U.S. patent application number 16/439317 was filed with the patent office on 2020-05-14 for modulators of complement factor b.
This patent application is currently assigned to Ionis Pharmaceuticals, Inc.. The applicant listed for this patent is Ionis Pharmaceuticals, Inc.. Invention is credited to Susan M. Freier, Tamar R. Grossman, Michael L. McCaleb, Andrew T. Watt.
Application Number | 20200149047 16/439317 |
Document ID | / |
Family ID | 52666522 |
Filed Date | 2020-05-14 |
View All Diagrams
United States Patent
Application |
20200149047 |
Kind Code |
A1 |
Grossman; Tamar R. ; et
al. |
May 14, 2020 |
MODULATORS OF COMPLEMENT FACTOR B
Abstract
The present embodiments provide methods, compounds, and
compositions for treating, preventing, or ameliorating a disease
associated with dysregulation of the complement alternative pathway
by administering a Complement Factor B (CFB) specific inhibitor to
a subject.
Inventors: |
Grossman; Tamar R.; (La
Jolla, CA) ; McCaleb; Michael L.; (La Jolla, CA)
; Watt; Andrew T.; (San Diego, CA) ; Freier; Susan
M.; (San Diego, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Ionis Pharmaceuticals, Inc. |
Carlsbad |
CA |
US |
|
|
Assignee: |
Ionis Pharmaceuticals, Inc.
Carlsbad
CA
|
Family ID: |
52666522 |
Appl. No.: |
16/439317 |
Filed: |
June 12, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15912386 |
Mar 5, 2018 |
|
|
|
16439317 |
|
|
|
|
15021651 |
Mar 11, 2016 |
|
|
|
PCT/US2014/055458 |
Sep 12, 2014 |
|
|
|
15912386 |
|
|
|
|
61877624 |
Sep 13, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2310/3231 20130101;
A61P 27/02 20180101; C12N 15/1137 20130101; C12N 2310/11 20130101;
A61P 13/12 20180101; C12Y 304/21047 20130101; A61P 13/00 20180101;
C12N 2310/321 20130101; C12N 2310/315 20130101; C12N 2310/3341
20130101; A61P 43/00 20180101 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1. A compound comprising a modified oligonucleotide consisting of 8
to 80 linked nucleosides complementary within nucleobases 30-49,
48-63, 150-169, 151-170, 152-171, 154-169, 154-173, 156-171,
156-175, 157-176, 158-173, 158-177, 480-499, 600-619, 638-657,
644-663, 738-757, 1089-1108, 1135-1154, 1141-1160, 1147-1166,
1150-1169, 1153-1172, 1159-1178, 1162-1181, 1165-1184, 1171-1186,
1171-1190, 1173-1188, 1173-1192, 1175-1190, 1175-1194, 1177-1196,
1183-1202, 1208-1227, 1235-1254, 1298-1317, 1304-1323, 1310-1329,
1316-1335, 1319-1338, 1322-1341, 1328-1347, 1349-1368, 1355-1374,
1393-1412, 1396-1415, 1399-1418, 1405-1424, 1421-1440, 1621-1640,
1646-1665, 1646-1665, 1647-1666, 1689-1708, 1749-1768, 1763-1782,
1912-1931, 2073-2092, 2085-2104, 2166-2185, 2172-2191, 2189-2208,
2191-2210, 2193-2212, 2195-2210, 2195-2214, 2196-2215, 2197-2212,
2197-2216, 2202-2221, 2223-2238, 2223-2242, 2225-2240, 2226-2245,
2227-2242, 2227-2246, 2238-2257, 2241-2260, 2267-2286, 2361-2380,
2388-2407, 2397-2416, 2448-2467, 2453-2472, 2455-2474, 2457-2472,
