U.S. patent application number 16/683588 was filed with the patent office on 2020-06-04 for dna methylation in colorectal and breast cancer diagnostic methods.
The applicant listed for this patent is Clinical Genomics Pty Ltd Commonwealth Scientific and Industrial Research Organisation. Invention is credited to Lawrence Charles Lapointe, Susan Margaret Mitchell, Peter Laurence Molloy, Susanne Kartin Pedersen.
Application Number | 20200172963 16/683588 |
Document ID | / |
Family ID | 47745779 |
Filed Date | 2020-06-04 |
United States Patent
Application |
20200172963 |
Kind Code |
A1 |
Molloy; Peter Laurence ; et
al. |
June 4, 2020 |
DNA METHYLATION IN COLORECTAL AND BREAST CANCER DIAGNOSTIC
METHODS
Abstract
The present invention relates generally to nucleic acid
molecules in respect of which changes to DNA methylation levels are
indicative of the onset or predisposition to the onset of a
neoplasm. More particularly, the present invention is directed to
nucleic acid molecules in respect of which changes to DNA
methylation levels are indicative of the onset and/or progression
of a large intestine or breast neoplasm, such as an adenoma or
adenocarcinoma. The DNA methylation status of the present invention
is useful in a range of applications including, but not limited to,
those relating to the diagnosis and/or monitoring of colorectal or
breast neoplasms, such as colorectal or breast adenocarcinomas.
Accordingly, in a related aspect the present invention is directed
to a method of screening for the onset, predisposition to the onset
and/or progression of a neoplasm by screening for modulation in DNA
methylation of one or more nucleic acid molecules. The nucleic acid
molecules used for diagnostics in the present invention are
sequences from LOC 100526820, subsequently named CAHM (colorectal
adenocarcinoma hypermethylated).
Inventors: |
Molloy; Peter Laurence;
(Chatswood, AU) ; Lapointe; Lawrence Charles;
(West Pennant Hills, AU) ; Pedersen; Susanne Kartin;
(North Ryde, AU) ; Mitchell; Susan Margaret;
(Gladesvulle, AU) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Clinical Genomics Pty Ltd
Commonwealth Scientific and Industrial Research
Organisation |
Elsternwick
Campbell |
|
AU
AU |
|
|
Family ID: |
47745779 |
Appl. No.: |
16/683588 |
Filed: |
November 14, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14240734 |
Jun 30, 2014 |
10526642 |
|
|
PCT/AU2012/000999 |
Aug 24, 2012 |
|
|
|
16683588 |
|
|
|
|
61527503 |
Aug 25, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6816 20130101;
C12Q 2600/154 20130101; C12Q 1/6886 20130101 |
International
Class: |
C12Q 1/6816 20060101
C12Q001/6816; C12Q 1/6886 20060101 C12Q001/6886 |
Claims
1. (canceled)
2. A method of detecting the onset, or predisposition to the onset,
of a large intestine neoplasm in a human subject, said method
comprising: contacting deoxy ribonucleic acid (DNA) from a human
subject with a bisulfite salt, thereby generating bisulfite
converted DNA, wherein said DNA from said human subject comprises a
nucleic acid having a sequence corresponding to SEQ ID NO: 17, or
the complement thereof; amplifying the bisulfite converted DNA;
measuring the amount of CpG methylation in the bisulfite converted
DNA; and determining whether a greater amount of CpG methylation in
the bisulfite converted DNA as compared to a control is present,
wherein when a greater amount of CpG methylation in the bisulfite
converted DNA as compared to the control is present, the onset, or
predisposition to the onset, of a large intestine neoplasm in the
human subject is detected.
3. The method of claim 2, wherein the amplifying of the bisulfite
converted DNA comprises contacting the bisulfite converted DNA with
a primer set comprising forward and reverse primers configured to
amplify a region of the bisulfite converted DNA.
4. The method of claim 3, wherein the region of the bisulfite
converted DNA comprises the sequence as set forth in SEQ ID NO: 1
or the complement thereof.
5. The method of claim 4, wherein the forward primer has a sequence
as set forth in SEQ ID NO: 18, and wherein the reverse primer has a
sequence as set forth in SEQ ID NO: 19.
6. The method of claim 3, wherein the region of the bisulfite
converted DNA comprises the sequence as set forth in SEQ ID NO: 3
or the complement thereof.
7. The method of claim 6, wherein the forward primer has a sequence
as set forth in SEQ ID NO: 13, and wherein the reverse primer has a
sequence as set forth in SEQ ID NO: 14.
8. The method of claim 3, wherein the region of the bisulfite
converted DNA comprises the sequence as set forth in SEQ ID NO: 4
or the complement thereof.
9. The method of claim 8, wherein the forward primer has a sequence
as set forth in SEQ ID NO: 13, and wherein the reverse primer has a
sequence as set forth in SEQ ID NO: 15.
10. The method of claim 2, wherein the DNA is free circulating
plasma DNA from a blood sample.
11. The method of claim 2, wherein when the onset, or
predisposition to the onset, of a large intestine neoplasm is
detected in said human subject, one or more of the following
procedures is performed on said human subject: (a) digital rectal
exam; (b) faecal occult blood test; (c) sigmoidoscopy or
colonoscopy; (d) double contrast barium enema X-ray; (e) virtual
colonoscopy; (f) computed axial tomography scan; or (g) positron
emission tomography.
12. The method of claim 8, wherein the measuring of the amount of
CpG methylation in the bisulfite converted DNA comprises: (i)
methylation-specific PCR; (ii) the MethyLight assay; (iii)
methylation-sensitive single nucleotide primer extension; (iv)
methylated CpG island amplification; (v) the HeavyMethyl assay;
(vi) Headloop PCR; (vii) the Helper-dependent chain reaction;
(viii) pyrosequencing; or (ix) Melting curve analysis.
13. The method of claim 2, wherein the large intestine neoplasm is
an adenoma, an adenocarcinoma, or a colorectal neoplasm.
14. The method of claim 2, wherein the control is the amount of
methylation of CpG dinucleotides detected in amplified bisulfite
converted DNA from a control human subject, which does not have a
large intestine neoplasm, wherein DNA from said control human
subject prior to bisulfite conversion comprises a nucleic acid
having a sequence corresponding to SEQ ID NO: 17.
15. A kit for assaying biological samples comprising one or more
polynucleotides that hybridize to a deoxy ribonucleic acid (DNA)
region defined by Hg19 coordinates Chr6: 163834097-163834982 and at
least one reagent for detection of gene methylation.
16. The kit according to claim 15, wherein said kit further
comprises a compound that selectively mutates a non-methylated
cytosine residue.
17. The kit according to claim 16, comprising: (i) sodium
bisulfite; (ii) primers that hybridize to a DNA region defined by
Hg19 coordinates Chr6: 163834097-163834982; and (iii)
detectably-labelled probes that distinguish between methylated and
unmethylated DNA that has been treated with bisulfite.
18. The kit according to claim 15, wherein said kit further
comprises one or more control DNA sequences representing methylated
or unmethylated forms of said DNA region.
19. The kit according to claim 18, wherein said one or more control
DNA sequences have a sequence corresponding to any one of SEQ ID
NOs: 5, 6, 7, 8, 9, 10, 11 or 12, or a sequence exhibiting at least
95% identity to said sequences.
20. The kit according to claim 15, wherein said kit comprises one
or more amplification primer sets, wherein the primer sets
comprise: (i) SEQ ID NOs:13 and 14 or a sequence exhibiting at
least 95% identity to said sequences; (ii) SEQ ID NOs:13, 14 and 15
or a sequence exhibiting at least 95% identity to said sequences;
(iii) SEQ ID NOs:18 and 19 or a sequence exhibiting at least 95%
identity to said sequences; or (iv) SEQ ID NOs:20 and 21 or a
sequence exhibiting at least 95% identity to said sequences.
21. An isolated nucleic acid molecule selected from the group
consisting of: (i) an isolated nucleic acid molecule or complement
thereof comprising a nucleotide sequence having at least 86%, 87%,
88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or
more identity over the full length of any one of SEQ ID NO:5-12;
and (ii) an isolated nucleic acid molecule or complement thereof
comprising a nucleotide sequence corresponding to any one of SEQ ID
NO: 5-12.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application of U.S.
application Ser. No. 14/240,734, filed on Jun. 30, 2014, which is a
U.S. National Phase Application of PCT International Application
Number PCT/AU2012/000999, filed on Aug. 24, 2012, designating the
United States of America and published in the English language,
which is an International Application of and claims the benefit of
priority to U.S. Provisional Application No. 61/527,503 filed Aug.
25, 2011, the disclosures of which are hereby expressly
incorporated by reference in their entireties.
REFERENCE TO SEQUENCE LISTING
[0002] A Sequence Listing submitted as an ASCII text file via
EFS-Web is hereby incorporated by reference in accordance with 35
U.S.C. .sctn. 1.52(e).
FIELD
[0003] The present invention relates generally to nucleic acid
molecules in respect of which changes to DNA methylation levels are
indicative of the onset or predisposition to the onset of a
neoplasm. More particularly, the present invention is directed to
nucleic acid molecules in respect of which changes to DNA
methylation levels are indicative of the onset and/or progression
of a large intestine or breast neoplasm, such as an adenoma or
adenocarcinoma. The DNA methylation status of the present invention
is useful in a range of applications including, but not limited to,
those relating to the diagnosis and/or monitoring of colorectal or
breast neoplasms, such as colorectal or breast adenocarcinomas.
Accordingly, in a related aspect the present invention is directed
to a method of screening for the onset, predisposition to the onset
and/or progression of a neoplasm by screening for modulation in DNA
methylation of one or more nucleic acid molecules.
BACKGROUND
[0004] Colorectal cancer includes cancerous growths in the colon,
rectum and appendix. With 655,000 deaths worldwide per year, it is
the fourth most common form of cancer in the United States and the
third leading cause of cancer-related death in the Western world.
Colorectal cancers arise from adenomatous polyps in the colon.
These mushroom-shaped growths are usually benign, but some develop
into cancer over time. Localized colon cancer is usually diagnosed
through colonoscopy. Invasive cancers that are confined within the
wall of the colon (TNM stages I and II) are curable with surgery.
If untreated, they spread to regional lymph nodes (stage III),
where up to 73% are curable by surgery and chemotherapy. Cancer
that metastasizes to distant sites (stage IV) is usually not
curable, although chemotherapy can extend survival, and in rare
cases, surgery and chemotherapy together have seen patients through
to a cure (Markowitz and Bertagnolli, 2009, N. Engl. J. Med.
361(25): 2449-60). Radiation is used with rectal cancer.
[0005] Breast cancer is a type of cancer originating from breast
tissue, most commonly from the inner lining of milk ducts or the
lobules that supply the ducts with milk. Cancers originating from
ducts are known as ductal carcinomas, while those originating from
lobules are known as lobular carcinomas. While the overwhelming
majority of cases occur in women, male breast cancer can also
occur.
[0006] Worldwide, breast cancer comprises 22.9% of all cancers in
women and is more than 100 times more common in women than in men,
although men tend to have poorer outcomes due to delays in
diagnosis. Prognosis and survival rates for breast cancer vary
greatly depending on the cancer type, stage, treatment, and
geographical location of the patient. Survival rates in the Western
world are high; for example, more than 8 out of 10 women (84%) in
England diagnosed with breast cancer survive for at least 5 years.
In developing countries, however, survival rates are much
poorer.
[0007] Many cancers are preceded by adenomas. Adenomas are benign
tumours, or neoplasms, of epithelial origin which are derived from
glandular tissue or exhibit clearly defined glandular structures.
Some adenomas show recognisable tissue elements, such as fibrous
tissue (fibroadenomas) and epithelial structure, while others, such
as bronchial adenomas, produce active compounds that might give
rise to clinical syndromes.
[0008] Adenomas may progress to become an invasive neoplasm and are
then termed adenocarcinomas. Accordingly, adenocarcinomas are
defined as malignant epithelial tumours arising from glandular
structures, which are constituent parts of many organs of the body.
The term adenocarcinoma is also applied to tumours showing a
glandular growth pattern. These tumours may be sub-classified
according to the substances that they produce, for example mucus
secreting and serous adenocarcinomas, or to the microscopic
arrangement of their cells into patterns, for example papillary and
follicular adenocarcinomas. These carcinomas may be solid or cystic
(cystadenocarcinomas). Each organ may produce tumours showing a
variety of histological types, for example the ovary may produce
both mucinous and cystadenocarcinoma.
[0009] Adenomas in different organs behave differently. In general,
the overall chance of carcinoma being present within an adenoma
(i.e. a focus of cancer having developed within a benign lesion) is
approximately 5%. However, this is related to size of an adenoma.
For instance, in the large bowel (colon and rectum specifically)
occurrence of a cancer within an adenoma is rare in adenomas of
less than 1 centimetre. Such a development is estimated at 40 to
50% in adenomas which are greater than 4 centimetres and show
certain histopathological change such as villous change, or high
grade dysplasia. Adenomas with higher degrees of dysplasia have a
higher incidence of carcinoma. In any given colorectal adenoma, the
predictors of the presence of cancer now or the future occurrence
of cancer in the organ include size (especially greater than 9 mm)
degree of change from tubular to villous morphology, presence of
high grade dysplasia and the morphological change described as
"serrated adenoma". In any given individual, the additional
features of increasing age, familial occurrence of colorectal
adenoma or cancer, male gender or multiplicity of adenomas, predict
a future increased risk for cancer in the organ--so-called risk
factors for cancer. Except for the presence of adenomas and its
size, none of these is objectively defined and all those other than
number and size are subject to observer error and to confusion as
to precise definition of the feature in question. Because such
factors can be difficult to assess and define, their value as
predictors of current or future risk for cancer is imprecise.
[0010] Once a sporadic adenoma has developed, the chance of a new
adenoma occurring is approximately 30% within 26 months.
[0011] The symptoms of colorectal cancer depend on the location of
tumor in the bowel, and whether is has metastasised. Unfortunately,
many of the symptoms may occur in other diseases as well, and hence
symptoms may not be conclusively diagnostic of colorectal
cancer.
[0012] Local symptoms are more likely if the tumor is located
closer to the anus. There may be a change in bowel habit (new-onset
constipation or diarrhea in the absence of another cause), a
feeling of incomplete defecation and reduction in diameter of
stools. Tenesmus and change in stool shape are both characteristic
of rectal cancer. Lower gastrointestinal bleeding, including the
passage of bright red blood in the stool, may indicate colorectal
cancer, as may the increased presence of mucus. Melena, black stool
with a tarry appearance, normally occurs in upper gastrointestinal
bleeding (such as from a duodenal ulcer), but is sometimes
encountered in colorectal cancer when the disease is located in the
beginning of the large bowl.
[0013] A tumor that is large enough to fill the entire lumen of the
bowel may cause bowel obstruction. This situation is characterized
by constipation, abdominal pain, abdominal distension and vomiting.
This occasionally leads to the obstructed and distended bowel
perforating and causing peritonitis.
[0014] Certain local effects of colorectal cancer occur when the
disease has become more advanced. A large tumor is more likely to
be noticed on feeling the abdomen, and it may be noticed by a
doctor on physical examination. The disease may invade other
organs, and may cause blood or air in the urine or vaginal
discharge.
[0015] If a tumor has caused chronic occult bleeding, iron
deficiency anaemia may occur. This may be experienced as fatigue,
palpitations and noticed as pallor. Colorectal cancer may also lead
to weight loss, generally due to a decreased appetite.
[0016] More unusual constitutional symptoms are an unexplained
fever and one of several paraneoplastic syndromes. The most common
paraneoplastic syndrome is thrombosis, usually deep vein
thrombosis.
[0017] Colorectal cancer most commonly spreads to the liver. This
may go unnoticed, but large deposits in the liver may cause
jaundice and abdominal pain (due to stretching of the capsule). If
the tumor deposit obstructs the bile duct, the jaundice may be
accompanied by other features of biliary obstruction, such as pale
stools.
[0018] Colorectal cancer can take many years to develop and early
detection of colorectal cancer greatly improves the prognosis. Even
modest efforts to implement colorectal cancer screening methods can
result in a drop in cancer deaths. Despite this, colorectal cancer
screening rates remain low. Therefore, screening for the disease is
recommended in individuals who are at increased risk. There are
currently several different tests available for this purpose:
[0019] Digital rectal exam: The doctor inserts a lubricated, gloved
finger into the rectum to feel for abnormal areas. It only detects
tumors large enough to be felt in the distal part of the rectum but
is useful as an initial screening test. [0020] Faecal occult blood
test: a test for blood in the stool. Two types of tests can be used
for detecting occult blood in stools i.e. guaiac based (chemical
test) and immunochemical. The sensitivity of immunochemical testing
is superior to that of chemical testing without an unacceptable
reduction in specificity (Weitzel J N (December 1999). "Genetic
cancer risk assessment. Putting it all together". Cancer 86 (11
Suppl): 2483-92). [0021] Endoscopy: [0022] Sigmoidoscopy: A lit
probe (sigmoidoscope) is inserted into the rectum and lower colon
to check for polyps and other abnormalities. [0023] Colonoscopy: A
lit probe called a colonoscope is inserted into the rectum and the
entire colon to look for polyps and other abnormalities that may be
caused by cancer. A colonoscopy has the advantage that if polyps
are found during the procedure they can be removed immediately.
Tissue can also be taken for biopsy. [0024] Double contrast barium
enema (DCBE): First, an overnight preparation is taken to cleanse
the colon. An enema containing barium sulfate is administered, then
air is insufflated into the colon, distending it. The result is a
thin layer of barium over the inner lining of the colon which is
visible on X-ray films. A cancer or a precancerous polyp can be
detected this way. This technique can miss the (less common) flat
polyp. [0025] Virtual colonoscopy replaces X-ray films in the
double contrast barium enema (above) with a special computed
tomography scan and requires special workstation software in order
for the radiologist to interpret. This technique is approaching
colonoscopy in sensitivity for polyps. However, any polyps found
must still be removed by standard colonoscopy. [0026] Standard
computed axial tomography is an x-ray method that can be used to
determine the degree of spread of cancer, but is not sensitive
enough to use for screening. Some cancers are found in CAT scans
performed for other reasons. [0027] Blood tests: Measurement of the
patient's blood for elevated levels of certain proteins can give an
indication of tumor load. In particular, high levels of
carcinoembryonic antigen (CEA) in the blood can indicate metastasis
of adenocarcinoma. These tests are frequently false positive or
false negative, and are not recommended for screening, it can be
useful to assess disease recurrence. CA19-9 and CA 242 biomarkers
can indicate e-selectin related metastatic risks, help follow
therapeutic progress, and assess disease recurrence. Recently, an
assay for detection in plasma of methylated sequences of the Septin
9 gene has also become available to assist in diagnosis of
colorectal cancer. [0028] Positron emission tomography (PET) is a
3-dimensional scanning technology where a radioactive sugar is
injected into the patient, the sugar collects in tissues with high
metabolic activity, and an image is formed by measuring the
emission of radiation from the sugar. Because cancer cells often
have very high metabolic rates, this can be used to differentiate
benign and malignant tumors. PET is not used for screening and does
not (yet) have a place in routine workup of colorectal cancer
cases. [0029] Whole-body PET imaging is the most accurate
diagnostic test for detection of recurrent colorectal cancer, and
is a cost-effective way to differentiate resectable from
nonresectable disease. A PET scan is indicated whenever a major
management decision depends upon accurate evaluation of tumour
presence and extent. [0030] Stool DNA testing is an emerging
technology in screening for colorectal cancer. Premalignant
adenomas and cancers shed DNA markers from their cells which are
not degraded during the digestive process and remain stable in the
stool. Capture, followed by PCR amplifies the DNA to detectable
levels for assay. [0031] High C-Reactive Protein levels as risk
marker
(http://www.sciencedaily.com/releases/2010/04/100419150831.htm).
[0032] Despite the existence of these tests, diagnosis remains
problematic. Most of the more sensitive tests are quite invasive
and expensive and therefore uptake by patients is low. There is
therefore an ongoing need to develop simpler and more informative
diagnostic protocols or aids to diagnosis that enable one to direct
colonoscopy at people more likely to have developed adenomas or
carcinomas. A simple and accurate screening test would enable much
more widely applicable screening systems to be set up. Similarly,
with breast cancer there is a significantly better prognosis if the
cancer is diagnosed early, this often being difficult to reliably
achieve since other than the BRCA gene test as a prognostic
indicator of a sub-group of aggressive cancers, reliance still lies
primarily with mammograms and self examination to identify tumours,
neither technique of which is sensitive enough to reliably detect
very early stage cancers.
[0033] In work leading up to the present invention it has been
determined that changes to the methylation of LOC100526820, in
particular two specific regions of LOC100526820, is indicative of
the development of neoplasms of the large intestine, such as
adenomas and adenocarcinomas. Still further, the identification of
specific genomic DNA cytosine nucleotides which become
hypermethylated has enabled the development of very simple and
specific amplification reactions for routine use in the context of
diagnosis.
SUMMARY
[0034] Throughout this specification and the claims which follow,
unless the context requires otherwise, the word "comprise", and
variations such as "comprises" and "comprising", will be understood
to imply the inclusion of a stated integer or step or group of
integers or steps but not the exclusion of any other integer or
step or group of integers or steps.
