U.S. patent application number 16/752301 was filed with the patent office on 2020-05-28 for therapeutic agents targeting the ncca-atp channel and methods of use thereof.
The applicant listed for this patent is University of Maryland, Baltimore The United States of America as Represented by the Department of Veterans Affairs. Invention is credited to Mingkui Chen, J. Marc Simard.
Application Number | 20200163902 16/752301 |
Document ID | / |
Family ID | 36119325 |
Filed Date | 2020-05-28 |
View All Diagrams
United States Patent
Application |
20200163902 |
Kind Code |
A1 |
Simard; J. Marc ; et
al. |
May 28, 2020 |
THERAPEUTIC AGENTS TARGETING THE NCCa-ATP CHANNEL AND METHODS OF
USE THEREOF
Abstract
The present invention is directed to therapeutic compositions
targeting the NC.sub.Ca-ATP channel of an astrocyte, neuron or
capillary endothelial cell and methods of using same. More
specifically, agonists and antagonists of the NC.sub.Ca-ATP channel
are contemplated. The therapeutic compositions are used to treat
cancer, more specifically, a metastatic brain tumor, wherein a
tumor-brain barrier is present. Such treatments are contemplated in
combination with conventional anti-cancer therapies. Alternatively,
the compositions are used to prevent cell death and to treat
cerebral edema that result from ischemia, due to interruption of
blood flow, to tissue trauma or to increased tissue pressure.
Inventors: |
Simard; J. Marc; (Baltimore,
MD) ; Chen; Mingkui; (Lake Forest, IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
University of Maryland, Baltimore
The United States of America as Represented by the Department of
Veterans Affairs |
Baltimore
Washington |
MD
DC |
US
US |
|
|
Family ID: |
36119325 |
Appl. No.: |
16/752301 |
Filed: |
January 24, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11574793 |
Oct 30, 2008 |
10583094 |
|
|
PCT/US05/26455 |
Jul 25, 2005 |
|
|
|
16752301 |
|
|
|
|
60610758 |
Sep 18, 2004 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 2300/00 20130101;
A61K 2300/00 20130101; A61K 2300/00 20130101; A61K 2300/00
20130101; A61K 2300/00 20130101; A61K 2300/00 20130101; A61K
2300/00 20130101; A61K 31/00 20130101; A61K 2300/00 20130101; A61K
31/64 20130101; A61K 38/49 20130101; A61K 38/49 20130101; A61K
31/565 20130101; A61P 43/00 20180101; A61K 31/40 20130101; A61K
31/44 20130101; A61K 31/40 20130101; A61K 31/44 20130101; A61P
35/00 20180101; C07K 14/4705 20130101; A61P 25/00 20180101; A61P
9/10 20180101; A61K 31/549 20130101; A61P 35/04 20180101; A61K
31/64 20130101; A61K 38/177 20130101; A61K 45/06 20130101; A61K
31/165 20130101; A61K 31/175 20130101; A61K 31/565 20130101; A61K
38/482 20130101; A61K 31/566 20130101; A61K 31/549 20130101; A61K
38/177 20130101; A61K 31/175 20130101 |
International
Class: |
A61K 31/00 20060101
A61K031/00; A61K 31/566 20060101 A61K031/566; A61K 31/165 20060101
A61K031/165; A61P 9/10 20060101 A61P009/10; A61K 38/48 20060101
A61K038/48; A61K 38/49 20060101 A61K038/49; A61K 45/06 20060101
A61K045/06; A61K 31/44 20060101 A61K031/44; A61K 31/64 20060101
A61K031/64; A61K 31/549 20060101 A61K031/549; A61K 31/565 20060101
A61K031/565; A61K 31/175 20060101 A61K031/175; A61K 38/17 20060101
A61K038/17; A61K 31/40 20060101 A61K031/40 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under Grant
No. NS048260 awarded by the National Institutes of Health and under
Grant Number NEUC-005-01F awarded by the United States Department
of Veterans Affairs. The government has certain rights in the
invention.
Claims
1. A method of reducing disruption of blood brain barrier in a
subject in need thereof comprising administering glibenclamide or a
pharmaceutically acceptable salt thereof and a thrombolytic agent
to said subject.
2. The method of claim 1, wherein the thrombolytic agent is a
tissue plasminogen activator (tPA).
3. The method of claim 1, wherein the thrombolytic agent is
urokinase, prourokinase, streptokinase, anistreplase, reteplase, or
tenecteplase.
4. The method of claim 1, further comprising administering to the
subject an anticoagulant or antiplatelet.
5. The method of claim 4, wherein the anticoagulant or antiplatelet
is aspirin, warfarin or coumadin.
6. The method of claim 1, further comprising administering to the
subject one or more statins, diuretics, or vasodilators.
7. The method of claim 1, further comprising administering mannitol
to the subject.
8. The method of claim 1, wherein the glibenclamide or
pharmaceutically acceptable salt thereof is administered
alimentarily.
9. The method of claim 8, wherein alimentarily comprises orally,
buccally, rectally, or sublingually.
10. The method of claim 1, wherein the glibenclamide or
pharmaceutically acceptable salt thereof is administered
parenterally.
11. The method of claim 10, wherein parenterally comprises
intravenously, intradermally, intramuscularly, intraarterially,
intrathecally, subcutaneously, intraperitoneally, or
intraventricularly.
12. The method of claim 10, wherein parenterally comprises
injection into the brain parenchyma.
13. The method of claim 1, wherein the glibenclamide or
pharmaceutically acceptable salt thereof is administered at a
dosage of 0.001 .mu.g/kg/day to 100 .mu.g/kg/day.
14. The method of claim 1, wherein the glibenclamide or
pharmaceutically acceptable salt thereof is administered at a
loading dosage of 0.1 .mu.g/kg to 100 .mu.g/kg.
15. The method of claim 1, wherein release of matrix
metalloproteinase-2 and/or matrix metalloproteinase-9 from brain
tissue of said subject is reduced.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of U.S. Non-Provisional
patent application Ser. No. 11/574,793 filed on Oct. 30, 2008,
which is a national phase application under 35 U.S.C. .sctn. 371
that claims priority to International Application No.
PCT/US05/26455 filed Jul. 25, 2005, which claims priority to U.S.
Provisional Application No. 60/610,758 filed Sep. 18, 2004, all of
which are incorporated herein by reference in their entirety.
INCORPORATION OF SEQUENCE LISTING
[0003] The sequence listing that is contained in the file named
"Seq_Lst_UOMD_P0006US_C4.TXT", which is 3 KB and filed herewith by
electronic submission and is incorporated by reference herein.
TECHNICAL FIELD
[0004] The present invention is directed to fields of cell biology,
physiology and medicine. More specifically, the present invention
addresses novel methods of treating a patient comprising
administering a therapeutic compound that targets a unique
non-selective cation channel activated by intracellular calcium and
blocked by intracellular ATP (NC.sub.Ca-ATP channel). In specific
embodiments, the therapeutic compound is an agonist, and uses
thereof in therapies, such as cancer therapies, benefiting from
death of neuronal cells. In other specific embodiments, the
therapeutic compound is an antagonist, and uses thereof in
therapies, such as treatment of cerebral ischemia or edema,
benefiting from blocking and/or inhibiting the NC.sub.Ca-ATP
channel. Compositions comprising agonists and/or antagonists of the
NC.sub.Ca-ATP channel are also contemplated.
BACKGROUND OF THE INVENTION
I. NC.sub.Ca-ATP Channel
[0005] A unique non-selective monovalent cationic ATP-sensitive
channel (NC.sub.Ca-ATP channel) was identified first in native
reactive astrocytes (NRAs) and later, as described herein, in
neurons and capillary endothelial cells after stroke or traumatic
brain injury (See, International application WO 03/079987 to Simard
et al., and Chen and Simard, 2001, each incorporated by reference
herein in its entirety). The NC.sub.Ca-ATP channel is thought to be
a heteromultimer structure comprised of sulfonylurea receptor type
1 (SUR1) regulatory subunits and pore-forming subunits, similar to
the K.sub.ATP channel in pancreatic .beta. cells (Chen et al.,
2003). The pore-forming subunits of the NC.sub.Ca-ATP channel
remain uncharacterized.
[0006] SUR imparts sensitivity to antidiabetic sulfonylureas such
as glibenclamide and tolbutamide, and is responsible for activation
by a chemically diverse group of agents termed "K.sup.+ channel
openers" such as diazoxide, pinacidil and cromakalin (Aguilar-Bryan
et al., 1995; Inagaki et al., 1996; Isomoto et al., 1996; Nichols
et al., 1996; Shyng et al., 1997). In various tissues, molecularly
distinct SURs are coupled to distinct pore-forming subunits to form
different K.sub.ATP channels with distinguishable physiological and
pharmacological characteristics. The K.sub.ATP channel in
pancreatic .beta. cells is formed from SUR1 linked with Kir6.2,
whereas the cardiac and smooth muscle K.sub.ATP channels are formed
from SUR2A and SUR2B linked with Kir6.2 and Kir6.1, respectively
(Fujita et al., 2000). Despite being made up of distinctly
different pore-forming subunits, the NC.sub.Ca-ATP channel is also
sensitive to sulfonylurea compounds.
[0007] Also, unlike the K.sub.ATP channel, the NC.sub.Ca-ATP
channel conducts sodium ions, potassium ions, cesium ions and other
monovalent cations with near equal facility (Chen and Simard, 2001)
suggesting further that the characterization, and consequently the
affinity to certain compounds, of the NC.sub.Ca-ATP channel differs
from the K.sub.ATP channel.
[0008] Other nonselective cation channels that are activated by
intracellular Ca.sup.2+ and inhibited by intracellular ATP have
been identified but not in astrocytes. Further, the NC.sub.Ca-ATP
channel expressed and found in astrocytes differs physiologically
from the other channels with respect to calcium sensitivity and
adenine nucleotide sensitivity (Chen et al., 2001).
II. Gliotic Capsule
[0009] The gliotic capsule that forms around a "foreign body" in
the brain is an important, albeit neglected, biological system. On
the one hand, the gliotic capsule represents the response of the
brain to an injurious stimulus--an attempt by the brain to wall
off, isolate, dispose of, and otherwise protect itself from the
foreign body. On the other hand, the gliotic capsule forms a
potentially harmful mass of tissue from which originates edema
fluid that contributes to brain swelling, and whose constituent
cells undergo cytotoxic edema, which adds further to brain
swelling. Also, the gliotic capsule protects foreign cells from
immunologic surveillance.
[0010] The essential elements involved in formation of a gliotic
capsule appear to be uniform in many types of CNS pathology, be it
a traumatically implanted foreign body, a metastatic tumor, a brain
abscess, or infarcted necrotic tissue following a stroke. First,
microglia and astrocytes become activated near the site of injury,
with large, stellate-shaped GFAP-positive reactive astrocytes
forming the most prominent cellular component of the response.
Secondly, the foreign nature of the entity is recognized, and the
response is initiated to surround and contain it. Although the
concept of "foreign body" encompasses a large variety of
pathological conditions, the responses in most cases bear a great
deal of similarity to one another.
[0011] The interface between the foreign body and the gliotic
capsule, referred to as the inner zone of the gliotic capsule,
appears to be of great importance in determining the overall
response to injury.
[0012] Despite the overall benefits, the gliotic capsule forms a
potentially harmful mass of tissue that contributes to brain
swelling and mass effect, and that may shelter foreign cells from
surveillance by the immune system. Applicants are the first to
determine that, in a variety pathological conditions in both rats
and humans, reactive astrocytes (R1 astrocytes) in the inner zone
of the gliotic capsule express a novel SUR1-regulated cation
channel, the NC.sub.Ca-ATP channel, and that this channel directly
controls cell viability: opening the channel is associated with
necrotic cell death and closing the channel is associated with
protection from cell death induced by energy (ATP) depletion.
III. Cancer
[0013] Brain metastasis is an important cause of morbidity and
mortality in cancer patients. Because most of these patients die of
systemic disease, the primary therapeutic goal is often simply to
improve the quality of life. Conventional therapy for brain
metastases is usually whole-brain irradiation. Chemotherapy may
result in regression of brain metastases in chemosensitive tumors,
but overall, results of adjunctive therapy including chemotherapy
and immunotherapy are disappointing.
[0014] The most widely recognized "barrier" that isolates brain
metastases is the blood-brain barrier (BBB). In addition, the
gliotic capsule that forms around the metastasis forms a
"tumor-brain barrier" (TBB) that also isolates and protects a
metastatic tumor. Unlike primary CNS-derived tumors such as
glioblastoma, metastatic cancers of the brain induce a significant
astrocytic reaction, resulting in formation of a gliotic capsule.
The gliotic capsule that forms around a metastatic tumor represents
the response of the brain to an injurious stimulus--an attempt by
the brain to wall off, isolate, dispose of, and otherwise protect
itself from the metastatic tumor. Importantly, however, the gliotic
capsule also functions as a barrier that protects the metastatic
tumor from immunologic surveillance and therapeutic targeting.
[0015] Successful immunotherapy and chemotherapy for metastatic
brain tumors remains elusive. In general, the difficulty in
treating these tumors is ascribed to presence of the blood brain
barrier (BBB), which is believed to prevent access of
chemotherapeutic agents and immunological cells to tumors located
in the brain. However, much of the blood supply to metastatic
tumors in the brain originates from vessels and capillaries located
in the gliotic capsule that surrounds the tumor, and these
capillaries, unlike those in brain per se, are fenestrated. The
gliotic capsule itself that surrounds the tumor has an inner zone
that is populated by R1 astrocytes that express tight junction
proteins and this inner zone is thought to form a barrier between
tumor and brain. The barrier formed by R1 astrocytes is termed the
tumor-brain barrier (TBB).
[0016] Monotherapies with chemotherapeutic agents tends not to be
very effective because conventional chemotherapeutic agents tend
not to reach portions of the CNS in effective amounts, primarily
because of the blood-brain barrier (BBB). For example, etoposide
and actinomycin D, two commonly used oncology agents that inhibit
topoisomerase II, fail to cross the blood-brain barrier in useful
amounts.
[0017] As described herein, Applicants are the first to determine
that the inner zone of the gliotic capsule is populated by R1
astrocytes expressing the NC.sub.Ca-ATP channel, and selectively
killing the astrocytes expressing the NC.sub.Ca-ATP channel
disrupts the TBB, causing migration of leukocytes across the
TBB.
[0018] Other and further objects, features, and advantages will be
apparent from the following description of the presently preferred
embodiments of the invention, which are given for the purpose of
disclosure.
BRIEF SUMMARY OF THE INVENTION
[0019] The present invention relates to a unique non-selective
cation channel activated by intracellular calcium and blocked by
intracellular ATP (NC.sub.Ca-ATP channel) that can be expressed in
neuronal cells, neuroglia cells (e.g., astrocyte, ependymal cell,
oligodentrocyte and microglia) or neural endothelial cells (e.g.,
capillary endothelial cells) in which the cells have been or are
exposed to a traumatic insult, for example, an acute neuronal
insult (e.g., hypoxia, ischemia, cerebral edema or cell swelling),
toxic compounds or metabolites, an acute injury, cancer, brain
abscess, etc. More particularly, the present invention relates to
the regulation and/or modulation of this NC.sub.Ca-ATP channel and
how its modulation can be used to treat various diseases and/or
conditions, for example hyperproliferative diseases and acute
neuronal insults (e.g., stroke, an ischemic/hypoxic insult). Yet
further, the present invention relates to the regulation and/or
modulation of this NC.sub.Ca-ATP channel and its role in
maintaining or disrupting the integrity of the gliotic capsule. The
modulation and/or regulation of the channel results from
administration of an activator or agonist of the channel or an
antagonist or inhibitor of the channel. Thus, depending upon the
disease, a composition (an antagonist or inhibitor) is administered
to block or inhibit the channel to prevent cell death, for example
to treat cerebral edema that results from ischemia due to tissue
trauma or to increased tissue pressure. In these instances the
channel is blocked to prevent or reduce or modulate depolarization
of the cells. In the case of cancer or other hyperproliferative
diseases, it is desirable to open or activate the channel by
administering an agonist or activator compound to cause cell
depolarization resulting in cell death of the cancer cells or
hyperproliferative cells.
[0020] The composition(s) of the present invention may be delivered
alimentary or parenterally. Examples of alimentary administration
include, but are not limited to orally, buccally, rectally, or
sublingually. Parenteral administration can include, but are not
limited to intramuscularly, subcutaneously, intraperitoneally,
intravenously, intratumorally, intraarterially, intraventricularly,
intracavity, intravesical, intrathecal, or intrapleural. Other
modes of administration may also include topically, mucosally,
transdermally, direct injection into the brain parenchyma.
[0021] An effective amount of an agonist or antagonist of
NC.sub.Ca-ATP channel that may be administered to a cell includes a
dose of about 0.0001 nM to about 2000 .mu.M. More specifically,
doses of an agonist to be administered are from about 0.01 nM to
about 2000 .mu.M; about 0.01 .mu.M to about 0.05 .mu.M; about 0.05
.mu.M to about 1.0 .mu.M; about 1.0 .mu.M to about 1.5 .mu.M; about
1.5 .mu.M to about 2.0 .mu.M; about 2.0 .mu.M to about 3.0 .mu.M;
about 3.0 .mu.M to about 4.0 .mu.M; about 4.0 .mu.M to about 5.0
.mu.M; about 5.0 .mu.M to about 10 .mu.M; about 10 .mu.M to about
50 .mu.M; about 50 .mu.M to about 100 .mu.M; about 100 .mu.M to
about 200 .mu.M; about 200 .mu.M to about 300 .mu.M; about 300
.mu.M to about 500 .mu.M; about 500 .mu.M to about 1000 .mu.M;
about 1000 .mu.M to about 1500 .mu.M and about 1500 .mu.M to about
2000 .mu.M. Of course, all of these amounts are exemplary, and any
amount in-between these points is also expected to be of use in the
invention.
[0022] An effective amount of an agonist and/or antagonist of the
NC.sub.Ca-ATP channel or related-compounds thereof as a treatment
varies depending upon the host treated and the particular mode of
administration. In one embodiment of the invention the dose range
of the agonist and/or antagonist of the NC.sub.Ca-ATP channel or
related-compounds thereof will be about 0.01 .mu.g/kg body weight
to about 20,000 .mu.g/kg body weight. The term "body weight " is
applicable when an animal is being treated. When isolated cells are
being treated, "body weight" as used herein should read to mean
"total cell body weight". The term "total body weight" may be used
to apply to both isolated cell and animal treatment. All
concentrations and treatment levels are expressed as "body weight"
or simply "kg" in this application are also considered to cover the
analogous "total cell body weight" and "total body weight"
concentrations. However, those of skill will recognize the utility
of a variety of dosage range, for example, 0.01 .mu.g/kg body
weight to 20,000 .mu.g/kg body weight, 0.02 .mu.g/kg body weight to
15,000 .mu.g/kg body weight, 0.03 .mu.g/kg body weight to 10,000
.mu.g/kg body weight, 0.04 .mu.g/kg body weight to 5,000 .mu.g/kg
body weight, 0.05 .mu.g/kg body weight to 2,500 .mu.g/kg body
weight, 0.06 .mu.g/kg body weight to 1,000 .mu.g/kg body weight,
0.07 .mu.g/kg body weight to 500 .mu.g/kg body weight, 0.08
.mu.g/kg body weight to 400 .mu.g/kg body weight, 0.09 .mu.g/kg
body weight to 200 .mu.g/kg body weight or 0.1 .mu.g/kg body weight
to 100 .mu.g/kg body weight. Further, those of skill will recognize
that a variety of different dosage levels will be of use, for
example, 0.0001 .mu.g/kg, 0.0002 .mu.g/kg, 0.0003 .mu.g/kg, 0.0004
.mu.g/kg, 0.005 .mu.g/kg, 0.0007 .mu.g/kg, 0.001 .mu.g/kg, 0.1
.mu.g/kg, 1.0 .mu.g/kg, 1.5 .mu.g/kg, 2.0 .mu.g/kg, 5.0 .mu.g/kg,
10.0 .mu.g/kg, 15.0 .mu.g/kg, 30.0 .mu.g/kg, 50 .mu.g/kg, 75
.mu.g/kg, 80 .mu.g/kg, 90 .mu.g/kg, 100 .mu.g/kg, 120 .mu.g/kg, 140
.mu.g/kg, 150 .mu.g/kg, 160 .mu.g/kg, 180 .mu.g/kg, 200 .mu.g/kg,
225 .mu.g/kg, 250 .mu.g/kg, 275 .mu.g/kg, 300 .mu.g/kg, 325
.mu.g/kg, 350 .mu.g/kg, 375 .mu.g/kg, 400 .mu.g/kg, 450 .mu.g/kg,
500 .mu.g/kg, 550 .mu.g/kg, 600 .mu.g/kg, 700 .mu.g/kg, 750
.mu.g/kg, 800 .mu.g/kg, 900 .mu.g/kg, 1 mg/kg, 5 mg/kg, 10 mg/kg,
12 mg/kg, 15 mg/kg, 20 mg/kg, and/or 30 mg/kg. Of course, all of
these dosages are exemplary, and any dosage in-between these points
is also expected to be of use in the invention. Any of the above
dosage ranges or dosage levels may be employed for an agonist
and/or antagonist of NC.sub.Ca-ATP channel or related-compounds
thereof.
[0023] The NC.sub.Ca-ATP channel is blocked by antagonists of type
1 sulfonylurea receptor (SUR1) and opened by SUR1 activators. More
specifically, the antagonists of type 1 sulfonylurea receptor
(SUR1) include blockers of K.sub.ATP channels and the SUR1
activators include activators of K.sub.ATP channels. More
specifically, the NC.sub.Ca-ATP channel of the present invention
has a single-channel conductance to potassium ion (K.sup.+) between
20 and 50 pS. The NC.sub.Ca-ATP channel is also stimulated by
Ca.sup.2+ on the cytoplasmic side of the cell membrane in a
physiological concentration range, where concentration range is
from 10.sup.-8 to 10.sup.-5 M. The NC.sub.Ca-ATP channel is also
inhibited by cytoplasmic ATP in a physiological concentration
range, where the concentration range is from 10.sup.-1 to 10 M. The
NC.sub.Ca-ATP channel is also permeable to the following cations;
K.sup.+, Cs.sup.+, Li.sup.+, Na.sup.+; to the extent that the
permeability ratio between any two of the cations is greater than
0.5 and less than 2.
[0024] Certain embodiments of the present invention comprise a
method of treating a hyperproliferative disease by administering to
a subject an amount of a compound effective to activate a
NC.sub.Ca-ATP channel in a neuronal cell or a neuroglia cell or a
neural endothelial cell or a combination thereof. The activation of
the channel results in an influx of sodium ions (Na.sup.+) causing
depolarization of the cell. The influx of Na.sup.+ alters the
osmotic gradient causing an influx of water into the cell which
leads to cytotoxic edema ultimately resulting in necrotic cell
death.
[0025] The hyperproliferative disease is a tumor, for example, a
benign or malignant tumor. More specifically, the tumor is a
neuroma or glioma. Still further, the tumor can originate from a
primary brain tumor or metastatic brain tumor. Gliomas can include,
but are not limited to astocytoma, brain stem glioma, ependymomas,
optic nerve glioma, and oligodendroglioma. The tumor may also be
gliobastoma, medulloblastoma, papilloma of choroid plexus,
metastases, meningioma, pituitary adenoma, Schwannoma, lymphoma,
congenital tumors, neurosarcoma, neurofibromatosis, neuroblastoma,
craniopharyngioma, pineal region tumors or primitive
neuroectodermal tumors.
[0026] The activator compound or agonist can be a type 1
sulfonylurea receptor agonist. For example, agonists that can be
used in the present invention include, but are not limited to
agonist of SUR1, for example, diazoxide, pinacidil, P1075, and
cromakalin. Other agonists can include, but are not limited to
diazoxide derivatives, for example
3-isopropylamino-7-methoxy-4H-1,2,4-benzothiadiazine 1,1-dioxide
(NNC 55-9216),
6,7-dichloro-3-isopropylamino-4H-1,2,4-benzothiadiazine 1,1-dioxide
(BPDZ 154), 7-chloro-3-isopropylamino-4H-1,2,4-benzothiadiazine
1,1-dioxide (BPDZ 73), 6-Chloro-3-isopropylamino-4
H-thieno[3,2-e]-1,2,4-thiadiazine 1,1-dioxide (NNC 55-0118)4,
6-chloro-3-(1-methylcyclopropyl)amino-4
H-thieno[3,2-e]-1,2,4-thiadiazine 1,1-dioxide (NN414),
3-(3-methyl-2-butylamino)-4H-pyrido[4,3-e]-1,2,4-thiadiazine
1,1-dioxide (BPDZ 44),
3-(1',2',2'-trimethylpropyl)amino-4H-pyrido(4,3-e)-1,2,4-thiadiazine
1,1-dioxide (BPDZ 62), 3-(1',2',2'-trimethylpropyl)amine-4H-pyrido
(2,3-e)-1,2,4-thiadiazine, 1,1-dioxide (BPDZ 79),
2-alkyl-3-alkylamino-2H-benzo- and
2-alkyl-3-alkylamino-2H-pyrido[4,3-e]-1,2,4-thiadiazine
1,1-dioxides,
6-Chloro-3-alkylamino-4H-thieno[3,2-e]-1,2,4-thiadiazine
1,1-dioxide derivatives, 4-N-Substituted and -unsubstituted
3-alkyl- and 3-(alkylamino)-4H-pyrido[4,3-e]-1,2,4-thiadiazine
1,1-dioxides. In addition, other compounds, including
6-chloro-2-methylquinolin-4(1H)-one (HEI 713) and LN 533021, as
well as the class of drugs, arylcyanoguanidines, are known
activators or agonist of SUR1. Other compounds that can be used
include compounds known to activate K.sub.ATP channels.
[0027] In further embodiments, the method comprises administering
to the subject an anti-cancer therapy in combination with the
activator compound that activates or stimulates or opens the
NC.sub.Ca-ATP channel. The anti-cancer or anti-tumor therapy is
chemotherapy, radiotherapy, immunotherapy, surgery or a combination
thereof.
[0028] Another embodiment of the present invention comprises a
method of disrupting the integrity of the tumor-brain barrier
surrounding a tumor in the brain of a subject comprising
administering to the subject a compound effective to activate a
NC.sub.Ca-ATP channel in a neuronal cell, or a neuroglia cell, a
neural endothelial cell or a combination thereof. This method can
further comprise administering to the subject an anti-cancer
therapy, wherein the anti-cancer or anti-tumor therapy is
chemotherapy, radiotherapy, immunotherapy, surgery or a combination
thereof.
[0029] Still further, another embodiment of the present invention
comprises a method of inducing cell death of a neuronal or a
neurolgia cell or a neural endothelial cell comprising
administering to the cell a compound effective to activate a
NC.sub.Ca-ATP channel in the cell. Activation of the NC.sub.Ca-ATP
channel results in an influx of sodium ions (Na.sup.+) causing
depolarization of the cell. The influx of Na.sup.+ alters the
osmotic gradient causing an influx of water into the cell which
leads to cytotoxic edema ultimately resulting in necrotic cell
death.
[0030] Yet further, another embodiment of the present invention
comprises a pharmaceutical composition comprising a thrombolytic
agent (e.g., tissue plasminogen activator (tPA), urokinase,
prourokinase, streptokinase, anistreplase, reteplase,
tenecteplase), an anticoagulant or antiplatelet (e.g., aspirin,
warfarin or coumadin), statins, diuretics, vasodilators, mannitol,
diazoixde or similar compounds that stimulates or promotes ischemic
precondition or a pharmaceutically acceptable salt thereof and a
compound that inhibits a NC.sub.Ca-ATP channel or a
pharmaceutically acceptable salt thereof. This pharmaceutical
composition can be considered neuroprotective. For example, the
pharmaceutical composition comprising a combination of the
thrombolytic agent and a compound that inhibits a NC.sub.Ca-ATP
channel is neuroprotective because it increases the therapeutic
window of for the administration of the thrombolytic agent by
several hours, for example the therapeutic window for
administration of thrombolytic agents may be increased by several
hours (4-8 hrs) by co-administering antagonist of the NC.sub.Ca-ATP
channel.
[0031] The channel can be inhibited by an NC.sub.Ca-ATP channel
inhibitor, an NC.sub.Ca-ATP channel blocker, a type 1 sulfonylurea
receptor (SUR1) antagonist, SUR1 inhibitor, or a compound capable
of reducing the magnitude of membrane current through the channel.
More specifically, the SUR1 antagonist is selected from the group
consisting of glibenclamide, tolbutamide, repaglinide, nateglinide,
meglitinide, midaglizole, LY397364, LY389382, glyclazide,
glimepiride, estrogen, estrogen related-compounds (estradiol,
estrone, estriol, genistein, non-steroidal estrogen (e.g.,
diethystilbestrol), phytoestrogen (e.g., coumestrol), zearalenone,
etc.), and compounds known to inhibit or block K.sub.ATP channels.
MgADP can also be used to inhibit the channel. Other compounds that
can be used to block or inhibit K.sub.ATP channels include, but are
not limited to tolbutamide, glyburide
(1[p-2[5-chloro-O-anisamido)ethyl]phenyl]sulfonyl]-3-cyclohexyl-3-urea);
chlopropamide (1-[[(p-chlorophenyl)sulfonyl]-3-propylurea;
glipizide (1-cyclohexyl-3[[p-[2(5-methylpyrazine
carboxamido)ethyl]phenyl]sulfonyl]urea); or
tolazamide(benzenesulfonamide-N[[(hexahydro-1H-azepin-1yl)amino]carbonyl]-
-4-methyl).
[0032] Another embodiment of the present invention comprises a
composition comprising a membrane preparation derived from a neural
endothelial cell expressing a NC.sub.Ca-ATP channel, wherein
channel is blocked by antagonists of type 1 sulfonylurea receptor
(SUR1) and opened by SUR1 activators. More specifically, the
channel has the following characteristics: (a) it is a 35 pS type
channel; (b) it is stimulated by cytoplasmic Ca.sup.2+ in the
concentration range from about 10.sup.-8 to about 10.sup.-5 M; (c)
it opens when cytoplasmic ATP is less than about 0.8 .mu.M; and (d)
it is permeable to the monovalent cations K.sup.+, Cs.sup.+,
Li.sup.+ and Na.sup.+.
[0033] In further embodiments, the compound that inhibits the
NC.sub.Ca-ATP channel can be administered in combination with a
thrombolytic agent (e.g., tissue plasminogen activator (tPA),
urokinase, prourokinase, streptokinase, anistreplase, reteplase,
tenecteplase), an anticoagulant or antiplatelet (e.g., aspirin,
warfarin or coumadin), statins, diuretics, vasodilators (e.g.,
nitroglycerin), mannitol, diazoixde or similar compounds that
stimulates or promotes ischemic precondition.
