U.S. patent application number 16/453642 was filed with the patent office on 2020-05-21 for methods and compositions for modulating alpha-1-antitrypsin expression.
This patent application is currently assigned to Ionis Pharmaceuticals, Inc.. The applicant listed for this patent is Ionis Pharmaceuticals, Inc.. Invention is credited to Susan M. Freier, Shuling Guo, Michael L. McCaleb, Brett P. Monia.
Application Number | 20200157535 16/453642 |
Document ID | / |
Family ID | 49223305 |
Filed Date | 2020-05-21 |
![](/patent/app/20200157535/US20200157535A1-20200521-C00001.png)
![](/patent/app/20200157535/US20200157535A1-20200521-C00002.png)
![](/patent/app/20200157535/US20200157535A1-20200521-C00003.png)
![](/patent/app/20200157535/US20200157535A1-20200521-C00004.png)
![](/patent/app/20200157535/US20200157535A1-20200521-C00005.png)
![](/patent/app/20200157535/US20200157535A1-20200521-C00006.png)
![](/patent/app/20200157535/US20200157535A1-20200521-C00007.png)
![](/patent/app/20200157535/US20200157535A1-20200521-C00008.png)
![](/patent/app/20200157535/US20200157535A1-20200521-C00009.png)
![](/patent/app/20200157535/US20200157535A1-20200521-C00010.png)
![](/patent/app/20200157535/US20200157535A1-20200521-C00011.png)
View All Diagrams
United States Patent
Application |
20200157535 |
Kind Code |
A1 |
Monia; Brett P. ; et
al. |
May 21, 2020 |
METHODS AND COMPOSITIONS FOR MODULATING ALPHA-1-ANTITRYPSIN
EXPRESSION
Abstract
Disclosed herein are methods for decreasing A1AT mRNA and
protein expression and treating, ameliorating, preventing, slowing
progression, or stopping progression of fibrosis. Disclosed herein
are methods for decreasing A1AT mRNA and protein expression and
treating, ameliorating, preventing, slowing progression, or
stopping progression of liver disease, such as, A1ATD associated
liver disease, and pulmonary disease, such as, A1ATD associated
pulmonary disease in an individual in need thereof. Methods for
inhibiting A1AT mRNA and protein expression can also be used as a
prophylactic treatment to prevent individuals at risk for
developing a liver disease, such as, A1ATD associated liver disease
and pulmonary disease, such as, A1ATD associated pulmonary
disease.
Inventors: |
Monia; Brett P.; (Encinitas,
CA) ; McCaleb; Michael L.; (La Jolla, CA) ;
Freier; Susan M.; (San Diego, CA) ; Guo; Shuling;
(Carlsbad, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Ionis Pharmaceuticals, Inc. |
Carlsbad |
CA |
US |
|
|
Assignee: |
Ionis Pharmaceuticals, Inc.
Carlsbad
CA
|
Family ID: |
49223305 |
Appl. No.: |
16/453642 |
Filed: |
June 26, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15709325 |
Sep 19, 2017 |
|
|
|
16453642 |
|
|
|
|
15097471 |
Apr 13, 2016 |
9796976 |
|
|
15709325 |
|
|
|
|
14386246 |
Sep 18, 2014 |
9340784 |
|
|
PCT/US2013/033004 |
Mar 19, 2013 |
|
|
|
15097471 |
|
|
|
|
61612793 |
Mar 19, 2012 |
|
|
|
61649075 |
May 18, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 14/8125 20130101;
A61K 31/7115 20130101; C12N 2310/3231 20130101; C12N 2310/3233
20130101; C12N 15/113 20130101; C12N 2310/346 20130101; C12N
2310/341 20130101; A61K 31/712 20130101; C12N 2310/321 20130101;
A61K 31/7125 20130101; C12N 2310/315 20130101; C12N 2310/3341
20130101; C12N 2310/11 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; A61K 31/7115 20060101 A61K031/7115; C07K 14/81
20060101 C07K014/81; A61K 31/7125 20060101 A61K031/7125; A61K
31/712 20060101 A61K031/712 |
Claims
1-3. (canceled)
4. A compound comprising a modified oligonucleotide consisting of
20 to 30 linked nucleosides and having a nucleobase sequence
comprising a portion of at least 20 contiguous nucleobases that is
100% complementary to an equal length portion of nucleobases 1349
to 1597 of SEQ ID NO: 1, and wherein the nucleobase sequence of the
modified oligonucleotide is at least 90% complementary to SEQ ID
NO: 1, and wherein each nucleotide of the modified oligonucleotide
is a modified nucleotide having, independently, a modified sugar
moiety, a modified internucleoside linkage, and/or modified
nucleobase.
5-23. (canceled)
24. A composition comprising a compound according to claim 4 and a
pharmaceutically acceptable carrier or diluent.
25. (canceled)
26. A method of treating, ameliorating or preventing an A1AT
deficiency disease in an animal comprising administering to an
animal having or at risk of developing an A1AT deficiency disease a
composition according to claim 24, and thereby treating,
ameliorating, or preventing the A1AT deficiency disease in the
animal.
27-49. (canceled)
Description
SEQUENCE LISTING
[0001] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled BIOL0163USC3SEQ_ST25.txt created Jun. 26, 2019, which
is 108 Kb in size. The information in the electronic format of the
sequence listing is incorporated herein by reference in its
entirety.
FIELD
[0002] Provided are methods and compositions for reducing
expression of alpha-1 antitrypsin (A1AT) mRNA and protein in an
animal. Such methods and compositions are useful for treating,
ameliorating, preventing, slowing progression, or stopping
progression of diseases, disorders, and conditions associated with
alpha-1 antitrypsin deficiency (A1ATD). Such diseases, disorders,
and conditions associated with A1ATD include liver diseases, such
as alpha-1 antitrypsin deficiency (A1ATD) associated liver disease,
and pulmonary diseases, such as A1ATD pulmonary disease.
BACKGROUND
[0003] Alpha-1 antitrypsin (also known as .alpha..sub.1-antitrypsin
or A1AT) is a 52 kD serpin glycoprotein produced in hepatocytes and
in smaller quantities in phagocytes and lung epithelial cells
(Gettins, P. G. Chem. Rev. 2002. 102: 4751-4804). A1AT is a
protease inhibitor.
[0004] A1AT deficiency (A1ATD) is a genetic disorder associated
with the development of liver and lung disease (Bals, R. Best
Pract. Res. Clin. Gastroenterol. 2010. 24: 629-633). A1AT
deficiency is caused by homozygosity for the A1AT mutant Z gene and
occurs in 1 in 2,000 births in many North American and European
populations (Teckman, J. H. Semin. Liver Dis. 2007. 27: 274-281).
Additionally, recent studies have suggested that the PiZ
heterozygous state may be associated with increased severity and
worse outcome in liver disease of known etiologies, such as HCV,
alcoholic liver disease (ALD) or NAFLD (Regev A. J. Pediatr.
Gastroenterol. Nutr. 2006. 43: S30-S35). In the most common genetic
deficiency (PiZ, resulting from a mutation of glutamate to lysine
at position 342 of the gene), there is accumulation of A1AT in the
liver as a result of polymer formation (Stockley, R. A. Expert
Opin. Emerg. Drugs. 2010. 15: 685-694). The abnormal mutant protein
accumulates within the endoplasmic reticulum of hepatocytes as
intrahepatocytic globules. The result of this intracellular
accumulation in homozygous ZZ individuals is an increased risk of
chronic liver disease and hepatocellular carcinoma (Perlmutter, D.
H. et al., Hepatology. 2007. 45: 1313-1323; Teckman, J. H. et al.,
Curr. Gastroenterol. Rep. 2006. 8: 14-20; Eriksson, S. et al., Am.
J. Respir. Crit. Care Med. 2003. 168: 856-869). There are no
specific treatments for A1ATD associated liver disease, other than
liver transplantation.
[0005] A1AT deficiency also predisposes individuals to the
development of chronic obstructive pulmonary disease (COPD) and
emphysema. In the absence of wild-type A1AT, neutrophil elastase is
free to break down elastin, which contributes to the elasticity of
the lungs, resulting in respiratory disorders (DeMeo, D. L. and
Silverman, E. K. Thorax. 2004. 59: 259-264). Also, in such
patients, there is an excess of mutant A1AT polymers, which are
bound to the alveolar wall. This enables the polymers to act as a
chronic stimulus for neutrophil influx in the lungs of A1AT
deficient individuals (Mahadeva, R. et al., Am. J. Pathobiol. 2005.
166: 377-387).
[0006] Described herein are compositions and methods for modulating
A1AT expression. The compounds and treatment methods described
herein provide significant advantages over the treatments options
currently available for A1AT-related disorders.
SUMMARY
[0007] Provided herein are compounds that modulate expression of
A1AT mRNA and protein.
[0008] Certain embodiments describe compounds. In certain
embodiments, the compound is an antisense compound. In certain
embodiments, the compound comprises an oligonucleotide. In certain
embodiments, the oligonucleotide is an antisense oligonucleotide.
In certain embodiments, the oligonucleotide is a modified
oligonucleotide. In certain embodiments, the oligonucleotide is a
modified antisense oligonucleotide. In certain embodiments, the
compound comprises a modified oligonucleotide consisting of 12 to
30 linked nucleosides and having a nucleobase sequence comprising
at least 8 contiguous nucleobases of a sequence set out in the
sequence listing as one of SEQ ID NOs: 20-41. Certain embodiments
describe a composition comprising a compound. In certain
embodiments, the composition comprises a compound according to any
of the embodiments as described herein or a salt thereof and a
pharmaceutically acceptable carrier or diluent.
[0009] In certain embodiments, provided are compounds and
compositions according to any of the embodiments as described
herein for use in therapy.
[0010] Provided herein are methods for modulating expression of
A1AT mRNA and protein. In certain embodiments, A1AT specific
inhibitors modulate expression of A1AT mRNA and protein. In certain
embodiments, A1AT specific inhibitors are nucleic acids, proteins,
or small molecules.
[0011] In certain embodiments, modulation can occur in a cell or
tissue. In certain embodiments, the cell or tissue is in an animal.
In certain embodiments, the animal is a human. In certain
embodiments, A1AT mRNA levels are reduced. In certain embodiments,
A1AT protein levels are reduced. In certain embodiments, A1AT mRNA
and protein levels are reduced. In certain embodiments, mutant A1AT
mRNA and protein levels are reduced. Such reduction can occur in a
time-dependent manner or in a dose-dependent manner.
[0012] Also provided are methods useful for treating, ameliorating,
preventing, slowing progression, or stopping progression of
diseases, disorders, and conditions associated with A1ATD. In
certain embodiments, such diseases, disorders, and conditions
associated with A1ATD include liver diseases, such as alpha-1
antitrypsin deficiency (A1ATD) associated liver disease, viral
liver disease, and nonalcoholic steatohepatitis (NASH). In certain
embodiments, A1ATD exacerbates underlying liver diseases. In
certain embodiments, diseases, disorders, and conditions associated
with A1ATD include pulmonary diseases, such as alpha-1 antitrypsin
deficiency (A1ATD) associated pulmonary disease, chronic
obstructive pulmonary disease (COPD), and emphysema. In certain
embodiments, A1ATD exacerbates underlying pulmonary diseases.
[0013] Diseases, disorders, and conditions associated with A1ATD
can have one or more risk factors, causes, or outcomes in common.
Certain risk factors and causes for development of diseases,
disorders, and conditions associated with A1ATD include genetic
predisposition to alpha-1 antitrypsin deficiency. In certain
embodiments, a defect in an individual's genetic code for alpha-1
antitrypsin (A1AT) is responsible for diseases, disorders, and
conditions associated with A1ATD, such as, liver diseases and
pulmonary diseases. In certain embodiments, genetic mutations lead
to expression of mutant A1AT. In certain embodiments, mutant A1AT
forms aggregates which are retained in the liver, causing liver
dysfunction or hepatic toxicity. Certain outcomes associated with
liver disease, including A1ATD associated liver disease, include
abdominal swelling or pain, bruising easily, dark urine, light
colored stools, itching all over the body, vomiting blood, passing
bloody or black stools, jaundice, lack of normal weight and height
gain in children, liver cirrhosis, and death. In certain
embodiments, mutant A1AT forms aggregates which are retained in the
lung, causing pulmonary dysfunction or pulmonary disease. Certain
outcomes associated with pulmonary disease, including A1ATD
associated pulmonary disease, include chronic cough, fatigue,
respiratory infections, shortness of breath (dyspnea), wheezing,
pulmonary hypertension, heart disease, and death.
[0014] In certain embodiments, methods of treatment include
administering an A1AT specific inhibitor to an individual in need
thereof. In certain embodiments, the A1AT specific inhibitor is a
nucleic acid. In certain embodiments, the nucleic acid is an
antisense compound. In certain embodiments, the antisense compound
is a modified oligonucleotide. In certain embodiments, the modified
oligonucleotide reduces A1AT protein levels, which alleviates
hepatic toxicity induced by protein aggregates. In certain
embodiments, the modified oligonucleotide reduces A1AT protein in
the liver. In certain embodiments, the modified oligonucleotide
reduces A1AT protein levels, which alleviates pulmonary dysfunction
induced by protein aggregates. In certain embodiments, the modified
oligonucleotide reduces A1AT protein in the lung. In certain
embodiments, the A1AT protein is mutant A1AT protein.
DETAILED DESCRIPTION
[0015] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed. Herein, the use of the singular includes the plural unless
specifically stated otherwise. As used herein, the use of "or"
means "and/or" unless stated otherwise. Additionally, as used
herein, the use of "and" means "and/or" unless stated otherwise.
Furthermore, the use of the term "including" as well as other
forms, such as "includes" and "included", is not limiting. Also,
terms such as "element" or "component" encompass both elements and
components comprising one unit and elements and components that
comprise more than one subunit, unless specifically stated
otherwise.
[0016] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
this disclosure, including, but not limited to, patents, patent
applications, published patent applications, articles, books,
treatises, and GENBANK Accession Numbers and associated sequence
information obtainable through databases such as National Center
for Biotechnology Information (NCBI) and other data referred to
throughout in the disclosure herein are hereby expressly
incorporated by reference for the portions of the document
discussed herein, as well as in their entirety.
Definitions
[0017] Unless specific definitions are provided, the nomenclature
utilized in connection with, and the procedures and techniques of,
analytical chemistry, synthetic organic chemistry, and medicinal
and pharmaceutical chemistry described herein are those well known
and commonly used in the art. Standard techniques may be used for
chemical synthesis, and chemical analysis.
[0018] Unless otherwise indicated, the following terms have the
following meanings:
[0019] "2'-O-methoxyethyl" (also 2'-MOE and
2'-O(CH.sub.2).sub.2--OCH.sub.3) refers to an O-methoxy-ethyl
modification of the 2' position of a furanosyl ring. A
2'-O-methoxyethyl modified sugar is a modified sugar.
[0020] "2'-MOE nucleoside" (also 2'-O-methoxyethyl nucleoside)
means a nucleoside comprising a 2'-MOE modified sugar moiety.
[0021] "2'-substituted nucleoside" means a nucleoside comprising a
substituent at the 2'-position of the furanosyl ring other than H
or OH. In certain embodiments, 2' substituted nucleosides include
nucleosides with bicyclic sugar modifications.
[0022] "3' target site" refers to the nucleotide of a target
nucleic acid which is complementary to the 3'-most nucleotide of a
particular antisense compound.
[0023] "5' target site" refers to the nucleotide of a target
nucleic acid which is complementary to the 5'-most nucleotide of a
particular antisense compound.
[0024] "5-methylcytosine" means a cytosine modified with a methyl
group attached to the 5' position. A 5-methylcytosine is a modified
nucleobase.
[0025] "A1AT nucleic acid" or "alpha-1 antitrypsin nucleic acid"
means any nucleic acid encoding A1AT. For example, in certain
embodiments, a A1AT nucleic acid includes a DNA sequence encoding
A1AT, an RNA sequence transcribed from DNA encoding A1AT (including
genomic DNA comprising introns and exons), and an mRNA sequence
encoding A1AT. "A1AT mRNA" means an mRNA encoding an A1AT
protein.
[0026] "A1AT specific inhibitor" refers to any agent capable of
specifically inhibiting the expression of A1AT mRNA and/or A1AT
protein at the molecular level. For example, A1AT specific
inhibitors include nucleic acids (including antisense compounds),
peptides, antibodies, small molecules, and other agents capable of
inhibiting the expression of A1AT mRNA and/or A1AT protein.
[0027] "A 1ATD" or "alpha-1 antitrypsin deficiency" means lack of
sufficient A1AT necessary for normal function. A1ATD may occur due
to expression of mutant A1AT, which is characterized by abnormal
folding of the protein, which may cause A1AT to aggregate in a
patient's liver, thus, allowing only small amounts of A1AT to be
released into the blood.
[0028] "A1ATD associated liver disease" or "alpha-1 antitrypsin
deficiency associated liver disease" means liver dysfunction and/or
hepatic toxicity associated with alpha-1 antitrypsin deficiency.
Symptoms and outcomes of A1ATD associated liver disease include
abdominal swelling or pain, bruising easily, dark urine, light
colored stools, itching all over his body, vomiting blood, passing
bloody or black stools, jaundice, lack of normal weight and height
gain in children, liver cirrhosis, and death. Although not limited
by mechanism, it is theorized that A1ATD is caused by a mutant form
of A1AT which forms protein aggregates that are retained in a
patient's liver. The presence of such aggregates interferes with
proper function of the liver resulting in liver dysfunction and
hepatic toxicity. Examples of A1ATD associated liver diseases
include, but are not limited to, cirrhosis and liver cancer.
[0029] "A1ATD associated pulmonary disease" or "alpha-1 antitrypsin
deficiency associated pulmonary disease" means pulmonary
dysfunction associated with alpha-1 antitrypsin deficiency.
Symptoms and outcomes of A1ATD associated pulmonary disease include
chronic cough, fatigue, respiratory infections, shortness of breath
(dyspnea), wheezing, pulmonary hypertension, heart disease, and
death. Although not limited by mechanism, it is theorized that
A1ATD is caused by a mutant form of A1AT which forms protein
aggregates that are retained in a patient's lungs. The presence of
such aggregates interferes with proper function of the lungs
resulting in lung dysfunction. Examples of A1ATD associated
pulmonary diseases include, but are not limited to, chronic
obstructive pulmonary diseases (COPD) such as chronic bronchitis or
emphysema.
[0030] "About" means within .+-.7% of a value. For example, if it
is stated, "the compounds affected at least about 70% inhibition of
A1AT", it is implied that the A1AT levels are inhibited within a
range of 63% and 77%.
[0031] "Active pharmaceutical agent" means the substance or
substances in a pharmaceutical composition that provide a
therapeutic benefit when administered to an individual. For
example, in certain embodiments an antisense oligonucleotide
targeted to A1AT is an active pharmaceutical agent.
[0032] "Active target region" or "target region" means a region to
which one or more active antisense compounds is targeted. "Active
antisense compounds" means antisense compounds that reduce target
nucleic acid levels or protein levels.
[0033] "Administered concomitantly" refers to the co-administration
of two agents in any manner in which the pharmacological effects of
both are manifest in the patient at the same time. Concomitant
administration does not require that both agents be administered in
a single pharmaceutical composition, in the same dosage form, or by
the same route of administration. The effects of both agents need
not manifest themselves at the same time. The effects need only be
overlapping for a period of time and need not be coextensive.
[0034] "Administering" means providing a pharmaceutical agent to an
individual, and includes, but is not limited to administering by a
medical professional and self-administering.
[0035] "Amelioration" or "ameliorate" or "ameliorating" refers to a
lessening of at least one indicator, sign, or symptom of an
associated disease, disorder, or condition. The severity of
indicators may be determined by subjective or objective measures,
which are known to those skilled in the art.
[0036] "Animal" refers to a human or non-human animal, including,
but not limited to, mice, rats, rabbits, dogs, cats, pigs, and
non-human primates, including, but not limited to, monkeys and
chimpanzees.
[0037] "Antibody" refers to a molecule characterized by reacting
specifically with an antigen in some way, where the antibody and
the antigen are each defined in terms of the other. Antibody may
refer to a complete antibody molecule or any fragment or region
thereof, such as the heavy chain, the light chain, Fab region, and
Fc region.
[0038] "Antisense activity" means any detectable or measurable
activity attributable to the hybridization of an antisense compound
to its target nucleic acid. In certain embodiments, antisense
activity is a decrease in the amount or expression of a target
nucleic acid or protein encoded by such target nucleic acid.
[0039] "Antisense compound" means an oligomeric compound that is
capable of undergoing hybridization to a target nucleic acid
through hydrogen bonding. Examples of antisense compounds include,
but are not limited to, single-stranded and double-stranded
compounds, such as, antisense oligonucleotides, siRNAs and
shRNAs.
[0040] "Antisense inhibition" means reduction of target nucleic
acid levels or target protein levels in the presence of an
antisense compound complementary to a target nucleic acid compared
to target nucleic acid levels or target protein levels in the
absence of the antisense compound.
[0041] "Antisense oligonucleotide" means a single-stranded
oligonucleotide having a nucleobase sequence that permits
hybridization to a corresponding region or segment of a target
nucleic acid.
[0042] "Antisense mechanisms" are all those mechanisms involving
hybridization of a compound with target nucleic acid, wherein the
outcome or effect of the hybridization is either target degradation
or target occupancy with concomitant stalling of the cellular
machinery involving, for example, transcription or splicing.
[0043] "Base complementarity" refers to the capacity for the
precise base pairing of nucleobases of an antisense oligonucleotide
with corresponding nucleobases in a target nucleic acid (i.e.,
hybridization), and is mediated by Watson-Crick, Hoogsteen or
reversed Hoogsteen hydrogen binding between corresponding
nucleobases. "Bicyclic sugar moiety" means a modified sugar moiety
comprising a 4 to 7 membered ring (including but not limited to a
furanosyl) comprising a bridge connecting two atoms of the 4 to 7
membered ring to form a second ring, resulting in a bicyclic
structure. In certain embodiments, the 4 to 7 membered ring is a
sugar ring. In certain embodiments the 4 to 7 membered ring is a
furanosyl. In certain such embodiments, the bridge connects the
2'-carbon and the 4'-carbon of the furanosyl.
[0044] "Bicyclic nucleic acid" or "BNA" or "BNA nucleosides" means
nucleic acid monomers having a bridge connecting two carbon atoms
between the 4' and 2'position of the nucleoside sugar unit, thereby
forming a bicyclic sugar. Examples of such bicyclic sugar include,
but are not limited to A) .alpha.-L-Methyleneoxy
(4'-CH.sub.2--O-2') LNA, (B) J-D-Methyleneoxy (4'-CH.sub.2--O-2')
LNA, (C) Ethyleneoxy (4'-(CH.sub.2).sub.2--O-2') LNA, (D) Aminooxy
(4'-CH.sub.2--O--N(R)-2') LNA and (E) Oxyamino
(4'-CH.sub.2--N(R)--O-2') LNA, as depicted below.
##STR00001##
[0045] As used herein, LNA compounds include, but are not limited
to, compounds having at least one bridge between the 4' and the 2'
position of the sugar wherein each of the bridges independently
comprises 1 or from 2 to 4 linked groups independently selected
from --[C(R.sub.1)(R.sub.2)].sub.a--,
--C(R.sub.1).dbd.C(R.sub.2)--, --C(R.sub.1).dbd.N--,
--C(.dbd.NR.sub.1)--, --C(.dbd.O)--, --C(.dbd.S)--, --O--,
--Si(R.sub.1).sub.2--, --S(.dbd.O).sub.x-- and --N(R.sub.1)--;
wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R.sub.1 and
R.sub.2 is, independently, H, a protecting group, hydroxyl,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, a
heterocycle radical, a substituted heterocycle radical, heteroaryl,
substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical,
substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1,
NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl
(C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12
alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12
alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12
alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20
aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(.dbd.O)--H),
substituted acyl, a heterocycle radical, a substituted heterocycle
radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12
aminoalkyl or a protecting group.
[0046] Examples of 4'-2' bridging groups encompassed within the
definition of LNA include, but are not limited to one of formulae:
--[C(R.sub.1)(R.sub.2)].sub.n--,
--[C(R.sub.1)(R.sub.2)].sub.n--O--,
--C(R.sub.1)(R.sub.2)--N(R.sub.1)--O-- or
--C(RIR.sub.2)--O--N(R.sub.1)--. Furthermore, other bridging groups
encompassed with the definition of LNA are 4'-CH.sub.2-2',
4'--(CH.sub.2).sub.2-2', 4'--(CH.sub.2).sub.3-2',
4'--CH.sub.2--O-2', 4'--(CH.sub.2).sub.2--O-2',
4'--CH.sub.2--O--N(R.sub.1)-2' and
4'-CH.sub.2--N(R.sub.1)--O-2'-bridges, wherein each R.sub.1 and
R.sub.2 is, independently, H, a protecting group or
C.sub.1-C.sub.12 alkyl.
[0047] Also included within the definition of LNA are LNAs in which
the 2'-hydroxyl group of the ribosyl sugar ring is connected to the
4' carbon atom of the sugar ring, thereby forming a methyleneoxy
(4'-CH.sub.2--O-2') bridge to form the bicyclic sugar moiety. The
bridge can also be a methylene (--CH.sub.2--) group connecting the
2' oxygen atom and the 4' carbon atom, for which the term
methyleneoxy (4'-CH.sub.2--O-2') LNA is used. Furthermore; in the
case of the bicylic sugar moiety having an ethylene bridging group
in this position, the term ethyleneoxy (4'-CH.sub.2CH.sub.2--O-2')
LNA is used. .alpha.-L-methyleneoxy (4'-CH.sub.2--O-2'), an isomer
of methyleneoxy (4'-CH.sub.2--O-2') LNA is also encompassed within
the definition of LNA, as used herein.
[0048] "Cap structure" or "terminal cap moiety" means chemical
modifications, which have been incorporated at either terminus of
an antisense compound.
[0049] "cEt" or "constrained ethyl" means a bicyclic nucleoside
having a sugar moiety comprising a bridge connecting the 4'-carbon
and the 2'-carbon, wherein the bridge has the formula:
4'-CH(CH.sub.3)--O-2'.
[0050] "Constrained ethyl nucleoside" (also cEt nucleoside) means a
nucleoside comprising a bicyclic sugar moiety comprising a
4'-CH(CH.sub.3)--O-2' bridge.
[0051] "Chemically distinct region" refers to a region of an
antisense compound that is in some way chemically different than
another region of the same antisense compound. For example, a
region having 2'-O-methoxyethyl nucleotides is chemically distinct
from a region having nucleotides without 2'-O-methoxyethyl
modifications.
[0052] "Chimeric antisense compound" means an antisense compound
that has at least two chemically distinct regions.
[0053] "Co-administration" means administration of two or more
pharmaceutical agents to an individual. The two or more
pharmaceutical agents may be in a single pharmaceutical
composition, or may be in separate pharmaceutical compositions.
Each of the two or more pharmaceutical agents may be administered
through the same or different routes of administration.
Co-administration encompasses parallel or sequential
administration.
[0054] "Comprise," "comprises" and "comprising" will be understood
to imply the inclusion of a stated step or element or group of
steps or elements but not the exclusion of any other step or
element or group of steps or elements. "Complementarity" means the
capacity for base pairing between nucleobases of a first nucleic
acid and a second nucleic acid. "Contiguous nucleobases" means
nucleobases immediately adjacent to each other.
[0055] "Deoxyribonucleotide" means a nucleotide having a hydrogen
at the 2' position of the sugar portion of the nucleotide.
Deoxyribonucleotides may be modified with any of a variety of
substituents.
[0056] "Designing" or "Designed to" refer to the process of
designing an oligomeric compound that specifically hybridizes with
a selected nucleic acid molecule.
[0057] "Downstream" refers to the relative direction toward the 3'
end or C-terminal end of a nucleic acid.
[0058] "Diluent" means an ingredient in a composition that lacks
pharmacological activity, but is pharmaceutically necessary or
desirable. For example, the diluent in an injected composition may
be a liquid, e.g. saline solution.
[0059] "Dose" means a specified quantity of a pharmaceutical agent
provided in a single administration, or in a specified time period.
In certain embodiments, a dose may be administered in one, two, or
more boluses, tablets, or injections. For example, in certain
embodiments where subcutaneous administration is desired, the
desired dose requires a volume not easily accommodated by a single
injection, therefore, two or more injections may be used to achieve
the desired dose. In certain embodiments, the pharmaceutical agent
is administered by infusion over an extended period of time or
continuously. Doses may be stated as the amount of pharmaceutical
agent per hour, day, week, or month.
[0060] "Effective amount" means the amount of active pharmaceutical
agent sufficient to effectuate a desired physiological outcome in
an individual in need of the agent. The effective amount may vary
among individuals depending on the health and physical condition of
the individual to be treated, the taxonomic group of the
individuals to be treated, the formulation of the composition,
assessment of the individual's medical condition, and other
relevant factors.
[0061] "Efficacy" means the ability to produce a desired
effect.
[0062] "Expression" includes all the functions by which a gene's
coded information is converted into structures present and
operating in a cell. Such structures include, but are not limited
to the products of transcription and translation.
[0063] "Fibrosis" refers to the formation of fibrous tissue. Excess
fibrosis in an organ or tissue can lead to a thickening of the
affected area and scar formation. Fibrosis can lead to organ or
tissue damage and a decrease in the function of the organ or
tissue. Examples of fibrosis include, but is not limited to,
cirrhosis (fibrosis of the liver) and pulmonary fibrosis (fibrosis
of the lung).
[0064] "Fully complementary" or "100% complementary" means each
nucleobase of a first nucleic acid has a complementary nucleobase
in a second nucleic acid. In certain embodiments, a first nucleic
acid is an antisense compound and a target nucleic acid is a second
nucleic acid.
[0065] "Gapmer" means a chimeric antisense compound in which an
internal region having a plurality of nucleosides that support
RNase H cleavage is positioned between external regions having one
or more nucleosides, wherein the nucleosides comprising the
internal region are chemically distinct from the nucleoside or
nucleosides comprising the external regions. The internal region
may be referred to as a "gap" and the external regions may be
referred to as the "wings." "Gap-widened" means a chimeric
antisense compound having a gap segment of 12 or more contiguous
2'-deoxyribonucleosides positioned between and immediately adjacent
to 5' and 3' wing segments having from one to six nucleosides.
[0066] "Hybridization" means the annealing of complementary nucleic
acid molecules. In certain embodiments, complementary nucleic acid
molecules include an antisense compound and a target nucleic
acid.
[0067] "Identifying an animal at risk for developing A1ATD
associated liver disease" means identifying an animal having been
diagnosed with A1ATD associated liver disease or identifying an
animal predisposed to develop A1ATD associated liver disease.
Individuals predisposed to develop an A1ATD associated liver
disease include those having one or more risk factors for A1ATD
associated liver disease, including, having a personal or family
history of A1ATD or A1ATD associated liver disease. Such
identification may be accomplished by any method including
evaluating an individual's medical history and standard clinical
tests or assessments, such as genetic testing.
[0068] "Identifying an animal at risk for developing A1ATD
associated pulmonary disease" means identifying an animal having
been diagnosed with A1ATD associated pulmonary disease or
identifying an animal predisposed to develop A1ATD associated
pulmonary disease. Individuals predisposed to develop an A1ATD
associated pulmonary disease include those having one or more risk
factors for A1ATD associated pulmonary disease, including, having a
personal or family history of A1ATD or A1ATD associated pulmonary
disease. Such identification may be accomplished by any method
including evaluating an individual's medical history and standard
clinical tests or assessments, such as genetic testing.
[0069] "Immediately adjacent" means there are no intervening
elements between the immediately adjacent elements.
[0070] "Individual" means a human or non-human animal selected for
treatment or therapy.
[0071] "Induce", "inhibit", "potentiate", "elevate", "increase",
"decrease", upregulate", "downregulate", or the like, generally
denote quantitative differences between two states.
[0072] "Inhibiting A1AT" means reducing expression of A1AT mRNA
and/or protein levels in the presence of an A1AT specific
inhibitor, including an A1AT antisense oligonucleotide, as compared
to expression of A1AT mRNA and/or protein levels in the absence of
an A1AT specific inhibitor, such as an A1AT antisense
oligonucleotide.
[0073] "Internucleoside linkage" refers to the chemical bond
between nucleosides.
[0074] "ISIS number" refers to an A1AT specific inhibitor that is a
modified antisense oligonucleotide having the nucleobase sequence
specified by the associated SEQ ID NO and the chemistry and motif
associated in the related example section. For example, "ISIS
487660" means an A1AT specific inhibitor that is a modified
antisense oligonucleotide having the nucleobase sequence (from 5'
to 3') "CCAGCTCAACCCTTCTITAA", incorporated herein as SEQ ID NO:
38, a 5-10-5 MOE gapmer, wherein each internucleoside linkage is a
phosphorothioate internucleoside linkage and each cytosine is a
5-methylcytosine, and each of nucleosides 1-5 and 16-20 comprise a
2'-O-methoxyethyl sugar moiety. For example, "ISIS 496407" means an
A1AT specific inhibitor that is a modified antisense
oligonucleotide having the nucleobase sequence (from 5' to 3')
"CTTCTTTAATGTCATCCAGG", incorporated herein as SEQ ID NO: 29, a
5-10-5 MOE gapmer, wherein each internucleoside linkage is a
phosphorothioate internucleoside linkage and each cytosine is a
5-methylcytosine, and each of nucleosides 1-5 and 16-20 comprise a
2'-O-methoxyethyl sugar moiety.
[0075] "Linked deoxynucleoside" means a nucleic acid base (A, G, C,
T, U) substituted by deoxyribose linked by a phosphate ester to
form a nucleotide.
[0076] "Linked nucleosides" means adjacent nucleosides which are
bonded together.
[0077] "Mismatch" or "non-complementary nucleobase" refers to the
case when a nucleobase of a first nucleic acid is not capable of
base pairing with the corresponding nucleobase of a second or
target nucleic acid.
[0078] "Modified internucleoside linkage" refers to a substitution
or any change from a naturally occurring internucleoside bond
(i.e., a phosphodiester internucleoside bond).
[0079] "Modified nucleobase" refers to any nucleobase other than
adenine, cytosine, guanine, thymidine, or uracil. An "unmodified
nucleobase" means the purine bases adenine (A) and guanine (G), and
the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
[0080] "Modified nucleoside" means a nucleoside having,
independently, a modified sugar moiety and/or modified
nucleobase.
[0081] "Modified nucleotide" means a nucleotide having,
independently, a modified sugar moiety, modified internucleoside
linkage, or modified nucleobase. A "modified nucleoside" means a
nucleoside having, independently, a modified sugar moiety or
modified nucleobase.
[0082] "Modified oligonucleotide" means an oligonucleotide
comprising a modified internucleoside linkage, a modified sugar, or
a modified nucleobase.
[0083] "Modified sugar" refers to a substitution or change from a
natural sugar.
[0084] "Motif" means the pattern of chemically distinct regions in
an antisense compound.
[0085] "Naturally occurring internucleoside linkage" means a 3' to
5' phosphodiester linkage.
[0086] "Natural sugar moiety" means a sugar found in DNA (2'-H) or
RNA (2'-OH).
[0087] "Non-complementary nucleobase" refers to a pair of
nucleobases that do not form hydrogen bonds with one another or
otherwise support hybridization.
[0088] "Nucleic acid" refers to molecules composed of monomeric
nucleotides. A nucleic acid includes ribonucleic acids (RNA),
deoxyribonucleic acids (DNA), single-stranded nucleic acids,
double-stranded nucleic acids, small interfering ribonucleic acids
(siRNA), and microRNAs (miRNA).
[0089] "Nucleobase" means a heterocyclic moiety capable of base
pairing with a base of another nucleic acid.
[0090] "Nucleobase complementarity" refers to a nucleobase that is
capable of base pairing with another nucleobase. For example, in
DNA, adenine (A) is complementary to thymine (T). For example, in
RNA, adenine (A) is complementary to uracil (U). In certain
embodiments, complementary nucleobase refers to a nucleobase of an
antisense compound that is capable of base pairing with a
nucleobase of its target nucleic acid. For example, if a nucleobase
at a certain position of an antisense compound is capable of
hydrogen bonding with a nucleobase at a certain position of a
target nucleic acid, then the position of hydrogen bonding between
the oligonucleotide and the target nucleic acid is considered to be
complementary at that nucleobase pair.
[0091] "Nucleobase sequence" means the order of contiguous
nucleobases independent of any sugar, linkage, or nucleobase
modification.
[0092] "Nucleoside" means a nucleobase linked to a sugar.
[0093] "Nucleoside mimetic" includes those structures used to
replace the sugar or the sugar and the base and not necessarily the
linkage at one or more positions of an oligomeric compound such as
for example nucleoside mimetics having morpholino, cyclohexenyl,
cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics,
e.g., non furanose sugar units. Nucleotide mimetic includes those
structures used to replace the nucleoside and the linkage at one or
more positions of an oligomeric compound such as for example
peptide nucleic acids or morpholinos (morpholinos linked by
--N(H)--C(.dbd.O)--O--or other non-phosphodiester linkage). Sugar
surrogate overlaps with the slightly broader term nucleoside
mimetic but is intended to indicate replacement of the sugar unit
(furanose ring) only. The tetrahydropyranyl rings provided herein
are illustrative of an example of a sugar surrogate wherein the
furanose sugar group has been replaced with a tetrahydropyranyl
ring system.
[0094] "Nucleotide" means a nucleoside having a phosphate group
covalently linked to the sugar portion of the nucleoside.
[0095] "Oligomeric compound" or "oligomer" means a polymer of
linked monomeric subunits which is capable of hybridizing to at
least a region of a nucleic acid molecule.
[0096] "Oligonucleotide" means a polymer of linked nucleosides each
of which can be modified or unmodified, independent one from
another.
[0097] "Parenteral administration" means administration through
injection or infusion. Parenteral administration includes
subcutaneous administration, intravenous administration,
intramuscular administration, intraarterial administration,
intraperitoneal administration, or intracranial administration,
e.g., intrathecal or intracerebroventricular administration.
[0098] "Peptide" means a molecule formed by linking at least two
amino acids by amide bonds. Peptide refers to polypeptides and
proteins.
[0099] "Pharmaceutical composition" means a mixture of substances
suitable for administering to an individual. For example, a
pharmaceutical composition may comprise one or more active
pharmaceutical agents and a sterile aqueous solution.
[0100] "Pharmaceutically acceptable derivative" encompasses
pharmaceutically acceptable salts, conjugates, prodrugs or isomers
of the compounds described herein.
[0101] "Pharmaceutically acceptable salts" means physiologically
and pharmaceutically acceptable salts of antisense compounds, i.e.,
salts that retain the desired biological activity of the parent
oligonucleotide and do not impart undesired toxicological effects
thereto.
[0102] "Phosphorothioate linkage" means a linkage between
nucleosides where the phosphodiester bond is modified by replacing
one of the non-bridging oxygen atoms with a sulfur atom. A
phosphorothioate linkage (P.dbd.S) is a modified internucleoside
linkage.
[0103] "Portion" means a defined number of contiguous (i.e.,
linked) nucleobases of a nucleic acid. In certain embodiments, a
portion is a defined number of contiguous nucleobases of a target
nucleic acid. In certain embodiments, a portion is a defined number
of contiguous nucleobases of an antisense compound.
[0104] "Prevent" or "preventing" refers to delaying or forestalling
the onset or development of a disease, disorder, or condition for a
period of time from minutes to indefinitely. Prevent also means
reducing risk of developing a disease, disorder, or condition.
[0105] "Prodrug" means a therapeutic agent that is prepared in an
inactive form that is converted to an active form within the body
or cells thereof by the action of endogenous enzymes or other
chemicals or conditions.
[0106] "Pulmonary administration" means administration topical to
the surface of the respiratory tract. Pulmonary administration
includes nebulization, inhalation, or insufflation of powders or
aerosols, by mouth and/or nose.
[0107] "Region" is defined as a portion of the target nucleic acid
having at least one identifiable structure, function, or
characteristic.
[0108] "Ribonucleotide" means a nucleotide having a hydroxy at the
2' position of the sugar portion of the nucleotide. Ribonucleotides
may be modified with any of a variety of substituents.
[0109] "Segments" are defined as smaller or sub-portions of regions
within a target nucleic acid.
[0110] "Sites," as used herein, are defined as unique nucleobase
positions within a target nucleic acid. "Side effects" means
physiological responses attributable to a treatment other than the
desired effects. In certain embodiments, side effects include
injection site reactions, liver function test abnormalities, renal
function abnormalities, liver toxicity, renal toxicity, central
nervous system abnormalities, myopathies, and malaise. For example,
increased aminotransferase levels in serum may indicate liver
toxicity or liver function abnormality. For example, increased
bilirubin may indicate liver toxicity or liver function
abnormality.
[0111] "Single-stranded oligonucleotide" means an oligonucleotide
which is not hybridized to a complementary strand.
[0112] "Specifically hybridizable" refers to an antisense compound
having a sufficient degree of complementarity between an antisense
oligonucleotide and a target nucleic acid to induce a desired
effect, while exhibiting minimal or no effects on non-target
nucleic acids under conditions in which specific binding is
desired, i.e., under physiological conditions in the case of in
vivo assays and therapeutic treatments.
[0113] "Subject" means a human or non-human animal selected for
treatment or therapy.
[0114] "Targeting" or "targeted" means the process of design and
selection of an antisense compound that will specifically hybridize
to a target nucleic acid and induce a desired effect.
[0115] "Target nucleic acid," "target RNA," and "target RNA
transcript" all refer to a nucleic acid capable of being targeted
by antisense compounds.
[0116] "Target region" means a portion of a target nucleic acid to
which one or more antisense compounds is targeted.
[0117] "Target segment" means the sequence of nucleotides of a
target nucleic acid to which an antisense compound is targeted. "5'
target site" refers to the 5'-most nucleotide of a target segment.
"3' target site" refers to the 3'-most nucleotide of a target
segment.
[0118] "Therapeutically effective amount" means an amount of a
pharmaceutical agent that provides a therapeutic benefit to an
individual.
[0119] "Treat" or "treating" refers to administering a
pharmaceutical composition to effect an alteration or improvement
of a disease, disorder, or condition.
[0120] "Unmodified" nucleobases mean the purine bases adenine (A)
and guanine (G), and the pyrimidine bases thymine (T), cytosine (C)
and uracil (U).
[0121] "Unmodified nucleotide" means a nucleotide composed of
naturally occurring nucleobases, sugar moieties, and
internucleoside linkages. In certain embodiments, an unmodified
nucleotide is an RNA nucleotide (i.e. .beta.-D-ribonucleosides) or
a DNA nucleotide (i.e. .beta.-D-deoxyribonucleoside). Upstream"
refers to the relative direction toward the 5' end or N-terminal
end of a nucleic acid.
Certain Embodiments
[0122] Certain embodiments provide methods for decreasing A1AT mRNA
and protein expression.
[0123] Certain embodiments provide methods for the treatment,
amelioration, or prevention of diseases, disorders, and conditions
associated with A1AT in an individual in need thereof. Also
contemplated are methods for the preparation of a medicament for
the treatment, amelioration, or prevention of a disease, disorder,
or condition associated with A1AT. In certain embodiments, A1AT
associated diseases, disorders, and conditions include liver
disease, such as, A1ATD associated liver disease. In certain
embodiments, A1AT associated diseases, disorders, and conditions
include pulmonary diseases, such as, A1ATD associated pulmonary
disease, COPD, or emphysema.
[0124] Such diseases, disorders, and conditions may have one or
more risk factors, causes, or outcomes in common. Certain risk
factors and causes for development of diseases, disorders, and
conditions associated with A1ATD include genetic predisposition to
alpha-1 antitrypsin deficiency. In certain embodiments, a defect in
an individual's genetic code for alpha-1 antitrypsin (A1AT) is
responsible for diseases, disorders, and conditions associated with
A1ATD, such as, liver diseases and pulmonary diseases. In certain
embodiments, genetic mutations lead to expression of mutant A1AT.
In certain embodiments, mutant A1AT forms aggregates which are
retained in the liver, causing liver dysfunction or hepatic
toxicity. Certain outcomes associated with liver disease, including
A1ATD associated liver disease, include abdominal swelling or pain,
bruising easily, dark urine, light colored stools, itching all over
the body, vomiting blood, passing bloody or black stools, jaundice,
lack of normal weight and height gain in children, liver cirrhosis,
and death. In certain embodiments, mutant A1AT forms aggregates
which are retained in the lung, causing pulmonary dysfunction or
pulmonary disease. Certain outcomes associated with pulmonary
disease, including A1ATD associated pulmonary disease, include
chronic cough, fatigue, respiratory infections, shortness of breath
(dyspnea), wheezing, pulmonary hypertension, heart disease, and
death.
[0125] Certain embodiments provide for the use of an A1AT specific
inhibitor for treating, ameliorating, preventing, slowing
progression, or stopping progression of an A1AT associated disease.
In certain embodiments, A1AT specific inhibitors are nucleic acids
(including antisense compounds), peptides, antibodies, small
molecules, and other agents capable of inhibiting the expression of
A1AT mRNA and/or A1AT protein.
[0126] In certain embodiments, methods of treatment include
administering an A1AT specific inhibitor to an individual in need
thereof. In certain embodiments, A1AT specific inhibitors are
antisense compounds. In certain embodiments, the antisense compound
is a modified oligonucleotide targeting A1AT.
[0127] Certain embodiments provide a method of reducing A1AT in an
animal comprising administering to the animal a modified
oligonucleotide targeting an A1AT nucleic acid sequence as shown in
SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide
targeting A1AT consists of 12 to 30 linked nucleosides and is at
least 90% complementary to the A1AT nucleic acid.
[0128] Certain embodiments provide a method of treating,
ameliorating and/or preventing an A1ATD associated liver disease in
an animal at risk for the A1ATD associated liver disease
comprising: (a) identifying the animal at risk for developing the
A1ATD associated liver disease; and (b) administering to the at
risk animal a therapeutically effective amount of a modified
oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
the modified oligonucleotide is at least 90% complementary to an
A1AT nucleic acid.
[0129] Certain embodiments provide a method of treating,
ameliorating and/or preventing an A1ATD associated pulmonary
disease in an animal at risk for the A1ATD associated pulmonary
disease comprising: (a) identifying the animal at risk for
developing the A1ATD associated pulmonary disease; and (b)
administering to the at risk animal a therapeutically effective
amount of a modified oligonucleotide consisting of 12 to 30 linked
nucleosides, wherein the modified oligonucleotide is at least 90%
complementary to an A1AT nucleic acid.
[0130] Certain embodiments provide a method of halting progression
of an A1ATD associated liver disease comprising: (a) identifying an
animal with the A1ATD associated liver disease; and (b)
administering to the animal a therapeutically effective amount of a
modified oligonucleotide consisting of 12 to 30 linked nucleosides,
wherein the modified oligonucleotide is at least 90% complementary
to an A1AT nucleic acid.
[0131] Certain embodiments provide a method of lowering the risk
for developing an A1ATD associated liver disease comprising: (a)
identifying an animal at risk for developing A1ATD associated liver
disease; and (b) administering to the at risk animal a
therapeutically effective amount of a modified oligonucleotide
consisting of 12 to 30 linked nucleosides, wherein the modified
oligonucleotide is at least 90% complementary to an A1AT nucleic
acid.
[0132] Certain embodiments provide a method of reducing fibrosis in
an animal comprising: (a) identifying the animal at risk for
developing fibrosis; and (b) administering to the at risk animal a
therapeutically effective amount of a modified oligonucleotide
consisting of 12 to 30 linked nucleosides, wherein the modified
oligonucleotide is at least 90% complementary to an A1AT nucleic
acid.
[0133] Certain embodiments provide a method of preventing organ
damage, decreasing organ damage and/or improving organ function in
an animal comprising: (a) identifying the animal at risk for organ
damage or decrease organ function; and (b) administering to the at
risk animal a therapeutically effective amount of a modified
oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
the modified oligonucleotide is at least 90% complementary to an
A1AT nucleic acid.
[0134] In certain embodiments, accumulation of A1AT aggregates is
forestalled, prevented or delayed in an animal by the methods
provided herein. In certain embodiments, the accumulation of A1AT
aggregates is in a lung, liver or other organ or tissue.
[0135] In certain embodiments, the methods provided herein
decreases TIMP1, collagen type 1, collagen type IV, collagen type
III, MMP13, SMA, ALT and/or AST expression.
[0136] Embodiments described herein provide the use of an A1AT
specific inhibitor, as described herein, for use in treating,
ameliorating, preventing, slowing progression, or stopping
progression of a liver disease, such as A1ATD associated liver
disease, as described herein, by combination therapy with an
additional agent or therapy, as described herein. Agents or
therapies can be co-administered or administered concomitantly. In
certain embodiments, A1AT specific inhibitors are antisense
compounds.
[0137] Embodiments described herein provide the use of an A1AT
specific inhibitor, as described herein, for use in treating,
ameliorating, preventing, slowing progression, or stopping
progression of a pulmonary disease, such as A1ATD associated
pulmonary disease, as described herein, by combination therapy with
an additional agent or therapy, as described herein. Agents or
therapies can be co-administered or administered concomitantly. In
certain embodiments, A1AT specific inhibitors are antisense
compounds.
[0138] In certain embodiments, A1AT specific inhibitors are
peptides or proteins (Chang, Y. P. et al., Am. J. Respir. Cell Mol.
Biol. 2006. 35: 540-548) or ribozymes (Zern, M. A. et al., Gene
Ther. 1999. 6: 114-120), and FLEAIG peptide (US 20110280863). In
certain embodiments, A1AT specific inhibitors are antibodies
(Miranda, E. et al., Hepatology. 2010. 52: 1078-1088; Piotrowska,
U. et al., Thyroid. 2002. 12: 563-570).
[0139] In certain embodiments, A1AT specific inhibitors are small
molecules, such as, but not limited to, rapamycin (Kaushal, S. et
al., Exp. Biol. Med. 2010. 235: 700-709), 4-phenylbutyric acid,
which prevents misfolding of A1AT (Burrows, J. A. et al., Proc.
Natl. Acad. Sci. U.S.A. 2000. 97: 1796-1801), nafamostat mesilate
(Sundaram, S. et al., Thromb. Haemost. 1996. 75: 76-82),
trimethylamine N-oxide (US 20110280863), 1-deoxynojirimycin (Tan,
A. et al., J. Biol. Chem. 1991. 266: 14504-14510), and
D-galactosamine (Gross, V. et al., Biochim. Biophys. Acta. 1990.
1036: 143-150).
[0140] In certain embodiments, provided herein are compounds
comprising a modified oligonucleotide consisting of 12 to 30 linked
nucleosides and comprising a nucleobase sequence comprising a
portion of at least 8, at least 10, at least 12, at least 14, at
least 15, at least 16, at least 17, at least 18, at least 19, or at
least 20 contiguous nucleobases complementary to an equal length
portion of nucleobases 1575 to 1594 of SEQ ID NO: 1, wherein the
nucleobase sequence of the modified oligonucleotide is at least 90%
complementary to SEQ ID NO: 1.
[0141] In certain embodiments, provided herein are compounds
comprising a modified oligonucleotide consisting of 12 to 30 linked
nucleosides and comprising a nucleobase sequence comprising a
portion of at least 8, at least 10, at least 12, at least 14, at
least 15, at least 16, at least 17, at least 18, at least 19, or at
least 20 contiguous nucleobases complementary to an equal length
portion of nucleobases 1564 to 1583 of SEQ ID NO: 1, wherein the
nucleobase sequence of the modified oligonucleotide is at least 90%
complementary to SEQ ID NO: 1.
[0142] In certain embodiments, provided herein are compounds
comprising a modified oligonucleotide consisting of 12 to 30 linked
nucleosides and comprising a nucleobase sequence comprising a
portion of at least 8, at least 10, at least 12, at least 14, at
least 15, at least 16, at least 17, at least 18, at least 19, or at
least 20 contiguous nucleobases complementary to an equal length
portion of nucleobases 1561 to 1597 of SEQ ID NO: 1, wherein the
nucleobase sequence of the modified oligonucleotide is at least 90%
complementary to SEQ ID NO: 1.
[0143] In certain embodiments, provided herein are compounds
comprising a modified oligonucleotide consisting of 12 to 30 linked
nucleosides and comprising a nucleobase sequence comprising a
portion of at least 8, at least 10, at least 12, at least 14, at
least 15, at least 16, at least 17, at least 18, at least 19, or at
least 20 contiguous nucleobases complementary to an equal length
portion of nucleobases 1349 to 1597 of SEQ ID NO: 1, wherein the
nucleobase sequence of the modified oligonucleotide is at least 90%
complementary to SEQ ID NO: 1.
[0144] In certain embodiments, provided herein are compounds
comprising a modified oligonucleotide consisting of 12 to 30 linked
nucleosides and comprising a nucleobase sequence comprising a
portion of at least 8, at least 10, at least 12, at least 14, at
least 15, at least 16, at least 17, at least 18, at least 19, or at
least 20 contiguous nucleobases complementary to an equal length
portion of nucleobases 459 to 513 of SEQ ID NO: 1, wherein the
nucleobase sequence of the modified oligonucleotide is at least 90%
complementary to SEQ ID NO: 1.
[0145] In certain embodiments, provided herein are compounds
comprising a modified oligonucleotide consisting of 12 to 30 linked
nucleosides and having a nucleobase sequence comprising at least 8,
at least 10, at least 12, at least 14, at least 16, at least 17, at
least 18, at least 19, or 20 contiguous nucleobases of the
nucleobase sequence of SEQ ID NO: 38.
[0146] In certain embodiments, provided herein are compounds
comprising a modified oligonucleotide consisting of 12 to 30 linked
nucleosides and having a nucleobase sequence comprising at least 8,
at least 10, at least 12, at least 14, at least 16, at least 17, at
least 18, at least 19, or 20 contiguous nucleobases of the
nucleobase sequence of SEQ ID NO: 29.
[0147] In certain embodiments, provided herein are compounds
comprising a modified oligonucleotide consisting of 12 to 30 linked
nucleosides and having a nucleobase sequence comprising at least 8,
at least 10, at least 12, at least 14, at least 16, at least 17, at
least 18, at least 19, or 20 contiguous nucleobases of the
nucleobase sequences of SEQ ID NO: 20-41.
[0148] In certain embodiments, the modified oligonucleotide
consists of 15 to 30, 18 to 24, 19 to 22, or 20 linked
nucleosides.
[0149] In certain embodiments, the nucleobase sequence of the
modified oligonucleotide is at least 91%, at least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at
least 98%, at least 99%, or 100% complementary to SEQ ID NO: 1.
[0150] In certain embodiments, the modified oligonucleotide
consists of a single-stranded modified oligonucleotide.
[0151] In certain embodiments, at least one internucleoside linkage
of the modified oligonucleotide is a modified internucleoside
linkage. In certain embodiments, at least one modified
oligonucleotide is a phosphorothioate internucleoside linkage. In
certain embodiments, each internucleoside linkage is a
phosphorothioate internucleoside linkage.
[0152] In certain embodiments, at least one nucleoside of the
modified oligonucleotide comprises a modified nucleobase. In
certain embodiments, the modified nucleobase is a
5-methylcytosine.
[0153] In certain embodiments, the modified oligonucleotide
comprises at least one modified sugar. In certain embodiments, the
modified sugar is a 2'-O-methoxyethyl.
[0154] In certain embodiments, the modified oligonucleotide
comprises at least one 2'-O-methoxyethyl nucleoside.
[0155] In certain embodiments, the modified sugar is a bicyclic
sugar. In certain embodiments, the bicyclic sugar comprises a
4'-CH(CH.sub.3)--O-2' bridge.
[0156] In certain embodiments, the modified oligonucleotide
comprises: [0157] a gap segment consisting of linked
deoxynucleosides; [0158] a 5' wing segment consisting of linked
nucleosides; [0159] a 3' wing segment consisting of linked
nucleosides; [0160] wherein the gap segment is positioned between
the 5' wing segment and the 3' wing segment and [0161] wherein each
nucleoside of each wing segment comprises a modified sugar.
[0162] In certain embodiments, the modified oligonucleotide
comprises: [0163] a gap segment consisting often linked
deoxynucleosides; [0164] a 5' wing segment consisting of five
linked nucleosides; [0165] a 3' wing segment consisting of five
linked nucleosides; [0166] wherein the gap segment is positioned
between the 5' wing segment and the 3' wing segment, wherein each
nucleoside of each wing segment comprises a 2'-O-methoxyehtyl
sugar; wherein each internucleoside linkage is a phosphorothioate
linkage; and wherein each cytosine is a 5'-methylcytosine.
[0167] In certain embodiments, the modified oligonucleotide
consists of 15 to 24 linked nucleosides and comprises a nucleobase
sequence comprising a portion of at least 15 contiguous nucleobases
complementary to an equal length portion of nucleobases 1575 to
1594 of SEQ ID NO: 1, and wherein the nucleobase sequence of the
modified oligonucleotide is 100% complementary to SEQ ID NO: 1.
[0168] In certain embodiments, the modified oligonucleotide
consists of 15 to 24 linked nucleosides and comprises a nucleobase
sequence comprising a portion of at least 15 contiguous nucleobases
complementary to an equal length portion of nucleobases 1564 to
1583 of SEQ ID NO: 1, and wherein the nucleobase sequence of the
modified oligonucleotide is 100% complementary to SEQ ID NO: 1.
[0169] In certain embodiments, the modified oligonucleotide
consists of 15 to 24 linked nucleosides and comprises a nucleobase
sequence comprising a portion of at least 15 contiguous nucleobases
complementary to an equal length portion of nucleobases 1561 to
1597 of SEQ ID NO: 1, and wherein the nucleobase sequence of the
modified oligonucleotide is 100% complementary to SEQ ID NO: 1.
[0170] In certain embodiments, the modified oligonucleotide
consists of 15 to 24 linked nucleosides and comprises a nucleobase
sequence comprising a portion of at least 15 contiguous nucleobases
complementary to an equal length portion of nucleobases 1349 to
1597 of SEQ ID NO: 1, and wherein the nucleobase sequence of the
modified oligonucleotide is 100% complementary to SEQ ID NO: 1.
[0171] In certain embodiments, the modified oligonucleotide
consists of 15 to 24 linked nucleosides and comprises a nucleobase
sequence comprising a portion of at least 15 contiguous nucleobases
complementary to an equal length portion of nucleobases 459 to 513
of SEQ ID NO: 1, and wherein the nucleobase sequence of the
modified oligonucleotide is 100% complementary to SEQ ID NO: 1.
[0172] In certain embodiments, the modified oligonucleotide
consists of 18 to 24 linked nucleosides and comprises a nucleobase
sequence comprising a portion of at least 18 contiguous nucleobases
complementary to an equal length portion of nucleobases 1575 to
1594 of SEQ ID NO: 1, and wherein the nucleobase sequence of the
modified oligonucleotide is 100% complementary to SEQ ID NO: 1.
[0173] In certain embodiments, the modified oligonucleotide
consists of 18 to 24 linked nucleosides and comprises a nucleobase
sequence comprising a portion of at least 18 contiguous nucleobases
complementary to an equal length portion of nucleobases 1564 to
1583 of SEQ ID NO: 1, and wherein the nucleobase sequence of the
modified oligonucleotide is 100% complementary to SEQ ID NO: 1.
[0174] In certain embodiments, the modified oligonucleotide
consists of 18 to 24 linked nucleosides and comprises a nucleobase
sequence comprising a portion of at least 18 contiguous nucleobases
complementary to an equal length portion of nucleobases 1561 to
1597 of SEQ ID NO: 1, and wherein the nucleobase sequence of the
modified oligonucleotide is 100% complementary to SEQ ID NO: 1.
[0175] In certain embodiments, the modified oligonucleotide
consists of 18 to 24 linked nucleosides and comprises a nucleobase
sequence comprising a portion of at least 18 contiguous nucleobases
complementary to an equal length portion of nucleobases 1349 to
1597 of SEQ ID NO: 1, and wherein the nucleobase sequence of the
modified oligonucleotide is 100% complementary to SEQ ID NO: 1.
[0176] In certain embodiments, the modified oligonucleotide
consists of 18 to 24 linked nucleosides and comprises a nucleobase
sequence comprising a portion of at least 18 contiguous nucleobases
complementary to an equal length portion of nucleobases 459 to 513
of SEQ ID NO: 1, and wherein the nucleobase sequence of the
modified oligonucleotide is 100% complementary to SEQ ID NO: 1.
[0177] In certain embodiments, provided herein are compositions
comprising a compound as described herein or a salt thereof and a
pharmaceutically acceptable carrier or diluent.
[0178] In certain embodiments, provided herein are compositions as
described herein for use in therapy.
[0179] In certain embodiments, provided herein are compositions as
described herein for use in treating, ameliorating, or preventing
an A1AT deficiency (A1ATD).
[0180] In certain embodiments, provided herein are compositions as
described herein for use in treating an individual with a genetic
predisposition to an A1ATD.
[0181] In certain embodiments, the compounds and compositions
described herein are for use in treating, ameliorating, or
preventing A1ATD associated liver disease.
[0182] In certain embodiments, the compounds and compositions
described herein are for preventing or delaying A1AT aggregation in
the liver.
[0183] In certain embodiments, the compounds and compositions
described herein are for use in treating, ameliorating, or
preventing A1ATD associated liver dysfunction.
[0184] In certain embodiments, the compounds and compositions
described herein are for use in treating, ameliorating, or
preventing A1ATD associated hepatic toxicity.
[0185] In certain embodiments, the compounds and compositions
described herein are for use in treating, ameliorating, or
preventing A1ATD associated pulmonary disease, COPD, and/or
emphysema.
[0186] In certain embodiments, the compounds and compositions
described herein are for preventing or delaying A1AT aggregation in
the lungs.
[0187] In certain embodiments, the compounds and compositions
described herein are for use in treating, ameliorating, or
preventing A1ATD associated pulmonary dysfunction.
[0188] In certain embodiments, the compounds and compositions
described herein are for use in treating, ameliorating, or
preventing A1ATD associated pulmonary toxicity.
[0189] In certain embodiments, provided herein are methods
comprising, identifying an animal at risk for developing A1ATD
associated liver disease; and administering to the at risk animal a
therapeutically effective amount of a modified oligonucleotide
consisting of 12 to 30 linked nucleosides, wherein the modified
oligonucleotide is at least 90% complementary to an A1AT nucleic
acid.
[0190] In certain embodiments, provided herein are methods
comprising, [0191] identifying an animal at risk for developing
A1ATD associated pulmonary disease; and [0192] administering to the
at risk animal a therapeutically effective amount of a modified
oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
the modified oligonucleotide is at least 90% complementary to an
A1AT nucleic acid.
[0193] Certain embodiments describe a method of slowing or halting
progression of A 1ATD associated liver disease by administering a
compound or composition described herein. In certain embodiments,
provided is a method comprising administering a modified
oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
the modified oligonucleotide is at least 90% complementary to an
A1AT nucleic acid, and wherein the progression of the A1ATD
associated liver disease is slowed or halted. In certain
embodiments, provided is a method comprising identifying an animal
having an A1ATD-associated liver disease and administering to the
animal a therapeutically effective amount of a modified
oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
the modified oligonucleotide is at least 90% complementary to an
A1AT nucleic acid, and wherein the progression of the A1ATD
associated liver disease is slowed or halted. In certain
embodiments, the nucleobase sequence of the modified
oligonucleotide is at least 91%, at least 92%, at least 93%, at
least 94%, at least 95%, at least 96%, at least 97%, at least 98%,
at least 99%, or 100% complementary to an A1AT nucleic acid.
[0194] Certain embodiments describe a method of preventing or
stopping or delaying or forestalling the accumulation or onset of
accumulation of A1AT globules in the liver. In certain embodiments,
the risk of A1ATD-associated liver disease is lowered or reduced.
In certain embodiments, the development or onset of
A1ATD-associated liver disease is prevented, delayed or
forestalled. In certain embodiments, provided is a method
comprising administering a modified oligonucleotide consisting of
12 to 30 linked nucleosides, wherein the modified oligonucleotide
is at least 90% complementary to an A1AT nucleic acid, and wherein
accumulation of A1AT globules in the liver is stopped, delayed or
forestalled. In certain embodiments, provided is a method
comprising administering a modified oligonucleotide consisting of
12 to 30 linked nucleosides, wherein the modified oligonucleotide
is at least 90% complementary to an A1AT nucleic acid, and wherein
the development or onset of A1ATD-associated liver disease is
prevented, delayed or forestalled. In certain embodiments, provided
is a method comprising identifying an animal at risk for developing
A1ATD-associated liver disease and administering to the at risk
animal a therapeutically effective amount of a modified
oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
the modified oligonucleotide is at least 90% complementary to an
A1AT nucleic acid, and wherein the risk of A1ATD associated liver
disease is lowered or reduced. In certain embodiments, provided is
a method comprising identifying an animal at risk for developing
A1ATD-associated liver disease and administering to the at risk
animal a therapeutically effective amount of a modified
oligonucleotide consisting of 12 to 30 linked nucleosides, wherein
the modified oligonucleotide is at least 90% complementary to an
A1AT nucleic acid, and wherein accumulation of A1AT globules or
aggregates in the liver is stopped, delayed or forestalled thereby
reducing or lowering the risk of A1ATD associated liver disease. In
certain embodiments, the nucleobase sequence of the modified
oligonucleotide is at least 91%, at least 92%, at least 93%, at
least 94%, at least 95%, at least 96%, at least 97%, at least 98%,
at least 99%, or 100% complementary to an A1AT nucleic acid.
[0195] In certain embodiments, the modified oligonucleotide
consists of 12 to 30 linked nucleosides and has a nucleobase
sequence comprising at least 12, at least 14, at least 16, at least
17, at least 18, at least 19, or at least 20 contiguous nucleobases
of the nucleobase sequences of SEQ ID NO: 20-41.
[0196] In certain embodiments, expression of A1AT mRNA is
reduced.
[0197] In certain embodiments, expression of A1AT protein is
reduced.
[0198] In certain embodiments, A1ATD associated liver disease is
treated, ameliorated, or prevented.
[0199] In certain embodiments, A1AT aggregation in the liver is
prevented or delayed.
[0200] In certain embodiments, A1ATD associated pulmonary disease
is treated, ameliorated, or prevented.
[0201] In certain embodiments, A1AT aggregation in the lung is
prevented or delayed.
Antisense Compounds
[0202] Oligomeric compounds include, but are not limited to,
oligonucleotides, oligonucleosides, oligonucleotide analogs,
oligonucleotide mimetics, antisense compounds, antisense
oligonucleotides, and siRNAs. An oligomeric compound may be
"antisense" to a target nucleic acid, meaning that it is capable of
undergoing hybridization to a target nucleic acid through hydrogen
bonding.
[0203] In certain embodiments, an antisense compound has a
nucleobase sequence that, when written in the 5' to 3' direction,
comprises the reverse complement of the target segment of a target
nucleic acid to which it is targeted. In certain such embodiments,
an antisense oligonucleotide has a nucleobase sequence that, when
written in the 5' to 3' direction, comprises the reverse complement
of the target segment of a target nucleic acid to which it is
targeted.