[0035] As used herein, the term "derived from" shall be taken to
indicate that a particular integer or group of integers has
originated from the species specified, but has not necessarily been
obtained directly from the specified source. Further, as used
herein the singular forms of "a", "and" and "the" include plural
referents unless the context clearly dictates otherwise.
[0036] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
[0037] The subject specification contains nucleotide sequence
information prepared using the programme Patentln Version 3.5,
presented herein after the bibliography. Each nucleotide sequence
is identified in the sequence listing by the numeric indicator
<210> followed by the sequence identifier (eg. <210>1,
<210>2, etc). The length, type of sequence (DNA, etc) and
source organism for each sequence is indicated by information
provided in the numeric indicator fields <211>, <212>
and <213>, respectively. Nucleotide sequences referred to in
the specification are identified by the indicator SEQ ID NO:
followed by the sequence identifier (eg. SEQ ID NO:1, SEQ ID NO:2,
etc.). The sequence identifier referred to in the specification
correlates to the information provided in numeric indicator field
<400> in the sequence listing, which is followed by the
sequence identifier (eg. <400>1, <400>2, etc). That is
SEQ ID NO:1 as detailed in the specification correlates to the
sequence indicated as <400>1 in the sequence listing.
[0038] One aspect of the present invention is directed to a method
of screening for the onset or predisposition to the onset of a
large intestine or breast neoplasm in an individual, said method
comprising assessing the methylation status of the DNA region
defined by Hg19 coordinates Chr6: 163834097-163834982 in a
biological sample from said individual wherein a higher level of
methylation of said DNA region relative to control levels is
indicative of a neoplastic large intestine or breast cell or a cell
predisposed to the onset of a neoplastic state.
[0039] In another aspect there is provided a method of screening
for the onset or predisposition to the onset of a large intestine
or breast neoplasm in a human, said method comprising assessing the
methylation status of the DNA region defined by Hg19 coordinates
Chr6: 163834097-163834982 in a biological sample from said
individual wherein a higher level of methylation of said DNA region
relative to control levels is indicative of a neoplastic large
intestine or breast cell or a cell predisposed to the onset of a
neoplastic state.
[0040] Yet another aspect of the present invention is directed to a
method of screening for the onset or predisposition to the onset of
a large intestine or breast neoplasm in an individual, said method
comprising assessing the methylation status of a DNA region
selected from one or both of the regions defined by Hg19
coordinates Chr6:163834295-163834500 or Chr6:163834621-163834906 in
a biological sample from said individual wherein a higher level of
methylation of one or both of these DNA regions is indicative of a
neoplastic large intestine or breast cell or a cell predisposed to
the onset of a neoplastic state.
[0041] In still another aspect there is provided a method of
screening for the onset or predisposition to the onset of a large
intestine or breast neoplasm in an individual, said method
comprising assessing the methylation status of a DNA region
selected from one or both of the regions defined by Hg19
coordinates Chr6:163834393-163834519 or Chr6:163834393-163834455 in
a biological sample from said individual wherein a higher level of
methylation of one or both of these DNA regions is indicative of a
neoplastic large intestine or breast cell or a cell predisposed to
the onset of a neoplastic state.
[0042] In yet still another aspect there is provided a method of
screening for the onset or predisposition to the onset of a large
intestine or breast neoplasm in an individual, said method
comprising assessing the methylation of one or more cytosine
residues selected from:
TABLE-US-00001 Chr6: 163834330 Chr6: 163834332 Chr6: 163834357
Chr6: 163834373 Chr6: 163834384 Chr6: 163834390 Chr6: 163834392
Chr6: 163834406 Chr6: 163834412 Chr6: 163834419 Chr6: 163834443
Chr6: 163834448 Chr6: 163834452 Chr6: 163834464 Chr6: 163834483
Chr6: 163834653 Chr6: 163834660 Chr6: 163834672 Chr6: 163834675
Chr6: 163834678 Chr6: 163834681 Chr6: 163834815 Chr6: 163834824
Chr6: 163834835 Chr6: 163834840 Chr6: 163834853 Chr6: 163834855
Chr6: 163834858 Chr6: 163834863 Chr6: 163834869 Chr6: 163834872
or a corresponding cytosine at position n+1 on the opposite DNA
strand, in a biological sample from said individual wherein a
higher level of methylation of one or more of said residues
relative to the methylation level of a corresponding residue in a
control sample is indicative of a neoplastic large intestine or
breast cell or a cell predisposed to the onset of a neoplastic
state.
[0043] In a further aspect, the increased methylation in a DNA
region of the present invention is determined using a process
comprising: [0044] (i) treating the DNA derived from a biological
sample with a compound that selectively mutates a non-methylated
cytosine residue under conditions sufficient to induce mutagenesis;
[0045] (ii) amplifying the DNA of step (i) using primers designed
to amplify a DNA region defined by one of SEQ ID NOs:1, 2, 3 or 4;
[0046] (iii) sequencing the amplification product of step (ii) to
identify the presence in the DNA from said test sample of one or
more cytosine residues which have not undergone mutation relative
to the corresponding mutated residues in DNA from a control
sample.
[0047] In another aspect, said mutagenesis is induced with
bisulfite or equivalent agent and unmethylated cytosine residues
are converted to uracil.
[0048] Another aspect of the present invention is directed to a
method of screening for the onset or predisposition to the onset of
a large intestine or breast neoplasm in an individual, said method
comprising assessing the level of expression of the DNA region
defined by Hg19 coordinates Chr6:163834295-163834500 in a
biological sample from said individual wherein a lower level of
expression of said DNA region relative to control levels is
indicative of a neoplastic large intestine or breast cell or a cell
predisposed to the onset of a neoplastic state.
[0049] Another aspect of the present invention provides a
diagnostic kit for assaying biological samples comprising one or
more agents for detecting the marker of the present invention and
reagents useful for facilitating the detection by said agents.
Further means may also be included, for example, to receive a
biological sample. The agent may be any suitable detecting
molecule.
[0050] In one embodiment, said kit comprises one or more nucleic
acid molecules corresponding to SEQ ID NOs:5, 6, 7, 8, 9, 10, 11 or
12, or substantially similar nucleic acid molecule. As detailed
hereinbefore, these sequences are useful as the standards
(controls) against which the product amplified from the test sample
is assessed.
[0051] In another embodiment, said kit comprises one or more
amplification primer sets which primer sets correspond to the
sequences as follows: [0052] (i) SEQ ID NOs:13 and 14 or
substantially similar sequences; [0053] (ii) SEQ ID Nos:13, 14 and
15 or substantially similar sequences; [0054] (iii) SEQ ID NOs:18
and 19 or substantially similar sequences; [0055] (iv) SEQ ID
NOs:20 and 21 or substantially similar sequences.
BRIEF DESCRIPTION OF THE DRAWINGS
[0056] FIG. 1: SEQ ID NO:1 with methylation positions indicated.
Solid lines: proportion of methylation measured in 10 colorectal
cancer specimens. Dashed lines: proportion of methylation measured
in 10 normal colon specimens.
[0057] FIG. 2: SEQ ID NO:2 with methylation positions indicated.
Solid lines: proportion of methylation measured in 10 colorectal
cancer specimens. Dashed lines: proportion of methylation measured
in 10 normal colon specimens.
[0058] FIG. 3 depicts the SEQ ID NO:1 and 2 sequences together with
the chromosomal location numbering of LOC100526820.
DETAILED DESCRIPTION
[0059] The present invention is predicated, in part, on the
elucidation of DNA methylation status which characterises large
intestine and breast neoplasms. This finding has now facilitated
the development of routine means of screening for the onset or
predisposition to the onset of a large intestine or breast neoplasm
based on increased methylation of the LOC100526820 DNA region
relative to control levels. In accordance with the present
invention, it has been determined that this DNA region is
modulated, in terms of differential changes to its levels of
methylation, depending on whether or not the cell in issue is
neoplastic or not. It should be understood that the DNA region in
issue is described herein both by reference to its name and its
chromosomal coordinates. To the extent that the chromosomal
coordinates corresponding to a DNA region is listed, this is
consistent with the human genome database version Hg19 which was
released in February 2009 (herein referred to as "Hg19
coordinates").
[0060] Accordingly, one aspect of the present invention is directed
to a method of screening for the onset or predisposition to the
onset of a large intestine or breast neoplasm in an individual,
said method comprising assessing the methylation status of the DNA
region defined by Hg19 coordinates Chr6: 163834097-163834982 in a
biological sample from said individual wherein a higher level of
methylation of said DNA region relative to control levels is
indicative of a neoplastic large intestine or breast cell or a cell
predisposed to the onset of a neoplastic state.
[0061] Reference to "large intestine" should be understood as a
reference to a cell derived from one of the eight anatomical
regions of the large intestine, which regions commence after the
terminal region of the ileum, these being: [0062] (i) the cecum;
[0063] (ii) the ascending colon; [0064] (iii) the transverse colon;
[0065] (iv) the descending colon; [0066] (v) the sigmoid colon;
[0067] (vi) the rectum; [0068] (vii) the splenic flexure; and
[0069] (viii) the hepatic flexure.
[0070] Without limiting the present invention to any one theory or
mode of action, the mammalian breast is a structurally dynamic
organ which varies with age, menstrual cycle and reproductive
status. It is a branched tubuloalveolar gland exhibiting secretory
acinii which are grouped with inner lobules and drain into
intralobular ducts which in turn drain into interlobular ducts. The
lobules are organised into 15-20 lobes, each of which empty into
separate lactiferous sinuses and from there into lactiferous ducts.
The intralobular stroma consists of a loose connective tissue with
a zone of hormone sensitive fibroblasts surrounding the lobular
epithelial components. These are thought to take part in
epithelial/basement membrane/stromal inductive interactions during
morphogenesis and differentiation. The breast undergoes unique
differentiative and proliferative development during the various
life cycle stages of an individual. Accordingly, it should be
understood that reference to the breast is a reference to the cells
comprising the breast at any stage of its development including
prepubescent, pubescent, prenatal, postnatal/lactating and
post-menopausal stages. In this regard, it should also be
understood that any given population of cells may be only
transiently present in the breast, such as those which are
generated during pregnancy for the purpose of facilitating
lactation.
[0071] Reference to "neoplasm" should be understood as a reference
to a lesion, tumour or other encapsulated or unencapsulated mass or
other form of growth which comprises neoplastic cells. A
"neoplastic cell" should be understood as a reference to a cell
exhibiting abnormal growth. The term "growth" should be understood
in its broadest sense and includes reference to proliferation. In
this regard, an example of abnormal cell growth is the uncontrolled
proliferation of a cell. Another example is failed apoptosis in a
cell, thus prolonging its usual life span. The neoplastic cell may
be a benign cell or a malignant cell. In a preferred embodiment,
the subject neoplasm is an adenoma or an adenocarcinoma. Without
limiting the present invention to any one theory or mode of action,
an adenoma is generally a benign tumour of epithelial origin which
is either derived from epithelial tissue or exhibits clearly
defined epithelial structures. These structures may take on a
glandular appearance. It can comprise a malignant cell population
within the adenoma, such as occurs with the progression of a benign
adenoma or benign neoplastic lesion to a malignant
adenocarcinoma.
[0072] Preferably, said neoplastic cell is an adenoma or
adenocarcinoma and even more preferably a colorectal or breast
adenoma or adenocarcinoma.
[0073] Reference to "DNA region" should be understood as a
reference to a specific section of genomic DNA. These DNA regions
are specified by reference to a set of chromosomal coordinates,
these being understood by the person of skill in the art. As
detailed hereinbefore, the chromosomal coordinates for the DNA
regions specified herein correspond to the Hg19 version of the
genome. In general, a gene can be routinely identified by reference
to its chromosomal location, via which its sequences can be
routinely obtained. It should also be understood that reference to
the DNA region Chr6:163834097-163834982 is interchangeably herein
referred to by the name LOC100526820. The 886 nucleotide reverse
strand sequence of this locus is provided in SEQ ID NO:17.
[0074] Other DNA regions, which fall within this locus are
disclosed herein. These are as follows: [0075] (i)
Chr6:163834295-163834500, the nucleotide sequence of which is:
TABLE-US-00002 [0075] (SEQ ID NO: 1) atctgtaaaa atgttgactt
ctgcttttca gactacgcgc acagcctctt tatttcctac tgcggcttca ttccctcacg
gaacactgac gccatcgcga aggaagcatt tcgagcacga ctgacgctcc ccttattatt
tgctaagccg ctgcgctcgg gtctggctac gatttgcttt cagaataacg ggaaggtgca
acaaga;
[0076] (ii) Chr6:163834621-163834906, the nucleotide sequence of
which is:
TABLE-US-00003 [0076] (SEQ ID NO: 2) gccgtgctgc tttccagcct
ctcagcaaat cacgaacacc gaaagaagcc acggcggcga cgggaggggc gtcgcgcgtg
cttccctcgg cgacaaagcg ggagccgggc gcgccggccg agggcgcccg gcgcagagtc
ccgcagaggc ggacgccgcg gcacgcgcct cgaaaagcct caaactctta tcctcggctc
tcccgcccca cctccgcccc gcagccaaga cccgcgccgt ggcgggcccg acggccaagg
aaagcccacc agccctccgc accgtg;
[0077] (iii) Chr6:163834393-163834455, the nucleotide sequence of
which is:
TABLE-US-00004 [0077] (SEQ ID NO: 3)
gaaggaagcatttcgagcacgactgacgctccccttattatttgctaagc
cgctgcgctcggg;
[0078] (iv) Chr6:163834393-163834519, the nucleotide sequence of
which is:
TABLE-US-00005 [0078] (SEQ ID NO: 4)
gaaggaagcatttcgagcacgactgacgctccccttattatttgctaagc
cgctgcgctcgggtctggctacgatttgctttcagaataacgggaaggtg
caacaagatcgcttccctagaggcgcg.
[0079] SEQ ID NOs:1 and 2 represent two discrete regions within the
LOC100526820 locus. SEQ ID NOs:3 and 4 represent two regions within
SEQ ID NO:1, with the SEQ ID NO:3 region in fact falling within the
longer SEQ ID NO:4 region. All of these regions are discussed in
more detail hereafter.
[0080] Reference to each of the DNA regions detailed above should
be understood as a reference to all forms of the molecules and to
fragments or variants thereof. As would be appreciated by the
person of skill in the art, some DNA regions are known to exhibit
allelic variation between individuals or single nucleotide
polymorphisms. SNPs encompass insertions and deletions of varying
size and simple sequence repeats, such as dinucleotide and
trinucleotide repeats. Variants include nucleic acid sequences from
the same region sharing at least 90%, 95%, 98%, 99% sequence
identity i.e. having one or more deletions, additions,
substitutions, inverted sequences etc. relative to the DNA regions
described herein. Accordingly, the present invention should be
understood to extend to such variants which, in terms of the
present diagnostic applications, achieve the same outcome despite
the fact that minor genetic variations between the actual nucleic
acid sequences may exist between individuals. The present invention
should therefore be understood to extend to all forms of DNA which
arise from any other mutation, polymorphic or allelic
variation.
[0081] It should be understood that the "individual" who is the
subject of testing may be any human or non-human mammal. Examples
of non-human mammals includes primates, livestock animals (e.g.
horses, cattle, sheep, pigs, donkeys), laboratory test animals
(e.g. mice, rats, rabbits, guinea pigs), companion animals (e.g.
dogs, cats) and captive wild animals (e.g. deer, foxes). Preferably
the mammal is a human.
[0082] According to this embodiment there is provided a method of
screening for the onset or predisposition to the onset of a large
intestine or breast neoplasm in a human, said method comprising
assessing the methylation status of the DNA region defined by Hg19
coordinates Chr6: 163834097-163834982 in a biological sample from
said individual wherein a higher level of methylation of said DNA
region relative to control levels is indicative of a neoplastic
large intestine or breast cell or a cell predisposed to the onset
of a neoplastic state.
[0083] Without limiting the present invention to any one theory or
mode of action, although measuring the methylation levels across
LOC100526820 is diagnostic of a large intestine neoplastic or
breast condition, it has been determined that two discrete regions
within LOC100526820 are particularly useful in this regard since
these regions contain a high density of CpG dinucleotides which are
frequently hypermethylated in large intestine and breast
neoplasias, such as colorectal cancers.
[0084] Accordingly, one embodiment of the present invention is
directed to a method of screening for the onset or predisposition
to the onset of a large intestine or breast neoplasm in an
individual, said method comprising assessing the methylation status
of a DNA region selected from one or both of the regions defined by
Hg19 coordinates Chr6:163834295-163834500 or
Chr6:163834621-163834906 in a biological sample from said
individual wherein a higher level of methylation of one or both of
these DNA regions is indicative of a neoplastic large intestine or
breast cell or a cell predisposed to the onset of a neoplastic
state.
[0085] In still another embodiment, the DNA region which is the
subject of analysis is Chr6:163834393-163834519 (SEQ ID NO:4) which
falls within the SEQ ID NO:1 region or Chr6:163834393-163834455
(SEQ ID NO:3) which falls within the SEQ ID NO:4 region. In one
particular embodiment, PCR based assays have been developed and
applied in the context of these two smaller DNA regions. These are
discussed in more detail hereafter.
[0086] According to this embodiment there is provided a method of
screening for the onset or predisposition to the onset of a large
intestine or breast neoplasm in an individual, said method
comprising assessing the methylation status of a DNA region
selected from one or both of the regions defined by Hg19
coordinates Chr6:163834393-163834519 or Chr6:163834393-163834455 in
a biological sample from said individual wherein a higher level of
methylation of one or both of these DNA regions is indicative of a
neoplastic large intestine or breast cell or a cell predisposed to
the onset of a neoplastic state.
[0087] In another embodiment, said neoplastic cell is an adenoma or
adenocarcinoma and even more preferably a colorectal or breast
adenoma or adenocarcinoma.
[0088] Without limiting the present invention to any one theory or
mode of action, DNA methylation is universal in bacteria, plants,
and animals. DNA methylation is a type of chemical modification of
DNA that is stable over rounds of cell division but does not
involve changes in the underlying DNA sequence of the organism.
Chromatin and DNA modifications are two important features of
epigenetics and play a role in the process of cellular
differentiation, allowing cells to stably maintain different
characteristics despite containing the same genomic material. In
eukaryotic organisms DNA methylation occurs only at the number 5
carbon of the cytosine pyrimidine ring. In mammals, DNA methylation
occurs mostly at the number 5 carbon of the cytosine of a CpG
dinucleotide. CpG dinucleotides comprise approximately 1% human
genome.
[0089] 70%-80% of all CpGs are methylated. CpGs may be grouped in
clusters called "CpG islands" that are present in the 5' regulatory
regions of many genes and are frequently unmethylated. In many
disease processes such as cancer, gene promoters and/or CpG islands
acquire abnormal hypermethylation, which is associated with
heritable transcriptional silencing. DNA methylation may impact the
transcription of genes in two ways. First, the methylation of DNA
may itself physically impede the binding of transcriptional
proteins to the gene, thus blocking transcription. Second,
methylated DNA may be bound by proteins known as Methyl-CpG-binding
domain proteins (MBDs). MBD proteins then recruit additional
proteins to the locus, such as histone deacetylases and other
chromatin remodelling proteins that can modify histones, thereby
forming compact, inactive chromatin termed silent chromatin. This
link between DNA methylation and chromatin structure is very
important. In particular, loss of Methyl-CpG-binding Protein 2
(MeCP2) has been implicated in Rett syndrome and Methyl-CpG binding
domain protein 2 (MBD2) mediates the transcriptional silencing of
hypermethylated genes in cancer.
[0090] In humans, the process of DNA methylation is carried out by
three enzymes, DNA methyltransferase 1, 3a and 3b (DNMT1, DNMT3a,
DNMT3b). It is thought that DNMT3a and DNMT3b are the de novo
methyltransferases that set up DNA methylation patterns early in
development. DNMT1 is the proposed maintenance methyltransferase
that is responsible for copying DNA methylation patterns to the
daughter strands during DNA replication. DNMT3L is a protein that
is homologous to the other DNMT3s but has no catalytic activity.
Instead, DNMT3L assists the de novo methyltransferases by
increasing their ability to bind to DNA and stimulating their
activity. Finally, DNMT2 has been identified as an "enigmatic" DNA
methylstransferase homolog, containing all 10 sequence motifs
common to all DNA methyltransferases; however, DNMT2 may not
methylate DNA but instead has been shown to methylate a small
RNA.
[0091] "Methylation status" should therefore be understood as a
reference to the presence, absence and/or quantity of methylation
at a particular nucleotide, or nucleotides, within a DNA region.
