U.S. patent application number 16/813179 was filed with the patent office on 2020-08-27 for method for rapid generation of an attenuated rna virus.
The applicant listed for this patent is INSERM, UNIVERSITE D'AIX-MARSEILLE. Invention is credited to Fabien Aubry, Lauriane De Fabritus, Xavier De Lamballerie, Ernest Andrew Gould, Antoine Nougairede.
Application Number | 20200270584 16/813179 |
Document ID | / |
Family ID | 1000004816307 |
Filed Date | 2020-08-27 |
United States Patent
Application |
20200270584 |
Kind Code |
A1 |
Nougairede; Antoine ; et
al. |
August 27, 2020 |
METHOD FOR RAPID GENERATION OF AN ATTENUATED RNA VIRUS
Abstract
The present invention harnesses the power of mutagenesis to
produce an attenuated RNA virus in a very short period, i.e. as
soon as the complete sequence of the target virus is known and an
infectious genome can be produced.
Inventors: |
Nougairede; Antoine;
(Marseille, FR) ; De Fabritus; Lauriane;
(Marseille, FR) ; Aubry; Fabien; (Marseille,
FR) ; De Lamballerie; Xavier; (Ensues la Redonne,
FR) ; Gould; Ernest Andrew; (St Albans, GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
UNIVERSITE D'AIX-MARSEILLE
INSERM |
Marseille
Paris |
|
FR
FR |
|
|
Family ID: |
1000004816307 |
Appl. No.: |
16/813179 |
Filed: |
March 9, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15315687 |
Dec 1, 2016 |
10619137 |
|
|
PCT/EP2015/063815 |
Jun 19, 2015 |
|
|
|
16813179 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 2039/525 20130101;
C12N 2770/24051 20130101; C12N 7/00 20130101; C12N 2770/24151
20130101; A61K 2039/5254 20130101; A61K 39/12 20130101; C12N 7/04
20130101; C12N 15/1031 20130101; Y02A 50/30 20180101 |
International
Class: |
C12N 7/04 20060101
C12N007/04; C12N 7/00 20060101 C12N007/00; A61K 39/12 20060101
A61K039/12; C12N 15/10 20060101 C12N015/10 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 20, 2014 |
EP |
14305956.6 |
Claims
1-13. (canceled)
14. A vaccine comprising cDNA fragments, wherein said cDNA
fragments are overlapping cDNA fragments obtained by: introducing a
promoter of DNA-dependent RNA polymerase in position 5' and
optionally a terminator and a RNA polyadenylation sequence in
position 3' of a re-encoded viral genome; amplifying said
re-encoded viral genome in at least 2, preferably at least 3, 4, 5
or 6 overlapping cDNA fragments; wherein said re-encoded viral
genome is obtained by re-encoding the viral genome of an infectious
RNA virus by randomly substituting a part of the nucleotide codons
of the entire viral genome of said infectious RNA virus by another
nucleotide codon encoding for the same amino acid, with the proviso
that: the number and position of rare nucleotide codons present in
said viral genome are not modified, said rare nucleotide codons
being CGU, CGC, CGA, CGG, UCG, CCG, GCG and ACG; and the regions of
said viral genome which are involved with RNA secondary structure
are not modified.
15. The vaccine according to claim 14, wherein about 1 to about 20%
of the nucleotide codons of the entire viral genome of said
infectious RNA virus are substituted by another nucleotide codon
encoding for the same amino acid.
16. The vaccine according to claim 14, wherein the step of
re-encoding the viral genome is performed by: determining the amino
acid sequence encoded by the entire viral genome of the infectious
RNA virus, and determining each nucleotide codon encoding each
amino acid; and substituting 1 to 20% of the nucleotide codon of
the viral genome encoding an amino acid comprising Ala (A), Arg
(R), Asn (N), Asp (D), Cys (C), Gln (Q),Glu (E), Gly (G), His (H),
Ile (I), Leu (L), Lys (K), Phe (F), Pro (P), Ser (S), Thr (T), Tyr
(Y), or Val (V) by a different nucleotide codon encoding the same
amino acid as specified in the following table: TABLE-US-00006
Amino acid Nucleotide codon Ala, A GCU, GCC, GCA Arg, R AGA, AGG
Asn, N AAU, AAC Asp, D GAU, GAC Cys, C UGU, UGC Gln, Q CAA, CAG
Glu, E GAA, GAG Gly, G GGU, GGC, GGA His, H CAU, CAC Ile, I AUU,
AUC, AUA Leu, L UUA, UUG, CUU, CUC, CUA, CUG Lys, K AAA, AAG Phe, F
UUU, UUC Pro, P CCU, CCC, CCA Ser, S UCU, UCC, UCA, AGU, AGC Thr, T
ACU, ACC, ACA Tyr, Y UAU, UAC Val, V GUU, GUC, GUA, GUG
17. The vaccine according to claim 14, wherein said virus is a
single stranded positive RNA virus.
18. The vaccine according to claim 17, wherein said single stranded
positive RNA virus is selected from the group consisting of
flavivirus, alphavirus and enterovirus.
19. The vaccine according to claim 14, wherein said virus is
Chikungunya virus and the step of re-encoding is performed: in the
region coding for the non-structural protein nsP1, by the
re-encoded cassette depicted in SEQ ID No: 63; in the region coding
for the non-structural protein nsP4, by the re-encoded depicted in
SEQ ID No: 64; and in the region coding for the region overlapping
the structural protein E2 and E1, by the re-encoded cassette
depicted in SEQ ID No: 65.
20. The vaccine according to claim 14, wherein said virus is
Tick-borne encephalitis virus and said the step of re-encoding is
performed in the NS5 genomic region, by the re-encoded cassette
depicted in SEQ ID No: 66.
21. The vaccine according to claim 14, wherein said virus is
Japanese encephalitis virus and said the step of re-encoding is
performed in the complete open reading frame (ORF), from the
beginning of PrM to the end of NS5 genomic region by at least one
re-encoded cassette selected from the group consisting of SEQ ID
No: 67; SEQ ID No: 68; SEQ ID No: 69; SEQ ID No: 70; SEQ ID No: 71;
and SEQ ID No: 72.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to a method for rapid
generation of attenuated RNA viruses that may be used as vaccines
to protect against viral infections and diseases.
BACKGROUND OF THE INVENTION
[0002] Many emerging infectious diseases are caused by single
strand RNA viruses. The major outbreaks of dengue fever, West Nile
encephalitis, Chikungunya fever, and Rift Valley fever that have
occurred in recent decades, each with a significant impact on human
health, highlight the urgent need to understand the factors that
allow these viruses to invade new territories or adapt to new host
or vector species.
[0003] These events are often perceived as a warning signs for a
potential pandemic. In the case of pandemic, understanding the
factors that shape the adaptability of these rapidly evolving
infectious agents and our ability to promptly develop a vaccine
will be the critical steps for controlling the spread of the
disease.
[0004] Indeed, to this date, vaccination still remains the best
approach for reducing mortality and morbidity of humans caused by
such viruses. In particular, live attenuated vaccines are highly
successful due to stimulation of different arms of the host immune
response. These live attenuated vaccines are natural virus variants
derived by passaging virus in abnormal hosts. However, the
preparation of a live attenuated vaccine suffers from many
drawbacks, especially since its preparation relies on an empirical
and time-consuming method. Therefore, it currently takes a long
time to develop a useful vaccine that can be administered to
humans.
[0005] There is thus an unmet need for an approach of generating
attenuated viruses, that has no possibility of reversion and that
provides a fast, efficient, cost-effective and safe method of
manufacturing a vaccine candidate.
[0006] The present invention fulfills this need by providing a
systematic approach for designing future vaccine candidates that
have essentially no possibility of reversion. This method is
broadly applicable to a wide range of viruses and provides an
effective approach for producing a wide variety of anti-viral
vaccines.
SUMMARY OF THE INVENTION
[0007] The present invention harnesses the power of mutagenesis to
produce an attenuated RNA virus in a very short period, i.e. as
soon as the complete sequence of the target virus is known and an
infectious genome can be produced.
[0008] Because there are more codons than amino acids, the genetic
code is necessarily redundant. Different codons that encode the
same amino acid are known as synonymous codons. Changes in the DNA
sequence of a protein between two synonymous codons are often
assumed to have no effect and are thus called synonymous mutation.
However, even though synonymous codons encode the same amino acids,
the inventors have shown that synonymous substitution over large
regions of the viral genome results in the effective attenuation of
the virus (Nougairede et al, Random Codon Re-encoding Induces
Stable Reduction of Replicative Fitness of Chikungunya Virus in
primate and Mosquito Cells, PLOS Pathogens, 2013). More precisely,
the inventors founded out that replacement of native nucleotide
codons of the genome of an RNA virus with synonymous nucleotide
codons decreases the replicative fitness of the virus, thereby
attenuating said virus.
[0009] The inventors also developed a novel approach for generating
RNA viruses which does not require cloning and propagation of a
full-length cDNA into a bacteria. This technology is based on the
observation that overlapping double-stranded DNA fragments, each
covering a portion of the viral genome, spontaneously enable
recombination and synthesis of a DNA copy of the complete viral
genome after transfection.
[0010] By combining these two approaches, the inventors developed a
method for directly generating an attenuated virus, which has
several advantages for vaccine candidate development, including the
possibility of obtaining vaccine candidate in a very short period,
as soon as the complete sequence of the targeted pathogen is known
and an infectious genome can be produced. The method of the
invention is thus extremely helpful for generating, within days, a
live attenuated vaccine directed against a novel pathogen for which
no treatment or vaccine is available.
[0011] Consequently, in a first aspect, the invention relates to a
method for generating an attenuated RNA virus comprising the
following steps:
[0012] step I) reencoding the viral genome of an infectious RNA
virus by randomly substituting a part of the nucleotide codons of
the entire viral genome of said infectious RNA virus by another
nucleotide codon encoding for the same amino acid, with the proviso
that: [0013] i) the number and position of rare nucleotide codons
present in said viral genome are not modified, said rare nucleotide
codons being CGU, CGC, CGA, CGG, UCG, CCG, GCG and ACG; and [0014]
ii) the regions of said viral genome which are involved with RNA
secondary structure are not modified.
[0015] step II) generating an attenuated RNA virus by : [0016]
sub-step II.a) introduction of a promoter of DNA-dependent RNA
polymerase in position 5' and optionally a terminator and a RNA
polyadenylation sequence in position 3' of the re-encoded viral
genome as obtained in step I); [0017] sub-step II.b) amplification
of the re-encoded viral genome as prepared in sub-step a) including
said promoter and optionally said terminator and RNA
polyadenylation sequence, in at least 2, preferably at least 3, 4,
5 or 6 overlapping cDNA fragments; [0018] sub-step II.c)
transfection of said cDNA fragments into a host cell, [0019]
sub-step II.d) incubation of said host cell of sub-step c); and
[0020] sub-step II.e) recovery of the infectious RNA virus from
said incubated host cell.
[0021] In a second aspect, the invention pertain to a
pharmaceutical composition comprising an attenuated RNA virus
obtained according to the method disclosed herein.
[0022] In a third aspect, the invention relates to the use of the
method disclosed herein for developing a live attenuated vaccine,
or the use of the attenuated RNA virus obtained according to the
method disclosed herein as a live attenuated vaccine.
[0023] In a fourth aspect, the invention relates to the overlapping
cDNA fragments obtained as disclosed in the method of the
invention, for use as a vaccine.
DETAILED DESCRIPTION OF THE INVENTION
[0024] In a first aspect, the invention relates to a method for
generating an attenuated RNA virus comprising the following
steps:
[0025] step I) re-encoding the viral genome of an infectious RNA
virus by randomly substituting a part of the nucleotide codons of
the entire viral genome of said infectious RNA virus by another
nucleotide codon encoding for the same amino acid, with the proviso
that: [0026] i) the number and position of rare nucleotide codons
present in said viral genome are not modified, said rare nucleotide
codons being CGU, CGC, CGA, CGG, UCG, CCG, GCG and ACG; and [0027]
ii) the regions of said viral genome which are involved with RNA
secondary structure are not modified.
[0028] step II) generating an attenuated RNA virus by : [0029]
sub-step II.a) introduction of a promoter of DNA-dependent RNA
polymerase in position 5' and optionally a terminator and a RNA
polyadenylation sequence in position 3' of the re-encoded viral
genome as obtained in step I); [0030] sub-step II.b) amplification
of the re-encoded viral genome as prepared in sub-step a) including
said promoter and optionally said terminator and RNA
polyadenylation sequence, in at least 2, preferably at least 3, 4,
5 or 6 overlapping cDNA fragments; [0031] sub-step II.c)
transfection of said cDNA fragments into a host cell; [0032]
sub-step II.d) incubation of said host cell of sub-step c); and
[0033] sub-step II.e) recovery of the infectious RNA virus from
said incubated host cell.
