U.S. patent application number 16/825997 was filed with the patent office on 2020-09-03 for combination therapy of an hbv capsid assembly inhibitor and an interferon.
This patent application is currently assigned to Hoffmann-La Roche Inc.. The applicant listed for this patent is Hoffmann-La Roche Inc.. Invention is credited to Lu Gao, Isabel Najera, Fang Shen, Hong Shen, Liping Shi, Steffen Wildum, Guang Yang.
Application Number | 20200276198 16/825997 |
Document ID | / |
Family ID | 1000004827997 |
Filed Date | 2020-09-03 |
![](/patent/app/20200276198/US20200276198A1-20200903-C00001.png)
![](/patent/app/20200276198/US20200276198A1-20200903-C00002.png)
![](/patent/app/20200276198/US20200276198A1-20200903-C00003.png)
![](/patent/app/20200276198/US20200276198A1-20200903-C00004.png)
![](/patent/app/20200276198/US20200276198A1-20200903-C00005.png)
![](/patent/app/20200276198/US20200276198A1-20200903-C00006.png)
![](/patent/app/20200276198/US20200276198A1-20200903-C00007.png)
![](/patent/app/20200276198/US20200276198A1-20200903-C00008.png)
![](/patent/app/20200276198/US20200276198A1-20200903-C00009.png)
![](/patent/app/20200276198/US20200276198A1-20200903-C00010.png)
![](/patent/app/20200276198/US20200276198A1-20200903-C00011.png)
View All Diagrams
United States Patent
Application |
20200276198 |
Kind Code |
A1 |
Gao; Lu ; et al. |
September 3, 2020 |
COMBINATION THERAPY OF AN HBV CAPSID ASSEMBLY INHIBITOR AND AN
INTERFERON
Abstract
The present invention is directed to compositions and methods
for treating hepatitis B virus infection. In particular, the
present invention is directed to a combination therapy comprising
administration of an HBV capsid assembly inhibitor and an
interferon for use in the treatment of hepatitis B virus
infections.
Inventors: |
Gao; Lu; (Shanghai, CN)
; Najera; Isabel; (Basel, CH) ; Shen; Hong;
(Shanghai, CN) ; Shen; Fang; (Shanghai, CN)
; Shi; Liping; (Shanghai, CN) ; Wildum;
Steffen; (Basel, CH) ; Yang; Guang; (Shanghai,
CN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Hoffmann-La Roche Inc. |
Little Falls |
NJ |
US |
|
|
Assignee: |
Hoffmann-La Roche Inc.
Little Falls
NJ
|
Family ID: |
1000004827997 |
Appl. No.: |
16/825997 |
Filed: |
March 20, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15970128 |
May 3, 2018 |
10596173 |
|
|
16825997 |
|
|
|
|
PCT/EP2016/076195 |
Oct 31, 2016 |
|
|
|
15970128 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/5377 20130101;
A61K 31/506 20130101; A61K 2300/00 20130101; A61K 38/212 20130101;
A61P 31/12 20180101 |
International
Class: |
A61K 31/506 20060101
A61K031/506; A61K 38/21 20060101 A61K038/21; A61P 31/12 20060101
A61P031/12; A61K 31/5377 20060101 A61K031/5377 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 3, 2015 |
CN |
PCT/CN2015/093688 |
Claims
1. (canceled)
2. A pharmaceutical composition comprising an HBV capsid assembly
inhibitor and an interferon, in a pharmaceutically acceptable
carrier, wherein the HBV capsid assembly inhibitor is a compound of
formula (I), ##STR00016## wherein: R.sup.1 is C.sub.1-6 alkyl or
trifluoromethyl-C.sub.xH.sub.2x--, wherein x is 1, 2, 3, 4, 5 or 6;
one of R.sup.2 and R.sup.3 is phenyl, which is once or twice or
three times substituted by C.sub.1-6 alkyl, cyano or halogen; and
the other one is hydrogen or deuterium; R.sup.4 is phenyl,
thiazolyl, oxazolyl, imidazolyl, thienyl or pyridinyl, which is
unsubstituted or substituted by C.sub.1-6alkyl, C.sub.1-6
alkylsulfanyl, halogen or cycloalkyl, wherein C.sub.1-6alkyl can be
further optionally substituted with halogen; A is ##STR00017##
which is unsubstituted or substituted by groups selected from
C.sub.1-6 alkyl, deuterium and halogen; or a pharmaceutically
acceptable salt, or enantiomer, or diastereomer thereof.
3. The pharmaceutical composition according to claim 2, wherein the
HBV capsid assembly inhibitor is selected from:
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid;
(R)-6-((S)-2-Carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-chloro-4-fl-
uoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester; or
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid or a pharmaceutically acceptable salt, or enantiomer, or
diastereomer thereof.
4. A pharmaceutical composition comprising an HBV capsid assembly
inhibitor and an interferon, in a pharmaceutically acceptable
carrier, wherein the HBV capsid assembly inhibitor is a compound of
formula (II): ##STR00018## wherein: R.sup.5 is C.sub.1-6alkyl;
R.sup.6 is phenyl, which is once or twice or three times
substituted by halogen or C.sub.1-6alkyl; R.sup.7 is hydrogen or
C.sub.1-6alkyl; R.sup.8 is bicyclic bridged heterocyclyl; or a
pharmaceutically acceptable salt, or tautomerism isomer, or
enantiomer, or diastereomer thereof.
5. The pharmaceutical composition according to claim 4, wherein the
HBV capsid assembly inhibitor is selected from:
2-[(1R,3S,5S)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid; and
2-[(1S,3R,5R)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid; or a pharmaceutically acceptable salt,
or tautomerism isomer, or enantiomer, or diastereomer thereof.
6. (canceled)
7. (canceled)
8. The pharmaceutical composition according to claim 2, wherein the
interferon is a non-conjugated interferon alfa or a pegylated
alfa-type interferon.
9. (canceled)
10. The pharmaceutical composition according to claim 2, wherein
the composition is selected from:
(S)-4-[(R)-6-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
Roferon A;
(R)-6-((S)-2-carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-chloro-4-
-fluoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester and Roferon A;
(2R,3S)-4-[(R)-6-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid and Roferon A;
(S)-4-[(R)-6-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
Intron A;
(R)-6-((S)-2-carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-chloro-4-
-fluoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester and Intron A;
(2R,3S)-4-[(R)-6-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid and Intron A;
(S)-4-[(R)-6-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
Pegasys;
(R)-6-((S)-2-carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-ch-
loro-4-fluoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester and Pegasys;
(2R,3S)-4-[(R)-6-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid and Pegasys;
(S)-4-[(R)-6-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
Pegasys;
(R)-6-((S)-2-carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-ch-
loro-4-fluoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester and Pegasys; and
(2R,3S)-4-[(R)-6-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid and Pegasys; in a pharmaceutically acceptable carrier.
11. The pharmaceutical composition according to claim 2, wherein
the composition consists of:
(S)-4-[(R)-6-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
Roferon A; or
(2R,3S)-4-[(R)-6-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thia-
zol-2-yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxyli-
c acid and Pegasys; in a pharmaceutically acceptable carrier.
12. (canceled)
13. (canceled)
14. (canceled)
15. (canceled)
16. (canceled)
17. (canceled)
18. (canceled)
19. (canceled)
20. (canceled)
21. A kit comprising a container that contains an HBV capsid
assembly inhibitor and an interferon, wherein the HBV capsid
assembly inhibitor is a compound of formula (I) ##STR00019##
wherein: R.sup.1 is C.sub.1-6 alkyl or
trifluoromethyl-C.sub.xH.sub.2x--, wherein x is 1, 2, 3, 4, 5 or 6;
one of R.sup.2 and R.sup.3 is phenyl, which is once or twice or
three times substituted by C.sub.1-6 alkyl, cyano or halogen; and
the other one is hydrogen or deuterium; R.sup.4 is phenyl,
thiazolyl, oxazolyl, imidazolyl, thienyl or pyridinyl, which is
unsubstituted or substituted by C.sub.1-6alkyl,
C.sub.1-6alkylsulfanyl, halogen or cycloalkyl, wherein
C.sub.1-6alkyl can be further optionally substituted with halogen;
A is ##STR00020## which is unsubstituted or substituted by groups
selected from C.sub.1-6alkyl, deuterium and halogen; or a
pharmaceutically acceptable salt, or enantiomer, or diastereomer
thereof.
22. The kit according to claim 21, further comprising a sterile
diluent.
23. The kit according to claim 21, further comprising a package
insert comprising printed instructions directing the use of a
combined treatment of the HBV capsid assembly inhibitor and the
interferon as a method for treatment or prophylaxis of hepatitis B
virus infection.
24. The kit according to claim 21, wherein the HBV capsid assembly
inhibitor is selected from the group consisting of:
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid;
(R)-6-((S)-2-Carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-chloro-4-fl-
uoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester; and
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid; or a pharmaceutically acceptable salt, or enantiomer, or
diastereomer thereof.
25. The kit according to claim 21, wherein the interferon is a
non-conjugated interferon alfa or a pegylated alfa-type
interferon.
26. The kit according to claim 21, wherein the HBV capsid assembly
inhibitor and the interferon used in the container are selected
from the group consisting of:
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
Roferon A;
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-
-2-yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid and Pegasys; in a pharmaceutically acceptable carrier.
27. A method for treatment or prophylaxis of hepatitis B virus
infection, the method comprising: administering to a subject an
effective first amount of an HBV capsid assembly inhibitor, or a
pharmaceutically acceptable salt, enantiomer or diastereomer
thereof; and a second amount of an interferon, wherein the HBV
capsid assembly inhibitor is a compound of formula (I) ##STR00021##
wherein: R.sup.1 is C.sub.1-6 alkyl or
trifluoromethyl-C.sub.xH.sub.2x--, wherein x is 1, 2, 3, 4, 5 or 6;
one of R.sup.2 and R.sup.3 is phenyl, which is once or twice or
three times substituted by C.sub.1-6 alkyl, cyano or halogen; and
the other one is hydrogen or deuterium; R.sup.4 is phenyl,
thiazolyl, oxazolyl, imidazolyl, thienyl or pyridinyl, which is
unsubstituted or substituted by C.sub.1-6alkyl,
C.sub.1-6alkylsulfanyl, halogen or cycloalkyl, wherein
C.sub.1-6alkyl can be further optionally substituted with halogen;
A is ##STR00022## which is unsubstituted or substituted by groups
selected from C.sub.1-6alkyl, deuterium and halogen; or a
pharmaceutically acceptable salt, or enantiomer, or diastereomer
thereof.
28. The method according to claim 27, wherein the HBV capsid
assembly inhibitor is selected from the group consisting of:
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid;
(R)-6-((S)-2-Carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-chloro-4-fl-
uoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester; and
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid; or a pharmaceutically acceptable salt, or enantiomer, or
diastereomer thereof.
29. The method according to claim 27, wherein the interferon is a
non-conjugated interferon alfa or a pegylated alfa-type
interferon.
30. The method according to claim 27, wherein the HBV capsid
assembly inhibitor and the interferon used in the subject are:
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
Roferon A; or
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thia-
zol-2-yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxyli-
c acid and Pegasys; in a pharmaceutically acceptable carrier.