The methylation status of a particular DNA sequence (e.g. DNA
region as described herein) can indicate the methylation state of
every base in the sequence or can indicate the methylation state of
a subset of the base pairs (e.g., of cytosines) or the methylation
state of one or more specific restriction enzyme recognition
sequences within the sequence, or can indicate information
regarding regional methylation density within the sequence without
providing precise information of where in the sequence the
methylation occurs. The methylation status can optionally be
represented or indicated by a "methylation value." A methylation
value can be generated, for example, by quantifying the amount of
intact DNA present following restriction digestion with a
methylation dependent restriction enzyme. In this example, if a
particular sequence in the DNA is quantified using quantitative
PCR, an amount of template DNA approximately equal to a mock
treated control indicates the sequence is not highly methylated
whereas an amount of template substantially less than occurs in the
mock treated sample indicates the presence of methylated DNA at the
sequence. Accordingly, a value, i.e., a methylation value, for
example from the above described example, represents the
methylation status and can thus be used as a quantitative indicator
of the methylation status. This is of particular use when it is
desirable to compare the methylation status of a sequence in a
sample to a threshold value.
[0092] The method of the present invention is predicated on the
comparison of the level of methylation of specific DNA regions of a
biological sample with the control methylation levels of these DNA
regions. The "control level" is the "normal level", which is the
level of methylation of the DNA region of a corresponding large
intestine or breast cell or cellular population which is not
neoplastic or in another biological sample, for example blood
plasma, from which DNA may be isolated for assay.
[0093] The normal (or "non-neoplastic") methylation level may be
determined using non-neoplastic tissues derived from the same
individual who is the subject of testing. However, it would be
appreciated that this may be quite invasive for the individual
concerned and it is therefore likely to be more convenient to
analyse the test results relative to a standard result which
reflects individual or collective results obtained from individuals
other than the patient in issue. This latter form of analysis is in
fact the preferred method of analysis since it enables the design
of kits which require the collection and analysis of a single
biological sample, being a test sample of interest. The standard
results which provide the normal methylation level may be
calculated by any suitable means which would be well known to the
person of skill in the art. For example, a population of normal
tissues can be assessed in terms of the level of methylation of the
genes of the present invention, thereby providing a standard value
or range of values against which all future test samples are
analysed. It should also be understood that the normal level may be
determined from the subjects of a specific cohort and for use with
respect to test samples derived from that cohort. Accordingly,
there may be determined a number of standard values or ranges which
correspond to cohorts which differ in respect of characteristics
such as age, gender, ethnicity or health status. Said "normal
level" may be a discrete level or a range of levels. An increase in
the methylation level of the subject genes relative to normal
levels is indicative of the tissue being neoplastic.
[0094] The term "methylation" shall be taken to mean the presence
of a methyl group added by the action of a DNA methyl transferase
enzyme to a cytosine base or bases in a region of nucleic acid,
e.g. genomic DNA. As described herein, there are several methods
known to those skilled in the art for determining the level or
degree of methylation of nucleic acid.
[0095] By "higher level" is meant that there are a higher number of
methylated CpG dinucleotides in the subject diagnosed than in a
control sample, that is, either the proportion of DNA molecules
methylated at a particular CpG site is higher or there are a higher
number of separate CpG sites methylated in the subject. It should
be understood that the terms "enhanced" and "increased" are used
interchangeably with the term "higher". The present invention is
not to be limited by a precise number of methylated residues that
are considered to be diagnostic of neoplasia in a subject, because
some variation between patient samples will occur. The present
invention is also not limited by positioning of the methylated
residue. Nevertheless, a number of specific cytosine residues have
been identified which undergo hypermethylation in the context of
large intestine neoplasms, in particular adenomas and benign
neoplastic lesions. These are localised to the LOC100526820 regions
defined by SEQ ID NOs:1 and 2. In one embodiment, therefore, a
screening method can be employed which is specifically directed to
assessing the methylation status of one or more of either these
residues or the corresponding cytosine at position n+1 on the
opposite DNA strand.
[0096] According to this embodiment there is provided a method of
screening for the onset or predisposition to the onset of a large
intestine or breast neoplasm in an individual, said method
comprising assessing the methylation of one or more cytosine
residues selected from:
TABLE-US-00006 Chr6: 163834330 Chr6: 163834332 Chr6: 163834357
Chr6: 163834373 Chr6: 163834384 Chr6: 163834390 Chr6: 163834392
Chr6: 163834406 Chr6: 163834412 Chr6: 163834419 Chr6: 163834443
Chr6: 163834448 Chr6: 163834452 Chr6: 163834464 Chr6: 163834483
Chr6: 163834653 Chr6: 163834660 Chr6: 163834672 Chr6: 163834675
Chr6: 163834678 Chr6: 163834681 Chr6: 163834815 Chr6: 163834824
Chr6: 163834835 Chr6: 163834840 Chr6: 163834853 Chr6: 163834855
Chr6: 163834858 Chr6: 163834863 Chr6: 163834869 Chr6: 163834872
[0097] or a corresponding cytosine at position n+1 on the opposite
DNA strand, in a biological sample from said individual wherein a
higher level of methylation of one or more of said residues
relative to the methylation level of a corresponding residue in a
control sample is indicative of a neoplastic large intestine or
breast cell or a cell predisposed to the onset of a neoplastic
state.
[0098] These chromosome 6 positions are numbered by reference to
the SEQ ID NO:1 and 2 sequences which are depicted in FIG. 3.
[0099] Without limiting the present invention to any one theory or
mode of action, the development of neoplasia involves both genetic
changes (point mutations, deletions, gene amplifications or
arrangements) as well as a range of epigenetic changes, including
DNA methylation and altered histone modifications at specific gene
loci. The most extensively characterised of these changes is the
hypermethylation of gene promoters of CpG islands. As detailed
earlier, such hypermethylation is frequently associated with
silencing of gene expression. In many cases this
methylation-associated gene silencing is understood to play an
important role in the development of the neoplasia, eg. through
silencing of tumour suppressor genes such as p16 or Rb, or of DNA
repair genes, eg. MLH1 or MGMT.
[0100] Genome-wide techniques for analysis of DNA methylation are
increasingly being used to identify changes in DNA methylation in
different cell types or disease conditions including cancer, with
different biochemical and informatic approaches identifying
overlapping sets of DNA methylation changes (Robinson et al.
Epigenomics 2:587-98 (2010)). Bisulfite-tag technology was used in
the context of the present invention to produce separate methylated
and unmethylated fractions of DNA based on their methylation status
at CpG sites within MspI (CCGG) or TaqI (TCGA) restriction enzyme
sites.
[0101] The detection method of the present invention can be
performed on any suitable biological sample. To this end, reference
to a "biological sample" should be understood as a reference to any
sample of biological material derived from an animal such as, but
not limited to, cellular material, biofluids (eg. blood), faeces,
tissue biopsy specimens, surgical specimens or fluid which has been
introduced into the body of an animal and subsequently removed
(such as, for example, the solution retrieved from an enema wash).
The biological sample which is tested according to the method of
the present invention may be tested directly or may require some
form of treatment prior to testing. For example, a biopsy or
surgical sample may require homogenisation prior to testing or it
may require sectioning for in situ testing of the qualitative
expression levels of individual genes. Alternatively, a cell sample
may require permeabilisation prior to testing. Further, to the
extent that the biological sample is not in liquid form, (if such
form is required for testing) it may require the addition of a
reagent, such as a buffer, to mobilise the sample.
[0102] To the extent that the DNA region of interest is present in
a biological sample, the biological sample may be directly tested
or else all or some of the nucleic acid present in the biological
sample may be isolated prior to testing. In yet another example,
the sample may be partially purified or otherwise enriched prior to
analysis. For example, to the extent that a biological sample
comprises a very diverse cell population, it may be desirable to
enrich for a sub-population of particular interest. It is within
the scope of the present invention for the target cell population
or molecules derived therefrom to be treated prior to testing, for
example, inactivation of live virus. It should also be understood
that the biological sample may be freshly harvested or it may have
been stored (for example by freezing) prior to testing or otherwise
treated prior to testing (such as by undergoing culturing).
[0103] The choice of what type of sample is most suitable for
testing in accordance with the method disclosed herein will be
dependent on the nature of the situation. Preferably, said sample
is a faecal (stool) sample, enema wash, surgical resection, tissue
biopsy or blood sample (e.g. whole blood, serum or plasma).
[0104] More preferably, said biological sample is a blood sample,
biopsy sample or stool sample.
[0105] As detailed hereinbefore, the present invention is designed
to screen for a neoplastic cell or cellular population, which is
located in the large intestine or the breast. Accordingly,
reference to "cell or cellular population" should be understood as
a reference to an individual cell or a group of cells. Said group
of cells may be a diffuse population of cells, a cell suspension,
an encapsulated population of cells or a population of cells which
take the form of tissue.
[0106] Reference to the "onset" of a neoplasm, such as adenoma or
adenocarcinoma, should be understood as a reference to one or more
cells of that individual exhibiting dysplasia. In this regard, the
adenoma or adenocarcinoma may be well developed in that a mass of
dysplastic cells has developed. Alternatively, the adenoma or
adenocarcinoma may be at a very early stage in that only relatively
few abnormal cell divisions have occurred at the time of diagnosis.
The present invention also extends to the assessment of an
individual's predisposition to the development of a neoplasm, such
as an adenoma or adenocarcinoma. Without limiting the present
invention in any way, changed methylation levels may be indicative
of that individual's predisposition to developing a neoplasia, such
as the future development of an adenoma or adenocarcinoma or
another adenoma or adenocarcinoma.
[0107] Although the preferred method is to assess methylation
levels for the purpose of diagnosing neoplasia development or
predisposition thereto, the detection of converse changes in the
levels of said methylation may be desired under certain
circumstances, for example, to monitor the effectiveness of
therapeutic or prophylactic treatment directed to modulating a
neoplastic condition, such as adenoma or adenocarcinoma
development. For example, where elevated levels of methylation
indicate that an individual has developed a condition characterised
by adenoma or adenocarcinoma development, screening for a decrease
in the levels of methylation subsequently to the onset of a
therapeutic treatment regime may be utilised to indicate successful
clearance of the neoplastic cells. In another example, one can use
this method to test the tissue at the margins of a tumour resection
in order to determine whether the full margin of the tumour has
been removed.
[0108] The present method can therefore be used in the diagnosis,
prognosis, classification, prediction of disease risk, detection of
recurrence of disease, and selection of treatment of a number of
types of neoplasias. A cancer at any stage of progression can be
detected, such as primary, metastatic, and recurrent cancers.
[0109] The present invention provides methods for determining
whether or not a mammal (e.g., a human) has a neoplasia of the
large intestine or breast, whether or not a biological sample taken
from a mammal contains neoplastic cells or DNA derived from
neoplastic cells, estimating the risk or likelihood of a mammal
developing a neoplasm, monitoring the efficacy of anti-cancer
treatment, or selecting the appropriate anti-cancer treatment in a
mammal with cancer. Such methods are based on the determination
that neoplastic cells have a different methylation status than
normal cells in the DNA regions described herein. Accordingly, by
determining whether or not a cell contains differentially
methylated sequences in the DNA regions as described herein, it is
possible to determine whether or not the cell is neoplastic.
[0110] The method of the invention can be used to evaluate
individuals known or suspected to have a neoplasia or as a routine
clinical test, i.e., in an individual not necessarily suspected to
have a neoplasia. Further diagnostic assays can be performed to
confirm the status of neoplasia in the individual and to confirm
the type of neoplasia. For example, if a blood test result
indicates the presence of a neoplasia, it may be necessary to
conduct further screening to establish whether that neoplasia is
breast or large intestine in origin.
[0111] Further, the present methods may be used to assess the
efficacy of a course of treatment. For example, the efficacy of an
anti-cancer treatment can be assessed by monitoring DNA methylation
of the sequences described herein over time in a mammal having
cancer. For example, a reduction or absence of methylation in any
of the diagnostic sequences of the invention in a biological sample
taken from a mammal following a treatment, compared to a level in a
sample taken from the mammal before, or earlier in, the treatment,
indicates efficacious treatment.
[0112] The method of the present invention is therefore useful as a
one-time test or as an on-going monitor of those individuals
thought to be at risk of neoplasia development or as a monitor of
the effectiveness of therapeutic or prophylactic treatment regimes
directed to inhibiting or otherwise slowing neoplasia development.
In these situations, mapping the modulation of methylation levels
in any one or more classes of biological samples is a valuable
indicator of the status of an individual or the effectiveness of a
therapeutic or prophylactic regime which is currently in use.
Accordingly, the method of the present invention should be
understood to extend to monitoring for increases or decreases in
methylation levels in an individual relative to their normal level
(as hereinbefore defined), or relative to one or more earlier
methylation levels determined from a biological sample of said
individual.
[0113] The methods for detecting neoplasia can comprise the
detection of one or more other cancer-associated polynucleotide or
polypeptides sequences. Accordingly, detection of methylation by
the method of the invention can be used either alone or in
combination with other screening methods for the diagnosis or
prognosis of neoplasia.
[0114] Any method for detecting DNA methylation can be used in the
methods of the present invention. A number of methods are available
for detection of differentially methylated DNA at specific loci in
either primary tissue samples or in patient samples such as blood,
urine, stool or saliva (reviewed in Kristensen and Hansen, Clin
Chem. 55:1471-83, 2009; Ammerpohl et al. Biochim Biophys Acta.
1790:847-62, 2009; Shames et al. Cancer Lett. 251:187-98, 2007;
Clark et al. Nat Protoc. 1:2353-64, 2006). For analysis of the
proportion or extent of DNA methylation in a target gene, DNA is
normally treated with sodium bisulfite and regions of interest
amplified using primers and PCR conditions that will amplify
independently of the methylation status of the DNA. The methylation
of the overall amplicon or individual CpG sites can then be
assessed by sequencing, including pyrosequencing, restriction
enzyme digestion (COBRA) or by melting curve analysis.
Alternatively ligation-based methods for analysis of methylation at
specific CpG sites may be used. Detection of aberrantly methylated
DNA released from tumours and into bodily fluids is being developed
as a means of cancer diagnosis. Here, in the case of
hypermethylated sequences, it is necessary to use sensitive methods
that allow the selective amplification of the methylated DNA
sequence from a background of normal cellular DNA that is
unmethylated. Such methods based on bisulfite-treated DNA include,
for example methylation selective PCR (MSP), Heavymethyl PCR,
Headloop PCR and Helper-dependent chain reaction
(PCT/AU2008/001475).
[0115] Briefly, in some embodiments, methods for detecting
methylation include randomly shearing or randomly fragmenting the
genomic DNA, cutting the DNA with a methylation-dependent or
methylation-sensitive restriction enzyme and subsequently
selectively identifying and/or analyzing the cut or uncut DNA.
Selective identification can include, for example, separating cut
and uncut DNA (e.g., by size) and quantifying a sequence of
interest that was cut or, alternatively, that was not cut. See,
e.g., U.S. Pat. No. 7,186,512. Alternatively, the method can
encompass amplifying intact DNA after restriction enzyme digestion,
thereby only amplifying DNA that was not cleaved by the restriction
enzyme in the area amplified. See, e.g., U.S. patent application
Ser. Nos. 10/971,986; 11/071,013; and 10/971,339. In some
embodiments, amplification can be performed using primers that are
gene specific. Alternatively, adaptors can be added to the ends of
the randomly fragmented DNA, the DNA can be digested with a
methylation-dependent or methylation-sensitive restriction enzyme,
intact DNA can be amplified using primers that hybridize to the
adaptor sequences. In this case, a second step can be performed to
determine the presence, absence or quantity of a particular gene in
an amplified pool of DNA. In some embodiments, the DNA is amplified
using real-time, quantitative PCR.
[0116] In some embodiments, the methods comprise quantifying the
average methylation density in a target sequence within a
population of genomic DNA. In some embodiments, the method
comprises contacting genomic DNA with a methylation-dependent
restriction enzyme or methylation-sensitive restriction enzyme
under conditions that allow for at least some copies of potential
restriction enzyme cleavage sites in the locus to remain uncleaved;
quantifying intact copies of the locus; and comparing the quantity
of amplified product to a control value representing the quantity
of methylation of control DNA, thereby quantifying the average
methylation density in the locus compared to the methylation
density of the control DNA.
[0117] The quantity of methylation of a locus of DNA can be
determined by providing a sample of genomic DNA comprising the
locus, cleaving the DNA with a restriction enzyme that is either
methylation-sensitive or methylation-dependent, and then
quantifying the amount of intact DNA or quantifying the amount of
cut DNA at the DNA locus of interest. The amount of intact or cut
DNA will depend on the initial amount of genomic DNA containing the
locus, the amount of methylation in the locus, and the number
(i.e., the fraction) of nucleotides in the locus that are
methylated in the genomic DNA. The amount of methylation in a DNA
locus can be determined by comparing the quantity of intact DNA or
cut DNA to a control value representing the quantity of intact DNA
or cut DNA in a similarly-treated DNA sample. The control value can
represent a known or predicted number of methylated nucleotides.
Alternatively, the control value can represent the quantity of
intact or cut DNA from the same locus in another (e.g., normal,
non-diseased) cell or a second locus.
[0118] By using at least one methylation-sensitive or
methylation-dependent restriction enzyme under conditions that
allow for at least some copies of potential restriction enzyme
cleavage sites in the locus to remain uncleaved and subsequently
quantifying the remaining intact copies and comparing the quantity
to a control, average methylation density of a locus can be
determined. A methylation-sensitive enzyme is one which cuts DNA if
its recognition sequence is unmethylated while a
methylation-dependent enzyme cuts DNA if its recognition sequence
is methylated. If the methylation-sensitive restriction enzyme is
contacted to copies of a DNA locus under conditions that allow for
at least some copies of potential restriction enzyme cleavage sites
in the locus to remain uncleaved, then the remaining intact DNA
will be directly proportional to the methylation density, and thus
may be compared to a control to determine the relative methylation
density of the locus in the sample. Similarly, if a
methylation-dependent restriction enzyme is contacted to copies of
a DNA locus under conditions that allow for at least some copies of
potential restriction enzyme cleavage sites in the locus to remain
uncleaved, then the remaining intact DNA will be inversely
proportional to the methylation density, and thus may be compared
to a control to determine the relative methylation density of the
locus in the sample. Such assays are disclosed in, e.g., U.S.
patent application Ser. No. 10/971,986.
[0119] Kits for the above methods can include, e.g., one or more of
methylation-dependent restriction enzymes, methylation-sensitive
restriction enzymes, amplification (e.g., PCR) reagents, probes
and/or primers.
[0120] Quantitative amplification methods (e.g., quantitative PCR
or quantitative linear amplification) can be used to quantify the
amount of intact DNA within a locus flanked by amplification
primers following restriction digestion. Methods of quantitative
amplification are disclosed in, e.g., U.S. Pat. Nos. 6,180,349;
6,033,854; and 5,972,602, as well as in, e.g., Gibson et al.,
Genome Research 6:995-1001 (1996); DeGraves, et al., Biotechniques
34(1):106-10, 112-5 (2003); Deiman B, et al., Mol. Biotechnol.
20(2):163-79 (2002). Amplifications may be monitored in "real
time."
[0121] Additional methods for detecting DNA methylation can involve
genomic sequencing before and after treatment of the DNA with
bisulfite. See, e.g., Frommer et al., Proc. Natl. Acad. Sci. USA
89:1827-1831 (1992). When sodium bisulfite is contacted to DNA,
unmethylated cytosine is converted to uracil, while methylated
cytosine is not modified.
[0122] In some embodiments, restriction enzyme digestion of PCR
products amplified from bisulfite-converted DNA is used to detect
DNA methylation. See, e.g., Sadri & Hornsby, Nucl. Acids Res.
24:5058-5059 (1996); Xiong & Laird, Nucleic Acids Res.
25:2532-2534 (1997).
[0123] In some embodiments, a methylation-specific PCR ("MSP")
reaction is used alone or in combination with other methods to
detect DNA methylation. An MSP assay entails initial modification
of DNA by sodium bisulfite, converting all unmethylated, but not
methylated, cytosines to uracil, and subsequent amplification with
primers specific for methylated versus unmethylated DNA. See,
Herman et al., Proc. Natl. Acad. Sci. USA 93:9821-9826, (1996);
U.S. Pat. No. 5,786,146.
[0124] In some embodiments, a MethyLight assay is used alone or in
combination with other methods to detect DNA methylation (see, Eads
et al., Cancer Res. 59:2302-2306 (1999)). Briefly, in the
MethyLight process genomic DNA is converted in a sodium bisulfite
reaction (the bisulfite process converts unmethylated cytosine
residues to uracil). Amplification of a DNA sequence of interest is
then performed using PCR primers that hybridize to CpG
dinucleotides. By using primers that hybridize only to sequences
resulting from bisulfite conversion of methylated DNA, (or
alternatively to unmethylated sequences) amplification can indicate
methylation status of sequences where the primers hybridize.
Furthermore, the amplification product can be detected with a probe
that specifically binds to a sequence resulting from bisulfite
treatment of a methylated (or unmethylated) DNA. If desired, both
primers and probes can be used to detect methylation status. Thus,
kits for use with MethyLight can include sodium bisulfite as well
as primers or detectably-labelled probes (including but not limited
to Taqman or molecular beacon probes) that distinguish between
methylated and unmethylated DNA that have been treated with
bisulfite. Other kit components can include, e.g., reagents
necessary for amplification of DNA including but not limited to,
PCR buffers, deoxynucleotides; and a thermostable polymerase.