[0034] Still further, another embodiment comprises a method of
treating an acute cerebral ischemia in a subject comprising
administering to a subject an amount of a thrombolytic agent or a
pharmaceutically acceptable salt thereof in combination with an
amount of a compound that inhibits a NC.sub.Ca-ATP channel or a
pharmaceutically acceptable salt thereof. In certain embodiments,
the thrombolytic agent is a tissue plasminogen activator (tPA),
urokinase, prourokinase, streptokinase, anistreplase, reteplase,
tenecteplase or any combination thereof. The SUR1 antagonist can be
administered by any standard parenteral or alimentary route, for
example the SUR1 antagonist may be administered as a bolus
injection or as an infusion or a combination thereof.
[0035] The channel is expressed on neuronal cells, neuroglia cells,
neural epithelial cells or a combination thereof. The inhibitor
blocks the influx of Na.sup.+ into the cells thereby preventing
depolarization of the cells. Inhibition of the influx of Na.sup.+
into the cells thereby prevents cytotoxic edema and reduces
hemorrhagic conversion. Thus, this treatment reduces cell death or
necrotic death of neuronal and/or neural endothelial cells.
[0036] In certain embodiments, the amount of the SUR1 antagonist
administered to the subject is in the range of about 0.0001
.mu.g/kg/day to about 20 mg/kg/day, about 0.01 .mu.g/kg/day to
about 100 .mu.g/kg/day, or about 100 .mu.g/kg/day to about 20
mg/kg/day. Still further, the SUR1 antagonist may be administered
to the subject in the from of a treatment in which the treatment
may comprise the amount of the SUR1 antagonist or the dose of the
SUR1 antagonist that is administered per day (1, 2, 3, 4, etc.),
week (1, 2, 3, 4, 5, etc.), month (1, 2, 3, 4, 5, etc.), etc.
Treatments may be administered such that the amount of SUR1
antagonist administered to the subject is in the range of about
0.0001 .mu.g/kg/treatment to about 20 mg/kg/treatment, about 0.01
.mu.g/kg/treatment to about 100 .mu.g/kg/treatment, or about 100
.mu.g/kg/treatment to about 20 mg/kg/treatment.
[0037] Another embodiment of the present invention comprises a
method of reducing mortality of a subject suffering from a stroke
comprising administering to the subject a compound effective to
inhibit a NC.sub.Ca-ATP channel in a neuronal cell, a neuroglia
cell, a neural endothelial cell or a combination thereof. The
compound reduces stroke size and reduces edema located in the
peri-infarct tissue. The compound can be administered alimentary
(e.g., orally, buccally, rectally or sublingually) or parenterally
(e.g., intravenously, intradermally, intramuscularly,
intraarterially, intrathecally, subcutaneously, intraperitoneally,
intraventricularly) and/or topically (e.g., transdermally),
mucosally, or by direct injection into the brain parenchyma.
[0038] Still further, another embodiment comprises a method of
reducing edema in a peri-infarct tissue area of a subject
comprising administering to the subject a compound effective to
inhibit a NC.sub.Ca-ATP channel in a neuronal cell, a neuroglia
cell, an endothelium cell or a combination thereof.
[0039] Further embodiments comprises a method of treating a subject
at risk for developing a stroke comprising administering to the
subject a compound effective to inhibit a NC.sub.Ca-ATP channel in
neuronal cell, a neuroglia cell, a neural endothelial cell or a
combination thereof.
[0040] In certain embodiments, the subject is undergoing treatment
for a cardiac condition, thus the condition increases the subjects
risk for developing a stroke. The treatment, for example, may
comprise the use of thrombolytic agents to treat myocardial
infarctions. Still further, the subject may be at risk for
developing a stroke because the subject suffers from atrial
fibrillation or a clotting disorder. Other subjects that are at
risk for developing a stroke include subjects that are at risk of
developing pulmonary emboli, subjects undergoing surgery (e.g.,
vascular surgery or neurological surgery), or subjects undergoing
treatments that increase their risk for developing a stroke, for
example, the treatment may comprise cerebral/endovascular
treatment, angiography or stent placement.
[0041] Another embodiment of the present invention comprises a
method of treating a subject at risk for developing cerebral edema
comprising administering to the subject a compound effective to
inhibit a NC.sub.Ca-ATP channel in a neuronal cell, a neuroglia
cell, a neural endothelial cell or a combination thereof. The
subject at risk may be suffering from an arterior-venous
malformation, or a mass-occupying lesion (e.g., hematoma) or may be
involved in activities that have an increased risk of brain
trauma.
[0042] Yet further, another embodiment of the present invention
comprises a method of maintaining the integrity of the gliotic
capsule surrounding brain abscess of a subject comprising
administering to the subject a compound effective to inhibit and/or
block a NC.sub.Ca-ATP channel in a neuronal cell, or a neuroglia
cell, a neural endothelial cell or a combination thereof.
[0043] Still further, another method of the present invention
comprises a method of diagnosing neuronal cell edema and/or
cytotoxic damage in the brain comprising: labeling an antagonist of
SUR1; administering the labeled antagonist of SUR1 to a subject;
measuring the levels of labeled antagonist of SUR1 in the brain of
the subject, wherein the presence of labeled antagonist of SUR1
indicates neuronal cell edema and/or cytotoxic damage in the
brain.
[0044] Another method of the present invention comprise determining
the boundaries of a brain tumor comprising: labeling an antagonist
of SUR1; administering the labeled antagonist of SUR1 to a subject;
visualizing the labeled antagonist of SUR1 in the brain of the
subject, wherein the presence of labeled antagonist of SUR1
indicates the boundaries of the brain tumor, for example, a
metastatic tumor. In certain embodiments, the step of visualizing
is performed using by using positron emission topography (PET)
scans.
[0045] In further embodiments, the methods can comprise a method of
determining the penumbra following a stroke comprising: labeling an
antagonist of SUR1; administering the labeled antagonist of SUR1 to
a subject; visualizing the labeled antagonist of SUR1 in the brain
of the subject, wherein the presence of labeled antagonist of SUR1
indicates the penumbra.
[0046] Yet further, the present invention comprises a method
monitoring stroke neural disease comprising: labeling an antagonist
of SUR1; administering the labeled antagonist of SUR1 to a subject;
visualizing the labeled antagonist of SUR1 in the brain of the
subject, wherein the presence of labeled antagonist of SUR1
indicates the progression of the disease. In certain embodiments,
the step is visualizing is performed daily to monitor the
progression of the stroke.
[0047] Another embodiment comprises a neuroprotective infusion kit
comprising a compound that inhibits a NC.sub.Ca-ATP channel in a
neuronal cell, a neuroglia cell, a neural endothelial cell or a
combination thereof and an IV solution. The compound and solution
are contained within the same container or within different
containers. More specifically, the compound is contained within the
container of solution.
[0048] The kit may further comprise a neuroprotective bolus kit,
wherein the bolus kit comprises a pre-loaded syringe of a compound
inhibits a NC.sub.Ca-ATP channel in a neuronal cell, a neuroglia
cell, a neural endothelial cell or a combination thereof.
[0049] Still further, another embodiment comprises a
neuroprotective kit comprising a compound that inhibits
NC.sub.Ca-ATP channel in a neuronal cell, a neuroglia cell, an
endothelium cell or a combination thereof and a thrombolytic agent
(e.g., tPA), an anticoagulant (e.g., warfarin or coumadin), an
antiplatelet (e.g., aspirin), a diuretic (e.g., mannitol), a
statin, or a vasodilator (e.g., nitroglycerin).
[0050] The foregoing has outlined rather broadly the features and
technical advantages of the present invention in order that the
detailed description of the invention that follows may be better
understood. Additional features and advantages of the invention
will be described hereinafter which form the subject of the claims
of the invention. It should be appreciated by those skilled in the
art that the conception and specific embodiment disclosed may be
readily utilized as a basis for modifying or designing other
structures for carrying out the same purposes of the present
invention. It should also be realized by those skilled in the art
that such equivalent constructions do not depart from the spirit
and scope of the invention as set forth in the appended claims. The
novel features which are believed to be characteristic of the
invention, both as to its organization and method of operation,
together with further objects and advantages will be better
understood from the following description when considered in
connection with the accompanying figures. It is to be expressly
understood, however, that each of the figures is provided for the
purpose of illustration and description only and is not intended as
a definition of the limits of the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0051] For a more complete understanding of the present invention,
reference is now made to the following descriptions taken in
conjunction with the accompanying drawing, in which:
[0052] FIG. 1 shows that addition of exogenous
phosphatidylinositol-4,5-bisphosphate (PIP.sub.2) causes activation
of the NC.sub.Ca-ATP channel, despite the presence of ATP in the
bath solution. Initially, channel activity was recorded in an
inside-out patch of membrane from an R1 astrocyte, with a bath
solution containing 1 .mu.M Ca.sup.2+ and 10 .mu.M ATP, which was
sufficient to block channel activity. Addition of 50 .mu.M
PIP.sub.2 resulted in channel activation, reflecting an apparent
decrease in affinity of the channel for ATP.
[0053] FIG. 2 shows that the NC.sub.Ca-ATP channel in an R1
astrocyte is inhibited by estrogen. The initial portion of the
record shows brisk activity from a number of superimposed channels,
recorded in a cell attached patch of membrane from an R1 astrocyte
obtained from a female. Addition of 10 nM estrogen to the bath
promptly resulted in strong inhibition of channel activity. The
mechanism involved is believed to be related to estrogen receptor
mediated activation of phospholipase C (PLC), resulting in
depletion of PIP.sub.2 from the membrane, and reflecting an
apparent increase in affinity for ATP.
[0054] FIGS. 3A-3B show Western blots demonstrating that R1
astrocytes from both males and females express estrogen receptors
and SUR1, a marker of the NC.sub.Ca-ATP channel. Cell lysates were
obtained from gelatin sponge implants from males (M) and females
(F) and studied at two dilutions (4.times. and 1.times.), with
lysates from uterus used as controls. FIG. 3A was developed using
antibodies directed against estrogen receptors (ER), demonstrating
that both ER.alpha. and ER.beta. are expressed in astrocytes from
both genders. Western blots showed that SUR1 is also expressed by
cells from both genders, with pancreatic tissue used as control
(FIG. 3B).
[0055] FIG. 4 shows that the NC.sub.Ca-ATP channel in an R1
astrocyte from a male is inhibited by estrogen. The initial portion
of the record shows brisk activity from a number of superimposed
channels, recorded in a cell attached patch of membrane from an R1
astrocyte obtained from a male. Addition of 10 nM estrogen to the
bath promptly resulted in strong inhibition of channel
activity.
[0056] FIGS. 5A-5D shows the gliotic capsule. FIG. 5A shows a
coronal section of a rat brain sectioned though the site of
implantation of a large gelatin sponge; the sponge (innermost dark
region) is encapsulated by a gliotic capsule (light area), outside
of which is found a region of vasogenic edema (outer dark area),
identified by pre-mortem administration of methylene blue. FIGS. 5B
and 5C show low power and high power views, respectively, of the
gliotic capsule immunolabeled for GFAP. FIG. 5D shows a high power
view of GFAP-labeled cells inside of the gelatin sponge
implant.
[0057] FIGS. 6A-6H show immunolabeled astrocytes. FIGS. 6A, 6C, 6E
show freshly-isolated large phase-bright R1 astrocytes
immunolabeled for GFAP (FIG. 6C) and vimentin (FIG. 6E). FIGS.
6B,D,F show freshly-isolated small phase-dark R2 astrocytes
immunolabeled for GFAP (FIG. 6D) and vimentin (FIG. 6F). FIG. 6G
shows primary cultures of astrocytes isolated from a gliotic
capsule, with R1 astrocytes developing into large polygonal cells
(FIG. 6Gb), and R2 astrocytes developing into small bipolar cells
(FIG. 6Ga). FIG. 6H shows that R2 astrocytes, but not R1
astrocytes, are labeled with fluorescein tagged chlorotoxin derived
from the scorpion, Leiurus quinquestriatus.
[0058] FIGS. 7A-7D show that the inner zone of the gliotic capsule
expresses SUR1 but not SUR2. Immunolabling for SUR1 (FIG. 7A)
showed prominent expression in cells adjacent to the gelatin sponge
(gf), whereas immunolabeling for SUR2 showed no expression (FIG.
7B). A single cell enzymatically isolated from a gelatin sponge
implant and immunolabeled for SUR1 is shown (FIG. 7C). FIG. 7D
shown RT-PCR for SUR1 in control insulinoma cells (lane 2) and in
isolated R1 astrocytes (lane 3), and for SUR2 in control cardiac
cells (lane 4), but not in isolated R1 astrocytes (lane 5).
[0059] FIGS. 8A-8I show various features of the gliotic capsule.
The gliotic capsule is characterized by GFAP-positive cells that
are several cell-layers thick (FIG. 8A). Only the inner zone of the
gliotic capsule is hypoxic, as demonstrated by pimonidozole
labeling (FIG. 8B) and by immunolabeling for HIF1.alpha. (FIG. 8C).
Also, only the inner zone is immunolabeled for SUR1 (FIG. 8D), and
for the tight junction proteins, ZO-1 (FIG. 8E) and occludens (FIG.
8F). FIGS. 8G-8I show that pimonidazole, HIF1.alpha. and occludens
all localize to GFAP-positive astrocytes that form the inner zone
of the gliotic capsule.
[0060] FIGS. 9A-B show effects of NC.sub.Ca-ATP channel inhibition
(FIG. 9A) and NC.sub.Ca-ATP channel activation (FIG. 9B) on the
gliotic capsule. Animals with gelatin sponge implants were treated
with glibenclamide infusion (FIG. 9A) or diazoxide infusion (FIG.
9B) via osmotic mini-pumps that delivered the compounds directly
into the area of the gelatin sponge. Immunolabeling for GFAP showed
that channel inhibition with glibenclamide resulted in formation of
a well defined gliotic capsule (FIG. 9A), whereas channel
activation with diazoxide resulted in formation of a broader,
ill-defined capsule (FIG. 9B), due to diazoxide-induced necrotic
death of inner zone cells.
[0061] FIGS. 10A-B show that infusion of diazoxide into the area
around the gelatin sponge resulted in a heavy infiltration of
polymorphonuclear leukocytes (PMNs). Nuclear labeling with DAPI
showed densely packed small cells in the vicinity of the gelatin
sponge (FIG. 10A), with immunolabeling using the PMN-specific
marker, MMP-8, demonstrating that these cells were PMNs (FIG. 10B).
It is believed that the strong inflammatory response represented by
the infiltrating PMNs was due to disruption of the barrier between
brain and foreign body (gelatin sponge) normally formed by the
inner zone of the gliotic capsule.
[0062] FIGS. 11A-11L show that R1 astrocytes in the inner zone of
the gliotic capsule typically express SUR1, a marker for the
NC.sub.Ca-ATP channel. The inner zones of the gliotic capsules in
rats with gelatin sponge implants (FIGS. 11A-11C), in rats with
cerebral abscess (FIGS. 11D-11F), and in humans with metastatic
tumor (FIGS. 11J-11L) are shown. Also shown is the area of reactive
gloss adjacent to a stroke in the rat (FIGS. 11G-11I) resulting
from occlusion of the middle cerebral artery. In all cases, a field
of cells is labeled for GFAP and co-labelled for SUR1, as
indicated. Examples of single cells at high power are also shown
for each condition.
[0063] FIGS. 12A-12C shows that stellate astrocytes near the edge
of a stroke up-regulate SUR1 (FIG. 12A), a marker of the
NC.sub.Ca-ATP channel. In the middle of the stroke, cells with
altered morphology including blebbing are also immunolabeled for
SUR1 (FIGS. 12B,12C).
[0064] FIGS. 13A-13C show that glibenclamide protects from Na
azide-induced channel opening and necrotic cell death. FIG. 13A
shows phase contrast images of 4 different freshly isolated R1
astrocytes observed over the course of 30 min each. The cell
exposed to vehicle solution alone remained phase bright with no
pathological deterioration (control). The cell depleted of ATP by
exposure to Na azide (1 mM) developed progressive blebbing
consistent with cytotoxic edema. Similarly, the cell exposed to the
NC.sub.Ca-ATP channel opener, diazoxide, developed progressive
blebbing consistent with cytotoxic edema. The cell exposed to Na
azide in the presence of glibenclamide remained phase bright with
no pathological deterioration. FIGS. 13B and 13C show cell death of
isolated R1 astrocytes induced by ATP depletion in vitro. Freshly
isolated R1 astrocytes were labeled for necrotic death with
propidium iodide (PI) (FIG. 13B), or for apoptotic death with
annexin V (FIG. 13C), under control conditions, after exposure to
Na azide (1 mM), or after exposure to Na azide in the presence of
glibenclamide (1 .mu.M). Exposure to Na azide resulted mostly in
necrotic death that was largely prevented by glibenclamide.
[0065] FIGS. 14A-14L shows that SUR1 is up-regulated in MCA stroke.
Watershed area between MCA-ACA in 3 different animals 8-16 hr after
MCA stroke, identified by pre-mortem administration of Evans blue
and postmortem perfusion with India ink (FIG. 14A), by TTC staining
(FIG. 14B) and by immunofluorescence imaging for SUR1 (FIG. 14C).
Immunofluorescence images showing SUR1 at 3 hr in the core of the
stroke in cells (FIG. 14D) double-labeled for the neuronal marker,
NeuN (FIG. 14E), and showing SUR1 at 8 hr in the peri-infarct
region in cells (FIGS. 14G, 14J) double-labeled for the astrocytic
marker, GFAP (FIG. 14H), and the endothelial cell marker, von
Willebrand factor (FIG. 14K). Superimposed images of double-labeled
fields are shown (FIGS. 14F, 14I, and 14L).
[0066] FIGS. 15A-15G show that SUR1 but not Kir6.1 or Kir6.2 is
transcriptionally up-regulated in MCA stroke. Western blots for
SUR1 (.apprxeq.180 kDa) at different times (FIG. 15A) and in
different locations (FIG. 15B) after MCA stroke; in (FIG. 15A),
lysates were all from TTC(+) peri-infarct regions of the involved
hemisphere, obtained at the times indicated; in (FIG. 15B), lysates
were all obtained 8 hr after MCA stoke from the regions indicated;
each individual lane in a and b is from a single animal.
Quantification of the data from (FIG. 15A) and (FIG. 15B),
respectively, combined with comparable data for Kir6.1 and Kir6.2;
for each individual blot, data were normalized to values of
.beta.-actin and to the control data for that blot and analyzed
separately; **, p<0.01. In situ hybridization for SUR1, 3 hr
after MCA stroke; paraffin sections showed that large neuron-like
cells (FIG. 15E) and capillaries (FIG. 15F) in the ischemic zone
were labeled, whereas tissues from the same areas on the control
side were not (FIG. 15G).
[0067] FIGS. 16A-16D show patch clamp recordings of NC.sub.Ca-ATP
channel in neuron-like cells in stroke. FIG. 16A shows
phase-contrast image of large neuron-like cells enzymatically
isolated from ischemic region 3 hr following MCAO. FIG. 16B shows
recording of inside-out patch using Cs.sup.+ as the charge carrier;
channel activity was blocked by glibenclamide given as indicated
(arrow); a and b show expanded records of the portions indicated.
FIG. 16C shows recordings at potentials indicated of inside-out
patch using K.sup.+ as the charge carrier; channel activity was
blocked by glibenclamide. FIG. 16D shows a plot of single channel
amplitudes at different voltages showing single channel slope
conductance of 34 pS.
[0068] FIGS. 17A-17E show that glibenclamide reduces mortality,
edema and stroke size in MCA stroke. In FIG. 17A, Mortality was
assessed during 7 days after MCA stroke [double occlusion model
with malignant cerebral edema (MCE)] in two treatment groups, each
comprised of 19 female and 10 male rats, treated with either saline
(empty symbols) or glibenclamide (filled symbols); mortality at 7
days was significantly different. Subgroup analyses for males and
females showed similar results. In FIG. 17B edema was assessed 8 hr
after MCA stroke (MCE model) in two treatment groups, each
comprised of 6 male rats treated with either saline or
glibenclamide; tissues were first processed with TTC to allow
separation into TTC(+) and TTC(-) portions of the involved
hemisphere and contralateral hemisphere, prior to determining
wet/dry weights; values in TTC(+) regions were statistically
different. In FIGS. 17C-17E, stroke size was assessed 48 hr after
MCA stroke [thromboembolic (TE) model] in two treatment groups,
each comprised of 10 male rats, treated with either saline or
glibenclamide; images of TTC-stained coronal sections following MCA
stroke (TE model) in an animal treated with saline (FIG. 17C) and
another treated with glibenclamide (FIG. 17D), showing cortical
sparing often associated with glibenclamide treatment; values of
stroke size, expressed as percent of hemisphere volume (FIG.
17E).
[0069] FIGS. 18A-18D show that tissue distribution of
BODIPY-glibenclamide in MCA stroke. a-c, Fluorescence images of
brain sections in an animal 6 hr after MCA stroke (MCE model) and
administration of BODIPY-glibenclamide; fluorescent labeling was
evident in cells, microvessels (FIG. 18A) and capillaries (FIG.
18C) from ischemic regions, but not in the contralateral hemisphere
(FIG. 18B); the images in (FIGS. 18A, 18B) are from the same
animal, taken with the same exposure time; in (FIG. 18C), the
single layer of nuclei confirms that the structure brightly labeled
by BODIPY-glibenclamide is a capillary. In FIG. 18D,
immunofluorescence image of a brain section from an animal 6 hr
after MCA stroke (MCE model) labeled with anti-SUR1 antibody
showing strong labeling in a capillary and in adjacent neuron-like
cells.
[0070] FIGS. 19A-9H show that glibenclamide reduces hemorrhagic
conversion. FIGS. 19A-19D are from animals co-treated with saline;
FIGS. 19E-19H are from animals co-treated with glibenclamide The
left column of photographs of coronal sections shows, in rows 1-2
only, intraventricular hemorrhage, plus large areas of hemorrhagic
conversion in ischemic cortical/subcortical regions (red areas on
the right side of pictures; arrows). The right column of
photographs of TTC-processed sections from the same animals show
the areas of infarction.
[0071] FIGS. 20A-20B show zymography showing gelatinase activity of
matrix metalloproteinases (MMP's) in stroke, and absence of direct
MMP inhibition by glibenclamide. FIG. 20A shows activation of MMP-9
& MMP-2 in stroke tissue compared to control; activity of
recombinant MMP-9 & MMP-2 shown at left. FIG. 20B shows
gelatinase activity of recombinant enzyme and stroke tissue under
control conditions (CTR), in presence of glibenclamide (10 .mu.M),
and in presence of MMP inhibitor II (300 nM; Calbiochem).
[0072] FIG. 21 shows phase contrast photomicrograph of cerebral
capillaries freshly isolated from normal brain, after enzymatic
cleaning in preparation for patch clamping.
[0073] FIGS. 22A-22F show that freshly isolated cerebral
endothelial and smooth muscle cells are readily distinguished
electrophysiologically. FIGS. 22A and 22B show superimposed
macroscopic currents recorded during 200 ms depolarizing pulses
from -120 mV to +120 mV in 20 mV steps in an endothelial cell (FIG.
22A) and in an elongated smooth muscle cell (FIG. 22B); holding
potential, -60 mV; nystatin perforated patch technique; bath
solution, standard Krebs with 2 mM Ca.sup.2+; pipette solution, 145
mM K.sup.+. FIGS. 22C and 22D show current-voltage curves computed
from average (mean.+-.SE) currents at the end of 200-ms test pulses
recorded in 9 endothelial cells (FIG. 22C) and 7 smooth muscle
cells (FIG. 22D); same holding potential, technique and solutions
as in FIGS. 22A and 22B. FIGS. 22E and 22F show current voltage
curves recorded during ramp pulses (0.45 mV/ms, holding potential,
-60 mV) in an endothelial cell (FIG. 22E) and in a smooth muscle
cell (FIG. 22F); same holding potential, technique and bath
solution as in FIGS. 22A and 22B, but with pipette solution
containing 145 mM Cs.sup.+ instead of K.sup.+.
[0074] FIG. 23 shows real time RT-PCR showing up-regulation of
SUR1-mRNA in stroke.
[0075] FIGS. 24A-24E show SUR1 knock down (SUR1KD) in R1 astrocytes
protects from ATP-depletion-induced depolarization. FIGS. 24A and
24B show Western blot (FIG. 24A) and quantification of Western
blots (FIG. 24B) of R1 cell lysates confirmed knock down of SUR1
expression by antisense. FIGS. 24C-24E show Na azide caused large
depolarizations in cells exposed to SCR-ODN (FIGS. 24C, 24E) but
little or no depolarization in cells exposed to AS-ODN (FIGS. 24D,
24E).
[0076] FIGS. 25A-25F show transcription factors in stroke.
Immunofluorescence images of subcortical watershed region between
ACA and MCA territories, from ipsilateral peri-infarct tissues 8 hr
after MCAO (FIGS. 25A-D) and from contralateral control tissues
(FIGS. 25E, 25F). The peri-infarct region showed up-regulation of
both transcription factors, Sp1 (FIGS. 25A, 25C) and HIF1.alpha.
(FIG. 25B) in neuron-like cells and capillaries, as well as SUR1 in
capillaries (FIG. 25D). Control tissues showed little Sp1 and no
HIF1.alpha. (FIGS. 25E and 25F).
[0077] FIGS. 26A-26C show an increase in nuclear localization of
the transcription factor, SP1, and SP1 co-localization with SUR1 in
stroke Immunofluorescence images showing increase of nuclear SP1
labeling in ischemic area 3-hr after MCAO (FIG. 26B), compared to
contralateral side (FIG. 26A). FIG. 26C double labeling of large
neuron-like cell showing nuclear SP1 (green) and
cytoplasmic/plasmalemmal SUR1 (red) in the same cell.
[0078] FIGS. 27A-27 show regulation of SUR1 expression by the
transcription factor, HIF1.alpha.. FIGS. 27A and 27C show Western
blot analysis of HIF1.alpha. protein in R1 astrocytes from gelfoam
implant model of control (CTR) and HIF1.alpha. knock-down (KD).
FIGS. 27B and 27C show SUR1 protein in the same cell lysates.
DETAILED DESCRIPTION OF THE INVENTION
[0079] It is readily apparent to one skilled in the art that
various embodiments and modifications can be made to the invention
disclosed in this Application without departing from the scope and
spirit of the invention.
I. DEFINITIONS
[0080] The use of the word "a" or "an" when used in conjunction
with the term "comprising" in the claims and/or the specification
may mean "one," but it is also consistent with the meaning of "one
or more," "at least one," and "one or more than one." The use of
the term "or" in the claims is used to mean "and/or" unless
explicitly indicated to refer to alternatives only or the
alternative are mutually exclusive, although the disclosure
supports a definition that refers to only alternatives and
"and/or."
[0081] As used herein, the term "acute" refers to the onset of a
health effect, usually the effect is a rapid onset that is
considered brief, not prolonged.
[0082] As used herein, the term "acute cerebral ischemia" refers to
a cerebral ischemic event that has a rapid onset and is not
prolonged. The terms "acute cerebral ischemia" and "stroke" can be
used interchangeably."
[0083] As used herein, the term "anti-cancer therapy" or
"anti-tumor" refers to any therapy that destroys a cancer cell
and/or a tumor cell, or slows, arrests, or reverses the growth of a
cancer cell and/or tumor cell. Anti-cancer or anti-tumor therapies
include, without limitation, radiation therapy (radiotherapy),
chemotherapy, or a combination of these therapies.
[0084] As used herein, the term "agonist" refers to a biological or
chemical agent that combines with a receptor on a cell and
initiates the same or equivalent reaction or activity produced by
the binding of an endogenous substance. In the present invention,
the agonist combines, binds, and/or associates with a NC.sub.Ca-ATP
channel of a neuronal cell, a neuroglial cell, or a neural
endothelial cell, such that the NC.sub.Ca-ATP channel is opened
(activated). In certain embodiments, the agonist combines, binds
and/or associates with a regulatory subunit of the NC.sub.Ca-ATP
channel, particularly a SUR1. Alternatively, the agonist combines,
binds, and/or associates with a pore-forming subunit of the
NC.sub.Ca-ATP channel, such that the NC.sub.Ca-ATP channel is
opened (activated). The terms agonist and/or activator can be used
interchangeably.
[0085] As used herein, the term "antagonist" refers to a biological
or chemical agent that acts within the body to reduce the
physiological activity of another chemical or biological substance.
In the present invention, the antagonist blocks, inhibits, reduces
and/or decreases the activity of a NC.sub.Ca-ATP channel of a
neuronal cell, a neuroglia cell or a neural endothelial cell (e.g.,
capillary endothelial cells). In the present invention, the
antagonist combines, binds, associates with a NC.sub.Ca-ATP channel
of neuronal cell, a neuroglia cell or a neural endothelial cell
(e.g., capillary endothelial cells), such that the NC.sub.Ca-ATP
channel is closed (deactivated), meaning reduced biological
activity with respect to the biological activity in the diseased
state. In certain embodiments, the antagonist combines, binds
and/or associates with a regulatory subunit of the NC.sub.Ca-ATP
channel, particularly a SUR1. Alternatively, the antagonist
combines, binds, and/or associates with a pore-forming subunit of
the NC.sub.Ca-ATP channel, such that the NC.sub.Ca-ATP channel is
closed (deactivated). The terms antagonist or inhibitor can be used
interchangeably.
[0086] As used herein, the terms "brain abscess" or "cerebral
abscess" refer to a circumscribed collection of purulent exudate
that is typically associated with swelling.
[0087] As used herein, the terms "blood brain barrier" or "BBB"
refer the barrier between brain blood vessels and brain tissues
whose effect is to restrict what may pass from the blood into the
brain.
[0088] As used herein, the term "cancer" refers to a
hyperproliferation of cells whose unique trait--loss of normal
controls--results in unregulated growth, lack of differentiation,
local tissue invasion, and metastasis. Cancer may include a tumor
comprised of tumor cells. Those of skill in the art understand that
not all cancers comprise tumor cells, for example leukemia does not
comprise tumor cells.
[0089] As used herein, the term "cerebral ischemia" refers to a
lack of adequate blood flow to an area, for example a lack of
adequate blood flow to the brain, which may be the result of a
blood clot, blood vessel constriction, a hemorrhage or tissue
compression from an expanding mass.
[0090] As used herein, the term "depolarization" refers to an
increase in the permeability of the cell membrane to sodium ions
wherein the electrical potential difference across the cell
membrane is reduced or eliminated.
[0091] As used herein, the terms "effective amount" or
"therapeutically effective amount" are interchangeable and refer to
an amount that results in an improvement or remediation of the
symptoms of the disease or condition. Those of skill in the art
understand that the effective amount may improve the patient's or
subject's condition, but may not be a complete cure of the disease
and/or condition.
[0092] As used herein, the term "endothelium" refers a layer of
cells that line the inside surfaces of body cavities, blood
vessels, and lymph vessels or that form capillaries.
[0093] As used herein, the term "endothelial cell" refers to a cell
of the endothelium or a cell that lines the surfaces of body
cavities, for example, blood or lymph vessels or capillaries. In
certain embodiments, the term endothelial cell refers to a neural
endothelial cell or an endothelial cell that is part of the nervous
system, for example the central nervous system or the brain.
[0094] As used herein, the term "hyperproliferative disease" refers
to a disease that results from a hyperproliferation of cells.
Exemplary hyperproliferative diseases include, but are not limited
to cancer, tumors or neoplasms.