[0204] In certain embodiments, an antisense compound targeted to an
A1AT nucleic acid is 12 to 30 subunits in length. In other words,
such antisense compounds are from 12 to 30 linked subunits. In
other embodiments, the antisense compound is 8 to 80, 12 to 50, 15
to 30, 18 to 24, 19 to 22, or 20 linked subunits.
[0205] In certain such embodiments, the antisense compounds are 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59,
60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76,
77, 78, 79, or 80 linked subunits in length, or a range defined by
any two of the above values. In some embodiments the antisense
compound is an antisense oligonucleotide, and the linked subunits
are nucleosides.
[0206] In certain embodiments antisense oligonucleotides targeted
to an A1AT nucleic acid may be shortened or truncated. For example,
a single subunit may be deleted from the 5' end (5' truncation), or
alternatively from the 3' end (3' truncation). A shortened or
truncated antisense compound targeted to a A1AT nucleic acid may
have two subunits deleted from the 5' end, or alternatively may
have two subunits deleted from the 3' end, of the antisense
compound. Alternatively, the deleted nucleosides may be dispersed
throughout the antisense compound, for example, in an antisense
compound having one nucleoside deleted from the 5' end and one
nucleoside deleted from the 3' end.
[0207] When a single additional subunit is present in a lengthened
antisense compound, the additional subunit may be located at the 5'
or 3' end of the antisense compound. When two or more additional
subunits are present, the added subunits may be adjacent to each
other, for example, in an antisense compound having two subunits
added to the 5' end (5' addition), or alternatively to the 3' end
(3' addition), of the antisense compound. Alternatively, the added
subunits may be dispersed throughout the antisense compound, for
example, in an antisense compound having one subunit added to the
5' end and one subunit added to the 3' end.
[0208] It is possible to increase or decrease the length of an
antisense compound, such as an antisense oligonucleotide, and/or
introduce mismatch bases without eliminating activity. For example,
in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a
series of antisense oligonucleotides 13-25 nucleobases in length
were tested for their ability to induce cleavage of a target RNA in
an oocyte injection model. Antisense oligonucleotides 25
nucleobases in length with 8 or 11 mismatch bases near the ends of
the antisense oligonucleotides were able to direct specific
cleavage of the target mRNA, albeit to a lesser extent than the
antisense oligonucleotides that contained no mismatches. Similarly,
target specific cleavage was achieved using 13 nucleobase antisense
oligonucleotides, including those with 1 or 3 mismatches.
[0209] Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March
2001) demonstrated the ability of an oligonucleotide having 100%
complementarity to the bcl-2 mRNA and having 3 mismatches to the
bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in
vitro and in vivo. Furthermore, this oligonucleotide demonstrated
potent anti-tumor activity in vivo.
[0210] Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988)
tested a series of tandem 14 nucleobase antisense oligonucleotides,
and a 28 and 42 nucleobase antisense oligonucleotides comprised of
the sequence of two or three of the tandem antisense
oligonucleotides, respectively, for their ability to arrest
translation of human DHFR in a rabbit reticulocyte assay. Each of
the three 14 nucleobase antisense oligonucleotides alone was able
to inhibit translation, albeit at a more modest level than the 28
or 42 nucleobase antisense oligonucleotides.
Certain Antisense Compound Motifs and Mechanisms
[0211] In certain embodiments, antisense compounds have chemically
modified subunits arranged in patterns, or motifs, to confer to the
antisense compounds properties such as enhanced inhibitory
activity, increased binding affinity for a target nucleic acid, or
resistance to degradation by in vivo nucleases. Chimeric antisense
compounds typically contain at least one region modified so as to
confer increased resistance to nuclease degradation, increased
cellular uptake, increased binding affinity for the target nucleic
acid, and/or increased inhibitory activity. A second region of a
chimeric antisense compound may confer another desired property
e.g., serve as a substrate for the cellular endonuclease RNase H,
which cleaves the RNA strand of an RNA:DNA duplex.
[0212] Antisense activity may result from any mechanism involving
the hybridization of the antisense compound (e.g., oligonucleotide)
with a target nucleic acid, wherein the hybridization ultimately
results in a biological effect. In certain embodiments, the amount
and/or activity of the target nucleic acid is modulated. In certain
embodiments, the amount and/or activity of the target nucleic acid
is reduced. In certain embodiments, hybridization of the antisense
compound to the target nucleic acid ultimately results in target
nucleic acid degradation. In certain embodiments, hybridization of
the antisense compound to the target nucleic acid does not result
in target nucleic acid degradation. In certain such embodiments,
the presence of the antisense compound hybridized with the target
nucleic acid (occupancy) results in a modulation of antisense
activity. In certain embodiments, antisense compounds having a
particular chemical motif or pattern of chemical modifications are
particularly suited to exploit one or more mechanisms. In certain
embodiments, antisense compounds function through more than one
mechanism and/or through mechanisms that have not been elucidated.
Accordingly, the antisense compounds described herein are not
limited by particular mechanism.
[0213] Antisense mechanisms include, without limitation, RNase H
mediated antisense; RNAi mechanisms, which utilize the RISC pathway
and include, without limitation, siRNA, ssRNA and microRNA
mechanisms; and occupancy based mechanisms. Certain antisense
compounds may act through more than one such mechanism and/or
through additional mechanisms.
[0214] RNase H-Mediated Antisense
[0215] In certain embodiments, antisense activity results at least
in part from degradation of target RNA by RNase H. RNase H is a
cellular endonuclease that cleaves the RNA strand of an RNA:DNA
duplex. It is known in the art that single-stranded antisense
compounds which are "DNA-like" elicit RNase H activity in mammalian
cells. Accordingly, antisense compounds comprising at least a
portion of DNA or DNA-like nucleosides may activate RNase H,
resulting in cleavage of the target nucleic acid. In certain
embodiments, antisense compounds that utilize RNase H comprise one
or more modified nucleosides. In certain embodiments, such
antisense compounds comprise at least one block of 1-8 modified
nucleosides. In certain such embodiments, the modified nucleosides
do not support RNase H activity. In certain embodiments, such
antisense compounds are gapmers, as described herein. In certain
such embodiments, the gap of the gapmer comprises DNA nucleosides.
In certain such embodiments, the gap of the gapmer comprises
DNA-like nucleosides. In certain such embodiments, the gap of the
gapmer comprises DNA nucleosides and DNA-like nucleosides.
[0216] Certain antisense compounds having a gapmer motif are
considered chimeric antisense compounds. In a gapmer an internal
region having a plurality of nucleotides that supports RNaseH
cleavage is positioned between external regions having a plurality
of nucleotides that are chemically distinct from the nucleosides of
the internal region. In the case of an antisense oligonucleotide
having a gapmer motif, the gap segment generally serves as the
substrate for endonuclease cleavage, while the wing segments
comprise modified nucleosides. In certain embodiments, the regions
of a gapmer are differentiated by the types of sugar moieties
comprising each distinct region. The types of sugar moieties that
are used to differentiate the regions of a gapmer may in some
embodiments include D-D-ribonucleosides, J-D-deoxyribonucleosides,
2'-modified nucleosides (such 2'-modified nucleosides may include
2'-MOE and 2'-O--CH.sub.3, among others), and bicyclic sugar
modified nucleosides (such bicyclic sugar modified nucleosides may
include those having a constrained ethyl). In certain embodiments,
nucleosides in the wings may include several modified sugar
moieties, including, for example 2'-MOE and bicyclic sugar moieties
such as constrained ethyl or LNA. In certain embodiments, wings may
include several modified and unmodified sugar moieties. In certain
embodiments, wings may include various combinations of 2'-MOE
nucleosides, bicyclic sugar moieties such as constrained ethyl
nucleosides or LNA nucleosides, and 2'-deoxynucleosides.
[0217] Each distinct region may comprise uniform sugar moieties,
variant, or alternating sugar moieties. The wing-gap-wing motif is
frequently described as "X--Y--Z", where "X" represents the length
of the 5'-wing, "Y" represents the length of the gap, and "Z"
represents the length of the 3'-wing. "X" and "Z" may comprise
uniform, variant, or alternating sugar moieties. In certain
embodiments, "X" and "Y" may include one or more
2'-deoxynucleosides. "Y" may comprise 2'-deoxynucleosides. As used
herein, a gapmer described as "X--Y--Z" has a configuration such
that the gap is positioned immediately adjacent to each of the
5'-wing and the 3' wing. Thus, no intervening nucleotides exist
between the 5'-wing and gap, or the gap and the 3'-wing. Any of the
antisense compounds described herein can have a gapmer motif. In
certain embodiments, "X" and "Z" are the same; in other embodiments
they are different. In certain embodiments, "Y" is between 8 and 15
nucleosides. X, Y, or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more
nucleosides.
[0218] In certain embodiments, the antisense compound has a gapmer
motif in which the gap consists of 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, or 16 linked nucleosides.
[0219] In certain embodiments, the antisense oligonucleotide has a
sugar motif described by Formula A as follows:
(J).sub.m-(B).sub.n-(J).sub.p-(B).sub.r-(A).sub.t-(D).sub.g-(A).sub.v-(B)-
.sub.w-(J).sub.x-(B).sub.y-(J).sub.z [0220] wherein: [0221] each A
is independently a 2'-substituted nucleoside; [0222] each B is
independently a bicyclic nucleoside; [0223] each J is independently
either a 2'-substituted nucleoside or a 2'-deoxynucleoside; [0224]
each D is a 2'-deoxynucleoside; [0225] m is 0-4; n is 0-2; p is
0-2; r is 0-2; t is 0-2; v is 0-2; w is 0-4; x is 0-2; y is 0-2; z
is 0-4; g is 6-14; provided that: [0226] at least one of m, n, and
r is other than 0; [0227] at least one of w and y is other than 0;
[0228] the sum of m, n, p, r, and t is from 2 to 5; and the sum of
v, w, x, y, and z is from 2 to 5.
[0229] RNAi Compounds
[0230] In certain embodiments, antisense compounds are interfering
RNA compounds (RNAi), which include double-stranded RNA compounds
(also referred to as short-interfering RNA or siRNA) and
single-stranded RNAi compounds (or ssRNA). Such compounds work at
least in part through the RISC pathway to degrade and/or sequester
a target nucleic acid (thus, include microRNA/microRNA-mimic
compounds). In certain embodiments, antisense compounds comprise
modifications that make them particularly suited for such
mechanisms.
[0231] i. ssRNA Compounds
[0232] In certain embodiments, antisense compounds including those
particularly suited for use as single-stranded RNAi compounds
(ssRNA) comprise a modified 5'-terminal end. In certain such
embodiments, the 5'-terminal end comprises a modified phosphate
moiety. In certain embodiments, such modified phosphate is
stabilized (e.g., resistant to degradation/cleavage compared to
unmodified 5'-phosphate). In certain embodiments, such 5'-terminal
nucleosides stabilize the 5'-phosphorous moiety. Certain modified
5'-terminal nucleosides may be found in the art, for example in
WO/2011/139702.
[0233] In certain embodiments, the 5'-nucleoside of an ssRNA
compound has Formula IIc:
##STR00002##
wherein: [0234] T.sub.1 is an optionally protected phosphorus
moiety; [0235] T.sub.2 is an internucleoside linking group linking
the compound of Formula IIc to the oligomeric compound; [0236] A
has one of the formulas:
[0236] ##STR00003## [0237] Q.sub.1 and Q.sub.2 are each,
independently, H, halogen, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6alkoxy, substituted
C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted
C.sub.2-C.sub.6 alkynyl or N(R.sub.3)(R.sub.4); [0238] Q.sub.3 is
O, S, N(R.sub.5) or C(R.sub.6)(R.sub.7); [0239] each R.sub.3,
R.sub.4 R.sub.5, R.sub.6 and R.sub.7 is, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl or
C.sub.1-C.sub.6 alkoxy; [0240] M.sub.3 is O, S, NR.sub.14,
C(R.sub.15)(R.sub.16), C(R.sub.15)(R.sub.16)C(R.sub.17)(R.sub.18),
C(R.sub.18).dbd.C(R.sub.17), OC(R.sub.15)(R.sub.16) or
OC(R.sub.5)(Bx.sub.2); [0241] R.sub.14 is H, C.sub.1-C.sub.6 alkyl,
substituted C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy,
substituted C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkenyl,
substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or
substituted C.sub.2-C.sub.6 alkynyl; [0242] R.sub.15, R.sub.16,
R.sub.17 and R.sub.18 are each, independently, H, halogen,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy,
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl;
[0243] Bx.sub.1 is a heterocyclic base moiety; [0244] or if
Bx.sub.2 is present then Bx.sub.2 is a heterocyclic base moiety and
Bx.sub.1 is H, halogen, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, substituted
C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted
C.sub.2-C.sub.6 alkynyl; [0245] J.sub.4, J.sub.5, J.sub.6 and
J.sub.7 are each, independently, H, halogen, C.sub.1-C.sub.6 alkyl,
substituted C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy,
substituted C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkenyl,
substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or
substituted C.sub.2-C.sub.6 alkynyl; [0246] or J.sub.4 forms a
bridge with one of J.sub.5 or J.sub.7 wherein said bridge comprises
from 1 to 3 linked biradical groups selected from O, S, NR.sub.19,
C(R.sub.20)(R.sub.21), C(R.sub.20).dbd.C(R.sub.21),
C[.dbd.C(R.sub.20)(R.sub.21)] and C(.dbd.O) and the other two of
J.sub.5, J.sub.6 and J.sub.7 are each, independently, H, halogen,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy,
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl;
[0247] each R.sub.19, R.sub.20 and R.sub.21 is, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy,
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl;
[0248] G is H, OH, halogen or
O--[C(R.sub.8)(R.sub.9)].sub.n--[(C.dbd.O).sub.m--X.sub.1].sub.j--Z;
[0249] each R.sub.1 and R.sub.9 is, independently, H, halogen,
C.sub.1-C.sub.6 alkyl or substituted C.sub.1-C.sub.6 alkyl; [0250]
X.sub.1 is O, S or N(E.sub.1); [0251] Z is H, halogen,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, substituted C.sub.2-C.sub.6 alkynyl or
N(E.sub.2)(E.sub.3); [0252] E.sub.1, E.sub.2 and E.sub.3 are each,
independently, H, C.sub.1-C.sub.6 alkyl or substituted
C.sub.1-C.sub.6 alkyl; [0253] n is from 1 to about 6; [0254] m is 0
or 1; [0255] j is 0 or 1; [0256] each substituted group comprises
one or more optionally protected substituent groups independently
selected from halogen, OJ.sub.1, N(J.sub.1)(J.sub.2),
.dbd.NJ.sub.1, SJ.sub.1, N.sub.3, CN, OC(.dbd.X.sub.2)J.sub.1,
OC(.dbd.X.sub.2)N(J.sub.1)(J.sub.2) and
C(.dbd.X.sub.2)N(J.sub.1)(J.sub.2); X.sub.2 is O, S or NJ.sub.3;
[0257] each J.sub.1, J.sub.2 and J.sub.3 is, independently, H or
C.sub.1-C.sub.6 alkyl; [0258] when j is 1 then Z is other than
halogen or N(E.sub.2)(E.sub.3); and [0259] wherein said oligomeric
compound comprises from 8 to 40 monomeric subunits and is
hybridizable to at least a portion of a target nucleic acid.
[0260] In certain embodiments, M.sub.3 is O, CH.dbd.CH, OCH.sub.2
or OC(H)(Bx.sub.2). In certain embodiments, M.sub.3 is O.
[0261] In certain embodiments, J.sub.4, J.sub.5, J.sub.6 and
J.sub.7 are each H. In certain embodiments, J.sub.4 forms a bridge
with one of J.sub.5 or J.sub.7.
[0262] In certain embodiments, A has one of the formulas:
##STR00004##
wherein: [0263] Q.sub.1 and Q.sub.2 are each, independently, H,
halogen, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy or substituted C.sub.1-C.sub.6 alkoxy. In
certain embodiments, Q.sub.1 and Q.sub.2 are each H. In certain
embodiments, Q.sub.1 and Q.sub.2 are each, independently, H or
halogen. In certain embodiments, Q.sub.1 and Q.sub.2 is H and the
other of Q.sub.1 and Q.sub.2 is F, CH.sub.3 or OCH.sub.3.
[0264] In certain embodiments, T.sub.1 has the formula:
##STR00005##
wherein: [0265] R.sub.a and R.sub.c are each, independently,
protected hydroxyl, protected thiol, C.sub.1-C.sub.6 alkyl,
substituted C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy,
substituted C.sub.1-C.sub.6 alkoxy, protected amino or substituted
amino; and [0266] R.sub.b is O or S. In certain embodiments,
R.sub.b is O and R.sub.a and R.sub.c are each, independently,
OCH.sub.3, OCH.sub.2CH.sub.3 or CH(CH.sub.3).sub.2.
[0267] In certain embodiments, G is halogen, OCH.sub.3, OCH.sub.2F,
OCHF.sub.2, OCF.sub.3, OCH.sub.2CH.sub.3, O(CH.sub.2).sub.2F,
OCH.sub.2CHF.sub.2, OCH.sub.2CF.sub.3, OCH.sub.2--CH.dbd.CH.sub.2,
O(CH.sub.2).sub.2--OCH.sub.3, O(CH.sub.2).sub.2--SCH.sub.3,
O(CH.sub.2).sub.2--OCF.sub.3,
O(CH.sub.2).sub.3--N(R.sub.10)(R.sub.11),
O(CH.sub.2).sub.2--ON(R.sub.10)(R.sub.11),
O(CH.sub.2).sub.2--O(CH.sub.2).sub.2--N(R.sub.10)(R.sub.11),
OCH.sub.2C(.dbd.O)--N(R.sub.10)(R.sub.11),
OCH.sub.2C(.dbd.O)--N(R.sub.12)--(CH.sub.2).sub.2--N(R.sub.10)(R.sub.11)
or
O(CH.sub.2).sub.2--N(R.sub.12)--C(.dbd.NR.sub.3)[N(R.sub.10)(R.sub.11)-
] wherein R.sub.10, R.sub.11, R.sub.12 and R.sub.13 are each,
independently, H or C.sub.1-C.sub.6 alkyl. In certain embodiments,
G is halogen, OCH.sub.3, OCF.sub.3, OCH.sub.2CH.sub.3,
OCH.sub.2CF.sub.3, OCH.sub.2--CH.dbd.CH.sub.2,
O(CH.sub.2).sub.2--OCH.sub.3,
O(CH.sub.2).sub.2--O(CH.sub.2).sub.2--N(CH.sub.3).sub.2,
OCH.sub.2C(.dbd.O)--N(H)CH.sub.3,
OCH.sub.2C(.dbd.O)--N(H)--(CH.sub.2).sub.2--N(CH.sub.3).sub.2 or
OCH.sub.2--N(H)--C(.dbd.NH)NH.sub.2. In certain embodiments, G is
F, OCH.sub.3 or O(CH.sub.2).sub.2--OCH.sub.3. In certain
embodiments, G is O(CH.sub.2).sub.2--OCH.sub.3.
[0268] In certain embodiments, the 5'-terminal nucleoside has
Formula lie:
##STR00006##
[0269] In certain embodiments, antisense compounds, including those
particularly suitable for ssRNA comprise one or more type of
modified sugar moieties and/or naturally occurring sugar moieties
arranged along an oligonucleotide or region thereof in a defined
pattern or sugar modification motif. Such motifs may include any of
the sugar modifications discussed herein and/or other known sugar
modifications.
[0270] In certain embodiments, the oligonucleotides comprise or
consist of a region having uniform sugar modifications. In certain
such embodiments, each nucleoside of the region comprises the same
RNA-like sugar modification. In certain embodiments, each
nucleoside of the region is a 2'-F nucleoside. In certain
embodiments, each nucleoside of the region is a 2'-OMe nucleoside.
In certain embodiments, each nucleoside of the region is a 2'-MOE
nucleoside. In certain embodiments, each nucleoside of the region
is a cEt nucleoside. In certain embodiments, each nucleoside of the
region is an LNA nucleoside. In certain embodiments, the uniform
region constitutes all or essentially all of the oligonucleotide.
In certain embodiments, the region constitutes the entire
oligonucleotide except for 1-4 terminal nucleosides.
[0271] In certain embodiments, oligonucleotides comprise one or
more regions of alternating sugar modifications, wherein the
nucleosides alternate between nucleotides having a sugar
modification of a first type and nucleotides having a sugar
modification of a second type. In certain embodiments, nucleosides
of both types are RNA-like nucleosides. In certain embodiments the
alternating nucleosides are selected from: 2'-OMe, 2'-F, 2'-MOE,
LNA, and cEt. In certain embodiments, the alternating modifications
are 2'-F and 2'-OMe. Such regions may be contiguous or may be
interrupted by differently modified nucleosides or conjugated
nucleosides.
[0272] In certain embodiments, the alternating region of
alternating modifications each consist of a single nucleoside
(i.e., the pattern is (AB).sub.xA.sub.y wherein A is a nucleoside
having a sugar modification of a first type and B is a nucleoside
having a sugar modification of a second type; x is 1-20 and y is 0
or 1). In certain embodiments, one or more alternating regions in
an alternating motif includes more than a single nucleoside of a
type. For example, oligonucleotides may include one or more regions
of any of the following nucleoside motifs: [0273] AABBAA; [0274]
ABBABB; [0275] AABAAB; [0276] ABBABAABB; [0277] ABABAA; [0278]
AABABAB; [0279] ABABAA; [0280] ABBAABBABABAA; [0281]
BABBAABBABABAA; or [0282] ABABBAABBABABAA; [0283] wherein A is a
nucleoside of a first type and B is a nucleoside of a second type.
In certain embodiments, A and B are each selected from 2'-F,
2'-OMe, BNA, and MOE.
[0284] In certain embodiments, oligonucleotides having such an
alternating motif also comprise a modified 5' terminal nucleoside,
such as those of formula IIc or lie.
[0285] In certain embodiments, oligonucleotides comprise a region
having a 2-2-3 motif. Such regions comprises the following
motif:
-(A).sub.2-(B).sub.x-(A).sub.2-(C).sub.y-(A).sub.3- [0286] wherein:
A is a first type of modified nucleoside; [0287] B and C, are
nucleosides that are differently modified than A, however, B and C
may have the same or different modifications as one another; [0288]
x and y are from 1 to 15.
[0289] In certain embodiments, A is a 2'-OMe modified nucleoside.
In certain embodiments, B and C are both 2'-F modified nucleosides.
In certain embodiments, A is a 2'-OMe modified nucleoside and B and
C are both 2'-F modified nucleosides.
[0290] In certain embodiments, oligonucleosides have the following
sugar motif:
5'-(Q)-(AB).sub.xA.sub.y-(D).sub.z
wherein: [0291] Q is a nucleoside comprising a stabilized phosphate
moiety. In certain embodiments, Q is a nucleoside having Formula
IIc or lie; [0292] A is a first type of modified nucleoside; [0293]
B is a second type of modified nucleoside; [0294] D is a modified
nucleoside comprising a modification different from the nucleoside
adjacent to it. Thus, if y is 0, then D must be differently
modified than B and if y is 1, then D must be differently modified
than A. In certain embodiments, D differs from both A and B. [0295]
X is 5-15; [0296] Y is 0 or 1; [0297] Z is 0-4.
[0298] In certain embodiments, oligonucleosides have the following
sugar motif:
5'-(Q)-(A).sub.x-(D).sub.z
wherein: [0299] Q is a nucleoside comprising a stabilized phosphate
moiety. In certain embodiments, Q is a nucleoside having Formula
IIc or lie; [0300] A is a first type of modified nucleoside; [0301]
D is a modified nucleoside comprising a modification different from
A. [0302] X is 11-30; [0303] Z is 0-4.
[0304] In certain embodiments A, B, C, and D in the above motifs
are selected from: 2'-OMe, 2'-F, 2'-MOE, LNA, and cEt. In certain
embodiments, D represents terminal nucleosides. In certain
embodiments, such terminal nucleosides are not designed to
hybridize to the target nucleic acid (though one or more might
hybridize by chance). In certain embodiments, the nucleobase of
each D nucleoside is adenine, regardless of the identity of the
nucleobase at the corresponding position of the target nucleic
acid. In certain embodiments the nucleobase of each D nucleoside is
thymine.
[0305] In certain embodiments, antisense compounds, including those
particularly suited for use as ssRNA comprise modified
internucleoside linkages arranged along the oligonucleotide or
region thereof in a defined pattern or modified internucleoside
linkage motif. In certain embodiments, oligonucleotides comprise a
region having an alternating internucleoside linkage motif. In
certain embodiments, oligonucleotides comprise a region of
uniformly modified internucleoside linkages. In certain such
embodiments, the oligonucleotide comprises a region that is
uniformly linked by phosphorothioate internucleoside linkages. In
certain embodiments, the oligonucleotide is uniformly linked by
phosphorothioate internucleoside linkages. In certain embodiments,
each internucleoside linkage of the oligonucleotide is selected
from phosphodiester and phosphorothioate. In certain embodiments,
each internucleoside linkage of the oligonucleotide is selected
from phosphodiester and phosphorothioate and at least one
internucleoside linkage is phosphorothioate.
[0306] In certain embodiments, the oligonucleotide comprises at
least 6 phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least 8
phosphorothioate internucleoside linkages. In certain embodiments,
the oligonucleotide comprises at least 10 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least one block of at least 6
consecutive phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least one block of at
least 8 consecutive phosphorothioate internucleoside linkages. In
certain embodiments, the oligonucleotide comprises at least one
block of at least 10 consecutive phosphorothioate internucleoside
linkages. In certain embodiments, the oligonucleotide comprises at
least one block of at least one 12 consecutive phosphorothioate
internucleoside linkages. In certain such embodiments, at least one
such block is located at the 3' end of the oligonucleotide. In
certain such embodiments, at least one such block is located within
3 nucleosides of the 3' end of the oligonucleotide.
[0307] Oligonucleotides having any of the various sugar motifs
described herein, may have any linkage motif. For example, the
oligonucleotides, including but not limited to those described
above, may have a linkage motif selected from non-limiting the
table below:
TABLE-US-00001 5' most linkage Central region 3'-region PS
Alternating PO/PS 6 PS PS Alternating PO/PS 7 PS PS Alternating
PO/PS 8 PS
ii. siRNA Compounds
[0308] In certain embodiments, antisense compounds are
double-stranded RNAi compounds (siRNA). In such embodiments, one or
both strands may comprise any modification motif described above
for ssRNA. In certain embodiments, ssRNA compounds may be
unmodified RNA. In certain embodiments, siRNA compounds may
comprise unmodified RNA nucleosides, but modified internucleoside
linkages.
[0309] Several embodiments relate to double-stranded compositions
wherein each strand comprises a motif defined by the location of
one or more modified or unmodified nucleosides. In certain
embodiments, compositions are provided comprising a first and a
second oligomeric compound that are fully or at least partially
hybridized to form a duplex region and further comprising a region
that is complementary to and hybridizes to a nucleic acid target.
It is suitable that such a composition comprise a first oligomeric
compound that is an antisense strand having full or partial
complementarity to a nucleic acid target and a second oligomeric
compound that is a sense strand having one or more regions of
complementarity to and forming at least one duplex region with the
first oligomeric compound.
[0310] The compositions of several embodiments modulate gene
expression by hybridizing to a nucleic acid target resulting in
loss of its normal function. In certain embodiment, the degradation
of the targeted nucleic acid is facilitated by an activated RISC
complex that is formed with compositions of the invention.
[0311] Several embodiments are directed to double-stranded
compositions wherein one of the strands is useful in, for example,
influencing the preferential loading of the opposite strand into
the RISC (or cleavage) complex. The compositions are useful for
targeting selected nucleic acid molecules and modulating the
expression of one or more genes. In some embodiments, the
compositions of the present invention hybridize to a portion of a
target RNA resulting in loss of normal function of the target
RNA.
[0312] Certain embodiments are drawn to double-stranded
compositions wherein both the strands comprises a hemimer motif, a
fully modified motif, a positionally modified motif or an
alternating motif. Each strand of the compositions of the present
invention can be modified to fulfil a particular role in for
example the siRNA pathway. Using a different motif in each strand
or the same motif with different chemical modifications in each
strand permits targeting the antisense strand for the RISC complex
while inhibiting the incorporation of the sense strand. Within this
model, each strand can be independently modified such that it is
enhanced for its particular role. The antisense strand can be
modified at the 5'-end to enhance its role in one region of the
RISC while the 3'-end can be modified differentially to enhance its
role in a different region of the RISC.
[0313] The double-stranded oligonucleotide molecules can be a
double-stranded polynucleotide molecule comprising
self-complementary sense and antisense regions, wherein the
antisense region comprises nucleotide sequence that is
complementary to nucleotide sequence in a target nucleic acid
molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. The double-stranded oligonucleotide
molecules can be assembled from two separate oligonucleotides,
where one strand is the sense strand and the other is the antisense
strand, wherein the antisense and sense strands are
self-complementary (i.e. each strand comprises nucleotide sequence
that is complementary to nucleotide sequence in the other strand;
such as where the antisense strand and sense strand form a duplex
or double-stranded structure, for example wherein the
double-stranded region is about 15 to about 30, e.g., about 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base
pairs; the antisense strand comprises nucleotide sequence that is
complementary to nucleotide sequence in a target nucleic acid
molecule or a portion thereof and the sense strand comprises
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof (e.g., about 15 to about 25 or more
nucleotides of the double-stranded oligonucleotide molecule are
complementary to the target nucleic acid or a portion thereof).
Alternatively, the double-stranded oligonucleotide is assembled
from a single oligonucleotide, where the self-complementary sense
and antisense regions of the siRNA are linked by means of a nucleic
acid based or non-nucleic acid-based linker(s).
[0314] The double-stranded oligonucleotide can be a polynucleotide
with a duplex, asymmetric duplex, hairpin or asymmetric hairpin
secondary structure, having self-complementary sense and antisense
regions, wherein the antisense region comprises nucleotide sequence
that is complementary to nucleotide sequence in a separate target
nucleic acid molecule or a portion thereof and the sense region
having nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. The double-stranded oligonucleotide
can be a circular single-stranded polynucleotide having two or more
loop structures and a stem comprising self-complementary sense and
antisense regions, wherein the antisense region comprises
nucleotide sequence that is complementary to nucleotide sequence in
a target nucleic acid molecule or a portion thereof and the sense
region having nucleotide sequence corresponding to the target
nucleic acid sequence or a portion thereof, and wherein the
circular polynucleotide can be processed either in vivo or in vitro
to generate an active siRNA molecule capable of mediating RNAi.
[0315] In certain embodiments, the double-stranded oligonucleotide
comprises separate sense and antisense sequences or regions,
wherein the sense and antisense regions are covalently linked by
nucleotide or non-nucleotide linkers molecules as is known in the
art, or are alternately non-covalently linked by ionic
interactions, hydrogen bonding, van der waals interactions,
hydrophobic interactions, and/or stacking interactions. In certain
embodiments, the double-stranded oligonucleotide comprises
nucleotide sequence that is complementary to nucleotide sequence of
a target gene. In another embodiment, the double-stranded
oligonucleotide interacts with nucleotide sequence of a target gene
in a manner that causes inhibition of expression of the target
gene.
[0316] As used herein, double-stranded oligonucleotides need not be
limited to those molecules containing only RNA, but further
encompasses chemically modified nucleotides and non-nucleotides. In
certain embodiments, the short interfering nucleic acid molecules
lack 2'-hydroxy (2'-OH) containing nucleotides. In certain
embodiments short interfering nucleic acids optionally do not
include any ribonucleotides (e.g., nucleotides having a 2'--OH
group). Such double-stranded oligonucleotides that do not require
the presence of ribonucleotides within the molecule to support RNAi
can however have an attached linker or linkers or other attached or
associated groups, moieties, or chains containing one or more
nucleotides with 2'--OH groups. Optionally, double-stranded
oligonucleotides can comprise ribonucleotides at about 5, 10, 20,
30, 40, or 50% of the nucleotide positions. As used herein, the
term siRNA is meant to be equivalent to other terms used to
describe nucleic acid molecules that are capable of mediating
sequence specific RNAi, for example short interfering RNA (siRNA),
double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA
(shRNA), short interfering oligonucleotide, short interfering
nucleic acid, short interfering modified oligonucleotide,
chemically modified siRNA, post-transcriptional gene silencing RNA
(ptgsRNA), and others. In addition, as used herein, the term RNAi
is meant to be equivalent to other terms used to describe sequence
specific RNA interference, such as post transcriptional gene
silencing, translational inhibition, or epigenetics. For example,
double-stranded oligonucleotides can be used to epigenetically
silence genes at both the post-transcriptional level and the
pre-transcriptional level. In a non-limiting example, epigenetic
regulation of gene expression by siRNA molecules of the invention
can result from siRNA mediated modification of chromatin structure
or methylation pattern to alter gene expression (see, for example,
Verdel et al., 2004, Science, 303, 672-676; Pal-Bhadra et al.,
2004, Science, 303, 669-672; Allshire, 2002, Science, 297,
1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein,
2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297,
2232-2237).
[0317] It is contemplated that compounds and compositions of
several embodiments provided herein can target by a dsRNA-mediated
gene silencing or RNAi mechanism, including, e.g., "hairpin" or
stem-loop double-stranded RNA effector molecules in which a single
RNA strand with self-complementary sequences is capable of assuming
a double-stranded conformation, or duplex dsRNA effector molecules
comprising two separate strands of RNA. In various embodiments, the
dsRNA consists entirely of ribonucleotides or consists of a mixture
of ribonucleotides and deoxynucleotides, such as the RNA/DNA
hybrids disclosed, for example, by WO 00/63364, filed Apr. 19,
2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999. The dsRNA
or dsRNA effector molecule may be a single molecule with a region
of self-complementarity such that nucleotides in one segment of the
molecule base pair with nucleotides in another segment of the
molecule. In various embodiments, a dsRNA that consists of a single
molecule consists entirely of ribonucleotides or includes a region
of ribonucleotides that is complementary to a region of
deoxyribonucleotides. Alternatively, the dsRNA may include two
different strands that have a region of complementarity to each
other.
[0318] In various embodiments, both strands consist entirely of
ribonucleotides, one strand consists entirely of ribonucleotides
and one strand consists entirely of deoxyribonucleotides, or one or
both strands contain a mixture of ribonucleotides and
deoxyribonucleotides. In certain embodiments, the regions of
complementarity are at least 70, 80, 90, 95, 98, or 100%
complementary to each other and to a target nucleic acid sequence.
In certain embodiments, the region of the dsRNA that is present in
a double-stranded conformation includes at least 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 50, 75, 100, 200, 500, 1000, 2000
or 5000 nucleotides or includes all of the nucleotides in a cDNA or
other target nucleic acid sequence being represented in the dsRNA.
In some embodiments, the dsRNA does not contain any single stranded
regions, such as single stranded ends, or the dsRNA is a hairpin.
In other embodiments, the dsRNA has one or more single stranded
regions or overhangs. In certain embodiments, RNA/DNA hybrids
include a DNA strand or region that is an antisense strand or
region (e.g, has at least 70, 80, 90, 95, 98, or 100%
complementarity to a target nucleic acid) and an RNA strand or
region that is a sense strand or region (e.g, has at least 70, 80,
90, 95, 98, or 100% identity to a target nucleic acid), and vice
versa.
[0319] In various embodiments, the RNA/DNA hybrid is made in vitro
using enzymatic or chemical synthetic methods such as those
described herein or those described in WO 00/63364, filed Apr. 19,
2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999. In other
embodiments, a DNA strand synthesized in vitro is complexed with an
RNA strand made in vivo or in vitro before, after, or concurrent
with the transformation of the DNA strand into the cell. In yet
other embodiments, the dsRNA is a single circular nucleic acid
containing a sense and an antisense region, or the dsRNA includes a
circular nucleic acid and either a second circular nucleic acid or
a linear nucleic acid (see, for example, WO 00/63364, filed Apr.
19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.)
Exemplary circular nucleic acids include lariat structures in which
the free 5' phosphoryl group of a nucleotide becomes linked to the
2' hydroxyl group of another nucleotide in a loop back fashion.
[0320] In other embodiments, the dsRNA includes one or more
modified nucleotides in which the 2' position in the sugar contains
a halogen (such as fluorine group) or contains an alkoxy group
(such as a methoxy group) which increases the half-life of the
dsRNA in vitro or in vivo compared to the corresponding dsRNA in
which the corresponding 2' position contains a hydrogen or an
hydroxyl group. In yet other embodiments, the dsRNA includes one or
more linkages between adjacent nucleotides other than a
naturally-occurring phosphodiester linkage. Examples of such
linkages include phosphoramide, phosphorothioate, and
phosphorodithioate linkages. The dsRNAs may also be chemically
modified nucleic acid molecules as taught in U.S. Pat. No.
6,673,661. In other embodiments, the dsRNA contains one or two
capped strands, as disclosed, for example, by WO 00/63364, filed
Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21,
1999.
[0321] In other embodiments, the dsRNA can be any of the at least
partially dsRNA molecules disclosed in WO 00/63364, as well as any
of the dsRNA molecules described in U.S. Provisional Application
60/399,998; and U.S. Provisional Application 60/419,532, and
PCT/US2003/033466, the teaching of which is hereby incorporated by
reference. Any of the dsRNAs may be expressed in vitro or in vivo
using the methods described herein or standard methods, such as
those described in WO 00/63364.
[0322] Occupancy
[0323] In certain embodiments, antisense compounds are not expected
to result in cleavage or the target nucleic acid via RNase H or to
result in cleavage or sequestration through the RISC pathway. In
certain such embodiments, antisense activity may result from
occupancy, wherein the presence of the hybridized antisense
compound disrupts the activity of the target nucleic acid. In
certain such embodiments, the antisense compound may be uniformly
modified or may comprise a mix of modifications and/or modified and
unmodified nucleosides.
Target Nucleic Acids, Target Regions and Nucleotide Sequences
[0324] Nucleotide sequences that encode A1AT include, without
limitation, the following: GENBANK Accession No. NM_000295.4
(incorporated herein as SEQ ID NO: 1), the complement of GENBANK
Accession No. NT_026437.12 truncated from nucleosides 75840001 to
U.S. Pat. No. 75,860,000 (incorporated herein as SEQ ID NO: 2), a
variant sequence at the site of the PiZ mutation (incorporated
herein as SEQ ID NO: 3), GENBANK Accession No. NM_001002235.2
(incorporated herein as SEQ ID NO: 4), GENBANK Accession No.
NM_001002236.2 (incorporated herein as SEQ ID NO: 5), GENBANK
Accession No. NM_001127700.1 (incorporated herein at SEQ ID NO: 6),
GENBANK Accession No. NM_001127701.1 (incorporated herein as SEQ ID
NO: 7), GENBANK Accession No. NM_001127702.1 (incorporated herein
as SEQ ID NO: 8), GENBANK Accession No. NM_001127703.1
(incorporated herein as SEQ ID NO: 9), GENBANK Accession No.
NM_001127704.1 (incorporated herein as SEQ ID NO: 10), GENBANK
Accession No. NM_001127705.1 (incorporated herein as SEQ ID NO:
11), GENBANK Accession No. NM_001127706.1 (incorporated herein as
SEQ ID NO: 12), GENBANK Accession No. NM_001127707.1 (incorporated
herein as SEQ ID NO: 13), and GENBANK Accession No. NW_001121215.1
truncated from nucleotides 7483001 to U.S. Pat. No. 7,503,000
(incorporated herein as SEQ ID NO: 14).
[0325] It is understood that the sequence set forth in each SEQ ID
NO in the Examples contained herein is independent of any
modification to a sugar moiety, an internucleoside linkage, or a
nucleobase. As such, antisense compounds defined by a SEQ ID NO may
comprise, independently, one or more modifications to a sugar
moiety, an internucleoside linkage, or a nucleobase. Antisense
compounds described by Isis Number (Isis No) indicate a combination
of nucleobase sequence and motif.
[0326] In certain embodiments, a target region is a structurally
defined region of the target nucleic acid. For example, a target
region may encompass a 3' UTR, a 5' UTR, an exon, an intron, an
exon/intron junction, a coding region, a translation initiation
region, translation termination region, or other defined nucleic
acid region. The structurally defined regions for A1AT can be
obtained by accession number from sequence databases such as NCBI
and such information is incorporated herein by reference. In
certain embodiments, a target region may encompass the sequence
from a 5' target site of one target segment within the target
region to a 3' target site of another target segment within the
same target region.
[0327] Targeting includes determination of at least one target
segment to which an antisense compound hybridizes, such that a
desired effect occurs. In certain embodiments, the desired effect
is a reduction in mRNA target nucleic acid levels. In certain
embodiments, the desired effect is reduction of levels of protein
encoded by the target nucleic acid or a phenotypic change
associated with the target nucleic acid.
[0328] A target region may contain one or more target segments.
Multiple target segments within a target region may be overlapping.
Alternatively, they may be non-overlapping. In certain embodiments,
target segments within a target region are separated by no more
than about 300 nucleotides. In certain emodiments, target segments
within a target region are separated by a number of nucleotides
that is, is about, is no more than, is no more than about, 250,
200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 9, 8, 7, 6, 5,
4, 3, 2, or 1 nucleotides on the target nucleic acid, or is a range
defined by any two of the preceeding values. In certain
embodiments, target segments within a target region are separated
by no more than, or no more than about, 5 nucleotides on the target
nucleic acid. In certain embodiments, target segments are
contiguous. Contemplated are target regions defined by a range
having a starting nucleic acid that is any of the 5' target sites
or 3' target sites listed herein.
[0329] Suitable target segments may be found within a 5' UTR, a
coding region, a 3' UTR, an intron, an exon, or an exon/intron
junction. Target segments containing a start codon or a stop codon
are also suitable target segments. A suitable target segment may
specifically exclude a certain structurally defined region such as
the start codon or stop codon.
[0330] The determination of suitable target segments may include a
comparison of the sequence of a target nucleic acid to other
sequences throughout the genome. For example, the BLAST algorithm
may be used to identify regions of similarity amongst different
nucleic acids. This comparison can prevent the selection of
antisense compound sequences that may hybridize in a non-specific
manner to sequences other than a selected target nucleic acid
(i.e., non-target or off-target sequences).
[0331] There may be variation in activity (e.g., as defined by
percent reduction of target nucleic acid levels) of the antisense
compounds within an active target region. In certain embodiments,
reductions in A1AT mRNA levels are indicative of inhibition of A1AT
expression. Reductions in levels of an A1AT protein are also
indicative of inhibition of target mRNA expression. Further,
phenotypic changes are indicative of inhibition of A1AT expression.
For example, reduced or prevented A1AT protein aggregates can be
indicative of inhibition of A1AT expression. In another example,
prevented liver dysfunction can be indicative of inhibition of A1AT
expression. In another example, restored liver function can be
indicative of inhibition of A1AT expression. In another example,
prevented or reduced hepatic toxicity can be indicative of A 1AT
expression. In another example, prevented pulmonary dysfunction can
be indicative of inhibition of A1AT expression. In another example,
restored pulmonary function can be indicative of inhibition of A1AT
expression. In another example, prevented or reduced pulmonary
toxicity can be indicative of A1AT expression.
Hybridization
[0332] In some embodiments, hybridization occurs between an
antisense compound disclosed herein and an A1AT nucleic acid. The
most common mechanism of hybridization involves hydrogen bonding
(e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen
bonding) between complementary nucleobases of the nucleic acid
molecules.
[0333] Hybridization can occur under varying conditions. Stringent
conditions are sequence-dependent and are determined by the nature
and composition of the nucleic acid molecules to be hybridized.
[0334] Methods of determining whether a sequence is specifically
hybridizable to a target nucleic acid are well known in the art. In
certain embodiments, the antisense compounds provided herein are
specifically hybridizable with an A1AT nucleic acid.
Complementarity
[0335] An antisense compound and a target nucleic acid are
complementary to each other when a sufficient number of nucleobases
of the antisense compound can hydrogen bond with the corresponding
nucleobases of the target nucleic acid, such that a desired effect
will occur (e.g., antisense inhibition of a target nucleic acid,
such as an A1AT nucleic acid).
[0336] Non-complementary nucleobases between an antisense compound
and an A1AT nucleic acid may be tolerated provided that the
antisense compound remains able to specifically hybridize to a
target nucleic acid. Moreover, an antisense compound may hybridize
over one or more segments of an A1AT nucleic acid such that
intervening or adjacent segments are not involved in the
hybridization event (e.g., a loop structure, mismatch or hairpin
structure).
[0337] In certain embodiments, the antisense compounds provided
herein, or a specified portion thereof, are, or are at least, 70%,
80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99%, or 100% complementary to an A1AT nucleic acid, a
target region, target segment, or specified portion thereof.
Percent complementarity of an antisense compound with a target
nucleic acid can be determined using routine methods.
[0338] For example, an antisense compound in which 18 of 20
nucleobases of the antisense compound are complementary to a target
region, and would therefore specifically hybridize, would represent
90 percent complementarity. In this example, the remaining
noncomplementary nucleobases may be clustered or interspersed with
complementary nucleobases and need not be contiguous to each other
or to complementary nucleobases. As such, an antisense compound
which is 18 nucleobases in length having 4 (four) noncomplementary
nucleobases which are flanked by two regions of complete
complementarity with the target nucleic acid would have 77.8%
overall complementarity with the target nucleic acid and would thus
fall within the scope of the present invention. Percent
complementarity of an antisense compound with a region of a target
nucleic acid can be determined routinely using BLAST programs
(basic local alignment search tools) and PowerBLAST programs known
in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410;
Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology,
sequence identity or complementarity, can be determined by, for
example, the Gap program (Wisconsin Sequence Analysis Package,
Version 8 for Unix, Genetics Computer Group, University Research
Park, Madison Wis.), using default settings, which uses the
algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482
489).
[0339] In certain embodiments, the antisense compounds provided
herein, or specified portions thereof, are fully complementary
(i.e., 100% complementary) to a target nucleic acid, or specified
portion thereof. For example, an antisense compound may be fully
complementary to an A1AT nucleic acid, or a target region, or a
target segment or target sequence thereof. As used herein, "fully
complementary" means each nucleobase of an antisense compound is
capable of precise base pairing with the corresponding nucleobases
of a target nucleic acid. For example, a 20 nucleobase antisense
compound is fully complementary to a target sequence that is 400
nucleobases long, so long as there is a corresponding 20 nucleobase
portion of the target nucleic acid that is fully complementary to
the antisense compound. Fully complementary can also be used in
reference to a specified portion of the first and/or the second
nucleic acid. For example, a 20 nucleobase portion of a 30
nucleobase antisense compound can be "fully complementary" to a
target sequence that is 400 nucleobases long. The 20 nucleobase
portion of the 30 nucleobase oligonucleotide is fully complementary
to the target sequence if the target sequence has a corresponding
20 nucleobase portion wherein each nucleobase is complementary to
the 20 nucleobase portion of the antisense compound. At the same
time, the entire 30 nucleobase antisense compound may or may not be
fully complementary to the target sequence, depending on whether
the remaining 10 nucleobases of the antisense compound are also
complementary to the target sequence.
[0340] The location of a non-complementary nucleobase may be at the
5' end or 3' end of the antisense compound. Alternatively, the
non-complementary nucleobase or nucleobases may be at an internal
position of the antisense compound. When two or more
non-complementary nucleobases are present, they may be contiguous
(i.e., linked) or non-contiguous. In one embodiment, a
non-complementary nucleobase is located in the wing segment of a
gapmer antisense oligonucleotide.
[0341] In certain embodiments, antisense compounds that are, or are
up to 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length
comprise no more than 4, no more than 3, no more than 2, or no more
than 1 non-complementary nucleobase(s) relative to a target nucleic
acid, such as an A1AT nucleic acid, or specified portion
thereof.
[0342] In certain embodiments, antisense compounds that are, or are
up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, or 30 nucleobases in length comprise no more than 6, no
more than 5, no more than 4, no more than 3, no more than 2, or no
more than 1 non-complementary nucleobase(s) relative to a target
nucleic acid, such as an A1AT nucleic acid, or specified portion
thereof.
[0343] The antisense compounds provided herein also include those
which are complementary to a portion of a target nucleic acid. As
used herein, "portion" refers to a defined number of contiguous
(i.e. linked) nucleobases within a region or segment of a target
nucleic acid. A "portion" can also refer to a defined number of
contiguous nucleobases of an antisense compound. In certain
embodiments, the antisense compounds, are complementary to at least
an 8 nucleobase portion of a target segment. In certain
embodiments, the antisense compounds are complementary to at least
a 12 nucleobase portion of a target segment. In certain
embodiments, the antisense compounds are complementary to at least
a 15 nucleobase portion of a target segment. In certain
embodiments, the antisense compounds are complementary to at least
an 18 nucleobase portion of a target segment. Also contemplated are
antisense compounds that are complementary to at least a 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a
target segment, or a range defined by any two of these values.
Identity
[0344] The antisense compounds provided herein may also have a
defined percent identity to a particular nucleotide sequence, SEQ
ID NO, or compound represented by a specific Isis number, or
portion thereof. As used herein, an antisense compound is identical
to the sequence disclosed herein if it has the same nucleobase
pairing ability. For example, a RNA which contains uracil in place
of thymidine in a disclosed DNA sequence would be considered
identical to the DNA sequence since both uracil and thymidine pair
with adenine. Shortened and lengthened versions of the antisense
compounds described herein as well as compounds having
non-identical bases relative to the antisense compounds provided
herein also are contemplated. The non-identical bases may be
adjacent to each other or dispersed throughout the antisense
compound. Percent identity of an antisense compound is calculated
according to the number of bases that have identical base pairing
relative to the sequence to which it is being compared.
[0345] In certain embodiments, the antisense compounds, or portions
thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%,
99% or 100% identical to one or more of the antisense compounds or
SEQ ID NOs, or a portion thereof, disclosed herein.
[0346] In certain embodiments, a portion of the antisense compound
is compared to an equal length portion of the target nucleic acid.
In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to
an equal length portion of the target nucleic acid.
[0347] In certain embodiments, a portion of the antisense
oligonucleotide is compared to an equal length portion of the
target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase
portion is compared to an equal length portion of the target
nucleic acid.
Modifications
[0348] A nucleoside is a base-sugar combination. The nucleobase
(also known as base) portion of the nucleoside is normally a
heterocyclic base moiety. Nucleotides are nucleosides that further
include a phosphate group covalently linked to the sugar portion of
the nucleoside. For those nucleosides that include a pentofuranosyl
sugar, the phosphate group can be linked to the 2', 3' or 5'
hydroxyl moiety of the sugar. Oligonucleotides are formed through
the covalent linkage of adjacent nucleosides to one another, to
form a linear polymeric oligonucleotide. Within the oligonucleotide
structure, the phosphate groups are commonly referred to as forming
the internucleoside linkages of the oligonucleotide.
[0349] Modifications to antisense compounds encompass substitutions
or changes to internucleoside linkages, sugar moieties, or
nucleobases. Modified antisense compounds are often preferred over
native forms because of desirable properties such as, for example,
enhanced cellular uptake, enhanced affinity for nucleic acid
target, increased stability in the presence of nucleases, or
increased inhibitory activity.
[0350] Chemically modified nucleosides may also be employed to
increase the binding affinity of a shortened or truncated antisense
oligonucleotide for its target nucleic acid. Consequently,
comparable results can often be obtained with shorter antisense
compounds that have such chemically modified nucleosides.
Modified Internucleoside Linkages
[0351] The naturally occurring internucleoside linkage of RNA and
DNA is a 3' to 5' phosphodiester linkage. Antisense compounds
having one or more modified, i.e. non-naturally occurring,
internucleoside linkages are often selected over antisense
compounds having naturally occurring internucleoside linkages
because of desirable properties such as, for example, enhanced
cellular uptake, enhanced affinity for target nucleic acids, and
increased stability in the presence of nucleases.
[0352] Oligonucleotides having modified internucleoside linkages
include internucleoside linkages that retain a phosphorus atom as
well as internucleoside linkages that do not have a phosphorus
atom. Representative phosphorus containing internucleoside linkages
include, but are not limited to, phosphodiesters, phosphotriesters,
methylphosphonates, phosphoramidate, and phosphorothioates. Methods
of preparation of phosphorous-containing and
non-phosphorous-containing linkages are well known.
[0353] In certain embodiments, antisense compounds targeted to an
A1AT nucleic acid comprise one or more modified internucleoside
linkages. In certain embodiments, the modified internucleoside
linkages are phosphorothioate linkages. In certain embodiments,
each internucleoside linkage of an antisense compound is a
phosphorothioate internucleoside linkage.
Modified Sugar Moieties
[0354] Antisense compounds can optionally contain one or more
nucleosides wherein the sugar group has been modified. Such sugar
modified nucleosides may impart enhanced nuclease stability,
increased binding affinity, or some other beneficial biological
property to the antisense compounds. In certain embodiments,
nucleosides comprise chemically modified ribofuranose ring
moieties. Examples of chemically modified ribofuranose rings
include without limitation, addition of substitutent groups
(including 5' and 2' substituent groups, bridging of non-geminal
ring atoms to form bicyclic nucleic acids (BNA), replacement of the
ribosyl ring oxygen atom with S, N(R), or C(R.sub.1)(R.sub.2) (R,
R.sub.1 and R.sub.2 are each independently H, C.sub.1-C.sub.12
alkyl or a protecting group) and combinations thereof. Examples of
chemically modified sugars include 2'-F-5'-methyl substituted
nucleoside (see PCT International Application WO 2008/101157
Published on Aug. 21, 2008 for other disclosed 5',2'-bis
substituted nucleosides) or replacement of the ribosyl ring oxygen
atom with S with further substitution at the 2'-position (see
published U.S. Patent Application US2005-0130923, published on Jun.
16, 2005) or alternatively 5'-substitution of a BNA (see PCT
International Application WO 2007/134181 Published on Nov. 22, 2007
wherein LNA is substituted with for example a 5'-methyl or a
5'-vinyl group).
[0355] Examples of nucleosides having modified sugar moieties
include without limitation nucleosides comprising 5'-vinyl,
5'-methyl (R or S), 4'-S, 2'-F, 2'--OCH.sub.3,
2'--OCH.sub.2CH.sub.3, 2'--OCH.sub.2CH.sub.2F and
2'-O(CH.sub.2).sub.2OCH.sub.3 substituent groups. The substituent
at the 2' position can also be selected from allyl, amino, azido,
thio, 0-allyl, O--C.sub.1-C.sub.10 alkyl, OCF.sub.3, OCH.sub.2F,
O(CH.sub.2).sub.2SCH.sub.3,
O(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n),
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), and
O--CH.sub.2--C(.dbd.O)--N(R.sub.1)--(CH.sub.2).sub.2--N(R.sub.m)(R.sub.n)-
, where each R.sub.l, R.sub.m and R.sub.n is, independently, H or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0356] As used herein, "bicyclic nucleosides" refer to modified
nucleosides comprising a bicyclic sugar moiety. Examples of
bicyclic nucleosides include without limitation nucleosides
comprising a bridge between the 4' and the 2' ribosyl ring atoms.
In certain embodiments, antisense compounds provided herein include
one or more bicyclic nucleosides comprising a 4' to 2' bridge.
Examples of such 4' to 2' bridged bicyclic nucleosides, include but
are not limited to one of the formulae: 4'-(CH.sub.2)--O-2' (LNA);
4'-(CH.sub.2)--S-2'; 4'--(CH.sub.2).sub.2--O-2' (ENA);
4'-CH(CH.sub.3)--O-2' (also referred to as constrained ethyl or
cEt) and 4'-CH(CH.sub.2OCH.sub.3)--O-2' (and analogs thereof see
U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008);
4'-C(CH.sub.3)(CH.sub.3)--O-2' (and analogs thereof see published
International Application WO/2009/006478, published Jan. 8, 2009);
4'-CH.sub.2--N(OCH.sub.3)-2' (and analogs thereof see published
International Application WO/2008/150729, published Dec. 11, 2008);
4'-CH.sub.2--O--N(CH.sub.3)-2' (see published U.S. Patent
Application US2004-0171570, published Sep. 2, 2004);
4'-CH.sub.2--N(R)--O-2', wherein R is H, C.sub.1-C.sub.12 alkyl, or
a protecting group (see U.S. Pat. No. 7,427,672, issued on Sep. 23,
2008); 4'-CH.sub.2--C(H)(CH.sub.3)-2' (see Chattopadhyaya et al.,
J. Org. Chem., 2009, 74, 118-134); and
4'-CH.sub.2--C(.dbd.CH.sub.2)-2' (and analogs thereof see published
International Application WO 2008/154401, published on Dec. 8,
2008).
[0357] Further reports related to bicyclic nucleosides can also be
found in published literature (see for example: Singh et al., Chem.
Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54,
3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000,
97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8,
2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039;
Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379;
Elayadi et al., Curr. Opinion Invest. Drugs. 2001, 2, 558-561;
Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr.
Opinion Mol. Ther., 2001, 3, 239-243; U.S. Pat. Nos. 6,268,490;
6,525,191; 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207;
7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication No.
US2008-0039618; US2009-0012281; U.S. Patent Ser. Nos. 60/989,574;
61/026,995; 61/026,998; 61/056,564; 61/086,231; 61/097,787; and
61/099,844; Published PCT International applications WO
1994/014226; WO 2004/106356; WO 2005/021570; WO 2007/134181; WO
2008/150729; WO 2008/154401; and WO 2009/006478. Each of the
foregoing bicyclic nucleosides can be prepared having one or more
stereochemical sugar configurations including for example
.alpha.-L-ribofuranose and D-D-ribofuranose (see PCT international
application PCT/DK98/00393, published on Mar. 25, 1999 as WO
99/14226).
[0358] In certain embodiments, bicyclic sugar moieties of BNA
nucleosides include, but are not limited to, compounds having at
least one bridge between the 4' and the 2' position of the
pentofuranosyl sugar moiety wherein such bridges independently
comprises 1 or from 2 to 4 linked groups independently selected
from --[C(R.sub.a)(R.sub.b)]--, --C(R.sub.a).dbd.C(R.sub.b)--,
--C(R.sub.a).dbd.N--, --C(.dbd.O)--, --C(.dbd.NR)--, --C(.dbd.S)--,
--O--, --Si(R.sub.a).sub.2--, --S(.dbd.O).sub.x--, and
--N(R.sub.a)--; wherein: [0359] x is 0, 1, or 2; [0360] n is 1, 2,
3, or 4; [0361] each R.sub.a and R.sub.b is, independently, H, a
protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle
radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7
alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical,
halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ, N.sub.3, COOJ.sub.1, acyl
(C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
[0362] each J.sub.1 and J.sub.2 is, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group.
[0363] In certain embodiments, the bridge of a bicyclic sugar
moiety is --[C(R.sub.a)(R.sub.b)].sub.n--,
--[C(R.sub.a)(R.sub.b)].sub.n--O--, --C(R.sub.a)--N(R.sub.b)--O--
or --C(R.sub.aR.sub.b)--O--N(R)--. In certain embodiments, the
bridge is 4'-CH.sub.2-2', 4'--(CH.sub.2).sub.2-2',
4'--(CH.sub.2).sub.3-2', 4'--CH.sub.2--O-2',
4'--(CH.sub.2).sub.2--O-2', 4'--CH.sub.2--O--N(R)-2' and
4'-CH.sub.2--N(R)--O-2'- wherein each R is, independently, H, a
protecting group or C.sub.1-C.sub.12 alkyl.
[0364] In certain embodiments, bicyclic nucleosides are further
defined by isomeric configuration. For example, a nucleoside
comprising a 4'-2' methylene-oxy bridge, may be in the .alpha.-L
configuration or in the .beta.-D configuration. Previously,
.alpha.-L-methyleneoxy (4'-CH.sub.2--O-2') BNA's have been
incorporated into antisense oligonucleotides that showed antisense
activity (Frieden et al., Nucleic Acids Research. 2003, 21,
6365-6372).
[0365] In certain embodiments, bicyclic nucleosides include, but
are not limited to, (A) .alpha.-L-methyleneoxy (4'-CH.sub.2--O-2')
BNA, (B) .beta.-D-methyleneoxy (4'-CH.sub.2--O-2') BNA, (C)
ethyleneoxy (4'-(CH.sub.2).sub.2--O-2') BNA, (D) aminooxy
(4'-CH.sub.2--O--N(R)-2') BNA, (E) oxyamino
(4'-CH.sub.2--N(R)--O-2') BNA, and (F) methyl(methyleneoxy)
(4'-CH(CH.sub.3)--O-2') BNA, (G) methylene-thio (4'-CH.sub.2--S-2')
BNA, (H) methylene-amino (4'-CH.sub.2--N(R)-2') BNA, (I) methyl
carbocyclic (4'-CH.sub.2--CH(CH.sub.3)-2') BNA, (J) propylene
carbocyclic (4'-(CH.sub.2).sub.3-2') BNA and (K) vinyl BNA as
depicted below:
##STR00007## ##STR00008## [0366] wherein Bx is the base moiety and
R is independently H, a protecting group, C.sub.1-C.sub.12 alkyl or
C.sub.1-C.sub.12 alkoxy.
[0367] In certain embodiments, bicyclic nucleosides are provided
having Formula I:
##STR00009##
wherein: [0368] Bx is a heterocyclic base moiety; [0369]
Q.sub.n-Q.sub.b-Q.sub.c- is --CH.sub.2--N(R.sub.c)--CH.sub.2--,
--C(.dbd.O)--N(R.sub.c)--CH.sub.2--, --CH.sub.2--O--N(R.sub.c)--,
--CH.sub.2--N(R.sub.c)--O-- or --N(R.sub.c)--O--CH.sub.2; [0370]
R.sub.c is C.sub.1-C.sub.12 alkyl or an amino protecting group; and
[0371] T.sub.a and T.sub.b are each, independently H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety or a covalent attachment to a support medium.
[0372] In certain embodiments, bicyclic nucleosides are provided
having Formula II:
##STR00010##
wherein: [0373] Bx is a heterocyclic base moiety; [0374] T.sub.a
and T.sub.b are each, independently H, a hydroxyl protecting group,
a conjugate group, a reactive phosphorus group, a phosphorus moiety
or a covalent attachment to a support medium; [0375] Z.sub.a is
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6
alkynyl, substituted C.sub.1-C.sub.6 alkyl, substituted
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkynyl, acyl,
substituted acyl, substituted amide, thiol or substituted thio.
[0376] In one embodiment, each of the substituted groups is,
independently, mono or poly substituted with substituent groups
independently selected from halogen, oxo, hydroxyl, OJ.sub.c,
NJ.sub.cJ.sub.d, SJ.sub.c, N.sub.3, OC(.dbd.X)J.sub.c, and
NJ.sub.eC(.dbd.X)NJ.sub.cJ.sub.d, wherein each J.sub.c, J.sub.d and
J.sub.e is, independently, H, C.sub.1-C.sub.6 alkyl, or substituted
C.sub.1-C.sub.6 alkyl and X is O or NJ.sub.c.
[0377] In certain embodiments, bicyclic nucleosides are provided
having Formula III:
##STR00011##
wherein: [0378] Bx is a heterocyclic base moiety; [0379] T.sub.a
and T.sub.b are each, independently H, a hydroxyl protecting group,
a conjugate group, a reactive phosphorus group, a phosphorus moiety
or a covalent attachment to a support medium; [0380] Z.sub.b is
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6
alkynyl, substituted C.sub.1-C.sub.6 alkyl, substituted
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkynyl or
substituted acyl (C(.dbd.O)--).
[0381] In certain embodiments, bicyclic nucleosides are provided
having Formula IV:
##STR00012##
wherein: [0382] Bx is a heterocyclic base moiety; [0383] T.sub.a
and T.sub.b are each, independently H, a hydroxyl protecting group,
a conjugate group, a reactive phosphorus group, a phosphorus moiety
or a covalent attachment to a support medium; [0384] R.sub.d is
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl;
[0385] each q.sub.a, q.sub.b, q.sub.c and q.sub.d is,
independently, H, halogen, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted
C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxyl, substituted
C.sub.1-C.sub.6 alkoxyl, acyl, substituted acyl, C.sub.1-C.sub.6
aminoalkyl or substituted C.sub.1-C.sub.6 aminoalkyl;
[0386] In certain embodiments, bicyclic nucleosides are provided
having Formula V:
##STR00013##
wherein: [0387] Bx is a heterocyclic base moiety; [0388] T.sub.a
and T.sub.b are each, independently H, a hydroxyl protecting group,
a conjugate group, a reactive phosphorus group, a phosphorus moiety
or a covalent attachment to a support medium; [0389] q.sub.a,
q.sub.b, q.sub.e and q.sub.f are each, independently, hydrogen,
halogen, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12
alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12
alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12
alkynyl, C.sub.1-C.sub.12 alkoxy, substituted C.sub.1-C.sub.12
alkoxy, OJ.sub.j, SJ.sub.j, SOJ.sub.j, SO.sub.2J.sub.j,
NJ.sub.jJ.sub.k, N.sub.3, CN, C(.dbd.O)OJ.sub.j,
C(.dbd.O)NJ.sub.jJ.sub.k, C(.dbd.O)J.sub.j,
O--C(.dbd.O)NJ.sub.jJ.sub.k, N(H)C(.dbd.NH)NJ.sub.jJ.sub.k,
N(H)C(.dbd.O)NJ.sub.jJ.sub.k or N(H)C(.dbd.S)NJ.sub.jJ.sub.k;
[0390] or q.sub.e and q.sub.f together are
.dbd.C(q.sub.g)(q.sub.h); [0391] q.sub.g and q.sub.f are each,
independently, H, halogen, C.sub.1-C.sub.12 alkyl or substituted
C.sub.1-C.sub.12 alkyl.
[0392] The synthesis and preparation of the methyleneoxy
(4'-CH.sub.2--O-2') BNA monomers adenine, cytosine, guanine,
5-methyl-cytosine, thymine and uracil, along with their
oligomerization, and nucleic acid recognition properties have been
described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs
and preparation thereof are also described in WO 98/39352 and WO
99/14226.
[0393] Analogs of methyleneoxy (4'-CH.sub.2--O-2') BNA and
2'-thio-BNAs, have also been prepared (Kumar et al., Bioorg. Med.
Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside
analogs comprising oligodeoxyribonucleotide duplexes as substrates
for nucleic acid polymerases has also been described (Wengel et
al., WO 99/14226). Furthermore, synthesis of 2'-amino-BNA, a novel
comformationally restricted high-affinity oligonucleotide analog
has been described in the art (Singh et al., J. Org. Chem., 1998,
63, 10035-10039). In addition, 2'-amino- and 2'-methylamino-BNA's
have been prepared and the thermal stability of their duplexes with
complementary RNA and DNA strands has been previously reported.
[0394] In certain embodiments, bicyclic nucleosides are provided
having Formula VI:
##STR00014##
wherein: [0395] Bx is a heterocyclic base moiety; [0396] T.sub.a
and T.sub.b are each, independently H, a hydroxyl protecting group,
a conjugate group, a reactive phosphorus group, a phosphorus moiety
or a covalent attachment to a support medium; [0397] each q.sub.i,
q.sub.j, q.sub.k and q.sub.l is, independently, H, halogen,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.1-C.sub.12 alkoxyl, substituted C.sub.1-C.sub.12 alkoxyl,
OJ.sub.j, SJ.sub.j, SOJ.sub.j, SO.sub.2J.sub.j, NJ.sub.jJ.sub.k,
N.sub.3, CN, C(.dbd.O)OJ.sub.j, C(.dbd.O)NJ.sub.jJ.sub.k,
C(.dbd.O)J.sub.j, O--C(.dbd.O)NJ.sub.jJ.sub.k,
N(H)C(.dbd.NH)NJ.sub.jJ.sub.k, N(H)C(.dbd.O)NJ.sub.jJ.sub.k or
N(H)C(.dbd.S)NJ.sub.jJ.sub.k; and [0398] q.sub.i and q.sub.j or
q.sub.l and q.sub.k together are .dbd.C(q.sub.g)(q.sub.h), wherein
q.sub.g and q.sub.h are each, independently, H, halogen,
C.sub.1-C.sub.12 alkyl or substituted C.sub.1-C.sub.12 alkyl.