31. (canceled)
32. (canceled)
33. (canceled)
34. The pharmaceutical composition according to claim 2, wherein
the interferon is Roferon A, Intron A, Pegasys or PegIntron.
35. The pharmaceutical composition according to claim 2, wherein
the interferon is Roferon A or Pegasys.
36. The kit according to claim 25, wherein the interferon is
Roferon A, Intron A, Pegasys or PegIntron.
37. The kit according to claim 25, wherein the interferon is
Roferon A or Pegasys.
38. The method according to claim 27, wherein the interferon is
Roferon A, Intron A, Pegasys or PegIntron.
39. The method according to claim 27, wherein the interferon is
Roferon A or Pegasys.
40. The method according to claim 27, wherein the HBV capsid
assembly inhibitor and the interferon are co-administered in the
same formulation or different formulations.
41. The method according to claim 27, wherein the HBV capsid
assembly inhibitor and the interferon are administered to a subject
by the same route or different routes.
42. The method according to claim 27, wherein the HBV capsid
assembly inhibitor and the interferon are administered to a subject
by parenteral or oral administration.
43. The method according to claim 27, wherein the HBV capsid
assembly inhibitor and the interferon are administered
simultaneously or sequentially.
44. The pharmaceutical composition according to claim 4, wherein
the composition is selected from:
2-[(1R,3S,5S)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and Roferon A;
2-[(1S,3R,5R)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and Roferon A;
2-[(1R,3S,5S)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and Intron A;
2-[(1S,3R,5R)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and Intron A;
2-[(1R,3S,5S)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and Pegasys;
2-[(1S,3R,5R)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and Pegasys;
2-[(1R,3S,5S)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and PegIntron; and
2-[(1S,3R,5R)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and PegIntron; in a pharmaceutically
acceptable carrier.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 15/970,128, now U.S. Pat. No. 10,596,173 which is a
continuation of International Application No. PCT/EP2016/076195,
filed Oct. 31, 2016, which claims priority to Application No.
PCT/CN2015/093688, filed Nov. 3, 2015, each of which is
incorporated herein by reference in its entirety.
TECHNICAL FIELD
[0002] The present invention is directed to compositions and
methods for treating hepatitis B virus infection. In particular,
the present invention is directed to a combination therapy
comprising administration of an HBV capsid assembly inhibitor and
an interferon for use in the treatment of hepatitis B virus
infections.
SEQUENCE LISTING
[0003] This application contains a Sequence Listing which has been
submitted via EFS-Web, and is hereby incorporated by reference in
its entirety. Said ASCII copy, created on Oct. 10, 2019, is named
P33189-US-1_Sequencelisting.txt and is 1,782 bytes in size.
BACKGROUND
[0004] Chronic infection of Hepatitis B virus (HBV) is a serious
public health problem, with more than 240 million people
chronically infected worldwide. HBV belongs to the Hepadnaviridae
family and has an icosahedral core comprising 240 copies of the
capsid (or core) protein. The predominant biological function of
capsid protein is to act as a structural protein to encapsidate
pre-genomic RNA and to form immature capsid particles in the
cytoplasm. This step is prerequisite for viral DNA replication.
Following entry into hepatocyte, its viral genome is delivered into
nucleus where a covalently closed circular DNA (cccDNA) is formed
through DNA repair of partially double-stranded viral genome. The
cccDNA in turn serves as the template for transcription of viral
RNAs. Viral pre-genomic RNA interacts with other two viral
components, capsid protein and polymerase to form capsid particles
where viral DNA replication occurs. When a near full-length relaxed
circular DNA is formed through reverse-transcription of viral
pregenomic RNA, an immature capsid becomes a mature capsid. Most
copies of the encapsidated genome are efficiently associated with
cellular lipids and viral envelope proteins (S, M, and L) for
virion assembly and secretion. However, non-infectious particles
are also produced that greatly outnumber the infectious virions.
These empty, enveloped particles are referred as subviral particles
(SVPs). The S, M and L envelope proteins are expressed from a
single ORF (open reading frame) that contains three different start
codons. All three proteins share a 226aa sequence, the S-domain, at
their C-termini. S-domain contains the HBsAg epitope (Lambert, C.
& R. Prange. Virol J, 2007, 4, 45).
[0005] Many observations showed that several HBV viral proteins
could counteract the initial host cellular response by interfering
with the viral recognition signaling system and subsequently the
interferon (IFN) antiviral activity. Among these, the excessive
secretion of HBV empty subviral particles may participate to the
maintenance of the immunological tolerant state observed in
chronically infected patients (CHB). The persistent exposure to
HBsAg and other viral antigens can lead to HBV-specific T-cell
deletion or to progressive functional impairment (Kondo et al.
Journal of Immunology 1993, 150, 4659-4671; Kondo et al. Journal of
Medical Virology 2004, 74, 425-433; Fisicaro et al.
Gastroenterology, 2010, 138, 682-93). Moreover HBsAg has been
reported to suppress the function of immune cells such as
monocytes, dendritic cells (DCs) and natural killer (NK) cells by
direct interaction (Op den Brouw et al. Immunology, 2009b, 126,
280-9; Woltman et al. PLoS One, 2011, 6, e15324; Shi et al. J Viral
Hepat. 2012, 19, e26-33; Kondo et al. ISRN Gasteroenterology, 2013,
Article ID 935295).
[0006] It has been well studied that HBV capsid protein plays
essential roles in HBV replication. Heteroaryldihydropyrimidines or
HAP, including compounds named Bay 41-4109, Bay 38-7690 and Bay
39-5493, were discovered in a tissue culture-based screening (Deres
K. et al. Science 2003, 893). These HAP analogs act as synthetic
allosteric activators and are able to induce aberrant capsid
formation that leads to degradation of the core protein. HAP
analogs also reorganized core protein from preassembled capsids
into noncapsid polymers, presumably by interaction of HAP with
dimers freed during capsid `breathing`, the transitory breaking of
individual inter-subunit bonds. Bay 41-4109 was administered to HBV
infected transgenic mouse model or humanized mouse models and
demonstrated in vivo efficacy with HBV DNA reduction (Deres K. et
al. Science 2003, 893; Brezillon N. et al. PLoS ONE 2011,
e25096).
[0007] The other first-line treatment for hepatitis B is
IFN-.alpha. (interferon alpha), albeit it is limited by its poor,
long-term response, and side effects. IFN-.alpha., as a front-line
host defense against viral infections, is known to induce
interferon-stimulated genes (ISGs), which play a diverse and
pleiotropic role in targeting various viral functions at different
steps of viral replication cycle, thereby potently suppressing
viral infection. In addition, IFN-.alpha. has an immunomodulatory
effect that can indirectly inhibit HBV replication by affecting
cell-mediated immunity in vivo (Micco L., et al., J. Hepatol, 2013,
58, 225-233). Even though IFN-administration has shown to inhibit
HBV replication in vitro and in vivo (Christen V., et al., J.
Virol. 2007, 81:159-165; Guan S. H., et al., J. Gastroenterol,
2007, 13:228-235; Wieland S. F., et al., J. Virol., 2000, 74,
4165-4173), a large number of individuals, particularly those
displaying high viral loads, respond poorly, suggesting that HBV
may have evolved mechanisms to antagonize the IFN response, as
alluded to earlier. Chronic HBV infection is generally
characterized by dysfunctional innate and adaptive immune responses
(Boni C., J. Virol., 2007, 81, 4215-4225). For example, in HBV
infected chimpanzees, IFN-.alpha., was not induced (Wieland S., et
al., Proc. Natl. Acad. Sci. USA, 2004, 101, 6669-6674). When
treated with Pegylated IFN-.alpha., the effectiveness of a
sustained virological response was achieved in only about 30% of
HBeAg-positive and 40% of HBeAg-negative cases in clinical studies
(Perrillo R., Hepatology, 2009, 49, S103-111; Janssen H. L., et
al., Lancet, 2005, 365, 123-129; Lau G. K., et al., N. Engl. J.
Med., 2005, 352, 2682-2695). The antiviral mechanisms of the
interferon alpha and the reasons for the differential therapeutic
response among the treated patients remain to be elucidated.
[0008] HBsAg is a biomarker for prognosis and treatment response in
chronic hepatitis B. The standard of clinic cure for HBV infection
is the loss and/or seroconversion of HBsAg. However current
therapies have demonstrated very low rates of HBsAg clearance,
comparable to those observed in placebos (Janssen et al. Lancet,
2005, 365, 123-9; Marcellin et al. N. Engl. J. Med., 2004, 351,
1206-17; Buster et al. Hepatology, 2007, 46, 388-94). Therefore, a
new therapy aiming to increase a success rate of inducing HBsAg
loss, and/or HBeAg loss, and/or HBV DNA reduction, and/or HBV
clearance and/or seroconversion, and/or normalization of ALT,
and/or promoting the production of anti-HBs is greatly in demand of
unmet medical need.
SUMMARY
[0009] The present invention relates to a pharmaceutical
composition comprising an HBV capsid assembly inhibitor and an
interferon, in a pharmaceutically acceptable carrier.
[0010] The "HBV capsid assembly inhibitor" herein is a compound of
formula (I), (II) or (III), or any one of the compounds disclosed
in patent WO2014/037480, WO 2014/184328 and WO2015/132276;
particularly the "HBV capsid assembly inhibitor" herein is
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid;
(R)-6-((S)-2-Carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-chloro-4-fl-
uoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester;
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid;
2-[(1R,3S,5S)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbon-
yl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicy-
clo[3.2.1]octan-3-yl]acetic acid;
2-[(1S,3R,5R)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid;
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
3-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
3-[(8aS)-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
4-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-3,3-dimethyl-butanoic acid;
(8S,8aR)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid; or
(8R,8aS)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid; or
pharmaceutically acceptable salt, or enantiomer, or diastereomer
thereof.
[0011] The "interferon" herein is selected from the group
consisting of interferon alpha, peginterferon-alpha 2a, recombinant
interferon alpha-2a, interferon alpha-2a, peginterferon alpha-2b,
recombinant interferon alpha-2b, interferon alpha-2b, glycosylated
interferon alpha-2b, interferon alpha-2b XL, recombinant interferon
alpha-2c, interferon alpha-2c, interferon beta, peginterferon
beta-1a, interferon beta-1a, interferon delta, peginterferon
lambda-1, interferon lambda, interferon omega, interferon tau,
gamma interferon, interferon alfacon-1, interferon alpha-n1,
interferon alpha-n3, albinterferon alpha-2b, BLX-883, DA-3021,
PEG-Infergen, and Belerofon. In one embodiment, the interferon is a
y-branched pegylated recombinant human interferon alpha-2b
injection (or Pai Ge Bin from Amoytop Biotech). In one embodiment,
the interferon is a non-conjugated interferon alfa or a pegylated
alfa-type interferon; particularly the interferon is Roferon A,
Intron A, Pegasys or PegIntron; more particularly the interferon is
Roferon A or Pegasys.
BRIEF DESCRIPTION OF THE FIGURES
[0012] FIG. 1: Isobologram of FIC for the pair-wise checkerboard
combination of Roferon and Compound 1 (at the 50% effect level).
The diagonal lane connecting points (0, 1) and (1, 0) represents
additivity (CI=1). Data points below this lane show synergism, data
points above show antagonism. Shown are mean values from 3
independent experiments.
[0013] FIG. 2: Isobologram of FIC for the pair-wise checkerboard
combination of Roferon and Compound 4 (at the 50% effect level).