[0125] In some embodiments, a Ms-SNuPE (Methylation-sensitive
Single Nucleotide Primer Extension) reaction is used alone or in
combination with other methods to detect DNA methylation (see,
Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531 (1997)). The
Ms-SNuPE technique is a quantitative method for assessing
methylation differences at specific CpG sites based on bisulfite
treatment of DNA, followed by single-nucleotide primer extension
(Gonzalgo & Jones, supra). Briefly, genomic DNA is reacted with
sodium bisulfite to convert unmethylated cytosine to uracil while
leaving 5-methylcytosine unchanged. Amplification of the desired
target sequence is then performed using PCR primers specific for
bisulfite-converted DNA, and the resulting product is isolated and
used as a template for methylation analysis at the CpG site(s) of
interest.
[0126] Typical reagents (e.g., as might be found in a typical
Ms-SNuPE-based kit) for Ms-SNuPE analysis can include, but are not
limited to: PCR primers for specific gene (or methylation-altered
DNA sequence or CpG island); optimized PCR buffers and
deoxynucleotides; gel extraction kit; positive control primers;
Ms-SNuPE primers for a specific gene; reaction buffer (for the
Ms-SNuPE reaction); and detectably-labelled nucleotides.
Additionally, bisulfite conversion reagents may include: DNA
denaturation buffer; sulfonation buffer; DNA recovery regents or
kit (e.g., precipitation, ultrafiltration, affinity column);
desulfonation buffer; and DNA recovery components.
[0127] Additional methylation detection methods include, but are
not limited to, methylated CpG island amplification (see, Toyota et
al., Cancer Res. 59:2307-12 (1999)), those described in, e.g., U.S.
Patent Publication 2005/0069879; Rein, et al. Nucleic Acids Res. 26
(10): 2255-64 (1998); Olek, et al. Nat. Genet. 17(3): 275-6 (1997);
and PCT Publication No. WO 00/70090, Headloop PCT and the
Helper-dependent chain reaction.
[0128] More detailed information in relation to several of these
generally described methods is provided below:
[0129] (a) Probe or Primer Design and/or Production
[0130] Several methods described herein for the diagnosis of a
neoplasia use one or more probes and/or primers. Methods for
designing probes and/or primers for use in, for example, PCR or
hybridization are known in the art and described, for example, in
Dieffenbach and Dveksler (Eds) (In: PCR Primer: A Laboratory
Manual, Cold Spring Harbor Laboratories, NY, 1995). Furthermore,
several software packages are publicly available that design
optimal probes and/or primers for a variety of assays, e.g. Primer
3 available from the Center for Genome Research, Cambridge, Mass.,
USA.
[0131] Clearly, the potential use of the probe or primer should be
considered during its design. For example, should the probe or
primer be produced for use in a methylation specific PCR or ligase
chain reaction (LCR) assay the nucleotide at the 3' end (or 5' end
in the case of LCR) should preferably correspond to a methylated
nucleotide in a nucleic acid.
[0132] Probes and/or primers useful for detection of a sequence
associated with a neoplasia are assessed, for example, to determine
those that do not form hairpins, self-prime or form primer dimers
(e.g. with another probe or primer used in a detection assay).
Furthermore, a probe or primer (or the sequence thereof) is often
assessed to determine the temperature at which it denatures from a
target nucleic acid (i.e. the melting temperature of the probe or
primer, or Tm). Methods for estimating Tm are known in the art and
described, for example, in Santa Lucia, Proc. Natl. Acad. Sci. USA,
95: 1460-1465, 1995 or Breslauer et al., Proc. Natl. Acad. Sci.
USA, 83: 3746-3750, 1986.
[0133] Methods for producing/synthesizing a probe or primer of the
present invention are known in the art. For example,
oligonucleotide synthesis is described, in Gait (Ed) (In:
Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford,
1984). For example, a probe or primer may be obtained by biological
synthesis (e.g. by digestion of a nucleic acid with a restriction
endonuclease) or by chemical synthesis. For short sequences (up to
about 100 nucleotides) chemical synthesis is preferable.
[0134] For longer sequences standard replication methods employed
in molecular biology are useful, such as, for example, the use of
M13 for single stranded DNA as described by Messing, Methods
Enzymol, 101, 20-78, 1983. Other methods for oligonucleotide
synthesis include, for example, phosphotriester and phosphodiester
methods (Narang, et al. Meth. Enzymol 68: 90, 1979) and synthesis
on a support (Beaucage, et al. Tetrahedron Letters 22: 1859-1862,
1981) as well as phosphoramidate technique, Caruthers, M. H., et
al., "Methods in Enzymology," Vol. 154, pp. 287-314 (1988), and
others described in "Synthesis and Applications of DNA and RNA," S.
A. Narang, editor, Academic Press, New York, 1987, and the
references cited therein. Probes comprising locked nucleic acid
(LNA) are synthesized as described, for example, in Nielsen et al.,
J. Chem. Soc. Perkin Trans., 1:3423, 1997; Singh and Wengel, Chem.
Commun. 1247, 1998. While, probes comprising peptide-nucleic acid
(PNA) are synthesized as described, for example, in Egholm et al.,
Am. Chem. Soc., 114: 1895, 1992; Egholm et al., Nature, 365: 566,
1993; and Orum et al., Nucl. Acids Res., 21: 5332, 1993.
[0135] (b) Methylation-Sensitive Endonuclease Digestion of DNA
[0136] In one example, the increased methylation in a sample is
determined using a process comprising treating the nucleic acid
with an amount of a methylation-sensitive restriction endonuclease
enzyme under conditions sufficient for nucleic acid to be digested
and then detecting the fragments produced. Exemplary
methylation-sensitive endonucleases include, for example, HhaI or
HhaII. Preferably, assays include internal controls that are
digested with a methylation-insensitive enzyme having the same
specificity as the methylation-sensitive enzyme employed. For
example, the methylation-insensitive enzyme MspI is an isoschizomer
of the methylation-sensitive enzyme HpaII.
Hybridization Assay Formats
[0137] In one example, the digestion of nucleic acid is detected by
selective hybridization of a probe or primer to the undigested
nucleic acid. Alternatively, the probe selectively hybridizes to
both digested and undigested nucleic acid but facilitates
differentiation between both forms, e.g., by electrophoresis.
Suitable detection methods for achieving selective hybridization to
a hybridization probe include, for example, Southern or other
nucleic acid hybridization (Kawai et al., Mol. Cell. Biol. 14,
7421-7427, 1994; Gonzalgo et al., Cancer Res. 57, 594-599,
1997).
[0138] Suitable hybridization conditions are determined based on
the melting temperature (Tm) of a nucleic acid duplex comprising
the probe. The skilled artisan will be aware that optimum
hybridization reaction conditions should be determined empirically
for each probe, although some generalities can be applied.
Preferably, hybridizations employing short oligonucleotide probes
are performed at low to medium stringency. In the case of a GC rich
probe or primer or a longer probe or primer a high stringency
hybridization and/or wash is preferred. A high stringency is
defined herein as being a hybridization and/or wash carried out in
about 0.1.times.SSC buffer and/or about 0.1% (w/v) SDS, or lower
salt concentration, and/or at a temperature of at least
65.degree.C., or equivalent conditions. Reference herein to a
particular level of stringency encompasses equivalent conditions
using wash/hybridization solutions other than SSC known to those
skilled in the art.
[0139] In accordance with the present example, a difference in the
fragments produced for the test sample and a negative control
sample is indicative of the subject having a neoplasia. Similarly,
in cases where the control sample comprises data from a tumor,
cancer tissue or a cancerous cell or pre-cancerous cell,
similarity, albeit not necessarily absolute identity, between the
test sample and the control sample is indicative of a positive
diagnosis (i.e. cancer).
Amplification Assay Formats
[0140] In an alternative example, the fragments produced by the
restriction enzyme are detected using an amplification system, such
as, for example, polymerase chain reaction (PCR), rolling circle
amplification (RCA), inverse polymerase chain reaction (iPCR), in
situ PCR (Singer-Sam et al., Nucl. Acids Res. 18:687, 1990), strand
displacement amplification (SDA) or cycling probe technology.
[0141] Methods of PCR are known in the art and described, for
example, by McPherson et al., PCR: A Practical Approach. (series
eds, D. Rickwood and B. D. Hames), IRL Press Limited, Oxford. pp
1-253, 1991 and by Dieffenbach (ed) and Dveksler (ed) (In: PCR
Primer: A Laboratory Manual, Cold Spring Harbour Laboratories, NY,
1995), the contents of which are each incorporated in their
entirety by way of reference. Generally, for PCR two
non-complementary nucleic acid primer molecules comprising at least
about 18 nucleotides in length, and more preferably at least 20-30
nucleotides in length are hybridized to different strands of a
nucleic acid template molecule at their respective annealing sites,
and specific nucleic acid molecule copies of the template that
intervene the annealing sites are amplified enzymatically.
Amplification products may be detected, for example, using
electrophoresis and detection with a detectable marker that binds
nucleic acids. Alternatively, one or more of the oligonucleotides
are labelled with a detectable marker (e.g. a fluorophore) and the
amplification product detected using, for example, a lightcycler
(Perkin Elmer, Wellesley, Mass., USA; Roche Applied Science,
Indianapolis, Ind., USA).
[0142] Strand displacement amplification (SDA) utilizes
oligonucleotide primers, a DNA polymerase and a restriction
endonuclease to amplify a target sequence. The oligonucleotides are
hybridized to a target nucleic acid and the polymerase is used to
produce a copy of the region intervening the primer annealing
sites. The duplexes of copied nucleic acid and target nucleic acid
are then nicked with an endonuclease that specifically recognizes a
sequence at the beginning of the copied nucleic acid. The DNA
polymerase recognizes the nicked DNA and produces another copy of
the target region at the same time displacing the previously
generated nucleic acid. The advantage of SDA is that it occurs in
an isothermal format, thereby facilitating high-throughput
automated analysis.
[0143] Cycling Probe Technology uses a chimeric synthetic primer
that comprises DNA-RNA-DNA that is capable of hybridizing to a
target sequence. Upon hybridization to a target sequence the
RNA-DNA duplex formed is a target for RNaseH thereby cleaving the
primer. The cleaved primer is then detected, for example, using
mass spectrometry or electrophoresis.
[0144] For primers that flank or are adjacent to a
methylation-sensitive endonuclease recognition site, it is
preferred that such primers flank only those sites that are
hypermethylated in neoplasia to ensure that a diagnostic
amplification product is produced. In this regard, an amplification
product will only be produced when the restriction site is not
cleaved, i.e., when it is methylated. Accordingly, detection of an
amplification product indicates that the CpG dinucleotide/s of
interest is/are methylated.
[0145] As will be known to the skilled artisan, the precise length
of the amplified product will vary depending upon the distance
between the primers. Clearly this form of analysis may be used to
determine the methylation status of a plurality of CpG
dinucleotides provided that each dinucleotide is within a
methylation sensitive restriction endonuclease site. In these
methods, one or more of the primers may be labelled with a
detectable marker to facilitate rapid detection of amplified
nucleic acid, for example, a fluorescent label (e.g. Cy5 or Cy3) or
a radioisotope (e.g. .sup.32P).
[0146] The amplified nucleic acids are generally analyzed using,
for example, non-denaturing agarose gel electrophoresis,
non-denaturing polyacrylamide gel electrophoresis, mass
spectrometry, liquid chromatography (e.g. HPLC or dHPLC), or
capillary electrophoresis. (e.g. MALDI-TOF). High throughput
detection methods, such as, for example, matrix-assisted laser
desorption/ionization time of flight (MALDI-TOF), electrospray
ionization (ESI), mass spectrometry (including tandem mass
spectrometry, e.g. LC MS/MS), biosensor technology, evanescent
fiber-optics technology or DNA chip technology (e.g., WO98/49557;
WO 96/17958; Fodor et al., Science 767-773, 1991; U.S. Pat. Nos.
5,143,854; and 5,837,832, the contents of which are all
incorporated herein by reference), are especially preferred for all
assay formats described herein. Alternatively, amplification of a
nucleic acid may be continuously monitored using a melting curve
analysis method as described herein and/or in, for example, U.S.
Pat. No. 6,174,670, which is incorporated herein by reference.
[0147] (c) Other Assay Formats
[0148] In an alternative example, the increased methylation in a
sample is determined by performing a process comprising treating
chromatin containing the nucleic acid with an amount of DNaseI
under conditions sufficient for nucleic acid to be digested and
then detecting the fragments produced. This assay format is
predicated on the understanding that chromatin containing
methylated DNA, e.g., hyper methylated DNA, has a more
tightly-closed conformation than non-hyper methylated DNA and, as a
consequence, is less susceptible to endonuclease digestion by DNase
I.
[0149] In accordance with this method, DNA fragments of different
lengths are produced by DNase I digestion of methylated compared to
non-methylated DNA. Such different DNA fragments are detected, for
example, using an assay described earlier. Alternatively, the DNA
fragments are detected using PCR-SSCP essentially as described, for
example, in Gregory and Feil Nucleic Acids Res., 27, e32i-e32iv,
1999. In adapting PCR-SSCP to the present invention, amplification
primers flanking or comprising one or more CpG dinucleotides in a
nucleic acid that are resistant to DNase I digestion in a neoplasia
sample but not resistant to DNase I digestion in a healthy/normal
control or healthy/normal test sample are used to amplify the DNase
I-generated fragments. In this case, the production of a specific
nucleic acid fragment using DNase I is diagnostic of neoplasia,
because the DNA is not efficiently degraded. In contrast, template
DNA from a healthy/normal subject sample is degraded by the action
of DNase I and, as a consequence, amplification fails to produce a
discrete amplification product. Alternative methods to PCR-SSCP,
such as for example, PCR-dHPLC are also known in the art and
contemplated by the present invention.
[0150] (d) Selective Mutagenesis of Non-Methylated DNA
[0151] In an alternative method the increased methylation in a
sample is determined using a process comprising treating the
nucleic acid with an amount of a compound that selectively mutates
a non-methylated cytosine residue within a CpG dinucleotide under
conditions sufficient to induce mutagenesis.
[0152] Preferred compounds mutate cytosine to uracil or thymidine,
such as, for example, a salt of bisulfite, e.g., sodium bisulfite
or potassium bisulfite (Frommer et al., Proc. Natl. Acad. Sci. USA
89, 1827-1831, 1992). Bisulfite treatment of DNA is known to
distinguish methylated from non-methylated cytosine residues, by
mutating cytosine residues that are not protected by methylation,
including cytosine residues that are not within a CpG dinucleotide
or that are positioned within a CpG dinucleotide that is not
subject to methylation.
Sequence Based Detection
[0153] In one example, the presence of one or more mutated
nucleotides or the number of mutated sequences is determined by
sequencing mutated DNA. One form of analysis comprises amplifying
mutated nucleic acid using an amplification reaction described
herein, for example, PCR. The amplified product is then directly
sequenced or cloned and the cloned product sequenced. Methods for
sequencing DNA are known in the art and include for example, the
dideoxy chain termination method or the Maxam-Gilbert method (see
Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd Ed.,
CSHP, New York 1989) or Zyskind et al., Recombinant DNA Laboratory
Manual, (Acad. Press, 1988)).
[0154] As the treatment of nucleic acid with a compound, such as,
for example, bisulfite results in non-methylated cytosines being
mutated to uracil (and hence thymidine after an amplification
process), analysis of the sequence determines the presence or
absence of a methylated nucleotide. For example, by comparing the
sequence obtained using a control sample or a sample that has not
been treated with bisulfite, or the known nucleotide sequence of
the region of interest with a treated sample facilitates the
detection of differences in the nucleotide sequence. Any thymine
residue detected at the site of a cytosine in the treated sample
compared to a control or untreated sample may be considered to be
caused by mutation as a result of bisulfite treatment. Suitable
methods for the detection of methylation using sequencing of
bisulfite treated nucleic acid are described, for example, in
Frommer et al., Proc. Natl. Acad. Sci. USA 89: 1827-1831, 1992 or
Clark et al., Nucl. Acids Res. 22: 2990-2997, 1994.
[0155] In another method, the presence of a mutated or non-mutated
nucleotide in a bisulfite treated sample is detected using
pyrosequencing, such as, for example, as described in Uhlmann et
al., Electrophoresis, 23: 4072-4079, 2002. Essentially this method
is a form of real-time sequencing that uses a primer that
hybridizes to a site adjacent or close to the site of a cytosine
that is methylated. Following hybridization of the primer and
template in the presence of a DNA polymerase each of four modified
deoxynucleotide triphosphates are added separately according to a
predetermined dispensation order. Only an added nucleotide that is
complementary to the bisulfite treated sample is incorporated and
inorganic pyrophosphate (PPi) is liberated. The PPi then drives a
reaction resulting in production of detectable levels of light.
Such a method allows determination of the identity of a specific
nucleotide adjacent to the site of hybridization of the primer.
[0156] Methods of solid phase pyrosequencing are known in the art
and reviewed in, for example, Landegren et al., Genome Res., 8(8):
769-776, 1998. Such methods enable the high-throughput detection of
methylation of a number of CpG dinucleotides.
[0157] A related method for determining the sequence of a bisulfite
treated nucleotide is methylation-sensitive single nucleotide
primer extension (Me-SnuPE) or SNaPmeth. Suitable methods are
described, for example, in Gonzalgo and Jones Nucl. Acids Res.,
25:2529-2531 or Uhlmann et al., Electrophoresis, 23: 4072-4079,
2002. An oligonucleotide is used that hybridizes to the region of a
nucleic acid adjacent to the site of a cytosine that is methylated.
This oligonucleotide is then used in a primer extension protocol
with a polymerase and a free nucleotide diphosphate or
dideoxynucleotide triphosphate that corresponds to either or any of
the possible bases that occur at this site following bisulfite
treatment (i.e., thymine or cytosine). Preferably, the
nucleotide-diphosphate is labelled with a detectable marker (e.g. a
fluorophore). Following primer extension, unbound labelled
nucleotide diphosphates are removed, e.g. using size exclusion
chromatography or electrophoresis, or hydrolyzed, using for
example, alkaline phosphatase, and the incorporation of the
labelled nucleotide to the oligonucleotide is detected, indicating
the base that is present at the site.
[0158] Clearly other high throughput sequencing methods are
encompassed by the present invention. Such methods include, for
example, solid phase minisequencing (as described, for example, in
Southern et al., Genomics, 13: 1008-1017, 1992), or minisequencing
with FRET (as described, for example, in Chen and Kwok, Nucleic
Acids Res. 25: 347-353, 1997).
Restriction Endonuclease-Based Assay Format
[0159] In one method, the presence of a non-mutated sequence is
detected using combined bisulfite restriction analysis (COBRA)
essentially as described in Xiong and Laird, Nucl. Acids Res., 25:
2532-2534, 2001. This method exploits the differences in
restriction enzyme recognition sites between methylated and
unmethylated nucleic acid after treatment with a compound that
selectively mutates a non-methylated cytosine residue, e.g.,
bisulfite.
[0160] Following bisulfite treatment a region of interest
comprising one or more CpG dinucleotides that are methylated and
are included in a restriction endonuclease recognition sequence is
amplified using an amplification reaction described herein, e.g.,
PCR. The amplified product is then contacted with the restriction
enzyme that cleaves at the site of the CpG dinucleotide for a time
and under conditions sufficient for cleavage to occur. A
restriction site may be selected to indicate the presence or
absence of methylation. For example, the restriction endonuclease
TaqI cleaves the sequence TCGA, following bisulfite treatment of a
non-methylated nucleic acid the sequence will be TTGA and, as a
consequence, will not be cleaved. The digested and/or non-digested
nucleic acid is then detected using a detection means known in the
art, such as, for example, electrophoresis and/or mass
spectrometry. The cleavage or non-cleavage of the nucleic acid is
indicative of cancer in a subject. Clearly, this method may be
employed in either a positive read-out or negative read-out system
for the diagnosis of a cancer.
Positive Read-Out Assay Format
[0161] In one embodiment, the assay format of the invention
comprises a positive read-out system in which DNA from a sample
that has been treated, for example, with bisulfite is detected as a
positive signal. Preferably, the non-hypermethylated DNA from a
healthy or normal control subject is not detected or only weakly
detected.
[0162] In a preferred embodiment, the increased methylation in a
subject sample is determined using a process comprising:
[0163] (i) treating the nucleic acid with an amount of a compound
that selectively mutates a non-methylated cytosine residue under
conditions sufficient to induce mutagenesis thereby producing a
mutated nucleic acid;
[0164] (ii) hybridizing a nucleic acid to a probe or primer
comprising a nucleotide sequence that is complementary to a
sequence comprising a methylated cytosine residue under conditions
such that selective hybridization to the non-mutated nucleic acid
occurs; and
[0165] (iii) detecting the selective hybridization.
[0166] In this context, the term "selective hybridization" means
that hybridization of a probe or primer to the non-mutated nucleic
acid occurs at a higher frequency or rate, or has a higher maximum
reaction velocity, than hybridization of the same probe or primer
to the corresponding mutated sequence. Preferably, the probe or
primer does not hybridize to the non-methylated sequence carrying
the mutation(s) under the reaction conditions used.