[0399] One carbocyclic bicyclic nucleoside having a
4'-(CH.sub.2).sub.3-2' bridge and the alkenyl analog bridge
4'-CH.dbd.CH--CH.sub.2-2' have been described (Freier et al.,
Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al.,
J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation
of carbocyclic bicyclic nucleosides along with their
oligomerization and biochemical studies have also been described
(Srivastava et al., J. Am. Chem. Soc., 2007, 129(26),
8362-8379).
[0400] As used herein, "4'-2' bicyclic nucleoside" or "4' to 2'
bicyclic nucleoside" refers to a bicyclic nucleoside comprising a
furanose ring comprising a bridge connecting two carbon atoms of
the furanose ring connects the 2' carbon atom and the 4' carbon
atom of the sugar ring.
[0401] As used herein, "monocylic nucleosides" refer to nucleosides
comprising modified sugar moieties that are not bicyclic sugar
moieties. In certain embodiments, the sugar moiety, or sugar moiety
analogue, of a nucleoside may be modified or substituted at any
position.
[0402] As used herein, "2'-modified sugar" means a furanosyl sugar
modified at the 2' position. In certain embodiments, such
modifications include substituents selected from: a halide,
including, but not limited to substituted and unsubstituted alkoxy,
substituted and unsubstituted thioalkyl, substituted and
unsubstituted amino alkyl, substituted and unsubstituted alkyl,
substituted and unsubstituted allyl, and substituted and
unsubstituted alkynyl. In certain embodiments, 2' modifications are
selected from substituents including, but not limited to:
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nNH.sub.2,
O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nF,
O(CH.sub.2).sub.nONH.sub.2, OCH.sub.2C(.dbd.O)N(H)CH.sub.3, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3].sub.2, where n and m
are from 1 to about 10. Other 2'-substituent groups can also be
selected from: C.sub.1-C.sub.12 alkyl, substituted alkyl, alkenyl,
alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3,
OCN, Cl, Br, CN, F, CF.sub.3, OCF.sub.3, SOCH.sub.3,
SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, an RNA cleaving group, a
reporter group, an intercalator, a group for improving
pharmacokinetic properties, or a group for improving the
pharmacodynamic properties of an antisense compound, and other
substituents having similar properties. In certain embodiments,
modified nucleosides comprise a 2'-MOE side chain (Baker et al., J.
Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE substitution have
been described as having improved binding affinity compared to
unmodified nucleosides and to other modified nucleosides, such as
2'-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having
the 2'-MOE substituent also have been shown to be antisense
inhibitors of gene expression with promising features for in vivo
use (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al.,
Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans.,
1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides,
1997, 16, 917-926).
[0403] As used herein, a "modified tetrahydropyran nucleoside" or
"modified THP nucleoside" means a nucleoside having a six-membered
tetrahydropyran "sugar" substituted in for the pentofuranosyl
residue in normal nucleosides (a sugar surrogate). Modified THP
nucleosides include, but are not limited to, what is referred to in
the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA),
manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002.
10, 841-854) or fluoro HNA (F-HNA) having a tetrahydropyran ring
system as illustrated below:
##STR00015##
[0404] In certain embodiments, sugar surrogates are selected having
Formula VII:
##STR00016##
wherein independently for each of said at least one tetrahydropyran
nucleoside analog of Formula VII: [0405] Bx is a heterocyclic base
moiety; [0406] T.sub.a and T.sub.b are each, independently, an
internucleoside linking group linking the tetrahydropyran
nucleoside analog to the antisense compound or one of T.sub.a and
T.sub.b is an internucleoside linking group linking the
tetrahydropyran nucleoside analog to the antisense compound and the
other of T.sub.a and T.sub.b is H, a hydroxyl protecting group, a
linked conjugate group or a 5' or 3'-terminal group; [0407]
q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7
are each independently, H, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted
C.sub.2-C.sub.6 alkynyl; and each of R.sub.1 and R.sub.2 is
selected from hydrogen, hydroxyl, halogen, substituted or
unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3,
OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 and CN, wherein X is O, S or
NJ.sub.1 and each J.sub.1, J.sub.2 and J.sub.3 is, independently, H
or C.sub.1-C.sub.6 alkyl.
[0408] In certain embodiments, the modified THP nucleosides of
Formula VII are provided wherein q.sub.1, q.sub.2, q.sub.3,
q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain
embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4,
q.sub.5, q.sub.6 and q.sub.7 is other than H.
[0409] In certain embodiments, at least one of q.sub.1, q.sub.2,
q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In
certain embodiments, THP nucleosides of Formula VII are provided
wherein one of R.sub.1 and R.sub.2 is fluoro. In certain
embodiments, R.sub.1 is fluoro and R.sub.2 is H; R.sub.1 is methoxy
and R.sub.2 is H, and R.sub.1 is methoxyethoxy and R.sub.2 is
H.
[0410] In certain embodiments, sugar surrogates comprise rings
having more than 5 atoms and more than one heteroatom. For example
nucleosides comprising morpholino sugar moieties and their use in
oligomeric compounds has been reported (see for example: Braasch et
al., Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos.
5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used here, the
term "morpholino" means a sugar surrogate having the following
formula:
##STR00017##
In certain embodiments, morpholinos may be modified, for example by
adding or altering various substituent groups from the above
morpholino structure. Such sugar surrogates are referred to herein
as "modified morpholinos."
[0411] Combinations of modifications are also provided without
limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT
International Application WO 2008/101157 published on Aug. 21, 2008
for other disclosed 5', 2'-bis substituted nucleosides) and
replacement of the ribosyl ring oxygen atom with S and further
substitution at the 2'-position (see published U.S. Patent
Application US2005-0130923, published on Jun. 16, 2005) or
alternatively 5'-substitution of a bicyclic nucleic acid (see PCT
International Application WO 2007/134181, published on Nov. 22,
2007 wherein a 4'-CH.sub.2--O-2' bicyclic nucleoside is further
substituted at the 5' position with a 5'-methyl or a 5'-vinyl
group). The synthesis and preparation of carbocyclic bicyclic
nucleosides along with their oligomerization and biochemical
studies have also been described (see, e.g., Srivastava et al., J.
Am. Chem. Soc. 2007, 129(26), 8362-8379).
[0412] In certain embodiments, antisense compounds comprise one or
more modified cyclohexenyl nucleosides, which is a nucleoside
having a six-membered cyclohexenyl in place of the pentofuranosyl
residue in naturally occurring nucleosides. Modified cyclohexenyl
nucleosides include, but are not limited to those described in the
art (see for example commonly owned, published PCT Application WO
2010/036696, published on Apr. 10, 2010, Robeyns et al., J. Am.
Chem. Soc., 2008, 130(6), 1979-1984; Horvith et al., Tetrahedron
Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem.
Soc., 2007, 129(30), 9340-9348; Gu et al., Nucleosides, Nucleotides
& Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al.,
Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al.,
Acta Crystallographica, Section F: Structural Biology and
Crystallization Communications, 2005, F61(6), 585-586; Gu et al.,
Tetrahedron, 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides,
2003, 13(6), 479-489; Wang et al., J. Org. Chem., 2003, 68,
4499-4505; Verbeure et al., Nucleic Acids Research, 2001, 29(24),
4941-4947; Wang et al., J. Org. Chem., 2001, 66, 8478-82; Wang et
al., Nucleosides. Nucleotides & Nucleic Acids, 2001, 20(4-7),
785-788; Wang et al., J. Am. Chem., 2000, 122, 8595-8602; Published
PCT application, WO 06/047842; and Published PCT Application WO
01/049687; the text of each is incorporated by reference herein, in
their entirety). Certain modified cyclohexenyl nucleosides have
Formula X.
##STR00018## [0413] wherein independently for each of said at least
one cyclohexenyl nucleoside analog of Formula X: [0414] Bx is a
heterocyclic base moiety; [0415] T.sub.3 and T.sub.4 are each,
independently, an internucleoside linking group linking the
cyclohexenyl nucleoside analog to an antisense compound or one of
T.sub.3 and T.sub.4 is an internucleoside linking group linking the
tetrahydropyran nucleoside analog to an antisense compound and the
other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a
linked conjugate group, or a 5'- or 3'-terminal group; and [0416]
q.sub.1, q.sub.2, q.sub.3, q.sub.4 q.sub.5, q.sub.6, q.sub.7,
q.sub.8 and q.sub.9 are each, independently, H, C.sub.1-C.sub.6
alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl,
substituted C.sub.2-C.sub.6 alkynyl or other sugar substituent
group.
[0417] As used herein, "2'-modified" or "2'-substituted" refers to
a nucleoside comprising a sugar comprising a substituent at the 2'
position other than H or OH. 2'-modified nucleosides, include, but
are not limited to, bicyclic nucleosides wherein the bridge
connecting two carbon atoms of the sugar ring connects the 2'
carbon and another carbon of the sugar ring; and nucleosides with
non-bridging 2'substituents, such as allyl, amino, azido, thio,
O-allyl, O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'--O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), or
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.00 alkyl. 2'-modified nucleosides may further
comprise other modifications, for example at other positions of the
sugar and/or at the nucleobase.
[0418] As used herein, "2'-F" refers to a nucleoside comprising a
sugar comprising a fluoro group at the 2' position of the sugar
ring.
[0419] As used herein, "2'-OMe" or "2'--OCH.sub.3" or "2'-O-methyl"
each refers to a nucleoside comprising a sugar comprising an
--OCH.sub.3 group at the 2' position of the sugar ring.
[0420] As used herein, "MOE" or "2'-MOE" or
"2'--OCH.sub.2CH.sub.2OCH.sub.3" or "2'-O-methoxyethyl" each refers
to a nucleoside comprising a sugar comprising a
--OCH.sub.2CH.sub.2OCH.sub.3 group at the 2' position of the sugar
ring.
[0421] As used herein, "oligonucleotide" refers to a compound
comprising a plurality of linked nucleosides. In certain
embodiments, one or more of the plurality of nucleosides is
modified. In certain embodiments, an oligonucleotide comprises one
or more ribonucleosides (RNA) and/or deoxyribonucleosides
(DNA).
[0422] Many other bicyclo and tricyclo sugar surrogate ring systems
are also known in the art that can be used to modify nucleosides
for incorporation into antisense compounds (see for example review
article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854). Such ring
systems can undergo various additional substitutions to enhance
activity.
[0423] Methods for the preparations of modified sugars are well
known to those skilled in the art. Some representative U.S. patents
that teach the preparation of such modified sugars include without
limitation, U.S.: 4,981,957; 5,118,800; 5,319,080; 5,359,044;
5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811;
5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873;
5,646,265; 5,670,633; 5,700,920; 5,792,847 and 6,600,032 and
International Application PCT/US2005/019219, filed Jun. 2, 2005 and
published as WO 2005/121371 on Dec. 22, 2005, and each of which is
herein incorporated by reference in its entirety.
[0424] In nucleotides having modified sugar moieties, the
nucleobase moieties (natural, modified or a combination thereof)
are maintained for hybridization with an appropriate nucleic acid
target.
[0425] In certain embodiments, antisense compounds comprise one or
more nucleosides having modified sugar moieties. In certain
embodiments, the modified sugar moiety is 2'-MOE. In certain
embodiments, the 2'-MOE modified nucleosides are arranged in a
gapmer motif. In certain embodiments, the modified sugar moiety is
a bicyclic nucleoside having a (4'-CH(CH.sub.3)--O-2') bridging
group. In certain embodiments, the (4'-CH(CH.sub.3)--O-2') modified
nucleosides are arranged throughout the wings of a gapmer
motif.
Modified Nucleobases
[0426] Nucleobase (or base) modifications or substitutions are
structurally distinguishable from, yet functionally interchangeable
with, naturally occurring or synthetic unmodified nucleobases. Both
natural and modified nucleobases are capable of participating in
hydrogen bonding. Such nucleobase modifications can impart nuclease
stability, binding affinity or some other beneficial biological
property to antisense compounds. Modified nucleobases include
synthetic and natural nucleobases such as, for example,
5-methylcytosine (5-me-C). Certain nucleobase substitutions,
including 5-methylcytosine substitutions, are particularly useful
for increasing the binding affinity of an antisense compound for a
target nucleic acid. For example, 5-methylcytosine substitutions
have been shown to increase nucleic acid duplex stability by
0.6-1.2.degree. C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B.,
eds., Antisense Research and Applications, CRC Press, Boca Raton,
1993, pp. 276-278).
[0427] Additional modified nucleobases include 5-hydroxymethyl
cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and
other alkyl derivatives of adenine and guanine, 2-propyl and other
alkyl derivatives of adenine and guanine, 2-thiouracil,
2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine,
5-propynyl (--C.ident.C--CH3) uracil and cytosine and other alkynyl
derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine.
[0428] Heterocyclic base moieties can also include those in which
the purine or pyrimidine base is replaced with other heterocycles,
for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and
2-pyridone. Nucleobases that are particularly useful for increasing
the binding affinity of antisense compounds include 5-substituted
pyrimidines, 6-azapyrimidines and N--2, N--6 and 0-6 substituted
purines, including 2 aminopropyladenine, 5-propynyluracil and
5-propynylcytosine.
[0429] In certain embodiments, antisense compounds comprise one or
more modified nucleobases. In certain embodiments, shortened or
gap-widened antisense oligonucleotides comprise one or more
modified nucleobases. In certain embodiments, the modified
nucleobase is 5-methylcytosine. In certain embodiments, each
cytosine is a 5-methylcytosine.
Compositions and Methods for Formulating Pharmaceutical
Compositions
[0430] Antisense oligonucleotides may be admixed with
pharmaceutically acceptable active or inert substances for the
preparation of pharmaceutical compositions or formulations.
Compositions and methods for the formulation of pharmaceutical
compositions are dependent upon a number of criteria, including,
but not limited to, route of administration, extent of disease, or
dose to be administered.
[0431] An antisense compound targeted to an A1AT nucleic acid can
be utilized in pharmaceutical compositions by combining the
antisense compound with a suitable pharmaceutically acceptable
diluent or carrier. A pharmaceutically acceptable diluent includes
phosphate-buffered saline (PBS). PBS is a diluent suitable for use
in compositions to be delivered parenterally or by inhalation.
Accordingly, in one embodiment, employed in the methods described
herein is a pharmaceutical composition comprising an antisense
compound targeted to an A1AT nucleic acid and a pharmaceutically
acceptable diluent. In certain embodiments, the pharmaceutically
acceptable diluent is PBS. In certain embodiments, the antisense
compound is an antisense oligonucleotide.
[0432] Pharmaceutical compositions comprising antisense compounds
encompass any pharmaceutically acceptable salts, esters, or salts
of such esters, or any other oligonucleotide which, upon
administration to an animal, including a human, is capable of
providing (directly or indirectly) the biologically active
metabolite or residue thereof. Accordingly, for example, the
disclosure is also drawn to pharmaceutically acceptable salts of
antisense compounds, prodrugs, pharmaceutically acceptable salts of
such prodrugs, and other bioequivalents. Suitable pharmaceutically
acceptable salts include, but are not limited to, sodium and
potassium salts.
[0433] A prodrug can include the incorporation of additional
nucleosides at one or both ends of an antisense compound which are
cleaved by endogenous nucleases within the body, to form the active
antisense compound.
Conjugated Antisense Compounds
[0434] Antisense compounds may be covalently linked to one or more
moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the resulting antisense
oligonucleotides. Typical conjugate groups include cholesterol
moieties and lipid moieties. Additional conjugate groups include
carbohydrates, phospholipids, biotin, phenazine, folate,
phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines,
coumarins, and dyes.
[0435] Antisense compounds can also be modified to have one or more
stabilizing groups that are generally attached to one or both
termini of antisense compounds to enhance properties such as, for
example, nuclease stability. Included in stabilizing groups are cap
structures. These terminal modifications protect the antisense
compound having terminal nucleic acid from exonuclease degradation,
and can help in delivery and/or localization within a cell. The cap
can be present at the 5'-terminus (5'-cap), or at the 3'-terminus
(3'-cap), or can be present on both termini. Cap structures are
well known in the art and include, for example, inverted deoxy
abasic caps. Further 3' and 5'-stabilizing groups that can be used
to cap one or both ends of an antisense compound to impart nuclease
stability include those disclosed in WO 03/004602 published on Jan.
16, 2003.
[0436] In certain embodiments, antisense compounds, including, but
not limited to those particularly suited for use as ssRNA, are
modified by attachment of one or more conjugate groups. In general,
conjugate groups modify one or more properties of the attached
oligonucleotide, including but not limited to pharmacodynamics,
pharmacokinetics, stability, binding, absorption, cellular
distribution, cellular uptake, charge and clearance. Conjugate
groups are routinely used in the chemical arts and are linked
directly or via an optional conjugate linking moiety or conjugate
linking group to a parent compound such as an oligonucleotide.
Conjugate groups includes without limitation, intercalators,
reporter molecules, polyamines, polyamides, polyethylene glycols,
thioethers, polyethers, cholesterols, thiocholesterols, cholic acid
moieties, folate, lipids, phospholipids, biotin, phenazine,
phenanthridine, anthraquinone, adamantane, acridine, fluoresceins,
rhodamines, coumarins and dyes. Certain conjugate groups have been
described previously, for example: cholesterol moiety (Letsinger et
al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid
(Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a
thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y.
Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med.
Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et
al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain,
e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al.,
EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990,
259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0437] For additional conjugates including those useful for ssRNA
and their placement within antisense compounds, see e.g., U.S.
Application No. 61/583,963.
Cell Culture and Antisense Compounds Treatment
[0438] The effects of antisense compounds on the level, activity or
expression of A1AT nucleic acids can be tested in vitro in a
variety of cell types. Cell types used for such analyses are
available from commerical vendors (e.g. American Type Culture
Collection, Manassas, Va.; Zen-Bio, Inc., Research Triangle Park,
N.C.; Clonetics Corporation, Walkersville, Md.) and are cultured
according to the vendor's instructions using commercially available
reagents (e.g. Invitrogen Life Technologies, Carlsbad, Calif.).
Illustrative cell types include, but are not limited to, HepG2
cells, Hep3B cells, and transgenic mouse primary hepatocytes.
In Vitro Testing of Antisense Oligonucleotides
[0439] Described herein are methods for treatment of cells with
antisense oligonucleotides, which can be modified appropriately for
treatment with other antisense compounds.
[0440] In general, cells are treated with antisense
oligonucleotides when the cells reach approximately 60-80%
confluency in culture.
[0441] One reagent commonly used to introduce antisense
oligonucleotides into cultured cells includes the cationic lipid
transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, Calif.).
Antisense oligonucleotides are mixed with LIPOFECTIN in OPTI-MEM 1
(Invitrogen, Carlsbad, Calif.) to achieve the desired final
concentration of antisense oligonucleotide and a LIPOFECTIN
concentration that typically ranges 2 to 12 ug/mL per 100 nM
antisense oligonucleotide.
[0442] Another reagent used to introduce antisense oligonucleotides
into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad,
Calif.). Antisense oligonucleotide is mixed with LIPOFECTAMINE in
OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to
achieve the desired concentration of antisense oligonucleotide and
a LIPOFECTAMINE concentration that typically ranges 2 to 12 ug/mL
per 100 nM antisense oligonucleotide.
[0443] Another technique used to introduce antisense
oligonucleotides into cultured cells includes electroporation.
[0444] Cells are treated with antisense oligonucleotides by routine
methods. Cells are typically harvested 16-24 hours after antisense
oligonucleotide treatment, at which time RNA or protein levels of
target nucleic acids are measured by methods known in the art and
described herein. In general, when treatments are performed in
multiple replicates, the data are presented as the average of the
replicate treatments.
[0445] The concentration of antisense oligonucleotide used varies
from cell line to cell line. Methods to determine the optimal
antisense oligonucleotide concentration for a particular cell line
are well known in the art. Antisense oligonucleotides are typically
used at concentrations ranging from 1 nM to 300 nM when transfected
with LIPOFECTAMINE. Antisense oligonucleotides are used at higher
concentrations ranging from 625 to 20,000 nM when transfected using
electroporation.
RNA Isolation
[0446] RNA analysis can be performed on total cellular RNA or
poly(A)+ mRNA. Methods of RNA isolation are well known in the art.
RNA is prepared using methods well known in the art, for example,
using the TRIZOL Reagent (Invitrogen, Carlsbad, Calif.) according
to the manufacturer's recommended protocols.
Analysis of Inhibition of Target Levels or Expression
[0447] Inhibition of levels or expression of an A 1AT nucleic acid
can be assayed in a variety of ways known in the art. For example,
target nucleic acid levels can be quantitated by, e.g., Northern
blot analysis, competitive polymerase chain reaction (PCR), or
quantitaive real-time PCR. RNA analysis can be performed on total
cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well
known in the art. Northern blot analysis is also routine in the
art. Quantitative real-time PCR can be conveniently accomplished
using the commercially available ABI PRISM 7600, 7700, or 7900
Sequence Detection System, available from PE-Applied Biosystems,
Foster City, Calif. and used according to manufacturer's
instructions.
Quantitative Real-Time PCR Analysis of Target RNA Levels
[0448] Quantitation of target RNA levels may be accomplished by
quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900
Sequence Detection System (PE-Applied Biosystems, Foster City,
Calif.) according to manufacturer's instructions. Methods of
quantitative real-time PCR are well known in the art.
[0449] Prior to real-time PCR, the isolated RNA is subjected to a
reverse transcriptase (RT) reaction, which produces complementary
DNA (cDNA) that is then used as the substrate for the real-time PCR
amplification. The RT and real-time PCR reactions are performed
sequentially in the same sample well. RT and real-time PCR reagents
are obtained from Invitrogen (Carlsbad, Calif.). RT real-time-PCR
reactions are carried out by methods well known to those skilled in
the art.
[0450] Gene (or RNA) target quantities obtained by real time PCR
are normalized using either the expression level of a gene whose
expression is constant, such as cyclophilin A, or by quantifying
total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, Calif.).
Cyclophilin A expression is quantified by real time PCR, by being
run simultaneously with the target, multiplexing, or separately.
Total RNA is quantified using RIBOGREEN RNA quantification reagent
(Invetrogen, Inc. Eugene, Oreg.). Methods of RNA quantification by
RIBOGREEN are taught in Jones, L. J., et al, (Analytical
Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE
Applied Biosystems) is used to measure RIBOGREEN fluorescence.
[0451] Probes and primers are designed to hybridize to an A1AT
nucleic acid. Methods for designing real-time PCR probes and
primers are well known in the art, and may include the use of
software such as PRIMER EXPRESS Software (Applied Biosystems,
Foster City, Calif.).
Analysis of Protein Levels
[0452] Antisense inhibition of A1AT nucleic acids can be assessed
by measuring A1AT protein levels. Protein levels of A1AT can be
evaluated or quantitated in a variety of ways well known in the
art, such as immunoprecipitation, Western blot analysis
(immunoblotting), enzyme-linked immunosorbent assay (ELISA),
quantitative protein assays, protein activity assays (for example,
caspase activity assays), immunohistochemistry, immunocytochemistry
or fluorescence-activated cell sorting (FACS). Antibodies directed
to a target can be identified and obtained from a variety of
sources, such as the MSRS catalog of antibodies (Aerie Corporation,
Birmingham, Mich.), or can be prepared via conventional monoclonal
or polyclonal antibody generation methods well known in the art.
Antibodies useful for the detection of mouse, rat, monkey, and
human A1AT are commercially available.
In Vivo Testing of Antisense Compounds
[0453] Antisense compounds, for example, antisense
oligonucleotides, are tested in animals to assess their ability to
inhibit expression of A1AT and produce phenotypic changes, such as,
reduced or prevented A1AT protein aggregation, prevented liver
and/or pulmonary dysfunction, restored liver and/or pulmonary
function, prevented or reduced hepatic and/or pulmonary toxicity.
Such parameters may be indicative of A1AT expression. In certain
embodiments, A1ATD associated liver dysfunction or hepatic toxicity
is determined by measuring A1AT aggregates in liver tissue,
measuring transaminases (including ALT and AST), measuring
bilirubin, and serum albumin. In certain embodiments, A1ATD
associated pulmonary dysfunction or pulmonary toxicity is
determined by measuring ATAT aggregates in pulmonary tissue or by
spirometry to measure FEV.sub.1 and FVC. Testing may be performed
in normal animals, or in experimental disease models. For
administration to animals, antisense oligonucleotides are
formulated in a pharmaceutically acceptable diluent, such as
phosphate-buffered saline. Administration includes parenteral
routes of administration, such as intraperitoneal, intravenous, and
subcutaneous. Administration also includes pulmonary routes of
administration, such as nebulization, inhalation, and insufflation.
Calculation of antisense oligonucleotide dosage and dosing
frequency depends upon factors such as route of administration and
animal body weight. Following a period of treatment with antisense
oligonucleotides, RNA is isolated from liver tissue and/or
pulmonary tissue and changes in A1AT nucleic acid expression are
measured.
Certain Indications
[0454] In certain embodiments, provided herein are methods of
treating an individual comprising administering one or more
pharmaceutical compositions described herein. In certain
embodiments, the individual has a liver disease, such as A1ATD
associated liver disease. In certain embodiments, the individual is
at risk for developing A1ATD associated liver disease. This
includes individuals with a genetic predisposition to developing
A1ATD. In certain embodiments, the individual has been identified
as in need of therapy. Examples of such individuals include, but
are not limited to those having a mutation in the genetic code for
A1AT. In certain embodiments, provided herein are methods for
prophylactically reducing A1AT expression in an individual. Certain
embodiments include treating an individual in need thereof by
administering to an individual a therapeutically effective amount
of an antisense compound targeted to an A1AT nucleic acid.
[0455] In one embodiment, administration of a therapeutically
effective amount of an antisense compound targeted to an A1AT
nucleic acid is accompanied by monitoring of A1AT levels in the
individual, to determine an individual's response to administration
of the antisense compound. An individual's response to
administration of the antisense compound is used by a physician to
determine the amount and duration of therapeutic intervention.
[0456] In certain embodiments, administration of an antisense
compound targeted to an A1AT nucleic acid results in reduction of
A1AT expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60,
65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of
these values. In certain embodiments, administration of an
antisense compound targeted to an A1AT nucleic acid results in a
change in a measure of A1AT aggregates retained in the liver, liver
function, and hepatic toxicity. In certain embodiments,
administration of an A1AT antisense compound decreases the measure
by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80,
85, 90, 95 or 99%, or a range defined by any two of these values.
In some embodiments, administration of an A1AT antisense compound
increases the measure by at least 15, 20, 25, 30, 35, 40, 45, 50,
55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by
any two of these values.
[0457] In certain embodiments, pharmaceutical compositions
comprising an antisense compound targeted to A1AT are used for the
preparation of a medicament for treating a patient suffering or
susceptible to a liver disease, such as, A1ATD associated liver
disease.
Certain Combination Therapies
[0458] In certain embodiments, one or more pharmaceutical
compositions described herein are co-administered with one or more
other pharmaceutical agents. In certain embodiments, such one or
more other pharmaceutical agents are designed to treat the same
disease, disorder, or condition as the one or more pharmaceutical
compositions described herein. In certain embodiments, such one or
more other pharmaceutical agents are designed to treat a different
disease, disorder, or condition as the one or more pharmaceutical
compositions described herein. In certain embodiments, such one or
more other pharmaceutical agents are designed to treat an undesired
side effect of one or more pharmaceutical compositions described
herein. In certain embodiments, one or more pharmaceutical
compositions described herein are co-administered with another
pharmaceutical agent to treat an undesired effect of that other
pharmaceutical agent. In certain embodiments, one or more
pharmaceutical compositions described herein are co-administered
with another pharmaceutical agent to produce a combinational
effect. In certain embodiments, one or more pharmaceutical
compositions described herein are co-administered with another
pharmaceutical agent to produce a synergistic effect.
[0459] In certain embodiments, one or more pharmaceutical
compositions described herein and one or more other pharmaceutical
agents are administered at the same time. In certain embodiments,
one or more pharmaceutical compositions described herein and one or
more other pharmaceutical agents are administered at different
times. In certain embodiments, one or more pharmaceutical
compositions described herein and one or more other pharmaceutical
agents are prepared together in a single formulation. In certain
embodiments, one or more pharmaceutical compositions described
herein and one or more other pharmaceutical agents are prepared
separately.
[0460] In certain embodiments, pharmaceutical agents that may be
co-administered with a pharmaceutical composition described herein
include carbamazepine, A1AT replacement therapy, antiviral therapy,
lipid lowering therapy, steroids and COPD therapies. In certain
embodiments, antiviral therapy includes interferon alpha-2b,
interferon alpha-2a, and interferon alphacon-1 (pegylated and
unpegylated); ribavirin; penciclovir (Denavir); foscarnet
(Foscavir); Ascoxal; Acyclovir; Valacyclovir; Famciclovir; a viral
RNA replication inhibitor; a second antisense oligomer; a viral
therapeutic vaccine; a viral prophylactic vaccine; lamivudine
(3TC); entecavir (ETV); tenofovir diisoproxil fumarate (TDF);
telbivudine (LdT); adefovir; or an anti-virus antibody therapy
(monoclonal or polyclonal). In certain embodiments, lipid lowering
therapy includes, but is not limited to, bile salt sequestering
resins (e.g., cholestyramine, colestipol, and colesevelam
hydrochloride), cholesterol biosynthesis inhibitors, especially HMG
CoA reductase inhibitors (such as atorvastatin, pravastatin,
simvastatin, lovastatin, fluvastatin, cerivastatin, rosuvastatin,
and pitivastatin (itavastatin/risivastatin)), nicotinic acid,
fibric acid derivatives (e.g., clofibrate, gemfibrozil,
fenofibrate, bezafibrate, and ciprofibrate), probucol, neomycin,
dextrothyroxine, plant-stanol esters, cholesterol absorption
inhibitors (e.g., ezetimibe and pamaqueside), CETP inhibitors (e.g.
torcetrapib, and JTT-705) MTP inhibitors (e.g., implitapide),
squalene synthetase inhibitors, bile acid sequestrants such as
cholestyramine, inhibitors of bile acid transporters (apical
sodium-dependent bile acid transporters), regulators of hepatic
CYP7a, ACAT inhibitors (e.g. Avasimibe), estrogen replacement
therapeutics (e.g., tamoxigen), synthetic HDL (e.g. ETC-216),
anti-inflammatories (e.g., glucocorticoids) and antisense compounds
targeting cardiovascular targets (e.g., Apo B targeting compounds
and ApoC-III targeting compounds). In certain embodiments, COPD
therapies include, for example, anti-inflammation drugs;
bronchodilators, such as ipratropium (Atrovent), tiotropium
(Spiriva), salmeterol (Serevent), formoterol (Foradil), or
albuterol; or oxygen therapy. Anti-inflammatory drugs can include
steroids, NSAIDS (non-steroidal anti-inflammatory drugs), COX
inhibitors, montelukast (Singulair), roflimulast, antihistamines
and the like. In certain embodiments, the second agent can be an
asthma drug such as an anti-inflammatory drug, a bronchodilator
(e.g., beta-2 agonists (LABA2), theophylline, ipratropium), a
leukotriene modifier, Cromolyn, nedocromil, a decongestant and
immunotherapy. In certain embodiments, such co-administration is
for the treatment of liver disease. In certain embodiments, such
co-administration is for the treatment of pulmonary disease.
[0461] In certain embodiments, pharmaceutical agents that may be
co-administered with an A1AT specific inhibitor as described herein
include, but are not limited to, an additional A1AT inhibitor. In
certain embodiments, the co-adminstered pharmaceutical agent is
administered prior to administration of a pharmaceutical
composition described herein. In certain embodiments, the
co-administered pharmaceutical agent is administered following
administration of a pharmaceutical composition described herein. In
certain embodiments the co-administered pharmaceutical agent is
administered at the same time as a pharmaceutical composition
described herein. In certain embodiments the dose of a
co-administered pharmaceutical agent is the same as the dose that
would be administered if the co-administered pharmaceutical agent
was administered alone. In certain embodiments the dose of a
co-administered pharmaceutical agent is lower than the dose that
would be administered if the co-administered pharmaceutical agent
was administered alone. In certain embodiments the dose of a
co-administered pharmaceutical agent is greater than the dose that
would be administered if the co-administered pharmaceutical agent
was administered alone.
[0462] In certain embodiments, the co-administration of a second
compound enhances the effect of a first compound, such that
co-administration of the compounds results in an effect that is
greater than the effect of administering the first compound alone.
In other embodiments, the co-administration results in an effect
that is additive of the effects of the compounds when administered
alone. In certain embodiments, the co-administration results an
effect that is supra-additive of the effect of the compounds when
administered alone. In certain embodiments, the first compound is
an antisense compound. In certain embodiments, the second compound
is an antisense compound.
Certain Compounds
[0463] Approximately 700 modified antisense oligonucleotides were
tested for their effect on human A1AT mRNA in vitro in several cell
types. Of the approximately 700 modified antisense
oligonucleotides, twenty-three compounds were selected for further
in vitro studies based on in vitro activity to test their potency
in dose response studies in PiZ transgenic mice primary
hepatocytes, HepG2 cells, Hep3B cells. Of the twenty-three
compound, fifteen compounds were tested in CD1 mice and
Sprague-Dawley rats for tolerability, and in PiZ transgenic mice
for efficacy and tolerability. A final selection of seven compounds
was made for further study in cynomolgous monkeys based on systemic
tolerability and activity in the rodent studies. These seven
compounds were selected because they are highly tolerable and very
active in transgenic PiZ mice. The compounds are complementary to
the regions 1421-1440, 1561-1580, 1564-1583, 1565-1584, 1571-1590,
1575-1594, and 1577-1596 of SEQ ID NO: 1. In certain embodiments,
the compounds targeting the listed regions comprise a modified
oligonucleotide having some nucleobase portion of the sequence
recited in SEQ ID NOs: 23, 26, 29, 30, 34, 38, and 40. In certain
embodiments, the compounds targeting the listed regions or having a
nucleobase portion of a sequence recited in the listed SEQ ID NOs
can be various lengths and may have one of various motifs. In
certain embodiments, a compound targeting a region or having a
nucleobase portion of a sequence recited in the listed SEQ ID NOs
has the specific length and motif as indicated by the ISIS NOs:
487660, 487662, 496386, 496392, 496393, 496404, and 496407.
Compounds described above as being highly tolerable and active in
transgenic PiZ mice were tested in cynomologous monkeys to assess
tolerability in a primate.
[0464] In certain embodiments, the compounds as described herein
are efficacious by virtue of having at least one of an in vitro
IC.sub.50 of less than 10 .mu.M, less than 9 .mu.M, less than 8
.mu.M, less than 7 .mu.M, less than 6 .mu.M, less than 5 .mu.M,
less than 4 .mu.M, less than 3 .mu.M, less than 2 .mu.M, less than
1 .mu.M when delivered to a human cell line as described herein. In
certain embodiments, the compounds as described herein are highly
tolerable as demonstrated by having at least one of an increase an
ALT or AST value of no more than 4 fold, 3 fold, or 2 fold over
saline treated animals or an increase in liver, spleen or kidney
weight of no more than 30%, 20%, 15%, 12%, 10%, 5% or 2%.
EXAMPLES
Non-Limiting Disclosure and Incorporation by Reference
[0465] While certain compounds, compositions, and methods described
herein have been described with specificity in accordance with
certain embodiments, the following examples serve only to
illustrate the compounds described herein and are not intended to
limit the same. Each of the references recited in the present
application is incorporated herein by reference in its
entirety.
Example 1: Antisense Inhibition of Human Alpha-1 Antitrypsin in
HepG2 Cells
[0466] Antisense oligonucleotides were designed targeting a human
alpha-1 antitrypsin (A1AT) nucleic acid and were tested for their
effects on A1AT mRNA in vitro. Cultured human HepG2 cells at a
density of 20,000 cells per well were transfected using
electroporation with 4,500 nM antisense oligonucleotide. After a
treatment period of approximately 24 hours, RNA was isolated from
the cells and A1AT mRNA levels were measured by quantitative
real-time PCR using human primer probe set RTS3320 (forward
sequence GGAGATGCTGCCCAGAAGAC, designated herein as SEQ ID NO: 45;
reverse sequence GCTGGCGGTATAGGCTGAAG, designated herein as SEQ ID
NO: 46; probe sequence ATCAGGATCACCCAACCITCAACAAGATCA, designated
herein as SEQ ID NO: 47). A1AT mRNA levels were adjusted according
to total RNA content, as measured by RIBOGREEN.RTM.. Results are
presented as percent inhibition of A1AT, relative to untreated
control cells. Of the 695 oligonucleotides tested, only those
selected for further study are presented.
[0467] The modified antisense oligonucleotides in Table 1 were
designed as 5-10-5 MOE gapmers. The garners are 20 nucleosides in
length, wherein the central gap segment comprises ten
2'-deoxynucleosides and is flanked on both sides (in the 5' and 3'
directions) by wings comprising five nucleosides each. Each
nucleoside in the 5' wing segment and each nucleoside in the 3'
wing segment has a 2'MOE sugar modification. The internucleoside
linkages throughout each gapmer are phosphorothioate (P.dbd.S)
linkages. All cytosine residues throughout each gapmer are
5-methylcytosines. "Human Target start site" indicates the 5'-most
nucleoside to which the gapmer is targeted in the human gene
sequence. The gapmers of Table 1 are targeted to SEQ ID NO: 1
(GENBANK Accession No. NM_000295.4) and SEQ ID NO: 2 (the
complement of GENBANK Accession No. NT_026437.12 truncated from
nucleosides 75840001 to 75860000).
TABLE-US-00002 TABLE 1 Inhibition of human A1AT mRNA levels by
modified antisense oligonucleotides targeted to SEQ ID NOs: 1 and 2
Start Stop Start Stop Site on Site on Site on Site on % SEQ ID SEQ
ID SEQ ID SEQ ID ISIS inhi- SEQ NO: 1 NO: 1 NO: 2 NO: 2 Motif
Sequence No bition NO ID 459 478 10624 10643 5-10-5 TGGTGCTGTT
489009 36 20 GGACTGGTGT 464 483 10629 10648 5-10-5 GATATTGGTG
489010 30 21 CTGTTGGACT 494 513 10659 10678 5-10-5 GGCTGTAGCG
489013 61 22 ATGCTCACTG 1421 1440 15118 15137 5-10-5 GGGTTTGTTG
496393 38 23 AACTTGACCT 1479 1498 15176 15195 5-10-5 CCACTTTTCC
496346 51 24 CATGAAGAGG 1493 1512 15190 15209 5-10-5 TTGGGTGGGA
496360 42 25 TTCACCACTT 1561 1580 15258 15277 5-10-5 CTTTAATGTC
496404 90 26 ATCCAGGGAG 1562 1581 15259 15278 5-10-5 TCTTTAATGT
496405 86 27 CATCCAGGGA 1563 1582 15260 15279 5-10-5 TTCTTTAATG
496406 89 28 TCATCCAGGG 1564 1583 15261 15280 5-10-5 CTTCTTTAAT
496407 94 29 GTCATCCAGG 1565 1584 15262 15281 5-10-5 CCTTCTTTAA
496386 95 30 TGTCATCCAG 1566 1585 15263 15282 5-10-5 CCCTTCTTTA
496387 97 31 ATGTCATCCA 1567 1586 15264 15283 5-10-5 ACCCTTCTTT
496388 95 32 AATGTCATCC 1570 1589 15267 15286 5-10-5 TCAACCCTTC
496391 83 33 TTTAATGTCA 1571 1590 15268 15287 5-10-5 CTCAACCCTT
496392 74 34 CTTTAATGTC 1572 1591 15269 15288 5-10-5 GCTCAACCCT
487657 79 35 TCTTTAATGT 1573 1592 15270 15289 5-10-5 AGCTCAACCC
487658 77 36 TTCTTTAATG 1574 1593 15271 15290 5-10-5 CAGCTCAACC
487659 77 37 CTTCTTTAAT 1575 1594 15272 15291 5-10-5 CCAGCTCAAC
487660 87 38 CCTTCTTTAA 1576 1595 15273 15292 5-10-5 ACCAGCTCAA
487661 83 39 CCCTTCTTTA 1577 1596 15274 15293 5-10-5 GACCAGCTCA
487662 79 40 ACCCTTCTTT 1578 1597 15275 15294 5-10-5 GGACCAGCTC
474061 84 41 AACCCTTCTT
Example 2: Antisense Inhibition of Human Alpha-1 Antitrypsin in
Transgenic Mouse Primary Hepatocytes
[0468] Transgenic mouse primary hepatocytes are from PiZ mice,
originally generated by Sifers et al (Nucl. Acids Res. 15:
1459-1457, 1987) by introducing a 14.4 kb DNA fragment containing
the entire A1AT gene plus 2 kb of 5' and 3' flanking genomic DNA
sequences into the germ line. Primary hepatocytes were isolated
from the mice and cultured for in vitro screening.
[0469] Additional antisense oligonucleotides were designed
targeting a human alpha-1 antitrypsin (A1AT) nucleic acid and were
tested for their effects on A1AT mRNA in vitro. Antisense
oligonucleotides from the study described in Example 1 were also
included in the assay and are presented in Table 2. Cultured
transgenic mouse primary hepatocytes at a density of 10,000 cells
per well were transfected using Cytofectin reagent with 150 nM
antisense oligonucleotide. After a treatment period of
approximately 24 hours, RNA was isolated from the cells and A1AT
mRNA levels were measured by quantitative real-time PCR using human
primer probe set RTS3320. A1AT mRNA levels were adjusted according
to total RNA content, as measured by RIBOGREEN.RTM.. Results are
presented as percent inhibition of A1AT, relative to untreated
control cells. Of the 311 oligonucleotides tested, only those only
those selected for further study are presented.
[0470] The modified antisense oligonucleotides presented in Table 2
were designed as 5-10-5 MOE gapmers or 5-9-5 MOE gapmers. The
5-10-5 gapmer is 20 nucleosides in length, wherein the central gap
segment comprises often 2'-deoxynucleosides and is flanked on both
sides (in the 5' and 3' directions) by wings comprising five
nucleosides each. The 5-9-5 gapmer is 19 nucleosides in length,
wherein the central gap segment comprises nine 2'-deoxynucleosides
and is flanked on both sides (in the 5' and 3' directions) by wings
comprising five nucleosides each. Each nucleoside in the 5' wing
segment and each nucleoside in the 3' wing segment has a 2'MOE
sugar modification. The internucleoside linkages throughout the
gapmer are phosphorothioate (P.dbd.S) linkages. All cytosine
residues throughout the gapmer are 5-methylcytosines. "Human Target
start site" indicates the 5'-most nucleoside to which the gapmer is
targeted in the human gene sequence. The gapmers of Table 2 are
targeted to SEQ ID NO: 2 or a variant sequence, designated herein
as SEQ ID NO: 3.
TABLE-US-00003 TABLE 2 Inhibition of human A1AT mRNA levels by
modified antisense oligonucleotides targeted to SEQ ID NO: 2 Start
Stop Start Stop Site on Site on Site on Site on % SEQ ID SEQ ID SEQ
ID SEQ ID ISIS inhi- SEQ NO: 2 NO: 2 NO: 3 NO: 3 No Sequence Motif
bition NO ID 15275 15294 n/a n/a 474061 GGACCAGCTC AACCCTTCTT
5-10-5 96 41 15269 15288 n/a n/a 487657 GCTCAACCCT TCTTTAATGT
5-10-5 96 35 15270 15289 n/a n/a 487658 AGCTCAACCC TTCTTTAATG
5-10-5 95 36 15271 15290 n/a n/a 487659 CAGCTCAACC CTTCTTTAAT
5-10-5 96 37 15272 15291 n/a n/a 487660 CCAGCTCAAC CCTTCTTTAA
5-10-5 95 38 15273 15292 n/a n/a 487661 ACCAGCTCAA CCCTTCTTTA
5-10-5 95 39 15274 15293 n/a n/a 487662 GACCAGCTCA ACCCTTCTTT
5-10-5 95 40 10624 10643 n/a n/a 489009 TGGTGCTGTT GGACTGGTGT
5-10-5 93 20 10629 10648 n/a n/a 489010 GATATTGGTG CTGTTGGACT
5-10-5 90 21 10659 10678 n/a n/a 489013 GGCTGTAGCG ATGCTCACTG
5-10-5 94 22 15176 15195 n/a n/a 496346 CCACTTTTCC CATGAAGAGG
5-10-5 95 24 15190 15209 n/a n/a 496360 TTGGGTGGGA TTCACCACTT
5-10-5 96 25 15262 15281 n/a n/a 496386 CCTTCTTTAA TGTCATCCAG
5-10-5 97 30 15263 15282 n/a n/a 496387 CCCTTCTTTA ATGTCATCCA
5-10-5 97 31 15264 15283 n/a n/a 496388 ACCCTTCTTT AATGTCATCC
5-10-5 97 32 15267 15286 n/a n/a 496391 TCAACCCTTC TTTAATGTCA
5-10-5 96 33 15268 15287 n/a n/a 496392 CTCAACCCTT CTTTAATGTC
5-10-5 96 34 15118 15137 n/a n/a 496393 GGGTTTGTTG AACTTGACCT
5-10-5 96 23 15258 15277 n/a n/a 496404 CTTTAATGTC ATCCAGGGAG
5-10-5 99 26 15259 15278 n/a n/a 496405 TCTTTAATGT CATCCAGGGA
5-10-5 97 27 15260 15279 n/a n/a 496406 TTCTTTAATG TCATCCAGGG
5-10-5 98 28 15261 15280 n/a n/a 496407 CTTCTTTAAT GTCATCCAGG
5-10-5 98 29 n/a n/a 19 37 489112 GTCCCTTTCT TGTCGATGG 5-9-5 56
42
Example 3: Dose-Dependent Antisense Inhibition of Human A1AT in
Transgenic Mouse Primary Hepatocytes
[0471] Transgenic mouse primary hepatocytes are from PiZ mice,
originally generated by Sifers et al (Nucl. Acids Res. 15:
1459-1457, 1987) by introducing a 14.4 kb DNA fragment containing
the entire A1AT gene plus 2 kb of 5' and 3' flanking genomic DNA
sequences into the germ line. Primary hepatocytes were isolated
from the mice and cultured for in vitro screening.
[0472] Gapmers from Examples 1 and 2 exhibiting in vitro inhibition
of human A1AT were tested at various doses in transgenic mouse
primary hepatocytes. Cells were plated at a density of 10,000 cells
per well and transfected using Cytofectin reagent with 4.69 nM,
9.38 nM, 18.75 nM, 37.50 nM, 75.00 nM, and 150.00 nM concentrations
of antisense oligonucleotide, as specified in Table 3. After a
treatment period of approximately 16 hours, RNA was isolated from
the cells and A1AT mRNA levels were measured by quantitative
real-time PCR. Human A1AT primer probe set RTS3320 was used to
measure mRNA levels. A1AT mRNA levels were adjusted according to
total RNA content, as measured by RIBOGREEN.RTM.. Results are
presented as percent inhibition of A1AT, relative to untreated
control cells.
[0473] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 3. A1AT mRNA levels
were reduced in a dose-dependent manner in some of the antisense
oligonucleotide treated cells. `n.d.` indicates that the IC.sub.50
for that compound was not calculated.
TABLE-US-00004 TABLE 3 Dose-dependent antisense inhibition of human
A1AT in transgenic mouse primary hepatocytes ISIS 4.69 9.38 18.75
37.5 75.0 150.0 IC.sub.50 No nM nM nM nM nM nM (nM) 474061 3 11 15
36 56 86 54 487657 24 55 75 93 98 98 9 487658 23 42 59 89 95 97 12
487659 30 22 56 81 94 96 15 487660 23 39 70 85 96 98 12 487661 19
39 57 85 95 97 14 487662 22 27 49 85 92 95 17 489009 7 18 46 79 97
99 21 489010 25 24 46 79 96 99 17 489013 26 53 77 87 99 100 9
489112 2 11 11 0 18 43 n.d. 496346 1 29 53 85 95 99 19 496360 25 37
51 82 96 99 14 496386 19 26 57 83 95 99 16 496387 24 48 78 92 98 99
9 496388 12 23 57 78 96 99 18 496391 0 9 54 69 94 98 24 496392 2 27
47 79 96 98 20 496393 34 24 60 83 96 99 13 496404 17 39 51 78 96 98
16 496405 15 18 35 72 94 99 22 496406 14 25 60 88 98 99 16 496407
26 39 62 88 97 99 12
Example 4: Dose-Dependent Antisense Inhibition of Human A1AT in
HepG2 Cells
[0474] Gapmers from of the study described in Example 3 were also
tested at various doses in HepG2 cells. Cells were plated at a
density of 20,000 cells per well and transfected using
electroporation with 0.31 .mu.M, 0.63 .mu.M, 1.25 .mu.M, 2.50
.mu.M, 5.00 .mu.M, and 10.00 .mu.M concentrations of antisense
oligonucleotide, as specified in Table 4. After a treatment period
of approximately 16 hours, RNA was isolated from the cells and A1AT
mRNA levels were measured by quantitative real-time PCR. Human A1AT
primer probe set RTS3320 was used to measure mRNA levels. A1AT mRNA
levels were adjusted according to total RNA content, as measured by
RIBOGREEN.RTM.. Results are presented as percent inhibition of
A1AT, relative to untreated control cells.
[0475] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 4. A1AT mRNA levels
were reduced in a dose-dependent manner in some of the antisense
oligonucleotide treated cells. `n.d.` indicates that the IC.sub.50
for that compound was not calculated.
TABLE-US-00005 TABLE 4 Dose-dependent antisense inhibition of human
A1AT in HepG2 cells ISIS 0.31 0.63 1.25 2.50 5.00 10.00 IC.sub.50
No .mu.M .mu.M .mu.M .mu.M .mu.M .mu.M (.quadrature.M) 474061 25 21
18 12 22 39 n.d. 487657 37 25 58 71 82 90 1 487658 13 29 55 66 77
87 1.4 487659 12 27 38 60 79 84 1.8 487660 55 77 85 91 92 89
<0.3 487661 47 63 69 85 88 86 <0.3 487662 36 55 76 81 85 86
0.4 489009 0 9 14 31 51 64 5.4 489010 19 21 23 37 46 50 9.8 489013
16 8 50 55 73 82 2 489112 26 0 15 14 12 23 n.d. 496346 0 20 39 49
38 48 6.8 496360 10 12 19 54 60 66 3.5 496386 50 66 88 96 97 98
<0.3 496387 52 72 90 96 98 99 <0.3 496388 56 67 86 93 97 98
<0.3 496391 17 29 56 77 87 95 1.2 496392 10 32 58 77 91 94 1.2
496393 34 22 22 43 50 61 5.7 496404 22 60 82 90 95 97 0.5 496405 33
37 67 80 92 96 0.7 496406 40 57 80 90 95 98 0.4 496407 51 50 77 88
94 98 0.3
Example 5: Dose-Dependent Antisense Inhibition of Human A1AT in
Hep3B Cells
[0476] Gapmers selected from of the studies described in Examples 3
and 4 were also tested at various doses in Hep3B cells. Cells were
plated at a density of 20,000 cells per well and transfected using
electroporation with 0.31 .mu.M, 0.63 .mu.M, 1.25 .mu.M, 2.50
.mu.M, 5.00 .mu.M, and 10.00 .mu.M concentrations of antisense
oligonucleotide, as specified in Table 5. After a treatment period
of approximately 16 hours, RNA was isolated from the cells and A1AT
mRNA levels were measured by quantitative real-time PCR. Human A1AT
primer probe set RTS3320 was used to measure mRNA levels. A1AT mRNA
levels were adjusted according to total RNA content, as measured by
RIBOGREEN.RTM.. Results are presented as percent inhibition of
A1AT, relative to untreated control cells.
[0477] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 5. A1AT mRNA levels
were reduced in a dose-dependent manner in some of the antisense
oligonucleotide treated cells. `n.d.` indicates that the IC.sub.50
for that compound was not calculated.
TABLE-US-00006 TABLE 5 Dose-dependent antisense inhibition of human
A1AT in Hep3B cells ISIS 0.31 0.63 1.25 2.50 5.00 10.00 IC.sub.50
NO .mu.M .mu.M .mu.M .mu.M .mu.M .mu.M (.quadrature.M) 474061 0 12
52 69 89 93 2.0 487657 15 30 45 53 72 88 2.0 489009 9 9 10 8 32 56
n.d. 489010 0 0 11 9 36 40 n.d. 489013 50 25 39 51 55 65 n.d.
489112 0 0 0 0 2 8 n.d. 496346 0 16 31 23 45 49 n.d. 496360 0 15 10
32 38 56 9.0 496387 29 63 79 92 98 99 0.4 496393 0 2 11 15 42 55
8.0 496406 9 20 63 72 90 96 1.0 496407 18 16 71 82 95 98 1.0
Example 6: Tolerability of Antisense Oligonucleotides Targeting
Human A1AT in CD1 Mice
[0478] CD1.RTM. mice (Charles River, Mass.) are a multipurpose
model of mice frequently utilized for testing safety and efficacy.
The mice were treated with ISIS antisense oligonucleotides selected
from the studies described above, and evaluated for changes in the
levels of various markers.
Treatment
[0479] Six to seven-week old male CD1 mice were maintained at a
12-hour light/dark cycle and fed Purina mouse chow 5001 ad libitum.
The mice were acclimated for at least 7 days in the research
facility before initiation of the experiment. Groups of four CD1
mice each were injected subcutaneously twice a week for 6 weeks
with 50 mg/kg of ISIS 474061, ISIS 487657, ISIS 487658, ISIS
487659, ISIS 487660, ISIS 487661, ISIS 487662, ISIS 487663, ISIS
487664, and ISIS 489013. A group of four CD1 mice were injected
subcutaneously twice a week for 6 weeks with PBS and served as the
control group. Three days after the last dose at each time point,
mice were euthanized and organs and plasma were harvested for
further analysis.
Body and Organ Weights
[0480] To evaluate the effect of ISIS oligonucleotides on body and
organ weights, body weight and liver, spleen, and kidney weights
were measured at the end of the study. The body weights at the end
of the study were compared with body weight at pre-dose. The organ
weights of the mice treated with antisense oligonucleotides were
compared with the corresponding organ weights of the PBS control.
The results are presented in Tables 6 and 7. Treatment with ISIS
oligonucleotides did not cause any changes outside the expected
range.
TABLE-US-00007 TABLE 6 Fold body weight change of CD1 mice compared
to pre-dose weights Body weight change PBS 1.32 ISIS 474061 1.31
ISIS 487657 1.26 ISIS 487658 1.29 ISIS 487659 1.30 ISIS 487660 1.37
ISIS 487661 1.39 ISIS 487662 1.35 ISIS 487663 1.28 ISIS 487664 1.42
ISIS 489013 1.34
TABLE-US-00008 TABLE 7 Fold organ weight change of CD1 mice
compared to the PBS control ISIS No Liver Kidney Spleen 474061 1.1
0.9 1.1 487657 1.4 1.0 2.2 487658 1.1 1.0 1.5 487659 1.1 1.0 1.5
487660 1.2 1.0 1.7 487661 1.3 0.9 1.6 487662 1.3 1.0 1.1 487663 1.0
1.0 1.0 487664 1.3 0.9 1.3 489013 1.2 1.0 1.5
Plasma Chemistry
[0481] To evaluate the effect of ISIS oligonucleotides on liver and
kidney function, plasma levels of transaminases were measured using
an automated clinical chemistry analyzer (Hitachi Olympus AU400e,
Melville, N.Y.). Plasma levels of ALT (alanine transaminase) and
AST (aspartate transaminase) were measured at the time of
sacrifice, and the results are presented in Table 8 in IU/L. Plasma
levels of total bilirubin, creatinine, BUN, and albumin were also
measured using the same clinical chemistry analyzer and are
presented in Table 9.
[0482] Mice treated with all oligonucleotides except 487664 did not
demonstrate any changes in plasma markers outside the expected
range.
TABLE-US-00009 TABLE 8 ALT and AST levels (IU/L) of CD1 mice ALT
AST PBS 44 59 ISIS 474061 146 142 ISIS 487657 172 242 ISIS 487658
90 139 ISIS 487659 91 97 ISIS 487660 124 97 ISIS 487661 259 182
ISIS 487662 221 143 ISIS 487663 53 61 ISIS 487664 508 279 ISIS
489013 79 97
TABLE-US-00010 TABLE 9 Plasma bilirubin, creatinine, BUN, and
albumin levels of CD1 mice Bilirubin Creatinine BUN Albumin (mg/dL)
(mg/dL) (mg/dL) (g/dL) PBS 0.12 0.13 26.5 2.9 ISIS 474061 0.15 0.12
27.7 2.9 ISIS 487657 0.15 0.11 24.2 3.0 ISIS 487658 0.14 0.12 28.0
2.9 ISIS 487659 0.15 0.13 27.1 2.9 ISIS 487660 0.14 0.12 25.4 2.9
ISIS 487661 0.12 0.14 29.4 2.8 ISIS 487662 0.11 0.12 24.8 2.8 ISIS
487663 0.18 0.11 28.1 3.0 ISIS 487664 0.16 0.11 26.0 2.7 ISIS
489013 0.13 0.13 27.2 2.8
Example 7: Efficacy and tolerability of antisense oligonucleotides
targeting human A1AT in transgenic PiZ mice
[0483] Transgenic PiZ mice were originally generated by Sifers et
al (Nucl. Acids Res. 15: 1459-1457, 1987) by introducing a 14.4 kb
DNA fragment containing the entire A1AT gene plus 2 kb of 5' and 3'
flanking genomic DNA sequences into the germline. The mice were
treated with ISIS antisense oligonucleotides selected from the
studies described above, and the efficacy and tolerability of the
antisense oligonucleotides was evaluated.
Treatment
[0484] Five to six-week old male and female PiZ mice were
maintained at a 12-hour light/dark cycle and fed Purina mouse chow
5001 ad libitum. The mice were acclimated for at least 7 days in
the research facility before initiation of the experiment. Groups
of four PiZ mice each, consisting of two males and two females,
were injected subcutaneously twice a week for 4 weeks with 25 mg/kg
(50 mg/kg/week) of ISIS 474061, ISIS 487657, ISIS 487658, ISIS
487659, ISIS 487660, ISIS 487661, ISIS 487662, ISIS 487663, and
ISIS 489013. One group of mice was injected subcutaneously twice a
week for 4 weeks with 25 mg/kg (50 mg/kg/week) of control
oligonucleotide, ISIS 141923 (CCITCCCTGAAGGTCCTCC, 5-10-5 MOE
gapmer with no known murine target, SEQ ID NO: 43). One group of
mice was injected subcutaneously twice a week for 4 weeks with PBS
and served as the control group. Blood samples were collected via
tail snip prior to dosing and at week 2 and week 4 after dosing.
Two days after the last dose, mice were euthanized and organs and
plasma were harvested for further analysis.
RNA Analysis
[0485] At the end of the study, RNA was extracted from liver tissue
for real-time PCR analysis of human A1AT levels using primer probe
set RTS3320. Results are presented as percent inhibition of A1AT,
relative to PBS control, normalized to the house-keeping gene,
Cyclophilin. As shown in Table 10, treatment with some of the ISIS
oligonucleotides reduced A1AT mRNA levels. Specifically, treatment
with ISIS 487660 reduced A1AT mRNA expression levels. Treatment
with the control oligonucleotide, ISIS 141923, did not affect A1AT
levels, as expected.
TABLE-US-00011 TABLE 10 Percent inhibition of human A1AT mRNA
relative to the PBS control % ISIS No inhibition 474061 36 487657
29 487658 18 487659 20 487660 76 487661 52 487662 53 487663 23
489013 13 141923 6
Protein Analysis
[0486] Plasma levels of A1AT were measured with an ELISA kit (Alpco
A1AT kit, #30-6752). Results are presented as percent inhibition of
A1AT, relative to the PBS control. As shown in Table 11, treatment
with some of the ISIS oligonucleotides reduced A1AT plasma levels.
Specifically, treatment with ISIS 487660 reduced A1AT levels.
Treatment with the control oligonucleotide, ISIS 141923, did not
affect A1AT levels, as expected.
TABLE-US-00012 TABLE 11 Percent inhibition in human A1AT plasma
levels relative to the PBS control ISIS No. week 2 week 4 474061 12
18 487657 14 18 487658 10 17 487659 12 16 487660 49 61 487661 35 41
487662 32 50 487663 25 41 489013 14 29
Example 8: Tolerability of Antisense Oligonucleotides Targeting
Human A1AT in CD1 Mice
[0487] CD1.RTM. mice were treated with ISIS antisense
oligonucleotides selected from the studies described above, and
evaluated for changes in the levels of various markers.
Treatment
[0488] Six to seven-week old male CD1 mice were maintained at a
12-hour light/dark cycle and fed Purina mouse chow 5001 ad libitum.
The mice were acclimated for at least 7 days in the research
facility before initiation of the experiment. Groups of four CD1
mice each were injected subcutaneously twice a week for 6 weeks
with 50 mg/kg (100 mg/kg/week) of ISIS 489009, ISIS 489010, ISIS
496346, ISIS 496360, ISIS 496386, ISIS 496387, ISIS 496388, ISIS
496391, ISIS 493692, ISIS 496393, ISIS 496404, ISIS 496405, ISIS
496406, and ISIS 496407. Blood samples were collected via tail snip
prior to dosing and at weeks 2, 3, and 4 after dosing. Three days
after the last dose at each time point, mice were euthanized and
organs and plasma were harvested for further analysis.
Plasma Chemistry
[0489] To evaluate the effect of ISIS oligonucleotides on liver and
kidney function, plasma levels of transaminases, bilirubin, BUN,
albumin, and creatinine were measured using an automated clinical
chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Plasma
levels were measured at the time of sacrifice, and the results are
presented in Table 12.
[0490] Mice treated with all oligonucleotides except 489009 and
ISIS 496388 did not demonstrate any changes in plasma chemistry
markers outside the expected range and, therefore, met tolerability
requirements. Specifically, treatment with ISIS 496407 was deemed
tolerable.
TABLE-US-00013 TABLE 12 Levels of plasma chemistry markers of CD1
mice ALT AST Bilirubin BUN Albumin Creatinine (IU/L) (IU/L) (mg/dL)
(mg/dL) g/dL) (mg/dL) PBS 48 65 0.15 22.6 2.9 0.17 ISIS 489009 695
412 0.19 23.8 2.8 0.16 ISIS 489010 166 225 0.19 21.1 2.9 0.15 ISIS
496346 131 111 0.17 25.4 2.8 0.18 ISIS 496360 55 71 0.15 25.5 3.0
0.16 ISIS 496386 53 79 0.16 21.3 2.9 0.17 ISIS 496387 84 134 0.12
22.4 2.7 0.18 ISIS 496388 528 419 0.11 23.6 2.4 0.16 ISIS 496391
107 149 0.14 22.4 2.8 0.16 ISIS 496392 64 116 0.11 24.3 2.6 0.13
ISIS 496393 130 115 0.10 26.6 3.0 0.17 ISIS 496404 74 91 0.18 21.6
3.0 0.13 ISIS 496405 79 103 0.12 23.6 2.8 0.14 ISIS 496406 81 99
0.14 21.3 2.8 0.15 ISIS 496407 71 102 0.19 18.2 2.7 0.14
Example 9: Efficacy and tolerability of antisense oligonucleotides
targeting human A1AT in PiZ mice
[0491] PiZ mice were treated with ISIS antisense oligonucleotides
selected from the studies described above and evaluated for changes
in the levels of various markers.
Treatment
[0492] Female and male PiZ mice were maintained at a 12-hour
light/dark cycle and fed Purina mouse chow 5001 ad libitum. The
mice were acclimated for at least 7 days in the research facility
before initiation of the experiment. Groups of four PiZ mice each
were injected subcutaneously twice a week for 4 weeks with 25 mg/kg
(50 mg/kg/week) of ISIS 487660, ISIS 487661, ISIS 487662, ISIS
489010, ISIS 496346, ISIS 496360, ISIS 496386, ISIS 496387, ISIS
496391, ISIS 496392, ISIS 496393, ISIS 496404, ISIS 496405, ISIS
496406, and ISIS 496407. A group of four PiZ mice was injected
subcutaneously twice a week for 4 weeks with PBS and served as the
control group. Blood samples were collected via tail snip prior to
dosing and at days 12 and 27 after dosing. Three days after the
last dose at each time point, mice were euthanized and organs and
plasma were harvested for further analysis.
RNA Analysis
[0493] At the end of the study, RNA was extracted from liver tissue
for real-time PCR analysis of A1AT using human primer probe set
RTS3320. Results are presented as percent inhibition of human A1AT,
relative to PBS control, normalized to RIBOGREEN.RTM.. As shown in
Table 13, treatment with some of the ISIS oligonucleotides reduced
A1AT mRNA levels. Specifically, ISIS 487660, ISIS 487662, ISIS
496386, ISIS 496387, ISIS 496392, ISIS 496404, and ISIS 496407
reduced A1AT mRNA levels.
TABLE-US-00014 TABLE 13 Percent inhibition of human A1AT mRNA
relative to the PBS control ISIS No % 487660 72 487661 54 487662 75
489010 49 496346 36 496360 24 496386 87 496387 86 496391 69 496392
73 496393 49 496404 70 496405 49 496406 74 496407 89
Example 10: Tolerability of Antisense Oligonucleotides Targeting
Human A1AT in Sprague-Dawley Rats
[0494] Sprague-Dawley rats are a multipurpose model of rats
frequently utilized for safety and efficacy testing. The rats were
treated with ISIS antisense oligonucleotides selected from the
studies described in Examples 8 and 9, and evaluated for changes in
the levels of various markers.
Treatment
[0495] Groups of four Sprague-Dawley rats each were injected
subcutaneously twice a week for 6 weeks with 50 mg/kg (100
mg/kg/week) of ISIS 487660, ISIS 487662, ISIS 496386, ISIS 496387,
ISIS 496392, ISIS 496406, and ISIS 496407. A group of four
Sprague-Dawley rats was injected subcutaneously twice a week for 6
weeks with PBS and served as the control group. Three days after
the last dose at each time point, the rats were euthanized and
organs and plasma were harvested for further analysis.
Plasma Chemistry
[0496] To evaluate the effect of ISIS oligonucleotides on liver and
kidney function, plasma levels of transaminases, BUN, albumin, and
creatinine were measured using an automated clinical chemistry
analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Plasma levels
were measured at the time of sacrifice, and the results are
presented in Table 14.
[0497] Rats treated with ISIS oligonucleotides did not demonstrate
changes in plasma chemistry markers outside the expected range and,
therefore, were deemed tolerable in this regard.
