); Roguska. et al., PNAS
91:969-973 (1994)), and chain shuffling (U.S. Pat. No.
5,565,332).
[0073] Generally, a humanized antibody has one or more amino acid
residues introduced into it from a source that is non-human. These
non-human amino acid residues are often referred to as "import"
residues, which are typically taken from an "import" variable
domain. Humanization can be essentially performed following the
methods of Winter and co-workers (Jones et al., Nature, 321:522-525
(1986); Reichmann et al., Nature, 332:323-327 (1988); Verhoeyen et
al., Science, 239:1534-1536 (1988), by substituting rodent CDRs or
CDR sequences for the corresponding sequences of a human antibody.
Accordingly, such "humanized" antibodies are chimeric antibodies
(U.S. Pat. No. 4,816,567), wherein substantially less than an
intact human variable domain has been substituted by the
corresponding sequence from a non-human species. In practice,
humanized antibodies are typically human antibodies in which some
CDR residues and possible some FR residues are substituted from
analogous sites in rodent antibodies.
[0074] Completely human antibodies are particularly desirable for
therapeutic treatment of human patients. Human antibodies can be
made by a variety of methods known in the art including phage
display methods described above using antibody libraries derived
from human immunoglobulin sequences. See also, U.S. Pat. Nos.
4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO
98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and
WO 91/10741; each of which is incorporated herein by reference in
its entirety. The techniques of Cole et al., and Boerder et al.,
are also available for the preparation of human monoclonal
antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy,
Alan R. Riss, (1985); and Boerner et al., J. Immunol.,
147(1):86-95, (1991)).
[0075] Human antibodies can also be produced using transgenic mice
which are incapable of expressing functional endogenous
immunoglobulins, but which can express human immunoglobulin genes.
For example, the human heavy and light chain immunoglobulin gene
complexes may be introduced randomly or by homologous recombination
into mouse embryonic stem cells. Alternatively, the human variable
region, constant region, and diversity region may be introduced
into mouse embryonic stem cells in addition to the human heavy and
light chain genes. The mouse heavy and light chain immunoglobulin
genes may be rendered non-functional separately or simultaneously
with the introduction of human immunoglobulin loci by homologous
recombination. In particular, homozygous deletion of the JH region
prevents endogenous antibody production. The modified embryonic
stem cells are expanded and microinjected into blastocysts to
produce chimeric mice. The chimeric mice are then bred to produce
homozygous offspring which express human antibodies. The transgenic
mice are immunized in the normal fashion with a selected antigen,
e.g., all or a portion of a polypeptide of the invention.
Monoclonal antibodies directed against the antigen can be obtained
from the immunized, transgenic mice using conventional hybridoma
technology. The human immunoglobulin transgenes harbored by the
transgenic mice rearrange during B cell differentiation, and
subsequently undergo class switching and somatic mutation. Thus,
using such a technique, it is possible to produce therapeutically
useful IgG, IgA, IgM and IgE antibodies. For an overview of this
technology for producing human antibodies, see Lonberg and Huszar,
Int. Rev. Immunol. 13:65-93 (1995). For a detailed discussion of
this technology for producing human antibodies and human monoclonal
antibodies and protocols for producing such antibodies, see, e.g.,
PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO
96/33735; European Patent No. 0 598 877; U.S. Pat. Nos. 5,413,923;
5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318;
5,885,793; 5,916,771; and 5,939,598, which are incorporated by
reference herein in their entirety. In addition, companies such as
Abgenix, Inc. (Freemont, Calif.), Genpharm (San Jose, Calif.), and
Medarex, Inc. (Princeton, N.J.) can be engaged to provide human
antibodies directed against a selected antigen using technology
similar to that described above.
[0076] Also human MAbs could be made by immunizing mice
transplanted with human peripheral blood leukocytes, splenocytes or
bone marrows (e.g., Trioma techniques of XTL). Completely human
antibodies which recognize a selected epitope can be generated
using a technique referred to as "guided selection." In this
approach a selected non-human monoclonal antibody, e.g., a mouse
antibody, is used to guide the selection of a completely human
antibody recognizing the same epitope. (Jespers et al.,
Bio/technology 12:899-903 (1988)).
[0077] Further, antibodies to the polypeptides of the invention
can, in turn, be utilized to generate anti-idiotype antibodies that
"mimic" polypeptides of the invention using techniques well known
to those skilled in the art. (See, e.g., Greenspan & Bona,
FASEB J. 7(5):437-444; (1989) and Nissinoff, J. Immunol.
147(8):2429-2438 (1991)). For example, antibodies which bind to and
competitively inhibit polypeptide multimerization and/or binding of
a polypeptide of the invention to a ligand can be used to generate
anti-idiotypes that "mimic" the polypeptide multimerization and/or
binding domain and, as a consequence, bind to and neutralize
polypeptide and/or its ligand. Such neutralizing anti-idiotypes or
Fab fragments of such anti-idiotypes can be used in therapeutic
regimens to neutralize polypeptide ligand. For example, such
anti-idiotypic antibodies can be used to bind a polypeptide of the
invention and/or to bind its ligands/receptors, and thereby block
its biological activity.
[0078] The antibodies of the present invention may be bispecific
antibodies. Bispecific antibodies are monoclonal, preferably human
or humanized, antibodies that have binding specificities for at
least two different antigens. In the present invention, one of the
binding specificities may be directed towards IL13, the other may
be for any other antigen, and preferably for a cell-surface
protein, receptor, receptor subunit, tissue-specific antigen,
virally derived protein, virally encoded envelope protein,
bacterially derived protein, or bacterial surface protein, etc.
[0079] Methods for making bispecific antibodies are well known.
Traditionally, the recombinant production of bispecific antibodies
is based on the co-expression of two immunoglobulin
heavy-chain/light-chain pairs, where the two heavy chains have
different specificities (Milstein and Cuello, Nature, 305:537-539
(1983). Because of the random assortment of immunoglobulin heavy
and light chains, these hybridomas (quadromas) produce a potential
mixture of ten different antibody molecules, of which only one has
the correct bispecific structure. The purification of the correct
molecule is usually accomplished by affinity chromatography steps.
Similar procedures are disclosed in WO 93/08829, published May 13,
1993, and in Traunecker et al., EMBO J., 10:3655-3659 (1991).
[0080] Antibody variable domains with the desired binding
specificities (antibody-antigen combining sites) can be fused to
immunoglobulin constant domain sequences. The fusion preferably is
with an immunoglobulin heavy-chain constant domain, comprising at
least part of the hinge, CH2, and CH3 regions. It may have the
first heavy-chain constant region (CH1) containing the site
necessary for light-chain binding present in at least one of the
fusions. DNAs encoding the immunoglobulin heavy-chain fusions and,
if desired, the immunoglobulin light chain, are inserted into
separate expression vectors, and are co-transformed into a suitable
host organism. For further details of generating bispecific
antibodies see, for example Suresh et al., Meth. In Enzym., 121:210
(1986).
[0081] Heteroconjugate antibodies are also contemplated by the
present invention. Heteroconjugate antibodies are composed of two
covalently joined antibodies. Such antibodies have, for example,
been proposed to target immune system cells to unwanted cells (U.S.
Pat. No. 4,676,980). It is contemplated that the antibodies may be
prepared in vitro using known methods in synthetic protein
chemistry, including those involving cross-linking agents. For
example, immunotoxins may be constructed using a disulfide exchange
reaction or by forming a thioester bond. Examples of suitable
reagents for this purpose include iminothiolate and
methyl-4-mercaptobutyrimidate and those disclosed, for example, in
U.S. Pat. No. 4,676,980.
[0082] In addition, one can generate single-domain antibodies to
IL-13. Examples of this technology have been described in WO9425591
for antibodies derived from Camelidae heavy chain Ig, as well in
US20030130496 describing the isolation of single domain fully human
antibodies from phage libraries.
Identification of Anti-IL13 Antibodies
[0083] The present invention provides antagonist monoclonal
antibodies that inhibit and neutralize the action of IL13. In
particular, the antibodies of the present invention bind to IL13
and inhibit the activation of the IL13 receptor alpha chain-1
(IL13R.alpha.1). The antibodies of the present invention include
the antibodies designated 228B/C-1, 228A-4, 227-26, and 227-43, and
humanized clones of 228B/C-1 are disclosed. The present invention
also includes antibodies that bind to the same epitope as one of
these antibodies, e.g., that of monoclonal antibody 228B/C-1.
[0084] Candidate anti-IL13 antibodies were tested by enzyme linked
immunosorbent assay (ELISA), Western immunoblotting, or other
immunochemical techniques. Assays performed to characterize the
individual antibodies included: (1) Inhibition of IL13-autocrine
proliferation of Hodgkin's lymphoma cell lines HDLM-2 and L-1236;
(2) Inhibition of IL13-induced STAT6 phosphorylation in THP-1
cells; and (3) Inhibition of IL13-induced suppression of CD14
expression in primary human monocytes; and (4) Inhibition of
IL13-induced up-regulation of CD23 expression on primary human
monocytes. Experimental details are described in the Examples.
[0085] Antibodies of the invention include, but are not limited to,
polyclonal, monoclonal, monovalent, bispecific, heteroconjugate,
multispecific, human, humanized or chimeric antibodies, single
chain antibodies, single-domain antibodies, Fab fragments, F(ab')
fragments, fragments produced by a Fab expression library,
anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id
antibodies to antibodies of the invention), and epitope-binding
fragments of any of the above.
[0086] The term "antibody," as used herein, refers to
immunoglobulin molecules and immunologically active portions of
immunoglobulin molecules, i.e., molecules that contain an antigen
binding site that immunospecifically binds an antigen. The
immunoglobulin molecules of the invention can be of any type (e.g.,
IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3,
IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule.
Moreover, the term "antibody" (Ab) or "monoclonal antibody" (MAb)
is meant to include intact molecules, as well as, antibody
fragments (such as, for example, Fab and F(ab').sub.2 fragments)
which are capable of specifically binding to a protein. Fab and
F(ab').sub.2 fragments lack the Fc fragment of intact antibody,
clear more rapidly from the circulation of the animal or plant, and
may have less non-specific tissue binding than an intact antibody
(Wahl et al., J. Nucl. Med. 24:316-325 (1983)).
[0087] The antibodies may be human antigen-binding antibody
fragments of the present invention and include, but are not limited
to, Fab, Fab' and F(ab').sub.2, Fd, single-chain Fvs (scFv),
single-chain antibodies, disulfide-linked Fvs (sdFv) and
single-domain antibodies comprising either a VL or VH domain.
Antigen-binding antibody fragments, including single-chain
antibodies, may comprise the variable region(s) alone or in
combination with the entirety or a portion of the following: hinge
region, CH1, CH2, and CH3 domains. Also included in the invention
are antigen-binding fragments comprising any combination of
variable region(s) with a hinge region, CH1, CH2, and CH3 domains.
The antibodies of the invention may be from any animal origin
including birds and mammals. Preferably, the antibodies are from
human, non-human primates, rodents (e.g., mouse and rat), donkey,
sheep, rabbit, goat, guinea pig, camel, horse, or chicken.
[0088] As used herein, "human" antibodies" include antibodies
having the amino acid sequence of a human immunoglobulin and
include antibodies isolated from human immunoglobulin libraries or
from animals transgenic for one or more human immunoglobulin and
that do not express endogenous immunoglobulins, as described infra
and, for example in, U.S. Pat. No. 5,939,598 by Kucherlapati et
al.
[0089] The antibodies of the present invention may be monospecific,
bispecific, trispecific or of greater multispecificity.
Multispecific antibodies may be specific for different epitopes of
IL13 or may be specific for both IL13 as well as for a heterologous
epitope, such as a heterologous polypeptide or solid support
material. See, e.g., PCT publications WO 93/17715; WO 92/08802; WO
91/00360; WO 92/05793; Tutt, et al., J. Immunol. 147:60-69 (1991);
U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648; 5,573,920;
5,601,819; Kostelny et al., J. Immunol. 148:1547-1553 (1992).
[0090] Antibodies of the present invention may be described or
specified in terms of the epitope(s) or portion(s) of IL13 which
they recognize or specifically bind. The epitope(s) or polypeptide
portion(s) may be specified as described herein, e.g., by
N-terminal and C-terminal positions, by size in contiguous amino
acid residues, or listed in the Tables and Figures.
[0091] Antibodies of the present invention may also be described or
specified in terms of their cross-reactivity. Antibodies that bind
IL13 polypeptides, which have at least 95%, at least 90%, at least
85%, at least 80%, at least 75%, at least 70%, at least 65%, at
least 60%, at least 55%, and at least 50% identity (as calculated
using methods known in the art and described herein) to IL-13 are
also included in the present invention. Anti-IL-13 antibodies may
also bind with a K.sub.D of less than about 10.sup.-7 M, less than
about 10.sup.-6 M, or less than about 10.sup.-5 M to other
proteins, such as IL-13 antibodies from species other than that
against which the anti-IL-13 antibody is directed.
[0092] In specific embodiments, antibodies of the present invention
cross-react with monkey homologues of human IL13 and the
corresponding epitopes thereof. In a specific embodiment, the
above-described cross-reactivity is with respect to any single
specific antigenic or immunogenic polypeptide, or combination(s) of
the specific antigenic and/or immunogenic polypeptides disclosed
herein.
[0093] Further included in the present invention are antibodies
which bind polypeptides encoded by polynucleotides which hybridize
to a polynucleotide encoding IL13 under stringent hybridization
conditions. Antibodies of the present invention may also be
described or specified in terms of their binding affinity to a
polypeptide of the invention. Preferred binding affinities include
those with an equilibrium dissociation constant or K.sub.D from
10.sup.-8 to 10.sup.-15 M, 10.sup.-8 to 10.sup.-12 M, 10.sup.-8 to
10.sup.-10 M, or 10.sup.-10 to 10.sup.-12 M. The invention also
provides antibodies that competitively inhibit binding of an
antibody to an epitope of the invention as determined by any method
known in the art for determining competitive binding, for example,
the immunoassays described herein. In preferred embodiments, the
antibody competitively inhibits binding to the epitope by at least
95%, at least 90%, at least 85%, at least 80%, at least 75%, at
least 70%, at least 60%, or at least 50%.
Vectors and Host Cells
[0094] In another aspect, the present invention provides vector
constructs comprising a nucleotide sequence encoding the antibodies
of the present invention and a host cell comprising such a vector.
Standard techniques for cloning and transformation may be used in
the preparation of cell lines expressing the antibodies of the
present invention.
[0095] Recombinant expression vectors containing a nucleotide
sequence encoding the antibodies of the present invention can be
prepared using well known techniques. The expression vectors
include a nucleotide sequence operably linked to suitable
transcriptional or translational regulatory nucleotide sequences
such as those derived from mammalian, microbial, viral, or insect
genes. Examples of regulatory sequences include transcriptional
promoters, operators, enhancers, mRNA ribosomal binding sites,
and/or other appropriate sequences which control transcription and
translation initiation and termination. Nucleotide sequences are
"operably linked" when the regulatory sequence functionally relates
to the nucleotide sequence for the appropriate polypeptide. Thus, a
promoter nucleotide sequence is operably linked to, e.g., the
antibody heavy chain sequence if the promoter nucleotide sequence
controls the transcription of the appropriate nucleotide
sequence.
[0096] In addition, sequences encoding appropriate signal peptides
that are not naturally associated with antibody heavy and/or light
chain sequences can be incorporated into expression vectors. For
example, a nucleotide sequence for a signal peptide (secretory
leader) may be fused in-frame to the polypeptide sequence so that
the antibody is secreted to the periplasmic space or into the
medium. A signal peptide that is functional in the intended host
cells enhances extracellular secretion of the appropriate antibody.
The signal peptide may be cleaved from the polypeptide upon
secretion of antibody from the cell. Examples of such secretory
signals are well known and include, e.g., those described in U.S.
Pat. Nos. 5,698,435, 5,698,417, and 6,204,023.
[0097] Host cells useful in the present invention include but are
not limited to microorganisms such as bacteria (e.g., E. coli, B.
subtilis) transformed with recombinant bacteriophage DNA, plasmid
DNA or cosmid DNA expression vectors containing antibody coding
sequences; yeast (e.g., Saccharomyces, Pichia) transformed with
recombinant yeast expression vectors containing antibody coding
sequences; insect cell systems infected with recombinant virus
expression vectors (e.g., Baculovirus) containing antibody coding
sequences; plant cell systems infected with recombinant virus
expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco
mosaic virus, TMV) or transformed with recombinant plasmid
expression vectors (e.g., Ti plasmid) containing antibody coding
sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3
cells) harboring recombinant expression constructs containing
promoters derived from the genome of mammalian cells (e.g.,
metallothionein promoter) or from mammalian viruses (e.g., the
adenovirus late promoter; the vaccinia virus 7.5K promoter).
[0098] The vector may be a plasmid vector, a single or
double-stranded phage vector, or a single or double-stranded RNA or
DNA viral vector. Such vectors may be introduced into cells as
polynucleotides by well known techniques for introducing DNA and
RNA into cells. The vectors, in the case of phage and viral vectors
also may be introduced into cells as packaged or encapsulated virus
by well known techniques for infection and transduction. Viral
vectors may be replication competent or replication defective. In
the latter case, viral propagation generally will occur only in
complementing host cells. Cell-free translation systems may also be
employed to produce the protein using RNAs derived from the present
DNA constructs. Such vectors may include the nucleotide sequence
encoding the constant region of the antibody molecule (see, e.g.,
PCT Publication WO 86/05807; PCT Publication WO 89/01036; and U.S.
Pat. No. 5,122,464) and the variable domain of the antibody may be
cloned into such a vector for expression of the entire heavy or
light chain.
[0099] Prokaryotes useful as host cells in the present invention
include gram negative or gram positive organisms such as E. coli,
and B. subtilis. Expression vectors for use in prokaryotic host
cells generally comprise one or more phenotypic selectable marker
genes. A phenotypic selectable marker gene is, for example, a gene
encoding a protein that confers antibiotic resistance or that
supplies an autotrophic requirement. Examples of useful expression
vectors for prokaryotic host cells include those derived from
commercially available plasmids such as the pKK223-3 (Pharmacia
Fine Chemicals, Uppsala, Sweden), pGEM1 (Promega Biotec, Madison,
Wis., USA), and the pET (Novagen, Madison, Wis., USA) and pRSET
(Invitrogen Corporation, Carlsbad, Calif., USA) series of vectors
(Studier, F. W., J. Mol. Biol. 219: 37 (1991); Schoepfer, R. Gene
124: 83 (1993)). Promoter sequences commonly used for recombinant
prokaryotic host cell expression vectors include T7, (Rosenberg, et
al. Gene 56, 125-135 (1987)), .beta.-lactamase (penicillinase),
lactose promoter system (Chang et al., Nature 275:615, (1978); and
Goeddel et al., Nature 281:544, (1979)), tryptophan (trp) promoter
system (Goeddel et al., Nucl. Acids Res. 8:4057, (1980)), and tac
promoter (Sambrook et al., 1990, Molecular Cloning, A Laboratory
Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor,
N.Y.)
[0100] Yeasts useful in the present invention include those from
the genus Saccharomyces, Pichia, Actinomycetes and Kluyveromyces.
Yeast vectors will often contain an origin of replication sequence
from a 2.mu. yeast plasmid, an autonomously replicating sequence
(ARS), a promoter region, sequences for polyadenylation, sequences
for transcription termination, and a selectable marker gene.
Suitable promoter sequences for yeast vectors include, among
others, promoters for metallothionein, 3-phosphoglycerate kinase
(Hitzeman et al., J. Biol. Chem. 255:2073, (1980)) or other
glycolytic enzymes (Holland et al., Biochem. 17:4900, (1978)) such
as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase,
pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate
isomerase, 3-phosphoglycerate mutase, pyruvate kinase,
triosephosphate isomerase, phosphoglucose isomerase, and
glucokinase. Other suitable vectors and promoters for use in yeast
expression are further described in Fleer et al., Gene, 107:285-195
(1991). Other suitable promoters and vectors for yeast and yeast
transformation protocols are well known in the art. Yeast
transformation protocols are well known. One such protocol is
described by Hinnen et al., Proc. Natl. Acad. Sci., 75:1929 (1978).
The Hinnen protocol selects for Trp.sup.+ transformants in a
selective medium.
[0101] Mammalian or insect host cell culture systems may also be
employed to express recombinant antibodies, e.g., Baculovirus
systems for production of heterologous proteins. In an insect
system, Autographa californica nuclear polyhedrosis virus (AcNPV)
may be used as a vector to express foreign genes. The virus grows
in Spodoptera frugiperda cells. The antibody coding sequence may be
cloned individually into non-essential regions (for example the
polyhedrin gene) of the virus and placed under control of an AcNPV
promoter (for example the polyhedrin promoter).
[0102] NS0 or Chinese hamster ovary (CHO) cells for mammalian
expression of the antibodies of the present invention may be used.
Transcriptional and translational control sequences for mammalian
host cell expression vectors may be excised from viral genomes.
Commonly used promoter sequences and enhancer sequences are derived
from Polyoma virus, Adenovirus 2, Simian Virus 40 (SV40), and human
cytomegalovirus (CMV). DNA sequences derived from the SV40 viral
genome may be used to provide other genetic elements for expression
of a structural gene sequence in a mammalian host cell, e.g., SV40
origin, early and late promoter, enhancer, splice, and
polyadenylation sites. Viral early and late promoters are
particularly useful because both are easily obtained from a viral
genome as a fragment which may also contain a viral origin of
replication. Exemplary expression vectors for use in mammalian host
cells are commercially available.
[0103] Polynucleotides Encoding Antibodies
[0104] The invention further provides polynucleotides or nucleic
acids, e.g., DNA, comprising a nucleotide sequence encoding an
antibody of the invention and fragments thereof. Exemplary
polynucleotides include those encoding antibody chains comprising
one or more of the amino acid sequences described herein. The
invention also encompasses polynucleotides that hybridize under
stringent or lower stringency hybridization conditions to
polynucleotides that encode an antibody of the present
invention.