The diagonal lane connecting points (0, 1) and (1, 0) represents
additivity (CI=1). Data points below this lane show synergism, data
points above show antagonism. Shown are mean values from 3
independent experiments.
[0014] FIG. 3: Effects of Compound 4 and Pegasys combination in PHH
cells. The left panel is the HBV DNA inhibition plot in the
presence of Compound 4 and Pegasys with corresponding drug
concentrations, and the inhibition percentage was calculated based
on non-treated infection controls (VC as 0% inhibition) and
positive drug controls (10 nM ETV as 100% inhibition); The additive
drug interactions derived from 95% confidence interval data was
shown in the right plot, which the calculated additive interactions
were subtracted from the experimentally determined values based on
average background, the peak is that with color indicate the level
of synergy or antagonism (% inhibition above additive), and
corresponding drug concentrations at which synergistic or
antagonism interactions affecting antiviral activity.
[0015] FIG. 4: Effects of Compound 3 and Pegasys combination in
HepaRG cells. The left panel is the HBV DNA inhibition plot in the
presence of Compound 3 and Pegasys with corresponding drug
concentrations, and the inhibition percentage was calculated based
on non-treated infection controls (VC as 0% inhibition) and
positive drug controls (10 nM ETV as 100% inhibition); The additive
drug interactions derived from 95% confidence interval data of
compound 3 and Pegasys was shown in the right plot, which the
calculated additive interactions were subtracted from the
experimentally determined values based on average background, the
peak is that with color indicate the level of synergy or antagonism
(% inhibition above additive), and corresponding drug
concentrations at which synergistic or antagonism interactions
affecting antiviral activity.
DETAILED DESCRIPTION
[0016] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention pertains.
[0017] As used herein, the term "C.sub.1-6alkyl" refers to a
monovalent linear or branched saturated hydrocarbon group of 1 to 6
carbon atoms. In particular embodiments, C.sub.1-6 alkyl has 1 to 6
carbon atoms, and in more particular embodiments 1 to 4 carbon
atoms. Examples of C.sub.1-6 alkyl include methyl, ethyl, propyl,
isopropyl, n-butyl, iso-butyl, sec-butyl or tert-butyl.
[0018] As used herein, the term "halo" or "halogen" are used
interchangeably herein and refer to fluoro, chloro, bromo, or
iodo.
[0019] The term "haloC.sub.1-6alkyl" refers to a C.sub.1-6alkyl
group wherein at least one of the hydrogen atoms of the
C.sub.1-6alkyl group has been replaced by same or different halogen
atoms, particularly fluoro atoms. Examples of haloC.sub.1-6alkyl
include monofluoro-, difluoro- or trifluoro-methyl, -ethyl or
-propyl, for example 3,3,3-trifluoropropyl, 2-fluoroethyl,
trifluoroethyl, fluoromethyl, difluoromethyl, difluoroethyl or
trifluoromethyl.
[0020] As used herein, the term "C.sub.1-6 alkoxy" refers to a
group of C.sub.1-6alkyl-O--, wherein the "C.sub.1-6alkyl" is as
defined above; for example methoxy, ethoxy, propoxy, iso-propoxy,
n-butoxy, iso-butoxy, 2-butoxy, tert-butoxy and the like.
Particular "C.sub.1-6 alkoxy" groups are methoxy and ethoxy and
more particularly methoxy.
[0021] As used herein, the term "C.sub.3-7 cycloalkyl" refers to a
saturated carbon ring containing from 3 to 7 carbon atoms,
particularly from 3 to 6 carbon atoms, for example, cyclopropyl,
cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and the like.
Particular "C.sub.3-7cycloalkyl" groups are cyclopropyl,
cyclopentyl and cyclohexyl.
[0022] As used herein, the term "heterocyclic" ring or
"heterocyclyl" refers to a saturated or partly unsaturated
monocyclic or bicyclic ring containing from 3 to 10 ring atoms
which can comprise one, two or three atoms selected from nitrogen,
oxygen and/or sulfur. Examples of monocyclic heterocyclyl rings
containing in particular from 3 to 7 ring atoms include, but not
limited to, aziridinyl, azetidinyl, oxetanyl, piperidinyl,
piperazinyl, azepinyl, diazepanyl, pyrrolidinyl, morpholinyl,
dihydrofuryl, tetrahydrofuryl, tetrahydropyranyl,
tetrahydrothiopyranyl and thiomorpholinyl. Bicyclic heterocyclyl
can be bicyclic fused ring or bicyclic bridged ring. Examples for
bicyclic heterocyclyl are 8-aza-bicyclo[3.2.1]octyl, quinuclidinyl,
8-oxa-3-aza-bicyclo[3.2.1]octyl, 9-aza-bicyclo[3.3.1]nonyl,
3-oxa-9-aza-bicyclo[3.3.1]nonyl, 3-thia-9-aza-bicyclo[3.3.1]nonyl,
or difluoroazabicyclo[3.2.1]octyl. Monocyclic and bicyclic
heterocyclyl can be further substituted by halogen, C.sub.1-6alkyl,
cyano, carboxy, carboxyC.sub.1-6alkyl.
[0023] As used herein, the term "diastereomer" refers to a
stereoisomer with two or more centers of chirality and whose
molecules are not mirror images of one another. Diastereomers have
different physical properties, e.g. melting points, boiling points,
spectral properties, activities and reactivities.
[0024] As used herein, the term "enantiomers" refers to two
stereoisomers of a compound which are non-superimposable mirror
images of one another.
[0025] As used herein, the term "pharmaceutically acceptable salts"
refers to salts which are not biologically or otherwise
undesirable. Pharmaceutically acceptable salts include both acid
and base addition salts.
[0026] As used herein, the term "prodrug" refers to a form or
derivative of a compound which is metabolized in vivo, e.g., by
biological fluids or enzymes by a subject after administration,
into a pharmacologically active form of the compound in order to
produce the desired pharmacological effect. Prodrugs are described
e.g. in the Organic Chemistry of Drug Design and Drug Action by
Richard B. Silverman, Academic Press, San Diego, 2004, Chapter 8
Prodrugs and Drug Delivery Systems, pp. 497-558.
[0027] The term "pharmaceutically acceptable acid addition salt"
refers to those pharmaceutically acceptable salts formed with
inorganic acids such as hydrochloric acid, hydrobromic acid,
sulfuric acid, nitric acid, carbonic acid, phosphoric acid, and
organic acids selected from aliphatic, cycloaliphatic, aromatic,
araliphatic, heterocyclic, carboxylic, and sulfonic classes of
organic acids such as formic acid, acetic acid, propionic acid,
glycolic acid, gluconic acid, lactic acid, pyruvic acid, oxalic
acid, malic acid, maleic acid, maloneic acid, succinic acid,
fumaric acid, tartaric acid, citric acid, aspartic acid, ascorbic
acid, glutamic acid, anthranilic acid, benzoic acid, cinnamic acid,
mandelic acid, embonic acid, phenylacetic acid, methanesulfonic
acid, ethanesulfonic acid, p-toluenesulfonic acid, and salicyclic
acid.
[0028] The term "pharmaceutically acceptable base addition salt"
refers to those pharmaceutically acceptable salts formed with an
organic or inorganic base. Examples of acceptable inorganic bases
include sodium, potassium, ammonium, calcium, magnesium, iron,
zinc, copper, manganese, and aluminum salts. Salts derived from
pharmaceutically acceptable organic nontoxic bases includes salts
of primary, secondary, and tertiary amines, substituted amines
including naturally occurring substituted amines, cyclic amines and
basic ion exchange resins, such as isopropylamine, trimethylamine,
diethylamine, triethylamine, tripropylamine, ethanolamine,
2-diethylaminoethanol, trimethamine, dicyclohexylamine, lysine,
arginine, histidine, caffeine, procaine, hydrabamine, choline,
betaine, ethylenediamine, glucosamine, methylglucamine,
theobromine, purines, piperizine, piperidine, N-ethylpiperidine,
and polyamine resins.
[0029] As used herein, "combo" refers to combination.
[0030] As used herein, "HBV DNA" refers to DNA material of HBV.
[0031] As used herein, "HBsAg" refers to hepatitis B surface
antigen.
[0032] As used herein, "HBeAg" refers to hepatitis B e antigen.
[0033] As used herein, "hepatitis B virus" or "HBV" refers to a
member of the Hepadnaviridae family having a small double-stranded
DNA genome of approximately 3,200 base pairs and a tropism for
liver cells. "HBV" includes hepatitis B virus that infects any of a
variety of mammalian (e.g., human, non-human primate, etc.) and
avian (duck, etc.) hosts. "HBV" includes any known HBV genotype,
e.g., serotype A, B, C, D, E, F, and G; any HBV serotype or HBV
subtype; any HBV isolate; HBV variants, e.g., HBeAg-negative
variants, drug-resistant HBV variants (e.g., lamivudine-resistant
variants; adefovir-resistant mutants; tenofovir-resistant mutants;
entecavir-resistant mutants; etc.); and the like.
[0034] As used herein, "HBV capsid assembly inhibitor" refers to a
compound that inhibits and/or disrupts and/or accelerates and/or
hinders and/or delays and or reduces and/or modifies normal HBV
capsid assembly (e.g., during maturation) and/or normal capsid
disassembly (e.g., during infectivity) and/or perturbs capsid
stability, thereby inducing aberrant capsid morphology and
function.
[0035] The term "therapeutically effective amount" refers to an
amount of a compound or molecule of the present invention that,
when administered to a subject, (i) treats or prevents the
particular disease, condition or disorder, (ii) attenuates,
ameliorates or eliminates one or more symptoms of the particular
disease, condition, or disorder, or (iii) prevents or delays the
onset of one or more symptoms of the particular disease, condition
or disorder described herein. The therapeutically effective amount
will vary depending on the compound, the disease state being
treated, the severity of the disease treated, the age and relative
health of the subject, the route and form of administration, the
judgment of the attending medical or veterinary practitioner, and
other factors.
[0036] The term "interferon" further includes conjugates, for
instance interferon alfa (IFN-.alpha.) conjugates that can be
prepared by coupling an interferon alfa to a water-soluble polymer.
A non-limiting list of such polymers includes other polyalkylene
oxide homopolymers such as polyethylene glycol (PEG), polypropylene
glycols, polyoxyethylenated polyols, copolymers thereof and block
copolymers thereof. As an alternative to polyalkylene oxide-based
polymers, effectively non-antigenic materials such as dextran,
polyvinylpyrrolidones, polyacrylamides, polyvinyl alcohols,
carbohydrate-based polymers and the like can be used. Such
interferon alfa-polymer conjugates are described in U.S. Pat. Nos.
4,766,106, 4,917,888, European Patent Application No, 0 236 987,
European Patent Application Nos. 0510 356, 0 593 868 and 0 809 996
(pegylated interferon alfa-2a) and International Publication No. WO
95/13090.