2457-2476, 2459-2474, 2459-2478, 2461-2476, 2461-2480, 2532-2551,
2550-2569, 2551-2566, 2551-2570, 2552-2568, 2552-2570, 2552-2571,
2553-2568, 2553-2570, 2553-2571, 2553-2572, 2554-2571, 2554-2572,
2554-2573, 2555-2570, 2555-2572, 2555-2574, 2556-2573, 2556-2574,
2556-2575, 2557-2573, 2557-2574, 2557-2575, 2557-2576, 2558-2575,
2558-2576, 2558-2577, 2559-2576, 2559-2577, 2559-2578, 2560-2577,
2560-2578, 2560-2579, 2561-2576, 2561-2578, 2561-2579, 2561-2580,
2562-2577, 2562-2579, 2562-2581, 2563-2578, 2563-2580, 2563-2582,
2564-2581, 2564-2583, 2565-2584, 2566-2583, 2566-2585, 2567-2582,
2567-2584, 2567-2586, 2568-2583, 2568-2585, 2568-2587, 2569-2586,
2569-2588, 2570-2585, 2570-2587, 2570-2589, 2571-2586, 2571-2588,
2571-2590, 2572-2589, 2572-2590, 2572-2591, 2573-2590, 2573-2592,
2574-2590, 2574-2591, 2574-2593, 2575-2590, 2575-2591, 2575-2592,
2575-2594, 2576-2593, 2576-2595, 2577-2594, 2577-2595, 2577-2596,
2578-2594, 2578-2596, 2578-2597, 2579-2598, 2580-2596, 2580-2597,
2580-2598, 2580-2599, 2581-2597, 2581-2598, 2581-2599, 2581-2600,
2582-2598, 2582-2599, 2582-2600, 2582-2601, 2583-2599, 2583-2600,
2583-2601, 2583-2602, 2584-2600, 2584-2601, 2584-2602, 2584-2603,
2585-2601, 2585-2603, 2585-2604, 2586-2601, 2586-2602, 2586-2604,
2586-2605, 2587-2602, 2587-2603, 2587-2605, 2587-2606, 2588-2603,
2588-2604, 2588-2605, 2588-2606, 2588-2607, 2589-2604, 2589-2605,
2589-2606, 2589-2607, 2589-2608, 2590-2605, 2590-2606, 2590-2607,
2590-2608, 2590-2609, 2590-2609, 2591-2607, 2591-2608, 2591-2609,
2591-2610, 2592-2607, 2592-2608, 2592-2609, 2592-2610, 2592-2611,
2593-2608, 2593-2609, 2593-2610, 2593-2612, 2594-2609, 2594-2610,
2594-2611, 2594-2612, 2594-2613, 2595-2610, 2595-2611, 2595-2612,
2595-2613, 2595-2614, 2596-2611, 2596-2612, 2596-2613, 2596-2614,
2596-2615, 2597-2612, 2597-2612, 2597-2613, 2597-2614, 2597-2615,
2597-2616, 2598-2613, 2598-2614, 2598-2615, 2598-2616, 2598-2617,
2599-2614, 2599-2615, 2599-2616, 2599-2617, 2599-2618, 2600-2615,
2600-2616, 2600-2617, 2600-2618, 2600-2619, 2601-2616, 2601-2617,
2601-2618, 2601-2619, 2601-2620, 2602-2617, 2602-2618, 2602-2619,
2602-2620, 2602-2621, 2603-2618, 2603-2619, 2603-2620, 2603-2621,
2603-2622, 2604-2619, 2604-2620, 2604-2621, 2604-2622, 2604-2623,
2605-2620, 2605-2621, 2605-2622, 2605-2623, 2605-2624, 2606-2621,
2606-2622, 2606-2623, 2606-2624, 2606-2625, 2607-2622, 2607-2623,
2607-2624, 2607-2625, 2607-2626, 2608-2623, 2608-2624, 2608-2625,
2608-2626, 2608-2627, 2609-2624, 2609-2625, 2609-2626, 2609-2627,
2609-2628, 2610-2625, 2610-2626, 2610-2627, 2610-2628, 2610-2629,
2611-2626, 2611-2627, 2611-2628, 2611-2629, 2611-2630, 2612-2627,
2612-2628, 2612-2629, 2612-2630, 2612-2631, 2613-2628, 2613-2629,
2613-2630, 2613-2631, 2614-2629, 2614-2630, 2614-2631, 2615-2630,
2615-2631, or 2616-2631 of SEQ ID NO: 1, wherein said modified
oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to
SEQ ID NO: 1.
