U.S. patent application number 16/818113 was filed with the patent office on 2020-07-02 for methods for the administration of iloperidone.
The applicant listed for this patent is Vanda Pharmaceuticals Inc.. Invention is credited to Mihael H. Polymeropoulos, Curt D. Wolfgang.
Application Number | 20200206213 16/818113 |
Document ID | / |
Family ID | 36143143 |
Filed Date | 2020-07-02 |
United States Patent
Application |
20200206213 |
Kind Code |
A1 |
Wolfgang; Curt D. ; et
al. |
July 2, 2020 |
METHODS FOR THE ADMINISTRATION OF ILOPERIDONE
Abstract
The present invention relates to methods for the identification
of genetic polymorphisms that may be associated with a risk for QT
prolongation after treatment with iloperidone and related methods
of administering iloperidone to patients with such
polymorphisms.
Inventors: |
Wolfgang; Curt D.;
(Germantown, MD) ; Polymeropoulos; Mihael H.;
(Potomac, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Vanda Pharmaceuticals Inc. |
Washington |
DC |
US |
|
|
Family ID: |
36143143 |
Appl. No.: |
16/818113 |
Filed: |
March 13, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16286878 |
Feb 27, 2019 |
|
|
|
16818113 |
|
|
|
|
15835872 |
Dec 8, 2017 |
10272076 |
|
|
16286878 |
|
|
|
|
14710817 |
May 13, 2015 |
|
|
|
15835872 |
|
|
|
|
14150575 |
Jan 8, 2014 |
9138432 |
|
|
14710817 |
|
|
|
|
14060978 |
Oct 23, 2013 |
|
|
|
14150575 |
|
|
|
|
11576178 |
Mar 28, 2007 |
8586610 |
|
|
PCT/US2005/035526 |
Sep 30, 2005 |
|
|
|
14060978 |
|
|
|
|
60614798 |
Sep 30, 2004 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 25/24 20180101;
C12Q 2600/106 20130101; A61P 9/04 20180101; A61P 25/18 20180101;
C12Q 1/6883 20130101; C12Q 2600/156 20130101; A61P 25/00 20180101;
A61K 31/454 20130101; C12Q 2600/172 20130101; A61K 31/519
20130101 |
International
Class: |
A61K 31/454 20060101
A61K031/454; C12Q 1/6883 20060101 C12Q001/6883; A61K 31/519
20060101 A61K031/519 |
Claims
1. A method for treating a patient with an active pharmaceutical
ingredient including at least one of: iloperidone, a
pharmaceutically acceptable salt of iloperidone, an active
metabolite of iloperidone, and a pharmaceutically acceptable salt
of an active metabolite of iloperidone, comprising the steps of:
determining the patient's CYP2D6 genotype; and administering to the
patient an effective amount of the active pharmaceutical
ingredient, whereby the amount of the active pharmaceutical
ingredient is determined based on the patient's CYP2D6
genotype.
2. The method of claim 1, wherein the amount of the active
pharmaceutical ingredient is decreased if the genotype indicates
decreased enzymatic activity of the CYP2D6 enzyme relative to the
wild type.
3. The method of claim 1, wherein the amount of the active
pharmaceutical ingredient is decreased if the patient's
CYP2D6G1846A genotype is AA.
4. The method of claim 1, wherein the amount of the active
pharmaceutical ingredient is decreased if the patient's
CYP2D6G1846A genotype is GA.
5. The method of claim 1, wherein the amount of the active
pharmaceutical ingredient is decreased if the patient's CYP2D6C100T
genotype is TT.
6. The method of claim 1, wherein the amount of the active
pharmaceutical ingredient is decreased if the patient's CYP2D6C100T
genotype is CT.
7. The method of claim 1, wherein the patient is suffering from at
least one of schizophrenia, schizoaffective disorder, depression,
bipolar mania/depression, cardiac arrhythmia, Tourette's Syndrome,
a psychotic disorder, a delusional disorder, and schizophreniform
disorder.
8. The method of claim 7, wherein the patient is at risk for a
prolonged QT interval.
9. A method for treating a patient who is a CYP2D6 poor metabolizer
with a pharmaceutically active ingredient including at least one
of: iloperidone, a pharmaceutically acceptable salt of iloperidone,
an active metabolite of iloperidone, and a pharmaceutically
acceptable salt of an active metabolite of iloperidone, wherein the
patient is administered a lower dosage than would be given to an
individual who is not a CYP2D6 poor metabolizer.
10. The method of claim 9, wherein the patient is determined to be
a CYP2D6 poor metabolizer based on at least one of the patient's
genotype, the patient's phenotype, and the fact that the patient is
being treated with an agent that reduces CYP2D6 activity.
11. The method of claim 9, wherein the patient's genotype includes
at least one CYP2D6 allele selected from a group consisting of 2549
A deletion, 1846 G>A, 1707 T deletion, 2935 A>C, 1758 G>T,
2613-2615 AGA deletion, 1023 C>T, 2850 C>T, 4180 G>C, 1659
G>A, 1661 G>C, 2850 C>T, 3183 G>A, -1584 C, -1235
A>G, -740C>T, and -678 G>A.
12. The method of claim 10, wherein the patient's genotype includes
at least one deletion of the CYP2D6 gene.
13. The method of claim 11, wherein the patient's genotype includes
a CYP2D7gene conversion in intron 1.
14. The method of claim 9, wherein the patient is suffering from at
least one of schizophrenia, schizoaffective disorder, depression,
bipolar mania/depression, cardiac arrhythmia, Tourette's Syndrome,
a psychotic disorder, a delusional disorder, and schizophreniform
disorder.
15. A method of treating a patient with a pharmaceutically active
ingredient including at least one of: iloperidone, a
pharmaceutically acceptable salt of iloperidone, an active
metabolite of iloperidone, and a pharmaceutically acceptable salt
of an active metabolite of iloperidone comprising the steps of:
determining whether the patient is being administered a CYP2D6
inhibitor; and reducing the dosage of drug if the patient is being
administered a CYP2D6 inhibitor.
16. The method of claim 15, wherein the CYP2D6 inhibitor includes
at least one of paroxetine, dolasetron, venlafaxin, and
fluoxetine.
17. The method of claim 15, wherein the patient is suffering from
at least one of schizophrenia, schizoaffective disorder,
depression, bipolar mania/depression, cardiac arrhythmia,
Tourette's Syndrome, a psychotic disorder, a delusional disorder,
and schizophreniform disorder.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of co-pending U.S. patent
application Ser. No. 16/286,878 filed Feb. 27, 2019, which is a
continuation of U.S. patent application Ser. No. 15/835,872 filed
Dec. 8, 2017, which is a continuation of U.S. patent application
No. 14/710,817, filed May 13, 2015, which is a continuation of U.S.
patent application Ser. No. 14/150,575, filed Jan. 8, 2014 (now
U.S. Pat. No. 9,138,432, issued Sep. 22, 2015), which is a
continuation of U.S. patent application Ser. No. 14/060,978, filed
Oct. 23, 2013, which is a continuation of U.S. patent application
Ser. No. 11/576,178, filed Mar. 28, 2007 (now U.S. Pat. No.
8,586,610, issued Nov. 19, 2013), which is a 35 U.S.C. .sctn. 371
national stage entry of International Patent Application No.
PCT/US2005/035526, filed Sep. 30, 2005, which claims the benefit of
U.S. Provisional Patent Application No. 60/614,798, filed Sep. 30,
2004. Each of the foregoing patent applications is incorporated by
reference herein as though fully set forth.
SEQUENCE LISTING
[0002] The sequence listing contained in the electronic file titled
"VAND-0002-US-CON6_SequenceListing_ST25_2020-03-13.txt," created
Mar. 13, 2020, comprising 2 KB, is hereby incorporated herein by
reference.