[0037] As used herein the term "pegylated" means covalent
conjugates of one or more polyethylene glycol (PEG) molecules and
one or more alpha- or beta-type interferon molecules. Preferred
conjugates for use in the formulations of the invention have one to
four PEG molecules per interferon molecule, and more preferably,
the conjugates are between a single PEG molecule and a single
interferon molecule. The pegylated interferon may comprise a single
positional isomer or a mixture of conjugate positional isomers,
e.g., the PEG molecules are covalently attached to different amino
acid residues on the individual interferon molecules. For example,
U.S. Pat. No. 5,951,974 describes the preparation of mixtures of
PEG-interferon alpha conjugate positional isomers in which some of
the isomers are conjugates between PEG and a histidine residue of
the interferon molecule, other isomers in the mixture are
conjugates between PEG and an interferon lysine residue and still
other isomers are conjugates between PEG and the amino terminus of
the interferon molecule.
[0038] The present invention relates to a pharmaceutical
composition comprising an HBV capsid assembly inhibitor and an
interferon, in a pharmaceutically acceptable carrier.
[0039] In one embodiment of the present invention, the "HBV capsid
assembly inhibitor" is a compound of formula (I):
##STR00001##
[0040] wherein
[0041] R.sup.1 is C.sub.1-6 alkyl or
trifluoromethyl-C.sub.xH.sub.2x--, wherein x is 1, 2, 3, 4, 5 or
6;
[0042] One of R.sup.2 and R.sup.3 is phenyl, which is once or twice
or three times substituted by C.sub.1-6 alkyl, cyano or halogen;
and the other one is hydrogen or deuterium;
[0043] R.sup.4 is phenyl, thiazolyl, oxazolyl, imidazolyl, thienyl
or pyridinyl, which is unsubstituted or substituted by
C.sub.1-6alkyl, C.sub.1-6 alkylsulfanyl, halogen or cycloalkyl,
wherein C.sub.1-6alkyl can be further optionally substituted with
halogen;
[0044] A is
##STR00002##
which is unsubstituted or substituted by groups selected from
C.sub.1-6 alkyl, deuterium and halogen;
[0045] or pharmaceutically acceptable salt, or enantiomer, or
diastereomer thereof.
[0046] More particularly the HBV capsid assembly inhibitor
according to present invention relates to
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid;
(R)-6-((S)-2-Carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-chloro-4-fl-
uoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester; or
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid; or any other compound disclosed in patent WO2014/037480; or
pharmaceutically acceptable salt, or enantiomer, or diastereomer
thereof. Compounds of formula (I) and compound 1, 2 and 3 can be
obtained by the synthetic procedures described in
WO2014/037480.
[0047] In another embodiment of present invention, the HBV capsid
assembly inhibitor is a compound of formula (II):
##STR00003##
[0048] wherein
[0049] R.sup.5 is C.sub.1-6alkyl;
[0050] R.sup.6 is phenyl, which is once or twice or three times
substituted by halogen or C.sub.1-6alkyl;
[0051] R.sup.7 is hydrogen or C.sub.1-6alkyl;
[0052] R.sup.8 is bicyclic bridged heterocyclyl;
[0053] or pharmaceutically acceptable salt, or tautomerism isomer,
or enantiomer, or diastereomer thereof.
[0054] More particularly the HBV capsid assembly inhibitor
according to present invention relates to
2-[(1R,3S,5S)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid; or
2-[(1S,3R,5R)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid; or any other compound disclosed in
patent WO 2014/184328; or pharmaceutically acceptable salt, or
tautomerism isomer, or enantiomer, or diastereomer thereof.
Compounds of formula (II) and compound 8 and 9 can be obtained by
the synthetic procedures described in WO 2014/184328.
[0055] In another embodiment of present invention, the HBV capsid
assembly inhibitor is a compound of formula (III):
##STR00004##
[0056] wherein
[0057] R.sup.9 is hydrogen, halogen or C.sub.1-6 alkyl;
[0058] R.sup.10 is hydrogen or halogen;
[0059] R.sup.11 is hydrogen or halogen;
[0060] R.sup.12 is C.sub.1-6alkyl;
[0061] R.sup.13 is hydrogen, hydroxyC.sub.1-6alkyl, aminocarbonyl,
C.sub.1-6alkoxycarbonyl or carboxy;
[0062] R.sup.14 is hydrogen, C.sub.1-6alkoxycarbonyl or
carboxy-C.sub.mH.sub.2m--;
[0063] X is carbonyl or sulfonyl;
[0064] Y is --CH.sub.2--, --O-- or --N(R.sup.15)--,
[0065] wherein R.sup.15 is hydrogen, C.sub.1-6alkyl,
haloC.sub.1-6alkyl, C.sub.3-7cycloalkyl-C.sub.mH.sub.2m--,
C.sub.1-6alkoxycarbonyl-C.sub.mH.sub.2m--, --C.sub.tH.sub.2t--COOH,
-haloC.sub.1-6alkyl-COOH, --(C.sub.1-6alkoxy)C.sub.1-6alkyl-COOH,
--C.sub.1-6alkyl-O--C.sub.1-6alkyl-COOH,
--C.sub.3-7cycloalkyl-C.sub.mH.sub.2m--COOH,
--C.sub.mH.sub.2m--C.sub.3-7cycloalkyl-COOH,
hydroxy-C.sub.tH.sub.2t--, carboxyspiro[3.3]heptyl or
carboxyphenyl-C.sub.mH.sub.2m--,
carboxypyridinyl-C.sub.mH.sub.2m--;
[0066] W is --CH.sub.2--, --C(C.sub.1-6alkyl).sub.2-, --O-- or
carbonyl;
[0067] n is 0 or 1;
[0068] m is 0-7;
[0069] t is 1-7;
[0070] or pharmaceutically acceptable salt, or enantiomer or
diastereomer thereof.
[0071] More particularly the HBV capsid assembly inhibitor
according to present invention relates to
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
3-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
3-[(8aS)-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
4-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-3,3-dimethyl-butanoic acid;
(8S,8aR)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid; or
(8R,8aS)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid; or any other
compound disclosed in patent WO2015/132276; or pharmaceutically
acceptable salt, or enantiomer, or diastereomer thereof. Compounds
of formula (III) and compound 4, 5, 6, 7, 10 and 11 can be obtained
by the synthetic procedures described in WO2015/132276.
[0072] In another embodiment of present invention, the HBV capsid
assembly inhibitor used in the combination with interferon is any
compound selected from patent WO2008154817, WO2008154819,
WO2014029193, WO2015074546, CN103664897 and CN103664925.
[0073] Suitable interferons in accordance with the present
invention may be any naturally-occurring or recombinant interferon
alfa, beta or gamma known to those skilled in the art. Natural and
recombinant alfa-interferons that may be used include interferon
alfa-n1 (e.g., Surniferon.RTM., Surnitomo.RTM.), interferon
alfa-n3, interferon alfa-2a (Roferon A.RTM., Hoffmann-La Roche,
Inc.) interferon alfa-2b (Intron A.RTM., Schering-Plough Corp.),
interferon alfa-2c (Berofor.RTM., Boehringer Ingelheim, Inc.), and
consensus interferon (Infergen.RTM., InterMune, Inc.). Preferred
interferons are interferon alfa-2a and interferon alfa-2b.
[0074] In one embodiment of the present invention, suitable
interferons in accordance with the present invention include, but
are not limited to, recombinant interferon alfa-2b such as Intron
A.RTM.); recombinant interferon alfa-2a such as Roferon A.RTM.;
recombinant interferon beta-1b such as Betaferon.RTM.; recombinant
interferon beta-1a such as Avonex.RTM. and Rebif.RTM.; and
recombinant interferon gamma-1b such as Imukin.RTM.. The use of
recombinant interferon alfa-2a or alfa-2b is preferred.
[0075] The terms "interferon alfa-2a", "interferon alfa-2b" and
"interferon beta-1a" are further intended to include "pegylated"
analogs meaning polyethylene glycol modified conjugates of
interferon alfa-2a such as Pegasys.RTM., interferon alfa-2b such as
PegIntron.RTM. and interferon beta-1a such as Plegridy.RTM.. The
use of pegylated recombinant interferon alfa-2a or alfa 2b is
preferred.
[0076] In one embodiment of the present invention, the "interferon"
is a non-conjugated interferon alfa or a pegylated conjugate
thereof.
[0077] More specifically, the "interferon" is selected from the
group consisting of interferon alfa-2a such as Roferon A.RTM.,
interferon alfa-2b such as Intron pegylated interferon alfa-2a such
as Pegasys.RTM. and pegylated interferon alfa-2b such as
PegIntron.RTM. respectively.
[0078] Obtaining and isolating interferon alfa from natural or
recombinant sources is well known (Pestka, Arch. Biochem. Biophys.
221, 1 (1983); European Pat. No. 043980.
[0079] Further more specifically, the "interferon" is a
non-conjugated interferon alfa-2a (for instance Roferon A.RTM.) or
a pegylated alfa-type interferon (for instance Pegasys.RTM.):
[0080] In yet another embodiment the above pegylated alfa-type
interferon is an alfa-2a interferon.
[0081] In one embodiment of the present invention, the
pharmaceutical composition comprises an HBV capsid assembly
inhibitor and an interferon, wherein the HBV capsid assembly
inhibitor and the interferon are independently selected from Table
1.