TABLE-US-00015 TABLE 14 Levels of plasma chemistry markers of
Sprague-Dawley rats ALT AST BUN Albumin Creatinine (IU/L) (IU/L)
(mg/dL) (g/dL) (mg/dL) PBS 51 64 20 4.4 0.20 ISIS 487660 42 70 22
3.3 0.28 ISIS 487662 48 104 29 3.0 0.26 ISIS 496386 43 85 23 3.3
0.29 ISIS 496387 42 74 23 3.0 0.28 ISIS 496392 42 78 21 3.3 0.28
ISIS 496406 70 159 24 2.8 0.23 ISIS 496407 45 82 21 3.1 0.26
Body and Organ Weights
[0498] To evaluate the effect of ISIS oligonucleotides on body and
organ weights, body weight and liver, spleen, and kidney weights
were measured two days before the rats were euthanized and organ
weights were measured at the end of the study. The results are
presented in Table 15. Treatment with ISIS oligonucleotides, except
ISIS 496406, did not cause any changes outside the expected range
and, therefore, were deemed tolerable in this regard.
TABLE-US-00016 TABLE 15 Body and organ weights (in grams) of
Sprague-Dawley rats Body weight Liver Kidney Spleen PBS 473 1.0 1.0
1.0 ISIS 487660 392 1.3 1.1 4.1 ISIS 487662 376 1.3 1.3 3.7 ISIS
496386 385 1.2 1.1 4.4 ISIS 496387 409 1.1 1.1 4.1 ISIS 496392 368
1.2 1.1 3.0 ISIS 496406 340 1.3 1.2 7.0 ISIS 496407 377 1.1 1.1
3.9
Example 11: Dose Response of Antisense Oligonucleotides Targeting
Human A1AT in PiZ Mice
[0499] PiZ mice were treated with ISIS antisense oligonucleotides
selected from the studies described above and evaluated for changes
in the levels of various markers.
Treatment
[0500] Female and male PiZ mice were maintained at a 12-hour
light/dark cycle and fed Purina mouse chow 5001 ad libitum. The
mice were acclimated for at least 7 days in the research facility
before initiation of the experiment. Groups of four PiZ mice each
were injected subcutaneously twice a week for 4 weeks with 12.5
mg/kg, 25 mg/kg, or 37.5 mg/kg of ISIS 487660, ISIS 487662, ISIS
489010, ISIS 496386, ISIS 496392, ISIS 496393, ISIS 496404, and
ISIS 496407 (weekly doses of 25 mg/kg, 50 mg/kg, and 75 mg/kg). One
group of four PiZ mice was injected subcutaneously twice a week for
4 weeks with 37.5 mg/kg (75 mg/kg/week) of ISIS 141923. One group
of four PiZ mice was injected subcutaneously twice a week for 4
weeks with PBS and served as the control group. Blood samples were
collected via tail snip prior to dosing and at week 4 after dosing.
Three days after the last dose at each time point, mice were
euthanized and organs and plasma were harvested for further
analysis.
RNA Analysis
[0501] At the end of the study, RNA was extracted from liver tissue
for real-time PCR analysis of A1AT using human primer probe set
RTS3320 (forward sequence GGAGATGCTGCCCAGAAGAC, designated herein
as SEQ ID NO: 48; reverse sequence GCTGGCGGTATAGGCTGAAG, designated
herein as SEQ ID NO: 49; probe sequence
ATCAGGATCACCCAACCTCAACAAGATCA, designated herein as SEQ ID NO: 50).
Results are presented as percent inhibition of human A1AT, relative
to PBS control, normalized to RIBOGREEN.RTM.. As shown in Table 16,
treatment with ISIS 487660, ISIS 496386, and ISIS 496407 reduced
A1AT mRNA levels. Treatment with the control oligonucleotide, ISIS
141923, did not affect A1AT mRNA expression, as ex gcted.
TABLE-US-00017 TABLE 16 Percent inhibition of human A1AT mRNA
relative to the PBS control ISIS No 25 mg/kg 50 mg/kg 75 mg/kg
487660 40 61 58 487662 19 52 51 489010 0 4 9 496386 47 71 84 496392
10 26 39 496393 0 0 0 496404 0 3 27 496407 22 51 76
Protein Analysis
[0502] Plasma levels of A1AT were measured at week 4 with an ELISA
kit (Alpco A1AT kit, #30-6752). Results are presented as percent
inhibition of A1AT, relative to pre-dose levels. As shown in Table
17, treatment with most of the ISIS oligonucleotides reduced A1AT
plasma levels. Specifically, treatment with ISIS 487660, ISIS
487662, ISIS 496386, and ISIS 496407 reduced A1AT plasma levels.
Treatment with the control oligonucleotide, ISIS 141923, did not
affect A1AT levels, as expected.
TABLE-US-00018 TABLE 17 Percent change in human A1AT plasma levels
relative to pre-dose levels ISIS No 25 mg/kg 50 mg/kg 75 mg/kg
487660 66 76 83 487662 42 68 73 489010 24 22 36 496386 67 82 88
496392 28 48 62 496393 12 34 32 496404 47 58 56 496407 46 65 88
Example 12: Dose-Dependent Antisense Inhibition of Human A1AT in
PiZ Mouse Primary Hepatocytes
[0503] Gapmers from the study described in Example 11 were also
tested at various doses in PiZ mouse primary hepatocytes. Cells
were plated at a density of 25,000 cells per well and transfected
using electroporation with 0.63 .mu.M, 2.00 .mu.M, 6.32 .mu.M,
20.00 .mu.M, 63.2 .mu.M, and 200.0 .mu.M concentrations of
antisense oligonucleotide, as specified in Table 18. After a
treatment period of approximately 16 hours, RNA was isolated from
the cells and A1AT mRNA levels were measured by quantitative
real-time PCR. Human A1AT primer probe set RTS3335_MGB (forward
sequence GACCACCGTGAAGGTGCCTAT, designated herein as SEQ ID NO: 51;
reverse sequence GGACAGCTITCITACAGTGCTGGAT, designated herein as
SEQ ID NO: 52; probe sequence ATGAAGCGTITAGGCATGTIT, designated
herein as SEQ ID NO: 53) was used to measure mRNA levels. A1AT mRNA
levels were adjusted according to total RNA content, as measured by
RIBOGREEN.RTM.. Results are presented as percent inhibition of
A1AT, relative to untreated control cells.
[0504] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 18. A1AT mRNA
levels were reduced in a dose-dependent manner in antisense
oligonucleotide treated cells.
TABLE-US-00019 TABLE 18 Dose-dependent antisense inhibition of
human A1AT in PiZ mouse primary hepatocytes ISIS 0.63 2.00 6.32
20.0 63.2 200.0 IC.sub.50 No .mu.M .mu.M .mu.M .mu.M .mu.M .mu.M
(.mu.M) 487660 0 60 87 90 87 93 0.3 487662 0 27 77 86 85 93 0.4
489010 0 0 12 41 82 95 2.3 496392 0 22 81 96 95 96 0.4 496393 0 12
62 91 96 97 0.5 492404 0 10 76 95 97 97 0.4 492386 0 43 85 96 96 97
0.3 492407 0 30 74 96 96 97 0.4
[0505] Example 13: Effect of ISIS Antisense Oligonucleotides
Targeting Human A1AT in Cynomolgus Monkeys
[0506] Cynomolgus monkeys were treated with ISIS antisense
oligonucleotides selected from studies described above. Antisense
oligonucleotide efficacy and tolerability were evaluated. The human
antisense oligonucleotides tested are also cross-reactive with the
complement of the rhesus genomic sequence NW_001121215.1 truncated
from nucleotides 7483001 to 7503000 (designated herein as SEQ ID
NO: 14). The greater the complementarity between the human
oligonucleotide and the rhesus monkey sequence, the more likely the
human oligonucleotide can cross-react with the rhesus monkey
sequence. The start and stop sites of each oligonucleotide to SEQ
ID NO: 1 and SEQ ID NO: 14 are presented in Table 19. "SEQ ID NO: 1
Start Site" indicates the 5'-most nucleotide to which the gapmer is
targeted in the human sequence. "SEQ ID NO: 1 Stop Site" indicates
the 3'-most nucleotide to which the gapmer is targeted in the human
sequence. "SEQ ID NO: 14 Start Site" indicates the 5'-most
nucleotide to which the gapmer is targeted in the rhesus monkey
gene sequence. "SEQ ID NO: 14 Stop Site" indicates the 3'-most
nucleotide to which the gapmer is targeted in the rhesus monkey
gene sequence. "Mismatches to SEQ ID NO: 14" are the number of
mismatches in nucleobases the human oligonucleotide has with the
rhesus genomic sequence.
TABLE-US-00020 TABLE 19 Antisense oligonucleotides complementary to
SEQ ID NO: 1 and SEQ ID NO: 14 SEQ SEQ SEQ SEQ Mis- ID 1 ID 1 ID 14
ID 14 matches SEQ Start Stop Start Start to SEQ ID Site Site Site
Site ID 14 Sequence ISIS No Motif NO 1575 1594 14921 14940 0
CCAGCTCAAC 487660 5-10-5 38 CCTTCTTTAA 1577 1596 14923 14942 0
GACCAGCTCA 487662 5-10-5 40 ACCCTTCTTT 1565 1584 14911 14930 1
CCTTCTTTAA 496386 5-10-5 30 TGTCATCCAG 1571 1590 14917 14936 0
CTCAACCCTT 496392 5-10-5 34 CTTTAATGTC 1421 1440 14767 14786 0
GGGTTTGTTG 496393 5-10-5 23 AACTTGACCT 1561 1580 14907 14926 1
CTTTAATGTC 496404 5-10-5 26 ATCCAGGGAG 1564 1583 14910 14929 1
CTTCTTTAAT 496407 5-10-5 29 GTCATCCAGG
Treatment
[0507] Prior to the study, 36 cynomolgus monkeys were kept in
quarantine for a 5-week period, during which the animals were
observed daily for general health. The monkeys were 2-3 years old
and weighed between 2 and 5 kg. Groups of four randomly assigned
male cynomolgus monkeys each were injected subcutaneously with ISIS
oligonucleotide or PBS using a stainless steel dosing needle and
syringe of appropriate size into the intracapsular region and outer
thigh of the monkeys. Seven groups were dosed four times a week for
the first week (days 1, 3, 5, and 7) as loading doses, and
subsequently once a week for weeks 2-12, with 50 mg/kg of ISIS
487660, ISIS 487662, ISIS 496386, ISIS 496392, ISIS 496393, ISIS
496404, or ISIS 496407. One group was injected subcutaneously with
25 mg/kg of ISIS 496407 four times a week for the first week (days
1, 3, 5, and 7) as loading doses, and subsequently once a week for
weeks 2-13. A control group of monkeys was injected with PBS
subcutaneously four times a week for the first week (days 1, 3, 5,
and 7), and subsequently once a week for weeks 2-13.
Hepatic Target Reduction
RNA Analysis
[0508] On day 86, RNA was extracted from liver tissue for real-time
PCR analysis of A1AT using primer probe set rhSERPINA1_LTS00903
((forward sequence TCTITAAAGGCAAATGGGAGAGA, designated herein as
SEQ ID NO: 54; reverse sequence TGCCTAAACGCCTCATCATG, designated
herein as SEQ ID NO: 55; probe sequence CCACGTGGACCAGGCGACCA,
designated herein as SEQ ID NO: 56). Results are presented as
percent inhibition of A1AT mRNA, relative to PBS control,
normalized to the house keeping gene Cyclophilin. Similar results
were obtained on normalization with RIBOGREEN.RTM.. As shown in
Table 20, treatment with ISIS antisense oligonucleotides resulted
in reduction of A1AT mRNA in comparison to the PBS control.
TABLE-US-00021 TABLE 20 Percent Inhibition of A1AT mRNA in the
cynomolgus monkey liver relative to the PBS control % inhibition %
inhibition Maintenance Dose (normalized (normalized ISIS No
(mg/kg/wk) RIBOGREEN) Cyclophilin) 487660 50 83 87 487662 50 54 37
496386 50 51 38 496392 50 63 55 496393 50 33 8 496404 50 12 3
496407 50 45 34 496407 25 25 1
Protein Analysis
[0509] On day 85, monkeys in all groups were fasted overnight. The
next day, approximately 1 mL of blood was collected into tubes
containing the potassium salt of EDTA. The tubes were centrifuged
at 3,000 rpm for 10 min at room temperature to obtain plasma. The
plasma samples from all groups were assayed in an automated
clinical chemistry analyzer (Hitachi Olympus AU400e, Melville,
N.Y.) to measure A1AT protein levels using an antibody based assay
designed by Olympus. As shown in Table 21, treatment with some of
the ISIS antisense oligonucleotides resulted in reduction of A1AT
protein levels in comparison to pre-dose levels on day -13.
TABLE-US-00022 TABLE 21 Percent Inhibition of plasma A1AT protein
levels in cynomolgus monkey relative to the PBS control Maintenance
Dose ISIS No (mg/kg/wk) % inhibition 487660 50 83 487662 50 42
496386 50 30 496392 50 49 496393 50 7 496404 50 5 496407 50 27
496407 25 29
Tolerability Studies
Body and Organ Weight Measurements
[0510] To evaluate the effect of ISIS oligonucleotides on the
overall health of the animals, body and organ weights were measured
at day 86. Body weights were measured and are presented in Table
22, expressed relative to pre-dose levels on day 1. Organ weights
were measured and the data is also presented in Table 22, expressed
relative to the body weight. Body and organ weights after treatment
with ISIS oligonucleotides were within the expected range.
TABLE-US-00023 TABLE 22 Body and organ weights in the cynomolgus
monkey (expressed in relative terms) Dose Body ISIS No (mg/kg/wk)
weight Spleen Kidney Liver PBS -- 1.05 0.1 0.5 2.2 487660 50 1.07
0.2 0.8 3.0 487662 50 1.04 0.4 0.7 3.1 496386 50 1.00 0.4 1.8 3.8
496392 50 1.11 0.3 0.6 3.0 496393 50 1.10 0.3 0.6 3.0 496404 50
1.01 0.3 0.9 3.2 496407 50 1.01 0.3 0.9 3.5 496407 25 1.10 0.3 0.7
3.0
Liver Function
[0511] To evaluate the effect of ISIS oligonucleotides on hepatic
function, approximately 1.5 mL of blood samples were collected from
all the study groups. The monkeys were fasted overnight prior to
blood collection. Blood was collected for serum separation in tubes
without anticoagulant. The tubes were kept at room temperature for
a minimum of 90 min and then centrifuged at 3,000 rpm for 10 min.
Levels of various liver function markers were measured using a
Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Plasma
levels of ALT and AST were measured and the results are presented
in Table 23, expressed in IU/L. Bilirubin and albumin were
similarly measured and are presented in Table 34. Liver function
after treatment with ISIS oligonucleotides was within the expected
range.
TABLE-US-00024 TABLE 23 Effect of antisense oligonucleotide
treatment on liver function markers in cynomolgus monkey plasma
Dose ALT AST Albumin Bilirubin ISIS No (mg/kg/wk) (IU/L) (IU/L)
(g/dL) (mg/dL) PBS -- 38 50 4.3 0.15 487660 50 52 78 4.1 0.13
487662 50 99 82 3.9 0.11 496386 50 71 77 3.3 0.10 496392 50 85 64
4.0 0.14 496393 50 68 62 4.2 0.16 496404 50 122 130 3.8 0.17 496407
50 56 64 3.6 0.13 496407 25 50 50 3.5 0.13
Kidney Function
[0512] To evaluate the effect of ISIS oligonucleotides on kidney
function, blood samples were collected from all the study groups.
The monkeys were fasted overnight prior to blood collection. Blood
was collected for serum separation in tubes without anticoagulant.
The tubes were kept at room temperature for a minimum of 90 min and
then centrifuged at 3,000 rpm for 10 min. Levels of BUN and
creatinine were measured using a Toshiba 200FR NEO chemistry
analyzer (Toshiba Co., Japan). Results are presented in Table 24,
expressed in mg/dL.
[0513] Fresh urine from all animals was collected for urine
analysis using a clean cage pan on wet ice. The urine samples were
analyzed by the Toshiba 200FR NEO chemistry analyzer (Toshiba Co.,
Japan) for their protein to creatinine (P/C) ratio. The data is
presented in Table 25.
[0514] Kidney function after treatment with ISIS oligonucleotides
was within the expected range.
TABLE-US-00025 TABLE 24 Effect of antisense oligonucleotide
treatment on plasma BUN and creatinine levels in cynomolgus monkeys
Dose BUN Creatinine ISIS No (mg/kg/wk) (mg/dL) (mg/dL) PBS -- 25
0.9 487660 50 26 0.9 487662 50 26 1.0 496386 50 69 1.5 496392 50 28
1.0 496393 50 24 0.9 496404 50 28 1.0 496407 50 42 1.3 496407 25 36
1.1
TABLE-US-00026 TABLE 25 Effect of antisense oligonucleotide
treatment on P/C ratio in the urine of cynomolgus monkeys Dose ISIS
No (mg/kg/wk) P/C PBS -- 0.0 487660 50 0.1 487662 50 0.0 496386 50
5.9 496392 50 0.0 496393 50 0.1 496404 50 0.4 496407 50 0.1 496407
25 1.6
Hematology
[0515] To evaluate any effect of ISIS oligonucleotides in
cynomolgus monkeys on hematologic parameters, approximately 0.5 mL
of blood was collected on day 86 from each of the available study
animals in tubes containing K.sub.2-EDTA. The animals were fasted
overnight prior to blood collection. Samples were analyzed for red
blood cell (RBC) count, white blood cells (WBC) count, individual
white blood cell counts, such as that of monocytes, neutrophils,
lymphocytes, as well as for platelet count, hemoglobin content and
hematocrit, using an ADVIA120 hematology analyzer (Bayer, USA). The
data is presented in Tables 26 and 27.
[0516] Hematologic parameters after treatment with ISIS
oligonucleotides were within the expected range.
TABLE-US-00027 TABLE 26 Effect of antisense oligonucleotide
treatment on various blood cells in cynomolgus monkeys ISIS Dose
WBC RBC Platelets Neutrophils Lymphocytes Monocytes No (mg/kg/wk)
(.times.10.sup.3/.mu.L) (.times.10.sup.6/.mu.L)
(.times.10.sup.3/.mu.L) (%) (%) (%) PBS -- 13.2 6.1 490.5 30.8 62.9
3.6 487660 50 13.2 5.8 472.8 16.1 75.9 5.0 487662 50 11.0 5.5 413.0
19.0 65.7 8.5 496386 50 12.4 5.4 269.5 45.8 44.6 5.5 496392 50 12.9
5.9 339.5 37.4 52.5 5.4 496393 50 12.7 5.8 343.5 34.4 59.6 2.7
496404 50 13.8 6.0 445.0 38.1 53.8 4.9 496407 50 10.9 5.5 470.5
37.0 54.3 4.0 496407 25 12.8 5.4 489.8 35.9 56.5 4.2
TABLE-US-00028 TABLE 27 Effect of antisense oligonucleotide
treatment on hematologic parameters in cynomolgus monkeys Dose
Hemoglobin Hematocrit ISIS No (mg/kg/wk) (g/dL) (%) PBS -- 13.0
41.9 487660 50 12.8 41.2 487662 50 12.1 39.2 496386 50 11.1 37.1
496392 50 13.4 42.7 496393 50 12.9 40.9 496404 50 13.5 42.0 496407
50 12.4 40.6 496407 25 11.7 38.5
Example 14: Efficacy of Antisense Oligonucleotides Targeting Human
A1AT in Transgenic PiZ Mice
[0517] Transgenic PiZ mice were treated with ISIS 496407 and its
efficacy was evaluated.
Treatment
[0518] Six-week old male and female PiZ mice were maintained at a
12-hour light/dark cycle and fed Purina mouse chow 5001 ad libitum.
The mice were acclimated for at least 7 days in the research
facility before initiation of the experiment. One cohort of PiZ
mice were injected subcutaneously twice a week for 8 weeks with 25
mg/kg (50 mg/kg/week) of ISIS 496407. One cohort of mice was
injected subcutaneously twice a week for 8 weeks with PBS and
served as the control. Two days after the last dose, mice were
euthanized, and organs and plasma were harvested for further
analysis.
RNA Analysis
[0519] At the end of the study, RNA was extracted from liver tissue
for real-time PCR analysis of human A1AT levels using primer probe
set RTS3320. Results are presented as percent inhibition of A1AT,
relative to PBS control, normalized to the house-keeping gene,
Cyclophilin. As shown in Table 28, treatment with ISIS 496407
reduced A1AT mRNA levels in both male and female mice relative to
the PBS control.
TABLE-US-00029 TABLE 28 Percent inhibition of human A1AT mRNA
relative to the PBS control % Male 93 Female 81
Protein Analysis
[0520] Plasma levels of A1AT were measured once every two weeks
with an ELISA kit (Alpco A1AT kit, #30-6752). Results are presented
as percent inhibition of A1AT, relative to the values taken
pre-dose. As shown in Table 29, treatment with ISIS 496407 reduced
A1AT plasma levels.
TABLE-US-00030 TABLE 29 Percent inhibition in human A1AT plasma
levels relative to the PBS control Week 2 Week 4 Week 6 Week 8 Male
60 80 90 90 Female 70 80 80 90
Analysis of Liver A1AT Protein Aggregates
[0521] For separation of soluble and insoluble A1AT protein, 10 mg
of whole liver was placed in a buffer consisting of 50 mmol/L Tris
HCl (pH 8.0), 150 mmol/L KCl, 5 mmol/L MgCl.sub.2, 0.5% Triton
X-100, and 80 .mu.L Complete.RTM. protease inhibitor stock. The
liver tissue was homogenized in a pre-chilled Dounce homogenizer
with 30 repetitions and then the suspension was vortexed
vigorously. A 1-mL aliquot of the suspension was passed through a
28-gauge needle 10 times to further homogenize the tissue. The
total protein concentration of the aliquot was determined. A 5 plg
liver sample aliquot was centrifuged at 10,000 g for 30 min at
4.degree. C. The supernatant containing the soluble A1AT fraction
was immediately removed into a fresh tube with extreme care being
taken to avoid disturbing the cell pellet, or non-soluble fraction.
The cell pellet containing the insoluble polymer of A1AT protein
was denatured and solubilized by addition of 10 .mu.L of chilled
cell lysis buffer (1% Triton X-100, 0.05% deoxycholate and 10
mmol/L EDTA in PBS), vortexing for 30 sec, sonication on ice for 10
min and further vortexing. Both the soluble A1AT fraction and the
solubilized A1AT polymer fraction were boiled in 2.5.times. sample
buffer (5% sodium dodecyle sulfate, 50% glycerol, 0.5 mol/L Tris
[pH 6.8], 10% beta-mercaptoethanol, 40% double distilled water).
The samples were then loaded on an SDS-PAGE. Western analysis was
subsequently conducted using goat anti-human alpha-1 antitrypsin
Nephelometric serum (DiaSorin Inc, Cat #80502). The bands of the
Western blot were quantified using a densitometer and analyzed
using ImageJ software. The data indicated that both soluble and
insoluble A1AT protein fractions were reduced after treatment with
ISIS 496407. Table 30 presents the results for the A1AT polymer
fraction, expressed as percentage reduction of the polymer relative
to the PBS control.
TABLE-US-00031 TABLE 30 Percent inhibition in human A1AT polymer
relative to the PBS control % Male 32 Female 38
Example 15: Effect of Antisense Inhibition of A1AT in Halting
Progression of A1AT Deficiency Liver Disease in PiZ Mice
[0522] The effect of inhibition of A 1AT mRNA expression with
antisense oligonucleotides on halting the progression of A1AT
deficiency liver disease was examined in PiZ mice.
Treatment
[0523] Male PiZ mice, 6-8 weeks in age, were randomly divided into
treatment groups of 4 mice each. Three treatment groups were
injected with 25 mg/kg of ISIS 487660 (SEQ ID NO: 38), administered
subcutaneously twice a week for 4, 8, or 12 weeks. Another three
groups were injected with PBS, administered subcutaneously twice a
week for 4, 8, or 12 weeks. Two PiZ mice with no treatment
administered were included to provide baseline measurements. At the
end of each treatment period, the mice were euthanized with
isoflurane followed by cervical dislocation. Liver tissue was
collected and processed for further analysis.
RNA Analysis
[0524] RNA isolation was performed using the Invitrogen
PureLink.TM. Total RNA Purification Kit, according to the
manufacturer's protocol. RT-PCR was performed and A1AT RNA
expression was measured using primer probe set RTS3320 and
normalized to RIBOGREEN.RTM..
[0525] A1AT mRNA expression was assessed in the liver. As shown in
Table 31, A1AT mRNA expression in mice treated with ISIS 487660 was
inhibited compared to the control group in all treatment groups.
The mRNA expression levels are expressed as percent inhibition of
expression levels compared to that in the PBS control.
TABLE-US-00032 TABLE 31 Percent inhibition of A1AT mRNA levels (%)
compared to the PBS control Weeks of treatment Liver 4 76 8 89 12
80
Protein Analysis
[0526] Plasma levels of A1AT were measured once every two weeks
with a clinical analyzer and Diasorin antibody to A1AT protein.
Results are presented as percent inhibition of A1AT, relative to
the values taken pre-dose. As shown in Table 32, treatment with
ISIS 487660 reduced A1AT plasma levels in all treatment groups.
TABLE-US-00033 TABLE 32 Percent inhibition in human A1AT plasma
levels relative to the PBS control Weeks of treatment % inhibition
4 63 8 65 12 68
Quantification of A1AT Globules in the Liver
[0527] A well-known characteristic of the A1AT deficiency liver
disease is the presence of PAS-positive globules in hepatocytes
(Teckman, J. H. et al., Am. J. Physiol. Gastrointest. Liver
Physiol. 2002. 283: G1156-G1165). Analysis was performed on a total
tissue area of 2,250,000 .mu.m.sup.2 using Spectrum software system
(Aperio, Calif.). Hepatocytes were stained with Period acid-Schiff
stain after diastase treatment of the liver sections.
[0528] The average diameters of the globules in each treatment
group were measured and are presented in Table 33. The total
globule area was calculated and is presented in Table 34. The
results indicate that treatment with ISIS 487660 reduced or halted
globule formation in hepatocytes in all treatment groups.
TABLE-US-00034 TABLE 33 Average globule diameter (.mu.M) in PiZ
mice Weeks of Treatment treatment groups Diameter -- Baseline 0.42
4 PBS 1.76 ISIS 487660 0.31 8 PBS 2.54 ISIS 487660 0.40 12 PBS 3.33
ISIS 487660 0.48
TABLE-US-00035 TABLE 34 Total globule area (.mu.m.sup.2) in PiZ
mice Weeks of Treatment treatment groups Area -- Baseline 41,392 4
PBS 95,948 ISIS 487660 58,218 8 PBS 76,074 ISIS 487660 61,260 12
PBS 147,753 ISIS 487660 64,546
Analysis of Liver A1AT Protein Aggregates
[0529] For separation of soluble and insoluble A1AT protein, 10 mg
of whole liver was placed in a buffer consisting of 50 mmol/L Tris
HCl (pH 8.0), 150 mmol/L KCl, 5 mmol/L MgCl.sub.2, 0.5% Triton
X-100, and 80 L Complete.RTM. protease inhibitor stock. The liver
tissue was homogenized in a pre-chilled Dounce homogenizer with 30
repetitions and then the suspension was vortexed vigorously. A 1-mL
aliquot of the suspension was passed through a 28-gauge needle 10
times to further homogenize the tissue. The total protein
concentration of the aliquot was determined. A 5 .mu.g liver sample
aliquot was centrifuged at 10,000 g for 30 min at 4.degree. C. The
supernatant containing the soluble A1AT fraction was immediately
removed into a fresh tube with extreme care being taken to avoid
disturbing the cell pellet, or non-soluble fraction. The cell
pellet containing the insoluble polymer of A1AT protein was
denatured and solubilized by addition of 10 .mu.L of chilled cell
lysis buffer (1% Triton X-100, 0.05% deoxycholate and 10 mmol/L
EDTA in PBS), vortexing for 30 sec, sonication on ice for 10 min
and further vortexing. Both the soluble A1AT fraction and the
solubilized A1AT polymer fraction were boiled in 2.5.times. sample
buffer (5% sodium dodecyle sulfate, 50% glycerol, 0.5 mol/L Tris[pH
6.8], 10% beta-mercaptoethanol, 40% double distilled water). The
samples were then loaded on an SDS-PAGE. Western analysis was
subsequently conducted using goat anti-human alpha-1 antitrypsin
Nephelometric serum (DiaSorin Inc, Cat #80502). The bands of the
Western blot were quantified using a densitometer and analyzed
using ImageJ software. The data indicated that both soluble and
insoluble A1AT protein fractions were reduced after treatment with
ISIS 496407. Table 35 presents the results for the A1AT polymer
fraction, expressed in arbitrary units.
TABLE-US-00036 TABLE 35 Human A1AT monomer and polymer levels Weeks
of Treatment treatment groups Monomer Polymer 4 PBS 238 2213 ISIS
487660 26 1327 8 PBS 675 2598 ISIS 487660 106 1517 12 PBS 159 2317
ISIS 487660 45 1124
Example 16: Effect of Antisense Inhibition of A1AT in Preventing
the Onset of A1AT Deficiency Liver Disease in PiZ Mice
[0530] The effect of inhibition of A 1AT mRNA expression with
antisense oligonucleotides on preventing the onset of A1AT
deficiency liver disease was examined in PiZ mice.
Treatment
[0531] Male and female PiZ mice, 2 weeks in age, were randomly
divided into treatment groups of 4 mice each. One group was
injected with 25 mg/kg of ISIS 487660 (SEQ ID NO: 38), administered
subcutaneously twice a week for 8 weeks (50 mg/kg/week). Another
group was injected with PBS, administered subcutaneously twice a
week for 8 weeks. Two mice were kept in a separate group and served
to establish baseline values or measurements of various parameters
pre-dose. Two PiZ mice with no treatment administered were included
to provide baseline measurements. At the end of each treatment
period, the mice were euthanized with isoflurane followed by
cervical dislocation. Liver tissue was collected and processed for
further analysis.
RNA Analysis
[0532] RNA isolation was performed using the Invitrogen
PureLink.TM. Total RNA Purification Kit, according to the
manufacturer's protocol. RT-PCR was performed and A1AT RNA
expression was measured using primer probe set RTS3320 and
normalized to RIBOGREEN.RTM..
[0533] A1AT mRNA expression was assessed in the liver. A1AT mRNA
expression in mice treated with ISIS 487660 was inhibited by 71%
compared to the control group in all treatment groups.
Protein Analysis
[0534] Plasma levels of A1AT were measured once every two weeks
using a clinical analyzer and Diasorin antibody to A1AT protein.
Results are presented as percent inhibition of A1AT, relative to
the values taken pre-dose. As shown in Table 36, treatment with
ISIS 487660 reduced A1AT plasma levels.
TABLE-US-00037 TABLE 36 Percent inhibition in human A1AT plasma
levels relative to baseline values Week % inhibition 2 40 4 40 6 50
8 40
Quantification of A1AT Globules in the Liver
[0535] Hepatocytes were stained with PAS. Analysis was performed on
a total tissue are of 2,250,000 .mu.m.sup.2 using Spectrum software
system (Aperio, Calif.). Hepatocytes were stained with Periodic
acid-Schiff stain after diastase treatment of the liver
sections.
[0536] The average diameters of the globules in each treatment
group were measured and are presented in Table 37. The total
globule area in all the groups was calculated and is presented in
Table 38. The results indicate that treatment with ISIS 487660
prevented globule formation in hepatocytes in all treatment
groups.
TABLE-US-00038 TABLE 37 Average globule diameter (.mu.M) in PiZ
mice Mouse Treatment gender groups Diameter Both Baseline 0.23 Male
PBS 2.1 ISIS 487660 0.1 Female PBS 2.3 ISIS 487660 0.1
TABLE-US-00039 TABLE 38 Total globule area (.mu.m.sup.2) in PiZ
mice Mouse Treatment gender groups Area Both Baseline 31,856 Male
PBS 63,531 ISIS 487660 33,053 Female PBS 155,564 ISIS 487660
26,084
Analysis of Liver A1AT Protein Aggregates
[0537] For separation of soluble and insoluble A1AT protein, 10 mg
of whole liver was placed in a buffer consisting of 50 mmol/L Tris
HCl (pH 8.0), 150 mmol/L KCl, 5 mmol/L MgCl.sub.2, 0.5% Triton
X-100, and 80 .mu.L Complete.RTM. protease inhibitor stock. The
liver tissue was homogenized in a pre-chilled Dounce homogenizer
with 30 repetitions and then the suspension was vortexed
vigorously. A 1-mL aliquot of the suspension was passed through a
28-gauge needle 10 times to further homogenize the tissue. The
total protein concentration of the aliquot was determined. A 5
.mu.g liver sample aliquot was centrifuged at 10,000 g for 30 min
at 4.degree. C. The supernatant containing the soluble A1AT
fraction was immediately removed into a fresh tube with extreme
care being taken to avoid disturbing the cell pellet, or
non-soluble fraction. The cell pellet containing the insoluble
polymer of A1AT protein was denatured and solubilized by addition
of 10 .mu.L of chilled cell lysis buffer (1% Triton X-100, 0.05%
deoxycholate and 10 mmol/L EDTA in PBS), vortexing for 30 sec,
sonication on ice for 10 min and further vortexing. Both the
soluble A1AT fraction and the solubilized A1AT polymer fraction
were boiled in 2.5.times. sample buffer (5% sodium dodecyle
sulfate, 50% glycerol, 0.5 mol/L Tris[pH 6.8], 10%
beta-mercaptoethanol, 40% double distilled water). The samples were
then loaded on an SDS-PAGE. Western analysis was subsequently
conducted using goat anti-human alpha-1 antitrypsin Nephelometric
serum (DiaSorin Inc, Cat #80502). The bands of the Western blot
were quantified using a densitometer and analyzed using ImageJ
software. The data indicated that treatment with ISIS 487660
prevented formation of A1AT protein aggregates in PiZ mice when
administered at 2 weeks of age.
Example 17: Effect of Antisense Inhibition of A1AT on Liver
Fibrosis in the PiZZ Mice Model
[0538] PiZZ mice contain the mutant piZ variant of the human A1AT
gene. The mice have accumulation of the mutant human protein in the
hepatocytes, similar to that in human patients, causing liver
necrosis and inflammation (Carlson, J. A. et al., J. Clin. Invest.
1989. 83: 1183-90). The effect of inhibition of A1AT mRNA
expression in ameliorating liver fibrosis was examined in PiZZ
mice.
Study 1
Treatment
[0539] Eight week old PiZZ mice were randomly divided into
treatment groups of 5 mice each. A group of mice was injected with
50 mg/kg/week of ISIS 496407, administered subcutaneously for 8
weeks. Another group of mice was injected with PBS, administered
subcutaneously for 8 weeks. At the end of each treatment period,
the mice were euthanized with isoflurane followed by cervical
dislocation. Liver tissue and plasma was collected and processed
for further analysis.
A1AT mRNA Analysis
[0540] RNA isolation from liver tissue was performed using the
Invitrogen PureLink.TM. Total RNA Purification Kit, according to
the manufacturer's protocol. RT-PCR was performed and A1AT RNA
expression was measured using primer probe set RTS3320 and
normalized to RIBOGREEN.RTM.. Hepatic A1AT levels were reduced by
91% in mice treated with ISIS 496407 compared to the PBS
control.
Analysis of Liver Fibrosis Markers
[0541] Increased levels of TIMP1 play an important role in the
pathogenesis of liver fibrosis (Arthur, M. J. et al., J.
Gastroenterol. Hepatol. 1998. 13: S33-8). RNA analysis of TIMP-1
levels was conducted using the primer probe set mTimp1_LTS00190
(forward sequence TCATGGAAAGCCTCTGTGGAT, designated herein as SEQ
ID NO: 57; reverse sequence GCGGCCCGTGATGAGA, designated herein as
SEQ ID NO: 58; probe sequence CCCACAAGTCCCAGAACCGCAGTG, designated
herein as SEQ ID NO: 59). A decrease in TIMP1 levels may lead to a
decrease in fibrosis of an organ or tissue. TIMP1 levels can be
used as a marker for fibrosis in an organ or tissue. TIMP1 levels
were decreased by 82% in mice treated with ISIS 496407.
[0542] In addition, analysis of liver damage was conducted by
histochemical staining. Fibrosis deposition was assessed by Sirius
Red staining and quantification of the stain intensity and area.
Liver sections from mice treated with ISIS 496407 demonstrated a
decrease in staining by 76% (0.20 in arbitrary units vs. 0.83 of
the PBS control) compared to staining of section of the PBS
control.
[0543] The results indicate that treatment with ISIS 496407
resulted in decreased liver TIMP1 levels and decreased staining of
the liver with Sirius Red. Hence, antisense inhibition of A1AT
resulted in decreased fibrosis in this mice model.
Plasma Chemistry
[0544] To evaluate the effect of ISIS oligonucleotides on liver and
kidney function, plasma levels of transaminases were measured using
an automated clinical chemistry analyzer (Hitachi Olympus AU400e,
Melville, N.Y.). Plasma levels of ALT (alanine transaminase) and
AST (aspartate transaminase) were measured at the time of
sacrifice, and the results are presented in Tables 39 and 40 in
IU/L.
[0545] Mice treated with ISIS 496407 decreased transaminase levels
compared to the control, which demonstrated increased levels of
both ALT and AST with time. The decrease in transaminase levels
indicate a prevention of organ damage, a decrease in organ damage
and/or an improvement in organ function in the oligonucleotide
treated mice.
TABLE-US-00040 TABLE 39 ALT levels (IU/L) of PiZZ mice Baseline
Week 2 Week 4 Week 6 Week 8 PBS 57 73 172 153 101 ISIS 496407 59 64
71 64 59
TABLE-US-00041 TABLE 40 AST levels (IU/L) of PiZZ mice Baseline
Week 2 Week 4 Week 6 Week 8 PBS 95 119 234 166 134 ISIS 496407 101
83 90 86 84
Treatment
[0546] Five week old PiZZ mice were randomly divided into treatment
groups of 6 mice each. A group of mice was injected with 50
mg/kg/week of ISIS 487660, administered subcutaneously for 8 weeks,
then 25 mg/kg/week for three weeks. Another group of mice was
injected with PBS, administered subcutaneously for 11 weeks. At the
end of each treatment period, the mice were euthanized with
isoflurane followed by cervical dislocation. Liver tissue and
plasma was collected and processed for further analysis.
Analysis of Liver Fibrosis Markers
[0547] The expression of various genes can be used as markers for
fibrosis formation in an organ or tissue. Expression of the
following fibrosis markers in the liver were analyzed: collagen
type 1, alpha 1; collagen type IV; collagen type III, alpha 1 (Du,
W. D. et al., World Gastroenterol. 1999. 5: 397-403); MMP12; MMP13;
and TIMP1 (Arthur, M. J. Am. J. Physiol. 2000. 279: G245-G249). The
results are presented in Table 41. A decrease in the expression of
one or more of these fibrosis markers may be correlative and/or
causative of a decrease in fibrosis of an organ or tissue.
TABLE-US-00042 TABLE 41 Inhibition of levels of fibrosis markers in
PiZZ mice % inhibition Collagen type 1, alpha 1 75 Collagen type
III, alpha 1 57 Collagen type IV 21 MMP12 0 MMP13 31 TIMP1 67
[0548] In addition, analysis of liver damage was conducted by
histochemical staining. Fibrosis deposition was assessed by Sirius
Red staining and quantification of the stain intensity and area.
Liver sections from mice treated with ISIS 487660 demonstrated a
decrease in staining by 69% (0.83 in arbitrary units vs. 2.65 of
the PBS control) compared to staining of section of the PBS
control. Levels of alpha-smooth muscle actin (SMA), a myofibroblast
marker (Hinz, B. et al., Am. J. Pathol. 2001. 159: 1009-1020), were
also assessed. SMA levels were measured in both groups. Liver
sections from mice treated with ISIS 487660 demonstrated a decrease
in levels by 40% (0.83 in arbitrary units vs. 1.38 of the PBS
control) compared to levels in the sections of the PBS control.
[0549] The results indicate that treatment with an A1AT
oligonucleotide, ISIS 487660, inhibited A1AT expression leading to
a decrease in liver fibrosis as indicated by histochemical staining
and the decrease of multiple liver fibrosis markers.
Plasma Chemistry
[0550] To evaluate the effect of ISIS oligonucleotides on liver and
kidney function, plasma levels of transaminases were measured using
an automated clinical chemistry analyzer (Hitachi Olympus AU400e,
Melville, N.Y.). Plasma levels of ALT, and AST were measured at the
time of sacrifice, and the results are presented in Tables 42 and
43 in IU/L.
[0551] Mice treated with ISIS 487660 decreased liver chemistry
marker levels compared to the control with time. The decrease in
transaminase levels indicate a prevention of organ damage, a
decrease in organ damage and/or an improvement in organ function in
the oligonucleotide treated mice.
TABLE-US-00043 TABLE 42 ALT levels (IU/L) of PiZZ mice Day 1 Day 15
Day 35 Day 56 Day 77 PBS 67 56 74 146 78 ISIS 487660 73 34 42 48
58
TABLE-US-00044 TABLE 43 AST levels (IU/L) of PiZZ mice Day 1 Day 15
Day 35 Day 56 Day 77 PBS 102 105 128 188 106 ISIS 487660 98 56 64
67 69
Example 18: Effect of Antisense Inhibition of A1AT on Reversal of
Aggregate Formation in the PiZ Mice Model
[0552] The effect of inhibition of A 1AT mRNA expression with
antisense oligonucleotides on reversing A1AT aggregate formation
was examined in PiZ mice. PiZ mice, at 16 weeks of age, were
monitored for 20 weeks for the effect of antisense inhibition in
reversing aggregate formation.
Treatment
[0553] Male PiZ mice, 16 weeks in age, were randomly divided into
treatment groups of 4 mice each. One group was injected with 25
mg/kg of ISIS 487660 (SEQ ID NO: 38), administered subcutaneously
twice a week for 20 weeks (50 mg/kg/week). Another group was
injected with PBS, administered subcutaneously twice a week for 20
weeks. At the end of each treatment period, the mice were
euthanized. Liver tissue was collected and processed for further
analysis.
Protein Analysis
[0554] PiZ mouse livers were homogenized and the soluble and
insoluble human A1AT fractions were separated. Both fractions were
separated on sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE); equal amounts of total liver protein
were loaded per soluble-insoluble pair in quantitative experiments.
A1AT protein was detected by a polyclonal antibodies against human
A1AT purchased from DiaSorin, Inc. (Stillwater, Minn.) and the
secondary antibody was HRP-conjugated rabbit anti-goat antibody
(Jackson ImmunoResearch). Western blot was quantitated with
ImageQuant. Results are presented as percent inhibition of A1AT,
relative to the values taken pre-dose at 16 weeks (baseline). As
shown in Table 1, treatment with ISIS 487660 reversed insoluble
A1AT protein accumulation in the liver compared to the PBS control
in older mice.
TABLE-US-00045 TABLE 44 Percentage of human A1AT liver protein
levels relative to baseline values Levels of soluble Levels of A1AT
insoluble A1AT PBS 58 107 ISIS 487660 10 65
Analysis of Liver A1AT Protein Aggregates
[0555] Histochemical staining for total A1AT protein and Periodic
acid-Schiff with diastase treatment stain (PAS-D, for A1AT
aggregates) of 16-week mice (the age of the mice at the start of
the study, which is taken as baseline), PBS control-treated mice,
and ISIS 487660 treated-mice was performed. Liver sections from
mice treated with ISIS 487660 exhibited decreased staining of total
A1AT, compared to compared to PBS control and baseline. Liver
sections were also stained with PAS-D. Positive PAS-D staining in
periportal hepatocytes indicate A1AT accumulation in the liver,
which is associated with the A1AT deficiency disorder. Sections
from mice treated with ISIS 487660 exhibited decreased staining of
PAS-D compared to PBS control and baseline.
Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID
NOS: 59 <210> SEQ ID NO 1 <211> LENGTH: 3220
<212> TYPE: DNA <213> ORGANISM: Homo sapien <400>
SEQUENCE: 1 acaatgactc ctttcggtaa gtgcagtgga agctgtacac tgcccaggca
aagcgtccgg 60 gcagcgtagg cgggcgactc agatcccagc cagtggactt
agcccctgtt tgctcctccg 120 ataactgggg tgaccttggt taatattcac
cagcagcctc ccccgttgcc cctctggatc 180 cactgcttaa atacggacga
ggacagggcc ctgtctcctc agcttcaggc accaccactg 240 acctgggaca
gtgaatcgac aatgccgtct tctgtctcgt ggggcatcct cctgctggca 300
ggcctgtgct gcctggtccc tgtctccctg gctgaggatc cccagggaga tgctgcccag
360 aagacagata catcccacca tgatcaggat cacccaacct tcaacaagat
cacccccaac 420 ctggctgagt tcgccttcag cctataccgc cagctggcac
accagtccaa cagcaccaat 480 atcttcttct ccccagtgag catcgctaca
gcctttgcaa tgctctccct ggggaccaag 540 gctgacactc acgatgaaat
cctggagggc ctgaatttca acctcacgga gattccggag 600 gctcagatcc
atgaaggctt ccaggaactc ctccgtaccc tcaaccagcc agacagccag 660
ctccagctga ccaccggcaa tggcctgttc ctcagcgagg gcctgaagct agtggataag
720 tttttggagg atgttaaaaa gttgtaccac tcagaagcct tcactgtcaa
cttcggggac 780 accgaagagg ccaagaaaca gatcaacgat tacgtggaga
agggtactca agggaaaatt 840 gtggatttgg tcaaggagct tgacagagac
acagtttttg ctctggtgaa ttacatcttc 900 tttaaaggca aatgggagag
accctttgaa gtcaaggaca ccgaggaaga ggacttccac 960 gtggaccagg
tgaccaccgt gaaggtgcct atgatgaagc gtttaggcat gtttaacatc 1020
cagcactgta agaagctgtc cagctgggtg ctgctgatga aatacctggg caatgccacc
1080 gccatcttct tcctgcctga tgaggggaaa ctacagcacc tggaaaatga
actcacccac 1140 gatatcatca ccaagttcct ggaaaatgaa gacagaaggt
ctgccagctt acatttaccc 1200 aaactgtcca ttactggaac ctatgatctg
aagagcgtcc tgggtcaact gggcatcact 1260 aaggtcttca gcaatggggc
tgacctctcc ggggtcacag aggaggcacc cctgaagctc 1320 tccaaggccg
tgcataaggc tgtgctgacc atcgacgaga aagggactga agctgctggg 1380
gccatgtttt tagaggccat acccatgtct atcccccccg aggtcaagtt caacaaaccc
1440 tttgtcttct taatgattga acaaaatacc aagtctcccc tcttcatggg
aaaagtggtg 1500 aatcccaccc aaaaataact gcctctcgct cctcaacccc
tcccctccat ccctggcccc 1560 ctccctggat gacattaaag aagggttgag
ctggtccctg cctgcatgtg actgtaaatc 1620 cctcccatgt tttctctgag
tctccctttg cctgctgagg ctgtatgtgg gctccaggta 1680 acagtgctgt
cttcgggccc cctgaactgt gttcatggag catctggctg ggtaggcaca 1740
tgctgggctt gaatccaggg gggactgaat cctcagctta cggacctggg cccatctgtt
1800 tctggagggc tccagtcttc cttgtcctgt cttggagtcc ccaagaagga
atcacagggg 1860 aggaaccaga taccagccat gaccccaggc tccaccaagc
atcttcatgt ccccctgctc 1920 atcccccact cccccccacc cagagttgct
catcctgcca gggctggctg tgcccacccc 1980 aaggctgccc tcctgggggc
cccagaactg cctgatcgtg ccgtggccca gttttgtggc 2040 atctgcagca
acacaagaga gaggacaatg tcctcctctt gacccgctgt cacctaacca 2100
gactcgggcc ctgcacctct caggcacttc tggaaaatga ctgaggcaga ttcttcctga
2160 agcccattct ccatggggca acaaggacac ctattctgtc cttgtccttc
catcgctgcc 2220 ccagaaagcc tcacatatct ccgtttagaa tcaggtccct
tctccccaga tgaagaggag 2280 ggtctctgct ttgttttctc tatctcctcc
tcagacttga ccaggcccag caggccccag 2340 aagaccatta ccctatatcc
cttctcctcc ctagtcacat ggccataggc ctgctgatgg 2400 ctcaggaagg
ccattgcaag gactcctcag ctatgggaga ggaagcacat cacccattga 2460
cccccgcaac ccctcccttt cctcctctga gtcccgactg gggccacatg cagcctgact
2520 tctttgtgcc tgttgctgtc cctgcagtct tcagagggcc accgcagctc
cagtgccacg 2580 gcaggaggct gttcctgaat agcccctgtg gtaagggcca
ggagagtcct tccatcctcc 2640 aaggccctgc taaaggacac agcagccagg
aagtcccctg ggcccctagc tgaaggacag 2700 cctgctccct ccgtctctac
caggaatggc cttgtcctat ggaaggcact gccccatccc 2760 aaactaatct
aggaatcact gtctaaccac tcactgtcat gaatgtgtac ttaaaggatg 2820
aggttgagtc ataccaaata gtgatttcga tagttcaaaa tggtgaaatt agcaattcta
2880 catgattcag tctaatcaat ggataccgac tgtttcccac acaagtctcc
tgttctctta 2940 agcttactca ctgacagcct ttcactctcc acaaatacat
taaagatatg gccatcacca 3000 agccccctag gatgacacca gacctgagag
tctgaagacc tggatccaag ttctgacttt 3060 tccccctgac agctgtgtga
ccttcgtgaa gtcgccaaac ctctctgagc cccagtcatt 3120 gctagtaaga
cctgcctttg agttggtatg atgttcaagt tagataacaa aatgtttata 3180
cccattagaa cagagaataa atagaactac atttcttgca 3220 <210> SEQ ID
NO 2 <211> LENGTH: 20000 <212> TYPE: DNA <213>
ORGANISM: Homo sapien <400> SEQUENCE: 2 tatctaagcc acccacgcag
ggcatgtatt tctgaataat aagccctcaa gtcctgctgg 60 gtctcccata
gtccccacgc aagggtgagt cttgcacgct cagccctgcc tgtggttccc 120
agaaggcctc tgtcactgcg tgcttgcttt ctctcccagg gaagataccc cagtgccatg
180 tcttggggca agagaaaatg aagacagacc tggaacatga acatggtggc
cttgccagaa 240 agcaagtgtg tgttgctgaa acatcagcag agattgtcaa
agggataaag agataactta 300 aaagggttcc tattgaccaa aatgcgacaa
gttgaccatc taaaatcaaa tcataattat 360 agttcaatag gacacattga
gtctcttaaa agcttccaat ccgtaatgac catcaaggcc 420 cataacctca
aaagagtaaa gttaaaataa agttcagaaa aggttagctg caataaaaca 480
tgagttttag taattttaac aagaagggga tgaagctata gatgcatttt tattccttct
540 tttaactatg ttgcccctta taatgtatag ctttgcctta tttttctctg
tctgagtaag 600 gataaagagt aaaggccagg cacagtggct cacacctgta
attccagcac tttgggaggc 660 cgaggcgggc agataacttg aggccaggag
tttgagacca gcctggccaa catggtgaaa 720 ccctgtcact actaaaaata
caaaaattaa ctggaattgg tagcacatgc ctgtaatgcc 780 agctactctg
gaggctgagg cacgagaatc gctcgtaatt ccagaattcg agaggtggag 840
tttgcagtaa gccaagattg cgccactgta ctccagcctg ggtgactgag tgagactctg
900 tctcaaaaaa aaaaaaaaaa agaagaagct gtgagtaggc cacatagttc
cagaaaatgc 960 agaaatcccc cctcccctcc ccaacacaca ggaagtggct
caggagatta cacacagaag 1020 gaaagtgtgt ctgctggggt tttgcaagtt
ggctaatttg aaaggtgact ggaggaggtg 1080 aaaaaatggt gcaaacttca
ttcattcatt aaatgagtta taagaagaca gacacaagtg 1140 tccattatgc
taacagagct ctgtgttaaa caccccacca gcatcgcctc atctaagcct 1200
cagaagagct atgtgggaaa gaaactttta tccctatttt atagatgagg aaaccaaggc
1260 tcagagaact gagggcctcc cccggatcca agtccaccta gctgcagtca
ccccacatcc 1320 tctgcatgtc acaggtgctc agaaagatgc tgaaggcacc
tggcccttca ccttcggaaa 1380 gccaaaatga gcacggcccc taaagagggg
attgacagcc ttttctggaa aaaatggaag 1440 tttgaatctg aggaggtgtc
cctcaacaac aggtgctgct ccccaaatct ggggccaaac 1500 gcagcagttg
ttcccccact tagacccctg agacccatct atatggtttt tcagagccag 1560
gacacatccc caaaggtcat ggcctttggt ggttagcatt gacttggggc ccatcacatg
1620 ccagaggctg cccgaagtgc ttaaatgtta ttatctcatt cgatcttcac
agtcctgatg 1680 gaagtgactc ttcttagagt cttcctatct cacagatgag
gaaaccgagg cacagagagg 1740 ttaagtggct tgtctaagag ctcacaaaaa
gagcgatgga gctaaggctt ggccccagat 1800 attagatccc gaacccacgc
cttaaccagt gacctgcact gactctcaaa gaaggaagct 1860 ggtgcctggg
aaggagggtg catagtgagg gtgtgcatgg ggtgtgtgtg tttgtggggt 1920
ggccagcact ctccgggggc actttgccaa tgagttcagc tcccatgaag tccactgttg
1980 ttctcctgac cagccactca gtcttgattt acttggccca gggccactgg
cacacctcac 2040 ccccttaccc gattccttgc tgcagacccc aaatctcgac
tctcacatcc ctatccagcc 2100 cataccacga ggctcccatc tccaggcagg
gccctgtggt ggggcagggc ctcccccaga 2160 tgccccttac tcatgaccag
ctcacaggat cttcccatga tgcatttcct ctggggggat 2220 cagcccagat
gctgcaatag acaattgtgg aagtaaccag gtggacaaga ctttccccct 2280
catgtcctgg ggttcctggg ggcacagtat ccttgtgaat ggccactgag tactcccacc