BACKGROUND OF THE INVENTION
[0003] Several genes associated with drug metabolism have been
found to be polymorphic. As a result, the abilities of individual
patients to metabolize a particular drug may vary greatly. This can
prove problematic or dangerous where an increased concentration of
a non-metabolized drug or its metabolites is capable of producing
unwanted physiological effects.
[0004] The cytochrome P450 2D6 gene (CYP2D6), located on chromosome
22, encodes the Phase I drug metabolizing enzyme debrisoquine
hydroxylase. A large number of drugs are known to be metabolized by
debrisoquine hydroxylase, including many common central nervous
system and cardiovascular drugs. One such drug is iloperidone
(1-[4-[3-[4-(6-fluoro-1,2-benzisoxazol-3-yl)-1-piperidinyl]propoxy]-3-met-
hoxyphenyl]ethanone). Iloperidone and methods for its production
and use as an antipsychotic and analgesic are described in U.S.
Pat. No. 5,364,866 to Strupczewski et al. The diseases and
disorders that can be treated by administration of iloperidone
include all forms of schizophrenia (i.e., paranoid, catatonic,
disorganized, undifferentiated, and residual), schizoaffective
disorders, bipolar mania/depression, cardiac arrhythmias,
Tourette's Syndrome, brief psychotic disorder, delusional disorder,
psychotic disorder NOS (not otherwise specified), psychotic
disorder due to a general medical condition, schizophreniform
disorder, and substance-induced psychotic disorder. P88 is an
active metabolite of iloperidone. See, e.g., PCT WO2003020707,
which is incorporated herein by reference.
[0005] Among the unwanted physiological effects associated with an
increased concentration of iloperidone or its metabolites is
prolongation of the electrocardiographic QT interval. Mutations in
the CYP2D6 gene have been associated with a number of drug
metabolism-related phenotypes. These include the ultra rapid
metabolizer (UM), extensive metabolizer (EM), intermediate
metabolizer (IM), and poor metabolizer (PM) phenotypes. Where a
particular drug is capable of producing unwanted physiological
effects in its metabolized or non-metabolized forms, it is
desirable to determine whether a patient is a poor metabolizer of
the drug prior to its administration.
[0006] A number of references are directed toward the
identification of CYP2D6 mutations and their corresponding
phenotypes. For example, United States Patent Application
Publication No. 2003/0083485 to Milos et al. describes a novel
CYP2D6 variant associated with the PM phenotype and methods for
assessing whether an individual possesses the variant prior to the
administration of a drug. United States Patent Application
Publication No. 2004/0072235 to Dawson describes a primer set
useful in identifying variants of the CYP2D6 gene. Similarly,
United States Patent Application Publication No. 2004/0091909 to
Huang describes methods for screening an individual for variants in
the CYP2D6 gene and other cytochrome P450 genes and tailoring the
individual's drug therapy according to his or her phenotypic
profile. Finally, United States Patent Application Publication No.
2004/0096874 to Neville et al. describes methods for identifying
cytochrome P450 variants.
SUMMARY OF THE INVENTION
[0007] The present invention comprises the discovery that treatment
of a patient, who has lower CYP2D6 activity than a normal person,
with a drug that is pre-disposed to cause QT prolongation and is
metabolized by the CYP2D6 enzyme, can be accomplishing more safely
by administering a lower dose of the drug than would be
administered to a person who has normal CYP2D6 enzyme activity.
Such drugs include, for example, dolasetron, paroxetine,
venlafaxin, and iloperidone. Patients who have lower than normal
CYP2D6 activity are herein referred to as CYP2D6 Poor
Metabolizers.
[0008] This invention also relates to methods for the
identification of genetic polymorphisms that may be associated with
a risk for QT prolongation after treatment with compounds
metabolized by the CYP2D6 enzyme, particularly iloperidone or an
active metabolite thereof or a pharmaceutically acceptable salt of
either (including, e.g., solvates, polymorphs, hydrates, and
stereoisomers thereof), and related methods of administering these
compounds to individuals with such polymorphisms.
[0009] The present invention describes an association between
genetic polymorphisms in the CYP2D6 locus, corresponding increases
in the concentrations of iloperidone or its metabolites, and the
effect of such increases in concentrations on corrected QT (QTc)
duration relative to baseline. Any number of formulas may be
employed to calculate the QTc, including, for example, the
Fridericia formula (QTcF) and the Bazett formula (QTcB), among
others. The present invention includes any such formula or method
for calculating a QTc.
[0010] A first aspect of the invention provides a method for
treating a patient with iloperidone or an active metabolite thereof
or a pharmaceutically acceptable salt of either, comprising the
steps of determining the patient's CYP2D6 genotype and
administering to the patient an effective amount of iloperidone or
an active metabolite thereof or a pharmaceutically acceptable salt
of either based on the patient's CYP2D6 genotype, such that
patients who are CYP2D6 poor metabolizers receive a lower dose than
patients who are CYP2D6 normal metabolizers.
[0011] Another aspect of the invention provides a method for
treating a patient who is a CYP2D6 poor metabolizer with
iloperidone or an active metabolite thereof or a pharmaceutically
acceptable salt of either, wherein the patient is administered a
lower dosage than would be given to an individual who is not a
CYP2D6 poor metabolizer.
[0012] Another aspect of the invention provides a method of
treating a patient with iloperidone or an active metabolite thereof
or a pharmaceutically acceptable salt of either comprising the
steps of determining whether the patient is being administered a
CYP2D6 inhibitor and reducing the dosage of drug if the patient is
being administered a CYP2D6 inhibitor.
[0013] Another aspect of the invention provides a method for
determining a patient's CYP2D6 phenotype comprising the steps of
administering to the patient a quantity of iloperidone or an active
metabolite thereof or a pharmaceutically acceptable salt of either,
determining a first concentration of at least one of iloperidone
and an iloperidone metabolite in the patient's blood, administering
to the patient at least one CYP2D6 inhibitor, determining a second
concentration of at least one of iloperidone and an iloperidone
metabolite in the patient's blood, and comparing the first and
second concentrations.
[0014] Another aspect of the invention provides a method for
determining whether a patient is at risk for prolongation of his or
her QTc interval due to iloperidone administration comprising the
step of: determining a patient's CYP2D6 metabolizer status by
either determining the patient's CYP2D6 genotype or CYP2D6
phenotype. In the case that a patient is determined to be at risk
for prolongation of his or her QTc interval, the dose of
iloperidone administered to the patient may be reduced.
[0015] Another aspect of the invention provides a method of
administering iloperidone or an active metabolite thereof, or a
pharmaceutically acceptable salt of either, for the treatment of a
disease or disorder in a human patient comprising the steps of
determining the activity of the patient's CYP2D6 enzyme on at least
one of iloperidone and its metabolites relative to the activity of
a wild type CYP2D6 enzyme and reducing the dose of at least one of
iloperidone and its pharmaceutically acceptable salts if the
patient's CYP2D6 enzyme activity is less than that of the wild type
CYP2D6.
[0016] Another aspect of the invention relates to modifying the
dose and/or frequency of dosing with iloperidone or a
pharmaceutically acceptable salt thereof based on the P88:P95 ratio
and/or the (P88+iloperidone):P95 ratio in a blood sample of a
patient being treated with iloperidone or P88, especially patients
susceptible to QT prolongation or to harmful effects associated
with QT prolongation.
[0017] Another aspect of the invention provides a kit for use in
determining a CYP2D6 genotype of an individual, comprising a
detection device, a sampling device, and instructions for use of
the kit.
[0018] Another aspect of the invention provides a kit for use in
determining a CYP2D6 phenotype of an individual, comprising a
detection device, a collection device, and instructions for use of
the kit.
[0019] Another aspect of the invention provides a kit for use in
determining at least one of a P88 to P95 ratio and a P88 and
iloperidone to P95 ratio in an individual, comprising a detection
device, a collection device, and instructions for use of the
kit.