[0095] As used herein, the term "gliotic capsule" refers to a
physical barrier surrounding, in whole or in part, a foreign body,
including a metastatic tumor, a cerebral abscess or other mass not
normally found in brain except under pathological conditions. In
certain embodiments, the gliotic capsule comprises an inner zone
comprising neuronal cells, neuroglial cells (e.g., astrocytes)
and/or endothelial cells expressing a NC.sub.Ca-ATP channel.
[0096] The term "morbidity" as used herein is the state of being
diseased. Yet further, morbidity can also refer to the disease rate
or the ratio of sick subjects or cases of disease in to a given
population.
[0097] The term "mortality" as used herein is the state of being
mortal or causing death. Yet further, mortality can also refer to
the death rate or the ratio of number of deaths to a given
population.
[0098] As used herein, the term "neuronal cell" refers to a cell
that is a morphologic and functional unit of the nervous system.
The cell comprises a nerve cell body, the dendrites, and the axon.
The terms neuron, nerve cell, neuronal, neurone, and neurocyte can
be used interchangeably. Neuronal cell types can include, but are
not limited to a typical nerve cell body showing internal
structure, a horizontal cell (of Cajal) from cerebral cortex;
Martinottic cell, biopolar cell, unipolar cell, Pukinje cell, and a
pyramidal cell of motor area of cerebral cortex.
[0099] As used herein, the term "neural" refers to anything
associated with the nervous system.
[0100] As used herein, the terms "neuroglia" or "neuroglial cell"
refers to a cell that is a non-neuronal cellular element of the
nervous system. The terms neuroglia, neurogliacyte, and neuroglial
cell can be used interchangeably. Neuroglial cells can include, but
are not limited to ependymal cells, astrocytes, oligodendrocytes,
or microglia.
[0101] The term "preventing" as used herein refers to minimizing,
reducing or suppressing the risk of developing a disease state or
parameters relating to the disease state or progression or other
abnormal or deleterious conditions.
[0102] As used herein, the term "stroke" refers to any acute,
clinical event related to the impairment of cerebral circulation.
The terms "acute cerebral ischemia" and "stroke" can be used
interchangeably."
[0103] As used herein, the term "tumor" refers to any swelling
tumefaction. Tumor is interchangeable with the term "neoplasm"
which is abnormal tissue growth. Tumors can be malignant or
benign.
[0104] As used herein, the term "tumor-brain barrier" refers to a
biochemical barrier between a foreign body in the brain and the
surrounding tissue of the brain. The tumor-brain barrier is
interchangeably referred to herein as TBB.
[0105] The terms "treating" and "treatment" as used herein refer to
administering to a subject a therapeutically effective amount of a
composition so that the subject has an improvement in the disease
or condition. The improvement is any observable or measurable
improvement. Thus, one of skill in the art realizes that a
treatment may improve the patient's condition, but may not be a
complete cure of the disease. Treating may also comprise treating
subjects at risk of developing a disease and/or condition.
II. THE PRESENT INVENTION
[0106] The present invention is directed to therapeutic
compositions and methods of using the same. In one embodiment, the
therapeutic composition is an agonist and/or antagonist of a
NC.sub.Ca-ATP channel of a neuronal cell, a neuroglial cell, or a
neural endothelial cell.
[0107] In certain embodiments, the present invention is directed to
a method of treating a cancer patient in need of such treatment
comprising administering an agonist of a NC.sub.Ca-ATP channel of
an astrocyte, wherein the agonist activates a NC.sub.Ca-ATP
channel. In specific embodiments, the agonist targets a SUR1 of the
NC.sub.Ca-ATP channel. In certain embodiments, the cancer is
located in the brain and, more specifically, comprises a metastatic
tumor located in the brain.
[0108] In certain embodiments, the agonist of the present invention
disrupts the integrity of the tumor-brain barrier surrounding the
cancer, thereby permitting access to otherwise barred agents across
the tumor-brain barrier. In certain embodiments, the agonist is
administered in combination with an anti-cancer therapy, including
chemotherapy, radiotherapy and/or immunotherapy.
[0109] Alternatively, the present invention is directed to a method
of disrupting a tumor-brain barrier comprising administering an
agonist of a NC.sub.Ca-ATP channel of an astrocyte, wherein said
agonist activates said NC.sub.Ca-ATP channel.
[0110] Methods involving an agonist of the NC.sub.Ca-ATP channel
are directed to selectively killing neuronal cells, neuroglial
cells (e.g., astrocytes) and/or neural endothelial cells expressing
the NC.sub.Ca-ATP channel by infusion of an agonist of the
NC.sub.Ca-ATP channel, such as diazoxide, to the astrocyte. The
infusion can be direct or indirect. Selective killing of neuronal
cells, neuroglial cells (e.g., astrocytes) and/or neural
endothelial cells are desirable when treating a pathology involving
a gliotic capsule, such as a metastatic brain tumor. The agonist
facilitates mounting an immune response, or, alternatively,
improves permeability for chemotherapeutic agents.
[0111] As described herein, the sulfonylurea receptor 1 (SUR1) is
expressed in R1 astrocytes as part of the NC.sub.Ca-ATP channel,
which make up the tumor-brain barrier (TBB) in brain metastasis.
Targeting the SUR1 of the R1 astrocytes with an agonist thereof
compromises the integrity of the TBB, thereby providing a treatment
mechanism for metastatic tumors in the brain. In specific
embodiments, the agonists of the present invention disrupt the
integrity of the gliotic capsule surrounding the foreign body,
thereby permitting entry of otherwise barred biological and/or
endogenous compounds, such as leukocytes, into the gliotic
capsule.
[0112] In certain embodiments, the agonists include, for example, a
compound capable of opening, activating and/or increasing the
activity of an neuronal cells, neuroglial cells (e.g., astrocytes)
and/or neural endothelial cells expressing NC.sub.Ca-ATP channel.
Specifically, the agonists are SUR1 activators such as, diazoxide
and the like, which are known in the art to open (activate) K
channels.
[0113] The present invention is contemplated for use in combination
with chemotherapy, immunotherapy and/or radiotherapy. In the
treatment of solid tumors (e.g., tumors in the lung, colon, breast,
and brain), efficient treatment is hindered by the difficulty in
penetrating the tumor mass with anti-cancer agents (Jain, 1994).
The identification of a means by which to facilitate the delivery
of therapeutic agents to the cancer site is needed to enhance the
effectiveness of current anti-cancer therapies. To address this
need, in alternative embodiments, Applicants provide herein methods
for enhancing, improving and/or increasing anti-cancer therapies by
administering an antagonist of a NC.sub.Ca-ATP channel.
[0114] For in vitro work, various solid tumor models may be used,
such as, for example, the well-recognized inducible breast cancer
model, from which tumor cells may be harvested and re-implanted
into the brain to produce autologous "metastatic" tumors.
[0115] In addition to the sulfonylurea receptor 1 (SUR1) being
expressed in R1 astrocytes as part of the NC.sub.Ca-ATP channel,
the present invention further describes that the SUR1 regulatory
subunit of this channel is up-regulated in neurons and capillary
endothelial cells following ischemia, and blocking this receptor
reduces stroke size, cerebral edema and mortality. Thus,
antagonists of the NC.sub.Ca-ATP channel may have an important role
in preventing, alleviating, inhibiting and/or abrogating the
formation of cytotoxic and ionic edema.
[0116] In other embodiments, the therapeutic compound of the
present invention comprises an antagonist of a NC.sub.Ca-ATP
channel of a neuronal cell, a neuroglial cell, a neural endothelial
cell or a combination thereof. Antagonists are contemplated for use
in treating adverse conditions associated with hypoxia and/or
ischemia that result in increased intracranial pressure and/or
cytotoxic edema of the central nervous system. Such conditions
include trauma, ischemic brain injury, namely secondary neuronal
injury, and hemorrhagic infarction. Antagonists protect the cells
expressing the NC.sub.Ca-ATP channel, which is desirable for
clinical treatment in which gliotic capsule integrity is important
and must be maintained to prevent the spread of infection, such as
with a brain abscess. The protection via inhibition of the
NC.sub.Ca-ATP channel is associated with a reduction in cerebral
edema.
[0117] In one aspect, the NC.sub.Ca-ATP channel is blocked,
inhibited, or otherwise is decreased in activity. In such examples,
an antagonist of the NC.sub.Ca-ATP channel is administered and/or
applied. The antagonist modulates the NC.sub.Ca-ATP channel such
that flux through the channel is reduced, ceased, decreased and/or
stopped. The antagonist may have a reversible or an irreversible
activity with respect to the activity of the NC.sub.Ca-ATP channel
of the neuronal cell, neuroglial cell, endothelial cell or a
combination thereof. The antagonist may prevent or lessen the
depolarization of the cells thereby lessening cell swelling due to
osmotic changes that can result from depolarization of the cells.
Thus, inhibition of the NC.sub.Ca-ATP channel can reduce cytotoxic
edema and death of endothelial cells.
[0118] Subjects that can be treated with the therapeutic
composition of the present invention include, but are not limited
subjects suffering from or at risk of developing conditions
associated hypoxia and/or ischemia that result in increased
intracranial pressure and/or with cytotoxic edema of the central
nervous system (CNS). Such conditions include, but are not limited
to trauma (e.g., traumatic brain injury (TBI), concussion) ischemic
brain injury, hemorrhagic infarction, stroke, atrial fibrillations,
clotting disorders, pulmonary emboli, arterio-venous malformations,
mass-occupying lesions (e.g., hematomas), etc. Still further
subjects at risk of developing such conditions can include subjects
undergoing treatments that increase the risk of stroke, for
example, surgery (vascular or neurological), treatment of
myocardial infarction with thrombolytics, cerebral/endovascular
treatments, stent placements, angiography, etc.
[0119] Another aspect of the present invention comprises
co-administration of an antagonist of the NC.sub.Ca-ATP channel
with a thrombolytic agent. Co-administration of these two compounds
increase the therapeutic window of the thrombolytic agent by
reducing hemorrhagic conversion. The therapeutic window for
thrombolytic agents may be increased by several (4-8) hours by
co-administering antagonist of the NC.sub.Ca-ATP channel.
[0120] In addition to a thrombolytic agent, other agents can be
used in combination with the antagonist of the present invention,
for example, but not limited to antiplatelets, anticoagulants,
vasodilators, statins, diuretics, etc.
[0121] Another aspect of the present invention comprises the use of
labeled SUR1 antagonists to diagnose, determine or monitor stages
of stroke, cerebral edema or visualize the size/boundaries/borders
of a tumor and/or the stroke. For example, the penumbra following
the stroke may be monitored or visualized using labeled SUR1
antagonists.
[0122] Yet further, the compositions of the present invention can
be used to produce neuroprotective kits that are used to treat
subjects at risk or suffering from conditions that are associated
with cytotoxic cerebral edema.
III. NC.sub.CA-ATP CHANNEL
[0123] The invention is based, in part, on the discovery of a
specific channel, the NC.sub.Ca-ATP channel, defined as a channel
on astrocytes in US Application Publication No. 20030215889, which
is incorporated herein by reference in its entirety. More
specifically, the present invention has further defined that this
channel is not only expressed on astrocytes, it is expressed on
neural cells, neuroglial cells, and/or neural endothelial cells
after brain trauma, for example, an hypoxic event, an ischemic
event, or other secondary neuronal injuries relating to these
events.
[0124] The NC.sub.Ca-ATP channel is activated by calcium ions
(Ca.sup.2+) and is sensitive to ATP. Thus, this channel is a
non-selective cation channel activated by intracellular Ca.sup.2+
and blocked by intracellular ATP. When opened by depletion of
intracellular ATP, this channel is responsible for complete
depolarization due to massive Na.sup.+ influx, which creates an
electrical gradient for Cl.sup.- and an osmotic gradient for
H.sub.2O, resulting in cytotoxic edema and cell death. When the
channel is blocked or inhibited, massive Na.sup.+ does not occur
thereby preventing cytotoxic edema.
[0125] Certain functional characteristics distinguishes the
NC.sub.Ca-ATP channel from other known ion channels. These
characteristics can include, but are not limited to 1) it is a
non-selective cation channels that readily allows passage of
Na.sup.+, K.sup.+ and other monovalent cations; 2) it is activated
by an increase in intracellular calcium, and/or by a decrease in
intracellular ATP; 3) it is regulated by sulfonylurea receptor type
1 (SUR1), which heretofore had been considered to be associated
exclusively with K.sub.ATP channels such as those found in
pancreatic .beta. cells.
[0126] More specifically, the NC.sub.Ca-ATP channel of the present
invention has a single-channel conductance to potassium ion
(K.sup.+) between 20 and 50 pS. The NC.sub.Ca-ATP channel is also
stimulated by Ca.sup.2+ on the cytoplasmic side of the cell
membrane in a physiological concentration range, where
concentration range is from 10.sup.-8 to 10.sup.-5 M. The
NC.sub.Ca-ATP channel is also inhibited by cytoplasmic ATP in a
physiological concentration range, where the concentration range is
from 10.sup.-1 to 10 M. The NC.sub.Ca-ATP channel is also permeable
to the following cations; K.sup.+, Cs.sup.+, Li.sup.+, Na.sup.+; to
the extent that the permeability ratio between any two of the
cations is greater than 0.5 and less than 2.
IV. MODULATORS OF THE NC.sub.CA-ATP CHANNEL
[0127] The present invention comprises modulators of the channel,
for example agonists and/or antagonist of the channel. Examples of
antagonist or agonist of the present invention may encompass
agonist and/or antagonists identified in US Application Publication
No. 20030215889, which is incorporated herein by reference in its
entirety. One of skill in the art is aware that the NC.sub.Ca-ATP
channel is comprised to two subunits, the regulatory subunit, SUR1,
and the pore forming subunit.
[0128] A. Modulators of SUR1
[0129] In certain embodiments, antagonists to sulfonylurea
receptor-1 (SUR1) are suitable for blocking the channel. Examples
of suitable SUR1 antagonists include, but are not limited to
glibenclamide, tolbutamide, repaglinide, nateglinide, meglitinide,
midaglizole, LY397364, LY389382, glyclazide, glimepiride, estrogen,
estrogen related-compounds estrogen related-compounds (estradiol,
estrone, estriol, genistein, non-steroidal estrogen (e.g.,
diethystilbestrol), phytoestrogen (e.g., coumestrol), zearalenone,
etc.) and combinations thereof. In a preferred embodiment of the
invention the SUR1 antagonists is selected from the group
consisting of glibenclamide and tolbutamide. Yet further, another
antagonist can be MgADP. Other antagonist include blockers of
K.sub.ATP channels, for example, but not limited to tolbutamide,
glyburide (1[p-2
[5-chloro-O-anisamido)ethyl]phenyl]sulfonyl]-3-cyclohexyl-3-urea);
chlopropamide (1-[[(p-chlorophenyl)sulfonyl]-3-propylurea;
glipizide (1-cyclohexyl-3[[p-[2(5-methylpyrazine carboxamido)
ethyl]phenyl]sulfonyl]urea); or
tolazamide(benzenesulfonamide-N-[[(hexahydro-1H-azepin-1yl)amino]carbonyl-
]-4-methyl).
[0130] Agonists that can be used in the present invention include,
but are not limited to agonist of SUR1, for example, diazoxide,
pinacidil, P1075, cromakalin or activators of K.sub.ATP channels.
Other agonists can include, but are not limited to diazoixde
derivatives, for example
3-isopropylamino-7-methoxy-4H-1,2,4-benzothiadiazine 1,1-dioxide
(NNC 55-9216),
6,7-dichloro-3-isopropylamino-4H-1,2,4-benzothiadiazine 1,1-dioxide
(BPDZ 154), 7-chloro-3-isopropylamino-4H-1,2,4-benzothiadiazine
1,1-dioxide (BPDZ 73), 6-Chloro-3-isopropylamino-4
H-thieno[3,2-e]-1,2,4-thiadiazine 1,1-dioxide (NNC 55-0118)4,
6-chloro-3-(1-methylcyclopropyl)amino-4
H-thieno[3,2-e]-1,2,4-thiadiazine 1,1-dioxide (NN414),
3-(3-methyl-2-butylamino)-4H-pyrido [4,3-e]-1,2,4-thiadiazine
1,1-dioxide (BPDZ 44),
3-(1',2',2'-trimethylpropyl)amino-4H-pyrido(4,3-e)-1,2,4-thiadiazine
1,1-dioxide (BPDZ 62), 3-(1',2',2'-trimethylpropyl)amine-4H-pyrido
(2,3-e)-1,2,4-thiadiazine, 1,1-dioxide (BPDZ 79),
2-alkyl-3-alkylamino-2H-benzo- and
2-alkyl-3-alkylamino-2H-pyrido[4,3-e]-1,2,4-thiadiazine
1,1-dioxides,
6-Chloro-3-alkylamino-4H-thieno[3,2-e]-1,2,4-thiadiazine
1,1-dioxide derivatives, 4-N-Substituted and -unsubstituted
3-alkyl- and 3-(alkylamino)-4H-pyrido[4,3-e]-1,2,4-thiadiazine
1,1-dioxides. In addition, other compounds, including
6-chloro-2-methylquinolin-4(1H)-one (HEI 713) and LN 533021, as
well as the class of drugs, arylcyanoguanidines, are known
activators or agonist of SUR1.
[0131] B. Modulators of SUR1 Transcription and/or Translation
[0132] In certain embodiments, the modulator can be a compound
(protein, nucleic acid, siRNA, etc.) that modulates transcription
and/or translation of SUR1 (regulatory subunit) and/or the
molecular entities that comprise the pore-forming subunit.
[0133] 1. Transcription Factors
[0134] Transcription factors are regulatory proteins that binds to
a specific DNA sequence (e.g., promoters and enhancers) and
regulate transcription of an encoding DNA region. Thus,
transcription factors can be used to modulate the expression of
SUR1. Typically, a transcription factor comprises a binding domain
that binds to DNA (a DNA binding domain) and a regulatory domain
that controls transcription. Where a regulatory domain activates
transcription, that regulatory domain is designated an activation
domain. Where that regulatory domain inhibits transcription, that
regulatory domain is designated a repression domain. More
specifically, transcription factors such as Sp1 and HIF1.alpha. can
be used to modulate expression of SUR1.
[0135] 2. Antisense and Ribozymes
[0136] An antisense molecule that binds to a translational or
transcriptional start site, or splice junctions, are ideal
inhibitors. Antisense, ribozyme, and double-stranded RNA molecules
target a particular sequence to achieve a reduction or elimination
of a particular polypeptide, such as SUR1. Thus, it is contemplated
that antisense, ribozyme, and double-stranded RNA, and RNA
interference molecules are constructed and used to modulate
SUR1.
[0137] a) Antisense Molecules
[0138] Antisense methodology takes advantage of the fact that
nucleic acids tend to pair with complementary sequences. By
complementary, it is meant that polynucleotides are those which are
capable of base-pairing according to the standard Watson-Crick
complementarity rules. That is, the larger purines will base pair
with the smaller pyrimidines to form combinations of guanine paired
with cytosine (G:C) and adenine paired with either thymine (A:T) in
the case of DNA, or adenine paired with uracil (A:U) in the case of
RNA. Inclusion of less common bases such as inosine,
5-methylcytosine, 6-methyladenine, hypoxanthine and others in
hybridizing sequences does not interfere with pairing.
[0139] Targeting double-stranded (ds) DNA with polynucleotides
leads to triple-helix formation; targeting RNA will lead to
double-helix formation. Antisense polynucleotides, when introduced
into a target cell, specifically bind to their target
polynucleotide and interfere with transcription, RNA processing,
transport, translation and/or stability. Antisense RNA constructs,
or DNA encoding such antisense RNAs, are employed to inhibit gene
transcription or translation or both within a host cell, either in
vitro or in vivo, such as within a host animal, including a human
subject.
[0140] Antisense constructs are designed to bind to the promoter
and other control regions, exons, introns or even exon-intron
boundaries of a gene. It is contemplated that the most effective
antisense constructs may include regions complementary to
intron/exon splice junctions. Thus, antisense constructs with
complementarity to regions within 50-200 bases of an intron-exon
splice junction are used. It has been observed that some exon
sequences can be included in the construct without seriously
affecting the target selectivity thereof. The amount of exonic
material included will vary depending on the particular exon and
intron sequences used. One can readily test whether too much exon
DNA is included simply by testing the constructs in vitro to
determine whether normal cellular function is affected or whether
the expression of related genes having complementary sequences is
affected.
[0141] It is advantageous to combine portions of genomic DNA with
cDNA or synthetic sequences to generate specific constructs. For
example, where an intron is desired in the ultimate construct, a
genomic clone will need to be used. The cDNA or a synthesized
polynucleotide may provide more convenient restriction sites for
the remaining portion of the construct and, therefore, would be
used for the rest of the sequence.
[0142] b) RNA Interference
[0143] It is also contemplated in the present invention that
double-stranded RNA is used as an interference molecule, e.g., RNA
interference (RNAi). RNA interference is used to "knock down" or
inhibit a particular gene of interest by simply injecting, bathing
or feeding to the organism of interest the double-stranded RNA
molecule. This technique selectively "knock downs" gene function
without requiring transfection or recombinant techniques (Giet,
2001; Hammond, 2001; Stein P, et al., 2002; Svoboda P, et al.,
2001; Svoboda P, et al., 2000).
[0144] Another type of RNAi is often referred to as small
interfering RNA (siRNA), which may also be utilized to inhibit
SUR1. A siRNA may comprises a double stranded structure or a single
stranded structure, the sequence of which is "substantially
identical" to at least a portion of the target gene (See WO
04/046320, which is incorporated herein by reference in its
entirety). "Identity," as known in the art, is the relationship
between two or more polynucleotide (or polypeptide) sequences, as
determined by comparing the sequences. In the art, identity also
means the degree of sequence relatedness between polynucleotide
sequences, as determined by the match of the order of nucleotides
between such sequences. Identity can be readily calculated. See,
for example: Computational Molecular Biology, Lesk, A. M., ed.
Oxford University Press, New York, 1988; Biocomputing: Informatics
and Genome Projects, Smith, D. W., ea., Academic Press, New York,
1993, and the methods disclosed in WO 99/32619, WO 01/68836, WO
00/44914, and WO 01/36646, specifically incorporated herein by
reference. While a number of methods exist for measuring identity
between two nucleotide sequences, the term is well known in the
art. Methods for determining identity are typically designed to
produce the greatest degree of matching of nucleotide sequence and
are also typically embodied in computer programs. Such programs are
readily available to those in the relevant art. For example, the
GCG program package (Devereux et al.), BLASTP, BLASTN, and FASTA
(Atschul et al.,) and CLUSTAL (Higgins et al., 1992; Thompson, et
al., 1994).
[0145] Thus, siRNA contains a nucleotide sequence that is
essentially identical to at least a portion of the target gene, for
example, SUR1, or any other molecular entity associated with the
NC.sub.Ca-ATP channel such as the pore-forming subunit. One of
skill in the art is aware that the nucleic acid sequences for SUR1
are readily available in GenBank, for example, GenBank accession
L40624, which is incorporated herein by reference in its entirety.
Preferably, the siRNA contains a nucleotide sequence that is
completely identical to at least a portion of the target gene. Of
course, when comparing an RNA sequence to a DNA sequence, an
"identical" RNA sequence will contain ribonucleotides where the DNA
sequence contains deoxyribonucleotides, and further that the RNA
sequence will typically contain a uracil at positions where the DNA
sequence contains thymidine.
[0146] One of skill in the art will appreciate that two
polynucleotides of different lengths may be compared over the
entire length of the longer fragment. Alternatively, small regions
may be compared. Normally sequences of the same length are compared
for a final estimation of their utility in the practice of the
present invention. It is preferred that there be 100% sequence
identity between the dsRNA for use as siRNA and at least 15
contiguous nucleotides of the target gene (e.g., SUR1), although a
dsRNA having 70%, 75%, 80%, 85%, 90%, or 95% or greater may also be
used in the present invention. A siRNA that is essentially
identical to a least a portion of the target gene may also be a
dsRNA wherein one of the two complementary strands (or, in the case
of a self-complementary RNA, one of the two self-complementary
portions) is either identical to the sequence of that portion or
the target gene or contains one or more insertions, deletions or
single point mutations relative to the nucleotide sequence of that
portion of the target gene. siRNA technology thus has the property
of being able to tolerate sequence variations that might be
expected to result from genetic mutation, strain polymorphism, or
evolutionary divergence.
[0147] There are several methods for preparing siRNA, such as
chemical synthesis, in vitro transcription, siRNA expression
vectors, and PCR expression cassettes. Irrespective of which method
one uses, the first step in designing an siRNA molecule is to
choose the siRNA target site, which can be any site in the target
gene. In certain embodiments, one of skill in the art may manually
select the target selecting region of the gene, which may be an ORF
(open reading frame) as the target selecting region and may
preferably be 50-100 nucleotides downstream of the "ATG" start
codon. However, there are several readily available programs
available to assist with the design of siRNA molecules, for example
siRNA Target Designer by Promega, siRNA Target Finder by GenScript
Corp., siRNA Retriever Program by Imgenex Corp., EMBOSS siRNA
algorithm, siRNA program by Qiagen, Ambion siRNA predictor, Ambion
siRNA predictor, Whitehead siRNA prediction, and Sfold. Thus, it is
envisioned that any of the above programs may be utilized to
produce siRNA molecules that can be used in the present
invention.
[0148] c) Ribozymes
[0149] Ribozymes are RNA-protein complexes that cleave nucleic
acids in a site-specific fashion. Ribozymes have specific catalytic
domains that possess endonuclease activity (Kim and Cech, 1987;
Forster and Symons, 1987). For example, a large number of ribozymes
accelerate phosphoester transfer reactions with a high degree of
specificity, often cleaving only one of several phosphoesters in an
oligonucleotide substrate (Cech et al., 1981; Reinhold-Hurek and
Shub, 1992). This specificity has been attributed to the
requirement that the substrate bind via specific base-pairing
interactions to the internal guide sequence ("IGS") of the ribozyme
prior to chemical reaction.
[0150] Ribozyme catalysis has primarily been observed as part of
sequence specific cleavage/ligation reactions involving nucleic
acids (Joyce, 1989; Cech et al., 1981). For example, U.S. Pat. No.
5,354,855 reports that certain ribozymes can act as endonucleases
with a sequence specificity greater than that of known
ribonucleases and approaching that of the DNA restriction enzymes.
Thus, sequence-specific ribozyme-mediated inhibition of gene
expression is particularly suited to therapeutic applications
(Scanlon et al., 1991; Sarver et al., 1990; Sioud et al., 1992).
Most of this work involved the modification of a target mRNA, based
on a specific mutant codon that is cleaved by a specific ribozyme.
In light of the information included herein and the knowledge of
one of ordinary skill in the art, the preparation and use of
additional ribozymes that are specifically targeted to a given gene
will now be straightforward.
[0151] Other suitable ribozymes include sequences from RNase P with
RNA cleavage activity (Yuan et al., 1992; Yuan and Altman, 1994),
hairpin ribozyme structures (Berzal-Herranz et al., 1992; Chowrira
et al., 1993) and hepatitis .delta. virus based ribozymes (Perrotta
and Been, 1992). The general design and optimization of ribozyme
directed RNA cleavage activity has been discussed in detail
(Haseloff and Gerlach, 1988; Symons, 1992; Chowrira, et al., 1994;
and Thompson, et al., 1995).
[0152] The other variable on ribozyme design is the selection of a
cleavage site on a given target RNA. Ribozymes are targeted to a
given sequence by virtue of annealing to a site by complimentary
base pair interactions. Two stretches of homology are required for
this targeting. These stretches of homologous sequences flank the
catalytic ribozyme structure defined above. Each stretch of
homologous sequence can vary in length from 7 to 15 nucleotides.
The only requirement for defining the homologous sequences is that,
on the target RNA, they are separated by a specific sequence which
is the cleavage site. For hammerhead ribozymes, the cleavage site
is a dinucleotide sequence on the target RNA, uracil (U) followed
by either an adenine, cytosine or uracil (A,C or U; Perriman, et
al., 1992; Thompson, et al., 1995). The frequency of this
dinucleotide occurring in any given RNA is statistically 3 out of
16.
[0153] Designing and testing ribozymes for efficient cleavage of a
target RNA is a process well known to those skilled in the art.
Examples of scientific methods for designing and testing ribozymes
are described by Chowrira et al. (1994) and Lieber and Strauss
(1995), each incorporated by reference. The identification of
operative and preferred sequences for use in SUR1 targeted
ribozymes is simply a matter of preparing and testing a given
sequence, and is a routinely practiced screening method known to
those of skill in the art.
[0154] C. Methods of Screening for Modulators
[0155] Further embodiments of the present invention can include
methods for identifying modulators of the NC.sub.Ca-ATP channel,
for example, agonist or antagonist, that modify the activity and/or
expression. These assays may comprise random screening of large
libraries of candidate substances; alternatively, the assays may be
used to focus on particular classes of compounds selected with an
eye towards structural attributes that are believed to make them
more likely to modulate the function or activity or expression of
the NC.sub.Ca-ATP channel.
[0156] By function, it is meant that one may assay for mRNA
expression, protein expression, protein activity, or channel
activity, more specifically, the ability of the modulator to open
or inhibit or block the NC.sub.Ca-ATP channel. Thus, the compounds
for screening in accordance with the invention include, but are not
limited to natural or synthetic organic compounds, peptides,
antibodies and fragments thereof, peptidomimetics, that bind to the
NC.sub.Ca-ATP channel and either open the channel (e.g., agonists)
or block the channel (e.g., antagonists). For use in the treatment
of neural cell swelling or brain swelling, compounds that block the
channel are preferred. Agonists that open or maintain the channel
in the open state include peptides, antibodies or fragments
thereof, and other organic compounds that include the SUR1 subunit
of the NC.sub.Ca-ATP channel (or a portion thereof) and bind to and
"neutralize" circulating ligand for SUR1.
[0157] With reference to screening of compounds that affect the
NC.sub.Ca-ATP channel, libraries of known compounds can be
screened, including natural products or synthetic chemicals, and
biologically active materials, including proteins, for compounds
which are inhibitors or activators. Preferably, such a compound is
an NC.sub.Ca-ATP antagonist, which includes an NC.sub.Ca-ATP
channel inhibitor, an NC.sub.Ca-ATP channel blocker, a SUR1
antagonist, SUR1 inhibitor, and/or a compound capable of reducing
the magnitude of membrane current through the channel.
[0158] Compounds may include, but are not limited to, small organic
or inorganic molecules, compounds available in compound libraries,
peptides such as, for example, soluble peptides, including but not
limited to members of random peptide libraries; (see, e.g., Lam, K.
S. et al., 1991, Nature 354: 82-84; Houghten, R. et al., 1991,
Nature 354: 84-86), and combinatorial chemistry-derived molecular
library made of D- and/or L-configuration amino acids,
phosphopeptides (including, but not limited to, members of random
or partially degenerate, directed phosphopeptide libraries; see,
e.g., Songyang, Z. et al., 1993, Cell 72: 767-778), antibodies
(including, but not limited to, polyclonal, monoclonal, humanized,
anti-idiotypic, chimeric or single chain antibodies, and FAb,
F(ab').sub.2 and FAb expression library fragments, and
epitope-binding fragments thereof).