[0105] The polynucleotides may be obtained, and the nucleotide
sequence of the polynucleotides determined, by any method known in
the art. For example, if the nucleotide sequence of the antibody is
known, a polynucleotide encoding the antibody may be assembled from
chemically synthesized oligonucleotides (e.g., as described in
Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly,
involves the synthesis of overlapping oligonucleotides containing
portions of the sequence encoding the antibody, annealing and
ligating of those oligonucleotides, and then amplification of the
ligated oligonucleotides by PCR.
[0106] Alternatively, a polynucleotide encoding an antibody may be
generated from nucleic acid from a suitable source. If a clone
containing a nucleic acid encoding a particular antibody is not
available, but the sequence of the antibody molecule is known, a
nucleic acid encoding the immunoglobulin may be chemically
synthesized or obtained from a suitable source (e.g., an antibody
cDNA library, or a cDNA library generated from, or nucleic acid,
preferably poly A.sup.+ RNA, isolated from, any tissue or cells
expressing the antibody, such as hybridoma cells selected to
express an antibody of the invention) by PCR amplification using
synthetic primers hybridizable to the 3' and 5' ends of the
sequence or by cloning using an oligonucleotide probe specific for
the particular gene sequence to identify, e.g., a cDNA clone from a
cDNA library that encodes the antibody. Amplified nucleic acids
generated by PCR may then be cloned into replicable cloning vectors
using any method well known in the art.
[0107] Once the nucleotide sequence and corresponding amino acid
sequence of the antibody is determined, the nucleotide sequence of
the antibody may be manipulated using methods well known in the art
for the manipulation of nucleotide sequences, e.g., recombinant DNA
techniques, site directed mutagenesis, PCR, etc. (see, for example,
the techniques described in Sambrook et al., 1990, Molecular
Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y. and Ausubel et al., eds.,
1998, Current Protocols in Molecular Biology, John Wiley &
Sons, NY, which are both incorporated by reference herein in their
entireties), to generate antibodies having a different amino acid
sequence, for example to create amino acid substitutions,
deletions, and/or insertions.
[0108] In a specific embodiment, the amino acid sequence of the
heavy and/or light chain variable domains may be inspected to
identify the sequences of the CDRs by well known methods, e.g., by
comparison to known amino acid sequences of other heavy and light
chain variable regions to determine the regions of sequence
hypervariability. Using routine recombinant DNA techniques, one or
more of the CDRs may be inserted within framework regions, e.g.,
into human framework regions to humanize a non-human antibody, as
described supra. The framework regions may be naturally occurring
or consensus framework regions, and preferably human framework
regions (see, e.g., Chothia et al., J. Mol. Biol. 278: 457-479
(1998) for a listing of human framework regions). Preferably, the
polynucleotide generated by the combination of the framework
regions and CDRs encodes an antibody that specifically binds a
polypeptide of the invention. Preferably, as discussed supra, one
or more amino acid substitutions may be made within the framework
regions, and, preferably, the amino acid substitutions improve
binding of the antibody to its antigen. Additionally, such methods
may be used to make amino acid substitutions or deletions of one or
more variable region cysteine residues participating in an
intrachain disulfide bond to generate antibody molecules lacking
one or more intrachain disulfide bonds. Other alterations to the
polynucleotide are encompassed by the present invention and within
the skill of the art.
[0109] In addition, techniques developed for the production of
"chimeric antibodies" (Morrison et al., Proc. Natl. Acad. Sci.
81:851-855 (1984); Neuberger et al., Nature 312:604-608 (1984);
Takeda et al., Nature 314:452-454 (1985)) by splicing genes from a
mouse antibody molecule of appropriate antigen specificity together
with genes from a human antibody molecule of appropriate biological
activity can be used. As described supra, a chimeric antibody is a
molecule in which different portions are derived from different
animal species, such as those having a variable region derived from
a murine MAb and a human immunoglobulin constant region, e.g.,
humanized antibodies.
[0110] Alternatively, techniques described for the production of
single chain antibodies (U.S. Pat. No. 4,946,778; Bird, Science
242:423-42 (1988); Huston et al., Proc. Natl. Acad. Sci. USA
85:5879-5883 (1988); and Ward et al., Nature 334:544-54 (1989)) can
be adapted to produce single chain antibodies. Single chain
antibodies are formed by linking the heavy and light chain
fragments of the Fv region via an amino acid bridge, resulting in a
single chain polypeptide. Techniques for the assembly of functional
Fv fragments in E. coli may also be used (Skerra et al., Science
242:1038-1041 (1988)).
Methods of Producing Anti-IL13 Antibodies
[0111] The antibodies of the invention can be produced by any
method known in the art for the synthesis of antibodies, in
particular, by chemical synthesis or preferably, by recombinant
expression techniques.
[0112] Recombinant expression of an antibody of the invention, or
fragment, derivative or analog thereof, (e.g., a heavy or light
chain of an antibody of the invention or a single chain antibody of
the invention), requires construction of an expression vector
containing a polynucleotide that encodes the antibody or a fragment
of the antibody. Once a polynucleotide encoding an antibody
molecule has been obtained, the vector for the production of the
antibody may be produced by recombinant DNA technology. An
expression vector is constructed containing antibody coding
sequences and appropriate transcriptional and translational control
signals. These methods include, for example, in vitro recombinant
DNA techniques, synthetic techniques, and in vivo genetic
recombination.
[0113] The expression vector is transferred to a host cell by
conventional techniques and the transfected cells are then cultured
by conventional techniques to produce an antibody of the invention.
In one aspect of the invention, vectors encoding both the heavy and
light chains may be co-expressed in the host cell for expression of
the entire immunoglobulin molecule, as detailed below.
[0114] A variety of host-expression vector systems may be utilized
to express the antibody molecules of the invention as described
above. Such host-expression systems represent vehicles by which the
coding sequences of interest may be produced and subsequently
purified, but also represent cells which may, when transformed or
transfected with the appropriate nucleotide coding sequences,
express an antibody molecule of the invention in situ. Bacterial
cells such as E. coli, and eukaryotic cells are commonly used for
the expression of a recombinant antibody molecule, especially for
the expression of whole recombinant antibody molecule. For example,
mammalian cells such as Chinese hamster ovary cells (CHO), in
conjunction with a vector such as the major intermediate early gene
promoter element from human cytomegalovirus is an effective
expression system for antibodies (Foecking et al., Gene 45:101
(1986); Cockett et al., Bio/Technology 8:2 (1990)).
[0115] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products may be important for the function of the
protein. Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins and gene products. Appropriate cell lines or host
systems can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for
proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such mammalian
host cells include, but are not limited to, CHO, COS, 293, 3T3, or
myeloma cells.
[0116] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
which stably express the antibody molecule may be engineered.
Rather than using expression vectors which contain viral origins of
replication, host cells can be transformed with DNA controlled by
appropriate expression control elements (e.g., promoter, enhancer,
sequences, transcription terminators, polyadenylation sites, etc.),
and a selectable marker. Following the introduction of the foreign
DNA, engineered cells may be allowed to grow for 1-2 days in an
enriched media, and then are switched to a selective media. The
selectable marker in the recombinant plasmid confers resistance to
the selection and allows cells to stably integrate the plasmid into
their chromosomes and grow to form foci which in turn can be cloned
and expanded into cell lines. This method may advantageously be
used to engineer cell lines which express the antibody molecule.
Such engineered cell lines may be particularly useful in screening
and evaluation of compounds that interact directly or indirectly
with the antibody molecule.
[0117] A number of selection systems may be used, including but not
limited to the herpes simplex virus thymidine kinase (Wigler et
al., Cell 11:223 (1977)), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl.
Acad. Sci. USA 48:202 (1992)), and adenine
phosphoribosyltransferase (Lowy et al., Cell 22:817 (1980)) genes
can be employed in tk, hgprt or aprt-cells, respectively. Also,
antimetabolite resistance can be used as the basis of selection for
the following genes: dhfr, which confers resistance to methotrexate
(Wigler et al., Proc. Natl. Acad. Sci. USA 77:357 (1980); O'Hare et
al., Proc. Natl. Acad. Sci. USA 78:1527 (1981)); gpt, which confers
resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl.
Acad. Sci. USA 78:2072 (1981)); neo, which confers resistance to
the aminoglycoside G-418 (VVu and Wu, Biotherapy 3:87-95 (1991));
and hygro, which confers resistance to hygromycin (Santerre et al.,
Gene 30:147 (1984)). Methods commonly known in the art of
recombinant DNA technology may be routinely applied to select the
desired recombinant clone, and such methods are described, for
example, in Ausubel et al. (eds.), Current Protocols in Molecular
Biology, John Wiley & Sons, N Y (1993); Kriegler, Gene Transfer
and Expression, A Laboratory Manual, Stockton Press, N Y (1990);
and in Chapters 12 and 13, Dracopoli et al. (eds), Current
Protocols in Human Genetics, John Wiley & Sons, N Y (1994);
Colberre-Garapin et al., J. Mol. Biol. 150:1 (1981), which are
incorporated by reference herein in their entireties.
[0118] The expression levels of an antibody molecule can be
increased by vector amplification (for a review, see Bebbington and
Hentschel, "The use of vectors based on gene amplification for the
expression of cloned genes in mammalian cells" (DNA Cloning, Vol.
3. Academic Press, New York, 1987)). When a marker in the vector
system expressing antibody is amplifiable, increase in the level of
inhibitor present in culture of host cell will increase the number
of copies of the marker gene. Since the amplified region is
associated with the antibody gene, production of the antibody will
also increase (Crouse et al., Mol. Cell. Biol. 3:257 (1983)).
[0119] The host cell may be co-transfected with two expression
vectors of the invention, the first vector encoding a heavy chain
derived polypeptide and the second vector encoding a light chain
derived polypeptide. The two vectors may contain identical
selectable markers which enable equal expression of heavy and light
chain polypeptides. Alternatively, a single vector may be used
which encodes, and is capable of expressing, both heavy and light
chain polypeptides. In such situations, the light chain should be
placed before the heavy chain to avoid an excess of toxic free
heavy chain (Proudfoot, Nature 322:52 (1986); Kohler, Proc. Natl.
Acad. Sci. USA 77:2197 (1980)). The coding sequences for the heavy
and light chains may comprise cDNA or genomic DNA.
[0120] Once an antibody molecule of the invention has been produced
by an animal, chemically synthesized, or recombinantly expressed,
it may be purified by any method known in the art for purification
of an immunoglobulin molecule, for example, by chromatography
(e.g., ion exchange, affinity, particularly by affinity for the
specific antigen after Protein A, and size-exclusion
chromatography), centrifugation, differential solubility, or by any
other standard technique for the purification of proteins. In
addition, the antibodies of the present invention or fragments
thereof can be fused to heterologous polypeptide sequences
described herein or otherwise known in the art, to facilitate
purification.
[0121] The present invention encompasses antibodies recombinantly
fused or chemically conjugated (including both covalently and
non-covalently conjugations) to a polypeptide. Fused or conjugated
antibodies of the present invention may be used for ease in
purification. See e.g., Harbor et al., supra, and PCT publication
WO 93/21232; EP 439,095; Naramura et al., Immunol. Lett. 39:91-99
(1994); U.S. Pat. No. 5,474,981; Gillies et al., Proc. Natl. Acad.
Sci. 89:1428-1432 (1992); Fell et al., J. Immunol.
146:2446-2452(1991), which are incorporated by reference in their
entireties.
[0122] Moreover, the antibodies or fragments thereof of the present
invention can be fused to marker sequences, such as a peptide to
facilitate purification. In preferred embodiments, the marker amino
acid sequence is a hexa-histidine peptide, such as the tag provided
in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth,
Calif., 91311), among others, many of which are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA
86:821-824 (1989), for instance, hexa-histidine provides for
convenient purification of the fusion protein. Other peptide tags
useful for purification include, but are not limited to, the "HA"
tag, which corresponds to an epitope derived from the influenza
hemagglutinin protein Wilson et al., Cell 37:767 (1984)) and the
"flag" tag.
Diagnostic Uses for Anti-IL13 Antibodies
[0123] The antibodies of the invention include derivatives that are
modified, i.e., by the covalent attachment of any type of molecule
to the antibody, such that covalent attachment does not interfere
with binding to IL13. For example, but not by way of limitation,
the antibody derivatives include antibodies that have been
modified, e.g., by biotinylation, HRP, or any other detectable
moiety.
[0124] Antibodies of the present invention may be used, for
example, but not limited to, to purify or detect IL13, including
both in vitro and in vivo diagnostic methods. For example, the
antibodies have use in immunoassays for qualitatively and
quantitatively measuring levels of IL13 in biological samples. See,
e.g., Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring
Harbor Laboratory Press, 2nd ed. 1988) (incorporated by reference
herein in its entirety).
[0125] As discussed in more detail below, the antibodies of the
present invention may be used either alone or in combination with
other compositions. The antibodies may further be recombinantly
fused to a heterologous polypeptide at the N- or C-terminus or
chemically conjugated (including covalently and non-covalently
conjugations) to polypeptides or other compositions. For example,
antibodies of the present invention may be recombinantly fused or
conjugated to molecules useful as labels in detection assays.
[0126] The present invention further encompasses antibodies or
fragments thereof conjugated to a diagnostic agent. The antibodies
can be used diagnostically to, for example, monitor the development
or progression of an allergic response as part of a clinical
testing procedure to, e.g., determine the efficacy of a given
treatment regimen. Detection can be facilitated by coupling the
antibody to a detectable substance. Examples of detectable
substances include various enzymes, prosthetic groups, fluorescent
materials, luminescent materials, bioluminescent materials,
radioactive materials, positron emitting metals using various
positron emission tomographies, and nonradioactive paramagnetic
metal ions. The detectable substance may be coupled or conjugated
either directly to the antibody (or fragment thereof) or
indirectly, through an intermediate (such as, for example, a linker
known in the art) using techniques known in the art. See, for
example, U.S. Pat. No. 4,741,900 for metal ions which can be
conjugated to antibodies for use as diagnostics according to the
present invention. Examples of suitable enzymes include horseradish
peroxidase, alkaline phosphatase, beta-galactosidase, or
acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin; and examples of suitable radioactive
material include .sup.125I, .sup.131I, .sup.111In or .sup.99Tc.
[0127] Antibodies may also be attached to solid supports, which are
particularly useful for immunoassays or purification of the target
antigen. Such solid supports include, but are not limited to,
glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl
chloride or polypropylene.
[0128] Labeled antibodies, and derivatives and analogs thereof,
which specifically bind to IL13 can be used for diagnostic purposes
to detect, diagnose, or monitor diseases, disorders, and/or
conditions associated with the aberrant expression and/or activity
of IL13. The invention provides for the detection of aberrant
expression of IL13, comprising (a) assaying the expression of IL13
in cells or body fluid of an individual using one or more
antibodies of the present invention specific to IL13 and (b)
comparing the level of gene expression with a standard gene
expression level, whereby an increase or decrease in the assayed
IL13 expression level compared to the standard expression level is
indicative of aberrant expression.
[0129] Antibodies may be used for detecting the presence and/or
levels of IL13 in a sample, e.g., a bodily fluid or tissue sample.
The detecting method may comprise contacting the sample with an
IL13 antibody and determining the amount of antibody that is bound
to the sample.
[0130] The invention provides a diagnostic assay for diagnosing a
disorder, comprising (a) assaying the expression of IL13 in cells
or body fluid of an individual using one or more antibodies of the
present invention and (b) comparing the level of gene expression
with a standard gene expression level, whereby an increase or
decrease in the assayed gene expression level compared to the
standard expression level is indicative of a particular
disorder.
[0131] Antibodies of the invention can be used to assay protein
levels in a biological sample using classical immunohistological
methods known to those of skill in the art (e.g., see Jalkanen, et
al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, et al., J. Cell.
Biol. 105:3087-3096 (1987)). Other antibody-based methods useful
for detecting protein gene expression include immunoassays, such as
the enzyme linked immunosorbent assay (ELISA) and the
radioimmunoassay (RIA). Suitable antibody assay labels are known in
the art and include enzyme labels, such as, glucose oxidase;
radioisotopes, such as iodine (.sup.125I, .sup.121I), carbon
(.sup.14C), sulfur (.sup.35S), tritium (.sup.3H), indium
(.sup.112In), and technetium (.sup.99Tc); luminescent labels, such
as luminol; and fluorescent labels, such as fluorescein and
rhodamine, and biotin.
[0132] One aspect of the invention is the detection and diagnosis
of a disease or disorder associated with aberrant expression of
IL13 in an animal, preferably a mammal and most preferably a human.
In one embodiment, diagnosis comprises: a) administering (for
example, parenterally, subcutaneously, or intraperitoneally) to a
subject an effective amount of a labeled molecule which
specifically binds to IL13; b) waiting for a time interval
following the administration permitting the labeled molecule to
preferentially concentrate at sites in the subject where the
polypeptide is expressed (and for unbound labeled molecule to be
cleared to background level); c) determining background level; and
d) detecting the labeled molecule in the subject, such that
detection of labeled molecule above the background level indicates
that the subject has a particular disease or disorder associated
with aberrant expression of IL13. Background level can be
determined by various methods including, comparing the amount of
labeled molecule detected to a standard value previously determined
for a particular system.
[0133] It will be understood in the art that the size of the
subject and the imaging system used will determine the quantity of
imaging moiety needed to produce diagnostic images. In the case of
a radioisotope moiety, for a human subject, the quantity of
radioactivity injected will normally range from about 5 to 20
millicuries of .sup.99Tc. The labeled antibody or antibody fragment
will then preferentially accumulate at the location of cells which
contain the specific protein. In vivo imaging is described in S. W.
Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies
and Their Fragments." (Chapter 13 in Tumor Imaging: The
Radiochemical Detection of Cancer, S. W. Burchiel and B. A. Rhodes,
eds., Masson Publishing Inc. (1982).
[0134] Depending on several variables, including the type of label
used and the mode of administration, the time interval following
the administration for permitting the labeled molecule to
preferentially concentrate at sites in the subject and for unbound
labeled molecule to be cleared to background level is 6 to 48 hours
or 6 to 24 hours or 6 to 12 hours. In another embodiment the time
interval following administration is 5 to 20 days or 5 to 10
days.
[0135] In an embodiment, monitoring of the disease or disorder is
carried out by repeating the method for diagnosing the disease or
disease, for example, one month after initial diagnosis, six months
after initial diagnosis, one year after initial diagnosis, etc.
[0136] Presence of the labeled molecule can be detected in the
patient using methods known in the art for in vivo scanning. These
methods depend upon the type of label used. Skilled artisans will
be able to determine the appropriate method for detecting a
particular label. Methods and devices that may be used in the
diagnostic methods of the invention include, but are not limited
to, computed tomography (CT), whole body scan such as position
emission tomography (PET), magnetic resonance imaging (MRI), and
sonography.
[0137] In a specific embodiment, the molecule is labeled with a
radioisotope and is detected in the patient using a radiation
responsive surgical instrument (Thurston et al., U.S. Pat. No.
5,441,050). In another embodiment, the molecule is labeled with a
fluorescent compound and is detected in the patient using a
fluorescence responsive scanning instrument. In another embodiment,
the molecule is labeled with a positron emitting metal and is
detected in the patent using positron emission-tomography. In yet
another embodiment, the molecule is labeled with a paramagnetic
label and is detected in a patient using magnetic resonance imaging
(MRI).
[0138] In another aspect, the present invention provides a method
for diagnosing the predisposition of a patient to develop diseases
caused by the unregulated expression of cytokines. Increased
amounts of IL13 in certain patient cells, tissues, or body fluids
may indicate that the patient is predisposed to certain immune
diseases. In one embodiment, the method comprises collecting a
cell, tissue, or body fluid sample a subject known to have low or
normal levels of IL13, analyzing the tissue or body fluid for the
presence of IL13 in the tissue, and predicting the predisposition
of the patient to certain immune diseases based upon the level of
expression of IL13 in the tissue or body fluid. In another
embodiment, the method comprises collecting a cell, tissue, or body
fluid sample known to contain a defined level of IL13 from a
patient, analyzing the tissue or body fluid for the amount of IL13,
and predicting the predisposition of the patient to certain immune
diseases based upon the change in the amount of IL13 compared to a
defined or tested level established for normal cell, tissue, or
bodily fluid. The defined level of IL13 may be a known amount based
upon literature values or may be determined in advance by measuring
the amount in normal cell, tissue, or body fluids. Specifically,
determination of IL13 levels in certain tissues or body fluids
permits specific and early, preferably before disease occurs,
detection of immune diseases in the patient. Immune diseases that
can be diagnosed using the present method include, but are not
limited to, the immune diseases described herein. In the preferred
embodiment, the tissue or body fluid is peripheral blood,
peripheral blood leukocytes, biopsy tissues such as lung or skin
biopsies, and tissue.
Therapeutic Uses of Anti-IL13 Antibodies
[0139] An antibody, with or without a therapeutic moiety conjugated
to it, administered alone or in combination with cytotoxic
factor(s) can be used as a therapeutic. The present invention is
directed to antibody-based therapies which involve administering
antibodies of the invention to an animal, a mammal, or a human, for
treating an IL13-mediated disease, disorder, or condition. The
animal or subject may be an animal in need of a particular
treatment, such as an animal having been diagnosed with a
particular disorder, e.g., one relating to IL13. Antibodies
directed against IL13 are useful for inhibiting allergic reactions
in animals, including but not limited to cows, pigs, horses,
chickens, cats, dogs, non-human primates etc., as well as humans.
For example, by administering a therapeutically acceptable dose of
an antibody, or antibodies, of the present invention, or a cocktail
of the present antibodies, or in combination with other antibodies
of varying sources, an allergic response to antigens may be reduced
or eliminated in the treated mammal.
