U.S. patent application number 16/790860 was filed with the patent office on 2020-09-10 for methods and compositions for cell-proliferation-related disorders.
The applicant listed for this patent is Agios Pharmaceuticals, Inc.. Invention is credited to Lenny Dang, Valeria Fantin, Stefan Gross, Hyun Gyung Jang, Shengfang Jin, Francesco G. Salituro, Jeffrey O. Saunders, Shin-San Michael Su, Katharine Yen.
Application Number | 20200281501 16/790860 |
Document ID | / |
Family ID | 1000004842900 |
Filed Date | 2020-09-10 |
View All Diagrams
United States Patent
Application |
20200281501 |
Kind Code |
A1 |
Dang; Lenny ; et
al. |
September 10, 2020 |
METHODS AND COMPOSITIONS FOR CELL-PROLIFERATION-RELATED
DISORDERS
Abstract
Methods of treating and evaluating subjects having neoactive
mutants are described herein.
Inventors: |
Dang; Lenny; (Boston,
MA) ; Fantin; Valeria; (Burlingame, CA) ;
Gross; Stefan; (Brookline, MA) ; Jang; Hyun
Gyung; (Waltham, MA) ; Jin; Shengfang;
(Newton, MA) ; Salituro; Francesco G.;
(Marlborough, MA) ; Saunders; Jeffrey O.;
(Lincoln, MA) ; Su; Shin-San Michael; (Boston,
MA) ; Yen; Katharine; (Wellesley, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Agios Pharmaceuticals, Inc. |
Cambridge |
MA |
US |
|
|
Family ID: |
1000004842900 |
Appl. No.: |
16/790860 |
Filed: |
February 14, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15589615 |
May 8, 2017 |
10610125 |
|
|
16790860 |
|
|
|
|
13939519 |
Jul 11, 2013 |
|
|
|
15589615 |
|
|
|
|
13256396 |
Nov 29, 2011 |
|
|
|
PCT/US2010/027253 |
Mar 12, 2010 |
|
|
|
13939519 |
|
|
|
|
61266929 |
Dec 4, 2009 |
|
|
|
61253820 |
Oct 21, 2009 |
|
|
|
61229689 |
Jul 29, 2009 |
|
|
|
61227649 |
Jul 22, 2009 |
|
|
|
61220543 |
Jun 25, 2009 |
|
|
|
61180609 |
May 22, 2009 |
|
|
|
61173518 |
Apr 28, 2009 |
|
|
|
61160664 |
Mar 16, 2009 |
|
|
|
61160253 |
Mar 13, 2009 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Y 101/01042 20130101;
A61K 31/426 20130101; G16H 40/63 20180101; A61B 5/055 20130101;
C12N 15/1137 20130101; G01N 33/574 20130101; A61K 45/06 20130101;
A61K 31/41 20130101; C12Q 1/6886 20130101; C12N 2310/14 20130101;
Y02A 90/10 20180101; C12Q 1/32 20130101 |
International
Class: |
A61B 5/055 20060101
A61B005/055; A61K 31/41 20060101 A61K031/41; A61K 31/426 20060101
A61K031/426; A61K 45/06 20060101 A61K045/06; C12N 15/113 20060101
C12N015/113; G01N 33/574 20060101 G01N033/574; G16H 40/63 20060101
G16H040/63; C12Q 1/32 20060101 C12Q001/32; C12Q 1/6886 20060101
C12Q001/6886 |
Claims
1. A method of treating a subject having an astrocytic tumor, an
oligodendroglial tumor, an oligoastrocytic tumor or an anaplastic
astrocytoma characterized by the presence of a mutant isocitrate
dehydrogenase 1 (IDH1), the method comprising administering to the
subject a therapeutically effective amount of a small molecule
inhibitor of said mutant IDH1 that inhibits the conversion of
alpha-ketoglutarate to 2-hydroxyglutarate (2-HG), wherein the IDH1
mutant has a mutation selected from R132H, R132C, R132S, R132G,
R132L and R132V.
2-8. (canceled)
9. The method of claim 1, wherein the mutation is detected in a
sample obtained from the subject.
10. The method of claim 9, wherein the sample comprises tissue or
bodily fluid.
11. (canceled)
12. The method of claim 9, wherein the mutation is detected by
polymerase chain reaction (PCR).
13-18. (canceled)
19. A method of treating a subject having acute myelogenous
leukemia (AML) characterized by the presence of a mutant isocitrate
dehydrogenase 1 (IDH1), the method comprising administering to the
subject a therapeutically effective amount of a small molecule
inhibitor of said mutant IDH1, wherein the IDH1 mutant has a
mutation selected from R132H, R132C, R132S, R132G, R132L, and
R132V.
Description
CLAIM OF PRIORITY
[0001] This application is a continuation of U.S. Ser. No.
15/589,615, filed May 8, 2017, which is a continuation of U.S. Ser.
No. 13/939,519, filed Jul. 11, 2013, which is a continuation of
U.S. Ser. No. 13/256,396, filed Nov. 29, 2011, which is a national
stage application under 35 U.S.C. .sctn. 371 of International
Application No. PCT/US2010/027253, filed Mar. 12, 2010, published
as International Publication No. WO 2010/105243 on Sep. 16, 2010,
which claims priority to U.S. Ser. No. 61/160,253, filed Mar. 13,
2009; U.S. Ser. No. 61/160,664, filed Mar. 16, 2009; U.S. Ser. No.
61/173,518, filed Apr. 28, 2009; U.S. Ser. No. 61/180,609, filed
May 22, 2009; U.S. Ser. No. 61/220,543, filed Jun. 25, 2009; U.S.
Ser. No. 61/227,649, filed Jul. 22, 2009; U.S. Ser. No. 61/229,689,
filed Jul. 29, 2009; U.S. Ser. No. 61/253,820, filed Oct. 21, 2009;
and U.S. Ser. No. 61/266,929, filed Dec. 4, 2009, the contents of
each of which are incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The invention relates to methods and compositions for
evaluating and treating cell proliferation-related disorders, e.g.,
proliferative disorders such as cancer.
BACKGROUND
[0003] Isocitrate dehydrogenase, also known as IDH, is an enzyme
which participates in the citric acid cycle. It catalyzes the third
step of the cycle: the oxidative decarboxylation of isocitrate,
producing alpha-ketoglutarate (.alpha.-ketoglutarate or .alpha.-KG)
and CO.sub.2 while converting NAD+ to NADH. This is a two-step
process, which involves oxidation of isocitrate (a secondary
alcohol) to oxalosuccinate (a ketone), followed by the
decarboxylation of the carboxyl group beta to the ketone, forming
alpha-ketoglutarate. Another isoform of the enzyme catalyzes the
same reaction; however this reaction is unrelated to the citric
acid cycle, is carried out in the cytosol as well as the
mitochondrion and peroxisome, and uses NADP+ as a cofactor instead
of NAD+.
SUMMARY OF THE INVENTION
[0004] Methods and compositions disclosed herein relate to the role
played in disease by neoactive products produced by neoactive
mutant enzymes, e.g., mutant metabolic pathway enzymes. The
inventors have discovered, inter alia, a neoactivity associated
with IDH mutants and that the product of the neoactivity can be
significantly elevated in cancer cells. Disclosed herein are
methods and compositions for treating, and methods of evaluating,
subjects having or at risk for a disorder, e.g., a cell
proliferation-related disorder characterized by a neoactivity in a
metabolic pathway enzyme, e.g., IDH neoactivity. Such disorders
include e.g., proliferative disorders such as cancer. The inventors
have discovered and disclosed herein novel therapeutic agents for
the treatment of disorders, e.g., cancers, characterized by, e.g.,
by a neoactivity, neoactive protein, neoactive mRNA, or neoactive
mutations. In embodiments a therapeutic agent reduces levels of
neoactivity or neoactive product or ameliorates an effect of a
neoactive product. Methods described herein also allow the
identification of a subject, or identification of a treatment for
the subject, on the basis of neaoctivity genotype or phenotype.
This evaluation can allow for optimal matching of subject with
treatment, e.g., where the selection of subject, treatment, or
both, is based on an analysis of neoactivity genotype or phenotype.
E.g., methods describe herein can allow selection of a treatment
regimen comprising administration of a novel compound, e.g., a
novel compound disclosed herein, or a known compound, e.g., a known
compound not previously recommended for a selected disorder. In
embodiments the known compound reduces levels of neoactivity or
neoactive product or ameliorates an effect of a neoactive product.
Methods described herein can guide and provide a basis for
selection and administration of a novel compound or a known
compound, or combination of compounds, not previously recommended
for subjects having a disorder characterized by a somatic neoactive
mutation in a metabolic pathway enzyme. In embodiments the
neoactive genotype or phenotype can act as a biomarker the presence
of which indicates that a compound, either novel, or previously
known, should be administered, to treat a disorder characterized by
a somatic neoactive mutation in a metabolic pathway enzyme.
Neoactive mutants of IDH1 having a neoactivity that results in the
production of 2-hydroxyglutarate, e.g., R-2-hydroxyglutarate and
associated disorders are discussed in detail herein. They are
exemplary, but not limiting, examples of embodiments of the
invention.
[0005] While not wishing to be bound by theory it is believed that
the balance between the production and elimination of neoactive
product, e.g., 2HG, e.g., R-2HG, is important in disease. Neoactive
mutants, to varying degrees for varying mutations, increase the
level of neoactive product, while other processes, e.g., in the
case of 2HG, e.g., R-2HG, enzymatic degradation of 2HG, e.g., by
2HG dehydrogenase, reduce the level of neoative product. An
incorrect balance is associated with disease. In embodiments, the
net result of a neoactive mutation at IDH1 or IDH2 result in
increased levels, in affected cells, of neoactive product, 2HG,
e.g., R-2HG,
[0006] Accordingly, in one aspect, the invention features, a method
of treating a subject having a cell proliferation-related disorder,
e.g., a disorder characterized by unwanted cell proliferation,
e.g., cancer, or a precancerous disorder. The cell
proliferation-related disorder is characterized by a somatic
mutation in a metabolic pathway enzyme. The mutation is associated
with a neoactivity that results in the production of a neoactivity
product. The method comprises: administering to the subject a
therapeutically effective amount of a therapeutic agent described
herein, e.g., a therapeutic agent that decreases the level of
neoactivity product encoded by a selected or mutant somatic allele,
e.g., an inhibitor of a neoactivity of the metabolic pathway enzyme
(the neoactive enzyme), a therapeutic agent that ameliorates an
unwanted affect of the neoactivity product, or a nucleic acid based
inhibitor, e.g., a dRNA which targets the neoactive enzyme mRNA, to
thereby treat the subject.
[0007] In an embodiment the subject is a subject not having, or not
diagnosed as having, 2-hydroxyglutaric aciduria.
[0008] In an embodiment the subject has a cell
proliferation-related disorder, e.g., a cancer, characterized by
the neoactivity of the metabolic pathway enzyme encoded by selected
or mutant allele.
[0009] In an embodiment the subject has a cell
proliferation-related disorder, e.g., a cancer, characterized by
the product formed by the neoactivity of the metabolic pathway
enzyme encoded by selected or mutant allele.
[0010] In one embodiment, the metabolic pathway is selected from a
metabolic pathway leading to fatty acid biosynthesis, glycolysis,
glutaminolysis, the pentose phosphate shunt, nucleotide
biosynthetic pathways, or the fatty acid biosynthetic pathway.
[0011] In an embodiment the therapeutic agent is a therapeutic
agent described herein.
[0012] In an embodiment the method comprises selecting a subject on
the basis of having a cancer characterized by the selected or
mutant allele, the neoactivity, or an elevated level of neaoctivity
product.
[0013] In an embodiment the method comprises selecting a subject on
the basis of having a cancer characterized by the product formed by
the neoactivity of the protein encoded by selected or mutant
allele, e.g., by the imaging and/or spectroscopic analysis, e.g.,
magnetic resonance-based analysis, e.g., MRI (magnetic resonance
imaging) and/or MRS (magnetic resonance spectroscopy), to determine
the presence, distribution or level of the product of the
neoactivity, e.g., in the case of an IDH1 allele described herein,
2-hydroxyglutarate (sometimes referred to herein as 2HG), e.g.,
R-2-hydroxyglutarate (sometimes referred to herein as R-2HG).
[0014] In an embodiment the method comprises confirming or
determining, e.g., by direct examination or evaluation of the
subject, or sample e.g., tissue, product (e.g., feces, sweat,
semen, exhalation, hair or nails), or bodily fluid (e.g., blood
(e.g., blood plasma), urine, lymph, or cerebrospinal fluid or other
sample sourced disclosed herein) therefrom, (e.g., by DNA
sequencing, immuno analysis, or assay for enzymatic activity), or
receiving such information about the subject, that the cancer is
characterized by the selected or mutant allele.
[0015] In an embodiment the method comprises confirming or
determining, e.g., by direct examination or evaluation of the
subject, the level of neoactivity or the level of the product of
the neoactivity, or receiving such information about the subject.
In an embodiment the presence, distribution or level of the product
of the neoactivity, e.g., in the case of an IDH1 allele described
herein, 2HG, e.g., R-2HG, is determined non-invasively, e.g., by
imaging methods, e.g., by magnetic resonance-based methods.
[0016] In an embodiment the method comprises administering a second
anti-cancer agent or therapy to the subject, e.g., surgical removal
or administration of a chemotherapeutic.
[0017] In another aspect, the invention features, a method of
treating a subject having a cell proliferation-related disorder,
e.g., a precancerous disorder, or cancer. In an embodiment the
subject does not have, or has not been diagnosed as having,
2-hydroxyglutaric aciduria. The cell proliferation-related disorder
is characterized by a somatic allele, e.g., a preselected allele,
or mutant allele, of an IDH, e.g., IDH1 or IDH2, which encodes a
mutant IDH, e.g., IDH1 or IDH2, enzyme having a neoactivity.
[0018] In embodiments the neoactivity is alpha hydroxy neoactivity.
As used herein, alpha hydroxy neoactivity refers to the ability to
convert an alpha ketone to an alpha hydroxy. In embodiments alpha
hydroxy neoactivity proceeds with a reductive cofactor, e.g., NADPH
or NADH. In embodiments the alpha hydroxyl neoactivity is 2HG
neoactivity. 2HG neoactivity, as used herein, refers to the ability
to convert alpha ketoglutarate to 2-hydroxyglutarate (sometimes
referred to herein as 2HG), e.g., R-2-hydroxyglutarate (sometimes
referred to herein as R-2HG). In embodiments 2HG neoactivity
proceeds with a reductive cofactor, e.g., NADPH or NADH. In an
embodiment a neoactive enzyme, e.g., an alpha hydroxyl, e.g., a
2HG, neoactive enzyme, can act on more than one substrate, e.g.,
more than one alpha hydroxy substrate.
[0019] The method comprises administering to the subject an
effective amount of a therapeutic agent of type described herein to
thereby treat the subject.
[0020] In an embodiment the therapeutic agent: results in lowering
the level of a neoactivity product, e.g., an alpha hydroxy
neoactivity product, e.g., 2HG, e.g., R-2HG.
[0021] In an embodiment the method comprises administering a
therapeutic agent that lowers neoactivity, e.g., 2HG neoactivity.
In an embodiment the method comprises administering an inhibitor of
a mutant IDH protein, e.g., a mutant IDH1 or mutant IDH2 protein,
having a neoactivity, e.g., alpha hydroxy neoactivity, e.g., 2HG
neoactivity.
[0022] In an embodiment the therapeutic agent comprises a compound
from Table 24a or Table 24b or a compound having the structure of
Formula (X) or (Formula (XI) described herein.
[0023] In an embodiment the therapeutic agent comprises nucleic
acid-based therapeutic agent, e.g., a dsRNA, e.g., a dsRNA
described herein.
[0024] In an embodiment the therapeutic agent is an inhibitor,
e.g., a polypeptide, peptide, or small molecule (e.g., a molecule
of less than 1,000 daltons), or aptomer, that binds to an IDH1
mutant or wildtype subunit and inhibits neoactivity, e.g., by
inhibiting formation of a dimer, e.g., a homodimer of mutant IDH1
subunits or a heterodimer of a mutant and a wildype subunit. In an
embodiment the inhibitor is a polypeptide. In an embodiment the
polypeptide acts as a dominant negative with respect to the
neoactivity of the mutant enzyme. The polypeptide can correspond to
full length IDH1 or a fragment thereof. The polypeptide need not be
identical with the corresponding residues of wildtype IDH1, but in
embodiments has at least 60, 70, 80, 90 or 95% homology with
wildtype IDH1.
[0025] In an embodiment the therapeutic agent decreases the
affinity of an IDH, e.g., IDH1 or IDH2 neoactive mutant protein for
NADH, NADPH or a divalent metal ion, e.g., Mg.sup.2+ or Mn.sup.2+,
or decreases the levels or availability of NADH, NADPH or divalent
metal ion, e.g., Mg.sup.2+ or Mn.sup.2+, e.g., by competing for
binding to the mutant enzyme. In an embodiment the enzyme is
inhibited by replacing Mg.sup.2+ or Mn.sup.2+ with Ca.sup.2+.
[0026] In an embodiment the therapeutic agent is an inhibitor that
reduces the level a neoactivity of an IDH, e.g., IDH1 or IDH2,
e.g., 2HG neoactivity.
[0027] In an embodiment the therapeutic agent is an inhibitor that
reduces the level of the product of a mutant having a neoactivity
of an IDH, e.g., IDH1 or IDH2 mutant, e.g., it reduces the level of
2HG, e.g., R-2HG.
[0028] In an embodiment the therapeutic agent is an inhibitor
that:
[0029] inhibits, e.g., specifically, a neoactivity of an IDH, e.g.,
IDH1 or IDH2, e.g., a neoactivity described herein, e.g., 2HG
neoactivity; or
[0030] inhibits both the wildtype activity and a neoactivity of an
IDH, e.g., IDH1 or IDH2, e.g., a neoactivity described herein, e.g,
2HG neoactivity.
[0031] In an embodiment the therapeutic agent is an inhibitor that
is selected on the basis that it:
[0032] inhibits, e.g., specifically, a neoactivity of an IDH, e.g.,
IDH1 or IDH2, e.g., a neoactivity described herein e.g., 2HG
neoactivity; or
[0033] inhibits both the wildtype activity and a neoactivity of an
IDH1, e.g., IDH1 or IDH2, e.g., a neoactivity described herein,
e.g., 2HG neoactivity.
[0034] In an embodiment the therapeutic agent is an inhibitor that
reduces the amount of a mutant IDH, e.g., IDH1 or IDH2, protein or
mRNA.
[0035] In an embodiment the therapeutic agent is an inhibitor that
interacts directly with, e.g., it binds to, the mutant IDH, e.g.,
IDH1 or IDH2 mRNA.
[0036] In an embodiment the therapeutic agent is an inhibitor that
interacts directly with, e.g., it binds to, the mutant IDH, e.g.,
IDH1 or IDH2, protein.
[0037] In an embodiment the therapeutic agent is an inhibitor that
reduces the amount of neoactive enzyme activity, e.g., by
interacting with, e.g., binding to, mutant IDH, e.g., IDH1 or IDH2,
protein. In an embodiment the inhibitor is other than an
antibody.
[0038] In an embodiment the therapeutic agent is an inhibitor that
is a small molecule and interacts with, e.g., binds, the mutant
RNA, e.g., mutant IDH1 or IDH2 mRNA (e.g., mutant IDH1 mRNA).
[0039] In an embodiment the therapeutic agent is an inhibitor that
interacts directly with, e.g., binds, either the mutant IDH, e.g.,
IDH1 or IDH2, protein or interacts directly with, e.g., binds, the
mutant IDH mRNA, e.g., IDH1 or IDH2 mRNA.
[0040] In an embodiment the IDH is IDH1 and the neoactivity is
alpha hydroxy neoactivity, e.g., 2HG neoactivity. Mutations in IDH1
associated with 2HG neoactivity include mutations at residue 132,
e.g., R132H, R132C, R132S, R132G, R132L, or R132V (e.g., R132H or
R132C).
[0041] In an embodiment the IDH is IDH2 and the neoactivity of the
IDH2 mutant is alpha hydroxy neoactivity, e.g., 2HG neoactivity.
Mutations in IDH2 associated with 2HG neoactivity include mutations
at residue 172, e.g., R172K, R172M, R172S, R172G, or R172W.
[0042] Treatment methods described herein can comprise evaluating a
neoactivity genotype or phenotype. Methods of obtaining and
analyzing samples, and the in vivo analysis in subjects, described
elsewhere herein, e.g., in the section entitled, "Methods of
evaluating samples and/or subjects," can be combined with this
method.
[0043] In an embodiment, prior to or after treatment, the method
includes evaluating the growth, size, weight, invasiveness, stage
or other phenotype of the cell proliferation-related disorder.
[0044] In an embodiment, prior to or after treatment, the method
includes evaluating the IDH, e.g., IDH1 or IDH2, alpha hydroxyl
neoactivity genotype, e.g., 2HG, genotype, or alpha hydroxy
neoactivity phenotype, e.g., 2HG, e.g., R-2HG, phenotype.
Evaluating the alpha hydroxyl, e.g., 2HG, genotype can comprise
determining if an IDH1 or IDH2 mutation having alpha hydroxy
neoactivity, e.g., 2HG neoactivity, is present, e.g., a mutation
disclosed herein having alpha hydroxy neoactivity, e.g., 2HG
neoactivity. Alpha hydroxy neoactivity phenotype, e.g., 2HG, e.g.,
R-2HG, phenotype, as used herein, refers to the level of alpha
hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG, level of alpha
hydroxy neoactivity, e.g., 2HG neoactivity, or level of mutant
enzyme having alpha hydroxy neoactivity, e.g., 2HG neoactivity (or
corresponding mRNA). The evaluation can be by a method described
herein.
[0045] In an embodiment the subject can be evaluated, before or
after treatment, to determine if the cell proliferation-related
disorder is characterized by an alpha hydroxy neoactivity product,
e.g., 2HG, e.g., R-2HG.
[0046] In an embodiment a cancer, e.g., a glioma or brain tumor in
a subject, can be analyzed, e.g., by imaging and/or spectroscopic
analysis, e.g., magnetic resonance-based analysis, e.g., MRI and/or
MRS, e.g., before or after treatment, to determine if it is
characterized by presence of an alpha hydroxy neoactivity product,
e.g., 2HG, e.g., R-2HG.
[0047] In an embodiment the method comprises evaluating, e.g., by
direct examination or evaluation of the subject, or a sample from
the subject, or receiving such information about the subject, the
IDH, e.g., IDH1 or IDH2, genotype, or an alpha hydroxy neoactivity
product, e.g., 2HG, e.g., R-2HG phenotype of, the subject, e.g., of
a cell, e.g., a cancer cell, characterized by the cell
proliferation-related disorder. (As described in more detail
elsewhere herein the evaluation can be, e.g., by DNA sequencing,
immuno analysis, evaluation of the presence, distribution or level
of an alpha hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG,
e.g., from spectroscopic analysis, e.g., magnetic resonance-based
analysis, e.g., MRI and/or MRS measurement, sample analysis such as
serum or spinal cord fluid analysis, or by analysis of surgical
material, e.g., by mass-spectroscopy). In embodiments this
information is used to determine or confirm that a
proliferation-related disorder, e.g., a cancer, is characterized by
an alpha hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG. In
embodiments this information is used to determine or confirm that a
cell proliferation-related disorder, e.g., a cancer, is
characterized by an IDH, e.g., IDH1 or IDH2, allele described
herein, e.g., an IDH1 allele having a mutation, e.g., a His, Ser,
Cys, Gly, Val, Pro or Leu (e.g., His, Ser, Cys, Gly, Val, or Leu at
residue 132, more specifically, His or Cys, or an IDH2 allele
having a mutation at residue 172, e.g., a K, M, S, G, or W.
[0048] In an embodiment, before and/or after treatment has begun,
the subject is evaluated or monitored by a method described herein,
e.g., the analysis of the presence, distribution, or level of an
alpha hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG, e.g., to
select, diagnose or prognose the subject, to select an inhibitor,
or to evaluate response to the treatment or progression of
disease.
[0049] In an embodiment the cell proliferation-related disorder is
a tumor of the CNS, e.g., a glioma, a leukemia, e.g., AML or ALL,
e.g., B-ALL or T-ALL, prostate cancer, fibrosarcoma, paraganglioma,
or myelodysplasia or myelodysplastic syndrome (e.g., B-ALL or
T-ALL, prostate cancer, or myelodysplasia or myelodysplastic
syndrome) and the evaluation is: evaluation of the presence,
distribution, or level of an alpha hydroxy neoactivity product,
e.g., 2HG, e.g., R-2HG; or evaluation of the presence,
distribution, or level of a neoactivity, e.g., an alpha hydroxy
neoactivity, e.g., 2HG neoactivity, of an IDH1 or IDH2, mutant
protein.
[0050] In an embodiment the disorder is other than a solid tumor.
In an embodiment the disorder is a tumor that, at the time of
diagnosis or treatment, does not have a necrotic portion. In an
embodiment the disorder is a tumor in which at least 30, 40, 50,
60, 70, 80 or 90% of the tumor cells carry an IHD, e.g., IDH1 or
IDH2, mutation having 2HG neoactivity, at the time of diagnosis or
treatment.
[0051] In an embodiment the cell proliferation-related disorder is
a cancer, e.g., a cancer described herein, characterized by an IDH1
somatic mutant having alpha hydroxy neoactivity, e.g., 2HG
neoactivity, e.g., a mutant described herein. In an embodiment the
tumor is characterized by increased levels of an alpha hydroxy
neoactivity product, 2HG, e.g., R-2HG, as compared to non-diseased
cells of the same type.
[0052] In an embodiment the method comprises selecting a subject
having a glioma, on the basis of the cancer being characterized by
unwanted (i.e., increased) levels of an alpha hydroxy neoactivity,
product, e.g., 2HG, e.g., R-2HG.
[0053] In an embodiment the cell proliferation-related disorder is
a tumor of the CNS, e.g., a glioma, e.g., wherein the tumor is
characterized by an IDH1 somatic mutant having alpha hydroxy
neoactivity, e.g., 2HG neoactivity, e.g., a mutant described
herein. Gliomas include astrocytic tumors, oligodendroglial tumors,
oligoastrocytic tumors, anaplastic astrocytomas, and glioblastomas.
In an embodiment the tumor is characterized by increased levels of
an alpha hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG, as
compared to non-diseased cells of the same type. E.g., in an
embodiment, the IDH1 allele encodes an IDH1 having other than an
Arg at residue 132. E.g., the allele encodes His, Ser, Cys, Gly,
Val, Pro or Leu (e.g., His, Ser, Cys, Gly, Val, or Leu), or any
residue described in Yan et al., at residue 132, according to the
sequence of SEQ ID NO:8 (see also FIG. 21). In an embodiment the
allele encodes an IDH1 having His at residue 132. In an embodiment
the allele encodes an IDH1 having Ser at residue 132.
[0054] In an embodiment the IDH1 allele has an A (or any other
nucleotide other than C) at nucleotide position 394, or an A (or
any other nucleotide other than G) at nucleotide position 395. In
an embodiment the allele is a C394A, a C394G, a C394T, a G395C, a
G395T or a G395A mutation; specifically a C394A or a G395A mutation
according to the sequence of SEQ ID NO:5.
[0055] In an embodiment the method comprises selecting a subject
having a glioma, wherein the cancer is characterized by having an
IDH1 allele described herein, e.g., an IDH1 allele having His, Ser,
Cys, Gly, Val, Pro or Leu at residue 132 (SEQ ID NO:8), more
specifically His, Ser, Cys, Gly, Val, or Leu; or His or Cys.
[0056] In an embodiment the method comprises selecting a subject
having a glioma, on the basis of the cancer being characterized by
an IDH1 allele described herein, e.g., an IDH1 allele having His,
Ser, Cys, Gly, Val, Pro or Leu at residue 132 (SEQ ID NO:8), more
specifically His, Ser, Cys, Gly, Val, or Leu; or His or Cys.
[0057] In an embodiment the method comprises selecting a subject
having a glioma, on the basis of the cancer being characterized by
increased levels of an alpha hydroxy neoactivity, product, e.g.,
2HG, e.g., R-2HG.
[0058] In an embodiment the method comprises selecting a subject
having a fibrosarcoma or paraganglioma wherein the cancer is
characterized by having an IDH1 allele described herein, e.g., an
IDH1 allele having Cys at residue 132 (SEQ ID NO:8).
[0059] In an embodiment the method comprises selecting a subject
having a fibrosarcoma or paraganglioma, on the basis of the cancer
being characterized by an IDH1 allele described herein, e.g., an
IDH1 allele having Cys at residue 132 (SEQ ID NO:8).
[0060] In an embodiment the method comprises selecting a subject
having a fibrosarcoma or paraganglioma, on the basis of the cancer
being characterized by increased levels of an alpha hydroxy
neoactivity, product, e.g., 2HG, e.g., R-2HG.
[0061] In an embodiment the cell proliferation-related disorder is
localized or metastatic prostate cancer, e.g., prostate
adenocarcinoma, e.g., wherein the cancer is characterized by an
IDH1 somatic mutant having alpha hydroxy neoactivity, e.g., 2HG
neoactivity, e.g., a mutant described herein. In an embodiment the
cancer is characterized by increased levels of an alpha hydroxy
neoactivity product, e.g., 2HG, e.g., R-2HG, as compared to
non-diseased cells of the same type.
[0062] E.g., in an embodiment, the IDH1 allele encodes an IDH1
having other than an Arg at residue 132. E.g., the allele encodes
His, Ser, Cys, Gly, Val, Pro or Leu, or any residue described in
Kang et al, 2009, Int. J. Cancer, 125: 353-355 at residue 132,
according to the sequence of SEQ ID NO:8 (see also FIG. 21) (e.g.,
His, Ser, Cys, Gly, Val, or Leu). In an embodiment the allele
encodes an IDH1 having His or Cys at residue 132.
[0063] In an embodiment the IDH1 allele has a T (or any other
nucleotide other than C) at nucleotide position 394, or an A (or
any other nucleotide other than G) at nucleotide position 395. In
an embodiment the allele is a C394T or a G395A mutation according
to the sequence of SEQ ID NO:5.
[0064] In an embodiment the method comprises selecting a subject
having prostate cancer, e.g., prostate adenocarcinoma, wherein the
cancer is characterized by an IDH1 allele described herein, e.g.,
an IDH1 allele having His or Cys at residue 132 (SEQ ID NO:8).
[0065] In an embodiment the method comprises selecting a subject
having prostate cancer, e.g., prostate adenocarcinoma, on the basis
of the cancer being characterized by an IDH1 allele described
herein, e.g., an IDH1 allele having His or Cys at residue 132 (SEQ
ID NO:8).
[0066] In an embodiment the method comprises selecting a subject
having prostate cancer, on the basis of the cancer being
characterized by increased levels of an alpha hydroxy neoactivity
product, e.g., 2HG, e.g., R-2HG.
[0067] In an embodiment the cell proliferation-related disorder is
a hematological cancer, e.g., a leukemia, e.g., AML, or ALL,
wherein the hematological cancer is characterized by an IDH1
somatic mutant having alpha hydroxy neoactivity, e.g., 2HG
neoactivity, e.g., a mutant described herein. In an embodiment the
cancer is characterized by increased levels of an alpha hydroxy
neoactivity product, e.g., 2HG, e.g., R-2HG, as compared to
non-diseased cells of the same type.
[0068] In an embodiment the cell proliferation-related disorder is
acute lymphoblastic leukemia (e.g., an adult or pediatric form),
e.g., wherein the acute lymphoblastic leukemia (sometimes referred
to herein as ALL) is characterized by an IDH1 somatic mutant having
alpha hydroxy neoactivity, e.g., 2HG neoactivity, e.g., a mutant
described herein. The ALL can be, e.g., B-ALL or T-ALL. In an
embodiment the cancer is characterized by increased levels of 2 an
alpha hydroxy neoactivity product, e.g., HG, e.g., R-2HG, as
compared to non-diseased cells of the same type. E.g., in an
embodiment, the IDH1 allele is an IDH1 having other than an Arg at
residue 132 (SEQ ID NO:8). E.g., the allele encodes His, Ser, Cys,
Gly, Val, Pro or Leu, or any residue described in Kang et al., at
residue 132, according to the sequence of SEQ ID NO:8 (see also
FIG. 21), more specifically His, Ser, Cys, Gly, Val, or Leu. In an
embodiment the allele encodes an IDH1 having Cys at residue
132.
[0069] In an embodiment the IDH1 allele has a T (or any other
nucleotide other than C) at nucleotide position 394. In an
embodiment the allele is a C394T mutation according to the sequence
of SEQ ID NO:5.
[0070] In an embodiment the method comprises selecting a subject
having ALL, e.g., B-ALL or T-ALL, characterized by an IDH1 allele
described herein, e.g., an IDH1 allele having Cys at residue 132
according to the sequence of SEQ ID NO:8.
[0071] In an embodiment the method comprises selecting a subject
ALL, e.g., B-ALL or T-ALL, on the basis of cancer being
characterized by having an IDH1 allele described herein, e.g., an
IDH1 allele having Cys at residue 132 (SEQ ID NO:8).
[0072] In an embodiment the method comprises selecting a subject
having ALL, e.g., B-ALL or T-ALL, on the basis of the cancer being
characterized by increased levels of an alpha hydroxy neoactivity
product, e.g., 2HG, e.g., R-2HG.
[0073] In an embodiment the cell proliferation-related disorder is
acute myelogenous leukemia (e.g., an adult or pediatric form),
e.g., wherein the acute myelogenous leukemia (sometimes referred to
herein as AML) is characterized by an IDH1 somatic mutant having
alpha hydroxy neoactivity, e.g., 2HG neoactivity, e.g., a mutant
described herein. In an embodiment the cancer is characterized by
increased levels of an alpha hydroxy neoactivity product, e.g.,
2HG, e.g., R-2HG, as compared to non-diseased cells of the same
type. E.g., in an embodiment, the IDH1 allele is an IDH1 having
other than an Arg at residue 132 (SEQ ID NO:8). E.g., the allele
encodes His, Ser, Cys, Gly, Val, Pro or Leu, or any residue
described in Kang et al., at residue 132, according to the sequence
of SEQ ID NO:8 (see also FIG. 21). In an embodiment the allele
encodes an IDH1 having Cys, His or Gly at residue 132, more
specifically, Cys at residue 132.
[0074] In an embodiment the IDH1 allele has a T (or any other
nucleotide other than C) at nucleotide position 394. In an
embodiment the allele is a C394T mutation according to the sequence
of SEQ ID NO:5.
[0075] In an embodiment the method comprises selecting a subject
having acute myelogenous lymphoplastic leukemia (AML) characterized
by an IDH1 allele described herein, e.g., an IDH1 allele having
Cys, His, or Gly at residue 132 according to the sequence of SEQ ID
NO:8, more specifically, Cys at residue 132.
[0076] In an embodiment the method comprises selecting a subject
having acute myelogenous lymphoplastic leukemia (AML) on the basis
of cancer being characterized by having an IDH1 allele described
herein, e.g., an IDH1 allele having Cys, His, or Gly at residue 132
(SEQ ID NO:8), more specifically, Cys at residue 132.
[0077] In an embodiment the method comprises selecting a subject
having acute myelogenous lymphoplastic leukemia (AML), on the basis
of the cancer being characterized by increased levels of an alpha
hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG.
[0078] In an embodiment the method further comprises evaluating the
subject for the presence of a mutation in the NRAS or NPMc
gene.
[0079] In an embodiment the cell proliferation-related disorder is
myelodysplasia or myelodysplastic syndrome, e.g., wherein the
myelodysplasia or myelodysplastic syndrome is characterized by
having an IDH1 somatic mutant having alpha hydroxy neoactivity,
e.g., 2HG neoactivity, e.g., a mutant described herein. In an
embodiment the disorder is characterized by increased levels of an
alpha hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG, as
compared to non-diseased cells of the same type. E.g., in an
embodiment, the IDH1 allele is an IDH1 having other than an Arg at
residue 132 (SEQ ID NO:8). E.g., the allele encodes His, Ser, Cys,
Gly, Val, Pro or Leu, or any residue described in Kang et al.,
according to the sequence of SEQ ID NO:8 (see also FIG. 21), more
specifically His, Ser, Cys, Gly, Val, or Leu. In an embodiment the
allele encodes an IDH1 having Cys at residue 132.
[0080] In an embodiment the IDH1 allele has a T (or any other
nucleotide other than C) at nucleotide position 394. In an
embodiment the allele is a C394T mutation according to the sequence
of SEQ ID NO:5.
[0081] In an embodiment the method comprises selecting a subject
having myelodysplasia or myelodysplastic syndrome characterized by
an IDH1 allele described herein, e.g., an IDH1 allele having Cys,
His, or Gly at residue 132 according to the sequence of SEQ ID
NO:8, more specifically, Cys at residue 132.
[0082] In an embodiment the method comprises selecting a subject
having myelodysplasia or myelodysplastic syndrome on the basis of
cancer being characterized by having an IDH1 allele described
herein, e.g., an IDH1 allele having Cys, His, or Gly at residue 132
(SEQ ID NO:8), more specifically, Cys at residue 132.
[0083] In an embodiment the method comprises selecting a subject
having myelodysplasia or myelodysplastic syndrome, on the basis of
the cancer being characterized by increased levels of an alpha
hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG.
[0084] In an embodiment the cell proliferation-related disorder is
a glioma, characterized by a mutation, or preselected allele, of
IDH2 associated with an alpha hydroxy neoactivity, e.g., 2HG
neoactivity. E.g., in an embodiment, the IDH2 allele encodes an
IDH2 having other than an Arg at residue 172. E.g., the allele
encodes Lys, Gly, Met, Trp, Thr, Ser, or any residue described in
described in Yan et al., at residue 172, according to the sequence
of SEQ ID NO:10 (see also FIG. 22), more specifically Lys, Gly,
Met, Trp, or Ser. In an embodiment the allele encodes an IDH2
having Lys at residue 172. In an embodiment the allele encodes an
IDH2 having Met at residue 172.
[0085] In an embodiment the method comprises selecting a subject
having a glioma, wherein the cancer is characterized by having an
IDH2 allele described herein, e.g., an IDH2 allele having Lys, Gly,
Met, Trp, Thr, or Ser at residue 172 (SEQ ID NO:10), more
specifically Lys, Gly, Met, Trp, or Ser; or Lys or Met.
[0086] In an embodiment the method comprises selecting a subject
having a glioma, on the basis of the cancer being characterized by
an IDH2 allele described herein, e.g., an IDH2 allele having Lys,
Gly, Met, Trp, Thr, or Ser at residue 172 (SEQ ID NO:10), more
specifically Lys, Gly, Met, Trp, or Ser; or Lys or Met.
[0087] In an embodiment the method comprises selecting a subject
having a glioma, on the basis of the cancer being characterized by
increased levels of an alpha hydroxy neoactivity product, e.g.,
2HG, e.g., R-2HG.
[0088] In an embodiment the cell proliferation-related disorder is
a prostate cancer, e.g., prostate adenocarcinoma, characterized by
a mutation, or preselected allele, of IDH2 associated with an alpha
hydroxy neoactivity, e.g., 2HG neoactivity. E.g., in an embodiment,
the IDH2 allele encodes an IDH2 having other than an Arg at residue
172. E.g., the allele encodes Lys, Gly, Met, Trp, Thr, Ser, or any
residue described in described in Yan et al., at residue 172,
according to the sequence of SEQ ID NO:10 (see also FIG. 22), more
specifically Lys, Gly, Met, Trp, or Ser. In an embodiment the
allele encodes an IDH2 having Lys at residue 172. In an embodiment
the allele encodes an IDH2 having Met at residue 172.
[0089] In an embodiment the method comprises selecting a subject
having a prostate cancer, e.g., prostate adenocarcinoma, wherein
the cancer is characterized by having an IDH2 allele described
herein, e.g., an IDH2 allele having Lys or Met at residue 172 (SEQ
ID NO:10).
[0090] In an embodiment the method comprises selecting a subject
having a prostate cancer, e.g., prostate adenocarcinoma, on the
basis of the cancer being characterized by an IDH2 allele described
herein, e.g., an IDH2 allele having Lys or Met at residue 172 (SEQ
ID NO:10).
[0091] In an embodiment the method comprises selecting a subject
having a prostate cancer, e.g., prostate adenocarcinoma, on the
basis of the cancer being characterized by increased levels of an
alpha hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG.
[0092] In an embodiment the cell proliferation-related disorder is
ALL, e.g., B-ALL or T-ALL, characterized by a mutation, or
preselected allele, of IDH2 associated with an alpha hydroxy
neoactivity, e.g., 2HG neoactivity. E.g., in an embodiment, the
IDH2 allele encodes an IDH2 having other than an Arg at residue
172. E.g., the allele encodes Lys, Gly, Met, Trp, Thr, Ser, or any
residue described in described in Yan et al., at residue 172,
according to the sequence of SEQ ID NO:10 (see also FIG. 22). In an
embodiment the allele encodes an IDH2 having Lys at residue 172. In
an embodiment the allele encodes an IDH2 having Met at residue
172.
[0093] In an embodiment the method comprises selecting a subject
having ALL, e.g., B-ALL or T-ALL, wherein the cancer is
characterized by having an IDH2 allele described herein, e.g., an
IDH2 allele having Lys or Met at residue 172 (SEQ ID NO:10).
[0094] In an embodiment the method comprises selecting a subject
having ALL, e.g., B-ALL or T-ALL, on the basis of the cancer being
characterized by an IDH2 allele described herein, e.g., an IDH2
allele having Lys or Met at residue 172 (SEQ ID NO:10).
[0095] In an embodiment the method comprises selecting a subject
having ALL, e.g., B-ALL or T-ALL, on the basis of the cancer being
characterized by increased levels of an alpha hydroxy neoactivity
product, e.g., 2HG, e.g., R-2HG.
[0096] In an embodiment the cell proliferation-related disorder is
AML, characterized by a mutation, or preselected allele, of IDH2
associated with an alpha hydroxy neoactivity, e.g., 2HG
neoactivity. E.g., in an embodiment, the IDH2 allele encodes an
IDH2 having other than an Arg at residue 172. E.g., the allele
encodes Lys, Gly, Met, Trp, Thr, Ser, or any residue described in
described in Yan et al., at residue 172, according to the sequence
of SEQ ID NO:10 (see also FIG. 22), more specifically Lys, Gly,
Met, or Ser. In an embodiment the allele encodes an IDH2 having Lys
at residue 172. In an embodiment the allele encodes an IDH2 having
Met at residue 172. In an embodiment the allele encodes an IDH2
having Gly at residue 172.
[0097] In an embodiment the method comprises selecting a subject
having AML, wherein the cancer is characterized by having an IDH2
allele described herein, e.g., an IDH2 allele having Lys, Gly or
Met at residue 172 (SEQ ID NO:10), more specifically Lys or
Met.
[0098] In an embodiment the method comprises selecting a subject
having AML, on the basis of the cancer being characterized by an
IDH2 allele described herein, e.g., an IDH2 allele having Lys, Gly,
or Met at residue 172 (SEQ ID NO:10), more specifically Lys or
Met.
[0099] In an embodiment the method comprises selecting a subject
having AML, on the basis of the cancer being characterized by
increased levels of an alpha hydroxy neoactivity product, e.g.,
2HG, e.g., R-2HG.
[0100] In an embodiment the cell proliferation-related disorder is
myelodysplasia or myelodysplastic syndrome, characterized by a
mutation, or preselected allele, of IDH2. E.g., in an embodiment,
the IDH2 allele encodes an IDH2 having other than an Arg at residue
172. E.g., the allele encodes Lys, Gly, Met, Trp, Thr, Ser, or any
residue described in described in Yan et al., at residue 172,
according to the sequence of SEQ ID NO:10 (see also FIG. 22), more
specifically Lys, Gly, Met, Trp or Ser. In an embodiment the allele
encodes an IDH2 having Lys at residue 172. In an embodiment the
allele encodes an IDH2 having Met at residue 172. In an embodiment
the allele encodes an IDH2 having Gly at residue 172.
[0101] In an embodiment the method comprises selecting a subject
having myelodysplasia or myelodysplastic syndrome, wherein the
cancer is characterized by having an IDH2 allele described herein,
e.g., an IDH2 allele having Lys, Gly, or Met at residue 172 (SEQ ID
NO:10), in specific embodiments, Lys or Met.
[0102] In an embodiment the method comprises selecting a subject
having myelodysplasia or myelodysplastic syndrome, on the basis of
the cancer being characterized by an IDH2 allele described herein,
e.g., an IDH2 allele having Lys, Gly, or Met at residue 172 (SEQ ID
NO:10), in specific embodiments, Lys or Met.
[0103] In an embodiment the method comprises selecting a subject
having myelodysplasia or myelodysplastic syndrome, on the basis of
the cancer being characterized by increased levels of an alpha
hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG.
[0104] In an embodiment a product of the neoactivity is 2HG (e.g.,
R-2HG) which acts as a metabolite. In another embodiment a product
of the neoactivity is 2HG (e.g., R-2HG) which acts as a toxin,
e.g., a carcinogen.
[0105] In some embodiments, the methods described herein can result
in reduced side effects relative to other known methods of treating
cancer.
[0106] Therapeutic agents and methods of subject evaluation
described herein can be combined with other therapeutic mocalities,
e.g., with art-known treatments.
[0107] In an embodiment the method comprises providing a second
treatment, to the subject, e.g., surgical removal, irradiation or
administration of a chemotherapeutitc agent, e.g., an
administration of an alkylating agent. Administration (or the
establishment of therapeutic levels) of the second treatment can:
begin prior to the beginning or treatment with (or prior to the
establishment of therapeutic levels of) the inhibitor; begin after
the beginning or treatment with (or after the establishment of
therapeutic levels of) the inhibitor, or can be administered
concurrently with the inhibitor, e.g., to achieve therapeiutc
levels of both concurrently.
[0108] In an embodiment the cell proliferation-related disorder is
a CNS tumor, e.g., a glioma, and the second therapy comprises
administration of one or more of: radiation; an alkylating agent,
e.g., temozolomide, e.g., Temoader.RTM., or BCNU; or an inhibitor
of HER1/EGFR tyrosine kinase, e.g., erlotinib, e.g.,
Tarceva.RTM..
[0109] The second therapy, e.g., in the case of glioma, can
comprise implantation of BCNU or carmustine in the brain, e.g.,
implantation of a Gliadel.RTM. wafer.
[0110] The second therapy, e.g., in the case of glioma, can
comprise administration of imatinib, e.g., Gleevec.RTM..
[0111] In an embodiment the cell proliferation-related disorder is
prostate cancer and the second therapy comprises one or more of:
androgen ablation; administration of a microtubule stabilizer,
e.g., docetaxol, e.g., Taxotere.RTM.; or administration of a
topoisomerase II inhibitor, e.g., mitoxantrone.
[0112] In an embodiment the cell proliferation-related disorder is
ALL, e.g., B-ALL or T-ALL, and the second therapy comprises one or
more of:
[0113] induction phase treatment comprising the administration of
one or more of: a steroid; an inhibitor of microtubule assembly,
e.g., vincristine; an agent that reduces the availability of
asparagine, e.g., asparaginase; an anthracycline; or an
antimetabolite, e.g., methotrexate, e.g., intrathecal methotrexate,
or 6-mercaptopurine;
[0114] consolidation phase treatment comprising the administration
of one or more of: a drug listed above for the induction phase; an
antimetabolite, e.g., a guanine analog, e.g., 6-thioguanine; an
alkylating agent, e.g., cyclophosphamide; an anti-metabolite, e.g.,
AraC or cytarabine; or an inhibitor of topoisomerase I, e.g.,
etoposide; or
[0115] maintenance phase treatment comprising the administration of
one or more of the drugs listed above for induction or
consolidation phase treatment.
[0116] In an embodiment the cell proliferation-related disorder is
AML, and the second therapy comprises administration of one or more
of: an inhibitor of topoisomerase II, e.g., daunorubicin,
idarubicin, topotecan or mitoxantrone; an inhibitor of
topoisomerase I, e.g., etoposide; or an anti-metabolite, e.g., AraC
or cytarabine.
[0117] In another aspect, the invention features, a method of
evaluating, e.g. diagnosing, a subject, e.g., a subject not having,
or not diagnosed as having, 2-hydroxyglutaric aciduria. The method
comprises analyzing a parameter related to the neoactivity genotype
or phenotype of the subject, e.g., analyzing one or more of:
[0118] a) the presence, distribution, or level of a neoactive
product, e.g., the product of an alpha hydroxy neoactivity, e.g.,
2HG, e.g., R-2HG, e.g., an increased level of product, 2HG, e.g.,
R-2HG (as used herein, an increased level of a product of an alpha
hydroxy neoactivity, e.g., 2HG, e.g., R-2HG, or similar term, e.g.,
an increased level of neoactive product or neoactivity product,
means increased as compared with a reference, e.g., the level seen
in an otherwise similar cell lacking the IDH mutation, e.g., IDH1
or IDH2 mutation, or in a tissue or product from a subject not
having the mutation (the terms increased and elevated as refereed
to the level of a product of alpha hydroxyl neoactivity as used
herein, are used interchangeably);
[0119] b) the presence, distribution, or level of a neoactivity,
e.g., alpha hydroxy neoactivity, e.g., 2HG neoactivity, of an IDH1
or IDH2, mutant protein;
[0120] c) the presence, distribution, or level of a neoactive
mutant protein, e.g., an IDH, e.g., an IDH1 or IDH2, mutant protein
which has a neoactivity, e.g., alpha hydroxy neoactivity, e.g., 2HG
neoactivity, or a corresponding RNA; or
[0121] d) the presence of a selected somatic allele or mutation
conferring neoactivity, e.g., an IDH, e.g., IDH1 or IDH2, which
encodes a protein with a neoactivity, e.g., alpha hydroxy
neoactivity, e.g., 2HG neoactivity, e.g., an allele disclosed
herein, in cells characterized by a cell proliferation-related
disorder from the subject, thereby evaluating the subject.
[0122] In an embodiment analyzing comprises performing a procedure,
e.g., a test, to provide data or information on one or more of a-d,
e.g., performing a method which results in a physical change in a
sample, in the subject, or in a device or reagent used in the
analysis, or which results in the formation of an image
representative of the data. Methods of obtaining and analyzing
samples, and the in vivo analysis in subjects, described elsewhere
herein, e.g., in the section entitled, "Methods of evaluating
samples and/or subjects," can be combined with this method. In
another embodiment analyzing comprises receiving data or
information from such test from another party. In an embodiment the
analyzing comprises receiving data or information from such test
from another party and, the method comprises, responsive to that
data or information, administering a treatment to the subject.
[0123] As described herein, the evaluation can be used in a number
of applications, e.g., for diagnosis, prognosis, staging,
determination of treatment efficacy, patent selection, or drug
selection.
[0124] Thus, in an embodiment method further comprises, e.g.,
responsive to the analysis of one or more of a-d:
[0125] diagnosing the subject, e.g., diagnosing the subject as
having a cell proliferation-related disorder, e.g., a disorder
characterized by unwanted cell proliferation, e.g., cancer, or a
precancerous disorder;
[0126] staging the subject, e.g., determining the stage of a cell
proliferation-related disorder, e.g., a disorder characterized by
unwanted cell proliferation, e.g., cancer, or a precancerous
disorder;
[0127] providing a prognosis for the subject, e.g., providing a
prognosis for a cell proliferation-related disorder, e.g., a
disorder characterized by unwanted cell proliferation, e.g.,
cancer, or a precancerous disorder;
[0128] determining the efficacy of a treatment, e.g., the efficacy
of a chemotherapeutic agent, irradiation or surgery;
[0129] determining the efficacy of a treatment with a therapeutic
agent, e.g., an inhibitor, described herein;
[0130] selecting the subject for a treatment for a cell
proliferation-related disorder, e.g., a disorder characterized by
unwanted cell proliferation, e.g., cancer, or a precancerous
disorder. The selection can be based on the need for a reduction in
neoactivity or on the need for amelioration of a condition
associated with or resulting from neoactivity. For example, if it
is determined that the subject has a cell proliferation-related
disorder, e.g., e.g., cancer, or a precancerous disorder
characterized by increased levels of an alpha hydroxy neoactivity
product, e.g., 2HG, e.g., R-2HG, or by a mutant IDH1 or IDH2,
having alpha hydroxyl neoactivity, e.g., 2HG, neaoctivity,
selecting the subject for treatment with a therapeutic agent
described herein, e.g., an inhibitor (e.g., a small molecule or a
nucleic acid-based inhibitor) of the neoactivity of that mutant
(e.g., conversion of alpha-ketoglutarate to 2HG, e.g., R-2HG);
[0131] correlating the analysis with an outcome or a prognosis;
[0132] providing a value for an analysis on which the evaluation is
based, e.g., the value for a parameter correlated to the presence,
distribution, or level of an alpha hydroxyl neoactivity product,
e.g., 2HG, e.g., R-2HG;
[0133] providing a recommendation for treatment of the subject;
or
[0134] memorializing a result of, or output from, the method, e.g.,
a measurement made in the course of performing the method, and
optionally transmitting the memorialization to a party, e.g., the
subject, a healthcare provider, or an entity that pays for the
subject's treatment, e.g., a government, insurance company, or
other third party payer.
[0135] As described herein, the evaluation can provide information
on which a number of decisions or treatments can be based.
[0136] Thus, in an embodiment the result of the evaluation, e.g.,
an increased level of an alpha hydroxyl neoactivity product, e.g.,
2HG, e.g., R-2HG, the presence of an IDH, e.g., IDH1 or IDH2,
neoactivity, e.g., alpha hydroxyl neoactivity, e.g., 2HG
neoactivity, the presence of an IDH, e.g., IDH1 or IDH2, mutant
protein (or corresponding RNA) which has alpha hydroxyl
neoactivity, e.g., 2HG neoactivity, the presence of a mutant allele
of IDH, e.g., IDH1 or IDH2, having alpha hydroxyl neoactivity, 2HG
neoactivity, e.g., an allele disclosed herein, is indicative
of:
[0137] a cell proliferation-related disorder, e.g., cancer, e.g.,
it is indicative of a primary or metastatic lesion;
[0138] the stage of a cell proliferation-related disorder;
[0139] a prognosis or outcome for a cell proliferation-related
disorder, e.g., it is indicative of a less aggressive form of the
disorder, e.g., cancer. E.g., in the case of glioma, presence of an
alpha hydroxyl neoactivity product, e.g., 2HG, e.g., R-2HG, can
indicate a less aggressive form of the cancer;
[0140] the efficacy of a treatment, e.g., the efficacy of a
chemotherapeutic agent, irradiation or surgery;
[0141] the need of a therapy disclosed herein, e.g., inhibition a
neoactivity of an IDH, e.g., IDH1 or IDH2, neoactive mutant
described herein. In an embodiment relatively higher levels (or the
presence of the mutant) is correlated with need of inhibition a
neoactivity of an IDH, e.g., IDH1 or IDH2, mutant described herein;
or
[0142] responsiveness to a treatment. The result can be used as a
noninvasive biomarker for clinical response. E.g., elevated levels
can be predictive on better outcome in glioma patients (e.g.,
longer life expectancy).
[0143] As described herein, the evaluation can provide for the
selection of a subject.
[0144] Thus, in an embodiment the method comprises, e.g.,
responsive to the analysis of one or more of a-d, selecting a
subject, e.g., for a treatment. The subject can be selected on a
basis described herein, e.g., on the basis of:
[0145] said subject being at risk for, or having, higher than
normal levels of an alpha hydroxy neoactivity product, e.g.,
2-hydroxyglurarate (e.g., R-2HG) in cell having a cell
proliferation-related disorder, e.g., a leukemia such as AML or
ALL, e.g., B-ALL or T-ALL, or a tumor lesion, e.g., a glioma or a
prostate tumor;
[0146] said subject having a proliferation-related disorder
characterized by a selected IDH, e.g., IDH1 or IDH2 allele, e.g.,
an IDH1 or IDH2 mutation, having alpha hydroxyl neoactivity, e.g.,
2HG neoactivity;
[0147] said subject having a selected IDH allele, e.g., a selected
IDH1 or IDH2 allele; having alpha hydroxyl neoactivity, e.g., 2HG
neoactivity;
[0148] said subject having a proliferation-related disorder;
[0149] said subject being in need of, or being able to benefit
from, a therapeutic agent of a type described herein;
[0150] said subject being in need of, or being able to benefit
from, a compound that inhibits alpha hydroxyl neoactivity, e.g.,
2HG neoactivity;
[0151] said subject being in need of, or being able to benefit
from, a compound that lowers the level of an alpha hydroxyl
neoactivity product, e.g., 2HG, e.g., R-2HG.
[0152] In an embodiment evaluation comprises selecting the subject,
e.g., for treatment with an anti-neoplastic agent, on the
establishment of, or determination that, the subject has increased
alpha hydroxyl neoactivity product, e.g., 2HG, e.g., R-2HG, or
increased alpha hydroxyl neoactivity, e.g., 2HG neoactivity, or
that the subject is in need of inhibition of a neoactivity of an
IDH, e.g., IDH1 or IDH2, mutant described herein.
[0153] As described herein, the evaluations provided for by methods
described herein allow the selection of optimal treatment
regimens.
[0154] Thus, in an embodiment the method comprises, e.g.,
responsive to the analysis of one or more of a-d, selecting a
treatment for the subject, e.g., selecting a treatment on a basis
disclosed herein. The treatment can be the administration of a
therapeutic agent disclosed herein. The treatment can be selected
on the basis that:
[0155] it us useful in treating a disorder characterized by one or
more of alpha hydroxyl neoactivity, e.g., 2HG neoactivity, an IDH1
or IDH2, mutant protein having alpha hydroxyl neoactivity, e.g.,
2HG neoactivity (or a corresponding RNA);
[0156] it is useful in treating a disorder characterized by a
selected somatic allele or mutation of an IDH, e.g., IDH1 or IDH2,
which encodes a protein with alpha hydroxyl neoactivity, e.g., 2HG
neoactivity, e.g., an allele disclosed herein, in cells
characterized by a cell proliferation-related disorder from the
subject;
[0157] it reduces the level of an alpha hydroxyl neoactivity
product, e.g., 2HG, e.g., R-2HG;
[0158] it reduces the level of alpha hydroxyl neoactivity, e.g.,
2HG neoactivity.