Hybridization-Based Assay Format
[0167] In one embodiment, the hybridization is detected using
Southern, dot blot, slot blot or other nucleic acid hybridization
means (Kawai et al., Mol. Cell. Biol. 14:7421-7427, 1994; Gonzalgo
et al., Cancer Res. 57, 594-599, 1997). Subject to appropriate
probe selection, such assay formats are generally described herein
above and apply mutatis mutandis to the presently described
selective mutagenesis approach.
[0168] Preferably, a ligase chain reaction format is employed to
distinguish between a mutated and non-mutated nucleic acid. Ligase
chain reaction (described in EP 320,308 and U.S. Pat. No.
4,883,750) uses at least two oligonucleotide probes that anneal to
a target nucleic acid in such a way that they are juxtaposed on the
target nucleic acid. In a ligase chain reaction assay, the target
nucleic acid is hybridized to a first probe that is complementary
to a diagnostic portion of the target sequence (the diagnostic
probe) e.g., a nucleic acid comprising one or more methylated CpG
dinucleotide(s), and with a second probe that is complementary to a
nucleotide sequence contiguous with the diagnostic portion (the
contiguous probe), under conditions wherein the diagnostic probe
remains bound substantially only to the target nucleic acid. The
diagnostic and contiguous probes can be of different lengths and/or
have different melting temperatures such that the stringency of the
hybridization can be adjusted to permit their selective
hybridization to the target, wherein the probe having the higher
melting temperature is hybridized at higher stringency and,
following washing to remove unbound and/or non-selectively bound
probe, the other probe having the lower melting temperature is
hybridized at lower stringency. The diagnostic probe and contiguous
probe are then covalently ligated such as, for example, using T4
DNA ligase, to thereby produce a larger target probe that is
complementary to the target sequence, and the probes that are not
ligated are removed by modifying the hybridization stringency. In
this respect, probes that have not been ligated will selectively
hybridize under lower stringency hybridization conditions than
probes that have been ligated. Accordingly, the stringency of the
hybridization can be increased to a stringency that is at least as
high as the stringency used to hybridize the longer probe, and
preferably at a higher stringency due to the increased length
contributed by the shorter probe following ligation.
[0169] In another example, one or both of the probes is labelled
such that the presence or absence of the target sequence can be
tested by melting the target-probe duplex, eluting the dissociated
probe, and testing for the label(s). Where both probes are
labelled, different ligands are used to permit distinction between
the ligated and unligated probes, in which case the presence of
both labels in the same eluate fraction confirms the ligation
event. If the target nucleic acid is bound to a solid matrix e.g.,
in a Southern hybridization, slot blot, dot blot, or microchip
assay format, the presence of both the diagnostic and contiguous
probes can be determined directly.
[0170] Methylation specific microarrays (MSO) are also useful for
differentiating between a mutated and non-mutated sequence. A
suitable method is described, for example, in Adorjan et al, Nucl.
Acids Res., 30: e21, 2002. MSO uses nucleic acid that has been
treated with a compound that selectively mutates a non-methylated
cytosine residue (e.g., bisulfite) as template for an amplification
reaction that amplifies both mutant and non-mutated nucleic acid.
The amplification is performed with at least one primer that
comprises a detectable label, such as, for example, a fluorophore,
e.g., Cy3 or Cy5.
[0171] To produce a microarray for detection of mutated nucleic
acid oligonucleotides are spotted onto, for example, a glass slide,
preferably, with a degree of redundancy (for example, as described
in Golub et al., Science, 286:531-537, 1999). Preferably, for each
CpG dinucleotide analyzed two different oligonucleotides are used.
Each oligonucleotide comprises a sequence N.sub.2-16CGN.sub.2-16 or
N.sub.2-16TGN.sub.2-16 (wherein N is a number of nucleotides
adjacent or juxtaposed to the CpG dinucleotide of interest)
reflecting the methylated or non-methylated status of the CpG
dinucleotides.
[0172] The labelled amplification products are then hybridized to
the oligonucleotides on the microarray under conditions that enable
detection of single nucleotide differences. Following washing to
remove unbound amplification product, hybridization is detected
using, for example, a microarray scanner. Not only does this method
allow for determination of the methylation status of a large number
of CpG dinucleotides, it is also semi-quantitative, enabling
determination of the degree of methylation at each CpG dinucleotide
analyzed. As there may be some degree of heterogeneity of
methylation in a single sample, such quantification may assist in
the diagnosis of cancer.
Amplification Based Assay Format
[0173] In an alternative example, the hybridization is detected
using an amplification system. In methylation-specific PCR formats
(MSP; Herman et al. Proc. Natl. Acad. Sci. USA 93: 9821-9826,
1992), the hybridization is detected using a process comprising
amplifying the bisulfite-treated DNA. Accordingly, by using one or
more probe or primer that anneals specifically to the unmutated
sequence under moderate and/or high stringency conditions an
amplification product is only produced using a sample comprising a
methylated nucleotide. Alternate assays that provide for selective
amplification of either the methylated or the unmethylated
component from a mixture of bisulfite-treated DNA are provided by
Cottrell et al., Nucl. Acids Res. 32: e10, 2004 (HeavyMethyl PCR),
Rand et al. Nucl. Acids Res. 33:e127, 2005 (Headloop PCR), Rand et
al., Epigenetics 1:94-100, 2006 (Bisulfite Differential
Denaturation PCR) and PCT/AU07/000389 (End-specific PCR).
[0174] Any amplification assay format described herein can be used,
such as, for example, polymerase chain reaction (PCR), rolling
circle amplification (RCA), inverse polymerase chain reaction
(iPCR), in situ PCR (Singer-Sam et al., Nucl. Acids Res. 18:687,
1990), strand displacement amplification, or cycling probe
technology. PCR techniques have been developed for detection of
gene mutations (Kuppuswamy et al., Proc. Natl. Acad. Sci. USA
88:1143-1147, 1991) and quantitation of allelic-specific expression
(Szabo and Mann, Genes Dev. 9:3097-3108, 1995; and Singer-Sam et
al., PCR Methods Appl. 1: 160-163, 1992). Such techniques use
internal primers, which anneal to a PCR-generated template and
terminate immediately 5' of the single nucleotide to be assayed.
Such as format is readily combined with ligase chain reaction as
described herein above. The use of a real-time quantitative assay
format is also useful. Subject to the selection of appropriate
primers, such assay formats are generally described herein above
and apply mutatis mutandis to the presently described selective
mutagenesis approach.
[0175] Methylation-specific melting-curve analysis (essentially as
described in Worm et al., Clin. Chem., 47: 1183-1189, 2001) is also
contemplated by the present invention. This process exploits the
difference in melting temperature in amplification products
produced using bisulfite treated methylated or unmethylated nucleic
acid. In essence, non-discriminatory amplification of a bisulfite
treated sample is performed in the presence of a fluorescent dye
that specifically binds to double stranded DNA (e.g., SYBR Green
I). By increasing the temperature of the amplification product
while monitoring fluorescence the melting properties and thus the
sequence of the amplification product is determined. A decrease in
the fluorescence reflects melting of at least a domain in the
amplification product. The temperature at which the fluorescence
decreases is indicative of the nucleotide sequence of the amplified
nucleic acid, thereby permitting the nucleotide at the site of one
or more CpG dinucleotides to be determined. As the sequence of the
nucleic acids amplified using the present invention.
[0176] The present invention also encompasses the use of real-time
quantitative forms of PCR, such as, for example, TaqMan (Holland et
al., Proc. Natl. Acad. Sci. USA, 88, 7276-7280, 1991; Lee et al.,
Nucleic Acid Res. 21, 3761-3766, 1993) to perform this embodiment.
For example, the MethylLight method of Eads et al., Nucl. Acids
Res. 28: E32, 2000 uses a modified TaqMan assay to detect
methylation of a CpG dinucleotide. Essentially, this method
comprises treating a nucleic acid sample with bisulfite and
amplifying nucleic acid comprising one or more CpG dinucleotides
that are methylated in a neoplastic cell and not in a control
sample using an amplification reaction, e.g., PCR. The
amplification reaction is performed in the presence of three
oligonucleotides, a forward and reverse primer that flank the
region of interest and a probe that hybridizes between the two
primers to the site of the one or more methylated CpG
dinucleotides. The probe is dual labelled with a 5' fluorescent
reporter and a 3' quencher (or vice versa). When the probe is
intact, the quencher dye absorbs the fluorescence of the reporter
due to their proximity. Following annealing of to the PCR product
the probe is cleaved by 5' to 3' exonuclease activity of, for
example, Taq DNA polymerase. This cleavage releases the reporter
from the quencher thereby resulting in an increased fluorescence
signal that can be used to estimate the initial template
methylation level. By using a probe or primer that selectively
hybridizes to unmutated nucleic acid (i.e. methylated nucleic acid)
the level of methylation is determined, e.g., using a standard
curve.
[0177] Alternatively, rather than using a labelled probe that
requires cleavage, a probe, such as, for example, a Molecular
Beacon..TM.. is used (see, for example, Mhlanga and Malmberg,
Methods 25:463-471, 2001). Molecular beacons are single stranded
nucleic acid molecules with a stem-and-loop structure. The loop
structure is complementary to the region surrounding the one or
more CpG dinucleotides that are methylated in a neoplastic sample
and not in a control sample. The stem structure is formed by
annealing two "arms" complementary to each other, which are on
either side of the probe (loop). A fluorescent moiety is bound to
one arm and a quenching moiety that suppresses any detectable
fluorescence when the molecular beacon is not bound to a target
sequence is bound to the other arm. Upon binding of the loop region
to its target nucleic acid the arms are separated and fluorescence
is detectable. However, even a single base mismatch significantly
alters the level of fluorescence detected in a sample. Accordingly,
the presence or absence of a particular base is determined by the
level of fluorescence detected. Such an assay facilitates detection
of one or more unmutated sites (i.e. methylated nucleotides) in a
nucleic acid.
[0178] Fluorescently labelled locked nucleic acid (LNA) molecules
or fluorescently labelled protein-nucleic acid (PNA) molecules are
useful for the detection of nucleotide differences (e.g., as
described in Simeonov and Nikiforov, Nucleic Acids Research,
30(17): 1-5, 2002). LNA and PNA molecules bind, with high affinity,
to nucleic acid, in particular, DNA. Fluorophores (in particular,
rhodomine or hexachlorofluorescein) conjugated to the LNA or PNA
probe fluoresce at a significantly greater level upon hybridization
of the probe to target nucleic acid. However, the level of increase
of fluorescence is not enhanced to the same level when even a
single nucleotide mismatch occurs. Accordingly, the degree of
fluorescence detected in a sample is indicative of the presence of
a mismatch between the LNA or PNA probe and the target nucleic
acid, such as, in the presence of a mutated cytosine in a
methylated CpG dinucleotide. Preferably, fluorescently labelled LNA
or PNA technology is used to detect at least a single base change
in a nucleic acid that has been previously amplified using, for
example, an amplification method known in the art and/or described
herein.
[0179] As will be apparent to the skilled artisan, LNA or PNA
detection technology is amenable to a high-throughput detection of
one or more markers by immobilizing an LNA or PNA probe to a solid
support, as described in Orum et al., Clin. Chem. 45: 1898-1905,
1999.
[0180] Alternatively, a real-time assay, such as, for example, the
so-called HeavyMethyl assay (Cottrell et al., Nucl. Acids Res. 32:
e10, 2004) is used to determine the presence or level of
methylation of nucleic acid in a test sample. Essentially, this
method uses one or more non-extendible nucleic acid (e.g.,
oligonucleotide) blockers that bind to bisulfite-treated nucleic
acid in a methylation specific manner (i.e., the blocker/s bind
specifically to unmutated DNA under moderate to high stringency
conditions). An amplification reaction is performed using one or
more primers that may optionally be methylation specific but that
flank the one or more blockers. In the presence of unmethylated
nucleic acid (i.e., non-mutated DNA) the blocker/s bind and no PCR
product is produced. Using a TaqMan assay essentially as described
supra the level of methylation of nucleic acid in a sample is
determined.
[0181] Other amplification based methods for detecting methylated
nucleic acid following treatment with a compound that selectively
mutates a non-methylated cytosine residue include, for example,
methylation-specific single stranded conformation analysis
(MS-SSCA) (Bianco et al., Hum. Mutat., 14: 289-293, 1999),
methylation-specific denaturing gradient gel electrophoresis
(MS-DGGE) (Abrams and Stanton, Methods Enzymol., 212: 71-74, 1992)
and methylation-specific denaturing high-performance liquid
chromatography (MS-DHPLC) (Deng et al, Chin. J. Cancer Res., 12:
171-191, 2000). Each of these methods use different techniques for
detecting nucleic acid differences in an amplification product
based on differences in nucleotide sequence and/or secondary
structure. Such methods are clearly contemplated by the present
invention.
[0182] As with other amplification-based assay formats, the
amplification product is analyzed using a range of procedures,
including gel electrophoresis, gel filtration, mass spectrometry,
and in the case of labelled primers, by identifying the label in
the amplification product. In an alternative embodiment,
restriction enzyme digestion of PCR products amplified from
bisulfite-converted DNA is performed essentially as described by
Sadri and Hornsby, Nucl. Acids Res. 24:5058-5059, 1996; and Xiong
and Laird, Nucl. Acids Res. 25, 2532-2534, 1997), to analyze the
product formed.
[0183] High throughput detection methods, such as, for example,
matrix-assisted laser desorption/ionization time of flight
(MALDI-TOF), electrospray ionization (ESI), Mass spectrometry
(including tandem mass spectrometry, e.g. LC MS/MS), biosensor
technology, evanescent fiber-optics technology or DNA chip
technology, can also be employed.
[0184] As with the other assay formats described herein that
utilize hybridization and/or amplification detection systems,
combinations of such processes as described herein above are
particularly contemplated the selective mutagenesis-based assay. In
one example, the increased methylation is detected by performing a
process comprising: [0185] (i) treating the nucleic acid with an
amount of a compound that selectively mutates a non-methylated
cytosine residue under conditions sufficient to induce mutagenesis
thereby producing a mutated nucleic acid; [0186] (ii) hybridizing
the nucleic acid to two non-overlapping and non-complementary
primers each of which comprises a nucleotide sequence that is
complementary to a sequence in the DNA comprising a methylated
cytosine residue under conditions such that hybridization to the
non-mutated nucleic acid occurs; [0187] (iii) amplifying nucleic
acid intervening the hybridized primers thereby producing a DNA
fragment consisting of a sequence that comprises a primer sequence;
[0188] (iv) hybridizing the amplified DNA fragment to a probe
comprising a nucleotide sequence that corresponds or is
complementary to a sequence comprising a methylated cytosine
residue under conditions such that hybridization to the non-mutated
nucleic acid occurs; and [0189] (v) detecting the
hybridization.
Negative Read-Out Assays
[0190] In another example, the assay format comprises a negative
read-out system in which reduced methylation of DNA from a
healthy/normal control sample is detected as a positive signal and
preferably, methylated DNA from a neoplastic sample is not detected
or is only weakly detected.
[0191] In a preferred embodiment, the reduced methylation is
determined using a process comprising:
[0192] (i) treating the nucleic acid with an amount of a compound
that selectively mutates a non-methylated cytosine residue under
conditions sufficient to induce mutagenesis thereby producing a
mutated nucleic acid;
[0193] (ii) hybridizing the nucleic acid to a probe or primer
comprising a nucleotide sequence that is complementary to a
sequence comprising the mutated cytosine residue under conditions
such that selective hybridization to the mutated nucleic acid
occurs; and
[0194] (iii) detecting the selective hybridization.
[0195] In one embodiment of these examples, said cytosine residue
is within a CpG dinucleotide or within a CpG island.
[0196] In this context, the term "selective hybridization" means
that hybridization of a probe or primer to the mutated nucleic acid
occurs at a higher frequency or rate, or has a higher maximum
reaction velocity, than hybridization of the same probe or primer
to the corresponding non-mutated sequence. Preferably, the probe or
primer does not hybridize to the methylated sequence (or
non-mutated sequence) under the reaction conditions used.
Hybridization-Based Assay Format
[0197] In one embodiment the hybridization is detected using
Southern, dot blot, slot blot or other nucleic acid hybridization
means (Kawai et al., Mol. Cell. Biol. 14, 7421-7427, 1994; Gonzalgo
et al., Cancer Res. 57, 594-599, 1997). Subject to appropriate
probe selection, such assay formats are generally described herein
above and apply mutatis mutandis to the presently described
selective mutagenesis approach. Preferably, a ligase chain reaction
format is employed to distinguish between a non-mutated and mutated
nucleic acid. In this respect, the assay requirements and
conditions are as described herein above for positive read-out
assays and apply mutatis mutandis to the present format. However
the selection of probes will differ. For negative read-out assays,
one or more probes are selected that selectively hybridize to the
mutated sequence rather than the non-mutated sequence.
[0198] Preferably, the ligase chain reaction probe(s) have
3'-terminal and/or 5'-terminal sequences that comprise a CpG
dinucleotide that is not methylated in a healthy control sample,
but is hypermethylated in cancer, such that the diagnostic probe
and contiguous probe are capable of being ligated only when the
cytosine of the CpG dinucleotide is mutated to thymidine e.g., in
the case of a non-methylated cytosine residue.
[0199] As will be apparent to the skilled artisan the MSO method
described supra is amenable to either or both positive and/or
negative readout assays. This is because the assay described
detects both mutated and non-mutated sequences thereby facilitating
determining the level of methylation. However, an assay detecting
only methylated or non-methylated sequences is contemplated by the
invention.
Amplification Based Assay Format
[0200] In an alternative example, the hybridization is detected
using an amplification system using any amplification assay format
as described herein above for positive read-out assay albeit using
primers (and probes where applicable) selectively hybridize to a
mutated nucleic acid.
[0201] In adapting the HeavyMethyl assay described supra to a
negative read-out format, the blockers that bind to
bisulfite-treated nucleic acid in a methylation specific manner
bind specifically to mutated DNA under moderate to high stringency
conditions. An amplification reaction is performed using one or
more primers that may optionally be methylation specific (i.e. only
bind to mutated nucleic acid) but that flank the one or more
blockers. In the presence of methylated nucleic acid (i.e., mutated
DNA) the blocker/s bind and no PCR product is produced.
[0202] In one example, the reduced methylation in the
normal/healthy control subject is detected by performing a process
comprising: [0203] (i) treating the nucleic acid with an amount of
a compound that selectively mutates non-methylated cytosine
residues under conditions sufficient to induce mutagenesis thereby
producing a mutated nucleic acid; [0204] (ii) hybridizing the
nucleic acid to two non-overlapping and non-complementary primers
each of which comprises a nucleotide sequence that is complementary
to a sequence in the DNA comprising a mutated cytosine residue
under conditions such that hybridization to the mutated nucleic
acid occurs; [0205] (iii) amplifying nucleic acid intervening the
hybridized primers thereby producing a DNA fragment consisting of a
sequence that comprises a primer sequence; [0206] (iv) hybridizing
the amplified DNA fragment to a probe comprising a nucleotide
sequence that corresponds or is complementary to a sequence
comprising a mutated cytosine residue under conditions such that
hybridization to the mutated nucleic acid occurs; and [0207] (v)
detecting the hybridization.
[0208] As will be apparent to the skilled artisan a negative
read-out assay preferably includes a suitable control sample to
ensure that the negative result is caused by methylated nucleic
acid rather than a reaction failing.
[0209] In one particular embodiment, the increased methylation in a
DNA region of the present invention is determined using a process
comprising: [0210] (i) treating the DNA derived from a biological
sample with a compound that selectively mutates a non-methylated
cytosine residue under conditions sufficient to induce mutagenesis;
[0211] (ii) amplifying the DNA of step (i) using primers designed
to amplify a DNA region defined by one of SEQ ID NOs:1, 2, 3 or 4;
[0212] (iii) sequencing the amplification product of step (ii) to
identify the presence in the DNA from said test sample of one or
more cytosine residues which have not undergone mutation relative
to the corresponding mutated residues in DNA from a control
sample.
[0213] In another embodiment, said mutagenesis is induced with
sodium bisulfite or equivalent agent and unmethylated cytosine
residues are converted to uracil. These uracil residues are
converted to thymine during the amplification step.
[0214] In accordance with the detection methods hereinbefore
described, in one embodiment, where the DNA region which is
analysed is the SEQ ID NO:1 region or substantially similar region,
the sequence of the corresponding region isolated from a
non-neoplastic control which has undergone a sodium bisulfite
mutagenesis step would substantially correspond to SEQ ID NO:5
while the sequence of the corresponding region isolated from a
subject exhibiting the onset or predisposition to the onset of a
large intestine or breast neoplasm would substantially correspond
to SEQ ID NO:6.
[0215] In accordance with this particular embodiment, the primers
which are utilised correspond or are substantially similar to SEQ
ID NOs:18 and 19.
[0216] In yet another embodiment, where the DNA region which is
analysed is the SEQ ID NO:2 region or substantially similar region,
the sequence of the corresponding region isolated from a
non-neoplastic control which has undergone a sodium bisulfite
mutagenesis step would substantially correspond to SEQ ID NO:7
while the sequence of the corresponding region isolated from a
subject exhibiting the onset or predisposition to the onset of a
large intestine or breast neoplasm would substantially correspond
to SEQ ID NO:8.