[0159] Other compounds which can be screened in accordance with the
invention include but are not limited to small organic molecules
that are able to cross the blood-brain barrier, gain entry into an
appropriate neural cell and affect the expression of the
NC.sub.Ca-ATP channel gene or some other gene involved in the
NC.sub.Ca-ATP channel activity (e.g., by interacting with the
regulatory region or transcription factors involved in gene
expression); or such compounds that affect the activity of the
NC.sub.Ca-ATP channel or the activity of some other intracellular
factor involved in the NC.sub.Ca-ATP channel activity.
[0160] To identify, make, generate, provide, manufacture or obtain
modulator, one generally will determine the activity of the
NC.sub.Ca-ATP channel in the presence, absence, or both of the
candidate substance, wherein an inhibitor or antagonist is defined
as any substance that down-regulates, reduces, inhibits, blocks or
decreases the NC.sub.Ca-ATP channel expression or activity, and
wherein an activator or agonist is defined as any substance that
up-regulates, enhances, activates, increases or opens the
NC.sub.Ca-ATP channel. For example, a method may generally
comprise: [0161] (a) providing a candidate substance suspected of
activating or inhibiting the NC.sub.Ca-ATP channel expression or
activity in vitro or in vivo; [0162] (b) assessing the ability of
the candidate substance to activate or inhibit the NC.sub.Ca-ATP
channel expression or activity in vitro or in vivo; [0163] (c)
selecting an modulator; and [0164] (d) manufacturing the
modulator.
[0165] In certain embodiments, an alternative assessing step can be
assessing the ability of the candidate substance to bind
specifically to the NC.sub.Ca-ATP channel in vitro or in vivo;
[0166] In further embodiments, the NC.sub.Ca-ATP channel may be
provided in a cell or a cell free system and the NC.sub.Ca-ATP
channel may be contacted with the candidate substance. Next, the
modulator is selected by assessing the effect of the candidate
substance on the NC.sub.Ca-ATP channel activity or expression. Upon
identification of the modulator, the method may further provide
manufacturing of the modulator.
V. METHODS OF CANCER TREATMENT
[0167] A. Treatment with an Agonist
[0168] In certain embodiments, the present invention is directed to
a method of treating a cancer patient in need of such treatment
comprising administering an agonist of a NC.sub.Ca-ATP channel of
an neuronal cell or a neuroglia cell or a neural endothelial cell,
wherein the agonist activates a NC.sub.Ca-ATP channel In specific
embodiments, the agonist targets a SUR1 of the NC.sub.Ca-ATP
channel. In certain embodiments, the cancer is located in the brain
and, more specifically, comprises a metastatic tumor located in the
brain.
[0169] Alternatively, the present invention is directed to a method
of disrupting a tumor-brain barrier comprising administering an
agonist of a NC.sub.Ca-ATP channel of an astrocyte, wherein said
agonist activates said NC.sub.Ca-ATP channel.
[0170] With the administration of an agonist of the NC.sub.Ca-ATP
channel, cell proliferation is abrogated, slowed, reduced or
inhibited due to the opening of the NC.sub.Ca-ATP channel. Such
neuronal cells in which the agonist the NC.sub.Ca-ATP channel may
be administered may include any cell that expresses SUR1.
[0171] An effective amount of an agonist or antagonist of
NC.sub.Ca-ATP channel that may be administered to a cell includes a
dose of about 0.0001 nM to about 2000 .mu.M. More specifically,
doses of an agonist to be administered are from about 0.01 nM to
about 2000 .mu.M; about 0.01 .mu.M to about 0.05 .mu.M; about 0.05
.mu.M to about 1.0 .mu.M; about 1.0 .mu.M to about 1.5 .mu.M; about
1.5 .mu.M to about 2.0 .mu.M; about 2.0 .mu.M to about 3.0 .mu.M;
about 3.0 .mu.M to about 4.0 .mu.M; about 4.0 .mu.M to about 5.0
.mu.M; about 5.0 .mu.M to about 10 .mu.M; about 10 .mu.M to about
50 .mu.M; about 50 .mu.M to about 100 .mu.M; about 100 .mu.M to
about 200 .mu.M; about 200 .mu.M to about 300 .mu.M; about 300
.mu.M to about 500 .mu.M; about 500 .mu.M to about 1000 .mu.M;
about 1000 .mu.M to about 1500 .mu.M and about 1500 .mu.M to about
2000 .mu.M. Of course, all of these amounts are exemplary, and any
amount in-between these points is also expected to be of use in the
invention.
[0172] It is envisioned that an agonist of NC.sub.Ca-ATP channel or
related-compound thereof will inhibit the proliferation of a cell
or growth of a neoplasm, either directly or indirectly, by
measurably slowing, stopping, or reversing the growth rate of the
cell or neoplasm or neoplastic cells in vitro or in vivo.
Desirably, the growth rate is slowed by 20%, 30%, 50%, or 70% or
more, as determined using a suitable assay for determination of
cell growth rates.
[0173] Still further, the present invention provides methods for
the treatment of a cancer by administering an agonist of the
NC.sub.Ca-ATP channel. The agonist or related-compound thereof can
be administered parenterally or alimentary. Parenteral
administrations include, but are not limited to intravenously,
intradermally, intramuscularly, intraarterially, intrathecally,
intraventricularly, intratumorally, subcutaneous, or
intraperitoneally U.S. Pat. Nos. 6,613,308, 5,466,468, 5,543,158;
5,641,515; and 5,399,363 (each specifically incorporated herein by
reference in its entirety). Alimentary administrations include, but
are not limited to orally, buccally, rectally, or sublingually.
[0174] The administration of the therapeutic compounds and/or the
therapies of the present invention may include systemic, local
and/or regional and may oral, intravenous, and intramuscular.
Alternatively, other routes of administration are also contemplated
such as, for example, arterial perfusion, intracavitary,
intraperitoneal, intrapleural, intraventricular, intratumoral,
intraparenchyma and/or intrathecal. If desired the therapeutic
compound may be administered by the same route as the
chemotherapeutic agent, even if the therapeutic compound and the
chemotherapeutic agent are not administered simultaneously. The
skilled artisan is aware of determining the appropriate
administration route using standard methods and procedures. In one
example, where assessment of a response to chemotherapy, both
peripherally and centrally is desired, the health care professional
may use a systemic administration.
[0175] Treatment methods will involve treating an individual with
an effective amount of a composition containing an agonist of
NC.sub.Ca-ATP channel or related-compound thereof. An effective
amount is described, generally, as that amount sufficient to
detectably and repeatedly to ameliorate, reduce, minimize or limit
the extent of a disease or its symptoms. More specifically, it is
envisioned that the treatment with the an agonist of NC.sub.Ca-ATP
channel or related-compounds thereof will kill cells, inhibit cell
growth, inhibit cell proliferation, inhibit metastasis, decrease
tumor size and otherwise reverse or reduce the malignant phenotype
of tumor cells, either directly or indirectly.
[0176] The effective amount of "therapeutically effective amounts"
of the an agonist of NC.sub.Ca-ATP channel or related-compounds
thereof to be used are those amounts effective to produce
beneficial results, particularly with respect to cancer treatment,
in the recipient animal or patient. Such amounts may be initially
determined by reviewing the published literature, by conducting in
vitro tests or by conducting metabolic studies in healthy
experimental animals. Before use in a clinical setting, it may be
beneficial to conduct confirmatory studies in an animal model,
preferably a widely accepted animal model of the particular disease
to be treated. Preferred animal models for use in certain
embodiments are rodent models, which are preferred because they are
economical to use and, particularly, because the results gained are
widely accepted as predictive of clinical value.
[0177] As is well known in the art, a specific dose level of active
compounds such as an agonist of NC.sub.Ca-ATP channel or
related-compounds thereof for any particular patient depends upon a
variety of factors including the activity of the specific compound
employed, the age, body weight, general health, sex, diet, time of
administration, route of administration, rate of excretion, drug
combination, and the severity of the particular disease undergoing
therapy. The person responsible for administration will determine
the appropriate dose for the individual subject. Moreover, for
human administration, preparations should meet sterility,
pyrogenicity, general safety and purity standards as required by
FDA Office of Biologics standards.
[0178] A therapeutically effective amount of an agonist of
NC.sub.Ca-ATP channel or related-compounds thereof as a treatment
varies depending upon the host treated and the particular mode of
administration. In one embodiment of the invention the dose range
of the agonist of NC.sub.Ca-ATP channel or related-compounds
thereof will be about 0.0001 .mu.g/kg body weight to about 500
mg/kg body weight. The term " body weight " is applicable when an
animal is being treated. When isolated cells are being treated, "
body weight " as used herein should read to mean "total cell body
weight". The term "total body weight" may be used to apply to both
isolated cell and animal treatment. All concentrations and
treatment levels are expressed as "body weight" or simply "kg" in
this application are also considered to cover the analogous "total
cell body weight " and "total body weight" concentrations. However,
those of skill will recognize the utility of a variety of dosage
range, for example, 0.0001 .mu.g/kg body weight to 450 mg/kg body
weight, 0.0002 .mu.g/kg body weight to 400 mg/kg body weight,
0.0003 .mu.g/kg body weight to 350 mg/kg body weight, 0.0004
.mu.g/kg body weight to 300 mg/kg body weight, 0.0005 .mu.g/kg body
weight to 250 mg/kg body weight, 5.0 .mu.g/kg body weight to 200
mg/kg body weight, 10.0 .mu.g/kg body weight to 150 mg/kg body
weight, 100.0 .mu.g/kg body weight to 100 mg/kg body weight, or
1000 .mu.g/kg body weight to 50 mg/kg body weight. Further, those
of skill will recognize that a variety of different dosage levels
will be of use, for example, 0.0001 .mu.g/kg, 0.0002 .mu.g/kg,
0.0003 .mu.g/kg, 0.0004 .mu.g/kg, 0.005 .mu.g/kg, 0.0007 .mu.g/kg,
0.001 .mu.g/kg, 0.1 .mu.g/kg, 1.0 .mu.g/kg, 1.5 .mu.g/kg, 2.0
.mu.g/kg, 5.0 .mu.g/kg, 10.0 .mu.g/kg, 15.0 .mu.g/kg, 30.0
.mu.g/kg, 50 .mu.g/kg, 75 .mu.g/kg, 80 .mu.g/kg, 90 .mu.g/kg, 100
.mu.g/kg, 120 .mu.g/kg, 140 .mu.g/kg, 150 .mu.g/kg, 160 .mu.g/kg,
180 .mu.g/kg, 200 .mu.g/kg, 225 .mu.g/kg, 250 .mu.g/kg, 275
.mu.g/kg, 300 .mu.g/kg, 325 .mu.g/kg, 350 .mu.g/kg, 375 .mu.g/kg,
400 .mu.g/kg, 450 .mu.g/kg, 500 .mu.g/kg, 550 .mu.g/kg, 600
.mu.g/kg, 700 .mu.g/kg, 750 .mu.g/kg, 800 .mu.g/kg, 900 .mu.g/kg, 1
mg/kg, 5 mg/kg, 10 mg/kg, 12 mg/kg, 15 mg/kg, 20 mg/kg, and/or 30
mg/kg. Of course, all of these dosages are exemplary, and any
dosage in-between these points is also expected to be of use in the
invention. Any of the above dosage ranges or dosage levels may be
employed for an agonist of NC.sub.Ca-ATP channel or
related-compounds thereof.
[0179] Administration of the therapeutic agonist of NC.sub.Ca-ATP
channel composition of the present invention to a patient or
subject will follow general protocols for the administration of
chemotherapeutics, taking into account the toxicity, if any, of the
agonist of NC.sub.Ca-ATP channel. It is expected that the treatment
cycles would be repeated as necessary. It also is contemplated that
various standard therapies, as well as surgical intervention, may
be applied in combination with the described therapy.
[0180] The treatments may include various "unit doses." Unit dose
is defined as containing a predetermined quantity of the
therapeutic composition (an agonist of NC.sub.Ca-ATP channel or its
related-compounds thereof) calculated to produce the desired
responses in association with its administration, e.g., the
appropriate route and treatment regimen. The quantity to be
administered, and the particular route and formulation, are within
the skill of those in the clinical arts. Also of import is the
subject to be treated, in particular, the state of the subject and
the protection desired. A unit dose need not be administered as a
single injection but may comprise continuous infusion over a set
period of time.
[0181] According to the present invention, one may treat the cancer
by directly injection a tumor with an agonist of NC.sub.Ca-ATP
channel or related-compound composition. Alternatively, the tumor
may be infused or perfused with the composition using any suitable
delivery vehicle. Local or regional administration, with respect to
the tumor, also is contemplated. More preferably, systemic
administration or oral administration may be performed. Continuous
administration also may be applied where appropriate, for example,
where a tumor is excised and the tumor bed is treated to eliminate
residual, microscopic disease. Delivery via syringe or
catheterization is preferred. Such continuous perfusion may take
place for a period from about 1-2 hours, to about 2-6 hours, to
about 6-12 hours, to about 12-24 hours, to about 1-2 days, to about
1-2 wk or longer following the initiation of treatment. Generally,
the dose of the therapeutic composition via continuous perfusion
will be equivalent to that given by a single or multiple
injections, adjusted over a period of time during which the
perfusion occurs. For tumors of >4 cm, the volume to be
administered will be about 4-10 ml (preferably 10 ml), while for
tumors of <4 cm, a volume of about 1-3 ml will be used
(preferably 3 ml). Multiple injections delivered as single dose
comprise about 0.1 to about 1 ml volumes.
[0182] In certain embodiments, the tumor being treated may not, at
least initially, be resectable. Treatments with therapeutic agonist
of NC.sub.Ca-ATP channel compositions may increase the
resectability of the tumor due to shrinkage at the margins, either
directly or indirectly, or by elimination of certain particularly
invasive portions. Following treatments, resection may be possible.
Additional treatments subsequent to resection will serve to
eliminate microscopic residual disease at the tumor site.
[0183] B. Combined Cancer Therapy with an Agonist of NC.sub.Ca-ATP
Channel and/or Other Anticancer Agents
[0184] In the context of the present invention, it is contemplated
that an agonist of NC.sub.Ca-ATP channel or related-compounds
thereof may be used in combination with an additional therapeutic
agent to more effectively treat cancer. Anticancer agents may
include but are not limited to, radiotherapy, chemotherapy, gene
therapy, hormonal therapy or immunotherapy that targets
cancer/tumor cells.
[0185] When an additional therapeutic agent is administered, as
long as the dose of the additional therapeutic agent does not
exceed previously quoted toxicity levels, the effective amounts of
the additional therapeutic agent may simply be defined as that
amount effective to inhibit and/or reduce the cancer growth when
administered to an animal in combination with an agonist of
NC.sub.Ca-ATP channel or related-compounds thereof. This may be
easily determined by monitoring the animal or patient and measuring
those physical and biochemical parameters of health and disease
that are indicative of the success of a given treatment. Such
methods are routine in animal testing and clinical practice.
[0186] To kill cells, induce cell-cycle arrest, inhibit cell
growth, inhibit metastasis, inhibit angiogenesis or otherwise
reverse or reduce the malignant phenotype of cancer cells, either
directly or indirectly, using the methods and compositions of the
present invention, one would generally contact a cell with agonist
of NC.sub.Ca-ATP channel or related-compounds thereof in
combination with an additional therapeutic agent. These
compositions would be provided in a combined amount effective to
inhibit cell growth and/or induce apoptosis in the cell. This
process may involve contacting the cells with agonist of
NC.sub.Ca-ATP channel or related-compounds thereof in combination
with an additional therapeutic agent or factor(s) at the same time.
This may be achieved by contacting the cell with a single
composition or pharmacological formulation that includes both
agents, or by contacting the cell with two distinct compositions or
formulations, at the same time, wherein one composition includes an
agonist of NC.sub.Ca-ATP channel or derivatives thereof and the
other includes the additional agent.
[0187] Alternatively, treatment with an agonist of NC.sub.Ca-ATP
channel or related-compounds thereof may precede or follow the
additional agent treatment by intervals ranging from minutes to
weeks. In embodiments where the additional agent is applied
separately to the cell, one would generally ensure that a
significant period of time did not expire between the time of each
delivery, such that the agent would still be able to exert an
advantageously combined effect on the cell. In such instances, it
is contemplated that one would contact the cell with both
modalities within about 12-24 hr of each other and, more
preferably, within about 6-12 hr of each other, with a delay time
of only about 12 hr being most preferred. In some situations, it
may be desirable to extend the time period for treatment
significantly, however, where several days (2, 3, 4, 5, 6 or 7) to
several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the
respective administrations.
[0188] It also is conceivable that more than one administration of
either an agonist of NC.sub.Ca-ATP channel or related-compounds
thereof in combination with an additional therapeutic agent such as
an anticancer agent will be desired. Various combinations may be
employed, where an agonist of NC.sub.Ca-ATP channel or
related-compounds thereof is "A" and the additional therapeutic
agent is "B", as exemplified below:
TABLE-US-00001 A/B/A B/A/B B/B/A A/A/B B/A/A A/B/B B/B/B/A B/B/A/B
A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B B/B/B/A A/A/A/B
B/A/A/A A/B/A/A A/A/B/A A/B/B/B B/A/B/B B/B/A/B
[0189] 1. Chemotherapeutic Agents
[0190] In some embodiments of the present invention chemotherapy
may be administered, as is typical, in regular cycles. A cycle may
involve one dose, after which several days or the weeks without
treatment ensues for normal tissues to recover from the drug's side
effects. Doses may be given several days in a row, or every other
day for several days, followed by a period of rest. If more than
one drug is used, the treatment plan will specify how often and
exactly when each drug should be given. The number of cycles a
person receives may be determined before treatment starts (based on
the type and stage of cancer) or may be flexible, in order to take
into account how quickly the tumor is shrinking. Certain serious
side effects may also require doctors to adjust chemotherapy plans
to allow the patient time to recover.
[0191] Chemotherapeutic agents that may be used in combination with
agonists of the present invention or an related-compound thereof in
the treatment of cancer, include, but are not limited to cisplatin
(CDDP), carboplatin, procarbazine, mechlorethamine,
cyclophosphamide, camptothecin, ifosfamide, melphalan,
chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin,
doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP16),
tamoxifen, raloxifene, estrogen receptor binding agents,
gemcitabien, navelbine, farnesyl-protein tansferase inhibitors,
transplatinum, 5-fluorouracil and methotrexate, or any
related-compound or derivative variant of the foregoing.
[0192] 2. Radiotherapeutic Agents
[0193] Radiotherapeutic agents may also be use in combination with
the compounds of the present invention in treating a cancer. Such
factors that cause DNA damage and have been used extensively
include what are commonly known as .gamma.-rays, X-rays, and/or the
directed delivery of radioisotopes to tumor cells. Other forms of
DNA damaging factors are also contemplated such as microwaves and
UV-irradiation. It is most likely that all of these factors effect
a broad range of damage on DNA, on the precursors of DNA, on the
replication and repair of DNA, and on the assembly and maintenance
of chromosomes. Dosage ranges for X-rays range from daily doses of
50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to
single doses of 2000 to 6000 roentgens. Dosage ranges for
radioisotopes vary widely, and depend on the half-life of the
isotope, the strength and type of radiation emitted, and the uptake
by the neoplastic cells.
[0194] 3. Immunotherapeutic Agents
[0195] Immunotherapeutics may also be employed in the present
invention in combination with an agonist of NC.sub.Ca-ATP channel
or related-compounds thereof in treating cancer Immunotherapeutics,
generally, rely on the use of immune effector cells and molecules
to target and destroy cancer cells. The immune effector may be, for
example, an antibody specific for some marker on the surface of a
tumor cell. The antibody alone may serve as an effector of therapy
or it may recruit other cells to actually effect cell killing. The
antibody also may be conjugated to a drug or toxin
(chemotherapeutic, radionuclide, ricin A chain, cholera toxin,
pertussis toxin, etc.) and serve merely as a targeting agent.
Alternatively, the effector may be a lymphocyte carrying a surface
molecule that interacts, either directly or indirectly, with a
tumor cell target. Various effector cells include cytotoxic T cells
and NK cells.
[0196] Generally, the tumor cell must bear some marker that is
amenable to targeting, e.g., is not present on the majority of
other cells. Many tumor markers exist and any of these may be
suitable for targeting in the context of the present invention.
Common tumor markers include carcinoembryonic antigen, prostate
specific antigen, urinary tumor associated antigen, fetal antigen,
tyrosinase (p97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA,
MucB, PLAP, estrogen receptor, laminin receptor, erb B and
p155.
[0197] 4. Inhibitors of Cellular Proliferation
[0198] The tumor suppressor oncogenes function to inhibit excessive
cellular proliferation. The inactivation of these genes destroys
their inhibitory activity, resulting in unregulated proliferation.
The tumor suppressors p53, p16 and C-CAM are described below.
[0199] High levels of mutant p53 have been found in many cells
transformed by chemical carcinogenesis, ultraviolet radiation, and
several viruses. The p53 gene is a frequent target of mutational
inactivation in a wide variety of human tumors and is already
documented to be the most frequently mutated gene in common human
cancers. It is mutated in over 50% of human NSCLC (Hollstein et
al., 1991) and in a wide spectrum of other tumors.
[0200] The p53 gene encodes a 393-amino acid phosphoprotein that
can form complexes with host proteins such as large-T antigen and
E1B. The protein is found in normal tissues and cells, but at
concentrations which are minute by comparison with transformed
cells or tumor tissue
[0201] Wild-type p53 is recognized as an important growth regulator
in many cell types. Missense mutations are common for the p53 gene
and are essential for the transforming ability of the oncogene. A
single genetic change prompted by point mutations can create
carcinogenic p53. Unlike other oncogenes, however, p53 point
mutations are known to occur in at least 30 distinct codons, often
creating dominant alleles that produce shifts in cell phenotype
without a reduction to homozygosity. Additionally, many of these
dominant negative alleles appear to be tolerated in the organism
and passed on in the germ line. Various mutant alleles appear to
range from minimally dysfunctional to strongly penetrant, dominant
negative alleles (Winberg, 1991).
[0202] Another inhibitor of cellular proliferation is p16. The
major transitions of the eukaryotic cell cycle are triggered by
cyclin-dependent kinases, or CDK's. One CDK, cyclin-dependent
kinase 4 (CDK4), regulates progression through the G1. The activity
of this enzyme may be to phosphorylate Rb at late G1. The activity
of CDK4 is controlled by an activating subunit, D-type cyclin, and
by an inhibitory subunit, the p16INK4 has been biochemically
characterized as a protein that specifically binds to and inhibits
CDK4, and thus may regulate Rb phosphorylation (Serrano et al.,
1993; Serrano et al., 1995). Since the p16INK4 protein is a CDK4
inhibitor (Serrano, 1993), deletion of this gene may increase the
activity of CDK4, resulting in hyperphosphorylation of the Rb
protein. p16 also is known to regulate the function of CDK6.
[0203] p16INK4 belongs to a newly described class of CDK-inhibitory
proteins that also includes p16B, p19, p21WAF1, and p27KIP1. The
p16INK4 gene maps to 9p21, a chromosome region frequently deleted
in many tumor types. Homozygous deletions and mutations of the
p16INK4 gene are frequent in human tumor cell lines. This evidence
suggests that the p16INK4 gene is a tumor suppressor gene. This
interpretation has been challenged, however, by the observation
that the frequency of the p16INK4 gene alterations is much lower in
primary uncultured tumors than in cultured cell lines (Caldas et
al., 1994; Cheng et al., 1994; Hussussian et al., 1994; Kamb et
al., 1994; Okamoto et al., 1994; Arap et al., 1995). Restoration of
wild-type p16INK4 function by transfection with a plasmid
expression vector reduced colony formation by some human cancer
cell lines (Okamoto et al., 1994; Arap et al., 1995).
[0204] Other genes that may be employed according to the present
invention include Rb, mda-7, APC, DCC, NF-1, NF-2, WT-1, MEN-I,
MEN-II, zac1, p73, VHL, MMAC1/PTEN, DBCCR-1, FCC, rsk-3, p27,
p27/p16 fusions, p21/p27 fusions, anti-thrombotic genes (e.g.,
COX-1, TFPI), PGS, Dp, E2F, ras, myc, neu, raf, erb, fms, trk, ret,
gsp, hst, abl, E1A, p300, genes involved in angiogenesis (e.g.,
VEGF, FGF, thrombospondin, BAI-1, GDAIF, or their receptors) and
MCC.
[0205] 5. Regulators of Programmed Cell Death
[0206] Apoptosis, or programmed cell death, is an essential process
in cancer therapy (Kerr et al., 1972). The Bcl-2 family of proteins
and ICE-like proteases have been demonstrated to be important
regulators and effectors of apoptosis in other systems. The Bcl-2
protein, discovered in association with follicular lymphoma, plays
a prominent role in controlling apoptosis and enhancing cell
survival in response to diverse apoptotic stimuli (Bakhshi et al.,
1985; Cleary and Sklar, 1985; Cleary et al., 1986; Tsujimoto et
al., 1985; Tsujimoto and Croce, 1986). The evolutionarily conserved
Bcl-2 protein now is recognized to be a member of a family of
related proteins, which can be categorized as death agonists or
death antagonists.
[0207] Members of the Bcl-2 that function to promote cell death
such as Bax, Bak, Bik, Bim, Bid, Bad and Harakiri, are contemplated
for use in combination with an agonist of NC.sub.Ca-ATP channel or
an related-compound thereof in treating cancer.
[0208] 6. Surgery
[0209] It is further contemplated that a surgical procedure may be
employed in the present invention. Approximately 60% of persons
with cancer will undergo surgery of some type, which includes
preventative, diagnostic or staging, curative and palliative
surgery. Curative surgery includes resection in which all or part
of cancerous tissue is physically removed, excised, and/or
destroyed. Tumor resection refers to physical removal of at least
part of a tumor. In addition to tumor resection, treatment by
surgery includes laser surgery, cryosurgery, electrosurgery, and
miscopically controlled surgery (Mohs' surgery). It is further
contemplated that the present invention may be used in conjunction
with removal of superficial cancers, precancers, or incidental
amounts of normal tissue.
[0210] Upon excision of part of all of cancerous cells, tissue, or
tumor, a cavity may be formed in the body. Treatment may be
accomplished by perfusion, direct injection or local application of
the area with an additional anti-cancer therapy. Such treatment may
be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or
every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, or 12 months. These treatments may be of varying dosages as
well.
[0211] 7. Other agents
[0212] It is contemplated that other agents may be used in
combination with the present invention to improve the therapeutic
efficacy of treatment. These additional agents include
immunomodulatory agents, agents that affect the upregulation of
cell surface receptors and GAP junctions, cytostatic and
differentiation agents, inhibitors of cell adhesion, or agents that
increase the sensitivity of the hyperproliferative cells to
apoptotic inducers Immunomodulatory agents include tumor necrosis
factor; interferon alpha, beta, and gamma; IL-2 and other
cytokines; F42K and other cytokine related-compounds; or MIP-1,
MIP-1beta, MCP-1, RANTES, and other chemokines. It is further
contemplated that the upregulation of cell surface receptors or
their ligands such as Fas/Fas ligand, DR4 or DR5/TRAIL would
potentiate the apoptotic inducing abilities of the present
invention by establishment of an autocrine or paracrine effect on
hyperproliferative cells. Increased intercellular signaling by
elevating the number of GAP junctions would increase the
anti-hyperproliferative effects on the neighboring
hyperproliferative cell population. In other embodiments,
cytostatic or differentiation agents can be used in combination
with the present invention to improve the anti-hyperproliferative
efficacy of the treatments. Inhibitors of cell adhesion are
contemplated to improve the efficacy of the present invention.
Examples of cell adhesion inhibitors are focal adhesion kinase
(FAKs) inhibitors and Lovastatin. It is further contemplated that
other agents that increase the sensitivity of a hyperproliferative
cell to apoptosis, such as the antibody c225, could be used in
combination with the present invention to improve the treatment
efficacy.
VI. METHODS OF CEREBRAL ISCHEMIA TREATMENT
[0213] A. Treatment with an Antagonist
[0214] In other embodiments, the therapeutic compound of the
present invention comprises an antagonist of a NC.sub.Ca-ATP
channel of a neuronal cell, a neuroglial cell, a neural endothelial
cell or a combination thereof. Antagonists are contemplated for use
in treating adverse conditions associated with intracranial
pressure and/or cytotoxic edema of the central nervous system. Such
conditions include trauma (e.g., traumatic brain injury (TBI)),
ischemic brain injury, primary and secondary neuronal injury,
stroke, arteriovenous malformations (AVM), mass-occupying lesion
(e.g., hematoma), and hemorrhagic infarction. Antagonists protect
the cells expressing the NC.sub.Ca-ATP channel, which is desirable
for clinical treatment in which ionic or cytotoxic edema is formed,
in which capillary integrity is lost following ischemia, and in
which gliotic capsule integrity is important and must be maintained
to prevent the spread of infection, such as with a brain abscess.
Those of skill in the art realize that a brain abscess is a
completely enclosed and results in cerebral swelling. The
protection via inhibition of the NC.sub.Ca-ATP channel is
associated with a reduction in cerebral ionic and cytotoxic edema.
Thus, the compound that inhibits the NC.sub.Ca-ATP channel is
neuroprotective.
[0215] In one aspect, the NC.sub.Ca-ATP channel is blocked,
inhibited, or otherwise is decreased in activity. In such examples,
an antagonist of the NC.sub.Ca-ATP channel is administered and/or
applied. The antagonist modulates the NC.sub.Ca-ATP channel such
that flux (ion and/or water) through the channel is reduced,
ceased, decreased and/or stopped. The antagonist may have a
reversible or an irreversible activity with respect to the activity
of the NC.sub.Ca-ATP channel of the neuronal cell, neuroglial cell,
a neural endothelial cell or a combination thereof. Thus,
inhibition of the NC.sub.Ca-ATP channel can reduce cytotoxic edema
and death of endothelial cells which are associated with formation
of ionic edema and with hemorrhagic conversion.
[0216] Accordingly, the present invention is useful in the
treatment or alleviation of acute cerebral ischemia. According to a
specific embodiment of the present invention the administration of
effective amounts of the active compound can block the channel,
which if remained open leads to neuronal cell swelling and cell
death. A variety of antagonists to SUR1 are suitable for blocking
the channel. Examples of suitable SUR1 antagonists include, but are
not limited to glibenclamide, tolbutamide, repaglinide,
nateglinide, meglitinide, midaglizole, LY397364, LY389382,
glyclazide, glimepiride, estrogen, estrogen related-compounds and
combinations thereof. In a preferred embodiment of the invention
the SUR1 antagonists is selected from the group consisting of
glibenclamide and tolbutamide. Another antagonist that can be used
is MgADP. Still other therapeutic "strategies" for preventing
neural cell swelling and cell death can be adopted including, but
not limited to methods that maintain the neural cell in a polarized
state and methods that prevent strong depolarization.