[0034] Based on their thorough researches, the inventors developed
a highly promising strategy for directly generating an attenuated
virus by large-scale re-encoding. Accordingly, the invention
provides an attenuated virus, which comprises a modified viral
genome containing nucleotide substitutions engineered in multiple
locations in the genome, wherein the substitutions introduce a
plurality of synonymous codons into the genome. The term
"attenuated virus", as used herein, refers to a virus with
compromised virulence in the intended recipient, e.g. human or
animal recipient. More specifically, an attenuated virus has a
decreased or weakened ability to produce disease while retaining
the ability to stimulate an immune response similar to the wild
type virus.
[0035] This novel strategy represents a significantly improved
route to vaccine development. Indeed, site-directed re-encoding,
associated with no modification of amino acid sequences, alleviates
the likelihood of novel phenotypic properties and thus provides
benefits to the generic development of live attenuated vaccines,
including reduced costs and single dose induction of long-term
immunity.
[0036] Large Scale Re-Encoding Step
[0037] The method of the invention comprises a first step I) of
mutagenesis, also referred to as "large scale re-encoding" in the
following. As used herein, the expressions "re-encoding method" or
"large scale re-encoding method" refer to a step of re-encoding the
viral genome of an RNA virus, preferably a region of said viral
genome, by randomly substituting a part of the nucleotide codons of
the entire viral genome of said infectious RNA virus by another
nucleotide codon encoding for the same amino acid, with the proviso
that: [0038] i) the number and position of rare nucleotide codons
present in said viral genome are not modified, said rare nucleotide
codons being CGU, CGC, CGA, CGG, UCG, CCG, GCG and ACG; and [0039]
ii) the regions of said viral genome which are involved with RNA
secondary structure are not modified.
[0040] Preferably, step I) is a step of re-encoding the viral
genome of an infectious RNA virus by randomly substituting about 1%
to about 20%, preferably about 1% to about 17%, preferably about 1%
to about 15%, preferably about 1 to about 10%, preferably about 3
to about 8%, preferably about 3% to about 5% of the nucleotide
codons of the entire viral genome of said infectious RNA virus by
another nucleotide codon encoding for the same amino acid, with the
proviso that: [0041] i) the number and position of rare nucleotide
codons present in said viral genome are not modified, said rare
nucleotide codons being CGU, CGC, CGA, CGG, UCG, CCG, GCG and ACG;
and [0042] ii) the regions of said viral genome which are involved
with RNA secondary structure are not modified.
[0043] The re-encoding method thus modifies the nucleic acid
composition of large coding regions of the viral genome of RNA
virus without modifying the encoded proteins by introducing a large
number of synonymous mutations.
[0044] The starting material of step I) is preferably an infectious
RNA virus. Preferably, the genome of the virus is re-encoded so
that about 1% to about 20% of the nucleotide codons are substituted
by different nucleotide codons which encode the same amino acid.
This is possible thanks to the codon usage bias.
[0045] As used herein, the expressions "synonymous nucleotide
codons" or "synonymous codons" refer to two or more nucleotide
codons encoding the same amino acid. Indeed, most amino acids are
encoded by more than one codon. Synonymous codons are codons that
encode the same amino acid.
[0046] As used herein, the expressions "synonymous mutation" or
"synonymous substitution" refer to the substitution of a nucleotide
codon by another nucleotide codon which encodes the same amino
acid, i.e. a synonymous codon. The inventors have shown that
synonymous substitutions reduce a virus's replicative fitness. In
addition, the introduction of synonymous codons into a virus genome
limits its ability to mutate or to use recombination to become
virulent. It is noteworthy that for obtaining an attenuated RNA
virus, which could still be used as a live attenuated vaccines,
only 1% to 20%, preferably 1% to 10% of the nucleotide codons of
the viral genome are randomly re-encoded. In the context of the
invention, the synonymous mutations are introduced by site-directed
mutagenesis. Preferably, said mutations are inserted by cassette
mutagenesis.
[0047] Whereas most amino acids can be encoded by several different
codons, not all codons are used equally frequently some codons are
"rare" codons. As used herein, a "rare" codon is one of at least
two synonymous codons encoding a particular amino acid that is
present in an mRNA at a significantly lower frequency than the most
frequently used codon for that amino acid. Typically, said rare
codons are CGU, CGC, CGA, CGG, UCG, CCG, GCG and ACG.
[0048] The method designed by the inventors is based on the
observation that said rare codons should remain unchanged for
efficiently controlling viral attenuation.
[0049] In addition, the inventors came to the conclusion that the
regions of the viral genome involved with RNA secondary structure
shall not be modified for efficiently controlling viral
attenuation. Consequently, said regions are to be not
re-encoded.
[0050] As used herein, the expression "regions of the viral genome
involved with RNA secondary structure" refers to conserved regions
of the genome of the virus, which contain functionally active RNA
structures, also known as "RNA secondary structure". Said RNA
structures are proved to be important during the various stages of
the viral life cycle. The person skilled in the art would easily
determine the regions involved with significant RNA secondary
structure, which are usually well conserved in evolutionary
phylogeny.
[0051] Basically, the step I) of re-encoding the genome of an
infectious RNA virus comprises the following step: [0052]
identifying codons in multiple locations within non-regulatory
portions of the viral genome, which codons can be replaced by
synonymous codons, said codons being not CGU, CGC, CGA, CGG, UCG,
CCG, GCG and ACG; [0053] selecting a synonymous codon to be
substituted for about 1 to about 20% of the identified nucleotide
codons; and [0054] substituting a synonymous codon for each of the
identified codons, preferably on the basis of the table 1
under.
[0055] Preferably, step I) is performed by: [0056] determining the
amino acid sequence encoded by the entire viral genome of the
infectious RNA virus, and determining each nucleotide codon
encoding each amino acid; and [0057] substituting about 1% to about
20%, preferably about 1% to about 17%, preferably about 1% to about
15%, preferably about 1 to about 10%, preferably about 3 to about
8%, preferably about 3% to about 5% of the nucleotide codon of the
viral genome encoding an amino acid of table 1, by a different
nucleotide codon encoding the same amino acid as specified in table
1:
TABLE-US-00001 [0057] TABLE 1 Synonymous mutation according to the
invention Amino acid Nucleotide codon Ala, A GCU, GCC, GCA Arg/R
AGA, AGG Asn/N AAU, AAC Asp/D GAU, GAC Cys/C UGU, UGC Gln/Q CAA,
CAG Glu/E GAA, GAG Gly/G GGU, GGC, GGA His/H CAU, CAC Ile/I AUU,
AUC, AUA Leu/L UUA, UUG, CUU, CUC, CUA, CUG Lys/K AAA, AAG Phe/F
UUU, UUC Pro/P CCU, CCC, CCA Ser/S UCU, UCC, UCA, AGU, AGC Thr/T
ACU, ACC, ACA Tyr/Y UAU, UAC Val/V GUU, GUC, GUA, GUG
[0058] The attenuated viruses, obtained according to the invention,
have the remarkable property to be not modified at the protein
level. Indeed, said attenuated viruses correspond to viruses which
were genetically modified through synonymous substitutions, at the
nucleic level only.
[0059] Viral attenuation can be confirmed in ways that are well
known to one of ordinary skill in the art. Non-limiting examples
include plaque assays, growth measurements, and reduced morbidity
or lethality in test animals.
[0060] More specifically, the inventors have shown that the large
scale re-encoding has an impact on the replicative fitness of the
target RNA virus, thereby attenuating said virus.
[0061] "Replicative fitness" is defined as an organism's
replicative capacity/adaptability in a given environment. The
replicative fitness of a virus, or an attenuated virus obtained
according to the method disclosed herein, can be measured in
cellulo, for example by means involving competitions between two or
more viral strains in tissue culture. Typically, the replicative
fitness can be determined once the virus is recovered, in various
type of cells such as non-human primate cells, or mosquito cells in
the case of arboviruses. Typically, the re-encoded virus to
evaluate and a wild type virus are passaged in various type of
cells, such as non-human primate cells (Vero), or mosquito (C6/36).
The replicative kinetics of each passages virus is determined using
known techniques such as analysis of the viral growth rate, based
on the analysis of TCID50 values.
[0062] The inventors have shown that the random re-encoding step
decreases the replicative fitness of the virus in both primate (and
arthropod cells in the case of arboviruses). The diminution of
replicative fitness correlated directly with the degree of
re-encoding. These results corroborates that codon re-encoding
profoundly reduces the infectious titer of released virus whilst
the number of viral particles remains stable.
[0063] Preferably, the attenuated RNA virus that the method aims to
generate (also referred to as "target virus" herein) is an
attenuated version of a single stranded positive RNA virus. More
preferably said virus is selected from the group consisting of
flavivirus, alphavirus and enterovirus.
[0064] A non-limiting list of flaviviruses comprises Dengue virus
(DENV), Yellow fever virus (YFV), St Louis encephalitis (SLEV),
Japanese encephalitis viruses (JEV), Murray Valley encephalitis
(MVEV), West Nile virus (WNV), Rocio (ROCV), Tick-borne
encephalitis virus (TBEV), Omsk hemorrhagic fever (OMSKV), Kyasanr
Forrest disease (KFDV), Powassan (POWV). Preferably, said
flavivirus is selected from the group consisting of : [0065]
Japanese encephalitis viruses (JEV); such as a genotype I strain
(JEV I) or the genotype III strain (JEV III), [0066] West Nile
virus (WNV), such as a genotype 2 strain; [0067] Dengue virus
(DENV), such as a serotype 4 strain; [0068] Yellow fever virus
(YFV), such as a South American wild-type strain; and [0069]
Tick-borne encephalitis virus (TBEV), such as a Far-Eastern subtype
strain. More preferably, said flavivirus is Tick-borne encephalitis
virus
[0070] A non-limiting list of alphaviruses comprises Chikungunya
virus (CHIK), Easterm equine encephalitis (EEE), Western equine
encephalitis virus, Venezuelan equine encephalitis virus (VEE),
Mayaro virus (MAY), O'nyong'nyong virus (ONN), Sindbis virus,
Semliki Forest virus, Barmah Forest virus, Ross River virus, Una
virus, Tonate virus. Preferably, said alphavirus is Chikungunya
virus.
[0071] A non-limiting list of enteroviruses comprises Coxsackie,
Echovirus, Poliovirus, and Rhinovirus. Preferably, said enterovirus
is Coxsackie, more preferably Coxsackie B virus.
[0072] In one preferred embodiment, the target virus is Chikungunya
virus. In this specific embodiment, the re-encoding step is
performed in three regions of the viral genome, namely: [0073] the
region encoding thee non-structural protein nsP1; [0074] the region
encoding the non-structural protein nsP4; and [0075] the region
overlapping the structural protein E2 and E1.
[0076] Typically, mutations are introduced thanks to cassette
mutagenesis, also called "re-encoded cassettes". Typically, a
re-encoded cassette of about 1300 pb to about 1500 pb is used for
each region.
[0077] In this embodiment, the viral genome of Chikungunya is
modified as follows: [0078] the region encoding the non-structural
protein nsP1, in position 242-1543 (nt) of the complete genome is
mutated by a re-encoded cassette of 1302 nt, as depicted in SEQ ID
No: 63; [0079] the region encoding the non-structural protein nsP4,
in position 6026-7435 (nt) of the complete genome is mutated by a
re-encoded cassette of 1410 nt, as depicted in SEQ ID No: 64; and
[0080] the region overlapping the structural protein E2 and E1, in
position 9526-11022 (nt) of the complete genome is mutated by a
re-encoded cassette of 1500 nt, as depicted in SEQ ID No: 65.
[0081] Typically, each of the re-encoded cassettes introduces 200
to 400 synonymous mutations, preferably about 250 to about 320,
preferably about 266 to about 320. Preferably, the re-encoded
cassette as depicted in SEQ ID No: 63, SEQ ID No: 64 and SEQ ID No:
65 respectively introduce 264, 298 and 320 synonymous
mutations.
[0082] In another embodiment, the target virus is Tick-borne
encephalitis virus (TBEV). In this specific embodiment, the
re-encoding step is performed in the NS5 genomic region of the
virus, which encodes the non-structural protein NS5. Typically a
re-encoded cassette of about 1400 pb is used. In this embodiment,
the viral genome of TBEV is modified to introduce about 200 to
about 350 synonymous mutations, preferably about 200 to about 300,
preferably about 225 to about 300, preferably about 225 to about
275, preferably about 225.
[0083] Preferably, the viral genome of the Tick-borne encephalitis
virus is mutated by a re-encoded cassette of 1412 nt, depicted in
SEQ ID No: 66. Said re-encoded cassette introduces 273
mutations.
[0084] In yet another embodiment, the target virus is Japanese
encephalitis virus (JEV), preferably a genotype 1 strain. In this
specific embodiment, the re-encoding step is performed in a large
region of the viral genome, typically in almost all the complete
open reading frame (ORF), from the beginning of PrM to the end of
NS5 genomic region.