[0217] In accordance with this particular embodiment, the primers
which are utilised correspond or are substantially similar to SEQ
ID NOs:20 and 21.
[0218] In still another embodiment, where the DNA region which is
analysed is the SEQ ID NO:3 region or substantially similar region,
the sequence of the corresponding region isolated from a
non-neoplastic control which has undergone a sodium bisulfite
mutagenesis step would substantially correspond to SEQ ID NO:9
while the sequence of the corresponding region isolated from a
subject exhibiting the onset or predisposition to the onset of a
large intestine or breast neoplasm would substantially correspond
to SEQ ID NO:10.
[0219] In accordance with this particular embodiment, the primers
which are utilised correspond or are substantially similar to SEQ
ID Nos:13 and 14. It should be appreciated by the person of skill
in the art that where the primers are methylation specific primers,
they will efficiently amplify the SEQ ID NO:10 molecule, which is
not mutated, but will amplify very inefficiently the SEQ ID NO:9
molecule, which will have undergone mutation of the unmethylated
cytosines. The same issue is relevant to SEQ ID NOs:11 and 12,
respectively, discussed below.
[0220] In yet still another embodiment, where the DNA region which
is analysed is the SEQ ID NO:4 region or substantially similar
region, the sequence of the corresponding region isolated from a
non-neoplastic control which has undergone a sodium bisulfite
mutagenesis step would substantially correspond to SEQ ID NO:11
while the sequence of the corresponding region isolated from a
subject exhibiting the onset or predisposition to the onset of a
large intestine neoplasm would substantially correspond to SEQ ID
NO:12.
[0221] In accordance with this particular embodiment, the primers
which are utilised correspond to SEQ ID NOs:13, 14 and 15.
[0222] As detailed hereinbefore, it would be appreciated by the
person of skill in the art that variation between patient samples
may occur in terms of the number of cytosine residues which are
methylated. Accordingly, in the context of the embodiments
hereinbefore recited, it should be understood that the sequences
which are obtained subsequently to amplification may vary slightly
from the sequences provided herein due to either
allelic/polymorphic variations or differences in the actual number
of cytosine residues which have undergone hypermethylation.
Accordingly, these embodiments should be understood to extend to
sequences exhibiting such variations. It is well within the skill
of the person in the art to assess a DNA sequence to determine
whether it is a naturally occurring variation of the DNA regions of
the present invention.
[0223] This invention also provides kits for the detection and/or
quantification of the diagnostic sequences of the invention, or
expression or methylation thereof using the methods described
herein.
[0224] For kits for detection of methylation, the kits of the
invention can comprise at least one polynucleotide that hybridizes
to at least one of the diagnostic sequences of the invention and at
least one reagent for detection of gene methylation. Reagents for
detection of methylation include, e.g., sodium bisulfite,
polynucleotides designed to hybridize to sequence that is the
product of a biomarker sequence of the invention if the biomarker
sequence is not methylated (e.g., containing at least one CU
conversion), and/or a methylation-sensitive or
methylation-dependent restriction enzyme. The kits may also include
control natural or synthetic DNA sequences representing methylated
or unmethylated forms of the sequence, such as those which are
disclosed above in SEQ ID NOs:5-12. The kits can provide solid
supports in the form of an assay apparatus that is adapted to use
in the assay. The kits may further comprise detectable labels,
optionally linked to a polynucleotide, e.g., a probe, in the kit.
Other materials useful in the performance of the assays can also be
included in the kits, including test tubes, transfer pipettes, and
the like. The kits can also include written instructions for the
use of one or more of these reagents in any of the assays described
herein.
[0225] As detailed hereinbefore, hypermethylation is associated
with transcriptional silencing. Accordingly, in addition to the
increased level of methylation of these genes providing a basis
upon which to screen for the predisposition to or onset of a large
intestine or breast neoplasm, the downregulation in the level of
expression of these genes is also diagnostically valuable. In
accordance with this aspect of the present invention, reference to
a gene "expression product" or "expression of a gene" is a
reference to either a transcription product (such as primary RNA or
mRNA) or a translation product such as protein. In this regard, one
can assess changes to the level of expression of a gene either by
screening for changes to the level of expression product which is
produced (i.e. RNA or protein), changes to the chromatin proteins
with which the gene is associated, for example the presence of
histone H3 methylated on lysine at amino acid position number 9 or
27 (repressive modifications) or changes to the DNA itself which
acts to downregulate expression, such as changes to the methylation
of the DNA.
[0226] Accordingly, another aspect of the present invention is
directed to a method of screening for the onset or predisposition
to the onset of a large intestine or breast neoplasm in an
individual, said method comprising assessing the level of
expression of the DNA region defined by Hg19 coordinates
Chr6:163834295-163834500 in a biological sample from said
individual wherein a lower level of expression of said DNA region
relative to control levels is indicative of a neoplastic large
intestine or breast cell or a cell predisposed to the onset of a
neoplastic state.
[0227] The method of this aspect of the present invention is
predicated on the comparison of the level of this neoplastic marker
with the control levels of this marker. The "control level" may be
either a "normal level", which is the level of marker expressed by
a corresponding large intestine cell or cellular population which
is not neoplastic.
[0228] As detailed hereinbefore, the normal (or "non-neoplastic")
level may be determined using tissues derived from the same
individual who is the subject of testing. However, it would be
appreciated that this may be quite invasive for the individual
concerned and it is therefore likely to be more convenient to
analyse the test results relative to a standard result which
reflects individual or collective results obtained from individuals
other than the patient in issue.
[0229] Preferably, said control level is a non-neoplastic
level.
[0230] As detailed hereinbefore, the present invention is designed
to screen for a neoplastic cell or cellular population, which is
located in the large intestine or breast. Accordingly, reference to
"cell or cellular population" should be understood as a reference
to an individual cell or a group of cells. Said group of cells may
be a diffuse population of cells, a cell suspension, an
encapsulated population of cells or a population of cells which
take the form of tissue.
[0231] Reference to "expression" should be understood as a
reference to the transcription and/or translation of a nucleic acid
molecule. Reference to "RNA" should be understood to encompass
reference to any form of RNA, such as primary RNA or mRNA or
non-translated RNA (e.g. miRNAs etc.). Without limiting the present
invention in any way, the modulation of gene transcription leading
to increased or decreased RNA synthesis may also correlate with the
translation of this RNA transcript (such as mRNA) to produce a
protein product. Accordingly, the present invention also extends to
detection methodology which is directed to screening for modulated
levels or patterns of the marker protein product as an indicator of
the neoplastic state of a cell or cellular population. Although one
method is to screen for mRNA transcripts and/or the corresponding
protein product, it should be understood that the present invention
is not limited in this regard and extends to screening for any
other form of expression product such as, for example, a primary
RNA transcript.
[0232] In terms of screening for the downregulation of expression
of a DNA region it would also be well known to the person of skill
in the art that changes which are detectable at the DNA level are
indicative of changes to gene expression activity and therefore
changes to expression product levels. Such changes include but are
not limited to, changes to DNA methylation. Accordingly, reference
herein to "screening the level of expression" and comparison of
these "levels of expression" to control "levels of expression"
should be understood as a reference to assessing DNA factors which
are related to transcription, such as gene/DNA methylation
patterns. These have, in part, been described in detail
hereinbefore.
[0233] It would also be known to a person skilled in the art that
changes in the structure of chromatin are indicative of changes in
gene expression. Silencing of gene expression is often associated
with modification of chromatin proteins, methylation of lysines at
either or both positions 9 and 27 of histone H3 being well studied
examples, while active chromatin is marked by acetylation of lysine
9 of histone H3. Thus association of gene sequences with chromatin
carrying repressive or active modifications can be used to make an
assessment of the expression level of a gene.
[0234] Reference to "nucleic acid molecule" should be understood as
a reference to both deoxyribonucleic acid molecules and ribonucleic
acid molecules and fragments thereof. The present invention
therefore extends to both directly screening for mRNA levels in a
biological sample or screening for the complementary cDNA which has
been reverse-transcribed from an mRNA population of interest. It is
well within the skill of the person of skill in the art to design
methodology directed to screening for either DNA or RNA. As
detailed above, the method of the present invention also extends to
screening for the protein product translated from the subject mRNA
or the genomic DNA itself.
[0235] Although the preferred method is to detect the expression
product or DNA changes of the neoplastic marker for the purpose of
diagnosing neoplasia development or predisposition thereto, the
detection of converse changes in the levels of said marker may be
desired under certain circumstances, for example, to monitor the
effectiveness of therapeutic or prophylactic treatment directed to
modulating a neoplastic condition, such as adenoma or
adenocarcinoma development. For example, where reduced expression
of the subject marker indicates that an individual has developed a
condition characterised by adenoma or adenocarcinoma development,
for example, screening for an increase in the levels of this marker
subsequently to the onset of a therapeutic regime may be utilised
to indicate reversal or other form of improvement of the subject
individual's condition. The method of the present invention is
therefore useful as a one off test or as an on-going monitor of
those individuals thought to be at risk of neoplasia development or
as a monitor of the effectiveness of therapeutic or prophylactic
treatment regimes directed to inhibiting or otherwise slowing
neoplasia development.
[0236] Means of assessing the subject expressed neoplasm marker in
a biological sample can be achieved by any suitable method, which
would be well known to the person of skill in the art. To this end,
it would be appreciated that to the extent that one is examining
either a homogeneous cellular population (such as a tumour biopsy
or a cellular population which has been enriched from a
heterogeneous starting population) or a tissue section, one may
utilise a wide range of techniques such as in situ hybridisation,
assessment of expression profiles by microassays, immunoassays and
the like (hereinafter described in more detail) to detect the
absence of or downregulation of the level of expression of the
marker of interest. However, to the extent that one is screening a
heterogenous cellular population or a bodily fluid in which
heterogeneous populations of cells are found, such as a blood
sample, the absence of or reduction in level of expression of the
marker may be undetectable due to the inherent expression of the
marker by non-neoplastic cells which are present in the sample.
That is, a decrease in the level of expression of a subgroup of
cells may not be detectable. In this situation, a more appropriate
mechanism of detecting a reduction in a neoplastic subpopulation of
the expression level of the marker of the present invention is via
indirect means, such as the detection of epigenetic changes.
[0237] Methods of detecting changes to gene expression levels (in
addition to the methylation analyses hereinbefore described in
detail), particularly where the subject biological sample is not
contaminated with high numbers of non-neoplastic cells, include but
are not limited to: [0238] (i) In vivo detection. Molecular Imaging
may be used following administration of imaging probes or reagents
capable of disclosing altered expression of the markers in the
intestinal tissues. Molecular imaging (Moore et al., BBA,
1402:239-249, 1988; Weissleder et al., Nature Medicine 6:351-355,
2000) is the in vivo imaging of molecular expression that
correlates with the macro-features currently visualized using
"classical" diagnostic imaging techniques such as X-Ray, computed
tomography (CT), MRI, Positron Emission Tomography (PET) or
endoscopy. [0239] (ii) Detection of downregulation of RNA
expression in the cells by Fluorescent In Situ Hybridization
(FISH), or in extracts from the cells by technologies such as
Quantitative Reverse Transcriptase Polymerase Chain Reaction
(QRTPCR) or Flow cytometric qualification of competitive RT-PCR
products (Wedemeyer et al., Clinical Chemistry 48:9 1398-1405,
2002). [0240] (iii) Assessment of expression profiles of RNA, for
example by array technologies (Alon et al., Proc. Natl. Acad. Sci.
USA: 96, 6745-6750, June 1999). [0241] (iv) Measurement of altered
protein levels in cell extracts, for example by immunoassay.
Testing for proteinaceous neoplastic marker expression product in a
biological sample can be performed by any one of a number of
suitable methods which are well known to those skilled in the art.
Examples of suitable methods include, but are not limited to,
antibody screening of tissue sections, biopsy specimens or bodily
fluid samples. To the extent that antibody based methods of
diagnosis are used, the presence of the marker protein may be
determined in a number of ways such as by Western blotting, ELISA
or flow cytometry procedures. These, of course, include both
single-site and two-site or "sandwich" assays of the
non-competitive types, as well as in the traditional competitive
binding assays. These assays also include direct binding of a
labelled antibody to a target. [0242] (v) Determining altered
expression of a protein neoplastic marker on the cell surface, for
example by immunohistochemistry. [0243] (vi) Determining altered
protein expression based on any suitable functional test, enzymatic
test or immunological test in addition to those detailed in points
(iv) and (v) above.
[0244] A person of ordinary skill in the art could determine, as a
matter of routine procedure, the appropriateness of applying a
given method to a particular type of biological sample.
[0245] Yet another aspect of the present invention is directed to
an isolated nucleic acid molecule selected from the list consisting
of: [0246] (i) An isolated nucleic acid molecule or molecule
complementary thereto or, fragment or derivative thereof comprising
one or more of the nucleotide sequences, as set forth in any one of
SEQ ID NO:5-12, or a nucleotide sequence having at least about 86%,
87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%
or more identity over the length of the sequence, or a nucleotide
sequence capable of hybridising to said nucleic acid molecule or
complementary form thereof under low stringency conditions; or
[0247] (ii) An isolated nucleic acid molecule or derivative or
fragment thereof comprising one or more of the nucleotide sequences
substantially as set forth in any one of SEQ ID NO:5-12 or a
fragment of said molecule.
[0248] As detailed hereinbefore, SEQ ID NOs:5-12 represent the
sequence of the DNA molecules which are expected to be obtained
following bisulfite treatment and amplification of the DNA regions
defined by SEQ ID NOs:1-4. Specifically, bisulfite treatment of DNA
from large intestine neoplasias would be unlikely to result in
cytosine to uracil mutagenesis events since only unmethylated
cytosine residues undergo mutation. Several of the specific
cytosine residues which undergo hypermethylation in a large
intestine neoplasia have been identified in the context of SEQ ID
NOs:1-4. Accordingly, amplification of the DNA regions defined by
SEQ ID NOs:1, 2, 3 and 4, assuming that all the relevant cytosine
residues are hypermethylated would be expected to result in a DNA
product with a sequence substantially corresponding to SEQ ID
NOs:6, 8, 10 and 12, respectively. In relation to DNA isolated from
non-neoplastic cells, that is control DNA, mutagenesis of the
relevant cytosine residues would be expected to occur following
bisulfite treatment since the residues are unmethylated.
Accordingly, amplification of the DNA regions defined by SEQ ID
NOs:1, 2, 3 and 4 in this situation would be expected to result in
a DNA product with a sequence substantially corresponding to SEQ ID
NOs:5, 7, 9 and 11, respectively. It would be appreciated by the
person of skill in the art, and as detailed hereinbefore, that
variation in the extent of hypermethylation, both in terms of its
degree and the number of cytosine residues which are
hypermethylated, can occur between different patients.
Nevertheless, despite that fact that each neoplastic sample may not
exhibit precisely identical hypermethylation patterns, the fact
remains that a neoplastic sample will exhibit detectable
hypermethylation in the regions defined by SEQ ID NOs:1-4 relative
to non-neoplastic samples.
[0249] From the point of view of electing specifically to assess
hypermethylation via a cytosine to uracil mutagenesis method,
followed by amplification of the DNA region in issue, the
methylated and unmethylated sequences defined by SEQ ID NOs:5-12
provide the standard against which patient results from this
diagnostic method can be assessed. It is irrelevant whether the
test samples exhibit hypermethylation to the full extent
represented by SEQ ID NOs:6, 8, 10 and 12. Rather, provided that
the sample exhibits hypermethylation at a higher level to that
represented by SEQ ID NOs:5, 7, 9 and 11, the result will be
indicative that the patient from whom the sample was taken has a
large intestine neoplasm. SEQ ID NOs:5, 7, 9, 11 and SEQ ID NOs:6,
8, 10, 12 therefore become the standards against which test results
can be analysed. Any increase in methylation will be clearly
evident against SEQ ID NOs:5, 7, 9 and 11 and is indicative of a
neoplasm. Comparing the degree and pattern of hypermethylation to
the sequences defined by SEQ ID NOs:6, 8, 10 and 12 provides useful
information in relation to variability which may exist between
individual patients or cohorts in terms of hypermethylation
patterns. Accordingly, inclusion of one or more of these standard
sequences in diagnostic kits is contemplated.
[0250] The phrases "nucleic acid" or "nucleic acid sequence" as
used herein refer to an oligonucleotide, nucleotide,
polynucleotide, or to a fragment of any of these, to DNA or RNA
(e.g., mRNA, rRNA, tRNA) of genomic or synthetic origin which may
be single-stranded or double-stranded and may represent a sense or
antisense strand, to peptide nucleic acid (PNA), or to any DNA-like
or RNA-like material, natural or synthetic in origin, including,
e.g., iRNA, ribonucleoproteins (e.g., iRNPs). The term encompasses
nucleic acids, i.e., oligonucleotides, containing known analogues
of natural nucleotides. The term also encompasses nucleic-acid-like
structures with synthetic backbones, see e.g., Mata (1997) Toxicol.
Appl. Pharmacol. 144:189-197; Strauss-Soukup et al. (1997)
Biochemistry 36 : 8692-8698; Samstag et al. (1996) Antisense
Nucleic Acid Drug Dev 6:153-156.
[0251] To this end, it should be understood that the present
invention extends to antisense nucleic acid molecules, siRNA and
miRNA which are directed to the nucleic acid molecules hereinbefore
defined.
[0252] The present invention should also be understood to extend to
probes and primers directed to the nucleic acid molecules
hereinbefore defined.
[0253] It would be appreciated that the design of antisense nucleic
acid molecules and probes and primers would be a matter of routine
procedure to the person of skill in the art in light of the
detailed teachings provided herein. Said antisense molecules,
probes and primers are preferably specific for their target
molecule although it would be appreciated that the same
cross-reactivity may occur depending on the sequence and length of
the antisense molecule, probe or primer. Whether or not a level of
cross-reactivity/promiscuity is acceptable is a judgement to be
made by the skilled person and will depend on the particularities
of the situation. In general, increased specificity can be effected
by increasing the length of the probe or primer. Preferably, said
probe or primer comprises a sequence of nucleotides of at least 10,
20, 30, 40 or 50 nucleotides, although the use of larger molecules
are also contemplated, derived from or directed to the nucleotide
sequences hereinbefore defined. This sequence may be labelled with
a reporter molecule capable of giving an identifiable signal.
[0254] The nucleic acid molecule of the present invention is
preferably in isolated form or ligated to a vector, such as an
expression vector. By "isolated" is meant a nucleic acid molecule
having undergone at least one purification step and this is
conveniently defined, for example, by a composition comprising at
least about 10% subject nucleic acid molecule, preferably at least
about 20%, more preferably at least about 30%, still more
preferably at least about 40-50%, even still more preferably at
least about 60-70%, yet even still more preferably 80-90% or
greater of subject nucleic acid molecule relative to other
components as determined by molecular weight, sequence or other
convenient means. The nucleic acid molecule of the present
invention may also be considered, in a preferred embodiment, to be
biologically pure.
[0255] The nucleic acids of the invention can be made, isolated
and/or manipulated by, e.g., cloning and expression of cDNA
libraries, amplification of mRNA or genomic DNA by PCR, and the
like.
[0256] The nucleic acids of this invention, whether RNA, iRNA,
antisense nucleic acid, cDNA, genomic DNA, vectors, viruses or
hybrids thereof, may be isolated from a variety of sources,
genetically engineered, amplified, and/or expressed or generated
recombinantly.
[0257] Alternatively, these nucleic acids can be synthesized in
vitro by well-known chemical synthesis techniques, as described in,
e.g., Adams (1983) J. Am. Chem. Soc. 105:661; Belousov et al.
(1997) supra; Frenkel et al. (1995) supra; Blommers et al. (1994)
supra; Narang et al. (1979) Meth. Enzymol. 68:90; Brown et al.
(1979) Meth. Enzymol. 68:109; Beaucage (1981) Tetra. Lett. 22:1859;
U.S. Pat. No. 4,458,066.
[0258] Techniques for the manipulation of nucleic acids, such as,
e.g., subcloning, labelling probes (e.g., random-primer labelling
using Klenow polymerase, nick translation, amplification),
sequencing, hybridization and the like are well described in the
scientific and patent literature.
[0259] Nucleic acids, vectors, polypeptides, and the like can be
analyzed and quantified by any of a number of general means well
known to those of skill in the art. These include, e.g., analytical
biochemical methods such as NMR, spectrophotometry, radiography,
electrophoresis, capillary electrophoresis, high performance liquid
chromatography (HPLC), thin layer chromatography (TLC), and
hyperdiffusion chromatography, various immunological methods, e.g.
fluid or gel precipitin reactions, immunodiffusion,
immuno-electrophoresis, radioimmunoassays (RIAs), enzyme-linked
immunosorbent assays (ELISAs), immuno-fluorescent assays, Southern
analysis, Northern analysis, dot-blot analysis, gel electrophoresis
(e.g., SDS-PAGE), nucleic acid or target or signal amplification
methods, radiolabelling, scintillation counting, and affinity
chromatography.