[0020] Yet another aspect of the invention provides a method for
commercializing a pharmaceutical composition comprising at least
one of iloperidone, a pharmaceutically acceptable salt of
iloperidone, an active metabolite of iloperidone, and a
pharmaceutically acceptable salt of an active metabolite of
iloperidone, said method comprising: obtaining regulatory approval
of the composition by providing data to a regulatory agency
demonstrating that the composition is effective in treating humans
when administered in accordance with instructions to determine
whether or not a patient is a CYP2D6 poor metabolizer prior to
determining what dose to administer to the patient; and
disseminating information concerning the use of such composition in
such manner to prescribers or patients or both.
[0021] The foregoing and other features of the invention will be
apparent from the following more particular description of
embodiments of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0022] Iloperidone is a benzisoxazole-piperidinyl derivative,
currently in development for the treatment of CNS disorders. Data
from placebo-controlled Phase Ill studies of iloperidone showed a
Fridericia correction of QT duration (QTcF) increase of 0.1 to 8.5
msec at doses of 4-24 mg, when comparing a single ECG at baseline
to a single ECG at endpoint. At lower doses of iloperidone (4 mg-16
mg) QTcF prolongation was minimal (0.1-5 msec). In the most recent
study, a greater prolongation was observed when higher doses of
iloperidone (20-24 mg/day) were studied. The mean change in the
QTcF at doses 20-24 mg/day was 8.5 msec, and 4.6 msec in the 12-16
mg/day dose range in this study. These data suggest that treatment
with iloperidone can be associated with prolongation of the QT
interval similar to other drugs in this class, and that the effect
may be dose sensitive in the clinical dose range.
[0023] The research leading to the present invention was designed
to examine the effect of different doses of iloperidone relative to
the effect of ziprasidone and quetiapine on QTc duration under
carefully controlled conditions. To further evaluate the possible
relationship between exposure to iloperidone and the comparators to
QTc duration, reassessment after pharmacological inhibition of the
principle metabolic pathways for each drug, under steady-state
conditions, was also planned.
[0024] Blood samples for pharmacogenetic analysis were collected at
screening. Two polymorphisms previously associated with poor
metabolizing status were genotyped in the CYP2D6 locus and 251
genotypes were collected. The individual genotypes were studied for
detection of association between genotype class and concentrations
of iloperidone and its metabolites P88 and P95. The functional
effect of the polymorphisms was also evaluated by analyzing the
effect of the addition of the CYP2D6 inhibitor paroxetine on the
concentrations of the parent drug and its metabolites.
[0025] The research leading to the present invention identified a
significant association between CYP2D6 genotype and concentrations
of P88 before the addition of inhibitors as well as the effect of
this association on QTc prolongation.
[0026] Iloperidone is a substrate for two P450 enzymes; CYP2D6 and
CYP3A4. Most metabolic clearance of iloperidone depends on these
two enzymes. CYP2D6 catalyzes hydroxylation of the pendant acetyl
group to form metabolite P94, which is converted to P95 after some
additional reactions. Addition of the CYP2D6 inhibitor fluoxetine,
along with iloperidone resulted in increases of the area under the
curve (AUC) for iloperidone and P88 of 131% and 119% respectively.
Addition of the CYP3A4 inhibitor ketoconazole in interaction
studies resulted in a 38-58% increase in the concentrations of
iloperidone and its main metabolites P88 and P95. P88 has a
pharmacological profile including affinity for the HERG channel
similar to that of iloperidone. P95 is less lipophilic and is
dissimilar in its binding profile compared to iloperidone,
including having very low affinity for the HERG channel For these
reasons P95 is regarded as being pharmacologically inactive.
[0027] The addition of metabolic inhibitors in this study therefore
allowed for an evaluation of the effect of increasing
blood-concentration of iloperidone and/or its metabolites on QT
duration. More specifically, this study allowed for an evaluation
of the effect of iloperidone on QTc before and after the addition
of the CYP2D6 inhibitor, paroxetine, as well as before and after
the addition of the CYP3A4 inhibitor, ketoconazole.
[0028] The CYP2D6 gene is highly polymorphic, with more than 70
allelic variants described so far. See, e.g.,
www.imm.ki.se/CYPalleles/cyp2d6.htm. Most embodiments of the
present invention concern the two most common polymorphisms within
the CYP2D6 gene in Caucasian populations, CYP2D6G1846A and
CYP2D6P34S (also referred to as CYP2D6C100T). These polymorphisms
correspond to nucleotides 3465 and 1719, respectively, in GenBank
sequence M33388.1 (GI:181303). The CYP2D6P34S/CYP2D6C100T
polymorphism also corresponds to nucleotide 100 in GenBank mRNA
sequence M20403.1 (GI:181349).
[0029] The CYP2D6G1846A polymorphism (known as the CYP2D6*4
alleles, encompassing *4A, *4B, *4C, *4D, *4E, *4F, *4G, *4H, *4J,
*4K, and *4L) represents a G to A transition at the junction
between intron 3 and exon 4, shifting the splice junction by one
base pair, resulting in frameshift and premature termination of the
protein (Kagimoto 1990, Gough 1990, Hanioka 1990). The
CYP2D6P34S/CYP2D6C100T polymorphism (known as the CYP2D6*10 and
CYP2D6*14 alleles) represents a C to T change that results in the
substitution of a Proline at position 34 by Serine (Yokota 1993,
Johansson 1994). Both of these polymorphisms have been associated
with reduced enzymatic activity for different substrates (Johansson
1994, Dahl 1995, Jaanson 2002, see also review by Bertilsson
2002)
Methods
A. Samples
[0030] 128 individuals consented to the pharmacogenetic study.
Blood samples were collected according to the pharmacogenetics
protocol and after the consent of patients. The DNA was extracted
from whole blood by Covance using the PUREGENE DNA isolation kit
(D-50K).
[0031] The 128 individuals that participated were a good
representation of the total sample of 165 individuals that
participated in the trial. 22 of 29 total were from the iloperidone
8 mg bid group, 30 of 34 were from the iloperidone 12 mg bid group,
22 of 31 from the 24 mg qd group, 3 of 5 of the risperidone group,
28 of 33 of the ziprazidone group, and 23 of 33 of the quetiapine
group.
B. Genotyping
[0032] Genotypes for the CYP2D6G1846A polymorphism were ascertained
for 123 of the 128 consenting individuals, while genotypes for the
CYP2D6C100T polymorphism were identified for all 128 participants.
Genotyping was performed on amplified DNA fragments. The CYP2D6
genomic region was amplified using a triplex PCR strategy (Neville
2002). In brief, primers used were:
TABLE-US-00001 Exons 1, 2 SEQ. ID NO. 1, 2D6L1F1:
CTGGGCTGGGAGCAGCCTC SEQ. ID NO. 2, 2D6L1R1: CACTCGCTGGCCTGTTTCATGTC
Exons 3, 4, 5, 6 SEQ. ID NO. 3, 2D6L2F: CTGGAATCCGGTGTCGAAGTGG SEQ.
ID NO. 4, 2D6L2R2: CTCGGCCCCTGCACTGTTTC Exons 7, 8, 9 SEQ. ID NO.
5, 2D6L3F: GAGGCAAGAAGGAGTGTCAGGG SEQ. ID NO. 6, 2D6L3R5B:
AGTCCTGTGGTGAGGTGACGAGG
[0033] Amplification was performed on 40-100 ng of genomic DNA
using a GC-rich PCR kit (Roche Diagnostics, Mannheim, Germany)
according to the manufacturer's recommendations. Thermocycling
conditions were as follows: initial denaturation (3 min 95.degree.
C.), 10 cycles of 30 s of denaturation (30 s at 95.degree. C.),
annealing (30 s at 66.degree. C.), and extension, (60 s at
72.degree. C.) followed by 22 cycles: 30 s at 95.degree. C., 30 s
at 66.degree. C., 60 s+5 s/cycle at 72.degree. C. A final extension
followed (7 min at 72.degree. C.).