[0085] Preferably, the viral genome of JEV is modified to introduce
about 163 to about 658, preferably about 163 to about 658
mutations.
[0086] Preferably, the viral genome of the Japanese encephalitis
virus is mutated by at least one re-encoded cassette selected from
the group consisting of : [0087] re-encoded cassette Ia, as
depicted in SEQ ID No: 67; [0088] re-encoded cassette Ib, as
depicted in SEQ ID No: 68; [0089] re-encoded cassette IIa, as
depicted in SEQ ID No: 69; [0090] re-encoded cassette IIb, as
depicted in SEQ ID No: 70; [0091] re-encoded cassette IIIa, as
depicted in SEQ ID No: 71; and [0092] re-encoded cassette IIIb, as
depicted in SEQ ID No:72.
[0093] More preferably, the viral genome of the Japanese
encephalitis virus is mutated by a combination of re-encoded
cassettes as follows : [0094] combination of re-encoded cassettes
Ia et IIa; or [0095] combination of re-encoded cassettes Ia et IIIa
; or [0096] combination of re-encoded cassettes IIa et IIIa.
[0097] Alternatively, said virus is a single-stranded negative
strand RNA virus. More preferably, said virus is a paramyxovirus,
an arenavirus, a filovirus, a rhabdovirus, a bunyavirus or an
influenza virus.
[0098] Direct Generation of an Attenuated RNA Virus
[0099] The method of the invention comprises a second step II) of
direct generation of an attenuated RNA virus.
[0100] The inventors developed a novel approach to directly
generate an attenuated RNA virus, starting from the randomly
re-encoded viral genome of said virus. The inventors evidenced that
overlapping cDNA fragments, each covering a portion of the genome
of a RNA virus, can give rise to a virus without the use of a
full-length cDNA or a plasmid or a vector comprising such
full-length cDNA. Consequently, the inventors put light that
overlapping double-stranded DNA fragments, each covering a portion
of the attenuated viral genome, spontaneously enable recombination
and synthesis of a DNA copy of the complete viral genome in
cellulo.
[0101] Said method is highly advantageous, especially since it
exonerates from : [0102] constructing a full-length cDNA, covering
the entire re-encoded viral genome; and/or [0103] the use of a
plasmid or a vector comprising such full-length cDNA; and/or [0104]
the necessity of reconstructing the full-length cDNA or the entire
attenuated viral genome before transfection into a host cell;
and/or [0105] modifying the attenuated viral genome such as
incorporating not naturally occurring recombination or restricting
enzyme sites; and/or [0106] using of helper virus or other viral
protein.
[0107] This specific step II) of the invention, also referred to as
"Infectious Subgenomic Amplicons" or "ISA", is thus a very simple
procedure able to expedite production of attenuated RNA viruses
within days, with perfect control of the viral sequences and
starting from an re-encoded viral genome.
[0108] The strategy relies on the production of several cDNA
fragments, each covering a fragment of the re-encoded viral genome.
The assembly of the construct is not made in vitro by Gibson
assembly or circular polymerase extension cloning before the
transfection but through a recombination process that directly
takes place in cellulo.
[0109] As used herein, the expression "generation of attenuated RNA
viruses" refers to the production of an RNA virus, in a genetically
modified form, i.e. in a re-encoded form according to the method of
the invention.
[0110] As used herein, the expression "not naturally occurring
recombination site" refers to sequences allowing site-specific
recombination that can be exemplified by the Cre-Lox or FLP-FRT
recombination systems. Restriction enzyme site refers to sequences
allowing site-specific cutting of double stranded DNA by
restriction enzymes that can be exemplified by the NotI or AluI
endonucleases.
[0111] The step II) of the method of the invention comprises a
sub-step II.a) of introducing a promoter of DNA-dependent RNA
polymerase in position 5' of the entire genome of a RNA virus.
Optionally, said sub-step II.a) further comprises the introduction
of a terminator and a RNA polyadenylation sequence in position 3'
of the entire genome of a RNA virus.
[0112] It is noteworthy that when the target virus is a
poly-adenylated virus, such as flavivirus, sub-step II.a) is a step
of introducing a promoter of DNA-dependent RNA polymerase in
position 5' and a terminator and a RNA polyadenylation sequence in
position 3' of the entire genome of a RNA virus.
[0113] By including, at the 5' terminus of the first cDNA fragment,
a promoter of DNA-dependent RNA polymerase, and at the 3' terminus
of the last cDNA fragment a ribozyme sequence and a signal sequence
for RNA poly-adenylation, the cDNA fragment is transcribed as a
full-length RNA attenuated genome with authentic 5' and 3'
termini.
[0114] Preferably, said promoter of DNA-dependent RNA polymerase in
position 5' is the human cytomegalovirus promoter (pCMV), as
depicted in SEQ ID N.degree. 1. Preferably, said terminator and RNA
polyadenylation sequence is respectively the hepatitis delta
ribozyme and the simian virus 40 polyadenylation signal
(HDR/SV40pA). The sequence of HDR/SV40pA is depicted in SEQ ID No:
2.
[0115] Consequently, sub-step a) provides for the complete
re-encoded viral genome of the RNA virus, flanked respectively in
5' and 3' by the human cytomegalovirus promoter (pCMV) (SEQ ID
No:1) and the hepatitis delta ribozyme followed by the simian virus
40 polyadenylation signal (HDR/SV40pA) (SEQ ID No:2)
[0116] The step II) of the method of the invention comprises a
sub-step II.b) of amplification of the entire re-encoded viral
genome in several overlapping cDNA fragments. In sub-step II.b),
the entire viral genome corresponds to the entire viral genome as
prepared in step a), i.e. which includes said promoter and
optionally said terminator and RNA polyadenylation sequence.
[0117] As used herein, the expression "overlapping cDNA fragments",
cDNA fragments", also designated as "amplicons" or "DNA subgenomic
fragments" or "subgenomic amplicons" are double-stranded DNA
fragments covering only a portion of the re-encoded viral genome of
a RNA virus.
[0118] Such fragments correspond to "subgenomic fragments".
[0119] The inventors enlightened that, when such fragments are
transfected within a cell, they surprisingly spontaneously
recombine in cellulo to reconstitute the entire re-encoded viral
genome. Said recombination occurs even if the viral genome is not
genetically modified to incorporate additional and not naturally
occurring recombination sites.
[0120] cDNA fragments according to the invention encompass: [0121]
DNA fragments obtained by amplification, for example by PCR; as
well as [0122] DNA fragments obtained de novo. Preferably, said
cDNA fragments are non-infectious.
[0123] As used herein, the expression "full-length cDNA", refers to
a DNA which comprises the entire viral genome of a virus into a
single piece, preferably the entire re-encoded viral genome.
[0124] As used herein, the expression "cDNA fragment covering a
portion of the entire re-encoded viral genome", refers to a DNA
fragment which comprises a portion of the entire re-encoded viral
genome. Typically, the cDNA fragments according to the invention
recombine spontaneously upon transfection in cells to constitute a
DNA copy of the entire re-encoded viral genome, flanked at the 5'
terminus by a promoter of DNA-dependent RNA polymerase, and at the
3' terminus by a termination sequence and a signal sequence for RNA
poly-adenylation. This construct is transcribed as a full-length
RNA re-encoded genome with authentic 5' and 3' termini by the
cellular machinery. On the contrary, a "full-length cDNA covering
the entire viral genome" is a single cDNA which encodes for the
totality of the viral genome, preferably the totality of the
re-encoded viral genome.
[0125] Preferably, step II.b) of the method of the invention allows
the production of from 2 to 15 overlapping cDNA fragments,
preferably of 3, 4, 5, or 6 overlapping cDNA fragments. Typically,
said cDNA fragments are of about 2 kb to about 6 kb, preferably of
about 4 kb and each cDNA fragment has about 70 to about 100 bp
overlapping regions.
[0126] Preferably, said overlapping cDNA fragments of step II.b)
are : [0127] fragments of infectious clone not amplified by PCR;
[0128] fragments of infectious clone amplified by PCR; [0129]
fragments of non infectious clone not amplified by PCR; [0130]
fragments of non infectious clone amplified by PCR; [0131]
fragments synthesised de novo not amplified by PCR; [0132]
fragments synthesised de novo amplified by PCR; and [0133]
fragments obtained by reverse-transcription PCR from the viral
genome.
[0134] The step II) of the method of the invention comprises a
sub-step II.c) of transfection of said cDNA fragments into a host
cell.
[0135] As used herein, the term "transfection" refers to the
introduction of nucleic acids (either DNA or RNA) into eukaryotic
or prokaryotic cells or organisms. A cell that has taken up the
exogenous nucleic acid is referred to as a "host cell" or
"transfected cell." Transfection may be accomplished by a variety
of means known in the art including calcium phosphate-DNA
co-precipitation, DEAE-dextran-mediated transfection,
polybrene-mediated transfection, electroporation, microinjection,
liposome fusion, lipofection, protoplast fusion, retroviral
infection, and biolistics.
[0136] Preferably, the host cell of sub-step c) is a permissive
cell, which enables the recovery of an infectious virus. Typically,
permissive cells employed in the method of the present invention
are cells which, upon transfection with the cDNA fragments, are
capable of realising a complete replication cycle of the virus,
including the production of viral particles. Preferably, said host
cell is selected from the group consisting of SW13, BHK-21, HEK 293
and Vero cell lines.
[0137] In a preferred embodiment, sub-step II.c) is a step of
direct transfection of the cDNA fragments obtained in sub-step
II.b) as such, and sub-step II.c) occurs directly after sub-step
II.b). In this specific embodiment, cDNA fragments as such are
transfected into the host cells. Said fragments spontaneously
recombine in cellulo into a DNA copy of the entire re-encoded viral
genome flanked at the 5' terminus by a promoter of DNA-dependent
RNA polymerase, and at the 3' terminus by a termination sequence
and a signal sequence for RNA poly-adenylation. As previously
mentioned, the method of the invention overcomes a technical
prejudice since it exonerates from transfecting a full-length cDNA,
covering the entire viral genome, as such. Besides, the method is
free from using a plasmid or a vector comprising said full-length
cDNA as such and/or the necessity of reconstructing the full cDNA
or the entire viral genome before transfection into a host
cell.
[0138] On the contrary, the method relies on the transfection of
the overlapping cDNA fragments, each comprising a portion of the
re-encoded viral genome. The transfection of overlapping
double-stranded DNA fragments, covering the entire genome of an RNA
virus, into permissive cells enables recombination and synthesis of
a DNA copy of the complete viral genome in cellulo.
[0139] In an alternative embodiment, sub-step II.c) is a step of
transfection of plasmids each comprising a cDNA fragment obtained
in sub-step II.b), wherein each cDNA fragment is incorporated in
individual and separate plasmids or vectors.
[0140] In this embodiment, each cDNA fragment is incorporated into
individual and separate plasmids or vectors. Each plasmid or vector
comprises a single fragment of cDNA. In this embodiment, the entire
re-encoded viral genome is reconstituted after transfection.
[0141] In one embodiment, the method of the invention comprises a
further step II.b') after sub-step b) and prior to sub-step c) of
purification of the overlapping cDNA fragments. Said purification
can be performed by any known techniques, preferably through a
chromatography column.
[0142] The step II) of the method of the invention comprises a
sub-step II.d) of incubation of the host cells, which preferably
lasts from 3 to 9 days. During said incubation step, the
transfected cDNA fragments spontaneously recombine in the host
cells to constitute a DNA copy of the entire re-encoded viral
genome, flanked at the 5' terminus by a promoter of DNA-dependent
RNA polymerase, and at the 3' terminus by a termination sequence
and a signal sequence for RNA poly-adenylation. This construct is
transcribed as a full-length RNA genome with authentic 5' and 3'
termini by the cellular machinery.
[0143] Consequently, the product rescued in sub-step II.d) is an
attenuated RNA virus.
[0144] Pharmaceutical Composition
[0145] In a second aspect, the invention pertains to a
pharmaceutical composition comprising an attenuated RNA virus
obtained according to the method disclosed herein. All the
previously disclosed technical data are applicable here.
[0146] Said pharmaceutical compositions comprising attenuated virus
are suitable for immunization.
[0147] Preferably, administration of such the pharmaceutical
composition of the present invention may be by various parenteral
routes such as subcutaneous, intravenous, intradermal,
intramuscular, intraperitoneal, intranasal, oral or transdermal
routes. Parenteral administration can be accomplished by bolus
injection or by gradual perfusion over time.
[0148] Preparations for parenteral administration include sterile
aqueous or non-aqueous solutions, suspensions, and/or emulsions,
which may contain auxiliary agents or excipients known in the art.
Examples of non-aqueous solvents are propylene glycol, polyethylene
glycol, vegetable oils such as olive oil, and injectable organic
esters such as ethyl oleate. Carriers or occlusive dressings can be
used to increase skin permeability and enhance antigen absorption.