2. (canceled)
3. (canceled)
4. A compound comprising a modified oligonucleotide consisting of 8
to 80 linked nucleosides having a nucleobase sequence comprising a
portion of at least 8 contiguous nucleobases 100% complementary to
an equal length portion of nucleobases 1608-1627, 1685-1704,
1686-1705, 1751-1770, 1769-1784, 1871-1890, 1872-1891, 1873-1892,
1875-1890, 1875-1894, 1877-1892, 1877-1896, 1878-1897, 1879-1894,
1879-1898, 2288-2307, 2808-2827, 2846-2865, 2852-2871, 2946-2965,
3773-3792, 3819-3838, 3825-3844, 3831-3850, 3834-3853, 3837-3856,
3843-3862, 4151-4166, 4151-4170, 4153-4172, 4159-4178, 4184-4203,
4211-4230, 4609-4628, 4612-4631, 4615-4634, 4621-4640, 4642-4661,
4648-4667, 4686-4705, 4689-4708, 4692-4711, 4698-4717, 4714-4733,
5270-5289, 5295-5314, 5296-5315, 5830-5849, 5890-5909, 5904-5923,
6406-6425, 6662-6681, 6674-6693, 6954-6973, 6960-6979, 6977-6996,
6979-6998, 6981-7000, 6983-6998, 6983-7002, 6984-7003, 6985-7000,
6985-7004, 6990-7009, 7122-7141, 7125-7144, 7151-7170, 7353-7372,
7362-7381, 7683-7702, 7688-7707, 7690-7709, 7692-7707, 7692-7711,
7694-7709, 7694-7713, 7696-7711, 7696-7715, 7767-7786, 7785-7804,
7786-7801, 7787-7803, 7787-7805, 7787-7806, 7788-7803, 7788-7805,
7788-7806, 7788-7807, 7789-7806, 7789-7807, 7789-7808, 7790-7805,
7790-7807, 7790-7809, 7791-7808, 7791-7809, 7791-7810, 7792-7808,
7792-7809, 7792-7810, 7792-7811, 7793-7810, 7793-7811, 7793-7812,
7794-7811, 7794-7812, 7794-7813, 7795-7812, 7795-7813, 7795-7814,
7796-7811, 7796-7813, 7796-7814, 7796-7815, 7797-7812, 7797-7814,
7797-7816, 7798-7813, 7798-7815, 7798-7817, 7799-7816, 7799-7818,
7800-7819, 7801-7818, 7801-7820, 7802-7817, 7802-7819, 7802-7821,
7803-7818, 7803-7820, 7803-7822, 7804-7821, 7804-7823, 7805-7820,
7805-7822, 7805-7824, 7806-7821, 7806-7823, 7806-7825, 7807-7824,
7807-7825, 7807-7826, 7808-7825, 7808-7827, 7809-7825, 7809-7826,
7809-7828, 7810-7825, 7810-7826, 7810-7827, 7810-7829, 7811-7828,
7811-7830, 7812-7829, 7812-7830, 7812-7831, 7813-7829, 7813-7831,
7813-7832, 7814-7833, 7815-7831, 7815-7832, 7815-7833, 7815-7834,
7816-7832, 7816-7833, 7816-7834, 7816-7835, 7817-7833, 7817-7834,
7817-7835, 7817-7836, 7818-7834, 7818-7835, 7818-7836, 7818-7837,
7819-7835, 7819-7836, 7819-7837, 7819-7838, 7820-7836, 7820-7838,
7820-7839, 7821-7836, 7821-7837, 7821-7839, 7821-7840, 7822-7837,
7822-7838, 7822-7840, 7822-7841, 7823-7838, 7823-7839, 7823-7839,
7823-7840, 7823-7841, 7823-7842, 7824-7839, 7824-7840, 7824-7840,
7824-7841, 7824-7842, 7824-7843, 7825-7840, 7825-7841, 7825-7842,
7825-7843, 7825-7844, 7826-7842, 7826-7843, 7826-7844, 7826-7845,