[0034] Third Wave Technologies, Inc (Madison, Wis.) developed the
probe sets for genotyping. Genotyping was performed on PCR products
using the Invader.RTM. assay (Lyamichev 1999) (Third Wave
Technologies, Inc) according to the manufacturer's
recommendations.
[0035] The genotypes of individuals distributed among the three
iloperidone groups were not significantly different (Table 1A
and1B).
TABLE-US-00002 TABLE 1A Genotype frequencies by iloperidone dose
class for CYP2D6C100T Iloperidone Genotype dose group CC CT TT
Total Ilo 8 mg bid 19.sup.a 2 1 22 Ilo 12 mg bid 23 6 1 30 Ilo 24
mg qd 15 6 1 22 Total 57 14 3 74 .sup.anumber of individuals
TABLE-US-00003 TABLE 1B Genotype frequencies by iloperidone dose
class for CYP2D6G1846A Iloperidone Genotype dose group AA AG GG
Total Ilo 8 mg bid 0 3 17 20 Ilo 12 mg bid 1 6 23 30 Ilo 24 mg qd 1
5 15 21 Total 2 14 55 71
C. Statistical Analysis
[0036] The genotype effect of the two CYP2D6 polymorphisms on
period 1 concentrations was evaluated using the following ANOVA
model. Concentrations of iloperidone, P88, and P95 at Period 1,
without inhibitor, at the time at which maximum blood concentration
of the parent compound or metabolite was reached (Tmax) were used
as the dependent variable, the genotypes of each polymorphism as
classes and the treatment as a covariate. In order to adjust for
treatment effects after the single dose of iloperidone, the 8 mg
bid was coded as 8, the 12 mg bid as 12 and the 24 mg qd as 24.
[0037] The function of these polymorphisms on the degree of
inhibition of the CYP2D6 enzyme was calculated from the ratio of
concentrations of P88 and P95 in period 2, after the addition of
the inhibitor of CYP2D6. The concentrations of iloperidone and/or
its metabolites (e.g., P88 and P95) may be determined in period 1
and/or period 2 by any known or later-developed method or device,
including titration.
D. Results and Discussion
[0038] In order to understand the functional significance of the
two CYP2D6 polymorphisms on the activity of the enzyme, we examined
the association of the various genotypes with the relative
concentrations of the metabolites P88 and P95. It is known that P88
is degraded by CYP2D6 and that CYP2D6 is involved in the synthesis
of P95. The relative amounts of P88 and P95 would therefore be
controlled by the activity of the CYP2D6 enzyme. We calculated the
ratio of P88/P95 before inhibition in Period 1 and at the Tmax of
the two metabolites, as well as the ratio of P88/P95 in Period 2
after the addition of the CYP2D6 inhibitor paroxetine. In
individuals with the wild type enzyme the concentration of P88 is
expected to increase in Period 2, while in the same period the
concentration of P95 is expected to decline.
[0039] For Period 1 the mean P88/P95 ratio among the 91 iloperidone
treated patients was equal to 1.0 with a range from 0.14 to 8.19.
Among the same individuals for Period 2 the mean ratio was 2.4 with
a range from 0.5 to 8.49. The mean ratio of the ratios Period
1/Period 2 was equal to 0.37 with a range from 0.11 to 2.75.
[0040] Among the genotyped individuals the values were similar with
means of 1, 2.45 and 0.37 for Period 1, Period 2 and Period
1/Period 2 respectively, indicating no sample bias. For
polymorphism CYP2D6G1846A the means were significantly different
between the three-genotype classes AA, AG and GG. For AA the
respective values were 6.1, 3.41, and 1.89, for AG they were 2.4,
4.2, and 0.52 and for GG 0.57, 1.94 and 0.28 (Table 2).
TABLE-US-00004 TABLE 2 Ratios of P88, P95 concentrations according
to genotype P88/P95 P88/P95 P88/P95 Population Period1 Period 2
(Period1/Period2) All 1.0 (0.14-8.19) 2.45 (0.50-8.49) 0.37
(0.11-2.75) CYP2D6G1846A AA 6.1 (3.96-8.19) 3.41 (2.96-3.87) 1.89
(1.0-2.75) AG 2.4 (0.44-7.0) 4.20 (2.2-7.57) 0.52 (0.14-1.28) GG
0.57 (0.14-2.2) 1.94 (0.52-4.71) 0.28 (0.11-0.61)
[0041] The differences between genotype classes were significant at
the p<0.0001 level in ANOVA test. These data suggest that the AA
class represent a CYP2D6 poor metabolizer as indicated by the high
ratio of P88/P95 in period 1 and the relatively small effect of the
addition of the inhibitor in Period 2. The AG class seems to
exhibit an intermediate phenotype between the poor metabolizer and
the wild type with an approximately 2-fold reduction of the CYP2D6
activity after the addition of the inhibitor, as indicated by the
ratio of the ratios (Table 2). This analysis provides a phenotypic
characterization of the CYP2D6G1846A polymorphism as it relates to
the metabolism of iloperidone.
[0042] Having established a functional role of this polymorphism,
we calculated the concentrations of P88 at Period 1 at the Tmax of
P88 for each genotype class. P88 concentrations were significantly
(p<0.005) higher for the AA and AG classes as compared to the GG
class for each of the three iloperidone dose groups (Table 3).
TABLE-US-00005 TABLE 3 P88 concentrations in Period 1 according to
CYP2D6 genotype Genotype N obs LSMeans P value AA 2 62.70
<0.0001 AG 14 31.40 GG 55 21.03 TRT dose 0.0015 CYP2D6G1846A
*TRT dose 0.0058
[0043] Although the number of individuals carrying the A allele is
limited, the results obtained in the study consistently suggest
that individuals of the AA and AG class are expected to experience
higher concentrations of P88 at Tmax as compared with GG
individuals. Similar results were obtained with polymorphism
CYP2D6C100T (Table 4 and 5).
TABLE-US-00006 TABLE 4 Ratios of P88, P95 concentrations according
to genotype P88/P95 P88/P95 P88/P95 Population Period 1 Period 2
(Period1/Period2) All 1.0 (0.14-8.19) 2.45 (0.50-8.49) 0.37
(0.11-2.75) CYP2D6C100T CC 0.6 (0.14-2.28) 1.93 (0.52-4.71) 0.27
(0.11-0.61) CT 2.2 (0.44-7.0) 4.14 (2.2-7.57) 0.49 (0.14-1.28) TT
5.24 (3.56-8.19) 4.19 (2.96-5.74) 1.46 (0.62-2.75)
TABLE-US-00007 TABLE 5 P88 concentrations in Period 1 according to
CYP2D6 genotype Genotype N obs LSMeans P value CC 57 21.03 CT 14
33.16 <0.0001 TT 3 51.00 TRT dose <0.0001 CYP2D6C100T *TRT
dose 0.0015
[0044] This result is expected given the fact that this
polymorphism is in almost complete linkage disequilibrium with the
CYP2D6G1846A polymorphism.
[0045] In order to understand whether the difference in
concentration of P88 at Period 1 Tmax was relevant to the increases
in QTc after the addition of the inhibitors, we used the observed
mean of P88 for the CYP2D6G1846A AG group to divide all individuals
into two classes. The first includes individuals with P88
concentrations at Period 3, after the addition of both inhibitors,
of equal to or less than 34 ng/mL and the second class includes
individuals with P88 concentration greater than 34 ng/mL. We then
compared the two classes in regards to the QTc change from baseline
at Period 3. Using an ANOVA statistic for the first class P88>34
(n=55) the QTc mean change from baseline in Period 3 was 22.7 msec
and that for P88.ltoreq.34 (n=12) the mean QTc for the same period
was 7.7 msec. The QTc changes from baseline for Period 1 and Period
2 according to genotype and iloperidone dose are given in Table 6
and 7.