Liquid dosage forms for oral administration may comprise a liposome
solution containing the liquid dosage form. Suitable forms for
suspending liposomes include emulsions, suspensions, solutions,
syrups, and elixirs containing inert diluents commonly used in the
art, such as purified water. Besides the inert diluents, such
compositions can also include adjuvants, wetting agents,
emulsifying and suspending agents, or sweetening, flavoring, or
perfuming agents.
[0149] When a composition of the present invention is used for
administration to an individual, it can further comprise salts,
buffers, adjuvants, or other substances which are desirable for
improving the efficacy of the composition. For vaccines, adjuvants,
substances which can augment a specific immune response, can be
used. Normally, the adjuvant and the composition are mixed prior to
presentation to the immune system, or presented separately, but
into the same site of the organism being immunized.
[0150] The administration of the composition may be for either a
"prophylactic" or "therapeutic" purpose. When provided
prophylactically, the compositions of the invention which are
vaccines are provided before any symptom or clinical sign of a
pathogen infection becomes manifest. The prophylactic
administration of the composition serves to prevent or attenuate
any subsequent infection. In this embodiment, the invention
pertains in the pharmaceutical composition as disclosed herein for
use for preventing an RNA virus infection in a subject.
[0151] When provided therapeutically, an attenuated viral vaccine
is provided upon the detection of a symptom or clinical sign of
actual infection. The therapeutic administration serves to
attenuate any actual infection. In this embodiment, the invention
relates to the pharmaceutical composition disclosed herein for use
for treating an RNA virus infection in a subject.
[0152] Thus, an attenuated vaccine composition of the present
invention may be provided either before the onset of infection (so
as to prevent or attenuate an anticipated infection) or after the
initiation of an actual infection.
[0153] Designing Future Vaccine Candidate
[0154] In a third aspect, the invention relates to the use of the
method disclosed herein for developing a live attenuated vaccine,
or the use of the attenuated RNA virus obtained according to the
method disclosed herein as a live attenuated vaccines. All the
previously disclosed technical data are applicable here.
[0155] The large scale codon re-encoding step of the invention has
been shown to be a powerful method of attenuation which has several
advantages for vaccine development, including the possibility to
obtain potential vaccine strains in a very short period as soon as
the complete sequence of the targeted pathogen is known and an
infectious genome can be produced. The method of the invention is
thus extremely helpful for generating, within days, a live
attenuated vaccine directed against a novel pathogen for which no
treatment or vaccine is available.
[0156] In addition, the inventors have shown that the method of the
invention is advantageous in several aspects when designing future
vaccine candidates, namely: [0157] (i) reversion to wild-type is
intrinsically more difficult, given the high number of mutations
produced; [0158] (ii) since the reduction of replicative fitness
decreases with the degree of re-encoding, the method opens the door
to finely tuning fitness reduction through modulation of the length
of re-encoded regions and the number of synonymous mutations
introduced; [0159] (iii) the use of a combination of several
re-encoded regions located throughout the viral genome prevents
complete phenotypic reversion due to recombination between WT and
re-encoded viruses: large scale sequence modification renders
recombination intrinsically more difficult, and in the case of
recombination, the part of the genome representing the re-encoded
strain would likely still carry some mutations associated with
fitness reduction.
[0160] Use of cDNA Fragments
[0161] The inventors met the burden to apply the method of the
invention directly in vivo. By doing so, the inventors develop a
method for creating a live attenuated vaccine directly within the
body of a patient in need thereof. Said method is based on the
administration of the overlapping cDNA fragments obtained from an
infectious RNA virus which was re-encoded, according to the method
disclosed herein.
[0162] Therefore, in a fourth aspect, the invention also relates to
cDNA fragments for use as a vaccine, preferably as a live
attenuated vaccine, wherein said cDNA fragments are overlapping
cDNA fragments obtained by: [0163] introducing a promoter of
DNA-dependent RNA polymerase in position 5' and optionally a
terminator and a RNA polyadenylation sequence in position 3' of a
re-encoded viral genome; and [0164] amplifying said re-encoded
viral genome in at least 2, preferably at least 3, 4, 5 or 6
overlapping cDNA fragments;
[0165] wherein said re-encoded viral genome is obtained by
re-encoding the viral genome of an infectious RNA virus by randomly
substituting a part of the nucleotide codons of the entire viral
genome of said infectious RNA virus by another nucleotide codon
encoding for the same amino acid, with the proviso that: [0166] i)
the number and position of rare nucleotide codons present in said
viral genome are not modified, said rare nucleotide codons being
CGU, CGC, CGA, CGG, UCG, CCG, GCG and ACG; and [0167] ii) the
regions of said viral genome which are involved with RNA secondary
structure are not modified.
[0168] All the previously disclosed technical data are applicable
here.
[0169] The following examples are given for the purpose of
illustrating various embodiments of the invention and are not meant
to limit the present invention in any fashion.
FIGURES LEGENDS
[0170] FIG. 1: Universal strategy to rescue single stranded
positive RNA viruses. The entire viral genome, schematically
represented in the figure (flaviviral genome), flanked respectively
in 5' and 3' by the human cytomegalovirus promoter (pCMV) and the
hepatitis delta ribozyme followed by the simian virus 40
polyadenylation signal (HDR/SV40pA), was amplified by PCR in 3
overlapping cDNA fragments. Transfection of PCR products into
permissive cells enabled the recovery of viruses after 3 to 9 days.
Horizontal blue arrows represent primers used to generate the 3
overlapping cDNA fragments.
[0171] FIG. 2: Schematic representation of the CHIKV re-encoded
viruses. From top to bottom: Nucleotide scale bar; schematic
representation of the CHIKV complete genome with coding regions
(grey rectangles), non-coding (black rectangles) and the polyA
tail. Re-encoded regions are represented in dark grey.
[0172] FIG. 3: Schematic representation of the 9 different
re-encoded JEV obtained with the ISA method.
[0173] Each rectangle represents a fragment. Purple rectangles are
used when no mutations were introduced (WT). Blue (low level of
re-encoding) and green (high level of re-encoding) rectangles are
used for re-encoded fragments (the value represents the number of
synonymous mutations).
[0174] FIG. 4: Replicative fitness of the WT and re-encoded
JEVs
[0175] In cellulo replicative fitness of re-encoded JEVs was
measured using human cells.r Results show an decrease of the
replicative fitness according to the level of re-encoding, the size
of the re-encoding region and the genomic position of the
re-encoded fragment(s).
EXAMPLES
Example 1
Generating an RNA Virus within Days
[0176] Example 1 illustrates the method ISA which allows the
production of a RNA virus within days.
[0177] The following illustration of ISA is based on viral genomes
which were not previously modified, i.e. viral genome which did not
go through a re-encoding step.
[0178] Methods
[0179] Cells, Viruses, Infectious Clones and Antibodies
[0180] Baby hamster kidney (BHK-21) cells were grown at 37.degree.
C. with 5% CO2 in a minimal essential medium (Life Technologies)
with 7% heat-inactivated foetal bovine serum (FBS; Life
Technologies) and 1% Penicillin/Streptomycin (PS; 5000U/mL and 5000
.mu.g/ml; Life Technologies). Human embryonic kidney 293 (HEK-293)
cells and African green monkey kidney (VeroE6) cells were grown at
37.degree. C. with 5% CO2 in the same medium than BHK-21 cells
supplemented with 1% of non-essential amino acids (Life
technologies). Human adrenal carcinoma (SW13) cells were grown at
37.degree. C. with 5% CO2 in RPMI 1640 medium (Life Technologies)
with 10% FBS and 1% PS. JEV genotype I strain JEV_CNS769_Laos_2009
(KC196115) was isolated in June 2009 from the cerebrospinal fluid
of a patient in Laos16; YFV strain BOL 88/1999 (KF907504), isolated
in 2009 from a human serum, was kindly provided by the National
Center of Tropical Diseases (CENETROP), Santa-Cruz, Bolivia; DENV-4
strain Dak HD 34 460 (KF907503), isolated from a human serum, was
kindly provided by Robert B Tesh from the Center for Biodefense and
Emerging Infectious Diseases--Sealy Center for Vaccine Development
(University of Texas Medical Branch, Galveston, Tex., USA); the
infectious clone of JEV genotype III derived from the strain rp9
(DQ648597) was kindly provided by Yi-Ling Lin from the Institute of
Biomedical Sciences, Academia Sinica, Taipei, Taiwan; the
infectious clone of WNV was derived from the strain Ouganda 1937
(M12294); the infectious clone of TBEV was derived from the strain
Oshima 5.10 (AB062063); the infectious clone of CV-B3 was derived
from the strain 2679 (KJ489414). A JEV-specific immune serum
(obtain after vaccination against JEV) and monoclonal DENV-specific
antibodies17 were used to perform direct immunofluorescence
assays.
[0181] Preparation of cDNA Fragments
[0182] The complete genome flanked respectively in 5' and 3' by the
human cytomegalovirus promoter (pCMV) (SEQ ID No:1) and the
hepatitis delta ribozyme followed by the simian virus 40
polyadenylation signal (HDR/SV40pA) (SEQ ID No:2) was amplified by
PCR in three overlapping DNA fragments of approximately 4,8 kb, 3,0
kb and 4,3 kb (4,8 kb, 2,9 kb and 5,2 kb for CHIKV, 4,8 kb, 4,1 kb
and 3,4 kb for TBEV and 2,9 kb, 2,8 kb and 2,7 kb for CV-B3) (see
Table 1 under).
[0183] For WNV, TBEV, JEV III and CHIKV, DNA fragments were
obtained by PCR using infectious clones (for JEV III, a mutation
was corrected using fusion PCR).
[0184] For JEV I (all DNA fragments), DENV-4 (first and third
fragments) and YFV (first and third fragments), DNA fragments were
synthesized de novo (Genscript) and amplified by PCR. Amplicons
were produced using the Platinum PCR SuperMix High Fidelity kit
(Life Technologies).
[0185] The mixture (final volume: 50 .mu.L) consisted of 45 .mu.L
of supermix, 2 .mu.L of DNA template at 1 ng/.mu.L (infectious
clone or synthesized DNA fragment) and 200 nM of each primer. For
DENV-4 and YFV, the second DNA fragment was obtained by RT-PCR from
clarified cell supernatants. Nucleic acids were extracted using the
EZ1 Virus Mini Kit v2 on the EZ1 Biorobot (both from Qiagen)
according to the manufacturer's instructions and amplified with the
Superscript III One-Step RT-PCR Platinum Taq Hifi kit (Life
Technologies). The mixture (final volume: 50 .mu.L) contained 25
.mu.L of Reaction Mix, 2 .mu.L of nucleic acid extract, 100 nM of
each primer, 1 .mu.L of Enzyme Mix and 20 .mu.L of Nuclease-Free
Water. Assays were performed on a Biometra T-professional Standard
Gradient thermocycler with the following conditions: 94.degree. C.
for 2 min followed by 40 cycles of 94.degree. C. for 15 sec,
64.degree. C. for 30 sec, 68.degree. C. for 5 min and a preliminary
step of 50.degree. C. for 30 min for the RT-PCR. Size of the PCR
products was verified by gel electrophoresis and purified using
Amicon Ultra--0.5 mL kit (Millipore) according to the
manufacturer's instructions. When plasmid DNA was used as template,
the complete removal of the template was ensured by a digestion
step with the restriction enzyme Dpnl (New England Biolabs) before
transfection. To control the efficiency of this additional step,
the inventors transfected (see below), as a control, only two cDNA
fragments (the first and the second, 1 .mu.g final). These controls
did not produce any infectious virus.