[0140] Therapeutic compounds of the invention include, but are not
limited to, antibodies of the invention (including fragments,
analogs and derivatives thereof as described herein) and nucleic
acids encoding antibodies of the invention as described below
(including fragments, analogs and derivatives thereof and
anti-idiotypic antibodies as described herein). The antibodies of
the invention can be used to treat, inhibit or prevent diseases,
disorders or conditions associated with aberrant expression and/or
activity of IL13, including, but not limited to, any one or more of
the diseases, disorders, or conditions described herein. The
treatment and/or prevention of diseases, disorders, or conditions
associated with aberrant expression and/or activity of IL13
includes, but is not limited to, alleviating at least one symptoms
associated with those diseases, disorders or conditions. Antibodies
of the invention may be provided in pharmaceutically acceptable
compositions as known in the art or as described herein.
[0141] Anti-IL13 antibodies of the present invention may be used
therapeutically in a variety of diseases. The present invention
provides a method for preventing or treating IL13-mediated diseases
in a mammal. The method comprises administering a disease
preventing or treating amount of anti-IL13 antibody to the mammal.
The anti-IL13 antibody binds to IL13 and regulates cytokine and
cellular receptor expression resulting in cytokine levels
characteristic of non-disease states. Thus, diseases for treatment
include allergy, asthma, autoimmune disease, or other inflammatory
diseases. Other allergic diseases include allergic rhinitis, atopic
dermatitis, food hypersensitivity and urticaria; immune-mediated
skin diseases include bullous skin diseases, erythema multiform and
contact dermatitis; autoimmune disease include psoriasis,
rheumatoid arthritis, juvenile chronic arthritis; inflammatory
bowel disease (i.e., ulcerative colitis, Crohn's disease); other
diseases associated with IL13 include idiopathic interstitial
pneumonia, goblet cell metaplasia, inflammatory and fibrotic lung
diseases such as cystic fibrosis, gluten-sensitive enteropathy, and
Whipple's disease; immunologic diseases of the lung such as
eosinophilic pneumonia, idiopathic pulmonary fibrosis and
hypersensitivity pneumonitis; chronic obstructive pulmonary
disease, RSV infection, uvelitis, scleroderma, osteoporosis, and
Hodgkin's lymphoma.
[0142] The amount of the antibody which will be effective in the
treatment, inhibition and prevention of a disease or disorder
associated with aberrant expression and/or activity of IL13 can be
determined by standard clinical techniques. The antibody can be
administered in treatment regimes consistent with the disease,
e.g., a single or a few doses over one to several days to
ameliorate a disease state or periodic doses over an extended time
to prevent allergy or asthma. In addition, in vitro assays may
optionally be employed to help identify optimal dosage ranges. The
precise dose to be employed in the formulation will also depend on
the route of administration, and the seriousness of the disease or
disorder, and should be decided according to the judgment of the
practitioner and each patient's circumstances. Effective doses may
be extrapolated from dose-response curves derived from in vitro or
animal model test systems.
[0143] For antibodies, the dosage administered to a patient is
typically 0.1 mg/kg to 100 mg/kg of the patient's body weight.
Preferably, the dosage administered to a patient is between 0.1
mg/kg and 20 mg/kg of the patient's body weight, more preferably 1
mg/kg to 10 mg/kg of the patient's body weight. Generally, human
antibodies have a longer half-life within the human body than
antibodies from other species due to the immune response to the
foreign polypeptides. Thus, lower dosages of human antibodies and
less frequent administration is often possible. Further, the dosage
and frequency of administration of antibodies of the invention may
be reduced by enhancing uptake and tissue penetration (e.g., into
the brain) of the antibodies by modifications such as, for example,
lipidation.
[0144] The antibodies of this invention may be advantageously
utilized in combination with other monoclonal or chimeric
antibodies, or with lymphokines or hematopoietic growth factors
(such as, e.g., IL-2, IL-3 IL-7, IFN), for example, which serve to
increase the number or activity of effector cells which interact
with the antibodies.
[0145] The antibodies of the invention may be administered alone or
in combination with other types of treatments, such as
immunotherapy, bronchodilators, anti-IgE molecules,
anti-histamines, or anti-leukotrienes.
[0146] In a preferred aspect, the antibody is substantially
purified (e.g., substantially free from substances that limit its
effect or produce undesired side-effects).
[0147] Various delivery systems are known and can be used to
administer an antibody of the present invention, including
injection, e.g., encapsulation in liposomes, microparticles,
microcapsules, recombinant cells capable of expressing the
compound, receptor-mediated endocytosis (see, e.g., Wu et al., J.
Biol. Chem. 262:4429-4432 (1987)), construction of a nucleic acid
as part of a retroviral or other vector, etc.
[0148] The anti-IL13 antibody can be administered to the mammal in
any acceptable manner. Methods of introduction include but are not
limited to intradermal, intramuscular, intraperitoneal,
intravenous, subcutaneous, intranasal, epidural, inhalation and
oral routes. The antibodies or compositions may be administered by
any convenient route, for example by infusion or bolus injection,
by absorption through epithelial or mucocutaneous linings (e.g.,
oral mucosa, rectal and intestinal mucosa, etc.) and may be
administered together with other biologically active agents.
Administration can be systemic or local. In addition, it may be
desirable to introduce the therapeutic antibodies or compositions
of the invention into the central nervous system by any suitable
route, including intraventricular and intrathecal injection;
intraventricular injection may be facilitated by an
intraventricular catheter, for example, attached to a reservoir,
such as an Ommaya reservoir.
[0149] Pulmonary administration can also be employed, e.g., by use
of an inhaler or nebulizer, and formulation with an aerosolizing
agent. The antibody may also be administered into the lungs of a
patient in the form of a dry powder composition (See e.g., U.S.
Pat. No. 6,514,496).
[0150] In a specific embodiment, it may be desirable to administer
the therapeutic antibodies or compositions of the invention locally
to the area in need of treatment; this may be achieved by, for
example, and not by way of limitation, local infusion, topical
application, by injection, by means of a catheter, by means of a
suppository, or by means of an implant, said implant being of a
porous, non-porous, or gelatinous material, including membranes,
such as sialastic membranes, or fibers. Preferably, when
administering an antibody of the invention, care must be taken to
use materials to which the protein does not absorb.
[0151] In another embodiment, the antibody can be delivered in a
vesicle, in particular a liposome (see Langer, Science
249:1527-1533 (1990); Treat et al., in Liposomes in the Therapy of
Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.),
Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp.
317-327; see generally ibid.).
[0152] In yet another embodiment, the antibody can be delivered in
a controlled release system. In one embodiment, a pump may be used
(see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201
(1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N.
Engl. J. Med. 321:574 (1989)). In another embodiment, polymeric
materials can be used (see Medical Applications of Controlled
Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla.
(1974); Controlled Drug Bioavailability, Drug Product Design and
Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger
and Peppas, J., Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983);
see also Levy et al., Science 228:190 (1985); During et al., Ann.
Neurol. 25:351 (1989); Howard et al., J. Neurosurg. 71:105 (1989)).
In yet another embodiment, a controlled release system can be
placed in proximity of the therapeutic target.
[0153] The present invention also provides pharmaceutical
compositions. Such compositions comprise a therapeutically
effective amount of the antibody, and a physiologically acceptable
carrier. In a specific embodiment, the term "physiologically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and more
particularly in humans. The term "carrier" refers to a diluent,
adjuvant, excipient, or vehicle with which the therapeutic is
administered. Such physiological carriers can be sterile liquids,
such as water and oils, including those of petroleum, animal,
vegetable or synthetic origin, such as peanut oil, soybean oil,
mineral oil, sesame oil and the like. Water is a preferred carrier
when the pharmaceutical composition is administered intravenously.
Saline solutions and aqueous dextrose and glycerol solutions can
also be employed as liquid carriers, particularly for injectable
solutions. Suitable pharmaceutical excipients include starch,
glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, sodium stearate, glycerol monostearate, talc, sodium
chloride, dried skim milk, glycerol, propylene, glycol, water,
ethanol and the like. The composition, if desired, can also contain
minor amounts of wetting or emulsifying agents, or pH buffering
agents. These compositions can take the form of solutions,
suspensions, emulsion, tablets, pills, capsules, powders,
sustained-release formulations and the like. The composition can be
formulated as a suppository, with traditional binders and carriers
such as triglycerides. Oral formulation can include standard
carriers such as pharmaceutical grades of mannitol, lactose,
starch, magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate, etc. Examples of suitable carriers are described in
"Remington's Pharmaceutical Sciences" by E. W. Martin. Such
compositions will contain an effective amount of the antibody,
preferably in purified form, together with a suitable amount of
carrier so as to provide the form for proper administration to the
patient. The formulation should suit the mode of
administration.
[0154] In one embodiment, the composition is formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for intravenous administration to human beings. Typically,
compositions for intravenous administration are solutions in
sterile isotonic aqueous buffer. Where necessary, the composition
may also include a solubilizing agent and a local anesthetic such
as lignocaine to ease pain at the site of the injection. Generally,
the ingredients are supplied either separately or mixed together in
unit dosage form, for example, as a dry lyophilized powder or water
free concentrate in a hermetically sealed container such as an
ampoule or sachette indicating the quantity of active agent. Where
the composition is to be administered by infusion, it can be
dispensed with an infusion bottle containing sterile pharmaceutical
grade water or saline. Where the composition is administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients may be mixed prior to
administration.
[0155] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Optionally associated with such container(s) can be a notice in the
form prescribed by a governmental agency regulating the
manufacture, use or sale of pharmaceuticals or biological products,
which notice reflects approval by the agency of manufacture, use or
sale for human administration.
[0156] In addition, the antibodies of the present invention may be
conjugated to various effector molecules such as heterologous
polypeptides, drugs, radionucleotides, or toxins. See, e.g., PCT
publications WO 92/08495; WO 91/14438; WO 89/12624; U.S. Pat. No.
5,314,995; and EP 396,387. An antibody or fragment thereof may be
conjugated to a therapeutic moiety such as a cytotoxin, e.g., a
cytostatic or cytocidal agent, a therapeutic agent or a radioactive
metal ion, e.g., alpha-emitters such as, for example, 213Bi. A
cytotoxin or cytotoxic agent includes any agent that is detrimental
to cells. Examples include paclitaxol, cytochalasin B, gramicidin
D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide,
vincristine, vinblastine, colchicin, doxorubicin, daunorubicin,
dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin
D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, and puromycin and analogs or homologues
thereof. Therapeutic agents include, but are not limited to,
antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating
agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine and vinblastine).
[0157] Techniques for conjugating such therapeutic moiety to
antibodies are well known, see, e.g., Arnon et al., "Monoclonal
Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in
Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.),
pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies
For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson
et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe,
"Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al. (eds.), pp. 475-506 (1985);
"Analysis, Results, And Future Prospective Of The Therapeutic Use
Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal
Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.),
pp. 303-16 (Academic Press 1985), and Thorpe et al., "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev. 62:119-58 (1982). Alternatively, an antibody can be
conjugated to a second antibody to form an antibody
heteroconjugate. (See, e.g., Segal in U.S. Pat. No. 4,676,980.)
[0158] The conjugates of the invention can be used for modifying a
given biological response, the therapeutic agent or drug moiety is
not to be construed as limited to classical chemical therapeutic
agents. For example, the drug moiety may be a protein or
polypeptide possessing a desired biological activity. Such proteins
may include, for example, a toxin such as abrin, ricin A,
pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor
necrosis factor, .alpha.-interferon, .beta.-interferon, nerve
growth factor, platelet derived growth factor, tissue plasminogen
activator, an apoptotic agent, e.g., TNF-.alpha., TNF-.beta., AIM I
(See, International Publication No. WO 97/33899), AIM II (See,
International Publication No. WO 97/34911), Fas Ligand (Takahashi
et al., Int. Immunol., 6:1567-1574 (1994)), VEGI (See,
International Publication No. WO 99/23105), a thrombotic agent or
an anti-angiogenic agent, e.g., angiostatin or endostatin; or,
biological response modifiers such as, for example, lymphokines,
interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6
("IL-6"), granulocyte macrophage colony stimulating factor
("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or
other growth factors.
Antibody-Based Gene Therapy
[0159] In a another aspect of the invention, nucleic acids
comprising sequences encoding antibodies or functional derivatives
thereof, are administered to treat, inhibit or prevent a disease or
disorder associated with aberrant expression and/or activity of
IL13, by way of gene therapy. Gene therapy refers to therapy
performed by the administration to a subject of an expressed or
expressible nucleic acid. In this embodiment of the invention, the
nucleic acids produce their encoded protein that mediates a
therapeutic effect. Any of the methods for gene therapy available
can be used according to the present invention. Exemplary methods
are described below.
[0160] For general reviews of the methods of gene therapy, see
Goldspiel et al., Clinical Pharmacy 12:488-505 (1993); Wu and Wu,
Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol.
Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993);
and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May,
TIBTECH 11(5):155-215 (1993).
[0161] In a one aspect, the compound comprises nucleic acid
sequences encoding an antibody, said nucleic acid sequences being
part of expression vectors that express the antibody or fragments
or chimeric proteins or heavy or light chains thereof in a suitable
host. In particular, such nucleic acid sequences have promoters
operably linked to the antibody coding region, said promoter being
inducible or constitutive, and, optionally, tissue-specific.
[0162] In another particular embodiment, nucleic acid molecules are
used in which the antibody coding sequences and any other desired
sequences are flanked by regions that promote homologous
recombination at a desired site in the genome, thus providing for
intrachromosomal expression of the antibody encoding nucleic acids
(Koller and Smithies, Proc. Natl. Acad. Sci. USA 86:8932-8935
(1989); Zijlstra et al., Nature 342:435-438 (1989). In specific
embodiments, the expressed antibody molecule is a single chain
antibody; alternatively, the nucleic acid sequences include
sequences encoding both the heavy and light chains, or fragments
thereof, of the antibody.
[0163] Delivery of the nucleic acids into a patient may be either
direct, in which case the patient is directly exposed to the
nucleic acid or nucleic acid-carrying vectors, or indirect, in
which case, cells are first transformed with the nucleic acids in
vitro, then transplanted into the patient. These two approaches are
known, respectively, as in vivo or ex vivo gene therapy.
[0164] In a specific embodiment, the nucleic acid sequences are
directly administered in vivo, where it is expressed to produce the
encoded product. This can be accomplished by any of numerous
methods known in the art, e.g., by constructing them as part of an
appropriate nucleic acid expression vector and administering it so
that they become intracellular, e.g., by infection using defective
or attenuated retrovirals or other viral vectors (see U.S. Pat. No.
4,980,286), or by direct injection of naked DNA, or by use of
microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or
coating with lipids or cell-surface receptors or transfecting
agents, encapsulation in liposomes, microparticles, or
microcapsules, or by administering them in linkage to a peptide
which is known to enter the nucleus, by administering it in linkage
to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu
and Wu, J. Biol. Chem. 262:4429-4432 (1987)) (which can be used to
target cell types specifically expressing the receptors), etc. In
another embodiment, nucleic acid-ligand complexes can be formed in
which the ligand comprises a fusogenic viral peptide to disrupt
endosomes, allowing the nucleic acid to avoid lysosomal
degradation. In yet another embodiment, the nucleic acid can be
targeted in vivo for cell specific uptake and expression, by
targeting a specific receptor (see, e.g., PCT Publications WO
92/06180; WO 92/22635; WO92/20316; WO93/14188, WO 93/20221).
Alternatively, the nucleic acid can be introduced intracellularly
and incorporated within host cell DNA for expression, by homologous
recombination (Koller and Smithies, Proc. Natl. Acad. Sci. USA
86:8932-8935 (1989); Zijlstra et al., Nature 342:435-438
(1989)).
[0165] In a specific embodiment, viral vectors that contain nucleic
acid sequences encoding an antibody of the invention are used. For
example, a retroviral vector can be used (see Miller et al., Meth.
Enzymol. 217:581-599 (1993)). These retroviral vectors contain the
components necessary for the correct packaging of the viral genome
and integration into the host cell DNA. The nucleic acid sequences
encoding the antibody to be used in gene therapy are cloned into
one or more vectors, which facilitates the delivery of the gene
into a patient. More detail about retroviral vectors can be found
in Boesen et al., Biotherapy 6:291-302 (1994), which describes the
use of a retroviral vector to deliver the mdrl gene to
hematopoietic stem cells in order to make the stem cells more
resistant to chemotherapy. Other references illustrating the use of
retroviral vectors in gene therapy are: Clowes et al., J. Clin.
Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994);
Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and
Grossman and Wilson, Curr. Opin. Gen. and Dev. 3:110-114
(1993).
[0166] Adenoviruses may also be used in the present invention.
Adenoviruses are especially attractive vehicles in the present
invention for delivering antibodies to respiratory epithelia.
Adenoviruses naturally infect respiratory epithelia. Other targets
for adenovirus-based delivery systems are liver, the central
nervous system, endothelial cells, and muscle. Adenoviruses have
the advantage of being capable of infecting non-dividing cells.
Kozarsky and Wilson, Curr. Opin. Gen. Dev. 3:499-503 (1993) present
a review of adenovirus-based gene therapy. Bout et al., Human Gene
Therapy 5:3-10 (1994) demonstrated the use of adenovirus vectors to
transfer genes to the respiratory epithelia of rhesus monkeys.
Other instances of the use of adenoviruses in gene therapy can be
found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et
al., Cell 68:143-155 (1992); Mastrangeli et al., J. Clin. Invest.
91:225-234 (1993); PCT Publication WO94/12649; and Wang, et al.,
Gene Therapy 2:775-783 (1995). Adeno-associated virus (AAV) has
also been proposed for use in gene therapy (Walsh et al., Proc.
Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Pat. Nos. 5,436,146;
6,632,670; 6,642,051).
[0167] Another approach to gene therapy involves transferring a
gene to cells in tissue culture by such methods as electroporation,
lipofection, calcium phosphate mediated transfection, or viral
infection. Usually, the method of transfer includes the transfer of
a selectable marker to the cells. The cells are then placed under
selection to isolate those cells that have taken up and are
expressing the transferred gene. Those cells are then delivered to
a patient.
[0168] In this embodiment, the nucleic acid is introduced into a
cell prior to administration in vivo of the resulting recombinant
cell. Such introduction can be carried out by any method known in
the art, including but not limited to transfection,
electroporation, microinjection, infection with a viral or
bacteriophage vector containing the nucleic acid sequences, cell
fusion, chromosome-mediated gene transfer, microcell-mediated gene
transfer, spheroplast fusion, etc. Numerous techniques are known in
the art for the introduction of foreign genes into cells (see,
e.g., Loeffler and Behr, Meth. Enzymol. 217:599-618 (1993); Cohen
et al., Meth. Enzymol. 217:618-644 (1993); Cline, Pharmac. Ther.
29:69-92m (1985) and may be used in accordance with the present
invention, provided that the necessary developmental and
physiological functions of the recipient cells are not disrupted.
The technique should provide for the stable transfer of the nucleic
acid to the cell, so that the nucleic acid is expressible by the
cell and preferably heritable and expressible by its cell
progeny.
[0169] The resulting recombinant cells can be delivered to a
patient by various methods known in the art. Recombinant blood
cells (e.g., hematopoietic stem or progenitor cells) are preferably
administered intravenously. The amount of cells envisioned for use
depends on the desired effect, patient state, etc., and can be
determined by one skilled in the art.
[0170] Cells into which a nucleic acid can be introduced for
purposes of gene therapy encompass any desired, available cell
type, and include but are not limited to epithelial cells,
endothelial cells, keratinocytes, fibroblasts, muscle cells,
hepatocytes; blood cells such as T lymphocytes, B lymphocytes,
monocytes, macrophages, neutrophils, eosinophils, megakaryocytes,
granulocytes; various stem or progenitor cells, in particular
hematopoietic stem or progenitor cells, e.g., as obtained from bone
marrow, umbilical cord blood, peripheral blood, fetal liver,
etc.
[0171] In a one embodiment, the cell used for gene therapy is
autologous to the patient. Nucleic acid sequences encoding an
antibody of the present invention are introduced into the cells
such that they are expressible by the cells or their progeny, and
the recombinant cells are then administered in vivo for therapeutic
effect. In a specific embodiment, stem or progenitor cells are
used. Any stem and/or progenitor cells which can be isolated and
maintained in vitro can potentially be used in accordance with this
embodiment of the present invention (see e.g. PCT Publication WO
94/08598; Stemple and Anderson, Cell 71:973-985 (1992); Rheinwald,
Meth. Cell Bio. 21A:229 (1980); and Pittelkow and Scott, Mayo
Clinic Proc. 61:771 (1986)).
EXAMPLES
Example 1
Preparation of IL13 Immunogen: A Mutated, Inactive Human IL13/Fc
(MT-IL13/Fc)
[0172] A. Cloning and Construction of an Expression Plasmid for
MT-IL13/Fc
[0173] It was reported that human IL13 with a mutation (glutamic
acid to lysine) at amino acid residue #13 bound IL13R.alpha.1 with
equal or higher affinity but had lost the ability to activate
IL13R.alpha.1-bearing cells (Thompson et al., J. Biol. Chem., 274:
29944 (1999)). This mutated, inactive IL13, designated MT-IL13, was
expressed in human embryonic kidney cells 293-T. The purified
recombinant protein was used as the immunogen in the present
invention to generate anti-IL13 monoclonal antibodies. Two
oligonucleotide primers:
TABLE-US-00001 (SEQ ID NO 9) 5'
AAGCTTTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGAAGCT CAT 3' (SEQ ID NO
10) 5' CTCGAGGTTGAACCGTCCCTCGCGAAAAAG 3'
[0174] corresponding to the oligonucleotide sequence of MT-IL13
gene were synthesized and used as templates in polymerase chain
reactions (PCR) to clone the IL13 gene from human testis cDNA
library (BD Biosciences Clontech, Palo Alto, Calif.). The PCR
fragment (342 base pairs) which lacked the predicted signal peptide
sequence of IL13 was ligated into the pSecTag/FRT vector
(Invitrogen, Carlsbad, Calif.) that contained a secretion signal
peptide sequence at the 5' end and a human Fc.gamma.1 (hinge and
constant regions CH2 and CH3) sequence at the 3' end. The
construct's composition was confirmed by sequencing.