TABLE-US-00008 TABLE 6 QTc change at Period 1 according to CYP2D6
genotype and iloperidone dose Iloperidone Dose Genotype 8 mg bid 12
mg bid 24 mg qd CYP2D6G1846A AA 17.7 (1).sup.a 38.4 (1) AG -0.8 (3)
5.8 (6) 19.0 (5) GG 7.8(17) 11.8 (23) 14.0 (14) CYP2D6C100T TT -8.4
(1) 17.7 (1) 38.4 (1) CT 2.9 (2) 5.8 (6) 19.0 (5) CC 7.8 (17) 11.8
(23) 9.5 (14) .sup.anumber of individuals
TABLE-US-00009 TABLE 7 QTc change at Period 2 according to CYP2D6
genotype and iloperidone dose Iloperidone Dose Genotype 8 mg bid 12
mg bid 24 mg qd CYP2D6G1846A AA 25.0 (1) 28.4 (1) AG 8.1 (3) 8.7
(6) 20.6 (5) GG 11.7 (18) 14.5 (21) 16.4 (15) CYP2D6C100T TT -0.7
(1) 25.0 (1) 28.4 (1) CT 12.5 (2) 8.7 (6) 20.6 (5) CC 11.7 (16)
14.5 (21) 16.4 (15)
[0046] These results however should be viewed with caution since
the number of observations is small. If one was, however, to focus
on the iloperidone 24 mg qd, there is a trend for higher QTc among
AA, and AG individuals for CYP2D6G1846A as compared to GG. This
difference disappears after the addition of the CYP2D6 inhibitor in
Period 2.
[0047] These observations suggest that the differences in P88
concentrations during Period 1 between the different classes of
genotypes may be relevant to QTc changes from baseline. Given the
small number of observations and the unbalanced in regards to
genotype design of the study, a confirmatory prospectively designed
study may be required before any further interpretation of this
data is warranted. Notwithstanding these caveats, the results
discussed above show that patients can be more safely treated with
iloperidone if the dose of iloperidone is adjusted based on the
CYP2D6 genotype of each patient. For example, if a patient has a
genotype which results in decreased activity of the CYP2D6 protein
relative to the wild type CYP2D6, then the dose of iloperidone
administered to such patient would be reduced to, for example, 75%
or less, 50% or less, or 25% or less of the dose typically
administered to a patient having a CYP2D6 genotype that results in
a CYP2D6 protein that has the same or substantially the same
enzymatic activity on P88 as the wild type CYP2D6 genotype/protein.
For example, where the normal dosage of iloperidone or other
CYP2D6-metabolized compound administered to an individual is 24 mg
per day, an individual with a genotype associated with decreased
CYP2D6 activity may receive a reduced dosage of 18, 12, or 6 mg per
day.
[0048] Decreased CYP2D6 activity may be the result of other
mutations, including those described at
www.imm.ki.se/CYPalleles/cyp2d6.htm, which is incorporated herein
by reference. In particular, it is noted that the CYP2D6*2A
mutation includes a CYP2D7 gene conversion in intron 1. In some
cases, the lower CYP2D6 activity in a CYP2D6 poor metabolizer may
be due to factors other than genotype. For example, a patient may
be undergoing treatment with an agent, e.g., a drug that reduces
CYP2D6 activity.
[0049] QTc prolongation is correlated to the ratios of P88/P95 and
(iloperidone+P88)/P95. The mean ratios among CYP2D6 extensive
metabolizers were 0.57 and 1.00, respectively. As shown above in
Tables 3 and 5, CYP2D6 poor metabolizers have elevated P88 levels
compared to CYP2D6 extensive metabolizers.
[0050] As CYP2D6 poor metabolizers comprise approximately 15% of
the population, it was found that approximately 15% of those
studied exhibited a P88/P95 ratio greater than 2.0 while the
remaining 85% exhibited P88/P95 ratios less than 2.0. Table 8 below
shows the least squares mean change in QTc for each dosage group.
While the results for some groups are not statistically
significant, they do indicate a trend supporting the hypothesis
that QTc prolongation is correlated to P88/P95 ratio. Similar
results were obtained when cutoff ratios of 3.0 and 4.0 were
analyzed, providing further support to the hypothesis that the
extent of QTc prolongation a patient may experience after treatment
can be predicted by measuring P88 and P95 blood levels.
TABLE-US-00010 TABLE 8 Mean QTc Prolongation According to P88/P95
Ratio LSMean LSMean LSMean LSMean QTc QTc QTc LSMean QTc change
change change change QTc from from from from change Baseline
Baseline Baseline Baseline from All P88/P95 8 mg 12 mg 8 + 12 mg
Baseline Treatment Ratio bid bid bid 24 qd Groups <2 7.2 8.7 8.3
13.9 10.244 (n = 23) (n = 31) (n = 54) (n = 24) (n = 78) >2 21.3
17.4 18.3 29.4 21.111 (n = 5) (n = 3) (n = 8) (n = 5) (n = 13) P
value 0.0725 0.392 0.0815 0.0329 0.0131
[0051] Similar results were observed when considering QTc
correlation to the (iloperidone+P88)/P95 ratio. Again, as
approximately 15% of the population are CYP2D6 poor metabolizers,
it was found that approximately 15% of those studied exhibited
(iloperidone+P88)/P95 ratios greater than 3.0 while the remaining
85% exhibited ratios less than 3.0. Table 9 below shows the least
squares mean change in QTc for each dosage group. While the results
for some groups are not statistically significant, they do indicate
a trend supporting the hypothesis that QTc prolongation is
correlated to (iloperidone+P88)/P95 ratio. Indeed, when cutoff
ratios of 4 and higher were analyzed, similar results were obtained
providing further support to the hypothesis that the extent of QTc
prolongation a patient may experience after treatment can be
predicted by measuring iloperidone, P88 and P95 blood levels.
TABLE-US-00011 TABLE 9 Mean QTc Prolongation According to
(iloperidone + P88)/P95 Ratio LSMean LSMean LSMean LSMean QTc QTc
QTc LSMean QTc change change change change QTc from (ILO + from
from from change Baseline P88)/ Baseline Baseline Baseline from All
P95 8 mg 12 mg 8 + 12 mg Baseline Treatment Ratio bid bid bid 24 qd
Groups <3 7.2 8.7 8.3 14.4 10.424 (n = 23) (n = 31) (n = 54) (n
= 24) (n = 78) >3 21.3 15.2 17.3 30.5 20.031 (n = 5) (n = 3) (n
= 8) (n = 5) (n = 13) P value 0.0725 0.4223 0.0857 0.0522
0.0278
[0052] The starting point for determining the optimum dose of
iloperidone is, as discussed above, a dose that has been shown to
be acceptably safe and effective in patients having a CYP2D6
genotype that results in a protein having the same activity on
iloperidone and P88 as the wild type CYP2D6 protein. Such doses are
known in the art and are disclosed, for example, in U.S. Pat. No.
5,364,866 discussed above.
[0053] Generally, the dose of iloperidone administered to a patient
will be decreased, as discussed above, if the enzymatic activity of
the CYP2D6 enzyme on iloperidone and P88 is less than about 75% of
that of the wild type CYP2D6. Enzymatic activity may be determined
by any number of methods, including, for example, measuring the
levels of iloperidone and/or P88 in an individual's blood. In such
a case, the iloperidone dose can be lowered such that measured
levels of iloperidone and/or P88 are substantially the same as
levels measured in the blood of individuals having normal CYP2D6
enzymatic activity. For example, if the CYP2D6 enzymatic activity
of a patient is estimated by one or more methods (e.g., genotyping,
determination of dextromorphan blood levels) to be 50% of the
enzymatic activity normally observed in an individual having normal
CYP2D6 enzymatic activity, the dose for the patient may need to be
adjusted to one-half of the dose given to an individual having
normal CYP2D6 enzymatic activity. Similarly, for ultrarapid
metabolizers, an analogous calculation will lead to the conclusion
that a dose adjustment of twice that given an individual having
normal CYP2D6 enzymatic activity may be needed in order to achieve
similar blood levels for the parent compound and active
metabolites.