TABLE-US-00002 TABLE 2 Primers used to obtain cDAN fragments cDNA
Frag- SEQ SEQ Virus ment Primer Forward Position ID Primer Reverse
Position ID JEV I I CACCCAACTGATCTTCAGCATCT -- 3
GAAGAATGATTCTGTAAGTGTCCAG 4054-4078 4 II CGTTGCCATGCCAATCTTAGCG
4002-4023 5 GGTGCTTGCGTCCTTCCACCAA 6983-7004 6 III
CAAATGAGTATGGAATGCTGGAAAA 6932-6956 7 CTCAGGGTCAATGCCAGCGCTT -- 8
JEV II I GCCCACCGGAAGGAGCTGAC -- 9 CAGAGAGCAAATCCCTATGACGA
4078-4100 10 II CGTCACCATGCCAGTCTTAGCG 4001-4022 11
GCTTGGCAATCCAGTCAGTCCT 7004-7025 12 III CAAACGAGTACGGAATGCTAGAAA
6931-6954 13 CTCATGTTTGACAGCTTATCATCG -- 14 WNV I
TCAATATTGGCCATTAGCCATATTAT 15 TGGATTGAACACTCCTGTAGACGC 4135-4158 16
II TGGTTGGAGTTGGAAGCCTCATC 4052-4074 17 GACCATGCCGTGGCCGGCC
7016-7034 18 III TGGACAAGACCAAGAATGACATTG 6920-6943 19
GTTACAAATAAAGCAATAGCATCACA -- 20 TBEV I CAGGGTTATTGTCTCATGAGCGGA --
21 GCCACGCCCAGGAAGAGCATGA 4033-4054 22 II GGGCCCTCTGGAAATGGGGAGA
3892-3913 23 CAACCCAGGCTTGTCACCATCTTT 8003-8026 24 III
GGGTGAGGTCGTGGACCTTGGA 7886-7907 25 CCTAGGAATTTCACAAATAAAGCATTTT --
26 YFV I CACCCAACTGATCTTCAGCATCT -- 27 GCATGGAAGTGTCCTTTGAGTTCT
4071-4094 28 II GACTTGCAACGATGCTCTTTTGCA 4020-4043 29
GAGAGAGCATCGTCACAATGCC 7040-7061 30 III GATTCCATCCAGCACCGCACC
6964-6984 31 CTCAGGGTCAATGCCAGCGCTT -- 32 DENV-4 I
GAATAAGGGCGACACGGAAATGT 33 TGAAGACAGCTTGTCCTGCACAA -- 34 II
GATCATGGCTTGGAGGACCATTAT 3980-4003 35 GCTACTGCATAGAGCGTCCATG
6949-6970 36 III TTTACCAGGTAAAAACAGAAACCAC 6892-6916 37
CTCAGGGTCAATGCCAGCGCTT 38 JEV I I CACCCAACTGATCTTCAGCATCT 39
CATGGAACCATTCCCTATGGACT 1635-1657 40 6 frag- II
ACTGGATTGTGAACCAAGGAGTG 1560-1582 41 GAAGAATGATTCTGTAAGTGTCCAG
4054-4078 42 ments III CGTTGCCATGCCAATCTTAGCG 4002-4023 43
AATATAACCCCGAGCGGCGATG 5511-5532 44 IV ATGTCACCAAACAGGGTGCCCAA
5440-5462 45 GGTGCTTGCGTCCTTCCACCAA 6983-7004 46 V
CAAATGAGTATGGAATGCTGGAAAA 6932-6956 47 GCGCCGTGCTCCATTGATTCTG
8950-8971 48 VI GGCTGTGGGCACATTTGTCACG 8843-8864 49
CTCAGGGTCAATGCCAGCGCTT -- 50 CHIKV I CACCCAACTGATCTTCAGCATCT 51
CTGCTCGGGTGACCTGTCCTA 4050-4070 52 II TGAGATGTTTTTCCTATTCAGCAACT
3961-3986 53 AACAATGTGTTGACGAACAGAGTTA 6966-6990 54 III
CTCCCTGCTGGACTTGATAGAG 6859-6880 55 CTCAGGGTCAATGCCAGCGCTT -- 56
CV-B3 I CACCCAACTGATCTTCAGCATCT 57 CCACACAACATGCGTACCAAGCA
2184-2206 58 II CAGGCGCTGGCGCTCCGACA 2148-2167 59
GTCTATGGTTATACTCTCTGAACA 4970-4994 60 III GACAGGAGGACACAAGTCAGAT
4921-4943 61 CTCAGGGTCAATGCCAGCGCTT -- 62
[0186] Cell Transfection
[0187] 1 .mu.g final of either an equimolar mix of all cDNA
fragments amplified by PCR or 1 .mu.g of infectious clone of CV-B3
was incubated with 12 .mu.l of Lipofectamine 2000 (Life
Technologies) in 600 .mu.l of Opti-MEM medium (Life Technologies).
According to the manufacturer's instructions, the mixture was added
to a 12.5 cm2 culture flask of sub-confluent cells containing 1mL
of medium without antibiotics. After 4 hours of incubation, the
cell supernatant was removed, cells were washed twice (HBSS; Life
Technologies) and 3 mL of fresh medium was added. The cell
supernatant was harvested when gross cytopathic effect (CPE) was
observed (3-9 days depending on the cell type and the virus growth
speed) or 9 days posttransfection for non cytopathic viruses,
clarified by centrifugation, aliquoted and stored at -80.degree. C.
Each virus was then passaged four times using the same cell type
except for the DENV-4 and YFV for which VeroE6 and HEK-293 were
respectively used. Passages were performed by inoculating 333 .mu.L
of clarified cell supernatantonto cells in a 12.5 cm2 culture flask
containing 666 .mu.L of medium: after 2 hours of incubation, cells
were washed twice (HBSS) and 3 mL of fresh medium was added. The
cell supernatant was harvested after 2-6 days, clarified by
centrifugation, aliquoted and stored at -80.degree. C. Clarified
cell supernatants (viruses stocks) were used to perform
quantification of viral RNA, TCID50 assay, direct
immunofluorescence assay and whole-genome sequencing.
[0188] Real Time PCR and RT PCR Assays
[0189] To assess the production of infectious viruses and ensure
that positive detection was not the result of cDNA contamination,
viral RNA was quantified and compared with the quantity of detected
cDNA using the Access RT-PCR Core Reagent kit (Promega) with or
without the reverse transcriptase. RNA was extracted using the EZ1
mini virus 2.0 kit and the EZ1 Biorobot (both from Qiagen)
according to the manufacturer's instructions. The mixture (final
volume: 25 .mu.L) contained a standard quantity of AMV/Tfl 5.times.
Reaction Buffer, 0.5 .mu.M of each primer, 0.5 .mu.L of dNTP Mix,
0.5 mM of MgSO4, 0.5 .mu.L of AMV reverse transcriptase (only for
RT-PCR), 0.5 .mu.L of Tfl DNA polymerase, 15.5 .mu.L of
Nuclease-Free Water and 2 .mu.L of extracted nucleic acids. Assays
were performed using the CFX96 Touch.TM. Real-Time PCR Detection
System (Biorad) with the following conditions: 50.degree. C. for 15
min, 95.degree. C. for 2 min, followed by 45 cycles of 95.degree.
C. for 15 sec, 60.degree. C. for 40 sec. Data collection occurred
during the 60.degree. C. step. The difference between Cycle
Threshold values (ct) obtained by Real time PCR and Real time
RT-PCR assays has been used to assess viral RNA production. In
addition, the amount of viral RNA expressed as dose detection limit
(arbitrary unit; AU) was calculated from standard curves (nucleic
acids from cell supernatants of cultured viruses were used as
standard; five nucleic acid extracts were pooled and 10
.mu.l-aliquots were stored at -80.degree. C.).
[0190] Tissue Culture Infectious Dose 50 (TCID50) Assay
[0191] For each determination, a 96-well plate culture containing
20,000 BHK-21 cells in 100 .mu.L of medium per well (added just
before the inoculation) was inoculated with 50 .mu.L of serial
10-fold dilutions of clarified cell culture supernatants: each row
included 6 wells of the same dilution and two negative controls.
The plates were incubated for 7 days and read for absence or
presence of CPE in each well. The determination of the TCID50/mL
was performed using the method of Reed and Muench18.
[0192] Direct Immuno-Fluorescence Assay (dIFA)
[0193] Direct IFA were performed using 12.5 cm2 culture flasks of
SW13 cells for JEV I and JEV III, and VeroE6 cells infected
respectively 2 and 6 days before using clarified cell supernatant
(see above: passage of viruses). The supernatant was removed and
the cells washed twice (HBSS; Invitrogen), trypsinised, harvested
and diluted (1/5) with fresh medium. After cytocentrifugation of
150 .mu.L of this cell suspension (3 min, 900 rpm; Cytospin, Thermo
Scientific), the slides were dried, plunged 20 min in cold acetone
for fixation, dried, incubated 30 min at 37.degree. C. with
appropriately diluted JEV-specific immune serum (see above) or
monoclonal DENV-specific antibodies, washed twice with PBS, washed
once with distilled water, dried, incubated 30 min at 37.degree. C.
with the appropriately diluted FITC-conjugated secondary antibody
and Evans blue counterstain, washed twice with PBS, washed once
with distilled water, dried, mounted and read using a fluorescence
microscope.
[0194] Sequence Analysis of the Full-Length Genome
[0195] Complete genome sequencing was performed using the Ion PGM
Sequencer19 (Life Technologies) and analyses conducted with the CLC
Genomics Workbench 6 software. Virus supernatants were first
clarified and treated with the Benzonase nuclease HC >99%
(Novagen) at 37.degree. C. overnight. Following RNA extraction (no
RNA carrier was used; see above) using the EZ1 mini virus 2.0 kit
and the EZ1 Biorobot (both from Qiagen), random amplification of
nucleic acids was performed as previously described20. Amplified
DNA was analysed using the Ion PGM Sequencer according to the
manufacturer's instructions. The read obtained were trimmed: first
using quality score, then by removing the primers used during the
random amplification and finally at the 5' and 3' extremities by
removing systematically 6 nucleotides. Only reads with a length
greater than 29 nucleotides are used and mapped to the original
genome sequence used as a reference. Mutation frequencies
(proportion of viral genomes with the mutation) for each position
were calculated simply as the number of reads with a mutation
compared to the reference divided by the total number of reads at
that site.
[0196] Results
[0197] The inventors developed a simple and versatile reverse
genetics that facilitates the recovery of infectious RNA viruses
from genomic DNA material without requiring cloning, propagation of
cDNA into bacteria or in vitro RNA transcription. Their working
hypothesis was that transfection of overlapping double-stranded DNA
fragments, covering the entire genome of an RNA virus, into
susceptible cells would spontaneously enable recombination and
synthesis of a DNA copy of the complete viral genome. By including
at the 5' terminus of the first (5') DNA fragment, a promoter of
DNA-dependent RNA polymerases, and at the 3' terminus of the last
(3') DNA fragment a ribozyme sequence and a signal sequence for RNA
poly-adenylation, the inventors anticipated that this genomic DNA
copy would be transcribed as a full-length RNA genome with
authentic 5' and 3' termini that would be efficiently exported out
of the nucleus (in the case of a virus replicating in the
cytoplasmic compartment).
[0198] The inventors first tested this hypothesis with 6
flaviviruses (i.e., arthropod-borne enveloped viruses with a
single-stranded RNA genome of positive polarity that replicate in
the cytoplasm of infected cells) that represent major flaviviral
evolutionary lineages: two Japanese encephalitis viruses (JEV;
genotype I (JEV I) and genotype III (JEV III)), one genotype 2 West
Nile virus (WNV), one serotype 4 dengue virus (DENV-4), one
wild-type strain of Yellow fever virus (YFV) and one Far-Eastern
subtype Tick-borne encephalitis virus (TBEV) (Table 2).
[0199] Entire genomes were amplified by PCR in 3 DNA fragments of
approximately 4 kb, each with 70-100 bp overlapping regions. The
first and last fragments were flanked respectively in 5' and 3' by
the human cytomegalovirus promoter (pCMV) and the hepatitis delta
ribozyme followed by the simian virus 40 polyadenylation signal
(HDR/SV40pA) (FIG. 1). PCR products were column-purified, and 1
.mu.g of an equimolar mix of all fragments was transfected into
SW13 and/or BHK-21 cell lines, which, ensure efficient recovery of
flaviviral infectious genomes. Cell supernatant media from these
infectious cultures were serially passaged four times using the
same cell types, enabling the isolation of JEV I, JEV III, TBEV and
WNV. For more demanding viruses, isolation could be achieved by
passaging in additional permissive cells (e.g., DENV-4: VeroE6
cells; YFV: HEK-293 cells). Virus replication after four serial
passages was demonstrated for each virus using a combination of the
following criteria: [0200] (i) production of viral genomes in cell
supernatant medium using real time RT-PCR methods, [0201] (ii)
production of infectious particles in cell supernatant medium using
TCID50 assays, [0202] (iii) detection of cytopathic effect (CPE),
[0203] (iv) detection of viral antigens by direct
immunofluorescence assays, and [0204] (v) complete viral genome
sequencing using next generation sequencing (NGS) method.
[0205] The robustness, flexibility and versatility of the methods
were further challenged as follows. Firstly, the inventors
decreased the size and increased the number of overlapping
fragments combined for transfection. This was exemplified in the
case of JEV I, for which the ISA method generated infectious
viruses, when using up to 6 overlapping amplicons of approximately
2 kb. Secondly, they applied the ISA method to viruses with a
single-stranded RNA genome of positive polarity that belong to
different families: Chikungunya virus (CHIKV, an enveloped virus,
family Togaviridae) and Coxsackievirus B3 (CV-B3, a nonenveloped
virus, family Picornaviridae). Again, infectious viruses could be
isolated following transfection and four passages in HEK-293 cells
(CHIKV) or BGM cells (CV-B3) (Table 2 under).
[0206] Furthermore, the inventors used as a control the CV-B3
obtained following transfection of a plasmid-bearing infectious
genome and they obtained similar results in terms of infectivity
and sequence data (Table 3).