[0175] B. Production of MT-IL13/Fc from Transfected 293T Cells
[0176] For transient expression of MT-IL13/Fe, purified plasmid DNA
was transfected into 293T cells by Lipofectamine 2000 (Invitrogen),
according to the manufacturers protocol. At 72 hours
post-transfection, culture supernatants from transfected cells were
collected for purification. For stable expression of MT-IL13/Fc,
cell lines were established using a Flp-In 293T cell line
(Invitrogen). To confirm expression, culture supernatants were
analyzed by sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE). The separated proteins were transferred
to nitrocellulose membrane and detected by reaction with
horseradish peroxidase (HRP) conjugated mouse anti-human IgG (Fc)
monoclonal antibody (Sigma, St. Louis, Mo.) or polyclonal goat
anti-IL13 antibodies (R&D Systems, Minneapolis, Minn.), which
were then detected with HRP-donkey anti-goat IgG (Jackson
ImmunoResearch Laboratories, West Grove, Pa.). The immunoreactive
proteins were identified on film, using enhanced chemi-luminescence
detection (Supersignal West Pico Chemiluminescent Substrate,
Pierce, Rockford, Ill.).
[0177] C. Purification of MTIL13/Fc
[0178] MT-IL13/Fc was purified with a hyper-D protein A affinity
column (Invitrogen) equilibrated with phosphate-buffered saline
(PBS). After applying the cell culture supernatant to the column,
the resin was washed with more than 20 column volumes of PBS. Then,
the resin was washed with SCC buffer (0.05 M sodium citrate, 0.5 M
sodium chloride, pH 6.0) to remove unbound proteins. The IL13
fusion proteins were then eluted (0.05 M sodium citrate, 0.15 M
sodium chloride, pH 3.0) and dialyzed in PBS.
[0179] Fractions from the affinity column containing MT-IL13/Fc
were analyzed by SDS-PAGE. The purity of the proteins were analyzed
by Coomassie Blue staining and the identity of the proteins by
Western immunoblotting using goat anti-human IgG (Fc) antibody
(Sigma) and goat anti-human IL13 antibody (R&D Systems) as
described above.
Example 2
Generation of Anti-IL13 Monoclonal Antibodies
[0180] Male NJ mice (Harlan, Indianapolis, Ind.), 8-12 weeks old,
were injected subcutaneously with 20 .mu.g MT-IL13/Fc in complete
Freund's adjuvant (Difco Laboratories, Detroit, Mich.) in 200 .mu.L
of PBS pH 7.4. At two-week intervals the mice were twice injected
subcutaneously with 20 .mu.g MT-IL13/Fc in incomplete Freund's
adjuvant. Then, two weeks later and three days prior to sacrifice,
the mice were again injected intraperitoneally with 20 .mu.g of the
same immunogen in PBS. Spleen cells isolated from one or more
antigen-immunized mouse were used for fusion. Similar procedures of
immunization and fusion were also used with E. coli expressed human
IL13 (R&D Systems) as immunogen.
[0181] In the fusion leading to the generation of the anti-IL13 MAb
228B/C-1, 26.4.times.10.sup.6 spleen cells and 58.8.times.10.sup.6
spleen cells from two immunized mice were combined. For each
fusion, single cell suspensions were prepared from the spleen of
immunized mice and used for fusion with Sp2/0 myeloma cells. Sp2/0
and spleen cells at a ratio of 1:1 were fused in a medium
containing 50% polyethylene glycol (M.W. 1450) (Kodak, Rochester,
N.Y.) and 5% dimethylsulfoxide (Sigma). The cells were then
adjusted to a concentration of 1.5.times.10.sup.5 spleen cells per
250 .mu.L of the suspension in DMEM medium (Invitrogen, CA),
supplemented with 10% fetal bovine serum, 100 units/mL of
penicillin, 100 .mu.g/mL of streptomycin, 0.1 mM hypoxanthine, 0.4
.mu.M aminopterin, and 16 .mu.M thymidine. Two hundred and fifty
microliters of the cell suspension were added to each well of about
fifty 96-well microculture plates. After about ten days culture
supernatants were withdrawn for screening for reactivity with
MT-IL13/Fc in ELISA.
[0182] Wells of Immulon 2 (Dynatech Laboratories, Chantilly, Va.)
microtest plates were coated by adding purified MT-IL13/Fc (0.1
.mu.g/mL) overnight at room temperature. After the coating solution
was removed by flicking of the plate, 200 .mu.L of a
blocking/diluting buffer (PBS containing 2% bovine serum albumin
and 0.05% TWEEN.RTM. 20) was added to each well for one hour to
block the non-specific sites. One hour later, the wells were then
washed with PBST buffer (PBS containing 0.05% TWEEN.RTM. 20). Fifty
microliters of culture supernatant was collected from each fusion
well, mixed with 50 .mu.L of the blocking/diluting buffer and then
added to the individual wells of the microtest plates. After one
hour of incubation, the wells were washed with PBST. The bound
murine antibodies were then detected by reaction with
HRP-conjugated goat anti-mouse IgG (Fc specific) (Jackson
ImmunoResearch Lab, West Grove, Pa.) and diluted at 1:2,000 with
the blocking/diluting buffer. Peroxidase substrate solution
containing 0.1% 3,3,5,5 tetramethyl benzidine (Sigma, St. Louis,
Mo.) and 0.003% hydrogen peroxide (Sigma) was added to the wells
for color development for 30 minutes. The reaction was terminated
by the addition of 50 .mu.L of 2 M H.sub.2SO.sub.4 per well. The
OD.sub.450 of the reaction mixture was measured with a BioTek ELISA
Reader (BioTek Instruments, Winooski, VM).
[0183] The culture supernatants from the positive wells of
MT-IL13/Fc screening were then tested for negative binding to an
irrelevant F.gamma.1 fusion protein. Final positive wells were then
selected for single-cell cloning by limiting dilution. Culture
supernatants from monoclonal antibodies were re-tested to confirm
their reactivity by ELISA. Selected hybridomas were grown in
spinner flasks and the spent culture supernatant collected for
antibody purification by protein A affinity chromatography.
[0184] The purified antibodies were tested by four assays: i)
Cross-reactivity with 293T cell expressed MT-IL13/Fc and E. coli
expressed mouse IL13; ii) Inhibition of IL13-autocrine
proliferation of HDLM-2 and L-1236 cells; iii) Inhibition of
IL13-induced STAT6 phosphorylation in THP-1 cells; and iv)
Inhibition of IL13-regulated CD14 and CD23 expression on human
monocytes.
[0185] Seventy-three anti-IL13 MAbs were obtained from the fusions
performed on MT-IL13/Fc and IL13 immunized mice. Thirty-nine of
these MAbs were purified for characterization by ELISA and
cell-based assays. Thirteen of these 39 MAbs inhibited autocrine
IL13-induced proliferation of HDLM-2 and L-1236 cells (see assay
description and results in Example 5). Four of the MAbs were found
to be very strongly reactive with human IL13 in ELISA and were
neutralizing against human IL13 in functional cell-based assays.
These MAbs were designated 228B/C-1, 228A-4, 227-26, and 227-43.
These antibodies were all generated using the glycosylated
MT-IL13/Fc as immunogen.
Example 3
[0186] Reactivity of Anti-IL13 Monoclonal Antibodies with Human and
Mouse IL13 in ELISA
[0187] The reactivity of various anti-IL13 monoclonal antibodies
was tested by ELISA. Different wells of 96-well microtest plates
were coated with either E. coli expressed non-glycosylated human
IL13 (R&D Systems), 293T cell expressed glycosylated
MT-IL13/Fe, or E. coli expressed mouse IL13 (R&D Systems) by
the addition of 100 .mu.L of IL13 protein at 0.1 .mu.g/mL in PBS.
After overnight incubation at room temperature, the wells were
treated with PBSTB (PBST containing 2% BSA) to saturate the
remaining binding sites. The wells were then washed with PBST.
[0188] One hundred microliters of two-fold serially diluted
anti-IL13 MAbs (0.5 .mu.g/mL (3.33 nM) to 0.05 ng/mL (0.00033 nM))
were added to the wells for 1 hour at room temperature. An
anti-IL13 MAb JES-5A2 from (BD Biosciences-Pharmingen, San Diego,
Calif.) was also tested as a positive control. This antibody was
generated by using E. coli expressed human IL13 as immunogen. An
isotype-matched mouse anti-HIV-1 gp120 MAb was used as irrelevant
negative control. The wells were then washed with PBST. Bound
antibody was detected by incubation with diluted HRP-goat
anti-mouse IgG (Fc) (Jackson ImmunoResearch) for 1 hour at room
temperature. Peroxidase substrate solution was then added for color
development as described above. The OD.sub.450 was measured using
an ELISA reader.
[0189] FIG. 1 shows the dose-dependent binding of anti-IL13 MAbs
228B/C-1, 228A-4, 227-26, 227-43, and the negative control in
ELISA. Among these MAbs, 228B/C-1 showed the strongest reactivity.
FIG. 2 shows the dose-dependent binding of the anti-IL13 MAbs to
MT-IL13/Fc in ELISA. 228B/C-1 and 228A-4 showed the strongest
reactivity with MT-IL13/Fc, whereas 227-26 and 227-43 showed
moderate reactivity.
[0190] FIGS. 1 and 2 show that 228B/C-1 has highest affinity for
both glycosylated and non-glycosylated human IL13 among all the
anti-IL13 MAbs tested. All these anti-IL13 MAbs did not cross-react
with mouse IL13 in ELISA (data no shown).
Example 4
Lack of Competition of 228B/C-1-Hrp Binding to Human IL13 by
JES10-5A2
[0191] To address whether JES10-5A2 and 228B/C-1 bind to the same
epitope on human IL13, a competition ELISA was used to examine the
effect of JES10-5A2 on 228B/C-1-HRP binding to E. coli expressed
human IL13. Each well of 96-well microtest plates were incubated
with 100 .mu.L of IL13 protein at 0.1 .mu.g/mL in PBS. After
overnight incubation at room temperature, the wells were treated
with PBSTB (PBST containing 2% BSA) to saturate the remaining
binding sites. The wells were then washed with PBST. Fifty
microliters of two fold serially diluted 228B/C-1 and JES10-5A2
(from a final concentration of 20 .mu.g/mL to 9.76 ng/mL) were
mixed with 50 .mu.L of pre-titrated 228B/C-1-HRP (at 1:6,400
dilution). The mixtures were then added to the wells and incubated
for 1 hour at room temperature. Peroxidase substrate solution was
then added for color development as described above. The OD.sub.450
was measured using an ELISA reader.
[0192] FIG. 3 demonstrates that JES10-5A2 does not compete with the
binding of 228B/C-1-HRP to human IL13, indicating that 228B/C-1 and
JES10-5A2 bind to different sites on human IL13.
Example 5
Screening for Anti-IL13 Neutralizing Monoclonal Antibodies by an
IL-13-Autocrine Dependent Proliferation Assay Using L-1236 and
HDLM-2 Cells
[0193] L-1236 and HDLM-2 are Hodgkin lymphoma cell lines obtained
from the German Collection of Microorganisms and Cell Cultures
(DSMZ, Braunschweig, Germany). These cell lines produce IL13 which
in turn activates their cell proliferation in an autocrine fashion
(Kapp U et. al., J. Exp. Med. 189:1939 (1999)).
[0194] Cells were cultured (25,000 cells/well) in the presence or
absence of different anti-IL13 MAb (0.2, 0.02 and 0.002 .mu.g/mL)
in 5% CO.sub.2 at 37.degree. C. for 3-5 days. Cell proliferation
was then measured either by an assay using the tetrazolium compound
MTS (Promega, Madison, \A/I) (readouts at OD.sub.490) or by the
incorporation of .sup.3H-thymidine (Amersham Biosciences,
Piscataway, N.J.).
[0195] The addition of an anti-IL13 neutralizing MAb to the culture
of these cell lines was expected to inhibit their proliferation by
the binding and inactivation of the IL13 produced by these cells.
The results illustrated in FIG. 4 shows the effect of anti-IL13 MAb
of the present invention on the proliferation of L-1235 cells. MAb
228B/C-1 displays the highest potency of inhibition of L-1236 cell
proliferation in a dose-dependent manner among the neutralizing
antibodies tested. TA1-37 (an anti-IL13 MAb generated by using E.
coli expressed human IL13 as immunogen) did not have any inhibitory
activity even at a dose as high as 0.2 .mu.g/mL. Similar results
were obtained with HDLM-2 cells.
Example 6
Assay for IL13-Regulated CD14 and CD23 Expression on Primary Human
Monocytes
[0196] IL13 induces suppression of CD14 expression and the
up-regulation of CD23 expression in the human monocytes (de Waal
Malefyt et al., J. Immunol., 151: 6370 (1993), Chomarat et al.,
Int. Rev. Immunol., 17: 1 (1998)). Peripheral blood leukocytes
(PBLs) were isolated from freshly collected, heparinized whole
blood of healthy human donors by density-gradient centrifugation in
Histopaque-1077 (Sigma). PBLs (1.5.times.10.sup.6) suspended in
RPMI-1640 medium (Invitrogen) with 5% fetal bovine serum were added
to each well of a 96-well tissue culture plate containing
recombinant IL13 (final 10 ng/mL=0.813 nM) and an anti-IL13
monoclonal antibody or an irrelevant antibody (three-fold serial
dilutions, from a final 12 .mu.g/mL=80 nM). CD14 expression or CD23
expression on monocytes was suppressed or up-regulated,
respectively, by the addition of 0.813 nM human IL13 to the
incubating medium. The medium control contained RPMI-1640/FBS
medium without recombinant IL13.
[0197] The cells were incubated in 5% CO.sub.2 at 37.degree. C. for
2 days. The cells were harvested for staining with anti-CD14-FITC
or anti-CD23-PE (BD Biosciences-Pharmingen). The expression levels
of CD14 and CD23 in the monocyte population were measured by flow
cytometry and represented by Median Fluorescence Intensity
(MFI).
[0198] The effects of anti-IL13 MAbs on IL13-suppressed CD14
expression on human monocytes are depicted in FIG. 5. Among all the
anti-IL13 MAbs tested, 228B/C-1 had the highest potency in
inhibiting the effect of IL13 on CD14 expression. Complete
inhibition of the effect of IL13 was achieved at 0.33 nM. The
inhibitory activities of MAbs 227-26 and 228A-4 were moderate,
whereas that of JES10-5A2 was weak. The effect of IL13 could not be
completely inhibited by JES10-5A2 even at 80 nM.
[0199] The effects of anti-IL13 MAbs on IL13-induced CD23
up-regulation on human monocytes are depicted in FIG. 6. Similar to
the results on CD14 expression (FIG. 5), 228B/C-1 was most potent
in inhibiting the effect of IL13 on CD23 expression among the
anti-IL13 MAbs tested. Complete inhibition by 228B/C-1 was achieved
at 0.33 nM. The inhibitory potency of JES10-5A2 was weak.
[0200] Based on the results presented in FIGS. 5 and 6, complete
inhibition of IL13 by 228B/C-1 can be achieved at a molar
stoichiometric ratio of 1:2 (MAb:IL13), and, therefore, 228B/C-1 is
a very high affinity neutralizing MAb against human IL13.
Example 7
IL13-Induced STAT6 Phosphorylation Assay in THP-1 Cells
[0201] IL13 can activate the myeloid cell line THP-1 (ATCC,
Manassas, Va.) to induce phosphorylation of STAT6 which is a
critical step in the signal transduction pathway of IL13 (Murata T
et al., Int. Immunol. 10: 1103-1110 (1998). The anti-IL13 MAbs were
tested for inhibition of IL13 in this assay.
[0202] THP-1 cells were maintained in Dulbecco's Modified Eagle
Medium (DMEM) (Invitrogen) supplemented with 5% fetal bovine serum.
On the day of experiments, the cells were washed and incubated in
serum-free DMEM at 37.degree. C. in 5% CO.sub.2 for 2 hours.
0.3.times.10.sup.6 cells in 80 .mu.L of the serum-free medium were
then added to each well of a 96-well round-bottom plate. One
hundred and twenty microliters of medium containing human IL13
(final concentration of 10 ng/mL=0.813 nM) and anti-IL13 MAbs (5
fold serial dilutions, from final concentration of 0.5
.mu.g/mL=3.333 nM). Negative control wells containing either no
IL13 or IL13 and an isotype-matched irrelevant mouse MAb.
[0203] The mixtures were incubated at 37.degree. C. under 5%
CO.sub.2 for 10 min. The plates were then centrifuged at
300.times.g for 3 minutes at 4.degree. C. After discarding the
supernatant, the cell pellets were resuspended in 100 .mu.L of
Laemmli non-reducing sample buffer (SDS-PAGE loading buffer,
BioRad, CA) and then transferred to microcentrifuge tubes. The
tubes were heated at 95.degree. C. for 5 minutes and then
centrifuged at 10,000.times.g for 10 minutes at room temperature.
The supernatants were collected and analyzed by 4-20% gradient
SDS-PAGE. The separated proteins were transferred to PVDF membrane
which was then incubated with diluted mouse anti-human Stat6 (Y641,
phospho-specific) MAb (BD Bioscienses Pharmingen).
[0204] The bound antibody was detected by HRP conjugated goat
anti-mouse IgG (Fc) antibodies (Jackson ImmunoResearch
Laboratories). The immunoreactive proteins were identified on film,
using enhanced chemiluminescence detection (Supersignal West Pico
Chemiluminescent Substrate, Pierce) FIG. 7 depicts the results of
the effect of anti-IL13 MAbs on IL13-induced phosphorylation of
Stat6 in THP-1 cells. Stat6 is phosphorylated in THP-1 cells
treated with 0.813 nM human IL13. Dose-dependent inhibition of
Stat6 phosphorylation was found when the cells were treated with
MAbs 228B/C-1, 228A-4, 227-26, 227-43 and JES10-5A2. MAb 228B/C-1
is the most potent neutralizing antibodies among the anti-IL13 MAbs
tested. Complete inhibition by 228B/C-1 was achieved at a
concentration between 0.667 nM and 0.133 nM. The approximate molar
stoichiometric ratio between 228B/C-1 and IL13 for complete
inhibition was 1:2. It is consistent with the data shown in FIGS. 5
and 6.
Example 8
Molecular Cloning of Heavy and Light Chain Genes Encoding Anti-IL13
Monoclonal Antibodies
[0205] Total RNA was isolated from hybridoma cells using a QIAGEN
kit (Valencia, Calif.). Reverse transcription (first strand cDNA)
reaction was carried out as follows: 1-1.5 mg of total RNA was
mixed with 1 ml 10 mM dNTPs, 50 ng random Hexamers, and RNase free
water in a final volume of 12 mL.
[0206] The reaction mixture was incubated at 65.degree. C. for 5
minutes and placed on ice immediately for 1 minute. After a brief
centrifugation, the following reagents were added: 4 mL of 5.times.
first strand buffer (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM
MgCl.sub.2), 2 mL of 0.1 mM DTT, and 1 mL of RNaseOUT RNase
inhibitor (40 U/mL). After mixing, the reaction was incubated at
room temperature for 2 minutes. One milliliter of Superscript II RT
(50 U/ml) was then added to the mixture for incubation at
25.degree. C. for 10 minutes followed by 50 minutes at 42.degree.
C. After a brief centrifugation, the reaction was incubated for 15
minutes at 70.degree. C. to inactivate the reverse transcriptase.
One microliter of RNase H (2 U/ml) was then added and the reaction
was incubated for 20 minutes at 37.degree. C. to destroy RNA.
[0207] To amplify the variable regions of the heavy and light
chains, a method described by O'Brien and Jones (O'Brien S. and
Jones T., "Humanizing antibodies by CDR grafting", Antibody
Engineering, Springer Lab manual, Eds. Kontermann and Duble, S
(2001)) was used. Briefly, 5' primers were selected from the signal
peptide region (11 sets for light chain and 12 sets of degenerate
primers for heavy chain) and 3' primers were selected from the
constant region of either the light or heavy chain. 5' and 3'
primers (1.5 mL of 10 mM) were mixed with 5 mL of 10.times.PCR
buffer (250 mM Tris-HCl, pH 8.8, 20 mM MgSO.sub.4, 100 mM KCl, 100
mM (NH.sub.4).sub.2 SO.sub.4, 1% Triton X-100, 1 mg/mL nuclease
free BSA), 1 mL cDNA as prepared previously, 1 mL of Turbo pfu
(Stratagene) and water to adjust the total volume of the reaction
to 50 mL. PCR was performed as follows: 1 cycle at 94.degree. C.
for 4 minutes; 25 cycles at 94.degree. C. for 30 seconds, at
53.degree. C. for 30 seconds, and at 72.degree. C. for 45 seconds;
and 1 cycle at 72.degree. C. for 7 minutes. Reaction mixtures were
resolved by electrophoresis in a 1% agarose gel.
[0208] Amplified DNA fragment was purified and cloned into a
pcDNA3.1 vector. Cloning was carried out using the Invitrogen TOPO
cloning kit following the manufacturer's suggested protocol
(Invitrogen). Fifteen to twenty colonies of transformed E. coli
were used for plasmid purification. Plasmids were sequenced using a
T7 primer. The predominant sequences for the heavy and light chains
were cloned into an M13 Fab expression vector by hybridization
mutagenesis (Glaser S. et al. Antibody Engineering (Oxford
University Press, New York (1995)), Near RI, BioTechniques 12: 88
(1992)). Binding properties of the expressed Fab were confirmed by
ELISA. FIGS. 8-10 depict the VH and VL chain amino acid sequences
for 228B/C, 228A-4, and 227-26, respectively.