[0054] Alternatively, the dose of iloperidone administered to a
patient may be decreased based upon the patient's CYP2D6 genotype
alone, or upon the patient's P88:P95 or (iloperidone+P88):P95
ratios. For example, if a patient has a "poor metabolizer"
genotype, or has a high P88:P95 or (iloperidone+P88):P95 ratio, the
patient's dose of iloperidone may be reduced by, for example, 25%,
50%, or 75%. A patient's genotype can be readily determined using
standard techniques on samples of body fluids or tissue. Such
techniques are disclosed, e.g., in PCT Application Publication
Number WO03054226.
[0055] While the CYP2D6G1846A (AA or AG) genotype and the
CYP2D6C100T (CT or TT) genotype are illustrated herein, the method
of the invention can employ other genotypes that result in
decreased activity of the CYP2D6 protein on iloperidone and P88. It
is within the skill of the art, based on the disclosure herein, to
identify additional CYP2D6 genotypes that result in decreased
enzymatic activity on iloperidone and P88.
[0056] Furthermore, while the disclosure herein focuses on
genotype, it is apparent to one of skill in the art that phenotype
can also be used as an indicator of decreased activity of the
CYP2D6 protein on iloperidone and P88. For example, McElroy et al.
describe a correlation between CYP2D6 phenotype and genotyping as
determined by dextromethorphan/dextrorphan ratios. Therefore,
although it is more convenient given the state of the art to look
at genotype, if one were to determine that a given patient
expressed a mutant CYP2D6 with lower activity on iloperidone and
P88 than the wild type, or expressed abnormally low amounts of
CYP2D6, then that patient would be given a lower dose of
iloperidone than a patient with wild type CYP2D6, as discussed
above. Alternative methods for determining the relative activity of
a patient's CYP2D6 gene include biochemical assays to directly
measure enzymatic activity, protein sequencing to examine the amino
acid sequence of a patient's CYP2D6, monitoring transcription and
translation levels, and sequencing the CYP2D6 gene mRNA transcript.
For example, Chainuvati et al. describe assessment of the CYP2D6
phenotype using a multi-drug phenotyping cocktail (the Cooperstown
5+1 cocktail).
[0057] Iloperidone can be formulated into dosage units and
administered to patients using techniques known in the art. See,
e.g., PCT Application Publication Number WO03054226, US Patent
Application Publication Number 20030091645, PCT Application Serial
Number PCT EP03/07619, and PCT Application Publication Number
WO02064141, all of which are incorporated herein by reference as
though fully set forth.
[0058] In addition, the present invention provides a kit for
determining a patient's CYP2D6 genotype and/or phenotype. Such a
kit may include, for example, a detection means, a collection
device, containers, and instructions, and may be used in
determining a treatment strategy for a patient having one or more
diseases or disorders for which iloperidone treatment is
indicated.
[0059] Detection means may detect a CYP2D6 polymorphism directly or
may detect the characteristic mRNA of the polymorphic gene or its
polypeptide expression product. In addition, as will be recognized
by one of skill in the art, detection means may also detect
polymorphisms in linkage disequilibrium with a CYP2D6 polymorphism.
Accordingly, any polymorphism in linkage disequilibrium with the
CYP2D6 polymorphisms disclosed in this application may be used to
indirectly detect such a CYP2D6 polymorphism, and is within the
scope of the present invention.
[0060] Detection means suitable for use in the methods and devices
of the present invention include those known in the art, such as
polynucleotides used in amplification, sequencing, and single
nucleotide polymorphism (SNP) detection techniques, Invader.RTM.
assays (Third Wave Technologies, Inc.), Taqman.RTM. assays (Applied
Biosystems, Inc.), gene chip assays (such as those available from
Affymetrix, Inc. and Roche Diagnostics), pyrosequencing,
fluorescence resonance energy transfer (FRET)-based cleavage
assays, fluorescent polarization, denaturing high performance
liquid chromatography (DHPLC), mass spectrometry, and
polynucleotides having fluorescent or radiological tags used in
amplification and sequencing.
[0061] A preferred embodiment of a kit of the present invention
includes an Invader.RTM. assay, wherein a specific upstream
"invader" oligonucleotide and a partially overlapping downstream
probe together form a specific structure when bound to a
complementary DNA sequence. This structure is recognized and cut at
a specific site by the Cleavase enzyme, releasing the 5' flap of
the probe oligonucleotide. This fragment then serves as the
"invader" oligonucleotide with respect to synthetic secondary
targets and secondary fluorescently-labeled signal probes contained
in a reaction mixture. This results in the specific cleavage of the
secondary signal probes by the Cleavase enzyme. Fluorescence signal
is generated when this secondary probe, labeled with dye molecules
capable of fluorescence resonance energy transfer, is cleaved.
Cleavases have stringent requirements relative to the structure
formed by the overlapping DNA sequences or flaps and can,
therefore, be used to specifically detect single base pair
mismatches immediately upstream of the cleavage site on the
downstream DNA strand. See, e.g., Ryan et al., Molecular Diagnosis,
4; 2:135-144 (1999); Lyamichev et al., Nature Biotechnology,
17:292-296 (1999); and U.S. Pat. Nos. 5,846,717 and 6,001,567, both
to Brow et al., all of which are hereby incorporated herein by
reference.
[0062] Another preferred embodiment of a kit of the present
invention includes a detection means comprising at least one CYP2D6
genotyping oligonucleotide specific to alleles known to predict a
patient's metabolizer phenotype. More particularly, the means
comprises an oligonucleotide specific for the CYP2D6G1846A or
CYP2D6C100T polymorphism. The means may similarly comprise
oligonucleotides specific for each polymorphism as well as the wild
type sequence.
[0063] Detection methods, means, and kits suitable for use in the
present invention are described in International Publication Nos.
WO 03/0544266 and WO 03/038123, each of which is hereby
incorporated herein by reference. It should also be understood that
the methods of the present invention described herein generally may
further comprise the use of a kit according to the present
invention.
[0064] Collection devices suitable for use in the present invention
include devices known in the art for collecting and/or storing a
biological sample of an individual from which nucleic acids and/or
polypeptides can be isolated. Such biological samples include, for
example, whole blood, semen, saliva, tears, urine, fecal material,
sweat, buccal smears, skin, hair, and biopsy samples of organs and
muscle. Accordingly, suitable collection devices include, for
example, specimen cups, swabs, glass slides, test tubes, lancets,
and Vacutainer.RTM. tubes and kits.
[0065] The present invention encompasses treatment of a patient for
any disease or condition that is ameliorated by administration of
iloperidone. As discussed above, such diseases or conditions
include, for example, schizoaffective disorders including
schizophrenia, depression including bipolar depression, as well as
other conditions such as cardiac arrhythmias, Tourette's syndrome,
psychotic disorders and delusional disorders.
[0066] A related aspect of the invention is a method for obtaining
regulatory approval for a pharmaceutical composition comprising
iloperidone or an active metabolite thereof, or a pharmaceutically
acceptable salt of either, which comprises including in proposed
prescribing information instructions to determine whether or not a
patient is a CYP2D6 poor metabolizer prior to determining what dose
to administer to the patient. In another related aspect, the
invention is a method for commercializing (i.e., selling and
promoting) pharmaceutical compositions comprising such compounds
said method comprising obtaining regulatory approval of the
composition by providing data to a regulatory agency demonstrating
that the composition is effective in treating humans when
administered in accordance with instructions to determine whether
or not a patient is a CYP2D6 poor metabolizer prior to determining
what dose to administer to the patient and then disseminating
information concerning the use of such composition in such manner
to prescribers (e.g., physicians) or patients or both.