TABLE-US-00003 TABLE 3 Characterization of the recovered viruses
Origin of the material used to produce Cell line Cell line Real
time subgenomic amplicons used for used during RT-PCR Log10 Virus
Strain I II III transfection passages (U.A) TCID50/ml JEV JEV I DNS
DNS DNS BHK-21 BHK-21 1.32E+08 5.8 SW13 SW13 1.52E+07 5.2 SW13*
SW13* 9.33E+06 2.8* JEV III I.C. I.C. I.C. BHK-21 BHK-21 3.77E+07
6.1 SW13 SW13 4.04E+06 4.8 Chimeric JEV DNS I.C. I.C. BHK-21 BHK-21
9.33E+07 6.7 I/JEV III SW13 SW13 1.00E+07 6.8 Chimeric JEV I.C. DNS
DNS BHK-21 BHK-21 6.58E+07 6.6 III/JEV I SW13 SW13 3.06E+07 6.4 WNV
Ouganda I.C. I.C. I.C. BHK-21 BHK-21 5.73E+07 5.3 TBEV Oshima 5.10
I.C. I.C. I.C. BHK-21 BHK-21 3.28E+08 9.1 DENV-4 Dak HD 34 460 DNS
Viral RNA DNS SW13 VeroB5 6.59E+04 N/A YFV BOL 88/1999 DNS Viral
RNA DNS SW13 HEK 1.42E+05 5.2 CHIKV OPY1 I.C. I.C. I.C. HEK-293
HEK-293 2.01E+07 7 CVB-3 2679 I.C. I.C I.C. SW13 BGM 4.64E+07 7.4
CV-B3.sup. 2679.sup. Not obtained by PCR.sup. SW13.sup. BGM.sup.
9.33E+07 7.4.sup. Substitutions Substitutions per site after per
site after dN/dS (all dN/dS (fixed 4 passages 4 passages Virus
Strain CPE dIFA mutations) mutations) (all mutations) (fixed
mutations) JEV JEV I Yes N/A 3.273 N/A 1.27E-03 7.29E-04 Yes
Positive 0.409 N/A 7.29E-04 9.11E-05 Yes N/A N/A N/A N/A N/A JEV
III Yes N/A 1.286 1.143 1.54E-03 1.45E-03 Yes Positive 0.536 N/A
6.37E-04 -- Chimeric JEV Yes N/A 0.404 1.571 1.36E-03 3.64E-04
I/JEV III Yes N/A 1.19 1.589 9.10E-04 7.20E-04 Chimeric JEV Yes N/A
0.268 0.268 2.73E-04 2.73E-04 III/JEV I Yes N/A 5.357 3.178
1.00E-03 6.38E-04 WNV Ougande Yes N/A 0.268 N/A 4.55E-04 2.73E-04
TBEV Oshima 5.10 Yes N/A 3.214 N/A 7.20E-04 9.00E-05 DENV-4 Dak HD
34 460 No Positive 0.436 0.535 8.45E-04 5.63E-04 YFV BOL 88/1999
Yes N/A 0.818 0.818 4.63E-04 4.63E-04 CHIKV OPY1 Yes N/A 2.24 N/A
4.21E-04 -- CVB-3 2679 Yes N/A N/A N/A 2.70E-04 -- CV-B3.sup.
2679.sup. Yes N/A N/A N/A -- -- Summary of the different viruses
produced in this study: the specific name of the strain, the origin
of the initial material (DNS, De Novo Synthesis; I.C., Infectious
Clone; or Viral RNA) used as the template for production of the
first (I), second (II) and third (III) fragment, the cell line used
for the transfection and the passages, the relative quantification
of the amount of viral RNA and infectious titres in cell
supernatants at the fourth passage by real time RT-PCR and TCID50
assay, the presence or absence of cytopathic effect (CPE) as well
as the research of viral antigens by direct immunofluorescence
assay (dIFA). Complete viral genome sequences were obtained using
NGS technology. dN and dS correspond respectively to the number of
non-synonymous substitutions per non-synonymous site and the number
of synonymous substitutions per synonymous site. *Results obtained
by transfection of six overlapping fragments. .sup. Results
obtained by transfecting directly the CV-B3 plasmid-bearing
infectious clone. N/A and AU mean not available and arbitrary unit
respectively.
[0207] Thirdly, the inventors demonstrated the capability of ISA
method to generate genetically modified viruses in days. This was
exemplified by the PCR-based correction of a frame-shift mutation
(1915de1) in fragment one of a defective JEV III infectious clone
and the subsequent recovery of the corresponding virus
(Supplementary Methods). They were also able to produce chimeric
viruses by exchanging the first DNA fragment (encoding structural
proteins) of genotype I and III JEVs. Despite 11 mismatches in the
overlapping region of the first two fragments, transfection
resulted in the production of intergenotypic JEV I/JEV III and JEV
III/JEV I chimeras. Analysis of complete genomic sequences
established at the fourth passage, using NGS, showed that the
genetic drift (rate of sequence change) was modest (ranging from
1,45E-03 to 9,00E-05 substitutions per site when considering fixed
mutations). A majority of non-synonymous mutations, the presence of
shared mutations amongst the different JEV strains (7/85), and the
non-random distribution of mutations (at frequency above 10%) along
the genome (with both hot spots and highly conserved regions)
denoted adaptation to the cell culture conditions.
[0208] The mutation rate varied according to the cells used for
isolation and, as expected, was higher in viruses derived from
low-passage strains than in those derived from culture-adapted
strains. In conclusion, the ISA method is a very simple procedure
with which to expedite production of infectious genetically
modified RNA viruses within days, with perfect control of the viral
sequences and starting from a variety of initial sources including
pre-existing infectious clones, viral RNA or de novo synthesized
DNA genomic sequences. This technique has the future potential to
generate the design of large reverse genetics experiments for RNA
viruses, on a scale that could not previously have been considered.
It also has the capacity, specifically to modulate the
characteristics of the viruses recovered from experimental
procedures. Additionally, because DNA subgenomic fragments can
conveniently be obtained by PCR, this method has the potential to
conserve the genetic diversity of viral populations13 when starting
from viral RNA. Error-prone PCR may be also be used to create
artificial viral heterogeneity, e.g. for facilitating the selection
of adapted viruses15 under various experimental selection
conditions and, conversely, high-fidelity polymerases and clonal
amplification templates may be used to control the degree of
clonality of the viruses produced.
[0209] Finally, the method of the invention has the potential to
revolutionise the safety and security of future exchanges of RNA
viruses between scientific institutions, by the separate shipment
at room temperature of simple, on-infectious, DNA subgenomic
fragments that, could then be combined and transfected by the
recipient institute, enabling rapid, simple and safe recovery of
the infectious viral strain.
Example 2
Attenuation of Chikungunya
[0210] Materials and Methods
[0211] Cells and Antibodies
[0212] African green monkey kidney (Vero) cells were grown at
37.degree. C. with 5% CO2 in a minimal essential medium
(Invitrogen) with 7% heat-inactivated fetal bovine serum (FBS;
Invitrogen) and 1% Penicillin/Streptomycin (PS; 5000U/ml and 5000
.mu.g/ml; Invitrogen). Human embryonic kidney 293 (HEK293) cells
were grown at 37.degree. C. with 5% CO2 in Dulbecco's modified
Eagles medium (Invitrogen) with 10% FBS and 1% PS. A. albopictus
C6/36 cells were grown at 30.degree. C. in L-15 medium (Invitrogen)
with 10% heat-inactivated FBS, 1% PS and 5% tryptose phosphate
broth (29.5g/L; Sigma-Aldrich).
[0213] A CHIKV-specific immune human serum was used to perform the
ELISA assay (see below). To decrease the concentration of
non-specific molecules that react with HEK293 cell compounds,
40.mu.1 of serum was put in contact 16 hours with extracted HEK293
cells (cells obtained from one 150cm2 flask culture, extracted
using acetone) in a final volume of 400.mu.1 (diluents: 1% BSA;
KPL). A recombinant protein (fusion between the C-terminal region
of the nsP2 and the N-terminal region of the nsP3; Text S2), kindly
provided by the AFMB laboratory (Architecture et Fonction des
Macromolecules Biologiques, UMR 6098, Marseille France), was used
to immunize two rabbits using standard methods (Rabbit Speedy
28-days immunization protocol, Eurogentec). Purified polyclonal
antibodies (Affinity purification using a Sepharose matrix;
Eurogentec) were used to perform the western blot analysis.
[0214] In Silico Re-Encoding Method
[0215] Three regions of the CHIKV genome were re-encoded using a
computer program that randomly attributed nucleotide codons based
on their corresponding amino acid sequence: for example, the amino
acid valine was randomly replaced by GTT, GTC, GTA or GTG. To
minimize the influence of rare codons in primate cell lines, the
number and the position of such rare codons in primate genomes
(i.e. CGU, CGC, CGA, CGG, UCG, CCG, GCG, ACG) were not modified. In
addition, unique restriction sites were conserved by correcting
synonymous mutations at some sites. The location of the re-encoded
cassettes, first based on the availability of unique restriction
sites was adjusted to avoid overlap with known RNA secondary
structures. Finally, three cassettes of 1302, 1410 and 1500 bases
and located in the nsP1, nsP4 and E2/E1 regions, respectively, were
designed using this method (the sequences of the cassettes are
respectively depicted in SEQ ID No: 63, SEQ ID No: 64 and SEQ ID
No: 65).
[0216] Construction of CHIKV Infectious Clones (ICs)
[0217] We modified a previously described IC of the LR2006 strain
(GenBank accession EU224268) by replacing the origin of replication
and the prokaryote promoter by a modified pBR322 origin and a
promoter CMV (pCMV), respectively. BamHI and XhoI unique
restriction sites were used to obtain an intermediate plasmid using
standard molecular techniques which contained a new origin of
replication (modified pBR322), the prokaryote promoter CMV (pCMV)
and the partial viral genome (from the first base to XhoI). The
partial viral genome (from XhoI to the end), the polyA tail and the
hepatitis D ribozyme (HDR) followed by a Simian virus 40 (SV40)
polyadenylation was synthesized (Genscript) and introduced into the
intermediate construct using XhoI and AvrII unique restriction
sites. Finally, unique restriction sites BamHI, AgeI and XhoI were
used to introduce synonymous mutations into the genome (mutated
cassettes were obtained by fusion of PCR products). A total of
eight synonymous mutations were introduced to generate the required
restriction sites or to eliminate undesirable restriction sites.
The infectious clone obtained, which was considered the wild-type
(WT), incorporated four new unique restriction sites.
[0218] All the re-encoded regions were synthesized (GenScript) and
then inserted into ICs by digestion (BamHI/XmaI for .PHI.nsp1,
AgeI/ApaI for .PHI.nsp4 and XhoI/AvrII for .PHI.env; NewEngland
Biolabs), gel purification of digestion products (Qiagen), ligation
(T4 DNA ligase; Invitrogen) and transformation into
electrocompetent STBL4 cells (Invitrogen). Before their
transfection, all the infectious clones were purified (0.22 .mu.m
filtration) and their integrity was verified by restriction map and
complete sequencing using a set of specific primer pairs.
[0219] Real Time RT-PCR Assays
[0220] A fragment of 179 nt located in the nsP2 region (nucleotide
position 2631 to 2809) was used to detect the genomic RNA (plus
strand) of all the CHIKVs (universal assay), re-encoded or not.
Another fragment of 168 nt located in the nsP4 region (nucleotide
position 6804 to 6971) was used to analyze cell supernatants from
competition experiments: two sets of primers and probes allowed us
to specifically detect either the viruses re-encoded in the nsP4
region or the viruses without modification in the same region.
[0221] Replication Kinetics
[0222] The replicative fitness of each virus was determined using
the results of replication kinetics studies, performed in
triplicate in Vero, HEK293 or C6/36 cells. For comparison of the
seven viruses from the seven ICs (the WT virus and the 6 re-encoded
viruses), one experiment was performed with all the viruses. Virus
stock or ICs were used to infect or transfect cells respectively.
For the evaluation of replicative fitness of the passaged viruses,
the inventors performed one experiment for each virus (WT,
.PHI.nsp4 and .PHI.nsp1 .PHI.nsp4 .PHI.env viruses) with the first
passage in Vero and the 12th, 25th, 37th and 50th passages for each
passage regimen (13 supernatants tested in triplicate). For the
single cycle replication kinetics, an estimated MOI of 5 was used
to infect a 75 cm2 culture flask of confluent Vero, C6/36 or HEK293
cells. Cells were washed twice (HBSS) 30 minutes after the
infection and 20 ml of medium was added. 1 ml of cell supernatant
was sampled just before the washes and at 2, 8, 14, 20 and 28 hours
pi. For the replication kinetics with low estimated MOI and the
evaluation of the replicative fitness of the passaged viruses, an
estimated MOI of 0.01 was used to infect a 25 cm2 culture flask of
confluent Vero or C6/36 cells. Cells were washed twice (HBSS) 2
hours after infection and 8 ml of medium was added. 1 ml of cell
supernatant was sampled after the washes (TO) and at 24, 48 and 72
hours pi. For the replication kinetics using infectious DNA clones,
a 75 cm2 culture flask of subconfluent HEK293 cells was transfected
with the ICs using Lipofectamine 2000 (Invitrogen) according to the
manufacturer's instructions. Cells were washed twice (HBSS) 4 hours
after the transfection and 20 ml of medium was added. 1 ml of cell
supernatant was sampled after the washes (TO) and at 16, 24 and 48
hours pi.