[0159] In an embodiment evaluation comprises selecting the subject,
e.g., for treatment.
[0160] In embodiments the treatment is the administration of a
therapeutic agent described herein.
[0161] The methods can also include treating a subject, e.g, with a
treatment selected in response to, or on the basis of, an
evaluation made in the method.
[0162] Thus, in an embodiment the method comprises, e.g.,
responsive to the analysis of one or more of a-d, administering a
treatment to the subject, e.g., the administration of a therapeutic
agent of a type described herein.
[0163] In an embodiment the therapeutic agent comprises a compound
from Table 24a or Table 24b or a compound having the structure of
Formula (X) or (XI) described below.
[0164] In an embodiment the therapeutic agent comprises nucleic
acid, e.g., dsRNA, e.g., a dsRNA described herein.
[0165] In an embodiment the therapeutic agent is an inhibitor,
e.g., a polypeptide, peptide, or small molecule (e.g., a molecule
of less than 1,000 daltons), or aptomer, that binds to an IDH1 or
IDH2 mutant (e.g., an aptomer that binds to an IDH1 mutant) or
wildtype subunit and inhibits neoactivity, e.g., by inhibiting
formation of a dimer, e.g., a homodimer of mutant IDH1 or IDH2
subunits (e.g., a homodimer of mutant IDH1 subunits) or a
heterodimer of a mutant and a wildype subunit. In an embodiment the
inhibitor is a polypeptide. In an embodiment the polypeptide acts
as a dominant negative with respect to the neoactivity of the
mutant enzyme. The polypeptide can correspond to full length IDH1
or IDH2 or a fragment thereof (e.g., the polypeptide corresponds to
full length IDH1 or a fragment thereof). The polypeptide need not
be identical with the corresponding residues of wildtype IDH1 or
IDH2 (e.g., wildtype IDH1), but in embodiments has at least 60, 70,
80, 90 or 95% homology with wildtype IDH1 or IDH2 (e.g., wildtype
IDH1).
[0166] In an embodiment the therapeutic agent decreases the
affinity of an IDH, e.g., IDH1 or IDH2 neoactive mutant protein for
NADH, NADPH or a divalent metal ion, e.g., Mg.sup.2+ or Mn.sup.2+,
or decreases the levels or availability of NADH, NADPH or divalent
metal ion, e.g., Mg.sup.2+ or Mn.sup.2+, e.g., by competing for
binding to the mutant enzyme. In an embodiment the enzyme is
inhibited by replacing Mg.sup.2+ or Mn.sup.2+ with Ca.sup.2+.
[0167] In an embodiment the therapeutic agent is an inhibitor that
reduces the level a neoactivity of an IDH, e.g., IDH1 or IDH2,
e.g., 2HG neoactivity.
[0168] In an embodiment the therapeutic agent is an inhibitor that
reduces the level of the product of a mutant having a neoactivity
of an IDH, e.g., IDH1 or IDH2 mutant, e.g., it reduces the level of
2HG, e.g., R-2HG.
[0169] In an embodiment the therapeutic agent is an inhibitor
that:
[0170] inhibits, e.g., specifically, a neoactivity of an IDH, e.g.,
IDH1 or IDH2, e.g., a neoactivity described herein, e.g., 2HG
neoactivity; or
[0171] inhibits both the wildtype activity and a neoactivity of an
IDH, e.g., IDH1 or IDH2, e.g., a neoactivity described herein, e.g,
2HG neoactivity.
[0172] In an embodiment the therapeutic agent is an inhibitor that
is selected on the basis that it:
[0173] inhibits, e.g., specifically, a neoactivity of an IDH, e.g.,
IDH1 or IDH2, e.g., a neoactivity described herein e.g., 2HG
neoactivity; or
[0174] inhibits both the wildtype activity and a neoactivity of an
IDH1, e.g., IDH1 or IDH2, e.g., a neoactivity described herein,
e.g., 2HG neoactivity.
[0175] In an embodiment the therapeutic agent is an inhibitor that
reduces the amount of a mutant IDH, e.g., IDH1 or IDH2, protein or
mRNA.
[0176] In an embodiment the therapeutic agent is an inhibitor that
interacts directly with, e.g., it binds to, the mutant IDH, e.g.,
IDH1 or IDH2 mRNA.
[0177] In an embodiment the therapeutic agent is an inhibitor that
interacts directly with, e.g., it binds to, the mutant IDH, e.g.,
IDH1 or IDH2, protein.
[0178] In an embodiment the therapeutic agent is an inhibitor that
reduces the amount of neoactive enzyme activity, e.g., by
interacting with, e.g., binding to, mutant IDH, e.g., IDH1 or IDH2,
protein. In an embodiment the inhibitor is other than an
antibody.
[0179] In an embodiment the therapeutic agent is an inhibitor that
is a small molecule and interacts with, e.g., binds, the mutant
RNA, e.g., mutant IDH1 mRNA.
[0180] In an embodiment the therapeutic agent is an inhibitor that
interacts directly with, e.g., binds, either the mutant IDH, e.g.,
IDH1 or IDH2, protein or interacts directly with, e.g., binds, the
mutant IDH mRNA, e.g., IDH1 or IDH2 mRNA.
[0181] In an embodiment the therapeutic agent is administered.
[0182] In an embodiment the treatment: inhibits, e.g.,
specifically, a neoactivity of IDH1 or IDH2 (e.g., a neoactivity of
IDH1), e.g., a neoactivity described herein; or inhibits both the
wildtype and activity and a neoactivity of IDH1 or IDH2 (e.g., a
neoactivity of IDH1), e.g., a neoactivity described herein In an
embodiment, the subject is subsequently evaluated or monitored by a
method described herein, e.g., the analysis of the presence,
distribution, or level of an alpha hydroxy neoactivity product,
e.g., 2HG, e.g., R-2HG, e.g., to evaluate response to the treatment
or progression of disease.
[0183] In an embodiment the treatment is selected on the basis that
it: inhibits, e.g., specifically, a neoactivity of IDH1 or IDH2
(e.g., a neoactivity of IDH1), e.g., alpha hydroxy neoactivity,
e.g., 2HG neoactivity; or inhibits both the wildtype and activity
and a neoactivity of IDH1 or IDH2 (e.g., a neoactivity of IDH1),
e.g., a neoactivity described herein.
[0184] In an embodiment, the method comprises determining the
possibility of a mutation other than a mutation in IDH1 or in IDH2.
In embodiments a relatively high level of 2HG, e.g., R-2HG is
indicative of another mutation.
[0185] In an embodiment, which embodiment includes selecting or
administering a treatment for the subject, the subject:
[0186] has not yet been treated for the subject the cell
proliferation-related disorder and the selected or administered
treatment is the initial or first line treatment;
[0187] has already been treated for the cell proliferation-related
and the selected or administered treatment results in an alteration
of the existing treatment;
[0188] has already been treated for the cell proliferation-related,
and the selected treatment results in continuation of the existing
treatment; or
[0189] has already been treated for the cell proliferation-related
disorder and the selected or administered treatment is different,
e.g., as compared to what was administered prior to the evaluation
or to what would be administered in the absence of elevated levels
of an alpha hydroxy neoactivity product, e.g., 2HG, e.g.,
R-2HG.
[0190] In an embodiment, which embodiment includes selecting or
administering a treatment for the subject, the selected or
administered treatment can comprise:
[0191] a treatment which includes administration of a therapeutic
agent at different, e.g., a greater (or lesser) dosage (e.g.,
different as compared to what was administered prior to the
evaluation or to what would be administered in the absence of
elevated levels of an alpha hydroxy neoactivity product, e.g., 2HG,
e.g., R-2HG);
[0192] a treatment which includes administration of a therapeutic
agent at a different frequency, e.g., more or less frequently, or
not at all (e.g., different as compared to what was administered
prior to the evaluation or to what would be administered in the
absence of elevated levels of an alpha hydroxy neoactivity product,
e.g., 2HG, e.g., R-2HG); or
[0193] a treatment which includes administration of a therapeutic
agent in a different therapeutic setting (e.g., adding or deleting
a second treatment from the treatment regimen) (e.g., different as
compared to what was administered prior to the evaluation or to
what would be administered in the absence of elevated levels of an
alpha hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG).
[0194] Methods of evaluating a subject described herein can
comprise evaluating a neoactivity genotype or phenotype. Methods of
obtaining and analyzing samples, and the in vivo analysis in
subjects, described elsewhere herein, e.g., in the section
entitled, "Methods of evaluating samples and/or subjects," can be
combined with this method.
[0195] In an embodiment the method comprises:
[0196] subjecting the subject (e.g., a subject not having
2-hydroxyglutaric aciduria) to imaging and/or spectroscopic
analysis, e.g., magnetic resonance-based analysis, e.g., MRI and/or
MRS e.g., imaging analysis, to provide a determination of the
presence, distribution, or level of an alpha hydroxy neoactivity
product, e.g., 2HG, e.g., R-2HG, e.g., as associated with a tumor,
e.g., a glioma, in the subject;
[0197] optionally storing a parameter related to the determination,
e.g., the image or a value related to the image from the imaging
analysis, in a tangible medium; and
[0198] responsive to the determination, performing one or more of:
correlating the determination with outcome or with a prognosis;
providing an indication of outcome or prognosis; providing a value
for an analysis on which the evaluation is based, e.g., the
presence, distribution, or level of an alpha hydroxy neoactivity
product, e.g., 2HG, e.g., R-2HG; providing a recommendation for
treatment of the subject; selecting a course of treatment for the
subject, e.g., a course of treatment described herein, e.g.,
selecting a course of treatment that includes inhibiting a
neoactivity of a mutant IDH, e.g., IDH1 or IDH2, allele, e.g., a
neoactivity described herein; administering a course of treatment
to the subject, e.g., a course of treatment described herein, e.g.,
a course of treatment that includes inhibiting a neoactivity of a
mutant IDH, e.g., IDH1 or IDH2, allele, e.g., a neoactivity
described herein; and memorializing memorializing a result of the
method or a measurement made in the course of the method, e.g., one
or more of the above and/or transmitting memorialization of one or
more of the above to a party, e.g., the subject, a healthcare
provider, or an entity that pays for the subject's treatment, e.g.,
a government, insurance company, or other third party payer.
[0199] In an embodiment the method comprises confirming or
determining, e.g., by direct examination or evaluation of the
subject, or sample e.g., tissue or bodily fluid (e.g., blood (e.g.,
blood plasma), urine, lymph, or cerebrospinal fluid) therefrom,
(e.g., by DNA sequencing or immuno analysis or evaluation of the
presence, distribution or level of an alpha hydroxy neoactivity
product, e.g., 2HG, e.g., R-2HG), or receiving such information
about the subject, that the subject has a cancer characterized by
an IDH, e.g., IDH1 or IDH2, allele described herein, e.g., an IDH1
allele having His, Ser, Cys, Gly, Val, Pro or Leu at residue 132
(SEQ ID NO:8), in specific embodiments, an IDH1 allele having His,
Ser, Cys, Gly, Val, or Leu at residue 132 or an IDH1 allele having
His or Cys at residue 132; or an IDH2 allele having Lys, Gly, Met,
Trp, Thr, or Ser at residue 172 (SEQ ID NO:10).
[0200] In an embodiment, prior to or after treatment, the method
includes evaluating the growth, size, weight, invasiveness, stage
or other phenotype of the cell proliferation-related disorder.
[0201] In an embodiment the cell proliferation-related disorder is
a tumor of the CNS, e.g., a glioma, a leukemia, e.g., AML or ALL,
e.g., B-ALL or T-ALL, prostate cancer, or myelodysplasia or
myelodysplastic syndrome and the evaluation is a or b. In an
embodiment the method comprises evaluating a sample, e.g., a sample
described herein, e.g., a tissue, e.g., a cancer sample, or a
bodily fluid, e.g., serum or blood, for increased alpha neoactivity
product, e.g., 2HG, e.g., R-2HG.
[0202] In an embodiment, a subject is subjected to MRS and the
evaluation comprises evaluating the presence or elevated amount of
a peak correlated to or corresponding to 2HG, e.g., R-2HG, as
determined by magnetic resonance. For example, a subject can be
analyzed for the presence and/or strength of a signal at about 2.5
ppm to determine the presence and/or amount of 2HG, e.g., R-2HG in
the subject.
[0203] In an embodiment the method comprises obtaining a sample
from the subject and analyzing the sample, or analyzing the
subject, e.g., by imaging the subject and optionally forming a
representation of the image on a computer.
[0204] In an embodiment the results of the analysis is compared to
a reference.
[0205] In an embodiment a value for a parameter correlated to the
presence, distribution, or level, e.g., of 2HG, e.g., R-2HG, is
determined. It can be compared with a reference value, e.g., the
value for a reference subject not having abnormal presence, level,
or distribution, e.g., a reference subject cell not having a
mutation in IDH, e.g., IDH1 or IDH2, having a neoactivity described
herein.
[0206] In an embodiment the method comprises determining if an IDH,
e.g., IDH1 or IDH2, mutant allele that is associated with 2HG
neoactivity is present. E.g., in the case of IDH1, the presence of
a mutation at residue 132 associated with 2HG neoactivity can be
determined. In the case of IDH2, the presence of a mutation at
residue 172 associated with 2HG neoactivity can be determined. The
determination can comprise sequencing a nucleic acid, e.g., genomic
DNA or cDNA, from an affected cell, which encodes the relevant
amino acid(s). The mutation can be a deletion, insertion,
rearrangement, or substitution. The mutation can involve a single
nucleotide, e.g., a single substitution, or more than one
nucleotide, e.g., a deletion of more than one nucleotides.
[0207] In an embodiment the method comprises determining the
sequence at position 394 or 395 of the IDH1 gene, or determining
the identity of amino acid residue 132 (SEQ ID NO:8) in the IDH1
gene in a cell characterized by the cell proliferation related
disorder.
[0208] In an embodiment the method comprises determining the amino
acid sequence, e.g., by DNA sequenceing, at position 172 of the
IDH2 gene in a cell characterized by the cell proliferation related
disorder.
[0209] In an embodiment a product of the neoactivity is 2-HG, e.g.,
R-2HG, which acts as a metabolite. In another embodiment a product
of the neoactivity is 2HG, e.g., R-2HG, which acts as a toxin,
e.g., a carcinogen.
[0210] In an embodiment the disorder is other than a solid tumor.
In an embodiment the disorder is a tumor that, at the time of
diagnosis or treatment, does not have a necrotic portion. In an
embodiment the disorder is a tumor in which at least 30, 40, 50,
60, 70, 80 or 90% of the tumor cells carry an IHD, e.g., IDH1 or
IDH2, mutation having 2HG neoactivity, at the time of diagnosis or
treatment.
[0211] In an embodiment the cell proliferation-related disorder is
a cancer, e.g., a cancer described herein, characterized by an IDH1
somatic mutant having alpha hydroxy neoactivity, e.g., 2HG
neoactivity, e.g., a mutant described herein. In an embodiment the
tumor is characterized by increased levels of an alpha hydroxy
neoactivity product, 2HG, e.g., R-2HG, as compared to non-diseased
cells of the same type.
[0212] In an embodiment the method comprises selecting a subject
having a glioma, on the basis of the cancer being characterized by
increased levels of an alpha hydroxy neoactivity, product, e.g.,
2HG, e.g., R-2HG.
[0213] In an embodiment the cell proliferation-related disorder is
a tumor of the CNS, e.g., a glioma, e.g., wherein the tumor is
characterized by an IDH1 somatic mutant having alpha hydroxy
neoactivity, e.g., 2HG neoactivity, e.g., a mutant described
herein. Gliomas include astrocytic tumors, oligodendroglial tumors,
oligoastrocytic tumors, anaplastic astrocytomas, and glioblastomas.
In an embodiment the tumor is characterized by increased levels of
an alpha hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG, as
compared to non-diseased cells of the same type. E.g., in an
embodiment, the IDH1 allele encodes an IDH1 having other than an
Arg at residue 132. E.g., the allele encodes His, Ser, Cys, Gly,
Val, Pro or Leu, or any residue described in Yan et al., at residue
132, according to the sequence of SEQ ID NO:8 (see also FIG. 21).
In an embodiment the allele encodes an IDH1 having His at residue
132. In an embodiment the allele encodes an IDH1 having Ser at
residue 132.
[0214] In an embodiment the IDH1 allele has an A (or any other
nucleotide other than C) at nucleotide position 394, or an A (or
any other nucleotide other than G) at nucleotide position 395. In
an embodiment the allele is a C394A, a C394G, a C394T, a G395C, a
G395T or a G395A mutation, specifically C394A or a G395A mutation
according to the sequence of SEQ ID NO:5.
[0215] In an embodiment the method comprises selecting a subject
having a glioma, wherein the cancer is characterized by having an
IDH1 allele described herein, e.g., an IDH1 allele having His, Ser,
Cys, Gly, Val, Pro or Leu at residue 132 (SEQ ID NO:8) (e.g., His,
Ser, Cys, Gly, Val, or Leu; or His or Cys).
[0216] In an embodiment the method comprises selecting a subject
having a glioma, on the basis of the cancer being characterized by
an IDH1 allele described herein, e.g., an IDH1 allele having His,
Ser, Cys, Gly, Val, Pro or Leu at residue 132 (SEQ ID NO:8) (e.g.,
His, Ser, Cys, Gly, Val, or Leu; or His or Cys).
[0217] In an embodiment the method comprises selecting a subject
having a glioma, on the basis of the cancer being characterized by
increased levels of an alpha hydroxy neoactivity, product, e.g.,
2HG, e.g., R-2HG.
[0218] In an embodiment, the cell proliferation disorder is
fibrosarcoma or paraganglioma wherein the cancer is characterized
by having an IDH1 allele described herein, e.g., an IDH1 allele
having Cys at residue 132 (SEQ ID NO:8).
[0219] In an embodiment, the cell proliferation disorder is
fibrosarcoma or paraganglioma wherein the cancer is characterized
by an IDH1 allele described herein, e.g., an IDH1 allele having Cys
at residue 132 (SEQ ID NO:8).
[0220] In an embodiment, the cell proliferation disorder is
fibrosarcoma or paraganglioma wherein the cancer is characterized
by increased levels of an alpha hydroxy neoactivity, product, e.g.,
2HG, e.g., R-2HG.
[0221] In an embodiment the cell proliferation-related disorder is
localized or metastatic prostate cancer, e.g., prostate
adenocarcinoma, e.g., wherein the cancer is characterized by an
IDH1 somatic mutant having alpha hydroxy neoactivity, e.g., 2HG
neoactivity, e.g., a mutant described herein. In an embodiment the
cancer is characterized by increased levels of an alpha hydroxy
neoactivity product, e.g., 2HG, e.g., R-2HG, as compared to
non-diseased cells of the same type.
[0222] E.g., in an embodiment, the IDH1 allele encodes an IDH1
having other than an Arg at residue 132. E.g., the allele encodes
His, Ser, Cys, Gly, Val, Pro or Leu, or any residue described in
Kang et al, 2009, Int. J. Cancer, 125: 353-355 at residue 132,
according to the sequence of SEQ ID NO:8 (see also FIG. 21) (e.g.,
His, Ser, Cys, Gly, Val, or Leu). In an embodiment the allele
encodes an IDH1 having His or Cys at residue 132.
[0223] In an embodiment the IDH1 allele has a T (or any other
nucleotide other than C) at nucleotide position 394, or an A (or
any other nucleotide other than G) at nucleotide position 395. In
an embodiment the allele is a C394T or a G395A mutation according
to the sequence of SEQ ID NO:5.
[0224] In an embodiment the method comprises selecting a subject
having prostate cancer, e.g., prostate adenocarcinoma, wherein the
cancer is characterized by an IDH1 allele described herein, e.g.,
an IDH1 allele having His or Cys at residue 132 (SEQ ID NO:8).
[0225] In an embodiment the method comprises selecting a subject
having prostate cancer, e.g., prostate adenocarcinoma, on the basis
of the cancer being characterized by an IDH1 allele described
herein, e.g., an IDH1 allele having His or Cys at residue 132 (SEQ
ID NO:8).
[0226] In an embodiment the method comprises selecting a subject
having prostate cancer, on the basis of the cancer being
characterized by increased levels of an alpha hydroxy neoactivity
product, e.g., 2HG, e.g., R-2HG.
[0227] In an embodiment the cell proliferation-related disorder is
a hematological cancer, e.g., a leukemia, e.g., AML, or ALL,
wherein the hematological cancer is characterized by an IDH1
somatic mutant having alpha hydroxy neoactivity, e.g., 2HG
neoactivity, e.g., a mutant described herein. In an embodiment the
cancer is characterized by increased levels of an alpha hydroxy
neoactivity product, e.g., 2HG, e.g., R-2HG, as compared to
non-diseased cells of the same type. In an embodiment the method
comprises evaluating a serum or blood sample for increased alpha
neoactivity product, e.g., 2HG, e.g., R-2HG.
[0228] In an embodiment the cell proliferation-related disorder is
acute lymphoblastic leukemia (e.g., an adult or pediatric form),
e.g., wherein the acute lymphoblastic leukemia (sometimes referred
to herein as ALL) is characterized by an IDH1 somatic mutant having
alpha hydroxy neoactivity, e.g., 2HG neoactivity, e.g., a mutant
described herein. The ALL can be, e.g., B-ALL or T-ALL. In an
embodiment the cancer is characterized by increased levels of 2 an
alpha hydroxy neoactivity product, e.g., HG, e.g., R-2HG, as
compared to non-diseased cells of the same type. E.g., in an
embodiment, the IDH1 allele is an IDH1 having other than an Arg at
residue 132 (SEQ ID NO:8). E.g., the allele encodes His, Ser, Cys,
Gly, Val, Pro or Leu, or any residue described in Kang et al., at
residue 132, according to the sequence of SEQ ID NO:8 (see also
FIG. 21) (e.g., His, Ser, Cys, Gly, Val, or Leu). In an embodiment
the allele encodes an IDH1 having Cys at residue 132.
[0229] In an embodiment the IDH1 allele has a T (or any other
nucleotide other than C) at nucleotide position 394. In an
embodiment the allele is a C394T mutation according to the sequence
of SEQ ID NO:5.
[0230] In an embodiment the method comprises selecting a subject
having ALL, e.g., B-ALL or T-ALL, characterized by an IDH1 allele
described herein, e.g., an IDH1 allele having Cys at residue 132
according to the sequence of SEQ ID NO:8.
[0231] In an embodiment the method comprises selecting a subject
ALL, e.g., B-ALL or T-ALL, on the basis of cancer being
characterized by having an IDH1 allele described herein, e.g., an
IDH1 allele having Cys at residue 132 (SEQ ID NO:8).
[0232] In an embodiment the method comprises selecting a subject
having ALL, e.g., B-ALL or T-ALL, on the basis of the cancer being
characterized by increased levels of an alpha hydroxy neoactivity
product, e.g., 2HG, e.g., R-2HG.
[0233] In an embodiment the cell proliferation-related disorder is
acute myelogenous leukemia (e.g., an adult or pediatric form),
e.g., wherein the acute myelogenous leukemia (sometimes referred to
herein as AML) is characterized by an IDH1 somatic mutant having
alpha hydroxy neoactivity, e.g., 2HG neoactivity, e.g., a mutant
described herein. In an embodiment the cancer is characterized by
increased levels of an alpha hydroxy neoactivity product, e.g.,
2HG, e.g., R-2HG, as compared to non-diseased cells of the same
type. E.g., in an embodiment, the IDH1 allele is an IDH1 having
other than an Arg at residue 132 (SEQ ID NO:8). E.g., the allele
encodes His, Ser, Cys, Gly, Val, Pro or Leu, or any residue
described in Kang et al., at residue 132, according to the sequence
of SEQ ID NO:8 (see also FIG. 21) (e.g., His, Ser, Cys, Gly, Val or
Leu). In an embodiment the allele encodes an IDH1 having Cys, His
or Gly at residue 132, specifically, Cys.
[0234] In an embodiment the IDH1 allele has a T (or any other
nucleotide other than C) at nucleotide position 394. In an
embodiment the allele is a C394T mutation according to the sequence
of SEQ ID NO:5.
[0235] In an embodiment the method comprises selecting a subject
having acute myelogenous lymphoplastic leukemia (AML) characterized
by an IDH1 allele described herein, e.g., an IDH1 allele having
Cys, His or Gly at residue 132 according to the sequence of SEQ ID
NO:8, specifically, Cys.
[0236] In an embodiment the method comprises selecting a subject
having acute myelogenous lymphoplastic leukemia (AML) on the basis
of cancer being characterized by having an IDH1 allele described
herein, e.g., an IDH1 allele having Cys, His or Gly at residue 132
(SEQ ID NO:8), specifically, Cys.
[0237] In an embodiment the method comprises selecting a subject
having acute myelogenous lymphoplastic leukemia (AML), on the basis
of the cancer being characterized by increased levels of an alpha
hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG. In an
embodiment the method comprises evaluating a serum or blood sample
for increased alpha neoactivity product, e.g., 2HG, e.g.,
R-2HG.
[0238] In an embodiment the method further comprises evaluating the
subject for the presence of a mutation in the NRAS or NPMc
gene.
[0239] In an embodiment the cell proliferation-related disorder is
myelodysplasia or myelodysplastic syndrome, e.g., wherein the
myelodysplasia or myelodysplastic syndrome is characterized by
having an IDH1 somatic mutant having alpha hydroxy neoactivity,
e.g., 2HG neoactivity, e.g., a mutant described herein. In an
embodiment the disorder is characterized by increased levels of an
alpha hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG, as
compared to non-diseased cells of the same type. E.g., in an
embodiment, the IDH1 allele is an IDH1 having other than an Arg at
residue 132 (SEQ ID NO:8). E.g., the allele encodes His, Ser, Cys,
Gly, Val, Pro or Leu, or any residue described in Kang et al.,
according to the sequence of SEQ ID NO:8 (see also FIG. 21),
specifically, His, Ser, Cys, Gly, Val, or Leu. In an embodiment the
allele encodes an IDH1 having Cys at residue 132.
[0240] In an embodiment the IDH1 allele has a T (or any other
nucleotide other than C) at nucleotide position 394. In an
embodiment the allele is a C394T mutation according to the sequence
of SEQ ID NO:5.
[0241] In an embodiment the method comprises selecting a subject
having myelodysplasia or myelodysplastic syndrome characterized by
an IDH1 allele described herein, e.g., an IDH1 allele having Cys at
residue 132 according to the sequence of SEQ ID NO:8.
[0242] In an embodiment the method comprises selecting a subject
having myelodysplasia or myelodysplastic syndrome on the basis of
cancer being characterized by having an IDH1 allele described
herein, e.g., an IDH1 allele having Cys at residue 132 (SEQ ID
NO:8).
[0243] In an embodiment the method comprises selecting a subject
having myelodysplasia or myelodysplastic syndrome, on the basis of
the cancer being characterized by increased levels of an alpha
hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG. In an
embodiment the method comprises evaluating a serum or blood sample
for increased alpha neoactivity product, e.g., 2HG, e.g.,
R-2HG.
[0244] In an embodiment the cell proliferation-related disorder is
a glioma, characterized by a mutation, or preselected allele, of
IDH2 associated with an alpha hydroxy neoactivity, e.g., 2HG
neoactivity. E.g., in an embodiment, the IDH2 allele encodes an
IDH2 having other than an Arg at residue 172. E.g., the allele
encodes Lys, Gly, Met, Trp, Thr, Ser, or any residue described in
described in Yan et al., at residue 172, according to the sequence
of SEQ ID NO:10 (see also FIG. 22), specifically, Lys, Gly, Met,
Trp or Ser. In an embodiment the allele encodes an IDH2 having Lys
at residue 172. In an embodiment the allele encodes an IDH2 having
Met at residue 172.
[0245] In an embodiment the method comprises selecting a subject
having a glioma, wherein the cancer is characterized by having an
IDH2 allele described herein, e.g., an IDH2 allele having Lys, Gly,
Met, Trp, Thr, or Ser at residue 172 (SEQ ID NO:10), specifically
Lys, Gly, Met, Trp, or Ser; or Lys or Met.
[0246] In an embodiment the method comprises selecting a subject
having a glioma, on the basis of the cancer being characterized by
an IDH2 allele described herein, e.g., an IDH2 allele having Lys,
Gly, Met, Trp, Thr, or Ser at residue 172 (SEQ ID NO:10),
specifically Lys, Gly, Met, Trp, or Ser; or Lys or Met.
[0247] In an embodiment the method comprises selecting a subject
having a glioma, on the basis of the cancer being characterized by
increased levels of an alpha hydroxy neoactivity product, e.g.,
2HG, e.g., R-2HG.
[0248] In an embodiment the cell proliferation-related disorder is
a prostate cancer, e.g., prostate adenocarcinoma, characterized by
a mutation, or preselected allele, of IDH2 associated with an alpha
hydroxy neoactivity, e.g., 2HG neoactivity. E.g., in an embodiment,
the IDH2 allele encodes an IDH2 having other than an Arg at residue
172. E.g., the allele encodes Lys, Gly, Met, Trp, Thr, Ser, or any
residue described in described in Yan et al., at residue 172,
according to the sequence of SEQ ID NO:10 (see also FIG. 22),
specifically Lys, Gly, Met, Trp, or Ser. In an embodiment the
allele encodes an IDH2 having Lys at residue 172. In an embodiment
the allele encodes an IDH2 having Met at residue 172.
[0249] In an embodiment the method comprises selecting a subject
having a prostate cancer, e.g., prostate adenocarcinoma, wherein
the cancer is characterized by having an IDH2 allele described
herein, e.g., an IDH2 allele having Lys or Met at residue 172 (SEQ
ID NO:10).
[0250] In an embodiment the method comprises selecting a subject
having a prostate cancer, e.g., prostate adenocarcinoma, on the
basis of the cancer being characterized by an IDH2 allele described
herein, e.g., an IDH2 allele having Lys or Met at residue 172 (SEQ
ID NO:10).
[0251] In an embodiment the method comprises selecting a subject
having a prostate cancer, e.g., prostate adenocarcinoma, on the
basis of the cancer being characterized by increased levels of an
alpha hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG.
[0252] In an embodiment the cell proliferation-related disorder is
ALL, e.g., B-ALL or T-ALL, characterized by a mutation, or
preselected allele, of IDH2 associated with an alpha hydroxy
neoactivity, e.g., 2HG neoactivity. E.g., in an embodiment, the
IDH2 allele encodes an IDH2 having other than an Arg at residue
172. E.g., the allele encodes Lys, Gly, Met, Trp, Thr, Ser, or any
residue described in described in Yan et al., at residue 172,
according to the sequence of SEQ ID NO:10 (see also FIG. 22),
specifically Lys, Gly, Met, Trp, or Ser. In an embodiment the
allele encodes an IDH2 having Lys at residue 172. In an embodiment
the allele encodes an IDH2 having Met at residue 172.
[0253] In an embodiment the method comprises selecting a subject
having ALL, e.g., B-ALL or T-ALL, wherein the cancer is
characterized by having an IDH2 allele described herein, e.g., an
IDH2 allele having Lys or Met at residue 172 (SEQ ID NO:10).
[0254] In an embodiment the method comprises selecting a subject
having ALL, e.g., B-ALL or T-ALL, on the basis of the cancer being
characterized by an IDH2 allele described herein, e.g., an IDH2
allele having Lys or Met at residue 172 (SEQ ID NO:10).
[0255] In an embodiment the method comprises selecting a subject
having ALL, e.g., B-ALL or T-ALL, on the basis of the cancer being
characterized by increased levels of an alpha hydroxy neoactivity
product, e.g., 2HG, e.g., R-2HG. In an embodiment the method
comprises evaluating a serum or blood sample for increased alpha
neoactivity product, e.g., 2HG, e.g., R-2HG.
[0256] In an embodiment the cell proliferation-related disorder is
AML, characterized by a mutation, or preselected allele, of IDH2
associated with an alpha hydroxy neoactivity, e.g., 2HG
neoactivity. E.g., in an embodiment, the IDH2 allele encodes an
IDH2 having other than an Arg at residue 172. E.g., the allele
encodes Lys, Gly, Met, Trp, Thr, Ser, or any residue described in
described in Yan et al., at residue 172, according to the sequence
of SEQ ID NO:10 (see also FIG. 22), specifically Lys, Gly, Met,
Trp, or Ser. In an embodiment the allele encodes an IDH2 having Lys
at residue 172. In an embodiment the allele encodes an IDH2 having
Met at residue 172.
[0257] In an embodiment the method comprises selecting a subject
having AML, wherein the cancer is characterized by having an IDH2
allele described herein, e.g., an IDH2 allele having Lys or Met at
residue 172 (SEQ ID NO:10).
[0258] In an embodiment the method comprises selecting a subject
having AML, on the basis of the cancer being characterized by an
IDH2 allele described herein, e.g., an IDH2 allele having Lys or
Met at residue 172 (SEQ ID NO:10).
[0259] In an embodiment the method comprises selecting a subject
having AML, on the basis of the cancer being characterized by
increased levels of an alpha hydroxy neoactivity product, e.g.,
2HG, e.g., R-2HG. In an embodiment the method comprises evaluating
a serum or blood sample for increased alpha neoactivity product,
e.g., 2HG, e.g., R-2HG.
[0260] In an embodiment the cell proliferation-related disorder is
myelodysplasia or myelodysplastic syndrome, characterized by a
mutation, or preselected allele, of IDH2. E.g., in an embodiment,
the IDH2 allele encodes an IDH2 having other than an Arg at residue
172. E.g., the allele encodes Lys, Gly, Met, Trp, Thr, Ser, or any
residue described in described in Yan et al., at residue 172,
according to the sequence of SEQ ID NO:10 (see also FIG. 22),
specifically Lys, Gly, Met, Trp, or Ser. In an embodiment the
allele encodes an IDH2 having Lys at residue 172. In an embodiment
the allele encodes an IDH2 having Met at residue 172.
[0261] In an embodiment the method comprises selecting a subject
having myelodysplasia or myelodysplastic syndrome, wherein the
cancer is characterized by having an IDH2 allele described herein,
e.g., an IDH2 allele having Lys or Met at residue 172 (SEQ ID
NO:10).
[0262] In an embodiment the method comprises selecting a subject
having myelodysplasia or myelodysplastic syndrome, on the basis of
the cancer being characterized by an IDH2 allele described herein,
e.g., an IDH2 allele having Lys or Met at residue 172 (SEQ ID
NO:10).
[0263] In an embodiment the method comprises selecting a subject
having myelodysplasia or myelodysplastic syndrome, on the basis of
the cancer being characterized by increased levels of an alpha
hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG. In an
embodiment the method comprises evaluating a serum or blood sample
for increased alpha neoactivity product, e.g., 2HG, e.g.,
R-2HG.
[0264] In another aspect the invention features a pharmaceutical
composition of an inhibitor (e.g., a small molecule or a nucleic
acid-based inhibitor) described herein.
[0265] In an embodiment a mutant protein specific reagent, e.g., an
antibody that specifically binds an IDH mutant protein, e.g., an
antibody that specifically binds an IDH1-R132H mutant protein, can
be used to detect neoactive mutant enzyme see, for example, that
described by Y. Kato et al., "A monoclonal antibody IMab-1
specifically recognizes IDH1.sup.R132H, the most common
glioma-derived mutation: (Kato, Biochem. Biophys. Res. Commun.
(2009), which is hereby incorporated by reference in its
entirety.
[0266] In another aspect, the invention features, a method of
evaluating a candidate compound, e.g., for the ability to inhibit a
neoactivity of a mutant enzyme, e.g., for use as an
anti-proliferative or anti-cancer agent. In an embodiment the
mutant enzyme is an IDH, e.g., an IDH1 or IDH2 mutant, e.g., a
mutant described herein. In an embodiment the neaoctivity is alpha
hydroxy neoactivity, e.g., 2HG neoactivity. The method
comprises:
[0267] optionally supplying the candidate compound;
[0268] contacting the candidate compound with a mutant enzyme
having a neoactivity, or with another enzyme, a referred to herein
as a proxy enzyme, having an activity, referred to herein as a
proxy activity, which is the same as the neoactivity (or with a
cell or cell lysate comprising the same); and
[0269] evaluating the ability of the candidate compound to
modulate, e.g., inhibit or promote, the neoactivity or the proxy
activity, thereby evaluating the candidate compound.
[0270] In an embodiment the mutant enzyme is a mutant IDH1, e.g.,
an IDH1 mutant described herein, and the neoactivity is an alpha
hydroxy neoactivity, e.g., 2HG neoactivity. Mutations associated
with 2HG neoactivity in IDH1 include mutations at residue 132,
e.g., R132H, R132C, R132S, R132G, R132L, or R132V, more
specifically, R132H or R132C.
[0271] In an embodiment the mutant enzyme is a mutant IDH2, e.g.,
an IDH2 mutant described herein, and the neoactivity is an alpha
hydroxy neoactivity, e.g., 2HG neoactivity. Mutations associated
with 2HG neoactivity in IDH2 include mutations at residue 172,
e.g., R172K, R172M, R172S, R172G, or R172W.
[0272] In an embodiment the method includes evaluating the ability
of the candidate compound to inhibit the neoactivity or the proxy
activity.
[0273] In an embodiment the method further comprises evaluating the
ability of the candidate compound to inhibit the forward reaction
of non-mutant or wild type enzyme activity, e.g., in the case of
IDH, e.g., IDH1 or IDH2, the conversion of isocitrate to
.alpha.-ketoglutarate (or an intermediate thereof, including the
reduced hydroxyl intermediate).
[0274] In an embodiment, the contacting step comprises contacting
the candidate compound with a cell, or a cell lysate thereof,
wherein the cell comprises a mutant enzyme having the neoactivity
or an enzyme having the activity.
[0275] In an embodiment, the cell comprises a mutation, or
preselected allele, of a mutant IDH1 gene. E.g., in an embodiment,
the IDH1 allele encodes an IDH1 having other than an Arg at residue
132. E.g., the allele can encode His, Ser, Cys, Gly, Val, Pro or
Leu, or any other residue described in Yan et al., at residue 132,
according to the sequence of SEQ ID NO:8 (see also FIG. 21),
specifically His, Ser, Cys, Gly, Val, or Leu.
[0276] In an embodiment the allele encodes an IDH1 having His at
residue 132.
[0277] In an embodiment the allele encodes an IDH1 having Ser at
residue 132.
[0278] In an embodiment the allele is an Arg132His mutation, or an
Arg132Ser mutation, according to the sequence of SEQ ID NO:8 (see
FIGS. 2 and 21).
[0279] In an embodiment, the cell comprises a mutation, or
preselected allele, of a mutant IDH2 gene. E.g., in an embodiment,
the IDH2 allele encodes an IDH2 having other than an Arg at residue
172. E.g., the allele encodes Lys, Gly, Met, Trp, Thr, Ser, or any
residue described in described in Yan et al., at residue 172,
according to the sequence of SEQ ID NO:10 (see also FIG. 22),
specifically, Lys, Gly, Met, Trp, or Ser. In an embodiment the
allele encodes an IDH2 having Lys at residue 172. In an embodiment
the allele encodes an IDH2 having Met at residue 172.
[0280] In an embodiment, the cell includes a heterologous copy of a
mutant IDH gene, e.g., a mutant IDH1 or IDH2 gene. (Heterologous
copy refers to a copy introduced or formed by a genetic engineering
manipulation.)
[0281] In an embodiment, the cell is transfected (e.g., transiently
or stably transfected) or transduced (e.g., transiently or stably
transduced) with a nucleic acid sequence encoding an IDH, e.g.,
IDH1 or IDH2, described herein, e.g., an IDH1 having other than an
Arg at residue 132. In an embodiment, the IDH, e.g., IDH1 or IDH2,
is epitope-tagged, e.g., myc-tagged.
[0282] In an embodiment, the cell, e.g., a cancer cell, is
non-mutant or wild type for the IDH, e.g., IDH1 or IDH2, allele.
The cell can include a heterologous IDH1 or IDH2 mutant.
[0283] In an embodiment, the cell is a cultured cell, e.g., a
primary cell, a secondary cell, or a cell line. In an embodiment,
the cell is a cancer cell, e.g., a glioma cell (e.g., a
glioblastoma cell), a prostate cancer cell, a leukemia cell (e.g.,
an ALL, e.g., B-ALL or T-ALL, cell or AML cell) or a cell
characterized by myelodysplasia or myelodysplastic syndrome. In
embodiment, the cell is a 293T cell, a U87MG cell, or an LN-18 cell
(e.g., ATCC HTB-14 or CRL-2610).
[0284] In an embodiment, the cell is from a subject, e.g., a
subject having cancer, e.g., a cancer characterized by an IDH,
e.g., IDH1 or IDH2, allele described herein, e.g., an IDH1 allele
having His, Ser, Cys, Gly, Val, Pro or Leu at residue 132 (SEQ ID
NO:8); specifically His or Cys; or an IDH2 allele having Lys, Gly,
Met, Trp, Thr, or Ser at residue 172 (SEQ ID NO:10), specifically
Lys, Gly, Met, Trp, or Ser.
[0285] In an embodiment, the evaluating step comprises evaluating
the presence and/or amount of an alpha hydroxy neoactivity product,
e.g., 2HG, e.g., R-2HG, e.g., in the cell lysate or culture medium,
e.g., by LC-MS.
[0286] In an embodiment, the evaluating step comprises evaluating
the presence and/or amount of an alpha hydroxy neoactivity, e.g.,
2HG neoactivity, in the cell lysate or culture medium.
[0287] In an embodiment, the method further comprises evaluating
the presence/amount one or more of TCA metabolite(s), e.g.,
citrate, .alpha.-KG, succinate, fumarate, and/or malate, e.g., by
LC-MS, e.g., as a control.
[0288] In an embodiment, the method further comprises evaluating
the oxidation state of NADPH, e.g., the absorbance at 340 nm, e.g.,
by spectrophotometer.
[0289] In an embodiment, the method further comprises evaluating
the ability of the candidate compound to inhibit a second enzymatic
activity, e.g., the forward reaction of non-mutant or wild type
enzyme activity, e.g., in the case of IDH1 or IDH2 (e.g., IDH1),
the conversion of isocitrate to .alpha.-ketoglutarate (or an
intermediate thereof, including the reduced hydroxyl
intermediate).
[0290] In an embodiment, the candidate compound is a small
molecule, a polypeptide, peptide, a carbohydrate based molecule, or
an aptamer (e.g., a nucleic acid aptamer, or a peptide aptamer).
The method can be used broadly and can, e.g., be used as one or
more of a primary screen, to confirm candidates produced by this or
other methods or screens, or generally to guide drug discovery or
drug candidate optimization.
[0291] In an embodiment, the method comprises evaluating, e.g.,
confirming, the ability of a candidate compound (e.g., a candidate
compound which meets a predetermined level of inhibition in the
evaluating step) to inhibit the neoactivity or proxy activity in a
second assay.
[0292] In an embodiment, the second assay comprises repeating one
or more of the contacting and/or evaluating step(s) of the basic
method.
[0293] In another embodiment, the second assay is different from
the first. E.g., where the first assay can use a cell or cell
lysate or other non-whole animal model the second assay can use an
animal model, e.g., a tumor transplant model, e.g., a mouse having
an IDH, e.g., IDH1 or IDH2, mutant cell or tumor transplanted in
it. E.g., a U87 cell, or glioma, e.g., glioblastoma, cell,
harboring a transfected IDH, e.g., IDH1 or IDH2, neoactive mutant
can be implanted as a xenograft and used in an assay. Primary human
glioma or AML tumor cells can be grafted into mice to allow
propogation of the tumor and used in an assay. A genetically
engineered mouse model (GEMM) harboring an IDH1 or IDH2 mutation
and/or other mutation, e.g., a p53 null mutation, can also be used
in an assay.
[0294] In an embodiment the method comprises:
[0295] optionally supplying the candidate compound;
[0296] contacting the candidate compound with a cell comprising a
nucleic acid sequence, e.g., a heterologous sequence, encoding an
IDH1 having other than an Arg at residue 132 (e.g., IDH1R132H) or
an IDH2 having other than an Arg at residue 172 (specifically an
IDH1 having other than an Arg at residue 132); and
[0297] evaluating the presence and/or amount of an alpha hydroxy
neoactivity product, e.g., 2HG, e.g., R-2HG, in the cell lysate or
culture medium, by LC-MS, thereby evaluating the compound.
[0298] In an embodiment the result of the evaluation is compared
with a reference, e.g., the level of product, e.g., an alpha
hydroxy neoactivity product, e.g., 2HG. e.g., R-2HG, in a control
cell, e.g., a cell having inserted therein a wild type or
non-mutant copy of IDH1 or IDH2 (e.g., IDH1).
[0299] In another aspect, the invention features, a method of
evaluating a candidate compound, e.g., for the ability to inhibit
an RNA encoding a mutant enzyme having a neoactivity, e.g., for use
as an anti-proliferative or anti-cancer agent. In an embodiment the
mutant enzyme is an IDH, e.g., an IDH1 or IDH2 mutant, e.g., a
mutant described herein. In an embodiment the neaoctivity is alpha
hydroxy neoactivity, e.g., 2HG neoactivity. The method
comprises:
[0300] optionally supplying the candidate compound, e.g., a nucleic
acid based inhibitor (e.g., a dsRNA (e.g., siRNA or shRNA), an
antisense, or a microRNA);
[0301] contacting the candidate compound with an RNA, e.g., an
mRNA, which encodes IDH, e.g., an IDH1 or IDH2, e.g., an RNA that
encode mutant enzyme having a neoactivity (or with a cell or cell
lysate comprising the same); and
[0302] evaluating the ability of the candidate compound to inhibit
the RNA, thereby evaluating the candidate compound. By inhibit the
RNA means, e.g., to cleave or otherwise inactivate the RNA.
[0303] In an embodiment the RNA encodes a fusion of all or part of
the IDH, e.g., IDH1 or IDH2, wildtype or mutant protein to a second
protein, e.g., a reporter protein, e.g., a fluorescent protein,
e.g., a green or red fluorescent protein.
[0304] In an embodiment the mutant enzyme is a mutant IDH1, e.g.,
an IDH1 mutant described herein, and the neoactivity is an alpha
hydroxy neoactivity, e.g., 2HG neoactivity.
[0305] In an embodiment the mutant enzyme is a mutant IDH2, e.g.,
an IDH2 mutant described herein, and the neoactivity is an alpha
hydroxy neoactivity, e.g., 2HG neoactivity.
[0306] In an embodiment, the contacting step comprises contacting
the candidate compound with a cell, or a cell lysate thereof,
wherein the cell comprises RNA encoding IDH, e.g., IDH1 or IDH2,
e.g., a mutant IDH, e.g., IDH1 or IDH2, enzyme having the
neoactivity.
[0307] In an embodiment, the cell comprises a mutation, or
preselected allele, of a mutant IDH1 gene. E.g., in an embodiment,
the IDH1 allele encodes an IDH1 having other than an Arg at residue
132. E.g., the allele can encode His, Ser, Cys, Gly, Val, Pro or
Leu, or any other residue described in Yan et al., at residue 132,
according to the sequence of SEQ ID NO:8 (see also FIG. 21),
specifically His, Ser, Cys, Gly, Val, or Leu.
[0308] In an embodiment the allele encodes an IDH1 having His at
residue 132.
[0309] In an embodiment the allele encodes an IDH1 having Ser at
residue 132.
[0310] In an embodiment the allele is an Arg132His mutation, or an
Arg132Ser mutation, according to the sequence of SEQ ID NO:8 (see
FIGS. 2 and 21).
[0311] In an embodiment, the cell comprises a mutation, or
preselected allele, of a mutant IDH2 gene. E.g., in an embodiment,
the IDH2 allele encodes an IDH2 having other than an Arg at residue
172. E.g., the allele encodes Lys, Gly, Met, Trp, Thr, Ser, or any
residue described in described in Yan et al., at residue 172,
according to the sequence of SEQ ID NO:10 (see also FIG. 22),
specifically Lys, Gly, Met, Trp or Ser. In an embodiment the allele
encodes an IDH2 having Lys at residue 172. In an embodiment the
allele encodes an IDH2 having Met at residue 172.
[0312] In an embodiment, the cell includes a heterologous copy of a
wildtype or mutant IDH gene, e.g., a wildtype or mutant IDH1 or
IDH2 gene. (Heterologous copy refers to a copy introduced or formed
by a genetic engineering manipulation.) In an embodiment the
heterologous gene comprises a fusion to a reporter protein, e.g., a
fluorescent protein, e.g., a green or red fluorescent protein.
[0313] In an embodiment, the cell is transfected (e.g., transiently
or stably transfected) or transduced (e.g., transiently or stably
transduced) with a nucleic acid sequence encoding an IDH, e.g.,
IDH1 or IDH2, described herein, e.g., an IDH1 having other than an
Arg at residue 132 or an IDH2 having other than an Arg at residue
172 (e.g., an IDH1 having other than an Arg at residue 132). In an
embodiment, the IDH, e.g., IDH1 or IDH2, is epitope-tagged, e.g.,
myc-tagged.
[0314] In an embodiment, the cell, e.g., a cancer cell, is
non-mutant or wild type for the IDH, e.g., IDH1 or IDH2, allele.
The cell can include a heterologous IDH1 or IDH2 mutant.
[0315] In an embodiment, the cell is a cultured cell, e.g., a
primary cell, a secondary cell, or a cell line. In an embodiment,
the cell is a cancer cell, e.g., a glioma cell (e.g., a
glioblastoma cell), a prostate cancer cell, a leukemia cell (e.g.,
an ALL, e.g., B-ALL or T-ALL cell or AML cell) or a cell
characterized by myelodysplasia or myelodysplastic syndrome. In
embodiment, the cell is a 293T cell, a U87MG cell, or an LN-18 cell
(e.g., ATCC HTB-14 or CRL-2610).
[0316] In an embodiment, the cell is from a subject, e.g., a
subject having cancer, e.g., a cancer characterized by an IDH,
e.g., IDH1 or IDH2, allele described herein, e.g., an IDH1 allele
having His, Ser, Cys, Gly, Val, Pro or Leu at residue 132 (SEQ ID
NO:8); specifically His or Cys. In an embodiment, the cancer is
characterized by an IDH2 allele having Lys, Gly, Met, Trp, Thr, or
Ser at residue 172 (SEQ ID NO:10), specifically Lys, Gly, Met, Trp,
or Ser.
[0317] In an embodiment, the method comprises a second assay and
the second assay comprises repeating one or more of the contacting
and/or evaluating step(s) of the basic method.
[0318] In another embodiment, the second assay is different from
the first. E.g., where the first assay can use a cell or cell
lysate or other non-whole animal model the second assay can use an
animal model
[0319] In an embodiment the efficacy of the candidate is evaluated
by its effect on reporter protein activity.
[0320] In another aspect, the invention features, a method of
evaluating a candidate compound, e.g., for the ability to inhibit
transcription of an RNA encoding a mutant enzyme having a
neoactivity, e.g., for use as an anti-proliferative or anti-cancer
agent. In an embodiment the mutant enzyme is an IDH, e.g., an IDH1
or IDH2 mutant, e.g., a mutant described herein. In an embodiment
the neaoctivity is alpha hydroxy neoactivity, e.g., 2HG
neoactivity. The method comprises:
[0321] optionally supplying the candidate compound, e.g., a small
molecule, polypeptide, peptide, aptomer, a carbohydrate-based
molecule or nucleic acid based molecule;
[0322] contacting the candidate compound with a system comprising a
cell or cell lysate; and
[0323] evaluating the ability of the candidate compound to inhibit
the translation of IDH, e.g., IDH1 or IDH2, RNA, e.g, thereby
evaluating the candidate compound.
[0324] In an embodiment the system comprises a fusion gene encoding
of all or part of the IDH, e.g., IDH1 or IDH2, wildtype or mutant
protein to a second protein, e.g., a reporter protein, e.g., a
fluorescent protein, e.g., a green or red fluorescent protein.
[0325] In an embodiment the mutant enzyme is a mutant IDH1, e.g.,
an IDH1 mutant described herein, and the neoactivity is alpha
hydroxy neoactivity, e.g., 2HG neoactivity.
[0326] In an embodiment the mutant enzyme is a mutant IDH2, e.g.,
an IDH2 mutant described herein, and the neoactivity is alpha
hydroxy neoactivity, e.g., 2HG neoactivity.
[0327] In an embodiment, the system includes a heterologous copy of
a wildtype or mutant IDH gene, e.g., a wildtype or mutant IDH1 or
IDH2 gene. (Heterologous copy refers to a copy introduced or formed
by a genetic engineering manipulation.) In an embodiment the
heterologous gene comprises a fusion to a reporter protein, e.g., a
fluorescent protein, e.g., a green or red fluorescent protein.
[0328] In an embodiment the cell, e.g., a cancer cell, is
non-mutant or wild type for the IDH, e.g., IDH1 or IDH2, allele.
The cell can include a heterologous IDH1 or IDH2 mutant.
[0329] In an embodiment, the cell is a cultured cell, e.g., a
primary cell, a secondary cell, or a cell line. In an embodiment,
the cell is a cancer cell, e.g., a glioma cell (e.g., a
glioblastoma cell), a prostate cancer cell, a leukemia cell (e.g.,
an ALL, e.g., B-ALL or T-ALL, cell or AML cell) or a cell
characterized by myelodysplasia or myelodysplastic syndrome. In
embodiment, the cell is a 293T cell, a U87MG cell, or an LN-18 cell
(e.g., ATCC HTB-14 or CRL-2610).
[0330] In an embodiment, the cell is from a subject, e.g., a
subject having cancer, e.g., a cancer characterized by an IDH,
e.g., IDH1 or IDH2, allele described herein, e.g., an IDH1 allele
having His, Ser, Cys, Gly, Val, Pro or Leu at residue 132 (SEQ ID
NO:8); specifically His, Ser, Cys, Gly, Val, or Leu. In an
embodiment, the cancer is characterized an IDH2 allele having Lys,
Gly, Met, Trp, Thr, or Ser at residue 172 (SEQ ID NO:10).
[0331] In an embodiment, the method comprises a second assay and
the second assay comprises repeating the method.
[0332] In another embodiment, the second assay is different from
the first. E.g., where the first assay can use a cell or cell
lysate or other non-whole animal model the second assay can use an
animal model.
[0333] In an embodiment the efficacy of the candidate is evaluated
by its effect on reporter protein activity.
[0334] In another aspect, the invention features, a method of
evaluating a candidate compound, e.g., a therapeutic agent, or
inhibitor, described herein in an animal model. The candidate
compound can be, e.g., a small molecule, polypeptide, peptide,
aptomer, a carbohydrate-based molecule or nucleic acid based
molecule. The method comprises, contacting the candidate with the
animal model and evaluating the animal model.
[0335] In an embodiment evaluating comprises;
[0336] determining an effect of the compound on the general health
of the animal;
[0337] determining an effect of the compound on the weight of the
animal;
[0338] determining an effect of the compound on liver function,
e.g, on a liver enzyme;
[0339] determining an effect of the compound on the cardiovascular
system of the animal;
[0340] determining an effect of the compound on neurofunction,
e.g., on neuromuscular control or response;
[0341] determining an effect of the compound on eating or
drinking;
[0342] determining the distribution of the compound in the
animal;
[0343] determining the persistence of the compound in the animal or
in a tissue or oragn of the animal, e.g., determining plasma
half-life; or
[0344] determining an effect of the compound on a selected cell in
the animal;
[0345] determining an effect of the compound on the growth, size,
weight, invasiveness or other phenotype of a tumor, e.g., an
endogenous tumor or a tumor arising from introduction of cells from
the same or a different species.
[0346] In an embodiment the animal is a non-human primate, e.g., a
cynomolgus monkey or chimpanzee.
[0347] In an embodiment the animal is a rodent, e.g., a rat or
mouse.
[0348] In an embodiment the animal is a large animal, e.g., a dog
or pig, other than a non-human primate.
[0349] In an embodiment the evaluation is memorialized and
optionally transmitted to another party.
[0350] In one aspect, the invention provides, a method of
evaluating or processing a therapeutic agent, e.g., a therapeutic
agent referred to herein, e.g., a therapeutic agent that results in
a lowering of the level of a product of an IDH, e.g., IDH1 or IDH2,
mutant having a neoactivity. In an embodiment the neoactivity is an
alpha hydroxy neoactivity, e.g., 2HG neoactivity, and the level of
an alpha hydroxy neoactivity product, e.g., 2HG e.g., R-2HG is
lowered.
[0351] The method includes:
[0352] providing, e.g., by testing a sample, a value (e.g., a test
value) for a parameter related to a property of the therapeutic
agent, e.g., the ability to inhibit the conversion of alpha
ketoglutarate to 2 hydroxyglutarate (i.e., 2HG), e.g., R-2
hydroxyglutarate (i.e., R-2HG), and,
[0353] optionally, providing a determination of whether the value
determined for the parameter meets a preselected criterion, e.g.,
is present, or is present within a preselected range,
[0354] thereby evaluating or processing the therapeutic agent.
[0355] In an embodiment the therapeutic agent is approved for use
in humans by a government agency, e.g., the FDA.
[0356] In an embodiment the parameter is correlated to the ability
to inhibit 2HG neoactivity, and, e.g., the therapeutic agent is an
inhibitor which binds to IDH1 or IDH2 protein and reduces an alpha
hydroxy neoactivity, e.g., 2HG neoactivity.
[0357] In an embodiment the parameter is correlated to the level of
mutant IDH, e.g., IDH1 or IDH2, protein, and, e.g., the therapeutic
agent is an inhibitor which reduces the level of IDH1 or IDH2
mutant protein.
[0358] In an embodiment the parameter is correlated to the level of
an RNA that encodes a mutant IDH, e.g., IDH1 or IDH2, protein, and,
e.g., the therapeutic agent reduces the level of RNA, e.g., mRNA,
that encodes IDH1 or IDH2 mutant protein.
[0359] In an embodiment the method includes contacting the
therapeutic agent with a mutant IDH, e.g., IDH1 or IDH2, protein
(or corresponding RNA).
[0360] In an embodiment, the method includes providing a comparison
of the value determined for a parameter with a reference value or
values, to thereby evaluate the therapeutic agent. In an
embodiment, the comparison includes determining if a test value
determined for the therapeutic agent has a preselected relationship
with the reference value, e.g., determining if it meets the
reference value. The value need not be a numerical value but, e.g.,
can be merely an indication of whether an activity is present.