[0217] In further embodiments, inhibitors or antagonist of the
NC.sub.Ca-ATP channel can be used to reduce or alleviate or
abrogate hemorrhagic conversion. The pathological sequence that
takes place in capillaries after ischemia can be divided into 3
stages, based on the principal constituents that move from the
intravascular compartment into brain parenchyma (Ayata 2002; Betz,
1996; Betz 1989). The first stage is characterized by formation of
"ionic" edema, during which the BBB remains intact, with movement
of electrolytes (Na.sup.+, Cl.sup.-) plus water into brain
parenchyma. The second stage is characterized by formation of
"vasogenic" edema, due to breakdown of the BBB, during which
macromolecules plus water enter into brain parenchyma. The third
stage is characterized by hemorrhagic conversion, due to
catastrophic failure of capillaries, during which all constituents
of blood extravasate into brain parenchyma. In accordance with
Starling's law, understanding these phases requires that 2 things
be identified: (i) the driving force that "pushes" things into
parenchyma; and (ii) the permeability pore that allows passage of
these things into parenchyma.
[0218] Thus, the use of the antagonist or related-compounds thereof
can reduce the mortality of a subject suffering from a stroke
and/or rescue the penumbra area or prevent damage in the penumbra
area which comprises areas of tissue that are at risk of becoming
irreversibly damaged.
[0219] With the administration of an antagonist of the
NC.sub.Ca-ATP channel, endothelial cell depolarization is
abrogated, slowed, reduced or inhibited due to the opening of the
NC.sub.Ca-ATP channel Thus, abrogation of cell depolarization
results in abrogation or inhibition of Na influx, which prevents a
change in osmotic gradient thereby preventing an influx of water
into the endothelial cell and stopping cell swelling, blebbing and
cytotoxic edema. Thus, preventing or inhibiting or attenuating
endothelial cell depolarization can prevent or reduce hemorrhagic
conversion.
[0220] Neuronal cells in which the antagonist of the NC.sub.Ca-ATP
channel may be administered may include any cell that expresses
SUR1, for example any neuronal cell, neuroglial cell or a neural
endothelia cell.
[0221] Subjects that may be treated with the antagonist or
related-compound thereof include those that are suffering from or
at risk of developing trauma (e.g., traumatic brain injury (TBI)),
ischemic brain injury, primary and secondary neuronal injury,
stroke, arteriovenous malformations (AVM), brain abscess,
mass-occupying lesion, hemorrhagic infarction, or any other
condition associated with cerebral hypoxia or cerebral ischemia
resulting in cerebral edema and/or increased intracranial pressure,
for example, but not limited to brain mass, brain edema, hematoma,
end stage cerebral edema, encephalopathies, etc. Thus, the
antagonist can be a therapeutic treatment in which the therapeutic
treatment includes prophylaxis or a prophylactic treatment. The
antagonist or related-compounds thereof are neuroprotective.
[0222] Other subjects that may be treated with the antagonist of
the present invention include those subjects that are at risk or
predisposed to developing a stroke. Such subjects can include, but
are not limited to subjects that suffer from atrial fibrillations,
clotting disorders, and/or risk of pulmonary emboli.
[0223] In certain embodiments, a subject at risk for developing a
stroke may include subjects undergoing treatments, for example, but
not limited to cerebral/endovascular treatments, surgery (e.g.,
craniotomy, cranial surgery, removal of brain tumors (e.g.,
hematoma), coronary artery bypass grafting (CABG), angiography,
stent replacement, other vascular surgeries, and/or other CNS or
neurological surgeries), and treatment of myocardial infarction
(MI) with thrombolytics. In such cases, the subject may be treated
with the antagonist or related-compound of the present invention
prior to the actual treatment. Pretreatment can include
administration of the antagonist and/or related-compound months (1,
2, 3, etc.), weeks (1, 2, 3, etc.), days (1, 2, 3, etc.), hours (1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12), or minutes (15, 30, 60, 90,
etc.) prior to the actual treatment or surgery. Treatment of the
antagonist and/or related-compound can continue during the
treatment and/or surgery and after the treatment and/or surgery
until the risk of developing a stroke in the subject is decreased,
lessened or alleviated.
[0224] In further embodiments, the antagonist of the present
invention can be given to a subject at risk of developing head/neck
trauma, such as a subject involved in sports or other activities
that have an increased risk of head/neck trauma.
[0225] An effective amount of an antagonist of the NC.sub.Ca-ATP
channel that may be administered to a cell includes a dose of about
0.0001 nM to about 2000 .mu.M. More specifically, doses of an
agonist to be administered are from about 0.01 nM to about 2000
.mu.M; about 0.01 .mu.M to about 0.05 .mu.M; about 0.05 .mu.M to
about 1.0 .mu.M; about 1.0 .mu.M to about 1.5 .mu.M; about 1.5
.mu.M to about 2.0 .mu.M; about 2.0 .mu.M to about 3.0 .mu.M; about
3.0 .mu.M to about 4.0 .mu.M; about 4.0 .mu.M to about 5.0 .mu.M;
about 5.0 .mu.M to about 10 .mu.M; about 10 .mu.M to about 50
.mu.M; about 50 .mu.M to about 100 .mu.M; about 100 .mu.M to about
200 .mu.M; about 200 .mu.M to about 300 .mu.M; about 300 .mu.M to
about 500 .mu.M; about 500 .mu.M to about 1000 .mu.M; about 1000
.mu.M to about 1500 .mu.M and about 1500 .mu.M to about 2000 .mu.M.
Of course, all of these amounts are exemplary, and any amount
in-between these points is also expected to be of use in the
invention.
[0226] The antagonist or related-compound thereof can be
administered parenterally or alimentary. Parenteral administrations
include, but are not limited to intravenously, intradermally,
intramuscularly, intraarterially, intrathecally, subcutaneous, or
intraperitoneally U.S. Pat. Nos. 6,613,308, 5,466,468, 5,543,158;
5,641,515; and 5,399,363 (each specifically incorporated herein by
reference in its entirety). Alimentary administrations include, but
are not limited to orally, buccally, rectally, or sublingually.
[0227] The administration of the therapeutic compounds and/or the
therapies of the present invention may include systemic, local
and/or regional administrations, for example, topically (dermally,
transdermally), via catheters, implantable pumps, etc.
Alternatively, other routes of administration are also contemplated
such as, for example, arterial perfusion, intracavitary,
intraperitoneal, intrapleural, intraventricular and/or intrathecal.
The skilled artisan is aware of determining the appropriate
administration route using standard methods and procedures. Other
routes of administration are discussed elsewhere in the
specification and are incorporated herein by reference.
[0228] Treatment methods will involve treating an individual with
an effective amount of a composition containing an antagonist of
NC.sub.Ca-ATP channel or related-compound thereof. An effective
amount is described, generally, as that amount sufficient to
detectably and repeatedly to ameliorate, reduce, minimize or limit
the extent of a disease or its symptoms. More specifically, it is
envisioned that the treatment with the an antagonist of
NC.sub.Ca-ATP channel or related-compounds thereof will inhibit
cell depolarization, inhibit Na influx, inhibit an osmotic gradient
change, inhibit water influx into the cell, inhibit cytotoxic cell
edema, decrease stroke size, inhibit hemorrhagic conversion, and
decrease mortality of the subject.
[0229] The effective amount of an antagonist of NC.sub.Ca-ATP
channel or related-compounds thereof to be used are those amounts
effective to produce beneficial results, particularly with respect
to stroke treatment, in the recipient animal or patient. Such
amounts may be initially determined by reviewing the published
literature, by conducting in vitro tests or by conducting metabolic
studies in healthy experimental animals. Before use in a clinical
setting, it may be beneficial to conduct confirmatory studies in an
animal model, preferably a widely accepted animal model of the
particular disease to be treated. Preferred animal models for use
in certain embodiments are rodent models, which are preferred
because they are economical to use and, particularly, because the
results gained are widely accepted as predictive of clinical
value.
[0230] As is well known in the art, a specific dose level of active
compounds such as an antagonist of the NC.sub.Ca-ATP channel or
related-compounds thereof for any particular patient depends upon a
variety of factors including the activity of the specific compound
employed, the age, body weight, general health, sex, diet, time of
administration, route of administration, rate of excretion, drug
combination, and the severity of the particular disease undergoing
therapy. The person responsible for administration will determine
the appropriate dose for the individual subject. Moreover, for
human administration, preparations should meet sterility,
pyrogenicity, general safety and purity standards as required by
FDA Office of Biologics standards.
[0231] One of skill in the art realizes that the effective amount
of the antagonist or related-compound thereof can be the amount
that is required to achieve the desired result: reduction in the
risk of stroke, reduction in intracranial pressure, reduction in
cell death, reduction in stroke size, etc. This amount also is an
amount that maintains a reasonable level of blood glucose in the
patient, for example, the amount of the antagonist maintains a
blood glucose level of at least 60 mmol/l, more preferably, the
blood glucose level is maintain in the range of about 60 mmol/l to
about 150 mmol/l. Thus, the amounts prevents the subject from
becoming hypoglycemic. If glucose levels are not normal, then one
of skill in the art would administer either insulin or glucose,
depending upon if the patient is hypoglycemic or hyperglycemic.
[0232] An effective amount of an antagonist of the NC.sub.Ca-ATP
channel or related-compounds thereof as a treatment varies
depending upon the host treated and the particular mode of
administration. In one embodiment of the invention the dose range
of the antagonist of the NC.sub.Ca-ATP channel or related-compounds
thereof will be about 0.01 .mu.g/kg body weight to about 20,000
.mu.g/kg body weight. The term " body weight " is applicable when
an animal is being treated. When isolated cells are being treated,
" body weight " as used herein should read to mean "total cell body
weight". The term "total body weight" may be used to apply to both
isolated cell and animal treatment. All concentrations and
treatment levels are expressed as "body weight" or simply "kg" in
this application are also considered to cover the analogous "total
cell body weight" and "total body weight" concentrations. However,
those of skill will recognize the utility of a variety of dosage
range, for example, 0.01 .mu.g/kg body weight to 20,000 .mu.g/kg
body weight, 0.02 .mu.g/kg body weight to 15,000 .mu.g/kg body
weight, 0.03 .mu.g/kg body weight to 10,000 .mu.g/kg body weight,
0.04 .mu.g/kg body weight to 5,000 .mu.g/kg body weight, 0.05
.mu.g/kg body weight to 2,500 .mu.g/kg body weight, 0.06 .mu.g/kg
body weight to 1,000 .mu.g/kg body weight, 0.07 .mu.g/kg body
weight to 500 .mu.g/kg body weight, 0.08 .mu.g/kg body weight to
400 .mu.g/kg body weight, 0.09 .mu.g/kg body weight to 200 .mu.g/kg
body weight or 0.1 .mu.g/kg body weight to 100 .mu.g/kg body
weight. Further, those of skill will recognize that a variety of
different dosage levels will be of use, for example, 0.0001
.mu.g/kg, 0.0002 .mu.g/kg, 0.0003 .mu.g/kg, 0.0004 .mu.g/kg, 0.005
.mu.g/kg, 0.0007 .mu.g/kg, 0.001 .mu.g/kg, 0.1 .mu.g/kg, 1.0
.mu.g/kg, 1.5 .mu.g/kg, 2.0 .mu.g/kg, 5.0 .mu.g/kg, 10.0 .mu.g/kg,
15.0 .mu.g/kg, 30.0 .mu.g/kg, 50 .mu.g/kg, 75 .mu.g/kg, 80
.mu.g/kg, 90 .mu.g/kg, 100 .mu.g/kg, 120 .mu.g/kg, 140 .mu.g/kg,
150 .mu.g/kg, 160 .mu.g/kg, 180 .mu.g/kg, 200 .mu.g/kg, 225
.mu.g/kg, 250 .mu.g/kg, 275 .mu.g/kg, 300 .mu.g/kg, 325 .mu.g/kg,
350 .mu.g/kg, 375 .mu.g/kg, 400 .mu.g/kg, 450 .mu.g/kg, 500
.mu.g/kg, 550 .mu.g/kg, 600 .mu.g/kg, 700 .mu.g/kg, 750 .mu.g/kg,
800 .mu.g/kg, 900 .mu.g/kg, 1 mg/kg, 5 mg/kg, 10 mg/kg, 12 mg/kg,
15 mg/kg, 20 mg/kg, and/or 30 mg/kg. Of course, all of these
dosages are exemplary, and any dosage in-between these points is
also expected to be of use in the invention. Any of the above
dosage ranges or dosage levels may be employed for an antagonist of
NC.sub.Ca-ATP channel or related-compounds thereof.
[0233] Administration of the therapeutic antagonist of
NC.sub.Ca-ATP channel composition of the present invention to a
patient or subject will follow general protocols for the
administration of therapies used in stroke treatment, such as
thrombolytics, taking into account the toxicity, if any, of the
antagonist of the NC.sub.Ca-ATP channel. It is expected that the
treatment cycles would be repeated as necessary. It also is
contemplated that various standard therapies, as well as surgical
intervention, may be applied in combination with the described
therapy.
[0234] The treatments may include various "unit doses." Unit dose
is defined as containing a predetermined quantity of the
therapeutic composition (an antagonist of the NC.sub.Ca-ATP channel
or its related-compounds thereof) calculated to produce the desired
responses in association with its administration, e.g., the
appropriate route and treatment regimen. The quantity to be
administered, and the particular route and formulation, are within
the skill of those in the clinical arts. Also of import is the
subject to be treated, in particular, the state of the subject and
the protection desired. A unit dose need not be administered as a
single injection but may comprise continuous infusion over a set
period of time.
[0235] B. Combination Treatments
[0236] In the context of the present invention, it is contemplated
that an antagonist of the NC.sub.Ca-ATP channel or
related-compounds thereof may be used in combination with an
additional therapeutic agent to more effectively treat a cerebral
ischemic event, and/or decrease intracranial pressure. In some
embodiments, it is contemplated that a conventional therapy or
agent, including but not limited to, a pharmacological therapeutic
agent may be combined with the antagonist or related-compound of
the present invention.
[0237] Pharmacological therapeutic agents and methods of
administration, dosages, etc. are well known to those of skill in
the art (see for example, the "Physicians Desk Reference", Goodman
& Gilman's "The Pharmacological Basis of Therapeutics",
"Remington's Pharmaceutical Sciences", and "The Merck Index,
Eleventh Edition", incorporated herein by reference in relevant
parts), and may be combined with the invention in light of the
disclosures herein. Some variation in dosage will necessarily occur
depending on the condition of the subject being treated. The person
responsible for administration will, in any event, determine the
appropriate dose for the individual subject, and such individual
determinations are within the skill of those of ordinary skill in
the art.
[0238] Non-limiting examples of a pharmacological therapeutic agent
that may be used in the present invention include an
antihyperlipoproteinemic agent, an antiarteriosclerotic agent, an
anticholesterol agent, an antiinflammatory agent, an
antithrombotic/fibrinolytic agent, anticoagulant, antiplatelet,
vasodilator, and/or diuretics. Thromoblytics that are used can
include, but are not limited to prourokinase, streptokinase, and
tissue plasminogen activator (tPA) Anticholesterol agents include
but are not limited to HMG-CoA Reductase inhibitors, cholesterol
absorption inhibitors, bile acid sequestrants, nicotinic acid and
derivatives thereof, fibric acid and derivatives thereof. HMG-CoA
Reductase inhibitors include statins, for example, but not limited
to atorvastatin calcium (Lipitor.RTM.), cerivastatin sodium
(Baycol.RTM.), fluvastatin sodium (Lescol.RTM.), lovastatin
(Advicor.RTM.), pravastatin sodium (Pravachol.RTM.), and
simvastatin (Zocor.RTM.). Agents known to reduce the absorption of
ingested cholesterol include, for example, Zetia.RTM.. Bile acid
sequestrants include, but are not limited to cholestryramine,
cholestipol and colesevalam. Other anticholesterol agents include
fibric acids and derivatives thereof (e.g., gemfibrozil,
fenofibrate and clofibrate); nicotinic acids and derivatives
thereof (e.g., nician, lovastatin) and agents that extend the
release of nicotinic acid, for example niaspan. Antiinflammatory
agents include, but are not limited to non-sterodial
anti-inflammatory agents (e.g., naproxen, ibuprofen, celeoxib) and
sterodial anti-inflammatory agents (e.g., glucocorticoids).
Anticoagulants include, but are not limited to heparin, warfarin,
and coumadin. Antiplatelets include, but are not limited to
aspirin, and aspirin related-compounds, for example acetaminophen.
Diuretics include, but are not limited to such as furosemide
(Lasix.RTM.), bumetanide (Bumex.RTM.), torsemide (Demadex.RTM.),
thiazide & thiazide-like diuretics (e.g., chlorothiazide
(Diuril.RTM.) and hydrochlorothiazide (Esidrix.RTM.), benzthiazide,
cyclothiazide, indapamide, chlorthalidone, bendroflumethizide,
metolazone), amiloride, triamterene, and spironolacton.
Vasodilators include, but are not limited to nitroglycerin,
[0239] Thus, in certain embodiments, the present invention
comprises co-administration of an antagonist of the NC.sub.Ca-ATP
channel with a thrombolytic agent. Co-administration of these two
compounds will increase the therapeutic window of the thrombolytic
agent. Examples of suitable thrombolytic agents that can be
employed in the methods and pharmaceutical compositions of this
invention are prourokinase, streptokinase, and tissue plasminogen
activator (tPA).
[0240] In certain embodiments, the present invention comprises
co-administration of an antagonist of the NC.sub.Ca-ATP channel
with glucose or related carbohydrate to maintain appropriate levels
of serum glucose. Appropriate levels of blood glucose are within
the range of about 60 mmol/l to about 150 mmol/liter. Thus, glucose
or a related carbohydrate is administered in combination to
maintain the serum glucose within this range.
[0241] When an additional therapeutic agent, as long as the dose of
the additional therapeutic agent does not exceed previously quoted
toxicity levels, the effective amounts of the additional
therapeutic agent may simply be defined as that amount effective to
reduce cerebral edema when administered to an animal in combination
with an agonist of NC.sub.Ca-ATP channel or related-compounds
thereof. This may be easily determined by monitoring the animal or
patient and measuring those physical and biochemical parameters of
health and disease that are indicative of the success of a given
treatment. Such methods are routine in animal testing and clinical
practice.
[0242] To inhibit hemorrhagic conversion, reduce cell swelling,
etc., using the methods and compositions of the present invention,
one would generally contact a cell with antagonist of NC.sub.Ca-ATP
channel or related-compounds thereof in combination with an
additional therapeutic agent, such as tPA, aspirin, statins,
diuretics, warfarin, coumadin, mannitol, etc. These compositions
would be provided in a combined amount effective to inhibit
hemorrhagic conversion, cell swelling and edema. This process may
involve contacting the cells with agonist of NC.sub.Ca-ATP channel
or related-compounds thereof in combination with an additional
therapeutic agent or factor(s) at the same time. This may be
achieved by contacting the cell with a single composition or
pharmacological formulation that includes both agents, or by
contacting the cell with two distinct compositions or formulations,
at the same time, wherein one composition includes an antagonist of
the NC.sub.Ca-ATP channel or derivatives thereof and the other
includes the additional agent.
[0243] Alternatively, treatment with an antagonist of NC.sub.Ca-ATP
channel or related-compounds thereof may precede or follow the
additional agent treatment by intervals ranging from minutes to
hours to weeks to months. In embodiments where the additional agent
is applied separately to the cell, one would generally ensure that
a significant period of time did not expire between the time of
each delivery, such that the agent would still be able to exert an
advantageously combined effect on the cell. In such instances, it
is contemplated that one would contact the cell with both
modalities within about 1-24 hr of each other and, more preferably,
within about 6-12 hr of each other.
[0244] Typically, for maximum benefit of the thrombolytic agent, or
therapy must be started within three hours of the onset of stroke
symptoms, making rapid diagnosis and differentiation of stroke and
stroke type critical. However, in the present invention,
administration of the NC.sub.Ca-ATP channel with a thrombolytic
agent increases this therapeutic window. The therapeutic window for
thrombolytic agents may be increased by several (4-8) hours by
co-administering antagonist of the NC.sub.Ca-ATP channel.
[0245] Yet further, the combination of the antagonist and tPA
results in a decrease or prevention of hemorrhagic conversion
following reperfusion. Hemorrhagic conversion is the transformation
of a bland infarct into a hemorrhagic infarct after restoration of
circulation. It is generally accepted that these complications of
stroke and of reperfusion are attributable to capillary endothelial
cell dysfunction that worsens as ischemia progresses. Thus, the
present invention is protective of the endothelial cell dysfunction
that occurs as a result of an ischemic event.
[0246] Endothelial cell dysfunction comprises three phases. Phase
one is characterized by formation of ionic edema with the blood
brain barrier still intact. The second phase is characterized by
formation of vasogenic edema in which the blood brain barrier is no
longer intact. Phase three is characterized by hemorrhagic
conversion due to failure of capillary integrity during which all
constituents of blood, including erythrocytes, extravasate into
brain parenchyma. Disruption of BBB involves ischemia-induced
activation of endothelial cells that results in expression and
release of MMPs, specifically, MMP-2 (gelatinase A) and MMP-9
(gelatinase B).
[0247] Since hemorrhagic conversion increases mortality of the
patient, it is essential that these patients receive treatment in
an urgent manner For example, it is known that hemorrhagic
conversion typically results in patients if reperfusion and tPA
treatment is delayed beyond 3 hr or more after thrombotic stroke.
Thus, the administration of the antagonist of the present invention
will reduce necrotic death of ischemic endothelial cells, and will
thereby prolong the therapeutic window for tPA, thereby decreasing
mortality of the patient.
VII. DIAGNOSTICS
[0248] The antagonist or related-compound can be used for
diagnosing, monitoring, or prognosis of ischemia or damage to
neurons, glial cells or in monitoring neuronal cells in zones of
cerebral edema, metastatic tumors, etc.
[0249] A. Genetic Diagnosis
[0250] One embodiment of the instant invention comprises a method
for detecting expression of any portion of a NC.sub.Ca-ATP channel,
for example, expression of the regulatory unit, SUR1, and/or
expression of the pore-forming subunit. This may comprise
determining the level of SUR1 expressed and/or the level of the
pore-forming subunit expressed. It is understood by the present
invention that the up-regulation or increased expression of the
NC.sub.Ca-ATP channel relates to increased levels of SUR1, which
correlates to increased neuronal damage, such as cerebral
edema.
[0251] Firstly, a biological sample is obtained from a subject. The
biological sample may be tissue or fluid. In certain embodiments,
the biological sample includes cells from the brain and/or cerebral
endothelial cells or microvessels and/or gliotic capsule. For
example, in metastatic tumors, glial cells are activated and form a
capsule around the tumor.
[0252] Nucleic acids used are isolated from cells contained in the
biological sample, according to standard methodologies (Sambrook et
al., 1989). The nucleic acid may be genomic DNA or fractionated or
whole cell RNA. Where RNA is used, it may be desired to convert the
RNA to a complementary DNA (cDNA). In one embodiment, the RNA is
whole cell RNA; in another, it is poly-A RNA. Normally, the nucleic
acid is amplified.
[0253] Depending on the format, the specific nucleic acid of
interest is identified in the sample directly using amplification
or with a second, known nucleic acid following amplification. Next,
the identified product is detected. In certain applications, the
detection may be performed by visual means (e.g., ethidium bromide
staining of a gel). Alternatively, the detection may involve
indirect identification of the product via chemiluminescence,
radioactive scintigraphy of radiolabel or fluorescent label or even
via a system using electrical or thermal impulse signals (Affymax
Technology; Bellus, 1994).
[0254] Following detection, one may compare the results seen in a
given subject with a statistically significant reference group of
normal subjects and subjects that have been diagnosed with a
stroke, cancer, cerebral edema, etc.
[0255] Yet further, it is contemplated that chip-based DNA
technologies such as those described by Hacia et al., (1996) and
Shoemaker et al., (1996) can be used for diagnosis. Briefly, these
techniques involve quantitative methods for analyzing large numbers
of genes rapidly and accurately. By tagging genes with
oligonucleotides or using fixed probe arrays, one can employ chip
technology to segregate target molecules as high density arrays and
screen these molecules on the basis of hybridization. See also
Pease et al., (1994); Fodor et al., (1991).
[0256] B. Other types of diagnosis
[0257] In order to increase the efficacy of molecules, for example,
compounds and/or proteins and/or antibodies, as diagnostic agents,
it is conventional to link or covalently bind or complex at least
one desired molecule or moiety.
[0258] Certain examples of conjugates are those conjugates in which
the molecule (for example, protein, antibody, and/or compound) is
linked to a detectable label. "Detectable labels" are compounds
and/or elements that can be detected due to their specific
functional properties, and/or chemical characteristics, the use of
which allows the antibody to which they are attached to be
detected, and/or further quantified if desired.
[0259] Conjugates are generally preferred for use as diagnostic
agents. Diagnostics generally fall within two classes, those for
use in in vitro diagnostics, such as in a variety of immunoassays,
and/or those for use in vivo diagnostic protocols, generally known
as "molecule-directed imaging".
[0260] Many appropriate imaging agents are known in the art, as are
methods for their attachment to molecules, for example, antibodies
(see, for e.g., U.S. Pat. Nos. 5,021,236; 4,938,948; and 4,472,509,
each incorporated herein by reference). The imaging moieties used
can be paramagnetic ions; radioactive isotopes; fluorochromes;
NMR-detectable substances; X-ray imaging.
[0261] In the case of paramagnetic ions, one might mention by way
of example ions such as chromium (III), manganese (II), iron (III),
iron (II), cobalt (II), nickel (II), copper (II), neodymium (III),
samarium (III), ytterbium (III), gadolinium (III), vanadium (II),
terbium (III), dysprosium (III), holmium (III) and/or erbium (III),
with gadolinium being particularly preferred. Ions useful in other
contexts, such as X-ray imaging, include but are not limited to
lanthanum (III), gold (III), lead (II), and especially bismuth
(III).
[0262] In the case of radioactive isotopes for therapeutic and/or
diagnostic application, one might mention astatine.sup.211,
.sup.11carbon, .sup.14carbon, .sup.51chromium, .sup.36chlorine,
.sup.57cobalt, .sup.58cobalt, copper.sup.67, .sup.152Eu,
gallium.sup.67, .sup.3hydrogen, iodine.sup.123, iodine.sup.125,
iodine.sup.131, indium.sup.111, .sup.59iron, .sup.32phosphorus,
rhenium.sup.186, rhenium.sup.188, .sup.75selenium, .sup.35sulphur,
technicium.sup.99m and/or yttrium.sup.90. .sup.125I is often being
preferred for use in certain embodiments, and technicium.sup.99m
and/or indium.sup.111 are also often preferred due to their low
energy and suitability for long range detection.
[0263] Among the fluorescent labels contemplated for use as
conjugates include Alexa 350, Alexa 430, AMCA, BODIPY 630/650,
BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX,
Cascade Blue, Cy3, Cy5,6-FAM, Fluorescein Isothiocyanate, HEX,
6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514,
Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin,
ROX, TAMRA, TET, Tetramethylrhodamine, and/or Texas Red.
[0264] Another type of conjugates contemplated in the present
invention are those intended primarily for use in vitro, where the
molecule is linked to a secondary binding ligand and/or to an
enzyme (an enzyme tag) that will generate a colored product upon
contact with a chromogenic substrate. Examples of suitable enzymes
include urease, alkaline phosphatase, (horseradish) hydrogen
peroxidase or glucose oxidase. Preferred secondary binding ligands
are biotin and/or avidin and streptavidin compounds. The use of
such labels is well known to those of skill in the art and are
described, for example, in U.S. Pat. Nos. 3,817,837; 3,850,752;
3,939,350; 3,996,345; 4,277,437; 4,275,149 and 4,366,241; each
incorporated herein by reference.
[0265] The steps of various other useful immunodetection methods
have been described in the scientific literature, such as, e.g.,
Nakamura et al., (1987) Immunoassays, in their most simple and
direct sense, are binding assays. Certain preferred immunoassays
are the various types of radioimmunoassays (RIA) and immunobead
capture assay. Immunohistochemical detection using tissue sections
also is particularly useful. However, it will be readily
appreciated that detection is not limited to such techniques, and
Western blotting, dot blotting, FACS analyses, and the like also
may be used in connection with the present invention.
[0266] Immunologically-based detection methods for use in
conjunction with Western blotting include enzymatically-,
radiolabel-, or fluorescently-tagged secondary molecules/antibodies
against the SUR1 or regulatory subunit of the Na.sub.CaATP channel
are considered to be of particular use in this regard. U.S. Patents
concerning the use of such labels include U.S. Pat. Nos. 3,817,837;
3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149 and
4,366,241, each incorporated herein by reference. Of course, one
may find additional advantages through the use of a secondary
binding ligand such as a second antibody or a biotin/avidin ligand
binding arrangement, as is known in the art.
[0267] In addition to the above imaging techniques, one of skill in
the art is also aware that positron emission tomography, PET
imaging or a PET scan, can also be used as a diagnostic
examination. PET scans involves the acquisition of physiologic
images based on the detection of radiation from the emission of
positrons. Positrons are tiny particles emitted from a radioactive
substance administered to the subject.
[0268] Thus, in certain embodiments of the present invention, the
antagonist or related-compound thereof is enzymatically-,
radiolabel-, or fluorescently-tagged, as described above and used
to diagnosis, monitor, and/or stage neuronal damage by cerebral
edema. For example, the enzymatically-, radiolabel-, or
fluorescently-tagged antagonist or related-compound thereof can be
used to determine the size, limits and/or boundaries of tumors. It
is difficult to determine the boundaries of certain tumors, for
example, metastatic tumors. In metastatic tumors, glial cells are
activated and form a capsule or gliotic capsule around the tumor.
Thus, the labeled antagonist or related-compound thereof can be
used to determine the border of tumor, which can enhance the
efficiency of its removal by the surgeon. Still further, the
labeled antagonist or related-compound thereof may be used to
determine or define the penumbra or the areas at risk for later
infarction or damage after a stroke.
VIII. FORMULATIONS AND ROUTES FOR ADMINISTRATION OF COMPOUNDS
[0269] Pharmaceutical compositions of the present invention
comprise an effective amount of one or more modulators of
NC.sub.Ca-ATP channel (antagonist and/or agonist) or
related-compounds or additional agent dissolved or dispersed in a
pharmaceutically acceptable carrier. The phrases "pharmaceutical or
pharmacologically acceptable" refers to molecular entities and
compositions that do not produce an adverse, allergic or other
untoward reaction when administered to an animal, such as, for
example, a human, as appropriate. The preparation of an
pharmaceutical composition that contains at least one modulators of
NC.sub.Ca-ATP channel (antagonist and/or agonist) or
related-compounds or additional active ingredient will be known to
those of skill in the art in light of the present disclosure, as
exemplified by Remington's Pharmaceutical Sciences, 18th Ed. Mack
Printing Company, 1990, incorporated herein by reference. Moreover,
for animal (e.g., human) administration, it will be understood that
preparations should meet sterility, pyrogenicity, general safety
and purity standards as required by FDA Office of Biological
Standards.