TABLE-US-00001 TABLE 1 List of HBV capsid assembly inhibitors and
interferons Compound Disclosed in NO. Class Compound Name Compound
Structure Patent 1 HBV capsid assembly inhibitor (S)-4-[(R)-6-(2-
Chloro-4-fluoro- phenyl)-5- methoxycarbonyl- 2-thiazol-2-yl-3,6-
dihydro-pyrimidin- 4-ylmethyl]- morpholine-3- carboxylic acid
##STR00005## WO 2014/037480 2 HBV capsid assembly inhibitor
(R)-6-((S)-2- Carboxy-4,4- difluoro-pyrrolidin- 1-ylmethyl)-4-(2-
chloro-4-fluoro- phenyl)-2-thiazol- 2-yl-1,4-dihydro- pyrimidine-5-
carboxylic acid methyl ester ##STR00006## WO 2014/037480 3 HBV
capsid assembly inhibitor (2R,3S)-4-[(R)-6- (2-Chloro-3-fluoro-
phenyl)-5- ethoxycarbonyl-2- thiazol-2-yl-3,6- dihydro-pyrimidin-
4-ylmethyl]-2- methyl- morpholine-3- carboxylic acid ##STR00007##
WO 2014/037480 4 HBV capsid assembly inhibitor 3-[(8aS)-7-[[(4S)-
5-ethoxycarbonyl- 4-(3-fluoro-2- methyl-phenyl)-2-
thiazol-2-yl-1,4- dihydropyrimidin- 6-yl]methyl]-3- oxo-5,6,8,8a-
tetrahydro-1H- imidazo[1,5- a]pyrazin-2-yl]- 2,2-dimethyl-
propanoic acid ##STR00008## WO 2015/132276 5 HBV capsid assembly
inhibitor 3-[(8aS)-7-[[(4R)- 4-(2-chloro-4- fluoro-phenyl)-5-
methoxycarbonyl- 2-thiazol-2-yl-1,4- dihydropyrimidin-
6-yl]methyl]-3- oxo-5,6,8,8a- imidazo[1,5- a]pyrazin-2-yl]-
2,2-dimethyl- propanoic acid ##STR00009## WO 2015/132276 6 HBV
capsid assembly inhibitor 3-[(8aS)-7-[[(4R)- 4-(2-chloro-3-
fluoro-phenyl)-5- ethoxycarbonyl-2- thiazol-2-yl-1,4-
dihydropyrimidin- 6-yl]methyl]-3- oxo-5,6,8,8a- tetrahydro-1H-
imidazo[1,5- a]pyrazin-2-yl]- 2,2-dimethyl- propanoic acid
##STR00010## WO 2015/132276 7 HBV capsid assembly inhibitor
4-[(8aS)-7-[[(4R)- 4-(2-chloro-4- fluoro-phenyl)-5-
methoxycarbonyl- 2-thiazol-2-yl-1,4- dihydropyrimidin-
6-yl]methyl]-3- oxo-5,6,8,8a- tetrahydro-1H- imidazo[1,5-
a]pyrazin-2-yl]- 3,3-dimethyl- butanoic acid ##STR00011## WO
2015/132276 8 HBV capsid assembly inhibitor 2-[(1R,3S,5S)-8-
[[(4R)-4-(2-chloro- 3-fluoro-phenyl)-5- methoxycarbonyl-
2-thiazol-2-yl-1,4- dihydropyrimidin- 6-yl]methyl]-6,6- difluoro-8-
azabicyclo[3.2.1] octan-3-yl]acetic acid ##STR00012## WO
2014/184328 9 HBV capsid assembly inhibitor 2-[(1S,3R,5R)-8-
[[(4R)-4-(2-chloro- 3-fluoro-phenyl)-5- methoxycaronyl-
2-thiazol-2-yl-1,4- dihydropyrimidin- 6-yl]methyl]-6,6- difluoro-8-
azabicyclo[3.2.1] octan-3-yl]acetic acid ##STR00013## WO
2014/184328 10 HBV capsid assembly inhibitor (8S,8aR)-2-tert-
butyl-7-[[(4R)-4- (2-chloro-3-fluoro- phenyl)-5- ethoxycarbonyl-2-
thiazol-2-yl-1,4- dihydropyrimidin- 6-yl]methyl]-3- oxo-5,6,8,8a-
tetrahydro-1H- imidazo[1,5- a]pyrazine-8- carboxylic acid
##STR00014## WO 2015/132276 11 HBV capsid assembly inhibitor
(8R,8aS)-2-tert- butyl-7-[[(4R)-4- (2-chloro-3-fluoro- phenyl)-5-
ethoxycarbonyl-2- thiazol-2-yl-1,4- dihydropyrimidin-
6-yl]methyl]-3- oxo-5,6,8,8a- tetrahydro-1H- imidazo[1,5-
a]pyrazine-8- carboxylic acid ##STR00015## WO 2015/132276 12 IFN
interferon alfa-2a (Roferon A .RTM.) 13 IFN interferon alfa-2b
(Intron A .RTM.) 14 IFN pegylated interferon alfa-2a (Pegasys
.RTM.) 15 IFN pegylated interferon alfa-2b (Pegintron .RTM.)
[0082] More particularly, the present invention relates to a
pharmaceutical composition comprising an HBV capsid assembly
inhibitor and an interferon which is selected from any one of the
following combinations:
[0083] Compound 1 and Compound 12; Compound 2 and Compound 12;
[0084] Compound 3 and Compound 12; Compound 4 and Compound 12;
[0085] Compound 5 and Compound 12; Compound 6 and Compound 12;
[0086] Compound 7 and Compound 12; Compound 8 and Compound 12;
[0087] Compound 9 and Compound 12; Compound 10 and Compound 12;
[0088] Compound 11 and Compound 12; Compound 1 and Compound 13;
[0089] Compound 2 and Compound 13; Compound 3 and Compound 13;
[0090] Compound 4 and Compound 13; Compound 5 and Compound 13;
[0091] Compound 6 and Compound 13; Compound 7 and Compound 13;
[0092] Compound 8 and Compound 13; Compound 9 and Compound 13;
[0093] Compound 10 and Compound 13; Compound 11 and Compound
13;
[0094] Compound 1 and Compound 14; Compound 2 and Compound 14;
[0095] Compound 3 and Compound 14; Compound 4 and Compound 14;
[0096] Compound 5 and Compound 14; Compound 6 and Compound 14;
[0097] Compound 7 and Compound 14; Compound 8 and Compound 14;
[0098] Compound 9 and Compound 14; Compound 10 and Compound 14;
[0099] Compound 11 and Compound 14; Compound 1 and Compound 15;
[0100] Compound 2 and Compound 15; Compound 3 and Compound 15;
[0101] Compound 4 and Compound 15; Compound 5 and Compound 15;
[0102] Compound 6 and Compound 15; Compound 7 and Compound 15;
[0103] Compound 8 and Compound 15; Compound 9 and Compound 15;
[0104] Compound 10 and Compound 15; Compound 11 and Compound
15;
[0105] in a pharmaceutically acceptable carrier.
[0106] The Compound 1 to 11 of the above said combination can be
replaced by its corresponding pharmaceutically acceptable salt,
enantiomer or diastereomer, which is another aspect of this
invention.
[0107] More specifically, the present invention relates to a
pharmaceutical composition comprising an HBV capsid assembly
inhibitor and an interferon which is selected from any one of the
following combinations: [0108]
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
Roferon A; [0109]
(R)-6-((S)-2-Carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-c-
hloro-4-fluoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester and Roferon A; [0110]
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid and Roferon A; [0111]
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and Roferon A;
[0112]
3-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and Roferon A;
[0113]
3-[(8aS)-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and Roferon A;
[0114]
4-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-3,3-dimethyl-butanoic acid and Roferon A;
[0115]
2-[(1R,3S,5S)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and Roferon A; [0116]
2-[(1S,3R,5R)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and Roferon A; [0117]
(8S,8aR)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid and Roferon A;
[0118]
(8R,8aS)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid and Roferon A;
[0119]
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
Intron A; [0120]
(R)-6-((S)-2-Carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-c-
hloro-4-fluoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester and Intron A; [0121]
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid and Intron A; [0122]
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and Intron A;
[0123]
3-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and Intron A;
[0124]
3-[(8aS)-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and Intron A;
[0125]
4-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-3,3-dimethyl-butanoic acid and Intron A;
[0126]
2-[(1R,3S,5S)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and Intron A; [0127]
2-[(1S,3R,5R)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and Intron A; [0128]
(8S,8aR)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid and Intron A;
[0129]
(8R,8aS)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid and Intron A;
[0130]
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
Pegasys; [0131]
(R)-6-((S)-2-Carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-chloro-4-fl-
uoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester and Pegasys; [0132]
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid and Pegasys; [0133]
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and Pegasys;
[0134]
3-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and Pegasys;
[0135]
3-[(8aS)-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and Pegasys;
[0136]
4-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-3,3-dimethyl-butanoic acid and Pegasys;
[0137]
2-[(1R,3S,5S)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and Pegasys; [0138]
2-[(1S,3R,5R)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and Pegasys; [0139]
(8S,8aR)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid and Pegasys;
[0140]
(8R,8aS)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid and Pegasys;
[0141]
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
PegIntron; [0142]
(R)-6-((S)-2-Carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-chloro-4-fl-
uoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester and PegIntron; [0143]
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid and PegIntron; [0144]
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and PegIntron;
[0145]
3-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and PegIntron;
[0146]
3-[(8aS)-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and PegIntron;
[0147]
4-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-3,3-dimethyl-butanoic acid and PegIntron;
[0148]
2-[(1R,3S,5S)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and PegIntron; [0149]
2-[(1S,3R,5R)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid and PegIntron; [0150]
(8S,8aR)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid and PegIntron; or
[0151]
(8R,8aS)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid and PegIntron;
[0152] in a pharmaceutically acceptable carrier.
[0153] In one embodiment of the present invention, the
pharmaceutical composition consists of an HBV capsid assembly
inhibitor and an interferon, in a pharmaceutically acceptable
carrier. More particularly, the composition consists of: [0154]
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
Roferon A; [0155]
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-
-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydr-
o-1H-imidazo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and
Roferon A; [0156]
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-
-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydr-
o-1H-imidazo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and
Pegasys; or [0157]
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2--
thiazol-2-yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carbo-
xylic acid and Pegasys; [0158] in a pharmaceutically acceptable
carrier.
[0159] In another embodiment of the present invention, other
interferons or HBV capsid assembly inhibitors can also be used in
the pharmaceutical composition including small molecules or large
molecules. Examples of other HBV capsid assembly inhibitors
include, but not limited to, Bay 41-4109, Bay 38-7690, Bay 39-5493,
GLS4, AT-61 and AT-130. Examples of other interferons include, but
not limited to, Surniferon, Sumitomo, Berofor, Infergen,
Multiferon, Rebif, Avonex, Cinnovex, Betaseron/Betaferon, Imukin,
Plegridy, Actimmune, Reiferon Retard and Pegetron.
[0160] Typical dosages of an HBV capsid assembly inhibitor and/or
an interferon can be in the ranges recommended by the manufacturer,
and where indicated by in vitro responses in an animal models, can
be reduced by up to about one order of magnitude concentration or
amount. Thus, the actual dosage will depend upon the judgment of
the physician, the condition of the patient, and the effectiveness
of the therapeutic method based on the in vitro responsiveness of
the appropriate animal models.
[0161] Another embodiment of present invention relates to a method
for manufacturing a medicament for treatment or prophylaxis of
hepatitis B virus infection, characterized in that an HBV capsid
assembly inhibitor and an interferon are used in the
medicament.
[0162] A further embodiment of present invention relates to the
method for manufacturing a medicament for treatment or prophylaxis
of hepatitis B virus infection, characterized in that the HBV
capsid assembly inhibitor and the interferon are co-administered in
the same formulation or different formulation.
[0163] For purposes of the present invention, "co-administer"
refers to any administration of the HBV capsid assembly inhibitor
and interferon as the two active agents, either separately or
together, where the two active agents are administered as part of
an appropriate dose regimen designed to obtain the benefit of the
combination therapy. Thus, the two active agents can be
administered either as part of the same pharmaceutical composition
or in separate pharmaceutical compositions. Also, the two active
agents can be administered either at the same time, or
sequentially.
[0164] The pharmaceutical composition of the HBV capsid assembly
inhibitor and interferon can be administered with various
pharmaceutically acceptable inert carriers in the form of tablets,
capsules, lozengens, troches, hard candies, powders, sprays,
creams, salves, suppositories, jellies, gels, pastes, lotions,
ointments, elixirs, syrups, and the like. Administration of such
dosage forms can be carried out in single or multiple doses.
Carries include solid diluents of fillers, sterile aqueous media
and various non-toxic organic solvents. Administration of such
dosage forms can be carried out through, but not limited to, oral
administration, parenteral administration, veterinary
administration.
[0165] A further embodiment of present invention relates to the
method for manufacturing a medicament for treatment or prophylaxis
of hepatitis B virus infection, characterized in that the HBV
capsid assembly inhibitor and interferon are intended for
administration to a subject by the same route or different
routes.
[0166] A further embodiment of present invention relates to the
method for manufacturing a medicament for treatment or prophylaxis
of hepatitis B virus infection, characterized in that the HBV
capsid assembly inhibitor and interferon thereof are intended for
administration to a subject by parenteral or oral
administration.
[0167] A further embodiment of present invention relates to the
method for manufacturing a medicament for treatment or prophylaxis
of hepatitis B virus infection, characterized in that the
administration of the HBV capsid assembly inhibitor and interferon
thereof to a subject is simultaneous or sequential. In any of the
methods of the present invention, the administration of agents
simultaneously can be performed by separately or sequentially
administering agents at the same time, or together as a fixed
combination. Also, in any of the methods of the present invention,
the administration of agents separately or sequentially can be in
any order.