[0361] In an embodiment the method includes determining if a test
value is equal to or greater than a reference value, if it is less
than or equal to a reference value, or if it falls within a range
(either inclusive or exclusive of one or both endpoints). In an
embodiment, the test value, or an indication of whether the
preselected criterion is met, can be memorialized, e.g., in a
computer readable record.
[0362] In an embodiment, a decision or step is taken, e.g., a
sample containing the therapeutic agent, or a batch of the
therapeutic agent, is classified, selected, accepted or discarded,
released or withheld, processed into a drug product, shipped, moved
to a different location, formulated, labeled, packaged, contacted
with, or put into, a container, e.g., a gas or liquid tight
container, released into commerce, or sold or offered for sale, or
a record made or altered to reflect the determination, depending on
whether the preselected criterion is met. E.g., based on the result
of the determination or whether an activity is present, or upon
comparison to a reference standard, the batch from which the sample
is taken can be processed, e.g., as just described.
[0363] The evaluation of the presence or level of activity can show
if the therapeutic agent meets a reference standard.
[0364] In an embodiment, methods and compositions disclosed herein
are useful from a process standpoint, e.g., to monitor or ensure
batch-to-batch consistency or quality, or to evaluate a sample with
regard to a reference, e.g., a preselected value.
[0365] In an embodiment, the method can be used to determine if a
test batch of a therapeutic agent can be expected to have one or
more of the properties. Such properties can include a property
listed on the product insert of a therapeutic agent, a property
appearing in a compendium, e.g., the US Pharmacopea, or a property
required by a regulatory agency, e.g., the FDA, for commercial
use.
[0366] In an embodiment the method includes testing the therapeutic
agent for its effect on the wildtype activity of an IDH, e.g., IDH1
or IDH2, protein, and providing a determination of whether the
value determined meets a preselected criterion, e.g., is present,
or is present within a preselected range.
[0367] In an embodiment the method includes:
[0368] contacting a therapeutic agent that is an inhibitor of IDH1
an alpha hydroxy neoactivity, e.g., 2HG neoactivity, with an IDH1
mutant having an alpha hydroxy neoactivity, e.g., 2HG
neoactivity,
[0369] determining a value related to the inhibition of an alpha
hydroxy neoactivity, e.g., 2HG neoactivity, and
[0370] comparing the value determined with a reference value, e.g.,
a range of values, for the inhibition of an alpha hydroxy
neoactivity, e.g., 2HG neoactivity. In an embodiment the reference
value is an FDA required value, e.g., a release criteria.
[0371] In an embodiment the method includes:
[0372] contacting a therapeutic agent that is an inhibitor of mRNA
which encodes a mutant IDH1 having an alpha hydroxy neoactivity,
e.g., 2HG neoactivity, with an mRNA that encodes an IDH1 mutant
having an alpha hydroxy neoactivity, e.g., 2HG neoactivity,
[0373] determining a value related to the inhibition of the mRNA,
and,
[0374] comparing the value determined with a reference value, e.g.,
a range of values for inhibition of the mRNA. In an embodiment the
reference value is an FDA required value, e.g., a release
criteria.
[0375] In one aspect, the invention features a method of evaluating
a sample of a therapeutic agent, e.g., a therapeutic agent referred
to herein, that includes receiving data with regard to an activity
of the therapeutic agent; providing a record which includes said
data and optionally includes an identifier for a batch of
therapeutic agent; submitting said record to a decision-maker,
e.g., a government agency, e.g., the FDA; optionally, receiving a
communication from said decision maker; optionally, deciding
whether to release market the batch of therapeutic agent based on
the communication from the decision maker. In one embodiment, the
method further includes releasing, or other wise processing, e.g.,
as described herein, the sample.
[0376] In another aspect, the invention features, a method of
selecting a payment class for treatment with a therapeutic agent
described herein, e.g., an inhibitor of IDH, e.g., IDH1 or IDH2,
neoactivity, for a subject having a cell proliferation-related
disorder. The method includes:
[0377] providing (e.g., receiving) an evaluation of whether the
subject is positive for increased levels of an alpha hydroxy
neoactivity product, e.g., 2HG, e.g., R-2HG, or neoactivity, e.g.,
an alpha hydroxy neoactivity, e.g., 2HG neoactivity, a mutant IDH1
or IDH2 having neoactivity, e.g., an alpha hydroxy neoactivity,
e.g., 2HG neoactivity, (or a corresponding RNA), or a mutant IDH,
e.g., IDH1 or IDH2, somatic gene, e.g., a mutant described herein,
and
[0378] performing at least one of (1) if the subject is positive
selecting a first payment class, and (2) if the subject is a not
positive selecting a second payment class.
[0379] In an embodiment the selection is memorialized, e.g., in a
medical records system.
[0380] In an embodiment the method includes evaluation of whether
the subject is positive for increased levels of an alpha hydroxy
neoactivity product, e.g., 2HG, e.g., R-2HG, or neoactivity, e.g.,
an alpha hydroxy neoactivity, e.g., 2HG neoactivity.
[0381] In an embodiment the method includes requesting the
evaluation.
[0382] In an embodiment the evaluation is performed on the subject
by a method described herein.
[0383] In an embodiment, the method comprises communicating the
selection to another party, e.g., by computer, compact disc,
telephone, facsimile, email, or letter.
[0384] In an embodiment, the method comprises making or authorizing
payment for said treatment.
[0385] In an embodiment, payment is by a first party to a second
party. In some embodiments, the first party is other than the
subject. In some embodiments, the first party is selected from a
third party payor, an insurance company, employer, employer
sponsored health plan, HMO, or governmental entity. In some
embodiments, the second party is selected from the subject, a
healthcare provider, a treating physician, an HMO, a hospital, a
governmental entity, or an entity which sells or supplies the drug.
In some embodiments, the first party is an insurance company and
the second party is selected from the subject, a healthcare
provider, a treating physician, an HMO, a hospital, a governmental
entity, or an entity which sells or supplies the drug. In some
embodiments, the first party is a governmental entity and the
second party is selected from the subject, a healthcare provider, a
treating physician, an HMO, a hospital, an insurance company, or an
entity which sells or supplies the drug.
[0386] As used herein, a cell proliferation-related disorder is a
disorder characterized by unwanted cell proliferation or by a
predisposition to lead to unwanted cell proliferation (sometimes
referred to as a precancerous disorder). Examples of disorders
characterized by unwanted cell proliferation include cancers, e.g.,
tumors of the CNS, e.g., a glioma. Gliomas include astrocytic
tumors, oligodendroglial tumors, oligoastrocytic tumors, anaplastic
astrocytomas, and glioblastomas. Other examples include
hematological cancers, e.g., a leukemia, e.g., AML (e.g., an adult
or pediatric form) or ALL, e.g., B-ALL or T-ALL (e.g., an adult or
pediatric form), localized or metastatic prostate cancer, e.g.,
prostate adenocarcinoma, fibrosarcoma, and paraganglioma;
specifically a leukemia, e.g., AML (e.g., an adult or pediatric
form) or ALL, e.g., B-ALL or T-ALL (e.g., an adult or pediatric
form), localized or metastatic prostate cancer, e.g., prostate
adenocarcinoma. Examples of disorders characterized by a
predisposition to lead to unwanted cell proliferation include
myelodysplasia or myelodysplastic syndrome, which are a diverse
collection of hematological conditions marked by ineffective
production (or dysplasia) of myeloid blood cells and risk of
transformation to AML.
[0387] As used herein, specifically inhibits a neoactivity (and
similar language), means the neoactivity of the mutant enzyme is
inhibited to a significantly greater degree than is the wildtype
enzyme activity. By way of example, "specifically inhibits the 2HG
neoactivity of mutant IDH1 (or IDH2)" means the 2HG neoactivity is
inhibited to a significantly greater degree than is the forward
reaction (the conversion of isocitrate to alpha ketoglutarate) of
wildtype IDH1 (or IDH2) activity. In embodiments the neactivity is
inhibited at least 2, 5, 10, or 100 fold more than the wildtype
activity. In embodiments an inhibitor that is specific for the 2HG
neaoctivity of IDH, e.g., IDH1 or IDH2, will also inhibit another
dehydrogenase, e.g., malate dehydrogenase. In other embodiments the
specific inhibitor does inhibit other dehydrogenases, e.g., malate
dehydrogenase.
[0388] As used herein, a cell proliferation-related disorder, e.g.,
a cancer, characterized by a mutation or allele, means a cell
proliferation-related disorder having a substantial number of cells
which carry that mutation or allele. In an embodiment at least 10,
25, 50, 75, 90, 95 or 99% of the cell proliferation-related
disorder cells, e.g., the cells of a cancer, or a representative,
average or typical sample of cancer cells, e.g., from a tumor or
from affected blood cells, carry at least one copy of the mutation
or allele. A cell proliferation-related disorder, characterized by
a mutant IDH, e.g., a mutant IDH1 or mutant IDH2, having 2HG
neoactivity is exemplary. In an embodiment the mutation or allele
is present as a heterozygote at the indicated frequencies.
[0389] As used herein, a "SNP" is a DNA sequence variation
occurring when a single nucleotide (A, T, C, or G) in the genome
(or other shared sequence) differs between members of a species (or
between paired chromosomes in an individual).
[0390] As used herein, a subject can be a human or non-human
subject. Non-human subjects include non-human primates, rodents,
e.g., mice or rats, or other non-human animals.
[0391] The details of one or more embodiments of the invention are
set forth in the description below. Other features, objects, and
advantages of the invention will be apparent from the description
and the drawings, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0392] FIG. 1 depicts DNA sequence verification of pET41a-IDH1 and
alignment against published IDH1 CDS. The sequence of IDH1 (CDS)
corresponds to SEQ ID NO:5. The sequence of pET41a-IDH1 corresponds
to SEQ ID NO:6, and the "consensus" sequence corresponds to SEQ ID
NO:7.
[0393] FIG. 2 depicts DNA sequence verification of R132S and R132H
mutants according to the SEQ ID NO:8. The amino acid sequence of
IDH1 (SEQ ID NO:8) is provided in FIG. 21.
[0394] FIG. 3 depicts separation of wild type IDH1 protein on
Ni-Sepharose column.
[0395] FIG. 4 depicts protein analysis of wild type IDH1 on SDS gel
pre and post Ni column fractionation. T: total protein; I:
insoluble fractions; S: soluble fraction; L: sample for loading on
Ni-column. The numbers in the figure indicates the fraction
numbers. Fractions #17.about.#27 were collected for further
purification.
[0396] FIG. 5A depicts separation of wild type IDH1 protein through
SEC column S-200.
[0397] FIG. 5B depicts protein analysis of wild type IDH1 on SDS
gel pre and post S-200 column fractionation. M: molecular weight
marker; Ni: nickel column fraction prior to S-200; S200: fraction
from SEC column.
[0398] FIG. 6 depicts separation of mutant R132S protein on
Ni-Sepharose column.
[0399] FIG. 7 depicts protein analysis of mutant R132S on SDS gel
pre and post Ni column fractionation. M: protein marker (KDa): 116,
66.2, 45, 35, 25, 18.4, 14.4; T: total cell protein; So: soluble
fraction; In: insoluble fraction; Ft: flow through. #3-#7 indicate
the corresponding eluted fraction numbers.
[0400] FIG. 8A depicts separation of mutant R132S protein through
SEC column S-200.
[0401] FIG. 8B depicts protein analysis of mutant R132S on SDS gel
post S-200 column fractionation. M: molecular weight marker; R132S:
fraction from SEC column.
[0402] FIG. 9 depicts separation of mutant R132H protein on
Ni-Sepharose column.
[0403] FIG. 10 depicts protein analysis of mutant R132H on SDS gel
pre and post Ni column fractionation. M: protein marker (KDa): 116,
66.2, 45, 35, 25, 18.4, 14.4; T: total cell protein; So: soluble
fraction; In: insoluble fraction; Ft: flow through; #5-#10 indicate
the corresponding eluted fraction numbers; Ni: sample from
Ni-Sepharose column, pool #5-#10 together.
[0404] FIG. 11A depicts separation of mutant R132H protein through
SEC column S-200.
[0405] FIG. 11B depicts protein analysis of mutant R132H on SDS gel
post S-200 column fractionation. M: molecular weight marker; R132H:
fraction from SEC column.
[0406] FIG. 12A depicts Michaelis-Menten plot of IDH1 wild-type in
the oxidative decarboxylation of ioscitrate to
.alpha.-ketoglutarate.
[0407] FIG. 12B depicts Michaelis-Menten plot of R132H mutant
enzyme in the oxidative decarboxylation of ioscitrate to
.alpha.-ketoglutarate.
[0408] FIG. 12C depicts Michaelis-Menten plot of R132S mutant
enzyme in the oxidative decarboxylation of ioscitrate to
.alpha.-ketoglutarate.
[0409] FIG. 13A depicts .alpha.-KG inhibition of IDH1
wild-type.
[0410] FIG. 13B depicts .alpha.-KG inhibition of R132H mutant
enzyme.
[0411] FIG. 13C depicts .alpha.-KG inhibition of R132S mutant
enzyme.
[0412] FIG. 14 depicts IDH1 wt, R132H, and R132S in the conversion
.alpha.-ketoglutarate to 2-hydroxyglutarate.
[0413] FIG. 15A depicts Substrate-Concentration velocity plot for
R132H mutant enzyme.
[0414] FIG. 15B depicts Substrate-Concentration velocity plot for
R132S mutant enzyme.
[0415] FIG. 16 depicts IDH1 wt, R132H, and R132S in the conversion
.alpha.-ketoglutarate to 2-hydroxyglutarate with NADH.
[0416] FIG. 17A depicts oxalomalate inhibition to IDH1 wt.
[0417] FIG. 17B depicts oxalomalate inhibition to R132H.
[0418] FIG. 17C depicts oxalomalate inhibition to R132S.
[0419] FIG. 18A depicts LC-MS/MS analysis of the control
reaction.
[0420] FIG. 18B depicts LC-MS/MS analysis of the reaction
containing enzyme.
[0421] FIG. 18C depicts LC-MS/MS analysis of the spiked control
reaction.
[0422] FIG. 19 depicts LC-MS/MS analysis of
alpha-hydroxyglutarate.
[0423] FIG. 20 depicts LC-MS/MS analysis showing that R132H
consumes .alpha.-KG to produce 2-hydroxyglutaric acid.
[0424] FIG. 21 depicts the amino acid sequence of IDH1 (SEQ ID
NO:13) as described in GenBank Accession No. NP_005887.2 (GI No.
28178825) (record dated May 10, 2009).
[0425] FIG. 21A is the cDNA sequence of IDH1 as presented at
GenBank Accession No. NM_005896.2 (Record dated May 10, 2009; GI
No. 28178824) (SEQ ID NO:8).
[0426] FIG. 21B depicts the mRNA sequence of IDH1 as described in
GenBank Accession No. NM_005896.2 (Record dated May 10, 2009; GI
No. 28178824) (SEQ ID NO:9).
[0427] FIG. 22 is the amino acid sequence of IDH2 as presented at
GenBank Accession No. NM_002168.2 (Record dated Aug. 16, 2009;
GI28178831) (SEQ ID NO:10).
[0428] FIG. 22A is the cDNA sequence of IDH2 as presented at
GenBank Accession No. NM_002168 (Record dated Aug. 16, 2009;
GI28178831) (SEQ ID NO:11).
[0429] FIG. 22B is the mRNA sequence of IDH2 as presented at
GenBank Accession No. NM_002168.2 (Record dated Aug. 16, 2009;
GI28178831) (SEQ ID NO:12).
[0430] FIG. 23 depicts the progress of forward reactions
(isocitrate to .alpha.-KG) for the mutant enzyme R132H and
R132S.
[0431] FIG. 24A depicts LC-MS/MS analysis of derivitized 2-HG
racemic mixture.
[0432] FIG. 24B depicts LC-MS/MS analysis of derivitized R-2HG
standard.
[0433] FIG. 24C depicts LC-MS/MS analysis of a coinjection of
derivitized 2-HG racemate and R-2-HG standard.
[0434] FIG. 24D depicts LC-MS/MS analysis of the deriviatized
neoactivity reaction product.
[0435] FIG. 24E depicts LC-MS/MS analysis of a coinjection of the
neoactivty enzyme reaction product and the R-2-HG standard.
[0436] FIG. 24F depicts LC-MS/MS analysis of a coinjection of the
neoactivity enzyme reaction product and the 2-HG racemic
mixture.
[0437] FIG. 25 depicts the inhibitory effect of 2-HG derived from
the reduction of .alpha.-KG by ICDH1 R132H on the wild-type ICDH1
catalytic oxidative decarboxylation of isocitrate to
.alpha.-KG.
[0438] FIG. 26A depicts levels of 2-HG in CRL-2610 cell lines
expressing wildtype or IDH-1 R132H mutant protein.
[0439] FIG. 26B depicts levels of 2-HG in HTB-14 cell lines
expressing wildtype or IDH-1 R132H mutant protein.
[0440] FIG. 27 depicts human IDH1 genomic DNA: intron/2.sup.nd exon
sequence.
[0441] FIG. 28 depicts concentrations of 2HG in human malignant
gliomas containing R132 mutations in IDH1. Human glioma samples
obtained by surgical resection were snap frozen, genotyped to
stratify as wild-type (WT) (N=10) or carrying an R132 mutant allele
(Mutant) (n=12) and metabolites extracted for LC-MS analysis. Among
the 12 mutant tumors, 10 carried a R132H mutation, one an R132S
mutation, and one an R132G mutation. Each symbol represents the
amount of the listed metabolite found in each tumor sample. Red
lines indicate the group sample means. The difference in 2HG
observed between WT and R132 mutant IDH1 mutant tumors was
statistically significant by Student's t-test (p<0.0001). There
were no statistically significant differences in .alpha.KG, malate,
fumarate, succinate, or isocitrate levels between the WT and R132
mutant IDH1 tumors.
[0442] FIG. 29A depicts the structural analysis of R132H mutant
IDH1. On left is shown an overlay structure of R132H mutant IDH1
and WT IDH1 in the `closed` conformation. On the right is shown an
overlay structure of WT IDH1 in the `open` conformation with mutant
IDH1 for comparison.
[0443] FIG. 29B depicts the close-up structural comparison of the
R132H IDH1 (left) and wild-type (WT) IDH1 (right) active-site
containing both .alpha.KG and NADPH. In addition to changes at
residue 132, the position of the catalytic residues Tyr 139 and Lys
212 are different and .alpha.KG is oriented differently relative to
NADPH for catalytic hydride transfer in the WT versus R132H mutant
enzymes.
[0444] FIG. 30A depicts the enzymatic properties of IDH1 R132H
mutants when recombinant human wild-type (WT) and R132H mutant
(R132H) IDH1 enzymes were assessed for oxidative decarboxylation of
isocitrate to .alpha.KG with NADP.sup.+ as cofactor. Different
concentrations of enzyme were used to generate the curves.
[0445] FIG. 30B depicts the enxymatic properties of IDH R132
mutants when WT and R132H mutant IDH1 enzymes were assessed for
reduction of .alpha.KG with NADPH as cofactor. Different
concentrations of enzyme were used to generate the curves.
[0446] FIG. 30C depicts kinetic parameters of oxidative and
reductive reactions as measured for WT and R132H IDH1 enzymes are
shown. K.sub.m and k.sub.cat values for the reductive activity of
the WT enzyme were unable to be determined as no measurable enzyme
activity was detectable at any substrate concentration.
[0447] FIG. 31A depicts the LC-MS/MS analysis identifying 2HG as
the reductive reaction product of recombinant human R132H mutant
IDH1.
[0448] FIG. 31B depicts the diacetyl-L-tartaric anhydride
derivatization and LC-MS/MS analysis of the chirality of 2HG
produced by R132H mutant IDH1. Normalized LC-MS/MS signal for the
reductive reaction (r.times.n) product alone, an R(-)-2HG standard
alone, and the two together (R.times.n+R(-)-2HG) are shown as is
the signal for a racemic mixture of R(-) and S(+) forms (2HG
Racemate) alone or with the reaction products
(R.times.n+Racemate).
[0449] FIG. 32A depicts SDS-PAGE and Western blot analyses of
C-terminal affinity-purification tagged IDH1 R132S protein used for
crystallization.
[0450] FIG. 32B depicts the chromatogram of FPLC analysis of the
IDH1 R132S protein sample.
[0451] FIG. 33 depicts crystals obtained from a protein solution
contained 5 mM NADP, 5 mM isocitrate, 10 mM Ca2+. Precipitant
solution contained 100 mM MES (pH 6.0) and 20% PEG 6000 using a
hanging drop method of crystallization.
[0452] FIG. 34 depicts crystal obtained from a protein solution
contained 5 mM NADP, 5 mM .alpha.-ketoglutarate, 10 mM Ca2+.
Precipitant contained 100 mM MES (pH 6.5) and 12% PEG 20000.
[0453] FIG. 35 is a bar graph depicting elevated NADPH reductive
catalysis activity in IDH2-R172K mutant enzyme as compared to
wildtype IDH2.
[0454] FIGS. 36A-C are graphs depicting the following: (A) Extracts
from IDH1/2 wt (n=10), and IDH1/2 mutant (n=16) patient leukemia
cells obtained at presentation and relapse, and IDH1 R132 mutant
leukemia cells grown in culture for 14 days (n=14) analyzed by
LC-MS to measure levels of 2-HG; and (B) 2-HG measured in serum of
patients with IDH1 wt or IDH1 R132 mutant leukemia. In (A) and (B),
each point represents an individual patient sample. Diamonds
represent wildtype, circles represent IDH1 mutants, and triangles
represent IDH2 mutants. Horizontal bars indicate the mean. (*)
indicates a statistically significant difference relative to
wild-type patient cells (p<0.05). (C) depicts In vitro growth
curves of IDH1 R132 mutant and IDH1 wild-type AML cells.
[0455] FIG. 37 is a graph depicting the results of extracts from
leukemia cells of AML patients carrying an IDH1/2 mutant (n=16) or
wild-type (n=10) allele obtained at initial presentation and
relapse assayed by LC-MS for levels of .alpha.-KG, succinate,
malate, and fumarate. Each point represents an individual patient
sample. Open circles represent wild-types, closed circles represent
IDH1 mutants, and triangles represent IDH2 mutants. Horizontal bars
represent the mean. There were no statistically significant
differences between the wild-type and IDH1/2 mutant AML
samples.
[0456] FIG. 38 depicts graphical representations of LC-MS analysis
of in vitro reactions using recombinant IDH1 R132C and IDH2 R172K
confirming that 2-HG and not isocitrate is the end product of the
mutant enzyme reactions.
[0457] FIGS. 39A and B depict (A) the wild-type IDH1 enzyme
catalysis of the oxidative decarboxylation of isocitrate to
alpha-ketoglutarate with the concomitant reduction of NADP to
NADPH; and (B) the IDH1 R132C mutant reduction of
alpha-ketoglutarate to 2-hydroxyglutarate while oxidizing NADPH to
NADP. These are referred to as the "forward" and "partial reverse"
reactions, respectively.
DETAILED DESCRIPTION
[0458] The inventors have discovered that certain mutated forms of
an enzyme (e.g., IDH1 or IDH2) have a gain of function, referred to
herein as a neoactivity, which can be targeted in the treatment of
a cell proliferation-related disorder, e.g., a proliferative
disorder such as cancer. For example, in the case of a metabolic
pathway enzyme, a gain of function or neoactivity can serve as a
target for treatment of cancer. Described herein are methods and
compositions for the treatment of a cell proliferation-related
disorder, e.g., a proliferative disorder such as cancer. The
methods include, e.g., treating a subject having a glioma or brain
tumor characterized by a preselected IDH1 allele, e.g., an allele
having A at position 394, such as a C394A, a C394G, a C394T, a
G395C, a G395T or a G395A mutation, (e.g., a C394A mutant) or an A
at position 395 (e.g., a G395A mutant) according to the sequence of
SEQ ID NO:5, that encodes an IDH1 having His, Ser, Cys, Gly, Val,
Pro or Leu at position 132 (e.g., His); or a preselected IDH2
allelle that encodes an IDH2 having Lys, Gly, Met, Trp, Thr, or Ser
at position 172 and having a neoactivity disclosed herein, by
administering to the subject a therapeutically effective amount of
an inhibitor of IDH1 or IDH2 (e.g., IDH1), e.g., a small molecule
or nucleic acid. The nucleic acid based inhibitor is, for example,
a dsRNA, e.g., a dsRNA that comprises the primary sequences of the
sense strand and antisense strands of Tables 7-14. The dsRNA is
composed of two separate strands, or a single strand folded to form
a hairpin structure (e.g., a short hairpin RNA (shRNA)). In some
embodiments, the nucleic acid based inhibitor is an antisense
nucleic acid, such as an antisense having a sequence that overlaps,
or includes, an antisense sequence provided in Tables 7-14.
Neoactivity of an Enzyme
[0459] Neoactivity, as used herein, means an activity that arises
as a result of a mutation, e.g., a point mutation, e.g., a
substitution, e.g., in the active site of an enzyme. In an
embodiment the neoactivity is substantially absent from wild type
or non-mutant enzyme. This is sometimes referred to herein as a
first degree neoactivity. An example of a first degree neoactivity
is a "gain of function" wherein the mutant enzyme gains a new
catalytic activity. In an embodiment the neoactivity is present in
wild type or non-mutant enzyme but at a level which is less than
10, 5, 1, 0.1, 0.01 or 0.001% of what is seen in the mutant enzyme.
This is sometimes referred to herein as a second degree
neoactivity. An example of a second degree neoactivity is a "gain
of function" wherein the mutant enzyme has an increase, for
example, a 5 fold increase in the rate of a catalytic activity
possessed by the enzyme when lacking the mutation.
[0460] In some embodiments, a non-mutant form the enzyme, e.g., a
wild type form, converts substance A (e.g., isocitrate) to
substance B (e.g., .alpha.-ketoglutarate), and the neoactivity
converts substance B (e.g., .alpha.-ketoglutarate) to substance C,
sometimes referred to as the neoactivity product (e.g.,
2-hydroxyglutarate, e.g., R-2-hydroxyglutarate). In some
embodiments, the enzyme is in a metabolic pathway, e.g., a
metabolic pathway leading to fatty acid biosynthesis, glycolysis,
glutaminolysis, the pentose phosphate shunt, the nucleotide
biosynthetic pathway, or the fatty acid biosynthetic pathway, e.g.,
IDH1 or IDH2.
[0461] In some embodiments, a non-mutant form the enzyme, e.g., a
wild type form, converts substance A to substance B, and the
neoactivity converts substance B to substance A. In some
embodiments, the enzyme is in a metabolic pathway, e.g., a
metabolic pathway leading to fatty acid biosynthesis, glycolysis,
glutaminolysis, the pentose phosphate shunt, the nucleotide
biosynthetic pathway, or the fatty acid biosynthetic pathway.
Isocitrate Dehydrogenases
[0462] Isocitrate dehydrogenases (IDHs) catalyze the oxidative
decarboxylation of isocitrate to 2-oxoglutarate (i.e.,
.alpha.-ketoglutarate). These enzymes belong to two distinct
subclasses, one of which utilizes NAD(+) as the electron acceptor
and the other NADP(+). Five isocitrate dehydrogenases have been
reported: three NAD(+)-dependent isocitrate dehydrogenases, which
localize to the mitochondrial matrix, and two NADP(+)-dependent
isocitrate dehydrogenases, one of which is mitochondrial and the
other predominantly cytosolic. Each NADP(+)-dependent isozyme is a
homodimer.
[0463] IDH1 (isocitrate dehydrogenase 1 (NADP+), cytosolic) is also
known as IDH; IDP; IDCD; IDPC or PICD. The protein encoded by this
gene is the NADP(+)-dependent isocitrate dehydrogenase found in the
cytoplasm and peroxisomes. It contains the PTS-1 peroxisomal
targeting signal sequence. The presence of this enzyme in
peroxisomes suggests roles in the regeneration of NADPH for
intraperoxisomal reductions, such as the conversion of
2,4-dienoyl-CoAs to 3-enoyl-CoAs, as well as in peroxisomal
reactions that consume 2-oxoglutarate, namely the
alpha-hydroxylation of phytanic acid. The cytoplasmic enzyme serves
a significant role in cytoplasmic NADPH production.
[0464] The human IDH1 gene encodes a protein of 414 amino acids.
The nucleotide and amino acid sequences for human IDH1 can be found
as GenBank entries NM_005896.2 and NP_005887.2 respectively. The
nucleotide and amino acid sequences for IDH1 are also described in,
e.g., Nekrutenko et al., Mol. Biol. Evol. 15:1674-1684(1998);
Geisbrecht et al., J. Biol. Chem. 274:30527-30533(1999); Wiemann et
al., Genome Res. 11:422-435(2001); The MGC Project Team, Genome
Res. 14:2121-2127(2004); Lubec et al., Submitted (December-2008) to
UniProtKB; Kullmann et al., Submitted (June-1996) to the
EMBL/GenBank/DDBJ databases; and Sjoeblom et al., Science
314:268-274(2006).
[0465] IDH2 (isocitrate dehydrogenase 2 (NADP+), mitochondrial) is
also known as IDH; IDP; IDHM; IDPM; ICD-M; or mNADP-IDH. The
protein encoded by this gene is the NADP(+)-dependent isocitrate
dehydrogenase found in the mitochondria. It plays a role in
intermediary metabolism and energy production. This protein may
tightly associate or interact with the pyruvate dehydrogenase
complex. Human IDH2 gene encodes a protein of 452 amino acids. The
nucleotide and amino acid sequences for IDH2 can be found as
GenBank entries NM_002168.2 and NP_002159.2 respectively. The
nucleotide and amino acid sequence for human IDH2 are also
described in, e.g., Huh et al., Submitted (November-1992) to the
EMBL/GenBank/DDBJ databases; and The MGC Project Team, Genome Res.
14:2121-2127(2004).
[0466] Non-mutant, e.g., wild type, IDH1 catalyzes the oxidative
decarboxylation of ioscitrate to .alpha.-ketoglutarate thereby
reducing NAD.sup.+ (NADP.sup.+) to NADP (NADPH), e.g., in the
forward reaction:
Isocitrate+NAD.sup.+(NADP.sup.+).fwdarw..alpha.-KG+CO.sub.2+NADH
(NADPH)+H.sup.+
[0467] In some embodiments, the neoactivity of a mutant IDH1 can
have the ability to convert .alpha.-ketoglutarate to
2-hydroxyglutarate, e.g., R-2-hydroxyglutarate:
.alpha.-KG+NADH (NADPH)+H.sup.+.fwdarw.2-hydroxyglutarate, e.g.,
R-2-hydroxyglutarate+NAD.sup.+(NADP.sup.+).
[0468] In some embodiments, the neoactivity can be the reduction of
pyruvate or malate to the corresponding .alpha.-hydroxyl
compounds.
[0469] In some embodiments, the neoactivity of a mutant IDH1 can
arise from a mutant IDH1 having a His, Ser, Cys, Gly, Val, Pro or
Leu, or any other mutations described in Yan et al., at residue 132
(e.g., His, Ser, Cys, Gly, Val or Leu; or His, Ser, Cys or Lys). In
some embodiments, the neoactivity of a mutant IDH2 can arise from a
mutant IDH2 having a Lys, Gly, Met, Trp, Thr, or Ser (e.g., Lys,
Gly, Met, Trp, or Ser; or Gly, Met or Lys), or any other mutations
described in Yan H et al., at residue 172. Exemplary mutations
include the following: R132H, R132C, R132S, R132G, R132L, and
R132V.
[0470] In some embodiments, the mutant IDH1 and/or IDH2 (e.g., a
mutant IDH1 and/or IDH2 having a neoactivity described herein)
could lead to an increased level of 2-hydroxyglutarate, e.g.,
R-2-hydroxyglutarate in a subject. The accumulation of
2-hydroxyglutarate, e.g., R-2-hydroxyglutarate in a subject, e.g.,
in the brain of a subject, can be harmful. For example, in some
embodiments, elevated levels of 2-hydroxyglutarate, e.g.,
R-2-hydroxyglutarate can lead to and/or be predictive of cancer in
a subject such as a cancer of the central nervous system, e.g.,
brain tumor, e.g., glioma, e.g., glioblastoma multiforme (GBM).
Accordingly, in some embodiments, a method described herein
includes administering to a subject an inhibitor of the
neoactivity.
Detection of 2-Hydroxyglutarate
[0471] 2-hydroxyglutarate can be detected, e.g., by LC/MS. To
detect secreted 2-hydroxyglutarate in culture media, 500 .mu.L
aliquots of conditioned media can be collected, mixed 80:20 with
methanol, and centrifuged at 3,000 rpm for 20 minutes at 4 degrees
Celsius. The resulting supernatant can be collected and stored at
-80 degrees Celsius prior to LC-MS/MS to assess 2-hydroxyglutarate
levels. To measure whole-cell associated metabolites, media can be
aspirated and cells can be harvested, e.g., at a non-confluent
density. A variety of different liquid chromatography (LC)
separation methods can be used. Each method can be coupled by
negative electrospray ionization (ESI, -3.0 kV) to
triple-quadrupole mass spectrometers operating in multiple reaction
monitoring (MRM) mode, with MS parameters optimized on infused
metabolite standard solutions. Metabolites can be separated by
reversed phase chromatography using 10 mM tributyl-amine as an ion
pairing agent in the aqueous mobile phase, according to a variant
of a previously reported method (Luo et al. J Chromatogr A 1147,
153-64, 2007). One method allows resolution of TCA metabolites:
t=0, 50% B; t=5, 95% B; t=7, 95% B; t=8, 0% B, where B refers to an
organic mobile phase of 100% methanol. Another method is specific
for 2-hydroxyglutarate, running a fast linear gradient from 50%-95%
B (buffers as defined above) over 5 minutes. A Synergi Hydro-RP,
100 mm.times.2 mm, 2.1 .mu.m particle size (Phenomonex) can be used
as the column, as described above. Metabolites can be quantified by
comparison of peak areas with pure metabolite standards at known
concentration. Metabolite flux studies from .sup.13C-glutamine can
be performed as described, e.g., in Munger et al. Nat Biotechnol
26, 1179-86, 2008.
[0472] In an embodiment 2HG, e.g., R-2HG, is evaluated and the
analyte on which the determination is based is 2HG, e.g., R-2HG. In
an embodiment the analyte on which the determination is based is a
derivative of 2HG, e.g., R-2HG, formed in process of performing the
analytic method. By way of example such a derivative can be a
derivative formed in MS analysis. Derivatives can include a salt
adduct, e.g., a Na adduct, a hydration variant, or a hydration
variant which is also a salt adduct, e.g., a Na adduct, e.g., as
formed in MS analysis. Exemplary 2HG derivatives include dehydrated
derivatives such as the compounds provided below or a salt adduct
thereof:
##STR00001##
Methods of Evaluating Samples and/or Subjects
[0473] This section provides methods of obtaining and analyzing
samples and of analyzing subjects.
[0474] Embodiments of the method comprise evaluation of one or more
parameters related to IDH, e.g., IDH1 or IDH2, an alpha hydroxy
neoactivity, e.g., 2HG neoactivity, e.g., to evaluate the IDH1 or
IDH2 2HG neoactivity genotype or phenotype. The evaluation can be
performed, e.g., to select, diagnose or prognose the subject, to
select a therapeutic agent, e.g., an inhibitor, or to evaluate
response to the treatment or progression of disease. In an
embodiment the evaluation, which can be performed before and/or
after treatment has begun, is based, at least in part, on analysis
of a tumor sample, cancer cell sample, or precancerous cell sample,
from the subject. E.g., a sample from the patient can be analyzed
for the presence or level of an alpha hydroxy neoactivity product,
e.g., 2HG, e.g., R-2HG, by evaluating a parameter correlated to the
presence or level of an alpha hydroxy neoactivity product, e.g.,
2HG, e.g., R-2HG. An alpha hydroxy neoactivity product, e.g., 2HG,
e.g., R-2HG, in the sample can be determined by a chromatographic
method, e.g., by LC-MS analysis. It can also be determined by
contact with a specific binding agent, e.g., an antibody, which
binds the alpha hydroxy neoactivity product, e.g., 2HG, e.g.,
R-2HG, and allows detection. In an embodiment the sample is
analyzed for the level of neoactivity, e.g., an alpha hydroxy
neoactivity, e.g., 2HG neoactivity. In an embodiment the sample is
analysed for the presence of a mutant IDH, e.g., IDH1 or IDH2,
protein having an alpha hydroxy neoactivity, e.g., 2HG neoactivity
(or a corresponding RNA). E.g., a mutant protein specific reagent,
e.g., an antibody that specifically binds an IDH mutant protein,
e.g., an antibody that specifically binds an IDH1-R132H mutant
protein or an IDH2-R172 mutant protein (e.g., an IDH1-R132H mutant
protein), can be used to detect neoactive mutant enzyme In an
embodiment a nucleic acid from the sample is sequenced to determine
if a selected allele or mutation of IDH1 or IDH2 disclosed herein
is present. In an embodiment the analysis is other than directly
determining the presence of a mutant IDH, e.g., IDH1 or IDH2,
protein (or corresponding RNA) or sequencing of an IDH, e.g., IDH1
or IDH2 gene. In an embodiment the analysis is other than directly
determining, e.g., it is other than sequencing genomic DNA or cDNA,
the presence of a mutation at residue 132 of IDH1 and/or a mutation
at residue 172 of IDH2. E.g., the analysis can be the detection of
an alpha hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG, or
the measurement of the mutation's an alpha hydroxy neoactivity,
e.g., 2HG neoactivity. In an embodiment the sample is removed from
the patient and analyzed. In an embodiment the evaluation can
include one or more of performing the analysis of the sample,
requesting analysis of the sample, requesting results from analysis
of the sample, or receiving the results from analysis of the
sample. (Generally herein, analysis can include one or both of
performing the underlying method or receiving data from another who
has performed the underlying method.)
[0475] In an embodiment the evaluation, which can be performed
before and/or after treatment has begun, is based, at least in
part, on analysis of a tissue (e.g., a tissue other than a tumor
sample), or bodily fluid, or bodily product. Exemplary tissues
include lymph node, skin, hair follicles and nails. Exemplary
bodily fluids include blood, plasma, urine, lymph, tears, sweat,
saliva, semen, and cerebrospinal fluid. Exemplary bodily products
include exhaled breath. E.g., the tissue, fluid or product can be
analyzed for the presence or level of an alpha hydroxy neoactivity
product, e.g., 2HG, e.g., R-2HG, by evaluating a parameter
correlated to the presence or level of an alpha hydroxy neoactivity
product, e.g., 2HG, e.g., R-2HG. An alpha hydroxy neoactivity
product, e.g., 2HG, e.g., R-2HG, in the sample can be determined by
a chromatographic method, e.g., by LC-MS analysis. It can also be
determined by contact with a specific binding agent, e.g., an
antibody, which binds the alpha hydroxy neoactivity product, e.g.,
2HG, e.g., R-2HG, and allows detection. In embodiments where
sufficient levels are present, the tissue, fluid or product can be
analyzed for the level of neoactivity, e.g., an alpha hydroxy
neoactivity, e.g., the 2HG neoactivity. In an embodiment the sample
is analysed for the presence of a mutant IDH, e.g., IDH1 or IDH2,
protein having an alpha hydroxy neoactivity, e.g., 2HG neoactivity
(or a corresponding RNA). E.g., a mutant protein specific reagent,
e.g., an antibody that specifically binds an IDH mutant protein,
e.g., an antibody that specifically binds an IDH1-R132H mutant
protein or an IDH2-R172 mutant protein (e.g., an IDH1-R132H mutant
protein), can be used to detect neoactive mutant enzyme. In an
embodiment a nucleic acid from the sample is sequenced to determine
if a selected allele or mutation of IDH1 or IDH2 disclosed herein
is present. In an embodiment the analysis is other than directly
determining the presence of a mutant IDH, e.g., IDH1 or IDH2,
protein (or corresponding RNA) or sequencing of an IDH, e.g., IDH1
or IDH2 gene. E.g., the analysis can be the detection of an alpha
hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG, or the
measurement of 2HG neoactivity. In an embodiment the tissue, fluid
or product is removed from the patient and analyzed. In an
embodiment the evaluation can include one or more of performing the
analysis of the tissue, fluid or product, requesting analysis of
the tissue, fluid or product, requesting results from analysis of
the tissue, fluid or product, or receiving the results from
analysis of the tissue, fluid or product.
[0476] In an embodiment the evaluation, which can be performed
before and/or after treatment has begun, is based, at least in
part, on alpha hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG,
imaging of the subject. In embodiments magnetic resonance methods
are is used to evaluate the presence, distribution, or level of an
alpha hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG, in the
subject. In an embodiment the subject is subjected to imaging
and/or spectroscopic analysis, e.g., magnetic resonance-based
analysis, e.g., MM and/or MRS e.g., analysis, and optionally an
image corresponding to the presence, distribution, or level of an
alpha hydroxy neoactivity product, e.g., 2HG, e.g., R-2HG, or of
the tumor, is formed. Optionally the image or a value related to
the image is stored in a tangible medium and/or transmitted to a
second site. In an embodiment the evaluation can include one or
more of performing imaging analysis, requesting imaging analysis,
requesting results from imaging analysis, or receiving the results
from imaging analysis.
Methods of Treating a Proliferative Disorder
[0477] Described herein are methods of treating a cell
proliferation-related disorder, e.g., a cancer, e.g., a glioma,
e.g., by inhibiting a neoactivity of a mutant enzyme, e.g., an
enzyme in a metabolic pathway, e.g., a metabolic pathway leading to
fatty acid biosynthesis, glycolysis, glutaminolysis, the pentose
phosphate shunt, the nucleotide biosynthetic pathway, or the fatty
acid biosynthetic pathway, e.g., IDH1 or IDH2. The cancer can be
characterized by the presence of a neoactivity, such as a gain of
function in one or more mutant enzymes (e.g., an enzyme in the
metabolic pathway, e.g., a metabolic pathway leading to fatty acid
biosynthesis, glycolysis, glutaminolysis, the pentose phosphate
shunt, the nucleotide biosynthetic pathway, or the fatty acid
biosynthetic pathway e.g., IDH1 or IDH2). In some embodiments, the
gain of function is the conversion of .alpha.-ketoglurarate to
2-hydroxyglutarate, e.g., R-2-hydroxyglutarate.
Compounds for the Treatment of Cancer
[0478] A candidate compound can be evaluated for modulation (e.g.,
inhibition) of neoactivity, for example, using an assay described
herein. A candidate compound can also be evaluated for modulation
(e.g., inhibition) of wild type or non-mutant activity. For
example, the formation of a product or by-product of any activity
(e.g., enzymatic activity) can be assayed, thus evaluating a
candidate compound. In some embodiments, the activity (e.g., wild
type/non-mutant or neoactivity) can be evaluated by measuring one
or more readouts from an enzymatic assay. For example, the change
in nature and/or amount of substrate and/or product can be
measured, e.g., using methods such as fluorescent or radiolabeled
substrates. Exemplary substrates and/or products include
.alpha.-ketoglutarate, CO.sub.2, NADP, NADPH, NAD, NADH, and
2-hydroxyglutarate, e.g., R-2-hydroxyglutarate. In some
embodiments, the rate of reaction of the enzyme can also be
evaluated as can the nature and/or amount of a product of the
enzymatic reaction. In addition to the measurement of potential
enzymatic activities, activity (e.g., wild type/non-mutant or
neoactivity) can be detected by the quenching of protein
fluorescence upon binding of a potential substrate, cofactor, or
enzymatic activity modulator to the enzyme.
[0479] In one embodiment, assay progress can be monitored by
changes in the OD340 or fluorescence of the NAD or NADP cofactor.
In another embodiment, the reaction progress can be coupled to a
secondary enzyme assay system in continuous mode or endpoint mode
for increasing the dynamic range of the assay. For example, an
endpoint assay can be performed by adding to the reaction an excess
of diaphorase and rezasarin. Diaphorase consumes the remaining
NADPH or NADH while producing resorufin from rezasarin. Resorufin
is a highly fluorescent product which can be measured by
fluorescence at Ex544 Em590. This not only terminates the reaction
but also generates an easily detectable signal with greater quantum
yield than the fluorescence of the cofactor.
[0480] A continuous assay can be implemented through coupling a
product of the primary reaction to a secondary enzyme reaction that
yields detectable results of greater dynamic range or more
convenient detection mode. For example, inclusion in the reaction
mix of aldehyde dehydrogenase (ALDH), which is an NADP+ dependent
enzyme, and 6-methoxy-2-napthaldehye, a chromogenic substrate for
ALDH, will result in the production of the fluorescent product
6-methoxy-2-napthoate (Ex310 Em 360) at a rate dependent on the
production of NADP+ by isocitrate dehydrogenase. The inclusion of a
coupling enzyme such as aldehyde dehydrogenase has the additional
benefit of allowing screening of neoactivity irrespective of
whether NADP+ or NAD+ is produced, since this enzyme is capable of
utilizing both. Additionally, since the NADPH or NADH cofactor
required for the "reverse" assay is regenerated, a coupled enzyme
system which cycles the cofactor back to the IDH enzyme has the
further advantage of permitting continuous assays to be conducted
at cofactor concentrations much below Km for the purpose of
enhancing the detection of competitive inhibitors of cofactor
binding.
[0481] In yet a third embodiment of an activity (e.g., wild
type/non-mutant or neoactivity) screen, one or a number of IDH
substrates, cofactors, or products can be isotopically labeled with
radioactive or "heavy" elements at defined atoms for the purpose of
following specific substrates or atoms of substrates through the
chemical reaction. For example, the alpha carbon of a-KG,
isocitrate, or 2-hydroxyglutarate, e.g., R-2-hydroxyglutarate may
be .sup.14C or .sup.13C. Amount, rate, identity and structure of
products formed can be analyzed by means known to those of skill in
the art, for example mass spectroscopy or radiometric HPLC.
[0482] Compounds that inhibit a neoactivity, e.g., a neoactivity
described herein, can include, e.g., small molecule, nucleic acid,
protein and antibody.
[0483] Exemplary small molecules include, e.g, small molecules that
bind to enzymes and decrease their activity, e.g., a neoactivity
described herein. The binding of an inhibitor can stop a substrate
from entering the enzyme's active site and/or hinder the enzyme
from catalyzing its reaction. Inhibitor binding is either
reversible or irreversible. Irreversible inhibitors usually react
with the enzyme and change it chemically. These inhibitors can
modify key amino acid residues needed for enzymatic activity. In
contrast, reversible inhibitors bind non-covalently and different
types of inhibition are produced depending on whether these
inhibitors bind the enzyme, the enzyme-substrate complex, or
both.
[0484] In some embodiments, the small molecule is oxalomalate,
oxalofumarate, or oxalosuccinate.
[0485] In some embodiments, the small molecule is a compound of
formula (X), or a compound as listed in Table 24a. The compound of
formula (X) is provided below:
##STR00002##
[0486] wherein X is C.sub.1-C.sub.6 alkylene (e.g., methylene),
C(O), or C(O)C.sub.1-C.sub.6 alkylene; wherein X is optionally
substituted;
[0487] R.sup.1 is halo (e.g., fluoro), C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 haloalkyl, hydroxyl, C.sub.1-C.sub.6 alkoxy, cyano,
nitro, amino, alkylamino, dialkylamino, amido, --C(O)OH, or
C(O)OC.sub.1-C.sub.6alkyl; and
[0488] m is 0, 1, 2, or 3.
[0489] In some embodiments, the compound is a compound of formula
(XI) or a pharmaceutically acceptable salt thereof or a compound
listed in Table 24b
##STR00003##
wherein: W, X, Y and Z are each independently selected from CH or
N; B and B' are independently selected from hydrogen, alkyl or when
taken together with the carbon to which they are attached form a
carbonyl group;
Q is C.dbd.O or SO.sub.2;
[0490] D and D' are independently selected from a bond, oxygen or
NR.sup.c; A is optionally substituted aryl or optionally
substituted heteroaryl; R.sup.1 is independently selected from
alkyl, acyl, cycloalkyl, aryl, heteroaryl, heterocyclyl,
heterocyclylalkyl, cycloalkylalkyl, aralkyl, and heteroaralkyl;
each of which may be optionally substituted with 0-3 occurrences of
R.sup.d; each R.sup.3 is independently selected from halo,
haloalkyl, alkyl and --OR.sup.a; each R.sup.a is independently
selected from alkyl, and haloalkyl; each R.sup.b is independently
alkyl; each R.sup.c is independently selected from hydrogen, alkyl
and alkenyl; each R.sup.d is independently selected from halo,
haloalkyl, alkyl, nitro, cyano, and --OR.sup.a, or two R.sup.d
taken together with the carbon atoms to which they are attached
form an optionally substituted heterocyclyl; n is 0, 1, or 2; his
0, 1, 2; and g is 0, 1 or 2.
[0491] In some embodiments, the small molecule is a selective
inhibitor of the neoactivity (e.g., relative to the wild type
activity).
[0492] Nucleic acids can be used to inhibit a neoactivity, e.g., a
neoactivity described herein, e.g., by decreasing the expression of
the enzyme. Exemplary nucleic acids include, e.g., siRNA, shRNA,
antisense RNA, aptamer and ribozyme. Art-known methods can be used
to select inhibitory molecules, e.g., siRNA molecules, for a
particular gene sequence.
[0493] Proteins can also be used to inhibit a neoactivity, e.g., a
neoactivity described herein, by directly or indirectly binding to
the enzyme and/or substrate, or competing binding to the enzyme
and/or substrate. Exemplary proteins include, e.g., soluble
receptors, peptides and antibodies. Exemplary antibodies include,
e.g., whole antibody or a fragment thereof that retains its ability
to bind to the enzyme or substrate.
[0494] Exemplary candidate compounds, which can be tested for
inhibitin of a neoactivity described herein (e.g., a neoactivity
associated with mutant IDH1), are described in the following
references, each of which are incorporated herein by reference:
Bioorganic & Medicinal Chemistry (2008), 16(7), 3580-3586; Free
Radical Biology & Medicine (2007), 42(1), 44-51; KR 2005036293
A; Applied and Environmental Microbiology (2005), 71(9), 5465-5475;
KR 2002095553 A; U.S. Pat. Appl. US 2004067234 A1; PCT Int. Appl.
(2002), WO 2002033063 A1; Journal of Organic Chemistry (1996),
61(14), 4527-4531; Biochimica et Biophysica Acta, Enzymology
(1976), 452(2), 302-9; Journal of Biological Chemistry (1975),
250(16), 6351-4; Bollettino-Societa Italiana di Biologia
Sperimentale (1972), 48(23), 1031-5; Journal of Biological
Chemistry (1969), 244(20), 5709-12.
Isomers
[0495] Certain compounds may exist in one or more particular
geometric, optical, enantiomeric, diasteriomeric, epimeric,
atropic, stereoisomer, tautomeric, conformational, or anomeric
forms, including but not limited to, cis- and trans-forms; E- and
Z-forms; c-, t-, and r-forms; endo- and exo-forms; R-, S-, and
meso-forms; D- and L-forms; d- and 1-forms; (+) and (-) forms;
keto-, enol-, and enolate-forms; syn- and anti-forms; synclinal-
and anticlinal-forms; a- and .beta.-forms; axial and equatorial
forms; boat-, chair-, twist-, envelope-, and halfchair-forms; and
combinations thereof, hereinafter collectively referred to as
"isomers" (or "isomeric forms").
[0496] In one embodiment, a compound described herein, e.g., an
inhibitor of a neoactivity or 2-HG is an enantiomerically enriched
isomer of a stereoisomer described herein. For example, the
compound has an enantiomeric excess of at least about 10%, 15%,
20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%, 95%, 96%, 97%, 98%, or 99%. Enantiomer, when used herein,
refers to either of a pair of chemical compounds whose molecular
structures have a mirror-image relationship to each other.
[0497] In one embodiment, a preparation of a compound disclosed
herein is enriched for an isomer of the compound having a selected
stereochemistry, e.g., R or S, corresponding to a selected
stereocenter, e.g., the 2-position of 2-hydroxyglutaric acid. 2HG
can be purchased from commercial sources or can be prepared using
methods known in the art, for example, as described in Org. Syn.
Coll vol., 7, P-99, 1990. For example, the compound has a purity
corresponding to a compound having a selected stereochemistry of a
selected stereocenter of at least about 60%, 65%, 70%, 75%, 80%,
85%, 90%, 95%, 96%, 97%, 98%, or 99%.
[0498] In one embodiment, a composition described herein includes a
preparation of a compound disclosed herein that is enriched for a
structure or structures having a selected stereochemistry, e.g., R
or S, at a selected stereocenter, e.g., the 2-position of
2-hydroxyglutaric acid. Exemplary R/S configurations can be those
provided in an example described herein.
[0499] An "enriched preparation," as used herein, is enriched for a
selected stereoconfiguration of one, two, three or more selected
stereocenters within the subject compound. Exemplary selected
stereocenters and exemplary stereoconfigurations thereof can be
selected from those provided herein, e.g., in an example described
herein. By enriched is meant at least 60%, e.g., of the molecules
of compound in the preparation have a selected stereochemistry of a
selected stereocenter. In an embodiment it is at least 65%, 70%,
75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%. Enriched refers to
the level of a subject molecule(s) and does not connote a process
limitation unless specified.
[0500] Note that, except as discussed below for tautomeric forms,
specifically excluded from the term "isomers," as used herein, are
structural (or constitutional) isomers (i.e., isomers which differ
in the connections between atoms rather than merely by the position
of atoms in space). For example, a reference to a methoxy group,
--OCH3, is not to be construed as a reference to its structural
isomer, a hydroxymethyl group, --CH2OH. Similarly, a reference to
ortho-chlorophenyl is not to be construed as a reference to its
structural isomer, meta-chlorophenyl. However, a reference to a
class of structures may well include structurally isomeric forms
falling within that class (e.g., C1-7alkyl includes n-propyl and
iso-propyl; butyl includes n-, iso-, sec-, and tert-butyl;
methoxyphenyl includes ortho-, meta-, and para-methoxyphenyl).
[0501] The above exclusion does not pertain to tautomeric forms,
for example, keto-, enol-, and enolate-forms, as in, for example,
the following tautomeric pairs: keto/enol (illustrated below),
imine/enamine, amide/imino alcohol, amidine/amidine, nitroso/oxime,
thioketone/enethiol, N-nitroso/hydroxyazo, and nitro/aci-nitro.
##STR00004##
[0502] Note that specifically included in the term "isomer" are
compounds with one or more isotopic substitutions. For example, H
may be in any isotopic form, including 1H, 2H (D), and 3H (T); C
may be in any isotopic form, including 12C, 13C, and 14C; O may be
in any isotopic form, including 16O and 18O; and the like. Unless
otherwise specified, a reference to a particular compound includes
all such isomeric forms, including (wholly or partially) racemic
and other mixtures thereof. Methods for the preparation (e.g.,
asymmetric synthesis) and separation (e.g., fractional
crystallisation and chromatographic means) of such isomeric forms
are either known in the art or are readily obtained by adapting the
methods taught herein, or known methods, in a known manner.
Salts
[0503] It may be convenient or desirable to prepare, purify, and/or
handle a corresponding salt of the active compound, for example, a
pharmaceutically-acceptable salt. Examples of pharmaceutically
acceptable salts are discussed in Berge et al., 1977,
"Pharmaceutically Acceptable Salts." J. Pharm. ScL. Vol. 66, pp.
1-19.
[0504] For example, if the compound is anionic, or has a functional
group which may be anionic (e.g., --COOH may be --COO''), then a
salt may be formed with a suitable cation. Examples of suitable
inorganic cations include, but are not limited to, alkali metal
ions such as Na+ and K+, alkaline earth cations such as Ca2+ and
Mg2+, and other cations such as Al+3. Examples of suitable organic
cations include, but are not limited to, ammonium ion (i.e., NH4+)
and substituted ammonium ions (e.g., NH3R+, NH2R2+, NHR3+, NR4+).
Examples of some suitable substituted ammonium ions are those
derived from: ethylamine, diethylamine, dicyclohexylamine,
triethylamine, butylamine, ethylenediamine, ethanolamine,
diethanolamine, piperazine, benzylamine, phenylbenzylamine,
choline, meglumine, and tromethamine, as well as amino acids, such
as lysine and arginine. An example of a common quaternary ammonium
ion is N(CH3)4+.
[0505] If the compound is cationic, or has a functional group that
may be cationic (e.g., --NH2 may be --NH3+), then a salt may be
formed with a suitable anion. Examples of suitable inorganic anions
include, but are not limited to, those derived from the following
inorganic acids: hydrochloric, hydrobromic, hydroiodic, sulfuric,
sulfurous, nitric, nitrous, phosphoric, and phosphorous.
[0506] Examples of suitable organic anions include, but are not
limited to, those derived from the following organic acids:
2-acetyoxybenzoic, acetic, ascorbic, aspartic, benzoic,
camphorsulfonic, cinnamic, citric, edetic, ethanedisulfonic,
ethanesulfonic, fumaric, glucheptonic, gluconic, glutamic,
glycolic, hydroxymaleic, hydroxynaphthalene carboxylic, isethionic,
lactic, lactobionic, lauric, maleic, malic, methanesulfonic, mucic,
oleic, oxalic, palmitic, pamoic, pantothenic, phenylacetic,
phenylsulfonic, propionic, pyruvic, salicylic, stearic, succinic,
sulfanilic, tartaric, toluenesulfonic, and valeric. Examples of
suitable polymeric organic anions include, but are not limited to,
those derived from the following polymeric acids: tannic acid,
carboxymethyl cellulose.
[0507] Unless otherwise specified, a reference to a particular
compound also includes salt forms thereof.
Chemically Protected Forms
[0508] It may be convenient or desirable to prepare, purify, and/or
handle the active compound in a chemically protected form. The term
"chemically protected form" is used herein in the conventional
chemical sense and pertains to a compound in which one or more
reactive functional groups are protected from undesirable chemical
reactions under specified conditions (e.g., pH, temperature,
radiation, solvent, and the like). In practice, well known chemical
methods are employed to reversibly render unreactive a functional
group, which otherwise would be reactive, under specified
conditions. In a chemically protected form, one or more reactive
functional groups are in the form of a protected or protecting
group (also known as a masked or masking group or a blocked or
blocking group). By protecting a reactive functional group,
reactions involving other unprotected reactive functional groups
can be performed, without affecting the protected group; the
protecting group may be removed, usually in a subsequent step,
without substantially affecting the remainder of the molecule. See,
for example, Protective Groups in Organic Synthesis (T. Green and
P. Wuts; 3rd Edition; John Wiley and Sons, 1999). Unless otherwise
specified, a reference to a particular compound also includes
chemically protected forms thereof.