[0260] The invention provides cloning vehicles comprising nucleic
acids of the invention. Cloning vehicles of the invention can
comprise viral particles, baculovirus, phage, plasmids, phagemids,
cosmids, fosmids, bacterial artificial chromosomes, viral DNA
(e.g., vaccinia, adenovirus, foul pox virus, pseudorabies and
derivatives of SV40), P1-based artificial chromosomes, yeast
plasmids, yeast artificial chromosomes, and any other vectors
specific for specific hosts of interest (such as bacillus,
Aspergillus and yeast). Vectors of the invention can include
chromosomal, non-chromosomal and synthetic DNA sequences. Large
numbers of suitable vectors are known to those of skill in the art,
and are commercially available.
[0261] The nucleic acids of the invention can be cloned, if
desired, into any of a variety of vectors using routine molecular
biological methods. Methods for cloning in vitro amplified nucleic
acids are described, e.g., U.S. Pat. No. 5,426,039. To facilitate
cloning of amplified sequences, restriction enzyme sites can be
"built into" a PCR primer pair.
[0262] The terms "similarity" and "identity" as used herein include
exact identity between compared sequences at the nucleotide level.
Where there is non-identity at the nucleotide level, "similarity"
and include "identity" differences between sequences which may
encode different amino acids that are nevertheless related to each
other at the structural, functional, biochemical and/or
conformational levels. In a particularly preferred embodiment,
nucleotide sequence comparisons are made at the level of identity
rather than similarity.
[0263] Terms used to describe sequence relationships between two or
more polynucleotides include "reference sequence", "comparison
window", "sequence similarity", "sequence identity", "percentage of
sequence similarity", "percentage of sequence identity",
"substantially similar" and "substantial identity". A "reference
sequence" is at least 12 but frequently 15 to 18 and often at least
25 or above, such as 30 monomer units in length. Because two
polynucleotides may each comprise (1) a sequence (i.e. only a
portion of the complete polynucleotide sequence) that is similar
between the two polynucleotides, and (2) a sequence that is
divergent between the two polynucleotides, sequence comparisons
between two (or more) polynucleotides are typically performed by
comparing sequences of the two polynucleotides over a "comparison
window" to identify and compare local regions of sequence
similarity. A "comparison window" refers to a conceptual segment of
typically 12 contiguous residues that is compared to a reference
sequence. The comparison window may comprise additions or deletions
(i.e. gaps) of about 20% or less as compared to the reference
sequence (which does not comprise additions or deletions) for
optimal alignment of the two sequences. Optimal alignment of
sequences for aligning a comparison window may be conducted by
computerized implementations of algorithms (GAP, BESTFIT, FASTA,
and TFASTA in the Wisconsin Genetics Software Package Release 7.0,
Genetics Computer Group, 575 Science Drive Madison, Wis., USA) or
by inspection and the best alignment (i.e. resulting in the highest
percentage homology over the comparison window) generated by any of
the various methods selected. Reference also may be made to the
BLAST family of programs as for example disclosed by Altschul et
al. (Nucl. Acids Res. 25: 3389, 1997). A detailed discussion of
sequence analysis can be found in Unit 19.3 of Ausubel et al.
("Current Protocols in Molecular Biology" John Wiley & Sons
Inc, Chapter 15, 1994-1998). A range of other algorithms may be
used to compare the nucleotide sequences such as but not limited to
PILEUP, CLUSTALW, SEQUENCHER or VectorNTI.
[0264] The terms "sequence similarity" and "sequence identity" as
used herein refers to the extent that sequences are identical or
functionally or structurally similar on a nucleotide-by-nucleotide
basis over a window of comparison. Thus, a "percentage of sequence
identity", for example, is calculated by comparing two optimally
aligned sequences over the window of comparison, determining the
number of positions at which the identical nucleic acid base (e.g.
A, T, C, G) occurs in both sequences to yield the number of matched
positions, dividing the number of matched positions by the total
number of positions in the window of comparison (i.e., the window
size), and multiplying the result by 100 to yield the percentage of
sequence identity.
[0265] The phrases "substantially identical" or "substantially
similar" in the context of two nucleic acids, can refer to two or
more sequences that have, e.g., at least about 86%, 87%, 88%, 89%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence
identity, when compared and aligned for maximum correspondence.
[0266] The invention provides isolated or recombinant nucleic acids
that hybridize under low stringency conditions to an exemplary
sequence of the invention. In alternative aspects, the stringent
conditions are highly stringent conditions or medium stringent
conditions, as known in the art and as described herein. These
methods may be used to isolate nucleic acids of the invention.
[0267] "Hybridization" refers to the process by which a nucleic
acid strand joins with a complementary strand through base pairing.
Hybridization reactions can be sensitive and selective so that a
particular sequence of interest can be identified even in samples
in which it is present at low concentrations. Stringent conditions
can be defined by, for example, the concentrations of salt or
formamide in the prehybridization and hybridization solutions, or
by the hybridization temperature, and are well known in the art.
For example, stringency can be increased by reducing the
concentration of salt, increasing the concentration of formamide,
or raising the hybridization temperature, altering the time of
hybridization, as described in detail, below. In alternative
aspects, nucleic acids of the invention are defined by their
ability to hybridize under various stringency conditions (e.g.,
high, medium, and low), as set forth herein.
[0268] Reference herein to a low stringency includes and
encompasses from at least about 0 to at least about 15% v/v
formamide and from at least about 1 M to at least about 2 M salt
for hybridization, and at least about 1 M to at least about 2 M
salt for washing conditions. Generally, low stringency is at from
about 25-30.degree. C. to about 42.degree. C. The temperature may
be altered and higher temperatures used to replace formamide and/or
to give alternative stringency conditions. Alternative stringency
conditions may be applied where necessary, such as medium
stringency, which includes and encompasses from at least about 16%
v/v to at least about 30% v/v formamide and from at least about 0.5
M to at least about 0.9 M salt for hybridization, and at least
about 0.5 M to at least about 0.9 M salt for washing conditions, or
high stringency, which includes and encompasses from at least about
31% v/v to at least about 50% v/v formamide and from at least about
0.01 M to at least about 0.15 M salt for hybridization, and at
least about 0.01 M to at least about 0.15 M salt for washing
conditions. In general, washing is carried out T.sub.m=69.3+0.41
(G+C)% (Marmur and Doty, J. Mol. Biol. 5: 109, 1962). However, the
T.sub.m of a duplex DNA decreases by 1.degree. C. with every
increase of 1% in the number of mismatch base pairs (Bonner and
Laskey, Eur. J. Biochem. 46: 83, 1974). Formamide is optional in
these hybridization conditions. Accordingly, particularly preferred
levels of stringency are defined as follows: low stringency is
6.times.SSC buffer, 0.1% w/v SDS at 25-42.degree. C.; a moderate
stringency is 2.times.SSC buffer, 0.1% w/v SDS at a temperature in
the range 20.degree. C. to 65.degree. C.; high stringency is
0.1.times.SSC buffer, 0.1% w/v SDS at a temperature of at least
65.degree. C.
[0269] Where nucleic acids of the invention are defined by their
ability to hybridize under high stringency, these conditions
comprise about 50% formamide at about 37.degree. C. to 42.degree.
C. In one aspect, nucleic acids of the invention are defined by
their ability to hybridize under reduced stringency comprising
conditions in about 35% to 25% formamide at about 30.degree. C. to
35.degree. C. Alternatively, nucleic acids of the invention are
defined by their ability to hybridize under high stringency
comprising conditions at 42.degree. C. in 50% formamide,
5.times.SSPE, 0.3% SDS, and a repetitive sequence blocking nucleic
acid, such as cot-1 or salmon sperm DNA (e.g., 200 n/ml sheared and
denatured salmon sperm DNA). In one aspect, nucleic acids of the
invention are defined by their ability to hybridize under reduced
stringency conditions comprising 35% formamide at a reduced
temperature of 35.degree. C.
[0270] Another aspect of the present invention provides a
diagnostic kit for assaying biological samples comprising one or
more agent for detecting the marker of the present invention and
reagents useful for facilitating the detection by said agents.
Further means may also be included, for example, to receive a
biological sample. The agent may be any suitable detecting
molecule.
[0271] In one embodiment, said kit comprises one or more nucleic
acid molecules corresponding to SEQ ID NOs:5, 6, 7, 8, 9, 10, 11 or
12, or substantially similar nucleic acid molecule. As detailed
hereinbefore, these sequences are useful as the standards
(controls) against which the product amplified from the test sample
is assessed.
[0272] In another embodiment, said kit comprises one or more
amplification primer sets which primer sets correspond to the
sequences as follows: [0273] (i) SEQ ID NOs:13 and 14 or
substantially similar sequences; [0274] (ii) SEQ ID Nos:13, 14 and
15 or substantially similar sequences; [0275] (iii) SEQ ID NOs:18
and 19 or substantially similar sequences; [0276] (iv) SEQ ID
NOs:20 and 21 or substantially similar sequences.
[0277] The present invention is further described by reference to
the following non-limiting examples.
EXAMPLE 1
Identification of Putative Region of Differential DNA
Methylation
[0278] Genome-wide analysis of DNA methylation using the
Bisulfite-tag procedure described in International Patent
Publication No. WO2011/017760 was applied to three colorectal
cancer cell lines, HCT116, SW480 and LIM in comparison with DNA
from peripheral blood. This technique characterises the level of
DNA methylation at TaqI (TCGA) and MspI (CCGG) restriction sites.
Among the differentially methylated sites identified was a CpG site
within a TaqI restriction site located on Chromosome 6, position
163,834,406. This site also showed differential methylation in
comparison to samples of 8 colorectal cancer DNAs with their 8
matched normal tissue DNAs. This site was identified to lie within
the previously uncharacterised gene Refseq LOC100526820 and DNA
methylation in this and surrounding sequence was investigated as
described hereafter. The gene has subsequently been named CAHM
(colorectal adenocarcinoma hypermethylated).
EXAMPLE 2
Methylation of Cytosines in SEQ ID NO: 1 in Colorectal Tissue
Specimens from 10 Normal Tissue Specimens and 10 Colorectal Cancer
Specimens
[0279] Primers were designed to amplify two regions of the
LOC100526820 gene after chemical conversion with sodium bisulfite.
Reaction with sodium bisulfite converts cytosine to uracil
(subsequently amplified as thymine) while leaving 5-methyl cytosine
unconverted; primers were designed to equivalently amplify
methylated and unmethylated DNA sequences.
TABLE-US-00007 (SEQ ID NO: 18) Forward primer:
5'ATTTGTAAAAATGTTGATTTTTGTTTTTTAGAT (SEQ ID NO: 19) Reverse primer:
5'TCTTATTACACCTTCCCRTTATTCTA
[0280] The primers were used for PCR from bisulfite treated DNA of
10 colorectal cancer specimens, their matched normal tissue and
normal blood DNA. Amplification was done using Promega GoTaq master
mix (without SybrGreen), 3 mM MgCl.sub.2 and with primers at 200 nM
and 10 ng of input DNA. Cycling conditions were 95.degree. C., 2
min (1 cycle, followed by 50 cycles of 95.degree. C. 15 sec,
56.degree. C. 30 sec; 72.degree. C. 30 sec. Amplified bands of DNA
were gel purified and ligated with linkers for sequencing on the
Roche 454 Titanium FLX system. Samples from individual patients and
the blood DNA sample were separately ligated with bar coded "MID"
linkers (Roche Cat No 05619211001) so that sequence reads could be
assigned to individual samples for sequence alignment and scoring.
Libraries of this, SEQ ID NO:2, Example 3 below, and amplicons from
other genes were prepared following protocols provided with the
Roche Library preparation kit and reagents and sequenced on two
halves of a flow cell; one half contained all the cancer samples
and one the equivalently bar-coded normal samples. The bisulfite
sequencing reads were segregated to individual samples using the
bar-code sequences and aligned with the bisulfite converted
sequence, SEQ ID NO:6. After best alignment, the fraction of
cytosines at each potential CpG methylation site (sites labelled
36, 38, 63 etc in FIG. 1, with reference to nucleotide position in
the amplicon) was determined for each sample.
[0281] FIG. 1(b) shows the profile of methylation at each of the
CpG sites within the amplicon. The solid lines represent cancer
samples and the corresponding dashed lines show the methylation
status of the matched normal tissue DNA. It is evident that 7 of
the cancer samples show high levels of methylation (around 80%) at
most CpG sites, two show intermediate levels and one shows minimal
methylation. By contrast, 8 of 10 normal DNA samples show
methylation, generally at <10% across the amplicon, one at low
levels, 10-20% and one at intermediate levels, about 30%. The
corresponding cancer sample for this partially methylated normal
sample is one of those showing high level methylation.
Significantly, analysis of DNA derived from peripheral blood showed
minimal methylation (<3%) at all CpG sites across the amplicon.
Thus the level of methylation at CpG sites within SEQ ID NO:1,
distinguishes colorectal cancer DNA from that of matched normal
colon tissue and control DNA derived from blood.
EXAMPLE 3
Methylation of Cytosines in SEQ ID NO:2 in Colorectal Tissue
Specimens from 10 Normal Tissue Specimens and 10 Colorectal Cancer
Specimens
[0282] An adjacent region SEQ ID NO:2 shown in FIG. 2(a), was
analysed as for SEQ ID NO:1 using the primer pair:
TABLE-US-00008 (SEQ ID NO: 20) Forward primer:
5'GTYGTGTTGTTTTTTAGTTTTTTAGTAAATT (SEQ ID NO: 21) Reverse primer:
5' CACRATACRAAAAACTAATAAACTTTCCTTA
[0283] FIG. 2(b) shows the profile of methylation at each of the
CpG sites within the amplicon. The solid lines represent cancer
samples and the corresponding dashed lines show the methylation
status of the matched normal tissue DNA. The sequence
characteristics of the central region of the amplicon limited read
length in the Roche 454 sequencing system; thus only CpG sites
proximal to the starting end of the sequence read could be
assessed. Nevertheless, it is clear that cancer-specific
hypermethylation includes the first 6 CpG sites (to base 61,
Chromosome co-ordinates 163,834,653 to 163,834,6681) at the left
end of the amplicon and extends to include the last 10 CpG sites,
between bases 195 and 252 (Chromosome co-ordinates 163,834,815 to
163,834,872). Again 9 of 10 cancer samples show intermediate or
high levels of methylation and only one matched normal sample shows
any significant methylation. Additionally, CpG site methylation
within this amplicon was also very low in peripheral blood DNA
(<3%). The combined data indicate that the region encompassed by
the two sequenced amplicons, ie from base 163834295 to 163834906 of
Chromosome 6 (hg19 sequence) demonstrates colorectal
cancer-specific hypermethylation and is suitable for the
development of assays for detection of colorectal cancer.
EXAMPLE 4
Measurement of Methylation Levels in the CAHM Gene (LOC100526820)
in Colon Tissue Specimens Using a Methylation Specific qPCR Assay
for Amplification
[0284] DNA was extracted from colon tissue specimens comprising 10
adenomas, 15 Stage I, 18 Stage B, 28 Stage C, 7 Stage IV, 6 matched
normal colon specimens and 7 other normal colon tissue. Isolated
DNA was bisulfite converted using the Zymo EZ Gold bisulfite
conversion kit as recommended by manufacturer.
[0285] The PCR assay is a 15 uL reaction mixture containing a final
concentration of 1.times. Platinum TaqDNA polymerase (Invitrogen),
3 mM MgCl2, 200 nM of oligonucleotide SEQ ID NOs:13 and 14, 200 uM
dNTPs (New England BioLabs), 1.times. Platinum Buffer and 1:120,000
dilution of Molecular Probe SYBR Green (Invitrogen). Cycling
conditions are 95.degree. C. for 2 min, followed by three cycles of
92.degree. C., 15 sec; 62.degree. C. 15 sec and 72.degree. C. 20
sec. This was followed by 50 cycles of 82.degree. C., 15 sec,
63.degree. C. 15 sec and 72.degree. C. 20 sec. The PCR
amplifications were performed in a Roche LightCycler 480 real-time
PCR instrument using 384-well plates.
[0286] Levels of methylation were quantified using a standard curve
of fully methylated DNA, 40 pg to 5 ng mixed with peripheral blood
leukocyte DNA to give a total input of 5 ng. Table 1 summarises the
frequency of methylation of LOC100526820 SEQ ID NO:3. The
PCR-targeted SEQ ID NO:10 was found to be positive in 70% of the
tissue DNA extracted from adenomas, 74% positive in the collective
cancer tissue specimens but only methylated in 25% of the tested
normal colorectal tissue specimens (and here at low levels).
EXAMPLE 5
Detection of Colorectal Neoplasia by Measuring Methylation Levels
in the CAHM Gene (LOC100526820) in Free Circulating Plasma DNA from
25 Colonoscopy Negative Healthy Normals, 25 Patients with
Colorectal Adenomas and 25 Patients with Colorectal Cancer
[0287] DNA was extracted 4 mL of human blood plasma from 25
patients with colorectal adenomas, 25 patients with colorectal
cancer and 25 colonoscopy negative healthy patients. The extraction
was performed using the QIAmp Isolation of free circulating nucleic
acids from serum/plasma (QIAGEN). Isolated DNA was bisulfite
converted using the Zymo bisulfite conversion kit as recommended by
manufacturer. A total of 36 uL of bisulfite converted DNA was
retrieved from 4 mL of plasma. A total of 2.5 uL of bisulfite
converted DNA from each patient was used in a 1.sup.st round PCR
reaction of 30 uL consisting of a final concentration of 1.times.
Platinum TaqDNA polymerase (Invitrogen), 3.3 mM MgCl2, 200 nM of
oligonucleotide SEQ ID NOs:13 and 15, 200 uM dNTPs (New England
BioLabs) and 1.times. Platinum Buffer. Cycling conditions were
95.degree. C. for 2 min, followed by eleven cycles of 92.degree.
C., 15 sec; 60.degree. C., 30 sec and 72.degree. C. 30 sec. The PCR
amplifications were performed in PALM end-point PCR cycler using
96-well plates. A second PCR was performed on 1 uL of material from
PCR round 1 into a total PCR reaction of 15 uL consisting of a
final concentration of 1.times. Platinum TaqDNA polymerase
(Invitrogen), 4 mM MgCl2, 200 nM of oligonucleotide SEQ ID NOs:13
and 14, 200 uM dNTPs (New England BioLabs), 1.times. Platinum
Buffer and 1:120,000 dilution of Molecular Probe SYBR Green
(Invitrogen). Cycling conditions are 95.degree. C. for 2 min,
followed by three cycles of 92.degree. C., 15 sec; 62.degree. C. 15
sec and 72.degree. C. 20 sec. This was followed by 47 cycles of
82.degree. C., 15 sec, 62.degree. C. 15 sec and 72.degree. C. 20
sec. A melt curve analysis was performed at 95.degree. C., 5 sec,
65.degree. C. 1 min and a continuous increase to 97.degree. C.
using a ramp speed of 0.11.degree. C./sec. The PCR amplifications
were performed in a Roche LightCycler 480 real-time PCR instrument
using 384-well plates. Patient samples with product melting curves
at 77.4.degree. C.+/-0.5.degree. C. were called positive. Levels of
methylation were quantified using a standard curve of fully
methylated DNA, 40 pg to 5 ng mixed with peripheral blood leukocyte
DNA to give a total input of 5 ng. Table 2 summarises the frequency
of methylation of the CAHM gene (LOC100526820) in free circulating
plasma DNA.
[0288] The sensitivity of detection is seen to increase with
increasing stage of the cancer. These data demonstrate the
potential utility of specific assays for methylation of the
LOC100526820 in DNA isolated from plasma for detection of
colorectal neoplasia.
EXAMPLE 6
Measurement of Methylation Levels in CAHM (LOC100526820) in Colon
Breast, Prostate and Lung Tissue Specimens Using a Methylation
Specific qPCR Assay for Amplification
[0289] DNA was extracted from tissue specimens comprising 10 breast
cancer and 10 matched normal breast tissue specimens, 10 lung
cancer and 10 matched normal lung tissue specimens and 5 prostate
cancer and 5 matched normal prostate tissue specimens. In addition,
a previously untested cohort of 10 colorectal cancer tissue
specimens and 10 matched normal colon tissue specimens were
included as controls. The concentration of isolated DNA was
determined using 200 nM of CFF1 primers and cycling conditions
described in Devos et al. Clin Chem 2009; 55:1337-1346 in a
modified 15 .mu.L PCR mixture comprising: 0.05 U/.mu.L Platinum Taq
DNA polymerase (Invitrogen), 1.times. Platinum Buffer, 3 mM MgCl2,
200 .mu.M dNTPs and 200 nM of a TaqMan probe (5'-6FAM-ATG GAT GAA
GAA AGA AAG GAT GAGT-BHQ-1) (SEQ ID NO:22).