2340 cctcccacca caacccccgg gattttgtcc tggtgcgttt ttccagatta
tcctagccct 2400 tcctcccagg atggatgtcc agagcagggc gggggctgag
cctagagccc tgccaaaaga 2460 gcaggacccc aaattctgag ccccttactt
gcctcacctg ctcccaccca tgctttcttc 2520 attcctcctc caaaagcccc
agctccccac tgcaatccct tctgcaccca gccaggtcct 2580 atgacacaca
cctccccagt gcacacagac ctgcccaact gtggggctgc ccactgggca 2640
tttcataggt ggctcagtcc tcttccctct gcagctggcc ccagaaacct gccagttatt
2700 ggtgccaggt ctgtgccagg agggcgaggc ctgtcatttc tagtaatcct
ctgggcagtg 2760 tgactgtacc tcttgcggca actcaaaggg agagggtgac
ttgtcccggg tcacagagct 2820 gaaagggcag gtacaacagg tgacatgccg
ggctgtctga gtttatgagg gcccagtctt 2880 gtgtctgccg ggcaatgagc
aaggctcctt cctgtccaag ctccccgccc ctccccagcc 2940 tactgcctcc
acccgaagtc tacttcctgg gtgggcagga actgggcact gtgcccaggg 3000
catgcactgc ctccacgcag caaccctcag agtcctgagc tgaaccaaga aggaggaggg
3060 ggtcgggcct ccgaggaagg cctagccgct gctgctgcca ggaattccag
gttggagggg 3120 cggcaacctc ctgccagcct tcaggccact ctcctgtgcc
tgccagaaga gacagagctt 3180 gaggagagct tgaggagagc aggaaaggtg
ggacattgct gctgctgctc actcagttcc 3240 acaggtggga gggacagcag
ggcttagagt gggggtcatt gtgcagatgg gaaaacaaag 3300 gcccagagag
gggaagaaat gcccaggagc taccgagggc aggcgacctc aaccacagcc 3360
cagtgctgga gctgtgagtg gatgtagagc agcggaatat ccattcagcc agctcagggg
3420 aaggacaggg gccctgaagc caggggatgg agctgcaggg aagggagctc
agagagaagg 3480 ggaggggagt ctgagctcag tttcccgctg cctgaaagga
gggtggtacc tactcccttc 3540 acagggtaac tgaatgagag actgcctgga
ggaaagctct tcaagtgtgg cccaccccac 3600 cccagtgaca ccagcccctg
acacggggga gggagggcag catcaggagg ggctttctgg 3660 gcacacccag
tacccgtctc tgagctttcc ttgaactgtt gcattttaat cctcacagca 3720
gctcaacaag gtacataccg tcaccatccc cattttacag atagggaaat tgaggctcgg
3780 agcggttaaa caactcacct gaggcctcac agccagtaag tgggttccct
ggtctgaatg 3840 tgtgtgctgg aggatcctgt gggtcactcg cctggtagag
ccccaaggtg gaggcataaa 3900 tgggactggt gaatgacaga aggggcaaaa
atgcactcat ccattcactc tgcaagtatc 3960 tacggcacgt acgccagctc
ccaagcaggt ttgcgggttg cacagcgggc gatgcaatct 4020 gatttaggct
tttaaaggga ttgcaatcaa gtggggcccc actagcctca accctgtacc 4080
tcccctcccc tccaccccca gcagtctcca aaggcctcca acaaccccag agtgggggcc
4140 atgtatccaa agaaactcca agctgtatac ggatcacact ggttttccag
gagcaaaaac 4200 agaaacaggc ctgaggctgg tcaaaattga acctcctcct
gctctgagca gcctgggggg 4260 cagactaagc agagggctgt gcagacccac
ataaagagcc tactgtgtgc caggcacttc 4320 acccgaggca cttcacaagc
atgcttggga atgaaacttc caactctttg ggatgcaggt 4380 gaaacagttc
ctggttcaga gaggtgaagc ggcctgcctg aggcagcaca gctcttcttt 4440
acagatgtgc ttccccacct ctaccctgtc tcacggcccc ccatgccagc ctgacggttg
4500 tgtctgcctc agtcatgctc catttttcca tcgggaccat caagagggtg
tttgtgtcta 4560 aggctgactg ggtaactttg gatgagcggt ctctccgctc
tgagcctgtt tcctcatctg 4620 tcaaatgggc tctaacccac tctgatctcc
cagggcggca gtaagtcttc agcatcaggc 4680 attttggggt gactcagtaa
atggtagatc ttgctaccag tggaacagcc actaaggatt 4740 ctgcagtgag
agcagagggc cagctaagtg gtactctccc agagactgtc tgactcacgc 4800
caccccctcc accttggaca caggacgctg tggtttctga gccaggtaca atgactcctt
4860 tcggtaagtg cagtggaagc tgtacactgc ccaggcaaag cgtccgggca
gcgtaggcgg 4920 gcgactcaga tcccagccag tggacttagc ccctgtttgc
tcctccgata actggggtga 4980 ccttggttaa tattcaccag cagcctcccc
cgttgcccct ctggatccac tgcttaaata 5040 cggacgagga cagggccctg
tctcctcagc ttcaggcacc accactgacc tgggacagtg 5100 aatcgtaagt
atgcctttca ctgcgagagg ttctggagag gcttctgagc tccccatggc 5160
ccaggcaggc agcaggtctg gggcaggagg ggggttgtgg agtgggtatc cgcctgctga
5220 ggtgcagggc agatggagag gctgcagctg agctcctatt ttcataataa
cagcagccat 5280 gagggttgtg tcctgtttcc cagtcctgcc cggtcccccc
tcggtacctc ctggtggata 5340 cactggttcc tgtaagcaga agtggatgag
ggtgtctagg tctgcagtcc tggcacccca 5400 ggatggggga caccagccaa
gatacagcaa cagcaacaaa gcgcagccat ttctttctgt 5460 ttgcacagct
cctctgtctg tcgggggctc ctgtctgttg tctcctataa gcctcaccac 5520
ctctcctact gcttgggcat gcatctttct ccccttctat agatgaggag gttaaggtcc
5580 agagaggggt ggggaggaac gccggctcac attctccatc ccctccagat
atgaccagga 5640 acagacctgt gccaggcctc agccttacat caaaatgggc
ctccccatgc accgtggacc 5700 tctgggccct cctgtcccag tggaggacag
gaagctgtga ggggcactgt cacccagggc 5760 tcaagctggc attcctgaat
aatcgctctg caccaggcca cggctaagct cagtgcgtga 5820 ttaagcctca
taaccctcca aggcagttac tagtgtgatt cccattttac agatgaggaa 5880
gatggggaca gagaggtgaa taactggccc caaatcacac accatccata attcgggctc
5940 aggcacctgg ctccagtccc caaactcttg aacctggccc tagtgtcact
gtttctcttg 6000 ggtctcaggc gctggatggg gaacaggaaa cctgggctgg
acttgaggcc tctctgatgc 6060 tcggtgactt cagacagttg ctcaacctct
ctgttctctt gggcaaaaca tgataacctt 6120 tgacttctgt cccctcccct
caccccaccc gaccttgatc tctgaagtgt tggaaggatt 6180 taatttttcc
tgcactgagt tttggagaca ggtcaaaaag atgaccaagg ccaaggtggc 6240
cagtttccta tagaacgcct ctaaaagacc tgcagcaata gcagcaagaa ctggtattct
6300 cgagaacttg ctgcgcagca ggcacttctt ggcattttat gtgtatttaa
tttcacaata 6360 gctctatgac aaagtccacc tttctcatct ccaggaaact
gaggttcaga gaggttaagt 6420 aacttgtcca aggtcacaca gctaatagca
agttgacgtg gagcaatctg gcctcagagc 6480 ctttaatttt agccacagac
tgatgctccc ctcttcattt agccaggctg cctctgaagt 6540 tttctgattc
aagacttctg gcttcagctt tgtacacaga gatgattcaa tgtcaggttt 6600
tggagtgaaa tctgtttaat cccagacaaa acatttagga ttacatctca gttttgtaag
6660 caagtagctc tgtgattttt agtgagttat ttaatgctct ttggggctca
atttttctat 6720 ctataaaata gggctaataa tttgcacctt atagggtaag
ctttgaggac agattagatg 6780 atacggtgcc tgtaaaacac caggtgttag
taagtgtggc aatgatggtg acgctgaggc 6840 tgatgtttgc ttagcatagg
gttaggcagc tggcaggcag taaacagttg gataatttaa 6900 tggaaaattt
gccaaactca gatgctgttc actgctgagc aggagcccct tcctgctgaa 6960
atggtcctgg ggagtgcagc aggctctccg ggaagaaatc taccatctct cgggcaggag
7020 ctcaacctgt gtgcaggtac agggagggct tcctcacctg gtgcccactc
atgcattacg 7080 tcagttattc ctcatccctg tccaaaggat tcttttctcc
attgtacagc tatgaagcta 7140 gtgctcaaag aagtgaagtc atttacccca
ggccccctgc cagtaagtga cagggcctgg 7200 tcacacttgg gtttatttat
tgcccagttc aacaggttgt ttgaccatag gcgagattct 7260 cttccctgca
ccctgccggg ttgctcttgg tcccttattt tatgctcccg ggtagaaatg 7320
gtgtgagatt aggcagggag tggctcgctt ccctgtccct ggccccgcaa agagtgctcc
7380 cacctgcccc gatcccagaa atgtcaccat gaagccttca ttcttttggt
ttaaagcttg 7440 gcctcagtgt ccgtacacca tggggtactt ggccagatgg
cgactttctc ctctccagtc 7500 gccctcccag gcactagctt ttaggagtgc
agggtgctgc ctctgataga agggccagga 7560 gagagcaggt tttggagtcc
tgatgttata aggaacagct tgggaggcat aatgaaccca 7620 acatgatgct
tgagaccaat gtcacagccc aattctgaca ttcatcatct gagatctgag 7680
gacacagctg tctcagttca tgatctgagt gctgggaaag ccaagacttg ttccagcttt
7740 gtcactgact tgctgtatag cctcaacaag gccctgaccc tctctgggct
tcaaactctt 7800 cactgtgaaa ggaggaaacc agagtaggtg atgtgacacc
aggaaagatg gatgggtgtg 7860 ggggaatgtg ctcctcccag ctgtcacccc
ctcgccaccc tccctgcacc agcctctcca 7920 cctcctttga gcccagaatt
cccctgtcta ggagggcacc tgtctcatgc ctagccatgg 7980 gaattctcca
tctgttttgc tacattgaac ccagatgcca ttctaaccaa gaatcctggc 8040
tgggtgcagg ggctctcgcc tgtaacccca gcactttggg aggccaaggc aggcggatca
8100 agaggtcagg agttcaagac ctgcctggcc aacacggtga aacctcagct
ctactaaaaa 8160 tacaaaaatt agccaggcgt ggtggcacac gcctgtaatc
ccagctattt gggaagctga 8220 gacagaagaa tttcttgaac ccgggaggtg
gaggtttcag tgagccgaga tcacgccact 8280 gcactccacc ctggcagata
aagcgagact ctgtctcaaa aaaaacccaa aaacctatgt 8340 tagtgtacag
agggccccag tgaagtcttc tcccagcccc actttgcaca actggggaga 8400
gtgaggcccc aggaccagag gattcttgct aaaggccaag tggatagtga tggccctgcc
8460 agggctagaa gccacaacct ctggccctga ggccactcag catatttagt
gtccccaccc 8520 tgcagaggcc caactccctc ctgaccactg agccctgtaa
tgatggggga atttccataa 8580 gccatgaagg actgcacaaa gttcagttgg
gaagtgaaag agaaattaaa gggagatgga 8640 aatatacagc actaatttta
gcaccgtctt tagttctaac aacactagct agctgaagaa 8700 aaatacaaac
atgtattatg taatgtgtgg tctgttccat ttggattact tagaggcacg 8760
agggccagga gaaaggtggt ggagagaaac cagctttgca cttcatttgt tgctttattg
8820 gaaggaaact tttaaaagtc caagggggtt gaagaatctc aatatttgtt
atttccagct 8880 ttttttctcc agtttttcat ttcccaaatt caaggacacc
tttttctttg tattttgtta 8940 agatgatggt tttggttttg tgactagtag
ttaacaatgt ggctgccggg catattctcc 9000 tcagctagga cctcagtttt
cccatctgtg aagacggcag gttctaccta gggggctgca 9060 ggctggtggt
ccgaagcctg ggcatatctg gagtagaagg atcactgtgg ggcagggcag 9120
gttctgtgtt gctgtggatg acgttgactt tgaccattgc tcggcagagc ctgctctcgc
9180 tggttcagcc acaggcccca ccactcccta ttgtctcagc cccgggtatg
aaacatgtat 9240 tcctcactgg cctatcacct gaagcctttg aatttgcaac
acctgccaac ccctccctca 9300 aaagagttgc cctctcagat ccttttgatg
taaggtttgg tgttgagact tatttcacta 9360 aattctcata cataaacatc
actttatgta tgaggcaaaa tgaggaccag ggagatgaat 9420 gacttgtcct
ggctcataca cctggaaagt gacagagtca gattagatcc caggtctatc 9480
tgaagttaaa agaggtgtct tttcacttcc cacctcctcc atctacttta aagcagcaca
9540 aacccctgct ttcaaggaga gatgagcgtc tctaaagccc ctgacagcaa
gagcccagaa 9600 ctgggacacc attagtgacc cagacggcag gtaagctgac
tgcaggagca tcagcctatt 9660 cttgtgtctg ggaccacaga gcattgtggg
gacagccccg tctcttggga aaaaaaccct 9720 aagggctgag gatccttgtg
agtgttgggt gggaacagct cccaggaggt ttaatcacag 9780 cccctccatg
ctctctagct gttgccattg tgcaagatgc atttcccttc tgtgcagcag 9840
tttccctggc cactaaatag tgggattaga tagaagccct ccaagggctt ccagcttgac
9900 atgattcttg attctgatct ggcccgattc ctggataatc gtgggcaggc
ccattcctct 9960 tcttgtgcct cattttcttc ttttgtaaaa caatggctgt
accatttgca tcttagggtc 10020 attgcagatg taagtgttgc tgtccagagc
ctgggtgcag gacctagatg taggattctg 10080 gttctgctac ttcctcagtg
acattgaata gctgacctaa tctctctggc tttggtttct 10140 tcatctgtaa
aagaaggata ttagcattag cacctcacgg gattgttaca agaaagcaat 10200
gaattaacac atgtgagcac ggagaacagt gcttggcata tggtaagcac tacgtacatt
10260 ttgctattct tctgattctt tcagtgttac tgatgtcggc aagtacttgg
cacaggctgg 10320 tttaataatc cctaggcact tccacgtggt gtcaatccct
gatcactggg agtcatcatg 10380 tgccttgact cggggcctgg cccccccatc
tctgtcttgc aggacaatgc cgtcttctgt 10440 ctcgtggggc atcctcctgc
tggcaggcct gtgctgcctg gtccctgtct ccctggctga 10500 ggatccccag
ggagatgctg cccagaagac agatacatcc caccatgatc aggatcaccc 10560
aaccttcaac aagatcaccc ccaacctggc tgagttcgcc ttcagcctat accgccagct
10620 ggcacaccag tccaacagca ccaatatctt cttctcccca gtgagcatcg
ctacagcctt 10680 tgcaatgctc tccctgggga ccaaggctga cactcacgat
gaaatcctgg agggcctgaa 10740 tttcaacctc acggagattc cggaggctca
gatccatgaa ggcttccagg aactcctccg 10800 taccctcaac cagccagaca
gccagctcca gctgaccacc ggcaatggcc tgttcctcag 10860 cgagggcctg
aagctagtgg ataagttttt ggaggatgtt aaaaagttgt accactcaga 10920
agccttcact gtcaacttcg gggacaccga agaggccaag aaacagatca acgattacgt
10980 ggagaagggt actcaaggga aaattgtgga tttggtcaag gagcttgaca
gagacacagt 11040 ttttgctctg gtgaattaca tcttctttaa aggtaaggtt
gctcaaccag cctgagctgt 11100 tcccatagaa acaagcaaaa atattctcaa
accatcagtt cttgaactct ccttggcaat 11160 gcattatggg ccatagcaat
gcttttcagc gtggattctt cagttttcta cacacaaaca 11220 ctaaaatgtt
ttccatcatt gagtaatttg aggaaataat agattaaact gtcaaaacta 11280
ctgacagctc tgcagaactt ttcagagcct ttaatgtcct tgtgtatact gtatatgtag
11340 aatatataat gcttagaact atagaacaaa ttgtaataca ctgcataaag
ggatagtttc 11400 atggaacata ctttacacga ctctagtgtc ccagaatcag
tatcagtttt gcaatctgaa 11460 agacctgggt tcaaatcctg cctctaacac
aattagcttt tgacaaaaac aatgcattct 11520 acctctttga ggtgctaatt
tctcatctta gcatggacaa aataccattc ttgctgtcag 11580 gtttttttag
gattaaacaa atgacaaaga ctgtggggat ggtgtgtggc atacagcagg 11640
tgatggactc ttctgtatct caggctgcct tcctgcccct gaggggttaa aatgccaggg
11700 tcctgggggc cccagggcat tctaagccag ctcccactgt cccaggaaaa
cagcataggg 11760 gaggggaggt gggaggcaag gccaggggct gcttcctcca
ctctgaggct cccttgctct 11820 tgaggcaaag gagggcagtg gagagcagcc
aggctgcagt cagcacagct aaagtcctgg 11880 ctctgctgtg gccttagtgg
gggcccaggt ccctctccag ccccagtctc ctccttctgt 11940 ccaatgagaa
agctgggatc aggggtccct gaggcccctg tccactctgc atgcctcgat 12000
ggtgaagctc tgttggtatg gcagagggga ggctgctcag gcatctgcat ttcccctgcc
12060 aatctagagg atgaggaaag ctctcaggaa tagtaagcag aatgtttgcc
ctggatgaat 12120 aactgagctg ccaattaaca aggggcaggg agccttagac
agaaggtacc aaatatgcct 12180 gatgctccaa cattttattt gtaatatcca
agacaccctc aaataaacat atgattccaa 12240 taaaaatgca cagccacgat
ggcatctctt agcctgacat cgccacgatg tagaaattct 12300 gcatcttcct
ctagttttga attatcccca cacaatcttt ttcggcagct tggatggtca 12360
gtttcagcac cttttacaga tgatgaagct gagcctcgag ggatgtgtgt cgtcaagggg
12420 gctcagggct tctcagggag gggactcatg gtttctttat tctgctacac
tcttccaaac 12480 cttcactcac ccctggtgat gcccaccttc ccctctctcc
aggcaaatgg gagagaccct 12540 ttgaagtcaa ggacaccgag gaagaggact
tccacgtgga ccaggtgacc accgtgaagg 12600 tgcctatgat gaagcgttta
ggcatgttta acatccagca ctgtaagaag ctgtccagct 12660 gggtgctgct
gatgaaatac ctgggcaatg ccaccgccat cttcttcctg cctgatgagg 12720
ggaaactaca gcacctggaa aatgaactca cccacgatat catcaccaag ttcctggaaa
12780 atgaagacag aaggtgattc cccaacctga gggtgaccaa gaagctgccc
acacctctta 12840 gccatgttgg gactgaggcc catcaggact ggccagaggg
ctgaggaggg tgaaccccac 12900 atccctgggt cactgctact ctgtataaac
ttggcttcca gaatgaggcc accactgagt 12960 tcaggcagcg ccatccatgc
tccatgagga ggacagtacc caggggtgag gaggtaaagg 13020 tctcgtccct
ggggacttcc cactccagtg tggacactgt cccttcccaa tatccagtgc 13080
ccagggcagg gacagcagca ccaccacacg ttctggcaga accaaaaagg aacagatggg
13140 cttcctggca aaggcagcag tggagtgtgg agttcaaggg tagaatgtcc
ctggggggac 13200 gggggaagag cctgtgtggc aaggcccaga aaagcaaggt
tcggaattgg aacagccagg 13260 ccatgttcgc agaaggcttg cgtttctctg
tcactttatc ggtgctgtta gattgggtgt 13320 cctgtagtaa gtgatactta
aacatgagcc acacattagt gtatgtgtgt gcattcgtga 13380 ttatgcccat
gccctgctga tctagttcgt tttgtacact gtaaaaccaa gatgaaaata 13440
caaaaggtgt cgggttcata ataggaatcg aggctggaat ttctctgttc catgccagca
13500 cctcctgagg tctctgctcc aggggttgag aaagaacaaa gaggctgaga
gggtaacgga 13560 tcagagagcc cagagccaag ctgcccgctc acaccagacc
ctgctcaggg tggcattgtc 13620 tccccatgga aaaccagaga ggagcactca
gcctggtgtg gtcactcttc tcttatccac 13680 taaacggttg tcactgggca
ctgccaccag ccccgtgttt ctctgggtgt agggccctgg 13740 ggatgttaca
ggctgggggc caggtgaccc aacactacag ggcaagatga gacaggcttc 13800
caggacacct agaatatcag aggaggtggc atttcaagct tttgtgattc attcgatgtt
13860 aacattcttt gactcaatgt agaagagcta aaagtagaac aaaccaaagc
cgagttccca 13920 tcttagtgtg ggtggaggac acaggagtaa gtggcagaaa
taatcagaaa agaaaacact 13980 tgcactgtgg tgggtcccag aagaacaaga
ggaatgctgt gccatgcctt gaatttcttt 14040 tctgcacgac aggtctgcca
gcttacattt acccaaactg tccattactg gaacctatga 14100 tctgaagagc
gtcctgggtc aactgggcat cactaaggtc ttcagcaatg gggctgacct 14160
ctccggggtc acagaggagg cacccctgaa gctctccaag gtgagatcac cctgacgacc
14220 ttgttgcacc ctggtatctg tagggaagaa tgtgtggggg ctgcagctct
gtcctgaggc 14280 tgaggaaggg gccgagggaa acaaatgaag acccaggctg
agctcctgaa gatgcccgtg 14340 attcactgac acgggacgtg gtcaaacagc
aaagccaggc aggggactgc tgtgcagctg 14400 gcactttcgg ggcctccctt
gaggttgtgt cactgaccct gaatttcaac tttgcccaag 14460 accttctaga
cattgggcct tgatttatcc atactgacac agaaaggttt gggctaagtt 14520
gtttcaaagg aatttctgac tccttcgatc tgtgagattt ggtgtctgaa ttaatgaatg
14580 atttcagcta aagatgacac ttattttgga aaactaaagg cgaccaatga
acaactgcag 14640 ttccatgaat ggctgcatta tcttggggtc tgggcactgt
gaaggtcact gccagggtcc 14700 gtgtcctcaa ggagcttcaa gccgtgtact
agaaaggaga gagccctgga ggcagacgtg 14760 gagtgacgat gctcttccct
gttctgagtt gtgggtgcac ctgagcaggg ggagaggcgc 14820 ttgtcaggaa
gatggacaga ggggagccag ccccatcagc caaagccttg aggaggagca 14880
aggcctatgt gacagggagg gagaggatgt gcagggccag ggccgtccag ggggagtgag
14940 cgcttcctgg gaggtgtcca cgtgagcctt gctcgaggcc tgggatcagc
cttacaacgt 15000 gtctctgctt ctctcccctc caggccgtgc ataaggctgt
gctgaccatc gacgagaaag 15060 ggactgaagc tgctggggcc atgtttttag
aggccatacc catgtctatc ccccccgagg 15120 tcaagttcaa caaacccttt
gtcttcttaa tgattgaaca aaataccaag tctcccctct 15180 tcatgggaaa
agtggtgaat cccacccaaa aataactgcc tctcgctcct caacccctcc 15240
cctccatccc tggccccctc cctggatgac attaaagaag ggttgagctg gtccctgcct
15300 gcatgtgact gtaaatccct cccatgtttt ctctgagtct ccctttgcct
gctgaggctg 15360 tatgtgggct ccaggtaaca gtgctgtctt cgggccccct
gaactgtgtt catggagcat 15420 ctggctgggt aggcacatgc tgggcttgaa
tccagggggg actgaatcct cagcttacgg 15480 acctgggccc atctgtttct
ggagggctcc agtcttcctt gtcctgtctt ggagtcccca 15540 agaaggaatc
acaggggagg aaccagatac cagccatgac cccaggctcc accaagcatc 15600
ttcatgtccc cctgctcatc ccccactccc ccccacccag agttgctcat cctgccaggg
15660 ctggctgtgc ccaccccaag gctgccctcc tgggggcccc agaactgcct
gatcgtgccg 15720 tggcccagtt ttgtggcatc tgcagcaaca caagagagag
gacaatgtcc tcctcttgac 15780 ccgctgtcac ctaaccagac tcgggccctg
cacctctcag gcacttctgg aaaatgactg 15840 aggcagattc ttcctgaagc
ccattctcca tggggcaaca aggacaccta ttctgtcctt 15900 gtccttccat
cgctgcccca gaaagcctca catatctccg tttagaatca ggtcccttct 15960
ccccagatga agaggagggt ctctgctttg ttttctctat ctcctcctca gacttgacca
16020 ggcccagcag gccccagaag accattaccc tatatccctt ctcctcccta
gtcacatggc 16080 cataggcctg ctgatggctc aggaaggcca ttgcaaggac
tcctcagcta tgggagagga 16140 agcacatcac ccattgaccc ccgcaacccc
tccctttcct cctctgagtc ccgactgggg 16200 ccacatgcag cctgacttct
ttgtgcctgt tgctgtccct gcagtcttca gagggccacc 16260 gcagctccag
tgccacggca ggaggctgtt cctgaatagc ccctgtggta agggccagga 16320
gagtccttcc atcctccaag gccctgctaa aggacacagc agccaggaag tcccctgggc
16380 ccctagctga aggacagcct gctccctccg tctctaccag gaatggcctt
gtcctatgga 16440 aggcactgcc ccatcccaaa ctaatctagg aatcactgtc
taaccactca ctgtcatgaa 16500 tgtgtactta aaggatgagg ttgagtcata
ccaaatagtg atttcgatag ttcaaaatgg 16560 tgaaattagc aattctacat
gattcagtct aatcaatgga taccgactgt ttcccacaca 16620 agtctcctgt
tctcttaagc ttactcactg acagcctttc actctccaca aatacattaa 16680
agatatggcc atcaccaagc cccctaggat gacaccagac ctgagagtct gaagacctgg
16740 atccaagttc tgacttttcc ccctgacagc tgtgtgacct tcgtgaagtc
gccaaacctc 16800 tctgagcccc agtcattgct agtaagacct gcctttgagt
tggtatgatg ttcaagttag 16860 ataacaaaat gtttataccc attagaacag
agaataaata gaactacatt tcttgcactt 16920 atgagctttc tgtgaatcag
acatccctat gaagtacctc ccctggctgt ttctcattta 16980 ctcactgtag
cagcactgcg atgtgtgagt atatctgctg tgctcttaaa ctccaaatct 17040
gaggaaactg aggctcagag aggctactgg tctcccacaa tgtcacacag ctcataagtg
17100 gcaaagctgg cttgatgggc tacttgttcc tctgaaccat accacctcac
cacactctcc 17160 ccttcgaggg tcacgctaaa cttctgcaga ggtaattcct
ccttaaacca gaagggttgc 17220 tggtggccca cagctcacgc ctagcacact
tcatgagaaa aacaccctgt gcccagtgtg 17280 gagcaggcat tgagctgaag
gtggtgagca gaagctcatc caccagatgt tgacacagcc 17340 cgcagccttg
ggcgacccac aggactcctc ttatttaact ggcatttggt aggagaacag 17400
gggcagagtc aaagacaagt tggctttctg gagagcccag ggcagggaag gaggtggcag
17460 cgctgagggc ggtcacctta gacaccatcg ttttactttg aagaattgtc
tgtcacacac 17520 gagttgacag tcaggatggg agagacccca ttcaaactag
cataacctcc cagagggaat 17580 tcctgggctc ccctgggaat caacagggat
cagtcaagga tgggcagagt gtcatgacaa 17640 cctcattatg aggaagacaa
atatatgtca caagtccgtg atgggacaac cataagacct 17700 cagcttcact
gtatcttcca gagttttaaa aaaatgtatt cactgtccaa cgtgatcctc 17760
cagacaggtt ctgcaggacg cagcctagga ctcattatcc ccaaagtaca catggggaaa
17820 ctcaggccca gcaggtcaaa tgctctgtcc agtgtgggcc tggaaggcag
gtcttctcca 17880 ctgttaggcc tggctgtccc caacagcaca tacttcctca
gtccatatgg gatcacgata 17940 aacaactcca tcctccagga ccacactgca
tcaacctgct gtgccctaac atcagctgaa 18000 ggccaagctg cggggcaccc
tgggtgttcc aagtcacttt ccctctgcag gcaggaacct 18060 catcctgctc
tgaaacagat gagagggaaa cgcagaaaac agcttccagc tcagccagga 18120
accttagagt cctgaccttt tacctcgcct aggagtttgc aggggagaga acacacgaat
18180 ttcggatttt aagcctaaat aaaggaagcc ttagtttgaa gtgcaagctc
tgccggacag 18240 ggggcaccct gtgagcccca tttgttaaga ggacaatagt
cagagagctt ccaggctctc 18300 acaccagaaa caggaaatac agatttcaca
ctgatctcct tcccaggagc aacttgatcc 18360 tctccataaa tccgagcggg
aagcatttat ccaaacaaca aacaagcaaa catgagctgt 18420 gtatggggga
tagagagaat gaaacccagg tccatcccgg ggagaatgct ggtctatggc 18480
agtggggagc agtgaataaa tgaggcgtac atccatggat ctgggtggag agggtcaggg
18540 tgtaacccag gacctttcca gaggcatgag aaacagtcag cctacaccca
cagatgacct 18600 caaacacccc aagtgctcct tgaaaggctg aggcttttgt
gttgctcttg gttggattat 18660 tcacaggcaa tgaagtaaac aaggcacacc
acaggactca gaaccaggga cagcttccgc 18720 aggaacctgg gtcagttcta
aaaggacaaa tggaatgacc ctgagtagag aagtcagaga 18780 aaggcactct
cactgaggca aactccctcc ccagcaggga cccaggcagc aactcggaaa 18840
agcaggagtg tcactattgt atcatatggg agagggcagg ctgtgtgctc tcagggaagt
18900 tcctcaactt ctctgtgccg tagtttcctc atctgcaaaa tgtaaatcaa
atttgaggtt 18960 tcaatgcaat gacttatttc tctaaagttc cttgtccttg
tcccatgtag cccagaaatc 19020 ttcctctggc ctagttgtgg agcctggcct
aagtcgcaca ttgctggaga tggtgaagct 19080 gaccagcatg agaggtcagt
ttctagaagc ccaaatccca acaggcataa gcctcaccct 19140 ccaatatcag
ctctatcaga aacaaacaaa caaaaacatg tcttattcat ttgtcctttt 19200
cctcaaatgg gtggcacttg ggcagggcag aagggctggt tatccaagct tggaagatgc
19260 tgacagcaga cgcttcaatg gcagtaggag ttttctgatc actgtcattg
gtatcacgct 19320 tactgttgaa atcgtgacat caggaatgat gaaaggaact
agagtcagat ggtctggagc 19380 ggggaagtga ggagctgaaa cctccttcag
tctggttgct gtgtccccag ggtgggtaga 19440 tcccctctgt tcatcccaca
tgggacaagt agagcgggag aggaatcaac cctttctaaa 19500 gggttgaagc
attgagctgt gagcttctcg gttgctgcag cacaatcctt gcccatcctg 19560
actgaaacaa ccagaattca tgaaatgcat caaagaagtc ttcacctact acgcaagcct
19620 ggaagggtga ctaagatctg aaaaacaccg ggaaggctaa aggaactccc
acaaggaaac 19680 cccattagaa agttctagtt acaagatgct cagcacaggc
catgcagaaa tacgcccaga 19740 tccggtggtg agcaaggaac ggtaggaatg
tgagcactga gtcacgcagg agagactcat 19800 aggggctcaa gccagcaagg
ggacggcctc caccccacgc actgttggcc aacagcttcc 19860 aggggcattt
gctctcagaa gtcaaagctg attttccaca attgaagtgc tcactgtttg 19920
ggatgattta ggaacaacac caacaaaaag gaatgaacaa tcagagctaa tagaattgtg
19980 tttaaactct gctgggcttc 20000 <210> SEQ ID NO 3
<211> LENGTH: 52 <212> TYPE: DNA <213> ORGANISM:
Homo sapien <400> SEQUENCE: 3 tgcataaggc tgtgctgacc
atcgacaaga aagggactga agctgctggg gc 52 <210> SEQ ID NO 4
<211> LENGTH: 3199 <212> TYPE: DNA <213>
ORGANISM: Homo sapien <400> SEQUENCE: 4 tgggcaggaa ctgggcactg
tgcccagggc atgcactgcc tccacgcagc aaccctcaga 60 gtcctgagct
gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc ctagccgctg 120
ctgctgccag gaattccagg ttggaggggc ggcaacctcc tgccagcctt caggccactc
180 tcctgtgcct gccagaagag acagagcttg aggagagctt gaggagagca
ggaaaggaca 240 atgccgtctt ctgtctcgtg gggcatcctc ctgctggcag
gcctgtgctg cctggtccct 300 gtctccctgg ctgaggatcc ccagggagat
gctgcccaga agacagatac atcccaccat 360 gatcaggatc acccaacctt
caacaagatc acccccaacc tggctgagtt cgccttcagc 420 ctataccgcc
agctggcaca ccagtccaac agcaccaata tcttcttctc cccagtgagc 480
atcgctacag cctttgcaat gctctccctg gggaccaagg ctgacactca cgatgaaatc
540 ctggagggcc tgaatttcaa cctcacggag attccggagg ctcagatcca
tgaaggcttc 600 caggaactcc tccgtaccct caaccagcca gacagccagc
tccagctgac caccggcaat 660 ggcctgttcc tcagcgaggg cctgaagcta
gtggataagt ttttggagga tgttaaaaag 720 ttgtaccact cagaagcctt
cactgtcaac ttcggggaca ccgaagaggc caagaaacag 780 atcaacgatt
acgtggagaa gggtactcaa gggaaaattg tggatttggt caaggagctt 840
gacagagaca cagtttttgc tctggtgaat tacatcttct ttaaaggcaa atgggagaga
900 ccctttgaag tcaaggacac cgaggaagag gacttccacg tggaccaggt
gaccaccgtg 960 aaggtgccta tgatgaagcg tttaggcatg tttaacatcc
agcactgtaa gaagctgtcc 1020 agctgggtgc tgctgatgaa atacctgggc
aatgccaccg ccatcttctt cctgcctgat 1080 gaggggaaac tacagcacct
ggaaaatgaa ctcacccacg atatcatcac caagttcctg 1140 gaaaatgaag
acagaaggtc tgccagctta catttaccca aactgtccat tactggaacc 1200
tatgatctga agagcgtcct gggtcaactg ggcatcacta aggtcttcag caatggggct
1260 gacctctccg gggtcacaga ggaggcaccc ctgaagctct ccaaggccgt
gcataaggct 1320 gtgctgacca tcgacgagaa agggactgaa gctgctgggg
ccatgttttt agaggccata 1380 cccatgtcta tcccccccga ggtcaagttc
aacaaaccct ttgtcttctt aatgattgaa 1440 caaaatacca agtctcccct
cttcatggga aaagtggtga atcccaccca aaaataactg 1500 cctctcgctc
ctcaacccct cccctccatc cctggccccc tccctggatg acattaaaga 1560
agggttgagc tggtccctgc ctgcatgtga ctgtaaatcc ctcccatgtt ttctctgagt
1620 ctccctttgc ctgctgaggc tgtatgtggg ctccaggtaa cagtgctgtc
ttcgggcccc 1680 ctgaactgtg ttcatggagc atctggctgg gtaggcacat
gctgggcttg aatccagggg 1740 ggactgaatc ctcagcttac ggacctgggc
ccatctgttt ctggagggct ccagtcttcc 1800 ttgtcctgtc ttggagtccc
caagaaggaa tcacagggga ggaaccagat accagccatg 1860 accccaggct
ccaccaagca tcttcatgtc cccctgctca tcccccactc ccccccaccc 1920
agagttgctc atcctgccag ggctggctgt gcccacccca aggctgccct cctgggggcc
1980 ccagaactgc ctgatcgtgc cgtggcccag ttttgtggca tctgcagcaa
cacaagagag 2040 aggacaatgt cctcctcttg acccgctgtc acctaaccag
actcgggccc tgcacctctc 2100 aggcacttct ggaaaatgac tgaggcagat
tcttcctgaa gcccattctc catggggcaa 2160 caaggacacc tattctgtcc
ttgtccttcc atcgctgccc cagaaagcct cacatatctc 2220 cgtttagaat
caggtccctt ctccccagat gaagaggagg gtctctgctt tgttttctct 2280
atctcctcct cagacttgac caggcccagc aggccccaga agaccattac cctatatccc
2340 ttctcctccc tagtcacatg gccataggcc tgctgatggc tcaggaaggc
cattgcaagg 2400 actcctcagc tatgggagag gaagcacatc acccattgac
ccccgcaacc cctccctttc 2460 ctcctctgag tcccgactgg ggccacatgc
agcctgactt ctttgtgcct gttgctgtcc 2520 ctgcagtctt cagagggcca
ccgcagctcc agtgccacgg caggaggctg ttcctgaata 2580 gcccctgtgg
taagggccag gagagtcctt ccatcctcca aggccctgct aaaggacaca 2640
gcagccagga agtcccctgg gcccctagct gaaggacagc ctgctccctc cgtctctacc
2700 aggaatggcc ttgtcctatg gaaggcactg ccccatccca aactaatcta
ggaatcactg 2760 tctaaccact cactgtcatg aatgtgtact taaaggatga
ggttgagtca taccaaatag 2820 tgatttcgat agttcaaaat ggtgaaatta
gcaattctac atgattcagt ctaatcaatg 2880 gataccgact gtttcccaca
caagtctcct gttctcttaa gcttactcac tgacagcctt 2940 tcactctcca
caaatacatt aaagatatgg ccatcaccaa gccccctagg atgacaccag 3000
acctgagagt ctgaagacct ggatccaagt tctgactttt ccccctgaca gctgtgtgac
3060 cttcgtgaag tcgccaaacc tctctgagcc ccagtcattg ctagtaagac
ctgcctttga 3120 gttggtatga tgttcaagtt agataacaaa atgtttatac
ccattagaac agagaataaa 3180 tagaactaca tttcttgca 3199 <210>
SEQ ID NO 5 <211> LENGTH: 3513 <212> TYPE: DNA
<213> ORGANISM: Homo sapien <400> SEQUENCE: 5
tgggcaggaa ctgggcactg tgcccagggc atgcactgcc tccacgcagc aaccctcaga
60 gtcctgagct gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc
ctagccgctg 120 ctgctgccag gaattccagg ttggaggggc ggcaacctcc
tgccagcctt caggccactc 180 tcctgtgcct gccagaagag acagagcttg
aggagagctt gaggagagca ggaaagggcg 240 gcagtaagtc ttcagcatca
ggcattttgg ggtgactcag taaatggtag atcttgctac 300 cagtggaaca
gccactaagg attctgcagt gagagcagag ggccagctaa gtggtactct 360
cccagagact gtctgactca cgccaccccc tccaccttgg acacaggacg ctgtggtttc
420 tgagccaggt acaatgactc ctttcgcagc ctcccccgtt gcccctctgg
atccactgct 480 taaatacgga cgaggacagg gccctgtctc ctcagcttca
ggcaccacca ctgacctggg 540 acagtgaatc gacaatgccg tcttctgtct
cgtggggcat cctcctgctg gcaggcctgt 600 gctgcctggt ccctgtctcc
ctggctgagg atccccaggg agatgctgcc cagaagacag 660 atacatccca
ccatgatcag gatcacccaa ccttcaacaa gatcaccccc aacctggctg 720
agttcgcctt cagcctatac cgccagctgg cacaccagtc caacagcacc aatatcttct
780 tctccccagt gagcatcgct acagcctttg caatgctctc cctggggacc
aaggctgaca 840 ctcacgatga aatcctggag ggcctgaatt tcaacctcac
ggagattccg gaggctcaga 900 tccatgaagg cttccaggaa ctcctccgta
ccctcaacca gccagacagc cagctccagc 960 tgaccaccgg caatggcctg
ttcctcagcg agggcctgaa gctagtggat aagtttttgg 1020 aggatgttaa
aaagttgtac cactcagaag ccttcactgt caacttcggg gacaccgaag 1080
aggccaagaa acagatcaac gattacgtgg agaagggtac tcaagggaaa attgtggatt
1140 tggtcaagga gcttgacaga gacacagttt ttgctctggt gaattacatc
ttctttaaag 1200 gcaaatggga gagacccttt gaagtcaagg acaccgagga
agaggacttc cacgtggacc 1260 aggtgaccac cgtgaaggtg cctatgatga
agcgtttagg catgtttaac atccagcact 1320 gtaagaagct gtccagctgg
gtgctgctga tgaaatacct gggcaatgcc accgccatct 1380 tcttcctgcc
tgatgagggg aaactacagc acctggaaaa tgaactcacc cacgatatca 1440
tcaccaagtt cctggaaaat gaagacagaa ggtctgccag cttacattta cccaaactgt
1500 ccattactgg aacctatgat ctgaagagcg tcctgggtca actgggcatc
actaaggtct 1560 tcagcaatgg ggctgacctc tccggggtca cagaggaggc
acccctgaag ctctccaagg 1620 ccgtgcataa ggctgtgctg accatcgacg
agaaagggac tgaagctgct ggggccatgt 1680 ttttagaggc catacccatg
tctatccccc ccgaggtcaa gttcaacaaa ccctttgtct 1740 tcttaatgat
tgaacaaaat accaagtctc ccctcttcat gggaaaagtg gtgaatccca 1800
cccaaaaata actgcctctc gctcctcaac ccctcccctc catccctggc cccctccctg
1860 gatgacatta aagaagggtt gagctggtcc ctgcctgcat gtgactgtaa
atccctccca 1920 tgttttctct gagtctccct ttgcctgctg aggctgtatg
tgggctccag gtaacagtgc 1980 tgtcttcggg ccccctgaac tgtgttcatg
gagcatctgg ctgggtaggc acatgctggg 2040 cttgaatcca ggggggactg
aatcctcagc ttacggacct gggcccatct gtttctggag 2100 ggctccagtc
ttccttgtcc tgtcttggag tccccaagaa ggaatcacag gggaggaacc 2160
agataccagc catgacccca ggctccacca agcatcttca tgtccccctg ctcatccccc
2220 actccccccc acccagagtt gctcatcctg ccagggctgg ctgtgcccac
cccaaggctg 2280 ccctcctggg ggccccagaa ctgcctgatc gtgccgtggc
ccagttttgt ggcatctgca 2340 gcaacacaag agagaggaca atgtcctcct
cttgacccgc tgtcacctaa ccagactcgg 2400 gccctgcacc tctcaggcac
ttctggaaaa tgactgaggc agattcttcc tgaagcccat 2460 tctccatggg
gcaacaagga cacctattct gtccttgtcc ttccatcgct gccccagaaa 2520
gcctcacata tctccgttta gaatcaggtc ccttctcccc agatgaagag gagggtctct
2580 gctttgtttt ctctatctcc tcctcagact tgaccaggcc cagcaggccc
cagaagacca 2640 ttaccctata tcccttctcc tccctagtca catggccata
ggcctgctga tggctcagga 2700 aggccattgc aaggactcct cagctatggg
agaggaagca catcacccat tgacccccgc 2760 aacccctccc tttcctcctc
tgagtcccga ctggggccac atgcagcctg acttctttgt 2820 gcctgttgct
gtccctgcag tcttcagagg gccaccgcag ctccagtgcc acggcaggag 2880
gctgttcctg aatagcccct gtggtaaggg ccaggagagt ccttccatcc tccaaggccc
2940 tgctaaagga cacagcagcc aggaagtccc ctgggcccct agctgaagga
cagcctgctc 3000 cctccgtctc taccaggaat ggccttgtcc tatggaaggc
actgccccat cccaaactaa 3060 tctaggaatc actgtctaac cactcactgt
catgaatgtg tacttaaagg atgaggttga 3120 gtcataccaa atagtgattt
cgatagttca aaatggtgaa attagcaatt ctacatgatt 3180 cagtctaatc
aatggatacc gactgtttcc cacacaagtc tcctgttctc ttaagcttac 3240
tcactgacag cctttcactc tccacaaata cattaaagat atggccatca ccaagccccc
3300 taggatgaca ccagacctga gagtctgaag acctggatcc aagttctgac
ttttccccct 3360 gacagctgtg tgaccttcgt gaagtcgcca aacctctctg
agccccagtc attgctagta 3420 agacctgcct ttgagttggt atgatgttca
agttagataa caaaatgttt atacccatta 3480 gaacagagaa taaatagaac
tacatttctt gca 3513 <210> SEQ ID NO 6 <211> LENGTH:
3236 <212> TYPE: DNA <213> ORGANISM: Homo sapien
<400> SEQUENCE: 6 tgggcaggaa ctgggcactg tgcccagggc atgcactgcc
tccacgcagc aaccctcaga 60 gtcctgagct gaaccaagaa ggaggagggg
gtcgggcctc cgaggaaggc ctagccgctg 120 ctgctgccag gaattccagg
ttggaggggc ggcaacctcc tgccagcctt caggccactc 180 tcctgtgcct
gccagaagag acagagcttg aggagagctt gaggagagca ggaaaggtgg 240
gacattgctg ctgctgctca ctcagttcca caggacaatg ccgtcttctg tctcgtgggg
300 catcctcctg ctggcaggcc tgtgctgcct ggtccctgtc tccctggctg
aggatcccca 360 gggagatgct gcccagaaga cagatacatc ccaccatgat
caggatcacc caaccttcaa 420 caagatcacc cccaacctgg ctgagttcgc
cttcagccta taccgccagc tggcacacca 480 gtccaacagc accaatatct
tcttctcccc agtgagcatc gctacagcct ttgcaatgct 540 ctccctgggg
accaaggctg acactcacga tgaaatcctg gagggcctga atttcaacct 600
cacggagatt ccggaggctc agatccatga aggcttccag gaactcctcc gtaccctcaa
660 ccagccagac agccagctcc agctgaccac cggcaatggc ctgttcctca
gcgagggcct 720 gaagctagtg gataagtttt tggaggatgt taaaaagttg
taccactcag aagccttcac 780 tgtcaacttc ggggacaccg aagaggccaa
gaaacagatc aacgattacg tggagaaggg 840 tactcaaggg aaaattgtgg
atttggtcaa ggagcttgac agagacacag tttttgctct 900 ggtgaattac
atcttcttta aaggcaaatg ggagagaccc tttgaagtca aggacaccga 960
ggaagaggac ttccacgtgg accaggtgac caccgtgaag gtgcctatga tgaagcgttt
1020 aggcatgttt aacatccagc actgtaagaa gctgtccagc tgggtgctgc
tgatgaaata 1080 cctgggcaat gccaccgcca tcttcttcct gcctgatgag
gggaaactac agcacctgga 1140 aaatgaactc acccacgata tcatcaccaa
gttcctggaa aatgaagaca gaaggtctgc 1200 cagcttacat ttacccaaac
tgtccattac tggaacctat gatctgaaga gcgtcctggg 1260 tcaactgggc
atcactaagg tcttcagcaa tggggctgac ctctccgggg tcacagagga 1320
ggcacccctg aagctctcca aggccgtgca taaggctgtg ctgaccatcg acgagaaagg
1380 gactgaagct gctggggcca tgtttttaga ggccataccc atgtctatcc
cccccgaggt 1440 caagttcaac aaaccctttg tcttcttaat gattgaacaa
aataccaagt ctcccctctt 1500 catgggaaaa gtggtgaatc ccacccaaaa
ataactgcct ctcgctcctc aacccctccc 1560 ctccatccct ggccccctcc
ctggatgaca ttaaagaagg gttgagctgg tccctgcctg 1620 catgtgactg
taaatccctc ccatgttttc tctgagtctc cctttgcctg ctgaggctgt 1680
atgtgggctc caggtaacag tgctgtcttc gggccccctg aactgtgttc atggagcatc
1740 tggctgggta ggcacatgct gggcttgaat ccagggggga ctgaatcctc
agcttacgga 1800 cctgggccca tctgtttctg gagggctcca gtcttccttg
tcctgtcttg gagtccccaa 1860 gaaggaatca caggggagga accagatacc
agccatgacc ccaggctcca ccaagcatct 1920 tcatgtcccc ctgctcatcc
cccactcccc cccacccaga gttgctcatc ctgccagggc 1980 tggctgtgcc
caccccaagg ctgccctcct gggggcccca gaactgcctg atcgtgccgt 2040
ggcccagttt tgtggcatct gcagcaacac aagagagagg acaatgtcct cctcttgacc
2100 cgctgtcacc taaccagact cgggccctgc acctctcagg cacttctgga
aaatgactga 2160 ggcagattct tcctgaagcc cattctccat ggggcaacaa
ggacacctat tctgtccttg 2220 tccttccatc gctgccccag aaagcctcac
atatctccgt ttagaatcag gtcccttctc 2280 cccagatgaa gaggagggtc
tctgctttgt tttctctatc tcctcctcag acttgaccag 2340 gcccagcagg
ccccagaaga ccattaccct atatcccttc tcctccctag tcacatggcc 2400
ataggcctgc tgatggctca ggaaggccat tgcaaggact cctcagctat gggagaggaa
2460 gcacatcacc cattgacccc cgcaacccct ccctttcctc ctctgagtcc
cgactggggc 2520 cacatgcagc ctgacttctt tgtgcctgtt gctgtccctg
cagtcttcag agggccaccg 2580 cagctccagt gccacggcag gaggctgttc
ctgaatagcc cctgtggtaa gggccaggag 2640 agtccttcca tcctccaagg
ccctgctaaa ggacacagca gccaggaagt cccctgggcc 2700 cctagctgaa
ggacagcctg ctccctccgt ctctaccagg aatggccttg tcctatggaa 2760
ggcactgccc catcccaaac taatctagga atcactgtct aaccactcac tgtcatgaat
2820 gtgtacttaa aggatgaggt tgagtcatac caaatagtga tttcgatagt
tcaaaatggt 2880 gaaattagca attctacatg attcagtcta atcaatggat
accgactgtt tcccacacaa 2940 gtctcctgtt ctcttaagct tactcactga
cagcctttca ctctccacaa atacattaaa 3000 gatatggcca tcaccaagcc
ccctaggatg acaccagacc tgagagtctg aagacctgga 3060 tccaagttct
gacttttccc cctgacagct gtgtgacctt cgtgaagtcg ccaaacctct 3120
ctgagcccca gtcattgcta gtaagacctg cctttgagtt ggtatgatgt tcaagttaga
3180 taacaaaatg tttataccca ttagaacaga gaataaatag aactacattt cttgca
3236 <210> SEQ ID NO 7 <211> LENGTH: 3532 <212>
TYPE: DNA <213> ORGANISM: Homo sapien <400> SEQUENCE: 7
tgggcaggaa ctgggcactg tgcccagggc atgcactgcc tccacgcagc aaccctcaga
60 gtcctgagct gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc
ctagccgctg 120 ctgctgccag gaattccagg ttggaggggc ggcaacctcc
tgccagcctt caggccactc 180 tcctgtgcct gccagaagag acagagcttg
aggagagctt gaggagagca ggaaaggtgg 240 gacattgctg ctgctgctca
ctcagttcca cagggcggca gtaagtcttc agcatcaggc 300 attttggggt
gactcagtaa atggtagatc ttgctaccag tggaacagcc actaaggatt 360
ctgcagtgag agcagagggc cagctaagtg gtactctccc agagactgtc tgactcacgc
420 caccccctcc accttggaca caggacgctg tggtttctga gccagcagcc
tcccccgttg 480 cccctctgga tccactgctt aaatacggac gaggacaggg
ccctgtctcc tcagcttcag 540 gcaccaccac tgacctggga cagtgaatcg
acaatgccgt cttctgtctc gtggggcatc 600 ctcctgctgg caggcctgtg
ctgcctggtc cctgtctccc tggctgagga tccccaggga 660 gatgctgccc
agaagacaga tacatcccac catgatcagg atcacccaac cttcaacaag 720
atcaccccca acctggctga gttcgccttc agcctatacc gccagctggc acaccagtcc
780 aacagcacca atatcttctt ctccccagtg agcatcgcta cagcctttgc
aatgctctcc 840 ctggggacca aggctgacac tcacgatgaa atcctggagg
gcctgaattt caacctcacg 900 gagattccgg aggctcagat ccatgaaggc
ttccaggaac tcctccgtac cctcaaccag 960 ccagacagcc agctccagct
gaccaccggc aatggcctgt tcctcagcga gggcctgaag 1020 ctagtggata
agtttttgga ggatgttaaa aagttgtacc actcagaagc cttcactgtc 1080
aacttcgggg acaccgaaga ggccaagaaa cagatcaacg attacgtgga gaagggtact
1140 caagggaaaa ttgtggattt ggtcaaggag cttgacagag acacagtttt
tgctctggtg 1200 aattacatct tctttaaagg caaatgggag agaccctttg
aagtcaagga caccgaggaa 1260 gaggacttcc acgtggacca ggtgaccacc
gtgaaggtgc ctatgatgaa gcgtttaggc 1320 atgtttaaca tccagcactg
taagaagctg tccagctggg tgctgctgat gaaatacctg 1380 ggcaatgcca
ccgccatctt cttcctgcct gatgagggga aactacagca cctggaaaat 1440
gaactcaccc acgatatcat caccaagttc ctggaaaatg aagacagaag gtctgccagc
1500 ttacatttac ccaaactgtc cattactgga acctatgatc tgaagagcgt
cctgggtcaa 1560 ctgggcatca ctaaggtctt cagcaatggg gctgacctct
ccggggtcac agaggaggca 1620 cccctgaagc tctccaaggc cgtgcataag
gctgtgctga ccatcgacga gaaagggact 1680 gaagctgctg gggccatgtt
tttagaggcc atacccatgt ctatcccccc cgaggtcaag 1740 ttcaacaaac
cctttgtctt cttaatgatt gaacaaaata ccaagtctcc cctcttcatg 1800
ggaaaagtgg tgaatcccac ccaaaaataa ctgcctctcg ctcctcaacc cctcccctcc
1860 atccctggcc ccctccctgg atgacattaa agaagggttg agctggtccc
tgcctgcatg 1920 tgactgtaaa tccctcccat gttttctctg agtctccctt
tgcctgctga ggctgtatgt 1980 gggctccagg taacagtgct gtcttcgggc
cccctgaact gtgttcatgg agcatctggc 2040 tgggtaggca catgctgggc
ttgaatccag gggggactga atcctcagct tacggacctg 2100 ggcccatctg
tttctggagg gctccagtct tccttgtcct gtcttggagt ccccaagaag 2160
gaatcacagg ggaggaacca gataccagcc atgaccccag gctccaccaa gcatcttcat
2220 gtccccctgc tcatccccca ctccccccca cccagagttg ctcatcctgc
cagggctggc 2280 tgtgcccacc ccaaggctgc cctcctgggg gccccagaac
tgcctgatcg tgccgtggcc 2340 cagttttgtg gcatctgcag caacacaaga
gagaggacaa tgtcctcctc ttgacccgct 2400 gtcacctaac cagactcggg
ccctgcacct ctcaggcact tctggaaaat gactgaggca 2460 gattcttcct
gaagcccatt ctccatgggg caacaaggac acctattctg tccttgtcct 2520
tccatcgctg ccccagaaag cctcacatat ctccgtttag aatcaggtcc cttctcccca
2580 gatgaagagg agggtctctg ctttgttttc tctatctcct cctcagactt
gaccaggccc 2640 agcaggcccc agaagaccat taccctatat cccttctcct
ccctagtcac atggccatag 2700 gcctgctgat ggctcaggaa ggccattgca
aggactcctc agctatggga gaggaagcac 2760 atcacccatt gacccccgca
acccctccct ttcctcctct gagtcccgac tggggccaca 2820 tgcagcctga
cttctttgtg cctgttgctg tccctgcagt cttcagaggg ccaccgcagc 2880
tccagtgcca cggcaggagg ctgttcctga atagcccctg tggtaagggc caggagagtc
2940 cttccatcct ccaaggccct gctaaaggac acagcagcca ggaagtcccc
tgggccccta 3000 gctgaaggac agcctgctcc ctccgtctct accaggaatg
gccttgtcct atggaaggca 3060 ctgccccatc ccaaactaat ctaggaatca
ctgtctaacc actcactgtc atgaatgtgt 3120 acttaaagga tgaggttgag
tcataccaaa tagtgatttc gatagttcaa aatggtgaaa 3180 ttagcaattc
tacatgattc agtctaatca atggataccg actgtttccc acacaagtct 3240
cctgttctct taagcttact cactgacagc ctttcactct ccacaaatac attaaagata
3300 tggccatcac caagccccct aggatgacac cagacctgag agtctgaaga
cctggatcca 3360 agttctgact tttccccctg acagctgtgt gaccttcgtg
aagtcgccaa acctctctga 3420 gccccagtca ttgctagtaa gacctgcctt
tgagttggta tgatgttcaa gttagataac 3480 aaaatgttta tacccattag
aacagagaat aaatagaact acatttcttg ca 3532 <210> SEQ ID NO 8
<211> LENGTH: 3340 <212> TYPE: DNA <213>
ORGANISM: Homo sapien <400> SEQUENCE: 8 tgggcaggaa ctgggcactg
tgcccagggc atgcactgcc tccacgcagc aaccctcaga 60 gtcctgagct
gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc ctagccgctg 120
ctgctgccag gaattccagg ttggaggggc ggcaacctcc tgccagcctt caggccactc
180 tcctgtgcct gccagaagag acagagcttg aggagagctt gaggagagca
ggaaaggtgg 240 gacattgctg ctgctgctca ctcagttcca cagcagcctc
ccccgttgcc cctctggatc 300 cactgcttaa atacggacga ggacagggcc
ctgtctcctc agcttcaggc accaccactg 360 acctgggaca gtgaatcgac
aatgccgtct tctgtctcgt ggggcatcct cctgctggca 420 ggcctgtgct
gcctggtccc tgtctccctg gctgaggatc cccagggaga tgctgcccag 480
aagacagata catcccacca tgatcaggat cacccaacct tcaacaagat cacccccaac
540 ctggctgagt tcgccttcag cctataccgc cagctggcac accagtccaa
cagcaccaat 600 atcttcttct ccccagtgag catcgctaca gcctttgcaa
tgctctccct ggggaccaag 660 gctgacactc acgatgaaat cctggagggc
ctgaatttca acctcacgga gattccggag 720 gctcagatcc atgaaggctt
ccaggaactc ctccgtaccc tcaaccagcc agacagccag 780 ctccagctga
ccaccggcaa tggcctgttc ctcagcgagg gcctgaagct agtggataag 840
tttttggagg atgttaaaaa gttgtaccac tcagaagcct tcactgtcaa cttcggggac
900 accgaagagg ccaagaaaca gatcaacgat tacgtggaga agggtactca
agggaaaatt 960 gtggatttgg tcaaggagct tgacagagac acagtttttg
ctctggtgaa ttacatcttc 1020 tttaaaggca aatgggagag accctttgaa
gtcaaggaca ccgaggaaga ggacttccac 1080 gtggaccagg tgaccaccgt
gaaggtgcct atgatgaagc gtttaggcat gtttaacatc 1140 cagcactgta
agaagctgtc cagctgggtg ctgctgatga aatacctggg caatgccacc 1200
gccatcttct tcctgcctga tgaggggaaa ctacagcacc tggaaaatga actcacccac
1260 gatatcatca ccaagttcct ggaaaatgaa gacagaaggt ctgccagctt
acatttaccc 1320 aaactgtcca ttactggaac ctatgatctg aagagcgtcc
tgggtcaact gggcatcact 1380 aaggtcttca gcaatggggc tgacctctcc
ggggtcacag aggaggcacc cctgaagctc 1440 tccaaggccg tgcataaggc
tgtgctgacc atcgacgaga aagggactga agctgctggg 1500 gccatgtttt
tagaggccat acccatgtct atcccccccg aggtcaagtt caacaaaccc 1560
tttgtcttct taatgattga acaaaatacc aagtctcccc tcttcatggg aaaagtggtg
1620 aatcccaccc aaaaataact gcctctcgct cctcaacccc tcccctccat
ccctggcccc 1680 ctccctggat gacattaaag aagggttgag ctggtccctg
cctgcatgtg actgtaaatc 1740 cctcccatgt tttctctgag tctccctttg
cctgctgagg ctgtatgtgg gctccaggta 1800 acagtgctgt cttcgggccc
cctgaactgt gttcatggag catctggctg ggtaggcaca 1860 tgctgggctt
gaatccaggg gggactgaat cctcagctta cggacctggg cccatctgtt 1920
tctggagggc tccagtcttc cttgtcctgt cttggagtcc ccaagaagga atcacagggg
1980 aggaaccaga taccagccat gaccccaggc tccaccaagc atcttcatgt
ccccctgctc 2040 atcccccact cccccccacc cagagttgct catcctgcca
gggctggctg tgcccacccc 2100 aaggctgccc tcctgggggc cccagaactg
cctgatcgtg ccgtggccca gttttgtggc 2160 atctgcagca acacaagaga
gaggacaatg tcctcctctt gacccgctgt cacctaacca 2220 gactcgggcc
ctgcacctct caggcacttc tggaaaatga ctgaggcaga ttcttcctga 2280
agcccattct ccatggggca acaaggacac ctattctgtc cttgtccttc catcgctgcc
2340 ccagaaagcc tcacatatct ccgtttagaa tcaggtccct tctccccaga
tgaagaggag 2400 ggtctctgct ttgttttctc tatctcctcc tcagacttga
ccaggcccag caggccccag 2460 aagaccatta ccctatatcc cttctcctcc
ctagtcacat ggccataggc ctgctgatgg 2520 ctcaggaagg ccattgcaag
gactcctcag ctatgggaga ggaagcacat cacccattga 2580 cccccgcaac
ccctcccttt cctcctctga gtcccgactg gggccacatg cagcctgact 2640
tctttgtgcc tgttgctgtc cctgcagtct tcagagggcc accgcagctc cagtgccacg
2700 gcaggaggct gttcctgaat agcccctgtg gtaagggcca ggagagtcct
tccatcctcc 2760 aaggccctgc taaaggacac agcagccagg aagtcccctg
ggcccctagc tgaaggacag 2820 cctgctccct ccgtctctac caggaatggc
cttgtcctat ggaaggcact gccccatccc 2880 aaactaatct aggaatcact
gtctaaccac tcactgtcat gaatgtgtac ttaaaggatg 2940 aggttgagtc
ataccaaata gtgatttcga tagttcaaaa tggtgaaatt agcaattcta 3000
catgattcag tctaatcaat ggataccgac tgtttcccac acaagtctcc tgttctctta
3060 agcttactca ctgacagcct ttcactctcc acaaatacat taaagatatg
gccatcacca 3120 agccccctag gatgacacca gacctgagag tctgaagacc
tggatccaag ttctgacttt 3180 tccccctgac agctgtgtga ccttcgtgaa
gtcgccaaac ctctctgagc cccagtcatt 3240 gctagtaaga cctgcctttg
agttggtatg atgttcaagt tagataacaa aatgtttata 3300 cccattagaa
cagagaataa atagaactac atttcttgca 3340 <210> SEQ ID NO 9
<211> LENGTH: 3495 <212> TYPE: DNA <213>
ORGANISM: Homo sapien <400> SEQUENCE: 9 tgggcaggaa ctgggcactg
tgcccagggc atgcactgcc tccacgcagc aaccctcaga 60 gtcctgagct
gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc ctagccgctg 120
ctgctgccag gaattccagg ttggaggggc ggcaacctcc tgccagcctt caggccactc
180 tcctgtgcct gccagaagag acagagcttg aggagagctt gaggagagca
ggaaagggcg 240 gcagtaagtc ttcagcatca ggcattttgg ggtgactcag
taaatggtag atcttgctac 300 cagtggaaca gccactaagg attctgcagt
gagagcagag ggccagctaa gtggtactct 360 cccagagact gtctgactca
cgccaccccc tccaccttgg acacaggacg ctgtggtttc 420 tgagccagca
gcctcccccg ttgcccctct ggatccactg cttaaatacg gacgaggaca 480
gggccctgtc tcctcagctt caggcaccac cactgacctg ggacagtgaa tcgacaatgc
540 cgtcttctgt ctcgtggggc atcctcctgc tggcaggcct gtgctgcctg
gtccctgtct 600 ccctggctga ggatccccag ggagatgctg cccagaagac
agatacatcc caccatgatc 660 aggatcaccc aaccttcaac aagatcaccc
ccaacctggc tgagttcgcc ttcagcctat 720 accgccagct ggcacaccag
tccaacagca ccaatatctt cttctcccca gtgagcatcg 780 ctacagcctt
tgcaatgctc tccctgggga ccaaggctga cactcacgat gaaatcctgg 840
agggcctgaa tttcaacctc acggagattc cggaggctca gatccatgaa ggcttccagg
900 aactcctccg taccctcaac cagccagaca gccagctcca gctgaccacc
ggcaatggcc 960 tgttcctcag cgagggcctg aagctagtgg ataagttttt
ggaggatgtt aaaaagttgt 1020 accactcaga agccttcact gtcaacttcg
gggacaccga agaggccaag aaacagatca 1080 acgattacgt ggagaagggt
actcaaggga aaattgtgga tttggtcaag gagcttgaca 1140 gagacacagt
ttttgctctg gtgaattaca tcttctttaa aggcaaatgg gagagaccct 1200
ttgaagtcaa ggacaccgag gaagaggact tccacgtgga ccaggtgacc accgtgaagg
1260 tgcctatgat gaagcgttta ggcatgttta acatccagca ctgtaagaag
ctgtccagct 1320 gggtgctgct gatgaaatac ctgggcaatg ccaccgccat
cttcttcctg cctgatgagg 1380 ggaaactaca gcacctggaa aatgaactca
cccacgatat catcaccaag ttcctggaaa 1440 atgaagacag aaggtctgcc
agcttacatt tacccaaact gtccattact ggaacctatg 1500 atctgaagag
cgtcctgggt caactgggca tcactaaggt cttcagcaat ggggctgacc 1560
tctccggggt cacagaggag gcacccctga agctctccaa ggccgtgcat aaggctgtgc
1620 tgaccatcga cgagaaaggg actgaagctg ctggggccat gtttttagag
gccataccca 1680 tgtctatccc ccccgaggtc aagttcaaca aaccctttgt
cttcttaatg attgaacaaa 1740 ataccaagtc tcccctcttc atgggaaaag
tggtgaatcc cacccaaaaa taactgcctc 1800 tcgctcctca acccctcccc
tccatccctg gccccctccc tggatgacat taaagaaggg 1860 ttgagctggt
ccctgcctgc atgtgactgt aaatccctcc catgttttct ctgagtctcc 1920
ctttgcctgc tgaggctgta tgtgggctcc aggtaacagt gctgtcttcg ggccccctga
1980 actgtgttca tggagcatct ggctgggtag gcacatgctg ggcttgaatc
caggggggac 2040 tgaatcctca gcttacggac ctgggcccat ctgtttctgg
agggctccag tcttccttgt 2100 cctgtcttgg agtccccaag aaggaatcac
aggggaggaa ccagatacca gccatgaccc 2160 caggctccac caagcatctt
catgtccccc tgctcatccc ccactccccc ccacccagag 2220 ttgctcatcc
tgccagggct ggctgtgccc accccaaggc tgccctcctg ggggccccag 2280
aactgcctga tcgtgccgtg gcccagtttt gtggcatctg cagcaacaca agagagagga
2340 caatgtcctc ctcttgaccc gctgtcacct aaccagactc gggccctgca
cctctcaggc 2400 acttctggaa aatgactgag gcagattctt cctgaagccc
attctccatg gggcaacaag 2460 gacacctatt ctgtccttgt ccttccatcg
ctgccccaga aagcctcaca tatctccgtt 2520 tagaatcagg tcccttctcc
ccagatgaag aggagggtct ctgctttgtt ttctctatct 2580 cctcctcaga
cttgaccagg cccagcaggc cccagaagac cattacccta tatcccttct 2640
cctccctagt cacatggcca taggcctgct gatggctcag gaaggccatt gcaaggactc
2700 ctcagctatg ggagaggaag cacatcaccc attgaccccc gcaacccctc
cctttcctcc 2760 tctgagtccc gactggggcc acatgcagcc tgacttcttt
gtgcctgttg ctgtccctgc 2820 agtcttcaga gggccaccgc agctccagtg
ccacggcagg aggctgttcc tgaatagccc 2880 ctgtggtaag ggccaggaga
gtccttccat cctccaaggc cctgctaaag gacacagcag 2940 ccaggaagtc
ccctgggccc ctagctgaag gacagcctgc tccctccgtc tctaccagga 3000
atggccttgt cctatggaag gcactgcccc atcccaaact aatctaggaa tcactgtcta
3060 accactcact gtcatgaatg tgtacttaaa ggatgaggtt gagtcatacc
aaatagtgat 3120 ttcgatagtt caaaatggtg aaattagcaa ttctacatga
ttcagtctaa tcaatggata 3180 ccgactgttt cccacacaag tctcctgttc
tcttaagctt actcactgac agcctttcac 3240 tctccacaaa tacattaaag
atatggccat caccaagccc cctaggatga caccagacct 3300 gagagtctga
agacctggat ccaagttctg acttttcccc ctgacagctg tgtgaccttc 3360
gtgaagtcgc caaacctctc tgagccccag tcattgctag taagacctgc ctttgagttg
3420 gtatgatgtt caagttagat aacaaaatgt ttatacccat tagaacagag
aataaataga 3480 actacatttc ttgca 3495 <210> SEQ ID NO 10
<211> LENGTH: 3492 <212> TYPE: DNA <213>
ORGANISM: Homo sapien <400> SEQUENCE: 10 tgggcaggaa
ctgggcactg tgcccagggc atgcactgcc tccacgcagc aaccctcaga 60
gtcctgagct gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc ctagccgctg
120 ctgctgccag gaattccagg ttggaggggc ggcaacctcc tgccagcctt
caggccactc 180 tcctgtgcct gccagaagag acagagcttg aggagagctt
gaggagagca ggaaagggcg 240 gcagtaagtc ttcagcatca ggcattttgg
ggtgactcag taaatggtag atcttgctac 300 cagtggaaca gccactaagg
attctgcagt gagagcagag ggccagctaa gtggtactct 360 cccagagact
gtctgactca cgccaccccc tccaccttgg acacaggacg ctgtggtttc 420
tgagccagcc tcccccgttg cccctctgga tccactgctt aaatacggac gaggacaggg
480 ccctgtctcc tcagcttcag gcaccaccac tgacctggga cagtgaatcg
acaatgccgt 540 cttctgtctc gtggggcatc ctcctgctgg caggcctgtg
ctgcctggtc cctgtctccc 600 tggctgagga tccccaggga gatgctgccc
agaagacaga tacatcccac catgatcagg 660 atcacccaac cttcaacaag
atcaccccca acctggctga gttcgccttc agcctatacc 720 gccagctggc
acaccagtcc aacagcacca atatcttctt ctccccagtg agcatcgcta 780
cagcctttgc aatgctctcc ctggggacca aggctgacac tcacgatgaa atcctggagg
840 gcctgaattt caacctcacg gagattccgg aggctcagat ccatgaaggc
ttccaggaac 900 tcctccgtac cctcaaccag ccagacagcc agctccagct
gaccaccggc aatggcctgt 960 tcctcagcga gggcctgaag ctagtggata