[0509] A wide variety of such "protecting," "blocking," or
"masking" methods are widely used and well known in organic
synthesis. For example, a compound which has two nonequivalent
reactive functional groups, both of which would be reactive under
specified conditions, may be derivatized to render one of the
functional groups "protected," and therefore unreactive, under the
specified conditions; so protected, the compound may be used as a
reactant which has effectively only one reactive functional group.
After the desired reaction (involving the other functional group)
is complete, the protected group may be "deprotected" to return it
to its original functionality.
[0510] For example, a hydroxy group may be protected as an ether
(--OR) or an ester (--OC(.dbd.O)R), for example, as: a t-butyl
ether; a benzyl, benzhydryl (diphenylmethyl), or trityl
(triphenylmethyl) ether; a trimethylsilyl or t-butyldimethylsilyl
ether; or an acetyl ester (--OC(.dbd.O)CH3, --OAc).
[0511] For example, an aldehyde or ketone group may be protected as
an acetal (R--CH(OR)2) or ketal (R2C(OR)2), respectively, in which
the carbonyl group (--C.dbd.O) is converted to a diether
(>C(OR)2), by reaction with, for example, a primary alcohol. The
aldehyde or ketone group is readily regenerated by hydrolysis using
a large excess of water in the presence of acid.
[0512] For example, an amine group may be protected, for example,
as an amide (--NRCO--R) or a urethane (--NRCO--OR), for example,
as: a methyl amide (--NHCO--CH3); a benzyloxy amide
(--NHCO--OCH2C6H5, --NH-Cbz); as a t-butoxy amide
(--NHCO--OC(CH3)3, --NH-Boc); a 2-biphenyl-2-propoxy amide
(--NHCO--OC(CH3)2C6H4C6H5, --NH-Bpoc), as a 9-fluorenylmethoxy
amide (--NH--Fmoc), as a 6-nitroveratryloxy amide (--NH--Nvoc), as
a 2-trimethylsilylethyloxy amide (--NH-Teoc), as a
2,2,2-trichloroethyloxy amide (--NH-Troc), as an allyloxy amide
(--NH-Alloc), as a 2(-phenylsulphonyl)ethyloxy amide (--NH--Psec);
or, in suitable cases (e.g., cyclic amines), as a nitroxide radical
(--N--O ).
[0513] For example, a carboxylic acid group may be protected as an
ester for example, as: an C{circumflex over ( )}alkyl ester (e.g.,
a methyl ester; a t-butyl ester); a Cvrhaloalkyl ester (e.g., a
C1-7trihaloalkyl ester); a triC1-7alkylsilyl-Ci.7alkyl ester; or a
C5.2oaryl-C1-7alkyl ester (e.g., a benzyl ester; a nitrobenzyl
ester); or as an amide, for example, as a methyl amide.
[0514] For example, a thiol group may be protected as a thioether
(--SR), for example, as: a benzyl thioether; an acetamidomethyl
ether (--S--CH2NHC(.dbd.O)CH3).
Nucleic Acid Based Inhibitors
[0515] Nucleic acid-based inhibitors for inhibition IDH, e.g.,
IDH1, can be, e.g., double stranded RNA (dsRNA) that function,
e.g., by an RNA interference (RNAi mechanism), an antisense RNA, or
a microRNA (miRNA). In an embodiment the nucleic-acid based
inhibitor binds to the target mRNA and inhibits the production of
protein therefrom, e.g., by cleavage of the targent mRNA.
[0516] Double Stranded RNA (dsRNA)
[0517] A nucleic acid based inhibitor useful for decreasing IDH1 or
IDH2 mutant function is, e.g., a dsRNA, such as a dsRNA that acts
by an RNAi mechanism. RNAi refers to the process of
sequence-specific post-transcriptional gene silencing in animals
mediated by short interfering RNAs (siRNAs). dsRNAs as used herein
are understood to include siRNAs. Typically, inhibition of IDH,
e.g., IDH1, by dsRNAs does not trigger the interferon response that
results from dsRNA-mediated activation of protein kinase PKR and
2',5'-oligoadenylate synthetase resulting in non-specific cleavage
of mRNA by ribonuclease L.
[0518] dsRNAs targeting an IDH, e.g., IDH1, enzyme, e.g., a
wildtype or mutant IDH1, can be unmodified or chemically modified.
The dsRNA can be chemically synthesized, expressed from a vector or
enzymatically synthesized. The invention also features various
chemically modified synthetic dsRNA molecules capable of modulating
IDH1 gene expression or activity in cells by RNA interference
(RNAi). The use of chemically modified dsRNA improves various
properties of native dsRNA molecules, such as through increased
resistance to nuclease degradation in vivo and/or through improved
cellular uptake.
[0519] The dsRNAs targeting nucleic acid can be composed of two
separate RNAs, or of one RNA strand, which is folded to form a
hairpin structure. Hairpin dsRNAs are typically referred to as
shRNAs.
[0520] An shRNA that targets IDH, e.g., a mutant or wildtype IDH1
gene can be expressed from a vector, e.g., viral vector, such as a
lentiviral or adenoviral vector. In certain embodiments, a suitable
dsRNA for inhibiting expression of an IDH1 gene will be identified
by screening an siRNA library, such as an adenoviral or lentiviral
siRNA library.
[0521] In an embodiment, a dsRNA that targets IDH, e.g., IDH1, is
about 15 to about 30 base pairs in length (e.g., about 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29) basepairs in length.
In another embodiment, the dsRNA includes overhanging ends of about
1 to about 3 (e.g., about 1, 2, or 3) nucleotides. By "overhang" is
meant that 3'-end of one strand of the dsRNA extends beyond the
5'-end of the other strand, or vice versa. The dsRNA can have an
overhang on one or both ends of the dsRNA molecule. In some
embodiments, the single-stranded overhang is located at the
3'-terminal end of the antisense strand, or, alternatively, at the
3'-terminal end of the sense strand. In some embodiments, the
overhang is a TT or UU dinucleotide overhang, e.g., a TT or UU
dinucleotide overhang. For example, in an embodiment, the dsRNA
includes a 21-nucleotide antisense strand, a 19 base pair duplex
region, and a 3'-terminal dinucleotide. In yet another embodiment,
a dsRNA includes a duplex nucleic acid where both ends are blunt,
or alternatively, where one of the ends is blunt.
[0522] In an embodiment, the dsRNA includes a first and a second
strand, each strand is about 18 to about 28 nucleotides in length,
e.g., about 19 to about 23 nucleotides in length, the first strand
of the dsRNA includes a nucleotide sequence having sufficient
complementarity to the IDH, e.g., IDH1, RNA for the dsRNA to direct
cleavage of the IDH, e.g., IDH1, mRNA via RNA interference, and the
second strand of the dsRNA includes a nucleotide sequence that is
complementary to the first strand.
[0523] In an embodiment, a dsRNA targeting an IDH, e.g., IDH1, gene
can target wildtype and mutant forms of the gene, or can target
different allelic isoforms of the same gene. For example, the dsRNA
will target a sequence that is identical in two or more of the
different isoforms. In an embodiment, the dsRNA targets an IDH1
having G at position 395 or C at position 394 (e.g., a wildtype
IDH1 RNA) and an IDH1 having A at position 395 or A at position
394, such as a C394A, a C394G, a C394T, a G395C, a G395T or a G395A
mutation, (e.g., an IDH1 RNA carrying a G395A and/or a C394A
mutation) (FIG. 2).
[0524] In an embodiment, a dsRNA will preferentially or
specifically target a mutant IDH RNA, or a particular IDH
polymorphism. In some embodiments, the IDH has a mutation at
position 394 or 395 such as a C394A, a C394G, a C394T, a G395C, a
G395T or a G395A mutation. For example, in an embodiment, the dsRNA
targets an IDH1 RNA carrying an A at position 395, e.g., G395A, and
in another embodiment, the dsRNA targets an IDH1 RNA carrying an A
at position 394, e.g., C394A mutation.
[0525] In an embodiment, a dsRNA targeting an IDH RNA includes one
or more chemical modifications. Non-limiting examples of such
chemical modifications include without limitation phosphorothioate
internucleotide linkages, 2'-deoxyribonucleotides, 2'-O-methyl
ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, "universal
base" nucleotides, "acyclic" nucleotides, 5-C-methyl nucleotides,
and terminal glyceryl and/or inverted deoxy abasic residue
incorporation. Such chemical modifications have been shown to
preserve RNAi activity in cells while at the same time,
dramatically increasing the serum stability of these compounds.
Furthermore, one or more phosphorothioate substitutions are
well-tolerated and have been shown to confer substantial increases
in serum stability for modified dsRNA constructs.
[0526] In an embodiment, a dsRNA targeting an IDH, e.g., IDH1, RNA
includes modified nucleotides while maintaining the ability to
mediate RNAi. The modified nucleotides can be used to improve in
vitro or in vivo characteristics such as stability, activity,
and/or bioavailability. For example, the dsRNA can include modified
nucleotides as a percentage of the total number of nucleotides
present in the molecule. As such, the dsRNA can generally include
about 5% to about 100% modified nucleotides (e.g., about 5%, 10%,
15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%,
80%, 85%, 90%, 95% or 100% modified nucleotides).
[0527] In some embodiments, the dsRNA targeting IDH, e.g., IDH1, is
about 21 nucleotides long. In another embodiment, the dsRNA does
not contain any ribonucleotides, and in another embodiment, the
dsRNA includes one or more ribonucleotides. In an embodiment, each
strand of the dsRNA molecule independently includes about 15 to
about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, or 30) nucleotides, wherein each strand includes
about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, or 30) nucleotides that are
complementary to the nucleotides of the other strand. In an
embodiment, one of the strands of the dsRNA includes a nucleotide
sequence that is complementary to a nucleotide sequence or a
portion thereof of the IDH1 or IDH2 gene, and the second strand of
the dsRNA includes a nucleotide sequence substantially similar to
the nucleotide sequence of the IDH1 or IDH2 gene or a portion
thereof.
[0528] In an embodiment, the dsRNA targeting IDH1 or IDH2 includes
an antisense region having a nucleotide sequence that is
complementary to a nucleotide sequence of the IDH1 or IDH2 gene or
a portion thereof, and a sense region having a nucleotide sequence
substantially similar to the nucleotide sequence of the IDH1 or
IDH2 gene or a portion thereof. In an embodiment, the antisense
region and the sense region independently include about 15 to about
30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, or 30) nucleotides, where the antisense region includes
about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, or 30) nucleotides that are
complementary to nucleotides of the sense region.
[0529] As used herein, the term "dsRNA" is meant to include nucleic
acid molecules that are capable of mediating sequence specific
RNAi, such as short interfering RNA (siRNA), short hairpin RNA
(shRNA), short interfering oligonucleotide, short interfering
nucleic acid, short interfering modified oligonucleotide,
chemically modified siRNA, post-transcriptional gene silencing RNA
(ptgsRNA), and others. In addition, as used herein, the term "RNAi"
is meant to include sequence specific RNA interference, such as
post transcriptional gene silencing, translational inhibition, or
epigenetics.
[0530] Nucleic Acid-Based IDH Inhibitors
[0531] In an embodiment the inhibitor is a nucleic acid-based
inhibitor, such as a double stranded RNA (dsRNA) or antisense RNA
that targets a mutant IDH, e.g., mutant IDH 1 or IDH2.
[0532] In one embodiment, the nucleic acid based inhibitor, e.g., a
dsRNA or antisense molecule, decreases or inhibits expression of an
IDH1 having other than an Arg, e.g., having a His, Ser, Cys, Gly,
Val, Pro or Leu, or any residue described in Yan et al., N. Eng. J.
Med. 360:765-73, at residue 132, according to the sequence of SEQ
ID NO:8 (see also FIG. 21). In one embodiment, the nucleic acid
based inhibitor decreases or inhibits expression of an IDH1 enzyme
having His at residue 132
[0533] In an embodiment the nucleic acid-based inhibitor is a dsRNA
that targets an mRNA that encodes an IDH1 allele described herein,
e.g., an IDH1 allele having other than an Arg at residue 132. E.g.,
the allele encodes His, Ser, Cys, Gly, Val, Pro or Leu, or any
residue described in Yan et al., at residue 132, according to the
sequence of SEQ ID NO:8 (see also FIG. 21).
[0534] In an embodiment the allele encodes an IDH1 having His at
residue 132.
[0535] In an embodiment the allele encodes an IDH1 having Ser at
residue 132.
[0536] In an embodiment, the nucleic acid-based inhibitor is a
dsRNA that targets IDH1, e.g., an IDH1 having an A or a T (or a
nucleotide other than C) at nucleotide position 394 or an A (or a
nucleotide other than G) at nucleotide position 395, e.g., a mutant
allele carrying a C394T mutation or a G395A mutation according to
the IDH1 sequence of SEQ ID NO:8 (see also FIG. 21A).
[0537] In an embodiment, the dsRNA targets an IDH1 having other
than C, e.g., a T or an A, at nucleotide position 394 or and other
than G, e.g., an A, at 395 (e.g., a mutant) and an IDH1 having a C
at nucleotide position 394 or a G at nucleotide position 395 (e.g.,
a wildtype), e.g., by targeting a region of the IDH1 mRNA that is
identical between the wildtype and mutant transcripts. In yet
another embodiment, the dsRNA targets a particular mutant or
polymorphism (such as a single nucleotide polymorphism (SNP)), but
not a wildtype allele. In this case, the nucleic acid based
inhibitor, e.g., a dsRNA, targets the region of the IDH1 containing
the mutation.
[0538] In some embodiments, the nucleic acid based inhibitor, e.g.,
a dsRNA preferentially or specifically inhibits the product of a
mutant IDH1 as compared to the product of a wildtype IDH1. In some
embodiments, the IDH has a mutation at position 394 or 395 such as
a C394A, a C394G, a C394T, a G395C, a G395T or a G395A mutation.
For example, in one embodiment, a dsRNA targets a region of an IDH1
mRNA that carries the mutation (e.g., a C394A of C394T or a G395A
mutation according to SEQ ID NO:5).
[0539] In one embodiment, the nucleic acid-based inhibitor is a
dsRNA including a sense strand and an antisense strand having a
primary sequence presented in Tables 7-14. In another embodiment,
the nucleic acid based inhibitor is an antisense oligonucleotide
that includes all or a part of an antisense primary sequence
presented in Tables 7-14 or which targets the same or substantially
the same region as does a dsRNA from Tables 7-14.
[0540] In one embodiment, the nucleic acid based inhibitor
decreases or inhibits expression of an IDH2 having Lys, Gly, Met,
Trp, Thr, Ser, or any residue described in Yan et al., at residue
172, according to the amino acid sequence of SEQ ID NO:10 (see also
FIG. 22). In one embodiment, the nucleic acid based inhibitor
decreases or inhibits expression of an IDH2 enzyme having Lys at
residue 172.
[0541] In an embodiment the nucleic acid-based inhibitor is a dsRNA
that targets an mRNA that encodes an IDH2 allele described herein,
e.g., an IDH2 allele having other than an Arg at residue 172. E.g.,
the allele can have Lys, Gly, Met, Trp, Thr, Ser, or any residue
described in Yan et al., at residue 172, according to the sequence
of SEQ ID NO:10 (see also FIG. 22).
[0542] In an embodiment the allele encodes an IDH2 having Lys at
residue 172.
[0543] In an embodiment the allele encodes an IDH2 having Met at
residue 172.
[0544] In an embodiment, the nucleic acid-based inhibitor is a
dsRNA that targets IDH2, e.g., an IDH2 having a G or a T (or a
nucleotide other than A or C) at nucleotide position 514 or an A or
T or C (or a nucleotide other than G) at nucleotide position 515,
e.g., a mutant allele carrying a A514G mutation or a G515T or a
G515A mutation according to the IDH2 sequence of SEQ ID NO:10 (FIG.
22A). In one embodiment, the nucleic acid-based inhibitor is a
dsRNA that targets IDH2, e.g., an IDH2 having a C or a T (or a
nucleotide other than G or A) at nucleotide position 516 according
to the IDH2 sequence of SEQ ID NO:10.
[0545] In an embodiment, the nucleic acid-based inhibitor is a
dsRNA that targets IDH2, e.g., an IDH2 having a G at nucleotide
position 514 or a T at nucleotide position 515 or an A at position
515, according to the IDH2 sequence of SEQ ID NO:10.
[0546] In an embodiment, the dsRNA targets an IDH2 having other
than A, e.g., a G or a T, at nucleotide position 514, or other than
G, e.g., an A or C or T at position 515 (e.g., a mutant), or other
than G, e.g., C or T, and an IDH2 having an A at nucleotide
position 514 or a G at nucleotide position 515 or a G at position
516 (e.g., a wildtype), e.g., by targeting a region of the IDH2
mRNA that is identical between the wildtype and mutant transcripts.
In yet another embodiment, the dsRNA targets a particular mutant or
polymorphism (such as a single nucleotide polymorphism (SNP)), but
not a wildtype allele. In this case, the nucleic acid based
inhibitor, e.g., a dsRNA, targets the region of the IDH2 containing
the mutation.
[0547] In some embodiments, the nucleic acid based inhibitor, e.g.,
a dsRNA, preferentially or specifically inhibits the product of a
mutant IDH2 as compared to the product of a wildtype IDH2. For
example, in one embodiment, a dsRNA targets a region of an IDH2
mRNA that carries the mutation (e.g., an A514G or G515T or a G515U
mutation according to SEQ ID NO:10).
[0548] In one embodiment, the nucleic acid-based inhibitor is a
dsRNA including a sense strand and an antisense strand having a
primary sequence presented in Tables 15-23. In another embodiment,
the nucleic acid based inhibitor is an antisense oligonucleotide
that includes all or a part of an antisense primary sequence
presented in Tables 15-23 or which targets the same or
substantially the same region as does a dsRNA from Tables
15-23.
[0549] In an embodiment, the nucleic acid based inhibitor is
delivered to the brain, e.g., directly to the brain, e.g., by
intrathecal or intraventricular delivery. The nucleic acid based
inhibitor can also be delivered from an inplantable device. In an
embodiment, the nucleic acid-based inhibitor is delivered by
infusion using, e.g., a catheter, and optionally, a pump.
[0550] Antisense
[0551] Suitable nucleic acid based inhibitors include antisense
nucleic acids. While not being bound by theory it is believed that
antisense inhibition is typically based upon hydrogen bonding-based
hybridization of oligonucleotide strands or segments such that at
least one strand or segment is cleaved, degraded, or otherwise
rendered inoperable.
[0552] An antisense agent can bind IDH1 or IDH2 DNA. In embodiments
it inhibits replication and transcription. While not being bound by
theory it is believed that an antisense agent can also function to
inhibit target RNA translocation, e.g., to a site of protein
translation, translation of protein from the RNA, splicing of the
RNA to yield one or more RNA species, and catalytic activity or
complex formation involving the RNA.
[0553] An antisense agents can have a chemical modification
described above as being suitable for dsRNA.
[0554] Antisense agents can include, for example, from about 8 to
about 80 nucleobases (i.e., from about 8 to about 80 nucleotides),
e.g., about 8 to about 50 nucleobases, or about 12 to about 30
nucleobases. Antisense compounds include ribozymes, external guide
sequence (EGS) oligonucleotides (oligozymes), and other short
catalytic RNAs or catalytic oligonucleotides which hybridize to the
target nucleic acid and modulate its expression. Anti-sense
compounds can include a stretch of at least eight consecutive
nucleobases that are complementary to a sequence in the target
gene. An oligonucleotide need not be 100% complementary to its
target nucleic acid sequence to be specifically hybridizable. An
oligonucleotide is specifically hybridizable when binding of the
oligonucleotide to the target interferes with the normal function
of the target molecule to cause a loss of utility, and there is a
sufficient degree of complementarity to avoid non-specific binding
of the oligonucleotide to non-target sequences under conditions in
which specific binding is desired, i.e., under physiological
conditions in the case of in vivo assays or therapeutic treatment
or, in the case of in vitro assays, under conditions in which the
assays are conducted.
[0555] Hybridization of antisense oligonucleotides with mRNA (e.g.,
an mRNA encoding IDH1 or IDH2) can interfere with one or more of
the normal functions of mRNA. While not being bound by theory it is
believed that a the functions of mRNA to be interfered with include
all key functions such as, for example, translocation of the RNA to
the site of protein translation, translation of protein from the
RNA, splicing of the RNA to yield one or more mRNA species, and
catalytic activity which may be engaged in by the RNA. Binding of
specific protein(s) to the RNA may also be interfered with by
antisense oligonucleotide hybridization to the RNA.
[0556] Exemplary antisense compounds include DNA or RNA sequences
that specifically hybridize to the target nucleic acid, e.g., the
mRNA encoding IDH1 or IDH2. The complementary region can extend for
between about 8 to about 80 nucleobases. The compounds can include
one or more modified nucleobases. Modified nucleobases may include,
e.g., 5-substituted pyrimidines such as 5-iodouracil,
5-iodocytosine, and C5-propynyl pyrimidines such as
C5-propynylcytosine and C5-propynyluracil. Other suitable modified
nucleobases include N.sup.4--(C.sub.1-C.sub.12) alkylaminocytosines
and N.sup.4,N.sup.4--(C.sub.1-C.sub.12) dialkylaminocytosines.
Modified nucleobases may also include
7-substituted-5-aza-7-deazapurines and 7-substituted-7-deazapurines
such as, for example, 7-iodo-7-deazapurines,
7-cyano-7-deazapurines, 7-aminocarbonyl-7-deazapurines. Examples of
these include 6-amino-7-iodo-7-deazapurines,
6-amino-7-cyano-7-deazapurines,
6-amino-7-aminocarbonyl-7-deazapurines,
2-amino-6-hydroxy-7-iodo-7-deazapurines,
2-amino-6-hydroxy-7-cyano-7-deazapurines, and
2-amino-6-hydroxy-7-aminocarbonyl-7-deazapurines. Furthermore,
N.sup.6--(C.sub.1-C.sub.12) alkylaminopurines and
N.sup.6,N.sup.6--(C.sub.1-C.sub.12) dialkylaminopurines, including
N.sup.6-methylaminoadenine and
N.sup.6,N.sup.6-dimethylaminoadenine, are also suitable modified
nucleobases. Similarly, other 6-substituted purines including, for
example, 6-thioguanine may constitute appropriate modified
nucleobases. Other suitable nucleobases include 2-thiouracil,
8-bromoadenine, 8-bromoguanine, 2-fluoroadenine, and
2-fluoroguanine. Derivatives of any of the aforementioned modified
nucleobases are also appropriate. Substituents of any of the
preceding compounds may include C.sub.1-C.sub.30 alkyl,
C.sub.2-C.sub.30 alkenyl, C.sub.2-C.sub.30 alkynyl, aryl, aralkyl,
heteroaryl, halo, amino, amido, nitro, thio, sulfonyl, carboxyl,
alkoxy, alkylcarbonyl, alkoxycarbonyl, and the like.
[0557] MicroRNA
[0558] In some embodiments, the nucleic acid-based inhibitor
suitable for targeting IDH, e.g., IDH1, is a microRNA (miRNA). A
miRNA is a single stranded RNA that regulates the expression of
target mRNAs either by mRNA cleavage, translational
repression/inhibition or heterochromatic silencing. The miRNA is 18
to 25 nucleotides, typically 21 to 23 nucleotides in length. In
some embodiments, the miRNA includes chemical modifications, such
as one or more modifications described herein.
[0559] In some embodiments, a nucleic acid based inhibitor
targeting IDH has partial complementarity (i.e., less than 100%
complementarity) with the target IDH, e.g., IDH1 or IDH2, mRNA. For
example, partial complementarity can include various mismatches or
non-base paired nucleotides (e.g., 1, 2, 3, 4, 5 or more mismatches
or non-based paired nucleotides, such as nucleotide bulges), which
can result in bulges, loops, or overhangs that result between the
antisense strand or antisense region of the nucleic acid-based
inhibitor and the corresponding target nucleic acid molecule.
[0560] The nucleic acid-based inhibitors described herein, e.g.,
antisense nucleic acid described herein, can be incorporated into a
gene construct to be used as a part of a gene therapy protocol to
deliver nucleic acids that can be used to express and produce
agents within cells. Expression constructs of such components may
be administered in any biologically-effective carrier, e.g., any
formulation or composition capable of effectively delivering the
component gene to cells in vivo. Approaches include insertion of
the subject gene in viral vectors including recombinant
retroviruses, adenovirus, adeno-associated virus, lentivirus, and
herpes simplex virus-1, or recombinant bacterial or eukaryotic
plasmids. Viral vectors transfect cells directly; plasmid DNA can
be delivered with the help of, for example, cationic liposomes
(lipofectin) or derivatized (e.g., antibody conjugated) polylysine
conjugates, gramacidin S, artificial viral envelopes or other such
intracellular earners, as well as direct injection of the gene
construct or CaPO.sub.4 precipitation carried out in vivo.
[0561] In an embodiment, in vivo introduction of nucleic acid into
a cell includes use of a viral vector containing nucleic acid,
e.g., a cDNA. Infection of cells with a viral vector has the
advantage that a large proportion of the targeted cells can receive
the nucleic acid. Additionally, molecules encoded within the viral
vector, e.g., by a cDNA contained in the viral vector, are
expressed efficiently in cells which have taken up viral vector
nucleic acid.
[0562] Retroviral vectors and adeno-associated virus vectors can be
used as a recombinant gene delivery system for the transfer of
exogenous genes in vivo particularly into humans. These vectors
provide efficient delivery of genes into cells, and the transferred
nucleic acids are stably integrated into the chromosomal DNA of the
host. Protocols for producing recombinant retroviruses and for
infecting cells in vitro or in vivo with such viruses can be found
in Current Protocols in Molecular Biology, Ausubel, F. M. et al.
(eds.) Greene Publishing Associates (1989), Sections 9.10-9.14 and
other standard laboratory manuals. Examples of suitable
retroviruses include pLJ, pZIP, pWE, and pEM which are known to
those skilled in the art. Examples of suitable packaging virus
lines for preparing both ecotropic and amphotropic retroviral
systems include Crip, Cre, 2, and Am. Retroviruses have been used
to introduce a variety of genes into many different cell types,
including epithelial cells, in vitro and/or in vivo (see, for
example, Eglitis et al. (1985) Science 230:1395-1398; Danos and
Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et
al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et
al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al.
(1991) Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991)
Proc. Natl. Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991)
Science 254:1802-1805; van Beusechem et al. (1992) Proc. Natl.
Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy
3:641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA
89:10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-4115; U.S.
Pat. Nos. 4,868,116 and 4,980,286; PCT Pub. Nos. WO 89/07136, WO
89/02468, WO 89/05345, and WO 92/07573).
[0563] Another viral gene delivery system utilizes
adenovirus-derived vectors. See, for example, Berkner et al. (1988)
BioTechniques 6:616; Rosenfeld et al. (1991) Science 252:431-434;
and Rosenfeld et al. (1992) Cell 68:143-155. Suitable adenoviral
vectors derived from the adenovirus strain Ad type 5 d1324 or other
strains of adenovirus (e.g., Ad2, Ad3, Ad7 etc.) are known to those
skilled in the art.
[0564] Yet another viral vector system useful for delivery of the
subject gene is the adeno-associated virus (AAV). See, for example,
Flotte et al. (1992) Am. J. Respir. Cell. Mol. Biol. 7:349-356;
Samulski et al. (1989) J. Virol. 63:3822-3828; and McLaughlin et
al. (1989) J. Virol. 62:1963-1973.
Pharmaceutical Compositions
[0565] The compositions delineated herein include the compounds
delineated herein, as well as additional therapeutic agents if
present, in amounts effective for achieving a modulation of disease
or disease symptoms, including those described herein.
[0566] The term "pharmaceutically acceptable carrier or adjuvant"
refers to a carrier or adjuvant that may be administered to a
patient, together with a compound of this invention, and which does
not destroy the pharmacological activity thereof and is nontoxic
when administered in doses sufficient to deliver a therapeutic
amount of the compound.
[0567] Pharmaceutically acceptable carriers, adjuvants and vehicles
that may be used in the pharmaceutical compositions of this
invention include, but are not limited to, ion exchangers, alumina,
aluminum stearate, lecithin, self-emulsifying drug delivery systems
(SEDDS) such as d-.alpha.-tocopherol polyethyleneglycol 1000
succinate, surfactants used in pharmaceutical dosage forms such as
Tweens or other similar polymeric delivery matrices, serum
proteins, such as human serum albumin, buffer substances such as
phosphates, glycine, sorbic acid, potassium sorbate, partial
glyceride mixtures of saturated vegetable fatty acids, water, salts
or electrolytes, such as protamine sulfate, disodium hydrogen
phosphate, potassium hydrogen phosphate, sodium chloride, zinc
salts, colloidal silica, magnesium trisilicate, polyvinyl
pyrrolidone, cellulose-based substances, polyethylene glycol,
sodium carboxymethylcellulose, polyacrylates, waxes,
polyethylene-polyoxypropylene-block polymers, polyethylene glycol
and wool fat. Cyclodextrins such as .alpha.-, .beta.-, and
.gamma.-cyclodextrin, or chemically modified derivatives such as
hydroxyalkylcyclodextrins, including 2- and
3-hydroxypropyl-.beta.-cyclodextrins, or other solubilized
derivatives may also be advantageously used to enhance delivery of
compounds of the formulae described herein.
[0568] The pharmaceutical compositions containing inhibitors of
IDH, e.g., IDH1, may be administered directly to the central
nervous system, such as into the cerebrospinal fluid or into the
brain. Delivery can be, for example, in a bolus or by continuous
pump infusion. In certain embodiments, delivery is by intrathecal
delivery or by intraventricular injection directly into the brain.
A catheter and, optionally, a pump can be used for delivery. The
inhibitors can be delivered in and released from an implantable
device, e.g., a device that is implanted in association with
surgical removal of tumor tissue. E.g., for delivery to the brain,
the delivery can be analogous to that with Gliadel, a biopolymer
wafer designed to deliver carmustine directly into the surgical
cavity created when a brain tumor is resected. The Gliadel wafer
slowly dissolves and delivers carmustine.
[0569] The therapeutics disclosed herein, e.g., nucleic acid based
inhibitors, e.g. siRNAs can be administered directly to the CNS,
e.g., the brain, e.g., using a pump and/or catheter system. In one
embodiment, the pump is implanted under the skin. In an embodiment
and a catheter attached to a pump is inserted into the CNS, e.g.,
into the brain or spine. In one embodiment, the pump (such as the
IsoMed Drug Pump from Medtronic) delivers dosing, e.g, constant
dosing, of a nucleic acid based inhibitor. In an embodiment, the
pump is programmable to administer variable or constant doses at
predetermined time intervals. For example, the IsoMed Drug pump
from Medtronic (or a similar device) can be used to administer a
constant supply of the inhibitor, or the SynchroMedII Drug Pump (or
a similar device) can be used to administer a variable dosing
regime.
[0570] Methods and devices described in U.S. Pat. Nos. 7,044,932,
6,620,151, 6,283949, and 6,685,452 can be used in methods described
herein.
[0571] The pharmaceutical compositions of this invention may be
administered orally, parenterally, by inhalation, topically,
rectally, nasally, buccally, vaginally or via an implanted
reservoir, preferably by oral administration or administration by
injection. The pharmaceutical compositions of this invention may
contain any conventional non-toxic pharmaceutically-acceptable
carriers, adjuvants or vehicles. In some cases, the pH of the
formulation may be adjusted with pharmaceutically acceptable acids,
bases or buffers to enhance the stability of the formulated
compound or its delivery form. The term parenteral as used herein
includes subcutaneous, intracutaneous, intravenous, intramuscular,
intraarticular, intraarterial, intrasynovial, intrasternal,
intrathecal, intralesional and intracranial injection or infusion
techniques.
[0572] The pharmaceutical compositions may be in the form of a
sterile injectable preparation, for example, as a sterile
injectable aqueous or oleaginous suspension. This suspension may be
formulated according to techniques known in the art using suitable
dispersing or wetting agents (such as, for example, Tween 80) and
suspending agents. The sterile injectable preparation may also be a
sterile injectable solution or suspension in a non-toxic
parenterally acceptable diluent or solvent, for example, as a
solution in 1,3-butanediol. Among the acceptable vehicles and
solvents that may be employed are mannitol, water, Ringer's
solution and isotonic sodium chloride solution. In addition,
sterile, fixed oils are conventionally employed as a solvent or
suspending medium. For this purpose, any bland fixed oil may be
employed including synthetic mono- or diglycerides. Fatty acids,
such as oleic acid and its glyceride derivatives are useful in the
preparation of injectables, as are natural
pharmaceutically-acceptable oils, such as olive oil or castor oil,
especially in their polyoxyethylated versions. These oil solutions
or suspensions may also contain a long-chain alcohol diluent or
dispersant, or carboxymethyl cellulose or similar dispersing agents
which are commonly used in the formulation of pharmaceutically
acceptable dosage forms such as emulsions and or suspensions. Other
commonly used surfactants such as Tweens or Spans and/or other
similar emulsifying agents or bioavailability enhancers which are
commonly used in the manufacture of pharmaceutically acceptable
solid, liquid, or other dosage forms may also be used for the
purposes of formulation.
[0573] The pharmaceutical compositions of this invention may be
orally administered in any orally acceptable dosage form including,
but not limited to, capsules, tablets, emulsions and aqueous
suspensions, dispersions and solutions. In the case of tablets for
oral use, carriers which are commonly used include lactose and corn
starch. Lubricating agents, such as magnesium stearate, are also
typically added. For oral administration in a capsule form, useful
diluents include lactose and dried corn starch. When aqueous
suspensions and/or emulsions are administered orally, the active
ingredient may be suspended or dissolved in an oily phase is
combined with emulsifying and/or suspending agents. If desired,
certain sweetening and/or flavoring and/or coloring agents may be
added.
[0574] The pharmaceutical compositions of this invention may also
be administered in the form of suppositories for rectal
administration. These compositions can be prepared by mixing a
compound of this invention with a suitable non-irritating excipient
which is solid at room temperature but liquid at the rectal
temperature and therefore will melt in the rectum to release the
active components. Such materials include, but are not limited to,
cocoa butter, beeswax and polyethylene glycols.
[0575] Topical administration of the pharmaceutical compositions of
this invention is useful when the desired treatment involves areas
or organs readily accessible by topical application. For
application topically to the skin, the pharmaceutical composition
should be formulated with a suitable ointment containing the active
components suspended or dissolved in a carrier. Carriers for
topical administration of the compounds of this invention include,
but are not limited to, mineral oil, liquid petroleum, white
petroleum, propylene glycol, polyoxyethylene polyoxypropylene
compound, emulsifying wax and water. Alternatively, the
pharmaceutical composition can be formulated with a suitable lotion
or cream containing the active compound suspended or dissolved in a
carrier with suitable emulsifying agents. Suitable carriers
include, but are not limited to, mineral oil, sorbitan
monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol,
2-octyldodecanol, benzyl alcohol and water. The pharmaceutical
compositions of this invention may also be topically applied to the
lower intestinal tract by rectal suppository formulation or in a
suitable enema formulation. Topically-transdermal patches are also
included in this invention.
[0576] The pharmaceutical compositions of this invention may be
administered by nasal aerosol or inhalation. Such compositions are
prepared according to techniques well-known in the art of
pharmaceutical formulation and may be prepared as solutions in
saline, employing benzyl alcohol or other suitable preservatives,
absorption promoters to enhance bioavailability, fluorocarbons,
and/or other solubilizing or dispersing agents known in the
art.
[0577] When the compositions of this invention comprise a
combination of a compound of the formulae described herein and one
or more additional therapeutic or prophylactic agents, both the
compound and the additional agent should be present at dosage
levels of between about 1 to 100%, and more preferably between
about 5 to 95% of the dosage normally administered in a monotherapy
regimen. The additional agents may be administered separately, as
part of a multiple dose regimen, from the compounds of this
invention. Alternatively, those agents may be part of a single
dosage form, mixed together with the compounds of this invention in
a single composition.
[0578] The compounds described herein can, for example, be
administered by injection, intravenously, intraarterially,
subdermally, intraperitoneally, intramuscularly, or subcutaneously;
or orally, buccally, nasally, transmucosally, topically, in an
ophthalmic preparation, or by inhalation, with a dosage ranging
from about 0.02 to about 100 mg/kg of body weight, alternatively
dosages between 1 mg and 1000 mg/dose, every 4 to 120 hours, or
according to the requirements of the particular drug. The methods
herein contemplate administration of an effective amount of
compound or compound composition to achieve the desired or stated
effect. Typically, the pharmaceutical compositions of this
invention will be administered from about 1 to about 6 times per
day or alternatively, as a continuous infusion. Such administration
can be used as a chronic or acute therapy. The amount of active
ingredient that may be combined with the carrier materials to
produce a single dosage form will vary depending upon the host
treated and the particular mode of administration. A typical
preparation will contain from about 5% to about 95% active compound
(w/w). Alternatively, such preparations contain from about 20% to
about 80% active compound.
[0579] Lower or higher doses than those recited above may be
required. Specific dosage and treatment regimens for any particular
patient will depend upon a variety of factors, including the
activity of the specific compound employed, the age, body weight,
general health status, sex, diet, time of administration, rate of
excretion, drug combination, the severity and course of the
disease, condition or symptoms, the patient's disposition to the
disease, condition or symptoms, and the judgment of the treating
physician.
[0580] Upon improvement of a patient's condition, a maintenance
dose of a compound, composition or combination of this invention
may be administered, if necessary. Subsequently, the dosage or
frequency of administration, or both, may be reduced, as a function
of the symptoms, to a level at which the improved condition is
retained when the symptoms have been alleviated to the desired
level. Patients may, however, require intermittent treatment on a
long-term basis upon any recurrence of disease symptoms.
Kits
[0581] A compound described herein can be provided in a kit.
[0582] In an embodiment the kit includes (a) a compound described
herein, e.g., a composition that includes a compound described
herein (wherein, e.g., the compound can be an inhibitor described
herein), and, optionally (b) informational material. The
informational material can be descriptive, instructional, marketing
or other material that relates to the methods described herein
and/or the use of a compound described herein for the methods
described herein.
[0583] In an embodiment the kit provides materials for evaluating a
subject. The evaluation can be, e.g., for: identifying a subject
having unwanted levels (e.g., higher than present in normal or
wildtype cells) of any of 2HG, 2HG neoactivity, or mutant IDH1 or
IDH2 protein having 2HG neoactivity (or corresponding RNA), or
having a somatic mutation in IDH1 or IDH2 characterized by 2HG
neoactivity; diagnosing, prognosing, or staging, a subject, e.g.,
on the basis of having increased levels of 2HG, 2HG neoactivity, or
mutant IDH1 or IDH2 protein having 2HG neoactivity (or
corresponding RNA), or having a somatic mutation in IDH1 or IDH2
characterized by 2HG neoactivity; selecting a treatment for, or
evaluating the efficacy of, a treatment, e.g., on the basis of the
subject having increased levels of 2HG, 2HG neoactivity, or mutant
IDH1 or IDH2 protein having 2HG neoactivity (or corresponding RNA),
or having a somatic mutation in IDH1 or IDH2 characterized by 2HG
neoactivity. The kit can include one or more reagent useful in the
evaluation, e.g., reagents mentioned elsewhere herein. A detection
reagent, e.g., an antibody or other specific binding reagent can be
included. Standards or reference samples, e.g., a positive or
negative control standard can be included. E.g., if the evaluation
is based on the presence of 2HG the kit can include a reagent, e.g,
a positive or negative control standards for an assay, e.g., a
LC-MS assay.
[0584] If the evaluation is based on the presence of 2HG
neoactivity, the kit can include a reagent, e.g., one or more of
those mentioned elsewhere herein, for assaying 2HG neoactivity. If
the evaluation is based on sequencing, the kit can include primers
or other materials useful for sequencing the relevant nucleic acids
for identifying an IHD, e.g., IDH1 or IDH2, neoactive mutant. E.g.,
the kit can contain a reagent that provides for interrogation of
the identity, i.e., sequencing of, residue 132 of IDH1 to determine
if a neoactive mutant is present. The kit can include nucleic
acids, e.g., an oligomer, e.g., primers, which allow sequencing of
the nucleotides that encode residue 132 of IDH1. In an embodiment
the kit includes a nucleic acid whose hybridization, or ability to
be amplified, is dependent on the identity of residue 132 of IDH1.
In other embodiments the kit includes a reagent, e.g., an antibody
or other specific binding molecule that can identify the presence
of a neoactive mutant, e.g., a protein encoded by a neoactive
mutant at 132 of IDH1. As described below, a kit can also include
buffers, solvents, and information related to the evaluation.
[0585] In one embodiment, the informational material can include
information about production of the compound, molecular weight of
the compound, concentration, date of expiration, batch or
production site information, and so forth. In one embodiment, the
informational material relates to methods for administering the
compound.
[0586] In one embodiment, the informational material can include
instructions to administer a compound described herein in a
suitable manner to perform the methods described herein, e.g., in a
suitable dose, dosage form, or mode of administration (e.g., a
dose, dosage form, or mode of administration described herein). In
another embodiment, the informational material can include
instructions to administer a compound described herein to a
suitable subject, e.g., a human, e.g., a human having or at risk
for a disorder described herein.
[0587] The informational material of the kits is not limited in its
form. In many cases, the informational material, e.g.,
instructions, is provided in printed matter, e.g., a printed text,
drawing, and/or photograph, e.g., a label or printed sheet.
However, the informational material can also be provided in other
formats, such as Braille, computer readable material, video
recording, or audio recording. In another embodiment, the
informational material of the kit is contact information, e.g., a
physical address, email address, website, or telephone number,
where a user of the kit can obtain substantive information about a
compound described herein and/or its use in the methods described
herein. Of course, the informational material can also be provided
in any combination of formats.
[0588] In addition to a compound described herein, the composition
of the kit can include other ingredients, such as a solvent or
buffer, a stabilizer, a preservative, a flavoring agent (e.g., a
bitter antagonist or a sweetener), a fragrance or other cosmetic
ingredient, and/or a second agent for treating a condition or
disorder described herein. Alternatively, the other ingredients can
be included in the kit, but in different compositions or containers
than a compound described herein. In such embodiments, the kit can
include instructions for admixing a compound described herein and
the other ingredients, or for using a compound described herein
together with the other ingredients.
[0589] A compound described herein can be provided in any form,
e.g., liquid, dried or lyophilized form. It is preferred that a
compound described herein be substantially pure and/or sterile.
When a compound described herein is provided in a liquid solution,
the liquid solution preferably is an aqueous solution, with a
sterile aqueous solution being preferred. When a compound described
herein is provided as a dried form, reconstitution generally is by
the addition of a suitable solvent. The solvent, e.g., sterile
water or buffer, can optionally be provided in the kit.
[0590] The kit can include one or more containers for the
composition containing a compound described herein. In some
embodiments, the kit contains separate containers, dividers or
compartments for the composition and informational material. For
example, the composition can be contained in a bottle, vial, or
syringe, and the informational material can be contained in a
plastic sleeve or packet. In other embodiments, the separate
elements of the kit are contained within a single, undivided
container. For example, the composition is contained in a bottle,
vial or syringe that has attached thereto the informational
material in the form of a label. In some embodiments, the kit
includes a plurality (e.g., a pack) of individual containers, each
containing one or more unit dosage forms (e.g., a dosage form
described herein) of a compound described herein. For example, the
kit includes a plurality of syringes, ampules, foil packets, or
blister packs, each containing a single unit dose of a compound
described herein. The containers of the kits can be air tight,
waterproof (e.g., impermeable to changes in moisture or
evaporation), and/or light-tight.
[0591] The kit optionally includes a device suitable for
administration of the composition, e.g., a syringe, inhalant,
pipette, forceps, measured spoon, dropper (e.g., eye dropper), swab
(e.g., a cotton swab or wooden swab), or any such delivery device.
In an embodiment, the device is a medical implant device, e.g.,
packaged for surgical insertion.
Combination Therapies
[0592] In some embodiments, a compound or composition described
herein, is administered together with an additional cancer
treatment. Exemplary cancer treatments include, for example:
surgery, chemotherapy, targeted therapies such as antibody
therapies, immunotherapy, and hormonal therapy. Examples of each of
these treatments are provided below.
[0593] Chemotherapy
[0594] In some embodiments, a compound or composition described
herein, is administered with a chemotherapy. Chemotherapy is the
treatment of cancer with drugs that can destroy cancer cells.
"Chemotherapy" usually refers to cytotoxic drugs which affect
rapidly dividing cells in general, in contrast with targeted
therapy. Chemotherapy drugs interfere with cell division in various
possible ways, e.g., with the duplication of DNA or the separation
of newly formed chromosomes. Most forms of chemotherapy target all
rapidly dividing cells and are not specific for cancer cells,
although some degree of specificity may come from the inability of
many cancer cells to repair DNA damage, while normal cells
generally can.
[0595] Examples of chemotherapeutic agents used in cancer therapy
include, for example, antimetabolites (e.g., folic acid, purine,
and pyrimidine derivatives) and alkylating agents (e.g., nitrogen
mustards, nitrosoureas, platinum, alkyl sulfonates, hydrazines,
triazenes, aziridines, spindle poison, cytotoxic agents,
toposimerase inhibitors and others). Exemplary agents include
Aclarubicin, Actinomycin, Alitretinon, Altretamine, Aminopterin,
Aminolevulinic acid, Amrubicin, Amsacrine, Anagrelide, Arsenic
trioxide, Asparaginase, Atrasentan, Belotecan, Bexarotene,
endamustine, Bleomycin, Bortezomib, Busulfan, Camptothecin,
Capecitabine, Carboplatin, Carboquone, Carmofur, Carmustine,
Celecoxib, Chlorambucil, Chlormethine, Cisplatin, Cladribine,
Clofarabine, Crisantaspase, Cyclophosphamide, Cytarabine,
Dacarbazine, Dactinomycin, Daunorubicin, Decitabine, Demecolcine,
Docetaxel, Doxorubicin, Efaproxiral, Elesclomol, Elsamitrucin,
Enocitabine, Epirubicin, Estramustine, Etoglucid, Etoposide,
Floxuridine, Fludarabine, Fluorouracil (5FU), Fotemustine,
Gemcitabine, Gliadel implants, Hydroxycarbamide, Hydroxyurea,
Idarubicin, Ifosfamide, Irinotecan, Irofulven, Ixabepilone,
Larotaxel, Leucovorin, Liposomal doxorubicin, Liposomal
daunorubicin, Lonidamine, Lomustine, Lucanthone, Mannosulfan,
Masoprocol, Melphalan, Mercaptopurine, Mesna, Methotrexate, Methyl
aminolevulinate, Mitobronitol, Mitoguazone, Mitotane, Mitomycin,
Mitoxantrone, Nedaplatin, Nimustine, Oblimersen, Omacetaxine,
Ortataxel, Oxaliplatin, Paclitaxel, Pegaspargase, Pemetrexed,
Pentostatin, Pirarubicin, Pixantrone, Plicamycin, Porfimer sodium,
Prednimustine, Procarbazine, Raltitrexed, Ranimustine, Rubitecan,
Sapacitabine, Semustine, Sitimagene ceradenovec, Strataplatin,
Streptozocin, Talaporfin, Tegafur-uracil, Temoporfin, Temozolomide,
Teniposide, Tesetaxel, Testolactone, Tetranitrate, Thiotepa,
Tiazofurine, Tioguanine, Tipifarnib, Topotecan, Trabectedin,
Triaziquone, Triethylenemelamine, Triplatin, Tretinoin, Treosulfan,
Trofosfamide, Uramustine, Valrubicin, Verteporfin, Vinblastine,
Vincristine, Vindesine, Vinflunine, Vinorelbine, Vorinostat,
Zorubicin, and other cytostatic or cytotoxic agents described
herein.
[0596] Because some drugs work better together than alone, two or
more drugs are often given at the same time. Often, two or more
chemotherapy agents are used as combination chemotherapy. In some
embodiments, the chemotherapy agents (including combination
chemotherapy) can be used in combination with a compound described
herein, e.g., phenformin.
[0597] Targeted Therapy
[0598] In some embodiments, a compound or composition described
herein, is administered with a targeted therapy. Targeted therapy
constitutes the use of agents specific for the deregulated proteins
of cancer cells. Small molecule targeted therapy drugs are
generally inhibitors of enzymatic domains on mutated,
overexpressed, or otherwise critical proteins within the cancer
cell. Prominent examples are the tyrosine kinase inhibitors such as
Axitinib, Bosutinib, Cediranib, desatinib, erlotinib, imatinib,
gefitinib, lapatinib, Lestaurtinib, Nilotinib, Semaxanib,
Sorafenib, Sunitinib, and Vandetanib, and also cyclin-depdendent
kinase inhibitors such as Alvocidib and Seliciclib. Monoclonal
antibody therapy is another strategy in which the therapeutic agent
is an antibody which specifically binds to a protein on the surface
of the cancer cells. Examples include the anti-HER2/neu antibody
trastuzumab (HERCEPTIN.RTM.) typically used in breast cancer, and
the anti-CD20 antibody rituximab and Tositumomab typically used in
a variety of B-cell malignancies. Other exemplary antibodies
include Cetuximab, Panitumumab, Trastuzumab, Alemtuzumab,
Bevacizumab, Edrecolomab, and Gemtuzumab. Exemplary fusion proteins
include Aflibercept and Denileukin diftitox. In some embodiments,
the targeted therapy can be used in combination with a compound
described herein, e.g., a biguanide such as metformin or
phenformin, preferably phenformin.
[0599] Targeted therapy can also involve small peptides as "homing
devices" which can bind to cell surface receptors or affected
extracellular matrix surrounding the tumor. Radionuclides which are
attached to these peptides (e.g., RGDs) eventually kill the cancer
cell if the nuclide decays in the vicinity of the cell. An example
of such therapy includes BEXXAR.RTM..
[0600] Immunotherapy
[0601] In some embodiments, a compound or composition described
herein, is administered with an immunotherapy. Cancer immunotherapy
refers to a diverse set of therapeutic strategies designed to
induce the patient's own immune system to fight the tumor.
Contemporary methods for generating an immune response against
tumors include intravesicular BCG immunotherapy for superficial
bladder cancer, and use of interferons and other cytokines to
induce an immune response in renal cell carcinoma and melanoma
patients.
[0602] Allogeneic hematopoietic stem cell transplantation can be
considered a form of immunotherapy, since the donor's immune cells
will often attack the tumor in a graft-versus-tumor effect. In some
embodiments, the immunotherapy agents can be used in combination
with a compound or composition described herein.
[0603] Hormonal Therapy
[0604] In some embodiments, a compound or composition described
herein, is administered with a hormonal therapy. The growth of some
cancers can be inhibited by providing or blocking certain hormones.
Common examples of hormone-sensitive tumors include certain types
of breast and prostate cancers. Removing or blocking estrogen or
testosterone is often an important additional treatment. In certain
cancers, administration of hormone agonists, such as progestogens
may be therapeutically beneficial. In some embodiments, the
hormonal therapy agents can be used in combination with a compound
or a composition described herein.
[0605] In some embodiments, a compound or composition described
herein, is administered together with an additional cancer
treatment (e.g., surgical removal), in treating cancer in nervous
system, e.g., cancer in central nervous system, e.g., brain tumor,
e.g., glioma, e.g., glioblastoma multiforme (GBM).
[0606] Several studies have suggested that more than 25% of
glioblastoma patients obtain a significant survival benefit from
adjuvant chemotherapy. Meta-analyses have suggested that adjuvant
chemotherapy results in a 6-10% increase in 1-year survival
rate.
[0607] Temozolomide is an orally active alkylating agent that is
used for persons newly diagnosed with glioblastoma multiforme. It
was approved by the United States Food and Drug Administration
(FDA) in March 2005. Studies have shown that the drug was well
tolerated and provided a survival benefit. Adjuvant and concomitant
temozolomide with radiation was associated with significant
improvements in median progression-free survival over radiation
alone (6.9 vs 5 mo), overall survival (14.6 vs 12.1 mo), and the
likelihood of being alive in 2 years (26% vs 10%).
[0608] Nitrosoureas: BCNU (carmustine)-polymer wafers (Gliadel)
were approved by the FDA in 2002. Though Gliadel wafers are used by
some for initial treatment, they have shown only a modest increase
in median survival over placebo (13.8 vs. 11.6 months) in the
largest such phase III trial, and are associated with increased
rates of CSF leak and increased intracranial pressure secondary to
edema and mass effect.
[0609] MGMT is a DNA repair enzyme that contributes to temozolomide
resistance. Methylation of the MGMT promoter, found in
approximately 45% of glioblastoma multiformes, results in an
epigenetic silencing of the gene, decreasing the tumor cell's
capacity for DNA repair and increasing susceptibility to
temozolomide.
[0610] When patients with and without MGMT promoter methylation
were treated with temozolomide, the groups had median survivals of
21.7 versus 12.7 months, and 2-year survival rates of 46% versus
13.8%, respectively.
[0611] Though temozolomide is currently a first-line agent in the
treatment of glioblastoma multiforme, unfavorable MGMT methylation
status could help select patients appropriate for future
therapeutic investigations.
[0612] O6-benzylguanine and other inhibitors of MGMT as well as RNA
interference-mediated silencing of MGMT offer promising avenues to
increase the effectiveness of temozolomide and other alkylating
antineoplastics, and such agents are under active study.
[0613] Carmustine (BCNU) and cis-platinum (cisplatin) have been the
primary chemotherapeutic agents used against malignant gliomas. All
agents in use have no greater than a 30-40% response rate, and most
fall into the range of 10-20%.
[0614] Data from the University of California at San Francisco
indicate that, for the treatment of glioblastomas, surgery followed
by radiation therapy leads to 1-, 3-, and 5-year survival rates of
44%, 6%, and 0%, respectively. By comparison, surgery followed by
radiation and chemotherapy using nitrosourea-based regimens
resulted in 1-, 3-, and 5-year survival rates of 46%, 18%, and 18%,
respectively.
[0615] A major hindrance to the use of chemotherapeutic agents for
brain tumors is the fact that the blood-brain barrier (BBB)
effectively excludes many agents from the CNS. For this reason,
novel methods of intracranial drug delivery are being developed to
deliver higher concentrations of chemotherapeutic agents to the
tumor cells while avoiding the adverse systemic effects of these
medications.
[0616] Pressure-driven infusion of chemotherapeutic agents through
an intracranial catheter, also known as convection-enhanced
delivery (CED), has the advantage of delivering drugs along a
pressure gradient rather than by simple diffusion. CED has shown
promising results in animal models with agents including BCNU and
topotecan.
[0617] Initial attempts investigated the delivery of
chemotherapeutic agents via an intraarterial route rather than
intravenously. Unfortunately, no survival advantage was
observed.
[0618] Chemotherapy for recurrent glioblastoma multiforme provides
modest, if any, benefit, and several classes of agents are used.
Carmustine wafers increased 6-month survival from 36% to 56% over
placebo in one randomized study of 222 patients, though there was a
significant association between the treatment group and serious
intracranial infections.
[0619] Genotyping of brain tumors may have applications in
stratifying patients for clinical trials of various novel
therapies.
[0620] The anti-angiogenic agent bevacizumab, when used with
irinotecan improved 6-month survival in recurrent glioma patients
to 46% compared with 21% in patients treated with temozolomide.
This bevacizumab and irinotecan combination for recurrent
glioblastoma multiforme has been shown to improve survival over
bevacizumab alone. Anti-angiogenic agents also decrease peritumoral
edema, potentially reducing the necessary corticosteroid dose.
[0621] Some glioblastomas responds to gefitinib or erlotinib
(tyrosine kinase inhibitors). The simultaneous presence in
glioblastoma cells of mutant EGFR (EGFRviii) and PTEN was
associated with responsiveness to tyrosine kinase inhibitors,
whereas increased p-akt predicts a decreased effect. Other targets
include PDGFR, VEGFR, mTOR, farnesyltransferase, and PI3K.
[0622] Other possible therapy modalities include imatinib, gene
therapy, peptide and dendritic cell vaccines, synthetic
chlorotoxins, and radiolabeled drugs and antibodies.
Patient Selection/Monitoring
[0623] Described herein are methods of treating a cell
proliferation-related disorder, e.g., cancer, in a subject and
methods of identifying a subject for a treatment described herein.
Also described herein are methods of predicting a subject who is at
risk of developing cancer (e.g., a cancer associate with a mutation
in an enzyme (e.g., an enzyme in the metabolic pathway such as IDH1
and/or IDH2)). The cancer is generally characterized by the
presence of a neoactivity, such as a gain of function in one or
more mutant enzymes (e.g., an enzyme in the metabolic pathway
leading to fatty acid biosynthesis, glycolysis, glutaminolysis, the
pentose phosphate shunt, the nucleotide biosynthetic pathway, or
the fatty acid biosynthetic pathway, e.g., IDH1 or IDH2). The
subject can be selected on the basis of the subject having a mutant
gene having a neoactivity, e.g., a neoactivity described herein. As
used herein, "select" means selecting in whole or part on said
basis.
[0624] In some embodiments, a subject is selected for treatment
with a compound described herein based on a determination that the
subject has a mutant enzyme described herein (e.g., an enzyme in
the metabolic pathway, e.g., a metabolic pathway leading to fatty
acid biosynthesis, glycolysis, glutaminolysis, the pentose
phosphate shunt, the nucleotide biosynthetic pathway, or the fatty
acid biosynthetic pathway, e.g., IDH1 or IDH2). In some
embodiments, the mutant enzyme has a neoactivity and the patient is
selected on that basis. The neoactivity of the enzyme can be
identified, for example, by evaluating the subject or sample (e.g.,
tissue or bodily fluid) therefrom, for the presence or amount of a
substrate, cofactor and/or product of the enzyme. The presence
and/or amount of substrate, cofactor and/or product can correspond
to the wild-type/non-mutant activity or can correspond to the
neoactivity of the enzyme. Exemplary bodily fluid that can be used
to identify (e.g., evaluate) the neoactivity of the enzyme include
amniotic fluid surrounding a fetus, aqueous humour, blood (e.g.,
blood plasma), Cerebrospinal fluid, cerumen, chyme, Cowper's fluid,
female ejaculate, interstitial fluid, lymph, breast milk, mucus
(e.g., nasal drainage or phlegm), pleural fluid, pus, saliva,
sebum, semen, serum, sweat, tears, urine, vaginal secretion, or
vomit.