[0067] Another aspect of the invention is a method for obtaining
regulatory approval for the administration of iloperidone based, in
part, on labeling that instructs the administration of a lower dose
if the patient is already being administered a CYP2D6 inhibitor,
e.g., paroxetine, etc.
EMBODIMENTS
[0068] In addition to other illustrative embodiments, this
invention can be seen to comprise one or more of the following
illustrative embodiments:
[0069] 1. A method for treating a patient with an active
pharmaceutical ingredient including at least one of: iloperidone, a
pharmaceutically acceptable salt of iloperidone, an active
metabolite of iloperidone, and a pharmaceutically acceptable salt
of an active metabolite of iloperidone, comprising the steps
of:
[0070] determining the patient's CYP2D6 genotype; and
[0071] administering to the patient an effective amount of the
active pharmaceutical ingredient, whereby the amount of the active
pharmaceutical ingredient is determined based on the patient's
CYP2D6 genotype.
[0072] 2. The method of embodiment 1, wherein the amount of the
active pharmaceutical ingredient is decreased if the genotype
indicates decreased enzymatic activity of the CYP2D6 enzyme
relative to the wild type.
[0073] 3. The method of embodiment 1, wherein the amount of the
active pharmaceutical ingredient is decreased if the patient's
CYP2D6G1846A genotype is AA.
[0074] 4. The method of embodiment 1, wherein the amount of the
active pharmaceutical ingredient is decreased if the patient's
CYP2D6G1846A genotype is GA.
[0075] 5. The method of embodiment 1, wherein the amount of the
active pharmaceutical ingredient is decreased if the patient's
CYP2D6C100T genotype is TT.
[0076] 6. The method of embodiment 1, wherein the amount of the
active pharmaceutical ingredient is decreased if the patient's
CYP2D6C100T genotype is CT.
[0077] 7. The method of embodiment 1, wherein the patient is
suffering from at least one of schizophrenia, schizoaffective
disorder, depression, bipolar mania/depression, cardiac arrhythmia,
Tourette's Syndrome, a psychotic disorder, a delusional disorder,
and schizophreniform disorder.
[0078] 8. The method of embodiment 7, wherein the patient is at
risk for a prolonged QT interval.
[0079] 9. A method for treating a patient who is a CYP2D6 poor
metabolizer with a pharmaceutically active ingredient including at
least one of: iloperidone, a pharmaceutically acceptable salt of
iloperidone, an active metabolite of iloperidone, and a
pharmaceutically acceptable salt of an active metabolite of
iloperidone, wherein the patient is administered a lower dosage
than would be given to an individual who is not a CYP2D6 poor
metabolizer.
[0080] 10. The method of embodiment 9, wherein the patient is
determined to be a CYP2D6 poor metabolizer based on at least one of
the patient's genotype, the patient's phenotype, and the fact that
the patient is being treated with an agent that reduces CYP2D6
activity.
[0081] 11. The method of embodiment 9, wherein the patient's
genotype includes at least one CYP2D6 allele selected from a group
consisting of 2549 A deletion, 1846 G>A, 1707 T deletion, 2935
A>C, 1758 G>T, 2613-2615 AGA deletion, 1023 C>T, 2850
C>T, 4180 G>C, 1659 G>A, 1661 G>C, 2850 C>T, 3183
G>A, -1584 C, -1235 A>G, -740C>T, and -678 G>A.
[0082] 12. The method of embodiment 10, wherein the patient's
genotype includes at least one deletion of the CYP2D6 gene.
[0083] 13. The method of embodiment 11, wherein the patient's
genotype includes a CYP2D7gene conversion in intron 1.
[0084] 14. The method of embodiment 9, wherein the patient is
suffering from at least one of schizophrenia, schizoaffective
disorder, depression, bipolar mania/depression, cardiac arrhythmia,
Tourette's Syndrome, a psychotic disorder, a delusional disorder,
and schizophreniform disorder.
[0085] 15. A method of treating a patient with a pharmaceutically
active ingredient including at least one of: iloperidone, a
pharmaceutically acceptable salt of iloperidone, an active
metabolite of iloperidone, and a pharmaceutically acceptable salt
of an active metabolite of iloperidone comprising the steps of:
determining whether the patient is being administered a CYP2D6
inhibitor; and reducing the dosage of drug if the patient is being
administered a CYP2D6 inhibitor.
[0086] 16. The method of embodiment 15, wherein the CYP2D6
inhibitor includes at least one of paroxetine, dolasetron,
venlafaxin, and fluoxetine.
[0087] 17. The method of embodiment 15, wherein the patient is
suffering from at least one of schizophrenia, schizoaffective
disorder, depression, bipolar mania/depression, cardiac arrhythmia,
Tourette's Syndrome, a psychotic disorder, a delusional disorder,
and schizophreniform disorder.
[0088] 18. A method for determining a patient's CYP2D6 phenotype
comprising the steps of: administering to the patient a quantity of
at least one of: iloperidone, a pharmaceutically acceptable salt of
iloperidone, an active metabolite of iloperidone, and a
pharmaceutically acceptable salt of an active metabolite of
iloperidone; and determining a first concentration of at least one
of iloperidone and an iloperidone metabolite in the patient's
blood.
[0089] 19. The method of embodiment 18, wherein the iloperidone
metabolite is selected from a group consisting of P88 and P95.
[0090] 20. The method of embodiment 19, wherein a first
concentration is determined for each of P88 and P95.
[0091] 21. The method of embodiment 20, wherein the patient is
designated a poor metabolizer if the ratio of first concentrations
of P88 to P95 is greater than or equal to about 2.0.
[0092] 22. The method of embodiment 20, wherein the patient is
designated a poor metabolizer if the ratio of first concentrations
of iloperidone and P88 to P95 is greater than or equal to about
3.0.
[0093] 23. The method of embodiment 18, further comprising the
steps of: administering to the patient at least one CYP2D6
inhibitor; determining a second concentration of at least one of
iloperidone and an iloperidone metabolite in the patient's blood;
and comparing the first and second concentrations.
[0094] 24. The method of embodiment 23, wherein the CYP2D6
inhibitor is selected from a group consisting of paroxetine,
ketoconazole, and fluoxetine.
[0095] 25. The method of embodiment 23, wherein a second
concentration is determined for each of P88 and P95.
[0096] 26. The method of embodiment 25, wherein the patient is
designated a poor metabolizer if the ratio of second concentrations
of P88 to P95 is greater than or equal to about 2.0.
[0097] 27. The method of embodiment 23, wherein a first and second
concentration is determined for each of iloperidone, P88, and
P95.
[0098] 28. The method of embodiment 27, wherein the patient is
designated a poor metabolizer if the ratio of second concentrations
of iloperidone and P88 to P95 is greater than or equal to about
3.0.
[0099] 29. A method for determining whether a patient is at risk
for prolongation of his or her QTc interval due to administration
of at least one of: iloperidone, a pharmaceutically acceptable salt
of iloperidone, an active metabolite of iloperidone, and a
pharmaceutically acceptable salt of an active metabolite of
iloperidone comprising the steps of: measuring a first QTc
interval; administering to the patient a quantity of at least one
of: iloperidone, a pharmaceutically acceptable salt of iloperidone,
an active metabolite of iloperidone, and a pharmaceutically
acceptable salt of an active metabolite of iloperidone; measuring a
second QTc interval; and comparing the first and second QTc
interval.
[0100] 30. The method of embodiment 29, wherein the dose of
iloperidone administered to the patient is about 24 milligrams per
day.
[0101] 31. The method of embodiment 29, further comprising the step
of administering to the patient at least one CYP2D6 inhibitor after
the administering step.
[0102] 32. The method of embodiment 31, wherein the CYP2D6
inhibitor is selected from a group consisting of paroxetine,
ketoconazole, and fluoxetine.