[0168] Another embodiment of present invention relates to the
method for manufacturing a medicament of composition for treatment
or prophylaxis of hepatitis B virus infection, characterized in
that HBV capsid assembly inhibitor thereof is a compound of formula
(I), formula (II) or formula (III), or pharmaceutically acceptable
salt, enantiomer or diastereomer thereof. Particularly, the HBV
capsid assembly inhibitor thereof is
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid;
(R)-6-((S)-2-Carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-chloro-4-fl-
uoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester;
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid;
2-[(1R,3S,5S)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbon-
yl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicy-
clo[3.2.1]octan-3-yl]acetic acid;
2-[(1S,3R,5R)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid;
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
3-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
3-[(8aS)-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
4-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-3,3-dimethyl-butanoic acid;
(8S,8aR)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid; or
(8R,8aS)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid; or
pharmaceutically acceptable salt, or enantiomer, or diastereomer
thereof.
[0169] Another embodiment of present invention relates to the
method for manufacturing a medicament for treatment or prophylaxis
of hepatitis B virus infection, characterized in that the
interferon thereof is a non-conjugated interferon alfa or a
pegylated alfa-type interferon; particularly the interferon is
Roferon A, Intron A, Pegasys or PegIntron; more particularly the
interferon is Roferon A or Pegasys.
[0170] Another embodiment of present invention relates to the
method for manufacturing a medicament for treatment or prophylaxis
of hepatitis B virus infection, characterized in that the HBV
capsid assembly inhibitor and the interferon used in the medicament
are
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
Roferon A;
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thia-
zol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-im-
idazo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and Roferon
A;
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and Pegasys; or
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid and Pegasys; in a pharmaceutically acceptable carrier.
[0171] Another embodiment of present invention relates to a kit
comprising a container comprising an HBV capsid assembly inhibitor
and an interferon, said kit can further comprise a sterile
diluent.
[0172] A further embodiment of present invention relates to the
said kit, wherein the kit can further comprise a package insert
comprising printed instructions directing the use of a combined
treatment of an HBV capsid assembly inhibitor and an interferon as
a method for treatment or prophylaxis of hepatitis B virus
infection.
[0173] Another embodiment of present invention relates to the said
kit, wherein the HBV capsid assembly inhibitor is
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid;
(R)-6-((S)-2-Carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-chloro-4-fl-
uoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester;
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid;
2-[(1R,3S,5S)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbon-
yl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicy-
clo[3.2.1]octan-3-yl]acetic acid;
2-[(1S,3R,5R)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid;
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
3-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
3-[(8aS)-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
4-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-3,3-dimethyl-butanoic acid;
(8S,8aR)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,
8a-tetrahydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid; or
(8R,8aS)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid; or
pharmaceutically acceptable salt, or enantiomer, or diastereomer
thereof.
[0174] Another embodiment of present invention relates to the said
kit, characterized in that the interferon thereof is a
non-conjugated interferon alfa or a pegylated alfa-type interferon;
particularly the interferon is Roferon A, Intron A, Pegasys or
PegIntron; more particularly the interferon is Roferon A or
Pegasys.
[0175] Another embodiment of present invention relates to the said
kit, characterized in that the HBV capsid assembly inhibitor and
the interferon used in the container are:
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
Roferon A;
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thia-
zol-2-yl-1,4-di hydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,
8a-tetrahydro-1H-imidazo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic
acid and Roferon A;
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and Pegasys; or
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid and Pegasys; in a pharmaceutically acceptable carrier. Another
embodiment of present invention relates to a method for the
treatment or prophylaxis of hepatitis B virus infection, comprising
administration to a subject with an effective first amount of an
HBV capsid assembly inhibitor, or pharmaceutically acceptable salt,
enantiomer or diastereomer thereof; and a second amount of an
interferon; wherein the HBV capsid assembly inhibitor is
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid;
(R)-6-((S)-2-Carboxy-4,4-difluoro-pyrrolidin-1-ylmethyl)-4-(2-chloro-4-fl-
uoro-phenyl)-2-thiazol-2-yl-1,4-dihydro-pyrimidine-5-carboxylic
acid methyl ester;
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid;
2-[(1R,3S,5S)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbon-
yl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicy-
clo[3.2.1]octan-3-yl]acetic acid;
2-[(1S,3R,5R)-8-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-methoxycarbonyl-2-t-
hiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-6,6-difluoro-8-azabicyclo[3.-
2.1]octan-3-yl]acetic acid;
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
3-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
3-[(8aS)-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid;
4-[(8aS)-7-[[(4R)-4-(2-chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazo-
l-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imid-
azo[1,5-a]pyrazin-2-yl]-3,3-dimethyl-butanoic acid;
(8S,8aR)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid; or
(8R,8aS)-2-tert-butyl-7-[[(4R)-4-(2-chloro-3-fluoro-phenyl)-5-ethoxycarbo-
nyl-2-thiazol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrah-
ydro-1H-imidazo[1,5-a]pyrazine-8-carboxylic acid; or
pharmaceutically acceptable salt, or enantiomer, or diastereomer
thereof.
[0176] Another embodiment of present invention relates to a method
for the treatment or prophylaxis of hepatitis B virus infection,
comprising administration to a subject with an effective first
amount of an HBV capsid assembly inhibitor, or pharmaceutically
acceptable salt, enantiomer or diastereomer thereof; and a second
amount of an interferon; wherein the interferon thereof is a
non-conjugated interferon alfa or a pegylated alfa-type interferon;
particularly the interferon is Roferon A, Intron A, Pegasys or
PegIntron; more particularly the interferon is Roferon A or
Pegasys.
[0177] Another embodiment of present invention relates to a method
for the treatment or prophylaxis of hepatitis B virus infection,
wherein the HBV capsid assembly inhibitor and the interferon used
in the subject are
(S)-4-[(R)-6-(2-Chloro-4-fluoro-phenyl)-5-methoxycarbonyl-2-thiazol-2-yl--
3,6-dihydro-pyrimidin-4-ylmethyl]-morpholine-3-carboxylic acid and
Roferon A;
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thia-
zol-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-im-
idazo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and Roferon
A;
3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methyl-phenyl)-2-thiazol-
-2-yl-1,4-dihydropyrimidin-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imida-
zo[1,5-a]pyrazin-2-yl]-2,2-dimethyl-propanoic acid and Pegasys; or
(2R,3S)-4-[(R)-6-(2-Chloro-3-fluoro-phenyl)-5-ethoxycarbonyl-2-thiazol-2--
yl-3,6-dihydro-pyrimidin-4-ylmethyl]-2-methyl-morpholine-3-carboxylic
acid and Pegasys; in a pharmaceutically acceptable carrier.
[0178] Another embodiment of present invention relates to use of
pharmaceutical composition herein mentioned above as an antiviral
medicament, in particular as the medicament for treatment or
prophylaxis of hepatitis B virus infection.
[0179] Another embodiment of present invention relates to the use
of an HBV capsid assembly inhibitor and an interferon for the
manufacture of pharmaceutical composition herein mentioned above as
an antiviral medicament, in particular the medicament for treatment
or prophylaxis of hepatitis B virus infection.
EXAMPLES
[0180] The invention will be more fully understood by reference to
the following examples. They should not, however, be construed as
limiting the scope of the invention.
Abbreviations
[0181] 3TC Lamivudine
[0182] CI Combination index
[0183] CL Confidence limit
[0184] CTG Cell Titer Glo
[0185] dHepaRG Differentiated HepaRG cells
[0186] DMSO Dimethyl sulfoxide
[0187] ETV Entecavir
[0188] FBS Fetal Bovine Serum
[0189] FIC Fractional inhibition concentration
[0190] FRG Fah-/-Rag2-/-Il2rg-/-
[0191] GE Genome equivalent
[0192] HBV Hepatitis B virus
[0193] IC50 Inhibitory Concentration 50%
[0194] IU/mL International unit per milliliter
[0195] .mu.M Micromolar
[0196] min Minute
[0197] nM Nanomolar
[0198] PBS Phosphate buffered saline
[0199] PEG Polyethylene glycol
[0200] PHH Primary human hepatocyte
[0201] qPCR Real-time quantitative polymerase chain reaction
[0202] SD Standard deviation
[0203] sec Second
[0204] UDG Uracil DNA glycosylase
Materials and Methods
Virus and Cells
HepG2.2.15 Cells
[0205] HepG2.2.15 cells were cultured in DMEM+Glutamax I medium
(Gibco, #21885) supplemented with 10% FBS, 1% Pen/Strep (Gibco,
#15140) and G-418 (250 .mu.g/mL) and used for production of
infectious HBV (genotype D). 90% confluent cells from three T175
flasks were trypsinized and transferred into one collagen coated
hyperflask (550 mL). Once the cells were confluent, medium was
changed to DMEM+Glutamax I medium with 1% DMSO and 2.5% FBS. Once
the cells were slightly over confluent, medium was changed to
DMEM/F12+Glutamax I medium (Gibco, #31331) supplemented with MEM
non-essential aminoacids (6 mL, Gibco, #11140), P/S (6 mL), sodium
pyruvate (6 mL), DMSO (9 mL) and FBS (10 mL) (all per 500 mL
medium). Medium was changed every 3 days and supernatants were
harvested for 2 weeks. Virus was concentrated from supernatants by
PEG precipitation and the titer (genome equivalent (GE)/mL) was
determined by qPCR. Briefly, supernatants were mixed with 40% PEG
solution at a ratio of 4:1, incubated on a shaker at 4.degree. C.
overnight and then centrifuged using 50 mL falcon tubes at
4.degree. C. for one hour at 3724 g (RCF). The supernatant was
discarded and the centrifugation step was repeated with new
supernatant reusing the tubes until all PEG-precipitated
supernatant was processed. The pellets were re-suspended in
William's E Medium (Gibco, #22551) at a concentration of
10.sup.7-10.sup.9 genome equivalents (GE) per ml and frozen at
-80.degree. C. DNA copy number calculation was based on a standard
curve generated from HBV plasmid dilutions with known
concentrations.
HepaRG Cells
[0206] HepaRG cells (Biopredic International, Saint-Gregoire,
France) were cultured in working growth medium (500 mL Willams E
Medium with 50 mL HepaRG Growth supplement from Biopredic, 5 mL
Glutamax-I (Gibco, #35050) and 5 mL Pen/Strep) for 2 weeks. After 2
weeks, medium was changed to differentiation medium containing 1.8%
DMSO (500 mL Willams E Medium with 50 mL HepaRG Growth supplement
from Biopredic, 5 mL Pen/Strep, 5 mL Glutamax-I and 9 mL DMSO).
Medium was changed twice a week up to 2 weeks. Once fully
differentiated, cells were trypsinized and seeded into collagenated
96-well plates (50,000 cells/well in 100 .mu.L) or 24-well plates
(300,000 cells/well in 500 .mu.L) in differentiation medium. Cells
were cultured at least 5 days in the plates before they were
infected with HBV.