agtttttgga ggatgttaaa aagttgtacc 1020 actcagaagc cttcactgtc
aacttcgggg acaccgaaga ggccaagaaa cagatcaacg 1080 attacgtgga
gaagggtact caagggaaaa ttgtggattt ggtcaaggag cttgacagag 1140
acacagtttt tgctctggtg aattacatct tctttaaagg caaatgggag agaccctttg
1200 aagtcaagga caccgaggaa gaggacttcc acgtggacca ggtgaccacc
gtgaaggtgc 1260 ctatgatgaa gcgtttaggc atgtttaaca tccagcactg
taagaagctg tccagctggg 1320 tgctgctgat gaaatacctg ggcaatgcca
ccgccatctt cttcctgcct gatgagggga 1380 aactacagca cctggaaaat
gaactcaccc acgatatcat caccaagttc ctggaaaatg 1440 aagacagaag
gtctgccagc ttacatttac ccaaactgtc cattactgga acctatgatc 1500
tgaagagcgt cctgggtcaa ctgggcatca ctaaggtctt cagcaatggg gctgacctct
1560 ccggggtcac agaggaggca cccctgaagc tctccaaggc cgtgcataag
gctgtgctga 1620 ccatcgacga gaaagggact gaagctgctg gggccatgtt
tttagaggcc atacccatgt 1680 ctatcccccc cgaggtcaag ttcaacaaac
cctttgtctt cttaatgatt gaacaaaata 1740 ccaagtctcc cctcttcatg
ggaaaagtgg tgaatcccac ccaaaaataa ctgcctctcg 1800 ctcctcaacc
cctcccctcc atccctggcc ccctccctgg atgacattaa agaagggttg 1860
agctggtccc tgcctgcatg tgactgtaaa tccctcccat gttttctctg agtctccctt
1920 tgcctgctga ggctgtatgt gggctccagg taacagtgct gtcttcgggc
cccctgaact 1980 gtgttcatgg agcatctggc tgggtaggca catgctgggc
ttgaatccag gggggactga 2040 atcctcagct tacggacctg ggcccatctg
tttctggagg gctccagtct tccttgtcct 2100 gtcttggagt ccccaagaag
gaatcacagg ggaggaacca gataccagcc atgaccccag 2160 gctccaccaa
gcatcttcat gtccccctgc tcatccccca ctccccccca cccagagttg 2220
ctcatcctgc cagggctggc tgtgcccacc ccaaggctgc cctcctgggg gccccagaac
2280 tgcctgatcg tgccgtggcc cagttttgtg gcatctgcag caacacaaga
gagaggacaa 2340 tgtcctcctc ttgacccgct gtcacctaac cagactcggg
ccctgcacct ctcaggcact 2400 tctggaaaat gactgaggca gattcttcct
gaagcccatt ctccatgggg caacaaggac 2460 acctattctg tccttgtcct
tccatcgctg ccccagaaag cctcacatat ctccgtttag 2520 aatcaggtcc
cttctcccca gatgaagagg agggtctctg ctttgttttc tctatctcct 2580
cctcagactt gaccaggccc agcaggcccc agaagaccat taccctatat cccttctcct
2640 ccctagtcac atggccatag gcctgctgat ggctcaggaa ggccattgca
aggactcctc 2700 agctatggga gaggaagcac atcacccatt gacccccgca
acccctccct ttcctcctct 2760 gagtcccgac tggggccaca tgcagcctga
cttctttgtg cctgttgctg tccctgcagt 2820 cttcagaggg ccaccgcagc
tccagtgcca cggcaggagg ctgttcctga atagcccctg 2880 tggtaagggc
caggagagtc cttccatcct ccaaggccct gctaaaggac acagcagcca 2940
ggaagtcccc tgggccccta gctgaaggac agcctgctcc ctccgtctct accaggaatg
3000 gccttgtcct atggaaggca ctgccccatc ccaaactaat ctaggaatca
ctgtctaacc 3060 actcactgtc atgaatgtgt acttaaagga tgaggttgag
tcataccaaa tagtgatttc 3120 gatagttcaa aatggtgaaa ttagcaattc
tacatgattc agtctaatca atggataccg 3180 actgtttccc acacaagtct
cctgttctct taagcttact cactgacagc ctttcactct 3240 ccacaaatac
attaaagata tggccatcac caagccccct aggatgacac cagacctgag 3300
agtctgaaga cctggatcca agttctgact tttccccctg acagctgtgt gaccttcgtg
3360 aagtcgccaa acctctctga gccccagtca ttgctagtaa gacctgcctt
tgagttggta 3420 tgatgttcaa gttagataac aaaatgttta tacccattag
aacagagaat aaatagaact 3480 acatttcttg ca 3492 <210> SEQ ID NO
11 <211> LENGTH: 3510 <212> TYPE: DNA <213>
ORGANISM: Homo sapien <400> SEQUENCE: 11 tgggcaggaa
ctgggcactg tgcccagggc atgcactgcc tccacgcagc aaccctcaga 60
gtcctgagct gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc ctagccgctg
120 ctgctgccag gaattccagg ttggaggggc ggcaacctcc tgccagcctt
caggccactc 180 tcctgtgcct gccagaagag acagagcttg aggagagctt
gaggagagca ggaaagggcg 240 gcagtaagtc ttcagcatca ggcattttgg
ggtgactcag taaatggtag atcttgctac 300 cagtggaaca gccactaagg
attctgcagt gagagcagag ggccagctaa gtggtactct 360 cccagagact
gtctgactca cgccaccccc tccaccttgg acacaggacg ctgtggtttc 420
tgagccaggt acaatgactc ctttcgcctc ccccgttgcc cctctggatc cactgcttaa
480 atacggacga ggacagggcc ctgtctcctc agcttcaggc accaccactg
acctgggaca 540 gtgaatcgac aatgccgtct tctgtctcgt ggggcatcct
cctgctggca ggcctgtgct 600 gcctggtccc tgtctccctg gctgaggatc
cccagggaga tgctgcccag aagacagata 660 catcccacca tgatcaggat
cacccaacct tcaacaagat cacccccaac ctggctgagt 720 tcgccttcag
cctataccgc cagctggcac accagtccaa cagcaccaat atcttcttct 780
ccccagtgag catcgctaca gcctttgcaa tgctctccct ggggaccaag gctgacactc
840 acgatgaaat cctggagggc ctgaatttca acctcacgga gattccggag
gctcagatcc 900 atgaaggctt ccaggaactc ctccgtaccc tcaaccagcc
agacagccag ctccagctga 960 ccaccggcaa tggcctgttc ctcagcgagg
gcctgaagct agtggataag tttttggagg 1020 atgttaaaaa gttgtaccac
tcagaagcct tcactgtcaa cttcggggac accgaagagg 1080 ccaagaaaca
gatcaacgat tacgtggaga agggtactca agggaaaatt gtggatttgg 1140
tcaaggagct tgacagagac acagtttttg ctctggtgaa ttacatcttc tttaaaggca
1200 aatgggagag accctttgaa gtcaaggaca ccgaggaaga ggacttccac
gtggaccagg 1260 tgaccaccgt gaaggtgcct atgatgaagc gtttaggcat
gtttaacatc cagcactgta 1320 agaagctgtc cagctgggtg ctgctgatga
aatacctggg caatgccacc gccatcttct 1380 tcctgcctga tgaggggaaa
ctacagcacc tggaaaatga actcacccac gatatcatca 1440 ccaagttcct
ggaaaatgaa gacagaaggt ctgccagctt acatttaccc aaactgtcca 1500
ttactggaac ctatgatctg aagagcgtcc tgggtcaact gggcatcact aaggtcttca
1560 gcaatggggc tgacctctcc ggggtcacag aggaggcacc cctgaagctc
tccaaggccg 1620 tgcataaggc tgtgctgacc atcgacgaga aagggactga
agctgctggg gccatgtttt 1680 tagaggccat acccatgtct atcccccccg
aggtcaagtt caacaaaccc tttgtcttct 1740 taatgattga acaaaatacc
aagtctcccc tcttcatggg aaaagtggtg aatcccaccc 1800 aaaaataact
gcctctcgct cctcaacccc tcccctccat ccctggcccc ctccctggat 1860
gacattaaag aagggttgag ctggtccctg cctgcatgtg actgtaaatc cctcccatgt
1920 tttctctgag tctccctttg cctgctgagg ctgtatgtgg gctccaggta
acagtgctgt 1980 cttcgggccc cctgaactgt gttcatggag catctggctg
ggtaggcaca tgctgggctt 2040 gaatccaggg gggactgaat cctcagctta
cggacctggg cccatctgtt tctggagggc 2100 tccagtcttc cttgtcctgt
cttggagtcc ccaagaagga atcacagggg aggaaccaga 2160 taccagccat
gaccccaggc tccaccaagc atcttcatgt ccccctgctc atcccccact 2220
cccccccacc cagagttgct catcctgcca gggctggctg tgcccacccc aaggctgccc
2280 tcctgggggc cccagaactg cctgatcgtg ccgtggccca gttttgtggc
atctgcagca 2340 acacaagaga gaggacaatg tcctcctctt gacccgctgt
cacctaacca gactcgggcc 2400 ctgcacctct caggcacttc tggaaaatga
ctgaggcaga ttcttcctga agcccattct 2460 ccatggggca acaaggacac
ctattctgtc cttgtccttc catcgctgcc ccagaaagcc 2520 tcacatatct
ccgtttagaa tcaggtccct tctccccaga tgaagaggag ggtctctgct 2580
ttgttttctc tatctcctcc tcagacttga ccaggcccag caggccccag aagaccatta
2640 ccctatatcc cttctcctcc ctagtcacat ggccataggc ctgctgatgg
ctcaggaagg 2700 ccattgcaag gactcctcag ctatgggaga ggaagcacat
cacccattga cccccgcaac 2760 ccctcccttt cctcctctga gtcccgactg
gggccacatg cagcctgact tctttgtgcc 2820 tgttgctgtc cctgcagtct
tcagagggcc accgcagctc cagtgccacg gcaggaggct 2880 gttcctgaat
agcccctgtg gtaagggcca ggagagtcct tccatcctcc aaggccctgc 2940
taaaggacac agcagccagg aagtcccctg ggcccctagc tgaaggacag cctgctccct
3000 ccgtctctac caggaatggc cttgtcctat ggaaggcact gccccatccc
aaactaatct 3060 aggaatcact gtctaaccac tcactgtcat gaatgtgtac
ttaaaggatg aggttgagtc 3120 ataccaaata gtgatttcga tagttcaaaa
tggtgaaatt agcaattcta catgattcag 3180 tctaatcaat ggataccgac
tgtttcccac acaagtctcc tgttctctta agcttactca 3240 ctgacagcct
ttcactctcc acaaatacat taaagatatg gccatcacca agccccctag 3300
gatgacacca gacctgagag tctgaagacc tggatccaag ttctgacttt tccccctgac
3360 agctgtgtga ccttcgtgaa gtcgccaaac ctctctgagc cccagtcatt
gctagtaaga 3420 cctgcctttg agttggtatg atgttcaagt tagataacaa
aatgtttata cccattagaa 3480 cagagaataa atagaactac atttcttgca 3510
<210> SEQ ID NO 12 <211> LENGTH: 3303 <212> TYPE:
DNA <213> ORGANISM: Homo sapien <400> SEQUENCE: 12
tgggcaggaa ctgggcactg tgcccagggc atgcactgcc tccacgcagc aaccctcaga
60 gtcctgagct gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc
ctagccgctg 120 ctgctgccag gaattccagg ttggaggggc ggcaacctcc
tgccagcctt caggccactc 180 tcctgtgcct gccagaagag acagagcttg
aggagagctt gaggagagca ggaaagcagc 240 ctcccccgtt gcccctctgg
atccactgct taaatacgga cgaggacagg gccctgtctc 300 ctcagcttca
ggcaccacca ctgacctggg acagtgaatc gacaatgccg tcttctgtct 360
cgtggggcat cctcctgctg gcaggcctgt gctgcctggt ccctgtctcc ctggctgagg
420 atccccaggg agatgctgcc cagaagacag atacatccca ccatgatcag
gatcacccaa 480 ccttcaacaa gatcaccccc aacctggctg agttcgcctt
cagcctatac cgccagctgg 540 cacaccagtc caacagcacc aatatcttct
tctccccagt gagcatcgct acagcctttg 600 caatgctctc cctggggacc
aaggctgaca ctcacgatga aatcctggag ggcctgaatt 660 tcaacctcac
ggagattccg gaggctcaga tccatgaagg cttccaggaa ctcctccgta 720
ccctcaacca gccagacagc cagctccagc tgaccaccgg caatggcctg ttcctcagcg
780 agggcctgaa gctagtggat aagtttttgg aggatgttaa aaagttgtac
cactcagaag 840 ccttcactgt caacttcggg gacaccgaag aggccaagaa
acagatcaac gattacgtgg 900 agaagggtac tcaagggaaa attgtggatt
tggtcaagga gcttgacaga gacacagttt 960 ttgctctggt gaattacatc
ttctttaaag gcaaatggga gagacccttt gaagtcaagg 1020 acaccgagga
agaggacttc cacgtggacc aggtgaccac cgtgaaggtg cctatgatga 1080
agcgtttagg catgtttaac atccagcact gtaagaagct gtccagctgg gtgctgctga
1140 tgaaatacct gggcaatgcc accgccatct tcttcctgcc tgatgagggg
aaactacagc 1200 acctggaaaa tgaactcacc cacgatatca tcaccaagtt
cctggaaaat gaagacagaa 1260 ggtctgccag cttacattta cccaaactgt
ccattactgg aacctatgat ctgaagagcg 1320 tcctgggtca actgggcatc
actaaggtct tcagcaatgg ggctgacctc tccggggtca 1380 cagaggaggc
acccctgaag ctctccaagg ccgtgcataa ggctgtgctg accatcgacg 1440
agaaagggac tgaagctgct ggggccatgt ttttagaggc catacccatg tctatccccc
1500 ccgaggtcaa gttcaacaaa ccctttgtct tcttaatgat tgaacaaaat
accaagtctc 1560 ccctcttcat gggaaaagtg gtgaatccca cccaaaaata
actgcctctc gctcctcaac 1620 ccctcccctc catccctggc cccctccctg
gatgacatta aagaagggtt gagctggtcc 1680 ctgcctgcat gtgactgtaa
atccctccca tgttttctct gagtctccct ttgcctgctg 1740 aggctgtatg
tgggctccag gtaacagtgc tgtcttcggg ccccctgaac tgtgttcatg 1800
gagcatctgg ctgggtaggc acatgctggg cttgaatcca ggggggactg aatcctcagc
1860 ttacggacct gggcccatct gtttctggag ggctccagtc ttccttgtcc
tgtcttggag 1920 tccccaagaa ggaatcacag gggaggaacc agataccagc
catgacccca ggctccacca 1980 agcatcttca tgtccccctg ctcatccccc
actccccccc acccagagtt gctcatcctg 2040 ccagggctgg ctgtgcccac
cccaaggctg ccctcctggg ggccccagaa ctgcctgatc 2100 gtgccgtggc
ccagttttgt ggcatctgca gcaacacaag agagaggaca atgtcctcct 2160
cttgacccgc tgtcacctaa ccagactcgg gccctgcacc tctcaggcac ttctggaaaa
2220 tgactgaggc agattcttcc tgaagcccat tctccatggg gcaacaagga
cacctattct 2280 gtccttgtcc ttccatcgct gccccagaaa gcctcacata
tctccgttta gaatcaggtc 2340 ccttctcccc agatgaagag gagggtctct
gctttgtttt ctctatctcc tcctcagact 2400 tgaccaggcc cagcaggccc
cagaagacca ttaccctata tcccttctcc tccctagtca 2460 catggccata
ggcctgctga tggctcagga aggccattgc aaggactcct cagctatggg 2520
agaggaagca catcacccat tgacccccgc aacccctccc tttcctcctc tgagtcccga
2580 ctggggccac atgcagcctg acttctttgt gcctgttgct gtccctgcag
tcttcagagg 2640 gccaccgcag ctccagtgcc acggcaggag gctgttcctg
aatagcccct gtggtaaggg 2700 ccaggagagt ccttccatcc tccaaggccc
tgctaaagga cacagcagcc aggaagtccc 2760 ctgggcccct agctgaagga
cagcctgctc cctccgtctc taccaggaat ggccttgtcc 2820 tatggaaggc
actgccccat cccaaactaa tctaggaatc actgtctaac cactcactgt 2880
catgaatgtg tacttaaagg atgaggttga gtcataccaa atagtgattt cgatagttca
2940 aaatggtgaa attagcaatt ctacatgatt cagtctaatc aatggatacc
gactgtttcc 3000 cacacaagtc tcctgttctc ttaagcttac tcactgacag
cctttcactc tccacaaata 3060 cattaaagat atggccatca ccaagccccc
taggatgaca ccagacctga gagtctgaag 3120 acctggatcc aagttctgac
ttttccccct gacagctgtg tgaccttcgt gaagtcgcca 3180 aacctctctg
agccccagtc attgctagta agacctgcct ttgagttggt atgatgttca 3240
agttagataa caaaatgttt atacccatta gaacagagaa taaatagaac tacatttctt
3300 gca 3303 <210> SEQ ID NO 13 <211> LENGTH: 3300
<212> TYPE: DNA <213> ORGANISM: Homo sapien <400>
SEQUENCE: 13 tgggcaggaa ctgggcactg tgcccagggc atgcactgcc tccacgcagc
aaccctcaga 60 gtcctgagct gaaccaagaa ggaggagggg gtcgggcctc
cgaggaaggc ctagccgctg 120 ctgctgccag gaattccagg ttggaggggc
ggcaacctcc tgccagcctt caggccactc 180 tcctgtgcct gccagaagag
acagagcttg aggagagctt gaggagagca ggaaagcctc 240 ccccgttgcc
cctctggatc cactgcttaa atacggacga ggacagggcc ctgtctcctc 300
agcttcaggc accaccactg acctgggaca gtgaatcgac aatgccgtct tctgtctcgt
360 ggggcatcct cctgctggca ggcctgtgct gcctggtccc tgtctccctg
gctgaggatc 420 cccagggaga tgctgcccag aagacagata catcccacca
tgatcaggat cacccaacct 480 tcaacaagat cacccccaac ctggctgagt
tcgccttcag cctataccgc cagctggcac 540 accagtccaa cagcaccaat
atcttcttct ccccagtgag catcgctaca gcctttgcaa 600 tgctctccct
ggggaccaag gctgacactc acgatgaaat cctggagggc ctgaatttca 660
acctcacgga gattccggag gctcagatcc atgaaggctt ccaggaactc ctccgtaccc
720 tcaaccagcc agacagccag ctccagctga ccaccggcaa tggcctgttc
ctcagcgagg 780 gcctgaagct agtggataag tttttggagg atgttaaaaa
gttgtaccac tcagaagcct 840 tcactgtcaa cttcggggac accgaagagg
ccaagaaaca gatcaacgat tacgtggaga 900 agggtactca agggaaaatt
gtggatttgg tcaaggagct tgacagagac acagtttttg 960 ctctggtgaa
ttacatcttc tttaaaggca aatgggagag accctttgaa gtcaaggaca 1020
ccgaggaaga ggacttccac gtggaccagg tgaccaccgt gaaggtgcct atgatgaagc
1080 gtttaggcat gtttaacatc cagcactgta agaagctgtc cagctgggtg
ctgctgatga 1140 aatacctggg caatgccacc gccatcttct tcctgcctga
tgaggggaaa ctacagcacc 1200 tggaaaatga actcacccac gatatcatca
ccaagttcct ggaaaatgaa gacagaaggt 1260 ctgccagctt acatttaccc
aaactgtcca ttactggaac ctatgatctg aagagcgtcc 1320 tgggtcaact
gggcatcact aaggtcttca gcaatggggc tgacctctcc ggggtcacag 1380
aggaggcacc cctgaagctc tccaaggccg tgcataaggc tgtgctgacc atcgacgaga
1440 aagggactga agctgctggg gccatgtttt tagaggccat acccatgtct
atcccccccg 1500 aggtcaagtt caacaaaccc tttgtcttct taatgattga
acaaaatacc aagtctcccc 1560 tcttcatggg aaaagtggtg aatcccaccc
aaaaataact gcctctcgct cctcaacccc 1620 tcccctccat ccctggcccc
ctccctggat gacattaaag aagggttgag ctggtccctg 1680 cctgcatgtg
actgtaaatc cctcccatgt tttctctgag tctccctttg cctgctgagg 1740
ctgtatgtgg gctccaggta acagtgctgt cttcgggccc cctgaactgt gttcatggag
1800 catctggctg ggtaggcaca tgctgggctt gaatccaggg gggactgaat
cctcagctta 1860 cggacctggg cccatctgtt tctggagggc tccagtcttc
cttgtcctgt cttggagtcc 1920 ccaagaagga atcacagggg aggaaccaga
taccagccat gaccccaggc tccaccaagc 1980 atcttcatgt ccccctgctc
atcccccact cccccccacc cagagttgct catcctgcca 2040 gggctggctg
tgcccacccc aaggctgccc tcctgggggc cccagaactg cctgatcgtg 2100
ccgtggccca gttttgtggc atctgcagca acacaagaga gaggacaatg tcctcctctt
2160 gacccgctgt cacctaacca gactcgggcc ctgcacctct caggcacttc
tggaaaatga 2220 ctgaggcaga ttcttcctga agcccattct ccatggggca
acaaggacac ctattctgtc 2280 cttgtccttc catcgctgcc ccagaaagcc
tcacatatct ccgtttagaa tcaggtccct 2340 tctccccaga tgaagaggag
ggtctctgct ttgttttctc tatctcctcc tcagacttga 2400 ccaggcccag
caggccccag aagaccatta ccctatatcc cttctcctcc ctagtcacat 2460
ggccataggc ctgctgatgg ctcaggaagg ccattgcaag gactcctcag ctatgggaga
2520 ggaagcacat cacccattga cccccgcaac ccctcccttt cctcctctga
gtcccgactg 2580 gggccacatg cagcctgact tctttgtgcc tgttgctgtc
cctgcagtct tcagagggcc 2640 accgcagctc cagtgccacg gcaggaggct
gttcctgaat agcccctgtg gtaagggcca 2700 ggagagtcct tccatcctcc
aaggccctgc taaaggacac agcagccagg aagtcccctg 2760 ggcccctagc
tgaaggacag cctgctccct ccgtctctac caggaatggc cttgtcctat 2820
ggaaggcact gccccatccc aaactaatct aggaatcact gtctaaccac tcactgtcat
2880 gaatgtgtac ttaaaggatg aggttgagtc ataccaaata gtgatttcga
tagttcaaaa 2940 tggtgaaatt agcaattcta catgattcag tctaatcaat
ggataccgac tgtttcccac 3000 acaagtctcc tgttctctta agcttactca
ctgacagcct ttcactctcc acaaatacat 3060 taaagatatg gccatcacca
agccccctag gatgacacca gacctgagag tctgaagacc 3120 tggatccaag
ttctgacttt tccccctgac agctgtgtga ccttcgtgaa gtcgccaaac 3180
ctctctgagc cccagtcatt gctagtaaga cctgcctttg agttggtatg atgttcaagt
3240 tagataacaa aatgtttata cccattagaa cagagaataa atagaactac
atttcttgca 3300 <210> SEQ ID NO 14 <211> LENGTH: 20000
<212> TYPE: DNA <213> ORGANISM: Macaca mulatta
<400> SEQUENCE: 14 aacatgaaca tggtggcctt gtcagaaagc
aagtgtgtgt tgctgaaaca tcagcagaga 60 ttgtcaaagg gataaagaga
taacttaaaa gggttcctac tgaccaaaat gagacaagtt 120 ggccatctaa
aatcaaatca taattatagt tcaataggac acatttcgtc tcttaaatct 180
tccaatccat aatgaccatc atggcccata acctcaaaag agtaaagtta aaataaagtt
240 cagaaaaggt tagttgcaat aaaacattag ttttattaat tttaacaaga
aggggatgaa 300 gctatagatg catttttttt ccttctttta actatgttgc
cccttacaag gtacagcttt 360 gccttatttt tctctgtctg agtaaggata
aagagtaaag gccgggcatg gtggctcaca 420 cctgtaattc cagcgctttg
ggaggccgag gcaggaggat cacttgaggc caggagtttg 480 agaccagcgt
ggccaacatg atgaaatctc gccactacta aaaatataaa aattagttgg 540
aaatggtagc gcatgcctgt aatgccagct actctggagg ctgaggcaca agaatcactt
600 gcaattccgg aattcaggag gtggagtttg cagtaagcca agattgcgcc
actgtaactc 660 cagcctgggt gactgagtga gactctgtct caaaaaaaga
agaataaaaa caagaagttg 720 tgagtaggcc aaatagttcc agaaaaagca
gaaatccacc acccccccga cacacaggaa 780 gcggctcagg aggtgacgca
gagaaggaaa gtgtgtctgc tggggttttg caagttggtt 840 aatttgaaag
atccctcaag gaggtaaaca aatggtgcaa acttcattca ttcatctcct 900
ggaagataaa cttcgaacac ccaactaacc ccaccaatta aatgagttaa aggaagacag
960 acacaagtgt caattatgct aacagagctc tgtgttaaat accccaccag
catcgcctca 1020 tttaagcctc acaactatgt gggaaagaga cttttatccc
cattttacag ataaggaaac 1080 caattctcag agaactgagg ccctccccca
gatccaagtc cgcttagctc cagtcacccc 1140 acgtcctctg catgtcacag
gtgctcagaa agatgcagat gcaccttcag gaagccaaaa 1200 tgagcagagc
ccctaaagag cggattgacg gcctctttct ggaaaaaatg gaagtttgaa 1260
tctgaggagg tatccctcaa caacaggtgc tgctcaccaa gtctggggcc aaacgcagca
1320 gctgttctcc cacttagacc cctgagacct gtctataagg tttttcagag
cgaggacaca 1380 tccccaaagg ttgtggcttc tggtggttag cattgacttg
gggcccatcc catgccagag 1440 gctgcccgaa gtgcttaaat gttattacct
catttgatct tcacaatcct aacggaagtg 1500 actcttctaa gagtctccct
atctcacaga tgagggaacc gaggcacaga gaggttaagt 1560 ggcttgtcta
agagctcaca gaaagagcgg tggagctaag gcttgacccc agatgttaga 1620
tcctgagccc atgctttaac cagtgacctg cactgcctcc caaagaagga agctggtgcc
1680 tgggagggag ggtgcagagc gagggtgtgc atggtgcatg tgtgtgtttg
tggggtggcc 1740 agcactcttc ggggcacttt gccaatgagt tcagctcccc
tgaagtccac tgttgctctc 1800 ctgaccagtc actcagtctg gatttacttg
gcccaaggcc attggcacca gcctggccaa 1860 cattgtggcc aggcttaccc
ccttacccgc ttccttgctg cagaccccaa atcttgactc 1920 ctacatccct
atccagccta caccacgagg ctcccatctc cgggcagggc cctgtgatgg 1980
gtcagggcct ccccagatgc cccttgttca ttaccagctc acaggatctt cccatgacgc
2040 atttcctctg aggggatcag cccagatgct gcaatagaca attctggaag
taaccgagtg 2100 gacaagactt tccccatcgt gtcctggggt tcctggggtc
acagtgtcct tgtgaatggc 2160 cactgagtgc tcccacctcc ccttaccgcc
cggggttttg tcctggtgca ttttcccaga 2220 tcatcccagc ccttcctccc
aggatggatg tccagagcag ggcaagggct gagcctagag 2280 ccctggaacc
aaaagaacag gaccccaaat tctgagcccc ttacttgccc cacctgctcc 2340
cacccatgct ttcttcattc ctcctccaaa tgccccagct ccccactgca atcccttctg
2400 cacccagcca ggtcctatga cacacacctc cccagtgcac acagacctgc
ccagccgcag 2460 ggctgcccac tgggcatgtc ataggtggct cagtcctctt
ccctctgcaa ctggccccag 2520 aaacctgcca gatgttggtg ccaggtctgt
gccagaaggg caaggcctgt catttctagt 2580 aatcctctgg gcagtgtgac
tgcacctttt acggcagctc aaagggagag ggtgactcgt 2640 cctgggtcac
agagctgaca gggcgggtag aacaggtgat atgcagggct ttctgagttt 2700
atgagggccc agtcttgtgt ctgcctggca atgggcaagg ccccttcctg cccaagctcc
2760 ccgcccctcc ccaacctatt gcctccgcca cccgccaccc gaggccaact
tcctgggtgg 2820 gcaggaactg ggccctgtgc ccagggcgtg cactgcctcc
acgcagcaac cctcagagta 2880 ctgagctgag caaaggagga ggaggggatc
agcactctga ggaaggccta gccactgctg 2940 ctgccaggaa ttccaggtag
gaggggcggc aaccttctgc cagcccccag gccactctcc 3000 tgtgcctgcc
agaggagacg gagcttgagg agagcaggaa aggtggaaca atgctgctgc 3060
tgctcactct gttccacaga tgggagggac agtggggctt ggagtggggg tcatggcaca
3120 gatgggaaaa tgaaggctca gagaggggaa gaaatgccca ggaggtaccg
agggcaggcg 3180 acctcaacca cagcccagca ctggagctgt gagtagacgt
agagtagcag aatatccatt 3240 cagccagctc aggggaagga caggggccct
gaagccaagg catggagctg gcagggaaga 3300 gagctcagag agaaggggag
gggagtctga gctcagtttc ccactgcctg aaaagagggt 3360 ggtacctact
cccctcacag ggtaactgaa tgagactgcc tggaggaaag ctcttcaaat 3420
gtggcccacc ccaccccagt gacccctgac atgggggagg aaggacagca tcagaaggga
3480 ctttccgggc acacccagca cccagctctg agctgtcctt gaactgttgc
attttaatcc 3540 tcacagcagc tcaacaaggt acataccgtc accgtcccca
ttttacagat ggggaaattg 3600 aggctcagag cagttaaaca actcacctga
ggcctcacag ccagttaagt gggttccctg 3660 gtctgaatat gtgtgctgga
ggatcctgtg ggtcactcgc ctggtagagc cccaaggtgg 3720 aggcataagt
gggactggtg aatgacagaa ggggcaaaaa acacactcat ccattaattc 3780
tggaagtatc cacggcacgt acgccagctc ccaagcaagt ttgcacattg cacaaagggt
3840 gatgcaatct gatttaggct tttaaaggga ttgcaatcaa gtggggccct
actggcctca 3900 accctgtacc acccctccct tccatcccca gtagtcccca
aagacctcca tcaaccccag 3960 gatgggggcc gtattcccaa agaaaatcca
agctgtatac gcatcacact gattttccag 4020 gagcagaaac agaaacaggc
ctgaggctgg tcagaattga accccctcct gctctgagca 4080 gcctgcgggg
caggctaagc agagggctgt gcagacccac ataaagagtc tactgtgtgc 4140
caggcacttc acccaaggca cttcacaagc atgcttggga atgagacttc caactctcta
4200 ggatgcaggt gaaacacttc ctggttcaaa caggtgaagc ggcctgcctg
agacagcatc 4260 acgcttcttt acaggtttgc tctcccacct ctaccctgtc
tcatggtccc ccatgccggc 4320 ctgacgcttg tgtctgcctc agtcatgctc
catttttcca tccggacaat caagagggtt 4380 tttgtgtcta aggctgactg
ggtaacttcg gatgagcggc ctctctgctc tgagcctcag 4440 tttcctcatc
tgtcaaatgg gctctaaccc actctgatct cccagggcgg catcagtctt 4500
cagcatcagg catttcgggg tgaattagta aatggtagat cttgctacca gtggaacagc
4560 cgctaaggat tctgcagtga gagcagaggg ccagcaaagt ggtactctcc
cagcgactgg 4620 ctgactcacg ccaccccctc caccttggac gcaggacact
gtggtttctg agccaggtac 4680 aatgactcct tttggtacgt gcagtggagg
ctgtatgctg ctcaggcaga gcgtccggac 4740 agcgtgggcg ggcgactcag
cgcccagcct gtgaacttag tccctgtttg ctcctccggt 4800 aactggggtg
atcttggtta atattcacca gcagcctccc ccgttgcccc tctgcaccca 4860
ctgcttaaat acggacaagg acagggctct gtctcctcag cctcaggcac caccactgac
4920 ctgggacggt gaatcgtaag tatgcctttc actgcgagag gttctggaga
ggcttctgag 4980 tcccccacgg cccaggcagg cagcaggtct ggggcaggag
gggggttgtg gagcgggtat 5040 ccgcccgctg aggtgccggg cagatggagg
ggctgcagct gggctcctat tgtcgtaata 5100 acagcagcca tgagggttgt
gtcctgcttc ccagtcctgc ccggtcccca ctcagtacct 5160 actggtggat
acactggctt ttgtaagcag aagtgcacga gggtgtctag ctccgcggtc 5220
ctggcacccc aagatacagc aacagcaagg aagcgcagcc atttctttct gtttgtgcag
5280 ctcctgtgtc tgtcaggggg ttcctatctg ttgtctcctg taagcctcac
cacctctcct 5340 actacttgga cacgcatctt tttccccttc tatggatgag
gaggttaagg ttcagggagg 5400 ggtgaggagg aacgccggct cacattctcc
atcccctcca gatacggcca ggaacagacc 5460 tgtgccaggt ctcagcctta
catcaagatg ggtctccccc tgcactgtgg acctctgggc 5520 cctcctgtcc
cagtggagga caggaagctg tgaggggcac cgtcacccag ggttcaagct 5580
ggcattcctg aataatcgct ctgtgccagg ccacggctaa gctctgtgca cgattaagcc
5640 tcataaccct ccaaggcagt taccagggtg attcccattt tacagatgag
gaagttgggg 5700 accgagtggt taataactgg ccccaaatca cacaccatcc
ataatttggg ctcaggcacc 5760 tggctccagg ccccgaaatc ctgagcctgg
ccctagtgct caccgtttct ctcaggtctc 5820 aggcgctgga tggggaacag
gaagcctggg ctggacttga ggcctctctg atgctcggtg 5880 acttcagaca
gttgctcaac ctctctgttc tcttgggcaa aacatgataa cctttgacct 5940
ctgtcccctc ccctcacccc acccgacctt gatctctgga gtgttggaag aatttaattt
6000 ttcctgcact gagtttggag acaggggtca aaaagctgac caaggccaag
ctggccagtt 6060 tcccatagaa cgcctctaaa agacctgcag cactagcagc
aagaactggt attcttgaga 6120 acttactgtg caccaggcac ttcttggtat
tttgtgcata tttaatttca caataactct 6180 atgacaaagt ccacctttct
catctccagg aaactgaggt tcagagaggt taagtaacgt 6240 gtccaaggtc
acacagttaa tagcaagttg atctggagca atctggcctg agagcctcta 6300
attctagcca caaactgagg ctgcccctct tcatttagcc aggccacctc tgaaatcttc
6360 tggttcaaga cttctggctc cagctttgta cacagagact attaaatgtc
aggttttgca 6420 gtcacatctg tttaatccca gacaaaacat ctgggattaa
atctcagttt tgtaagcaag 6480 tagctctgtg atttttagtg agttatttaa
tcctctttgg cctcaatttt tctgtctata 6540 aaatagggtt aatcatttgc
acctcatagg gtaagctttg aggacagatt agatgataca 6600 gtgcctgtaa
atcgcctggt gttagtaagt gtggcaatga tggtgacact gaggttgatg 6660
tttgcttagc ataggttagg cagctagcag gcagtaaaca aatacttgga gaatttaatg
6720 gaaaattggc caaactcaga tgctgttcac tgctgagcag gagccccctc
ctgctgaaat 6780 gggtcctggg gagcgcagca gctggcagga agaaatctgc
catctctcgg gcaggagctc 6840 aacctctgtg caggcacagg gacggcttcc
gcacctggtg cccactcacg cattacgtca 6900 gttattcctc atctctctcc
aagggattct tttctccact gtatagctct gaagccaatg 6960 ctcacagaag
tgaagtcatt taccccgggc cccctgccag taagtgacag ggcctggtca 7020
cacttgggtt tatttattgc ccatttcaac aggtcgtttg accataggcg agattctctt
7080 ccctgcaccc tgctgggttg ctcttggtcc cttattttat gctcccgggt
agaaatggtg 7140 tgagattagg caggaagtgg cttgcttccc tctccctggc
cctgcaaagg gtgctcccac 7200 ctgccccagt tccagaaatg tcaccatgaa
gtcttcattc ttctgtttta aagcttggcc 7260 tcagtgtcca tacaccatgg
ggtacttgac catctacttt ctcctctcca gccgccctcc 7320 caggcactag
cttttgaggg tgcagggtgc tgcctctgat agaagggccg ggagagagca 7380
ggttttggag tcctgatgct atgaggaaca gcttgggagg cataatgaac ccaacacgat
7440 gcttgagacc aatgtcagag cccaattctg ccattcatca tctgagattt
gagggcacag 7500 ctgtctcagt ccgtgatctg agtgctggga aagccaagac
ttgttccagc tttgtcacca 7560 acttgctgta tggcctcgac aaggccctga
ccctctctgg gcttcaaact cttcactgtg 7620 aaaggaggaa accagaggag
gtgatgtgac gccagaaaag atggatgggt gtggggaatt 7680 gtgctcctcc
cagctgtcac cccctctcca ccctccctgc accagcctcg ccacctcctt 7740
cgagcccagc agcctcctgt ctaggagggt gcctcttctc catctgtttt gctacatcga
7800 acccagatgc cattctaacc aagaatcctg gctgggtgca gtgacactca
cctgtaaccc 7860 cagcactttg ggaggccgag gcaggcggat caagaggtca
ggatttcaag acctgcctgg 7920 ccaacatggt gaaatctcgt ctctactaaa
aatacaaaaa ttagccagat gtggtggcat 7980 gtgcctgtaa tcccagctac
ttgggaaact gaggcaggag aactgcttga acctgggagg 8040 cagaggtttc
agtgagccaa gatcacacca ctgcactcta gcctggggga taaagcgaga 8100
ctctgtctca aaaaaaaaaa aaaaaaaaat cctatgttag cgtacagagg tccccagtga
8160 ggtcttctcc cagccccact ttgcacaact ggggagagtg aggccccagg
accagaggat 8220 gcttactcaa ggccaaacgg atagtgatgg ccctgccagg
actagaagcc acaacttctg 8280 gccctaaggc cactcagcgt atttagtgtc
cccaccctgc agaggcccaa ctccctcctg 8340 ccctctgagc tctgtaatga
tgggggaatt tccataaacc atgaaggact gcacaaaatc 8400 cagctgggaa
gtgaaagaga aacctaaggg agatggaaat atacagcact aattttagca 8460
ccgtcttcag ttctaacaac actagctagt tgaagaaaaa tacaaacatg tattatgtag
8520 tgtgtggtcc gttccatttg gattacttag aggcaagagg gccaggagaa
aggtggtaga 8580 gagaaaccag ctttaggctt cattttgttg ctttactgga
aagaaacttt taacagtcca 8640 ggggggtcaa tgaatctcaa tatttgttat
ttccaacttt tttctccagt gtttcatttc 8700 ccaaattcaa ggacacattt
ttctttgtat tttgttaaga tgatgatttt acttttgtga 8760 ctagtagtta
actatgtggc tgccaggcat attctcctca gctaggacct cagttttccc 8820
atctgtgtag acagcaggtt ctacttaggg ggctgcagat tgatggtccg aagtctgggc
8880 atatctggag tagaaggagc actgtggggc atggcaggct ctgcgttgct
gtggatgaca 8940 ctgactttga ccattgctca gcagagcctg ctctcgccgg
ttcagccaca ggccccacca 9000 ctccctattg tctcagcccc agctatgaaa
catgtattcc tcactggact atcacctgaa 9060 ggctttgaat ttgcaacacc
tgtcaacccc tccctcaaaa gggttgccct ctcagatcct 9120 tttgatgtaa
ggtttggtgt ctagacttat ttcactaaat tcttccaaca gcctcacttt 9180
atgtatgagg caaaatgagg accagggaga taaatgacgt gtcctggctc atacacctgg
9240 aaagtgacag agtcagatta gatcccaggt ctatctgaag ctaaaagaga
tgctttttca 9300 cttcccacca cgcccatctc ctttaaagca gcacaaagcc
ttgcttcaca ggagagatga 9360 gcttctctaa agtccctgac agcaagagcc
cagaactggg acaccattgg tgatccagat 9420 ggcaggtgag ctgactgcag
ggacatcagc ctattcttgt ggctgggacc acagagcatt 9480 gtggggacag
ccccctctct taggaaaaaa ccctaagggc tgaggatcct tgtgagtgtt 9540
gggagggaac agctcccagg ggatttaatc acagccccac catgctctag ctggtgccat
9600 tgtgcaagat gcatttccct tctgtgcagc agtgtccctg gccactcaac
agtgggatta 9660 gatagaagcc ctccaagggc ttctagcttg acgtgattct
tcattctgat ctggcccgat 9720 tcctggataa tcgtggccag gcccattcct
cttcttatgc ctcatttgct tcttttgtaa 9780 aacagtggct gtaccacttg
catcttaggg tcattgcaga tgtaagtgga gctgtccaga 9840 gcctgggcgc
aggacctaga tgtaggattc tggttctgct actttacttc ctcagtgaca 9900
ttgaataggt gacctaatct ctctggtttt ggtttcttca tctgaaaaag aaggatagta
9960 gcatcagcac ctcacaggat tgttacaaga aagcaatgag ttaacacatg
tgcgcacgta 10020 gaacagtgct tggcatatgg taagcactac atacattttg
ctattcttct gattctttca 10080 gtgttactga tgtcagcaag tacttggcac
aggctggttt aataagcctt aggcacttcc 10140 acgtggtgtc aatcccgggt
cactgggagt catcatgtgc cctgactcgg ggcctggccc 10200 ccgtctctgt
cttgcaggac aatgccatct tctgtctcat ggggcgtcct cctgctggca 10260
ggcctgtgct gcctgctccc cggctctctg gctgaggatc cccagggaga tgctgcccag
10320 aagacggata catcccacca tgatcaggac cacccaaccc tcaacaagat
cacccccagc 10380 ctggctgagt tcggcttcag cctataccgc cagctggcac
accagtccaa cagcaccaat 10440 atcttcttct ccccagtgag catcgctaca
gcctttgcaa tgctctccct ggggaccaag 10500 gctgacactc acagtgaaat
cctggagggc ctgaatttca acgtcacgga gattccggag 10560 gctcaggtcc
atgaaggctt ccaggaactc ctccataccc tcaacaagcc agacagccag 10620
ctccagctga ccaccggcaa cggcctgttc ctcaacaaga gcctgaaggt agtggataag
10680 tttttggagg atgtcaaaaa actgtaccac tcagaagcct tctctgtcaa
ctttgaggac 10740 accgaagagg ccaagaaaca gatcaacaat tacgtggaga
aggaaactca agggaaaatt 10800 gtggatttgg tcaaggagct tgacagagac
acagtttttg ctctggtgaa ttacatcttc 10860 tttaaaggta aggttgcaaa
accagcctga gctgttccca tagaaacaac caaaaatatt 10920 ctcaaaccat
catctcttga actctccttg gcaatgcatt atgggctata gaaatgcatg 10980
tcagtgtggg ctcttcaatt ttctacacac aaacactaaa atgttttcca tcattgagta
11040 atttgaggga ataatagatt aaattgtcaa aaccgctgac agctctgcag
aactttccag 11100 agcctttaat gtccttgtgt gtactgtgta cgtagaatat
ataatgctta gaactataga 11160 acaaattgta atatactgca taaagggata
gtttcatgga acgtacttta gacgactcta 11220 gtgtcccaga atcagtatca
gttttgcagt ctgaaagacc tgggttcaaa tcccgcctct 11280 accactatta
gcttttgaca ccgaacaatg cattctacct ccttgaggtg ctaatttccc 11340
atcttagcat ggacaaaata gtttttttta ggattaaaca agtgacaaac accttgggaa
11400 aagtgtggca tacagtaggt ggtgggctcc tctgtatctc aggctgcctt
cctgcccctg 11460 aggggtgctc ttgaggcaaa ggagggcagt ggagagcagc
caggctgcag tcagcacaac 11520 tggggtcctg gctctgctgt ggcttagggc
aggccccggt ccctctccag ccccagtctc 11580 ctccttctgt ccaatgagaa
agctgggatc ggggtccctg aggcccctgt ccactctgca 11640 tgcctcgatg
gtgaagctct cttggcatgg cagaggggag gctgctcagg catctgcatt 11700
tcccctgcca atccagggga taaagaaaac cctcaggaat agtaagcaga atgtttgccc
11760 tgaatgaata actgagctgc caattaacaa gaggcaggga gccttagaca
ggaggtaaca 11820 aatatgcctg atgctccaac attttatttg taatatccaa
gacaccctca aataaacata 11880 cgattccaat aaaatgcaca gtcaggatgg
catctcttag ccttacatct ctgcgatgta 11940 gaaattctgc atcttcctct
agttttgaat tatctccaca cagacctttt tggcagcctg 12000 gatggttggt
ttcagcacct tttgcagatg atgaagctga ggcttgaggg atgtgtgtcg 12060
tcaagggggt tcagggcttc tcagggaggg gactgatggc tcctttattc tgccacactc
12120 ttccaaacct tcacccaccc ctactgatgc ccgccttacc ctctctgtcc
aggcaaatgg 12180 gagagaccct ttgacgttga ggccaccaag gaagaggact
tccacgtgga ccaggcgacc 12240 accgtgaagg tgcccatgat gaggcgttta
ggcatgttta acatctacca ctgtgagaag 12300 ctgtccagct gggtgctgct
gatgaaatac ctgggcaatg ccaccgccat cttcttcctg 12360 cctgatgagg
ggaaactgca gcacctggaa aatgaactca cccatgatat catcaccaag 12420
ttcctggaaa atgaaaacag caggtgattc cccaacctga gggtgaccaa gaagctgccc
12480 acacctctta gccacgttgg gactgaggcc cgtcagaact gaccagaggg
ttggagaggg 12540 tgaacactac atccctgggt cactgctact ctgcataaac
ttggcttcca gaatgaggcc 12600 accactgagt tcaggtggca ccggccatgc
tccatgagca ggacagtacc caggggtgac 12660 gaggtaaagg tctcgtcctt
ggggacttcc cactccagcg tggacactgt cccttcccaa 12720 tatccagtgc
ccaggacagg gacagcagca ccaccacacg ttctggcaga accaaaaggg 12780
aacagatggg cttcctggca aaggcagtag tggagtgtgg agttcaaggg tagactgtcc
12840 ctgtggggat gggggaagag cctgtgtggc taggcccaga aaagcaaggt
tcaaaattgg 12900 aatagccagg gcatgttagc aaaaggcttg agtttctctg
tcactttatc ggtgctgtta 12960 gattgggtgc cctgtagtaa atgatactcc
aatatgagtc acacattagt gtgtctgtgt 13020 gcattcgtaa ttatgcccat
gccctcctat ctagtttatt ttgtacactg taaaaccaag 13080 atgaaaatac
aaaaggtgtt gggttcataa taggaattga ggctggaatt tctttgtttc 13140
acgccagcac ctcctgaggt ccctgctcca ggggttgaga aagaacaagg aggctgagag
13200 ggtaactgat cagagagccc aaagccaggc tgcccgctca caccagaccc
tgctcggggc 13260 ggctctgtct ccccatggaa aacaagaggg gagcactcag
cctggtgtgg tcagtcttct 13320 gggggcactg ctaccagccc atgttcctct
gggtatagga ccctggggat gtttcaggct 13380 gggggcccag tgaccaaaca
ctacagggca ggatgagaca tgcttccagt acacctagaa 13440 tctcagagga
ggtggcattt caagctttca tgattcattt gatgttaaca ttctttgact 13500
cagtgtagaa gagctaatag tagaacaaac caaagccaag ttcccatgtt agagtgggtg
13560 gaggacacag gagtaagtgg cagaaataat cagaaaagaa aacacttgca
ctgcggtggg 13620 tcccagaaga acaagaggaa tgctgtgcca tgccctgaat
ttcttttctg catggcaggt 13680 ctgccaactt acatttaccc agactggcca
ttactggaac ctatgatctg aagacagtcc 13740 tgggccacct gggtatcact
aaggtcttca gcaatggggc tgacctctcg gggatcacgg 13800 aggaggcacc
cctgaagctc tccaaggtga gatcaccctg atgaccctgt tgcaccccgg 13860
gatctgtagg gaaggatgta tgggggctgc agttctgtcc tgaggctgag gaaggggcca
13920 agggaaacaa atgaagaccg aggctgagct cctgaggatg cccgtgattc
actgacgcgg 13980 gacgtggtca gacggcaaag ccaggcaggg gcctgctgtg
ctgctggcac tttcagggcc 14040 tcccttgagg ttgtgtcacc gaccccgaat
ttcatctttg cccaggacct tctagacatt 14100 gggccttgat ttatccatat
tgacacagaa aggtttgggc taagttgttt caaaggactt 14160 tgtgactcct
tcgatctgtg agatttggtg tctgaatgaa tgaatgatgt cagctaaaga 14220
tgactcttcc tttggaaaac taaaggtgac caaagaacaa ctgcagttcc gtgaacggct
14280 gcgttgtctt gggatctggg cactgtgaag gtcactgtca gggtccatgt
cctcgaggag 14340 cttcaagctg tgtgctagaa aggagagagc cctggagaca
ggcgtggagt ggcgatgctc 14400 tttccccttc tgagttgtgg gtgcaccctg
agcaggggca taggcgcttg tcaggaagat 14460 agacagaggg gagccagccc
tgtcagccaa agccttgagg aggagcaagg tctgtgtgac 14520 agggagggag
aggatgtgca gggccagggc tgtgcagcgg gagaaaggcc tgagtgaaca 14580
cttcctggga ggtgtccacg tgagccttgc tccaggcctg ggctggggca caactcagcc
14640 ttagaacatg tctctgcttc tctcccttcc aggccgtgca taaggctgtg
ctgaccatcg 14700 atgagaaagg gactgaagct gctggggcca tgtttttaga
ggccataccc atgtctattc 14760 cccccgaggt caagttcaac aaaccctttg
tcttcttaat gattgaacaa aataccaagt 14820 ctcccctctt catgggaaaa
gtggtgaatc ccacccagaa ataactgcct gtcactcctc 14880 agcccctccc
ctccatccct ggccccctcc ctgaatgaca ttaaagaagg gttgagctgg 14940
tccctgcctg cgtgtgtgac tgcaaacccc tcccatgttg tctctgggtc ttcctttgcc
15000 tgctgaggcc gtgtgtgggc tccaggtcac agtgctctct ccggaccccc
tcaactgtgt 15060 tcatggagca tctggctggg caggcatatg ctgggccagg
atggaggggg ctgaatcctc 15120 agcttacgga cctgggccca tctgtttctg
gagagctcca gtcttccttg tcctgtcttg 15180 gagtccctaa taaggaatca
caggggagga atcagatacc agcccatgac cccaggctcc 15240 tccaagcatc
ttcatgtccc cctgctcatc ccccactccc cgccacccag agttcctcat 15300
cctgccaggg ctgcctgtgc ccaccccaag gctgccctcc tgggagcccg agaactgcct
15360 gaccatgccc tagccctgtt ttgtggcatc tgcaacaaca aaagagagag
gaccgtgtcc 15420 tcttcttgtc ccactgtcac ctaaccaggc ttgggcccgg
cgcctcttgg gcacttctgg 15480 aaaacaactg aagcagattc ctcctgaagc
ccattctcca tggggcgaca aggacaccta 15540 ttctgccctt gtccttccat
cgctgcccca taaagcctca catgtctcag tttagaatca 15600 ggtcccttct
cctcagatga agaggagggt ctctgcttct ttttctctat ctcctcctca 15660
gactcaacca ggcccagcag tccccacaag accattaccc tatatccctt ctcctcccta
15720 gtcatgtggc cataggcctg ctgatggctc acgaaggcca tcgcaaggat
tccccagcta 15780 tgggagagga agcacagcac ccactgaccc ctgcaacccc
tctctttctc ccctgagtcc 15840 tgactggggc cacatgaagc ctgacttctt
tgtgcctgtt gctgtccctg cagtcttcag 15900 agggcagccg cagctccagt
gccatggaag gaggctgttc cggaatagcc cttgtggtaa 15960 gggccaggag
agtccttcca tcctccaagg ctctgctaaa gggcacagca gccaggaggt 16020
cccctgagcc cccagctgaa ggacaggctg ctccctctgt ctctaccagg aattgccttg
16080 tcctgtggaa ggcactgacc catcccaaac taatcttgga atccctgtct
aaccactcac 16140 tgtcatgaat gtgtgcttaa aggatgaggt tgagtcaaac
caaatagtga tttttgtagt 16200 tcaaaatggt gaaattagca attcaacatg
attcagccta atcaatggat accaactgtt 16260 tcccacacaa gtctcctgtt
ctcttaagct tactcagtga cagcctttca ctctccacaa 16320 atacattaaa
gatatgaccg tcaccaagcc tcctaggatg acaccagacc tgagagtctg 16380
aagaccggta tccccctgcc agctgtgtga ccttcatgaa gtcgccaaac ctttctgagc
16440 cacagccgtg gccagtaaga cctgcctttg agttggtacg atgttcaagt
cagataataa 16500 aacaccgttt acacctatta gagcagagaa taaatagagc
tacatttctt gcatttatga 16560 gctttctgtg aatcagacat ccctgtgaag
aacctccctg gctatttctc atttaataac 16620 tgtagcagca ctgtgatgtg
tgagtagatc cgctgtgctc ttaaactcca aatctacata 16680 tgaggaaact
gaggctcaga gaggctgctg gtctcccaca atgtcacata gttcataagt 16740
ggcaaagctg gcttgatggg ctactcgttc ctctgaacca caccacctca ccacactctc
16800 cccttcgagg gtcatgctaa acttctgcag agctaattcc tccttaaacc
ataagggttg 16860 ctggtggccc acagctcacg cctagcacgc ttcatgagaa
aaacgccctc cacccaatgt 16920 ggagcaggcc ctgagctgaa ggtggtgagc
agaagctcat ccaccagatg ttgacacagc 16980 ccgcggcctt gggcgaccca
caggactcct cttatttaac tggcatttgg taggagaaca 17040 ggggcagagt
caaagacaag tgggctttcc ggagcagcca ggacagggaa ggaggctgca 17100
gtgctgaggg catcacctta gacaccatcg ttttactttg aagaatcgtc tgtcacacac
17160 gagttgacag tccggttggg agagactcca ttcaaaccag cataagctcc
cagaggaatt 17220 cctgggctcc tgtgggaatc aacagggatc agtcaggggt
gggcagagtg tcatgacaac 17280 ctcattagga ggaagacaaa tacatgtcac
aagtccgtga ggcaacagcc ataagacctc 17340 agcttcactg tatcttccag
agttttttaa aaaatgcatt cactgtctaa tgtgatcctc 17400 cagacaggtc
ctgcaggact cagcctagga atcattatcc ccaaagtaca catggggaaa 17460
ctgaggccca gcaggtcaaa tgctctgtcc agtgtgggcc tggaaggcag gacttctccg
17520 ctcttaggcc tggctgtccc caactgcaca cacttcctca gtccatatgg
gatcacgata 17580 aaaactccat cctccagaac cgcactgcgt caacctgctg
tgctctaaca acagctgaag 17640 gccgagctgc ggggcatcct gggtgttccg
agtcagtttc ccactgcagg caggaacctc 17700 atcctgctct gaaacagatg
agagggaaac acggaaaaca gctgcgagct cagccgggaa 17760 cctcagagtc
atgacctttt accccaccta ggagtttgca ggggacagaa cacacgaatt 17820
tgagatttta agcctaaaca aaggaagcct tggtttgaag tgcaagctct gccagacaga
17880 gggcaccctg tgagccccat ttgttaagag gacgatagtc agggagcttc
taggttctca 17940 caccagaaat gggaaataca gattatacat tgatctcctt
cccaggagca acttgatcct 18000 cccataaatc cgagcaggca gcatttattc
aaacaacaaa caagcaaaca ggagctgcgt 18060 atgggggata gagagatgaa
acccaggtcc gtccctggga gagtgctgat ctacggcggt 18120 ggggaacggt
gaataaacga ggcgtgcgtc catggatctg ggtggagagg gtcagggtgc 18180
agcccgggac ctttccagag gcgtaagaaa tgatcagtat acacccgcag atgacctcaa
18240 acaccccaag ggctccttga aaggctgagg cctttgtgtt gttcttggtt
ggaaaattca 18300 caggcagtgg agtgaacaag gcacacggca ggactcagag
ccagggacag cttctgcagg 18360 aacccggctc agttctaaaa ggacaaatgg
aatgaccctg agtaaagaag tcagagaagg 18420 gcaccctcac tgaggcaaac
tccctcccca gcagggaccc agcagcaacc caaaaaagca 18480 ggagtctcac
ttcatcatca tatgggagag ggcaggctgt gtgatctcag ggaagttcct 18540
caacttctct gtgccatagt ttcctcatct gcaaaatgta aatcgaattt gaggtctcga
18600 tgaaatgtct tatttctcta aagtcccttg tccttgtccc atgcagccta
gaaatcttcc 18660 tctggcctag ttgtggagcc aaggatagac cgggcctgaa
tcttacattg ctggagatgg 18720 tgaagctgac cagcatgaga ggtcaggttt
tagaagccca aatcccagca ggcataagcc 18780 tcaccctcca atatcagctt
tatcagaaac aaaaaaataa catgtcatat ccatttgccc 18840 ttttccttaa
atgagtagca cttgggcagg gcagaggggc tgattatcca agctgggaag 18900
acgctgacag cagacgcttc aatggcagtc taggagtttt ctgataactg tcattggtat
18960 cacacttact attgaaatcg tgacatcagg aatgatgaaa ggaactagag
tcacatggtc 19020 tggagcaggg aagtgaggag ctgaaacctc cttcaacctg
gttgctgtgt ccccagggtg 19080 ggtaaagccc ctctgttcat cccacatgga
acaaatagag tggaatcagt ccttgctaaa 19140 gggttgaaga actgagctgt
gagcttcttg attgctgcag cacaatcctt gcccatcctg 19200 actgatataa
ccagaattcg tgaaatgcat caaataagtc ttcaactact atgcaagcct 19260
gggagggtga ctaagatctg aaaaacacaa ggaaagctaa aggaattccc acaaggaaac
19320 tccattagaa agttctagtt acaaggtact cagcacaggc catgcagaaa
taagcccaga 19380 tccggtggtg agcaggaaag ggtggggatg tgagtgctga
gccacacagg agagagtaat 19440 agaggctcaa gccagcaagg ggacggccac
caccccacgc agtgttggcc aacagtttcc 19500 ggggcatttg ctctcagaag
tcaaagctga ttttccagaa ttgaagtgct cattgtttgg 19560 gatgatttag
gaacaacatc agcaaaaacg aatgaacaat cagggctaat agaattgtgt 19620
ttaaactctg ttgggcttcc ttgacagagg gcacggggag caaaaaaagt cagcagtgtg
19680 tattaagtaa aaaaactttt tttccctttt aattggcagt taataccctc
aaaatatgtt 19740 ctgagattga tcaagtaagt gtccttcggc attaaaatat
taggatgcaa ttgctaaggg 19800 cttcttagca aagttgaaag aacacaggaa
tcccaactcc actgtctcct tagcatgcaa 19860 tcctgagtgg gctgttacag
ctgtctgtgc ctcagcgccc tcacctgcaa gacaggtaaa 19920 ataataccta
actcctaggt tacttttgtg gattaatgtg caaagcgtca ccctaaaaaa 19980
gtgctgctac ttaaatgacc 20000 <210> SEQ ID NO 15 <400>
SEQUENCE: 15 000 <210> SEQ ID NO 16 <400> SEQUENCE: 16
000 <210> SEQ ID NO 17 <400> SEQUENCE: 17 000
<210> SEQ ID NO 18 <400> SEQUENCE: 18 000 <210>
SEQ ID NO 19 <400> SEQUENCE: 19 000 <210> SEQ ID NO 20
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 20
tggtgctgtt ggactggtgt 20 <210> SEQ ID NO 21 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 21 gatattggtg
ctgttggact 20 <210> SEQ ID NO 22 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 22 ggctgtagcg atgctcactg 20
<210> SEQ ID NO 23 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 23 gggtttgttg aacttgacct 20 <210> SEQ
ID NO 24 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
24 ccacttttcc catgaagagg 20 <210> SEQ ID NO 25 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 25 ttgggtggga
ttcaccactt 20 <210> SEQ ID NO 26 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 26 ctttaatgtc atccagggag 20
<210> SEQ ID NO 27 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 27 tctttaatgt catccaggga 20 <210> SEQ
ID NO 28 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
28 ttctttaatg tcatccaggg 20 <210> SEQ ID NO 29 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 29 cttctttaat
gtcatccagg 20 <210> SEQ ID NO 30 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 30 ccttctttaa tgtcatccag 20
<210> SEQ ID NO 31 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 31 cccttcttta atgtcatcca 20 <210> SEQ
ID NO 32 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
32 acccttcttt aatgtcatcc 20 <210> SEQ ID NO 33 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 33 tcaacccttc
tttaatgtca 20 <210> SEQ ID NO 34 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 34 ctcaaccctt ctttaatgtc 20
<210> SEQ ID NO 35 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 35 gctcaaccct tctttaatgt 20 <210> SEQ
ID NO 36 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
36 agctcaaccc ttctttaatg 20 <210> SEQ ID NO 37 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 37 cagctcaacc
cttctttaat 20 <210> SEQ ID NO 38 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 38 ccagctcaac ccttctttaa 20
<210> SEQ ID NO 39 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 39 accagctcaa cccttcttta 20 <210> SEQ
ID NO 40 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
40 gaccagctca acccttcttt 20 <210> SEQ ID NO 41 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 41 ggaccagctc
aacccttctt 20 <210> SEQ ID NO 42 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 42 gtccctttct tgtcgatgg 19
<210> SEQ ID NO 43 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 43 ccttccctga aggttcctcc 20 <210> SEQ
ID NO 44 <400> SEQUENCE: 44 000 <210> SEQ ID NO 45
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial sequence <220> FEATURE: <223> OTHER
INFORMATION: Primer <400> SEQUENCE: 45 ggagatgctg cccagaagac
20 <210> SEQ ID NO 46 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial sequence <220>
FEATURE: <223> OTHER INFORMATION: Primer <400>
SEQUENCE: 46 gctggcggta taggctgaag 20 <210> SEQ ID NO 47
<211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM:
Artificial sequence <220> FEATURE: <223> OTHER
INFORMATION: Probe <400> SEQUENCE: 47 atcaggatca cccaaccttc
aacaagatca 30 <210> SEQ ID NO 48 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 48 ggagatgctg cccagaagac 20 <210> SEQ
ID NO 49 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Primer <400> SEQUENCE: 49 gctggcggta
taggctgaag 20 <210> SEQ ID NO 50 <211> LENGTH: 30
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Probe
<400> SEQUENCE: 50 atcaggatca cccaaccttc aacaagatca 30
<210> SEQ ID NO 51 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Primer <400> SEQUENCE: 51
gaccaccgtg aaggtgccta t 21 <210> SEQ ID NO 52 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 52 ggacagcttc ttacagtgct ggat 24 <210>
SEQ ID NO 53 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Probe <400> SEQUENCE: 53
atgaagcgtt taggcatgtt 20 <210> SEQ ID NO 54 <211>
LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 54 tctttaaagg caaatgggag aga 23 <210>
SEQ ID NO 55 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Primer <400> SEQUENCE: 55
tgcctaaacg cctcatcatg 20 <210> SEQ ID NO 56 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION: Probe
<400> SEQUENCE: 56 ccacgtggac caggcgacca 20 <210> SEQ
ID NO 57 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Primer <400> SEQUENCE: 57 tcatggaaag
cctctgtgga t 21 <210> SEQ ID NO 58 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 58 gcggcccgtg atgaga 16 <210> SEQ ID NO
59 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Probe <400> SEQUENCE: 59 cccacaagtc
ccagaaccgc agtg 24
1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 59 <210>
SEQ ID NO 1 <211> LENGTH: 3220 <212> TYPE: DNA
<213> ORGANISM: Homo sapien <400> SEQUENCE: 1
acaatgactc ctttcggtaa gtgcagtgga agctgtacac tgcccaggca aagcgtccgg
60 gcagcgtagg cgggcgactc agatcccagc cagtggactt agcccctgtt
tgctcctccg 120 ataactgggg tgaccttggt taatattcac cagcagcctc
ccccgttgcc cctctggatc 180 cactgcttaa atacggacga ggacagggcc
ctgtctcctc agcttcaggc accaccactg 240 acctgggaca gtgaatcgac
aatgccgtct tctgtctcgt ggggcatcct cctgctggca 300 ggcctgtgct
gcctggtccc tgtctccctg gctgaggatc cccagggaga tgctgcccag 360
aagacagata catcccacca tgatcaggat cacccaacct tcaacaagat cacccccaac
420 ctggctgagt tcgccttcag cctataccgc cagctggcac accagtccaa
cagcaccaat 480 atcttcttct ccccagtgag catcgctaca gcctttgcaa
tgctctccct ggggaccaag 540 gctgacactc acgatgaaat cctggagggc
ctgaatttca acctcacgga gattccggag 600 gctcagatcc atgaaggctt
ccaggaactc ctccgtaccc tcaaccagcc agacagccag 660 ctccagctga
ccaccggcaa tggcctgttc ctcagcgagg gcctgaagct agtggataag 720
tttttggagg atgttaaaaa gttgtaccac tcagaagcct tcactgtcaa cttcggggac
780 accgaagagg ccaagaaaca gatcaacgat tacgtggaga agggtactca
agggaaaatt 840 gtggatttgg tcaaggagct tgacagagac acagtttttg
ctctggtgaa ttacatcttc 900 tttaaaggca aatgggagag accctttgaa
gtcaaggaca ccgaggaaga ggacttccac 960 gtggaccagg tgaccaccgt
gaaggtgcct atgatgaagc gtttaggcat gtttaacatc 1020 cagcactgta
agaagctgtc cagctgggtg ctgctgatga aatacctggg caatgccacc 1080
gccatcttct tcctgcctga tgaggggaaa ctacagcacc tggaaaatga actcacccac
1140 gatatcatca ccaagttcct ggaaaatgaa gacagaaggt ctgccagctt
acatttaccc 1200 aaactgtcca ttactggaac ctatgatctg aagagcgtcc
tgggtcaact gggcatcact 1260 aaggtcttca gcaatggggc tgacctctcc
ggggtcacag aggaggcacc cctgaagctc 1320 tccaaggccg tgcataaggc
tgtgctgacc atcgacgaga aagggactga agctgctggg 1380 gccatgtttt
tagaggccat acccatgtct atcccccccg aggtcaagtt caacaaaccc 1440
tttgtcttct taatgattga acaaaatacc aagtctcccc tcttcatggg aaaagtggtg
1500 aatcccaccc aaaaataact gcctctcgct cctcaacccc tcccctccat
ccctggcccc 1560 ctccctggat gacattaaag aagggttgag ctggtccctg
cctgcatgtg actgtaaatc 1620 cctcccatgt tttctctgag tctccctttg
cctgctgagg ctgtatgtgg gctccaggta 1680 acagtgctgt cttcgggccc
cctgaactgt gttcatggag catctggctg ggtaggcaca 1740 tgctgggctt
gaatccaggg gggactgaat cctcagctta cggacctggg cccatctgtt 1800
tctggagggc tccagtcttc cttgtcctgt cttggagtcc ccaagaagga atcacagggg
1860 aggaaccaga taccagccat gaccccaggc tccaccaagc atcttcatgt
ccccctgctc 1920 atcccccact cccccccacc cagagttgct catcctgcca
gggctggctg tgcccacccc 1980 aaggctgccc tcctgggggc cccagaactg
cctgatcgtg ccgtggccca gttttgtggc 2040 atctgcagca acacaagaga
gaggacaatg tcctcctctt gacccgctgt cacctaacca 2100 gactcgggcc
ctgcacctct caggcacttc tggaaaatga ctgaggcaga ttcttcctga 2160
agcccattct ccatggggca acaaggacac ctattctgtc cttgtccttc catcgctgcc
2220 ccagaaagcc tcacatatct ccgtttagaa tcaggtccct tctccccaga
tgaagaggag 2280 ggtctctgct ttgttttctc tatctcctcc tcagacttga
ccaggcccag caggccccag 2340 aagaccatta ccctatatcc cttctcctcc
ctagtcacat ggccataggc ctgctgatgg 2400 ctcaggaagg ccattgcaag
gactcctcag ctatgggaga ggaagcacat cacccattga 2460 cccccgcaac
ccctcccttt cctcctctga gtcccgactg gggccacatg cagcctgact 2520
tctttgtgcc tgttgctgtc cctgcagtct tcagagggcc accgcagctc cagtgccacg
2580 gcaggaggct gttcctgaat agcccctgtg gtaagggcca ggagagtcct
tccatcctcc 2640 aaggccctgc taaaggacac agcagccagg aagtcccctg