[0223] All the sampled cell supernatants were clarified by
centrifugation, aliquoted and stored at -80.degree. C. They were
then analysed using a TCID50 assay and a real time RT-PCR assay
(not performed systematically, see figure legends). Nucleic acids
were extracted from clarified cell supernatants using the EZ1 Virus
Mini Kit v2 on the EZ1 Biorobot (both from Qiagen).
[0224] Virus Competition Experiments
[0225] WT virus was grown in competition with one of four
re-encoded viruses .PHI.nsp4, .PHI.nsp1 .PHI.nsp4, .PHI.nsp1
.PHI.env or .PHI.nsp 1 .PHI.nsp4 .PHI.env) using five different PFU
ratios (WT/re-encoded virus 1/99, 20/80, 50/50, 80/20, 99/1). A
global estimated MOI of 0.5 was used for the first inoculation. For
each experiment, a 25 cm2 flask culture of confluent cells was
infected for 2 hours, washed (HBSS) and then incubated for 48 h
after the addition of 7 ml of medium. Viruses from each experiment
were then passaged nine times as follows: a 25 cm2 flask culture of
confluent cells was infected for 2 hours with the purified culture
supernatant (centrifugation), washed (HBSS) and then incubated for
48 h after the addition of 7 ml of medium. At each passage, the
estimated MOI was bottlenecked at approximately 0.5. After each
infection, nucleic acids were extracted from the clarified culture
supernatant using the EZ1 Virus Mini Kit v2 on the EZ1 Biorobot
(both from Qiagen). Using two specific real time RT-PCR assays
targeting the .PHI.nsP4 region (see above), the amount of each
virus was assessed and the ratio of the two values (WT/re-encoded)
was calculated.
[0226] Quantification of Intracellular RNA and Viral Proteins
[0227] A global estimated MOI of 5 was used to infect confluent 12
well-plates of HEK293 cells with virus stock. Cells were washed
once (HBSS) 30 minutes after the infection and 2 ml of media was
added. At 8 hours pi, the absence of cytopathic effect was checked,
culture supernatants were discarded, and cells were washed once
(HBSS). All experiments were performed in triplicate. For Western
blot analysis and intracellular viral RNA quantification, total RNA
and protein isolation was performed using the same well with the
Nucleospin RNA/protein kit according to the manufacturer's
instructions (Macherey-Nagel). Protein extracts were resolved on
10% polyacrylamide gels containing SDS and transferred to PVDF
membrane. Anti-Nsp1/2 rabbit pAb, anti-actin C-2 mAb (Santa Cruz
Biotechnology) and the corresponding HRP-conjugated secondary
antibody were used. Protein bands were revealed using Immobilon
(Millipore) followed by exposure of blot to radiographic film. Real
time RT-PCR assay (see above) was performed to assess viral
intracellular RNA (mRNA actin was used as a normalizer to account
for differences in cells number and/or quality of extracted RNA as
described previously). For the quantification of viral proteins by
ELISA, cells were mechanically harvested using a cell scraper,
resuspended in 800 .mu.L of PBS, vortexed and disrupted by
sonication (30 seconds at 20 KHz, Misonix Sonicator XL).
Pre-treated CHIKV-specific immune human serum was used to detect
viral proteins.
[0228] Experimental Passage of Viruses in Cellulo
[0229] The WT and two re-encoded viruses .PHI.nsp4 and .PHI.nsp1
.PHI.nsp4 .PHI.env) were passaged 50 times following three
regimens: serial passages in Vero or C6/36 cells and alternate
passages between Vero and C6/36. For each passage, a 25 cm2 culture
flask of confluent cells was infected for 2 hours with the diluted
clarified cell supernatant, washed (HBSS) and incubated for 48
hours after the addition of 7 ml of medium. Cell supernatant was
then harvested, clarified by centrifugation, aliquoted and stored
at -80.degree. C. For each passage, the estimated MOI was
bottlenecked at approximately 0.1. To avoid contamination, virus
passages were performed in three phases: serial passages of WT and
.PHI.nsp4 viruses, alternate passages of the same viruses and
passages of the .PHI.nsp1 .PHI.nsp4 .PHI.env virus. All the viruses
passaged at the same time were manipulated sequentially and in
different laminar flow cabinets.
[0230] Plaque Assay
[0231] Monolayers of Vero cells in 12-well culture plates were
infected with 1 ml of virus stock (see above). After two hours,
cells were washed (HBSS) and 2 ml of 0.9% agarose in culture medium
was added. After an incubation of 72 hours, cells were fixed 4
hours with 10% formaldehyde and stained for 30 minutes with a 0.1%
naphthalene black solution.
[0232] Tissue Culture Infectious Dose 50 (TCID50) Assay
[0233] For each determination, a 96-well plate culture of confluent
Vero cells was inoculated with 150 .mu.l/well of serial 10-fold
dilutions of centrifugation clarified cell culture supernatants:
each row included 6 wells of the dilution and two negative
controls. The plates were incubated for 7 days and read for absence
or presence of CPE in each well. The determination of the TCID50/m1
was performed using the method of Reed and Muench. When the value
obtained with a sample was less than the detection threshold of the
method (101.82 TCID50/m1), the inventors performed another assay
with two-fold, 20-fold and 200-fold dilutions (detection threshold:
101.13 TCID50/ml). Values lower than this threshold were considered
equal to 101.13 TCID50/ml in the graphic presentations and were not
taken into account in the statistical analyses. Assuming that the
re-encoding and/or the experimental passages could modify
significantly the appearance of CPE, the inventors used a qRT-PCR
assay (see below) as a sensitive indicator of the presence of
infectious virus. This assay was performed for each virus (first
passage and when available, 25th and 50th passages). For all the
viruses, CPE positive wells were positive in qRT-PCR with a
threshold cycle lower than 16 while those that failed to produce
CPE were negative or positive with a threshold cycle >35, the
value expected after the dilution of the initial RNA yields.
[0234] Haemagglutination Assay
[0235] An estimated MOI of 5 was used to infect with virus stock
(see above) a 25cm2 culture flask of confluent Vero or C6/36 cells.
Cells were washed twice (HBSS) 30 minutes after the infection and 8
ml of medium without FBS was added. 2 ml of cell supernatant was
sampled at 16 hours pi. Sampled supernatants were clarified by
centrifugation, aliquoted and stored at -80.degree. C. They were
then analysed using a TCID50 assay (see above), a real time RT-PCR
assay and a haemagglutination titration assay was performed using
standard methods: twofold serial dilutions of cell supernatant on
U-bottom microplates were prepared in 0.4% bovine albumin/borate
saline pH 9.0 solution (final volume: 35 .mu.l per well).
Thirty-five microliters of pre-diluted goose red blood cells (1/150
using the final pH 6.0 adjusting diluents) were added, the mixture
was homogenized, incubated for 45 min at room temperature and then
read using four scoring symbols: ++for complete haemagglutination,
+for partial haemagglutination, +/- for trace haemagglutination
and-for negative haemagglutination. The haemagglutination titre was
the reciprocal of the highest dilution in which+was observed.
[0236] Results
[0237] The inventors have evaluated the effect on replicative
fitness and cytopathogenicity of large-scale re-encoding of CHIKV,
a re-emerging Old World pathogenic arbovirus. The generation of
attenuated viruses by large-scale re-encoding represents an
exciting and potentially important route to vaccine development,
and also to understanding the basis of the evolution of viral
pathogenicity. Site-directed re-encoding, associated with no
modification of amino acid sequences, alleviates the likelihood of
novel phenotypic properties, allows us to modulate fitness by
altering the length of the codon replacement interval, but
additionally provides benefits to the generic development of live
attenuated vaccines, including reduced costs and single dose
induction of long-term immunity.
[0238] A key result was the observation that the random re-encoding
method disclosed herein decreased the replicative fitness of CHIKV
in both primate and arthropod cells. The diminution of CHIKV
replicative fitness correlated directly with the degree of
re-encoding. The inventors found that during one replicative cycle
in mosquito cells, codon re-encoding profoundly reduced the
infectious titre of released virus whilst the number of viral
particles remained stable. This implies that the maturation process
(i.e. the formation of ribonucleoproteins and their insertion into
plasma membranes that contain HA) could be at fault when viruses
are re-encoded.
[0239] In contrast, in primate cells, this decline in infectivity
of the viral particles was associated with the reduced generation
of viral RNA and proteins probably due to a compromised replication
complex.
[0240] These results indicate that synonymous mutations in viral
genomes have major fitness effects and not only in the small number
of cis-acting elements described previously (Gerardin et al.,
2008).
[0241] Indeed, during this experiment, six re-encoded viruses were
produced of which the most re-encoded virus modified in three
regions that encode different proteins (together, 882 synonymous
mutations were introduced spanning 4,212 nt). In support of
previous studies which demonstrated that re-encoded poliovirus and
influenza A viruses are attenuated, the observation of a reduction
in replicative fitness strongly suggest that a proportion of
synonymous mutations are not neutral in RNA viruses. Indeed, it is
likely that some synonymous mutations were positively selected
during the passaging process, reinforcing the idea that synonymous
sites are central to viral fitness. In conclusion, it is likely
that synonymous mutations can be either neutral, beneficial or
deleterious as is the case for non-synonymous mutations.
[0242] Evolutionary patterns at synonymous sites could be shaped by
genome-wide mutational processes, such as G+C%, codon usage bias
and dinucleotide frequency. These global constraints, which
theoretically produce a subset of viable genomes, were assessed by
previous studies of codon re-encoding in poliovirus, influenza A
virus and bacterial virus T7 which applied specific modification of
codon usage bias, codon pair bias or CpG/UpA frequencies.
[0243] Using a large-scale random re-encoding method, which only
slightly modified these global properties, the inventors still
observed replicative fitness reductions in both primate and
arthropod cells. These results indicate that local constraints may
also provide significant selection pressure on synonymous sites in
RNA viruses, for example by disrupting RNA secondary structures.
Since numerous functional secondary structures are present in
coding regions of RNA viruses, and hence include synonymous sites
(with notable examples in poliovirus, tick-borne encephalitis
virus, alphaviruses and HIV-1), it is likely that similar
structures are common in CHIKV.
[0244] Recently, it was demonstrated that a similar re-encoding
strategy applied to the noncapsid regions of the poliovirus
resulted in the identification of two novel functional RNA
elements. The concept of large-scale random re-encoding, as
described here, is also supported by the report of the negative
impact of random single synonymous mutations (which did not modify
the genetic characteristics of the genome) on viral replicative
fitness.
[0245] Finally, these results indicate that the reduction of viral
replicative fitness is driven by a variety of factors.
[0246] First, the nature of the virus studied is an important
parameter: the inventors found that introducing up to 882 random
synonymous mutations clearly affected the replicative fitness of
the CHIKV, whilst two previous studies demonstrated that comparable
random re-encoding methods applied to the capsid precursor (P1)
region of the poliovirus did not significantly affect replicative
fitness (934 and 153 synonymous substitutions were introduced,
respectively).
[0247] The location of the re-encoded region constitutes the second
factor of importance: re-encoding in the E2/E1 region resulted in a
greater loss of fitness than in other genomic regions. The analysis
of complete wild type CHIKV genomes revealed naturally low levels
of synonymous diversity in this re-encoded region indicating that
this region is subject to specific local evolutionary constraints
which in part explain the significant impact of re-encoding in this
region.
[0248] The average impact of one mutation is clearly likely to be
less important in random re-encoding than in specific approaches.
This suggests that random large-scale re-encoding could be
advantageous in several aspects when designing future vaccine
candidates, namely: [0249] (i) reversion to wild-type should be
intrinsically more difficult, given the high number of mutations
produced; [0250] (ii) since in the present experiments the
reduction of replicative fitness decreased with the degree of
re-encoding, the method opens the door to finely tuning fitness
reduction through modulation of the length of re-encoded regions
and the number of synonymous mutations introduced; [0251] (iii) the
use of a combination of several re-encoded regions located
throughout the viral genome may prevent complete phenotypic
reversion due to recombination between WT and re-encoded viruses:
large scale sequence modification may render recombination
intrinsically more difficult, and in the case of recombination, the
part of the genome representing the re-encoded strain would likely
still carry some mutations associated with fitness reduction.
[0252] Consequently these re-encoded viruses are very stable. To
corroborate, the inventors passaged the wild type and two
re-encoded CHIKVs in cellulo. During serial passage of the
re-encoded viruses, the inventors observed that the response to
codon re-encoding and adaptation to culture conditions occurred
simultaneously. However, the high levels of observed convergent
evolution between the WT virus and the re-encoded viruses indicates
that selection arising from codon re-encoding was likely weaker
than that for adaptation to culture conditions, and/or that the
beneficial mutations to restore the cost of re-encoding were less
likely to arise. Therefore, this indirect insight into the
difficulty of reversing the effects of re-encoding further
highlights the stability of these re-encoded viruses.