[0270] As used herein, "pharmaceutically acceptable carrier"
includes any and all solvents, dispersion media, coatings,
surfactants, antioxidants, preservatives (e.g., antibacterial
agents, antifungal agents), isotonic agents, absorption delaying
agents, salts, preservatives, drugs, drug stabilizers, gels,
binders, excipients, disintegration agents, lubricants, sweetening
agents, flavoring agents, dyes, such like materials and
combinations thereof, as would be known to one of ordinary skill in
the art (see, for example, Remington's Pharmaceutical Sciences,
18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated
herein by reference). Except insofar as any conventional carrier is
incompatible with the active ingredient, its use in the
pharmaceutical compositions is contemplated.
[0271] The modulators of NC.sub.CaATP channel (antagonist and/or
agonist) or related-compounds may comprise different types of
carriers depending on whether it is to be administered in solid,
liquid or aerosol form, and whether it need to be sterile for such
routes of administration as injection. The present invention can be
administered intravenously, intradermally, transdermally,
intrathecally, intraventricularly, intraarterially,
intraperitoneally, intranasally, intravaginally, intrarectally,
topically, intramuscularly, subcutaneously, mucosally, orally,
topically, locally, inhalation (e.g., aerosol inhalation),
injection, infusion, continuous infusion, localized perfusion
bathing target cells directly, via a catheter, via a lavage, in
cremes, in lipid compositions (e.g., liposomes), or by other method
or any combination of the forgoing as would be known to one of
ordinary skill in the art (see, for example, Remington's
Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990,
incorporated herein by reference).
[0272] The modulators of NC.sub.Ca-ATP channel (antagonist and/or
agonist) or related-compounds may be formulated into a composition
in a free base, neutral or salt form. Pharmaceutically acceptable
salts, include the acid addition salts, e.g., those formed with the
free amino groups of a proteinaceous composition, or which are
formed with inorganic acids such as for example, hydrochloric or
phosphoric acids, or such organic acids as acetic, oxalic, tartaric
or mandelic acid. Salts formed with the free carboxyl groups can
also be derived from inorganic bases such as for example, sodium,
potassium, ammonium, calcium or ferric hydroxides; or such organic
bases as isopropylamine, trimethylamine, histidine or procaine.
Upon formulation, solutions will be administered in a manner
compatible with the dosage formulation and in such amount as is
therapeutically effective. The formulations are easily administered
in a variety of dosage forms such as formulated for parenteral
administrations such as injectable solutions, or aerosols for
delivery to the lungs, or formulated for alimentary administrations
such as drug release capsules and the like.
[0273] Further in accordance with the present invention, the
composition of the present invention suitable for administration is
provided in a pharmaceutically acceptable carrier with or without
an inert diluent. The carrier should be assimilable and includes
liquid, semi-solid, i.e., pastes, or solid carriers. Except insofar
as any conventional media, agent, diluent or carrier is detrimental
to the recipient or to the therapeutic effectiveness of a the
composition contained therein, its use in administrable composition
for use in practicing the methods of the present invention is
appropriate. Examples of carriers or diluents include fats, oils,
water, saline solutions, lipids, liposomes, resins, binders,
fillers and the like, or combinations thereof. The composition may
also comprise various antioxidants to retard oxidation of one or
more component. Additionally, the prevention of the action of
microorganisms can be brought about by preservatives such as
various antibacterial and antifungal agents, including but not
limited to parabens (e.g., methylparabens, propylparabens),
chlorobutanol, phenol, sorbic acid, thimerosal or combinations
thereof.
[0274] In accordance with the present invention, the composition is
combined with the carrier in any convenient and practical manner,
i.e., by solution, suspension, emulsification, admixture,
encapsulation, absorption and the like. Such procedures are routine
for those skilled in the art.
[0275] In a specific embodiment of the present invention, the
composition is combined or mixed thoroughly with a semi-solid or
solid carrier. The mixing can be carried out in any convenient
manner such as grinding. Stabilizing agents can be also added in
the mixing process in order to protect the composition from loss of
therapeutic activity, i.e., denaturation in the stomach. Examples
of stabilizers for use in an the composition include buffers, amino
acids such as glycine and lysine, carbohydrates such as dextrose,
mannose, galactose, fructose, lactose, sucrose, maltose, sorbitol,
mannitol, etc.
[0276] In further embodiments, the present invention may concern
the use of a pharmaceutical lipid vehicle compositions that include
modulators of NC.sub.CaATP channel (antagonist and/or agonist) or
related-compounds, one or more lipids, and an aqueous solvent. As
used herein, the term "lipid" will be defined to include any of a
broad range of substances that is characteristically insoluble in
water and extractable with an organic solvent. This broad class of
compounds are well known to those of skill in the art, and as the
term "lipid" is used herein, it is not limited to any particular
structure. Examples include compounds which contain long-chain
aliphatic hydrocarbons and their derivatives. A lipid may be
naturally occurring or synthetic (i.e., designed or produced by
man) However, a lipid is usually a biological substance. Biological
lipids are well known in the art, and include for example, neutral
fats, phospholipids, phosphoglycerides, steroids, terpenes,
lysolipids, glycosphingolipids, glycolipids, sulphatides, lipids
with ether and ester-linked fatty acids and polymerizable lipids,
and combinations thereof. Of course, compounds other than those
specifically described herein that are understood by one of skill
in the art as lipids are also encompassed by the compositions and
methods of the present invention.
[0277] One of ordinary skill in the art would be familiar with the
range of techniques that can be employed for dispersing a
composition in a lipid vehicle. For example, the modulators of
NC.sub.CaATP channel (antagonist and/or agonist) or
related-compounds may be dispersed in a solution containing a
lipid, dissolved with a lipid, emulsified with a lipid, mixed with
a lipid, combined with a lipid, covalently bonded to a lipid,
contained as a suspension in a lipid, contained or complexed with a
micelle or liposome, or otherwise associated with a lipid or lipid
structure by any means known to those of ordinary skill in the art.
The dispersion may or may not result in the formation of
liposomes.
[0278] The actual dosage amount of a composition of the present
invention administered to an animal patient can be determined by
physical and physiological factors such as body weight, severity of
condition, the type of disease being treated, previous or
concurrent therapeutic and/or prophylatic interventions, idiopathy
of the patient and on the route of administration. Depending upon
the dosage and the route of administration, the number of
administrations of a preferred dosage and/or an effective amount
may vary according tot he response of the subject. The practitioner
responsible for administration will, in any event, determine the
concentration of active ingredient(s) in a composition and
appropriate dose(s) for the individual subject.
[0279] In certain embodiments, pharmaceutical compositions may
comprise, for example, at least about 0.1% of an active compound.
In other embodiments, the an active compound may comprise between
about 2% to about 75% of the weight of the unit, or between about
25% to about 60%, for example, and any range derivable therein.
Naturally, the amount of active compound(s) in each therapeutically
useful composition may be prepared is such a way that a suitable
dosage will be obtained in any given unit dose of the compound.
Factors such as solubility, bioavailability, biological half-life,
route of administration, product shelf life, as well as other
pharmacological considerations will be contemplated by one skilled
in the art of preparing such pharmaceutical formulations, and as
such, a variety of dosages and treatment regimens may be
desirable.
[0280] A. Alimentary Compositions and Formulations
[0281] In preferred embodiments of the present invention, the
modulators of NC.sub.CaATP channel (antagonist and/or agonist) or
related-compounds are formulated to be administered via an
alimentary route. Alimentary routes include all possible routes of
administration in which the composition is in direct contact with
the alimentary tract. Specifically, the pharmaceutical compositions
disclosed herein may be administered orally, buccally, rectally, or
sublingually. As such, these compositions may be formulated with an
inert diluent or with an assimilable edible carrier, or they may be
enclosed in hard- or soft-shell gelatin capsule, or they may be
compressed into tablets, or they may be incorporated directly with
the food of the diet.
[0282] In certain embodiments, the active compounds may be
incorporated with excipients and used in the form of ingestible
tablets, buccal tables, troches, capsules, elixirs, suspensions,
syrups, wafers, and the like (Mathiowitz et al., 1997; Hwang et
al., 1998; U.S. Pat. Nos. 5,641,515; 5,580,579 and 5,792, 451, each
specifically incorporated herein by reference in its entirety). The
tablets, troches, pills, capsules and the like may also contain the
following: a binder, such as, for example, gum tragacanth, acacia,
cornstarch, gelatin or combinations thereof; an excipient, such as,
for example, dicalcium phosphate, mannitol, lactose, starch,
magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate or combinations thereof; a disintegrating agent, such as,
for example, corn starch, potato starch, alginic acid or
combinations thereof; a lubricant, such as, for example, magnesium
stearate; a sweetening agent, such as, for example, sucrose,
lactose, saccharin or combinations thereof; a flavoring agent, such
as, for example peppermint, oil of wintergreen, cherry flavoring,
orange flavoring, etc. When the dosage unit form is a capsule, it
may contain, in addition to materials of the above type, a liquid
carrier. Various other materials may be present as coatings or to
otherwise modify the physical form of the dosage unit. For
instance, tablets, pills, or capsules may be coated with shellac,
sugar, or both. When the dosage form is a capsule, it may contain,
in addition to materials of the above type, carriers such as a
liquid carrier. Gelatin capsules, tablets, or pills may be
enterically coated. Enteric coatings prevent denaturation of the
composition in the stomach or upper bowel where the pH is acidic.
See, e.g., U.S. Pat. No. 5,629,001. Upon reaching the small
intestines, the basic pH therein dissolves the coating and permits
the composition to be released and absorbed by specialized cells,
e.g., epithelial enterocytes and Peyer's patch M cells. A syrup of
elixir may contain the active compound sucrose as a sweetening
agent methyl and propylparabens as preservatives, a dye and
flavoring, such as cherry or orange flavor. Of course, any material
used in preparing any dosage unit form should be pharmaceutically
pure and substantially non-toxic in the amounts employed. In
addition, the active compounds may be incorporated into
sustained-release preparation and formulations.
[0283] For oral administration the compositions of the present
invention may alternatively be incorporated with one or more
excipients in the form of a mouthwash, dentifrice, buccal tablet,
oral spray, or sublingual orally-administered formulation. For
example, a mouthwash may be prepared incorporating the active
ingredient in the required amount in an appropriate solvent, such
as a sodium borate solution (Dobell's Solution). Alternatively, the
active ingredient may be incorporated into an oral solution such as
one containing sodium borate, glycerin and potassium bicarbonate,
or dispersed in a dentifrice, or added in a
therapeutically-effective amount to a composition that may include
water, binders, abrasives, flavoring agents, foaming agents, and
humectants. Alternatively the compositions may be fashioned into a
tablet or solution form that may be placed under the tongue or
otherwise dissolved in the mouth.
[0284] Additional formulations which are suitable for other modes
of alimentary administration include suppositories. Suppositories
are solid dosage forms of various weights and shapes, usually
medicated, for insertion into the rectum. After insertion,
suppositories soften, melt or dissolve in the cavity fluids. In
general, for suppositories, traditional carriers may include, for
example, polyalkylene glycols, triglycerides or combinations
thereof. In certain embodiments, suppositories may be formed from
mixtures containing, for example, the active ingredient in the
range of about 0.5% to about 10%, and preferably about 1% to about
2%.
[0285] B. Parenteral Compositions and Formulations
[0286] In further embodiments, modulators of NC.sub.CaATP channel
(antagonist and/or agonist) or related-compounds may be
administered via a parenteral route. As used herein, the term
"parenteral" includes routes that bypass the alimentary tract.
Specifically, the pharmaceutical compositions disclosed herein may
be administered for example, but not limited to intravenously,
intradermally, intramuscularly, intraarterially,
intraventricularly, intrathecally, subcutaneous, or
intraperitoneally U.S. Pat. Nos. 6,7537,514, 6,613,308, 5,466,468,
5,543,158; 5,641,515; and 5,399,363 (each specifically incorporated
herein by reference in its entirety).
[0287] Solutions of the active compounds as free base or
pharmacologically acceptable salts may be prepared in water
suitably mixed with a surfactant, such as hydroxypropylcellulose.
Dispersions may also be prepared in glycerol, liquid polyethylene
glycols, and mixtures thereof and in oils. Under ordinary
conditions of storage and use, these preparations contain a
preservative to prevent the growth of microorganisms. The
pharmaceutical forms suitable for injectable use include sterile
aqueous solutions or dispersions and sterile powders for the
extemporaneous preparation of sterile injectable solutions or
dispersions (U.S. Pat. No. 5,466,468, specifically incorporated
herein by reference in its entirety). In all cases the form must be
sterile and must be fluid to the extent that easy injectability
exists. It must be stable under the conditions of manufacture and
storage and must be preserved against the contaminating action of
microorganisms, such as bacteria and fungi. The carrier can be a
solvent or dispersion medium containing, for example, water,
ethanol, DMSO, polyol (i.e., glycerol, propylene glycol, and liquid
polyethylene glycol, and the like), suitable mixtures thereof,
and/or vegetable oils. Proper fluidity may be maintained, for
example, by the use of a coating, such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. The prevention of the action of
microorganisms can be brought about by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
sorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars or
sodium chloride. Prolonged absorption of the injectable
compositions can be brought about by the use in the compositions of
agents delaying absorption, for example, aluminum monostearate and
gelatin.
[0288] For parenteral administration in an aqueous solution, for
example, the solution should be suitably buffered if necessary and
the liquid diluent first rendered isotonic with sufficient saline
or glucose. These particular aqueous solutions are especially
suitable for intravenous, intramuscular, subcutaneous, and
intraperitoneal administration. In this connection, sterile aqueous
media that can be employed will be known to those of skill in the
art in light of the present disclosure. For example, one dosage may
be dissolved in 1 ml of isotonic NaCl solution and either added to
1000 ml of hypodermoclysis fluid or injected at the proposed site
of infusion, (see for example, "Remington's Pharmaceutical
Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some
variation in dosage will necessarily occur depending on the
condition of the subject being treated. The person responsible for
administration will, in any event, determine the appropriate dose
for the individual subject. Moreover, for human administration,
preparations should meet sterility, pyrogenicity, general safety
and purity standards as required by FDA Office of Biologics
standards.
[0289] Sterile injectable solutions are prepared by incorporating
the active compounds in the required amount in the appropriate
solvent with various of the other ingredients enumerated above, as
required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the various sterilized
active ingredients into a sterile vehicle which contains the basic
dispersion medium and the required other ingredients from those
enumerated above. In the case of sterile powders for the
preparation of sterile injectable solutions, the preferred methods
of preparation are vacuum-drying and freeze-drying techniques which
yield a powder of the active ingredient plus any additional desired
ingredient from a previously sterile-filtered solution thereof. A
powdered composition is combined with a liquid carrier such as,
e.g., water or a saline solution, with or without a stabilizing
agent.
[0290] C. Miscellaneous Pharmaceutical Compositions and
Formulations
[0291] In other preferred embodiments of the invention, the active
compound modulators of NC.sub.CaATP channel (antagonist and/or
agonist) or related-compounds may be formulated for administration
via various miscellaneous routes, for example, topical (i.e.,
transdermal) administration, mucosal administration (intranasal,
vaginal, etc.) and/or inhalation.
[0292] Pharmaceutical compositions for topical administration may
include the active compound formulated for a medicated application
such as an ointment, paste, cream or powder. Ointments include all
oleaginous, adsorption, emulsion and water-solubly based
compositions for topical application, while creams and lotions are
those compositions that include an emulsion base only. Topically
administered medications may contain a penetration enhancer to
facilitate adsorption of the active ingredients through the skin.
Suitable penetration enhancers include glycerin, alcohols, alkyl
methyl sulfoxides, pyrrolidones and luarocapram. Possible bases for
compositions for topical application include polyethylene glycol,
lanolin, cold cream and petrolatum as well as any other suitable
absorption, emulsion or water-soluble ointment base. Topical
preparations may also include emulsifiers, gelling agents, and
antimicrobial preservatives as necessary to preserve the active
ingredient and provide for a homogenous mixture. Transdermal
administration of the present invention may also comprise the use
of a "patch". For example, the patch may supply one or more active
substances at a predetermined rate and in a continuous manner over
a fixed period of time.
[0293] In certain embodiments, the pharmaceutical compositions may
be delivered by eye drops, intranasal sprays, inhalation, and/or
other aerosol delivery vehicles. Methods for delivering
compositions directly to the lungs via nasal aerosol sprays has
been described e.g., in U.S. Pat. Nos. 5,756,353 and 5,804,212
(each specifically incorporated herein by reference in its
entirety). Likewise, the delivery of drugs using intranasal
microparticle resins (Takenaga et al., 1998) and
lysophosphatidyl-glycerol compounds (U.S. Pat. No. 5,725, 871,
specifically incorporated herein by reference in its entirety) are
also well-known in the pharmaceutical arts. Likewise, transmucosal
drug delivery in the form of a polytetrafluoroetheylene support
matrix is described in U.S. Pat. No. 5,780,045 (specifically
incorporated herein by reference in its entirety).
[0294] The term aerosol refers to a colloidal system of finely
divided solid of liquid particles dispersed in a liquefied or
pressurized gas propellant. The typical aerosol of the present
invention for inhalation will consist of a suspension of active
ingredients in liquid propellant or a mixture of liquid propellant
and a suitable solvent. Suitable propellants include hydrocarbons
and hydrocarbon ethers. Suitable containers will vary according to
the pressure requirements of the propellant. Administration of the
aerosol will vary according to subject's age, weight and the
severity and response of the symptoms.
IX. DIAGNOSTIC OR THERAPEUTIC KITS
[0295] Any of the compositions described herein may be comprised in
a kit. In a non-limiting example, it is envisioned that a compound
that selectively binds to or identifies SUR1 may be comprised in a
diagnositc kit. Such compounds can be referred to as an "SUR1
marker", which may include, but are not limited to antibodies
(monoclonal or polyclonal), SUR1 oligonucleotides, SUR1
polypeptides, small molecule or combinations thereof, antagonist,
agonist, etc. It is envisioned that any of these SUR1 markers may
be linked to a radioactive substance and/or a fluorescent marker
and/or a enzymatic tag for quick determination. The kits may also
comprise, in suitable container means a lipid, and/or an additional
agent, for example a radioactive or enzymatic or florescent
marker.
[0296] The kits may comprise a suitably aliquoted SUR1 marker,
lipid and/or additional agent compositions of the present
invention, whether labeled or unlabeled, as may be used to prepare
a standard curve for a detection assay. The components of the kits
may be packaged either in aqueous media or in lyophilized form. The
container means of the kits will generally include at least one
vial, test tube, flask, bottle, syringe or other container means,
into which a component may be placed, and preferably, suitably
aliquoted. Where there are more than one component in the kit, the
kit also will generally contain a second, third or other additional
container into which the additional components may be separately
placed. However, various combinations of components may be
comprised in a vial. The kits of the present invention also will
typically include a means for containing the SUR1 marker, lipid,
additional agent, and any other reagent containers in close
confinement for commercial sale. Such containers may include
injection or blow molded plastic containers into which the desired
vials are retained.
[0297] Therapeutic kits of the present invention are kits
comprising an antagonist, agonist or an related-compound thereof.
Depending upon the condition and/or disease that is being treated,
the kit may comprise an SUR1 antagonist or related-compound thereof
to block and/or inhibit the NC.sub.CaATP channel or the kit may
comprise an SUR1 agonist or related-compound thereof to open the
NC.sub.CaATP channel Such kits will generally contain, in suitable
container means, a pharmaceutically acceptable formulation of SUR1
antagonist, agonist or related-compound thereof. The kit may have a
single container means, and/or it may have distinct container means
for each compound.
[0298] When the components of the kit are provided in one and/or
more liquid solutions, the liquid solution is an aqueous solution,
with a sterile aqueous solution being particularly preferred. The
SUR1 antagonist, agonist or related-compounds thereof may also be
formulated into a syringeable composition. In which case, the
container means may itself be a syringe, pipette, and/or other such
like apparatus, from which the formulation may be applied to an
infected area of the body, injected into an animal, and/or even
applied to and/or mixed with the other components of the kit.
[0299] Examples of aqueous solutions include, but are not limited
to ethanol, DMSO and/or Ringer's solution. In certain embodiments,
the concentration of DMSO or ethanol that is used is no greater
than 0.1% or (1 ml/1000 L).
[0300] However, the components of the kit may be provided as dried
powder(s). When reagents and/or components are provided as a dry
powder, the powder can be reconstituted by the addition of a
suitable solvent. It is envisioned that the solvent may also be
provided in another container means.
[0301] The container means will generally include at least one
vial, test tube, flask, bottle, syringe and/or other container
means, into which the SUR1 antagonist, agonist or related-compounds
thereof is suitably allocated. The kits may also comprise a second
container means for containing a sterile, pharmaceutically
acceptable buffer and/or other diluent.
[0302] The kits of the present invention will also typically
include a means for containing the vials in close confinement for
commercial sale, such as, e.g., injection and/or blow-molded
plastic containers into which the desired vials are retained.
[0303] Irrespective of the number and/or type of containers, the
kits of the invention may also comprise, and/or be packaged with,
an instrument for assisting with the injection/administration
and/or placement of the SUR1 antagonist, agonist or
related-compounds thereof within the body of an animal. Such an
instrument may be a syringe, pipette, forceps, and/or any such
medically approved delivery vehicle.
[0304] In addition to the SUR1 antagonist, agonist or
related-compounds thereof, the kits may also include a second
active ingredient. Examples of the second active ingredient include
substances to prevent hypoglycemia (e.g., glucose, D5W, glucagon,
etc.), thrombolytic agents, anticoagulants, antiplatelets, statins,
diuretics, vasodilators, etc. These second active ingredients may
be combined in the same vial as the SUR1 antagonist, agonist or
related-compounds thereof or they may be contained in a separate
vial.
[0305] Still further, the kits of the present invention can also
include glucose testing kits. Thus, the blood glucose of the
patient is measured using the glucose testing kit, then the SUR1
antagonist, agonist or related-compounds thereof can be
administered to the subject followed by measuring the blood glucose
of the patient.
[0306] In addition to the above kits, the therapeutic kits of the
present invention can be assembled such that an IV bag comprises a
septum or chamber which can be opened or broken to release the
compound into the IV bag. Another type of kit may include a bolus
kit in which the bolus kit comprises a pre-loaded syringe or
similar easy to use, rapidly administrable device. An infusion kit
may comprise the vials or ampoules and an IV solution (e.g.,
Ringer's solution) for the vials or ampoules to be added prior to
infusion. The infusion kit may also comprise a bolus kit for a
bolus/loading dose to be administered to the subject prior, during
or after the infusion.
X. EXAMPLES
[0307] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
Example 1
Modulation by Estrogen
[0308] A characteristic feature of K.sub.ATP channels (Kir6.1,
Kir6.2) is that channel affinity for ATP is modulated by the
presence of the membrane lipid, PIP.sub.2. The open-state stability
of K.sub.ATP channels is increased by application of PIP.sub.2 to
the cytoplasmic side of the membrane (Ashcroft, 1998; Baukrowitz et
al., 1998; Rohacs et al., 1999). An increase in the open-state
stability is manifested as an increase in the channel open
probability in the absence of ATP, and in a corresponding decrease
in sensitivity to inhibition by ATP (Enkvetchakul et al., 2000;
Haruna et al., 2000; Koster et al., 1999; and Larsson et al.,
2000).
[0309] Given the numerous similarities between the K.sub.ATP
channel and the NC.sub.Ca-ATP channel, the inventors postulated
that ATP-sensitivity of the NC.sub.Ca-ATP channel would respond to
PIP.sub.2 in the same way. This was tested by studying
NC.sub.Ca-ATP channels in inside out patches with Cs.sup.+ as the
charge carrier, and with 1 .mu.M Ca.sup.2+ and 10 .mu.M ATP in the
bath, with the latter expected to fully block the channel Under
these conditions, only the NC.sub.Ca-ATP channel was recorded in R1
astrocytes. When PIP.sub.2 (50 .mu.M) was added to the bath,
channel activity became prominent (FIG. 1), as predicted by analogy
to the effect of PIP.sub.2 on K.sub.ATP channels. This channel
activity was blocked by glibenclamide, confirming identity of the
channel.
[0310] To determine if a receptor-mediated mechanism was involved
in the modulation of NC.sub.Ca-ATP channel activity, a well known
phospholipase C (PLC) was used to study if PLC activation would
cause degradation and consumption of PIP.sub.2 and thereby increase
affinity for ATP, e.g., reduce channel opening. Estrogen is a well
known PLC activator in brain as well as elsewhere (Beyer et al.,
2002; Le Mellay et al., 1999; Qui et al., 2003). For this
experiment, cell attached patches were studied to prevent
alteration of intracellular signaling machinery. NC.sub.Ca-ATP
channel activity was produced by exposure to Na azide to cause
depletion of cellular ATP (FIG. 2, initial part of the record).
[0311] When estrogen (E2; 10 nM) was applied to the bath, activity
due to the NC.sub.Ca-ATP channel was soon terminated (FIG. 2). This
suggested that estrogen exerted regulatory control over the
NC.sub.Ca-ATP channel, and suggested that an estrogen receptor
capable of rapid (non-genomic) activation of signaling cascades was
present on these cells.
[0312] Next, to determine whether estrogen receptors could be
detected in R1 astrocytes from males and females. Gelatin sponge
implants were harvested 7 days after implantation in a group of 3
female rats (F) and another group of 3 male rats (M). Pooled
protein from each group was analyzed at 2 dilutions (4.times.=50
.mu.g total protein; 1.times.=12.5 .mu.g total protein) by Western
blotting, with protein from uterus being used as a control (FIG.
3A). Membranes were blotted with an antibody that recognized both
.alpha. and .beta. estrogen receptors. Both males and females
showed prominent bands at the appropriate molecular weights for the
.alpha. (66 kDa) and .beta. (55 kDa) receptors (FIG. 3) (Hiroi et
al., 1999). The same samples of protein from males and females were
also used to confirm presence of SUR1, with protein from pancreas
used as a positive control (FIG. 3B). Notably, estrogen receptors
have previously been reported in astrocytes from males and females
(Choi et al., 2001). In cerebral cortex, the .beta. isoform is
reportedly more abundant (Guo et al., 2001) as suggested by the
Western blot.
[0313] Next, the electrophysiological experiment of FIG. 2 was
repeated using R1 astrocytes harvested from male rats. As above,
cell attached patches were studied in which NC.sub.Ca-ATP channel
activity was activated by depletion of intracellular ATP following
exposure to Na azide (FIG. 4A). Examination of the record at higher
temporal resolution confirmed activity of a well defined channel of
the appropriate conductance for the NC.sub.Ca-ATP channel (FIG.
4B). When estrogen was applied to the bath (FIG. 4, E2, 10 nM,
arrow), activity due to the NC.sub.Ca-ATP channel was quickly
terminated (FIG. 4). These data provided further evidence that
estrogen exerted regulatory control over the NC.sub.Ca-ATP channel,
and suggested, in addition, that this response was equally robust
in R1 astrocytes from males and females.
[0314] By analogy to the effects of estrogen, other mechanisms that
deplete PIP.sub.2, including other receptor-mediated mechanism as
well as more direct activators of PLC such as G-proteins etc.,
would be expected to have a similar inhibitory effect on activity
of the NC.sub.Ca-ATP channel and thereby exert a protective
effect.
Example 2
The Gliotic Capsule
[0315] The standard model involved placing a stab injury into the
parietal lobe of an anesthetized rat and implanting a sterile
foreign body (gelatin sponge; Gelfoam.RTM.) into the stab wound.
Variants of the standard model included impregnating the sponge
with a substance (e.g., lipopolysaccharide, LPS) or infusing a
substance continuously in vivo using an osmotic mini-pump with the
delivery catheter placed directly into the sponge. The injury
procedure was well tolerated by the animals, with virtually no
morbidity or mortality and minimal pain. After an appropriate time
in vivo, the whole brain was harvested for histological or
immunohistochemical study of tissue sections. Alternatively, if the
sponge itself was gently removed from the brain, the inner zone of
the gliotic capsule adheres to the sponge and was excised along
with it. Thus, the sponge was assayed for protein (e.g., Western)
or mRNA (RT-PCR), or it was enzymatically dissociated to yield
constituent cells for electrophysiological or other single-cell
measurements.
[0316] The gliotic capsule was well developed 7-10 days after
injury. The gliotic capsule was visualized in coronal sections by
perfusing the animal with Evans Blue prior to perfusion-fixation of
the brain (FIG. 5A). A region of edema (dark) was seen to outline
the avascular gliotic capsule (light) that surrounded the gelatin
sponge (dark) Immunohistochemical examination with anti-GFAP
antibodies showed that the brain parenchyma in the vicinity of the
sponge harbors many GFAP-positive reactive astrocytes (FIG. 5B;
arrow showed where the gelatin sponge was). At higher power, these
intraparenchymal GFAP-positive cells were shown to be large and to
bear many prominent cell processes (FIG. 5C, arrow). Examining the
gelatin sponge itself showed GFAP-positive reactive astrocytes that
migrated into the interstices of the sponge (FIG. 5D, arrow).
Example 3
Isolation of Cells from the Gliotic Capsule
[0317] Phase contrast microscopy of cells freshly isolated by
papain digestion of the inner zone of the gliotic capsule and
gelatin sponge revealed three types of cells. Most of the cells
(>90%) were large, round, have no cell processes and were
phase-bright (FIG. 6A). A number of cells (3-5%) were small, round,
have no cell processes and were phase-dark (FIG. 6B). Occasionally,
a cell was found that was intermediate in size, was phase-bright
and had multiple processes that were more than one cell diameter in
length (Chen et al., 2003). Immunofluorescence study showed that
all of these cells were strongly positive for typical astrocyte
markers, including GFAP (FIG. 6C,D) and vimentin (FIG. 6E,F).
Microglia were not prominent in the inner zone of the gliotic
capsule itself, as indicated by sparse labeling for OX-42. Cells of
the inner zone of the gliotic capsule were negative for the 02A
progenitor marker, A2B5, and the fibroblast marker, prolyl
4-hydroxylase (Dalton et al., 2003).
[0318] As with freshly isolated cells, three morphologically
distinct types of cells were observed in primary culture. Most
cells (>90%) were large polygonal cells (FIG. 6Gb), a few (3-5%)
were small bipolar cells (FIG. 6Ga), and only occasionally were
process-bearing stellate-shaped cells observed (Perillan et al.,
2000). All of these cells were strongly labeled with anti-GFAP
antibodies (FIG. 6H). Experiments in which cells obtained by
enzymatic digestion were followed individually in primary culture
showed that the large phase-bright cells develop into large
polygonal cells (FIG. 6Gb), and the small phase-dark cells
developed into small bipolar cells (FIG. 6Ga) (Dalton et al.,
2003).
[0319] The three morphologically distinguishable types of
GFAP-positive astrocytes from the inner zone of the gliotic capsule
exhibited very different macroscopic whole cell
electrophysiological profiles:
[0320] (i) Electrophysiological studies on stellate astrocytes
showed that they expressed Kir2.3 and Kir4.1 inward rectifier
channels, and immunolabeling experiments suggested that they also
expressed K.sub.ATP channels comprised of SUR1 and Kir6.1 subunits
(Chen et al., 2003; Perillan et al., 2000);
[0321] (ii) Electrophysiological studies on R2 astrocytes showed
that they expressed a novel Ca.sup.2+-activated Cl-channel that was
sensitive to the polypeptide toxin from the scorpion, Leiurus
quinquestriatus (Dalton et al., 2003). Only the R2 astrocyte
expressed this channel.