Example 9
Humanization of Clone 228B/C
[0209] A. General Protocol
[0210] The variable regions of murine antibody 228B/C were cloned
and sequenced as described in Example 8. A chimeric Fab in a phage
vector was constructed as a control which combined the variable
regions of the murine 228B/C and the constant region of the human
kappa chain and the CH1 part of human IgG.
[0211] To begin the humanization process, a suitable v gene
sequence selected from known human germ line gene sequences was
selected to provide the framework regions one to three (FM1-FM3),
and a suitable J gene sequence was selected to provide framework 4
(FM4) according to the criteria described in WO04/070010
(incorporated herein by reference). This template may be chosen
based on, e.g., its comparative overall length, the size of the
CDRs, the amino acid residues located at the junction between the
framework and the CDRs, overall homology, etc. The template chosen
can be a mixture of more than one sequence or may be a consensus
template.
[0212] Constructing an expression vector comprising the heavy
and/or light chain variants generated comprised the formulas:
FRH1-CDRH1-FRH2-CDRH2-FRH3-CDRH3-FRH4 (i) and
FRL1-CDRL1-FRL2-CDRL2-FRL3-CDRL3-FRL4 (ii),
wherein FRH1, FRH2, FRH3, FRH4, FRL1, FRL2, FRL3 and FRL4 represent
the variants of the framework template heavy chain and light chain
sequences chosen from the germ line templates and the CDRs
represent those of the parent antibody. The differences between the
murine parent antibody and the selected human template sequences
were determined to serve as a basis for generating a library of
antibody Fabs. This library can be generated for the light chain
individually, and then the heavy chain or simultaneously. Affinity
maturation of the CDR regions may also be analyzed simultaneously
or sequentially with the humanization of the framework.
[0213] The library of variant Fabs was generated containing (1) the
murine amino acid residue, (2) the amino acid residue from the
chosen human germ line gene, or optionally, (3) a randomly selected
amino acid, at each of the selected positions found to differ from
the murine framework sequence. The desired variants were generated
by annealing overlapping oligonucleotides and then incorporating
the chosen residue at the framework positions that were of
interest. An amplification of the annealed product was done using
two primers, one of which was biotin-labeled. The biotin tag was
used for the purification of a single-strand of the primer and this
was used as a mutagenic oligo in a Kunkel-based mutagenesis
reaction using the vector of interest in a U-template format
(Rosok, M. J., et al., (1996) Journal of Biological Chemistry 271:
22611-22618). After annealing and elongating the plasmid, the
reaction underwent digestion with a unique restriction enzyme,
XbaI, which cleaves the original template but not the newly
synthesized mutated strand. The plasmid was electroporated into
competent cells for amplification and mixed with a phage-competent
E. coli cell-type for generation of phage particles. The plasmid
constructs are able to synthesize a Fab which is secreted into the
supernatant. Individual plaques were selected and the antibody
eluted for analysis.
[0214] The library was analyzed for quality and completeness. Upon
sequencing a random sampling of the library, the number of
candidates selected that had the correct insertion of the Vk (or
Vh) region was determined. This number was used to determine the
overall efficiency of the library. Once the library was
established, the candidates were screened using a functional
ELISA-based assay to determine which candidates produced functional
Fabs specific for IL-13. Those candidates demonstrating activity
for IL-13 comparable to the chimeric clone were assayed further for
reproducibility. Several of the candidates were sequenced to
determine how tolerant the targeted framework positions were for
humanization.
[0215] After the libraries were found to be representative,
variants were analyzed for binding affinity, and those found to
have comparable or greater binding affinity than the chimeric
control antibody were sequenced. If the isolates analyzed did not
contain a residue from human germ line gene at a chosen position in
the framework, it was concluded that the human amino acid residue
was not tolerated at that position. At this point, if only the
murine and human amino acids were tested, another Fab library could
be made randomizing the amino acids at the positions where human
template residues were not found. Fabs with suitable replacement
residues (non murine) would then be selected and converted into
whole MAbs. In addition, consensus templates may be used as the
starting framework.
[0216] B. IL-13 Monoclonal Antibody Vk Humanization
[0217] Humanization of the variable region of the light chain (Vk)
was performed first. However, one can begin with either chain or
humanize both chains simultaneously. The human template chosen was
Human Template 2 and involved studying the effects on 9 residues
close to the CDRs within the light chain to determine if they could
be humanized without a loss of functional activity. The positions
that were studied on the light chain for the second round of
screening were 4, 9, 12, 73, 81, 82, 83, 84, and 109.
[0218] A library was generated varying each of these positions with
either the murine or the human template residue. Approximately 860
variants were screened using a functional ELISA assay. Only 18
candidates demonstrated comparable function to the chimeric clone.
These candidates were assayed further. Six candidates of the 18
demonstrated a greater affinity for antigen compared to the
chimeric clone, and these 6 were sequenced. The sequencing results
are presented in FIGS. 11A and B, and from these results, positions
4, 12 and 81 favor the murine residue.
[0219] C. Vh Humanization
[0220] In order to assess the contribution of the heavy chain
framework residues to the overall function of the candidate
antibody, a library was established varying 10 positions within the
human DP27 template framework that differed from the murine parent,
while maintaining the murine light chain. The library was generated
using synthesized overlapping oligonucleotides for the Vh, and
generation of the murine Vk using PCR. The Vk and Vh were then
inserted into the Fab expression vector using mutagenesis and the
library was then screened for functional Fabs. The complexity of
the library was (2.sup.10/70%).times.3=3840.
[0221] A total of 1056 candidates were screened, using a 96-well
format ELISA assay. The candidates from this library that were
chosen for sequencing were those that yielded the highest values
from the screen results. Five of these high activity candidates
were sequenced to determine their level of humanization and their
sequences are presented in FIGS. 12A and B. From these results,
three of the framework residues on the heavy chain favored the
murine residue (#24, 68 and 94).
[0222] The second framework studied was the human template NEW. A
combinatorial library was generated in which both the Vk and Vh
were humanized concurrently. Nine residues on the Vk were varied
between the murine and the human residues and nine residues were
also chosen for the Vh. Approximately 5200 candidates (55 96-well
plates) were screened from this library. From the screen,
approximately 300 candidates yielded results comparable to the
chimeric clone. From this group, thirty candidates were sequenced
to determine the humanization level of these functional clones.
[0223] The sequencing results for the light chains are presented in
FIGS. 11A and B. The heavy chain sequences are presented in FIGS.
12 A & B. Position 83 on the Vk had a high incidence for
retaining the murine residue, whereas several positions in the Vh
template favored the murine residue. In particular, position 94
retained the murine residue in 29 out of 30 candidates screened.
Although no candidates appear to have completely humanized
frameworks, several variable regions which were highly humanized in
either the Vk or Vh will be used for further humanization. The most
humanized Vk was combined with the most humanized Vh to assay
functional activity. (See FIG. 13.)
[0224] A second library which combined the framework residues of
the Vk and Vh of interest was generated using DP27 as the heavy
chain template and HT2 as the light chain template. As described
above, overlapping oligonucleotides were synthesized which
contained the human framework with either human or murine residues
at each position in question. These oligos were mixed and then
annealed to generate the complete variable regions. The regions
were amplified through PCR and then made into single-stranded
fragments. The fragments were phosphorylated and then used in a
mutagenesis reaction to incorporate the variable regions into the
M13-based vector. The library was then screened for functional Fabs
that were specific for IL-13 in an ELISA-based assay. The sequences
for the light chain and heavy chains are shown in FIGS. 11 C&D
and 12C&D, respectively.
[0225] From the sequencing results, the Vk chain was able to
tolerate human residues throughout, and thus this chain was fully
humanized. For the heavy chain, two positions were intolerant of
the human residues: position 24 and 94. Thus, the heavy chain
variable region was .about.98% humanized.
[0226] D. Generation of Combinatorial Humanized Candidates
[0227] Since no candidate picked up from the screening of either of
the libraries was fully humanized, the humanization was engineered.
A series of candidates were generated in which the desired
humanization levels were obtained. The most humanized Vk from the
HT2 library was combined with the most humanized Vh from either the
NEW or the DP27 libraries. These combinatorial candidates were then
assayed to determine which maintained the specific function while
carrying the highest humanization level. The candidates chosen from
HT2-NEW were HT2-NEW #73 for heavy chain and HT2-NEW #115 for the
light chain. The candidates chosen from HT2-DP27 light chain were
HT2-DP27#89 and HT2-DP27#144, and the candidates for heavy chain
were HT2-DP27#123 and HT2-DP27#276. For HT2-DP27, constructs were
made as follows: #89 Vk with #276 Vh and #89 Vk with #123 Vh; #144
Vk with #276 Vh and #144 Vk with #123 Vh. In addition, one
construct was made with #144 Vk DP27 with #73 Vh NEW to determine
whether NEW and DP27 interactions with the HT2 light chain
differed.
[0228] These combinations were tested by ELISA to determine if
there was any further loss of function upon further humanization.
For these assays, the antigen IL-13 was captured on the plate in a
limiting amount. The anti-IL13 Fabs were then added to the plate at
a known concentration and titrated down the plate at a 1:3
dilution. Binding was detected with a secondary antibody that is
specific for Fab. FIG. 13 depicts the functional assay results.
FIG. 13A--115Vk/73Vh; FIG. 13B--89Vk/276Vh; FIG. 13C--144Vk/276Vh;
and FIG. 13D--144Vk/73Vh. From these data, the observed results
suggested that the engineered combinations of humanized variable
regions did not adversely affect the binding of the Fabs to the
antigen.
[0229] Because the results in FIGS. 11 and 12 suggested that the
HT2 light chain could be fully humanized and all but 2 positions in
DP27 (24 and 94) could be humanized, the ideal humanized candidate
was engineered in which the only 2 murine residues remained. Upon
generation of this particular candidate, the clone was assayed in
comparison with its parent as well as the other candidates to
determine if there was any loss of function. From the data
presented in FIG. 14A, this humanized candidate shows no
significant loss of function with this high degree of humanization
(89 Vk/276G). Humanization was also done for the HT2-NEW framework
candidate. This candidate has a final humanization level of 98%, as
there are two murine residues that remain on the heavy chain. FIG.
14B depicts the ELISA results for this construct (115Vk/73Vh
FL).
[0230] An attempt was made to further humanize 89Vk/276G by
replacing the two remaining murine residues. Upon mutating the
positions to the human residues, the candidate clones were assayed
by ELISA and compared to the parent. However, a significant loss of
function was observed upon replacing the murine residues with those
of the chosen template. Therefore, another library was generated in
which the two positions on the Vh were randomized to allow for all
possible amino acids at these two positions. The candidates were
screened using a functional ELISA assay and thirty candidates that
yielded comparable results to the parent clone (89Vk/276G) were
sequenced to determine which amino acids were present at the
targeted positions. A list of the candidates and the amino acids at
the two positions is shown below.
TABLE-US-00002 Candidate 24 94 Candidate 24 94 228B/C V G RL49 A T
DP27 F R RL59 I M 89/276G V G RL61 S T RL7 A S RL62 T T RL8 L S
RL70 S L RL11 T V RL72 V T RL12 I I RL78 I M RL15 L L RL79 V T RL19
S L RL84 L T RL27 G V RL88 L S RL32 G G RL89 L S RL35 S L RL91 G L
RL36 G V RL95 I L RL40 L S RL97 T T RL45 T T RL18 S R
[0231] Thus, from this screen, there are several amino acids which
apparently are tolerated at the designated positions and yet do not
result in significant loss of function. Thus, by changing the
framework residues to amino acids that are not found in the murine
sequence nor in the human framework, a fully functional Fab was
generated without detrimental effect on binding to the target
antigen. The candidates that were further tested from this random
library were RL-19 and RL-36.
Example 10
CDR Optimization
[0232] Upon determining the optimal framework sequence for the
candidate anti-IL-13 antibody, optimization of the CDRs was
performed. For this process, the CDR amino acid sequence was
randomized and then the libraries were screened to identify those
candidates which had equal or better functional activity than the
parent clone. For this library, the parent candidate was RL-36 (see
above). The six CDRs were randomized, one position at a time and
the libraries were screened using a functional ELISA. Strongly
reactive candidates were sequenced for comparison with the parent
CDR. It is noted that all unique sequences listed in the tables
below also appear in FIG. 20 with appropriate SEQ ID NO
identifiers.
[0233] A CDR-L1 Optimization
[0234] CDR-L1 comprised 15 amino acids. Each of these positions was
randomized using synthesized oligonucleotides which were the mixed
in equimolar amounts to be used in a mutagenesis reaction. The
efficiency of incorporation of the mutagenic oligonucleotides was
determined to be 40%. Using this percentage, the number of
candidates which needed to be screened was 3600. The clones were
assayed using a functional ELISA and those clones that yielded
comparable functional activity were sequenced. From the number of
candidates that were screened, 166 positive candidates were
identified. From this group, 10 candidates were sequenced to
determine the changes within the CDR. From the sequencing results
shown below results, the positions 11 and 14 lead to improved
affinity are N to Q and M to L.
TABLE-US-00003 SEQ ID 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 NO:
CDR-L1 R A S K S V D S Y G N S F M H 99 L1-21 R A S K S V D S Y G N
S F L H 103 L1-39 R A S K S V D S Y G Q S F M H 100 L1-47 K A S K S
V D S Y G N S F M H 194 L1-50 R A S K S V D S Y G N S Y M H 102
L1-59 R A S K S V D S Y G Q S F M H 100 L1-61 R A S K S V D S Y G N
S F M H 99 L1-62 R A S K S V D S Y G N S F L H 103 L1-63 R A S K S
V D S Y G N S F L H 103 L1-117 N A S K S V D S Y G N S F M H 195
L1-125 R A S K S V D S Y G N S F M H 99
[0235] B. CDR2-L2 Optimization
[0236] CDR-L2 comprised 7 amino acids. This library was prepared as
described above. The efficiency of this library was 80% and 840
clones were assayed. The number of positive clones identified from
the assay was 75 and 11 were sequenced. From the results shown
below, several positions within this CDR yielded improved activity,
although the positions and replacement amino acids appeared random.
This result supports the observation that CDR-L2 is farthest from
the antigen binding site and as such should exert the least
influence upon antigen binding.
TABLE-US-00004 1 2 3 4 5 6 7 SEQ ID NO: CDR-L2 L A S N L E S 104
L2-10 L A S N L N S 105 L2-13 L A S N L E S 104 L2-25 L A S N L Q S
106 L2-37 L A T N L E S 107 L2-41 L A S N L K S 108 L2-44 L A S N L
E K 109 L2-45 L A S R L E S 110 L2-53 L A S N L H S 111 L2-58 L A S
N L S S 112 L2-65 L A S F L E S 113 L2-70 L A N N L E S 114
[0237] C. CDR-L3 Optimization
[0238] CDR-L3 was composed of 9 amino acids. This library upon
generation yielded an efficiency of 50%, requiring .about.1700
clones be screened. From this screen, 257 positive candidates were
identified and ten were sequenced. From these results, only one
position yielded a change from the parent sequence. Several
candidates demonstrated the same sequence which suggested that this
positional change was highly favored (N to A).
TABLE-US-00005 1 2 3 4 5 6 7 8 9 SEQ ID NO: CDR-L3 Q Q N N E D P R
T 115 L3-1 Q Q N N E D P R T 115 L3-32 Q Q N A E D P R T 116 L3-90
Q Q N N E D P R T 115 L3-100 Q Q N N E D P R T 115 L3-150 Q Q N N E
D P R T 115 L3-170 Q Q N A E D P R T 116 L3-185 Q Q N A E D P R T
116 L3-207 Q Q N A E D P R T 116 L3-225 Q Q N N E D P R T 115
[0239] D. CDR-H1 Optimization
[0240] CDR-H1 comprised 5 amino acids. The efficiency of this
library was 80%, requiring only about 600 candidates be screened.
From the screen, there were 138 positive clones and eleven of the
clones were sequenced. From the results are listed below, the
second position within this CDR seemed to offer the greatest chance
of improvement of antigen binding. However, several amino acids
favorably affect binding.
TABLE-US-00006 1 2 3 4 5 SEQ ID NO: CDR-H1 A Y S V N 117 H1-2 A K S
V N 118 H1-12 G Y S V N 120 H1-18 A K S V N 118 H1-24 A K S V N 118
H1-31 A H S V N 121 H1-89 A Y S V N 117 H1-90 G Y S V N 120 H1-114
A S S V N 185 H1-115 A H S V N 121 H1-123 A R S V N 122 H1-126 A R
S V N 122
[0241] E. CDR-H2 Optimization
[0242] CDR-H2 comprised 16 amino acids. The efficiency of this
library was 70%, which meant that over 2100 candidates needed to be
screened. From the screen, 192 positive candidates were identified
and thirteen were sequenced to determine the changes that occurred
within the CDR. From the sequencing results listed below, several
positions improved binding affinity but none of the amino acid
changes appeared significantly different from the parent.
TABLE-US-00007 SEQ ID 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 NO:
CDR-H2 M I W G D G K I V Y N S A L K S 123 H2-38 M I W G D G K I S
Y N S A L K S 124 H2-43 M I W G D G K I V Y N S A L E S 125 H2-51 M
I W G D G K I V Y N S A L K S 126 H2-66 M I W G D G K I S Y N S A L
K S 124 H2-79 M I W G D G K I V Y N S D L K S 127 H2-86 M I W G D G
K V V Y N S A L K S 128 H2-101 M I W G D G K I V Y N S E L K S 129
H2-109 M I W G D G K I A Y N S A L K S 130 H2-119 M I W G D G K I V
Y N S A L K E 131 H2-121 M V W G D G K I V Y N S A L K S 132 H2-129
M I W G D G K I V Y N S A L K S 123 H2-169 M I W G D G K I V Y N S
A L A S 133 H2-176 M I W G D G K K V Y N S A L K S 134
[0243] F. CDR-H3 Optimization
[0244] CDR-H3 comprised 10 amino acids. This CDR in general is
believed to be the one that imposes the greatest influence on
antigen binding, because this loop is generally in the middle of
the binding site. This library had an efficiency of 40%, and so
2400 candidates needed to be screened. Of these, 174 positive
candidates were identified and ten were sequenced to determine the
changes within the CDR. The results listed below indicated that the
change from Y to R in the third position may be an important one
for improvement in binding.
TABLE-US-00008 1 2 3 4 5 6 7 8 9 10 SEQ ID NO: H3 D G Y Y P Y A M D
N 135 H3-1 D G R Y P Y A M D N 136 H3-30 D G Y Y P Y A M S N 139
H3-73 D G Y Y P Y A M A N 140 H3-89 D G Y Y P Y A M A N 140 H3-130
D G R Y P Y A M D N 136 H3-131 D G R Y P Y A M D N 136 H3-133 D G Y
Y P Y A L D N 141 H3-135 D G R Y P Y A M D N 136 H3-161 D G Y Y P Y
A M D N 135 H3-162 D G Y Y P Y A M K N 137
[0245] G. Combinatorial Library
[0246] Once the changes within the CDRs which yielded the greatest
overall improvement in antigen binding were determined, the best
candidates were then combined to see if these changes improved
binding. Thus, a candidate was engineered to combine all favorable
amino acid substitutions.
[0247] To generate the combinatorial library, the initial clone was
the one that incorporated the alteration in CDR-L1-59 (N to Q). To
this clone, the other changes were made for CDR-L3, N to A
(position 4), for CDR-H1, Y to either R, H, K or S (position 2),
for CDR-H3, Y to R (position 3) and D to either K or S (position
9). No changes were made to CDR-L2 or CDR-H2. Over 1100 candidates
from this library were screened using a functional ELISA assay. A
total of 120 candidates were identified as having activity greater
than the parent clone. The sequences of those clones are shown in
FIG. 15.
[0248] To confirm that these combinatorial candidates maintained
function, a competition assay was performed. For this assay, IL-13
was captured on an ELISA plate. The candidates, which are purified
Fabs, were pre-mixed in varying concentrations to a constant
concentration of labeled chimeric anti-IL-13 Fab. This mixture was
added to the ELISA plate. The labeled chimeric anti-IL-13 capable
of binding to the plate-bound IL-13 were detected.
[0249] From the results of this competition, the two candidates
assayed demonstrated equivalent ability to compete with the
chimeric candidate (228 B/C #3) for binding to IL-13 (FIG. 16). The
irrelevant Fab is 51, which demonstrates no ability to compete.
FIG. 17 depicts the sequences of three affinity matured
candidates.
Example 11
Epitope Mapping
[0250] Anti-IL13 MAb 228B/C-1 binds to a conformational epitope and
binds to cynomologous monkey IL13 with the same high affinity as it
does to human IL13. However, 228B/C does not bind to murine IL13.
So, the strategy devised for epitope mapping was to exchange small
portions of the monkey IL13 with the corresponding mouse IL13
sequence. Overlapping oligonucleotides were synthesized as shown in
FIG. 18. Two rounds of PCR were performed to assemble the IL13
hybrid constructs so that part of monkey IL13 was replaced by the
corresponding sequence from mouse IL13 (FIG. 18). The final PCR
amplified IL13 coding regions were cloned into pcDNA3.1 vector in
frame with a V5 tag using TOPO cloning kit (Invitrogen). All PCR
amplified region were confirmed by sequencing to contain only the
desired domain swapping mutations and not additional unwanted
mutation in the expression vectors.
[0251] The anti-IL13 MAb binding epitope was identified as a 8-mer
peptide from amino acid #49 to 56, ESLINVSG (SEQ ID NO 18). This
epitope is located in Helix-B and loop-BC in human IL13. When the
epitope peptide derived from cyno-IL13 was used to swap the
corresponding sequence in murine IL13, the resulting hybrid IL13
molecule can bind to 228B/C with affinity similar to that of the
original cynoIL13, further validated that 228B/C MAb binding to
cyno or human IL13 at this peptide between residual #49-56.