[0253] These experiments also confirm that mutations acquired in
one host can be deleterious in a different host type (serial
passages in primate cells increased viral replicative fitness in
primate cells, whilst serial passages in mosquito cells decreased
viral fitness in primate cells) and, with the exception of the most
re-encoded virus, that alternate passages seriously (i) limit
replicative fitness enhancement, and (ii) delay the appearance of
the mutations.
[0254] In conclusion, these experiments demonstrate that random
codon re-encoding significantly decreases the replicative fitness
of CHIKV. Although all these results are important and encouraging,
they cannot be easily extended to RNA viruses producing chronic
infections. Thus, studies in animal models are obviously needed to
evaluate the potential of these new generation attenuation methods
for producing vaccine candidates. However, this approach could
assist in the development of future RNA virus vaccines, including
those for arboviruses. Introducing a large number of slightly
deleterious synonymous mutations reduced the replicative fitness of
CHIKV by orders of magnitude in both primate and arthropod cells.
This strategy resulted in limited reversion and recovery of fitness
after intensive serial subculture of the viruses, and is likely to
reduce the risk of complete phenotypic reversion if recombination
with wild type virus occurs. Our results encourage us that such
modified viruses would find it difficult to return to their natural
arboviral cycle in the real world. Furthermore, the decrease of the
replicative fitness correlated with the extent of re-encoding, an
observation that may be advantageous in the development of future
strategies to modulate viral attenuation.
Example 3
Attenuation of Further RNA Viruses
[0255] The large scale codon re-encoding step of the invention has
been shown to be a powerful method of attenuation which has several
advantages for vaccine development, including the possibility to
obtain potential vaccine strains in a very short period as soon as
the complete sequence of the targeted pathogen is known and an
infectious genome can be produced. It also has the possibility to
modulate precisely the degree of replicative fitness loss and to
generate safe, live-attenuated vaccines that confer long-term
protection, in a cost effective manner.
[0256] The inventors applied the method of attenuation disclosed
herein and exemplified in example 2, to 2 other arboviruses (both
are flaviviruses; enveloped single-strand positive-sense RNA
viruses): the Tick-Borne Encephalitis Virus (TBEV) and the Japanese
encephalitis virus (JEV).
[0257] A) TBEV
[0258] Following the method of large-scale codon re-encoding
previously applied to the Chikungunya virus (CHIKV), the inventors
modified the NS5 genomic region (a cassette of 1412 pb, as depicted
in SEQ ID No: 66) of the TBEV (Oshima 5-10 strain), inserting 273
silent mutations (random codon re-encoding).
[0259] The TBEV strain Oshima 5-10, which was isolated in 1995 in
Japan, belong to the Far Eastern subtype and shows an important
virulence in mice (it provokes encephalitis as for humans).
Wild-type (WT) and NS5_random_re-encoded viruses are obtained using
the ISA method and classical methods (infectious clones were
obtained). The replicative fitness of the corresponding viruses was
measured in cellulo and was almost identical.
TABLE-US-00004 TABLE 4 Genetic characteristics of the studied TBEV
%G + C of the Cassette size ENC of the complete (NS5 genomic Number
of complete open open reading Virus region) mutations reading frame
frame WT -- -- 54.0 54.3 NS5 re- 1412 nt 273 55.5 53.8 encoded
Codon usage was measured using the effective number of codons ENC
which gives a value ranging from 20 (only one codon used for each
amino acid) to 61 (random codon usage for each amino acid).
[0260] An in vivo model was then used to measure the attenuation
phenotype of this re-encoded TBEV. After intraperitoneal
inoculation (2.10.sup.4, 2.10.sup.5 and 2.10.sup.6 TCID50 of
viruses were used), mice were monitored for symptom appearance and
weighted every day during 20 days.
[0261] Results show a delay weight loss and symptom appearance for
mice infected with NS5_random_re-encoded virus compare to those
infected by WT virus. Moreover, the number of mice displaying at
least one symptom, weight loss (.ltoreq.94%) and virus in the brain
(detection of viral RNA by real time RT-PCR) is significantly
higher for WT infected mice than NS5_random_re-encoded infected
mice. High levels of seroneutralising IgG antibodies were observed
in mice infected with NS5_random_re-encoded virus at 30 days after
the first inoculation. Finally, challenge experiments (mice were
challenged 30 days after the first inoculation) by the WT virus
show that all the mice previously infected by re-encoded viruses
were protected (based on appearance of symptoms and weight
loss).
TABLE-US-00005 TABLE 5 Genetic characteristics of the different WT,
lightly or strongly re-encoded fragments. Fragment I Fragment II
Fragment III Virus Length Mutation G + C % Length Mutation G + C %
Length mutation G + C % WT 3646 -- 50.8 2854 -- 52.3 3410 -- 53.0
500 3646 225 49.7 2854 161 51.6 3410 199 52.0 (6.2%) (5.6%) (5.8%)
1500 3646 672 49.1 2854 482 49.6 3410 563 50.3 (18.4%) (16.9%)
(16.5%) Number of the fragment (first, second or third), length,
number of synonymous mutations and G + C % are indicated. 500 and
1500 mean low and high level of re-encoding.
[0262] Using the reverse genetics method ISA and combinations of
these WT and re-encoded fragments, the inventors produced a large
number of recombinant viruses harboring gradual levels of
re-encoding in different parts of the genome.
[0263] B) JEV
[0264] The inventors have modified the JEV strain
`JEV_CNS769_Laos_2009` (Genotype 1) using the large scale random
codon re-encoding method.
[0265] A different approach is used here: the inventors re-encoded
in silico almost all the complete open reading frame (ORF), from
the beginning of PrM to the end of NS5 genomic regions, using two
different levels of re-encoding: a high level and a low level of
re-encoding with the insertion of either 585 or 1717 synonymous
mutations throughout the open reading frame (FIG. 3).
[0266] For his purposes, the inventors used at least one re-encoded
cassette as depicted in SEQ ID No: 67; SEQ ID No: 68; SEQ ID No:
69; SEQ ID No: 70; SEQ ID No: 71; and SEQ ID No:72.
[0267] In cellulo replicative fitness of these re-encoded JEVs was
measured using human cells: Preliminary results show an decrease of
the replicative fitness according to the level of re-encoding, the
size of the re-encoding region and the genomic position of the
re-encoded fragment(s) (FIG. 4).
Example 4
In Vivo Generation
[0268] Overlapping fragments covering the entire genome of RNA
viruses and flanked respectively at 5 and 3' by promoter of
DNA-dependent RNA polymerase and terminator/RNA polyadenylation
signal were prepared using the method of the invention.
[0269] These DNA fragments were directly inoculated to live animals
and allowed to recover infectious virus from several animal
samples. In addition, clinical surveillance of animals (appearance
of symptom and significant weight loss) allowed to observed typical
signs of infection.
[0270] a) Experiment 1: Tick-Borne Encephalitis Virus (TBEV;
Flavivirus)
[0271] The inventors used a wild-type strain of tick-borne
encephalitis virus (strain Oshima 5.10 (GenBank accession number
AB062063)). They applied the method of the invention to DNA
overlapping fragments.
[0272] Five-weeks-old C57B1/6J female mice were inoculated with
three DNA overlapping fragments.
[0273] The clinical course of the viral infection was monitored by
following
[0274] (i) the clinical manifestations of the disease (shivering,
humpback, dirty eyes, hemi- or tetra-paresia, hemiplegia or
tetraplegia) ; and
[0275] (ii) the weight of the mice exactly as described by Fabritus
L et al., 2015, Attenuation of Tick-Borne Encephalitis Virus Using
Large-Scale Random Codon Re-encoding. PLoS Pathog 11(3).
[0276] Brains and spleens were collected from sacrificed mice 14
days post-inoculation. Brains and spleens were grounded and
centrifuged. The resulting supernatant was used to assess the
presence of infectious virus.
[0277] The presence of infectious virus was assessed using
molecular (real time RT-PCR) and classical cell culture methods
(isolation of infectious viruses).
[0278] Using an initial amount of DNA ranging between 2 to 5 .mu.g,
and two different inoculation routes (intraperitoneal and
intradermal injections), infectious viruses were detected from both
brains and spleens. Clinical manifestations (significant weight
losses and symptoms) of the diseases were also observed.
[0279] b) Experiment 2: Intracerebral Inoculation of Suckling
Mice
[0280] The inventors used wild-type strains of tick-borne
encephalitis virus (strain Oshima 5.10 (GenBank accession number
AB062063)) and Japanese encephalitis (JEV_CNS769_Laos_2009 (GenBank
accession number KC196115)). They used the method of the invention
to generate the DNA overlapping fragments.
[0281] DNA overlapping fragments were used diluted in PBS or were
mixed with a transfection reagent.
[0282] Suckling OF1 mice were inoculated by intracerebral injection
of DNA overlapping fragments. The clinical course of the viral
infection was monitored by following the clinical manifestation of
the disease (shivering, lethargy). Brains were collected from
sacrificed mice 6-12 days post-inoculation. Brains were grounded
and centrifuged. The resulting supernatant was used to assess the
presence of infectious virus.
[0283] The presence of infectious virus was assessed using
molecular (real time RT-PCR) and classical cell culture methods
(isolation of infectious viruses).
[0284] Using 2.mu.g of DNA, infectious viruses were detected in
brains for both viruses (TBEV and JEV) and with or without addition
of transfection reagent. Clinical manifestations of the diseases
were also observed.
Conclusion
[0285] The inventors have thus harnessed the power of the methods
disclosed herein by generating virus in vivo. Sais method would
thus be highly efficient for developing a live attenuated vaccine
in vivo, i.e. directly within the body a subject.
Sequence CWU 1
1
131781DNAArtificial SequencePromotor 1gaataagggc gacacggaaa
tgtcacccaa ctgatcttca gcatcttcaa tattggccat 60tagccatatt attcattggt
tatatagcat aaatcaatat tggctattgg ccattgcata 120cgttgtatct
atatcataat atgtacattt atattggctc atgtccaata tgaccgccat
180gttggcattg attattgact agttattaat agtaatcaat tacggggtca
ttagttcata 240gcccatatat ggagttccgc gttacataac ttacggtaaa
tggcccgcct ggctgaccgc 300ccaacgaccc ccgcccattg acgtcaataa
tgacgtatgt tcccatagta acgccaatag 360ggactttcca ttgacgtcaa
tgggtggagt atttacggta aactgcccac ttggcagtac 420atcaagtgta
tcatatgcca agtccgcccc ctattgacgt caatgacggt aaatggcccg
480cctggcatta tgcccagtac atgaccttac gggactttcc tacttggcag
tacatctacg 540tattagtcat cgctattacc atggtgatgc ggttttggca
gtacaccaat gggcgtggat 600agcggtttga ctcacgggga tttccaagtc
tccaccccat tgacgtcaat gggagtttgt 660tttggcacca aaatcaacgg
gactttccaa aatgtcgtaa taaccccgcc ccgttgacgc 720aaatgggcgg
taggcgtgta cggtgggagg tctatataag cagagctcgt ttagtgaacc 780g
7812192DNAArtificial SequenceHDR - SV40pA 2ggccggcatg gtcccagcct
cctcgctggc gccggctggg caacattccg aggggaccgt 60cccctcggta atggcgaatg
ggactcgcga cagacatgat aagatacatt gatgagtttg 120gacaaaccac
aactagaatg cagtgaaaaa aatgctttat ttgtgaaatt aagcgctggc
180attgaccctg ag 192323PRTArtificial Sequenceprimer F 3Cys Ala Cys
Cys Cys Ala Ala Cys Thr Gly Ala Thr Cys Thr Thr Cys1 5 10 15Ala Gly
Cys Ala Thr Cys Thr 20425DNAArtificial Sequenceprimer R 4gaagaatgat
tctgtaagtg tccag 25522DNAArtificial Sequenceprimer F 5cgttgccatg
ccaatcttag cg 22622DNAArtificial Sequenceprimer R 6ggtgcttgcg
tccttccacc aa 22725DNAArtificial Sequenceprimer F 7caaatgagta
tggaatgctg gaaaa 25822DNAArtificial Sequenceprimer R 8ctcagggtca
atgccagcgc tt 22920DNAArtificial Sequenceprimer F 9gcccaccgga
aggagctgac 201023DNAArtificial Sequenceprimer R 10cagagagcaa
atccctatga cga 231122DNAArtificial Sequenceprimer F 11cgtcaccatg
ccagtcttag cg 221222DNAArtificial Sequenceprimer R 12gcttggcaat
ccagtcagtc ct 221324DNAArtificial Sequenceprimer F 13caaacgagta
cggaatgcta gaaa 24
* * * * *