[0322] (iii) Electrophysiological studies on R1 astrocytes showed
that they express Kir2.3 inward rectifier channels that are
regulated by TGF.beta.1 via PKC.delta. (Perillan et al., 2002;
Perillan et al., 2000). When freshly isolated but not after
culturing, R1 astrocytes also expressd a novel SUR1-regulated
NC.sub.Ca-ATP channel (Chen et al., 2003; Chen et al., 2001).
Example 4
Expression of SUR1
[0323] Glibenclamide binds to sulfonylurea receptors, SUR1 and
SUR2, with higher affinity for SUR1. Immunofluorescence studies
were performed using anti-SURx antibodies. The inner zone of the
gliotic capsule immediately outside of the gelatin sponge (gf in
FIG. 7) was strongly labeled with anti-SUR1 antibody (FIG. 8A) but
not with anti-SUR2 antibody (FIG. 7B). Although individual cells
were not discerned at low magnification, higher magnification
showed that SUR1 label was uniformly distributed in individual
cells after isolation (FIG. 7C).
[0324] Evidence for transcription of SUR1, but not SUR2 was also
found in RT-PCR experiments run on mRNA from gelatin sponges
isolated 7 days after implantation. The signal observed in
astrocytes (FIG. 7D, lane 3) was present at the appropriate
position on the gel, similar to that from control insulinoma
RIN-m5f cells (FIG. 7D, lane 2). By contrast, mRNA for SUR2 is not
transcribed in reactive astrocytes (FIG. 7D, lane 5) although it is
in cardiomyocytes used as control (FIG. 7D, lane 4).
Example 5
Characterization of the Inner Zone of the Gliotic Capsule
[0325] To examine whether or not all GFAP-positive reactive
astrocytes in the gliotic capsule are SUR1 positive, brains from
rats that had been implanted 1 week earlier with a gelatin sponge,
then perfusion-fixed and equilibrated in 40% sucrose in PBS
.times.2 days were studied. Cryostat sections were double labeled
with anti-GFAP and anti-SUR1 antibodies and studied with
immunofluorescence. For this and other immunolabeling experiments,
standard control protocol included use of the appropriate
immunogenic peptide when available or omission of primary
antibody.
[0326] Five animals were sectioned and imaged with low power
images. The images invariably showed that the depth (thickness) of
the GFAP response from the edge of the gelatin sponge was
several-fold greater than the depth of the SUR1 response.
Measurements of the depth of the GFAP response yielded values of
about 400-500 .mu.m (FIG. 8A; in FIGS. 8A-8I, the location of the
gelatin sponge implant was always to the left; bar in FIG. 8F
equals 100 .mu.m). By contrast, the prominent portion of the SUR1
response extended for a depth of only 25-50 .mu.m (FIG. 8D).
Outside of the SUR1-positive zone was a wide region of
GFAP-positive reactive astrocytes that were mostly SUR1 negative.
The SUR1 response was always located precisely at the interface
with the foreign body, in the innermost zone of the gliotic
capsule. Cells that were SUR1 positive were always GFAP positive.
It was evident from this experiment that cells clinging to the
gelatin sponge and that were harvested with it were likeliest to
express SUR1. Also, it was clear that R1 astrocytes in this
innermost region comprised a unique subpopulation of reactive
astrocytes. From this observation emerged the concept of the "inner
zone" of the gliotic capsule as being a unique entity, distinct
from the remainder of the gliotic capsule.
Example 6
Other Characteristics of the Inner Zone of the Gliotic Capsule
[0327] Other studies were performed to further evaluate the inner
zone of the gliotic capsule. In previous experiments, it was found
that primary culture of R1 astrocytes under normoxic culture
conditions resulted in loss of the SUR1-regulated NC.sub.Ca-ATP
channel after 3 days, whereas cultured under hypoxic conditions
resulted in continued expression of the channel (Chen et al.,
2003). Thus, it was determined that expression of the channel
required hypoxic conditions, and thus the inner zone of the gliotic
capsule where SUR1 expressing R1 astrocytes were found might also
be hypoxic. To evaluate this, the histochemical marker,
pimonidazole, was used which at pO.sub.2<10 mm Hg, forms
irreversible covalent adducts with cellular proteins that can be
detected immunohistochemically (Arteel et al, 1998; Hale et al.,
2002; Kennedy et al., 1997).
[0328] Briefly, rats were prepared with a stab injury and
implantation of a gelatin sponge. Rats were allowed to survive 1
week. Pimonidazole was administered prior to death, and
cryosections were processed for immunofluorescence study using the
appropriate antibody to detect pimonidazole adducts. Cryosections
were double labeled for GFAP. This experiment confirmed the
presence of hypoxic conditions restricted to the SUR1-positive
inner zone of the gliotic capsule, with the most prominent
pimonidazole labeling extending only 20-50 .mu.m deep (FIG. 8B;
GFAP not shown but the depth of the GFAP response resembled that in
FIG. 8A). High resolution imaging showed that pimonidazole labeling
(FIG. 8G, upper right) was present in large GFAP-positive
astrocytes (FIG. 8G, lower left).
[0329] It was reasoned that hypoxia of the inner zone might lead to
up-regulation/activation of the hypoxia-responsive transcription
factor, HIF-1. To examine this, immunolabeling was performed of
sections with anti-HIF-1.alpha. antibodies with co-labeling for
GFAP. This experiment confirmed that HIF-1.alpha. labeling was
mostly restricted to the SUR1-positive inner zone of the gliotic
capsule, with labeling extending only 20-50 .mu.m deep (FIG. 8C;
GFAP not shown but the depth of the GFAP response resembled that in
FIG. 8A). High resolution imaging showed that HIF-1.alpha. labeling
(FIG. 8H, upper right) was present in large GFAP-positive
astrocytes (FIG. 8H, lower left).
[0330] Expression of tight junction proteins was also examined. Two
tight junction proteins, ZO-1 and occludin-5, were studied,
labeling alternate cryosections with antibodies directed against
these proteins. Sections were double labeled for GFAP. Again, only
the innermost layer 20-50 .mu.m deep was labeled for either ZO-1 or
occludin-5 (FIG. 8E and 8F; GFAP not shown but the depth of the
GFAP response resembled that in FIG. 8A). High resolution imaging
showed that occludin-5 labeling (FIG. 8I, upper right) was present
in large GFAP-positive astrocytes (FIG. 8I, lower left).
[0331] Thus, the inner zone of the gliotic capsule, with its R1
astrocytes that express SUR1-regulated NC.sub.Ca-ATP channels and
tight junction proteins, may be acting as an important barrier
between the foreign body and the brain, e.g., a foreign body-brain
barrier (FbBB). If true, one would expect that breaching the
barrier might significantly affect the overall response to
injury.
Example 7
Manipulation of the Inner Zone
[0332] Rats were prepared with a stab injury and implantation of a
gelatin sponge according to our usual protocol and were allowed to
survive 1 week. At time of surgery, rats were also implanted with
osmotic mini-pumps subcutaneously with the delivery catheter placed
in the brain at the site of injury. Animals received pumps with
either glibenclamide (1 .mu.M at 0.5 .mu.l/hr.times.7 days) or
diazoxide (10 .mu.M at 0.5 .mu.l/hr.times.7 days). No systemic
toxicity was observed, neurological behavior was not impaired, and
animals appeared healthy and were not febrile.
[0333] Cryosections of injured brains were examined for GFAP. In
animals receiving glibenclamide, a well defined gliotic capsule was
visualized that was sharply demarcated from surrounding brain, with
the inner zone appearing to be densely populated by GFAP-positive
cells (FIG. 9A; gelatin sponge to the right). By contrast, animals
receiving diazoxide showed an expanded GFAP-positive response that
extended farther from the foreign body, with an outer region that
was poorly demarcated, and an inner zone that was loose and not
compact (FIG. 9B; gelatin sponge to the right).
[0334] Cryosections were also examined with the nuclear label,
DAPI. In sections from glibenclamide-treated animals, most of the
labeling was attributable to GFAP-positive astrocytes. However, in
sections from diazoxide-treated animals, DAPI labeling showed
"sheets" of small nucleated cells (dull spots in FIG. 10A). On
inspection, these sheets of cells appeared to be polymorphonuclear
leukocytes (PMNs, neutrophils). This was confirmed by labeling with
MMP-8, a PMN-specific marker (FIG. 10B). It is important to note
that no evidence of infection was present, and microbiological
cultures of explanted materials showed no bacterial growth,
including aerobic and anaerobic cultures, indicating that the
inflammatory response was not due to infection.
[0335] Thus, protecting inner zone R1 astrocytes with glibenclamide
appeared to have restrained the overall GFAP-response to injury,
whereas killing inner zone R1 astrocytes with diazoxide appeared to
have caused an expansion of the overall GFAP-response and
recruitment of tremendous numbers of neutrophils. These
observations strongly reinforced the concept of the "inner zone" of
the gliotic capsule as being a unique entity, with a critical
function in determining the overall response to injury.
Example 8
SUR1 in Multiple Brain Pathologies
[0336] Tissues were obtained from the 3 rat models (trauma, abscess
and stroke) and from human metastatic tumor, and double
immunolabeling was performed with antibodies directed against GFAP
and SUR1. Low power views showed a layer of tissue adjacent to the
gelatin sponge implant with positive immunolabeling for GFAP that
coincided with positive immunolabeling for SUR1 (FIG. 11A,B).
Examination of individual cells at high power showed that the SUR1
immunolabel was present in large stellate-shaped astrocytes,
confirming the presence of SUR1-positive R1 astrocytes in the inner
zone of the gliotic capsule surrounding a foreign body implant
(FIG. 11C).
[0337] A brain abscess model in the rat was studied. The abscess
was produced by implanting an autologous fecal pellet subcortically
under general anesthesia. These animals survived quite well,
although they showed evidence of mild weight loss. When sacrificed
1 week after surgery, a purulent cavity was found surrounded by a
gliotic capsule. Low power views of the gliotic capsule adjacent to
the area of puss showed cells with positive immunolabeling for GFAP
that coincided with positive immunolabeling for SUR1 (FIG. 11D,E).
Examination of individual cells at high power showed that the SUR1
immunolabel was present in large stellate-shaped astrocytes,
confirming the presence of SUR1-positive R1 astrocytes in the inner
zone of the gliotic capsule surrounding brain abscess (FIG.
11F).
[0338] A standard stoke model in the rat was studied. The stroke
was produced by intra-carotid insertion of a thread up to the
bifurcation of the internal carotid artery, placed under general
anesthesia. Animals surviving the stroke were sacrificed at 1 week
and the brain was examined Low power views of tissues adjacent to
the area of stroke showed cells with positive immunolabeling for
GFAP that coincided with positive immunolabeling for SUR1 (FIG.
11G,H). Examination of individual cells at high power showed that
the SUR1 immunolabel was present in large stellate-shaped
astrocytes, confirming the presence of SUR1-positive R1 astrocytes
in the gliotic capsule surrounding stroke (FIG. 11I).
[0339] Tissue was obtained from humans undergoing surgery for
resection of metastatic brain tumors. At surgery, the gliotic
capsule that surrounds the metastasis is readily distinguished from
the tumor itself and from edematous white matter. Low power views
of the gliotic capsule adjacent to the metastasis showed cells with
positive immunolabeling for GFAP that coincided with positive
immunolabeling for SUR1 (FIG. 11J,K). Examination of individual
cells at high power showed that the SUR1 immunolabel was present in
large stellate-shaped astrocytes with multiple well-developed
processes, confirming the presence of SUR1-positive R1 astrocytes
in the gliotic capsule surrounding metastatic brain tumor in humans
(FIG. 11L).
[0340] These data show for the first time SUR1 up-regulation in
reactive astrocytes at the site of formation of a gliotic capsule
consistent with expression of SUR1-regulated NC.sub.Ca-ATP channels
in R1 astrocytes. The data indicate that SUR1 expression in R1
astrocytes in the gliotic capsule was a common phenomenon in
numerous pathological conditions that affect the brain. These data
highlight a unique opportunity to manipulate R1 astrocytes of the
inner zone selectively by exploiting pharmacological agents that
act at SUR1 and that can therefore determine death or survival of
these cells.
[0341] Overall, these observations strongly reinforced the concept
of the "inner zone" of the gliotic capsule as being a unique
entity, distinct from the remainder of the gliotic capsule.
Example 9
The NC.sub.Ca-ATP Channel and Necrotic Death
[0342] NC.sub.Ca-ATP channels were studied in a rodent model of
stroke. In the penumbra, SUR1 labeling was found in stellate-shaped
cells (FIG. 12A) that were also GFAP-positive. In the middle of the
stroke, stellate cells were absent, but SUR1 labeling was found in
round cells exhibiting a bleb-like appearance (FIG. 12B,C) that
were also GFAP-positive (not shown). The round cells with blebbing
in situ resembled reactive astrocytes in vitro undergoing necrotic
death after exposure to Na azide. The effect of glibenclamide vs.
saline was determined. Glibenclamide or saline was administered via
subcutaneously-implanted osmotic mini-pump (1 .mu.M at 0.5
.mu.l/hr). In saline treated rats, 3-day mortality after stroke was
68%, whereas in glibenclamide-treated rats, 3-day mortality was
reduced to 28% (n=29 in each group; p<0.001, by .chi..sup.2). In
separate animals, the stroke hemisphere in glibenclamide-treated
rats contained only half as much excess water as in saline-treated
rats (n=5 in each group; p<0.01, by t-test), confirming an
important role of the NC.sub.Ca-ATP channel in edema formation.
[0343] SUR1 was also studied in a rodent model of trauma. The
effect of direct infusion of drugs into the site of trauma was
examined using an implanted osmotic mini-pump. The channel
inhibitor, glibenclamide, was used to reduce death of reactive
astrocytes, and the channel activator, diazoxide, to promote
astrocyte death. Glibenclamide infusion reduced the overall injury
response, stabilized the gliotic capsule around the foreign body
implant, and minimized the inflammatory response compared to
control.
[0344] Conversely, diazoxide essentially destroyed the gliotic
capsule and incited a huge inflammatory response, characterized by
massive influx of polymorphonuclear cells (PMNs) (FIG. 10A, B).
These data suggested that NC.sub.Ca-ATP channel plays a critical
role in the injury response, and they strongly support the
hypothesis that inflammation is closely linked to activity of the
NC.sub.Ca-ATP channel and necrotic death of reactive
astrocytes.
Example 10
Permanent MCA Models
[0345] Adult male or female Wistar rats (275-350 gm) were fasted
overnight then anesthetized (Ketamine, 60 mg/kg plus Xylazine, 7.5
mg/kg, i.p.). The right femoral artery was cannulated, and
physiological parameters, including temperature, pH, pO.sub.2,
pCO.sub.2 and glucose were monitored. Using a ventral cervical
incision, the right external carotid and pterygopalatine arteries
were ligated. The common carotid artery was ligated proximally and
catheterized to allow embolization of the internal carotid
artery.
[0346] For thromboembolic (TE) stroke, 7-8 allogeneic clots, 1.5 mm
long, were embolized. Allogeneic, thrombin-induced, fibrin-rich
blood clots were prepared (Toomy et al., 2002).
[0347] For large MCA strokes with malignant cerebral edema (MCE),
the inventors first embolized microparticles (Nakabayashi et al.,
1997) [polyvinyl alcohol (PVA) particles; Target Therapeutics,
Fremont Calif.; 150-250 .mu.m diameter, 600 .mu.g in 1.5 ml
heparinized-saline], followed by standard permanent intraluminal
suture occlusion (Kawamura et al., 1991) using a monofilament
suture (4-0 nylon, rounded at the tip and coated with
poly-L-lysine) advanced up to the ICA bifurcation and secured in
place with a ligature.
[0348] After stroke, animals are given 10 ml glucose-free normal
saline by dermoclysis. Rectal temperature was maintained at
.apprxeq.37.degree. C. using a servo-controlled warming blanket
until animals awoke from anesthesia. Blood gases and serum glucose
at the time of stroke were: pO.sub.2, 94.+-.5 mm Hg; pCO.sub.2,
36.+-.5 mm Hg; pH, 7.33.+-.0.01; glucose 142.+-.6 mg/dl in controls
and pO.sub.2, 93.+-.3 mm Hg; pCO.sub.2, 38.+-.2 mm Hg; pH,
7.34.+-.0.01; glucose 152.+-.7 mg/dl in glibenclamide-treated
animals.
[0349] With both models, animals awoke promptly from anesthesia and
moved about, generally exhibited abnormal neurological function,
typically circling behavior and hemiparesis. Mortality with the
thromboembolic (TE) model was minimal, whereas with the malignant
cerebral edema (MCE) model, animals exhibited delayed
deterioration, often leading to death. Most deaths occurred 12-24
hr after MCA occlusion, with necropsies confirming that death was
due to bland infarcts. Rarely, an animal died <6 hr after stroke
and was found at necropsy to have a subarachnoid hemorrhage, in
which case it was excluded from the study. Mortality in untreated
animals with MCE and bland infarcts was 65%, similar to that in
humans with large MCA strokes (Ayata & Ropper, 2002).
Example 11
Studies on Stroke Size, Mortality, Tissue-Water, and Drug
Localization
[0350] After MCA occlusion (both TE and MCE models), mini-osmotic
pumps (Alzet 2002, Durect Corporation, Cupertino, Calif.) were
implanted subcutaneously that delivered either saline or
glibenclamide (Sigma, St. Louis, Mo.; 300 .mu.M or 148 .mu.g/ml,
0.5 .mu.l/hr subcutaneously, no loading dose). Stroke size (TE
model), measured as the volume of TTC(-) tissue in consecutive 2 mm
thick slices and expressed as the percent of hemisphere volume, was
compared 48 after stroke in 2 treatment groups, each comprised of
10 male rats, treated with either saline or glibenclamide.
Mortality (MCE model) was compared during the first week after
stroke in 2 treatment groups, each comprised of 29 rats (19 female
plus 10 male), treated with either saline or glibenclamide. Edema
(MCE model) was compared at 8 hr after stroke in 2 treatment
groups, each comprised of 11 male rats, treated with either saline
or glibenclamide; rats in each of these 2 treatment groups were
subdivided into 2 subgroups, with the first of these being used to
analyze water in the entire involved hemisphere (no TTC
processing), and the second being used to analyze water in the
TTC(+) vs. TTC(-) portions of the involved hemisphere. For
localization of fluorescent-tagged drug, 20 male rats were
subjected to MCA stroke (MCE model) and were implanted with
mini-osmotic pumps that delivered BODIPY-conjugated glibenclamide
(BODIPY-FL-glyburide, Molecular Probes, Eugene, Oreg.; 300 .mu.M or
235 .mu.g/ml, 0.5 .mu.l/hr subcutaneously, no loading dose). Of
these, 15 rats were used for validation of drug action (mortality,
tissue water and glucose) and 5 rats were used for determination of
drug distribution.
Example 12
Immunolabeling
[0351] Brains were perfusion-fixed (4% paraformaldehyde) and
cryoprotected (30% sucrose). Cryosections (10 .mu.m) were prepared
and immunolabeled using standard techniques (Chen et al., 2003).
After permeabilizing (0.3% Triton X-100 for 10 min), sections were
blocked (2% donkey serum for 1 hr; Sigma D-9663), then incubated
with primary antibody directed against SUR1 (1:300; 1 hr at room
temperature then 48 h at 4.degree. C.; SC-5789; Santa Cruz
Biotechnology). After washing, sections were incubated with
fluorescent secondary antibody (1:400; donkey anti-goat Alexa Fluor
555; Molecular Probes, Oreg.). For co-labeling, primary antibodies
directed against NeuN (1:100; MAB377; Chemicon, Calif.); GFAP
(1:500; CY3 conjugated; C-9205; Sigma, St. Louis, Mo.) and vWf
(1:200; F3520, Sigma) were used and tissues were processed
according to manufacturers' recommendations. Species-appropriate
fluorescent secondary antibodies were used as needed. Fluorescent
signals were visualized using epifluorescence microscopy (Nikon
Eclipse E1000).
Example 13
TTC Staining, Stroke Size
[0352] Freshly harvested brains were cut into 2-mm thick coronal
sections, and slices were exposed to TTC (0.125% w/v in 62.5 mM
Tris-HCl, 13 mM MgCl.sub.2, 1.5% dimethylformamide) for 30 min at
37.degree. C. For stroke size, stained sections were photographed
and images were analyzed (Scion Image) to determine the percent of
the involved hemisphere occupied by TTC(-) tissue; no correction
for edema was performed. For some determinations of water or SUR1
protein content, individual coronal sections were divided under
magnification into 3 parts: (i) the non-involved, control
hemisphere; (ii) the TTC(+) portion of the involved hemisphere;
(iii) the TTC(-) portion of the involved hemisphere. For each
animal, pooled tissues from the 3 parts were then processed for
tissue water measurements or for Western blots.
Example 14
Tissue Water Content
[0353] Tissue water was quantified by the wet/dry weight method
(Hua et al., 2003). Tissue samples were blotted to remove small
quantities of adsorbed fluid. Samples were weighed with a precision
scale to obtain the wet weight (WW), dried to constant weight at
80.degree. C. and low vacuum, and then reweighed to obtain the dry
weight (WD). The percent H.sub.2O of each tissue sample was then
calculated as (WW-WD).times.100/WW.
Example 15
Immunoblots
[0354] Tissues lysates and gels were prepared (Perillan et al.,
2002). Membranes were developed for SUR1 (SC-5789; Santa Cruz
Biotechnology), Kir6.1 (Santa Cruz) or Kir6.2 (Santa Cruz).
Membranes were stripped and re-blotted for .beta.-actin (1:5000;
Sigma, St. Louis, Mo.), which was used to normalize the primary
data. Detection was carried out using the ECL system (Amersham
Biosciences, Inc.) with routine imaging and quantification (Fuji
LAS-3000).
Example 16
In Situ Hybridization
[0355] Non-radioactive digoxigenin-labeled probes were made
according to the manufacturer's protocol (Roche) using SP6 or T7
RNA polymerase. RNA dig-labeled probes (sense and anti-sense) were
generated from pGEM-T easy plasmids (Promega) with the SUR1 insert
(613 bp) flanked by the primers: 5' AAGCACGTCAACGCCCT 3' (SEQ ID
NO: 1) (forward); 5' GAAGCTTTTCCGGCTTGTC 3' (SEQ ID NO: 2)
(reverse). Fresh-frozen (10 .mu.m) or paraffin-embedded (4 .mu.m)
sections of rat brain (3, 6, 8 hours after MCA stroke) were used
for in situ hybridization (Anisimov et al., 2002).
Example 17
Inner Zone of the Gliotic Capsule
[0356] To assess if other causes of hypoxia, for example arterial
occlusion, resulted in up-regulation of SUR1, two rodent models of
permanent focal cerebral ischemia described in Example 10 were
used.
[0357] The MCE model was used to evaluate SUR1 protein and mRNA,
and to assess effects of SUR1 inhibition on edema and survival,
while the TE model was used to measure effects of SUR1 inhibition
on stroke size. Absence of perfusion (FIG. 14A), TTC staining
(Mathews et al., 2000) (FIG. 14B) and GFAP immunolabeling were used
to distinguish infarct from peri-infarct regions.
[0358] SUR1 expression increased transiently in the core of the
infarct. Here, an increase in SUR1 became evident as early as 2-3
hr after MCA occlusion (FIG. 14D), well before onset of necrosis,
and later disappeared as necrosis set in (FIG. 14C, right side of
figure). At these early times before necrosis, SUR1 was very
prominent in neurons that co-labeled with NeuN (FIG. 14D-F).
[0359] In peri-infarct regions, including the classical ischemic
"watershed" zone between anterior cerebral artery (ACA) and MCA
territories, SUR1 expression increased later than in the core but
was sustained. By 6-12 hr, SUR1 expression sharply demarcated
infarct and peri-infarct areas (FIG. 14C). Here, SUR1 expression
was found in neurons, astrocytes and capillary endothelial cells,
as shown by co-labeling with NeuN, GFAP (FIG. 14G-I) and von
Willebrand factor (FIG. 14J-L), respectively. SUR1 is not normally
expressed in such abundance in these cortical and subcortical areas
(Treherne & Ashford, 1991; Karschin et al., 1997) as is evident
in contralateral tissues (FIG. 14C, left side of figure).
[0360] Western blots showed an increase in expression of SUR1
protein, most prominently in peri-infarct regions (FIG. 15A-D).
However, the pore-forming subunits of K.sub.ATP channels, Kir6.1 or
Kir6.2, were not up-regulated (FIG. 15C-D). In situ hybridization
showed SUR1 transcripts in neurons and capillaries from regions of
ischemia that were not present in control tissues (FIG. 15E-G),
suggesting that SUR1, but not K.sub.ATP channels, was
transcriptionally up-regulated in cerebral ischemia.
[0361] Thus, these data suggest that SUR1, but not Kir6.1 or
Kir6.2, is transcriptionally up-regulated in cerebral ischemia,
first in regions that are destined to undergo necrosis, and later
in peri-infarct regions.
Example 18
SUR1 Up-Regulation
[0362] FIG. 15A-G of the showed that SUR1 was significantly
up-regulated in stroke. It also showed that the pore-forming
subunits, Kir6.1 and Kir6.2, were not up-regulated in stroke,
suggesting that K.sub.ATP channels were not involved. To prove that
SUR1 up-regulation is due to NC.sub.Ca-ATP channels and not to
K.sub.ATP channels, patch clamp recordings of neurons and
endothelial cells from ischemic regions were performed. Large
neuron-like cells were enxymatically isolated 3-hr (FIG. 16A) and
6-hr after stroke. Patch clamp study was carried out using Cs.sup.+
in the bath and pipette, to block all K.sup.+ channels including
K.sub.ATP channels. These experiments showed robust cation channel
activity that was blocked by glibenclamide, as predicted for the
NC.sub.Ca-ATP channel (FIG. 16B). In addition, when channel
activity was recorded with K.sup.+, the slope conductance was 34 pS
(FIG. 16C,D), as previously reported in freshly isolated R1
astrocytes, and much less than the 70-75 pS reported for K.sub.ATP
channels.
Example 19
Function of SUR1 in Cerebral Ischemia
[0363] To determine the function of SUR1 that was newly expressed
in cerebral ischemia, the effects of glibenclamide, a highly
selective inhibitor of SUR1 was studied. The effect of
glibenclamide on mortality (MCE model) was studied. In a large
group of animals, both male and female, treatment with
glibenclamide resulted in a dramatic reduction in mortality
compared to saline, from 65% to 24% (p<0.002; FIG. 17A).
[0364] Since glibenclamide had been shown to ameliorate cytotoxic
edema of astrocytes induced by energy depletion (Chen et al.,
2003), it was reasoned that the beneficial effect on mortality was
related to edema. The effect of glibenclamide on the formation of
edema 8 hr after induction of stroke (MCE model) was examined This
is a time that preceded death of any animal in the mortality study.
In the first of two experiments, water content in the involved and
uninvolved hemispheres was measured using the methods described in
Example 14. For the control hemisphere, water was 77.9.+-.0.2%. For
the involved hemisphere, water rose by 3.4%, to 81.3.+-.0.5% for
the group treated with saline, whereas it rose by only 2.0%, to
79.9.+-.0.3%, for the group treated with glibenclamide. These
values were significantly different (p<0.05), consistent with an
important role of SUR1 in formation of edema.
[0365] Next, to better characterize the location of edema, the
water content after dividing coronal brain sections into viable
TTC(+) and non-viable TTC(-) parts was examined Water in the
uninvolved hemisphere was 78.0.+-.0.1% (FIG. 17B), similar to the
previous value of 77.9.+-.0.2%, indicating that TTC processing had
not altered water content. For the involved hemisphere, water in
the TTC(+) tissue rose by 5.4%, to 83.4.+-.1.1% for the group
treated with saline, whereas it rose by only 2.5%, to 80.5.+-.0.3%,
for the group treated with glibenclamide (FIG. 17B). These values
were significantly different (p<0.05). By contrast, values for
water in TTC(-) tissues, 78.7.+-.1.0% and 78.6.+-.0.4% with saline
and with glibenclamide, respectively, were not different (p=0.97),
and were only slightly higher than the value for the uninvolved
hemisphere (78.0%), reflecting a need for ongoing blood flow to
increase tissue water (FIG. 17B) (Ayata & Ropper, 2002).
[0366] In these animals, serum glucose at 8 hr when edema was
measured remained in a range unlikely to have an effect on
ischemia-induced damage (Li et al., 1994; Wass & Lanier, 1996)
(122.+-.4 vs. 93.+-.3 mg/dl for saline and glibenclamide-treated
animals, respectively; 11 rats/group). Together, these data
indicated that the edema was located almost entirely in viable
peri-infarct (penumbral) tissue adjacent to the early core of the
stroke, and that glibenclamide was highly effective in reducing it,
consistent with an important role for SUR1 in formation of
edema.
[0367] Thus, the data with low-dose glibenclamide, which is highly
selective for SUR1 (Gribble & Reimann, 2003; Meyer et al.,
1999) provided compelling evidence of a critical role for SUR1 in
formation of cerebral edema.
Example 20
The Effect of Stroke Size
[0368] A non-lethal thromboembolic (TE) model was used to assess
stroke size 48 hr after induction of stroke.
[0369] With the TE model, glibenclamide treatment resulted in a
highly significant reduction in stroke volume, compared to saline
controls (32.5.+-.4.9% vs. 15.5.+-.2.3%; p<0.01) (FIG. 17C-E).
Essentially all animals, regardless of treatment group, suffered
infarctions involving the basal ganglia, which were supplied by
terminal lenticulostriate arterioles. However, reduced stroke
volumes in the glibenclamide group were often associated with
marked sparing of the cerebral cortex (FIG. 17C-D), a phenomenon
previously reported with decompressive craniectomy (Doerfler et
al., 2001). With glibenclamide, cortical sparing may reflect
improved leptomeningeal collateral blood flow due to reduced
cerebral edema and reduced intracranial pressure.
Example 21
MCE Model Following Stroke
[0370] The fluorescent derivative, BODIPY-glibenclamide, was used
to label tissues in vivo following stroke (MCE model).
[0371] When delivered in the same manner as the parent compound,
the fluorescent derivative exhibited similar protective effects,
but was less potent [7-day mortality, 40% (n=10); water in the
TTC(+) portion of the involved hemisphere at 8 hr, 82.7.+-.1.4%
(n=5); serum glucose, 109.+-.4 mg/dl], consistent with reduced
efficacy of the labeled drug (Zunkler et al., 2004). The low
systemic dose of drug used yielded minimal labeling in the
uninvolved hemisphere (FIG. 18B) and pancreas, and none in the
unperfused core of the stroke. However, cells in peri-infarct
regions were clearly labeled, with well-defined labeling of large
neuron-like cells and of microvessels (FIG. 18A), including
capillaries (FIG. 18C), that showed prominent expression of SUR1
(FIG. 18D). Preferential cellular labeling in ischemic brain likely
reflected not only an increase in glibenclamide binding sites, but
also an increase in uptake, possibly due to alteration of the blood
brain barrier.