ggcccctagc tgaaggacag 2700 cctgctccct ccgtctctac caggaatggc
cttgtcctat ggaaggcact gccccatccc 2760 aaactaatct aggaatcact
gtctaaccac tcactgtcat gaatgtgtac ttaaaggatg 2820 aggttgagtc
ataccaaata gtgatttcga tagttcaaaa tggtgaaatt agcaattcta 2880
catgattcag tctaatcaat ggataccgac tgtttcccac acaagtctcc tgttctctta
2940 agcttactca ctgacagcct ttcactctcc acaaatacat taaagatatg
gccatcacca 3000 agccccctag gatgacacca gacctgagag tctgaagacc
tggatccaag ttctgacttt 3060 tccccctgac agctgtgtga ccttcgtgaa
gtcgccaaac ctctctgagc cccagtcatt 3120 gctagtaaga cctgcctttg
agttggtatg atgttcaagt tagataacaa aatgtttata 3180 cccattagaa
cagagaataa atagaactac atttcttgca 3220 <210> SEQ ID NO 2
<211> LENGTH: 20000 <212> TYPE: DNA <213>
ORGANISM: Homo sapien <400> SEQUENCE: 2 tatctaagcc acccacgcag
ggcatgtatt tctgaataat aagccctcaa gtcctgctgg 60 gtctcccata
gtccccacgc aagggtgagt cttgcacgct cagccctgcc tgtggttccc 120
agaaggcctc tgtcactgcg tgcttgcttt ctctcccagg gaagataccc cagtgccatg
180 tcttggggca agagaaaatg aagacagacc tggaacatga acatggtggc
cttgccagaa 240 agcaagtgtg tgttgctgaa acatcagcag agattgtcaa
agggataaag agataactta 300 aaagggttcc tattgaccaa aatgcgacaa
gttgaccatc taaaatcaaa tcataattat 360 agttcaatag gacacattga
gtctcttaaa agcttccaat ccgtaatgac catcaaggcc 420 cataacctca
aaagagtaaa gttaaaataa agttcagaaa aggttagctg caataaaaca 480
tgagttttag taattttaac aagaagggga tgaagctata gatgcatttt tattccttct
540 tttaactatg ttgcccctta taatgtatag ctttgcctta tttttctctg
tctgagtaag 600 gataaagagt aaaggccagg cacagtggct cacacctgta
attccagcac tttgggaggc 660 cgaggcgggc agataacttg aggccaggag
tttgagacca gcctggccaa catggtgaaa 720 ccctgtcact actaaaaata
caaaaattaa ctggaattgg tagcacatgc ctgtaatgcc 780 agctactctg
gaggctgagg cacgagaatc gctcgtaatt ccagaattcg agaggtggag 840
tttgcagtaa gccaagattg cgccactgta ctccagcctg ggtgactgag tgagactctg
900 tctcaaaaaa aaaaaaaaaa agaagaagct gtgagtaggc cacatagttc
cagaaaatgc 960 agaaatcccc cctcccctcc ccaacacaca ggaagtggct
caggagatta cacacagaag 1020 gaaagtgtgt ctgctggggt tttgcaagtt
ggctaatttg aaaggtgact ggaggaggtg 1080 aaaaaatggt gcaaacttca
ttcattcatt aaatgagtta taagaagaca gacacaagtg 1140 tccattatgc
taacagagct ctgtgttaaa caccccacca gcatcgcctc atctaagcct 1200
cagaagagct atgtgggaaa gaaactttta tccctatttt atagatgagg aaaccaaggc
1260 tcagagaact gagggcctcc cccggatcca agtccaccta gctgcagtca
ccccacatcc 1320 tctgcatgtc acaggtgctc agaaagatgc tgaaggcacc
tggcccttca ccttcggaaa 1380 gccaaaatga gcacggcccc taaagagggg
attgacagcc ttttctggaa aaaatggaag 1440 tttgaatctg aggaggtgtc
cctcaacaac aggtgctgct ccccaaatct ggggccaaac 1500 gcagcagttg
ttcccccact tagacccctg agacccatct atatggtttt tcagagccag 1560
gacacatccc caaaggtcat ggcctttggt ggttagcatt gacttggggc ccatcacatg
1620 ccagaggctg cccgaagtgc ttaaatgtta ttatctcatt cgatcttcac
agtcctgatg 1680 gaagtgactc ttcttagagt cttcctatct cacagatgag
gaaaccgagg cacagagagg 1740 ttaagtggct tgtctaagag ctcacaaaaa
gagcgatgga gctaaggctt ggccccagat 1800 attagatccc gaacccacgc
cttaaccagt gacctgcact gactctcaaa gaaggaagct 1860 ggtgcctggg
aaggagggtg catagtgagg gtgtgcatgg ggtgtgtgtg tttgtggggt 1920
ggccagcact ctccgggggc actttgccaa tgagttcagc tcccatgaag tccactgttg
1980 ttctcctgac cagccactca gtcttgattt acttggccca gggccactgg
cacacctcac 2040 ccccttaccc gattccttgc tgcagacccc aaatctcgac
tctcacatcc ctatccagcc 2100 cataccacga ggctcccatc tccaggcagg
gccctgtggt ggggcagggc ctcccccaga 2160 tgccccttac tcatgaccag
ctcacaggat cttcccatga tgcatttcct ctggggggat 2220 cagcccagat
gctgcaatag acaattgtgg aagtaaccag gtggacaaga ctttccccct 2280
catgtcctgg ggttcctggg ggcacagtat ccttgtgaat ggccactgag tactcccacc
2340 cctcccacca caacccccgg gattttgtcc tggtgcgttt ttccagatta
tcctagccct 2400 tcctcccagg atggatgtcc agagcagggc gggggctgag
cctagagccc tgccaaaaga 2460 gcaggacccc aaattctgag ccccttactt
gcctcacctg ctcccaccca tgctttcttc 2520 attcctcctc caaaagcccc
agctccccac tgcaatccct tctgcaccca gccaggtcct 2580 atgacacaca
cctccccagt gcacacagac ctgcccaact gtggggctgc ccactgggca 2640
tttcataggt ggctcagtcc tcttccctct gcagctggcc ccagaaacct gccagttatt
2700 ggtgccaggt ctgtgccagg agggcgaggc ctgtcatttc tagtaatcct
ctgggcagtg 2760 tgactgtacc tcttgcggca actcaaaggg agagggtgac
ttgtcccggg tcacagagct 2820 gaaagggcag gtacaacagg tgacatgccg
ggctgtctga gtttatgagg gcccagtctt 2880 gtgtctgccg ggcaatgagc
aaggctcctt cctgtccaag ctccccgccc ctccccagcc 2940 tactgcctcc
acccgaagtc tacttcctgg gtgggcagga actgggcact gtgcccaggg 3000
catgcactgc ctccacgcag caaccctcag agtcctgagc tgaaccaaga aggaggaggg
3060 ggtcgggcct ccgaggaagg cctagccgct gctgctgcca ggaattccag
gttggagggg 3120 cggcaacctc ctgccagcct tcaggccact ctcctgtgcc
tgccagaaga gacagagctt 3180 gaggagagct tgaggagagc aggaaaggtg
ggacattgct gctgctgctc actcagttcc 3240 acaggtggga gggacagcag
ggcttagagt gggggtcatt gtgcagatgg gaaaacaaag 3300 gcccagagag
gggaagaaat gcccaggagc taccgagggc aggcgacctc aaccacagcc 3360
cagtgctgga gctgtgagtg gatgtagagc agcggaatat ccattcagcc agctcagggg
3420 aaggacaggg gccctgaagc caggggatgg agctgcaggg aagggagctc
agagagaagg 3480 ggaggggagt ctgagctcag tttcccgctg cctgaaagga
gggtggtacc tactcccttc 3540 acagggtaac tgaatgagag actgcctgga
ggaaagctct tcaagtgtgg cccaccccac 3600 cccagtgaca ccagcccctg
acacggggga gggagggcag catcaggagg ggctttctgg 3660
gcacacccag tacccgtctc tgagctttcc ttgaactgtt gcattttaat cctcacagca
3720 gctcaacaag gtacataccg tcaccatccc cattttacag atagggaaat
tgaggctcgg 3780 agcggttaaa caactcacct gaggcctcac agccagtaag
tgggttccct ggtctgaatg 3840 tgtgtgctgg aggatcctgt gggtcactcg
cctggtagag ccccaaggtg gaggcataaa 3900 tgggactggt gaatgacaga
aggggcaaaa atgcactcat ccattcactc tgcaagtatc 3960 tacggcacgt
acgccagctc ccaagcaggt ttgcgggttg cacagcgggc gatgcaatct 4020
gatttaggct tttaaaggga ttgcaatcaa gtggggcccc actagcctca accctgtacc
4080 tcccctcccc tccaccccca gcagtctcca aaggcctcca acaaccccag
agtgggggcc 4140 atgtatccaa agaaactcca agctgtatac ggatcacact
ggttttccag gagcaaaaac 4200 agaaacaggc ctgaggctgg tcaaaattga
acctcctcct gctctgagca gcctgggggg 4260 cagactaagc agagggctgt
gcagacccac ataaagagcc tactgtgtgc caggcacttc 4320 acccgaggca
cttcacaagc atgcttggga atgaaacttc caactctttg ggatgcaggt 4380
gaaacagttc ctggttcaga gaggtgaagc ggcctgcctg aggcagcaca gctcttcttt
4440 acagatgtgc ttccccacct ctaccctgtc tcacggcccc ccatgccagc
ctgacggttg 4500 tgtctgcctc agtcatgctc catttttcca tcgggaccat
caagagggtg tttgtgtcta 4560 aggctgactg ggtaactttg gatgagcggt
ctctccgctc tgagcctgtt tcctcatctg 4620 tcaaatgggc tctaacccac
tctgatctcc cagggcggca gtaagtcttc agcatcaggc 4680 attttggggt
gactcagtaa atggtagatc ttgctaccag tggaacagcc actaaggatt 4740
ctgcagtgag agcagagggc cagctaagtg gtactctccc agagactgtc tgactcacgc
4800 caccccctcc accttggaca caggacgctg tggtttctga gccaggtaca
atgactcctt 4860 tcggtaagtg cagtggaagc tgtacactgc ccaggcaaag
cgtccgggca gcgtaggcgg 4920 gcgactcaga tcccagccag tggacttagc
ccctgtttgc tcctccgata actggggtga 4980 ccttggttaa tattcaccag
cagcctcccc cgttgcccct ctggatccac tgcttaaata 5040 cggacgagga
cagggccctg tctcctcagc ttcaggcacc accactgacc tgggacagtg 5100
aatcgtaagt atgcctttca ctgcgagagg ttctggagag gcttctgagc tccccatggc
5160 ccaggcaggc agcaggtctg gggcaggagg ggggttgtgg agtgggtatc
cgcctgctga 5220 ggtgcagggc agatggagag gctgcagctg agctcctatt
ttcataataa cagcagccat 5280 gagggttgtg tcctgtttcc cagtcctgcc
cggtcccccc tcggtacctc ctggtggata 5340 cactggttcc tgtaagcaga
agtggatgag ggtgtctagg tctgcagtcc tggcacccca 5400 ggatggggga
caccagccaa gatacagcaa cagcaacaaa gcgcagccat ttctttctgt 5460
ttgcacagct cctctgtctg tcgggggctc ctgtctgttg tctcctataa gcctcaccac
5520 ctctcctact gcttgggcat gcatctttct ccccttctat agatgaggag
gttaaggtcc 5580 agagaggggt ggggaggaac gccggctcac attctccatc
ccctccagat atgaccagga 5640 acagacctgt gccaggcctc agccttacat
caaaatgggc ctccccatgc accgtggacc 5700 tctgggccct cctgtcccag
tggaggacag gaagctgtga ggggcactgt cacccagggc 5760 tcaagctggc
attcctgaat aatcgctctg caccaggcca cggctaagct cagtgcgtga 5820
ttaagcctca taaccctcca aggcagttac tagtgtgatt cccattttac agatgaggaa
5880 gatggggaca gagaggtgaa taactggccc caaatcacac accatccata
attcgggctc 5940 aggcacctgg ctccagtccc caaactcttg aacctggccc
tagtgtcact gtttctcttg 6000 ggtctcaggc gctggatggg gaacaggaaa
cctgggctgg acttgaggcc tctctgatgc 6060 tcggtgactt cagacagttg
ctcaacctct ctgttctctt gggcaaaaca tgataacctt 6120 tgacttctgt
cccctcccct caccccaccc gaccttgatc tctgaagtgt tggaaggatt 6180
taatttttcc tgcactgagt tttggagaca ggtcaaaaag atgaccaagg ccaaggtggc
6240 cagtttccta tagaacgcct ctaaaagacc tgcagcaata gcagcaagaa
ctggtattct 6300 cgagaacttg ctgcgcagca ggcacttctt ggcattttat
gtgtatttaa tttcacaata 6360 gctctatgac aaagtccacc tttctcatct
ccaggaaact gaggttcaga gaggttaagt 6420 aacttgtcca aggtcacaca
gctaatagca agttgacgtg gagcaatctg gcctcagagc 6480 ctttaatttt
agccacagac tgatgctccc ctcttcattt agccaggctg cctctgaagt 6540
tttctgattc aagacttctg gcttcagctt tgtacacaga gatgattcaa tgtcaggttt
6600 tggagtgaaa tctgtttaat cccagacaaa acatttagga ttacatctca
gttttgtaag 6660 caagtagctc tgtgattttt agtgagttat ttaatgctct
ttggggctca atttttctat 6720 ctataaaata gggctaataa tttgcacctt
atagggtaag ctttgaggac agattagatg 6780 atacggtgcc tgtaaaacac
caggtgttag taagtgtggc aatgatggtg acgctgaggc 6840 tgatgtttgc
ttagcatagg gttaggcagc tggcaggcag taaacagttg gataatttaa 6900
tggaaaattt gccaaactca gatgctgttc actgctgagc aggagcccct tcctgctgaa
6960 atggtcctgg ggagtgcagc aggctctccg ggaagaaatc taccatctct
cgggcaggag 7020 ctcaacctgt gtgcaggtac agggagggct tcctcacctg
gtgcccactc atgcattacg 7080 tcagttattc ctcatccctg tccaaaggat
tcttttctcc attgtacagc tatgaagcta 7140 gtgctcaaag aagtgaagtc
atttacccca ggccccctgc cagtaagtga cagggcctgg 7200 tcacacttgg
gtttatttat tgcccagttc aacaggttgt ttgaccatag gcgagattct 7260
cttccctgca ccctgccggg ttgctcttgg tcccttattt tatgctcccg ggtagaaatg
7320 gtgtgagatt aggcagggag tggctcgctt ccctgtccct ggccccgcaa
agagtgctcc 7380 cacctgcccc gatcccagaa atgtcaccat gaagccttca
ttcttttggt ttaaagcttg 7440 gcctcagtgt ccgtacacca tggggtactt
ggccagatgg cgactttctc ctctccagtc 7500 gccctcccag gcactagctt
ttaggagtgc agggtgctgc ctctgataga agggccagga 7560 gagagcaggt
tttggagtcc tgatgttata aggaacagct tgggaggcat aatgaaccca 7620
acatgatgct tgagaccaat gtcacagccc aattctgaca ttcatcatct gagatctgag
7680 gacacagctg tctcagttca tgatctgagt gctgggaaag ccaagacttg
ttccagcttt 7740 gtcactgact tgctgtatag cctcaacaag gccctgaccc
tctctgggct tcaaactctt 7800 cactgtgaaa ggaggaaacc agagtaggtg
atgtgacacc aggaaagatg gatgggtgtg 7860 ggggaatgtg ctcctcccag
ctgtcacccc ctcgccaccc tccctgcacc agcctctcca 7920 cctcctttga
gcccagaatt cccctgtcta ggagggcacc tgtctcatgc ctagccatgg 7980
gaattctcca tctgttttgc tacattgaac ccagatgcca ttctaaccaa gaatcctggc
8040 tgggtgcagg ggctctcgcc tgtaacccca gcactttggg aggccaaggc
aggcggatca 8100 agaggtcagg agttcaagac ctgcctggcc aacacggtga
aacctcagct ctactaaaaa 8160 tacaaaaatt agccaggcgt ggtggcacac
gcctgtaatc ccagctattt gggaagctga 8220 gacagaagaa tttcttgaac
ccgggaggtg gaggtttcag tgagccgaga tcacgccact 8280 gcactccacc
ctggcagata aagcgagact ctgtctcaaa aaaaacccaa aaacctatgt 8340
tagtgtacag agggccccag tgaagtcttc tcccagcccc actttgcaca actggggaga
8400 gtgaggcccc aggaccagag gattcttgct aaaggccaag tggatagtga
tggccctgcc 8460 agggctagaa gccacaacct ctggccctga ggccactcag
catatttagt gtccccaccc 8520 tgcagaggcc caactccctc ctgaccactg
agccctgtaa tgatggggga atttccataa 8580 gccatgaagg actgcacaaa
gttcagttgg gaagtgaaag agaaattaaa gggagatgga 8640 aatatacagc
actaatttta gcaccgtctt tagttctaac aacactagct agctgaagaa 8700
aaatacaaac atgtattatg taatgtgtgg tctgttccat ttggattact tagaggcacg
8760 agggccagga gaaaggtggt ggagagaaac cagctttgca cttcatttgt
tgctttattg 8820 gaaggaaact tttaaaagtc caagggggtt gaagaatctc
aatatttgtt atttccagct 8880 ttttttctcc agtttttcat ttcccaaatt
caaggacacc tttttctttg tattttgtta 8940 agatgatggt tttggttttg
tgactagtag ttaacaatgt ggctgccggg catattctcc 9000 tcagctagga
cctcagtttt cccatctgtg aagacggcag gttctaccta gggggctgca 9060
ggctggtggt ccgaagcctg ggcatatctg gagtagaagg atcactgtgg ggcagggcag
9120 gttctgtgtt gctgtggatg acgttgactt tgaccattgc tcggcagagc
ctgctctcgc 9180 tggttcagcc acaggcccca ccactcccta ttgtctcagc
cccgggtatg aaacatgtat 9240 tcctcactgg cctatcacct gaagcctttg
aatttgcaac acctgccaac ccctccctca 9300 aaagagttgc cctctcagat
ccttttgatg taaggtttgg tgttgagact tatttcacta 9360 aattctcata
cataaacatc actttatgta tgaggcaaaa tgaggaccag ggagatgaat 9420
gacttgtcct ggctcataca cctggaaagt gacagagtca gattagatcc caggtctatc
9480 tgaagttaaa agaggtgtct tttcacttcc cacctcctcc atctacttta
aagcagcaca 9540 aacccctgct ttcaaggaga gatgagcgtc tctaaagccc
ctgacagcaa gagcccagaa 9600 ctgggacacc attagtgacc cagacggcag
gtaagctgac tgcaggagca tcagcctatt 9660 cttgtgtctg ggaccacaga
gcattgtggg gacagccccg tctcttggga aaaaaaccct 9720 aagggctgag
gatccttgtg agtgttgggt gggaacagct cccaggaggt ttaatcacag 9780
cccctccatg ctctctagct gttgccattg tgcaagatgc atttcccttc tgtgcagcag
9840 tttccctggc cactaaatag tgggattaga tagaagccct ccaagggctt
ccagcttgac 9900 atgattcttg attctgatct ggcccgattc ctggataatc
gtgggcaggc ccattcctct 9960 tcttgtgcct cattttcttc ttttgtaaaa
caatggctgt accatttgca tcttagggtc 10020 attgcagatg taagtgttgc
tgtccagagc ctgggtgcag gacctagatg taggattctg 10080 gttctgctac
ttcctcagtg acattgaata gctgacctaa tctctctggc tttggtttct 10140
tcatctgtaa aagaaggata ttagcattag cacctcacgg gattgttaca agaaagcaat
10200 gaattaacac atgtgagcac ggagaacagt gcttggcata tggtaagcac
tacgtacatt 10260 ttgctattct tctgattctt tcagtgttac tgatgtcggc
aagtacttgg cacaggctgg 10320 tttaataatc cctaggcact tccacgtggt
gtcaatccct gatcactggg agtcatcatg 10380 tgccttgact cggggcctgg
cccccccatc tctgtcttgc aggacaatgc cgtcttctgt 10440 ctcgtggggc
atcctcctgc tggcaggcct gtgctgcctg gtccctgtct ccctggctga 10500
ggatccccag ggagatgctg cccagaagac agatacatcc caccatgatc aggatcaccc
10560 aaccttcaac aagatcaccc ccaacctggc tgagttcgcc ttcagcctat
accgccagct 10620 ggcacaccag tccaacagca ccaatatctt cttctcccca
gtgagcatcg ctacagcctt 10680 tgcaatgctc tccctgggga ccaaggctga
cactcacgat gaaatcctgg agggcctgaa 10740 tttcaacctc acggagattc
cggaggctca gatccatgaa ggcttccagg aactcctccg 10800 taccctcaac
cagccagaca gccagctcca gctgaccacc ggcaatggcc tgttcctcag 10860
cgagggcctg aagctagtgg ataagttttt ggaggatgtt aaaaagttgt accactcaga
10920 agccttcact gtcaacttcg gggacaccga agaggccaag aaacagatca
acgattacgt 10980 ggagaagggt actcaaggga aaattgtgga tttggtcaag
gagcttgaca gagacacagt 11040 ttttgctctg gtgaattaca tcttctttaa
aggtaaggtt gctcaaccag cctgagctgt 11100 tcccatagaa acaagcaaaa
atattctcaa accatcagtt cttgaactct ccttggcaat 11160
gcattatggg ccatagcaat gcttttcagc gtggattctt cagttttcta cacacaaaca
11220 ctaaaatgtt ttccatcatt gagtaatttg aggaaataat agattaaact
gtcaaaacta 11280 ctgacagctc tgcagaactt ttcagagcct ttaatgtcct
tgtgtatact gtatatgtag 11340 aatatataat gcttagaact atagaacaaa
ttgtaataca ctgcataaag ggatagtttc 11400 atggaacata ctttacacga
ctctagtgtc ccagaatcag tatcagtttt gcaatctgaa 11460 agacctgggt
tcaaatcctg cctctaacac aattagcttt tgacaaaaac aatgcattct 11520
acctctttga ggtgctaatt tctcatctta gcatggacaa aataccattc ttgctgtcag
11580 gtttttttag gattaaacaa atgacaaaga ctgtggggat ggtgtgtggc
atacagcagg 11640 tgatggactc ttctgtatct caggctgcct tcctgcccct
gaggggttaa aatgccaggg 11700 tcctgggggc cccagggcat tctaagccag
ctcccactgt cccaggaaaa cagcataggg 11760 gaggggaggt gggaggcaag
gccaggggct gcttcctcca ctctgaggct cccttgctct 11820 tgaggcaaag
gagggcagtg gagagcagcc aggctgcagt cagcacagct aaagtcctgg 11880
ctctgctgtg gccttagtgg gggcccaggt ccctctccag ccccagtctc ctccttctgt
11940 ccaatgagaa agctgggatc aggggtccct gaggcccctg tccactctgc
atgcctcgat 12000 ggtgaagctc tgttggtatg gcagagggga ggctgctcag
gcatctgcat ttcccctgcc 12060 aatctagagg atgaggaaag ctctcaggaa
tagtaagcag aatgtttgcc ctggatgaat 12120 aactgagctg ccaattaaca
aggggcaggg agccttagac agaaggtacc aaatatgcct 12180 gatgctccaa
cattttattt gtaatatcca agacaccctc aaataaacat atgattccaa 12240
taaaaatgca cagccacgat ggcatctctt agcctgacat cgccacgatg tagaaattct
12300 gcatcttcct ctagttttga attatcccca cacaatcttt ttcggcagct
tggatggtca 12360 gtttcagcac cttttacaga tgatgaagct gagcctcgag
ggatgtgtgt cgtcaagggg 12420 gctcagggct tctcagggag gggactcatg
gtttctttat tctgctacac tcttccaaac 12480 cttcactcac ccctggtgat
gcccaccttc ccctctctcc aggcaaatgg gagagaccct 12540 ttgaagtcaa
ggacaccgag gaagaggact tccacgtgga ccaggtgacc accgtgaagg 12600
tgcctatgat gaagcgttta ggcatgttta acatccagca ctgtaagaag ctgtccagct
12660 gggtgctgct gatgaaatac ctgggcaatg ccaccgccat cttcttcctg
cctgatgagg 12720 ggaaactaca gcacctggaa aatgaactca cccacgatat
catcaccaag ttcctggaaa 12780 atgaagacag aaggtgattc cccaacctga
gggtgaccaa gaagctgccc acacctctta 12840 gccatgttgg gactgaggcc
catcaggact ggccagaggg ctgaggaggg tgaaccccac 12900 atccctgggt
cactgctact ctgtataaac ttggcttcca gaatgaggcc accactgagt 12960
tcaggcagcg ccatccatgc tccatgagga ggacagtacc caggggtgag gaggtaaagg
13020 tctcgtccct ggggacttcc cactccagtg tggacactgt cccttcccaa
tatccagtgc 13080 ccagggcagg gacagcagca ccaccacacg ttctggcaga
accaaaaagg aacagatggg 13140 cttcctggca aaggcagcag tggagtgtgg
agttcaaggg tagaatgtcc ctggggggac 13200 gggggaagag cctgtgtggc
aaggcccaga aaagcaaggt tcggaattgg aacagccagg 13260 ccatgttcgc
agaaggcttg cgtttctctg tcactttatc ggtgctgtta gattgggtgt 13320
cctgtagtaa gtgatactta aacatgagcc acacattagt gtatgtgtgt gcattcgtga
13380 ttatgcccat gccctgctga tctagttcgt tttgtacact gtaaaaccaa
gatgaaaata 13440 caaaaggtgt cgggttcata ataggaatcg aggctggaat
ttctctgttc catgccagca 13500 cctcctgagg tctctgctcc aggggttgag
aaagaacaaa gaggctgaga gggtaacgga 13560 tcagagagcc cagagccaag
ctgcccgctc acaccagacc ctgctcaggg tggcattgtc 13620 tccccatgga
aaaccagaga ggagcactca gcctggtgtg gtcactcttc tcttatccac 13680
taaacggttg tcactgggca ctgccaccag ccccgtgttt ctctgggtgt agggccctgg
13740 ggatgttaca ggctgggggc caggtgaccc aacactacag ggcaagatga
gacaggcttc 13800 caggacacct agaatatcag aggaggtggc atttcaagct
tttgtgattc attcgatgtt 13860 aacattcttt gactcaatgt agaagagcta
aaagtagaac aaaccaaagc cgagttccca 13920 tcttagtgtg ggtggaggac
acaggagtaa gtggcagaaa taatcagaaa agaaaacact 13980 tgcactgtgg
tgggtcccag aagaacaaga ggaatgctgt gccatgcctt gaatttcttt 14040
tctgcacgac aggtctgcca gcttacattt acccaaactg tccattactg gaacctatga
14100 tctgaagagc gtcctgggtc aactgggcat cactaaggtc ttcagcaatg
gggctgacct 14160 ctccggggtc acagaggagg cacccctgaa gctctccaag
gtgagatcac cctgacgacc 14220 ttgttgcacc ctggtatctg tagggaagaa
tgtgtggggg ctgcagctct gtcctgaggc 14280 tgaggaaggg gccgagggaa
acaaatgaag acccaggctg agctcctgaa gatgcccgtg 14340 attcactgac
acgggacgtg gtcaaacagc aaagccaggc aggggactgc tgtgcagctg 14400
gcactttcgg ggcctccctt gaggttgtgt cactgaccct gaatttcaac tttgcccaag
14460 accttctaga cattgggcct tgatttatcc atactgacac agaaaggttt
gggctaagtt 14520 gtttcaaagg aatttctgac tccttcgatc tgtgagattt
ggtgtctgaa ttaatgaatg 14580 atttcagcta aagatgacac ttattttgga
aaactaaagg cgaccaatga acaactgcag 14640 ttccatgaat ggctgcatta
tcttggggtc tgggcactgt gaaggtcact gccagggtcc 14700 gtgtcctcaa
ggagcttcaa gccgtgtact agaaaggaga gagccctgga ggcagacgtg 14760
gagtgacgat gctcttccct gttctgagtt gtgggtgcac ctgagcaggg ggagaggcgc
14820 ttgtcaggaa gatggacaga ggggagccag ccccatcagc caaagccttg
aggaggagca 14880 aggcctatgt gacagggagg gagaggatgt gcagggccag
ggccgtccag ggggagtgag 14940 cgcttcctgg gaggtgtcca cgtgagcctt
gctcgaggcc tgggatcagc cttacaacgt 15000 gtctctgctt ctctcccctc
caggccgtgc ataaggctgt gctgaccatc gacgagaaag 15060 ggactgaagc
tgctggggcc atgtttttag aggccatacc catgtctatc ccccccgagg 15120
tcaagttcaa caaacccttt gtcttcttaa tgattgaaca aaataccaag tctcccctct
15180 tcatgggaaa agtggtgaat cccacccaaa aataactgcc tctcgctcct
caacccctcc 15240 cctccatccc tggccccctc cctggatgac attaaagaag
ggttgagctg gtccctgcct 15300 gcatgtgact gtaaatccct cccatgtttt
ctctgagtct ccctttgcct gctgaggctg 15360 tatgtgggct ccaggtaaca
gtgctgtctt cgggccccct gaactgtgtt catggagcat 15420 ctggctgggt
aggcacatgc tgggcttgaa tccagggggg actgaatcct cagcttacgg 15480
acctgggccc atctgtttct ggagggctcc agtcttcctt gtcctgtctt ggagtcccca
15540 agaaggaatc acaggggagg aaccagatac cagccatgac cccaggctcc
accaagcatc 15600 ttcatgtccc cctgctcatc ccccactccc ccccacccag
agttgctcat cctgccaggg 15660 ctggctgtgc ccaccccaag gctgccctcc
tgggggcccc agaactgcct gatcgtgccg 15720 tggcccagtt ttgtggcatc
tgcagcaaca caagagagag gacaatgtcc tcctcttgac 15780 ccgctgtcac
ctaaccagac tcgggccctg cacctctcag gcacttctgg aaaatgactg 15840
aggcagattc ttcctgaagc ccattctcca tggggcaaca aggacaccta ttctgtcctt
15900 gtccttccat cgctgcccca gaaagcctca catatctccg tttagaatca
ggtcccttct 15960 ccccagatga agaggagggt ctctgctttg ttttctctat
ctcctcctca gacttgacca 16020 ggcccagcag gccccagaag accattaccc
tatatccctt ctcctcccta gtcacatggc 16080 cataggcctg ctgatggctc
aggaaggcca ttgcaaggac tcctcagcta tgggagagga 16140 agcacatcac
ccattgaccc ccgcaacccc tccctttcct cctctgagtc ccgactgggg 16200
ccacatgcag cctgacttct ttgtgcctgt tgctgtccct gcagtcttca gagggccacc
16260 gcagctccag tgccacggca ggaggctgtt cctgaatagc ccctgtggta
agggccagga 16320 gagtccttcc atcctccaag gccctgctaa aggacacagc
agccaggaag tcccctgggc 16380 ccctagctga aggacagcct gctccctccg
tctctaccag gaatggcctt gtcctatgga 16440 aggcactgcc ccatcccaaa
ctaatctagg aatcactgtc taaccactca ctgtcatgaa 16500 tgtgtactta
aaggatgagg ttgagtcata ccaaatagtg atttcgatag ttcaaaatgg 16560
tgaaattagc aattctacat gattcagtct aatcaatgga taccgactgt ttcccacaca
16620 agtctcctgt tctcttaagc ttactcactg acagcctttc actctccaca
aatacattaa 16680 agatatggcc atcaccaagc cccctaggat gacaccagac
ctgagagtct gaagacctgg 16740 atccaagttc tgacttttcc ccctgacagc
tgtgtgacct tcgtgaagtc gccaaacctc 16800 tctgagcccc agtcattgct
agtaagacct gcctttgagt tggtatgatg ttcaagttag 16860 ataacaaaat
gtttataccc attagaacag agaataaata gaactacatt tcttgcactt 16920
atgagctttc tgtgaatcag acatccctat gaagtacctc ccctggctgt ttctcattta
16980 ctcactgtag cagcactgcg atgtgtgagt atatctgctg tgctcttaaa
ctccaaatct 17040 gaggaaactg aggctcagag aggctactgg tctcccacaa
tgtcacacag ctcataagtg 17100 gcaaagctgg cttgatgggc tacttgttcc
tctgaaccat accacctcac cacactctcc 17160 ccttcgaggg tcacgctaaa
cttctgcaga ggtaattcct ccttaaacca gaagggttgc 17220 tggtggccca
cagctcacgc ctagcacact tcatgagaaa aacaccctgt gcccagtgtg 17280
gagcaggcat tgagctgaag gtggtgagca gaagctcatc caccagatgt tgacacagcc
17340 cgcagccttg ggcgacccac aggactcctc ttatttaact ggcatttggt
aggagaacag 17400 gggcagagtc aaagacaagt tggctttctg gagagcccag
ggcagggaag gaggtggcag 17460 cgctgagggc ggtcacctta gacaccatcg
ttttactttg aagaattgtc tgtcacacac 17520 gagttgacag tcaggatggg
agagacccca ttcaaactag cataacctcc cagagggaat 17580 tcctgggctc
ccctgggaat caacagggat cagtcaagga tgggcagagt gtcatgacaa 17640
cctcattatg aggaagacaa atatatgtca caagtccgtg atgggacaac cataagacct
17700 cagcttcact gtatcttcca gagttttaaa aaaatgtatt cactgtccaa
cgtgatcctc 17760 cagacaggtt ctgcaggacg cagcctagga ctcattatcc
ccaaagtaca catggggaaa 17820 ctcaggccca gcaggtcaaa tgctctgtcc
agtgtgggcc tggaaggcag gtcttctcca 17880 ctgttaggcc tggctgtccc
caacagcaca tacttcctca gtccatatgg gatcacgata 17940 aacaactcca
tcctccagga ccacactgca tcaacctgct gtgccctaac atcagctgaa 18000
ggccaagctg cggggcaccc tgggtgttcc aagtcacttt ccctctgcag gcaggaacct
18060 catcctgctc tgaaacagat gagagggaaa cgcagaaaac agcttccagc
tcagccagga 18120 accttagagt cctgaccttt tacctcgcct aggagtttgc
aggggagaga acacacgaat 18180 ttcggatttt aagcctaaat aaaggaagcc
ttagtttgaa gtgcaagctc tgccggacag 18240 ggggcaccct gtgagcccca
tttgttaaga ggacaatagt cagagagctt ccaggctctc 18300 acaccagaaa
caggaaatac agatttcaca ctgatctcct tcccaggagc aacttgatcc 18360
tctccataaa tccgagcggg aagcatttat ccaaacaaca aacaagcaaa catgagctgt
18420 gtatggggga tagagagaat gaaacccagg tccatcccgg ggagaatgct
ggtctatggc 18480 agtggggagc agtgaataaa tgaggcgtac atccatggat
ctgggtggag agggtcaggg 18540 tgtaacccag gacctttcca gaggcatgag
aaacagtcag cctacaccca cagatgacct 18600 caaacacccc aagtgctcct
tgaaaggctg aggcttttgt gttgctcttg gttggattat 18660 tcacaggcaa
tgaagtaaac aaggcacacc acaggactca gaaccaggga cagcttccgc 18720
aggaacctgg gtcagttcta aaaggacaaa tggaatgacc ctgagtagag aagtcagaga
18780 aaggcactct cactgaggca aactccctcc ccagcaggga cccaggcagc
aactcggaaa 18840 agcaggagtg tcactattgt atcatatggg agagggcagg
ctgtgtgctc tcagggaagt 18900 tcctcaactt ctctgtgccg tagtttcctc
atctgcaaaa tgtaaatcaa atttgaggtt 18960 tcaatgcaat gacttatttc
tctaaagttc cttgtccttg tcccatgtag cccagaaatc 19020 ttcctctggc
ctagttgtgg agcctggcct aagtcgcaca ttgctggaga tggtgaagct 19080
gaccagcatg agaggtcagt ttctagaagc ccaaatccca acaggcataa gcctcaccct
19140 ccaatatcag ctctatcaga aacaaacaaa caaaaacatg tcttattcat
ttgtcctttt 19200 cctcaaatgg gtggcacttg ggcagggcag aagggctggt
tatccaagct tggaagatgc 19260 tgacagcaga cgcttcaatg gcagtaggag
ttttctgatc actgtcattg gtatcacgct 19320 tactgttgaa atcgtgacat
caggaatgat gaaaggaact agagtcagat ggtctggagc 19380 ggggaagtga
ggagctgaaa cctccttcag tctggttgct gtgtccccag ggtgggtaga 19440
tcccctctgt tcatcccaca tgggacaagt agagcgggag aggaatcaac cctttctaaa
19500 gggttgaagc attgagctgt gagcttctcg gttgctgcag cacaatcctt
gcccatcctg 19560 actgaaacaa ccagaattca tgaaatgcat caaagaagtc
ttcacctact acgcaagcct 19620 ggaagggtga ctaagatctg aaaaacaccg
ggaaggctaa aggaactccc acaaggaaac 19680 cccattagaa agttctagtt
acaagatgct cagcacaggc catgcagaaa tacgcccaga 19740 tccggtggtg
agcaaggaac ggtaggaatg tgagcactga gtcacgcagg agagactcat 19800
aggggctcaa gccagcaagg ggacggcctc caccccacgc actgttggcc aacagcttcc
19860 aggggcattt gctctcagaa gtcaaagctg attttccaca attgaagtgc
tcactgtttg 19920 ggatgattta ggaacaacac caacaaaaag gaatgaacaa
tcagagctaa tagaattgtg 19980 tttaaactct gctgggcttc 20000 <210>
SEQ ID NO 3 <211> LENGTH: 52 <212> TYPE: DNA
<213> ORGANISM: Homo sapien <400> SEQUENCE: 3
tgcataaggc tgtgctgacc atcgacaaga aagggactga agctgctggg gc 52
<210> SEQ ID NO 4 <211> LENGTH: 3199 <212> TYPE:
DNA <213> ORGANISM: Homo sapien <400> SEQUENCE: 4
tgggcaggaa ctgggcactg tgcccagggc atgcactgcc tccacgcagc aaccctcaga
60 gtcctgagct gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc
ctagccgctg 120 ctgctgccag gaattccagg ttggaggggc ggcaacctcc
tgccagcctt caggccactc 180 tcctgtgcct gccagaagag acagagcttg
aggagagctt gaggagagca ggaaaggaca 240 atgccgtctt ctgtctcgtg
gggcatcctc ctgctggcag gcctgtgctg cctggtccct 300 gtctccctgg
ctgaggatcc ccagggagat gctgcccaga agacagatac atcccaccat 360
gatcaggatc acccaacctt caacaagatc acccccaacc tggctgagtt cgccttcagc
420 ctataccgcc agctggcaca ccagtccaac agcaccaata tcttcttctc
cccagtgagc 480 atcgctacag cctttgcaat gctctccctg gggaccaagg
ctgacactca cgatgaaatc 540 ctggagggcc tgaatttcaa cctcacggag
attccggagg ctcagatcca tgaaggcttc 600 caggaactcc tccgtaccct
caaccagcca gacagccagc tccagctgac caccggcaat 660 ggcctgttcc
tcagcgaggg cctgaagcta gtggataagt ttttggagga tgttaaaaag 720
ttgtaccact cagaagcctt cactgtcaac ttcggggaca ccgaagaggc caagaaacag
780 atcaacgatt acgtggagaa gggtactcaa gggaaaattg tggatttggt
caaggagctt 840 gacagagaca cagtttttgc tctggtgaat tacatcttct
ttaaaggcaa atgggagaga 900 ccctttgaag tcaaggacac cgaggaagag
gacttccacg tggaccaggt gaccaccgtg 960 aaggtgccta tgatgaagcg
tttaggcatg tttaacatcc agcactgtaa gaagctgtcc 1020 agctgggtgc
tgctgatgaa atacctgggc aatgccaccg ccatcttctt cctgcctgat 1080
gaggggaaac tacagcacct ggaaaatgaa ctcacccacg atatcatcac caagttcctg
1140 gaaaatgaag acagaaggtc tgccagctta catttaccca aactgtccat
tactggaacc 1200 tatgatctga agagcgtcct gggtcaactg ggcatcacta
aggtcttcag caatggggct 1260 gacctctccg gggtcacaga ggaggcaccc
ctgaagctct ccaaggccgt gcataaggct 1320 gtgctgacca tcgacgagaa
agggactgaa gctgctgggg ccatgttttt agaggccata 1380 cccatgtcta
tcccccccga ggtcaagttc aacaaaccct ttgtcttctt aatgattgaa 1440
caaaatacca agtctcccct cttcatggga aaagtggtga atcccaccca aaaataactg
1500 cctctcgctc ctcaacccct cccctccatc cctggccccc tccctggatg
acattaaaga 1560 agggttgagc tggtccctgc ctgcatgtga ctgtaaatcc
ctcccatgtt ttctctgagt 1620 ctccctttgc ctgctgaggc tgtatgtggg
ctccaggtaa cagtgctgtc ttcgggcccc 1680 ctgaactgtg ttcatggagc
atctggctgg gtaggcacat gctgggcttg aatccagggg 1740 ggactgaatc
ctcagcttac ggacctgggc ccatctgttt ctggagggct ccagtcttcc 1800
ttgtcctgtc ttggagtccc caagaaggaa tcacagggga ggaaccagat accagccatg
1860 accccaggct ccaccaagca tcttcatgtc cccctgctca tcccccactc
ccccccaccc 1920 agagttgctc atcctgccag ggctggctgt gcccacccca
aggctgccct cctgggggcc 1980 ccagaactgc ctgatcgtgc cgtggcccag
ttttgtggca tctgcagcaa cacaagagag 2040 aggacaatgt cctcctcttg
acccgctgtc acctaaccag actcgggccc tgcacctctc 2100 aggcacttct
ggaaaatgac tgaggcagat tcttcctgaa gcccattctc catggggcaa 2160
caaggacacc tattctgtcc ttgtccttcc atcgctgccc cagaaagcct cacatatctc
2220 cgtttagaat caggtccctt ctccccagat gaagaggagg gtctctgctt
tgttttctct 2280 atctcctcct cagacttgac caggcccagc aggccccaga
agaccattac cctatatccc 2340 ttctcctccc tagtcacatg gccataggcc
tgctgatggc tcaggaaggc cattgcaagg 2400 actcctcagc tatgggagag
gaagcacatc acccattgac ccccgcaacc cctccctttc 2460 ctcctctgag
tcccgactgg ggccacatgc agcctgactt ctttgtgcct gttgctgtcc 2520
ctgcagtctt cagagggcca ccgcagctcc agtgccacgg caggaggctg ttcctgaata
2580 gcccctgtgg taagggccag gagagtcctt ccatcctcca aggccctgct
aaaggacaca 2640 gcagccagga agtcccctgg gcccctagct gaaggacagc
ctgctccctc cgtctctacc 2700 aggaatggcc ttgtcctatg gaaggcactg
ccccatccca aactaatcta ggaatcactg 2760 tctaaccact cactgtcatg
aatgtgtact taaaggatga ggttgagtca taccaaatag 2820 tgatttcgat
agttcaaaat ggtgaaatta gcaattctac atgattcagt ctaatcaatg 2880
gataccgact gtttcccaca caagtctcct gttctcttaa gcttactcac tgacagcctt
2940 tcactctcca caaatacatt aaagatatgg ccatcaccaa gccccctagg
atgacaccag 3000 acctgagagt ctgaagacct ggatccaagt tctgactttt
ccccctgaca gctgtgtgac 3060 cttcgtgaag tcgccaaacc tctctgagcc
ccagtcattg ctagtaagac ctgcctttga 3120 gttggtatga tgttcaagtt
agataacaaa atgtttatac ccattagaac agagaataaa 3180 tagaactaca
tttcttgca 3199 <210> SEQ ID NO 5 <211> LENGTH: 3513
<212> TYPE: DNA <213> ORGANISM: Homo sapien <400>
SEQUENCE: 5 tgggcaggaa ctgggcactg tgcccagggc atgcactgcc tccacgcagc
aaccctcaga 60 gtcctgagct gaaccaagaa ggaggagggg gtcgggcctc
cgaggaaggc ctagccgctg 120 ctgctgccag gaattccagg ttggaggggc
ggcaacctcc tgccagcctt caggccactc 180 tcctgtgcct gccagaagag
acagagcttg aggagagctt gaggagagca ggaaagggcg 240 gcagtaagtc
ttcagcatca ggcattttgg ggtgactcag taaatggtag atcttgctac 300
cagtggaaca gccactaagg attctgcagt gagagcagag ggccagctaa gtggtactct
360 cccagagact gtctgactca cgccaccccc tccaccttgg acacaggacg
ctgtggtttc 420 tgagccaggt acaatgactc ctttcgcagc ctcccccgtt
gcccctctgg atccactgct 480 taaatacgga cgaggacagg gccctgtctc
ctcagcttca ggcaccacca ctgacctggg 540 acagtgaatc gacaatgccg
tcttctgtct cgtggggcat cctcctgctg gcaggcctgt 600 gctgcctggt
ccctgtctcc ctggctgagg atccccaggg agatgctgcc cagaagacag 660
atacatccca ccatgatcag gatcacccaa ccttcaacaa gatcaccccc aacctggctg
720 agttcgcctt cagcctatac cgccagctgg cacaccagtc caacagcacc
aatatcttct 780 tctccccagt gagcatcgct acagcctttg caatgctctc
cctggggacc aaggctgaca 840 ctcacgatga aatcctggag ggcctgaatt
tcaacctcac ggagattccg gaggctcaga 900 tccatgaagg cttccaggaa
ctcctccgta ccctcaacca gccagacagc cagctccagc 960 tgaccaccgg
caatggcctg ttcctcagcg agggcctgaa gctagtggat aagtttttgg 1020
aggatgttaa aaagttgtac cactcagaag ccttcactgt caacttcggg gacaccgaag
1080 aggccaagaa acagatcaac gattacgtgg agaagggtac tcaagggaaa
attgtggatt 1140 tggtcaagga gcttgacaga gacacagttt ttgctctggt
gaattacatc ttctttaaag 1200 gcaaatggga gagacccttt gaagtcaagg
acaccgagga agaggacttc cacgtggacc 1260 aggtgaccac cgtgaaggtg
cctatgatga agcgtttagg catgtttaac atccagcact 1320 gtaagaagct
gtccagctgg gtgctgctga tgaaatacct gggcaatgcc accgccatct 1380
tcttcctgcc tgatgagggg aaactacagc acctggaaaa tgaactcacc cacgatatca
1440 tcaccaagtt cctggaaaat gaagacagaa ggtctgccag cttacattta
cccaaactgt 1500 ccattactgg aacctatgat ctgaagagcg tcctgggtca
actgggcatc actaaggtct 1560 tcagcaatgg ggctgacctc tccggggtca
cagaggaggc acccctgaag ctctccaagg 1620 ccgtgcataa ggctgtgctg
accatcgacg agaaagggac tgaagctgct ggggccatgt 1680 ttttagaggc
catacccatg tctatccccc ccgaggtcaa gttcaacaaa ccctttgtct 1740
tcttaatgat tgaacaaaat accaagtctc ccctcttcat gggaaaagtg gtgaatccca
1800 cccaaaaata actgcctctc gctcctcaac ccctcccctc catccctggc
cccctccctg 1860 gatgacatta aagaagggtt gagctggtcc ctgcctgcat
gtgactgtaa atccctccca 1920 tgttttctct gagtctccct ttgcctgctg
aggctgtatg tgggctccag gtaacagtgc 1980 tgtcttcggg ccccctgaac
tgtgttcatg gagcatctgg ctgggtaggc acatgctggg 2040 cttgaatcca
ggggggactg aatcctcagc ttacggacct gggcccatct gtttctggag 2100
ggctccagtc ttccttgtcc tgtcttggag tccccaagaa ggaatcacag gggaggaacc
2160
agataccagc catgacccca ggctccacca agcatcttca tgtccccctg ctcatccccc
2220 actccccccc acccagagtt gctcatcctg ccagggctgg ctgtgcccac
cccaaggctg 2280 ccctcctggg ggccccagaa ctgcctgatc gtgccgtggc
ccagttttgt ggcatctgca 2340 gcaacacaag agagaggaca atgtcctcct
cttgacccgc tgtcacctaa ccagactcgg 2400 gccctgcacc tctcaggcac
ttctggaaaa tgactgaggc agattcttcc tgaagcccat 2460 tctccatggg
gcaacaagga cacctattct gtccttgtcc ttccatcgct gccccagaaa 2520
gcctcacata tctccgttta gaatcaggtc ccttctcccc agatgaagag gagggtctct
2580 gctttgtttt ctctatctcc tcctcagact tgaccaggcc cagcaggccc
cagaagacca 2640 ttaccctata tcccttctcc tccctagtca catggccata
ggcctgctga tggctcagga 2700 aggccattgc aaggactcct cagctatggg
agaggaagca catcacccat tgacccccgc 2760 aacccctccc tttcctcctc
tgagtcccga ctggggccac atgcagcctg acttctttgt 2820 gcctgttgct
gtccctgcag tcttcagagg gccaccgcag ctccagtgcc acggcaggag 2880
gctgttcctg aatagcccct gtggtaaggg ccaggagagt ccttccatcc tccaaggccc
2940 tgctaaagga cacagcagcc aggaagtccc ctgggcccct agctgaagga
cagcctgctc 3000 cctccgtctc taccaggaat ggccttgtcc tatggaaggc
actgccccat cccaaactaa 3060 tctaggaatc actgtctaac cactcactgt
catgaatgtg tacttaaagg atgaggttga 3120 gtcataccaa atagtgattt
cgatagttca aaatggtgaa attagcaatt ctacatgatt 3180 cagtctaatc
aatggatacc gactgtttcc cacacaagtc tcctgttctc ttaagcttac 3240
tcactgacag cctttcactc tccacaaata cattaaagat atggccatca ccaagccccc
3300 taggatgaca ccagacctga gagtctgaag acctggatcc aagttctgac
ttttccccct 3360 gacagctgtg tgaccttcgt gaagtcgcca aacctctctg
agccccagtc attgctagta 3420 agacctgcct ttgagttggt atgatgttca
agttagataa caaaatgttt atacccatta 3480 gaacagagaa taaatagaac
tacatttctt gca 3513 <210> SEQ ID NO 6 <211> LENGTH:
3236 <212> TYPE: DNA <213> ORGANISM: Homo sapien
<400> SEQUENCE: 6 tgggcaggaa ctgggcactg tgcccagggc atgcactgcc
tccacgcagc aaccctcaga 60 gtcctgagct gaaccaagaa ggaggagggg
gtcgggcctc cgaggaaggc ctagccgctg 120 ctgctgccag gaattccagg
ttggaggggc ggcaacctcc tgccagcctt caggccactc 180 tcctgtgcct
gccagaagag acagagcttg aggagagctt gaggagagca ggaaaggtgg 240
gacattgctg ctgctgctca ctcagttcca caggacaatg ccgtcttctg tctcgtgggg
300 catcctcctg ctggcaggcc tgtgctgcct ggtccctgtc tccctggctg
aggatcccca 360 gggagatgct gcccagaaga cagatacatc ccaccatgat
caggatcacc caaccttcaa 420 caagatcacc cccaacctgg ctgagttcgc
cttcagccta taccgccagc tggcacacca 480 gtccaacagc accaatatct
tcttctcccc agtgagcatc gctacagcct ttgcaatgct 540 ctccctgggg
accaaggctg acactcacga tgaaatcctg gagggcctga atttcaacct 600
cacggagatt ccggaggctc agatccatga aggcttccag gaactcctcc gtaccctcaa
660 ccagccagac agccagctcc agctgaccac cggcaatggc ctgttcctca
gcgagggcct 720 gaagctagtg gataagtttt tggaggatgt taaaaagttg
taccactcag aagccttcac 780 tgtcaacttc ggggacaccg aagaggccaa
gaaacagatc aacgattacg tggagaaggg 840 tactcaaggg aaaattgtgg
atttggtcaa ggagcttgac agagacacag tttttgctct 900 ggtgaattac
atcttcttta aaggcaaatg ggagagaccc tttgaagtca aggacaccga 960
ggaagaggac ttccacgtgg accaggtgac caccgtgaag gtgcctatga tgaagcgttt
1020 aggcatgttt aacatccagc actgtaagaa gctgtccagc tgggtgctgc
tgatgaaata 1080 cctgggcaat gccaccgcca tcttcttcct gcctgatgag
gggaaactac agcacctgga 1140 aaatgaactc acccacgata tcatcaccaa
gttcctggaa aatgaagaca gaaggtctgc 1200 cagcttacat ttacccaaac
tgtccattac tggaacctat gatctgaaga gcgtcctggg 1260 tcaactgggc
atcactaagg tcttcagcaa tggggctgac ctctccgggg tcacagagga 1320
ggcacccctg aagctctcca aggccgtgca taaggctgtg ctgaccatcg acgagaaagg
1380 gactgaagct gctggggcca tgtttttaga ggccataccc atgtctatcc
cccccgaggt 1440 caagttcaac aaaccctttg tcttcttaat gattgaacaa
aataccaagt ctcccctctt 1500 catgggaaaa gtggtgaatc ccacccaaaa
ataactgcct ctcgctcctc aacccctccc 1560 ctccatccct ggccccctcc
ctggatgaca ttaaagaagg gttgagctgg tccctgcctg 1620 catgtgactg
taaatccctc ccatgttttc tctgagtctc cctttgcctg ctgaggctgt 1680
atgtgggctc caggtaacag tgctgtcttc gggccccctg aactgtgttc atggagcatc
1740 tggctgggta ggcacatgct gggcttgaat ccagggggga ctgaatcctc
agcttacgga 1800 cctgggccca tctgtttctg gagggctcca gtcttccttg
tcctgtcttg gagtccccaa 1860 gaaggaatca caggggagga accagatacc
agccatgacc ccaggctcca ccaagcatct 1920 tcatgtcccc ctgctcatcc
cccactcccc cccacccaga gttgctcatc ctgccagggc 1980 tggctgtgcc
caccccaagg ctgccctcct gggggcccca gaactgcctg atcgtgccgt 2040
ggcccagttt tgtggcatct gcagcaacac aagagagagg acaatgtcct cctcttgacc
2100 cgctgtcacc taaccagact cgggccctgc acctctcagg cacttctgga
aaatgactga 2160 ggcagattct tcctgaagcc cattctccat ggggcaacaa
ggacacctat tctgtccttg 2220 tccttccatc gctgccccag aaagcctcac
atatctccgt ttagaatcag gtcccttctc 2280 cccagatgaa gaggagggtc
tctgctttgt tttctctatc tcctcctcag acttgaccag 2340 gcccagcagg
ccccagaaga ccattaccct atatcccttc tcctccctag tcacatggcc 2400
ataggcctgc tgatggctca ggaaggccat tgcaaggact cctcagctat gggagaggaa
2460 gcacatcacc cattgacccc cgcaacccct ccctttcctc ctctgagtcc
cgactggggc 2520 cacatgcagc ctgacttctt tgtgcctgtt gctgtccctg
cagtcttcag agggccaccg 2580 cagctccagt gccacggcag gaggctgttc
ctgaatagcc cctgtggtaa gggccaggag 2640 agtccttcca tcctccaagg
ccctgctaaa ggacacagca gccaggaagt cccctgggcc 2700 cctagctgaa
ggacagcctg ctccctccgt ctctaccagg aatggccttg tcctatggaa 2760
ggcactgccc catcccaaac taatctagga atcactgtct aaccactcac tgtcatgaat
2820 gtgtacttaa aggatgaggt tgagtcatac caaatagtga tttcgatagt
tcaaaatggt 2880 gaaattagca attctacatg attcagtcta atcaatggat
accgactgtt tcccacacaa 2940 gtctcctgtt ctcttaagct tactcactga
cagcctttca ctctccacaa atacattaaa 3000 gatatggcca tcaccaagcc
ccctaggatg acaccagacc tgagagtctg aagacctgga 3060 tccaagttct
gacttttccc cctgacagct gtgtgacctt cgtgaagtcg ccaaacctct 3120
ctgagcccca gtcattgcta gtaagacctg cctttgagtt ggtatgatgt tcaagttaga
3180 taacaaaatg tttataccca ttagaacaga gaataaatag aactacattt cttgca
3236 <210> SEQ ID NO 7 <211> LENGTH: 3532 <212>
TYPE: DNA <213> ORGANISM: Homo sapien <400> SEQUENCE: 7
tgggcaggaa ctgggcactg tgcccagggc atgcactgcc tccacgcagc aaccctcaga
60 gtcctgagct gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc
ctagccgctg 120 ctgctgccag gaattccagg ttggaggggc ggcaacctcc
tgccagcctt caggccactc 180 tcctgtgcct gccagaagag acagagcttg
aggagagctt gaggagagca ggaaaggtgg 240 gacattgctg ctgctgctca
ctcagttcca cagggcggca gtaagtcttc agcatcaggc 300 attttggggt
gactcagtaa atggtagatc ttgctaccag tggaacagcc actaaggatt 360
ctgcagtgag agcagagggc cagctaagtg gtactctccc agagactgtc tgactcacgc
420 caccccctcc accttggaca caggacgctg tggtttctga gccagcagcc
tcccccgttg 480 cccctctgga tccactgctt aaatacggac gaggacaggg
ccctgtctcc tcagcttcag 540 gcaccaccac tgacctggga cagtgaatcg
acaatgccgt cttctgtctc gtggggcatc 600 ctcctgctgg caggcctgtg
ctgcctggtc cctgtctccc tggctgagga tccccaggga 660 gatgctgccc
agaagacaga tacatcccac catgatcagg atcacccaac cttcaacaag 720
atcaccccca acctggctga gttcgccttc agcctatacc gccagctggc acaccagtcc
780 aacagcacca atatcttctt ctccccagtg agcatcgcta cagcctttgc
aatgctctcc 840 ctggggacca aggctgacac tcacgatgaa atcctggagg
gcctgaattt caacctcacg 900 gagattccgg aggctcagat ccatgaaggc
ttccaggaac tcctccgtac cctcaaccag 960 ccagacagcc agctccagct
gaccaccggc aatggcctgt tcctcagcga gggcctgaag 1020 ctagtggata
agtttttgga ggatgttaaa aagttgtacc actcagaagc cttcactgtc 1080
aacttcgggg acaccgaaga ggccaagaaa cagatcaacg attacgtgga gaagggtact
1140 caagggaaaa ttgtggattt ggtcaaggag cttgacagag acacagtttt
tgctctggtg 1200 aattacatct tctttaaagg caaatgggag agaccctttg
aagtcaagga caccgaggaa 1260 gaggacttcc acgtggacca ggtgaccacc
gtgaaggtgc ctatgatgaa gcgtttaggc 1320 atgtttaaca tccagcactg
taagaagctg tccagctggg tgctgctgat gaaatacctg 1380 ggcaatgcca
ccgccatctt cttcctgcct gatgagggga aactacagca cctggaaaat 1440
gaactcaccc acgatatcat caccaagttc ctggaaaatg aagacagaag gtctgccagc
1500 ttacatttac ccaaactgtc cattactgga acctatgatc tgaagagcgt
cctgggtcaa 1560 ctgggcatca ctaaggtctt cagcaatggg gctgacctct
ccggggtcac agaggaggca 1620 cccctgaagc tctccaaggc cgtgcataag
gctgtgctga ccatcgacga gaaagggact 1680 gaagctgctg gggccatgtt
tttagaggcc atacccatgt ctatcccccc cgaggtcaag 1740 ttcaacaaac
cctttgtctt cttaatgatt gaacaaaata ccaagtctcc cctcttcatg 1800
ggaaaagtgg tgaatcccac ccaaaaataa ctgcctctcg ctcctcaacc cctcccctcc
1860 atccctggcc ccctccctgg atgacattaa agaagggttg agctggtccc
tgcctgcatg 1920 tgactgtaaa tccctcccat gttttctctg agtctccctt
tgcctgctga ggctgtatgt 1980 gggctccagg taacagtgct gtcttcgggc
cccctgaact gtgttcatgg agcatctggc 2040 tgggtaggca catgctgggc
ttgaatccag gggggactga atcctcagct tacggacctg 2100 ggcccatctg
tttctggagg gctccagtct tccttgtcct gtcttggagt ccccaagaag 2160
gaatcacagg ggaggaacca gataccagcc atgaccccag gctccaccaa gcatcttcat
2220 gtccccctgc tcatccccca ctccccccca cccagagttg ctcatcctgc
cagggctggc 2280 tgtgcccacc ccaaggctgc cctcctgggg gccccagaac
tgcctgatcg tgccgtggcc 2340 cagttttgtg gcatctgcag caacacaaga
gagaggacaa tgtcctcctc ttgacccgct 2400 gtcacctaac cagactcggg
ccctgcacct ctcaggcact tctggaaaat gactgaggca 2460
gattcttcct gaagcccatt ctccatgggg caacaaggac acctattctg tccttgtcct
2520 tccatcgctg ccccagaaag cctcacatat ctccgtttag aatcaggtcc
cttctcccca 2580 gatgaagagg agggtctctg ctttgttttc tctatctcct
cctcagactt gaccaggccc 2640 agcaggcccc agaagaccat taccctatat
cccttctcct ccctagtcac atggccatag 2700 gcctgctgat ggctcaggaa
ggccattgca aggactcctc agctatggga gaggaagcac 2760 atcacccatt
gacccccgca acccctccct ttcctcctct gagtcccgac tggggccaca 2820
tgcagcctga cttctttgtg cctgttgctg tccctgcagt cttcagaggg ccaccgcagc
2880 tccagtgcca cggcaggagg ctgttcctga atagcccctg tggtaagggc
caggagagtc 2940 cttccatcct ccaaggccct gctaaaggac acagcagcca
ggaagtcccc tgggccccta 3000 gctgaaggac agcctgctcc ctccgtctct
accaggaatg gccttgtcct atggaaggca 3060 ctgccccatc ccaaactaat
ctaggaatca ctgtctaacc actcactgtc atgaatgtgt 3120 acttaaagga
tgaggttgag tcataccaaa tagtgatttc gatagttcaa aatggtgaaa 3180
ttagcaattc tacatgattc agtctaatca atggataccg actgtttccc acacaagtct
3240 cctgttctct taagcttact cactgacagc ctttcactct ccacaaatac
attaaagata 3300 tggccatcac caagccccct aggatgacac cagacctgag
agtctgaaga cctggatcca 3360 agttctgact tttccccctg acagctgtgt
gaccttcgtg aagtcgccaa acctctctga 3420 gccccagtca ttgctagtaa
gacctgcctt tgagttggta tgatgttcaa gttagataac 3480 aaaatgttta
tacccattag aacagagaat aaatagaact acatttcttg ca 3532 <210> SEQ
ID NO 8 <211> LENGTH: 3340 <212> TYPE: DNA <213>
ORGANISM: Homo sapien <400> SEQUENCE: 8 tgggcaggaa ctgggcactg
tgcccagggc atgcactgcc tccacgcagc aaccctcaga 60 gtcctgagct
gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc ctagccgctg 120
ctgctgccag gaattccagg ttggaggggc ggcaacctcc tgccagcctt caggccactc
180 tcctgtgcct gccagaagag acagagcttg aggagagctt gaggagagca
ggaaaggtgg 240 gacattgctg ctgctgctca ctcagttcca cagcagcctc
ccccgttgcc cctctggatc 300 cactgcttaa atacggacga ggacagggcc
ctgtctcctc agcttcaggc accaccactg 360 acctgggaca gtgaatcgac
aatgccgtct tctgtctcgt ggggcatcct cctgctggca 420 ggcctgtgct
gcctggtccc tgtctccctg gctgaggatc cccagggaga tgctgcccag 480
aagacagata catcccacca tgatcaggat cacccaacct tcaacaagat cacccccaac
540 ctggctgagt tcgccttcag cctataccgc cagctggcac accagtccaa
cagcaccaat 600 atcttcttct ccccagtgag catcgctaca gcctttgcaa
tgctctccct ggggaccaag 660 gctgacactc acgatgaaat cctggagggc
ctgaatttca acctcacgga gattccggag 720 gctcagatcc atgaaggctt
ccaggaactc ctccgtaccc tcaaccagcc agacagccag 780 ctccagctga
ccaccggcaa tggcctgttc ctcagcgagg gcctgaagct agtggataag 840
tttttggagg atgttaaaaa gttgtaccac tcagaagcct tcactgtcaa cttcggggac
900 accgaagagg ccaagaaaca gatcaacgat tacgtggaga agggtactca
agggaaaatt 960 gtggatttgg tcaaggagct tgacagagac acagtttttg
ctctggtgaa ttacatcttc 1020 tttaaaggca aatgggagag accctttgaa
gtcaaggaca ccgaggaaga ggacttccac 1080 gtggaccagg tgaccaccgt
gaaggtgcct atgatgaagc gtttaggcat gtttaacatc 1140 cagcactgta
agaagctgtc cagctgggtg ctgctgatga aatacctggg caatgccacc 1200
gccatcttct tcctgcctga tgaggggaaa ctacagcacc tggaaaatga actcacccac
1260 gatatcatca ccaagttcct ggaaaatgaa gacagaaggt ctgccagctt
acatttaccc 1320 aaactgtcca ttactggaac ctatgatctg aagagcgtcc
tgggtcaact gggcatcact 1380 aaggtcttca gcaatggggc tgacctctcc
ggggtcacag aggaggcacc cctgaagctc 1440 tccaaggccg tgcataaggc
tgtgctgacc atcgacgaga aagggactga agctgctggg 1500 gccatgtttt
tagaggccat acccatgtct atcccccccg aggtcaagtt caacaaaccc 1560
tttgtcttct taatgattga acaaaatacc aagtctcccc tcttcatggg aaaagtggtg
1620 aatcccaccc aaaaataact gcctctcgct cctcaacccc tcccctccat
ccctggcccc 1680 ctccctggat gacattaaag aagggttgag ctggtccctg
cctgcatgtg actgtaaatc 1740 cctcccatgt tttctctgag tctccctttg
cctgctgagg ctgtatgtgg gctccaggta 1800 acagtgctgt cttcgggccc
cctgaactgt gttcatggag catctggctg ggtaggcaca 1860 tgctgggctt
gaatccaggg gggactgaat cctcagctta cggacctggg cccatctgtt 1920
tctggagggc tccagtcttc cttgtcctgt cttggagtcc ccaagaagga atcacagggg
1980 aggaaccaga taccagccat gaccccaggc tccaccaagc atcttcatgt
ccccctgctc 2040 atcccccact cccccccacc cagagttgct catcctgcca
gggctggctg tgcccacccc 2100 aaggctgccc tcctgggggc cccagaactg
cctgatcgtg ccgtggccca gttttgtggc 2160 atctgcagca acacaagaga
gaggacaatg tcctcctctt gacccgctgt cacctaacca 2220 gactcgggcc
ctgcacctct caggcacttc tggaaaatga ctgaggcaga ttcttcctga 2280
agcccattct ccatggggca acaaggacac ctattctgtc cttgtccttc catcgctgcc
2340 ccagaaagcc tcacatatct ccgtttagaa tcaggtccct tctccccaga
tgaagaggag 2400 ggtctctgct ttgttttctc tatctcctcc tcagacttga
ccaggcccag caggccccag 2460 aagaccatta ccctatatcc cttctcctcc
ctagtcacat ggccataggc ctgctgatgg 2520 ctcaggaagg ccattgcaag
gactcctcag ctatgggaga ggaagcacat cacccattga 2580 cccccgcaac
ccctcccttt cctcctctga gtcccgactg gggccacatg cagcctgact 2640
tctttgtgcc tgttgctgtc cctgcagtct tcagagggcc accgcagctc cagtgccacg
2700 gcaggaggct gttcctgaat agcccctgtg gtaagggcca ggagagtcct
tccatcctcc 2760 aaggccctgc taaaggacac agcagccagg aagtcccctg
ggcccctagc tgaaggacag 2820 cctgctccct ccgtctctac caggaatggc
cttgtcctat ggaaggcact gccccatccc 2880 aaactaatct aggaatcact
gtctaaccac tcactgtcat gaatgtgtac ttaaaggatg 2940 aggttgagtc
ataccaaata gtgatttcga tagttcaaaa tggtgaaatt agcaattcta 3000
catgattcag tctaatcaat ggataccgac tgtttcccac acaagtctcc tgttctctta
3060 agcttactca ctgacagcct ttcactctcc acaaatacat taaagatatg
gccatcacca 3120 agccccctag gatgacacca gacctgagag tctgaagacc
tggatccaag ttctgacttt 3180 tccccctgac agctgtgtga ccttcgtgaa
gtcgccaaac ctctctgagc cccagtcatt 3240 gctagtaaga cctgcctttg
agttggtatg atgttcaagt tagataacaa aatgtttata 3300 cccattagaa
cagagaataa atagaactac atttcttgca 3340 <210> SEQ ID NO 9
<211> LENGTH: 3495 <212> TYPE: DNA <213>
ORGANISM: Homo sapien <400> SEQUENCE: 9 tgggcaggaa ctgggcactg
tgcccagggc atgcactgcc tccacgcagc aaccctcaga 60 gtcctgagct
gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc ctagccgctg 120
ctgctgccag gaattccagg ttggaggggc ggcaacctcc tgccagcctt caggccactc
180 tcctgtgcct gccagaagag acagagcttg aggagagctt gaggagagca
ggaaagggcg 240 gcagtaagtc ttcagcatca ggcattttgg ggtgactcag
taaatggtag atcttgctac 300 cagtggaaca gccactaagg attctgcagt
gagagcagag ggccagctaa gtggtactct 360 cccagagact gtctgactca
cgccaccccc tccaccttgg acacaggacg ctgtggtttc 420 tgagccagca
gcctcccccg ttgcccctct ggatccactg cttaaatacg gacgaggaca 480
gggccctgtc tcctcagctt caggcaccac cactgacctg ggacagtgaa tcgacaatgc
540 cgtcttctgt ctcgtggggc atcctcctgc tggcaggcct gtgctgcctg
gtccctgtct 600 ccctggctga ggatccccag ggagatgctg cccagaagac
agatacatcc caccatgatc 660 aggatcaccc aaccttcaac aagatcaccc
ccaacctggc tgagttcgcc ttcagcctat 720 accgccagct ggcacaccag
tccaacagca ccaatatctt cttctcccca gtgagcatcg 780 ctacagcctt
tgcaatgctc tccctgggga ccaaggctga cactcacgat gaaatcctgg 840
agggcctgaa tttcaacctc acggagattc cggaggctca gatccatgaa ggcttccagg
900 aactcctccg taccctcaac cagccagaca gccagctcca gctgaccacc
ggcaatggcc 960 tgttcctcag cgagggcctg aagctagtgg ataagttttt
ggaggatgtt aaaaagttgt 1020 accactcaga agccttcact gtcaacttcg
gggacaccga agaggccaag aaacagatca 1080 acgattacgt ggagaagggt
actcaaggga aaattgtgga tttggtcaag gagcttgaca 1140 gagacacagt
ttttgctctg gtgaattaca tcttctttaa aggcaaatgg gagagaccct 1200
ttgaagtcaa ggacaccgag gaagaggact tccacgtgga ccaggtgacc accgtgaagg
1260 tgcctatgat gaagcgttta ggcatgttta acatccagca ctgtaagaag
ctgtccagct 1320 gggtgctgct gatgaaatac ctgggcaatg ccaccgccat
cttcttcctg cctgatgagg 1380 ggaaactaca gcacctggaa aatgaactca
cccacgatat catcaccaag ttcctggaaa 1440 atgaagacag aaggtctgcc
agcttacatt tacccaaact gtccattact ggaacctatg 1500 atctgaagag
cgtcctgggt caactgggca tcactaaggt cttcagcaat ggggctgacc 1560
tctccggggt cacagaggag gcacccctga agctctccaa ggccgtgcat aaggctgtgc
1620 tgaccatcga cgagaaaggg actgaagctg ctggggccat gtttttagag