PHH Cells
[0207] The HBV positive serum for infection in this study is
obtained from FRG mice (WuxiAppTec, #34459) infected with an HBV
patient serum (Genotype B, e negative), FRG mice were injected with
1.times.10.sup.9 GE HBV via the tail vein. PHHs were isolated with
two-step perfusion with collagenase using an extracorporeal
perfusion apparatus at day 30 after inoculation, and PHHs were
seeded in collagenated 24-well plates for ex vivo combination
treatment.
Data Analysis and Calculation Model
Isobologram Model
[0208] The combination experimental results were analyzed using the
model described by Craig et al. (Craig J, Duncan I, Whittaker L and
Roberts N. (1990). Antiviral synergy between inhibitors of HIV
proteinase and reverse transcriptase. Antiviral Chem. Chemother.
4:161-166). EC.sub.50 values were obtained for compounds used alone
and in combination with others. To relate these two values and
describe the degree of synergy/additivity/antagonism between them,
the Fractional Inhibitory Concentration (FIC) was first calculated
and used to generate isobolograms. Briefly, the FIC is the ratio of
the EC.sub.50 of the drug in combination to the EC.sub.50 of the
drug on its own:
FIC=ratio[EC.sub.50 combination:EC.sub.50 alone]
[0209] The Combination Index (CI), obtained by adding the FICs of
the two compounds, was then used to describe the effect between
compounds used in the combinations. A CI<1 means synergism, a
CI=1 means additivity and a CI>1 means antagonism.
CalcuSyn Model
[0210] Each experiment was performed in at least triplicate and
performed independently 3 times. Mean percent inhibition of HBV
replication based on DNA copy number was calculated from all
experiments and analyzed using the Calcusyn software (CalcuSyn
Version 2.11, Biosoft, Cambridge, UK) based on the Loewe additivity
model described by Chou and Talalay (Chou TC (2006). Theoretical
basis, experimental design, and computerized simulation of
synergism and antagonism in drug combination studies. Pharmacol.
Rev., 58:621-681). For the CalcuSyn evaluation, data from three
diagonal lanes with a constant concentration ratio for the drug
combinations of each lane from the checkerboard plate were used
(marked in bold in Table 2). In a first step, this program converts
the dose-effect curves for each drug or drug combination to median
effect plots. A combination index (CI) for each experimental
combination was then calculated by the following equation (for
mutually nonexclusive interactions):
[(D).sub.1/(Dx).sub.1]+[(D).sub.2/(Dx).sub.2]+[(D).sub.1(D).sub.2/(Dx).s-
ub.1(Dx).sub.2]
[0211] where (Dx).sub.1 and (Dx).sub.2 are the doses of drug 1 and
drug 2 that have x effect when each drug is used alone, and
(D).sub.1 and (D).sub.2 are the doses of drug 1 and drug 2 that
have the same x effect when they are used in combination
respectively. The software calculates the CIs at 50%, 75% and 90%
antiviral effect of combinations. Combination effect assessment was
based on overall CI values (average of CI values at 50%, 75% and
90% effect level) as follows: CI value <0.7 as synergy, 0.7 to
0.9 as slight to moderate synergy, 0.9 to 1.1 as additive, 1.1 to
1.5 as slight to moderate antagonism and >1.5 as antagonism
(Chou T C (2006). Theoretical basis, experimental design, and
computerized simulation of synergism and antagonism in drug
combination studies. Pharmacol. Rev., 58:621-681). Drug
combinations were analyzed at three different fixed drug ratios
spanning and including the approximate ratio of their
EC.sub.50s.
MacSynergy Model
[0212] Each experiment was performed in at least triplicate. Mean
percent inhibition of HBV replication based on DNA copy number was
calculated from all experiments and analyzed using the MacSynergy
TM II document (By Mark Neal Prichard, University of Michigan,
USA).
[0213] This program allows the three-dimensional examination of two
compounds with Bliss-Independence model. Confidence bounds are
determined from replicate data. If the 95% confidence level does
not overlap the theoretic additive surface, the interaction between
the two drugs differs significantly from additive. The resulting
surface would appear as a horizontal plane at 0% inhibition above
calculated if the interactions are merely additives. Any peaks
above the plane would be indicative of synergy. Similarly, any
depression of the plane would indicate antagonism. The confidence
intervals around the experimental dose-response surface are used to
evaluate the data statistically and the volume of the peaks is
calculated and used to quantitate the volume of synergy
produced.
Example 1. Combination Study with Roferon in HepaRG Cells
[0214] For HBV infection of differentiated HepaRG cells, medium was
removed and new differentiation medium (120 .mu.L/well) containing
4% PEG-8000 and virus stock (20 to 30 GE/cell) was added. Cells
were cultured at 37.degree. C. for 16 to 20 hs before medium was
removed, cells were washed 4 times with PBS and new differentiation
medium (120 .mu.L/well) was added. At day 4 post infection, medium
was removed and 100 .mu.L new differentiation medium was added to
each well. 3-fold serial dilutions (5 .mu.L compound to 10 .mu.L
DMSO) of Drug A and Drug B were prepared in 100% DMSO (HBV capsid
assembly inhibitor) or in medium (Roferon) starting with 15 .mu.L
undiluted compound (400-fold concentration of highest test
concentration). 5 .mu.L of Drug A and Drug B dilutions were then
added to 990 .mu.L medium (containing 1.3% DMSO) in a 96-well plate
in a checkerboard fashion according to the design shown in Table 2.
100 .mu.L thereof were added to the dHepaRG cells with a final DMSO
concentration of 1.8%. The concentration ranges tested were 100 nM
to 1.23 nM for Drug A (Compound 1 or Compound 4), and 30 IU/mL to
0.04 IU/mL for Drug B (Roferon). Medium was replaced by new medium
with compound at day 7 post infection and at day 11 post infection
cell supernatants were harvested and directly used for HBV DNA
extraction or stored at -20.degree. C. Cell viability of the cells
was determined using the cell viability assay described below.
TABLE-US-00002 TABLE 2 Plate layout for combinations with Roferon 1
2 3 4 5 6 7 8 9 10 11 12 a X X X X X X X X X X X X b X A1 A1 + B7
A1 + B6 A1 + B5 A1 + B4 A1 + B3 A1 + B2 A1 + B1 VC ETV CC d X A2 A2
+ B7 A2 + B6 A2 + B5 A2 + B4 A2 + B3 A2 + B2 A2 + B1 VC ETV CC d X
A3 A3 + B7 A3 + B6 A3 + B5 A3 + B4 A3 + B3 A3 + B2 A3 + B1 VC ETV
CC e X A4 A4 + B7 A4 + B6 A4 + B5 A4 + B4 A4 + B3 A4 + B2 A4 + B1
VC ETV CC f X A5 A5 + B7 A5 + B6 A5 + B5 A5 + B4 A5 + B3 A5 + B2 A5
+ B1 VC ETV CC g X VC B7 B6 B5 B4 B3 B2 B1 VC ETV CC h X X X X X X
X X X X X X X: PBS CC: cell control (uninfected) VC: virus control
ETV: reference control (200 nM Entecavir) A1-5: serial dilution of
drug A B1-7: serial dilution of drug B A1 + B7: example of
combination of drug A and B at different ratios
DNA Extraction and qPCR
[0215] HBV DNA from dHepaRG cell supernatants was extracted using
the MagNA Pure 96 (Roche) robot. 100 .mu.L of the supernatants were
mixed in a processing cartridge with 200 .mu.L MagNA Pure 96
external lysis buffer (Roche, Cat. No. 06374913001) and incubated
for 10 minutes. DNA was then extracted using the "MagNA Pure 96 DNA
and Viral Nucleic Acid Small Volume Kit" (Roche, Cat. No.
06543588001) and the "Viral NA Plasma SV external lysis 2.0"
protocol. DNA elution volume was 50 .mu.L.
[0216] Quantification of extracted HBV DNA was performed using a
Taqman qPCR machine (ViiA7, life technologies). Each DNA sample was
tested in duplicate in the PCR. 5 .mu.L of DNA sample were added to
15 .mu.L of PCR mastermix containing 10 .mu.L TaqMan Gene
Expression Master Mix (Applied Biosystems, Cat. No. 4369016), 0.5
.mu.L PrimeTime XL qPCR Primer/Probe (IDT) and 4.5 .mu.L distilled
water in a 384-well plate and the PCR was performed using the
following settings: UDG Incubation (2 min, 50.degree. C.), Enzyme
Activation (10 min, 95.degree. C.) and PCR (40 cycles with 15 sec,
95.degree. for denaturing and 1 min, 60.degree. C. for annealing
and extension). DNA copy numbers were calculated from C.sub.t
values based on a HBV plasmid DNA standard curve by the ViiA7
software.
Sequences for TaqMan Primers and Probes (IDT)
TABLE-US-00003 [0217] Forward core primer (F3_core): (SEQ ID: No.
1) CTG TGC CTT GGG TGG CTT T Reverse primer (R3_core): (SEQ ID: No.
2) AAG GAA AGA AGT CAG AAG GCA AAA Taqman probe (P3_core): (SEQ ID:
No. 3) 56-FAM/AGC TCC AAA/ZEN/TTC TTT ATA AGG GTC GAT GTC CAT
G/3IABkFQ
Cell Viability Assay
[0218] Cell viability of the HBV infected and treated HepaRG cells
was determined at day 11 post infection using the
CellTiter-Glo.RTM. Luminescent Cell Viability Assay (Promega, Cat.
No. G7572). 100 .mu.L of CTG reagent were added to each well of the
cells, incubated for 10 min and 80 .mu.L of each well were
transferred to a new white 96 well plate. Luminescence (0.2 sec)
was measured using an Envision reader (PerkinElmer).
Combination Study
[0219] The interaction between Compound 1 and Roferon was analyzed
using the CalcuSyn software. Study and calculation results are
shown in Table 3, 4 and 5. The overall CI for three different
concentration ratios was between 0.41 and 0.66, thus the
combination of Compound 1 and Roferon is synergistic.
[0220] The interaction between Compound 1 and Roferon was also
analyzed using the Isobologram model (FIG. 1). The FIC values for
the combination of Compound 1 and Roferon were plotted one against
the other for each of the experiments. The analysis showed that
most of the CI values were <1. Therefore, the combination of
Compound 1 and Roferon is synergistic.
[0221] The interaction between Compound 4 and Roferon was analyzed
using the CalcuSyn software. Study and calculation results are
shown in Table 3, 4 and 5. The overall CI for three different
concentration ratios was between 0.69 and 0.77, thus the
combination of Compound 4 and Roferon is moderate synergistic.
[0222] The interaction between Compound 4 and Roferon was also
analyzed using the Isobologram model (FIG. 2). The FIC values for
the combination of Compound 4 and Roferon were plotted one against
the other for each of the experiments. The analysis showed that
most of the CI values were <1. Therefore, the combination of
Compound 4 and Roferon is synergistic.
[0223] None of the combinations had a significant effect on cell
viability.
TABLE-US-00004 TABLE 3 Mean EC.sub.50 .+-. SD values for the
individual compounds used in the combination studies EC.sub.50 .+-.
SD (n) EC.sub.50 .+-. SD (n) Drug A Drug B Drug A Drug B 3TC 3TC
12.9 nM .+-. 6.4 (3) 13.7 nM .+-. 1.0 (3) Roferon Compound 1 0.9
IU/mL .+-. 0.5 (3) 21.2 nM .+-. 5.7 (3) Roferon Compound 4 1.8
IU/ml .+-. 1.7 (3) 8.7 nM .+-. 2.0 (3)
[0224] Results shown in Table 3 are mean EC.sub.50.+-.SD values for
the individual compounds in HBV infected HepaRG cells from n
independent experiments.