[0625] In some embodiments, a subject can be evaluated for
neoactivity of an enzyme using magnetic resonance. For example,
where the mutant enzyme is IDH1 or IDH2 and the neoactivity is
conversion of .alpha.-ketoglutarate to 2-hydroxyglutarate, the
subject can be evaluated for the presence of and/or an elevated
amount of 2-hydroxyglutarate, e.g., R-2-hydroxyglutarate relative
to the amount of 2-hydroxyglutarate, e.g., R-2-hydroxyglutarate
present in a subject who does not have a mutation in IDH1 or IDH2
having the above neoactivity. In some embodiments, neoactivity of
IDH1 or IDH2 can be determined by the presence or elevated amount
of a peak corresponding to 2-hydroxyglutarate, e.g.,
R-2-hydroxyglutarate as determined by magnetic resonance. For
example, a subject can be evaluated for the presence and/or
strength of a signal at about 2.5 ppm to determine the presence
and/or amount of 2-hydroxyglutarate, e.g., R-2-hydroxyglutarate in
the subject. This can be correlated to and/or predictive of a
neoactivity described herein for the mutant enzyme IDH. Similarly,
the presence, strength and/or absence of a signal at about 2.5 ppm
could be predictive of a response to treatment and thereby used as
a noninvasive biomarker for clinical response.
[0626] Neoactivity of a mutant enzyme such as IDH can also be
evaluated using other techniques known to one skilled in the art.
For example, the presence or amount of a labeled substrate,
cofactor, and/or reaction product can be measured such as a
.sup.13C or .sup.14C labeled substrate, cofactor, and/or reaction
product. The neoactivity can be evaluated by evaluating the forward
reaction of the wild-type/non mutant enzyme (such as the oxidative
decarboxylation of ioscitrate to .alpha.-ketoglutarate in a mutant
IDH1 or IDH2 enzyme, specifically a mutant IDH1 enzyme) and/or the
reaction corresponding to the neoactivity (e.g., the conversion of
.alpha.-ketoglutarate to 2-hydroxyglutarate, e.g.,
R-2-hydroxyglutarate in a mutant IDH1 or IDH2 enzyme, specifically
a mutant IDH1 enzyme).
Disorders
[0627] The IDH-related methods disclosed herein, e.g., methods of
evaluating or treating subjects, are directed to subjects having a
cell proliferation-related disorder characterized by an IDH mutant,
e.g., an IDH1 or IDH2, mutant having neoactivity, e.g., 2HG
neoactivity. Examples of some of the disorders below have been
shown to be characterized by an IDH1 or IDH2 mutation. Others can
be analyzed, e.g., by sequencing cell samples to determine the
presence of a somatic mutation at amino acid 132 of IDH1 or at
amino acid 172 of IDH2. Without being bound by theory it is
expected that a portion of the tumors of given type of cancer will
have an IDH, e.g., IDH1 or IDH2, mutant having 2HG neoactivity.
[0628] The disclosed methods are useful in evaluating or treating
proliferative disorders, e.g. evaluating or treating solid tumors,
soft tissue tumors, and metastases thereof wherein the solid tumor,
soft tissue tumor or metastases thereof is a cancer described
herein. Exemplary solid tumors include malignancies (e.g.,
sarcomas, adenocarcinomas, and carcinomas) of the various organ
systems, such as those of brain, lung, breast, lymphoid,
gastrointestinal (e.g., colon), and genitourinary (e.g., renal,
urothelial, or testicular tumors) tracts, pharynx, prostate, and
ovary. Exemplary adenocarcinomas include colorectal cancers,
renal-cell carcinoma, liver cancer, non-small cell carcinoma of the
lung, and cancer of the small intestine. The disclosed methods are
also useful in evaluating or treating non-solid cancers.
[0629] The methods described herein can be used with any cancer,
for example those described by the National Cancer Institute. A
cancer can be evaluated to determine whether it is using a method
described herein. Exemplary cancers described by the National
Cancer Institute include: Acute Lymphoblastic Leukemia, Adult;
Acute Lymphoblastic Leukemia, Childhood; Acute Myeloid Leukemia,
Adult; Adrenocortical Carcinoma; Adrenocortical Carcinoma,
Childhood; AIDS-Related Lymphoma; AIDS-Related Malignancies; Anal
Cancer; Astrocytoma, Childhood Cerebellar; Astrocytoma, Childhood
Cerebral; Bile Duct Cancer, Extrahepatic; Bladder Cancer; Bladder
Cancer, Childhood; Bone Cancer, Osteosarcoma/Malignant Fibrous
Histiocytoma; Brain Stem Glioma, Childhood; Brain Tumor, Adult;
Brain Tumor, Brain Stem Glioma, Childhood; Brain Tumor, Cerebellar
Astrocytoma, Childhood; Brain Tumor, Cerebral Astrocytoma/Malignant
Glioma, Childhood; Brain Tumor, Ependymoma, Childhood; Brain Tumor,
Medulloblastoma, Childhood; Brain Tumor, Supratentorial Primitive
Neuroectodermal Tumors, Childhood; Brain Tumor, Visual Pathway and
Hypothalamic Glioma, Childhood; Brain Tumor, Childhood (Other);
Breast Cancer; Breast Cancer and Pregnancy; Breast Cancer,
Childhood; Breast Cancer, Male; Bronchial Adenomas/Carcinoids,
Childhood; Carcinoid Tumor, Childhood; Carcinoid Tumor,
Gastrointestinal; Carcinoma, Adrenocortical; Carcinoma, Islet Cell;
Carcinoma of Unknown Primaiy; Central Nervous System Lymphoma,
Primary; Cerebellar Astrocytoma, Childhood; Cerebral
Astrocytoma/Malignant Glioma, Childhood; Cervical Cancer; Childhood
Cancers; Chronic Lymphocytic Leukemia; Chronic Myelogenous
Leukemia; Chronic Myeloproliferative Disorders; Clear Cell Sarcoma
of Tendon Sheaths; Colon Cancer; Colorectal Cancer, Childhood;
Cutaneous T-CeIl Lymphoma; Endometrial Cancer; Ependymoma,
Childhood; Epithelial Cancer, Ovarian; Esophageal Cancer;
Esophageal Cancer, Childhood; Ewing's Family of Tumors;
Extracranial Germ Cell Tumor, Childhood; Extragonadal Germ Cell
Tumor; Extrahepatic Bile Duct Cancer; Eye Cancer, Intraocular
Melanoma; Eye Cancer, Retinoblastoma; Gallbladder Cancer; Gastric
(Stomach) Cancer; Gastric (Stomach) Cancer, Childhood;
Gastrointestinal Carcinoid Tumor; Germ Cell Tumor, Extracranial,
Childhood; Germ Cell Tumor, Extragonadal; Germ Cell Tumor, Ovarian;
Gestational Trophoblastic Tumor; Glioma, Childhood Brain Stem;
Glioma, Childhood Visual Pathway and Hypothalamic; Hairy Cell
Leukemia; Head and Neck Cancer; Hepatocellular (Liver) Cancer,
Adult (Primary); Hepatocellular (Liver) Cancer, Childhood
(Primary); Hodgkin's Lymphoma, Adult; Hodgkin's Lymphoma,
Childhood; Hodgkin's Lymphoma During Pregnancy; Hypopharyngeal
Cancer; Hypothalamic and Visual Pathway Glioma, Childhood;
Intraocular Melanoma; Islet Cell Carcinoma (Endocrine Pancreas);
Kaposi's Sarcoma; Kidney Cancer; Laryngeal Cancer; Laryngeal
Cancer, Childhood; Leukemia, Acute Lymphoblastic, Adult; Leukemia,
Acute Lymphoblastic, Childhood; Leukemia, Acute Myeloid, Adult;
Leukemia, Acute Myeloid, Childhood; Leukemia, Chronic Lymphocytic;
Leukemia, Chronic Myelogenous; Leukemia, Hairy Cell; Lip and Oral
Cavity Cancer; Liver Cancer, Adult (Primary); Liver Cancer,
Childhood (Primary); Lung Cancer, Non-Small Cell; Lung Cancer,
Small Cell; Lymphoblastic Leukemia, Adult Acute; Lymphoblastic
Leukemia, Childhood Acute; Lymphocytic Leukemia, Chronic; Lymphoma,
AIDS-Related; Lymphoma, Central Nervous System (Primary); Lymphoma,
Cutaneous T-CeIl; Lymphoma, Hodgkin's, Adult; Lymphoma, Hodgkin's,
Childhood; Lymphoma, Hodgkin's During Pregnancy; Lymphoma,
Non-Hodgkin's, Adult; Lymphoma, Non-Hodgkin's, Childhood; Lymphoma,
Non-Hodgkin's During Pregnancy; Lymphoma, Primary Central Nervous
System; Macroglobulinemia, Waldenstrom's; Male Breast Cancer;
Malignant Mesothelioma, Adult; Malignant Mesothelioma, Childhood;
Malignant Thymoma; Medulloblastoma, Childhood; Melanoma; Melanoma,
Intraocular; Merkel Cell Carcinoma; Mesothelioma, Malignant;
Metastatic Squamous Neck Cancer with Occult Primary; Multiple
Endocrine Neoplasia Syndrome, Childhood; Multiple Myeloma/Plasma
Cell Neoplasm; Mycosis Fungoides; Myelodysplastic Syndromes;
Myelogenous Leukemia, Chronic; Myeloid Leukemia, Childhood Acute;
Myeloma, Multiple; Myeloproliferative Disorders, Chronic; Nasal
Cavity and Paranasal Sinus Cancer; Nasopharyngeal Cancer;
Nasopharyngeal Cancer, Childhood; Neuroblastoma; Non-Hodgkin's
Lymphoma, Adult; Non-Hodgkin's Lymphoma, Childhood; Non-Hodgkin's
Lymphoma During Pregnancy; Non-Small Cell Lung Cancer; Oral Cancer,
Childhood; Oral Cavity and Lip Cancer; Oropharyngeal Cancer;
Osteosarcoma/Malignant Fibrous Histiocytoma of Bone; Ovarian
Cancer, Childhood; Ovarian Epithelial Cancer; Ovarian Germ Cell
Tumor; Ovarian Low Malignant Potential Tumor; Pancreatic Cancer;
Pancreatic Cancer, Childhood; Pancreatic Cancer, Islet Cell;
Paranasal Sinus and Nasal Cavity Cancer; Parathyroid Cancer; Penile
Cancer; Pheochromocytoma; Pineal and Supratentorial Primitive
Neuroectodermal Tumors, Childhood; Pituitary Tumor; Plasma Cell
Neoplasm/Multiple Myeloma; Pleuropulmonary Blastoma; Pregnancy and
Breast Cancer; Pregnancy and Hodgkin's Lymphoma; Pregnancy and
Non-Hodgkin's Lymphoma; Primary Central Nervous System Lymphoma;
Primary Liver Cancer, Adult; Primary Liver Cancer, Childhood;
Prostate Cancer; Rectal Cancer; Renal Cell (Kidney) Cancer; Renal
Cell Cancer, Childhood; Renal Pelvis and Ureter, Transitional Cell
Cancer; Retinoblastoma; Rhabdomyosarcoma, Childhood; Salivary Gland
Cancer; Salivary Gland Cancer, Childhood; Sarcoma, Ewing's Family
of Tumors; Sarcoma, Kaposi's; Sarcoma (Osteosarcoma)/Malignant
Fibrous Histiocytoma of Bone; Sarcoma, Rhabdomyosarcoma, Childhood;
Sarcoma, Soft Tissue, Adult; Sarcoma, Soft Tissue, Childhood;
Sezary Syndrome; Skin Cancer; Skin Cancer, Childhood; Skin Cancer
(Melanoma); Skin Carcinoma, Merkel Cell; Small Cell Lung Cancer;
Small Intestine Cancer; Soft Tissue Sarcoma, Adult; Soft Tissue
Sarcoma, Childhood; Squamous Neck Cancer with Occult Primary,
Metastatic; Stomach (Gastric) Cancer; Stomach (Gastric) Cancer,
Childhood; Supratentorial Primitive Neuroectodermal Tumors,
Childhood; T-Cell Lymphoma, Cutaneous; Testicular Cancer; Thymoma,
Childhood; Thymoma, Malignant; Thyroid Cancer; Thyroid Cancer,
Childhood; Transitional Cell Cancer of the Renal Pelvis and Ureter;
Trophoblastic Tumor, Gestational; Unknown Primary Site, Cancer of,
Childhood; Unusual Cancers of Childhood; Ureter and Renal Pelvis,
Transitional Cell Cancer; Urethral Cancer; Uterine Sarcoma; Vaginal
Cancer; Visual Pathway and Hypothalamic Glioma, Childhood; Vulvar
Cancer; Waldenstrom's Macro globulinemia; and Wilms' Tumor.
Metastases of the aforementioned cancers can also be treated or
prevented in accordance with the methods described herein.
[0630] The methods described herein are useful in treating cancer
in nervous system, e.g., brain tumor, e.g., glioma, e.g.,
glioblastoma multiforme (GBM), e.g., by inhibiting a neoactivity of
a mutant enzyme, e.g., an enzyme in a metabolic pathway, e.g., a
metabolic pathway leading to fatty acid biosynthesis, glycolysis,
glutaminolysis, the pentose phosphate shunt, the nucleotide
biosynthetic pathway, or the fatty acid biosynthetic pathway, e.g.,
IDH1 or IDH2.
[0631] Gliomas, a type of brain tumors, can be classified as grade
I to grade IV on the basis of histopathological and clinical
criteria established by the World Health Organization (WHO). WHO
grade I gliomas are often considered benign. Gliomas of WHO grade
II or III are invasive, progress to higher-grade lesions. WHO grade
IV tumors (glioblastomas) are the most invasive form. Exemplary
brain tumors include, e.g., astrocytic tumor (e.g., pilocytic
astrocytoma, subependymal giant-cell astrocytoma, diffuse
astrocytoma, pleomorphic xanthoastrocytoma, anaplastic astrocytoma,
astrocytoma, giant cell glioblastoma, glioblastoma, secondary
glioblastoma, primary adult glioblastoma, and primary pediatric
glioblastoma); oligodendroglial tumor (e.g., oligodendroglioma, and
anaplastic oligodendroglioma); oligoastrocytic tumor (e.g.,
oligoastrocytoma, and anaplastic oligoastrocytoma); ependymoma
(e.g., myxopapillary ependymoma, and anaplastic ependymoma);
medulloblastoma; primitive neuroectodermal tumor, schwannoma,
meningioma, meatypical meningioma, anaplastic meningioma; and
pituitary adenoma. Exemplary cancers are described in Acta
Neuropathol (2008) 116:597-602 and N Engl J Med. 2009 Feb. 19;
360(8):765-73, the contents of which are each incorporated herein
by reference.
[0632] In embodiments the disorder is glioblastoma.
[0633] In an embodiment the disorder is prostate cancer, e.g.,
stage T1 (e.g., T1a, T1b and T1c), T2 (e.g., T2a, T2b and T2c), T3
(e.g., T3a and T3b) and T4, on the TNM staging system. In
embodiments the prostate cancer is grade G1, G2, G3 or G4 (where a
higher number indicates greater difference from normal tissue).
Types of prostate cancer include, e.g., prostate adenocarcinoma,
small cell carcinoma, squamous carcinoma, sarcomas, and
transitional cell carcinoma.
[0634] Methods and compositions of the invention can be combined
with art-known treatment. Art-known treatment for prostate cancer
can include, e.g., active surveillance, surgery (e.g., radical
prostatectomy, transurethral resection of the prostate,
orchiectomy, and cryosurgegry), radiation therapy including
brachytherapy (prostate brachytherapy) and external beam radiation
therapy, High-Intensity Focused Ultrasound (HIFU), chemotherapy,
cryosurgery, hormonal therapy (e.g., antiandrogens (e.g.,
flutamide, bicalutamide, nilutamide and cyproterone acetate,
ketoconazole, aminoglutethimide), GnRH antagonists (e.g.,
Abarelix)), or a combination thereof.
[0635] All references described herein are expressly incorporated
herein by reference.
EXAMPLES
Example 1 IDH1 Cloning, Mutagenesis, Expression and
Purification
[0636] 1. Wild Type IDH1 was Cloned into pET41a, Creating His8 Tag
at C-Terminus.
[0637] The IDH1 gene coding region (cDNA) was purchased from
Invitrogen in pENTR221 vector (www.invitrogen.com, Cat #
B-068487_Ultimate_ORF). Oligo nucleotides were designed to PCR out
the coding region of IDH1 with NdeI at the 5' end and XhoI at the
3'. (IDH1-f: TAATCATATGTCCAAAAAAATCAGT (SEQ ID NO:1), IDH1-r:
TAATCTCGAGTGAAAGTTTGGCCTGAGCTAGTT (SEQ ID NO:2)). The PCR product
is cloned into the NdeI/XhoI cleaved pET41a vector. NdeI/XhoI
cleavage of the vector pET41a releases the GST portion of the
plasmid, and creating a C-terminal His8 tag (SEQ ID NO:3) without
the N-terminal GST fusion. The original stop codon of IDH1 is
change to serine, so the junction sequence in final IDH1 protein
is: Ser-Leu-Glu-His-His-His-His-His-His-His-His-Stop (SEQ ID
NO:4).
[0638] The C-terminal His tag strategy instead of N-terminal His
tag strategy was chosen, because C-terminal tag might not
negatively impact IDH1 protein folding or activity. See, e.g., Xu X
et al, J Biol Chem. 2004 Aug. 6; 279(32):33946-57.
[0639] The sequence for pET41a-IDH1 plasmid is confirmed by DNA
sequencing. FIG. 1 shows detailed sequence verification of
pET41a-IDH1 and alignment against published IDH1 CDS below.
2. IDH1 Site Directed Mutagenesis to Create the IDHr132s and
IDHr132h Mutants.
[0640] Site directed mutagenesis was performed to convert R132 to S
or H, DNA sequencing confirmed that G395 is mutated to A (creating
Arg.fwdarw.His mutation in the IDH1 protein), and C394 is mutated
to A (creating Arg.fwdarw.Ser in the IDH1 protein). Detailed method
for site directed mutagenesis is described in the user manual for
QuikChange.RTM. MultiSite-Directed Mutagenesis Kit (Stratagene, cat
#200531). FIG. 2 shows DNA sequence verification of such mutations.
Highlighted nucleotides were successfully changed in the
mutagenesis: G395.fwdarw.A mutation allows amino acid
Arg132.fwdarw.His; C394.fwdarw.A mutation allows amino acid
Arg132.fwdarw.Ser.
3. IDH1 Protein Expression and Purification.
[0641] IDHwt, IDHR132S, and IDHR132H proteins were expressed in the
E. coli strain Rosetta and purified according to the detailed
procedure below. Active IDH1 proteins are in dimer form, and SEC
column fraction/peak that correspond to the dimer form were
collected for enzymology analysis and cross comparison of catalytic
activities of these proteins.
A. Cell Culturing:
[0642] Cells were grown in LB (20 .mu.g/ml Kanamycin) at 37.degree.
C. with shaking until OD600 reaches 0.6. The temperature was
changed to 18.degree. C. and protein was induced by adding IPTG to
final concentration of 1 mM. Cells were collected 12-16 hours after
IPTG induction.
B. Buffer System:
[0643] Lysis buffer: 20 mM Tris, pH7.4, 0.1% Triton X-100, 500 mM
NaCl, 1 mM PMSF, 5 mM .beta.-mercaptoethanol, 10% glycerol.
[0644] Ni-Column Buffer A: 20 mM Tris, pH7.4, 500 mM NaCl, 5 mM
.beta.-mercaptoethanol, 10% glycerol.
[0645] Ni-column Buffer B: 20 mM Tris, pH7.4, 500 mM NaCl, 5 mM
.beta.-mercaptoethanol, 500 mM Imidazole, 10% glycerol
[0646] Gel filtration Buffer C: 200 mM NaCl, 50 mM Tris 7.5, 5 mM
.beta.-mercaptoethanol, 2 mM MnSO.sub.4, 10% glycerol.
C. Protein purification procedure 1. Cell pellet were resuspended
in the lysis buffer (1 gram cell/5-10 ml buffer). 2. Cells were
broken by passing the cell through Microfludizer with at a pressure
of 15,000 psi for 3 times. 3. Soluble protein was collected from
supernatant after centrifugation at 20,000 g (Beckman Avanti
J-26XP) for 30 min at 4.degree. C. 4. 5-10 ml of Ni-column was
equilibrated by Buffer A until the A280 value reached baseline. The
supernatant was loaded onto a 5-ml Ni-Sepharose column (2 ml/min).
The column was washed by 10-20 CV of washing buffer (90% buffer
A+10% buffer B) until A280 reach the baseline (2 ml/min). 5. The
protein was eluted by liner gradient of 10-100% buffer B (20 CV)
with the flow rate of 2 ml/min and the sample fractions were
collected as 2 ml/tube. 6. The samples were analyzed on SDS-PAGE
gel. 7. The samples were collected and dialyzed against 200.times.
Gel filtration buffer for 2 times (1 hour and >4 hours). 8. The
samples were concentrated to 10 ml. 9. 200 ml of S-200
Gel-filtration column was equilibrated by buffer C until the A280
value reached baseline. The samples were loaded onto Gel filtration
column (0.5 ml/min). 10. The column was washed by 10 CV of buffer
C, collect fractions as 2-4 ml/tube. 11. The samples were analyzed
on SDS-PAGE gel and protein concentration was determined.
D. Protein Purification Results
[0647] The results for purification of wild type IDH1 are shown in
FIGS. 3, 4, 5A and 5B.
[0648] The results for purification of mutant IDH1R132S are shown
in FIGS. 6, 7, 8A and 8B.
[0649] The results for purification of wild type IDH1R132H are
shown in FIGS. 9, 10, 11A and 11B.
Example 2 Enzymology Analysis of IDH1 Wild Type and Mutants
1. Analysis of IDH1 Wild-Type and Mutants R132H and R132S in the
Oxidative Decarboxylation of Isocitrate to .alpha.-Ketoglutarate
(.alpha.-KG).
A. Methods
[0650] To determine the catalytic efficiency of enzymes in the
oxidative decarboxylation of isocitrate to .alpha.-Ketoglutarate
(.alpha.-KG) direction, reactions were performed to determine Vmax
and Km for isocitrate. In these reactions, the substrate was varied
while the cofactor was held constant at 500 uM. All reactions were
performed in 150 mM NaCl, 20 mM Tris-Cl, pH 7.5, 10% glycerol, and
0.03% (w/v) BSA). Reaction progress was followed by spectroscopy at
340 nM monitoring the change in oxidation state of the cofactor.
Sufficient enzyme was added to give a linear change in absorbance
for 10 minutes.
B. ICDH1 R132H and ICDH1 R132S are Impaired for Conversion of
Isocitrate to .alpha.-KG.
[0651] Michaelis-Menten plots for the relationship of isocitrate
concentration to reaction velocity are presented in FIGS. 12A-12C.
Kinetic parameters are summarized in the Table 1. All data was fit
to the Hill equation by least-squares regression analysis.
TABLE-US-00001 TABLE 1 Relative Vmax Km Hill Vmax/ Catalytic Enzyme
(umol/min/mg) (uM) Constant Km Efficiency Wt 30.5 56.8 1.8 0.537
100% R132H 0.605 171.7 0.6 0.0035 0.35% R132S 95 >1e6 0.479
<9.5e7 <.001%
[0652] Both mutant enzymes display a reduced Hill coefficient and
an increase in Km for isocitrate, suggesting a loss of
co-operativity in substrate binding and/or reduced affinity for
substrate. R132H enzyme also displays a reduced Vmax, suggestive of
a lower kcat. R132S displays an increase in Vmax, suggesting an
increase in kcat, although this comes at the expense of a 20,000
fold increase in Km so that the overall effect on catalytic
efficiency is a great decrease as compared to the wild-type enzyme.
The relative catalytic efficiency, described as Vmax/Km, is
dramatically lower for the mutants as compared to wild-type. The in
vivo effect of these mutations would be to decrease the flux
conversion of isocitrate to .alpha.-KG.
C. The ICDH1 R132H and R132S Mutants Display Reduced Product
Inhibition in the Oxidative Decarboxylation of Isocitrate to
.alpha.-Ketoglutarate (.alpha.-KG).
[0653] A well-known regulatory mechanism for control of metabolic
enzymes is feedback inhibition, in which the product of the
reaction acts as a negative regulator for the generating enzyme. To
examine whether the R132S or R132H mutants maintain this regulatory
mechanism, the Ki for .alpha.-KG in the oxidative decarboxylation
of ioscitrate to .alpha.-ketoglutarate was determined. Data is
presented in FIGS. 13A-13C and summarized in Table 2. In all cases,
.alpha.-KG acts as a competitive inhibitor of the isocitrate
substrate. However, R132H and R132S display a 20-fold and 13-fold
increase in sensitivity to feedback inhibition as compared to the
wild-type enzyme.
TABLE-US-00002 TABLE 2 Enzyme Ki (uM) Wt 612.2 R132H 28.6 R132S
45.3
D. The Effect of MnCl.sub.2 in Oxidative Decarboxylation of
Isocitrate to .alpha.-Ketoglutarate (.alpha.-KG).
[0654] MnCl.sub.2 can be substituted with MgCl.sub.2 to examine if
there is any difference in oxidative decarboxylation of isocitrate
to .alpha.-Ketoglutarate (.alpha.-KG).
E. The Effect of R132 Mutations on the Inhibitory Effect of
Oxalomalate on IDH1
[0655] The purpose of this example is to examine the susceptibility
of IDH1R132S and IDH1R132H in oxidative decarboxylation of
isocitrate to .alpha.-Ketoglutarate (.alpha.-KG) to the known IDH1
inhibitor oxalomalate. Experiments were performed to examine if
R132 mutations circumvent the inhibition by oxalomalate.
[0656] Final concentrations: Tris 7.5 20 mM, NaCl 150 mM,
MnCl.sub.2 2 mM, Glycerol 10%, BSA 0.03%, NADP 0.5 mM, IDH1 wt 1.5
ug/ml, IDH1R132S 30 ug/ml, IDH1R132H 60 ug/ml, DL-isocitrate (5-650
uM). The results are summarized in FIG. 17 and Table 3. The R132S
mutation displays approximately a two-fold increase in
susceptibility to inhibition by oxalomalate, while the R132H
mutation is essentially unaffected. In all three cases, the same
fully competitive mode of inhibition with regards to isocitrate was
observed.
TABLE-US-00003 TABLE 3 Enzyme Oxalomalate Ki (uM) wt 955.4 R132S
510 R132H 950.8
F. Forward Reactions (Isocitrate to .alpha.-KG) of Mutant Enzyme do
not go to Completion.
[0657] Forward reactions containing ICDH1 R132S or ICDH1 R132H were
assembled and reaction progress monitored by an increase in the
OD340 of the reduced NADPH cofactor. It was observed (FIG. 23),
that these reactions proceed in the forward direction for a period
of time and then reverse direction and oxidize the cofactor reduced
in the early stages of the reaction, essentially to the starting
concentration present at the initiation of the experiment. Addition
of further isocitrate re-initiated the forward reaction for a
period of time, but again did not induce the reaction to proceed to
completion. Rather, the system returned to initial concentrations
of NADPH. This experiment suggested that the mutant enzymes were
performing a reverse reaction other than the conversion of
.alpha.-KG to isocitrate.
2. Analysis of IDH1 Wild-Type and Mutants R132H and R132S in the
Reduction of .alpha.-Ketoglutarate (.alpha.-KG).
A. Methods
[0658] To determine the catalytic efficiency of enzymes in the
reduction of .alpha.-Ketoglutarate (.alpha.-KG), reactions were
performed to determine Vmax and Km for .alpha.-KG. In these
reactions, substrate was varied while the cofactor was held
constant at 500 uM. All reactions were performed in 50 mM potassium
phosphate buffer, pH 6.5, 10% glycerol, 0.03% (w/v) BSA, 5 mM
MgCl.sub.2, and 40 mM sodium hydrocarbonate. Reaction progress was
followed by spectroscopy at 340 nM monitoring the change in
oxidation state of the cofactor. Sufficient enzyme was added to
give a linear change in absorbance for 10 minutes.
B. The R132H and R132S Mutant Enzymes, but not the Wild-Type
Enzyme, Support the Reduction of .alpha.-KG.
[0659] To test the ability of the mutant and wild-type enzymes to
perform the reduction of .alpha.-KG, 40 ug/ml of enzyme was
incubated under the conditions for the reduction of
.alpha.-Ketoglutarate (.alpha.-KG) as described above. Results are
presented in FIG. 14. The wild-type enzyme was unable to consume
NADPH, while R132S and R132H reduced .alpha.-KG and consumed
NADPH.
C. The Reduction of .alpha.-KG by the R132H and R132S Mutants
Occurs In Vitro at Physiologically Relevant Concentrations of
.alpha.-KG.
[0660] To determine the kinetic parameters of the reduction of
.alpha.-KG performed by the mutant enzymes, a substrate titration
experiment was performed, as presented in FIGS. 15A-15B. R132H
maintained the Hill-type substrate interaction as seen in the
oxidative decarboxylation of isocitrate, but displayed positive
substrate co-operative binding. R132S showed a conversion to
Michaelis-Menten kinetics with the addition of uncompetitive
substrate inhibition, as compared to wild-type enzyme in the
oxidative decarboxylation of isocitrate. The enzymatic parameters
of the mutant enzyme are presented in Table 4. Since the wild-type
enzyme did not consume measurable NADPH in the experiment described
above, a full kinetic workup was not performed.
TABLE-US-00004 TABLE 4 Vmax Km Hill Ki Vmax/ Enzyme (umol/min/mg)
(mM) Constant (mM) Km R132H 1.3 0.965 1.8 1.35 R132S 2.7 0.181
0.479 24.6 14.92
[0661] The relative catalytic efficiency of reduction of .alpha.-KG
is approximately ten-fold higher in the R132S mutant than in the
R132H mutant. The biological consequence is that the rate of
metabolic flux should be greater in cells expressing R132S as
compared to R132H.
D. Analysis of IDH1 Wild-Type and Mutants R132H and R132S in the
Reduction of Alpha-Ketoglutarate with NADH.
[0662] In order to evaluate the ability of the mutant enzymes to
utilize NADH in the reduction of alpha-ketoglutarate, the following
experiment was conducted. Final concentrations: NaHCO.sub.340 mM,
MgCl2 5 mM, Glycerol 10%, K2HPO4 50 mM, BSA 0.03%, NADH 0.5 mM,
IDH1 wt 5 ug/ml, R132S 30 ug/ml, R132H 60 ug/ml,
alpha-Ketoglutarate 5 mM.
[0663] The results are shown in FIG. 16 and Table 5. The R132S
mutant demonstrated the ability to utilize NADH while the wild type
and R132H show no measurable consumption of NADH in the presence of
alpha-ketoglutarate.
TABLE-US-00005 TABLE 5 Consumption of NADH by R132S in the presence
of alpha-ketoglutarate R132S Mean SD Rate (.DELTA.A/sec) 0.001117
0.001088 0.001103 2.05E-05 Umol/min/mg 0.718328 0.699678 0.709003
0.013187
SUMMARY
[0664] To understand how R132 mutations alter the enzymatic
properties of IDH1, wild-type and R132H mutant IDH1 proteins were
produced and purified from E. coli. When NADP.sup.+-dependent
oxidative decarboxylation of isocitrate was measured using purified
wild-type or R132H mutant IDH1 protein, it was confirmed that R132H
mutation impairs the ability of IDH1 to catalyze this reaction
(Yan, H. et al. N Engl J Med 360, 765-73 (2009); Zhao, S. et al.
Science 324, 261-5 (2009)), as evident by the loss in binding
affinity for both isocitrate and MgCl.sub.2 along with a 1000-fold
decrease in catalytic turnover (FIGS. 30A and 30C). In contrast,
when NADPH-dependent reduction of .alpha.KG was assessed using
either wild-type or R132H mutant IDH1 protein, only R132H mutant
could catalyze this reaction at a measurable rate (FIGS. 30 and
30C). Part of this increased rate of .alpha.KG reduction results
from an increase in binding affinity for both the cofactor NADPH
and substrate .alpha.KG in the R132H mutant IDH1 (FIG. 30C). Taken
together, these data demonstrate that while the R132H mutation
leads to a loss of enzymatic function for oxidative decarboxylation
of isocitrate, this mutation also results in a gain of enzyme
function for the NADPH-dependent reduction of .alpha.KG.
2: Analysis of Mutant IDH1
[0665] The R132H Mutant does not Result in the Conversion of
.alpha.-KG to Isocitrate.
[0666] Using standard experimental methods, an API2000 mass
spectrometer was configured for optimal detection of .alpha.-KG and
isocitrate (Table 6). MRM transitions were selected and tuned such
that each analyte was monitored by a unique transition. Then, an
enzymatic reaction containing 1 mM .alpha.-KG, 1 mM NADPH, and
ICDH1 R132H were assembled and run to completion as judged by the
decrease to baseline of the optical absorbance at 340 nM. A control
reaction was performed in parallel from which the enzyme was
omitted. Reactions were quenched 1:1 with methanol, extracted, and
subjected to analysis by LC-MS/MS.
[0667] FIG. 18A presents the control reaction indicating that
.alpha.KG was not consumed in the absence of enzyme, and no
detectable isocitrate was present. FIG. 18B presents the reaction
containing R132H enzyme, in which the .alpha.-KG has been consumed,
but no isocitrate was detected. FIG. 18C presents a second analysis
of the reaction containing enzyme in which isocitrate has been
spiked to a final concentration of 1 mM, demonstrating that had
.alpha.-KG been converted to isocitrate at any appreciable
concentration greater than 0.01%, the configured analytical system
would have been capable of detecting its presence in the reaction
containing enzyme. The conclusion from this experiment is that
while .alpha.-KG was consumed by R132H, isocitrate was not
produced. This experiment indicates that one neoactivity of the
R132H mutant is the reduction of .alpha.-KG to a compound other
than isocitrate.
TABLE-US-00006 TABLE 6 Instrument settings for MRM detection of
compounds Compound Q1 Q3 DP FP EP CEP CE CXP .alpha.-KG 144.975
100.6 -6 -220 -10 -16 -10 -22 isocitrate 191.235 110.9 -11 -230
-4.5 -14 -16 -24 a- 147.085 128.7 -11 -280 -10 -22 -12 -24
hydroxyglutarate
The R132H Mutant Reduces .alpha.-KG to 2-Hydroxyglutaric Acid.
[0668] Using standard experimental methods, an API2000 mass
spectrometer was configured for optimal detection
2-hydroxyglutarate (Table 6 and FIG. 19). The reaction products of
the control and enzyme-containing reactions from above were
investigated for the presence of 2-hydroxyglutaric acid, FIG. 20.
In the control reaction, no 2-hydroxyglutaric acid was detected,
while in reaction containing R132H, 2-hydroxyglutaric acid was
detected. This data confirms that one neoactivity of the R132H
mutant is the reduction of .alpha.-KG to 2-hydroxyglutaric
acid.
[0669] To determine whether R132H mutant protein directly produced
2HG from .alpha.KG, the product of the mutant IDH1 reaction was
examined using negative ion mode triple quadrupole electrospray
LC-MS. These experiments confirmed that 2HG was the direct product
of NADPH-dependent .alpha.KG reduction by the purified R132H mutant
protein through comparison with a known metabolite standards (FIG.
31A). Conversion of .alpha.KG to isocitrate was not observed.
[0670] One can determine the enantiomeric specificity of the
reaction product through derivitazation with DATAN
(diacetyl-L-tartaric acid) and comparing the retention time to that
of known R and S standards. This method is described in Struys et
al. Clin Chem 50:1391-1395(2004). The stereo-specific production of
either the R or S enantomer of alpha-hydroxyglutaric acid by ICDH1
R132H may modify the biological activity of other enzymes present
in the cell. The racemic production may also occur.
[0671] For example, one can measure the inhibitory effect of
alpha-hydroxyglutaric acid on the enzymatic activity of enzymes
which utilize .alpha.-KG as a substrate. In one embodiment,
alpha-hydroxyglutaric acid may be a substrate- or product-analogue
inhibitor of wild-type ICDH1. In another embodiment
alpha-hydroxyglutaric acid may be a substrate- or product-analogue
inhibitor of HIF1 prolyl hydroxylase. In the former case,
inhibition of wild type ICDH1 by the enzymatic product of R132H
will reduce the circulating levels of .alpha.KG in the cell. In the
latter case, inhibition of HIF1 prolyl hydroxylase will result in
the stabilization of HIF1 and an induction of the hypoxic response
cohort of cellular responses.
ICDH R13211 Reduces .alpha.KG to the R-Enantiomer of
2-Hydroxyglutarate.
[0672] There are two possible enantiomers of the ICDHR132H
reductive reaction product, converting alpha-ketoglutarate to
2-hydroxyglutarate, with the chiral center being located at the
alpha-carbon position. Exemplary products are depicted below.
##STR00005##
[0673] These are referred to by those with knowledge in the art as
the R (or pro-R) and S (or pro-S) enantiomers, respectively. In
order to determine which form or both is produced as a result of
the ICDH1 neoactivity described above, the relative amount of each
chiral form in the reaction product was determined in the procedure
described below.
[0674] Reduction of .alpha.-KG to 2-HG was performed by ICDHR132H
in the presence of NADPH as described above, and the reaction
progress was monitored by a change in extinction coefficient of the
nucleotide cofactor at 340 nM; once the reaction was judged to be
complete, the reaction was extracted with methanol and dried down
completely in a stream of nitrogen gas. In parallel, samples of
chirally pure R-2-HG and a racemic mixture of R- and S-2-HG
(produced by a purely chemical reduction of .alpha.-KG to 2-HG)
were resuspended in ddH.sub.2O, similarly extracted with methanol,
and dried.
[0675] The reaction products or chiral standards were then
resuspended in a solution of dichloromethane:acetic acid (4:1)
containing 50 g/L DATAN and heated to 75.degree. C. for 30 minutes
to promote the derivitization of 2-HG in the scheme described
below:
##STR00006##
[0676] After cooling to room temperature, the derivitization
reactions were dried to completion and resuspended in ddH.sub.2O
for analysis on an LC-MS/MS system. Analysis of reaction products
and chiral standards was performed on an API2000 LC-MS/MS system
using a 2.times.150 mM C18 column with an isocratic flow of 200
.mu.l/min of 90:10 (ammonium formate, pH 3.6:methanol) and
monitoring the retention times of the 2-HG-DATAN complex using XIC
and the diagnostic MRM transition of 363/147 in the negative ion
mode.
[0677] It should be noted that retention times in the experiments
described below are approximate and accurate to within +/-1 minute;
the highly reproducible peak seen at 4 minutes is an artefact of a
column switching valve whose presence has no result on the
conclusions drawn from the experiment.
[0678] Injection of the racemic mixture gave two peaks of equal
area at retention times of 8 and 10 minutes (FIG. 24A), while
injection of the R-2-HG standard resulted in a major peak of
>95% area at 10 minutes and a minor peak<5% area at 8 minutes
(FIG. 24B); indicating that the R-2-HG standard is approximately
95% R and 5% S. Thus, this method allows us to separate the R and
S-2-HG chiral forms and to determine the relative amounts of each
in a given sample. Coinjection of the racemic mixture and the
R-2-HG standard resulted in two peaks at 8 and 10 minutes, with a
larger peak at 10 minutes resulting from the addition of surplus
pro-R-form (the standard) to a previously equal mixture of R- and
S-2-HG (FIG. 24C). These experiments allow us to assign the 8
minute peak to the S-2-HG form and the 10 minute peak to the R-2-HG
form.
[0679] Injection of the derivatized neoactivity enzyme reaction
product alone yields a single peak at 10 minutes, suggesting that
the neoactivity reaction product is chirally pure R-2-HG (FIG.
24D). Coinjection of the neoactivity reaction product with the
R-2-HG standard results in a major peak of >95% area at 10
minutes (FIG. 24E) and a single minor peak of <5% area at 8
minutes (previously observed in injection of the R-2-HG standard
alone) confirming the chirality of the neoactivity product as R.
Coinjection of a racemic mixture and the neoactivity reaction
product (FIG. 24F) results in a 60% area peak at 10 minutes and a
40% area peak at 8 minutes; this deviation from the previously
symmetrical peak areas observed in the racemate sample being due to
the excess presence of R-2-HG form contributed by the addition of
the neoactivity reaction product.
These experiments allow us to conclude that the ICDH1 neoactivity
is a highly specific chiral reduction of .alpha.-KG to R-2-HG.
Enzyme Properties of Other IDH1 Mutations
[0680] To determine whether the altered enzyme properties resulting
from R132H mutation were shared by other R132 mutations found in
human gliomas, recombinant R132C, R132L and R132S mutant IDH1
proteins were generated and the enzymatic properties assessed.
Similar to R132H mutant protein, R132C, R132L, and R132S mutations
all result in a gain-of-function for NADPH-dependent reduction of
.alpha.KG (data not shown). Thus, in addition to impaired oxidative
decarboxylation of isocitrate, one common feature shared among the
IDH1 mutations found in human gliomas is the ability to catalyze
direct NADPH-dependent reduction of .alpha.KG.
Identification of 2-HG Production in Glioblastoma Cell Lines
Containing the IDH-1 R132H Mutant Protein.
[0681] Generation of Genetic Engineered Glioblastoma Cell Lines
Expressing Wildtype or Mutant IDH-1 Protein.
[0682] A carboxy-terminal Myc-DDK-tagged open reading frame (ORF)
clone of human isocitrate dehydrogenase 1 (IDH1; Ref. ID:
NM_005896) cloned in vector pCMV6 was obtained from commercial
vendor Origen Inc. Vector pCMV6 contains both kanamycin and
neomycin resistance cassettes for selection in both bacterial and
mammalian cell systems. Standard molecular biology mutagenesis
techniques were utilized to alter the DNA sequence at base pair 364
of the ORF to introduce base pair change from guanine to adenine
resulting in a change in the amino acid code at position 132 from
argentine (wt) to histidine (mutant; or R132H). Specific DNA
sequence alteration was confirmed by standard methods for DNA
sequence analysis. Parental vector pCMV6 (no insert), pCMV6-wt IDH1
or pCMV6-R132H were transfected into immortalized human
glioblastoma cell lines ATCC.RTM. CRL-2610 (LN-18) or HTB-14 (U-87)
in standard growth medium (DMEM; Dulbecco's modified Eagles Medium
containing 10% fetal bovine serum). Approximately 24 hrs after
transfection, the cell cultures were transitioned to DMEM
containing G418 sodium salt at concentrations of either 750 ug/ml
(CRL-2610) or 500 ug/ml (HTB-14) to select those cells in culture
that expressed the integrated DNA cassette expressing both the
neomycin selectable marker and the ORF for human wild type or
R132H. Pooled populations of G418 resistant cells were generated
and expression of either wild type IDH1 or R132 IDH1 was confirmed
by standard Western blot analysis of cell lysates using commercial
antibodies recognizing either human IDH1 antigen or the engineered
carboxy-terminal MYC-DDK expression tag. These stable clonal pools
were then utilized for metaobolite preparation and analysis.
[0683] Procedure for Metabolite Preparation and Analysis.
[0684] Glioblastoma cell lines (CRL-2610 and HTB-14) expressing
wildtype or mutant IDH-1 protein were grown using standard
mammalian tissue culture techniques on DMEM media containing 10%
FCS, 25 mM glucose, 4 mM glutamine, and G418 antibiotic (CRL-2610
at 750 ug/mL; HTB-14 at 500 ug/mL) to insure ongoing selection to
preserve the transfected mutant expression sequences. In
preparation for metabolite extraction experiments, cells were
passaged into 10 cm round culture dishes at a density of
1.times.10.sup.6 cells. Approximately 12 hours prior to metabolite
extraction, the culture media was changed (8 mL per plate) to DMEM
containing 10% dialyzed FCS (10,000 mwco), 5 mM glucose, 4 mM
glutamine, and G-418 antibiotic as before; the dialyzed FCS removes
multiple small molecules form the culture media and enables cell
culture-specific assessment of metabolite levels. The media was
again changed 2 horrs prior to metabolite extraction. Metabolite
extraction was accomplished by quickly aspirating the media from
the culture dishes in a sterile hood, immediately placing the
dishes in a tray containing dry ice to cool them to -80.degree. C.,
and as quickly as possible, adding 2.6 mL of 80% MeOH/20% water,
pre-chilled to -80.degree. C. in a dry-ice/acetone bath. These
chilled, methanol extracted cells were then physically separated
from the culture dish by scraping with a sterile polyethylene cell
lifter (Corning #3008), brought into suspension and transferred to
a 15 mL conical vial, then chilled to -20.degree. C. An additional
1.0 mL of 80% MeOH/20% water was applied to the chilled culture
dish and the cell lifting procedure repeated, to give a final
extraction volume of 3.6 mL. The extracts were centrifuged at
20,000.times.g for 30 minutes to sediment the cell debris, and 3.0
mL of the supernatants was transferred to a screw-cap freezer vial
and stored at -80.degree. C. until ready for analysis.
[0685] In preparation for analysis, the extracts were removed from
the freezer and dried on a nitrogen blower to remove methanol. The
100% aqueous samples were analyzed by LCMS as follows. The extract
(10 .mu.L) was injected onto a reverse-phase HPLC column (Synergi
150 mm.times.2 mm, Phenomenex Inc.) and eluted using a linear
gradient of LCMS-grade methanol (Buffer B) in Aq. 10 mM
tributylamine, 15 mM Acetic acid (Buffer A), running from 3% Buffer
B to 95% Buffer B over 45 minutes at 200 .mu.L/min. Eluted
metabolite ions were detected using a triple-quadrapole mass
spectrometer, tuned to detect in negative mode with
multiple-reaction-monitoring mode transition set (MRM's) according
to the molecular weights and fragmentation patterns for 38 known
central metabolites, including 2-hydroxyglutarate (MRM parameters
were optimized by prior infusion of known compound standards). Data
was processed using Analyst Software (Applied Biosystems, Inc.) and
metabolite signal intensities were converted into absolute
concentrations using signal build-up curves from injected mixtures
of metabolite standards at known concentrations. Final metabolite
concentrations were reported as mean of at least three replicates,
+/-standard deviation.
[0686] Results.
[0687] Analyses reveal significantly higher levels of 2-HG in cells
that express the IDH-1 R132H mutant protein. As shown in FIG. 26A,
levels of 2-HG in CRL-2610 cell lines expressing the IDH-1 R132H
mutant protein are approximately 28-fold higher than identical
lines expressing the wild-type protein. Similarly, levels of 2-HG
in HTB-14 cell lines expressing the IDH-1 R132H mutant protein are
approximately 38-fold higher than identical lines expressing the
wild-type protein, as shown in FIG. 26B.
Evaluation of 2-Hydroxyglutarate (2-HG) Production in Human
Glioblastoma Tumors Containing Mutations in Isocitrate
Dehydrogenase 1 (IDH1) at Amino Acid 132.
[0688] Heterozygous somatic mutations at nucleotide position 395
(amino acid codon 132) in the transcript encoding isocitrate
dehydrogenase 1 (IDH1) can occur in brain tumors.
[0689] Tissue Source: Human Brain Tumors were Obtained During
Surgical Resection, flash frozen in liquid nitrogen and stored at
-80.degree. C. Clinical classification of the tissue as gliomas was
performed using standard clinical pathology categorization and
grading.
[0690] Genomic Sequence Analysis to Identify Brain Tumor Samples
Containing Either Wild Type Isocitrate Dehydrogenase (IDH1) or
Mutations Altering Amino Acid 132.
[0691] Genomic DNA was isolated from 50-100 mgs of brain tumor
tissue using standard methods. A polymerase chain reaction (PCR)
procedure was then performed on the isolated genomic DNA to amplify
a 295 base pair fragment of the genomic DNA that contains both
intron and 2.sup.nd exon sequences of human IDH1 (FIG. 27). In FIG.
27, intron sequence is shown in lower case font; 2.sup.nd exon IDH1
DNA sequence is shown in upper case font; forward (5') and reverse
(3') primer sequences are shown in underlined font; guanine
nucleotide mutated in a subset of human glioma tumors is shown in
bold underlined font.
[0692] The amplified DNA fragment was then sequenced using standard
protocols and sequence alignments were performed to classify the
sequences as either wild type or mutant at the guanine nucleotide
at base pair 170 of the amplified PCR fragment. Tumors were
identified that contained genomic DNA having either two copies of
guanine (wild type) or a mixed or monoalellic combination of one
IDH1 allele containing guanine and the other an adenine (mutant)
sequence at base pair 170 of the amplified product (Table 15). The
nucleotide change results in a change at amino acid position 132 of
human IDH1 protein from arginine (wild type) to histidine (mutant)
as has been previously reported.
TABLE-US-00007 TABLE 15 Sequence variance at base pair 170 of the
amplified genomic DNA from human glioma samples. Sample Base IDH1
Amino ID 170 Acid 132 Genotype 1102 G arginine wild type 1822 A
histidine mutant 496 G arginine wild type 1874 A histidine mutant
816 A histidine mutant 534 G arginine wild type AP-1 A histidine
mutant AP-2 A histidine mutant
[0693] Procedure for Metabolite Preparation and Analysis.
[0694] Metabolite extraction was accomplished by adding a
10.times.volume (m/v ratio) of -80 C methanol:water mix (80%:20%)
to the brain tissue (approximately 100 mgs) followed by 30 s
homogenization at 4 C. These chilled, methanol extracted
homogenized tissues were then centrifuged at 14,000 rpm for 30
minutes to sediment the cellular and tissue debris and the cleared
tissue supernatants were transferred to a screw-cap freezer vial
and stored at -80.degree. C. For analysis, a 2.times. volume of
tributylamine (10 mM) acetic acid (10 mM) pH 5.5 was added to the
samples and analyzed by LCMS as follows. Sample extracts were
filtered using a Millex-FG 0.20 micron disk and 10 .mu.L were
injected onto a reverse-phase HPLC column (Synergi 150 mm.times.2
mm, Phenomenex Inc.) and eluted using a linear gradient LCMS-grade
methanol (50%) with 10 mM tributylamine and 10 mM acetic acid)
ramping to 80% methanol:10 mM tributylamine: 10 mM acetic acid over
6 minutes at 200 .mu.L/min. Eluted metabolite ions were detected
using a triple-quadrapole mass spectrometer, tuned to detect in
negative mode with multiple-reaction-monitoring mode transition set
(MRM's) according to the molecular weights and fragmentation
patterns for 8 known central metabolites, including
2-hydroxyglutarate (MRM parameters were optimized by prior infusion
of known compound standards). Data was processed using Analyst
Software (Applied Biosystems, Inc.) and metabolite signal
intensities were obtained by standard peak integration methods.
[0695] Results.
[0696] Analyses revealed dramatically higher levels of 2-HG in
cells tumor samples that express the IDH-1 R132H mutant protein.
Data is summarized in Table 16 and FIG. 28.
TABLE-US-00008 TABLE 16 Tumor Cells Primary in Tumor Nucle- Sample
Specimen Foci Geno- otide 2HG .quadrature.KG Malate Fumarate
Succinate Isocitrate ID Diagnosis Grade (%) type change Codon
(.quadrature.mole/g) (.quadrature.mole/g) (.quadrature.mole/g)
(.quadrature.mole/g) (.quadrature.mole/g) (.quadrature.mole/g) 1
Glioblastoma, WHO n/a wild wild R132 0.18 0.161 1.182 0.923 1.075
0.041 residual/ grade type type recurrent IV 2 Glioblastoma WHO n/a
wild wild R132 0.16 0.079 1.708 1.186 3.156 0.100 grade type type
IV 3 Glioblastoma WHO n/a wild wild R132 0.13 0.028 0.140 0.170
0.891 0.017 grade type type IV 4 Oligoastro- WHO n/a wild wild R132
0.21 0.016 0.553 1.061 1.731 0.089 cytoma grade type type II 5
Glioblastoma WHO n/a mutant G364A R132H 16.97 0.085 1.091 0.807
1.357 0.058 grade IV 6 Glioblastoma WHO n/a mutant G364A R132H
19.42 0.023 0.462 0.590 1.966 0.073 grade IV 7 Glioblastoma WHO n/a
mutant G364A R132H 31.56 0.068 0.758 0.503 2.019 0.093 grade IV 8
Oligodendro- WHO 75 mutant G364A R132H 12.49 0.033 0.556 0.439
0.507 0.091 glioma, grade anaplastic III 9 Oligodendro- WHO 90
mutant G364A R132H 4.59 0.029 1.377 1.060 1.077 0.574 glioma, grade
anaplastic III 10 Oligoastro- WHO n/a mutant G364A R132H 6.80 0.038
0.403 0.503 1.561 0.065 cytoma grade II 11 Glioblastoma WHO n/a
wild wild R132 0.686 0.686 0.686 0.686 0.686 0.007 grade type type
IV 12 Glioblastoma WHO n/a mutant G364A R132H 18.791 18.791 18.791
18.791 18.791 0.031 grade IV 13 Glioblastoma WHO n/a mutant G364A
R132H 4.59 0.029 1.377 1.060 1.077 0.043 grade IV 14 Glioblastoma
WHO n/a wild wild R132 0.199 0.046 0.180 0.170 0.221 0.014 grade
type type IV 15 Glioblastoma WHO n/a mutant C363G R132G 13.827
0.030 0.905 0.599 1.335 0.046 grade IV 16 Glioblastoma WHO n/a
mutant G364A R132H 28.364 0.068 0.535 0.488 2.105 0.054 grade IV 17
Glioblastoma WHO n/a mutant C363A R132S 9.364 0.029 1.038 0.693
2.151 0.121 grade IV 18 Glioblastoma WHO n/a wild wild R132 0.540
0.031 0.468 0.608 1.490 0.102 grade type type IV 19 Glioma, WHO 80
mutant G364A R132H 19.000 0.050 0.654 0.391 2.197 0.171 malignant,
grade astrocytoma IV 20 Oligodendro- WHO 80 wild wild R132 0.045
0.037 1.576 0.998 1.420 0.018 glioma grade type type III 21 Glioma,
WHO 95 wild wild R132 0.064 0.034 0.711 0.710 2.105 0.165
malignant, grade type type astrocytoma IV 22 Glioblastoma WHO 70
wild wild R132 0.171 0.041 2.066 1.323 0.027 0.072 grade type type
IV
[0697] To determine if 2HG production is characteristic of tumors
harboring mutations in IDH1, metabolites were extracted from human
malignant gliomas that were either wild-type or mutant for IDH1. It
has been suggested that .alpha.KG levels are decreased in cells
transfected with mutant IDH1 (Zhao, S. et al. Science 324, 261-5
(2009)). The average .alpha.KG level from 12 tumor samples
harboring various R132 mutations was slightly less than the average
.alpha.KG level observed in 10 tumors which are wild-type for IDH1.
This difference in .alpha.KG was not statistically significant, and
a range of .alpha.KG levels was observed in both wild-type and
mutant tumors. In contrast, increased 2HG levels were found in all
tumors that contained an R132 IDH1 mutation. All R132 mutant IDH1
tumors examined had between 5 and 35 .mu.mol of 2HG per gram of
tumor, while tumors with wild-type IDH1 had over 100 fold less 2HG.
This increase in 2HG in R132 mutant tumors was statistically
significant (p<0.0001). It was confirmed that (R)-2HG was the
isomer present in tumor samples (data not shown). Together these
data establish that the novel enzymatic activity associated with
R132 mutations in IDH1 results in the production of 2HG in human
brain tumors that harbor these mutations.
[0698] 2HG is known to accumulate in the inherited metabolic
disorder 2-hydroxyglutaric aciduria. This disease is caused by
deficiency in the enzyme 2-hydroxyglutarate dehydrogenase, which
converts 2HG to .alpha.KG (Strays, E. A. et al. Am J Hum Genet 76,
358-60 (2005)). Patients with 2-hydroxyglutarate dehydrogenase
deficiencies accumulate 2HG in the brain as assessed by MRI and CSF
analysis, develop leukoencephalopathy, and have an increased risk
of developing brain tumors (Aghili, M., Zahedi, F. & Rafiee, J
Neurooncol 91, 233-6 (2009); Kolker, S., Mayatepek, E. &
Hoffmann, G. F. Neuropediatrics 33, 225-31 (2002); Wajner, M.,
Latini, A., Wyse, A. T. & Dutra-Filho, C. S. J Inherit Metab
Dis 27, 427-48 (2004)). Furthermore, elevated brain levels of 2HG
result in increased ROS levels (Kolker, S. et al. Eur J Neurosci
16, 21-8 (2002); Latini, A. et al. Eur J Neurosci 17, 2017-22
(2003)), potentially contributing to an increased risk of cancer.
The ability of 2HG to act as an NMDA receptor agonist may
contribute to this effect (Kolker, S. et al. Eur J Neurosci 16,
21-8 (2002)). 2HG may also be toxic to cells by competitively
inhibiting glutamate and/or .alpha.KG utilizing enzymes. These
include transaminases which allow utilization of glutamate nitrogen
for amino and nucleic acid biosynthesis, and .alpha.KG-dependent
prolyl hydroxylases such as those which regulate Hifla levels.
Alterations in Hifla have been reported to result from mutant IDH1
protein expression (Zhao, S. et al. Science 324, 261-5 (2009)).