gccataccca 1680 tgtctatccc ccccgaggtc aagttcaaca aaccctttgt
cttcttaatg attgaacaaa 1740 ataccaagtc tcccctcttc atgggaaaag
tggtgaatcc cacccaaaaa taactgcctc 1800 tcgctcctca acccctcccc
tccatccctg gccccctccc tggatgacat taaagaaggg 1860 ttgagctggt
ccctgcctgc atgtgactgt aaatccctcc catgttttct ctgagtctcc 1920
ctttgcctgc tgaggctgta tgtgggctcc aggtaacagt gctgtcttcg ggccccctga
1980 actgtgttca tggagcatct ggctgggtag gcacatgctg ggcttgaatc
caggggggac 2040 tgaatcctca gcttacggac ctgggcccat ctgtttctgg
agggctccag tcttccttgt 2100 cctgtcttgg agtccccaag aaggaatcac
aggggaggaa ccagatacca gccatgaccc 2160 caggctccac caagcatctt
catgtccccc tgctcatccc ccactccccc ccacccagag 2220 ttgctcatcc
tgccagggct ggctgtgccc accccaaggc tgccctcctg ggggccccag 2280
aactgcctga tcgtgccgtg gcccagtttt gtggcatctg cagcaacaca agagagagga
2340 caatgtcctc ctcttgaccc gctgtcacct aaccagactc gggccctgca
cctctcaggc 2400 acttctggaa aatgactgag gcagattctt cctgaagccc
attctccatg gggcaacaag 2460 gacacctatt ctgtccttgt ccttccatcg
ctgccccaga aagcctcaca tatctccgtt 2520 tagaatcagg tcccttctcc
ccagatgaag aggagggtct ctgctttgtt ttctctatct 2580
cctcctcaga cttgaccagg cccagcaggc cccagaagac cattacccta tatcccttct
2640 cctccctagt cacatggcca taggcctgct gatggctcag gaaggccatt
gcaaggactc 2700 ctcagctatg ggagaggaag cacatcaccc attgaccccc
gcaacccctc cctttcctcc 2760 tctgagtccc gactggggcc acatgcagcc
tgacttcttt gtgcctgttg ctgtccctgc 2820 agtcttcaga gggccaccgc
agctccagtg ccacggcagg aggctgttcc tgaatagccc 2880 ctgtggtaag
ggccaggaga gtccttccat cctccaaggc cctgctaaag gacacagcag 2940
ccaggaagtc ccctgggccc ctagctgaag gacagcctgc tccctccgtc tctaccagga
3000 atggccttgt cctatggaag gcactgcccc atcccaaact aatctaggaa
tcactgtcta 3060 accactcact gtcatgaatg tgtacttaaa ggatgaggtt
gagtcatacc aaatagtgat 3120 ttcgatagtt caaaatggtg aaattagcaa
ttctacatga ttcagtctaa tcaatggata 3180 ccgactgttt cccacacaag
tctcctgttc tcttaagctt actcactgac agcctttcac 3240 tctccacaaa
tacattaaag atatggccat caccaagccc cctaggatga caccagacct 3300
gagagtctga agacctggat ccaagttctg acttttcccc ctgacagctg tgtgaccttc
3360 gtgaagtcgc caaacctctc tgagccccag tcattgctag taagacctgc
ctttgagttg 3420 gtatgatgtt caagttagat aacaaaatgt ttatacccat
tagaacagag aataaataga 3480 actacatttc ttgca 3495 <210> SEQ ID
NO 10 <211> LENGTH: 3492 <212> TYPE: DNA <213>
ORGANISM: Homo sapien <400> SEQUENCE: 10 tgggcaggaa
ctgggcactg tgcccagggc atgcactgcc tccacgcagc aaccctcaga 60
gtcctgagct gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc ctagccgctg
120 ctgctgccag gaattccagg ttggaggggc ggcaacctcc tgccagcctt
caggccactc 180 tcctgtgcct gccagaagag acagagcttg aggagagctt
gaggagagca ggaaagggcg 240 gcagtaagtc ttcagcatca ggcattttgg
ggtgactcag taaatggtag atcttgctac 300 cagtggaaca gccactaagg
attctgcagt gagagcagag ggccagctaa gtggtactct 360 cccagagact
gtctgactca cgccaccccc tccaccttgg acacaggacg ctgtggtttc 420
tgagccagcc tcccccgttg cccctctgga tccactgctt aaatacggac gaggacaggg
480 ccctgtctcc tcagcttcag gcaccaccac tgacctggga cagtgaatcg
acaatgccgt 540 cttctgtctc gtggggcatc ctcctgctgg caggcctgtg
ctgcctggtc cctgtctccc 600 tggctgagga tccccaggga gatgctgccc
agaagacaga tacatcccac catgatcagg 660 atcacccaac cttcaacaag
atcaccccca acctggctga gttcgccttc agcctatacc 720 gccagctggc
acaccagtcc aacagcacca atatcttctt ctccccagtg agcatcgcta 780
cagcctttgc aatgctctcc ctggggacca aggctgacac tcacgatgaa atcctggagg
840 gcctgaattt caacctcacg gagattccgg aggctcagat ccatgaaggc
ttccaggaac 900 tcctccgtac cctcaaccag ccagacagcc agctccagct
gaccaccggc aatggcctgt 960 tcctcagcga gggcctgaag ctagtggata
agtttttgga ggatgttaaa aagttgtacc 1020 actcagaagc cttcactgtc
aacttcgggg acaccgaaga ggccaagaaa cagatcaacg 1080 attacgtgga
gaagggtact caagggaaaa ttgtggattt ggtcaaggag cttgacagag 1140
acacagtttt tgctctggtg aattacatct tctttaaagg caaatgggag agaccctttg
1200 aagtcaagga caccgaggaa gaggacttcc acgtggacca ggtgaccacc
gtgaaggtgc 1260 ctatgatgaa gcgtttaggc atgtttaaca tccagcactg
taagaagctg tccagctggg 1320 tgctgctgat gaaatacctg ggcaatgcca
ccgccatctt cttcctgcct gatgagggga 1380 aactacagca cctggaaaat
gaactcaccc acgatatcat caccaagttc ctggaaaatg 1440 aagacagaag
gtctgccagc ttacatttac ccaaactgtc cattactgga acctatgatc 1500
tgaagagcgt cctgggtcaa ctgggcatca ctaaggtctt cagcaatggg gctgacctct
1560 ccggggtcac agaggaggca cccctgaagc tctccaaggc cgtgcataag
gctgtgctga 1620 ccatcgacga gaaagggact gaagctgctg gggccatgtt
tttagaggcc atacccatgt 1680 ctatcccccc cgaggtcaag ttcaacaaac
cctttgtctt cttaatgatt gaacaaaata 1740 ccaagtctcc cctcttcatg
ggaaaagtgg tgaatcccac ccaaaaataa ctgcctctcg 1800 ctcctcaacc
cctcccctcc atccctggcc ccctccctgg atgacattaa agaagggttg 1860
agctggtccc tgcctgcatg tgactgtaaa tccctcccat gttttctctg agtctccctt
1920 tgcctgctga ggctgtatgt gggctccagg taacagtgct gtcttcgggc
cccctgaact 1980 gtgttcatgg agcatctggc tgggtaggca catgctgggc
ttgaatccag gggggactga 2040 atcctcagct tacggacctg ggcccatctg
tttctggagg gctccagtct tccttgtcct 2100 gtcttggagt ccccaagaag
gaatcacagg ggaggaacca gataccagcc atgaccccag 2160 gctccaccaa
gcatcttcat gtccccctgc tcatccccca ctccccccca cccagagttg 2220
ctcatcctgc cagggctggc tgtgcccacc ccaaggctgc cctcctgggg gccccagaac
2280 tgcctgatcg tgccgtggcc cagttttgtg gcatctgcag caacacaaga
gagaggacaa 2340 tgtcctcctc ttgacccgct gtcacctaac cagactcggg
ccctgcacct ctcaggcact 2400 tctggaaaat gactgaggca gattcttcct
gaagcccatt ctccatgggg caacaaggac 2460 acctattctg tccttgtcct
tccatcgctg ccccagaaag cctcacatat ctccgtttag 2520 aatcaggtcc
cttctcccca gatgaagagg agggtctctg ctttgttttc tctatctcct 2580
cctcagactt gaccaggccc agcaggcccc agaagaccat taccctatat cccttctcct
2640 ccctagtcac atggccatag gcctgctgat ggctcaggaa ggccattgca
aggactcctc 2700 agctatggga gaggaagcac atcacccatt gacccccgca
acccctccct ttcctcctct 2760 gagtcccgac tggggccaca tgcagcctga
cttctttgtg cctgttgctg tccctgcagt 2820 cttcagaggg ccaccgcagc
tccagtgcca cggcaggagg ctgttcctga atagcccctg 2880 tggtaagggc
caggagagtc cttccatcct ccaaggccct gctaaaggac acagcagcca 2940
ggaagtcccc tgggccccta gctgaaggac agcctgctcc ctccgtctct accaggaatg
3000 gccttgtcct atggaaggca ctgccccatc ccaaactaat ctaggaatca
ctgtctaacc 3060 actcactgtc atgaatgtgt acttaaagga tgaggttgag
tcataccaaa tagtgatttc 3120 gatagttcaa aatggtgaaa ttagcaattc
tacatgattc agtctaatca atggataccg 3180 actgtttccc acacaagtct
cctgttctct taagcttact cactgacagc ctttcactct 3240 ccacaaatac
attaaagata tggccatcac caagccccct aggatgacac cagacctgag 3300
agtctgaaga cctggatcca agttctgact tttccccctg acagctgtgt gaccttcgtg
3360 aagtcgccaa acctctctga gccccagtca ttgctagtaa gacctgcctt
tgagttggta 3420 tgatgttcaa gttagataac aaaatgttta tacccattag
aacagagaat aaatagaact 3480 acatttcttg ca 3492 <210> SEQ ID NO
11 <211> LENGTH: 3510 <212> TYPE: DNA <213>
ORGANISM: Homo sapien <400> SEQUENCE: 11 tgggcaggaa
ctgggcactg tgcccagggc atgcactgcc tccacgcagc aaccctcaga 60
gtcctgagct gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc ctagccgctg
120 ctgctgccag gaattccagg ttggaggggc ggcaacctcc tgccagcctt
caggccactc 180 tcctgtgcct gccagaagag acagagcttg aggagagctt
gaggagagca ggaaagggcg 240 gcagtaagtc ttcagcatca ggcattttgg
ggtgactcag taaatggtag atcttgctac 300 cagtggaaca gccactaagg
attctgcagt gagagcagag ggccagctaa gtggtactct 360 cccagagact
gtctgactca cgccaccccc tccaccttgg acacaggacg ctgtggtttc 420
tgagccaggt acaatgactc ctttcgcctc ccccgttgcc cctctggatc cactgcttaa
480 atacggacga ggacagggcc ctgtctcctc agcttcaggc accaccactg
acctgggaca 540 gtgaatcgac aatgccgtct tctgtctcgt ggggcatcct
cctgctggca ggcctgtgct 600 gcctggtccc tgtctccctg gctgaggatc
cccagggaga tgctgcccag aagacagata 660 catcccacca tgatcaggat
cacccaacct tcaacaagat cacccccaac ctggctgagt 720 tcgccttcag
cctataccgc cagctggcac accagtccaa cagcaccaat atcttcttct 780
ccccagtgag catcgctaca gcctttgcaa tgctctccct ggggaccaag gctgacactc
840 acgatgaaat cctggagggc ctgaatttca acctcacgga gattccggag
gctcagatcc 900 atgaaggctt ccaggaactc ctccgtaccc tcaaccagcc
agacagccag ctccagctga 960 ccaccggcaa tggcctgttc ctcagcgagg
gcctgaagct agtggataag tttttggagg 1020 atgttaaaaa gttgtaccac
tcagaagcct tcactgtcaa cttcggggac accgaagagg 1080 ccaagaaaca
gatcaacgat tacgtggaga agggtactca agggaaaatt gtggatttgg 1140
tcaaggagct tgacagagac acagtttttg ctctggtgaa ttacatcttc tttaaaggca
1200 aatgggagag accctttgaa gtcaaggaca ccgaggaaga ggacttccac
gtggaccagg 1260 tgaccaccgt gaaggtgcct atgatgaagc gtttaggcat
gtttaacatc cagcactgta 1320 agaagctgtc cagctgggtg ctgctgatga
aatacctggg caatgccacc gccatcttct 1380 tcctgcctga tgaggggaaa
ctacagcacc tggaaaatga actcacccac gatatcatca 1440 ccaagttcct
ggaaaatgaa gacagaaggt ctgccagctt acatttaccc aaactgtcca 1500
ttactggaac ctatgatctg aagagcgtcc tgggtcaact gggcatcact aaggtcttca
1560 gcaatggggc tgacctctcc ggggtcacag aggaggcacc cctgaagctc
tccaaggccg 1620 tgcataaggc tgtgctgacc atcgacgaga aagggactga
agctgctggg gccatgtttt 1680 tagaggccat acccatgtct atcccccccg
aggtcaagtt caacaaaccc tttgtcttct 1740 taatgattga acaaaatacc
aagtctcccc tcttcatggg aaaagtggtg aatcccaccc 1800 aaaaataact
gcctctcgct cctcaacccc tcccctccat ccctggcccc ctccctggat 1860
gacattaaag aagggttgag ctggtccctg cctgcatgtg actgtaaatc cctcccatgt
1920 tttctctgag tctccctttg cctgctgagg ctgtatgtgg gctccaggta
acagtgctgt 1980 cttcgggccc cctgaactgt gttcatggag catctggctg
ggtaggcaca tgctgggctt 2040 gaatccaggg gggactgaat cctcagctta
cggacctggg cccatctgtt tctggagggc 2100 tccagtcttc cttgtcctgt
cttggagtcc ccaagaagga atcacagggg aggaaccaga 2160 taccagccat
gaccccaggc tccaccaagc atcttcatgt ccccctgctc atcccccact 2220
cccccccacc cagagttgct catcctgcca gggctggctg tgcccacccc aaggctgccc
2280 tcctgggggc cccagaactg cctgatcgtg ccgtggccca gttttgtggc
atctgcagca 2340 acacaagaga gaggacaatg tcctcctctt gacccgctgt
cacctaacca gactcgggcc 2400 ctgcacctct caggcacttc tggaaaatga
ctgaggcaga ttcttcctga agcccattct 2460 ccatggggca acaaggacac
ctattctgtc cttgtccttc catcgctgcc ccagaaagcc 2520 tcacatatct
ccgtttagaa tcaggtccct tctccccaga tgaagaggag ggtctctgct 2580
ttgttttctc tatctcctcc tcagacttga ccaggcccag caggccccag aagaccatta
2640 ccctatatcc cttctcctcc ctagtcacat ggccataggc ctgctgatgg
ctcaggaagg 2700 ccattgcaag gactcctcag ctatgggaga ggaagcacat
cacccattga cccccgcaac 2760 ccctcccttt cctcctctga gtcccgactg
gggccacatg cagcctgact tctttgtgcc 2820 tgttgctgtc cctgcagtct
tcagagggcc accgcagctc cagtgccacg gcaggaggct 2880 gttcctgaat
agcccctgtg gtaagggcca ggagagtcct tccatcctcc aaggccctgc 2940
taaaggacac agcagccagg aagtcccctg ggcccctagc tgaaggacag cctgctccct
3000 ccgtctctac caggaatggc cttgtcctat ggaaggcact gccccatccc
aaactaatct 3060 aggaatcact gtctaaccac tcactgtcat gaatgtgtac
ttaaaggatg aggttgagtc 3120 ataccaaata gtgatttcga tagttcaaaa
tggtgaaatt agcaattcta catgattcag 3180 tctaatcaat ggataccgac
tgtttcccac acaagtctcc tgttctctta agcttactca 3240 ctgacagcct
ttcactctcc acaaatacat taaagatatg gccatcacca agccccctag 3300
gatgacacca gacctgagag tctgaagacc tggatccaag ttctgacttt tccccctgac
3360 agctgtgtga ccttcgtgaa gtcgccaaac ctctctgagc cccagtcatt
gctagtaaga 3420 cctgcctttg agttggtatg atgttcaagt tagataacaa
aatgtttata cccattagaa 3480 cagagaataa atagaactac atttcttgca 3510
<210> SEQ ID NO 12 <211> LENGTH: 3303 <212> TYPE:
DNA <213> ORGANISM: Homo sapien <400> SEQUENCE: 12
tgggcaggaa ctgggcactg tgcccagggc atgcactgcc tccacgcagc aaccctcaga
60 gtcctgagct gaaccaagaa ggaggagggg gtcgggcctc cgaggaaggc
ctagccgctg 120 ctgctgccag gaattccagg ttggaggggc ggcaacctcc
tgccagcctt caggccactc 180 tcctgtgcct gccagaagag acagagcttg
aggagagctt gaggagagca ggaaagcagc 240 ctcccccgtt gcccctctgg
atccactgct taaatacgga cgaggacagg gccctgtctc 300 ctcagcttca
ggcaccacca ctgacctggg acagtgaatc gacaatgccg tcttctgtct 360
cgtggggcat cctcctgctg gcaggcctgt gctgcctggt ccctgtctcc ctggctgagg
420 atccccaggg agatgctgcc cagaagacag atacatccca ccatgatcag
gatcacccaa 480 ccttcaacaa gatcaccccc aacctggctg agttcgcctt
cagcctatac cgccagctgg 540 cacaccagtc caacagcacc aatatcttct
tctccccagt gagcatcgct acagcctttg 600 caatgctctc cctggggacc
aaggctgaca ctcacgatga aatcctggag ggcctgaatt 660 tcaacctcac
ggagattccg gaggctcaga tccatgaagg cttccaggaa ctcctccgta 720
ccctcaacca gccagacagc cagctccagc tgaccaccgg caatggcctg ttcctcagcg
780 agggcctgaa gctagtggat aagtttttgg aggatgttaa aaagttgtac
cactcagaag 840 ccttcactgt caacttcggg gacaccgaag aggccaagaa
acagatcaac gattacgtgg 900 agaagggtac tcaagggaaa attgtggatt
tggtcaagga gcttgacaga gacacagttt 960 ttgctctggt gaattacatc
ttctttaaag gcaaatggga gagacccttt gaagtcaagg 1020 acaccgagga
agaggacttc cacgtggacc aggtgaccac cgtgaaggtg cctatgatga 1080
agcgtttagg catgtttaac atccagcact gtaagaagct gtccagctgg gtgctgctga
1140 tgaaatacct gggcaatgcc accgccatct tcttcctgcc tgatgagggg
aaactacagc 1200 acctggaaaa tgaactcacc cacgatatca tcaccaagtt
cctggaaaat gaagacagaa 1260 ggtctgccag cttacattta cccaaactgt
ccattactgg aacctatgat ctgaagagcg 1320 tcctgggtca actgggcatc
actaaggtct tcagcaatgg ggctgacctc tccggggtca 1380 cagaggaggc
acccctgaag ctctccaagg ccgtgcataa ggctgtgctg accatcgacg 1440
agaaagggac tgaagctgct ggggccatgt ttttagaggc catacccatg tctatccccc
1500 ccgaggtcaa gttcaacaaa ccctttgtct tcttaatgat tgaacaaaat
accaagtctc 1560 ccctcttcat gggaaaagtg gtgaatccca cccaaaaata
actgcctctc gctcctcaac 1620 ccctcccctc catccctggc cccctccctg
gatgacatta aagaagggtt gagctggtcc 1680 ctgcctgcat gtgactgtaa
atccctccca tgttttctct gagtctccct ttgcctgctg 1740 aggctgtatg
tgggctccag gtaacagtgc tgtcttcggg ccccctgaac tgtgttcatg 1800
gagcatctgg ctgggtaggc acatgctggg cttgaatcca ggggggactg aatcctcagc
1860 ttacggacct gggcccatct gtttctggag ggctccagtc ttccttgtcc
tgtcttggag 1920 tccccaagaa ggaatcacag gggaggaacc agataccagc
catgacccca ggctccacca 1980 agcatcttca tgtccccctg ctcatccccc
actccccccc acccagagtt gctcatcctg 2040 ccagggctgg ctgtgcccac
cccaaggctg ccctcctggg ggccccagaa ctgcctgatc 2100 gtgccgtggc
ccagttttgt ggcatctgca gcaacacaag agagaggaca atgtcctcct 2160
cttgacccgc tgtcacctaa ccagactcgg gccctgcacc tctcaggcac ttctggaaaa
2220 tgactgaggc agattcttcc tgaagcccat tctccatggg gcaacaagga
cacctattct 2280 gtccttgtcc ttccatcgct gccccagaaa gcctcacata
tctccgttta gaatcaggtc 2340 ccttctcccc agatgaagag gagggtctct
gctttgtttt ctctatctcc tcctcagact 2400 tgaccaggcc cagcaggccc
cagaagacca ttaccctata tcccttctcc tccctagtca 2460 catggccata
ggcctgctga tggctcagga aggccattgc aaggactcct cagctatggg 2520
agaggaagca catcacccat tgacccccgc aacccctccc tttcctcctc tgagtcccga
2580 ctggggccac atgcagcctg acttctttgt gcctgttgct gtccctgcag
tcttcagagg 2640 gccaccgcag ctccagtgcc acggcaggag gctgttcctg
aatagcccct gtggtaaggg 2700 ccaggagagt ccttccatcc tccaaggccc
tgctaaagga cacagcagcc aggaagtccc 2760 ctgggcccct agctgaagga
cagcctgctc cctccgtctc taccaggaat ggccttgtcc 2820 tatggaaggc
actgccccat cccaaactaa tctaggaatc actgtctaac cactcactgt 2880
catgaatgtg tacttaaagg atgaggttga gtcataccaa atagtgattt cgatagttca
2940 aaatggtgaa attagcaatt ctacatgatt cagtctaatc aatggatacc
gactgtttcc 3000 cacacaagtc tcctgttctc ttaagcttac tcactgacag
cctttcactc tccacaaata 3060 cattaaagat atggccatca ccaagccccc
taggatgaca ccagacctga gagtctgaag 3120 acctggatcc aagttctgac
ttttccccct gacagctgtg tgaccttcgt gaagtcgcca 3180 aacctctctg
agccccagtc attgctagta agacctgcct ttgagttggt atgatgttca 3240
agttagataa caaaatgttt atacccatta gaacagagaa taaatagaac tacatttctt
3300 gca 3303 <210> SEQ ID NO 13 <211> LENGTH: 3300
<212> TYPE: DNA <213> ORGANISM: Homo sapien <400>
SEQUENCE: 13 tgggcaggaa ctgggcactg tgcccagggc atgcactgcc tccacgcagc
aaccctcaga 60 gtcctgagct gaaccaagaa ggaggagggg gtcgggcctc
cgaggaaggc ctagccgctg 120 ctgctgccag gaattccagg ttggaggggc
ggcaacctcc tgccagcctt caggccactc 180 tcctgtgcct gccagaagag
acagagcttg aggagagctt gaggagagca ggaaagcctc 240 ccccgttgcc
cctctggatc cactgcttaa atacggacga ggacagggcc ctgtctcctc 300
agcttcaggc accaccactg acctgggaca gtgaatcgac aatgccgtct tctgtctcgt
360 ggggcatcct cctgctggca ggcctgtgct gcctggtccc tgtctccctg
gctgaggatc 420 cccagggaga tgctgcccag aagacagata catcccacca
tgatcaggat cacccaacct 480 tcaacaagat cacccccaac ctggctgagt
tcgccttcag cctataccgc cagctggcac 540 accagtccaa cagcaccaat
atcttcttct ccccagtgag catcgctaca gcctttgcaa 600 tgctctccct
ggggaccaag gctgacactc acgatgaaat cctggagggc ctgaatttca 660
acctcacgga gattccggag gctcagatcc atgaaggctt ccaggaactc ctccgtaccc
720 tcaaccagcc agacagccag ctccagctga ccaccggcaa tggcctgttc
ctcagcgagg 780 gcctgaagct agtggataag tttttggagg atgttaaaaa
gttgtaccac tcagaagcct 840 tcactgtcaa cttcggggac accgaagagg
ccaagaaaca gatcaacgat tacgtggaga 900 agggtactca agggaaaatt
gtggatttgg tcaaggagct tgacagagac acagtttttg 960 ctctggtgaa
ttacatcttc tttaaaggca aatgggagag accctttgaa gtcaaggaca 1020
ccgaggaaga ggacttccac gtggaccagg tgaccaccgt gaaggtgcct atgatgaagc
1080 gtttaggcat gtttaacatc cagcactgta agaagctgtc cagctgggtg
ctgctgatga 1140 aatacctggg caatgccacc gccatcttct tcctgcctga
tgaggggaaa ctacagcacc 1200 tggaaaatga actcacccac gatatcatca
ccaagttcct ggaaaatgaa gacagaaggt 1260 ctgccagctt acatttaccc
aaactgtcca ttactggaac ctatgatctg aagagcgtcc 1320 tgggtcaact
gggcatcact aaggtcttca gcaatggggc tgacctctcc ggggtcacag 1380
aggaggcacc cctgaagctc tccaaggccg tgcataaggc tgtgctgacc atcgacgaga
1440 aagggactga agctgctggg gccatgtttt tagaggccat acccatgtct
atcccccccg 1500 aggtcaagtt caacaaaccc tttgtcttct taatgattga
acaaaatacc aagtctcccc 1560 tcttcatggg aaaagtggtg aatcccaccc
aaaaataact gcctctcgct cctcaacccc 1620 tcccctccat ccctggcccc
ctccctggat gacattaaag aagggttgag ctggtccctg 1680 cctgcatgtg
actgtaaatc cctcccatgt tttctctgag tctccctttg cctgctgagg 1740
ctgtatgtgg gctccaggta acagtgctgt cttcgggccc cctgaactgt gttcatggag
1800 catctggctg ggtaggcaca tgctgggctt gaatccaggg gggactgaat
cctcagctta 1860 cggacctggg cccatctgtt tctggagggc tccagtcttc
cttgtcctgt cttggagtcc 1920 ccaagaagga atcacagggg aggaaccaga
taccagccat gaccccaggc tccaccaagc 1980 atcttcatgt ccccctgctc
atcccccact cccccccacc cagagttgct catcctgcca 2040 gggctggctg
tgcccacccc aaggctgccc tcctgggggc cccagaactg cctgatcgtg 2100
ccgtggccca gttttgtggc atctgcagca acacaagaga gaggacaatg tcctcctctt
2160 gacccgctgt cacctaacca gactcgggcc ctgcacctct caggcacttc
tggaaaatga 2220 ctgaggcaga ttcttcctga agcccattct ccatggggca
acaaggacac ctattctgtc 2280 cttgtccttc catcgctgcc ccagaaagcc
tcacatatct ccgtttagaa tcaggtccct 2340 tctccccaga tgaagaggag
ggtctctgct ttgttttctc tatctcctcc tcagacttga 2400 ccaggcccag
caggccccag aagaccatta ccctatatcc cttctcctcc ctagtcacat 2460
ggccataggc ctgctgatgg ctcaggaagg ccattgcaag gactcctcag ctatgggaga
2520 ggaagcacat cacccattga cccccgcaac ccctcccttt cctcctctga
gtcccgactg 2580 gggccacatg cagcctgact tctttgtgcc tgttgctgtc
cctgcagtct tcagagggcc 2640 accgcagctc cagtgccacg gcaggaggct
gttcctgaat agcccctgtg gtaagggcca 2700
ggagagtcct tccatcctcc aaggccctgc taaaggacac agcagccagg aagtcccctg
2760 ggcccctagc tgaaggacag cctgctccct ccgtctctac caggaatggc
cttgtcctat 2820 ggaaggcact gccccatccc aaactaatct aggaatcact
gtctaaccac tcactgtcat 2880 gaatgtgtac ttaaaggatg aggttgagtc
ataccaaata gtgatttcga tagttcaaaa 2940 tggtgaaatt agcaattcta
catgattcag tctaatcaat ggataccgac tgtttcccac 3000 acaagtctcc
tgttctctta agcttactca ctgacagcct ttcactctcc acaaatacat 3060
taaagatatg gccatcacca agccccctag gatgacacca gacctgagag tctgaagacc
3120 tggatccaag ttctgacttt tccccctgac agctgtgtga ccttcgtgaa
gtcgccaaac 3180 ctctctgagc cccagtcatt gctagtaaga cctgcctttg
agttggtatg atgttcaagt 3240 tagataacaa aatgtttata cccattagaa
cagagaataa atagaactac atttcttgca 3300 <210> SEQ ID NO 14
<211> LENGTH: 20000 <212> TYPE: DNA <213>
ORGANISM: Macaca mulatta <400> SEQUENCE: 14 aacatgaaca
tggtggcctt gtcagaaagc aagtgtgtgt tgctgaaaca tcagcagaga 60
ttgtcaaagg gataaagaga taacttaaaa gggttcctac tgaccaaaat gagacaagtt
120 ggccatctaa aatcaaatca taattatagt tcaataggac acatttcgtc
tcttaaatct 180 tccaatccat aatgaccatc atggcccata acctcaaaag
agtaaagtta aaataaagtt 240 cagaaaaggt tagttgcaat aaaacattag
ttttattaat tttaacaaga aggggatgaa 300 gctatagatg catttttttt
ccttctttta actatgttgc cccttacaag gtacagcttt 360 gccttatttt
tctctgtctg agtaaggata aagagtaaag gccgggcatg gtggctcaca 420
cctgtaattc cagcgctttg ggaggccgag gcaggaggat cacttgaggc caggagtttg
480 agaccagcgt ggccaacatg atgaaatctc gccactacta aaaatataaa
aattagttgg 540 aaatggtagc gcatgcctgt aatgccagct actctggagg
ctgaggcaca agaatcactt 600 gcaattccgg aattcaggag gtggagtttg
cagtaagcca agattgcgcc actgtaactc 660 cagcctgggt gactgagtga
gactctgtct caaaaaaaga agaataaaaa caagaagttg 720 tgagtaggcc
aaatagttcc agaaaaagca gaaatccacc acccccccga cacacaggaa 780
gcggctcagg aggtgacgca gagaaggaaa gtgtgtctgc tggggttttg caagttggtt
840 aatttgaaag atccctcaag gaggtaaaca aatggtgcaa acttcattca
ttcatctcct 900 ggaagataaa cttcgaacac ccaactaacc ccaccaatta
aatgagttaa aggaagacag 960 acacaagtgt caattatgct aacagagctc
tgtgttaaat accccaccag catcgcctca 1020 tttaagcctc acaactatgt
gggaaagaga cttttatccc cattttacag ataaggaaac 1080 caattctcag
agaactgagg ccctccccca gatccaagtc cgcttagctc cagtcacccc 1140
acgtcctctg catgtcacag gtgctcagaa agatgcagat gcaccttcag gaagccaaaa
1200 tgagcagagc ccctaaagag cggattgacg gcctctttct ggaaaaaatg
gaagtttgaa 1260 tctgaggagg tatccctcaa caacaggtgc tgctcaccaa
gtctggggcc aaacgcagca 1320 gctgttctcc cacttagacc cctgagacct
gtctataagg tttttcagag cgaggacaca 1380 tccccaaagg ttgtggcttc
tggtggttag cattgacttg gggcccatcc catgccagag 1440 gctgcccgaa
gtgcttaaat gttattacct catttgatct tcacaatcct aacggaagtg 1500
actcttctaa gagtctccct atctcacaga tgagggaacc gaggcacaga gaggttaagt
1560 ggcttgtcta agagctcaca gaaagagcgg tggagctaag gcttgacccc
agatgttaga 1620 tcctgagccc atgctttaac cagtgacctg cactgcctcc
caaagaagga agctggtgcc 1680 tgggagggag ggtgcagagc gagggtgtgc
atggtgcatg tgtgtgtttg tggggtggcc 1740 agcactcttc ggggcacttt
gccaatgagt tcagctcccc tgaagtccac tgttgctctc 1800 ctgaccagtc
actcagtctg gatttacttg gcccaaggcc attggcacca gcctggccaa 1860
cattgtggcc aggcttaccc ccttacccgc ttccttgctg cagaccccaa atcttgactc
1920 ctacatccct atccagccta caccacgagg ctcccatctc cgggcagggc
cctgtgatgg 1980 gtcagggcct ccccagatgc cccttgttca ttaccagctc
acaggatctt cccatgacgc 2040 atttcctctg aggggatcag cccagatgct
gcaatagaca attctggaag taaccgagtg 2100 gacaagactt tccccatcgt
gtcctggggt tcctggggtc acagtgtcct tgtgaatggc 2160 cactgagtgc
tcccacctcc ccttaccgcc cggggttttg tcctggtgca ttttcccaga 2220
tcatcccagc ccttcctccc aggatggatg tccagagcag ggcaagggct gagcctagag
2280 ccctggaacc aaaagaacag gaccccaaat tctgagcccc ttacttgccc
cacctgctcc 2340 cacccatgct ttcttcattc ctcctccaaa tgccccagct
ccccactgca atcccttctg 2400 cacccagcca ggtcctatga cacacacctc
cccagtgcac acagacctgc ccagccgcag 2460 ggctgcccac tgggcatgtc
ataggtggct cagtcctctt ccctctgcaa ctggccccag 2520 aaacctgcca
gatgttggtg ccaggtctgt gccagaaggg caaggcctgt catttctagt 2580
aatcctctgg gcagtgtgac tgcacctttt acggcagctc aaagggagag ggtgactcgt
2640 cctgggtcac agagctgaca gggcgggtag aacaggtgat atgcagggct
ttctgagttt 2700 atgagggccc agtcttgtgt ctgcctggca atgggcaagg
ccccttcctg cccaagctcc 2760 ccgcccctcc ccaacctatt gcctccgcca
cccgccaccc gaggccaact tcctgggtgg 2820 gcaggaactg ggccctgtgc
ccagggcgtg cactgcctcc acgcagcaac cctcagagta 2880 ctgagctgag
caaaggagga ggaggggatc agcactctga ggaaggccta gccactgctg 2940
ctgccaggaa ttccaggtag gaggggcggc aaccttctgc cagcccccag gccactctcc
3000 tgtgcctgcc agaggagacg gagcttgagg agagcaggaa aggtggaaca
atgctgctgc 3060 tgctcactct gttccacaga tgggagggac agtggggctt
ggagtggggg tcatggcaca 3120 gatgggaaaa tgaaggctca gagaggggaa
gaaatgccca ggaggtaccg agggcaggcg 3180 acctcaacca cagcccagca
ctggagctgt gagtagacgt agagtagcag aatatccatt 3240 cagccagctc
aggggaagga caggggccct gaagccaagg catggagctg gcagggaaga 3300
gagctcagag agaaggggag gggagtctga gctcagtttc ccactgcctg aaaagagggt
3360 ggtacctact cccctcacag ggtaactgaa tgagactgcc tggaggaaag
ctcttcaaat 3420 gtggcccacc ccaccccagt gacccctgac atgggggagg
aaggacagca tcagaaggga 3480 ctttccgggc acacccagca cccagctctg
agctgtcctt gaactgttgc attttaatcc 3540 tcacagcagc tcaacaaggt
acataccgtc accgtcccca ttttacagat ggggaaattg 3600 aggctcagag
cagttaaaca actcacctga ggcctcacag ccagttaagt gggttccctg 3660
gtctgaatat gtgtgctgga ggatcctgtg ggtcactcgc ctggtagagc cccaaggtgg
3720 aggcataagt gggactggtg aatgacagaa ggggcaaaaa acacactcat
ccattaattc 3780 tggaagtatc cacggcacgt acgccagctc ccaagcaagt
ttgcacattg cacaaagggt 3840 gatgcaatct gatttaggct tttaaaggga
ttgcaatcaa gtggggccct actggcctca 3900 accctgtacc acccctccct
tccatcccca gtagtcccca aagacctcca tcaaccccag 3960 gatgggggcc
gtattcccaa agaaaatcca agctgtatac gcatcacact gattttccag 4020
gagcagaaac agaaacaggc ctgaggctgg tcagaattga accccctcct gctctgagca
4080 gcctgcgggg caggctaagc agagggctgt gcagacccac ataaagagtc
tactgtgtgc 4140 caggcacttc acccaaggca cttcacaagc atgcttggga
atgagacttc caactctcta 4200 ggatgcaggt gaaacacttc ctggttcaaa
caggtgaagc ggcctgcctg agacagcatc 4260 acgcttcttt acaggtttgc
tctcccacct ctaccctgtc tcatggtccc ccatgccggc 4320 ctgacgcttg
tgtctgcctc agtcatgctc catttttcca tccggacaat caagagggtt 4380
tttgtgtcta aggctgactg ggtaacttcg gatgagcggc ctctctgctc tgagcctcag
4440 tttcctcatc tgtcaaatgg gctctaaccc actctgatct cccagggcgg
catcagtctt 4500 cagcatcagg catttcgggg tgaattagta aatggtagat
cttgctacca gtggaacagc 4560 cgctaaggat tctgcagtga gagcagaggg
ccagcaaagt ggtactctcc cagcgactgg 4620 ctgactcacg ccaccccctc
caccttggac gcaggacact gtggtttctg agccaggtac 4680 aatgactcct
tttggtacgt gcagtggagg ctgtatgctg ctcaggcaga gcgtccggac 4740
agcgtgggcg ggcgactcag cgcccagcct gtgaacttag tccctgtttg ctcctccggt
4800 aactggggtg atcttggtta atattcacca gcagcctccc ccgttgcccc
tctgcaccca 4860 ctgcttaaat acggacaagg acagggctct gtctcctcag
cctcaggcac caccactgac 4920 ctgggacggt gaatcgtaag tatgcctttc
actgcgagag gttctggaga ggcttctgag 4980 tcccccacgg cccaggcagg
cagcaggtct ggggcaggag gggggttgtg gagcgggtat 5040 ccgcccgctg
aggtgccggg cagatggagg ggctgcagct gggctcctat tgtcgtaata 5100
acagcagcca tgagggttgt gtcctgcttc ccagtcctgc ccggtcccca ctcagtacct
5160 actggtggat acactggctt ttgtaagcag aagtgcacga gggtgtctag
ctccgcggtc 5220 ctggcacccc aagatacagc aacagcaagg aagcgcagcc
atttctttct gtttgtgcag 5280 ctcctgtgtc tgtcaggggg ttcctatctg
ttgtctcctg taagcctcac cacctctcct 5340 actacttgga cacgcatctt
tttccccttc tatggatgag gaggttaagg ttcagggagg 5400 ggtgaggagg
aacgccggct cacattctcc atcccctcca gatacggcca ggaacagacc 5460
tgtgccaggt ctcagcctta catcaagatg ggtctccccc tgcactgtgg acctctgggc
5520 cctcctgtcc cagtggagga caggaagctg tgaggggcac cgtcacccag
ggttcaagct 5580 ggcattcctg aataatcgct ctgtgccagg ccacggctaa
gctctgtgca cgattaagcc 5640 tcataaccct ccaaggcagt taccagggtg
attcccattt tacagatgag gaagttgggg 5700 accgagtggt taataactgg
ccccaaatca cacaccatcc ataatttggg ctcaggcacc 5760 tggctccagg
ccccgaaatc ctgagcctgg ccctagtgct caccgtttct ctcaggtctc 5820
aggcgctgga tggggaacag gaagcctggg ctggacttga ggcctctctg atgctcggtg
5880 acttcagaca gttgctcaac ctctctgttc tcttgggcaa aacatgataa
cctttgacct 5940 ctgtcccctc ccctcacccc acccgacctt gatctctgga
gtgttggaag aatttaattt 6000 ttcctgcact gagtttggag acaggggtca
aaaagctgac caaggccaag ctggccagtt 6060 tcccatagaa cgcctctaaa
agacctgcag cactagcagc aagaactggt attcttgaga 6120 acttactgtg
caccaggcac ttcttggtat tttgtgcata tttaatttca caataactct 6180
atgacaaagt ccacctttct catctccagg aaactgaggt tcagagaggt taagtaacgt
6240 gtccaaggtc acacagttaa tagcaagttg atctggagca atctggcctg
agagcctcta 6300 attctagcca caaactgagg ctgcccctct tcatttagcc
aggccacctc tgaaatcttc 6360 tggttcaaga cttctggctc cagctttgta
cacagagact attaaatgtc aggttttgca 6420 gtcacatctg tttaatccca
gacaaaacat ctgggattaa atctcagttt tgtaagcaag 6480 tagctctgtg
atttttagtg agttatttaa tcctctttgg cctcaatttt tctgtctata 6540
aaatagggtt aatcatttgc acctcatagg gtaagctttg aggacagatt agatgataca
6600 gtgcctgtaa atcgcctggt gttagtaagt gtggcaatga tggtgacact
gaggttgatg 6660 tttgcttagc ataggttagg cagctagcag gcagtaaaca
aatacttgga gaatttaatg 6720
gaaaattggc caaactcaga tgctgttcac tgctgagcag gagccccctc ctgctgaaat
6780 gggtcctggg gagcgcagca gctggcagga agaaatctgc catctctcgg
gcaggagctc 6840 aacctctgtg caggcacagg gacggcttcc gcacctggtg
cccactcacg cattacgtca 6900 gttattcctc atctctctcc aagggattct
tttctccact gtatagctct gaagccaatg 6960 ctcacagaag tgaagtcatt
taccccgggc cccctgccag taagtgacag ggcctggtca 7020 cacttgggtt
tatttattgc ccatttcaac aggtcgtttg accataggcg agattctctt 7080
ccctgcaccc tgctgggttg ctcttggtcc cttattttat gctcccgggt agaaatggtg
7140 tgagattagg caggaagtgg cttgcttccc tctccctggc cctgcaaagg
gtgctcccac 7200 ctgccccagt tccagaaatg tcaccatgaa gtcttcattc
ttctgtttta aagcttggcc 7260 tcagtgtcca tacaccatgg ggtacttgac
catctacttt ctcctctcca gccgccctcc 7320 caggcactag cttttgaggg
tgcagggtgc tgcctctgat agaagggccg ggagagagca 7380 ggttttggag
tcctgatgct atgaggaaca gcttgggagg cataatgaac ccaacacgat 7440
gcttgagacc aatgtcagag cccaattctg ccattcatca tctgagattt gagggcacag
7500 ctgtctcagt ccgtgatctg agtgctggga aagccaagac ttgttccagc
tttgtcacca 7560 acttgctgta tggcctcgac aaggccctga ccctctctgg
gcttcaaact cttcactgtg 7620 aaaggaggaa accagaggag gtgatgtgac
gccagaaaag atggatgggt gtggggaatt 7680 gtgctcctcc cagctgtcac
cccctctcca ccctccctgc accagcctcg ccacctcctt 7740 cgagcccagc
agcctcctgt ctaggagggt gcctcttctc catctgtttt gctacatcga 7800
acccagatgc cattctaacc aagaatcctg gctgggtgca gtgacactca cctgtaaccc
7860 cagcactttg ggaggccgag gcaggcggat caagaggtca ggatttcaag
acctgcctgg 7920 ccaacatggt gaaatctcgt ctctactaaa aatacaaaaa
ttagccagat gtggtggcat 7980 gtgcctgtaa tcccagctac ttgggaaact
gaggcaggag aactgcttga acctgggagg 8040 cagaggtttc agtgagccaa
gatcacacca ctgcactcta gcctggggga taaagcgaga 8100 ctctgtctca
aaaaaaaaaa aaaaaaaaat cctatgttag cgtacagagg tccccagtga 8160
ggtcttctcc cagccccact ttgcacaact ggggagagtg aggccccagg accagaggat
8220 gcttactcaa ggccaaacgg atagtgatgg ccctgccagg actagaagcc
acaacttctg 8280 gccctaaggc cactcagcgt atttagtgtc cccaccctgc
agaggcccaa ctccctcctg 8340 ccctctgagc tctgtaatga tgggggaatt
tccataaacc atgaaggact gcacaaaatc 8400 cagctgggaa gtgaaagaga
aacctaaggg agatggaaat atacagcact aattttagca 8460 ccgtcttcag
ttctaacaac actagctagt tgaagaaaaa tacaaacatg tattatgtag 8520
tgtgtggtcc gttccatttg gattacttag aggcaagagg gccaggagaa aggtggtaga
8580 gagaaaccag ctttaggctt cattttgttg ctttactgga aagaaacttt
taacagtcca 8640 ggggggtcaa tgaatctcaa tatttgttat ttccaacttt
tttctccagt gtttcatttc 8700 ccaaattcaa ggacacattt ttctttgtat
tttgttaaga tgatgatttt acttttgtga 8760 ctagtagtta actatgtggc
tgccaggcat attctcctca gctaggacct cagttttccc 8820 atctgtgtag
acagcaggtt ctacttaggg ggctgcagat tgatggtccg aagtctgggc 8880
atatctggag tagaaggagc actgtggggc atggcaggct ctgcgttgct gtggatgaca
8940 ctgactttga ccattgctca gcagagcctg ctctcgccgg ttcagccaca
ggccccacca 9000 ctccctattg tctcagcccc agctatgaaa catgtattcc
tcactggact atcacctgaa 9060 ggctttgaat ttgcaacacc tgtcaacccc
tccctcaaaa gggttgccct ctcagatcct 9120 tttgatgtaa ggtttggtgt
ctagacttat ttcactaaat tcttccaaca gcctcacttt 9180 atgtatgagg
caaaatgagg accagggaga taaatgacgt gtcctggctc atacacctgg 9240
aaagtgacag agtcagatta gatcccaggt ctatctgaag ctaaaagaga tgctttttca
9300 cttcccacca cgcccatctc ctttaaagca gcacaaagcc ttgcttcaca
ggagagatga 9360 gcttctctaa agtccctgac agcaagagcc cagaactggg
acaccattgg tgatccagat 9420 ggcaggtgag ctgactgcag ggacatcagc
ctattcttgt ggctgggacc acagagcatt 9480 gtggggacag ccccctctct
taggaaaaaa ccctaagggc tgaggatcct tgtgagtgtt 9540 gggagggaac
agctcccagg ggatttaatc acagccccac catgctctag ctggtgccat 9600
tgtgcaagat gcatttccct tctgtgcagc agtgtccctg gccactcaac agtgggatta
9660 gatagaagcc ctccaagggc ttctagcttg acgtgattct tcattctgat
ctggcccgat 9720 tcctggataa tcgtggccag gcccattcct cttcttatgc
ctcatttgct tcttttgtaa 9780 aacagtggct gtaccacttg catcttaggg
tcattgcaga tgtaagtgga gctgtccaga 9840 gcctgggcgc aggacctaga
tgtaggattc tggttctgct actttacttc ctcagtgaca 9900 ttgaataggt
gacctaatct ctctggtttt ggtttcttca tctgaaaaag aaggatagta 9960
gcatcagcac ctcacaggat tgttacaaga aagcaatgag ttaacacatg tgcgcacgta
10020 gaacagtgct tggcatatgg taagcactac atacattttg ctattcttct
gattctttca 10080 gtgttactga tgtcagcaag tacttggcac aggctggttt
aataagcctt aggcacttcc 10140 acgtggtgtc aatcccgggt cactgggagt
catcatgtgc cctgactcgg ggcctggccc 10200 ccgtctctgt cttgcaggac
aatgccatct tctgtctcat ggggcgtcct cctgctggca 10260 ggcctgtgct
gcctgctccc cggctctctg gctgaggatc cccagggaga tgctgcccag 10320
aagacggata catcccacca tgatcaggac cacccaaccc tcaacaagat cacccccagc
10380 ctggctgagt tcggcttcag cctataccgc cagctggcac accagtccaa
cagcaccaat 10440 atcttcttct ccccagtgag catcgctaca gcctttgcaa
tgctctccct ggggaccaag 10500 gctgacactc acagtgaaat cctggagggc
ctgaatttca acgtcacgga gattccggag 10560 gctcaggtcc atgaaggctt
ccaggaactc ctccataccc tcaacaagcc agacagccag 10620 ctccagctga
ccaccggcaa cggcctgttc ctcaacaaga gcctgaaggt agtggataag 10680
tttttggagg atgtcaaaaa actgtaccac tcagaagcct tctctgtcaa ctttgaggac
10740 accgaagagg ccaagaaaca gatcaacaat tacgtggaga aggaaactca
agggaaaatt 10800 gtggatttgg tcaaggagct tgacagagac acagtttttg
ctctggtgaa ttacatcttc 10860 tttaaaggta aggttgcaaa accagcctga
gctgttccca tagaaacaac caaaaatatt 10920 ctcaaaccat catctcttga
actctccttg gcaatgcatt atgggctata gaaatgcatg 10980 tcagtgtggg
ctcttcaatt ttctacacac aaacactaaa atgttttcca tcattgagta 11040
atttgaggga ataatagatt aaattgtcaa aaccgctgac agctctgcag aactttccag
11100 agcctttaat gtccttgtgt gtactgtgta cgtagaatat ataatgctta
gaactataga 11160 acaaattgta atatactgca taaagggata gtttcatgga
acgtacttta gacgactcta 11220 gtgtcccaga atcagtatca gttttgcagt
ctgaaagacc tgggttcaaa tcccgcctct 11280 accactatta gcttttgaca
ccgaacaatg cattctacct ccttgaggtg ctaatttccc 11340 atcttagcat
ggacaaaata gtttttttta ggattaaaca agtgacaaac accttgggaa 11400
aagtgtggca tacagtaggt ggtgggctcc tctgtatctc aggctgcctt cctgcccctg
11460 aggggtgctc ttgaggcaaa ggagggcagt ggagagcagc caggctgcag
tcagcacaac 11520 tggggtcctg gctctgctgt ggcttagggc aggccccggt
ccctctccag ccccagtctc 11580 ctccttctgt ccaatgagaa agctgggatc
ggggtccctg aggcccctgt ccactctgca 11640 tgcctcgatg gtgaagctct
cttggcatgg cagaggggag gctgctcagg catctgcatt 11700 tcccctgcca
atccagggga taaagaaaac cctcaggaat agtaagcaga atgtttgccc 11760
tgaatgaata actgagctgc caattaacaa gaggcaggga gccttagaca ggaggtaaca
11820 aatatgcctg atgctccaac attttatttg taatatccaa gacaccctca
aataaacata 11880 cgattccaat aaaatgcaca gtcaggatgg catctcttag
ccttacatct ctgcgatgta 11940 gaaattctgc atcttcctct agttttgaat
tatctccaca cagacctttt tggcagcctg 12000 gatggttggt ttcagcacct
tttgcagatg atgaagctga ggcttgaggg atgtgtgtcg 12060 tcaagggggt
tcagggcttc tcagggaggg gactgatggc tcctttattc tgccacactc 12120
ttccaaacct tcacccaccc ctactgatgc ccgccttacc ctctctgtcc aggcaaatgg
12180 gagagaccct ttgacgttga ggccaccaag gaagaggact tccacgtgga
ccaggcgacc 12240 accgtgaagg tgcccatgat gaggcgttta ggcatgttta
acatctacca ctgtgagaag 12300 ctgtccagct gggtgctgct gatgaaatac
ctgggcaatg ccaccgccat cttcttcctg 12360 cctgatgagg ggaaactgca
gcacctggaa aatgaactca cccatgatat catcaccaag 12420 ttcctggaaa
atgaaaacag caggtgattc cccaacctga gggtgaccaa gaagctgccc 12480
acacctctta gccacgttgg gactgaggcc cgtcagaact gaccagaggg ttggagaggg
12540 tgaacactac atccctgggt cactgctact ctgcataaac ttggcttcca
gaatgaggcc 12600 accactgagt tcaggtggca ccggccatgc tccatgagca
ggacagtacc caggggtgac 12660 gaggtaaagg tctcgtcctt ggggacttcc
cactccagcg tggacactgt cccttcccaa 12720 tatccagtgc ccaggacagg
gacagcagca ccaccacacg ttctggcaga accaaaaggg 12780 aacagatggg
cttcctggca aaggcagtag tggagtgtgg agttcaaggg tagactgtcc 12840
ctgtggggat gggggaagag cctgtgtggc taggcccaga aaagcaaggt tcaaaattgg
12900 aatagccagg gcatgttagc aaaaggcttg agtttctctg tcactttatc
ggtgctgtta 12960 gattgggtgc cctgtagtaa atgatactcc aatatgagtc
acacattagt gtgtctgtgt 13020 gcattcgtaa ttatgcccat gccctcctat
ctagtttatt ttgtacactg taaaaccaag 13080 atgaaaatac aaaaggtgtt
gggttcataa taggaattga ggctggaatt tctttgtttc 13140 acgccagcac
ctcctgaggt ccctgctcca ggggttgaga aagaacaagg aggctgagag 13200
ggtaactgat cagagagccc aaagccaggc tgcccgctca caccagaccc tgctcggggc
13260 ggctctgtct ccccatggaa aacaagaggg gagcactcag cctggtgtgg
tcagtcttct 13320 gggggcactg ctaccagccc atgttcctct gggtatagga
ccctggggat gtttcaggct 13380 gggggcccag tgaccaaaca ctacagggca
ggatgagaca tgcttccagt acacctagaa 13440 tctcagagga ggtggcattt
caagctttca tgattcattt gatgttaaca ttctttgact 13500 cagtgtagaa
gagctaatag tagaacaaac caaagccaag ttcccatgtt agagtgggtg 13560
gaggacacag gagtaagtgg cagaaataat cagaaaagaa aacacttgca ctgcggtggg
13620 tcccagaaga acaagaggaa tgctgtgcca tgccctgaat ttcttttctg
catggcaggt 13680 ctgccaactt acatttaccc agactggcca ttactggaac
ctatgatctg aagacagtcc 13740 tgggccacct gggtatcact aaggtcttca
gcaatggggc tgacctctcg gggatcacgg 13800 aggaggcacc cctgaagctc
tccaaggtga gatcaccctg atgaccctgt tgcaccccgg 13860 gatctgtagg
gaaggatgta tgggggctgc agttctgtcc tgaggctgag gaaggggcca 13920
agggaaacaa atgaagaccg aggctgagct cctgaggatg cccgtgattc actgacgcgg
13980 gacgtggtca gacggcaaag ccaggcaggg gcctgctgtg ctgctggcac
tttcagggcc 14040 tcccttgagg ttgtgtcacc gaccccgaat ttcatctttg
cccaggacct tctagacatt 14100 gggccttgat ttatccatat tgacacagaa
aggtttgggc taagttgttt caaaggactt 14160 tgtgactcct tcgatctgtg
agatttggtg tctgaatgaa tgaatgatgt cagctaaaga 14220
tgactcttcc tttggaaaac taaaggtgac caaagaacaa ctgcagttcc gtgaacggct
14280 gcgttgtctt gggatctggg cactgtgaag gtcactgtca gggtccatgt
cctcgaggag 14340 cttcaagctg tgtgctagaa aggagagagc cctggagaca
ggcgtggagt ggcgatgctc 14400 tttccccttc tgagttgtgg gtgcaccctg
agcaggggca taggcgcttg tcaggaagat 14460 agacagaggg gagccagccc
tgtcagccaa agccttgagg aggagcaagg tctgtgtgac 14520 agggagggag
aggatgtgca gggccagggc tgtgcagcgg gagaaaggcc tgagtgaaca 14580
cttcctggga ggtgtccacg tgagccttgc tccaggcctg ggctggggca caactcagcc
14640 ttagaacatg tctctgcttc tctcccttcc aggccgtgca taaggctgtg
ctgaccatcg 14700 atgagaaagg gactgaagct gctggggcca tgtttttaga
ggccataccc atgtctattc 14760 cccccgaggt caagttcaac aaaccctttg
tcttcttaat gattgaacaa aataccaagt 14820 ctcccctctt catgggaaaa
gtggtgaatc ccacccagaa ataactgcct gtcactcctc 14880 agcccctccc
ctccatccct ggccccctcc ctgaatgaca ttaaagaagg gttgagctgg 14940
tccctgcctg cgtgtgtgac tgcaaacccc tcccatgttg tctctgggtc ttcctttgcc
15000 tgctgaggcc gtgtgtgggc tccaggtcac agtgctctct ccggaccccc
tcaactgtgt 15060 tcatggagca tctggctggg caggcatatg ctgggccagg
atggaggggg ctgaatcctc 15120 agcttacgga cctgggccca tctgtttctg
gagagctcca gtcttccttg tcctgtcttg 15180 gagtccctaa taaggaatca
caggggagga atcagatacc agcccatgac cccaggctcc 15240 tccaagcatc
ttcatgtccc cctgctcatc ccccactccc cgccacccag agttcctcat 15300
cctgccaggg ctgcctgtgc ccaccccaag gctgccctcc tgggagcccg agaactgcct
15360 gaccatgccc tagccctgtt ttgtggcatc tgcaacaaca aaagagagag
gaccgtgtcc 15420 tcttcttgtc ccactgtcac ctaaccaggc ttgggcccgg
cgcctcttgg gcacttctgg 15480 aaaacaactg aagcagattc ctcctgaagc
ccattctcca tggggcgaca aggacaccta 15540 ttctgccctt gtccttccat
cgctgcccca taaagcctca catgtctcag tttagaatca 15600 ggtcccttct
cctcagatga agaggagggt ctctgcttct ttttctctat ctcctcctca 15660
gactcaacca ggcccagcag tccccacaag accattaccc tatatccctt ctcctcccta
15720 gtcatgtggc cataggcctg ctgatggctc acgaaggcca tcgcaaggat
tccccagcta 15780 tgggagagga agcacagcac ccactgaccc ctgcaacccc
tctctttctc ccctgagtcc 15840 tgactggggc cacatgaagc ctgacttctt
tgtgcctgtt gctgtccctg cagtcttcag 15900 agggcagccg cagctccagt
gccatggaag gaggctgttc cggaatagcc cttgtggtaa 15960 gggccaggag
agtccttcca tcctccaagg ctctgctaaa gggcacagca gccaggaggt 16020
cccctgagcc cccagctgaa ggacaggctg ctccctctgt ctctaccagg aattgccttg
16080 tcctgtggaa ggcactgacc catcccaaac taatcttgga atccctgtct
aaccactcac 16140 tgtcatgaat gtgtgcttaa aggatgaggt tgagtcaaac
caaatagtga tttttgtagt 16200 tcaaaatggt gaaattagca attcaacatg
attcagccta atcaatggat accaactgtt 16260 tcccacacaa gtctcctgtt
ctcttaagct tactcagtga cagcctttca ctctccacaa 16320 atacattaaa
gatatgaccg tcaccaagcc tcctaggatg acaccagacc tgagagtctg 16380
aagaccggta tccccctgcc agctgtgtga ccttcatgaa gtcgccaaac ctttctgagc
16440 cacagccgtg gccagtaaga cctgcctttg agttggtacg atgttcaagt
cagataataa 16500 aacaccgttt acacctatta gagcagagaa taaatagagc
tacatttctt gcatttatga 16560 gctttctgtg aatcagacat ccctgtgaag
aacctccctg gctatttctc atttaataac 16620 tgtagcagca ctgtgatgtg
tgagtagatc cgctgtgctc ttaaactcca aatctacata 16680 tgaggaaact
gaggctcaga gaggctgctg gtctcccaca atgtcacata gttcataagt 16740
ggcaaagctg gcttgatggg ctactcgttc ctctgaacca caccacctca ccacactctc
16800 cccttcgagg gtcatgctaa acttctgcag agctaattcc tccttaaacc
ataagggttg 16860 ctggtggccc acagctcacg cctagcacgc ttcatgagaa
aaacgccctc cacccaatgt 16920 ggagcaggcc ctgagctgaa ggtggtgagc
agaagctcat ccaccagatg ttgacacagc 16980 ccgcggcctt gggcgaccca
caggactcct cttatttaac tggcatttgg taggagaaca 17040 ggggcagagt
caaagacaag tgggctttcc ggagcagcca ggacagggaa ggaggctgca 17100
gtgctgaggg catcacctta gacaccatcg ttttactttg aagaatcgtc tgtcacacac
17160 gagttgacag tccggttggg agagactcca ttcaaaccag cataagctcc
cagaggaatt 17220 cctgggctcc tgtgggaatc aacagggatc agtcaggggt
gggcagagtg tcatgacaac 17280 ctcattagga ggaagacaaa tacatgtcac
aagtccgtga ggcaacagcc ataagacctc 17340 agcttcactg tatcttccag
agttttttaa aaaatgcatt cactgtctaa tgtgatcctc 17400 cagacaggtc
ctgcaggact cagcctagga atcattatcc ccaaagtaca catggggaaa 17460
ctgaggccca gcaggtcaaa tgctctgtcc agtgtgggcc tggaaggcag gacttctccg
17520 ctcttaggcc tggctgtccc caactgcaca cacttcctca gtccatatgg
gatcacgata 17580 aaaactccat cctccagaac cgcactgcgt caacctgctg
tgctctaaca acagctgaag 17640 gccgagctgc ggggcatcct gggtgttccg
agtcagtttc ccactgcagg caggaacctc 17700 atcctgctct gaaacagatg
agagggaaac acggaaaaca gctgcgagct cagccgggaa 17760 cctcagagtc
atgacctttt accccaccta ggagtttgca ggggacagaa cacacgaatt 17820
tgagatttta agcctaaaca aaggaagcct tggtttgaag tgcaagctct gccagacaga
17880 gggcaccctg tgagccccat ttgttaagag gacgatagtc agggagcttc
taggttctca 17940 caccagaaat gggaaataca gattatacat tgatctcctt
cccaggagca acttgatcct 18000 cccataaatc cgagcaggca gcatttattc
aaacaacaaa caagcaaaca ggagctgcgt 18060 atgggggata gagagatgaa
acccaggtcc gtccctggga gagtgctgat ctacggcggt 18120 ggggaacggt
gaataaacga ggcgtgcgtc catggatctg ggtggagagg gtcagggtgc 18180
agcccgggac ctttccagag gcgtaagaaa tgatcagtat acacccgcag atgacctcaa
18240 acaccccaag ggctccttga aaggctgagg cctttgtgtt gttcttggtt
ggaaaattca 18300 caggcagtgg agtgaacaag gcacacggca ggactcagag
ccagggacag cttctgcagg 18360 aacccggctc agttctaaaa ggacaaatgg
aatgaccctg agtaaagaag tcagagaagg 18420 gcaccctcac tgaggcaaac
tccctcccca gcagggaccc agcagcaacc caaaaaagca 18480 ggagtctcac
ttcatcatca tatgggagag ggcaggctgt gtgatctcag ggaagttcct 18540
caacttctct gtgccatagt ttcctcatct gcaaaatgta aatcgaattt gaggtctcga
18600 tgaaatgtct tatttctcta aagtcccttg tccttgtccc atgcagccta
gaaatcttcc 18660 tctggcctag ttgtggagcc aaggatagac cgggcctgaa
tcttacattg ctggagatgg 18720 tgaagctgac cagcatgaga ggtcaggttt
tagaagccca aatcccagca ggcataagcc 18780 tcaccctcca atatcagctt
tatcagaaac aaaaaaataa catgtcatat ccatttgccc 18840 ttttccttaa
atgagtagca cttgggcagg gcagaggggc tgattatcca agctgggaag 18900
acgctgacag cagacgcttc aatggcagtc taggagtttt ctgataactg tcattggtat
18960 cacacttact attgaaatcg tgacatcagg aatgatgaaa ggaactagag
tcacatggtc 19020 tggagcaggg aagtgaggag ctgaaacctc cttcaacctg
gttgctgtgt ccccagggtg 19080 ggtaaagccc ctctgttcat cccacatgga
acaaatagag tggaatcagt ccttgctaaa 19140 gggttgaaga actgagctgt
gagcttcttg attgctgcag cacaatcctt gcccatcctg 19200 actgatataa
ccagaattcg tgaaatgcat caaataagtc ttcaactact atgcaagcct 19260
gggagggtga ctaagatctg aaaaacacaa ggaaagctaa aggaattccc acaaggaaac
19320 tccattagaa agttctagtt acaaggtact cagcacaggc catgcagaaa
taagcccaga 19380 tccggtggtg agcaggaaag ggtggggatg tgagtgctga
gccacacagg agagagtaat 19440 agaggctcaa gccagcaagg ggacggccac
caccccacgc agtgttggcc aacagtttcc 19500 ggggcatttg ctctcagaag
tcaaagctga ttttccagaa ttgaagtgct cattgtttgg 19560 gatgatttag
gaacaacatc agcaaaaacg aatgaacaat cagggctaat agaattgtgt 19620
ttaaactctg ttgggcttcc ttgacagagg gcacggggag caaaaaaagt cagcagtgtg
19680 tattaagtaa aaaaactttt tttccctttt aattggcagt taataccctc
aaaatatgtt 19740 ctgagattga tcaagtaagt gtccttcggc attaaaatat
taggatgcaa ttgctaaggg 19800 cttcttagca aagttgaaag aacacaggaa
tcccaactcc actgtctcct tagcatgcaa 19860 tcctgagtgg gctgttacag
ctgtctgtgc ctcagcgccc tcacctgcaa gacaggtaaa 19920 ataataccta
actcctaggt tacttttgtg gattaatgtg caaagcgtca ccctaaaaaa 19980
gtgctgctac ttaaatgacc 20000 <210> SEQ ID NO 15 <400>
SEQUENCE: 15 000 <210> SEQ ID NO 16 <400> SEQUENCE: 16
000 <210> SEQ ID NO 17 <400> SEQUENCE: 17 000
<210> SEQ ID NO 18 <400> SEQUENCE: 18 000 <210>
SEQ ID NO 19 <400> SEQUENCE: 19 000 <210> SEQ ID NO 20
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic oligonucleotide <400> SEQUENCE: 20
tggtgctgtt ggactggtgt 20 <210> SEQ ID NO 21 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 21
gatattggtg ctgttggact 20 <210> SEQ ID NO 22 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 22 ggctgtagcg
atgctcactg 20 <210> SEQ ID NO 23 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 23 gggtttgttg aacttgacct 20
<210> SEQ ID NO 24 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 24 ccacttttcc catgaagagg 20 <210> SEQ
ID NO 25 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
25 ttgggtggga ttcaccactt 20 <210> SEQ ID NO 26 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 26 ctttaatgtc
atccagggag 20 <210> SEQ ID NO 27 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 27 tctttaatgt catccaggga 20
<210> SEQ ID NO 28 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 28 ttctttaatg tcatccaggg 20 <210> SEQ
ID NO 29 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
29 cttctttaat gtcatccagg 20 <210> SEQ ID NO 30 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 30 ccttctttaa
tgtcatccag 20 <210> SEQ ID NO 31 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 31 cccttcttta atgtcatcca 20
<210> SEQ ID NO 32 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 32 acccttcttt aatgtcatcc 20 <210> SEQ
ID NO 33 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
33 tcaacccttc tttaatgtca 20 <210> SEQ ID NO 34 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 34 ctcaaccctt
ctttaatgtc 20 <210> SEQ ID NO 35 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 35 gctcaaccct tctttaatgt 20
<210> SEQ ID NO 36 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 36 agctcaaccc ttctttaatg 20 <210> SEQ
ID NO 37 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
37 cagctcaacc cttctttaat 20 <210> SEQ ID NO 38 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 38 ccagctcaac
ccttctttaa 20 <210> SEQ ID NO 39 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 39 accagctcaa cccttcttta 20
<210> SEQ ID NO 40 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 40 gaccagctca acccttcttt 20 <210> SEQ
ID NO 41 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
41 ggaccagctc aacccttctt 20 <210> SEQ ID NO 42 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 42
gtccctttct tgtcgatgg 19 <210> SEQ ID NO 43 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 43 ccttccctga
aggttcctcc 20 <210> SEQ ID NO 44 <400> SEQUENCE: 44 000
<210> SEQ ID NO 45 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Primer <400> SEQUENCE: 45
ggagatgctg cccagaagac 20 <210> SEQ ID NO 46 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 46 gctggcggta taggctgaag 20 <210> SEQ
ID NO 47 <211> LENGTH: 30 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Probe <400> SEQUENCE: 47 atcaggatca
cccaaccttc aacaagatca 30 <210> SEQ ID NO 48 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 48 ggagatgctg cccagaagac 20 <210> SEQ
ID NO 49 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Primer <400> SEQUENCE: 49 gctggcggta
taggctgaag 20 <210> SEQ ID NO 50 <211> LENGTH: 30
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Probe
<400> SEQUENCE: 50 atcaggatca cccaaccttc aacaagatca 30
<210> SEQ ID NO 51 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Primer <400> SEQUENCE: 51
gaccaccgtg aaggtgccta t 21 <210> SEQ ID NO 52 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 52 ggacagcttc ttacagtgct ggat 24 <210>
SEQ ID NO 53 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Probe <400> SEQUENCE: 53
atgaagcgtt taggcatgtt 20 <210> SEQ ID NO 54 <211>
LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 54 tctttaaagg caaatgggag aga 23 <210>
SEQ ID NO 55 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Primer <400> SEQUENCE: 55
tgcctaaacg cctcatcatg 20 <210> SEQ ID NO 56 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION: Probe
<400> SEQUENCE: 56 ccacgtggac caggcgacca 20 <210> SEQ
ID NO 57 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Primer <400> SEQUENCE: 57 tcatggaaag
cctctgtgga t 21 <210> SEQ ID NO 58 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 58 gcggcccgtg atgaga 16 <210> SEQ ID NO
59 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Probe <400> SEQUENCE: 59 cccacaagtc
ccagaaccgc agtg 24
* * * * *