Sequence comparison between human, cyno, and murine IL13 reveals
only three residues Ile52, Val54, Gly56 in human IL13 are not
conserved, suggesting the critical residues for IL13 and anti-IL13
MAb interaction through this 8-mer peptide is determined by one or
combination of some of these three residues.
[0252] This epitope was further confirmed by peptide spot analysis.
The entire human IL13 peptide was scanned with a series of
overlapping 12-mer peptides synthesized via SPOT on cellulose
membrane. The only anti-IL13 MAb reactive peptide was identified as
a 12-mer peptide of amino acid #44-56, YCAALESLINVS (SEQ ID NO 19),
which is overlapping with the region identified through domain
swapping experiments.
DEPOSITS
[0253] The following cultures have been deposited with the American
Type Culture Collection, 10801 University Boulevard, Manassas Va.
20110-2209 USA (ATCC):
TABLE-US-00009 Hybridoma ATCC NO. Deposit Date Anti-IL13 228B/C-1
PTA-5657 Nov. 20, 2003 Anti-IL13 228A-4 PTA-5656 Nov. 20, 2003
Anti-IL13 227-26 PTA-5654 Nov. 20, 2003 Anti-IL13 227-43 PTA-5655
Nov. 20, 2003
[0254] This deposit was made under the provisions of the Budapest
Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest Treaty). This assures maintenance
of a viable culture for 30 years from the date of deposit. The
organism will be made available by ATCC under the terms of the
Budapest Treaty, which assures permanent and unrestricted
availability of the progeny of the culture to the public upon
issuance of the pertinent U.S. patent.
[0255] The assignee of the present application has agreed that if
the culture on deposit should die or be lost or destroyed when
cultivated under suitable conditions, it will be promptly replaced
on notification with a viable specimen of the same culture.
Availability of the deposited strain is not to be construed as a
license to practice the invention in contravention of the rights
granted under the authority of any government in accordance with
its patent laws.
[0256] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
the cultures deposited, since the deposited embodiments are
intended as illustration of one aspect of the invention and any
culture that are functionally equivalent are within the scope of
this invention. The deposit of material herein does not constitute
an admission that the written description herein contained is
inadequate to enable the practice of any aspect of the invention,
including the best mode thereof, nor is it to be construed as
limiting the scope of the claims to the specific illustration that
it represents. Indeed, various modifications of the invention in
addition to those shown and described herein will become apparent
to those skilled in the art from the foregoing description and fall
within the scope of the appended claims.
[0257] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
1951114PRTHomo sapiens 1Ser Pro Gly Pro Val Pro Pro Ser Thr Ala Leu
Arg Glu Leu Ile Glu1 5 10 15Glu Leu Val Asn Ile Thr Gln Asn Gln Lys
Ala Pro Leu Cys Asn Gly 20 25 30Ser Met Val Trp Ser Ile Asn Leu Thr
Ala Gly Met Tyr Cys Ala Ala 35 40 45Leu Glu Ser Leu Ile Asn Val Ser
Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60Gln Arg Met Leu Ser Gly Phe
Cys Pro His Lys Val Ser Ala Gly Gln65 70 75 80Phe Ser Ser Leu His
Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe 85 90 95Val Lys Asp Leu
Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg 100 105 110Phe
Asn2114PRTHomo sapiensmisc_feature(13)..(13)Xaa can be any
naturally occurring amino acid 2Ser Pro Gly Pro Val Pro Pro Ser Thr
Ala Leu Arg Xaa Leu Ile Glu1 5 10 15Glu Leu Val Asn Ile Thr Gln Asn
Gln Lys Ala Pro Leu Cys Asn Gly 20 25 30Ser Met Val Trp Ser Ile Asn
Leu Thr Ala Gly Met Tyr Cys Ala Ala 35 40 45Leu Glu Ser Leu Ile Asn
Val Ser Gly Cys Ser Ala Ile Glu Lys Thr 50 55 60Gln Arg Met Leu Ser
Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln65 70 75 80Phe Ser Ser
Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe 85 90 95Val Lys
Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg 100 105
110Phe Asn3113PRTMurinae gen. sp.CHAIN(1)..(113)VARIABLE REGION OF
LIGHT CHAIN OF MONOCLONAL ANTIBODY 228B/C 3Asn Ile Val Leu Thr Gln
Ser Pro Ala Ser Leu Ala Val Ser Leu Gly1 5 10 15Gln Arg Ala Thr Ile
Ser Cys Arg Ala Ser Lys Ser Val Asp Ser Tyr 20 25 30Gly Asn Ser Phe
Met His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40 45Lys Leu Leu
Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro Ala 50 55 60Arg Phe
Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr Leu Thr Ile Asp65 70 75
80Pro Val Glu Ala Asp Asp Ala Ala Ser Tyr Tyr Cys Gln Gln Asn Asn
85 90 95Glu Asp Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
Arg 100 105 110Ala4118PRTMurinae gen. sp.CHAIN(1)..(118)VARIABLE
REGION OF HEAVY CHAIN OF MONOCLONAL ANTIBODY 228B/C 4Gln Val Gln
Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln1 5 10 15Ser Leu
Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu Asn Ala Tyr 20 25 30Ser
Val Asn Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Leu 35 40
45Gly Met Ile Trp Gly Asp Gly Lys Ile Val Tyr Asn Ser Ala Leu Lys
50 55 60Ser Arg Leu Asn Ile Ser Lys Asp Ser Ser Lys Ser Gln Val Phe
Leu65 70 75 80Lys Met Ser Ser Leu Gln Ser Asp Asp Thr Ala Arg Tyr
Tyr Cys Ala 85 90 95Gly Asp Gly Tyr Tyr Pro Tyr Ala Met Asp Asn Trp
Gly His Gly Thr 100 105 110Ser Val Thr Val Ser Ser
1155118PRTMurinae gen. sp.CHAIN(1)..(118)VARIABLE REGION OF LIGHT
CHAIN OF MONOCLONAL ANTIBODY 228A-4 5Gln Val Gln Leu Lys Glu Ser
Gly Pro Gly Leu Val Ala Pro Ser Gln1 5 10 15Ser Leu Ser Ile Thr Cys
Thr Val Ser Gly Phe Ser Leu Thr Asp Tyr 20 25 30Asn Ile Asn Trp Ile
Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Leu 35 40 45Gly Met Ile Trp
Gly Asp Gly Ser Thr Ala Tyr Asn Ser Ala Leu Lys 50 55 60Ser Arg Leu
Ser Ile Ser Lys Asp Asn Ser Lys Ser Gln Ile Phe Leu65 70 75 80Lys
Met Asn Ser Leu Gln Thr Glu Asp Thr Ala Arg Tyr Tyr Cys Ala 85 90
95Arg Asp Gly Tyr Phe Pro Tyr Ala Met Ala Tyr Trp Gly Gln Gly Thr
100 105 110Ser Val Thr Val Ser Ser 1156118PRTMurinae gen.
sp.CHAIN(1)..(118)VARIABLE REGION OF HEAVY CHAIN OF MONOCLONAL
ANTIBODY 228A-4 6Gln Val Gln Leu Lys Glu Ser Gly Pro Gly Leu Val
Ala Pro Ser Gln1 5 10 15Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe
Ser Leu Thr Asp Tyr 20 25 30Asn Ile Asn Trp Ile Arg Gln Pro Pro Gly
Lys Gly Leu Glu Trp Leu 35 40 45Gly Met Ile Trp Gly Asp Gly Ser Thr
Ala Tyr Asn Ser Ala Leu Lys 50 55 60Ser Arg Leu Ser Ile Ser Lys Asp
Asn Ser Lys Ser Gln Ile Phe Leu65 70 75 80Lys Met Asn Ser Leu Gln
Thr Glu Asp Thr Ala Arg Tyr Tyr Cys Ala 85 90 95Arg Asp Gly Tyr Phe
Pro Tyr Ala Met Ala Tyr Trp Gly Gln Gly Thr 100 105 110Ser Val Thr
Val Ser Ser 1157114PRTMurinae gen. sp.CHAIN(1)..(114)VARIABLE
REGION OF LIGHT CHAIN OF MONOCLONAL ANTIBODY
227-26CHAIN(1)..(114)VARIABLE REGION OF LIGHT CHAIN OF MONOCLONAL
ANTIBODY 227-26-1 7Asp Val Leu Met Thr Gln Thr Pro Leu Ser Leu Pro
Val Ser Leu Gly1 5 10 15Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln
Ser Ile Val His Ser 20 25 30Asn Gly Asn Thr Tyr Leu Gln Trp Tyr Leu
Gln Lys Pro Gly Gln Ser 35 40 45Pro Lys Leu Leu Ile Tyr Lys Val Ser
Asn Arg Phe Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu
Asp Leu Gly Val Tyr Tyr Cys Phe Gln Gly 85 90 95Ser His Val Pro Tyr
Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 110Arg
Ala8120PRTMurinae gen. sp.CHAIN(1)..(120)VARIABLE REGION OF HEAVY
CHAIN OF MONOCLONAL ANTIBODY 227-26-1 8Gln Val Gln Leu Gln Gln Ser
Gly Asp Asp Leu Val Leu Pro Gly Ala1 5 10 15Ser Val Lys Leu Ser Cys
Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30Trp Ile Asn Trp Ile
Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45Gly His Ile Ala
Pro Gly Ser Gly Ser Thr Tyr Phe Asn Glu Met Phe 50 55 60Lys Gly Lys
Ala Thr Leu Thr Val Asp Thr Ser Ser Ser Thr Ala Tyr65 70 75 80Ile
Gln Leu Ser Ser Leu Ser Ser Glu Asp Ser Ala Val Tyr Phe Cys 85 90
95Ala Arg Ser Asp Ile Phe Leu Ser Tyr Ala Met Asp Tyr Trp Gly Gln
100 105 110Gly Thr Ser Val Thr Val Ser Ser 115 120950DNAARTIFICIAL
SEQUENCEForward oligonucleotide primer for a mutant IL13 sequence
9aagctttccc caggccctgt gcctccctct acagccctca ggaagctcat
501030DNAARTIFICIAL SEQUENCEReverse Oligo nucleotide primer of a
mutant IL13 sequence 10ctcgaggttg aaccgtccct cgcgaaaaag
301122DNAARTIFICIAL SEQUENCEForward degenerate oligonucleotide
primer for monkey IL13 11gyyctrggcy ycatggcgct yt
221225DNAARTIFICIAL SEQUENCEReverse degenerate oligonucleotide
primer for monkey IL13 12tttcagttga accgtccyty gcgaa
2513399DNAMacaca fascicularis 13atggcgctct tgttgaccat ggtcattgct
ctcacttgcc tcggcggctt tgcctcccca 60agccctgtgc ctccctctac agccctcaag
gagctcattg aggagctggt caacatcacc 120cagaaccaga aggccccgct
ctgcaatggc agcatggtgt ggagcatcaa cctgacagct 180ggcgtgtact
gtgcagccct ggaatccctg atcaacgtgt caggctgcag tgccatcgag
240aagacccaga ggatgctgaa cggattctgc ccgcacaagg tctcagctgg
gcagttttcc 300agcttgcgtg tccgagacac caaaatcgag gtggcccagt
ttgtaaagga cctgctcgta 360catttaaaga aactttttcg caatggacgg ttcaactga
3991434DNAARTIFICIAL SEQUENCEForward oligonucleotide primer for
cynomologus monkey IL13 14aagcttcacc atggcgctct tgttgaccat ggtc
341540DNAARTIFICIAL SEQUENCEReverse oligonucleotide primer for
cynomologus monkey IL13 15tcacaagatc tgggctcctc gaggttgaac
cgtccattgc 401623DNAARTIFICIAL SEQUENCEForward oligonucleotide
primer for Fc gamma1 16ctcgaggagc ccagatcttg tga
231735DNAARTIFICIAL SEQUENCEReverse oligonucleotide primer for Fc
gamma 1 17gctctagagc ctcatttacc cggagacagg gagag 35188PRTARTIFICIAL
SEQUENCEEPITOPE BINDING SITE 18Glu Ser Leu Ile Asn Val Ser Gly1
51912PRTARTIFICIAL SEQUENCEEPITOPE BINDING SITE 19Tyr Cys Ala Ala
Leu Glu Ser Leu Ile Asn Val Ser1 5 102023PRTARTIFICIAL SEQUENCEFRL1
228B/C-1 20Asn Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser
Leu Gly1 5 10 15Gln Arg Ala Thr Ile Ser Cys 202123PRTARTIFICIAL
SEQUENCEFRL1 TEMPLATE HT2 21Asp Ile Val Met Thr Gln Ser Pro Asp Ser
Leu Ser Val Ser Leu Gly1 5 10 15Glu Arg Ala Thr Ile Asn Cys
202223PRTARTIFICIAL SEQUENCEFRL1 VARIANT B 22Asp Ile Val Met Thr
Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly1 5 10 15Glu Arg Ala Thr
Ile Asn Cys 202323PRTARTIFICIAL SEQUENCEFRL1 VARIANT J 23Asp Ile
Val Leu Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly1 5 10 15Glu
Arg Ala Thr Ile Asn Cys 202423PRTARTIFICIAL SEQUENCEFRL1 VARIANT L
24Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ser Val Ser Leu Gly1
5 10 15Glu Arg Ala Thr Ile Asn Cys 202523PRTARTIFICIAL SEQUENCEFRL1
VARIANT HT-NEW #300 25Asp Ile Val Leu Thr Gln Ser Pro Asp Ser Leu
Ser Val Ser Leu Gly1 5 10 15Glu Arg Ala Thr Ile Asn Cys
202623PRTARTIFICIAL SEQUENCEFRL1 VARIANT HT2-DP27 #29 26Asp Ile Val
Leu Thr Gln Ser Pro Val Ser Leu Ala Val Ser Leu Gly1 5 10 15Glu Arg
Ala Thr Ile Asn Cys 202723PRTARTIFICIAL SEQUENCEFRL1 VARIANT
HT2-DP27 #53 27Asp Ile Val Met Thr Gln Ser Pro Ala Ser Leu Ser Val
Ser Leu Gly1 5 10 15Glu Arg Ala Thr Ile Asn Cys 202823PRTARTIFICIAL
SEQUENCEFRL1 VARIANT HT2-DP27 #66 28Asp Ile Val Met Thr Gln Ser Pro
Asp Ser Leu Ala Val Ser Leu Gly1 5 10 15Glu Arg Ala Thr Ile Asn Cys
202915PRTARTIFICIAL SEQUENCEFRL2 228B/C 29Trp Tyr Gln Gln Lys Pro
Gly Gln Pro Pro Lys Leu Leu Ile Tyr1 5 10 153032PRTARTIFICIAL
SEQUENCEFRL3 288 B/C 30Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser
Arg Thr Asp Phe Thr1 5 10 15Leu Thr Ile Asp Pro Val Glu Ala Asp Asp
Ala Ala Ser Tyr Tyr Cys 20 25 303132PRTARTIFICIAL SEQUENCEFRL3 HT2
31Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1
5 10 15Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr
Cys 20 25 303232PRTARTIFICIAL SEQUENCEFRL3 VARIANT B 32Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5 10 15Leu Thr
Ile Asp Pro Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
303332PRTARTIFICIAL SEQUENCEFRL3 VARIANT J 33Gly Val Pro Asp Arg
Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5 10 15Leu Thr Ile Asp
Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
303432PRTARTIFICIAL SEQUENCEFRL3 VARIANT L 34Gly Val Pro Asp Arg
Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu Thr Ile Asp
Pro Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
303532PRTARTIFICIAL SEQUENCEFRL3 VARIANT N 35Gly Val Pro Asp Arg
Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu Thr Ile Asp
Pro Val Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
303632PRTARTIFICIAL SEQUENCEFRL3 VARIANT P 36Gly Val Pro Asp Arg
Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu Thr Ile Asp
Ser Val Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
303732PRTARTIFICIAL SEQUENCEFRL3 VARIANT R 37Gly Val Pro Asp Arg
Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu Thr Ile Ser
Ser Val Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
303832PRTARTIFICIAL SEQUENCEFRL3 VARIANT HT2-NEW #1 38Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu Thr
Ile Ser Pro Val Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
303932PRTARTIFICIAL SEQUENCEFRL3 VARIANT HT2-NEW #9 39Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5 10 15Leu Thr
Ile Ser Ser Val Glu Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
304032PRTARTIFICIAL SEQUENCEFRL3 VARIANT HT2-NEW #14 40Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu Thr
Ile Ser Pro Val Glu Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
304132PRTARTIFICIAL SEQUENCEFRL3 HT2-NEW #21 41Gly Val Pro Asp Arg
Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5 10 15Leu Thr Ile Ser
Ser Val Glu Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
304232PRTARTIFICIAL SEQUENCEFRL3 VARIANT HT2-NEW # 67 42Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5 10 15Leu Thr
Ile Asp Pro Leu Glu Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
304332PRTARTIFICIAL SEQUENCEFRL3 VARIANT HT2-NEW #74 43Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5 10 15Leu Thr
Ile Ser Pro Val Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
304432PRTARTIFICIAL SEQUENCEFRL3 VARIANT HT2-NEW #78 44Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5 10 15Leu Thr
Ile Asp Ser Val Glu Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
304532PRTARTIFICIAL SEQUENCEFRL3 VARIANT HT2-NEW #322 45Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu Thr
Ile Asp Ser Leu Glu Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
304632PRTARTIFICIAL SEQUENCEFRL3 VARIANT HT2-NEW #162 46Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5 10 15Leu Thr
Ile Asp Pro Val Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
304732PRTARTIFICIAL SEQUENCEFRL3 VARIANT HT2-DP27 # 7 47Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5 10 15Leu Thr
Ile Asp Ser Val Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
304832PRTARTIFICIAL SEQUENCEFRL3 VARIANT HT2-DP27 #57 48Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5 10 15Leu Thr
Ile Ser Pro Val Glu Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
304932PRTARTIFICIAL SEQUENCEFRL3 VARIANT HT2-DP27 #73 49Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5 10 15Leu Thr
Ile Asp Pro Val Glu Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
305032PRTARTIFICIAL SEQUENCEFRL3 VARIANT HT2-DP27 #92 50Gly Val Pro
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5 10 15Leu Thr
Ile Asp Thr Val Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25
305132PRTARTIFICIAL SEQUENCEFRL3 VARIANT HT2-DP27 #118 51Gly Val
Pro Asp Arg Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu
Thr Ile Ser Pro Leu Gln Ala Glu Asp
Val Ala Val Tyr Tyr Cys 20 25 305232PRTARTIFICIAL SEQUENCEFRL3
VARIANT HT2-DP27 #123 52Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser
Arg Thr Asp Phe Thr1 5 10 15Leu Thr Ile Ser Ser Leu Glu Ala Glu Asp
Val Ala Val Tyr Tyr Cys 20 25 305332PRTARTIFICIAL SEQUENCEFRL3
VARIANT HT2-DP27 #83 53Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser
Arg Thr Asp Phe Thr1 5 10 15Leu Thr Ile Asp Pro Leu Glu Ala Glu Asp
Val Ala Val Tyr Tyr Cys 20 25 305432PRTARTIFICIAL SEQUENCEFRL3
VARIANT HT2-DP27 #135 54Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Phe Thr1 5 10 15Leu Thr Ile Ser Ser Leu Glu Ala Glu Asp
Val Ala Val Tyr Tyr Cys 20 25 305532PRTARTIFICIAL SEQUENCEFRL3
VARIANT HT2-DP27 #273 55Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Phe Thr1 5 10 15Leu Thr Ile Ser Ser Val Gln Ala Glu Asp
Val Ala Val Tyr Tyr Cys 20 25 305632PRTARTIFICIAL SEQUENCEFRL3
VARIANT HT2-DP27 #301 56Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Phe Thr1 5 10 15Leu Thr Ile Ser Pro Leu Gln Ala Glu Asp