Regardless of mechanism, it appears likely that the
gain-of-function ability of cells to produce 2HG as a result of
R132 mutations in IDH1 contributes to tumorigenesis. Patients with
2-hydroxyglutarate dehydrogenase deficiency have a high risk of CNS
malignancy (Aghili, M., Zahedi, F. & Rafiee, E. J Neurooncol
91, 233-6 (2009)). The ability of mutant IDH1 to directly act on
.alpha.KG may explain the prevalence of IDH1 mutations in tumors
from CNS tissue, which are unique in their high level of glutamate
uptake and its ready conversion to .alpha.KG in the cytosol
(Tsacopoulos, M. J Physiol Paris 96, 283-8 (2002)), thereby
providing high levels of substrate for 2HG production. The apparent
co-dominance of the activity of mutant IDH1 with that of the
wild-type enzyme is consistent with the genetics of the disease, in
which only a single copy of the gene is mutated. As discussed
above, the wild-type IDH1 could directly provide NADPH and
.alpha.KG to the mutant enzyme. These data also demonstrate that
mutation of R132 to histidine, serine, cysteine, glycine or leucine
share a common ability to catalyze the NADPH-dependent conversion
of .alpha.KG to 2HG. These findings help clarify why mutations at
other amino acid residues of IDH1, including other residues
essential for catalytic activity, are not found. Finally, these
findings have clinical implications in that they suggest that 2HG
production will identify patients with IDH1 mutant brain tumors.
This will be important for prognosis as patients with IDH1
mutations live longer than patients with gliomas characterized by
other mutations (Parsons, D. W. et al. Science 321, 1807-12
(2008)). In addition, patients with lower grade gliomas may benefit
by the therapeutic inhibition of 2HG production. Inhibition of 2HG
production by mutant IDH1 might slow or halt conversion of lower
grade glioma into lethal secondary glioblastoma, changing the
course of the disease.
The Reaction Product of ICDH1 R13211 Reduction of .alpha.-KG
Inhibits the Oxidative Decarboxylation of Isocitrate by Wild-Type
ICDH1.
[0699] A reaction containing the wild-type ICDH1, NADP, and
.alpha.-KG was assembled (under conditions as described above) to
which was added in a titration series either (R)-2-hydroxyglutarate
or the reaction product of the ICDH1 R1321H mutant reduction of
.alpha.-KG to 2-hydroxyglutarate. The reaction product 2-HG was
shown to inhibit the oxidative decarboxylation of isocitrate by the
wild-type ICDH1, while the (R)-2-hydroxyglutarate did not show any
effect on the rate of the reaction. Since there are only two
possible chiral products of the ICDH1 R132H mutant reduction of
.alpha.-KG to 2-HG, and the (R)-2-HG did not show inhibition in
this assay, it follows that the product of the mutant reaction is
the (S)-2-HG form. This experiment is presented in FIG. 25.
[0700] To determine the chirality of the 2HG produced, the products
of the R132H reaction was derivatized with diacetyl-L-tartaric
anhydride, which allowed separating the (S) and (R) enantiomers of
2HG by simple reverse-phase LC and detecting the products by tandem
mass spectrometry (Struys, E. A., Jansen, E. E., Verhoeven, N. M.
& Jakobs, C. Clin Chem 50, 1391-5 (2004)) (FIG. 31B). The peaks
corresponding to the (S) and (R) isomers of 2HG were confirmed
using racemic and R(-)-2HG standards. The reaction product from
R132H co-eluted with R(-)-2HG peak, demonstrating that the R(-)
stereoisomer is the product produced from .alpha.KG by R132H mutant
IDH1.
[0701] The observation that the reaction product of the mutant
enzyme is capable of inhibiting a metabolic reaction known to occur
in cells suggests that this reaction product might also inhibit
other reactions which utilize .alpha.-KG, isocitrate, or citrate as
substrates or produce them as products in vivo or in vitro.
Example 3 Metabolomics Analysis of IDH1 Wild Type and Mutants
[0702] Metabolomics research can provide mechanistic basis for why
R132 mutations confer survival advantage for GBM patients carrying
such mutations.
1. Metabolomics of GBM Tumor Cell Lines: Wild Type Vs R132
Mutants
[0703] Cell lines with R132 mutations can be identified and
profiled. Experiments can be performed in proximal metabolite pool
with a broad scope of metabolites.
2. Oxalomalate Treatment of GBM Cell Lines
[0704] Oxalomalate is a competitive inhibitor of IDH1. Change of
NADPH (metabolomics) when IDH1 is inhibited by a small molecule can
be examined.
3. Metabolomics of Primary GBM Tumors: Wild Type Vs R132
Mutations
[0705] Primary tumors with R132 mutations can be identified.
Experiments can be performed in proximal metabolite pool with a
broad scope of metabolites.
4. Detection of 2-Hydroxyglutarate in Cells that Overexpress IDH1
132 Mutants
[0706] Overexpression of an IDH1 132 mutant in cells may cause an
elevated level of 2-hydroxyglutarate and/or a reduced level of
alpha-ketoglutarate. One can perform a metabolomic experiment to
demonstrate the consequence of this mutation on the cellular
metabolite pool.
Example 4 Evaluation of IDH1 as a Cancer Target
[0707] shRNAmir inducible knockdown can be performed to examine the
cellular phenotype and metabolomics profiles. HTS grade IDH1
enzymes are available. The IDH mutations described herein can be
used for patient selection.
Example 5 siRNAs
[0708] IDH1
[0709] Exemplary siRNAs are presented in the following tables.
Art-known methods can be used to select other siRNAs. siRNAs can be
evaluated, e.g., by determining the ability of an siRNA to silence
an IDH, e.g., IDH1, e.g., in an in vitro system, e.g., in cultured
cells, e.g., HeLa cells or cultured glioma cells. siRNAs known in
the art for silencing the target can also be used, see, e.g.,
Silencing of cytosolic NADP+ dependent isoccitrate dehydrogenase by
small interfering RNA enhances the sensitivity of HeLa cells toward
stauropine, Lee et al., 2009, Free Radical Research, 43:
165-173.
[0710] The siRNAs in Table 7 (with the exception of entry 1356)
were generated using the siRNA selection tool available on the
worldwide web at jura.wi.mit.edu/bioc/siRNAext/. (Yuan et al. Nucl.
Acids. Res. 2004 32:W130-W134.) Other selection tools can be used
as well. Entry 1356 was adapted from Silencing of cytosolic NADP+
dependent isoccitrate dehydrogenase by small interfering RNA
enhances the sensitivity of HeLa cells toward stauropine, Lee et
al., 2009, Free Radical Research, 43: 165-173.
[0711] The siRNAs in Tables 7, 8, 9, 10, 11, 12, 13 and 14
represent candidates spanning the IDH1 mRNA at nucleotide positions
628 and 629 according to the sequence at GenBank Accession No.
NM_005896.2 (SEQ ID NO:9, FIG. 22).
[0712] The RNAs in the tables can be modified, e.g., as described
herein. Modifications include chemical modifications to enhance
properties, e.g., resistance to degradation, or the use of
overhangs. For example, either one or both of the sense and
antisense strands in the tables can include an additional
dinucleotide at the 3' end, e.g., TT, UU, dTdT.
TABLE-US-00009 TABLE 7 siRNAs targeting wildtype IDH1 Position on
mRNA SEQ SEQ (FIG. sense ID antisense ID 21B) (5' to 3') NO: (5' to
3') NO: 13 GGUUUCUGCAGAGUCUAC 14 AGUAGACUCUGCAGAAAC 15 U C 118
CUCUUCGCCAGCAUAUCA 16 AUGAUAUGCUGGCGAAGA 17 U G 140
GGCAGGCGAUAAACUACA 18 AUGUAGUUUAUCGCCUGC 19 U C 145
GCGAUAAACUACAUUCAG 20 ACUGAAUGUAGUUUAUCG 21 U C 199
GAAAUCUAUUCACUGUCA 22 UUGACAGUGAAUAGAUUU 23 A C 257
GUUCUGUGGUAGAGAUGC 24 UGCAUCUCUACCACAGAA 25 A C 272
GCAAGGAGAUGAAAUGAC 26 UGUCAUUUCAUCUCCUUG 27 A C 277
GGAGAUGAAAUGACACGA 28 UUCGUGUCAUUUCAUCUC 29 A C 278
GAGAUGAAAUGACACGAA 30 AUUCGUGUCAUUUCAUCU 31 U C 280
GAUGAAAUGACACGAAUC 32 UGAUUCGUGUCAUUUCAU 33 A C 292
CGAAUCAUUUGGGAAUUG 34 UCAAUUCCCAAAUGAUUC 35 A G 302
GGGAAUUGAUUAAAGAGA 36 UUCUCUUUAAUCAAUUCC 37 A C 332
CCUACGUGGAAUUGGAUC 38 AGAUCCAAUUCCACGUAG 39 U G 333
CUACGUGGAAUUGGAUCU 40 UAGAUCCAAUUCCACGUA 41 A G 345
GGAUCUACAUAGCUAUGA 42 AUCAUAGCUAUGUAGAUC 43 U C 356
GCUAUGAUUUAGGCAUAG 44 UCUAUGCCUAAAUCAUAG 45 A C 408
GGAUGCUGCAGAAGCUAU 46 UAUAGCUUCUGCAGCAUC 47 A C 416
CAGAAGCUAUAAAGAAGC 48 UGCUUCUUUAUAGCUUCU 49 A G 418
GAAGCUAUAAAGAAGCAU 50 UAUGCUUCUUUAUAGCUU 51 A C 432
GCAUAAUGUUGGCGUCAA 52 UUUGACGCCAACAUUAUG 53 A C 467
CUGAUGAGAAGAGGGUUG 54 UCAACCCUCUUCUCAUCA 55 A G 481
GUUGAGGAGUUCAAGUUG 56 UCAACUUGAACUCCUCAA 57 A C 487
GAGUUCAAGUUGAAACAA 58 UUUGUUUCAACUUGAACU 59 A C 495
GUUGAAACAAAUGUGGAA 60 UUUCCACAUUUGUUUCAA 61 A C 502
CAAAUGUGGAAAUCACCA 62 UUGGUGAUUUCCACAUUU 63 A G 517
CCAAAUGGCACCAUACGA 64 UUCGUAUGGUGCCAUUUG 65 A G 528
CAUACGAAAUAUUCUGGG 66 ACCCAGAAUAUUUCGUAU 67 U G 560
GAGAAGCCAUUAUCUGCA 68 UUGCAGAUAAUGGCUUCU 69 A C 614
CUAUCAUCAUAGGUCGUC 70 UGACGACCUAUGAUGAUA 71 A G 618
CAUCAUAGGUCGUCAUGC 72 AGCAUGACGACCUAUGAU 73 U G 621
CAUAGGUCGUCAUGCUUA 74 AUAAGCAUGACGACCUAU 75 U G 691
GAGAUAACCUACACACCA 76 UUGGUGUGUAGGUUAUCU 77 A C 735
CCUGGUACAUAACUUUGA 78 UUCAAAGUUAUGUACCAG 79 A G 747
CUUUGAAGAAGGUGGUGG 80 ACCACCACCUUCUUCAAA 81 U G 775
GGGAUGUAUAAUCAAGAU 82 UAUCUUGAUUAUACAUCC 83 A C 811
GCACACAGUUCCUUCCAA 84 UUUGGAAGGAACUGUGUG 85 A C 818
GUUCCUUCCAAAUGGCUC 86 AGAGCCAUUUGGAAGGAA 87 U C 844
GGUUGGCCUUUGUAUCUG 88 UCAGAUACAAAGGCCAAC 89 A C 851
CUUUGUAUCUGAGCACCA 90 UUGGUGCUCAGAUACAAA 91 A G 882
GAAGAAAUAUGAUGGGCG 92 ACGCCCAUCAUAUUUCUU 93 U C 942
GUCCCAGUUUGAAGCUCA 94 UUGAGCUUCAAACUGGGA 95 A C 968
GGUAUGAGCAUAGGCUCA 96 AUGAGCCUAUGCUCAUAC 97 U C 998
GGCCCAAGCUAUGAAAUC 98 UGAUUUCAUAGCUUGGGC 99 A C 1001
CCCAAGCUAUGAAAUCAG 100 UCUGAUUUCAUAGCUUGG 101 A G 1127
CAGAUGGCAAGACAGUAG 102 UCUACUGUCUUGCCAUCU 103 A G 1133
GCAAGACAGUAGAAGCAG 104 UCUGCUUCUACUGUCUUG 105 A C 1184
GCAUGUACCAGAAAGGAC 106 UGUCCUUUCUGGUACAUG 107 A C 1214
CCAAUCCCAUUGCUUCCA 108 AUGGAAGCAAUGGGAUUG 109 U G 1257
CCACAGAGCAAAGCUUGA 110 AUCAAGCUUUGCUCUGUG 111 U G 1258
CACAGAGCAAAGCUUGAU 112 UAUCAAGCUUUGCUCUGU 113 A G 1262
GAGCAAAGCUUGAUAACA 114 UUGUUAUCAAGCUUUGCU 115 A C 1285
GAGCUUGCCUUCUUUGCA 116 UUGCAAAGAAGGCAAGCU 117 A C 1296
CUUUGCAAAUGCUUUGGA 118 UUCCAAAGCAUUUGCAAA 119 A G 1301
CAAAUGCUUUGGAAGAAG 120 ACUUCUUCCAAAGCAUUU 121 U G 1307
CUUUGGAAGAAGUCUCUA 122 AUAGAGACUUCUUCCAAA 123 U G 1312
GAAGAAGUCUCUAUUGAG 124 UCUCAAUAGAGACUUCUU 125 A C 1315
GAAGUCUCUAUUGAGACA 126 UUGUCUCAAUAGAGACUU 127 A C 1356
GGACUUGGCUGCUUGCAU 128 AAUGCAAGCAGCCAAGUC 129 U C 1359
CUUGGCUGCUUGCAUUAA 130 UUUAAUGCAAGCAGCCAA 131 A G 1371
CAUUAAAGGUUUACCCAA 132 AUUGGGUAAACCUUUAAU 133 U G 1385
CCAAUGUGCAACGUUCUG 134 UCAGAACGUUGCACAUUG 135 A G 1390
GUGCAACGUUCUGACUAC 136 AGUAGUCAGAACGUUGCA 137 U C 1396
CGUUCUGACUACUUGAAU 138 UAUUCAAGUAGUCAGAAC 139 A G 1415
CAUUUGAGUUCAUGGAUA 140 UUAUCCAUGAACUCAAAU 141 A G 1422
GUUCAUGGAUAAACUUGG 142 UCCAAGUUUAUCCAUGAA 143 A C 1425
CAUGGAUAAACUUGGAGA 144 UUCUCCAAGUUUAUCCAU 145 A G 1455
CAAACUAGCUCAGGCCAA 146 UUUGGCCUGAGCUAGUUU 147 A G 1487
CCUGAGCUAAGAAGGAUA 148 UUAUCCUUCUUAGCUCAG 149 A G 1493
CUAAGAAGGAUAAUUGUC 150 AGACAAUUAUCCUUCUUA 151 U G 1544
CUGUGUUACACUCAAGGA 152 AUCCUUGAGUGUAACACA 153 U G 1546
GUGUUACACUCAAGGAUA 154 UUAUCCUUGAGUGUAACA 155 A C 1552
CACUCAAGGAUAAAGGCA 156 UUGCCUUUAUCCUUGAGU 157 A G 1581
GUAAUUUGUUUAGAAGCC 158 UGGCUUCUAAACAAAUUA 159 A C 1646
GUUAUUGCCACCUUUGUG 160 UCACAAAGGUGGCAAUAA 161 A C 1711
CAGCCUAGGAAUUCGGUU 162 UAACCGAAUUCCUAGGCU 163 A G 1713
GCCUAGGAAUUCGGUUAG 164 ACUAACCGAAUUCCUAGG 165 U C 1714
CCUAGGAAUUCGGUUAGU 166 UACUAACCGAAUUCCUAG 167 A G 1718
GGAAUUCGGUUAGUACUC 168 UGAGUACUAACCGAAUUC 169 A C 1719
GAAUUCGGUUAGUACUCA 170 AUGAGUACUAACCGAAUU 171 U C 1725
GGUUAGUACUCAUUUGUA 172 AUACAAAUGAGUACUAAC 173 U C 1730
GUACUCAUUUGUAUUCAC 174 AGUGAAUACAAAUGAGUA 175 U C
1804 GGUAAAUGAUAGCCACAG 176 ACUGUGGCUAUCAUUUAC 177 U C 1805
GUAAAUGAUAGCCACAGU 178 UACUGUGGCUAUCAUUUA 179 A C 1816
CCACAGUAUUGCUCCCUA 180 UUAGGGAGCAAUACUGUG 181 A G 1892
GGGAAGUUCUGGUGUCAU 182 UAUGACACCAGAACUUCC 183 A C 1897
GUUCUGGUGUCAUAGAUA 184 AUAUCUAUGACACCAGAA 185 U C 1934
GCUGUGCAUUAAACUUGC 186 UGCAAGUUUAAUGCACAG 187 A C 1937
GUGCAUUAAACUUGCACA 188 AUGUGCAAGUUUAAUGCA 189 U C 1939
GCAUUAAACUUGCACAUG 190 UCAUGUGCAAGUUUAAUG 191 A C 1953
CAUGACUGGAACGAAGUA 192 AUACUUCGUUCCAGUCAU 193 U G 1960
GGAACGAAGUAUGAGUGC 194 UGCACUCAUACUUCGUUC 195 A C 1961
GAACGAAGUAUGAGUGCA 196 UUGCACUCAUACUUCGUU 197 A C 1972
GAGUGCAACUCAAAUGUG 198 ACACAUUUGAGUUGCACU 199 U C 1976
GCAACUCAAAUGUGUUGA 200 UUCAACACAUUUGAGUUG 201 A C 1982
CAAAUGUGUUGAAGAUAC 202 AGUAUCUUCAACACAUUU 203 U G 1987
GUGUUGAAGAUACUGCAG 204 ACUGCAGUAUCUUCAACA 205 U C 1989
GUUGAAGAUACUGCAGUC 206 UGACUGCAGUAUCUUCAA 207 A C 2020
CCUUGCUGAAUGUUUCCA 208 UUGGAAACAUUCAGCAAG 209 A G 2021
CUUGCUGAAUGUUUCCAA 210 AUUGGAAACAUUCAGCAA 211 U G 2024
GCUGAAUGUUUCCAAUAG 212 UCUAUUGGAAACAUUCAG 213 A C 2035
CCAAUAGACUAAAUACUG 214 ACAGUAUUUAGUCUAUUG 215 U G 2067
GAGUUUGGAAUCCGGAAU 216 UAUUCCGGAUUCCAAACU 217 A C 2073
GGAAUCCGGAAUAAAUAC 218 AGUAUUUAUUCCGGAUUC 219 U C 2074
GAAUCCGGAAUAAAUACU 220 UAGUAUUUAUUCCGGAUU 221 A C 2080
GGAAUAAAUACUACCUGG 222 UCCAGGUAGUAUUUAUUC 223 A C 2133
GGCCUGGCCUGAAUAUUA 224 AUAAUAUUCAGGCCAGGC 225 U C 2134
GCCUGAAUAUUAUACUAC 226 AGUAGUAUAAUAUUCAGG 227 U C 2136
CUGGCCUGAAUAUUAUAC 228 AGUAUAAUAUUCAGGCCA 229 U G 2166
CAUAUUUCAUCCAAGUGC 230 UGCACUUGGAUGAAAUAU 231 A G 2180
GUGCAAUAAUGUAAGCUG 232 UCAGCUUACAUUAUUGCA 233 A C 2182
GCAAUAAUGUAAGCUGAA 234 AUUCAGCUUACAUUAUUG 235 U C 2272
CACUAUCUUAUCUUCUCC 236 AGGAGAAGAUAAGAUAGU 237 U G 2283
CUUCUCCUGAACUGUUGA 238 AUCAACAGUUCAGGAGAA 239 U G
TABLE-US-00010 TABLE 8 siRNAs targeting wildtype IDH1 Position on
mRNA SEQ SEQ (FIG. sense ID antisense ID 21B) (5' to 3') NO: (5' to
3') NO: 611 AACCUAUCAUCAUAGGUC 240 CGACCUAUGAUGAUAGGU 241 G U 612
ACCUAUCAUCAUAGGUCG 242 ACGACCUAUGAUGAUAGG 243 U U 613
CCUAUCAUCAUAGGUCGU 244 GACGACCUAUGAUGAUAG 245 C G 614
CUAUCAUCAUAGGUCGUC 246 UGACGACCUAUGAUGAUA 247 A G 615
UAUCAUCAUAGGUCGUCA 248 AUGACGACCUAUGAUGAU 249 U A 616
AUCAUCAUAGGUCGUCAU 250 CAUGACGACCUAUGAUGA 251 G U 617
UCAUCAUAGGUCGUCAUG 252 GCAUGACGACCUAUGAUG 253 C A 618
CAUCAUAGGUCGUCAUGC 254 AGCAUGACGACCUAUGAU 255 U G 619
AUCAUAGGUCGUCAUGCU 256 AAGCAUGACGACCUAUGA 257 U U 620
UCAUAGGUCGUCAUGCUU 258 UAAGCAUGACGACCUAUG 259 A A 621
CAUAGGUCGUCAUGCUUA 260 AUAAGCAUGACGACCUAU 261 U G 622
AUAGGUCGUCAUGCUUAU 262 CAUAAGCAUGACGACCUA 263 G U 623
UAGGUCGUCAUGCUUAUG 264 CCAUAAGCAUGACGACCU 265 G A 624
AGGUCGUCAUGCUUAUGG 266 CCCAUAAGCAUGACGACC 267 G U 625
GGUCGUCAUGCUUAUGGG 268 CCCCAUAAGCAUGACGAC 269 G C 626
GUCGUCAUGCUUAUGGGG 270 UCCCAUAAGCAUGACGAC 271 A C 627
UCGUCAUGCUUAUGGGGA 272 AUCCCAUAAGCAUGACGA 273 U C
TABLE-US-00011 TABLE 9 siRNAs targeting G395A mutant IDH1 (SEQ ID
NO: 5) (equivalent to G629A of SEQ ID NO: 9 (FIG. 21B)) Posi- tion
on mRNA SEQ SEQ (FIG. sense ID antisense ID 21B) (5' to 3') NO: (5'
to 3') NO: 611 AACCUAUCAUCAU 274 UGACCUAUGAUGAUAGGUU 275 AGGUCA 612
ACCUAUCAUCAUA 276 AUGACCUAUGAUGAUAGGU 277 GGUCAU 613 CCUAUCAUCAUAG
278 GAUGACCUAUGAUGAUAGG 279 GUCAUC 614 CUAUCAUCAUAGG 280
UGAUGACCUAUGAUGAUAG 281 UCAUCA 615 UAUCAUCAUAGGU 282
AUGAUGACCUAUGAUGAUA 283 CAUCAU 616 AUCAUCAUAGGUC 284
CAUGAUGACCUAUGAUGAU 285 AUCAUG 617 UCAUCAUAGGUCA 286
GCAUGAUGACCUAUGAUGA 287 UCAUGC 618 CAUCAUAGGUCAU 288
AGCAUGAUGACCUAUGAUG 289 CAUGCU 619 AUCAUAGGUCAUC 290
AAGCAUGAUGACCUAUGAU 291 AUGCUU 620 UCAUAGGUCAUCA 292
UAAGCAUGAUGACCUAUGA 293 UGCUUA 621 CAUAGGUCAUCAU 294
AUAAGCAUGAUGACCUAUG 295 GCUUAU 622 AUAGGUCAUCAUG 296
CAUAAGCAUGAUGACCUAU 297 CUUAUG 623 UAGGUCAUCAUGC 298
CCAUAAGCAUGAUGACCUA 299 UUAUGG 624 AGGUCAUCAUGCU 300
CCCAUAAGCAUGAUGACCU 301 UAUGGG 625 GGUCAUCAUGCUU 302
CCCCAUAAGCAUGAUGACC 303 AUGGGG 626 GUCAUCAUGCUUA 304
UCCCCAUAAGCAUGAUGAC 305 UGGGGA 627 UCAUCAUGCUUAU 306
AUCCCCAUAAGCAUGAUGA 307 GGGGAU
TABLE-US-00012 TABLE 10 siRNAs targeting C394A mutant IDH1 (SEQ ID
NO: 5) (equivalent to C628A of SEQ ID NO: 9 (FIG. 21B)) (Arg132Ser
(SEQ ID NO: 8)) Posi- tion on mRNA SEQ SEQ (FIG. sense ID antisense
ID 21B) (5' to 3') NO: (5' to 3') NO: 611 AACCUAUCAUCAU 308
CUACCUAUGAUGAUAGGUU 309 AGGUAG 612 ACCUAUCAUCAUA 310
ACUACCUAUGAUGAUAGGU 311 GGUAGU 613 CCUAUCAUCAUAG 312
GACUACCUAUGAUGAUAGG 313 GUAGUC 614 CUAUCAUCAUAGG 314
UGACUACCUAUGAUGAUAG 315 UAGUCA 615 UAUCAUCAUAGGU 316
AUGACUACCUAUGAUGAUA 317 AGUCAU 616 AUCAUCAUAGGUA 318
CAUGACUACCUAUGAUGAU 319 GUCAUG 617 UCAUCAUAGGUAG 320
GCAUGACUACCUAUGAUGA 321 UCAUGC 618 CAUCAUAGGUAGU 322
AGCAUGACUACCUAUGAUG 323 CAUGCU 619 AUCAUAGGUAGUC 324
AAGCAUGACUACCUAUGAU 325 AUGCUU 620 UCAUAGGUAGUCA 326
UAAGCAUGACUACCUAUGA 327 UGCUUA 621 CAUAGGUAGUCAU 328
AUAAGCAUGACUACCUAUG 329 GCUUAU 622 AUAGGUAGUCAUG 330
CAUAAGCAUGACUACCUAU 331 CUUAUG 623 UAGGUAGUCAUGC 332
CCAUAAGCAUGACUACCUA 333 UUAUGG 624 AGGUAGUCAUGCU 334
CCCAUAAGCAUGACUACCU 335 UAUGGG 625 GGUAGUCAUGCUU 336
CCCCAUAAGCAUGACUACC 337 AUGGGG 626 GUAGUCAUGCUUA 338
UCCCCAUAAGCAUGACUAC 339 UGGGGA 627 UAGUCAUGCUUAU 340
AUCCCCAUAAGCAUGACUA 341 GGGGAU
TABLE-US-00013 TABLE 11 siRNAs targeting C394U mutant IDH1 (SEQ ID
NO: 5) (equivalent to C628U of SEQ ID NO: 9 (FIG. 21B)) (Arg132Cys
(SEQ ID NO: 8)) Posi- tion on mRNA SEQ SEQ (FIG. sense ID antisense
ID 21B) (5' to 3') NO: (5' to 3') NO: 611 AACCUAUCAUCAU 342
CAACCUAUGAUGAUAGGUU 343 AGGUUG 612 ACCUAUCAUCAUA 344
ACAACCUAUGAUGAUAGGU 345 GGUUGU 613 CCUAUCAUCAUAG 346
GACAACCUAUGAUGAUAGG 347 GUUGUC 614 CUAUCAUCAUAGG 348
UGACAACCUAUGAUGAUAG 349 UUGUCA 615 UAUCAUCAUAGGU 350
AUGACAACCUAUGAUGAUA 351 UGUCAU 616 AUCAUCAUAGGUU 352
CAUGACAACCUAUGAUGAU 353 GUCAUG 617 UCAUCAUAGGUUG 354
GCAUGACAACCUAUGAUGA 355 UCAUGC 618 CAUCAUAGGUUGU 356
AGCAUGACAACCUAUGAUG 357 CAUGCU 619 AUCAUAGGUUGUC 358
AAGCAUGACAACCUAUGAU 359 AUGCUU 620 UCAUAGGUUGUCA 360
UAAGCAUGACAACCUAUGA 361 UGCUUA 621 CAUAGGUUGUCAU 362
AUAAGCAUGACAACCUAUG 363 GCUUAU 622 AUAGGUUGUCAUG 364
CAUAAGCAUGACAACCUAU 365 CUUAUG 623 UAGGUUGUCAUGC 366
CCAUAAGCAUGACAACCUA 367 UUAUGG 624 AGGUUGUCAUGCU 368
CCCAUAAGCAUGACAACCU 369 UAUGGG 625 GGUUGUCAUGCUU 370
CCCCAUAAGCAUGACAACC 371 AUGGGG 626 GUUGUCAUGCUUA 372
UCCCCAUAAGCAUGACAAC 373 UGGGGA 627 UUGUCAUGCUUAU 374
AUCCCCAUAAGCAUGACAA 375 GGGGAU
TABLE-US-00014 TABLE 12 siRNAs targeting C394G mutant IDH1 (SEQ ID
NO: 5) (equivalent to C628G of SEQ ID NO: 9 (FIG. 21B)) (Arg132Gly
(SEQ ID NO:8)) Posi- tion on mRNA SEQ SEQ (FIG. sense ID antisense
ID 21B) (5' to 3') NO: (5' to 3') NO: 611 AACCUAUCAUCAUA 376
CCACCUAUGAUGAUAGGU 377 GGUGG U 612 ACCUAUCAUCAUAG 378
ACCACCUAUGAUGAUAGG 379 GUGGU U 613 CCUAUCAUCAUAGG 380
GACCACCUAUGAUGAUAG 381 UGGUC G 614 CUAUCAUCAUAGGU 382
UGACCACCUAUGAUGAUA 383 GGUCA G 615 UAUCAUCAUAGGUG 384
AUGACCACCUAUGAUGAU 385 GUCAU A 616 AUCAUCAUAGGUGG 386
CAUGACCACCUAUGAUGA 387 UCAUG U 617 UCAUCAUAGGUGGU 388
GCAUGACCACCUAUGAUG 389 CAUGC A 618 CAUCAUAGGUGGUC 390
AGCAUGACCACCUAUGAU 391 AUGCU G 619 AUCAUAGGUGGUCA 392
AAGCAUGACCACCUAUGA 393 UGCUU U 620 UCAUAGGUGGUCAU 394
UAAGCAUGACCACCUAUG 395 GCUUA A 621 CAUAGGUGGUCAUG 396
AUAAGCAUGACCACCUAU 397 CUUAU G 622 AUAGGUGGUCAUGC 398
CAUAAGCAUGACCACCUA 399 UUAUG U 623 UAGGUGGUCAUGCU 400
CCAUAAGCAUGACCACCU 401 UAUGG A 624 AGGUUGUCAUGCUU 402
CCCAUAAGCAUGACCACC 403 AUGGG U 625 GGUUGUCAUGCUUA 404
CCCCAUAAGCAUGACCAC 405 UGGGG C 626 GUUGUCAUGCUUAU 406
UCCCCAUAAGCAUGACCA 407 GGGGA C 627 UUGUCAUGCUUAUG 408
AUCCCCAUAAGCAUGACC 409 GGGAU A
TABLE-US-00015 TABLE 13 siRNAs targeting G395C mutant IDH1 (SEQ ID
NO: 5) (equivalent to G629C of SEQ ID NO: 9 (FIG. 21B)) (Arg132Pro
(SEQ ID NO: 8)) Posi- tion on mRNA SEQ SEQ (FIG. sense ID antisense
ID 21B) (5' to 3') NO: (5' to 3') NO: 611 AACCUAUCAUCAUA 410
CGACCUAUGAUGAUAGGU 411 GGUCG U 612 ACCUAUCAUCAUAG 412
ACGACCUAUGAUGAUAGG 413 GUCGU U 613 CCUAUCAUCAUAGG 414
GACGACCUAUGAUGAUAG 415 UCGUC G 614 CUAUCAUCAUAGGU 416
UGACGACCUAUGAUGAUA 417 CGUCA G 615 UAUCAUCAUAGGUC 418
AUGACGACCUAUGAUGAU 419 GUCAU A 616 AUCAUCAUAGGUCG 420
CAUGACGACCUAUGAUGA 421 UCAUG U 617 UCAUCAUAGGUCGU 422
GCAUGACGACCUAUGAUG 423 CCAUG A 618 CAUCAUAGGUCGUC 424
AGCAUGACGACCUAUGAU 425 AUGCU G 619 AUCAUAGGUCGUCA 426
AAGCAUGACGACCUAUGA 427 UGCUU U 620 UCAUAGGUCGUCAU 428
UAAGCAUGACGACCUAUG 429 GCUUA A 621 CAUAGGUCGUCAUG 430
AUAAGCAUGACGACCUAU 431 CUUAU G 622 AUAGGUCGUCAUGC 432
CAUAAGCAUGACGACCUA 433 UUAUG U 623 UAGGUCGUCAUGCU 434
CCAUAAGCAUGACGACCU 435 UAUGG A 624 AGGUCGUCAUGCUU 436
CCCAUAAGCAUGACGACC 437 AUGGG U 625 GGUCGUCAUGCUUA 438
CCCCAUAAGCAUGACGAC 439 UGGGG C 626 GUCGUCAUGCUUAU 440
UCCCCAUAAGCAUGACGA 441 GGGGA C 627 UCGUCAUGCUUAUG 442
AUCCCCAUAAGCAUGACG 443 UGGGA A
TABLE-US-00016 TABLE 14 siRNAs targeting G395U mutant IDH1 (SEQ ID
NO: 5) (equivalent to G629U of SEQ ID NO: 9 (FIG. 21B)) (Arg132Leu
(SEQ ID NO: 8)) Posi- tion on mRNA SEQ SEQ (FIG. sense ID antisense
ID 21B) (5' to 3') NO: (5' to 3') NO: 611 AACCUAUCAUCAUA 444
AGACCUAUGAUGAUAGGU 445 GGUCU U 612 ACCUAUCAUCAUAG 446
AAGACCUAUGAUGAUAGG 447 GUCUU U 613 CCUAUCAUCAUAGG 448
GAAGACCUAUGAUGAUAG 449 UCUUC G 614 CUAUCAUCAUAGGU 450
UGAAGACCUAUGAUGAUA 451 CUUCA G 615 UAUCAUCAUAGGUC 452
AUGAAGACCUAUGAUGAU 453 UUCAU A 616 AUCAUCAUAGGUCU 454
CAUGAAGACCUAUGAUGA 455 UCAUG U 617 UCAUCAUAGGUCUU 456
GCAUGAAGACCUAUGAUG 457 CAUGC A 618 CAUCAUAGGUCUUC 458
AGCAUGAAGACCUAUGAU 459 AUGCU G 619 AUCAUAGGUCUUCA 460
AAGCAUGAAGACCUAUGA 461 UGCUU U 620 UCAUAGGUCUUCAU 462
UAAGCAUGAAGACCUAUG 463 GCUUA A 621 CAUAGGUCUUCAUG 464
AUAAGCAUGAAGACCUAU 465 CUUAU G 622 AUAGGUCUUCAUGC 466
CAUAAGCAUGAAGACCUA 467 UUAUG U 623 UAGGUCUUCAUGCU 468
CCAUAAGCAUGAAGACCU 469 UAUGG A 624 AGGUCUUCAUGCUU 470
CCCAUAAGCAUGAAGACC 471 AUGGG U 625 GGUCUUCAUGCUUA 472
CCCCAUAAGCAUGAAGAC 473 UGGGG C 626 GUCUUCAUGCUUAU 474
UCCCCAUAAGCAUGAAGA 475 GGGGA C 627 UCUUCAUGCUUAUG 476
AUCCCCAUAAGCAUGAAG 477 GGGAU A
IDH2
[0713] Exemplary siRNAs are presented in the following tables.
Art-known methods can be used to select other siRNAs. siRNAs can be
evaluated, e.g., by determining the ability of an siRNA to silence
an e.g., IDH2, e.g., in an in vitro system, e.g., in cultured
cells, e.g., HeLa cells or cultured glioma cells. e.g.,
[0714] The siRNAs in Table 15 were generated using the siRNA
selection tool available on the worldwide web at
jura.wi.mit.edu/bioc/siRNAext/. (Yuan et al. Nucl. Acids. Res. 2004
32:W130-W134.) Other selection tools can be used as well. Entry
1356 was adapted from Silencing of cytosolic NADP+ dependent
isoccitrate dehydrogenase by small interfering RNA enhances the
sensitivity of HeLa cells toward stauropine, Lee et al., 2009, Free
Radical Research, 43: 165-173.
[0715] The siRNAs in Tables 16-23 represent candidates spanning the
IDH2 mRNA at nucleotide positions 600, 601, and 602 according to
the mRNA sequence presented at GenBank Accession No. NM_002168.2
(Record dated Aug. 16, 2009; GI28178831) (SEQ ID NO 12, FIG. 22B;
equivalent to nucleotide positions 514, 515, and 516 of the cDNA
sequence represented by SEQ ID NO:11, FIG. FIG. 22A).
[0716] The RNAs in the tables can be modified, e.g., as described
herein. Modifications include chemical modifications to enhance
properties, e.g., resistance to degradation, or the use of
overhangs. For example, either one or both of the sense and
antisense strands in the tables can include an additional
dinucleotide at the 3' end, e.g., TT, UU, dTdT.
TABLE-US-00017 TABLE 15 siRNAs targeting wildtype IDH2 Posi- tion
on mRNA SEQ SEQ (FIG. sense ID antisense ID 22B) (5' to 3') NO: (5'
to 3') NO: 250 GUGAUGAGAUGACC 478 AUACGGGUCAUCUCAUCAC 479 CGUAU 252
GAUGAGAUGACCCG 480 UAAUACGGGUCAUCUCAUC 481 UAUUA 264 CGUAUUAUCUGGCA
482 UGAACUGCCAGAUAAUACG 483 GUUCA 274 GGCAGUUCAUCAAG 484
UUCUCCUUGAUGAACUGCC 485 GAGAA 451 GUGUGGAAGAGUUC 486
AGCUUGAACUCUUCCACAC 487 AAGCU 453 GUGGAAGAGUUCAA 488
UCAGCUUGAACUCUUCCAC 489 GCUGA 456 GAAGAGUUCAAGCU 490
UCUUCAGCUUGAACUCUUC 491 GAAGA 795 CAGUAUGCCAUCCA 492
UCUUCUGGAUGGCAUACUG 493 GAAGA 822 CUGUACAUGAGCAC 494
UCUUGGUGCUCAUGUACAG 495 CAAGA 832 GCACCAAGAACACC 496
AGUAUGGUGUUCUUGGUGC 497 AUACU 844 CCAUACUGAAAGCC 498
UCGUAGGCUUUCAGUAUGG 499 UACGA 845 CAUACUGAAAGCCU 500
AUCGUAGGCUUUCAGUAUG 501 ACGAU 868 GUUUCAAGGACAUC 502
UGGAAGAUGUCCUUGAAAC 503 UUCCA 913 CCGACUUCGACAAG 504
UUAUUCUUGUCGAAGUCGG 505 AAUAA 915 GACUUCGACAAGAA 506
UCUUAUUCUUGUCGAAGUC 507 UAAGA 921 GACAAGAAUAAGAU 508
ACCAGAUCUUAUUCUUGUC 509 CUGGU 949 GGCUCAUUGAUGAC 510
ACCAUGUCAUCAAUGAGCC 511 AUGGU 1009 GCAAGAACUAUGAC 512
UCUCCGUCAUAGUUCUUGC 513 GGAGA 1010 CAAGAACUAUGACG 514
AUCUCCGUCAUAGUUCUUG 515 GAGAU 1024 GAGAUGUGCAGUCA 516
AUGUCUGACUGCACAUCUC 517 GACAU 1096 CUGAUGGGAAGACG 518
UCAAUCGUCUUCCCAUCAG 519 AUUGA 1354 GCAAUGUGAAGCUG 520
UCGUUCAGCUUCACAUUGC 521 AACGA 1668 CUGUAAUUUAUAUU 522
AGGGCAAUAUAAAUUACAG 523 GCCCU 1694 CAUGGUGCCAUAUU 524
AGCUAAAUAUGGCACCAUG 525 UAGCU 1697 GGUGCCAUAUUUAG 526
AGUAGCUAAAUAUGGCACC 527 CUACU 1698 GUGCCAUAUUUAGC 528
UAGUAGCUAAAUAUGGCAC 529 UACUA 1700 GCCAUAUUUAGCUA 530
UUUAGUAGCUAAAUAUGGC 531 CUAAA
TABLE-US-00018 TABLE 16 siRNAs targeting wildtype IDH2 Posi- tion
on mRNA SEQ SEQ (FIG. sense ID antisense ID 22B) (5' to 3') NO: (5'
to 3') NO: 584 GCCCAUCACCAUU 532 CCUGCCAAUGGUGAUGGGC 533 GGGCAG 585
CCCAUCACCAUUG 534 GCCUGCCAAUGGUGAUGGG 535 GCAGGC 586 CCAUCACCAUUGG
536 UGCCUGCCAAUGGUGAUGG 537 CAGGCA 587 CAUCACCAUUGGC 538
GUGCCUGCCAAUGGUGAUG 539 AGGCAC 588 AUCACCAUUGGCA 540
CGUGCCUGCCAAUGGUGAU 541 GGGCAC 589 UCACCAUUGGCAG 542
GCGUGCCUGCCAAUGGUGA 543 GCACGC 590 CACCAUUGGCAGG 544
GGCGUGCCUGCCAAUGGUG 545 CACGCC 591 ACCAUUGGCAGGC 546
GGGCGUGCCUGCCAAUGGU 547 ACGCCC 592 CCAUUGGCAGGCA 548
UGGGCGUGCCUGCCAAUGG 549 CGCCCA 593 CAUUGGCAGGCAC 550
AUGGGCGUGCCUGCCAAUG 551 GCCCAU 594 AUUGGCAGGCACG 552
CAUGGGCGUGCCUGCCAAU 553 CCCAUG 595 UUGGCAGGCACGC 554
CCAUGGGCGUGCCUGCCAA 555 CCAUGG 596 UGGCAGGCACGCC 556
GCCAUGGGCGUGCCUGCCA 557 CAUGGC 597 GGCAGGCACGCCC 558
CGCCAUGGGCGUGCCUGCC 559 AUGGCG 598 GCAGGCACGCCCA 560
UCGCCAUGGGCGUGCCUGC 561 UGGCGA 599 CAGGCACGCCCAU 562
GUCGCCAUGGGCGUGCCUG 563 GGCGAC 600 AGGCACGCCCAUG 564
GGUCGCCAUGGGCGUGCCU 565 GCGACC
TABLE-US-00019 TABLE 17 siRNAs targeting A514G mutant IDH2
(equivalent to A600G of SEQ ID NO: 12, (FIG. 22B) Posi- tion on
mRNA SEQ SEQ (FIG. sense ID antisense ID 22B) (5' to 3') NO: (5' to
3') NO: 584 GCCCAUCACCAUU 566 CCCGCCAAUGGUGAUGGGC 567 GGCGGG 585
CCCAUCACCAUUG 568 GCCCGCCAAUGGUGAUGGG 569 CGCGGG 586 CCAUCACCAUUGG
570 UGCCCGCCAAUGGUGAUGG 571 CGGGCA 587 CAUCACCAUUGGC 572
GUGCCCGCCAAUGGUGAUG 573 GGGCAC 588 AUCACCAUUGGCG 574
CGUGCCCGCCAAUGGUGAU 575 GGGCAC 589 UCACCAUUGGCGG 576
GCGUGCCCGCCAAUGGUGA 577 GCACGC 590 CACCAUUGGCGGG 578
GGCGUGCCCGCCAAUGGUG 579 CACGCC 591 ACCAUUGGCGGGC 580
GGGCGUGCCCGCCAAUGGU 581 ACGCCC 592 CCAUUGGCGGGCA 582
UGGGCGUGCCCGCCAAUGG 583 CGCCCA 593 CAUUGGCGGGCAC 584
AUGGGCGUGCCCGCCAAUG 585 GCCCAU 594 AUUGGCGGGCACG 586
CAUGGGCGUGCCCGCCAAU 587 CCCAUG 595 UUGGCGGGCACGC 588
CCAUGGGCGUGCCCGCCAA 589 CCAUGG 596 UGGCGGGCACGCC 590
GCCAUGGGCGUGCCCGCCA 591 CAUGGC 597 GGCGGGCACGCCC 592
CGCCAUGGGCGUGCCCGCC 593 AUGGCG 598 GCGGGCACGCCCA 594
UCGCCAUGGGCGUGCCCGC 595 UGGCGA 599 CGGGCACGCCCAU 596
GUCGCCAUGGGCGUGCCCG 597 GGCGAC 600 GGGCACGCCCAUG 598
GGUCGCCAUGGGCGUGCCC 599 GCGACC
TABLE-US-00020 TABLE 18 siRNAs targeting A514U mutant IDH2
(equivalent to A600U of SEQ ID NO: 12, (FIG. 22B) Posi- tion on
mRNA SEQ SEQ (FIG. sense ID antisense ID 22B) (5' to 3') NO: (5' to
3') NO: 584 GCCCAUCACCAUU 600 CCAGCCAAUGGUGAUGGGC 601 GGCUGG 585
CCCAUCACCAUUG 602 GCCAGCCAAUGGUGAUGGG 603 GCUGGC 586 CCAUCACCAUUGG
604 UGCCAGCCAAUGGUGAUGG 605 CUGGCA 587 CAUCACCAUUGGC 606
GUGCCAGCCAAUGGUGAUG 607 UGGCAC 588 AUCACCAUUGGCU 608
CGUGCCAGCCAAUGGUGAU 609 GGCACG 589 UCACCAUUGGCUG 610
GCGUGCCAGCCAAUGGUGA 611 GCACGC 590 CACCAUUGGCUGG 612
GGCGUGCCAGCCAAUGGUG 613 CACGCC 591 ACCAUUGGCUGGC 614
GGGCGUGCCAGCCAAUGGU 615 ACGCCC 592 CCAUUGGCUGGCA 616
UGGGCGUGCCAGCCAAUGG 617 CGCCCA 593 CAUUGGCUGGCAC 618
AUGGGCGUGCCAGCCAAUG 619 GCCCAU 594 AUUGGCUGGCACG 620
CAUGGGCGUGCCAGCCAAU 621 CCCAUG 595 UUGGCUGGCACGC 622
CCAUGGGCGUGCCAGCCAA 623 CCAUGG 596 UGGCUGGCACGCC 624
GCCAUGGGCGUGCCAGCCA 625 CAUGGC 597 GGCUGGCACGCCC 626
CGCCAUGGGCGUGCCAGCC 627 AUGGCG 598 GCUGGCACGCCCA 628
UCGCCAUGGGCGUGCCAGC 629 UGGCGA 599 CUGGCACGCCCAU 630
GUCGCCAUGGGCGUGCCAG 631 GGCGAC 600 UGGCACGCCCAUG 632
GGUCGCCAUGGGCGUGCCA 633 GCGACC
TABLE-US-00021 TABLE 19 siRNAs targeting G515A mutant IDH2
(equivalent to G601A of SEQ ID NO: 12, (FIG. 22B) Posi- tion on
mRNA SEQ SEQ (FIG. sense ID antisense ID 22B) (5' to 3') NO: (5' to
3') NO: 584 GCCCAUCACCAUU 634 CUUGCCAAUGGUGAUGGGC 635 GGCAAG 585
CCCAUCACCAUUG 636 GCUUGCCAAUGGUGAUGGG 637 GCAAGC 586 CCAUCACCAUUGG
638 UGCUUGCCAAUGGUGAUGG 639 CAAGCA 587 CAUCACCAUUGGC 640
GUGCUUGCCAAUGGUGAUG 641 AAGCAC 588 AUCACCAUUGGCA 642
CGUGCUUGCCAAUGGUGAU 643 AGCACG 589 UCACCAUUGGCAA 644
GCGUGCUUGCCAAUGGUGA 645 GCACGC 590 CACCAUUGGCAAG 646
GGCGUGCUUGCCAAUGGUG 647 CACGCC 591 ACCAUUGGCAAGC 648
GGGCGUGCUUGCCAAUGGU 649 ACGCCC 592 CCAUUGGCAAGCA 650
UGGGCGUGCUUGCCAAUGG 651 CGCCCA 593 CAUUGGCAAGCAC 652
AUGGGCGUGCUUGCCAAUG 653 GCCCAU 594 AUUGGCAAGCACG 654
CAUGGGCGUGCUUGCCAAU 655 CCCAUG 595 UUGGCAAGCACGC 656
CCAUGGGCGUGCUUGCCAA 657 CCAUGG 596 UGGCAAGCACGCC 658
GCCAUGGGCGUGCUUGCCA 659 CAUGGC 597 GGCAAGCACGCCC 660
CGCCAUGGGCGUGCUUGCC 661 AUGGCG 598 GCAAGCACGCCCA 662
UCGCCAUGGGCGUGCUUGC 663 UGGCGA 599 CAAGCACGCCCAU 664
GUCGCCAUGGGCGUGCUUG 665 GGCGAC 600 AAGCACGCCCAUG 666
GGUCGCCAUGGGCGUGCUU 667 GCGACC
TABLE-US-00022 TABLE 20 siRNAs targeting G515C mutant IDH2
(equivalent to G601C of SEQ ID NO: 12, (FIG. 22B) Posi- tion on
mRNA SEQ SEQ (FIG. sense ID antisense ID 22B) (5' to 3') NO: (5' to
3') NO: 584 GCCCAUCACCAUU 668 CGUGCCAAUGGUGAUGGGC 669 GGCACG 585
CCCAUCACCAUUG 670 GCGUGCCAAUGGUGAUGGG 671 GCACGC 586 CCAUCACCAUUGG
672 UGCGUGCCAAUGGUGAUGG 673 CACGCA 587 CAUCACCAUUGGC 674
GUGCGUGCCAAUGGUGAUG 675 ACGCAC 588 AUCACCAUUGGCA 676
CGUGCGUGCCAAUGGUGAU 677 CGCACG 589 UCACCAUUGGCAC 678
GCGUGCGUGCCAAUGGUGA 679 GCACGC 590 CACCAUUGGCACG 680
GGCGUGCGUGCCAAUGGUG 681 CACGCC 591 ACCAUUGGCACGC 682
GGGCGUGCGUGCCAAUGGU 683 ACGCCC 592 CCAUUGGCACGCA 684
UGGGCGUGCGUGCCAAUGG 685 CGCCCA 593 CAUUGGCACGCAC 686
AUGGGCGUGCGUGCCAAUG 687 GCCCAU 594 AUUGGCACGCACG 688
CAUGGGCGUGCGUGCCAAU 689 CCCAUG 595 UUGGCACGCACGC 690
CCAUGGGCGUGCGUGCCAA 691 CCAUGG 596 UGGCACGCACGCC 692
GCCAUGGGCGUGCGUGCCA 693 CAUGGC 597 GGCACGCACGCCC 694
CGCCAUGGGCGUGCGUGCC 695 AUGGCG 598 GCACGCACGCCCA 696
UCGCCAUGGGCGUGCGUGC 697 UGGCGA 599 CACGCACGCCCAU 698
GUCGCCAUGGGCGUGCGUG 699 GGCGAC 600 ACGCACGCCCAUG 700
GGUCGCCAUGGGCGUGCGU 701 GCGACC
TABLE-US-00023 TABLE 21 siRNAs targeting G515U mutant IDH2
(equivalent to G601U of SEQ ID NO: 12, (FIG. 22B) Posi- tion on
mRNA SEQ SEQ (FIG. sense ID antisense ID 22B) (5' to 3') NO: (5' to
3') NO: 584 GCCCAUCACCAUU 702 CAUGCCAAUGGUGAUGGGC 703 GGCAUG 585
CCCAUCACCAUUG 704 GCAUGCCAAUGGUGAUGGG 705 GCAUGC 586 CCAUCACCAUUGG
706 UGCAUGCCAAUGGUGAUGG 707 CAUGCA 587 CAUCACCAUUGGC 708
GUGCAUGCCAAUGGUGAUG 709 AUGCAC 588 AUCACCAUUGGCA 710
CGUGCAUGCCAAUGGUGAU 711 UGCACG 589 UCACCAUUGGCAU 712
GCGUGCAUGCCAAUGGUGA 713 GCACGC 590 CACCAUUGGCAUG 714
GGCGUGCAUGCCAAUGGUG 715 CACGCC 591 ACCAUUGGCAUGC 716
GGGCGUGCAUGCCAAUGGU 717 ACGCCC 592 CCAUUGGCAUGCA 718
UGGGCGUGCAUGCCAAUGG 719 CGCCCA 593 CAUUGGCAUGCAC 720
AUGGGCGUGCAUGCCAAUG 721 GCCCAU 594 AUUGGCAUGCACG 722
CAUGGGCGUGCAUGCCAAU 723 CCCAUG 595 UUGGCAUGCACGC 724
CCAUGGGCGUGCAUGCCAA 725 CCAUGG 596 UGGCAUGCACGCC 726
GCCAUGGGCGUGCAUGCCA 727 CAUGGC 597 GGCAUGCACGCCC 728
CGCCAUGGGCGUGCAUGCC 729 AUGGCG 598 GCAUGCACGCCCA 730
UCGCCAUGGGCGUGCAUGC 731 UGGCGA 599 CAUGCACGCCCAU 732
GUCGCCAUGGGCGUGCAUG 733 GGCGAC 600 AUGCACGCCCAUG 734
GGUCGCCAUGGGCGUGCAU 735 GCGACC
TABLE-US-00024 TABLE 22 siRNAs targeting G516C mutant IDH2
(equivalent to G602C of SEQ ID NO: 12, (FIG. 22B) Posi- tion on
mRNA SEQ SEQ (FIG. sense ID antisense ID 22B) (5' to 3') NO: (5' to
3') NO: 584 GCCCAUCACCAUU 736 GCUGCCAAUGGUGAUGGGC 737 GGCAGC 585
CCCAUCACCAUUG 738 GGCUGCCAAUGGUGAUGGG 739 GCAGCC 586 CCAUCACCAUUGG
740 UGGCUGCCAAUGGUGAUGG 741 CAGCCA 587 CAUCACCAUUGGC 742
GUGGCUGCCAAUGGUGAUG 743 AGCCAC 588 AUCACCAUUGGCA 744
CGUGGCUGCCAAUGGUGAU 745 GCCACG 589 UCACCAUUGGCAG 746
GCGUGGCUGCCAAUGGUGA 747 CCACGC 590 CACCAUUGGCAGC 748
GGCGUGGCUGCCAAUGGUG 749 CACGCC 591 ACCAUUGGCAGCC 750
GGGCGUGGCUGCCAAUGGU 751 ACGCCC 592 CCAUUGGCAGCCA 752
UGGGCGUGGCUGCCAAUGG 753 CGCCCA 593 CAUUGGCAGCCAC 754
AUGGGCGUGGCUGCCAAUG 755 GCCCAU 594 AUUGGCAGCCACG 756
CAUGGGCGUGGCUGCCAAU 757 CCCAUG 595 UUGGCAGCCACGC 758
CCAUGGGCGUGGCUGCCAA 759 CCAUGG 596 UGGCAGCCACGCC 760
GCCAUGGGCGUGGCUGCCA 761 CAUGGC 597 GGCAGCCACGCCC 762
CGCCAUGGGCGUGGCUGCC 763 AUGGCG 598 GCAGCCACGCCCA 764
UCGCCAUGGGCGUGGCUGC 765 UGGCGA 599 CAGCCACGCCCAU 766
GUCGCCAUGGGCGUGGCUG 767 GGCGAC 600 AGCCACGCCCAUG 768
GGUCGCCAUGGGCGUGGCU 769 GCGACC
TABLE-US-00025 TABLE 23 siRNAs targeting G516U mutant IDH2
(equivalent to G602U of SEQ ID NO: 12, (FIG. 22B) Posi- tion on
mRNA SEQ SEQ (FIG. sense ID antisense ID 22B) (5' to 3') NO: (5' to
3') NO: 584 GCCCAUCACCAUU 770 ACUGCCAAUGGUGAUGGGC 771 GGCAGU 585
CCCAUCACCAUUG 772 GACUGCCAAUGGUGAUGGG 773 GCAGUC 586 CCAUCACCAUUGG
774 UGACUGCCAAUGGUGAUGG 775 CAGUCA 587 CAUCACCAUUGGC 776
GUGACUGCCAAUGGUGAUG 777 AGUCAC 588 AUCACCAUUGGCA 778
CGUGACUGCCAAUGGUGAU 779 GUCACG 589 UCACCAUUGGCAG 780
GCGUGACUGCCAAUGGUGA 781 UCACGC 590 CACCAUUGGCAGU 782
GGCGUGACUGCCAAUGGUG 783 CACGCC 591 ACCAUUGGCAGUC 784
GGGCGUGACUGCCAAUGGU 785 ACGCCC 592 CCAUUGGCAGUCA 786
UGGGCGUGACUGCCAAUGG 787 CGCCCA 593 CAUUGGCAGUCAC 788
AUGGGCGUGACUGCCAAUG 789 GCCCAU 594 AUUGGCAGUCACG 790
CAUGGGCGUGACUGCCAAU 791 CCCAUG 595 UUGGCAGUCACGC 792
CCAUGGGCGUGACUGCCAA 793 CCAUGG 596 UGGCAGUCACGCC 794
GCCAUGGGCGUGACUGCCA 795 CAUGGC 597 GGCAGUCACGCCC 796
CGCCAUGGGCGUGACUGCC 797 AUGGCG 598 GCAGUCACGCCCA 798
UCGCCAUGGGCGUGACUGC 799 UGGCGA 599 CAGUCACGCCCAU 800
GUCGCCAUGGGCGUGACUG 801 GGCGAC 600 AGUCACGCCCAUG 802
GGUCGCCAUGGGCGUGACU 803 GCGACC
Example 6 Structural Analysis of R132H Mutant IDH1
[0717] To define how R132 mutations alter the enzymatic properties
of IDH1, the crystal structure of R132H mutant IDH1 bound to
.alpha.KG, NADPH, and Ca.sup.2+ was solved at 2.1 .ANG.
resolution.
[0718] The overall quaternary structure of the homodimeric R132H
mutant enzyme adopts the same closed catalytically competent
conformation (shown as a monomer in FIG. 29A) that has been
previously described for the wild-type enzyme (Xu, X. et al. J Biol
Chem 279, 33946-57 (2004)). NADPH is positioned as expected for
hydride transfer to .alpha.KG in an orientation that would produce
R(-)-2HG, consistent with our chiral determination of the 2HG
product.
[0719] Two important features were noted by the change of R132 to
histidine: the effect on catalytic conformation equilibrium and the
reorganization of the active-site. Locating atop a .beta.-sheet in
the relatively rigid small domain, R132 acts as a gate-keeper
residue and appears to orchestrate the hinge movement between the
open and closed conformations. The guanidinium moiety of R132
swings from the open to the closed conformation with a distance of
nearly 8 .ANG.. Substitution of histidine for arginine is likely to
change the equilibrium in favor of the closed conformation that
forms the catalytic cleft for cofactor and substrate to bind
efficiently, which partly explains the high-affinity for NADPH
exhibited by the R132H mutant enzyme. This feature may be
advantageous for the NADPH-dependent reduction of .alpha.KG to
R(-)-2HG in an environment where NADPH concentrations are low.