[0103] 33. A method of administering a pharmaceutically active
ingredient including at least one of: iloperidone, a
pharmaceutically acceptable salt of iloperidone, an active
metabolite of iloperidone, and a pharmaceutically acceptable salt
of an active metabolite of iloperidone for the treatment of at
least one of a disease and a disorder in a human patient comprising
the steps of: determining at least one of the activity of the
patient's CYP2D6 enzyme on the pharmaceutically active ingredient
relative to the activity of a wild type CYP2D6 enzyme and the
expression of the patient's CYP2D6 enzyme relative to expression in
an individual having normal CYP2D6 enzyme expression; and reducing
the dose of the pharmaceutically active ingredient where at least
one of the patient's CYP2D6 enzyme activity is less than that of
the wild type CYP2D6 and the patient's CYP2D6 enzyme expression is
less than that of an individual having normal CYP2D6 enzyme
expression.
[0104] 34. The method of embodiment 33, wherein the patient is
suffering from at least one of schizophrenia, schizoaffective
disorder, depression, bipolar mania/depression, cardiac arrhythmia,
Tourette's Syndrome, a psychotic disorder, a delusional disorder,
and schizophreniform disorder.
[0105] 35. The method of embodiment 33, wherein the determining
step comprises: administering to the patient a quantity of at least
one of: iloperidone, a pharmaceutically acceptable salt of
iloperidone, an active metabolite of iloperidone, and a
pharmaceutically acceptable salt of an active metabolite of
iloperidone; determining a first concentration of at least one of
iloperidone and an iloperidone metabolite in the patient's blood;
administering to the patient at least one CYP2D6 inhibitor;
determining a second concentration of at least one of iloperidone
and an iloperidone metabolite in the patient's blood; and comparing
the first and second concentrations.
[0106] 36. The method of embodiment 35, wherein the CYP2D6
inhibitor is selected from a group consisting of paroxetine,
ketoconazole, and fluoxetine.
[0107] 37. The method of embodiment 35, wherein the iloperidone
metabolite is selected from a group consisting of P88 and P95.
[0108] 38. The method of embodiment 37, wherein a first and second
concentration is determined for each of P88 and P95.
[0109] 39. The method of embodiment 35, wherein the patient is
designated a poor metabolizer if the ratio of second concentrations
of P88 to P95 is greater than or equal to about 2.0.
[0110] 40. The method of embodiment 37, wherein a first and second
concentration is determined for each of iloperidone, P88, and
P95.
[0111] 41. The method of embodiment 40, wherein the patient is
designated a poor metabolizer if the ratio of second concentrations
of iloperidone and P88 to P95 is greater than ore equal to about
3.0.
[0112] 42. The method of embodiment 33, wherein the determining
step is based on the individual's phenotype.
[0113] 43. A kit for determining a CYP2D6 genotype of an
individual, comprising: a detection device; a sampling device; and
instructions for use of the kit.
[0114] 44. The kit of embodiment 43, wherein the detection device
includes a polynucleotide for binding to a portion of the CYP2D6
gene, the polynucleotide including at least one of a fluorescent
tag and a radiological tag.
[0115] 45. The kit of embodiment 44, wherein the polynucleotide
will bind to only one of a CYP2D6 wild-type sequence and a
polymorphic CYP2D6 sequence.
[0116] 46. The kit of embodiment 43, wherein the sampling device
includes an apparatus for at least one of collecting and storing a
biological sample of the individual.
[0117] 47. A method for determining a dosage of at least one of:
iloperidone, a pharmaceutically acceptable salt of iloperidone, an
active metabolite of iloperidone, and a pharmaceutically acceptable
salt of an active metabolite of iloperidone to be administered to
an individual, comprising the steps of: obtaining a biological
sample of the individual; and determining a CYP2D6 phenotype of the
individual using the kit of embodiment 43, wherein the dosage is
reduced if the CYP2D6 phenotype is consistent with that of a poor
metabolizer.
[0118] 48. The method of embodiment 47, wherein the individual is
suffering from at least one of a disorder and a disease.
[0119] 49. The method of embodiment 47, wherein the individual is
suffering from at least one of schizophrenia, schizoaffective
disorder, depression, bipolar mania/depression, cardiac arrhythmia,
Tourette's Syndrome, a psychotic disorder, a delusional disorder,
and schizophreniform disorder.
[0120] 50. The method of embodiment 49, wherein the patient is
suffering from at least one of paranoid schizophrenia, catatonic
schizophrenia, disorganized schizophrenia, undifferentiated
schizophrenia, and residual schizophrenia.
[0121] 51. The method of embodiment 49, wherein the patient is
suffering from at least one of brief psychotic disorder, a
psychotic disorder NOS, a psychotic disorder due to a general
medical condition, and a substance-induced psychotic disorder.
[0122] 52. A method for obtaining regulatory approval for a
pharmaceutical composition including at least one of: iloperidone,
a pharmaceutically acceptable salt of iloperidone, an active
metabolite of iloperidone, and a pharmaceutically acceptable salt
of an active metabolite of iloperidone, comprising: including in
proposed prescribing information instructions to determine whether
a patient is a CYP2D6 poor metabolizer prior to determining a
dosage to administer to the patient.
[0123] 53. The method of embodiment 52, wherein the patient is
determined to be a CYP2D6 poor metabolizer based on at least one of
the patient's genotype, the patient's phenotype, and the fact that
the patient is being treated with an agent that reduces CYP2D6
activity.
[0124] 54. The method of embodiment 52, wherein the instructions
describe a method for determining the patient's CYP2D6 genotype,
the method comprising: administering to the patient a quantity of
at least one of iloperidone, a pharmaceutically acceptable salt of
iloperidone, an active metabolite of iloperidone, and a
pharmaceutically acceptable salt of an active metabolite of
iloperidone; determining a first concentration of at least one of
iloperidone and an iloperidone metabolite in the patient's blood;
administering to the patient at least one CYP2D6 inhibitor;
determining a second concentration of at least one of iloperidone
and an iloperidone metabolite in the patient's blood; and comparing
the first and second concentrations.
[0125] 55. A method for commercializing a pharmaceutical
composition comprising at least one of: iloperidone, a
pharmaceutically acceptable salt of iloperidone, an active
metabolite of iloperidone, and a pharmaceutically acceptable salt
of an active metabolite of iloperidone, said method comprising:
obtaining regulatory approval of the composition by providing data
to a regulatory agency demonstrating that the composition is
effective in treating humans when administered in accordance with
instructions to determine whether or not a patient is a CYP2D6 poor
metabolizer prior to determining what dose to administer to the
patient; and disseminating information concerning the use of such
composition in such manner to prescribers or patients or both.
[0126] While this invention has been described in conjunction with
the specific embodiments outlined above, it is evident that many
alternatives, modifications and variations will be apparent to
those skilled in the art. Accordingly, the embodiments of the
invention as set forth above are intended to be illustrative, not
limiting. Various changes may be made without departing from the
spirit and scope of the invention as defined in the following
claims.
Sequence CWU 1
1
6119DNAArtificial SequencePrimer for amplifying CYP2D6 Exons 1 and
2 1ctgggctggg agcagcctc 19223DNAArtificial SequencePrimer for
amplifying CYP2D6 Exons 1 and 2 2cactcgctgg cctgtttcat gtc
23322DNAArtificial SequencePrimer for amplifying CYP2D6 Exons 3, 4,
5 and 6 3ctggaatccg gtgtcgaagt gg 22420DNAArtificial SequencePrimer
for amplifying CYP2D6 Exons 3, 4, 5 and 6 4ctcggcccct gcactgtttc
20522DNAArtificial SequencePrimer for amplifying CYP2D6 Exons 7, 8
and 9 5gaggcaagaa ggagtgtcag gg 22623DNAArtificial SequencePrimer
for amplifying CYP2D6 Exons 7, 8 and 9 6agtcctgtgg tgaggtgacg agg
23
* * * * *
References