TABLE-US-00005 TABLE 4 Cytotoxicity analysis for the individual
compounds used in the combination studies % cell viability at max %
cell viability at max concentration .+-. SD (n) concentration .+-.
SD (n) Drug A Drug B Drug A Drug B 3TC 3TC 86.4 .+-. 2.6 (3) 104.5
.+-. 2.6 (3) Roferon Compound 1 96.6 .+-. 9.3 (3) 96.8 .+-. 4.2 (3)
Roferon Compound 4 99.3 .+-. 2.7 (3) 96.1 .+-. 14.5 (3)
[0225] Results shown in Table 4 are mean % cell viability.+-.SD at
the maximum concentration of the individual compounds used to treat
HBV infected HepaRG cells in n independent experiments.
Cytotoxicity analysis was done to confirm that drugs did not show
cytotoxic effect (also at high concentrations) which could
interfere with antiviral activity.
TABLE-US-00006 TABLE 5 CalcuSyn based combination indices for the
pair-wise checkerboard combinations (HBV DNA) CI values at the
following Drug Molar levels of HBV inhibition combination n.sup.a
ratio 50% 75% 90% Overall CI Assessment.sup.b 3TC and 3TC 3 1:0.3
1.12 .+-. 0.24 1.05 .+-. 0.16 1.02 .+-. 0.11 1.06 .+-. 0.16
additivity 1:1 0.98 .+-. 0.12 1.00 .+-. 0.14 1.06 .+-. 0.11 1.02
.+-. 0.11 1:3 1.02 .+-. 0.22 1.03 .+-. 0.22 1.08 .+-. 0.21 1.04
.+-. 0.19 Compound 1 3 0.03:1 0.48 .+-. 0.12 0.39 .+-. 0.12 0.37
.+-. 0.14 0.41 .+-. 0.12 synergism and Roferon 0.1:1 0.63 .+-. 0.05
0.48 .+-. 0.08 0.44 .+-. 0.09 0.52 .+-. 0.11 0.3:1 0.75 .+-. 0.21
0.61 .+-. 0.03 0.61 .+-. 0.15 0.66 .+-. 0.15 Compound 4 3 0.03:1
0.72 .+-. 0.18 0.81 .+-. 0.22 0.76 .+-. 0.18 0.77 .+-. 0.17
moderate and Roferon 0.1:1 0.64 + 0.14 0.65 .+-. 0.14 0.78 .+-.
0.20 0.69 .+-. 0.16 synergism 0.3:1 0.72 + 0.16 0.64 + 0.17 0.78 +
0.32 0.71 .+-. 0.21 .sup.aNumber of independent experiments
.sup.bAssessment was based on overall CI values as described above
in section "Data Analysis and calculation model".
[0226] HBV infected HepaRG cells were treated with different drug
combinations and the effect on HBV DNA was evaluated using the
CalcuSyn software, and the calculation results were shown in Table
5. Combination of 3TC and 3TC was used as additivity control in the
assay.
Example 2. Combination Study with Pegasys in PHH Cells
[0227] PHH cells were isolated from HBV infected FRG mice and were
seeded in collagenated 24-well plates for ex vivo combination
treatment, and the next day HBV infected PHHs were treated with
sequential combination of Compound 4 and Pegasys. The compound was
first serially diluted in DMSO to make 100.times. of final
concentration, and then further diluted with culture medium.
Pegasys was serially diluted in culture medium to make 100.times.
of final concentration, and then further diluted with culture
medium. The final concentration of DMSO in the culture medium was
2%. From day 0 to day 6, HBV infected PHH cells were mono-treated
with Compound 4 (B1: 3 .mu.M, B2: 300 nM, B3: 30 nM, B4: 3 nM) for
6 days, 10 nM ETV (E) was used as control. The culture medium was
refreshed with Compound 4 every 2 days, and the culture supernatant
was collected every time. From day 6 on, PHH cells thereof were
treated with Pegasys (A3: 0.03 IU/mL, A2: 0.3 IU/mL, A1: 3 IU/mL)
and Compound 4 (B1: 3 .mu.M, B2: 300 nM, B3: 30 nM, B4: 3 nM, 10 nM
ETV as control) for another 24 days, then the culture medium was
refreshed with above compounds every 2 days, and the culture
supernatant was collected every time for analysis. Plate layout (in
triplicate) was followed as Table 6.
TABLE-US-00007 TABLE 6 Plate layout for combinations with Pegasys
in PHH cells 1 2 3 4 5 6 a VC B1 B2 B3 B4 ETV b A3 A3 + B1 A3 + B2
A3 + B3 A3 + B4 ETV + A3 c A2 A2 + B1 A2 + B2 A2 + B3 A2 + B4 ETV +
A2 d A1 A1 + B1 A1 + B2 A1 + B3 A1 + B4 ETV + A1 VC: virus control
ETV: reference control (10 nM Entecavir) A1-3: serial dilution of
drug A B1-4: serial dilution of drug B A3 + B1: example of
combination of drug A and B at different concentration E + A1:
example of combination of ETV and drug A as control
DNA Extraction and qPCR
[0228] The DNA in the serum was isolated with the QIAamp 96 DNA
Blood Kit according to the manual and quantified by the real-time
PCR (Fast Real-Time PCR System, ABI). 104, of DNA sample were added
to 15 .mu.L of PCR mastermix containing 12.5 .mu.L mastermix, 1
.mu.L HBV primers forward/reverse, 0.54, HBV specific probe in
96-well plate, a HBV plasmid DNA used for standards for DNA copies
numbers calculation. qPCR was performed with 95.degree. C. for 10
min, then cycling at 95.degree. C. for 15 sec, 60.degree. C. for 1
min for 40 cycles.
Sequences for TaqMan Primers and Probes:
TABLE-US-00008 [0229] Forward primer: (SEQ ID: No. 4)
5'-GTGTCTGCGGCGTTTTATCA-3' Reverse primer: (SEQ ID: No. 5)
5'-GACAAACGGGCAACATACCTT-3' Probe: (SEQ ID: No. 6) FAM
5'-CCTCTKCATCCTGCTGCTATGCCTCATC-3' Tamra
Combination Study
[0230] The anti-HBV activity of combining Compound 4 and Pegasys on
HBV DNA was examined, and the interaction between Compound 4 and
Pegasys was analyzed using MacSynergy II (FIG. 3), the resulting
surface showed peaks above the plane which indicative of synergy
and the log volume is 9.79, thus the combination of Compound 4 and
Pegasys is synergistic.
Example 3. Combination Study with Pegasys in HepaRG Cells
[0231] dHepaRG cells were seeded in 24-well plate to recover for 7
days prior to HBV infection, and HBV virus (200 GE/cell) in
differentiation medium (300 .mu.L/well) containing 4% PEG-8000 was
added to dHepaRG cells for 16 hours, then cells was washed with PBS
for 3 times and new differentiation medium was added, culture
medium was refreshed every 3 days. At day 13 post viral infection,
HBV infected dHepaRG cells were treated with sequential combination
of Compound 3 and Pegasys. The compound was first serially diluted
in DMSO to make 100.times. of final concentration, and then further
diluted with culture medium. Pegasys was serially diluted in
culture medium to make 100.times. of final concentration, and then
further diluted with culture medium. The final concentration of
DMSO in the culture medium was 2%. From day 13, HBV infected HepaRG
cells were mono-treated with Compound 3 (B1: 100 nM, B2: 20 nM, B3:
5 nM) for 5 days, 10 nM ETV (E) was used as control. The culture
medium was refreshed including compound every 2.5 days, and the
culture supernatant was collected every time. After 5 days
mono-treatment, dHepaRG cells were treated with Pegasys (A1: 3
IU/mL, A2: 0.3 IU/mL, A3: 0.03 IU/mL) and Compound 3 (B1: 100 nM,
B2: 20 nM, B3: 5 nM, ETV as control) for another 10 days, the
culture medium was refreshed with above compounds every 2.5 days,
and culture supernatant was collected every time for analysis.
Plate layout (in triplicate) was followed as Table 7.
TABLE-US-00009 TABLE 7 Plate layout for combinations with Pegasys
in HepaRG cells 1 2 3 4 5 6 a UC VC B1 B2 B3 ETV b VC A1 A1 + B1 A1
+ B2 A1 + B3 ETV + A1 c VC A2 A2 + B1 A2 + B2 A2 + B3 ETV + A2 d VC
A3 A3 + B1 A3 + B2 A3 + B3 ETV + A3 UC: Uninfected control (pre-S1
peptide was used as entry inhibitor) VC: virus control ETV:
reference control (10 nM Entecavir) A1-3: serial dilution of drug A
B1-3: serial dilution of drug B A1 + B1: example of combination of
drug A and B at different concentration E + A1 : example of
combination of ETV and drug A as control
DNA Extraction and qPCR
[0232] The DNA in the culture supernatant of indicated time was
isolated with the MagNA pure 96 instrument according to the manual
and quantified by the real-time PCR (Light Cycler 480 II, Roche). 5
.mu.L of DNA sample were added to 154, of PCR mastermix containing
104, mastermix, 0.5 .mu.L HBV primers forward/reverse, 0.254, HBV
specific probe and 3.75 .mu.L ddH.sub.2O in 384-well plate, a HBV
plasmid DNA used for standards for DNA copies numbers calculation.
PCR was performed with 95.degree. C. for 10 min, then cycling at
95.degree. C. for 15 sec, 60.degree. C. for 1 min for 40
cycles.
Sequences for TaqMan Primers and Probes:
TABLE-US-00010 [0233] Forward primer: (SEQ ID: No. 7)
5'-AAGAAAAACCCCGCCTGTAA-3' Reverse primer: (SEQ ID: No. 8)
5'-CCTGTTCTGACTACTGCCTCTCC-3' Probe: (SEQ ID: No. 9) 5'-TAMRA +
CCTGATGTGATGTTCTCCATGTTCAGC + GHQ2-3'
Combination Study:
[0234] The anti-HBV activity of combining Compound 3 and Pegasys on
HBV DNA was examined, and the interaction between Compound 3 and
Pegasys was analyzed using MacSynergy II (FIG. 4), the resulting
surface showed peaks above the plane which indicative of synergy
and the log volume is 12.98, thus the combination of Compound 3 and
Pegasys is synergistic.
Sequence CWU 1
1
9119DNAHepatitis B virus 1ctgtgccttg ggtggcttt 19224DNAHepatitis B
virus 2aaggaaagaa gtcagaaggc aaaa 24334DNAHepatitis B virus
3agctccaaat tctttataag ggtcgatgtc catg 34420DNAHepatitis B virus
4gtgtctgcgg cgttttatca 20521DNAHepatitis B virus 5gacaaacggg
caacatacct t 21628DNAHepatitis B virus 6cctctkcatc ctgctgctat
gcctcatc 28720DNAHepatitis B virus 7aagaaaaacc ccgcctgtaa
20823DNAHepatitis B virus 8cctgttctga ctactgcctc tcc
23927DNAHepatitis B virus 9cctgatgtga tgttctccat gttcagc 27
* * * * *