Secondly, closer examination of the catalytic pocket of the mutant
IDH1 structure in comparison to the wild-type enzyme showed not
only the expected loss of key salt-bridge interactions between the
guanidinium of R132 and the .alpha./.beta. carboxylates of
isocitrate, as well as changes in the network that coordinates the
metal ion, but also an unexpected reorganization of the
active-site. Mutation to histidine resulted in a significant shift
in position of the highly conserved residues Y139 from the A
subunit and K212' from the B subunit (FIG. 29B), both of which are
thought to be critical for catalysis of this enzyme family (Aktas,
D. F. & Cook, P. F. Biochemistry 48, 3565-77 (2009)). In
particular, the hydroxyl moiety of Y139 now occupies the space of
the .beta.-carboxylate of isocitrate. In addition, a significant
repositioning of .alpha.KG compared to isocitrate where the distal
carboxylate of .alpha.KG now points upward to make new contacts
with N96 and S94 was observed. Overall, this single R132 mutation
results in formation of a distinct active site compared to
wild-type IDH1.
Example 7 Materials and Methods
Summary
[0720] R132H, R132C, R132L and R132S mutations were introduced into
human IDH1 by standard molecular biology techniques. 293T and the
human glioblastoma cell lines U87MG and LN-18 were cultured in
DMEM, 10% fetal bovine serum. Cells were transfected and selected
using standard techniques. Protein expression levels were
determined by Western blot analysis using IDHc antibody (Santa Cruz
Biotechnology), IDH1 antibody (proteintech), MYC tag antibody (Cell
Signaling Technology), and IDH2 antibody (Abcam). Metabolites were
extracted from cultured cells and from tissue samples according to
close variants of a previously reported method (Lu, W., Kimball, E.
& Rabinowitz, J. D. J Am Soc Mass Spectrom 17, 37-50 (2006)),
using 80% aqueous methanol (-80.degree. C.) and either tissue
scraping or homogenization to disrupt cells. Enzymatic activity in
cell lysates was assessed by following a change in NADPH
fluorescence over time in the presence of isocitrate and NADP, or
.alpha.KG and NADPH. For enzyme assays using recombinant IDH1
enzyme, proteins were produced in E. coli and purified using Ni
affinity chromatography followed by Sephacryl S-200 size-exclusion
chromatography. Enzymatic activity for recombinant IDH1 protein was
assessed by following a change in NADPH UV absorbance at 340 nm
using a stop-flow spectrophotometer in the presence of isocitrate
and NADP or .alpha.KG and NADPH. Chirality of 2HG was determined as
described previously (Struys, E. A., Jansen, E. E., Verhoeven, N.
M. & Jakobs, C. Clin Chem 50, 1391-5 (2004)). For
crystallography studies, purified recombinant IDH1 (R132H) at 10
mg/mL in 20 mM Tris pH 7.4, 100 mM NaCl was pre-incubated for 60
min with 10 mM NADPH, 10 mM calcium chloride, and 75 mM .alpha.KG.
Crystals were obtained at 20.degree. C. by vapor diffusion
equilibration using 3 .mu.L drops mixed 2:1 (protein:precipitant)
against a well-solution of 100 mM MES pH 6.5, 20% PEG 6000. Patient
tumor samples were obtained after informed consent as part of a
UCLA IRB-approved research protocol. Brain tumor samples were
obtained after surgical resection, snap frozen in isopentane cooled
by liquid nitrogen and stored at -80 C. The IDH1 mutation status of
each sample was determined using standard molecular biology
techniques as described previously (Yan, H. et al. N Engl J Med
360, 765-73 (2009)). Metabolites were extracted and analyzed by
LC-MS/MS as described above. Full methods are available in the
supplementary material.
Supplementary Methods
[0721] Cloning, Expression, and Purification of ICDH1 wt and
Mutants in E. coli.
[0722] The open reading frame (ORF) clone of human isocitrate
dehydrogenase 1 (cDNA) (IDH1; ref. ID NM_005896) was purchased from
Invitrogen in pENTR221 (Carlsbad, Calif.) and Origene Inc. in pCMV6
(Rockville, Md.). To transfect cells with wild-type or mutant IDH1,
standard molecular biology mutagenesis techniques were utilized to
alter the DNA sequence at base pair 395 of the ORF in pCMV6 to
introduce base pair change from guanine to adenine, which resulted
in a change in the amino acid code at position 132 from arginine
(wt) to histidine (mutant; or R132H), and confirmed by standard DNA
sequencing methods. For 293T cell transfection, wild-type and R132H
mutant IDH1 were subcloned into pCMV-Sport6 with or without a
carboxy-terminal Myc-DDK-tag. For stable cell line generation,
constructs in pCMV6 were used. For expression in E. coli, the
coding region was amplified from pENTR221 by PCR using primers
designed to add NDEI and XHO1 restrictions sites at the 5' and 3'
ends respectively. The resultant fragment was cloned into vector
pET41a (EMD Biosciences, Madison, Wis.) to enable the E. coli
expression of C-terminus His8-tagged protein. Site directed
mutagenesis was performed on the pET41a-ICHD1 plasmid using the
QuikChange.RTM. MultiSite-Directed Mutagenesis Kit (Stratagene, La
Jolla, Calif.) to change G395 to A, resulting in the Arg to His
mutation. R132C, R132L and R132S mutants were introduced into
pET41a-ICHD1 in an analogous way.
[0723] Wild-type and mutant proteins were expressed in and purified
from the E. coli Rosetta.TM. strain (Invitrogen, Carlsbad, Calif.)
as follows. Cells were grown in LB (20 .mu.g/ml Kanamycin) at
37.degree. C. with shaking until OD600 reaches 0.6. The temperature
was changed to 18.degree. C. and protein expression was induced by
adding IPTG to final concentration of 1 mM. After 12-16 hours of
IPTG induction, cells were resuspended in Lysis Buffer (20 mM Tris,
pH7.4, 0.1% Triton X-100, 500 mM NaCl, 1 mM PMSF, 5 mM
.beta.-mercaptoethanol, 10% glycerol) and disrupted by
microfluidation. The 20,000 g supernatant was loaded on metal
chelate affinity resin (MCAC) equilibrated with Nickel Column
Buffer A (20 mM Tris, pH7.4, 500 mM NaCl, 5 mM
.beta.-mercaptoethanol, 10% glycerol) and washed for 20 column
volumes. Elution from the column was effected by a 20 column-volume
linear gradient of 10% to 100% Nickel Column Buffer B (20 mM Tris,
pH7.4, 500 mM NaCl, 5 mM .beta.-mercaptoethanol, 500 mM Imidazole,
10% glycerol) in Nickel Column Buffer A). Fractions containing the
protein of interest were identified by SDS-PAGE, pooled, and
dialyzed twice against a 200-volume excess of Gel Filtration Buffer
(200 mM NaCl, 50 mM Tris 7.5, 5 mM .beta.-mercaptoethanol, 2 mM
MnSO.sub.4, 10% glycerol), then concentrated to 10 ml using
Centricon (Millipore, Billerica, Mass.) centrifugal concentrators.
Purification of active dimers was achieved by applying the
concentrated eluent from the MCAC column to a Sephacryl S-200 (GE
Life Sciences, Piscataway, N.J.) column equilibrated with Gel
Filtration Buffer and eluting the column with 20 column volumes of
the same buffer. Fractions corresponding to the retention time of
the dimeric protein were identified by SDS-PAGE and pooled for
storage at -80.degree. C.
Cell Lines and Cell Culture.
[0724] 293T cells were cultured in DMEM (Dulbecco's modified Eagles
Medium) with 10% fetal bovine serum and were transfected using
pCMV-6-based IDH-1 constructs in six-well plates with Fugene 6
(Roche) or Lipofectamine 2000 (Invitrogen) according to
manufacturer's instructions. Parental vector pCMV6 (no insert),
pCMV6-wt IDH1 or pCMV6-R132H were transfected into human
glioblastoma cell lines (U87MG; LN-18 (ATCC, HTB-14 and CRL-2610;
respectively) cultured in DMEM with 10% fetal bovine serum.
Approximately 24 hrs after transfection, the cell cultures were
transitioned to medium containing G418 sodium salt at
concentrations of either 500 ug/ml (U87MG) or 750 ug/ml (LN-18) to
select stable transfectants. Pooled populations of G418 resistant
cells were generated and expression of either wild-type IDH1 or
R132 IDH1 was confirmed by standard Western blot analysis.
Western Blot.
[0725] For transient transfection experiments in 293 cells, cells
were lysed 72 hours after transfection with standard RIPA buffer.
Lysates were separated by SDS-PAGE, transferred to nitrocellulose
and probed with goat-anti-IDHc antibody (Santa Cruz Biotechnology
sc49996) or rabbit-anti-MYC tag antibody (Cell Signaling Technology
#2278) and then detected with HRP-conjugated donkey anti-goat or
HRP-conjugated goat-anti-rabbit antibody (Santa Cruz Biotechnology
sc2004). IDH1 antibody to confirm expression of both wild-type and
R132H IDH1 was obtained from Proteintech. The IDH2 mouse monoclonal
antibody used was obtained from Abcam.
Detection of Isocitrate, .alpha.KG, and 2HG in Purified Enzyme
Reactions by LC-MS/MS.
[0726] Enzyme reactions performed as described in the text were run
to completion as judged by measurement of the oxidation state of
NADPH at 340 nm. Reactions were extracted with eight volumes of
methanol, and centrifuged to remove precipitated protein. The
supernatant was dried under a stream of nitrogen and resuspended in
H.sub.2O. Analysis was conducted on an API2000 LC-MS/MS (Applied
Biosystems, Foster City, Calif.). Sample separation and analysis
was performed on a 150.times.2 mm, 4 uM Synergi Hydro-RP 80 A
column, using a gradient of Buffer A (10 mM tributylamine, 15 mM
acetic acid, 3% (v/v) methanol, in water) and Buffer B (methanol)
using MRM transitions.
Cell Lysates Based Enzyme Assays.
[0727] 293T cell lysates for measuring enzymatic activity were
obtained 48 hours after transfection with M-PER lysis buffer
supplemented with protease and phosphatase inhibitors. After
lysates were sonicated and centrifuged at 12,000 g, supernatants
were collected and normalized for total protein concentration. To
measure IDH oxidative activity, 3 .mu.g of lysate protein was added
to 200 .mu.l of an assay solution containing 33 mM Tris-acetate
buffer (pH 7.4), 1.3 mM MgCl.sub.2, 0.33 mM EDTA, 100 .mu.M
.beta.-NADP, and varying concentrations of D-(+)-threo-isocitrate.
Absorbance at 340 nm, reflecting NADPH production, was measured
every 20 seconds for 30 min on a SpectraMax 190 spectrophotometer
(Molecular Devices). Data points represent the mean activity of 3
replicates per lysate, averaged among 5 time points centered at
every 5 min. To measure IDH reductive activity, 3 .mu.g of lysate
protein was added to 200 .mu.l of an assay solution which contained
33 mM Tris-acetate (pH 7.4), 1.3 mM MgCl.sub.2, 25 .mu.M
.beta.-NADPH, 40 mM NaHCO.sub.3, and 0.6 mM .alpha.KG. The decrease
in 340 nm absorbance over time was measured to assess NADPH
consumption, with 3 replicates per lysate.
Recombinant IDH1 Enzyme Assays.
[0728] All reactions were performed in standard enzyme reaction
buffer (150 mM NaCl, 20 mM Tris-Cl, pH 7.5, 10% glycerol, 5 mM
MgCl.sub.2 and 0.03% (w/v) bovine serum albumin). For determination
of kinetic parameters, sufficient enzyme was added to give a linear
reaction for 1 to 5 seconds. Reaction progress was monitored by
observation of the reduction state of the cofactor at 340 nm in an
SFM-400 stopped-flow spectrophotometer (BioLogic, Knoxville,
Tenn.). Enzymatic constants were determined using curve fitting
algorithms to standard kinetic models with the Sigmaplot software
package (Systat Software, San Jose, Calif.).
Determination of Chirality of Reaction Products from Enzyme
Reactions and Tumors.
[0729] Enzyme reactions were run to completion and extracted with
methanol as described above, then derivatized with enantiomerically
pure tartaric acid before resolution and analysis by LC-MS/MS.
After being thoroughly dried, samples were resuspended in freshly
prepared 50 mg/ml (2R,3R)-(+)-Tartaric acid in
dichloromethane:acetic acid (4:1) and incubated for 30 minutes at
75.degree. C. After cooling to room temperature, samples were
briefly centrifuged at 14,000 g, dried under a stream of nitrogen,
and resuspended in H.sub.2O. Analysis was conducted on an API200
LC-MS/MS (Applied Biosystems, Foster City, Calif.), using an
isocratic flow of 90:10 (2 mM ammonium formate, pH 3.6:MeOH) on a
Luna C18(2) 150.times.2 mm, 5 uM column. Tartaric-acid derivatized
2HG was detected using the 362.9/146.6 MRM transition and the
following instrument settings: DP-1, FP-310, EP-4, CE-12, CXP-26.
Analysis of the (R)-2HG standard, 2HG racemic mixture, and
methanol-extracted tumor biomass (q.v.) was similarly
performed.
Crystallography Conditions.
[0730] Crystals were obtained at 20.degree. C. by vapor diffusion
equilibration using 3 .mu.L drops mixed 2:1 (protein:precipitant)
against a well-solution of 100 mM MES pH 6.5, 20% PEG 6000.
Protein Characterization.
[0731] Approximately 90 mg of human cytosolic isocitrate
dehydrogenase (HcIDH) was supplied to Xtal BioStructures by Agios.
This protein was an engineered mutant form, R132S, with an
11-residue C-terminal affinity-purification tag (sequence
SLEHHHHHHHH). The calculated monomeric molecular weight was 48.0
kDa and the theoretical pI was 6.50. The protein, at about 6 mg/mL
concentration, was stored in 1-mL aliquots in 50 mM Tris-HCl (pH
7.4), 500 mM NaCl, 5 mM .beta.-mercaptoethanol and 10% glycerol at
-80.degree. C. As shown in FIG. 32A, SDS-PAGE was performed to test
protein purity and an anti-histidine Western blot was done to
demonstrate the protein was indeed his-tagged. A sample of the
protein was injected into an FPLC size-exclusion column to evaluate
the sample purity and to determine the polymeric state in solution.
FIG. 32B is a chromatogram of this run showing a single peak
running at an estimated 87.6 kDa, suggesting IDH exists as a dimer
at pH 7.4. Prior to crystallization, the protein was exchanged into
20 mM Tris-HCl (pH 7.4) and 100 mM NaCl using Amicon centrifugal
concentrators. At this time, the protein was also concentrated to
approximately 15 mg/mL. At this protein concentration and ionic
strength, the protein tended to form a detectable level of
precipitate. After spinning out the precipitate, the solution was
stable at .about.10 mg/mL at 4.degree. C.
Initial Attempts at Crystallization.
[0732] The strategy for obtaining diffraction-quality crystals was
derived from literature conditions, specifically "Structures of
Human Cytosolic NADP-dependent Isocitrate Dehydrogenase Reveal a
Novel Self-regulatory Mechanism of Activity," Xu, et al. (2005) J.
Biol. Chem. 279: 33946-56. In this study, two crystal forms of
HcIDH wildtype protein were produced. One contained their "binary
complex", IDH-NADP, which crystallized from hanging drops in the
tetragonal space group P4.sub.32.sub.12. The drops were formed from
equal parts of protein solution (15 mg/mL IDH, 10 mM NADP) and
precipitant consisting of 100 mM IVIES (pH 6.5) and 12% PEG 20000.
The other crystal form contained their "quaternary complex",
IDH-NADP/isocitrate/Ca.sup.2+, which crystallized in the monoclinic
space group P2.sub.1 using 100 mM MES (pH 5.9) and 20% PEG 6000 as
the precipitant. Here they had added 10 mM DL-isocitrate and 10 mM
calcium chloride to the protein solution. First attempts at
crystallizing the R132S mutant in this study centered around these
two reported conditions with little variation. The following lists
the components of the crystallization that could be varied; several
different combinations of these components were tried in the
screening process.
TABLE-US-00026 In the protein solution: HcIDH(R132S) always ~10
mg/mL or ~0.2 mM Tris-HCl (pH 7.4) always 20 mM NaCl always 100 mM
NADP.sup.+/ absent or 5 mM NADP.sup.+ NADPH (did not try NADPH)
DL-isocitic acid, absent or 5 mM trisodium salt calcium chloride
absent or 10 mM In the precipitant: 100 mM MES (pH 6.5) and 12% PEG
20000 OR 100 mM MES (pH 6.0) and 20% PEG 6000 Drop size: always 3
.mu.L Drop ratios: 2:1, 1:1 or 1:2 (protein:precipitant)
[0733] Upon forming the hanging drops, a milky precipitate was
always observed. On inspection after 2-4 days at 20.degree. C. most
drops showed dense precipitation or phase separation. In some
cases, the precipitate subsided and it was from these types of
drops small crystals had grown, for example, as shown in FIG.
33.
Crystal Optimization.
[0734] Once bonafide crystals were achieved, the next step was to
optimize the conditions to obtain larger and more regularly-shaped
crystals of IDH-NADP/isocitrate/Ca.sup.2+ in a timely and
consistent manner. The optimal screen focused on varying the pH
from 5.7 to 6.2, the MES concentration from 50 to 200 mM and the
PEG 6000 concentration from 20 to 25%. Also, bigger drops were set
up (5-6 .mu.l) and the drop ratios were again varied. These
attempts failed to produce larger, diffraction-quality crystals but
did reproduce the results reported above. Either a dense
precipitate, oily phase separation or small crystals were
observed.
Using .alpha.-Ketoglutarate.
[0735] Concurrent to the optimization of the isocitrate crystals,
other screens were performed to obtain crystals of IDH(R132S)
complexed with .alpha.-ketoglutarate instead. The protein solution
was consistently 10 mg/mL IDH in 20 mM Tris-HCl (pH 7.4) and 100 mM
NaCl. The following were added in this order: 5 mM NADP, 5 mM
.alpha.-ketoglutaric acid (free acid, pH balanced with NaOH) and 10
mM calcium chloride. The protein was allowed to incubate with these
compounds for at least an hour before the drops were set up. The
precipitant was either 100 mM MES (pH 6.5) and 12% PEG 20000 or 100
mM MES (pH 6.5) and 20% PEG 6000. Again, precipitation or phase
separation was primarily seen, but in some drops small crystals did
form. At the edge of one of the drops, a single large crystal
formed, pictured below. This was the single crystal used in the
following structure determination. FIG. 34 shows crystal obtained
from a protein solution contained 5 mM NADP, 5 mM
.alpha.-ketoglutarate, 10 mM Ca2+. Precipitant contained 100 mM MES
(pH 6.5) and 12% PEG 20000.
Cryo Conditions.
[0736] In order to ship the crystal to the X-ray source and protect
it during cryo-crystallography, a suitable cryo-protectant was
needed. Glycerol is quite widely used and was the first choice. A
cryo solution was made, basically as a mixture of the protein
buffer and precipitant solution plus glycerol: 20 mM Tris-HCl (pH
7.5), 100 mM NaCl, 5 mM NADP, 5 mM .alpha.-ketoglutaric acid, 10 mM
calcium chloride, 100 mM MES (pH 6.5), 12% PEG 20000 and either
12.5% glycerol or 25% glycerol. The crystal was transferred to the
cryo solution in two steps. First, 5 .mu.L of the 12.5% glycerol
solution was added directly to the drop and incubated for 10
minutes, watching for possible cracking of the crystal. The liquid
was removed from the drop and 10 .mu.L of the 25% glycerol solution
was added on top of the crystal. Again, this incubated for 10
minutes, harvested into a nylon loop and plunged into liquid
nitrogen. The crystal was stored submerged in a liquid nitrogen
dewar for transport.
Data Collection and Processing.
[0737] The frozen crystal was mounted on a Rigaku RAXIS IV X-ray
instrument under a stream of nitrogen gas at temperatures near
-170.degree. C. A 200.degree. dataset was collected with the image
plate detector using 1.54 .ANG. wavelength radiation from a
rotating copper anode home source, 1.degree. oscillations and 10
minute exposures. The presence of 25% glycerol as a cryoprotectant
was sufficient for proper freezing, as no signs of crystal cracking
(split spots or superimposed lattices) were observed. A diffuse
ring was observed at 3.6 .ANG. resolution, most likely caused by
icing. The X-ray diffraction pattern showed clear lattice planes
and reasonable spot separation, although the spacing along one
reciprocal axis was rather small (b=275.3). The data was indexed to
2.7 .ANG. resolution into space group P2.sub.12.sub.12 with HKL2000
(Otwinowski and Minor, 1997). Three structures for HcIDH are known,
designated the closed form (1T0L), the open form (1T09 subunit A)
and semi-open form (1T09 subunit B). Molecular replacement was
performed with the CCP4 program PHASER (Bailey, 1994) using only
the protein atoms from these three forms. Only the closed form
yielded a successful molecular replacement result with 6 protein
subunits in the asymmetric unit. The unit cell contains
approximately 53.8% solvent.
Model Refinement.
[0738] Using the CCP4 program REFMAC5, rigid-body refinement was
performed to fit each of the 6 IDH subunits in the asymmetric unit.
This was followed by rigid-body refinement of the three domains in
each protein subunit. Restrained refinement utilizing
non-crystallographic symmetry averaging of related pairs of
subunits yielded an initial structure with R.sub.cryst of 33% and
R.sub.free of 42%. Model building and real-space refinement were
performed using the graphics program COOT (Emsley and Cowtan,
2004). A difference map was calculated and this showed strong
electron density into which six individual copies of the NADP
ligand and calcium ion were manually fit with COOT. Density for the
.alpha.-ketoglutarate structure was less defined and was fit after
the binding-site protein residues were fit using a 2F.sub.o-F.sub.c
composite omit map. Automated Ramachandran-plot optimization
coupled with manual real-space density fitting was applied to
improve the overall geometry and fit. A final round of restrained
refinement with NCS yielded an R.sub.cryst of 30.1% and R.sub.free
of 35.2%.
TABLE-US-00027 Unit cell a, .ANG. b, .ANG. c, .ANG. .alpha. B
.gamma. volume, .ANG..sup.3 Z 116.14 275.30 96.28 90.degree.
90.degree. 90.degree. 3.08 .times. 10.sup.6 24
TABLE-US-00028 Reflections in working set/test 68,755/3,608 set
(5.0%) R.sub.cryst 30.1% R.sub.free 35.2%
X-Ray Data and Refinement Statistics for
IDH(R132S)-NADP/.alpha.-Ketoglurate/Ca.sup.2+
TABLE-US-00029 [0739] Crystal parameters Space group
P2.sub.12.sub.12 Unit cell dimensions a, b, c, .ANG. 116.139,
275.297, 96.283 .alpha., .beta., .gamma., .degree. 90.0, 90.0, 90.0
Volume, .ANG..sup.3 3,078,440 No. protein molecules in asymmetric
unit 6 No. protein molecules in unit cell, Z 24 Data collection
Beam line Date of collection Apr. 25, 2009 .lamda., .ANG. 1.5418
Detector Rigaku Raxis IV Data set (phi), .degree. 200 Resolution,
.ANG. 25-2.7 (2.8-2.7) Unique reflections (N, F > 0) 73,587
Completeness, % 85.4 (48.4) <I>/.sigma.I 9.88 (1.83) R-merge
0.109 (0.33) Redundancy 4.3 (1.8) Mosaicity 0.666 Wilson B factor
57.9 Anisotropy B factor, .ANG..sup.2 -1.96 Refinement Statistics
Resolution limit, .ANG. 20.02-2.70 No. of reflections used
68,755/3608 for R-work.sup.a/R-free.sup.b Protein atoms 19788
Ligand atoms 348 No. of waters 357 Ions etc. 6 Matthews coeff.
.ANG..sup.3/Dalton 2.68 Solvent, % 53.8 R-work.sup.a/R-free.sup.b,
(%) 30.1/35.2 Figure-of-merit.sup.c 0.80 (0.74) Average B factors
31.0 Coordinates error (Luzzati plot), .ANG. 0.484 R.M.S.
deviations Bond lengths, .ANG. 0.026 Bond angles, .degree. 2.86
Completeness and R-merge are given for all data and for data in the
highest resolution shell. Highest shell values are in parentheses.
.sup.aR
factor=.SIGMA..sub.hkl|F.sub.o-F.sub.c|/.SIGMA..sub.hklF.sub.o,
where F.sub.o and F.sub.c are the observed and calculated structure
factor amplitudes, respectively for all reflections hkl used in
refinement. .sup.bR-free is calculated for 5% of the data that were
not used in refinement. .sup.cFigure of merit= {square root over
(x.sup.2+y.sup.2)}, where x=(.SIGMA.P(.alpha.)cos
.alpha.)/(.SIGMA.P(.alpha.)), y=(.SIGMA.P(.alpha.) sin
.alpha.)/(.SIGMA.P(.alpha.)), and the phase probability
P(.alpha.)=exp(A cos .alpha.+B sin .alpha.+C cos(2.alpha.)+D
sin(2.alpha.)), where A, B, C, and D are the Hendrickson-Lattman
coefficients and .alpha. is the phase.
Stereochemistry of
IDH(R132S)-NADP/.alpha.-Ketoglurate/Ca.sup.2+
TABLE-US-00030 [0740] No. of % of Ramachandran plot statistics
amino acids Residues Residues in most favored regions 1824 82.2 [A,
B, L] Residues in additional allowed regions 341 15.4 [a, b, l, p]
Residues in generously allowed regions 38 1.7 [-a, -b, -l, -p]
Residues in disallowed regions 17 0.8 Number of non-glycine and
non-proline 2220 100 residues Number of end-residues (excl. Gly and
387 Pro) Number of glycine residues 198 Number of proline residues
72 Total number of residues 2877 Overall <G> - factor.sup.d
score (>-1.0) -0.65
Generated by PROCHECK (Laskowski R A, MacArthur M W, Moss D S,
Thornton J M (1993) J Appl Crystallogr 26:283-291.)
[0741] .sup.dG-factors for main-chain and side-chain dihedral
angles, and main-chain covalent forces (bond lengths and bond
angles). Values should be ideally -0.5 or above -1.0.
TABLE-US-00031 Radiation wavelength, A 1.54 Resolution, .ANG.
(outer shell) 20-2.70 (2.80-2.70) Unique reflections 73,587
Completeness (outer shell) 85.4% (48.4%) Redundancy (outer shell)
4.3 (1.8) R.sub.merge (outer shell) 10.9% (33%)
<I>/<.sigma.(I)> (outer shell) 9.88 (1.83)
Clinical Specimens, Metabolite Extraction and Analysis.
[0742] Human brain tumors were obtained during surgical resection,
snap frozen in isopentane cooled by liquid nitrogen and stored at
-80 C. Clinical classification of the tissue was performed using
standard clinical pathology categorization and grading as
established by the WHO. Genomic sequence analysis was deployed to
identify brain tumor samples containing either wild-type isocitrate
dehydrogenase (IDH1) or mutations altering amino acid 132. Genomic
DNA was isolated from 50-100 mgs of brain tumor tissue using
standard methods. A polymerase chain reaction on the isolated
genomic DNA was used to amplify a 295 base pair fragment of the
genomic DNA that contains both the intron and 2.sup.nd exon
sequences of human IDH1 and mutation status assessed by standard
molecular biology techniques.
Metabolite extraction was accomplished by adding a 10.times. volume
(m/v ratio) of -80.degree. C. methanol:water mix (80%:20%) to the
brain tissue (approximately 100 mgs) followed by 30 s
homogenization at 4 C. These chilled, methanol extracted
homogenized tissues were then centrifuged at 14,000 rpm for 30
minutes to sediment the cellular and tissue debris and the cleared
tissue supernatants were transferred to a screw-cap freezer vial
and stored at -80.degree. C. For analysis, a 2.times. volume of
tributylamine (10 mM) acetic acid (10 mM) pH 5.5 was added to the
samples and analyzed by LCMS as follows. Sample extracts were
filtered using a Millex-FG 0.20 micron disk and 10 .mu.L were
injected onto a reverse-phase HPLC column (Synergi 150 mm.times.2
mm, Phenomenex Inc.) and eluted using a linear gradient LCMS-grade
methanol (50%) with 10 mM tributylamine and 10 mM acetic acid)
ramping to 80% methanol:10 mM tributylamine: 10 mM acetic acid over
6 minutes at 200 .mu.L/min. Eluted metabolite ions were detected
using a triple-quadrupole mass spectrometer, tuned to detect in
negative mode with multiple-reaction-monitoring mode transition set
(MRM's) according to the molecular weights and fragmentation
patterns for 8 known central metabolites, including
2-hydroxyglutarate as described above. Data was processed using
Analyst Software (Applied Biosystems, Inc.) and metabolite signal
intensities were obtained by standard peak integration methods.
Example 9 Compounds that Inhibit IDH1 R132H
[0743] Assays were conducted in a volume of 76 ul assay buffer (150
mM NaCl, 10 mM MgCl2, 20 mM Tris pH 7.5, 0.03% bovine serum
albumin) as follows in a standard 384-well plate: To 25 ul of
substrate mix (8 uM NADPH, 2 mM .alpha.KG), 1 ul of test compound
was added in DMSO. The plate was centrifuged briefly, and then 25
ul of enzyme mix was added (0.2 ug/ml ICDH1 R132H) followed by a
brief centrifugation and shake at 100 RPM. The reaction was
incubated for 50 minutes at room temperature, then 25 ul of
detection mix (30 uM resazurin, 36 ug/ml) was added and the mixture
further incubated for 5 minutes at room temperature. The conversion
of resazurin to resorufin was detected by fluorescent spectroscopy
at Ex544 Em590 c/o 590.
[0744] Table 24a shows the wild type vs mutant selectivity profile
of 5 examples of IDH1R132H inhibitors. The IDH1 wt assay was
performed at 1.times.Km of NADPH as opposed to IDHR132H at
10.times. or 100.times.Km of NADPH. The second example showed no
inhibition, even at 100 uM. Also, the first example has IC50=5.74
uM but is shifted significantly when assayed at 100.times.Km,
indicating direct NADPH-competitive inhibitor. The selectivity
between wild type vs mutant could be >20-fold.
TABLE-US-00032 TABLE 24a ICDH IC50 ICDH (uM) @ IC50 4 uM (uM)
IDH1wt (10x @ IC50 IC50 @ LDHa LDHb Km) 40 uM Ratio 1x Km STRUCTURE
IC50 IC50 NADPH NADPH (40/4) (uM) ##STR00007## 25.43 64.07 5.74
>100 17.42 16.22 ##STR00008## 5.92 17.40 12.26 41.40 3.38 No
inhibition ##STR00009## 8.61 >100 12.79 14.70 1.15 19.23
##STR00010## 33.75 >100 14.98 19.17 1.28 46.83 ##STR00011##
12.76 >100 23.80 33.16 1.39 69.33
Additional exemplary compounds that inhibit IDH1R132H are provided
below in Table 24b.
TABLE-US-00033 Compound No. ##STR00012## 1 ##STR00013## 2
##STR00014## 3 ##STR00015## 4 ##STR00016## 5 ##STR00017## 6
##STR00018## 7 ##STR00019## 8 ##STR00020## 9 ##STR00021## 10
##STR00022## 11 ##STR00023## 12 ##STR00024## 13 ##STR00025## 14
##STR00026## 15 ##STR00027## 16 ##STR00028## 17 ##STR00029## 18
##STR00030## 19 ##STR00031## 20 ##STR00032## 21 ##STR00033## 22
##STR00034## 23 ##STR00035## 24 ##STR00036## 25 ##STR00037## 26
##STR00038## 27 ##STR00039## 28 ##STR00040## 29 ##STR00041## 30
##STR00042## 31 ##STR00043## 32 ##STR00044## 33 ##STR00045## 34
##STR00046## 35 ##STR00047## 36 ##STR00048## 37 ##STR00049## 38
##STR00050## 39 ##STR00051## 40 ##STR00052## 41 ##STR00053## 42
##STR00054## 43 ##STR00055## 44 ##STR00056## 45 ##STR00057## 46
##STR00058## 47 ##STR00059## 48 ##STR00060## 49 ##STR00061## 50
##STR00062## 51 ##STR00063## 52 ##STR00064## 53 ##STR00065## 54
##STR00066## 55 ##STR00067## 56 ##STR00068## 57 ##STR00069## 58
##STR00070## 59 ##STR00071## 60 ##STR00072## 61 ##STR00073## 62
##STR00074## 63 ##STR00075## 64 ##STR00076## 65 ##STR00077## 66
##STR00078## 67 ##STR00079## 68 ##STR00080## 69 ##STR00081## 70
##STR00082## 71 ##STR00083## 72 ##STR00084## 73 ##STR00085## 74
##STR00086## 75 ##STR00087## 76 ##STR00088## 77 ##STR00089## 78
##STR00090## 79 ##STR00091## 80 ##STR00092## 81 ##STR00093## 82
##STR00094## 83 ##STR00095## 84 ##STR00096## 85 ##STR00097## 86
##STR00098## 87 ##STR00099## 88 ##STR00100## 89 ##STR00101## 90
##STR00102## 91 ##STR00103## 92
Example 10. The Mutant Enzyme IDH2-R172K has Elevated NADPH
Reductive Catalysis Activity as Compared to Wildtype IDH2
Enzyme
[0745] NADPH reduction activity was measured for the enzymes
IDH2-R172K, IDH2-wildtype, IDH1-R132H and IDH1-wildtype. The final
reactant concentrations for each reaction were as follows: 20 mM
Tris 7.5, 150 mM NaCl, 2 mM MnCl.sub.2, 10% glycerol, 0.03% BSA,
enzyme (1-120 .mu.g/mL), 1 mM NADPH, and 5 mM .alpha.KG (alpha
ketoglutarate). The resulting specific activities (.mu.mol/min/mg)
are presented in the graph in FIG. 35. The results indicate that
the mutant IDH2 has elevated reductive activity as compared to
wildtype IDH2, even though both the mutant and wildtype IDH2
enzymes were able to make 2HG (2-hydroxyglutarate) at saturating
levels of reactants .alpha.KG and NADPH.
Example 11: 2-HG Accumulates in AML with IDH1/2 Mutations
Patients and Clinical Data
[0746] Peripheral blood and bone marrow were collected from AML
patients at the time of diagnosis and at relapse, following REB
approved informed consent. The cells were separated by ficol
hypaque centrifugation, and stored at -150.degree. C. in 10% DMSO,
40% FCS and 50% alpha-MEM medium. Patient sera were stored at
-80.degree. C. Cytogenetics and molecular testing were performed in
the diagnostic laboratory of the University Health Network
(Toronto, Canada). A subgroup of patients (n=132) was given
consistent initial treatment using a standard induction and
consolidation chemotherapy regimen consisting of daunorubicin and
cytarabine.
IDH1 and IDH2 Genotyping
[0747] DNA was extracted from leukemic cells and cell lines using
the Qiagen Puregene kit (Valencia Calif.). For a subset of samples
(n=96), RNA was extracted from leukemic cells using a Qiagen RNeasy
kit, and reverse transcribed into cDNA for IDH1 and IDH2
genotyping. IDH1 and IDH2 genotype was determined at the Analytical
Genetics Technology Centre at the University Health Network
(Toronto, Canada) using a Sequenom MassARRAY.TM. platform
(Sequenom, San Diego, Calif.). Positive results were confirmed by
direct sequencing on an ABI PRISM 3130XL genetic analyzer (Applied
Biosystems, Foster City, Calif.).
Cell Lines
[0748] AML cell lines (OCI/AML-1, OCI/AML-2, OCI/AML-3, OCI/AML-4,
OCI/AML-5, HL-60, MV-4-11, THP-1, K562, and KG1A) and 5637 cells
were obtained from the laboratory of Mark Minden (Ontario Cancer
Institute, Toronto, Canada). Primary AML cells were cultured in
alpha-MEM media supplemented with 20% fetal bovine serum, and 10%
5637 cell conditioned media as previously described.sup.13. Growth
curves were generated by counting viable cells as assessed by
trypan blue exclusion on a Vi-CELL automated cell counter (Beckman
Coulter, Fullarton, Calif.).
Expression/Purification of IDH1 and IDH2 Proteins
[0749] The human IDH1 cDNA (ref. ID NM_005896) and IDH2 cDNA (ref.
ID NM_002168) were purchased from OriGene Technologies (Rockville,
Md.). For expression in E. coli, the coding region was amplified by
PCR using primers designed to add NDEI and XHO1 restrictions sites
at the 5' and 3' ends respectively. The resultant fragments for
IDH1 (full length) and IDH2 (residues 40-452) were cloned into
vector pET41a (EMD Biosciences, Madison, Wis.) to enable the E.
coli expression of C-terminal His8-tagged protein. Site directed
mutagenesis was performed on the pET41a-IDH1 and pET41a-IDH2
plasmid using the QuikChange.RTM. Lightning Site-Directed
Mutagenesis Kit (Stratagene, La Jolla, Calif.) to change C394 to T
in the IDH1 cDNA, resulting in the R132C mutation, and to change
G515 to A in the IDH2 cDNA, resulting in the R172K mutation.
Wild-type and mutant IDH1 proteins were expressed in and purified
from the E. coli Rosetta.TM. (DE3) strain according to
manufacturer's instructions (Invitrogen, Carlsbad, Calif.).
Overexpression of IDH2 protein was accomplished by co-transfection
of expression plasmids encoding respective IDH2 clones and pG-KJE8
expressing chaperone proteins.
IDH1/2 Activity Assays
[0750] Enzymatic activity was assessed by following the change in
NADPH absorbance at 340 nm over time in an SFM-400 stopped-flow
spectrophotometer (BioLogic, Knoxville, Tenn.) in the presence of
isocitrate and NADP+(forward reaction), or .alpha.-KG and NADPH
(reverse reaction). All reactions were performed in standard enzyme
reaction buffer (150 mM NaCl, 20 mM Tris-Cl, pH 7.5, 10 mM
MgCl.sub.2 and 0.03% (w/v) bovine serum albumin). For determination
of kinetic parameters, sufficient enzyme was added to give a linear
reaction for 1 to 5 seconds. Enzymatic binding constants were
determined using curve fitting algorithms to standard kinetic
models with the Sigmaplot software package (Systat Software, San
Jose, Calif.). For determination of kcat, enzyme was incubated with
5.times.Km of substrate and cofactor; consumption of NADPH or NADP
was determined by a change in the OD.sub.340 over time. In both
cases an extinction coefficient of 6200 M.sup.-1 cm.sup.-1 was used
for NADPH.
2-HG and Metabolite Analysis
[0751] Metabolites were extracted from cultured cells, primary
leukemic cells, and sera using 80% aqueous methanol (-80.degree.
C.) as previously described. For cell extraction, frozen biopsies
were thawed quickly at 37.degree. C., and an aliquot of 2 million
cells was spun down at 4.degree. C. The pellet was resuspended in
-80.degree. C. 80% methanol. For serum extraction, 1 ml of serum
was thawed quickly and mixed with 4 ml -80.degree. C. methanol. All
extracts were spun at 13000 rpm at 4.degree. C. to remove
precipitate, dried at room temperature, and stored at -80.degree.
C. until analysis by LC-MS. Metabolite levels (2-HG, .alpha.-KG,
succinate, fumarate, and malate) were determined by ion paired
reverse phase LC coupled to negative mode electrospray
triple-quadropole MS using multiple reaction monitoring, and
integrated elution peaks were compared with metabolite standard
curves for absolute quantification as described.
Statistical Analysis
[0752] Fisher's exact test was used to test for differences in
categorical variables between IDH1/2 wt and IDH1/2 mutant patients.
One way ANOVA followed by a student's t-test with correction for
multiple comparisons was used to test for differences in IDH1
activity and metabolite concentrations. Differences with p<0.05
were considered significant.
Results
[0753] In order to investigate the role of IDH1 R132 mutations in
AML, leukemic cells obtained at initial presentation, from a series
of 145 AML patients treated at the Princess Margaret Hospital with
the aim of identifying mutant samples in our viable cell tissue
bank were genotyped. Heterozygous IDH1 R132 mutations were found in
11 (8%) of these patients (Table 25). The spectrum of IDH1
mutations observed in AML appears to differ from that seen in CNS
tumors. In the CNS, the majority of mutations (80-90%) are IDH1
R132H substitutions, whereas 5, 4, and 2 patients with IDH1 R132H,
R132C, and R132G mutations, respectively (Table 25), were observed.
In four cases, leukemic cells were also available from samples
taken at the time of relapse. The IDH1 mutation was retained in 4/4
of these samples (Table 25). One of the patients harboring an IDH1
mutation had progressed to AML from an earlier myelodysplastic
syndrome (MDS). When cells from the prior MDS in this patient were
analyzed, IDH1 was found to be wild-type. An additional 14 patients
with MDS were genotyped, and all patients were found to be
wild-type for IDH1, suggesting that IDH1 mutations are not a common
feature of this disease. In samples from a subset of IDH1 mutant
patients (n=8), reverse transcribed RNA was used for genotyping in
order to assess the relative expression of mutant and wild-type
alleles. Seqenom genotyping showed balanced allele peaks for these
samples, indicating that both the wild-type and mutant genes are
expressed. Ten established AML cell lines were also genotyped
(OCI/AML-1, OCI/AML-2, OCI/AML-3, OCI/AML-4, OCI/AML-5, HL-60,
MV-4-11, THP-1, K562, and KG1A) and none carried an IDH1 R132
mutation. Table 25: Identification of 13 AML patients bearing an
IDH1 R132 or IDH2 R172 mutation*
TABLE-US-00034 TABLE 25 NPM1 2-HG Amino and Genotype level acid FAB
FLT3 Cytogenetic at (ng/2 .times. 10.sup.6 Patient ID Mutation
change subtype status profile relapse cells) IDH1 mutations 090108
G/A R132H M4 na Normal na 2090 090356 G/A R132H na na na na 1529
0034 C/T R132C M5a Normal Normal na 10285 0086 C/G R132G M2 Normal
Normal na 10470 0488 C/T R132C M0 Normal Normal R132C 13822 8587
G/A R132H na Normal Normal na 5742 8665 C/T R132C M1 na Normal na
7217 8741 G/A R132H M4 NPM1 Normal R132H 6419 9544 C/G R132G na na
Normal R132G 4962 0174268 G/A R132H M1 NPM1 Normal R132H 8464
090148 C/T R132C M1 na 46, xx, i(7) na na (p10) [20] IDH2 mutations
9382 G/A R172K M0 Normal Normal na 19247 0831 G/A R172K M1 Normal
Normal na 15877 * NPM1 denotes nucleophosmin 1, and FLT FMS-related
tyrosine kinase 3. na indicates that some data was not available
for some patients.
[0754] A metabolite screening assay to measure 2-HG in this set of
AML, samples was set up. Levels of 2-HG were approximately 50-fold
higher in samples harboring an IDH1 R132 mutation (Table 25, FIG.
36A, Table 26). 2-HG was also elevated in the sera of patients with
IDH1 R132 mutant AML (FIG. 36B). There was no relationship between
the specific amino acid substitution at residue 132 of IDH1 and the
level of 2-HG in this group of patients.
TABLE-US-00035 TABLE 26 Metabolite concentrations in individual
IDH1/2 mutant and wild-type AML cells* 2-HG .alpha.-KG Malate
Fumarate Succinate IDH1/2 (ng/2 .times. (ng/2 .times. (ng/2 .times.
(ng/2 .times. (ng/2 .times. Sample Genotype 10.sup.6 cells)
10.sup.6 cells) 10.sup.6 cells) 10.sup.6 cells) 10.sup.6 cells)
0034 R132C 10285 125 192 239 2651 0086 R132G 10470 124 258 229 3043
0488 R132C 13822 95 184 193 2671 8587 R132H 5742 108 97 95 1409
8665 R132C 7217 137 118 120 1648 8741 R132H 6419 87 66 61 938 9544
R132G 4962 95 76 72 1199 0174268 R132H 8464 213 323 318 2287 090356
R132H 1529 138 657 366 1462 090108 R132H 2090 Na 246 941 3560
090148.dagger. R132C na Na na Na Na 8741.dagger-dbl. R132H 2890 131
113 106 1509 9554.dagger-dbl. R132G 7448 115 208 227 2658
0174268.dagger-dbl. R132H 964 72 134 138 2242 0488.dagger-dbl.
R132C 7511 85 289 310 3448 9382 R172K 19247 790 821 766 5481 0831
R172K 15877 350 721 708 5144 157 Wild 212 121 484 437 3057 type 202
Wild 121 57 161 136 1443 type 205 Wild 147 39 162 153 1011 type 209
Wild 124 111 167 168 1610 type 239 Wild 112 106 305 361 1436 type
277 Wild 157 61 257 257 2029 type 291 Wild 113 118 124 128 1240
type 313 Wild 116 75 151 181 1541 type 090158 Wild 411 217 658 647
3202 type 090156 Wild 407 500 1276 1275 6091 type *IDH1/2 denotes
isocitrate dehydrogenase 1 and 2, 2-HG 2-hydroxy glutarate, and
.alpha.-KG alpha-ketogluatarate. Metabolite measurements were not
available for all patients. .dagger.metabolic measurements were not
made due to limited patient sample .dagger-dbl.indicates samples
obtained at relapse.
[0755] Two samples harboring wild-type IDH1 also showed high levels
of 2-HG (Table 25). The high 2-HG concentration prompted sequencing
of the IDH2 gene in these two AML samples, which established the
presence of IDH2 R172K mutations in both samples (Table 25).
[0756] Evaluation of the clinical characteristics of patients with
or without IDH1/2 mutations revealed a significant correlation
between IDH1/2 mutations and normal karyotype (p=0.05), but no
other differences between these two groups (Table 27). Notably,
there was no difference in treatment response for a subgroup of
patients who received consistent treatment (n=136). These findings
are consistent with the initial report identifying IDH1 mutations
in AML.
TABLE-US-00036 TABLE 27 Characteristics of IDH1/2 mutant and
wild-type patients* IDH1/2 Wild-type IDH1/2 Mutant P Variable (N =
132) (N = 13) Value Age (yr) 58.8 .+-. 16.2 52.6 .+-. 7.0
0.17.dagger. Sex (% male) 53 (70/132) 62 (8/13) 0.77.dagger-dbl.
WBC at diagnosis 40.7 .+-. 50.6 28.7 .+-. 34.1 0.38.dagger.
(10.sup.9 cells/L) Initial treatment response 70 (85/122) 62 (8/13)
0.54.dagger-dbl. (% complete remission) Cytogenetic profile 62
(72/117) 92 (11/12) 0.05.dagger-dbl. (% normal) Additional
mutations FLT3 (%) 17 (8/47) 0 (0/8) 0.58.dagger-dbl. NPM1 (%) 30
(14/47) 25 (2/8) 1.0.dagger-dbl. *For plus-minus values, the value
indicates the mean, and .+-. indicates the standard deviation.
IDH1/2 denotes isocitrate dehydrogenase 1 and 2, WBC white blood
cell count, FLT3 FMS-related tyrosine kinase 3, and NPM1
nucleophosmin 1. .dagger.P-value was calculated using the student's
t-test. .dagger-dbl.P-value was calculated using Fisher's exact
test.
[0757] Panels of AML cells from wild-type and IDH1 mutant patients
were cultured in vitro. There was no difference in the growth rates
or viability of the IDH1 R132 mutant and wild-type cells, with both
groups showing high variability in their ability to proliferate in
culture, as is characteristic of primary AML cells (FIG. 36C).
There was no relationship between 2-HG levels in the IDH1 R132
mutant cells and their growth rate or viability in culture. After
14 days in culture, the mutant AML cells retained their IDH1 R132
mutations (11/11), and continued to accumulate high levels of 2-HG
(FIG. 36A), further confirming that IDH1 R132 mutations lead to the
production and accumulation of 2-HG in AML cells.
[0758] To investigate the effect of IDH1/2 mutations on the
concentration of cellular metabolites proximal to the IDH reaction,
.alpha.-KG, succinate, malate, and fumarate levels were measured in
AML cells with IDH1/2 mutations and in a set of wild-type AML cells
matched for AML subtype and cytogenetic profile. None of the
metabolites were found to be greatly altered in the IDH1 mutants
compared to the IDH1 wild-type cells (FIG. 27, Supplementary Table
26). The mean level of .alpha.-KG was not altered in the IDH1/2
mutant AML cells, suggesting that the mutation does not decrease
the concentration of this metabolite as has been previously
hypothesized. To confirm that the R132C mutation of IDH1, and the
R172K mutation of IDH2 confer a novel enzymatic activity that
produces 2-HG, recombinant mutant enzymes were assayed for the
NADPH-dependent reduction of .alpha.-KG. When samples were analyzed
by LC-MS upon completion of the enzyme assay, 2-HG was identified
as the end product for both the IDH1 R132C and IDH2 R172K mutant
enzymes (FIG. 38). No isocitrate was detectable by LC-MS,
indicating that 2-HG is the sole product of this reaction (FIG.
38). This observation held true even when the reductive reaction
was performed in buffer containing NaHCO.sub.3 saturated with
CO.sub.2. A large proportion of IDH1 mutant patients in AML have an
IDH1 R132C mutation (Table 25). In order to biochemically
characterize mutant IDH1 R132C, the enzymatic properties of
recombinant R132C protein were assessed in vitro. Kinetic analyses
showed that the R132C substitution severely impairs the oxidative
decarboxylation of isocitrate to .alpha.-KG, with a significant
decrease in k.sub.cat, even though the affinity for the co-factor
NADP.sup.+ remains essentially unchanged (Table 28). However,
unlike the R132H mutant enzyme described previously the R132C
mutation leads to a dramatic loss of affinity for isocitrate
(K.sub.M), and a drop in net isocitrate metabolism efficiency
(k.sub.cat/K.sub.M) of more than six orders of magnitude (Table
28). This suggests a potential difference in the substrate-level
regulation of enzyme activity in the context of AML. While
substitution of cysteine at R132 inactivates the canonical
conversion of isocitrate to .alpha.-KG, the IDH1 R132C mutant
enzyme acquires the ability to catalyze the reduction of .alpha.-KG
to 2-HG in an NADPH dependent manner (FIG. 39). This reductive
reaction of mutant IDH1 R132C is highly efficient
(k.sub.cat/K.sub.M) compared to the wild-type enzyme, due to the
considerable increase in binding affinity of both the NADPH and
.alpha.-KG substrates (K.sub.M) (Table 28).
TABLE-US-00037 TABLE 28 Kinetic parameters of the IDH1 R132C mutant
enzyme Oxidative (.fwdarw. NADPH) WT R132C K.sub.M, NADP+ (.mu.M)
49 21 K.sub.M, isocitrate (.mu.M) 57 8.7 .times. 10.sup.4 K.sub.M,
MgCl2 (.mu.M) 29 4.5 .times. 10.sup.2 K.sub.i, .alpha.KG (.mu.M)
6.1 .times. 10.sup.2 61 k.sub.cat (s.sup.-1) 1.3 .times. 10.sup.5
7.1 .times. 10.sup.2 k.sub.cat/K.sub.M, isoc(M.sup.-1 s.sup.-1) 2.3
.times. 10.sup.9 8.2 .times. 10.sup.3 Reductive (.fwdarw.