Val Ala Val Tyr Tyr Cys 20 25 305712PRTARTIFICIAL SEQUENCEFRL4 228
B/C 57Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala1 5
105811PRTARTIFICIAL SEQUENCEFRL4 HT2 58Phe Gly Gly Gly Thr Lys Val
Glu Ile Lys Arg1 5 105911PRTARTIFICIAL SEQUENCEFRL4 VARIANT B 59Phe
Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg1 5 106030PRTARTIFICIAL
SEQUENCEFRH1 228 B/C 60Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu
Val Ala Pro Ser Gln1 5 10 15Ser Leu Ser Ile Thr Cys Thr Val Ser Gly
Phe Ser Leu Asn 20 25 306130PRTARTIFICIAL SEQUENCEFRH1 DP27 61Gln
Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln1 5 10
15Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser 20 25
306230PRTARTIFICIAL SEQUENCEFRH1 NEW 62Gln Val Gln Leu Gln Glu Ser
Gly Pro Gly Leu Val Arg Pro Ser Gln1 5 10 15Thr Leu Ser Leu Thr Cys
Thr Val Ser Gly Ser Thr Phe Ser 20 25 306330PRTARTIFICIAL
SEQUENCEFRH1 VARIANT HT2-NEW #73 63Gln Val Gln Leu Gln Glu Ser Gly
Pro Gly Leu Val Arg Pro Ser Gln1 5 10 15Thr Leu Ser Leu Thr Cys Thr
Val Ser Gly Ser Thr Phe Ser 20 25 306430PRTARTIFICIAL SEQUENCEFRH1
HT2-DP27 #7 64Gln Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys
Pro Thr Gln1 5 10 15Thr Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser
Leu Asn 20 25 306530PRTARTIFICIAL SEQUENCEFRH1 VARIANT HT2-DP27 #40
65Gln Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln1
5 10 15Thr Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser 20
25 306630PRTARTIFICIAL SEQUENCEFRH1 VARIANT HT2-DP27 #268 66Gln Val
Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln1 5 10 15Thr
Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Asn 20 25
306714PRTARTIFICIAL SEQUENCEFRH2 228 B/C 67Trp Val Arg Gln Pro Pro
Gly Lys Gly Leu Glu Trp Leu Gly1 5 106814PRTARTIFICIAL SEQUENCEFRH2
DP27 68Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu Ala1 5
106914PRTARTIFICIAL SEQUENCEFRH2 NEW 69Trp Val Arg Gln Pro Pro Gly
Arg Gly Leu Glu Trp Ile Gly1 5 107014PRTARTIFICIAL SEQUENCEFRH2
VARIANT 1 70Trp Val Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu
Gly1 5 107114PRTARTIFICIAL SEQUENCEFRH2 VARIANT 3 71Trp Ile Arg Gln
Pro Pro Gly Lys Gly Leu Glu Trp Leu Gly1 5 107214PRTARTIFICIAL
SEQUENCEFRH2 VARIANT HT2-DP27 #7 72Trp Ile Arg Gln Pro Pro Gly Lys
Ala Leu Glu Trp Leu Gly1 5 107314PRTARTIFICIAL SEQUENCEFRH2 VARIANT
HT2-DP27 # 43 73Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Leu
Ala1 5 107414PRTARTIFICIAL SEQUENCEFRH2 VARIANT HT2-DP27 #50 74Trp
Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Leu Ala1 5
107514PRTARTIFICIAL SEQUENCEFRH2 VARIANT HT2-DP27 #100 75Trp Val
Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu Ala1 5
107632PRTARTIFICIAL SEQUENCEFRH3 228 B/C 76Arg Leu Asn Ile Ser Lys
Asp Ser Ser Lys Ser Gln Val Phe Leu Lys1 5 10 15Met Ser Ser Leu Gln
Ser Asp Asp Thr Ala Arg Tyr Tyr Cys Ala Gly 20 25
307732PRTARTIFICIAL SEQUENCEFRH3 DP27 77Arg Leu Thr Ile Ser Lys Asp
Thr Ser Lys Asn Gln Val Val Leu Thr1 5 10 15Met Thr Asn Met Asp Pro
Val Asp Thr Ala Thr Tyr Tyr Cys Ala Arg 20 25 307832PRTARTIFICIAL
SEQUENCEFRH3 NEW 78Arg Val Thr Met Leu Lys Asp Thr Ser Lys Asn Gln
Phe Ser Leu Arg1 5 10 15Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val
Tyr Tyr Cys Ala Arg 20 25 307932PRTARTIFICIAL SEQUENCEFRH3 VARIANT
1 79Arg Leu Thr Ile Ser Lys Asp Ser Ser Lys Asn Gln Val Val Leu
Thr1 5 10 15Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys
Ala Gly 20 25 308032PRTARTIFICIAL SEQUENCEFRH3 VARIANT 3 80Arg Leu
Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val Val Leu Thr1 5 10 15Met
Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys Ala Gly 20 25
308132PRTARTIFICIAL SEQUENCEFRH3 VARIANT 4 81Arg Leu Thr Ile Ser
Lys Asp Thr Ser Lys Asn Gln Val Val Leu Thr1 5 10 15Met Thr Asn Met
Asp Pro Val Asp Thr Ala Arg Tyr Tyr Cys Ala Gly 20 25
308232PRTARTIFICIAL SEQUENCEFRH3 HT2-NEW #1 82Arg Leu Asn Met Ser
Lys Asp Thr Ser Lys Asn Gln Phe Phe Leu Arg1 5 10 15Leu Ser Ser Val
Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Gly 20 25
308332PRTARTIFICIAL SEQUENCEFRH3 VARIANT HT2-NEW #9 83Arg Leu Asn
Met Ser Lys Asp Thr Ser Lys Asn Gln Phe Phe Leu Arg1 5 10 15Leu Ser
Ser Val Thr Ala Ala Asp Thr Ala Arg Tyr Tyr Cys Ala Gly 20 25
308432PRTARTIFICIAL SEQUENCEFRH3 VARIANT HT2-NEW #14 84Arg Val Asn
Met Ser Lys Asp Thr Ser Lys Asn Gln Phe Ser Leu Arg1 5 10 15Leu Ser
Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg 20 25
308532PRTARTIFICIAL SEQUENCEFRH3 VARIANT HT2-DP27 #26 85Arg Leu Asn
Ile Ser Lys Asp Thr Ser Lys Asn Gln Val Val Leu Thr1 5 10 15Met Thr
Asn Met Asp Pro Val Asp Thr Ala Arg Tyr Tyr Cys Ala Arg 20 25
308632PRTARTIFICIAL SEQUENCEFRH3 VARIANT HT2-DP27 #275 86Arg Leu
Thr Ile Ser Lys Asp Ile Ser Lys Asn Gln Val Val Leu Thr1 5 10 15Met
Thr Asn Met Asp Pro Val Asp Thr Ala Arg Tyr Tyr Cys Ala Gly 20 25
308732PRTARTIFICIAL SEQUENCEFRH3 VARIANT HT2-DP27 #301 87Arg Leu
Asn Ile Ser Lys Asp Thr Ser Lys Asn Gln Val Val Leu Thr1 5 10 15Met
Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys Ala Gly 20 25
308832PRTARTIFICIAL SEQUENCEFRH3 VARIANT HT2-DP27 #580 88Arg Leu
Asn Ile Ser Lys Asp Ser Ser Lys Asn Gln Val Val Leu Thr1 5 10 15Met
Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys Ala Gly 20 25
308932PRTARTIFICIAL SEQUENCEFRH3 VARIANT HT2-DP27 #345 89Arg Leu
Asn Ile Ser Lys Asp Thr Ser Lys Asn Gln Val Val Leu Thr1 5 10 15Met
Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys Ala Arg 20 25
309032PRTARTIFICIAL SEQUENCEFRH3 VARIANT HT2-DP27 #634 90Arg Leu
Thr Ile Ser Lys Asp Ser Ser Lys Asn Gln Val Val Leu Thr1 5 10 15Met
Thr Asn Met Asp Pro Val Asp Thr Ala Arg Tyr Tyr Cys Ala Gly 20 25
309111PRTARTIFICIAL SEQUENCEFRH4 228B/C 91Trp Gly His Gly Thr Ser
Val Thr Val Ser Ser1 5 109211PRTARTIFICIALFRH4 DP27 92Trp Gly Gln
Gly Ser Leu Val Thr Val Ser Ser1 5 1093112PRTARTIFICIAL
SEQUENCEVARIABLE LIGHT CHAIN OF CL5 93Asp Ile Val Met Thr Gln Ser
Pro Asp Ser Leu Ser Val Ser Leu Gly1 5 10 15Glu Arg Ala Thr Ile Asn
Cys Arg Ala Ser Lys Ser Val Asp Ser Tyr 20 25 30Gly Gln Ser Phe Met
His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40 45Lys Leu Leu Ile
Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro Asp 50 55 60Arg Phe Ser
Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser65 70 75 80Ser
Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Asn Ala 85 90
95Glu Asp Pro Arg Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105 11094118PRTARTIFICIAL SEQUENCEVARIABLE HEAVY CHAIN OF CL5
94Gln Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln1
5 10 15Thr Leu Thr Leu Thr Cys Thr Gly Ser Gly Phe Ser Leu Ser Ala
Tyr 20 25 30Ser Val Asn Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu
Trp Leu 35 40 45Ala Met Ile Trp Gly Asp Gly Lys Ile Val Tyr Asn Ser
Ala Leu Lys 50 55 60Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn
Gln Val Val Leu65 70 75 80Thr Met Thr Asn Met Asp Pro Val Asp Thr
Ala Thr Tyr Tyr Cys Ala 85 90 95Val Asp Gly Tyr Tyr Pro Tyr Ala Met
Lys Asn Trp Gly Gln Gly Ser 100 105 110Leu Val Thr Val Ser Ser
11595112PRTARTIFICIAL SEQUENCEVARIABLE LIGHT CHAIN OF CL-13 95Asp
Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ser Val Ser Leu Gly1 5 10
15Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser Lys Ser Val Asp Ser Tyr
20 25 30Gly Gln Ser Phe Met His Trp Tyr Gln Gln Lys Pro Gly Gln Pro
Pro 35 40 45Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val
Pro Asp 50 55 60Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile Ser65 70 75 80Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr
Cys Gln Gln Asn Asn 85 90 95Glu Asp Pro Arg Thr Phe Gly Gly Gly Thr
Lys Val Glu Ile Lys Arg 100 105 11096118PRTARTIFICIAL
SEQUENCEVARIABLE HEAVY CHAIN OF CL-13 96Gln Val Thr Leu Arg Glu Ser
Gly Pro Ala Leu Val Lys Pro Thr Gln1 5 10 15Thr Leu Thr Leu Thr Cys
Thr Gly Ser Gly Phe Ser Leu Ser Ala Lys 20 25 30Ser Val Asn Trp Ile
Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu 35 40 45Ala Met Ile Trp
Gly Asp Gly Lys Ile Val Tyr Asn Ser Ala Leu Lys 50 55 60Ser Arg Leu
Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val Val Leu65 70 75 80Thr
Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys Ala 85 90
95Val Asp Gly Tyr Tyr Pro Tyr Ala Met Ser Asn Trp Gly Gln Gly Ser
100 105 110Leu Val Thr Val Ser Ser 11597112PRTARTIFICIAL
SEQUENCEVARIABLE LIGHT CHAIN OF CL-50 97Asp Ile Val Met Thr Gln Ser
Pro Asp Ser Leu Ser Val Ser Leu Gly1 5 10 15Glu Arg Ala Thr Ile Asn
Cys Arg Ala Ser Lys Ser Val Asp Ser Tyr 20 25 30Gly Gln Ser Phe Met
His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40 45Lys Leu Leu Ile
Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro Asp 50 55 60Arg Phe Ser
Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser65 70 75 80Ser
Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Asn Ala 85 90
95Glu Asp Pro Arg Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105 11098118PRTARTIFICIAL SEQUENCEVARIABLE HEAVY CHAIN OF CL-50
98Gln Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln1
5 10 15Thr Leu Thr Leu Thr Cys Thr Gly Ser Gly Phe Ser Leu Ser Ala
Lys 20 25 30Ser Val Asn Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu
Trp Leu 35 40 45Ala Met Ile Trp Gly Asp Gly Lys Ile Val Tyr Asn Ser
Ala Leu Lys 50 55 60Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn
Gln Val Val Leu65 70 75 80Thr Met Thr Asn Met Asp Pro Val Asp Thr
Ala Thr Tyr Tyr Cys Ala 85 90 95Val Asp Gly Tyr Tyr Pro Tyr Ala Met
Lys Asn Trp Gly Gln Gly Ser 100 105 110Leu Val Thr Val Ser Ser
1159915PRTARTIFICIAL SEQUENCECDR-L1 228B/C 99Arg Ala Ser Lys Ser
Val Asp Ser Tyr Gly Asn Ser Phe Met His1 5 10 1510015PRTARTIFICIAL
SEQUENCECDR-L1 VARIANT 1 100Arg Ala Ser Lys Ser Val Asp Ser Tyr Gly
Gln Ser Phe Met His1 5 10 1510115PRTARTIFICIAL SEQUENCECDR-L1
VARIANT 2 101Arg Ala Ser Lys Ser Val Asp Ser Tyr Gly Gln Ser Phe
Leu His1 5 10 1510215PRTARTIFICIAL SEQUENCECDR-L1 VARIANT 3 102Arg
Ala Ser Lys Ser Val Asp Ser Tyr Gly Asn Ser Tyr Met His1 5 10
1510315PRTARTIFICIAL SEQUENCECDR-L1 VARIANT 4 103Arg Ala Ser Lys
Ser Val Asp Ser Tyr Gly Asn Ser Phe Leu His1 5 10
151047PRTARTIFICIAL SEQUENCECDR-L2 228B/C 104Leu Ala Ser Asn Leu
Glu Ser1 51057PRTARTIFICIAL SEQUENCECDR-L2 VARIANT 1 105Leu Ala Ser
Asn Leu Asn Ser1 51067PRTARTIFICIAL SEQUENCECDR-L2 VARIANT 2 106Leu
Ala Ser Asn Leu Gln Ser1 51077PRTARTIFICIAL SEQUENCECDR-L2 VARIANT
3 107Leu Ala Thr Asn Leu Glu Ser1 51087PRTARTIFICIAL SEQUENCECDR-L2
VARIANT 4 108Leu Ala Ser Asn Leu Lys Ser1 51097PRTARTIFICIAL
SEQUENCECDR-L2 VARIANT 5 109Leu Ala Ser Asn Leu Glu Lys1
51107PRTARTIFICIAL SEQUENCECDR-L2 VARIANT 6 110Leu Ala Ser Arg Leu
Glu Ser1 51117PRTARTIFICIAL SEQUENCECDR-L2 VARIANT 7 111Leu Ala Ser
Asn Leu His Ser1 51127PRTARTIFICIAL SEQUENCECDR-L2 VARIANT 8 112Leu
Ala Ser Asn Leu Ser Ser1 51137PRTARTIFICIAL SEQUENCECDR-L2 VARIANT
9 113Leu Ala Ser Phe Leu Glu Ser1 51147PRTARTIFICIAL SEQUENCECDR-L2
VARIANT 10 114Leu Ala Asn Asn Leu Glu Ser1 51159PRTARTIFICIAL
SEQUENCECDR-L3 228B/C 115Gln Gln Asn Asn Glu Asp Pro Arg Thr1
51169PRTARTIFICIAL SEQUENCECDR-L3 VARIANT 1 116Gln Gln Asn Ala Glu
Asp Pro Arg Thr1 51175PRTARTIFICIAL SEQUENCECDR-H1 228B/C 117Ala
Tyr Ser Val Asn1 51185PRTARTIFICIAL SEQUENCECDR-H1 VARIANT 1 118Ala
Lys Ser Val Asn1 51195PRTARTIFICIAL SEQUENCECDR-H1 VARIANT 2 119Ala
Asn Ser Val Asn1 51205PRTARTIFICIAL SEQUENCECDR-H1 VARIANT 3 120Gly
Tyr Ser Val Asn1 51215PRTARTIFICIAL SEQUENCECDR-H1 VARIANT 4 121Ala
His Ser Val Asn1 51225PRTARTIFICIAL SEQUENCECDR-H1 VARIANT 5 122Ala
Arg Ser Val Asn1 512316PRTARTIFICIAL SEQUENCECDR-H2 228B/C 123Met
Ile Trp Gly Asp Gly Lys Ile Val Tyr Asn Ser Ala Leu Lys Ser1 5 10
1512416PRTARTIFICIAL SEQUENCECDR-H2 VARIANT 1 124Met Ile Trp Gly
Asp Gly Lys Ile Ser Tyr Asn Ser Ala Leu Lys Ser1 5 10
1512516PRTARTIFICIAL SEQUENCECDR-H2 VARIANT 2 125Met Ile Trp Gly
Asp Gly Lys Ile Val Tyr Asn Ser Ala Leu Glu Ser1
5 10 1512616PRTARTIFICIAL SEQUENCECDR-H2 VARIANT 3 126Met Ile Trp
Gly Asp Gly Lys Ile Val Tyr Asn Ser Ala Leu Lys Ser1 5 10
1512716PRTARTIFICIAL SEQUENCECDR-H2 VARIANT 4 127Met Ile Trp Gly
Asp Gly Lys Ile Val Tyr Asn Ser Asp Leu Lys Ser1 5 10
1512816PRTARTIFICIAL SEQUENCECDR-H2 VARIANT 5 128Met Ile Trp Gly
Asp Gly Lys Val Val Tyr Asn Ser Ala Leu Lys Ser1 5 10
1512916PRTARTIFICIAL SEQUENCECDR-H2 VARIANT 6 129Met Ile Trp Gly
Asp Gly Lys Ile Val Tyr Asn Ser Glu Leu Lys Ser1 5 10
1513016PRTARTIFICIAL SEQUENCECDR-H2 VARIANT 7 130Met Ile Trp Gly
Asp Gly Lys Ile Ala Tyr Asn Ser Ala Leu Lys Ser1 5 10
1513116PRTARTIFICIAL SEQUENCECDR-H2 VARIANT 8 131Met Ile Trp Gly
Asp Gly Lys Ile Val Tyr Asn Ser Ala Leu Lys Glu1 5 10
1513216PRTARTIFICIAL SEQUENCECDR-H2 VARIANT 9 132Met Val Trp Gly
Asp Gly Lys Ile Val Tyr Asn Ser Ala Leu Lys Ser1 5 10
1513316PRTARTIFICIAL SEQUENCECDR-H2 VARIANT 10 133Met Ile Trp Gly
Asp Gly Lys Ile Val Tyr Asn Ser Ala Leu Ala Ser1 5 10
1513416PRTARTIFICIAL SEQUENCECDR-H2 VARIANT 11 134Met Ile Trp Gly
Asp Gly Lys Lys Val Tyr Asn Ser Ala Leu Lys Ser1 5 10
1513510PRTARTIFICIAL SEQUENCECDR-H3 228B/C 135Asp Gly Tyr Tyr Pro
Tyr Ala Met Asp Asn1 5 1013610PRTARTIFICIAL SEQUENCECDR-H3 VARIANT
1 136Asp Gly Arg Tyr Pro Tyr Ala Met Asp Asn1 5
1013710PRTARTIFICIAL SEQUENCECDR-H3 VARIANT 2 137Asp Gly Tyr Tyr
Pro Tyr Ala Met Lys Asn1 5 1013810PRTARTIFICIAL SEQUENCECDR-H3
VARIANT 3 138Asp Gly Arg Tyr Pro Tyr Ala Met Lys Asn1 5
1013910PRTARTIFICIAL SEQUENCECDR-H3 VARIANT 4 139Asp Gly Tyr Tyr
Pro Tyr Ala Met Ser Asn1 5 1014010PRTARTIFICIAL SEQUENCECDR-H3
VARIANT 5 140Asp Gly Tyr Tyr Pro Tyr Ala Met Ala Asn1 5
1014110PRTARTIFICIAL SEQUENCECDR-H3 VARIANT 6 141Asp Gly Tyr Tyr
Pro Tyr Ala Leu Asp Asn1 5 10142112PRTARTIFICIAL SEQUENCEVARIABLE
LIGHT CHAIN OF CL-89 142Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu
Ser Val Ser Leu Gly1 5 10 15Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser
Lys Ser Val Asp Ser Tyr 20 25 30Gly Asn Ser Phe Met His Trp Tyr Gln
Gln Lys Pro Gly Gln Pro Pro 35 40 45Lys Leu Leu Ile Tyr Leu Ala Ser
Asn Leu Glu Ser Gly Val Pro Asp 50 55 60Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Phe Thr Leu Thr Ile Ser65 70 75 80Ser Leu Gln Ala Glu
Asp Val Ala Val Tyr Tyr Cys Gln Gln Asn Asn 85 90 95Glu Asp Pro Arg
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg 100 105
110143118PRTARTIFICIAL SEQUENCEVARIABLE HEAVY CHAIN CL-276G 143Gln
Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln1 5 10
15Thr Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser Ala Tyr
20 25 30Ser Val Asn Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp
Leu 35 40 45Ala Met Ile Trp Gly Asp Gly Lys Ile Val Tyr Asn Ser Ala
Leu Lys 50 55 60Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln
Val Val Leu65 70 75 80Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala
Thr Tyr Tyr Cys Ala 85 90 95Gly Asp Gly Tyr Tyr Pro Tyr Ala Met Asp
Asn Trp Gly Gln Gly Ser 100 105 110Leu Val Thr Val Ser Ser
115144112PRTARTIFICIAL SEQUENCEVARIABLE LIGHT CHAIN OF RL-36 144Asp
Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ser Val Ser Leu Gly1 5 10
15Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser Lys Ser Val Asp Ser Tyr
20 25 30Gly Asn Ser Phe Met His Trp Tyr Gln Gln Lys Pro Gly Gln Pro
Pro 35 40 45Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val
Pro Asp 50 55 60Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile Ser65 70 75 80Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr
Cys Gln Gln Asn Asn 85 90 95Glu Asp Pro Arg Thr Phe Gly Gly Gly Thr
Lys Val Glu Ile Lys Arg 100 105 110145118PRTARTIFICIAL
SEQUENCEVARIABLE HEAVY CHAIN RL-36 145Gln Val Thr Leu Arg Glu Ser
Gly Pro Ala Leu Val Lys Pro Thr Gln1 5 10 15Thr Leu Thr Leu Thr Cys
Thr Gly Ser Gly Phe Ser Leu Ser Ala Tyr 20 25 30Ser Val Asn Trp Ile
Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu 35 40 45Ala Met Ile Trp
Gly Asp Gly Lys Ile Val Tyr Asn Ser Ala Leu Lys 50 55 60Ser Arg Leu
Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val Val Leu65 70 75 80Thr
Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys Ala 85 90
95Val Asp Gly Tyr Tyr Pro Tyr Ala Met Asp Asn Trp Gly Gln Gly Ser
100 105 110Leu Val Thr Val Ser Ser 115146118PRTARTIFICIAL
SEQUENCEVARIABLE HEAVY CHAIN RL-19 146Gln Val Thr Leu Arg Glu Ser
Gly Pro Ala Leu Val Lys Pro Thr Gln1 5 10 15Thr Leu Thr Leu Thr Cys
Thr Ser Ser Gly Phe Ser Leu Ser Ala Tyr 20 25 30Ser Val Asn Trp Ile
Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu 35 40 45Ala Met Ile Trp
Gly Asp Gly Lys Ile Val Tyr Asn Ser Ala Leu Lys 50 55 60Ser Arg Leu
Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val Val Leu65 70 75 80Thr
Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys Ala 85 90
95Leu Asp Gly Tyr Tyr Pro Tyr Ala Met Asp Asn Trp Gly Gln Gly Ser
100 105 110Leu Val Thr Val Ser Ser 115147118PRTARTIFICIAL
SEQUENCEVARIABLE HEAVY CHAIN RL-11 147Gln Val Thr Leu Arg Glu Ser
Gly Pro Ala Leu Val Lys Pro Thr Gln1 5 10 15Thr Leu Thr Leu Thr Cys
Thr Thr Ser Gly Phe Ser Leu Ser Ala Tyr 20 25 30Ser Val Asn Trp Ile
Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu 35 40 45Ala Met Ile Trp
Gly Asp Gly Lys Ile Val Tyr Asn Ser Ala Leu Lys 50 55 60Ser Arg Leu
Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val Val Leu65 70 75 80Thr
Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys Ala 85 90
95Val Asp Gly Tyr Tyr Pro Tyr Ala Met Asp Asn Trp Gly Gln Gly Ser
100 105 110Leu Val Thr Val Ser Ser 115148118PRTARTIFICIAL
SEQUENCEVARIABLE HEAVY CHAIN RL-8 148Gln Val Thr Leu Arg Glu Ser
Gly Pro Ala Leu Val Lys Pro Thr Gln1 5 10 15Thr Leu Thr Leu Thr Cys
Thr Leu Ser Gly Phe Ser Leu Ser Ala Tyr 20 25 30Ser Val Asn Trp Ile
Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu 35 40 45Ala Met Ile Trp
Gly Asp Gly Lys Ile Val Tyr Asn Ser Ala Leu Lys 50 55 60Ser Arg Leu
Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val Val Leu65 70 75 80Thr
Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys Ala 85 90
95Ser Asp Gly Tyr Tyr Pro Tyr Ala Met Asp Asn Trp Gly Gln Gly Ser
100 105 110Leu Val Thr Val Ser Ser 115149118PRTARTIFICIAL
SEQUENCEVARIABLE HEAVY CHAIN RL-45 149Gln Val Thr Leu Arg Glu Ser
Gly Pro Ala Leu Val Lys Pro Thr Gln1 5 10 15Thr Leu Thr Leu Thr Cys
Thr Thr Ser Gly Phe Ser Leu Ser Ala Tyr 20 25 30Ser Val Asn Trp Ile
Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu 35 40 45Ala Met Ile Trp
Gly Asp Gly Lys Ile Val Tyr Asn Ser Ala Leu Lys 50 55 60Ser Arg Leu
Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val Val Leu65 70 75 80Thr
Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys Ala 85 90
95Thr Asp Gly Tyr Tyr Pro Tyr Ala Met Asp Asn Trp Gly Gln Gly Ser
100 105 110Leu Val Thr Val Ser Ser 115150112PRTARTIFICIAL
SEQUENCEVARIABLE LIGHT CHAIN RL-36-L1,59 150Asp Ile Val Met Thr Gln
Ser Pro Asp Ser Leu Ser Val Ser Leu Gly1 5 10 15Glu Arg Ala Thr Ile
Asn Cys Arg Ala Ser Lys Ser Val Asp Ser Tyr 20 25 30Gly Gln Ser Phe
Met His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40 45Lys Leu Leu
Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro Asp 50 55 60Arg Phe
Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser65 70 75
80Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Asn Asn
85 90 95Glu Asp Pro Arg Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
Arg 100 105 110151118PRTARTIFICIAL SEQUENCEVARIABLE HEAVY CHAIN
RL36-L1,59 151Gln Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys
Pro Thr Gln1 5 10 15Thr Leu Thr Leu Thr Cys Thr Gly Ser Gly Phe Ser
Leu Ser Ala Tyr 20 25 30Ser Val Asn Trp Ile Arg Gln Pro Pro Gly Lys
Ala Leu Glu Trp Leu 35 40 45Ala Met Ile Trp Gly Asp Gly Lys Ile Val
Tyr Asn Ser Ala Leu Lys 50 55 60Ser Arg Leu Thr Ile Ser Lys Asp Thr
Ser Lys Asn Gln Val Val Leu65 70 75 80Thr Met Thr Asn Met Asp Pro
Val Asp Thr Ala Thr Tyr Tyr Cys Ala 85 90 95Val Asp Gly Tyr Tyr Pro
Tyr Ala Met Asp Asn Trp Gly Gln Gly Ser 100 105 110Leu Val Thr Val
Ser Ser 115152248PRTARTIFICIAL SEQUENCESINGLE CHAIN FV 152Gln Val
Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln1 5 10 15Thr
Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser Ala Tyr 20 25
30Ser Val Asn Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu
35 40 45Ala Met Ile Trp Gly Asp Gly Lys Ile Val Tyr Asn Ser Ala Leu
Lys 50 55 60Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val
Val Leu65 70 75 80Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr
Tyr Tyr Cys Ala 85 90 95Gly Asp Gly Tyr Tyr Pro Tyr Ala Met Asp Asn
Trp Gly Gln Gly Ser 100 105 110Leu Val Thr Val Ser Ser Gly Gly Ser
Ser Arg Ser Ser Ser Ser Gly 115 120 125Gly Gly Gly Ser Gly Gly Gly
Gly Asp Ile Val Met Thr Gln Ser Pro 130 135 140Asp Ser Leu Ser Val
Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Arg145 150 155 160Ala Ser
Lys Ser Val Asp Ser Tyr Gly Asn Ser Phe Met His Trp Tyr 165 170
175Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Leu Ala Ser
180 185 190Asn Leu Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly
Ser Gly 195 200 205Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala
Glu Asp Val Ala 210 215 220Val Tyr Tyr Cys Gln Gln Asn Asn Glu Asp
Pro Arg Thr Phe Gly Gly225 230 235 240Gly Thr Lys Val Glu Ile Lys
Arg 24515323PRTArtificial SequenceFRL1 VARIANT N 153Asp Ile Val Leu
Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly1 5 10 15Glu Arg Ala
Thr Ile Asn Cys 2015423PRTArtificial SequenceFRL1 VARIANT HT2-DP27
#118 154Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu
Gly1 5 10 15Glu Arg Ala Thr Ile Asn Cys 2015532PRTArtificial
SequenceFRL3 VARIANT HT2-dp27 #40 155Gly Val Pro Asp Arg Phe Ser
Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu Thr Ile Asp Ser Val
Glu Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25 3015632PRTArtificial
SequenceFRL3 VARIANT HT2-dp27 #26 156Gly Val Pro Asp Arg Phe Ser
Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu Thr Ile Asp Pro Val
Glu Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25 3015732PRTArtificial
SequenceFRL3 VARIANT HT2-dp27 #164 157Gly Val Pro Asp Arg Phe Ser
Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu Thr Ile Ser Pro Leu
Glu Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25 3015832PRTArtificial
SequenceFRL3 VARIANT HT2-dp27 #304 158Gly Val Pro Asp Arg Phe Ser
Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu Thr Ile Asp Ser Val
Glu Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25 3015932PRTArtificial
SequenceFRL3 VARIANT HT2-dp27 #274 159Gly Val Pro Asp Arg Phe Ser
Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu Thr Ile Asp Pro Val
Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25 3016032PRTArtificial
SequenceFRL3 VARIANT HT2-dp27 #530 160Gly Val Pro Asp Arg Phe Ser
Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu Thr Ile Ser Ser Leu
Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25 3016132PRTArtificial
SequenceFRL3 VARIANT HT2-dp27 #374 161Gly Val Pro Asp Arg Phe Ser
Gly Ser Gly Ser Arg Thr Asp Phe Thr1 5 10 15Leu Thr Ile Asp Ser Leu
Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25 3016232PRTArtificial
SequenceFRL3 VARIANT HT2-dp27 #610 162Gly Val Pro Asp Arg Phe Ser
Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5 10 15Leu Thr Ile Asp Ser Leu
Glu Ala Glu Asp Val Ala Val Tyr Tyr Cys 20 25 3016314PRTArtificial
SequenceFRH2 Variant HT2-NEW #14 163Trp Val Arg Gln Pro Pro Gly Lys
Gly Leu Glu Trp Ile Gly1 5 1016414PRTArtificial SequenceFRH2
Variant HT2-NEW #67 164Trp Val Arg Gln Pro Pro Gly Arg Gly Leu Glu
Trp Leu Gly1 5 1016532PRTArtificial SequenceFRH3 Variant HT2-NEW
#17 165Arg Leu Asn Met Ser Lys Asp Thr Ser Lys Asn Gln Phe Ser Leu
Arg1 5 10 15Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys
Ala Gly 20 25 3016632PRTArtificial SequenceFRH3 Variant HT2-NEW #65
166Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Phe Ser Leu Arg1
5 10 15Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Arg Tyr Tyr Cys Ala
Gly 20 25 3016732PRTArtificial SequenceFRH3 Variant HT2-NEW #67
167Arg Val Asn Met Ser Lys Asp Thr Ser Lys Asn Gln Phe Ser Leu Arg1
5 10 15Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Arg Tyr Tyr Cys Ala
Gly 20 25 3016832PRTArtificial SequenceFRH3 Variant HT2-NEW #73
168Arg Val Thr Met Leu Lys Asp Thr Ser Lys Asn Gln Phe Ser Leu Arg1
5 10 15Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala
Gly 20 25 3016932PRTArtificial SequenceFRH3 Variant HT2-NEW #74
169Arg Val Thr Ile Leu Lys Asp Thr Ser Lys Asn Gln Phe Ser Leu Arg1
5 10 15Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Arg Tyr Tyr Cys Ala
Gly 20 25 3017032PRTArtificial SequenceFRH3 Variant HT2-NEW #78
170Arg Val Asn Ile Leu Lys Asp Thr Ser Lys Asn Gln Phe Ser Leu Arg1
5 10 15Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala
Gly 20 25
3017132PRTArtificial SequenceFRH3 Variant HT2-NEW #275 171Arg Val
Asn Ile Leu Lys Asp Thr Ser Lys Asn Gln Phe Phe Leu Arg1 5 10 15Leu
Ser Ser Val Thr Ala Ala Asp Thr Ala Arg Tyr Tyr Cys Ala Gly 20 25
3017232PRTArtificial SequenceFRH3 Variant HT2-NEW #284 172Arg Leu
Ile Ile Ser Lys Asp Thr Ser Lys Asn Gln Phe Ser Leu Arg1 5 10 15Leu
Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Gly 20 25
3017332PRTArtificial SequenceFRH3 Variant HT2-NEW #291 173Arg Leu
Thr Ile Leu Lys Asp Thr Ser Lys Asn Gln Phe Phe Leu Arg1 5 10 15Leu
Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Gly 20 25
3017432PRTArtificial SequenceFRH3 Variant HT2-NEW #300 174Arg Val
Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Phe Ser Leu Arg1 5 10 15Leu
Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Gly 20 25
3017532PRTArtificial SequenceFRH3 Variant HT2-NEW #302 175Arg Val
Asn Met Ser Lys Asp Thr Ser Lys Asn Gln Phe Ser Leu Arg1 5 10 15Leu
Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Gly 20 25
3017632PRTArtificial SequenceFRH3 Variant HT2-NEW #322 176Arg Val
Asn Ile Ser Lys Asp Thr Ser Lys Asn Gln Phe Phe Leu Arg1 5 10 15Leu
Ser Ser Val Thr Ala Ala Asp Thr Ala Arg Tyr Tyr Cys Ala Gly 20 25
3017732PRTArtificial SequenceFRH3 Variant HT2-NEW #111 177Arg Leu
Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Phe Phe Leu Arg1 5 10 15Leu
Ser Ser Val Thr Ala Ala Asp Thr Ala Arg Tyr Tyr Cys Ala Gly 20 25
3017832PRTArtificial SequenceFRH3 Variant HT2-NEW #162 178Arg Leu
Thr Met Ser Lys Asp Thr Ser Lys Asn Gln Phe Ser Leu Arg1 5 10 15Leu
Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Gly 20 25
3017932PRTArtificial SequenceFRH3 Variant HT2-NEW #139 179Arg Val
Thr Met Ser Lys Asp Thr Ser Lys Asn Gln Phe Phe Leu Arg1 5 10 15Leu
Ser Ser Val Thr Ala Ala Asp Thr Ala Arg Tyr Tyr Cys Ala Gly 20 25
3018032PRTArtificial SequenceFRH3 Variant HT2-NEW #177 180Arg Val
Thr Met Ser Lys Asp Thr Ser Lys Asn Gln Phe Ser Leu Arg1 5 10 15Leu
Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Gly 20 25
3018111PRTArtificial SequenceFRH4 variant HT2-dp27 #19 181Trp Gly
His Gly Ser Leu Val Thr Val Ser Ser1 5 1018232PRTArtificial
SequenceFRH3 variant HT2-dp27 #19 182Arg Leu Asn Ile Ser Lys Asp
Ser Ser Lys Asn Gln Val Val Leu Thr1 5 10 15Met Thr Asn Met Asp Pro
Val Asp Thr Ala Arg Tyr Tyr Cys Ala Gly 20 25 3018332PRTArtificial
SequenceFRH3 variant HT2-dp27 #43 183Arg Leu Asn Ile Ser Lys Asp
Thr Ser Lys Asn Gln Val Val Leu Thr1 5 10 15Met Thr Asn Met Asp Pro
Val Asp Thr Ala Arg Tyr Tyr Cys Ala Gly 20 25 3018432PRTArtificial
SequenceFRH3 variant HT2-dp27 #118 184Arg Leu Thr Ile Ser Lys Asp
Ile Ser Lys Asn Gln Val Val Leu Thr1 5 10 15Met Thr Asn Met Asp Pro
Val Asp Thr Ala Arg Tyr Tyr Cys Ala Gly 20 25 301855PRTArtificial
SequenceCDR-H1 Cl-65 Variant 185Ala Ser Ser Val Asn1
5186131PRTArtificial SequenceMajority sequence of aligned IL-13 of
various species 186Met Ala Leu Trp Leu Thr Ala Val Ile Ala Leu Ala
Cys Leu Gly Gly1 5 10 15Leu Ala Ser Pro Gly Pro Val Pro Pro Ser Thr
Ala Leu Lys Glu Leu 20 25 30Ile Glu Glu Leu Val Asn Ile Thr Gln Asn
Gln Lys Ala Pro Leu Cys 35 40 45Asn Gly Ser Met Val Trp Ser Val Asn
Leu Thr Ala Gly Gly Tyr Cys 50 55 60Ala Ala Leu Glu Ser Leu Ile Asn
Ile Ser Gly Cys Ser Ala Ile Gln65 70 75 80Arg Thr Gln Arg Met Leu
Asn Gly Leu Cys Pro His Lys Ala Ser Ala 85 90 95Gly Gln Ser Ser Ser
Arg Val Arg Asp Thr Lys Ile Glu Val Ala Gln 100 105 110Phe Val Lys
Asp Leu Leu Asn Tyr Ser Lys Gln Leu Phe Arg Asn Gly 115 120 125Arg
Phe Asn 130187132PRTHomo sapiensHuman interleukin-13 sequence
187Met Ala Leu Leu Leu Thr Thr Val Ile Ala Leu Thr Cys Leu Gly Gly1
5 10 15Phe Ala Ser Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu
Leu 20 25 30Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro
Leu Cys 35 40 45Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly
Met Tyr Cys 50 55 60Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys
Ser Ala Ile Glu65 70 75 80Lys Thr Gln Arg Met Leu Ser Gly Phe Cys
Pro His Lys Val Ser Ala 85 90 95Gly Gln Phe Ser Ser Leu His Val Arg
Asp Thr Lys Ile Glu Val Ala 100 105 110Gln Phe Val Lys Asp Leu Leu
Leu His Leu Lys Lys Leu Phe Arg Glu 115 120 125Gly Arg Phe Asn
130188132PRTMacaqueMonkey interleukin-13 sequence 188Met Ala Leu
Leu Leu Thr Met Val Ile Ala Leu Thr Cys Leu Gly Gly1 5 10 15Phe Ala
Ser Pro Ser Pro Val Pro Pro Ser Thr Ala Leu Lys Glu Leu 20 25 30Ile
Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys 35 40
45Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Val Tyr Cys
50 55 60Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile
Glu65 70 75 80Lys Thr Gln Arg Met Leu Asn Gly Phe Cys Pro His Lys
Val Ser Ala 85 90 95Gly Gln Phe Ser Ser Leu Arg Val Arg Asp Thr Lys
Ile Glu Val Ala 100 105 110Gln Phe Val Lys Asp Leu Leu Val His Leu
Lys Lys Leu Phe Arg Asn 115 120 125Gly Arg Phe Asn
130189132PRTBovineCow interleukin-13 sequence 189Met Ala Leu Leu
Leu Thr Ala Val Ile Val Leu Ile Cys Phe Gly Gly1 5 10 15Leu Thr Ser
Pro Ser Pro Val Pro Ser Ala Thr Ala Leu Lys Glu Leu 20 25 30Ile Glu
Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Val Pro Leu Cys 35 40 45Asn
Gly Ser Met Val Trp Ser Leu Asn Leu Thr Ser Ser Met Tyr Cys 50 55
60Ala Ala Leu Asp Ser Leu Ile Ser Ile Ser Asn Cys Ser Val Ile Gln65
70 75 80Arg Thr Lys Lys Met Leu Asn Ala Leu Cys Pro His Lys Pro Ser
Ala 85 90 95Lys Gln Val Ser Ser Glu Tyr Val Arg Asp Thr Lys Ile Glu
Val Ala 100 105 110Gln Phe Leu Lys Asp Leu Leu Arg His Ser Arg Ile
Val Phe Arg Asn 115 120 125Glu Arg Phe Asn 130190131PRTCanis C.
lupusDog interleukin-13 sequence 190Met Ala Leu Trp Leu Thr Val Val
Ile Ala Leu Thr Cys Leu Gly Gly1 5 10 15Leu Ala Ser Pro Ser Pro Val
Thr Pro Ser Pro Thr Leu Lys Glu Leu 20 25 30Ile Glu Glu Leu Val Asn
Ile Thr Gln Asn Gln Ala Ser Leu Cys Asn 35 40 45Gly Ser Met Val Trp
Ser Val Asn Leu Thr Ala Gly Met Tyr Cys Ala 50 55 60Ala Leu Glu Ser
Leu Ile Asn Val Ser Asp Cys Ser Ala Ile Gln Arg65 70 75 80Thr Gln
Arg Met Leu Lys Ala Leu Cys Ser Gln Lys Pro Ala Ala Gly 85 90 95Gln
Ile Ser Ser Glu Arg Ser Arg Asp Thr Lys Ile Glu Val Ile Gln 100 105
110Leu Val Lys Asn Leu Leu Thr Tyr Val Arg Gly Val Tyr Arg His Gly
115 120 125Asn Phe Arg 130191131PRTRatRat interleukin-13 sequence
191Met Ala Leu Trp Val Thr Ala Val Leu Ala Leu Ala Cys Leu Gly Gly1
5 10 15Leu Ala Thr Pro Gly Pro Val Arg Arg Ser Thr Ser Pro Pro Val
Ala 20 25 30Leu Arg Glu Leu Ile Glu Glu Leu Ser Asn Ile Thr Gln Asp
Gln Lys 35 40 45Thr Ser Leu Cys Asn Ser Ser Met Val Trp Ser Val Asp
Leu Thr Ala 50 55 60Gly Gly Phe Cys Ala Ala Leu Glu Ser Leu Thr Asn
Ile Ser Ser Cys65 70 75 80Asn Ala Ile His Arg Thr Gln Arg Ile Leu
Asn Gly Leu Cys Asn Gln 85 90 95Lys Ala Ser Asp Val Ala Ser Ser Pro
Pro Asp Thr Lys Ile Glu Val 100 105 110Ala Gln Phe Ile Ser Lys Leu
Leu Asn Tyr Ser Lys Gln Leu Phe Arg 115 120 125Tyr Gly His
130192131PRTMus MusculusMouse interleukin-13 sequence 192Met Ala
Leu Trp Val Thr Ala Val Leu Ala Leu Ala Cys Leu Gly Gly1 5 10 15Leu
Ala Ala Pro Gly Pro Val Pro Arg Ser Val Ser Leu Pro Leu Thr 20 25
30Leu Lys Glu Leu Ile Glu Glu Leu Ser Asn Ile Thr Gln Asp Gln Thr
35 40 45Pro Leu Cys Asn Gly Ser Met Val Trp Ser Val Asp Leu Ala Ala
Gly 50 55 60Gly Phe Cys Val Ala Leu Asp Ser Leu Thr Asn Ile Ser Asn
Cys Asn65 70 75 80Ala Ile Tyr Arg Thr Gln Arg Ile Leu His Gly Leu
Cys Asn Arg Lys 85 90 95Ala Pro Thr Thr Val Ser Ser Leu Pro Asp Thr
Lys Ile Glu Val Ala 100 105 110His Phe Ile Thr Lys Leu Leu Ser Tyr
Thr Lys Gln Leu Phe Arg His 115 120 125Gly Pro Phe
130193125PRTMeriones (rodent)Gerbil interleukin-13 sequence 193Met
Ala Leu Trp Leu Thr Ala Val Leu Ala Leu Ala Cys Leu Ser Gly1 5 10
15Leu Ala Val Pro Gly Pro Val Gly Arg Ser Val Ser Pro Pro Val Ala
20 25 30Leu Lys Glu Leu Ile Glu Glu Leu Ser Asn Ile Thr Gln Asp Gln
Arg 35 40 45Thr Pro Leu Cys Asn Gly Ser Met Val Trp Ser Val Asp Leu
Ala Ala 50 55 60Gly Gly Phe Cys Ala Ala Leu Asp Ser Leu Thr Asn Ile
Ser Ser Cys65 70 75 80Asn Thr Ile Gln Lys Thr Gln Arg Ile Leu Asn
Gly Leu Cys Ala Arg 85 90 95Lys Ala Pro Ala Val Val Ser Arg Val Pro
Asp Thr Lys Ile Glu Ala 100 105 110Ala Gln Phe Ile Lys Asn Leu Leu
Asn Tyr Ser Lys Gln 115 120 12519415PRTARTIFICIAL SEQUENCECDR-L2
VARIANT 5 194Lys Ala Ser Lys Ser Val Asp Ser Tyr Gly Asn Ser Phe
Met His1 5 10 1519515PRTARTIFICIAL SEQUENCECDR-L2 VARIANT 6 195Asn
Ala Ser Lys Ser Val Asp Ser Tyr Gly Asn Ser Phe Met His1 5 10
15
* * * * *