[0290] 1 .mu.g DNA was bisulphite converted using the Epitect Plus
Bisulfite kit as recommended by manufacturer (QIAGEN). The
concentration of purified bisulphite converted DNA was determined
using bisulphite conversion specific ACTB primers (Forward primer:
5'-GTG ATG GAG GAG GTT TAG TAA GTT (SEQ ID NO:23); Reverse primer:
5'-AAT TAC AAA AAC CAC AAC CTA ATA AA) (SEQ ID NO:24) in a final
concentration of 900 nM for each primer in a 15 .mu.L PCR
comprising 0.05 U/.mu.L Platinum Taq DNA polymerase (Invitrogen),
1.times. Platinum Buffer, 2 mM MgCl2, 200 .mu.M dNTPs (Invitrogen)
and 100 nM TaqMan probe (5'-6FAM-ACC ACC ACC CAA CAC ACA ATA ACA
AAC ACA-BHQ-1) (SEQ ID NO:25). PCR cycling conditions: 95.degree.
C., 2 minutes; 60 cycles of [95.degree. C., 10 seconds; 60.degree.
C., 50 seconds], 4.degree. C. 10 seconds.
[0291] The level of CAHM methylation in 5 ng bisulphite converted
tissue DNA (triplicates) was determined using the CAHM PCR assay in
a 25 .mu.L reaction mixture containing a final concentration of
1.times. Platinum TaqDNA polymerase (Invitrogen), 3 mM MgCl2, 200
nM of oligonucleotide SEQ ID NOs:13 and 14, 200 .mu.M dNTPs,
1.times. Platinum Buffer and 1:120,000 dilution of Molecular Probe
SYBR Green (Invitrogen). PCR cycling conditions: 95.degree. C., 2
min, 3 cycles of [92.degree. C., 15 seconds; 62.degree. C., 15
seconds; 72.degree. C., 20 seconds] followed by 50 cycles of
[82.degree. C., 15 seconds; 63.degree. C., 15 seconds; 72.degree.
C., 20 seconds] where after a melt curve analysis was performed
with the settings of 95.degree. C., 5 sec, 65.degree. C., 1 min,
ramping to 97.degree. C. at 0.11.degree. C./sec continuous
acquisition (5/sec); followed by cooling to 40.degree. C. for 10
seconds. The PCR amplifications were performed in a Roche
LightCycler 480 real-time PCR instrument using 96-well plates.
[0292] Levels of methylation were quantified using a standard curve
of fully methylated DNA, 20 pg to 5 ng. Table 3 summarises the
frequency of methylation of CAHM (LOC100526820) SEQ ID NO:3.
[0293] The PCR-targeted SEQ ID NO:10 was more than 2% methylated in
9 of 10 colorectal cancer specimens and 1 of 10 normal specimens.
In contrast, CAHM showed no methylation in any of the 10 paired
prostate specimens. Low level methylation (less than 0.3%) was
measured in 3 of the 20 matched lung specimens (2 normals and 1
cancer) and 18 of the matched breast specimens. Only 2 breast
cancer specimens had more than 2% CAHM methylation. These data
demonstrate the high sensitivity of methylation in the CAHM locus
for detection of colon cancer compared with other cancers, but also
that a CAHM methylation may detect a sub-group of breast
cancers.
[0294] Those skilled in the art will appreciate that the invention
described herein is susceptible to variations and modifications
other than those specifically described. It is to be understood
that the invention includes all such variations and modifications.
The invention also includes all of the steps, features,
compositions and compounds referred to or indicated in this
specification, individually or collectively, and any and all
combinations of any two or more of said steps or features.
TABLE-US-00009 TABLE 1 SEQ ID NO: 10 Total Number positive samples
(2% cut-off) % positive Adenoma 10 7 70 Cancer A 15 8 53 Cancer B
18 13 72 Cancer C 28 22 79 Cancer D 7 7 100 Cancer Total 68 50 74
Matched normal 6 1 16 Other normal colon 7 2 28 Sm Int; stomach;
rectum 3 1 Sm int.
TABLE-US-00010 TABLE 2 75 n (%) Ave. age F/M % pos Normal 25 59.9
12/13 8% Adenoma 25 59.2 14/11 8% LGD -- -- -- -- HGD -- -- -- --
>3 lesions 7 59.4 3/4 14% <3 lesions 18 59.1 11/7 6% TA 15
59.3 8/7 0% TVA 0 -- -- -- VA 4 59 3/1 25% other 6 59.2 3/3 17%
>10 mm -- -- -- -- <10 mm 25 59.2 14/11 8% Cancer 25 61.1
14/11 64% I -- -- -- -- II 9 63 6/3 33% III 8 64.6 4/4 63% IV 8
55.4 4/4 100% Stage unk -- -- -- --
TABLE-US-00011 TABLE 3 SEQ ID NO: 10 Total Number positive samples
(2% cut-off) % positive Breast cancer 10 2 20 Matched normal breast
tissue 10 0 0 Lung cancer 10 0 0 Matched normal lung tissue 10 0 0
Prostate cancer 5 0 0 Matched normal prostate tissue 5 0 0 Colon
cancer 10 9 90 Matched normal prostate tissue 10 1 10
BIBLIOGRAPHY
[0295] Abrams and Stanton, Methods Enzymol., 212: 71-74, 1992
[0296] Adams (1983) J. Am. Chem. Soc. 105:661 [0297] Alon et al.,
Proc. Natl. Acad. Sci. USA: 96, 6745-6750, June 1999 [0298]
Altschul et al. (Nucl. Acids Res. 25: 3389, 1997 [0299] Ammerpohl
et al. Biochim Biophys Acta. 1790:847-62, 2009 [0300] Ausubel, F.
et al., "Current Protocols in Molecular Biology", John Wiley &
Sons, (1998) [0301] Beaucage, et al. Tetrahedron Letters 22:
1859-1862, 1981 [0302] Belousov et al. (1997) Nucleotide. Acids
Res. 25(17):3440-3444 [0303] Blommers et al. (1994) Biochemistry
33:7886-96 [0304] Bonner and Laskey, Eur. J. Biochem. 46: 83, 1974
[0305] Breslauer et al., Proc. Natl. Acad. Sci. USA, 83: 3746-3750,
1986 [0306] Brown et al. (1979) Meth. Enzymol. 68:109 [0307]
Caruthers, M. H., et al., "Methods in Enzymology," Vol. 154, pp.
287-314 (1988) [0308] Chen and Kwok, Nucleic Acids Res. 25:
347-353, 1997 [0309] Clark et al. Nat Protoc. 1:2353-64, 2006
[0310] Cottrell et al., Nucl. Acids Res. 32: e10, 2004 [0311]
DeGraves, et al., Biotechniques 34(1):106-10, 112-5 (2003) [0312]
Deiman B, et al., Mol. Biotechnol. 20(2):163-79 (2002) [0313] Deng
et al, Chin. J. Cancer Res., 12: 171-191, 2000 [0314] Devos et al.
Clin Chem 2009; 55:1337-1346 [0315] Dieffenbach and Dveksler (Eds)
(In: PCR Primer: A Laboratory Manual, Cold Spring Harbor
Laboratories, NY, 1995 [0316] Eads et al., Cancer Res. 59:2302-2306
(1999) [0317] Egholm et al., Am. Chem. Soc., 114: 1895, 1992 [0318]
Egholm et al., Nature, 365: 566, 1993 [0319] Frenkel et al. (1995)
Free Rad. Biol. & Med. 19(3):373-380 [0320] Frommer et al.,
Proc. Natl. Acad. Sci. USA 89:1827-1831 (1992) [0321] Gibson et
al., Genome Research 6:995-1001 (1996) [0322] Golub et al.,
Science, 286:531-537, 1999 [0323] Gonzalgo & Jones, Nucleic
Acids Res. 25:2529-2531 (1997) [0324] Gonzalgo et al., Cancer Res.
57, 594-599, 1997 [0325] Herman et al., Proc. Natl. Acad. Sci. USA
93:9821-9826, (1996) [0326] Holland et al., Proc. Natl. Acad. Sci.
USA, 88, 7276-7280, 1991 [0327]
http://www.sciencedaily.com/releases/2010/04/100419150831.htm
[0328] Kawai et al., Mol. Cell. Biol. 14:7421-7427, 1994 [0329]
Kristensen and Hansen, Clin Chem. 55:1471-83, 2009 [0330]
Kuppuswamy et al., Proc. Natl. Acad. Sci. USA 88:1143-1147, 1991
[0331] Landegren et al., Genome Res., 8(8): 769-776, 1998 [0332]
Lee et al., Nucleic Acid Res. 21, 3761-3766, 1993 [0333] Markowitz
S D, Bertagnolli M M (December 2009). "Molecular basis of
colorectal cancer". N. Engl. J. Med. 361 (25): 2449-60 [0334]
Marmur and Doty, J. Mol. Biol. 5: 109, 1962 [0335] Mata (1997)
Toxicol. Appl. Pharmacol. 144:189-197 [0336] Messing, Methods
Enzymol, 101, 20-78, 1983 [0337] Mhlanga and Malmberg, Methods
25:463-471, 2001 [0338] Moore et al., BBA, 1402:239-249, 1988
[0339] Narang, et al. Meth. Enzymol 68: 90, 1979 [0340] Nielsen et
al., J. Chem. Soc. Perkin Trans., 1:3423, 1997 [0341] Olek, et al.
Nat. Genet. 17(3): 275-6 (1997) [0342] Orum et al., Clin. Chem. 45:
1898-1905, 1999 [0343] Orum et al., Nucl. Acids Res., 21: 5332,
1993 [0344] PCT Publication No. WO 00/70090 [0345] Rand et al.
Nucl. Acids Res. 33:e127, 2005 [0346] Rand et al., Epigenetics
1:94-100, 2006 [0347] Rein, et al. Nucleic Acids Res. 26 (10):
2255-64 (1998) [0348] Robinson et al. Epigenomics 2:587-98 (2010)
[0349] Sadri & Hornsby, Nucl. Acids Res. 24:5058-5059 (1996)
[0350] Sambroock et al. Molecular Cloning, A Laboratory Manual (2nd
Ed., CSHP, New York 1989) (Cold Spring Harbour Laboratory Press,
1989) [0351] Samstag et al. (1996) Antisense Nucleic Acid Drug Dev
6:153-156 [0352] Santa Lucia, Proc. Natl. Acad. Sci. USA, 95:
1460-1465, 1995 [0353] Shames et al. Cancer Lett. 251:187-98, 2007
[0354] Simeonov and Nikiforov, Nucleic Acids Research, 30(17): 1-5,
2002 [0355] Singer-Sam et al., Nucl. Acids Res. 18:687, 1990 [0356]
Singer-Sam et al., PCR Methods Appl. 1: 160-163, 1992 [0357] Singh
and Wengel, Chem. Commun. 1247, 1998 [0358] Southern et al.,
Genomics, 13: 1008-1017, 1992 [0359] Strauss-Soukup et al. (1997)
Biochemistry 36:8692-8698 [0360] Szabo and Mann, Genes Dev.
9:3097-3108, 1995 [0361] Toyota et al., Cancer Res. 59:2307-12
(1999) [0362] U.S. Pat. No. 5,786,146 [0363] U.S. Patent
Publication 2005/0069879 [0364] Uhlmann et al., Electrophoresis,
23: 4072-4079, 2002 [0365] Wedemeyer et al., Clinical Chemistry
48:9 1398-1405, 2002 [0366] Weissleder et al., Nature Medicine
6:351-355, 2000 [0367] Weitzel J N (December 1999). "Genetic cancer
risk assessment. Putting it all together". Cancer 86 (11 Suppl):
2483-92. [0368] Xiong & Laird, Nucleic Acids Res. 25:2532-2534
(1997) [0369] Zyskind et al., Recombinant DNA Laboratory Manual,
(Acad. Press, 1988)
Sequence CWU 1
1
251206DNAhomo sapien 1atctgtaaaa atgttgactt ctgcttttca gactacgcgc
acagcctctt tatttcctac 60tgcggcttca ttccctcacg gaacactgac gccatcgcga
aggaagcatt tcgagcacga 120ctgacgctcc ccttattatt tgctaagccg
ctgcgctcgg gtctggctac gatttgcttt 180cagaataacg ggaaggtgca acaaga
2062286DNAhomo sapien 2gccgtgctgc tttccagcct ctcagcaaat cacgaacacc
gaaagaagcc acggcggcga 60cgggaggggc gtcgcgcgtg cttccctcgg cgacaaagcg
ggagccgggc gcgccggccg 120agggcgcccg gcgcagagtc ccgcagaggc
ggacgccgcg gcacgcgcct cgaaaagcct 180caaactctta tcctcggctc
tcccgcccca cctccgcccc gcagccaaga cccgcgccgt 240ggcgggcccg
acggccaagg aaagcccacc agccctccgc accgtg 286363DNAhomo sapien
3gaaggaagca tttcgagcac gactgacgct ccccttatta tttgctaagc cgctgcgctc
60ggg 634127DNAhomo sapien 4gaaggaagca tttcgagcac gactgacgct
ccccttatta tttgctaagc cgctgcgctc 60gggtctggct acgatttgct ttcagaataa
cgggaaggtg caacaagatc gcttccctag 120aggcgcg 1275206DNAhomo sapien
5atttgtaaaa atgttgattt ttgtttttta gattatgtgt atagtttttt tattttttat
60tgtggtttta tttttttatg gaatattgat gttattgtga aggaagtatt ttgagtatga
120ttgatgtttt ttttattatt tgttaagttg ttgtgtttgg gtttggttat
gatttgtttt 180tagaataatg ggaaggtgta ataaga 2066206DNAhomo sapien
6atttgtaaaa atgttgattt ttgtttttta gattacgcgt atagtttttt tattttttat
60tgcggtttta tttttttacg gaatattgac gttatcgcga aggaagtatt tcgagtacga
120ttgacgtttt ttttattatt tgttaagtcg ttgcgttcgg gtttggttac
gatttgtttt 180tagaataacg ggaaggtgta ataaga 2067286DNAhomo sapien
7gttgtgttgt tttttagttt tttagtaaat tatgaatatt gaaagaagtt atggtggtga
60tgggaggggt gttgtgtgtg ttttttttgg tgataaagtg ggagttgggt gtgttggttg
120agggtgtttg gtgtagagtt ttgtagaggt ggatgttgtg gtatgtgttt
tgaaaagttt 180taaattttta tttttggttt ttttgtttta tttttgtttt
gtagttaaga tttgtgttgt 240ggtgggtttg atggttaagg aaagtttatt
agttttttgt attgtg 2868286DNAhomo sapien 8gtcgtgttgt tttttagttt
tttagtaaat tacgaatatc gaaagaagtt acggcggcga 60cgggaggggc gtcgcgcgtg
tttttttcgg cgataaagcg ggagtcgggc gcgtcggtcg 120agggcgttcg
gcgtagagtt tcgtagaggt ggacgtcgcg gtacgcgttt cgaaaagttt
180taaattttta ttttcggttt tttcgtttta ttttcgtttc gtagttaaga
ttcgcgtcgt 240ggcgggttcg acggttaagg aaagtttatt agtttttcgt atcgtg
286963DNAhomo sapien 9gaaggaagta ttttgagtat gattgatgtt ttttttatta
tttgttaagt tgttgtgttt 60ggg 631063DNAhomo sapien 10gaaggaagta
tttcgagtac gattgacgtt ttttttatta tttgttaagt cgttgcgttc 60ggg
6311127DNAhomo sapien 11gaaggaagta ttttgagtat gattgatgtt ttttttatta
tttgttaagt tgttgtgttt 60gggtttggtt atgatttgtt tttagaataa tgggaaggtg
taataagatt gtttttttag 120aggtgtg 12712127DNAhomo sapien
12gaaggaagta tttcgagtac gattgacgtt ttttttatta tttgttaagt cgttgcgttc
60gggtttggtt acgatttgtt tttagaataa cgggaaggtg taataagatc gtttttttag
120aggcgcg 1271327DNAhomo sapien 13gaaggaagta tttcgagtac gattgac
271419DNAhomo sapien 14cccgaacgca acgacttaa 191528DNAhomo sapien
15gcctctaaaa aaacgatctt attacacc 28161535DNAhomo sapien
16ccccggagcg cgcctgcgtg gggcgggggc ggcagccgac taggggctgg gtctggccgt
60ttagggccgg gtcttggccc gtcgcccacg gtgcggaggg ctggtgggct ttccttggcc
120gtcgggcccg ccacggcgcg ggtcttggct gcggggcgga ggtggggcgg
gagagccgag 180gataagagtt tgaggctttt cgaggcgcgt gccgcggcgt
ccgcctctgc gggactctgc 240gccgggcgcc ctcggccggc gcgcccggct
cccgctttgt cgccgaggga agcacgcgcg 300acgcccctcc cgtcgccgcc
gtggcttctt tcggtgttcg tgatttgctg agaggctgga 360aagcagcacg
gcggagagga gccttgcact cgccaggcgg gaagcctgcg cggacacgcg
420tgcgcaccca cggggcggcg ggcgggcgtg gggggtccgg gccacgcggg
cgacgcgcct 480ctagggaagc gatcttgttg caccttcccg ttattctgaa
agcaaatcgt agccagaccc 540gagcgcagcg gcttagcaaa taataagggg
agcgtcagtc gtgctcgaaa tgcttccttc 600gcgatggcgt cagtgttccg
tgagggaatg aagccgcagt aggaaataaa gaggctgtgc 660gcgtagtctg
aaaagcagaa gtcaacattt ttacagatga agaaagaata cggaggcaag
720aggtctttct ctgcagtttg gtggatttcc aacatttaga cttgtttgga
agaatttcct 780cagctgcacc aatgaagtcc ttgatctata gaagtcggca
gtccctaaat ctacgtctgc 840attttgttgc aaatccttta taacattcca
ttaaaataat gcagagttat ttaatatcca 900gttggccatc gtgagagtaa
ttcgcggctg agattttgtt aatcattctg tcttctgact 960taacagtgaa
cgtaggtgat tttttttgta aaatgttgct tcacatgaat tgtgagaatc
1020acctctaagt ttgaattgta ctgaaggcac tataagaatt tcaaatgaac
gctgagtagc 1080cagtagcctt ctggcctttt cgtttaacaa gcacagagtt
cgtttttaaa attaagttac 1140tttgacagag gaaatgtaat agccttggta
gacaacatta aaaatgtaac tgtcagatgt 1200tttaaagtct ccaacagccg
tatctgtttt agagccatag aatatttact tactgaattg 1260cctgtttaaa
gatgaacttt ctaaatgcag ggaatagtaa cttgcaaaaa agctatggtc
1320tctaagtaat gaaggctgtt tcagtaccta gaaaaatcaa aatcaaggtt
ttgatgctgc 1380tagtgtaaaa gatgcaatcc ccttcttaat ggcctgctta
tttattaagc tcctaggcac 1440tatgctgaat gccctacatg catatctcgt
ttaatcatca gtacaacttg ggcttaggtt 1500agactgttat ccccatttta
caaataaggg gaaac 153517886DNAhomo sapien 17cgcctgcgtg gggcgggggc
ggcagccgac taggggctgg gtctggccgt ttagggccgg 60gtcttggccc gtcgcccacg
gtgcggaggg ctggtgggct ttccttggcc gtcgggcccg 120ccacggcgcg
ggtcttggct gcggggcgga ggtggggcgg gagagccgag gataagagtt
180tgaggctttt cgaggcgcgt gccgcggcgt ccgcctctgc gggactctgc
gccgggcgcc 240ctcggccggc gcgcccggct cccgctttgt cgccgaggga
agcacgcgcg acgcccctcc 300cgtcgccgcc gtggcttctt tcggtgttcg
tgatttgctg agaggctgga aagcagcacg 360gcggagagga gccttgcact
cgccaggcgg gaagcctgcg cggacacgcg tgcgcaccca 420cggggcggcg
ggcgggcgtg gggggtccgg gccacgcggg cgacgcgcct ctagggaagc
480gatcttgttg caccttcccg ttattctgaa agcaaatcgt agccagaccc
gagcgcagcg 540gcttagcaaa taataagggg agcgtcagtc gtgctcgaaa
tgcttccttc gcgatggcgt 600cagtgttccg tgagggaatg aagccgcagt
aggaaataaa gaggctgtgc gcgtagtctg 660aaaagcagaa gtcaacattt
ttacagatga agaaagaata cggaggcaag aggtctttct 720ctgcagtttg
gtggatttcc aacatttaga cttgtttgga agaatttcct cagctgcacc
780aatgaagtcc ttgatctata gaagtcggca gtccctaaat ctacgtctgc
attttgttgc 840aaatccttta taacattcca ttaaaataat gcagagttat ttaata
8861833DNAartificialprimer 18atttgtaaaa atgttgattt ttgtttttta gat
331926DNAartificialprimer 19tcttattaca ccttcccrtt attcta
262031DNAartificialprimer 20gtygtgttgt tttttagttt tttagtaaat t
312131DNAartificialprimer 21cacratacra aaaactaata aactttcctt a
312225DNAArtificialprobe 22atggatgaag aaagaaagga tgagt
252324DNAArtificialprimer 23gtgatggagg aggtttagta agtt
242426DNAArtificialprimer 24aattacaaaa accacaacct aataaa
262530DNAArtificialprobe 25accaccaccc aacacacaat aacaaacaca 30
* * * * *
References