[0372] Thus, the data indicated the presence of NC.sub.Ca-ATP
channels in capillary endothelium and neurons in addition to their
previously described presence in astrocytes (Chen et al., 2001;
Chen et al., 2003). Additional patch clamp experiments on neurons
and microvessels isolated from ischemic cortex 1-6 hr after MCA
occlusion (MCE model) confirmed the presence of NC.sub.Ca-ATP
channels, showing a non-selective cation channel of around 30-35 pS
conductance, that was easily recorded with Cs.sup.+ as the charge
carrier, and that was blocked by glibenclamide. This channel was
not present in cells from non-ischemic cerebral tissues.
[0373] In view of the above, it is suggested that SUR1-regulated
NC.sub.Ca-ATP channels that are opened by ATP depletion and that
are newly expressed in ischemic neurons, astrocytes and endothelial
cells constitute an important, heretofore unidentified pathway for
Na.sup.+ flux required for formation of cytotoxic and ionic edema.
Together, these findings suggest a critical involvement of SUR1 in
a new pathway that determines formation of edema following cerebral
ischemia. Molecular therapies directed at SUR1 may provide
important new avenues for treatment of many types of CNS injuries
associated with ischemia.
Example 22
Co-Administration of Glibenclamide and tPA
[0374] A rodent model of thromboembolic stroke was used (Aoki et
al., 2002; Kijkhuizen et al., 2001; Kano et al., 2000; Sumii et
al., 2002; Tejima et al., 2001). Briefly, male spontaneously
hypertensive rats that have been fasted overnight are anesthetized
using halothane (1-1.5% in a 70/30 mixture of N.sub.2O/O.sub.2)
with spontaneous respiration (Lee et al., 2004; Sumii et al.,
2002). Rectal temperature was maintained at .apprxeq.37.degree. C.
with a thermostat-controlled heating pad. The right femoral artery
was cannulated, and physiological parameters, including
temperature, mean blood pressure, pH, pO.sub.2, and pCO.sub.2,
glucose were monitored. Temporary focal ischemia was obtained with
an embolic model that used allogeneic clots to occlude the MCA.
Allogeneic, thrombin-induced, fibrin-rich blood clots were prepared
using methods adapted from Niessen et al. (Asahi et al., 2000;
Niessen et al., 2003; Sumii et al., 2002). Seven clots, 1.5 mm
long, were used for embolizing.
[0375] Using a ventral cervical incision, the internal and external
carotid arteries were exposed. The external carotid artery and
pterygopalatine arteries were ligated. Removable surgical clips
were applied to the common and internal carotid arteries. The
modified PE-50 catheter containing the clots was inserted
retrograde into the external carotid artery and advanced up to the
internal carotid artery. The temporary clips were removed, and the
clots were injected. Incisions were closed.
[0376] After stroke, animals were given glucose-free normal saline,
10 ml total, by dermoclysis. Temperature was maintained until
animals were awake and were moving about.
[0377] Just prior to the time designated for treatment
(reperfusion), animals were re-anesthetized and the femoral vein
was cannulated. At the time designated for treatment, saline, or a
loading dose of glibenclamide (1.5 .mu.g/kg, i.v., Sigma, St.
Louis) was first administered. Then, reperfusion was achieved with
i.v. administration of rtPA (10 mg/kg, Alteplase, Genetech;
dissolved in 2 ml distilled water, given over 30 min) (Buesseb et
al., 2002). Then, using a dorsal thoracic incision, a mini-osmotic
pump (Alzet 2002, Durect Corporation, Cupertino, Calif.) was
implanted subcutaneously that delivered either saline or
glibenclamide (300 .mu.M or 148 .mu.g/ml, 0.5 .mu.l/hr s.q.).
Physiological parameters, including temperature, mean blood
pressure (tail cuff plethysmography), blood gases and glucose were
monitored.
[0378] At the same time of 6 hr, animals were co-treated with
either saline or glibenclamide (loading dose of 1.5 .mu.g/kg i.v.
plus implantation of a mini-osmotic pump containing 148
.mu.g/m1=300 .mu.M delivered at 1/2 .mu.l/hr). Animals were
euthanized 24 hr following stroke and brains were perfused to
remove blood from the intravascular compartment. Coronal sections
of the fresh brains were prepared and photographed, following which
sections were processed for TTC staining to identify areas of
infarction.
[0379] All animals (5/5) co-treated with saline showed large
regions of hemorrhagic conversion in cortical and subcortical
parenchymal areas of infarction, along with evidence of
intraventricular hemorrhage (FIG. 19A-D). In contrast, only 1/5
animals co-treated with glibenclamide had hemorrhagic conversion,
with 4/5 showing no evidence of hemorrhage (FIG. 19E-H).
[0380] These data suggest that there was protection from
hemorrhagic conversion with the administration of glibenclamide, as
well as reduction in stroke size, ionic edema, and vasogenic
edema.
Example 23
Isolation of Brain Capillaries and Endothelial Cells
[0381] The method was adapted in part from Harder et al. (1994)
with modifications as previously reported (Seidel, 1991). Briefly,
a rat was deeply anesthetized, the descending aorta was ligated,
the right atrium was opened and the left ventricle was cannulated
to allow perfusion of 50 ml of a physiological solution containing
a 1% suspension of iron oxide particles (particle size, 10 .mu.m;
Aldrich Chemical Co.). The brain was removed, the pia and pial
vessels were stripped away and the cortical mantel is minced into
pieces 1-2 mm.sup.3 with razor blades. The tissue pieces were
incubated with trypsin plus DNAse and then sieved through nylon
mesh (210 .mu.m). Retained microvessels were resuspended in
collagenase, agitated and incubated at 37.degree. C. for an
additional 10 min. To terminate the digestion, microvessels were
adhered to the side of the container with a magnet and washed
repeatedly to remove enzyme and cellular debris.
[0382] Using these methods yielded healthy-appearing microvascular
structures that were suitable for further digestion to obtain
single cells (FIG. 21) for further experiments.
[0383] Isolated endothelial cells were studied using freshly
isolated endothelial cells using a nystatin-perforated patch
technique. With physiological solutions, the cells exhibited a
prominent, strongly rectifying inward current at negative
potentials, and a modest outward current at positive potentials
(FIG. 22A), yielding a characteristic current-voltage curve with
near-zero current at intermediate potentials (FIG. 22C), similar to
previous observations in freshly isolated endothelial cells (Hogg
et al., 2002). When K.sup.+ in the pipette solution was replaced
with Cs.sup.+, K.sup.+ channel currents were completely blocked. In
endothelial cells, this yielded a current-voltage curve that was
linear (FIG. 22E). These data demonstrated that voltage dependent
channels in freshly isolated endothelial cells are exclusively
K+channels that do not carry Na.sup.+.
Example 24
Isolation of Neurons
[0384] Neurons were isolated from vibratome sections Immunolabeling
experiments indicated that ischemic NeuN-positive neurons expressed
SUR1 within 2-3 hr after MCAO, before necrosis was evident.
Therefore, tissues were prepared at 2-3 hr after MCAO. The brain
was divided coronally at the level of the bregma, and cryosections
were prepared from one half and vibratome sections were prepared
from the other half. Cryosections (10 .mu.m) were used for TTC
staining (Mathews et al., 2000) or alternatively, high-contrast
silver infarct staining (SIS), (Vogel et al., 1999) to identify the
region of ischemia, and for immunolabeling, to verify SUR1
up-regulation in neurons double labeled for NeuN. Vibratome
sections (300 .mu.m) were processed (Hainsworth et al., 2000; Kay
et al., 1986; Moyer et al., 1998) to obtain single neurons for
patch clamping. Selected portions of coronal slices were incubated
at 35.degree. C. in HBSS bubbled with air. After at least 30 min,
the pieces were transferred to HBSS containing 1.5 mg/ml protease
XIV (Sigma). After 30-40 min of protease treatment, the pieces were
rinsed in enzyme-free HBSS and mechanically triturated. For
controls, cells from mirror-image cortical areas in the uninvolved
hemisphere were used. Cells were allowed to settle in HBSS for
10-12 min in a plastic Petri dish mounted on the stage of an
inverted microscope. Large and medium-sized pyramidal-shaped
neurons were selected for recordings. At this early time of 2-3 hr,
only neurons and capillaries, not astrocytes, show up-regulation of
SUR1.
[0385] Once the cells were isolated patch clamp experiments using
well known methods including whole-cell, inside-out, outside-out
and perforated patch were used (Chen et al., 2003; Chen et al.,
2001; Perillan et al., 2002; Perillan et al., 2000; Perillan et
al., 1999)
Example 25
MMP Inhibition by Glibenclamide
[0386] Activation of MMP-9 & MMP-2 in stroke tissue was
compared to controls. Briefly, gelatinase activity of recombinant
enzyme and stroke tissue under control conditions (CTR), in
presence of glibenclamide (10 .mu.M), and in presence of
MMP-inhibitor II (300 nM; Calbiochem).
[0387] Next, the supernatants underwent a gelatinase purification
process with gelatin-Sepharose 4B (Pharmacia), and Zymography was
performed on the purified supernatants in sodium dodecyl sulfate
gels containing gelatin (Rosenberg, 1994). Dried gels were scanned
with a transparency scanner, and images were analyzed by
densitometry. The relative lysis of an individual sample was
expressed as the integrated density value of its band and divided
by the protein content of the sample.
[0388] Zymography confirmed that gelatinase activity was increased
after stroke (FIG. 20A), and showed that gelatinase activity
assayed in the presence of glibenclamide (FIG. 20B, Glibenclamide)
was the same as that assayed without (FIG. 20B, CTR), although
gelatinase activity was strongly inhibited by commercially
available MMP inhibitor II (FIG. 20B, MMP-2/MMP-9 inhibitor). These
data demonstrated that glibenclamide did not directly inhibit
gelatinase activity, and suggested that the reduction of
hemorrhagic conversion observed with glibenclamide likely came
about due to a beneficial, protective effect of glibenclamide on
ischemic endothelial cells.
Example 26
Up-Regulation of SUR1-mRNA in Stroke
[0389] Additional molecular evidence for involvement of SUR1 in
stroke was obtained using quantitative RT-PCR.
[0390] Total RNA was extracted and purified from samples of
homogenized brain tissues contralateral (CTR) and ipsilateral to
MCAO (STROKE) using guanidine isothyocyonatye. cDNA was synthesized
with 4 .mu.g of total RNA per 50 .mu.l of reaction mixture using
TaqMan RT kit (Applied Biosystems). Relative values of SUR1-mRNA
were obtained by normalizing to H1f0 (histone 1 member 0). The
following probes were used SUR1 forward: GAGTCGGACTTCTCGCCCT (SEQ
ID NO: 3); SUR1 reverse: CCTTGACAGTGGCCGAACC (SEQ ID NO: 4); SUR1
TaqMan Probe: 6-FAM-TTCCACATCCTGGTCACACCGCTGT (SEQ ID NO: 5) TAMRA;
H1f0 forward: CGGACCACCCCAAGTATTCA (SEQ ID NO: 6); H1f0 reverse:
GCCGGCACGGTTCTTCT (SEQ ID NO: 7); H1f0 TaqMan Probe:
6-FAM-CATGATCGTGGCTGCTA TCCAGGCA(SEQ ID NO: 8)-TAMRA.
[0391] These data showed that mRNA for SUR1 was significantly
increased in the core region, 3 hr after MCAO (FIG. 23).
Example 27
SUR1 Knockdown (SUR1KD) is Protective
[0392] To further test involvement of SUR1, SUR1 expression was
"knocked down" in situ by infusing oligodeoxynucleotide (ODN) for
14 days using a mini-osmotic pump, with the delivery catheter
placed in the gelfoam implantation site in the brain, in the
otherwise standard model we use for R1 astrocyte isolation
(Perillan et al., 1980, Perillan et al., 2002, Perillan et al.,
2000, Perillan et al., 1999). Knockdown of SUR1 expression (SUR1KD)
was achieved using antisense (AS; 5'-GGCCGAGTGGTTCTCGGT-3') (SEQ ID
NO: 9) (Yokoshiki et al., 1999) oligodeoxynucleotide (ODN), with
scrambled (SCR; 5'-TGCCTGAGGCGTGGCTGT-3' (SEQ ID NO: 10)) ODN being
used as control.
[0393] Immunoblots of gliotic capsule showed significant reduction
in SUR1 expression in SUR1 knockdown (SUR1KD) tissues compared to
controls receiving scrambled sequence ODN (FIGS. 24A and 24B).
[0394] The inventors enzymatically isolated single cells from
SUR1KD and controls using a standard cell isolation protocols
described above (Chen et al., 2003) to assess functional responses
to ATP depletion induced by Na azide. In R1 astrocytes from control
tissues, Na azide (1 mM) caused rapid depolarization due to
Na.sup.+ influx attributable to activation of NC.sub.Ca-ATP
channels (FIG. 24C). Notably, this depolarizing response was
opposite the hyperpolarizing response observed when K.sub.ATP
channels were activated. In R1 astrocytes from SUR1KD, however, Na
azide had little effect on resting membrane potential (FIG. 24D).
In controls, application of Na azide resulted in depolarization of
64.+-.3.7 mV, whereas in cells for SUR1KD, depolarization was only
8.7.+-.1.7 mV (FIG. 24E).
[0395] In addition, membrane blebbing that typically follows
exposure to Na azide was not observed in cells from SUR1KD,
confirming the role for SUR1 in cytotoxic edema of R1
astrocytes.
Example 28
Molecular Factors that Regulate SUR1 Expression
[0396] Based on work in pancreatic .beta. cells, a number of SP1
transcription factor binding sites have been identified in the
proximal SUR1 promoter region that are considered to be important
for activation of SUR1 transcriptional activity (Ashfield et al.,
1998; Hilali et al., 2004). Notably, SP1 has essentially not been
studied in stroke (Salminen et al., 1995).
[0397] Briefly, the ischemic peri-infarct tissues was immunolabeled
for SP1, which is important for SUR1 expression, for HIF1.alpha.,
which is widely recognized to be up-regulated in cerebral ischemia
(Semenza 2001; Sharp et al., 2000) and for SUR1 itself. SP1 was
prominently expressed in large neuron-like cells and in capillaries
(FIG. 25A, 25C) in regions confirmed to be ischemic by virtue of
expression of HIF1.alpha. (FIG. 25B). Notably, capillaries that
expressed SP1 also showed prominent expression of SUR1 (FIG. 25C,
25D). Contralateral control tissues showed little immunolabeling
for SP1 and none for HIF1.alpha. (FIG. 25E, 25F).
[0398] Nuclear SP1 localization was significantly augmented
early-on in stroke (FIG. 26A, 26B), and nuclear SP1 was found in
large neuron-like cells that express SUR1 following MCAO (FIG.
26C).
[0399] HIF1.alpha. knock-down animals were obtained by infusion of
antisense oligodeoxynucleotide at the site of gelfoam implant. FIG.
27 confirms the HIF1.alpha. knock-down animals results in a
significant decrease in SUR1 expression (FIG. 27B, 27D), providing
strong evidence that not only SP1 but also HIF1.alpha. is likely to
be an important regulator of SUR1 expression.
REFERENCES
[0400] All patents and publications mentioned in the specifications
are indicative of the levels of those skilled in the art to which
the invention pertains. All patents and publications are herein
incorporated by reference to the same extent as if each individual
publication was specifically and individually indicated to be
incorporated by reference. [0401] Aguilar-Bryan L, et al., Science.
1995; 268:423-426. [0402] Ammala C, et al., Nature. 1996;
379:545-548. [0403] Anisimov, S. V., et al., Mech. Dev. 117, 25-74
(2002). [0404] Aoki K, et al., Acta Neuropathol (Berl). 2003;
106:121-124. [0405] Arteel G E, et al., Eur J Biochem. 1998;
253:743-750. [0406] Ashcroft F M. Science. 1998; 282:1059-1060.
[0407] Ayata, C. & Ropper, A. H. J. Clin. Neurosci. 9, 113-124
(2002). [0408] Babenko A P, et al., Annu Rev Physiol. 1998;
60:667-687. [0409] Ballanyi, K. J. Exp. Biol. 207, 3201-3212
(2004). [0410] Barclay J, et al., J Neurosci. 2002; 22:8139-8147.
[0411] Baukrowitz T, et al., Science. 1998; 282:1141-1144. [0412]
Becker J B, et al., Ann N Y Acad Sci. 2001; 937:172-187. [0413]
Beyer C, et al., J Steroid Biochem Mol Biol. 2002; 81:319-325.
[0414] Blurton-Jones M, et al., J Comp Neurol. 2001; 433:115-123.
[0415] Bussink J, et al., Radiat Res. 2000; 154:547-555. [0416]
Cevolani D, et al., Brain Res Bull. 2001; 54:353-361. [0417] Chen
M, et al., J Neurosci. 2003; 23:8568-8577. [0418] Chen M, Simard J
M. J Neurosci. 2001; 21:6512-6521 [0419] Chen H., et al., J.
Neurol. Sci. 118, 109-6 (1993). [0420] Choi I, et al., Mol Cell
Endocrinol. 2001; 181:139-150. [0421] Cress A E. Biotechniques.
2000; 29:776-781. [0422] Dalton S, et al., Glia. 2003; 42:325-339.
[0423] Dhandapani K, et al., Endocrine. 2003; 21:59-66. [0424]
Dhandapani K M, et al., Biol Reprod. 2002; 67:1379-1385. [0425]
Dhandapani K M, et al., BMC Neurosci. 2002; 3:6. [0426] Diab A, et
al., Infect Immun 1999; 67:2590-2601. [0427] Doerfler, A., et al.,
Stroke 32, 2675-2681 (2001). [0428] Drain P, et al., Proc Natl Acad
Sci USA. 1998; 95:13953-13958. [0429] Dubik D et al., Oncogene.
1992; 7:1587-1594. [0430] El Ashry D, et al., J Steroid Biochem Mol
Biol. 1996; 59:261-269. [0431] Enkvetchakul D, et al., Biophys J.
2000; 78:2334-2348. [0432] Falk E M, et al., Pharmacol Biochem
Behav. 2002; 72:617-622. [0433] Fischer S, et al., J Cell Physiol.
2004; 198:359-369. [0434] Foy M R, et al., Brain Res. 1984;
321:311-314. [0435] Fujita A, et al., Pharmacol Ther. 2000;
85:39-53. [0436] Garcia-Estrada J, et al., Brain Res. 1993;
628:271-278. [0437] Garcia-Ovejero D, et al., J Comp Neurol. 2002;
450:256-271. [0438] Garcia-Segura L M, et al., Frog Neurobiol.
2001; 63:29-60. [0439] Garlid K D, et al., Circ Res. 1997;
81:1072-1082. [0440] Giaccia A J, et al., Int J Radiat Oncol Biol
Phys. 1992; 23:891-897. [0441] Gribble, F. M. & Reimann, F
Diabetologia 46, 875-891 (2003). [0442] Grover G J. Can J Physiol
Pharmacol. 1997; 75:309-315. [0443] Guo X Z, et al., Cell Res.
2001; 11:321-324. [0444] Hainsworth et al., Neuropharmacology.
2001; 40:784-791. [0445] Hale L P, et al., Am J Physiol Heart Circ
Physiol. 2002; 282:H1467-H1477. [0446] Halstead J, et al., J Biol
Chem. 1995; 270:13600-13603. [0447] Harder et al., Am J Physiol.
1994; 266:H2098-H2107.Haruna T, et al., Pflugers Arch. 2000;
441:200-207. [0448] Haug A, et al., Arch Toxicol. 1994; 68:1-7.
[0449] Higashijima T, et al., J Biol Chem. 1990; 265:14176-14186.
[0450] Higgins C F. Annu Rev Cell Biol. 1992; 8:67-113. [0451]
Hiroi H, et al., J Mol Endocrinol. 1999; 22:37-44. [0452] Hobbs M
V, et al., J Immunol. 1993; 150:3602-3614. [0453] Hogg et al., FEBS
Lett. 2002; 522:125-129. [0454] Hogg et al., Lung. 2002;
180:203-214. [0455] Hohenegger M, et al., Proc Natl Acad Sci U S A.
1998; 95:346-351. [0456] Honda K, et al., J Neurosci Res. 2000;
60:321-327. [0457] Hossain M A, et al., J Biol Chem. 2000;
275:27874-27882. [0458] Hua Y, et al., J Cereb Blood Flow Metab.
2003; 23:1448-1454. [0459] Hunt R A, et al., Hypertension. 1999;
34:603-608. [0460] Huovinen R, et al., Int J Cancer. 1993;
55:685-691. [0461] Ignotz R A, et al., J Cell Biochem. 2000;
78:588-594. [0462] Inagaki N, et al., Neuron. 1996; 16:1011-1017.
[0463] Isomoto S, et al., J Biol Chem. 1996; 271:24321-24324.
[0464] Jain, Sci. Amer. 271: 58-65, 1994. [0465] Jorgensen M B, et
al., Exp Neurol. 1993; 120:70-88. [0466] Jovanovic A, et al., Lab
Invest. 1998; 78:1101-1107. [0467] Kakinuma Y, et al., Clin Sci
(Lond). 2002; 103 Suppl 48:210S-214S. [0468] Kangas L. Cancer
Chemother Pharmacol. 1990; 27:8-12. [0469] Kangas L. J Steroid
Biochem. 1990; 36:191-195. [0470] Kanthasamy A, et al.,
Neuroscience. 2002; 114:917-924. [0471] Karschin, C., et al., FEBS
Lett. 401, 59-64 (1997). [0472] Kawamura, S., et al., Acta
Neurochir. (Wien.) 109, 126-132 (1991). [0473] Kay et al., J
Neurosci Methods. 1986; 16:227-238. [0474] Ke C, et al., Neurosci
Lett. 2001; 301:21-24. [0475] Kelly M J, et al., Steroids. 1999;
64:64-75. [0476] Kennedy A S, et al., Int J Radiat Oncol Biol Phys.
1997; 37:897-905. [0477] Kielian T, et al., J Immunol. 2001;
166:4634-4643. [0478] Kimura D. Sci Am. 1992; 267:118-125. [0479]
Kohshi K, J Neurol Sci. 2003; 209:115-117. [0480] Koster J C, J Gen
Physiol. 1999; 114:203-213. [0481] Kucich U, et al., Arch Biochem
Biophys. 2000; 374:313-324. [0482] Kuiper G G, et al.,
Endocrinology. 1997; 138:863-870. [0483] Kuiper G G, et al., Proc
Natl Acad Sci U S A. 1996; 93:5925-5930. [0484] Larsson O, et al.,
Diabetes. 2000; 49:1409-1412. [0485] Lawson K. Kidney Int. 2000;
57:838-845. [0486] Le Mellay V, et al., J Cell Biochem. 1999;
75:138-146. [0487] Leaney J L, Tinker A. Proc Natl Acad Sci U S A.
2000; 97:5651-5656. [0488] Li, P. A., et al., Neurosci. Lett. 177,
63-65 (1994). [0489] Lieberherr M, et al., J Cell Biochem. 1999;
74:50-60. [0490] Liss B, Roeper J. Mol Membr Biol. 2001;
18:117-127. [0491] Liu Y, et al., Circulation. 1998; 97:2463-2469.
[0492] Mateo J, et al., Biochem J. 2003; 376:537-544. [0493]
Mathews et al., J Neurosci Methods. 2000; 102:43-51. [0494] McNally
J G, et al., Methods. 1999; 19:373-385. [0495] Meyer, M., et al.,
Br. J. Pharmacol. 128, 27-34 (1999). [0496] Moon R C, Constantinou
AI. Breast Cancer Res Treat. 1997; 46:181-189. [0497] Moyer et al.,
J Neurosci Methods. 1998; 86:35-54. [0498] Munoz A, et al., Stroke.
2003; 34:164-170. [0499] Murayama T, et al., J Cell Physiol. 1996;
169:448-454. [0500] Murphy K, et al., Mol Pharmacol. 2003;, in
press. [0501] Nakabayashi, K. et al. AJNR Am. J. Neuroradiol. 18,
485-491 (1997). [0502] Nichols C G, et al., Science. 1996;
272:1785-1787. [0503] Oehmichen M, et al., Exp Toxicol Pathol.
2000; 52:348-352. [0504] Oehmichen M, et al., Neurotoxicology.
2001; 22:99-107. [0505] Olive P L, et al., Br J Cancer. 2000;
83:1525-1531. [0506] Paczynski R P, et al., Stroke. 2000;
31:1702-1708. [0507] Paech K, et al., Science. 1997; 277:1508-1510.
[0508] Panten U, et al., Biochem Pharmacol. 1989; 38:1217-1229.
[0509] Papadopoulos M C, et al., Mt Sinai J Med. 2002; 69:242-248.
[0510] Perillan P R, et al., J Biol Chem. 2002; 277:1974-1980.
[0511] Perillan P R, et al., Glia. 1999; 27:213-225. [0512]
Perillan P R, et al., Glia. 2000; 31:181-192. [0513] Phillips M I,
Zhang Y C. Methods Enzymol. 2000; 313:46-56. [0514] Piiper A, et
al., Am J Physiol. 1997; 272:G135-G140. [0515] Pogue B W, et al.,
Radiat Res. 2001; 155:15-25. [0516] Proks P, et al., J Physiol.
1999; 514 (Pt 1):19-25. [0517] Qiu J, et al., J Neurosci. 2003;
23:9529-9540. [0518] Rama Rao K V, et al., J Neurosci Res. 2003;
74:891-897. [0519] Rama Rao K V, et al., Neuroreport. 2003;
14:2379-2382. [0520] Ramirez V D, Zheng J. Front Neuroendocrinol.
1996; 17:402-439. [0521] Raucher D, et al., Cell. 2000;
100:221-228. [0522] Robinson A P, et al., Immunology. 1986;
57:239-247. [0523] Robinson S P, et al., Eur J Cancer Clin Oncol.
1988; 24:1817-1821. [0524] Rohacs T, et al., J Biol Chem. 1999;
274:36065-36072. [0525] Rossignol F, et al., Gene. 2002;
299:135-140. [0526] Ruknudin A, et al., J Biol Chem. 1998;
273:14165-14171. [0527] Ruscher K, et al., J Neurosci. 2002;
22:10291-10301. [0528] Russo J, et al., IARC Sci Publ. 1990; 47-78.
[0529] Russo J, Russo I H. Lab Invest. 1987; 57:112-137. [0530]
Saadoun S, et al., Br J Cancer. 2002; 87:621-623. [0531] Schubert
P, et al., Ann N Y Acad Sci. 2000; 903:24-33. [0532] Seidel et al.,
Cell Tissue Res. 1991; 265:579-587. [0533] Seino, S. Annu. Rev.
Physiol 61, 337-362 (1999). [0534] Semenza G L. Biochem Pharmacol.
2000; 59:47-53. [0535] Shaywitz B A, et al., Nature. 1995;
373:607-609. [0536] Shyng S, et al., J Gen Physiol. 1997;
110:643-654. [0537] Singer C A, et al., J Neurosci. 1999;
19:2455-2463. [0538] Singh M, et al., J Neurosci. 1999;
19:1179-1188. [0539] Smith S S, et al., Brain Res. 1987; 422:40-51.
[0540] Smith S S, et al., Brain Res. 1988; 475:272-282. [0541]
Sohrabji F, et al., Proc Natl Acad Sci U S A. 1995; 92:11110-11114.
[0542] Stone D J, et al., J Neurosci. 1998; 18:3180-3185. [0543]
Streit W J, et al., Frog Neurobiol. 1999; 57:563-581. [0544] Sun M
C, et al., J Neurosurg. 2003; 98:565-569. [0545] Sylvia V L, et al,
J Steroid Biochem Mol Biol. 2000; 73:211-224. [0546] Teixeira C, et
al., Cancer Res. 1995; 55:3902-3907. [0547] Thrash-Bingham C A, et
al., J Natl Cancer Inst. 1999; 91:143-151. [0548] Toker A. Curr
Opin Cell Biol. 1998; 10:254-261. [0549] Toomey, J. R. et al.
Stroke 33, 578-585 (2002). [0550] Toran-Allerand C D. J Steroid
Biochem Mol Biol. 1996; 56:169-178. [0551] Torner L, et al., J
Neurosci. 2001; 21:3207-3214. [0552] Treherne, J. M. & Ashford,
M. L. Neuroscience 40, 523-531 (1991). [0553] Tucker S J, et al.,
EMBO J. 1998; 17:3290-3296. [0554] Tucker S J, et al., Nature.
1997; 387:179-183. [0555] U.S. Pat. No. 5,637,085 [0556] U.S. Pat.
No. 6,391,911 [0557] Vogel et al., Stroke. 1999; 30:1134-1141.
[0558] Wallace W, et al., Biotechniques. 2001; 31:1076-8, 1080,
1082. [0559] Wang J Y, et al., Glia. 2000; 32:155-164. [0560] Wang
Y L. Methods Cell Biol. 1998; 56:305-315. [0561] Wass, C. T. &
Lanier, W. L. Mayo Clin. Proc. 71, 801-812 (1996). [0562] Wiesener
M S, et al., FASEB J. 2003; 17:271-273. [0563] WO 03/079987 [0564]
Woolley C S. Curr Opin Neurobiol. 1999; 9:349-354. [0565] Xie L H,
et al., Proc Natl Acad Sci U S A. 1999; 96:15292-15297. [0566]
Yajima Y, et al., Endocrinology. 1997; 138:1949-1958. [0567] Young,
W. & Constantini, S. The Neurobiology of Central Nervous System
Trauma. Salzman, S. [0568] K. & Faden, A. I. (eds.), pp.
123-130 (Oxford University Press, New York,1994). [0569] Zhang L,
et al., Brain Res Mol Brain Res. 2002; 103:1-11. [0570] Zhang Y, et
al., J Neurosci. 2001; 21:RC176. [0571] Zheng J, Ramirez V D. J
Steroid Biochem Mol Biol. 1997; 62:327-336. [0572] Zunkler, B. J.,
et al., Biochem. Pharmacol. 67, 1437-1444 (2004).
[0573] Although the present invention and its advantages have been
described in detail, it should be understood that various changes,
substitutions and alterations can be made herein without departing
from the spirit and scope of the invention as defined by the
appended claims. Moreover, the scope of the present application is
not intended to be limited to the particular embodiments of the
process, machine, manufacture, composition of matter, means,
methods and steps described in the specification. As one of
ordinary skill in the art will readily appreciate from the
disclosure of the present invention, processes, machines,
manufacture, compositions of matter, means, methods, or steps,
presently existing or later to be developed that perform
substantially the same function or achieve substantially the same
result as the corresponding embodiments described herein may be
utilized according to the present invention. Accordingly, the
appended claims are intended to include within their scope such
processes, machines, manufacture, compositions of matter, means,
methods, or steps.
Sequence CWU 1
1
10117DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1aagcacgtca acgccct 17219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 2gaagcttttc cggcttgtc 19319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 3gagtcggact tctcgccct 19419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 4ccttgacagt ggccgaacc 19525DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 5ttccacatcc tggtcacacc gctgt 25620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 6cggaccaccc caagtattca 20717DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 7gccggcacgg ttcttct 17825DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 8catgatcgtg gctgctatcc aggca 25918DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 9ggccgagtgg ttctcggt 181018DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 10tgcctgaggc gtggctgt 18
* * * * *