NADP.sup.+) WT R132C K.sub.M, NADPH (.mu.M) n/a* 0.3 K.sub.M,
.alpha.kg (.mu.M) n/a 295 k.sub.cat (s.sup.-1) ~7 (est.) 5.5
.times. 10.sup.2 *n/a indicates no measureable activity
Sequence CWU 1
1
804125DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1taatcatatg tccaaaaaaa tcagt
25233DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 2taatctcgag tgaaagtttg gcctgagcta gtt
3338PRTArtificial SequenceDescription of Artificial Sequence
Synthetic 8xHis tag 3His His His His His His His His1
5411PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 4Ser Leu Glu His His His His His His His His1 5
1051245DNAHomo sapiens 5atgtccaaaa aaatcagtgg cggttctgtg gtagagatgc
aaggagatga aatgacacga 60atcatttggg aattgattaa agagaaactc atttttccct
acgtggaatt ggatctacat 120agctatgatt taggcataga gaatcgtgat
gccaccaacg accaagtcac caaggatgct 180gcagaagcta taaagaagca
taatgttggc gtcaaatgtg ccactatcac tcctgatgag 240aagagggttg
aggagttcaa gttgaaacaa atgtggaaat caccaaatgg caccatacga
300aatattctgg gtggcacggt cttcagagaa gccattatct gcaaaaatat
cccccggctt 360gtgagtggat gggtaaaacc tatcatcata ggtcgtcatg
cttatgggga tcaatacaga 420gcaactgatt ttgttgttcc tgggcctgga
aaagtagaga taacctacac accaagtgac 480ggaacccaaa aggtgacata
cctggtacat aactttgaag aaggtggtgg tgttgccatg 540gggatgtata
atcaagataa gtcaattgaa gattttgcac acagttcctt ccaaatggct
600ctgtctaagg gttggccttt gtatctgagc accaaaaaca ctattctgaa
gaaatatgat 660gggcgtttta aagacatctt tcaggagata tatgacaagc
agtacaagtc ccagtttgaa 720gctcaaaaga tctggtatga gcataggctc
atcgacgaca tggtggccca agctatgaaa 780tcagagggag gcttcatctg
ggcctgtaaa aactatgatg gtgacgtgca gtcggactct 840gtggcccaag
ggtatggctc tctcggcatg atgaccagcg tgctggtttg tccagatggc
900aagacagtag aagcagaggc tgcccacggg actgtaaccc gtcactaccg
catgtaccag 960aaaggacagg agacgtccac caatcccatt gcttccattt
ttgcctggac cagagggtta 1020gcccacagag caaagcttga taacaataaa
gagcttgcct tctttgcaaa tgctttggaa 1080gaagtctcta ttgagacaat
tgaggctggc ttcatgacca aggacttggc tgcttgcatt 1140aaaggtttac
ccaatgtgca acgttctgac tacttgaata catttgagtt catggataaa
1200cttggagaaa acttgaagat caaactagct caggccaaac tttaa
124561297DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 6atgtccaaaa aaatcagtgg cggttctgtg
gtagagatgc aaggagatga aatgacacga 60atcatttggg aattgattaa agagaaactc
atttttccct acgtggaatt ggatctacat 120agctatgatt taggcataga
gaatcgtgat gccaccaacg accaagtcac caaggatgct 180gcagaagcta
taaagaagca taatgttggc gtcaaatgtg ccactatcac tcctgatgag
240aagagggttg aggagttcaa gttgaaacaa atgtggaaat caccaaatgg
caccatacga 300aatattctgg gtggcacggt cttcagagaa gccattatct
gcaaaaatat cccccggctt 360gtgagtggat gggtaaaacc tatcatcata
ggtcgtcatg cttatgggga tcaatacaga 420gcaactgatt ttgttgttcc
tgggcctgga aaagtagaga taacctacac accaagtgac 480ggaacccaaa
aggtgacata cctggtacat aactttgaag aaggtggtgg tgttgccatg
540gggatgtata atcaagataa gtcaattgaa gattttgcac acagttcctt
ccaaatggct 600ctgtctaagg gttggccttt gtatctgagc accaaaaaca
ctattctgaa gaaatatgat 660gggcgtttta aagacatctt tcaggagata
tatgacaagc agtacaagtc ccagtttgaa 720gctcaaaaga tctggtatga
gcataggctc atcgacgaca tggtggccca agctatgaaa 780tcagagggag
gcttcatctg ggcctgtaaa aactatgatg gtgacgtgca gtcggactct
840gtggcccaag ggtatggctc tctcggcatg atgaccagcg tgctggtttg
tccagatggc 900aagacagtag aagcagaggc tgcccacggg actgtaaccc
gtcactaccg catgtaccag 960aaaggacagg agacgtccac caatcccatt
gcttccattt ttgcctggac cagagggtta 1020gcccacagag caaagcttga
taacaataaa gagcttgcct tctttgcaaa tgctttggaa 1080gaagtctcta
ttgagacaat tgaggctggc ttcatgacca aggacttggc tgcttgcatt
1140aaaggtttac ccaatgtgca acgttctgac tacttgaata catttgagtt
catggataaa 1200cttggagaaa acttgaagat caaactagct caggccaaac
tttcactcga gcaccaccac 1260caccaccacc accactaatt gattaatacc taggctg
129771245DNAArtificial SequenceDescription of Artificial Sequence
Synthetic consensus sequence 7atgtccaaaa aaatcagtgg cggttctgtg
gtagagatgc aaggagatga aatgacacga 60atcatttggg aattgattaa agagaaactc
atttttccct acgtggaatt ggatctacat 120agctatgatt taggcataga
gaatcgtgat gccaccaacg accaagtcac caaggatgct 180gcagaagcta
taaagaagca taatgttggc gtcaaatgtg ccactatcac tcctgatgag
240aagagggttg aggagttcaa gttgaaacaa atgtggaaat caccaaatgg
caccatacga 300aatattctgg gtggcacggt cttcagagaa gccattatct
gcaaaaatat cccccggctt 360gtgagtggat gggtaaaacc tatcatcata
ggtcgtcatg cttatgggga tcaatacaga 420gcaactgatt ttgttgttcc
tgggcctgga aaagtagaga taacctacac accaagtgac 480ggaacccaaa
aggtgacata cctggtacat aactttgaag aaggtggtgg tgttgccatg
540gggatgtata atcaagataa gtcaattgaa gattttgcac acagttcctt
ccaaatggct 600ctgtctaagg gttggccttt gtatctgagc accaaaaaca
ctattctgaa gaaatatgat 660gggcgtttta aagacatctt tcaggagata
tatgacaagc agtacaagtc ccagtttgaa 720gctcaaaaga tctggtatga
gcataggctc atcgacgaca tggtggccca agctatgaaa 780tcagagggag
gcttcatctg ggcctgtaaa aactatgatg gtgacgtgca gtcggactct
840gtggcccaag ggtatggctc tctcggcatg atgaccagcg tgctggtttg
tccagatggc 900aagacagtag aagcagaggc tgcccacggg actgtaaccc
gtcactaccg catgtaccag 960aaaggacagg agacgtccac caatcccatt
gcttccattt ttgcctggac cagagggtta 1020gcccacagag caaagcttga
taacaataaa gagcttgcct tctttgcaaa tgctttggaa 1080gaagtctcta
ttgagacaat tgaggctggc ttcatgacca aggacttggc tgcttgcatt
1140aaaggtttac ccaatgtgca acgttctgac tacttgaata catttgagtt
catggataaa 1200cttggagaaa acttgaagat caaactagct caggccaaac tttma
124581245DNAHomo sapiens 8atgtccaaaa aaatcagtgg cggttctgtg
gtagagatgc aaggagatga aatgacacga 60atcatttggg aattgattaa agagaaactc
atttttccct acgtggaatt ggatctacat 120agctatgatt taggcataga
gaatcgtgat gccaccaacg accaagtcac caaggatgct 180gcagaagcta
taaagaagca taatgttggc gtcaaatgtg ccactatcac tcctgatgag
240aagagggttg aggagttcaa gttgaaacaa atgtggaaat caccaaatgg
caccatacga 300aatattctgg gtggcacggt cttcagagaa gccattatct
gcaaaaatat cccccggctt 360gtgagtggat gggtaaaacc tatcatcata
ggtcgtcatg cttatgggga tcaatacaga 420gcaactgatt ttgttgttcc
tgggcctgga aaagtagaga taacctacac accaagtgac 480ggaacccaaa
aggtgacata cctggtacat aactttgaag aaggtggtgg tgttgccatg
540gggatgtata atcaagataa gtcaattgaa gattttgcac acagttcctt
ccaaatggct 600ctgtctaagg gttggccttt gtatctgagc accaaaaaca
ctattctgaa gaaatatgat 660gggcgtttta aagacatctt tcaggagata
tatgacaagc agtacaagtc ccagtttgaa 720gctcaaaaga tctggtatga
gcataggctc atcgacgaca tggtggccca agctatgaaa 780tcagagggag
gcttcatctg ggcctgtaaa aactatgatg gtgacgtgca gtcggactct
840gtggcccaag ggtatggctc tctcggcatg atgaccagcg tgctggtttg
tccagatggc 900aagacagtag aagcagaggc tgcccacggg actgtaaccc
gtcactaccg catgtaccag 960aaaggacagg agacgtccac caatcccatt
gcttccattt ttgcctggac cagagggtta 1020gcccacagag caaagcttga
taacaataaa gagcttgcct tctttgcaaa tgctttggaa 1080gaagtctcta
ttgagacaat tgaggctggc ttcatgacca aggacttggc tgcttgcatt
1140aaaggtttac ccaatgtgca acgttctgac tacttgaata catttgagtt
catggataaa 1200cttggagaaa acttgaagat caaactagct caggccaaac tttaa
124592339DNAHomo sapiens 9cctgtggtcc cgggtttctg cagagtctac
ttcagaagcg gaggcactgg gagtccggtt 60tgggattgcc aggctgtggt tgtgagtctg
agcttgtgag cggctgtggc gccccaactc 120ttcgccagca tatcatcccg
gcaggcgata aactacattc agttgagtct gcaagactgg 180gaggaactgg
ggtgataaga aatctattca ctgtcaaggt ttattgaagt caaaatgtcc
240aaaaaaatca gtggcggttc tgtggtagag atgcaaggag atgaaatgac
acgaatcatt 300tgggaattga ttaaagagaa actcattttt ccctacgtgg
aattggatct acatagctat 360gatttaggca tagagaatcg tgatgccacc
aacgaccaag tcaccaagga tgctgcagaa 420gctataaaga agcataatgt
tggcgtcaaa tgtgccacta tcactcctga tgagaagagg 480gttgaggagt
tcaagttgaa acaaatgtgg aaatcaccaa atggcaccat acgaaatatt
540ctgggtggca cggtcttcag agaagccatt atctgcaaaa atatcccccg
gcttgtgagt 600ggatgggtaa aacctatcat cataggtcgt catgcttatg
gggatcaata cagagcaact 660gattttgttg ttcctgggcc tggaaaagta
gagataacct acacaccaag tgacggaacc 720caaaaggtga catacctggt
acataacttt gaagaaggtg gtggtgttgc catggggatg 780tataatcaag
ataagtcaat tgaagatttt gcacacagtt ccttccaaat ggctctgtct
840aagggttggc ctttgtatct gagcaccaaa aacactattc tgaagaaata
tgatgggcgt 900tttaaagaca tctttcagga gatatatgac aagcagtaca
agtcccagtt tgaagctcaa 960aagatctggt atgagcatag gctcatcgac
gacatggtgg cccaagctat gaaatcagag 1020ggaggcttca tctgggcctg
taaaaactat gatggtgacg tgcagtcgga ctctgtggcc 1080caagggtatg
gctctctcgg catgatgacc agcgtgctgg tttgtccaga tggcaagaca
1140gtagaagcag aggctgccca cgggactgta acccgtcact accgcatgta
ccagaaagga 1200caggagacgt ccaccaatcc cattgcttcc atttttgcct
ggaccagagg gttagcccac 1260agagcaaagc ttgataacaa taaagagctt
gccttctttg caaatgcttt ggaagaagtc 1320tctattgaga caattgaggc
tggcttcatg accaaggact tggctgcttg cattaaaggt 1380ttacccaatg
tgcaacgttc tgactacttg aatacatttg agttcatgga taaacttgga
1440gaaaacttga agatcaaact agctcaggcc aaactttaag ttcatacctg
agctaagaag 1500gataattgtc ttttggtaac taggtctaca ggtttacatt
tttctgtgtt acactcaagg 1560ataaaggcaa aatcaatttt gtaatttgtt
tagaagccag agtttatctt ttctataagt 1620ttacagcctt tttcttatat
atacagttat tgccaccttt gtgaacatgg caagggactt 1680ttttacaatt
tttattttat tttctagtac cagcctagga attcggttag tactcatttg
1740tattcactgt cactttttct catgttctaa ttataaatga ccaaaatcaa
gattgctcaa 1800aagggtaaat gatagccaca gtattgctcc ctaaaatatg
cataaagtag aaattcactg 1860ccttcccctc ctgtccatga ccttgggcac
agggaagttc tggtgtcata gatatcccgt 1920tttgtgaggt agagctgtgc
attaaacttg cacatgactg gaacgaagta tgagtgcaac 1980tcaaatgtgt
tgaagatact gcagtcattt ttgtaaagac cttgctgaat gtttccaata
2040gactaaatac tgtttaggcc gcaggagagt ttggaatccg gaataaatac
tacctggagg 2100tttgtcctct ccatttttct ctttctcctc ctggcctggc
ctgaatatta tactactcta 2160aatagcatat ttcatccaag tgcaataatg
taagctgaat cttttttgga cttctgctgg 2220cctgttttat ttcttttata
taaatgtgat ttctcagaaa ttgatattaa acactatctt 2280atcttctcct
gaactgttga ttttaattaa aattaagtgc taattaccaa aaaaaaaaa
233910452PRTHomo sapiens 10Met Ala Gly Tyr Leu Arg Val Val Arg Ser
Leu Cys Arg Ala Ser Gly1 5 10 15Ser Arg Pro Ala Trp Ala Pro Ala Ala
Leu Thr Ala Pro Thr Ser Gln 20 25 30Glu Gln Pro Arg Arg His Tyr Ala
Asp Lys Arg Ile Lys Val Ala Lys 35 40 45Pro Val Val Glu Met Asp Gly
Asp Glu Met Thr Arg Ile Ile Trp Gln 50 55 60Phe Ile Lys Glu Lys Leu
Ile Leu Pro His Val Asp Ile Gln Leu Lys65 70 75 80Tyr Phe Asp Leu
Gly Leu Pro Asn Arg Asp Gln Thr Asp Asp Gln Val 85 90 95Thr Ile Asp
Ser Ala Leu Ala Thr Gln Lys Tyr Ser Val Ala Val Lys 100 105 110Cys
Ala Thr Ile Thr Pro Asp Glu Ala Arg Val Glu Glu Phe Lys Leu 115 120
125Lys Lys Met Trp Lys Ser Pro Asn Gly Thr Ile Arg Asn Ile Leu Gly
130 135 140Gly Thr Val Phe Arg Glu Pro Ile Ile Cys Lys Asn Ile Pro
Arg Leu145 150 155 160Val Pro Gly Trp Thr Lys Pro Ile Thr Ile Gly
Arg His Ala His Gly 165 170 175Asp Gln Tyr Lys Ala Thr Asp Phe Val
Ala Asp Arg Ala Gly Thr Phe 180 185 190Lys Met Val Phe Thr Pro Lys
Asp Gly Ser Gly Val Lys Glu Trp Glu 195 200 205Val Tyr Asn Phe Pro
Ala Gly Gly Val Gly Met Gly Met Tyr Asn Thr 210 215 220Asp Glu Ser
Ile Ser Gly Phe Ala His Ser Cys Phe Gln Tyr Ala Ile225 230 235
240Gln Lys Lys Trp Pro Leu Tyr Met Ser Thr Lys Asn Thr Ile Leu Lys
245 250 255Ala Tyr Asp Gly Arg Phe Lys Asp Ile Phe Gln Glu Ile Phe
Asp Lys 260 265 270His Tyr Lys Thr Asp Phe Asp Lys Asn Lys Ile Trp
Tyr Glu His Arg 275 280 285Leu Ile Asp Asp Met Val Ala Gln Val Leu
Lys Ser Ser Gly Gly Phe 290 295 300Val Trp Ala Cys Lys Asn Tyr Asp
Gly Asp Val Gln Ser Asp Ile Leu305 310 315 320Ala Gln Gly Phe Gly
Ser Leu Gly Leu Met Thr Ser Val Leu Val Cys 325 330 335Pro Asp Gly
Lys Thr Ile Glu Ala Glu Ala Ala His Gly Thr Val Thr 340 345 350Arg
His Tyr Arg Glu His Gln Lys Gly Arg Pro Thr Ser Thr Asn Pro 355 360
365Ile Ala Ser Ile Phe Ala Trp Thr Arg Gly Leu Glu His Arg Gly Lys
370 375 380Leu Asp Gly Asn Gln Asp Leu Ile Arg Phe Ala Gln Met Leu
Glu Lys385 390 395 400Val Cys Val Glu Thr Val Glu Ser Gly Ala Met
Thr Lys Asp Leu Ala 405 410 415Gly Cys Ile His Gly Leu Ser Asn Val
Lys Leu Asn Glu His Phe Leu 420 425 430Asn Thr Thr Asp Phe Leu Asp
Thr Ile Lys Ser Asn Leu Asp Arg Ala 435 440 445Leu Gly Arg Gln
450111359DNAHomo sapiens 11atggccggct acctgcgggt cgtgcgctcg
ctctgcagag cctcaggctc gcggccggcc 60tgggcgccgg cggccctgac agcccccacc
tcgcaagagc agccgcggcg ccactatgcc 120gacaaaagga tcaaggtggc
gaagcccgtg gtggagatgg atggtgatga gatgacccgt 180attatctggc
agttcatcaa ggagaagctc atcctgcccc acgtggacat ccagctaaag
240tattttgacc tcgggctccc aaaccgtgac cagactgatg accaggtcac
cattgactct 300gcactggcca cccagaagta cagtgtggct gtcaagtgtg
ccaccatcac ccctgatgag 360gcccgtgtgg aagagttcaa gctgaagaag
atgtggaaaa gtcccaatgg aactatccgg 420aacatcctgg gggggactgt
cttccgggag cccatcatct gcaaaaacat cccacgccta 480gtccctggct
ggaccaagcc catcaccatt ggcaggcacg cccatggcga ccagtacaag
540gccacagact ttgtggcaga ccgggccggc actttcaaaa tggtcttcac
cccaaaagat 600ggcagtggtg tcaaggagtg ggaagtgtac aacttccccg
caggcggcgt gggcatgggc 660atgtacaaca ccgacgagtc catctcaggt
tttgcgcaca gctgcttcca gtatgccatc 720cagaagaaat ggccgctgta
catgagcacc aagaacacca tactgaaagc ctacgatggg 780cgtttcaagg
acatcttcca ggagatcttt gacaagcact ataagaccga cttcgacaag
840aataagatct ggtatgagca ccggctcatt gatgacatgg tggctcaggt
cctcaagtct 900tcgggtggct ttgtgtgggc ctgcaagaac tatgacggag
atgtgcagtc agacatcctg 960gcccagggct ttggctccct tggcctgatg
acgtccgtcc tggtctgccc tgatgggaag 1020acgattgagg ctgaggccgc
tcatgggacc gtcacccgcc actatcggga gcaccagaag 1080ggccggccca
ccagcaccaa ccccatcgcc agcatctttg cctggacacg tggcctggag
1140caccggggga agctggatgg gaaccaagac ctcatcaggt ttgcccagat
gctggagaag 1200gtgtgcgtgg agacggtgga gagtggagcc atgaccaagg
acctggcggg ctgcattcac 1260ggcctcagca atgtgaagct gaacgagcac
ttcctgaaca ccacggactt cctcgacacc 1320atcaagagca acctggacag
agccctgggc aggcagtag 1359121740DNAHomo sapiens 12ccagcgttag
cccgcggcca ggcagccggg aggagcggcg cgcgctcgga cctctcccgc 60cctgctcgtt
cgctctccag cttgggatgg ccggctacct gcgggtcgtg cgctcgctct
120gcagagcctc aggctcgcgg ccggcctggg cgccggcggc cctgacagcc
cccacctcgc 180aagagcagcc gcggcgccac tatgccgaca aaaggatcaa
ggtggcgaag cccgtggtgg 240agatggatgg tgatgagatg acccgtatta
tctggcagtt catcaaggag aagctcatcc 300tgccccacgt ggacatccag
ctaaagtatt ttgacctcgg gctcccaaac cgtgaccaga 360ctgatgacca
ggtcaccatt gactctgcac tggccaccca gaagtacagt gtggctgtca
420agtgtgccac catcacccct gatgaggccc gtgtggaaga gttcaagctg
aagaagatgt 480ggaaaagtcc caatggaact atccggaaca tcctgggggg
gactgtcttc cgggagccca 540tcatctgcaa aaacatccca cgcctagtcc
ctggctggac caagcccatc accattggca 600ggcacgccca tggcgaccag
tacaaggcca cagactttgt ggcagaccgg gccggcactt 660tcaaaatggt
cttcacccca aaagatggca gtggtgtcaa ggagtgggaa gtgtacaact
720tccccgcagg cggcgtgggc atgggcatgt acaacaccga cgagtccatc
tcaggttttg 780cgcacagctg cttccagtat gccatccaga agaaatggcc
gctgtacatg agcaccaaga 840acaccatact gaaagcctac gatgggcgtt
tcaaggacat cttccaggag atctttgaca 900agcactataa gaccgacttc
gacaagaata agatctggta tgagcaccgg ctcattgatg 960acatggtggc
tcaggtcctc aagtcttcgg gtggctttgt gtgggcctgc aagaactatg
1020acggagatgt gcagtcagac atcctggccc agggctttgg ctcccttggc
ctgatgacgt 1080ccgtcctggt ctgccctgat gggaagacga ttgaggctga
ggccgctcat gggaccgtca 1140cccgccacta tcgggagcac cagaagggcc
ggcccaccag caccaacccc atcgccagca 1200tctttgcctg gacacgtggc
ctggagcacc gggggaagct ggatgggaac caagacctca 1260tcaggtttgc
ccagatgctg gagaaggtgt gcgtggagac ggtggagagt ggagccatga
1320ccaaggacct ggcgggctgc attcacggcc tcagcaatgt gaagctgaac
gagcacttcc 1380tgaacaccac ggacttcctc gacaccatca agagcaacct
ggacagagcc ctgggcaggc 1440agtaggggga ggcgccaccc atggctgcag
tggaggggcc agggctgagc cggcgggtcc 1500tcctgagcgc ggcagagggt
gagcctcaca gcccctctct ggaggccttt ctaggggatg 1560tttttttata
agccagatgt ttttaaaagc atatgtgtgt ttcccctcat ggtgacgtga
1620ggcaggagca gtgcgtttta cctcagccag tcagtatgtt ttgcatactg
taatttatat 1680tgcccttgga acacatggtg ccatatttag ctactaaaaa
gctcttcaca aaaaaaaaaa 174013414PRTHomo sapiens 13Met Ser Lys Lys
Ile Ser Gly Gly Ser Val Val Glu Met Gln Gly Asp1 5 10 15Glu Met Thr
Arg Ile Ile Trp Glu Leu Ile Lys Glu Lys Leu Ile Phe 20 25 30Pro Tyr
Val Glu Leu Asp Leu His Ser Tyr Asp Leu Gly Ile Glu Asn 35 40 45Arg
Asp Ala Thr Asn Asp Gln Val Thr Lys Asp Ala Ala Glu Ala Ile 50 55
60Lys Lys His Asn Val Gly Val Lys Cys Ala Thr Ile Thr Pro Asp Glu65
70 75 80Lys Arg Val Glu Glu Phe Lys Leu Lys Gln Met Trp Lys Ser Pro
Asn 85 90 95Gly Thr Ile Arg Asn Ile Leu Gly Gly Thr Val Phe Arg Glu
Ala Ile 100 105 110Ile Cys Lys Asn Ile Pro Arg Leu Val Ser Gly Trp
Val Lys Pro Ile 115 120 125Ile Ile Gly Arg His Ala Tyr Gly Asp Gln
Tyr Arg Ala Thr Asp Phe 130 135 140Val Val Pro Gly Pro Gly Lys Val
Glu Ile Thr
Tyr Thr Pro Ser Asp145 150 155 160Gly Thr Gln Lys Val Thr Tyr Leu
Val His Asn Phe Glu Glu Gly Gly 165 170 175Gly Val Ala Met Gly Met
Tyr Asn Gln Asp Lys Ser Ile Glu Asp Phe 180 185 190Ala His Ser Ser
Phe Gln Met Ala Leu Ser Lys Gly Trp Pro Leu Tyr 195 200 205Leu Ser
Thr Lys Asn Thr Ile Leu Lys Lys Tyr Asp Gly Arg Phe Lys 210 215
220Asp Ile Phe Gln Glu Ile Tyr Asp Lys Gln Tyr Lys Ser Gln Phe
Glu225 230 235 240Ala Gln Lys Ile Trp Tyr Glu His Arg Leu Ile Asp
Asp Met Val Ala 245 250 255Gln Ala Met Lys Ser Glu Gly Gly Phe Ile
Trp Ala Cys Lys Asn Tyr 260 265 270Asp Gly Asp Val Gln Ser Asp Ser
Val Ala Gln Gly Tyr Gly Ser Leu 275 280 285Gly Met Met Thr Ser Val
Leu Val Cys Pro Asp Gly Lys Thr Val Glu 290 295 300Ala Glu Ala Ala
His Gly Thr Val Thr Arg His Tyr Arg Met Tyr Gln305 310 315 320Lys
Gly Gln Glu Thr Ser Thr Asn Pro Ile Ala Ser Ile Phe Ala Trp 325 330
335Thr Arg Gly Leu Ala His Arg Ala Lys Leu Asp Asn Asn Lys Glu Leu
340 345 350Ala Phe Phe Ala Asn Ala Leu Glu Glu Val Ser Ile Glu Thr
Ile Glu 355 360 365Ala Gly Phe Met Thr Lys Asp Leu Ala Ala Cys Ile
Lys Gly Leu Pro 370 375 380Asn Val Gln Arg Ser Asp Tyr Leu Asn Thr
Phe Glu Phe Met Asp Lys385 390 395 400Leu Gly Glu Asn Leu Lys Ile
Lys Leu Ala Gln Ala Lys Leu 405 4101419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 14gguuucugca gagucuacu 191519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 15aguagacucu gcagaaacc 191619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 16cucuucgcca gcauaucau 191719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 17augauaugcu ggcgaagag 191819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 18ggcaggcgau aaacuacau 191919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 19auguaguuua ucgccugcc 192019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 20gcgauaaacu acauucagu 192119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 21acugaaugua guuuaucgc 192219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 22gaaaucuauu cacugucaa 192319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 23uugacaguga auagauuuc 192419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 24guucuguggu agagaugca 192519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 25ugcaucucua ccacagaac 192619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 26gcaaggagau gaaaugaca 192719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 27ugucauuuca ucuccuugc 192819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 28ggagaugaaa ugacacgaa 192919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 29uucgugucau uucaucucc 193019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 30gagaugaaau gacacgaau 193119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 31auucguguca uuucaucuc 193219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 32gaugaaauga cacgaauca 193319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 33ugauucgugu cauuucauc 193419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 34cgaaucauuu gggaauuga 193519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 35ucaauuccca aaugauucg 193619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 36gggaauugau uaaagagaa 193719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 37uucucuuuaa ucaauuccc 193819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 38ccuacgugga auuggaucu 193919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 39agauccaauu ccacguagg 194019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 40cuacguggaa uuggaucua 194119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 41uagauccaau uccacguag 194219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 42ggaucuacau agcuaugau 194319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 43aucauagcua uguagaucc 194419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 44gcuaugauuu aggcauaga 194519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 45ucuaugccua aaucauagc 194619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 46ggaugcugca gaagcuaua 194719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 47uauagcuucu gcagcaucc 194819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 48cagaagcuau aaagaagca 194919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 49ugcuucuuua uagcuucug 195019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 50gaagcuauaa agaagcaua 195119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 51uaugcuucuu uauagcuuc 195219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 52gcauaauguu ggcgucaaa 195319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 53uuugacgcca acauuaugc 195419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 54cugaugagaa gaggguuga 195519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 55ucaacccucu ucucaucag 195619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 56guugaggagu ucaaguuga 195719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 57ucaacuugaa cuccucaac 195819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 58gaguucaagu ugaaacaaa 195919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 59uuuguuucaa cuugaacuc 196019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 60guugaaacaa auguggaaa 196119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 61uuuccacauu uguuucaac 196219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 62caaaugugga aaucaccaa 196319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 63uuggugauuu ccacauuug 196419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 64ccaaauggca ccauacgaa 196519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 65uucguauggu gccauuugg 196619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 66cauacgaaau auucugggu 196719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 67acccagaaua uuucguaug 196819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 68gagaagccau uaucugcaa 196919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 69uugcagauaa uggcuucuc 197019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 70cuaucaucau aggucguca 197119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 71ugacgaccua ugaugauag 197219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 72caucauaggu cgucaugcu 197319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 73agcaugacga ccuaugaug 197419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 74cauaggucgu caugcuuau 197519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 75auaagcauga cgaccuaug 197619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 76gagauaaccu acacaccaa 197719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 77uuggugugua gguuaucuc 197819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 78ccugguacau aacuuugaa 197919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 79uucaaaguua uguaccagg 198019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 80cuuugaagaa ggugguggu 198119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 81accaccaccu ucuucaaag 198219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 82gggauguaua aucaagaua 198319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 83uaucuugauu auacauccc 198419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 84gcacacaguu ccuuccaaa 198519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 85uuuggaagga acugugugc 198619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 86guuccuucca aauggcucu 198719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 87agagccauuu ggaaggaac 198819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 88gguuggccuu uguaucuga 198919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 89ucagauacaa aggccaacc 199019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 90cuuuguaucu gagcaccaa 199119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 91uuggugcuca gauacaaag 199219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 92gaagaaauau gaugggcgu 199319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 93acgcccauca uauuucuuc 199419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 94gucccaguuu gaagcucaa 199519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 95uugagcuuca aacugggac 199619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 96gguaugagca uaggcucau 199719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 97augagccuau gcucauacc 199819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 98ggcccaagcu augaaauca 199919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 99ugauuucaua gcuugggcc 1910019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 100cccaagcuau gaaaucaga 1910119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 101ucugauuuca uagcuuggg 1910219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 102cagauggcaa gacaguaga 1910319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 103ucuacugucu ugccaucug 1910419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 104gcaagacagu agaagcaga 1910519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 105ucugcuucua cugucuugc 1910619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 106gcauguacca gaaaggaca 1910719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 107uguccuuucu gguacaugc 1910819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 108ccaaucccau ugcuuccau 1910919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 109auggaagcaa
ugggauugg 1911019RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 110ccacagagca aagcuugau
1911119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 111aucaagcuuu gcucugugg
1911219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 112cacagagcaa agcuugaua
1911319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 113uaucaagcuu ugcucugug
1911419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 114gagcaaagcu ugauaacaa
1911519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 115uuguuaucaa gcuuugcuc
1911619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 116gagcuugccu ucuuugcaa
1911719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 117uugcaaagaa ggcaagcuc
1911819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 118cuuugcaaau gcuuuggaa
1911919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 119uuccaaagca uuugcaaag
1912019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 120caaaugcuuu ggaagaagu
1912119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 121acuucuucca aagcauuug
1912219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 122cuuuggaaga agucucuau
1912319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 123auagagacuu cuuccaaag
1912419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 124gaagaagucu cuauugaga
1912519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 125ucucaauaga gacuucuuc
1912619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 126gaagucucua uugagacaa
1912719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 127uugucucaau agagacuuc
1912819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 128ggacuuggcu gcuugcauu
1912919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 129aaugcaagca gccaagucc
1913019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 130cuuggcugcu ugcauuaaa
1913119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 131uuuaaugcaa gcagccaag
1913219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 132cauuaaaggu uuacccaau
1913319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 133auuggguaaa ccuuuaaug
1913419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 134ccaaugugca acguucuga
1913519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 135ucagaacguu gcacauugg
1913619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 136gugcaacguu cugacuacu
1913719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 137aguagucaga acguugcac
1913819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 138cguucugacu acuugaaua
1913919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 139uauucaagua gucagaacg
1914019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 140cauuugaguu cauggauaa
1914119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 141uuauccauga acucaaaug
1914219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 142guucauggau aaacuugga
1914319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 143uccaaguuua uccaugaac
1914419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 144cauggauaaa cuuggagaa
1914519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 145uucuccaagu uuauccaug
1914619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 146caaacuagcu caggccaaa
1914719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 147uuuggccuga gcuaguuug
1914819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 148ccugagcuaa gaaggauaa
1914919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 149uuauccuucu uagcucagg
1915019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 150cuaagaagga uaauugucu
1915119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 151agacaauuau ccuucuuag
1915219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 152cuguguuaca cucaaggau
1915319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 153auccuugagu guaacacag
1915419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 154guguuacacu caaggauaa
1915519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 155uuauccuuga guguaacac
1915619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 156cacucaagga uaaaggcaa
1915719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 157uugccuuuau ccuugagug
1915819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 158guaauuuguu uagaagcca
1915919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 159uggcuucuaa acaaauuac
1916019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 160guuauugcca ccuuuguga
1916119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 161ucacaaaggu ggcaauaac
1916219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 162cagccuagga auucgguua
1916319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 163uaaccgaauu ccuaggcug
1916419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 164gccuaggaau ucgguuagu
1916519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 165acuaaccgaa uuccuaggc
1916619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 166ccuaggaauu cgguuagua
1916719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 167uacuaaccga auuccuagg
1916819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 168ggaauucggu uaguacuca
1916919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 169ugaguacuaa ccgaauucc
1917019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 170gaauucgguu aguacucau
1917119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 171augaguacua accgaauuc
1917219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 172gguuaguacu cauuuguau
1917319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 173auacaaauga guacuaacc
1917419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 174guacucauuu guauucacu
1917519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 175agugaauaca aaugaguac
1917619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 176gguaaaugau agccacagu
1917719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 177acuguggcua ucauuuacc
1917819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 178guaaaugaua gccacagua
1917919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 179uacuguggcu aucauuuac
1918019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 180ccacaguauu gcucccuaa
1918119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 181uuagggagca auacugugg
1918219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 182gggaaguucu ggugucaua
1918319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 183uaugacacca gaacuuccc
1918419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 184guucuggugu cauagauau
1918519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 185auaucuauga caccagaac
1918619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 186gcugugcauu aaacuugca
1918719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 187ugcaaguuua augcacagc
1918819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 188gugcauuaaa cuugcacau
1918919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 189augugcaagu uuaaugcac
1919019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 190gcauuaaacu ugcacauga
1919119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 191ucaugugcaa guuuaaugc
1919219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 192caugacugga acgaaguau
1919319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 193auacuucguu ccagucaug
1919419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 194ggaacgaagu augagugca
1919519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 195ugcacucaua cuucguucc
1919619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 196gaacgaagua ugagugcaa
1919719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 197uugcacucau acuucguuc
1919819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 198gagugcaacu caaaugugu
1919919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 199acacauuuga guugcacuc
1920019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 200gcaacucaaa uguguugaa
1920119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 201uucaacacau uugaguugc
1920219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 202caaauguguu gaagauacu
1920319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 203aguaucuuca acacauuug
1920419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 204guguugaaga uacugcagu
1920519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 205acugcaguau cuucaacac
1920619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 206guugaagaua cugcaguca
1920719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 207ugacugcagu aucuucaac
1920819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 208ccuugcugaa uguuuccaa
1920919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 209uuggaaacau ucagcaagg
1921019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 210cuugcugaau guuuccaau
1921119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 211auuggaaaca uucagcaag
1921219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 212gcugaauguu uccaauaga
1921319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 213ucuauuggaa acauucagc
1921419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 214ccaauagacu aaauacugu
1921519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 215acaguauuua gucuauugg
1921619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 216gaguuuggaa uccggaaua
1921719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 217uauuccggau uccaaacuc
1921819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 218ggaauccgga auaaauacu
1921919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 219aguauuuauu ccggauucc
1922019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 220gaauccggaa uaaauacua
1922119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 221uaguauuuau uccggauuc
1922219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 222ggaauaaaua cuaccugga
1922319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 223uccagguagu auuuauucc
1922419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 224ggccuggccu gaauauuau
1922519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 225auaauauuca ggccaggcc
1922619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 226gccugaauau uauacuacu
1922719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 227aguaguauaa uauucaggc
1922819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 228cuggccugaa uauuauacu
1922919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 229aguauaauau ucaggccag
1923019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 230cauauuucau ccaagugca
1923119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 231ugcacuugga ugaaauaug
1923219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 232gugcaauaau guaagcuga
1923319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 233ucagcuuaca uuauugcac
1923419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 234gcaauaaugu aagcugaau
1923519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 235auucagcuua cauuauugc
1923619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 236cacuaucuua ucuucuccu
1923719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 237aggagaagau aagauagug
1923819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 238cuucuccuga acuguugau
1923919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 239aucaacaguu caggagaag
1924019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 240aaccuaucau cauaggucg
1924119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 241cgaccuauga ugauagguu
1924219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 242accuaucauc auaggucgu
1924319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 243acgaccuaug augauaggu
1924419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 244ccuaucauca uaggucguc
1924519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 245gacgaccuau gaugauagg
1924619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 246cuaucaucau aggucguca
1924719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 247ugacgaccua ugaugauag
1924819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 248uaucaucaua ggucgucau
1924919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 249augacgaccu augaugaua
1925019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 250aucaucauag gucgucaug
1925119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 251caugacgacc uaugaugau
1925219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 252ucaucauagg ucgucaugc
1925319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 253gcaugacgac cuaugauga
1925419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 254caucauaggu cgucaugcu
1925519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 255agcaugacga ccuaugaug
1925619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 256aucauagguc gucaugcuu
1925719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 257aagcaugacg accuaugau
1925819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 258ucauaggucg ucaugcuua
1925919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 259uaagcaugac gaccuauga
1926019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 260cauaggucgu caugcuuau
1926119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 261auaagcauga cgaccuaug
1926219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 262auaggucguc augcuuaug
1926319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 263cauaagcaug acgaccuau
1926419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 264uaggucguca ugcuuaugg
1926519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 265ccauaagcau gacgaccua
1926619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 266aggucgucau gcuuauggg
1926719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 267cccauaagca ugacgaccu
1926819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 268ggucgucaug cuuaugggg
1926919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 269ccccauaagc augacgacc
1927019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 270gucgucaugc uuaugggga
1927119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 271ucccauaagc augacgacc
1927219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 272ucgucaugcu uauggggau
1927319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 273aucccauaag caugacgac
1927419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 274aaccuaucau cauagguca
1927519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 275ugaccuauga ugauagguu
1927619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 276accuaucauc auaggucau
1927719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 277augaccuaug augauaggu
1927819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 278ccuaucauca uaggucauc
1927919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 279gaugaccuau gaugauagg
1928019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 280cuaucaucau aggucauca
1928119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 281ugaugaccua ugaugauag
1928219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 282uaucaucaua ggucaucau
1928319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 283augaugaccu augaugaua
1928419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 284aucaucauag gucaucaug
1928519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 285caugaugacc uaugaugau
1928619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 286ucaucauagg ucaucaugc
1928719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 287gcaugaugac cuaugauga
1928819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 288caucauaggu caucaugcu
1928919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 289agcaugauga ccuaugaug
1929019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 290aucauagguc aucaugcuu
1929119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 291aagcaugaug accuaugau
1929219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 292ucauagguca ucaugcuua
1929319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 293uaagcaugau gaccuauga
1929419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 294cauaggucau caugcuuau
1929519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 295auaagcauga ugaccuaug
1929619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 296auaggucauc augcuuaug
1929719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 297cauaagcaug augaccuau
1929819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 298uaggucauca ugcuuaugg
1929919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 299ccauaagcau gaugaccua
1930019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 300aggucaucau gcuuauggg
1930119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 301cccauaagca ugaugaccu
1930219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 302ggucaucaug cuuaugggg
1930319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 303ccccauaagc augaugacc
1930419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 304gucaucaugc uuaugggga
1930519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 305uccccauaag caugaugac
1930619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 306ucaucaugcu uauggggau
1930719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 307auccccauaa gcaugauga
1930819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 308aaccuaucau cauagguag
1930919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 309cuaccuauga ugauagguu
1931019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic
oligonucleotide 310accuaucauc auagguagu 1931119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 311acuaccuaug augauaggu 1931219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 312ccuaucauca uagguaguc 1931319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 313gacuaccuau gaugauagg 1931419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 314cuaucaucau agguaguca 1931519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 315ugacuaccua ugaugauag 1931619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 316uaucaucaua gguagucau 1931719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 317augacuaccu augaugaua 1931819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 318aucaucauag guagucaug 1931919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 319caugacuacc uaugaugau 1932019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 320ucaucauagg uagucaugc 1932119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 321gcaugacuac cuaugauga 1932219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 322caucauaggu agucaugcu 1932319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 323agcaugacua ccuaugaug 1932419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 324aucauaggua gucaugcuu 1932519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 325aagcaugacu accuaugau 1932619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 326ucauagguag ucaugcuua 1932719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 327uaagcaugac uaccuauga 1932819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 328cauagguagu caugcuuau 1932919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 329auaagcauga cuaccuaug 1933019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 330auagguaguc augcuuaug 1933119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 331cauaagcaug acuaccuau 1933219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 332uagguaguca ugcuuaugg 1933319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 333ccauaagcau gacuaccua 1933419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 334agguagucau gcuuauggg 1933519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 335cccauaagca ugacuaccu 1933619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 336gguagucaug cuuaugggg 1933719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 337ccccauaagc augacuacc 1933819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 338guagucaugc uuaugggga 1933919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 339uccccauaag caugacuac 1934019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 340uagucaugcu uauggggau 1934119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 341auccccauaa gcaugacua 1934219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 342aaccuaucau cauagguug 1934319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 343caaccuauga ugauagguu 1934419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 344accuaucauc auagguugu 1934519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 345acaaccuaug augauaggu 1934619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 346ccuaucauca uagguuguc 1934719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 347gacaaccuau gaugauagg 1934819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 348cuaucaucau agguuguca 1934919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 349ugacaaccua ugaugauag 1935019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 350uaucaucaua gguugucau 1935119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 351augacaaccu augaugaua 1935219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 352aucaucauag guugucaug 1935319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 353caugacaacc uaugaugau 1935419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 354ucaucauagg uugucaugc 1935519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 355gcaugacaac cuaugauga 1935619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 356caucauaggu ugucaugcu 1935719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 357agcaugacaa ccuaugaug 1935819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 358aucauagguu gucaugcuu 1935919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 359aagcaugaca accuaugau 1936019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 360ucauagguug ucaugcuua 1936119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 361uaagcaugac aaccuauga 1936219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 362cauagguugu caugcuuau 1936319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 363auaagcauga caaccuaug 1936419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 364auagguuguc augcuuaug 1936519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 365cauaagcaug acaaccuau 1936619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 366uagguuguca ugcuuaugg 1936719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 367ccauaagcau gacaaccua 1936819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 368agguugucau gcuuauggg 1936919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 369cccauaagca ugacaaccu 1937019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 370gguugucaug cuuaugggg 1937119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 371ccccauaagc augacaacc 1937219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 372guugucaugc uuaugggga 1937319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 373uccccauaag caugacaac 1937419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 374uugucaugcu uauggggau 1937519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 375auccccauaa gcaugacaa 1937619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 376aaccuaucau cauaggugg 1937719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 377ccaccuauga ugauagguu 1937819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 378accuaucauc auagguggu 1937919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 379accaccuaug augauaggu 1938019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 380ccuaucauca uaggugguc 1938119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 381gaccaccuau gaugauagg 1938219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 382cuaucaucau aggugguca 1938319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 383ugaccaccua ugaugauag 1938419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 384uaucaucaua gguggucau 1938519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 385augaccaccu augaugaua 1938619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 386aucaucauag guggucaug 1938719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 387caugaccacc uaugaugau 1938819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 388ucaucauagg uggucaugc 1938919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 389gcaugaccac cuaugauga 1939019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 390caucauaggu ggucaugcu 1939119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 391agcaugacca ccuaugaug 1939219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 392aucauaggug gucaugcuu 1939319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 393aagcaugacc accuaugau 1939419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 394ucauaggugg ucaugcuua 1939519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 395uaagcaugac caccuauga 1939619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 396cauagguggu caugcuuau 1939719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 397auaagcauga ccaccuaug 1939819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 398auaggugguc augcuuaug 1939919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 399cauaagcaug accaccuau 1940019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 400uaggugguca ugcuuaugg 1940119RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 401ccauaagcau gaccaccua 1940219RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 402agguugucau gcuuauggg 1940319RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 403cccauaagca ugaccaccu 1940419RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 404gguugucaug cuuaugggg 1940519RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 405ccccauaagc augaccacc 1940619RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 406guugucaugc uuaugggga 1940719RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 407uccccauaag caugaccac 1940819RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 408uugucaugcu uauggggau 1940919RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 409auccccauaa gcaugacca 1941019RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 410aaccuaucau cauaggucg
1941119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 411cgaccuauga ugauagguu
1941219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 412accuaucauc auaggucgu
1941319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 413acgaccuaug augauaggu
1941419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 414ccuaucauca uaggucguc
1941519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 415gacgaccuau gaugauagg
1941619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 416cuaucaucau aggucguca
1941719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 417ugacgaccua ugaugauag
1941819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 418uaucaucaua ggucgucau
1941919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 419augacgaccu augaugaua
1942019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 420aucaucauag gucgucaug
1942119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 421caugacgacc uaugaugau
1942219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 422ucaucauagg ucgucaugc
1942319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 423gcaugacgac cuaugauga
1942419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 424caucauaggu cgucaugcu
1942519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 425agcaugacga ccuaugaug
1942619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 426aucauagguc gucaugcuu
1942719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 427aagcaugacg accuaugau
1942819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 428ucauaggucg ucaugcuua
1942919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 429uaagcaugac gaccuauga
1943019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 430cauaggucgu caugcuuau
1943119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 431auaagcauga cgaccuaug
1943219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 432auaggucguc augcuuaug
1943319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 433cauaagcaug acgaccuau
1943419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 434uaggucguca ugcuuaugg
1943519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 435ccauaagcau gacgaccua
1943619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 436aggucgucau gcuuauggg
1943719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 437cccauaagca ugacgaccu
1943819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 438ggucgucaug cuuaugggg
1943919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 439ccccauaagc augacgacc
1944019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 440gucgucaugc uuaugggga
1944119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 441uccccauaag caugacgac
1944219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 442ucgucaugcu uauggggau
1944319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 443auccccauaa gcaugacga
1944419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 444aaccuaucau cauaggucu
1944519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 445agaccuauga ugauagguu
1944619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 446accuaucauc auaggucuu
1944719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 447aagaccuaug augauaggu
1944819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 448ccuaucauca uaggucuuc
1944919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 449gaagaccuau gaugauagg
1945019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 450cuaucaucau aggucuuca
1945119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 451ugaagaccua ugaugauag
1945219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 452uaucaucaua ggucuucau
1945319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 453augaagaccu augaugaua
1945419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 454aucaucauag gucuucaug
1945519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 455caugaagacc uaugaugau
1945619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 456ucaucauagg ucuucaugc
1945719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 457gcaugaagac cuaugauga
1945819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 458caucauaggu cuucaugcu
1945919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 459agcaugaaga ccuaugaug
1946019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 460aucauagguc uucaugcuu
1946119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 461aagcaugaag accuaugau
1946219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 462ucauaggucu ucaugcuua
1946319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 463uaagcaugaa gaccuauga
1946419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 464cauaggucuu caugcuuau
1946519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 465auaagcauga agaccuaug
1946619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 466auaggucuuc augcuuaug
1946719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 467cauaagcaug aagaccuau
1946819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 468uaggucuuca ugcuuaugg
1946919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 469ccauaagcau gaagaccua
1947019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 470aggucuucau gcuuauggg
1947119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 471cccauaagca ugaagaccu
1947219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 472ggucuucaug cuuaugggg
1947319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 473ccccauaagc augaagacc
1947419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 474gucuucaugc uuaugggga
1947519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 475uccccauaag caugaagac
1947619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 476ucuucaugcu uauggggau
1947719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 477auccccauaa gcaugaaga
1947819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 478gugaugagau gacccguau
1947919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 479auacggguca ucucaucac
1948019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 480gaugagauga cccguauua
1948119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 481uaauacgggu caucucauc
1948219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 482cguauuaucu ggcaguuca
1948319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 483ugaacugcca gauaauacg
1948419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 484ggcaguucau caaggagaa
1948519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 485uucuccuuga ugaacugcc
1948619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 486guguggaaga guucaagcu
1948719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 487agcuugaacu cuuccacac
1948819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 488guggaagagu ucaagcuga
1948919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 489ucagcuugaa cucuuccac
1949019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 490gaagaguuca agcugaaga
1949119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 491ucuucagcuu gaacucuuc
1949219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 492caguaugcca uccagaaga
1949319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 493ucuucuggau ggcauacug
1949419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 494cuguacauga gcaccaaga
1949519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 495ucuuggugcu cauguacag
1949619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 496gcaccaagaa caccauacu
1949719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 497aguauggugu ucuuggugc
1949819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 498ccauacugaa agccuacga
1949919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 499ucguaggcuu ucaguaugg
1950019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 500cauacugaaa gccuacgau
1950119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 501aucguaggcu uucaguaug
1950219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 502guuucaagga caucuucca
1950319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 503uggaagaugu ccuugaaac
1950419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 504ccgacuucga caagaauaa
1950519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 505uuauucuugu cgaagucgg
1950619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 506gacuucgaca agaauaaga
1950719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 507ucuuauucuu gucgaaguc
1950819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 508gacaagaaua agaucuggu
1950919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 509accagaucuu auucuuguc
1951019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 510ggcucauuga ugacauggu
1951119RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 511accaugucau
caaugagcc 1951219RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 512gcaagaacua ugacggaga
1951319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 513ucuccgucau aguucuugc
1951419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 514caagaacuau gacggagau
1951519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 515aucuccguca uaguucuug
1951619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 516gagaugugca gucagacau
1951719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 517augucugacu gcacaucuc
1951819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 518cugaugggaa gacgauuga
1951919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 519ucaaucgucu ucccaucag
1952019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 520gcaaugugaa gcugaacga
1952119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 521ucguucagcu ucacauugc
1952219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 522cuguaauuua uauugcccu
1952319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 523agggcaauau aaauuacag
1952419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 524cauggugcca uauuuagcu
1952519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 525agcuaaauau ggcaccaug
1952619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 526ggugccauau uuagcuacu
1952719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 527aguagcuaaa uauggcacc
1952819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 528gugccauauu uagcuacua
1952919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 529uaguagcuaa auauggcac
1953019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 530gccauauuua gcuacuaaa
1953119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 531uuuaguagcu aaauauggc
1953219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 532gcccaucacc auuggcagg
1953319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 533ccugccaaug gugaugggc
1953419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 534cccaucacca uuggcaggc
1953519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 535gccugccaau ggugauggg
1953619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 536ccaucaccau uggcaggca
1953719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 537ugccugccaa uggugaugg
1953819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 538caucaccauu ggcaggcac
1953919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 539gugccugcca auggugaug
1954019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 540aucaccauug gcaggcacg
1954119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 541cgugccugcc aauggugau
1954219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 542ucaccauugg caggcacgc
1954319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 543gcgugccugc caaugguga
1954419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 544caccauuggc aggcacgcc
1954519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 545ggcgugccug ccaauggug
1954619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 546accauuggca ggcacgccc
1954719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 547gggcgugccu gccaauggu
1954819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 548ccauuggcag gcacgccca
1954919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 549ugggcgugcc ugccaaugg
1955019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 550cauuggcagg cacgcccau
1955119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 551augggcgugc cugccaaug
1955219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 552auuggcaggc acgcccaug
1955319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 553caugggcgug ccugccaau
1955419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 554uuggcaggca cgcccaugg
1955519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 555ccaugggcgu gccugccaa
1955619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 556uggcaggcac gcccauggc
1955719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 557gccaugggcg ugccugcca
1955819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 558ggcaggcacg cccauggcg
1955919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 559cgccaugggc gugccugcc
1956019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 560gcaggcacgc ccauggcga
1956119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 561ucgccauggg cgugccugc
1956219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 562caggcacgcc cauggcgac
1956319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 563gucgccaugg gcgugccug
1956419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 564aggcacgccc auggcgacc
1956519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 565ggucgccaug ggcgugccu
1956619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 566gcccaucacc auuggcggg
1956719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 567cccgccaaug gugaugggc
1956819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 568cccaucacca uuggcgggc
1956919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 569gcccgccaau ggugauggg
1957019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 570ccaucaccau uggcgggca
1957119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 571ugcccgccaa uggugaugg
1957219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 572caucaccauu ggcgggcac
1957319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 573gugcccgcca auggugaug
1957419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 574aucaccauug gcgggcacg
1957519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 575cgugcccgcc aauggugau
1957619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 576ucaccauugg cgggcacgc
1957719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 577gcgugcccgc caaugguga
1957819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 578caccauuggc gggcacgcc
1957919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 579ggcgugcccg ccaauggug
1958019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 580accauuggcg ggcacgccc
1958119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 581gggcgugccc gccaauggu
1958219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 582ccauuggcgg gcacgccca
1958319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 583ugggcgugcc cgccaaugg
1958419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 584cauuggcggg cacgcccau
1958519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 585augggcgugc ccgccaaug
1958619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 586auuggcgggc acgcccaug
1958719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 587caugggcgug cccgccaau
1958819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 588uuggcgggca cgcccaugg
1958919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 589ccaugggcgu gcccgccaa
1959019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 590uggcgggcac gcccauggc
1959119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 591gccaugggcg ugcccgcca
1959219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 592ggcgggcacg cccauggcg
1959319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 593cgccaugggc gugcccgcc
1959419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 594gcgggcacgc ccauggcga
1959519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 595ucgccauggg cgugcccgc
1959619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 596cgggcacgcc cauggcgac
1959719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 597gucgccaugg gcgugcccg
1959819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 598gggcacgccc auggcgacc
1959919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 599ggucgccaug ggcgugccc
1960019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 600gcccaucacc auuggcugg
1960119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 601ccagccaaug gugaugggc
1960219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 602cccaucacca uuggcuggc
1960319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 603gccagccaau ggugauggg
1960419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 604ccaucaccau uggcuggca
1960519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 605ugccagccaa uggugaugg
1960619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 606caucaccauu ggcuggcac
1960719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 607gugccagcca auggugaug
1960819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 608aucaccauug gcuggcacg
1960919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 609cgugccagcc aauggugau
1961019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 610ucaccauugg cuggcacgc
1961119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 611gcgugccagc
caaugguga 1961219RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 612caccauuggc uggcacgcc
1961319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 613ggcgugccag ccaauggug
1961419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 614accauuggcu ggcacgccc
1961519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 615gggcgugcca gccaauggu
1961619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 616ccauuggcug gcacgccca
1961719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 617ugggcgugcc agccaaugg
1961819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 618cauuggcugg cacgcccau
1961919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 619augggcgugc cagccaaug
1962019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 620auuggcuggc acgcccaug
1962119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 621caugggcgug ccagccaau
1962219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 622uuggcuggca cgcccaugg
1962319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 623ccaugggcgu gccagccaa
1962419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 624uggcuggcac gcccauggc
1962519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 625gccaugggcg ugccagcca
1962619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 626ggcuggcacg cccauggcg
1962719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 627cgccaugggc gugccagcc
1962819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 628gcuggcacgc ccauggcga
1962919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 629ucgccauggg cgugccagc
1963019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 630cuggcacgcc cauggcgac
1963119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 631gucgccaugg gcgugccag
1963219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 632uggcacgccc auggcgacc
1963319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 633ggucgccaug ggcgugcca
1963419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 634gcccaucacc auuggcaag
1963519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 635cuugccaaug gugaugggc
1963619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 636cccaucacca uuggcaagc
1963719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 637gcuugccaau ggugauggg
1963819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 638ccaucaccau uggcaagca
1963919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 639ugcuugccaa uggugaugg
1964019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 640caucaccauu ggcaagcac
1964119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 641gugcuugcca auggugaug
1964219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 642aucaccauug gcaagcacg
1964319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 643cgugcuugcc aauggugau
1964419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 644ucaccauugg caagcacgc
1964519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 645gcgugcuugc caaugguga
1964619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 646caccauuggc aagcacgcc
1964719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 647ggcgugcuug ccaauggug
1964819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 648accauuggca agcacgccc
1964919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 649gggcgugcuu gccaauggu
1965019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 650ccauuggcaa gcacgccca
1965119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 651ugggcgugcu ugccaaugg
1965219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 652cauuggcaag cacgcccau
1965319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 653augggcgugc uugccaaug
1965419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 654auuggcaagc acgcccaug
1965519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 655caugggcgug cuugccaau
1965619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 656uuggcaagca cgcccaugg
1965719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 657ccaugggcgu gcuugccaa
1965819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 658uggcaagcac gcccauggc
1965919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 659gccaugggcg ugcuugcca
1966019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 660ggcaagcacg cccauggcg
1966119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 661cgccaugggc gugcuugcc
1966219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 662gcaagcacgc ccauggcga
1966319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 663ucgccauggg cgugcuugc
1966419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 664caagcacgcc cauggcgac
1966519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 665gucgccaugg gcgugcuug
1966619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 666aagcacgccc auggcgacc
1966719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 667ggucgccaug ggcgugcuu
1966819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 668gcccaucacc auuggcacg
1966919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 669cgugccaaug gugaugggc
1967019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 670cccaucacca uuggcacgc
1967119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 671gcgugccaau ggugauggg
1967219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 672ccaucaccau uggcacgca
1967319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 673ugcgugccaa uggugaugg
1967419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 674caucaccauu ggcacgcac
1967519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 675gugcgugcca auggugaug
1967619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 676aucaccauug gcacgcacg
1967719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 677cgugcgugcc aauggugau
1967819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 678ucaccauugg cacgcacgc
1967919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 679gcgugcgugc caaugguga
1968019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 680caccauuggc acgcacgcc
1968119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 681ggcgugcgug ccaauggug
1968219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 682accauuggca cgcacgccc
1968319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 683gggcgugcgu gccaauggu
1968419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 684ccauuggcac gcacgccca
1968519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 685ugggcgugcg ugccaaugg
1968619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 686cauuggcacg cacgcccau
1968719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 687augggcgugc gugccaaug
1968819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 688auuggcacgc acgcccaug
1968919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 689caugggcgug cgugccaau
1969019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 690uuggcacgca cgcccaugg
1969119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 691ccaugggcgu gcgugccaa
1969219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 692uggcacgcac gcccauggc
1969319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 693gccaugggcg ugcgugcca
1969419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 694ggcacgcacg cccauggcg
1969519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 695cgccaugggc gugcgugcc
1969619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 696gcacgcacgc ccauggcga
1969719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 697ucgccauggg cgugcgugc
1969819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 698cacgcacgcc cauggcgac
1969919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 699gucgccaugg gcgugcgug
1970019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 700acgcacgccc auggcgacc
1970119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 701ggucgccaug ggcgugcgu
1970219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 702gcccaucacc auuggcaug
1970319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 703caugccaaug gugaugggc
1970419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 704cccaucacca uuggcaugc
1970519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 705gcaugccaau ggugauggg
1970619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 706ccaucaccau uggcaugca
1970719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 707ugcaugccaa uggugaugg
1970819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 708caucaccauu ggcaugcac
1970919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 709gugcaugcca auggugaug
1971019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 710aucaccauug gcaugcacg
1971119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 711cgugcaugcc aauggugau
1971219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 712ucaccauugg caugcacgc
1971319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 713gcgugcaugc caaugguga
1971419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 714caccauuggc augcacgcc
1971519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 715ggcgugcaug ccaauggug
1971619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 716accauuggca ugcacgccc
1971719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 717gggcgugcau gccaauggu
1971819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 718ccauuggcau gcacgccca
1971919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 719ugggcgugca ugccaaugg
1972019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 720cauuggcaug cacgcccau
1972119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 721augggcgugc augccaaug
1972219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 722auuggcaugc acgcccaug
1972319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 723caugggcgug caugccaau
1972419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 724uuggcaugca cgcccaugg
1972519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 725ccaugggcgu gcaugccaa
1972619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 726uggcaugcac gcccauggc
1972719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 727gccaugggcg ugcaugcca
1972819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 728ggcaugcacg cccauggcg
1972919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 729cgccaugggc gugcaugcc
1973019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 730gcaugcacgc ccauggcga
1973119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 731ucgccauggg cgugcaugc
1973219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 732caugcacgcc cauggcgac
1973319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 733gucgccaugg gcgugcaug
1973419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 734augcacgccc auggcgacc
1973519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 735ggucgccaug ggcgugcau
1973619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 736gcccaucacc auuggcagc
1973719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 737gcugccaaug gugaugggc
1973819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 738cccaucacca uuggcagcc
1973919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 739ggcugccaau ggugauggg
1974019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 740ccaucaccau uggcagcca
1974119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 741uggcugccaa uggugaugg
1974219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 742caucaccauu ggcagccac
1974319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 743guggcugcca auggugaug
1974419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 744aucaccauug gcagccacg
1974519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 745cguggcugcc aauggugau
1974619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 746ucaccauugg cagccacgc
1974719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 747gcguggcugc caaugguga
1974819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 748caccauuggc agccacgcc
1974919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 749ggcguggcug ccaauggug
1975019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 750accauuggca gccacgccc
1975119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 751gggcguggcu gccaauggu
1975219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 752ccauuggcag ccacgccca
1975319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 753ugggcguggc ugccaaugg
1975419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 754cauuggcagc cacgcccau
1975519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 755augggcgugg cugccaaug
1975619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 756auuggcagcc acgcccaug
1975719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 757caugggcgug gcugccaau
1975819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 758uuggcagcca cgcccaugg
1975919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 759ccaugggcgu ggcugccaa
1976019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 760uggcagccac gcccauggc
1976119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 761gccaugggcg uggcugcca
1976219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 762ggcagccacg cccauggcg
1976319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 763cgccaugggc guggcugcc
1976419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 764gcagccacgc ccauggcga
1976519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 765ucgccauggg cguggcugc
1976619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 766cagccacgcc cauggcgac
1976719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 767gucgccaugg gcguggcug
1976819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 768agccacgccc auggcgacc
1976919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 769ggucgccaug ggcguggcu
1977019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 770gcccaucacc auuggcagu
1977119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 771acugccaaug gugaugggc
1977219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 772cccaucacca uuggcaguc
1977319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 773gacugccaau ggugauggg
1977419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 774ccaucaccau uggcaguca
1977519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 775ugacugccaa uggugaugg
1977619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 776caucaccauu ggcagucac
1977719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 777gugacugcca auggugaug
1977819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 778aucaccauug gcagucacg
1977919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 779cgugacugcc aauggugau
1978019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 780ucaccauugg cagucacgc
1978119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 781gcgugacugc caaugguga
1978219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 782caccauuggc agucacgcc
1978319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 783ggcgugacug ccaauggug
1978419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 784accauuggca gucacgccc
1978519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 785gggcgugacu gccaauggu
1978619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 786ccauuggcag ucacgccca
1978719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 787ugggcgugac ugccaaugg
1978819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 788cauuggcagu cacgcccau
1978919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 789augggcguga cugccaaug
1979019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 790auuggcaguc acgcccaug
1979119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 791caugggcgug acugccaau
1979219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 792uuggcaguca cgcccaugg
1979319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 793ccaugggcgu gacugccaa
1979419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 794uggcagucac gcccauggc
1979519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 795gccaugggcg ugacugcca
1979619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 796ggcagucacg cccauggcg
1979719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 797cgccaugggc gugacugcc
1979819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 798gcagucacgc ccauggcga
1979919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 799ucgccauggg cgugacugc
1980019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 800cagucacgcc cauggcgac
1980119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 801gucgccaugg gcgugacug
1980219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 802agucacgccc auggcgacc
1980319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 803ggucgccaug ggcgugacu 19804489DNAHomo
sapiens 804gcataatgag ctctatatgc catcactgca gttgtaggtt ataactatcc
atttgtctga 60aaaactttgc ttctaatttt tctctttcaa gctatgattt aggcatagag
aatcgtgatg 120ccaccaacga ccaagtcacc aaggatgctg cagaagctat
aaagaagcat aatgttggcg 180tcaaatgtgc cactatcact cctgatgaga
agagggttga ggagttcaag ttgaaacaaa 240tgtggaaatc accaaatggc
accatacgaa atattctggg tggcacggtc ttcagagaag 300ccattatctg
caaaaatatc ccccggcttg tgagtggatg ggtaaaacct atcatcatag
360gtcgtcatgc ttatggggat caagtaagtc atgttggcaa taatgtgatt
ttgcatgbtg 420gcccagaaat ttccaacttg tatgtgtttt attcttatct
tttggtatct acacccatta 480agcaaggta 489
* * * * *