7827-7842, 7827-7843, 7827-7844, 7827-7845, 7827-7846, 7828-7843,
7828-7844, 7828-7845, 7828-7847, 7829-7844, 7829-7845, 7829-7846,
7829-7847, 7829-7848, 7830-7845, 7830-7846, 7830-7847, 7830-7848,
7830-7849, 7831-7846, 7831-7847, 7831-7848, 7831-7849, 7831-7850,
7832-7847, 7832-7848, 7832-7849, 7832-7850, 7832-7851, 7833-7848,
7833-7849, 7833-7850, 7833-7851, 7833-7852, 7834-7849, 7834-7850,
7834-7851, 7834-7852, 7834-7853, 7835-7850, 7835-7851, 7835-7852,
7835-7853, 7835-7854, 7836-7851, 7836-7852, 7836-7853, 7836-7854,
7836-7855, 7837-7852, 7837-7853, 7837-7854, 7837-7855, 7837-7856,
7838-7853, 7838-7854, 7838-7855, 7838-7856, 7838-7857, 7839-7854,
7839-7855, 7839-7856, 7839-7857, 7839-7858, 7840-7855, 7840-7856,
7840-7857, 7840-7858, 7840-7859, 7841-7856, 7841-7857, 7841-7858,
7841-7859, 7841-7860, 7842-7857, 7842-7858, 7842-7859, 7842-7860,
7842-7861, 7843-7858, 7843-7859, 7843-7860, 7843-7861, 7843-7862,
7844-7859, 7844-7860, 7844-7861, 7844-7862, 7845-7860, 7845-7861,
7845-7862, 7846-7861, and 7846-7862 of SEQ ID NO: 2, wherein the
nucleobase sequence of the modified oligonucleotide is at least
85%, 90%, 95%, or 100% complementary to SEQ ID NO: 2.
5. (canceled)
6. (canceled)
7. A compound comprising a modified oligonucleotide consisting of 8
to 80 linked nucleosides having a nucleobase sequence comprising a
portion of at least 8 contiguous nucleobases complementary to an
equal length portion of nucleobases 2457-2631, 2457-2472,
2457-2474, 2457-2476, 2457-2566, 2457-2570, 2457-2571, 2457-2572,
2457-2573, 2457-2574, 2457-2575, 2457-2576, 2457-2577, 2457-2578,
2457-2579, 2457-2580, 2457-2581, 2457-2582, 2457-2583, 2457-2584,
2457-2585, 2457-2586, 2457-2587, 2457-2588, 2457-2589, 2457-2590,
2457-2591, 2457-2592, 2457-2593, 2457-2594, 2457-2595, 2457-2596,
2457-2597, 2457-2598, 2457-2599, 2457-2600, 2457-2601, 2457-2602,
2457-2603, 2457-2604, 2457-2605, 2457-2606, 2457-2607, 2457-2608,
2457-2609, 2457-2610, 2457-2611, 2457-2612, 2457-2613, 2457-2614,
2457-2615, 2457-2616, 2457-2617, 2457-2618, 2457-2619, 2457-2620,
2457-2621, 2457-2622, 2457-2623, 2457-2624, 2457-2625, 2457-2626,
2457-2627, 2457-2628, 2457-2629, 2457-2630, 2457-2631, 2459-2474,
2459-2476, 2459-2566, 2459-2570, 2459-2571, 2459-2572, 2459-2573,
2459-2574, 2459-2575, 2459-2576, 2459-2577, 2459-2578, 2459-2579,
2459-2580, 2459-2581, 2459-2582, 2459-2583, 2459-2584, 2459-2585,
2459-2586, 2459-2587, 2459-2588, 2459-2589, 2459-2590, 2459-2591,
2459-2592, 2459-2593, 2459-2594, 2459-2595, 2459-2596, 2459-2597,
2459-2598, 2459-2599, 2459-2600, 2459-2601, 2459-2602, 2459-2603,
2459-2604, 2459-2605, 2459-2606, 2459-2607, 2459-2608, 2459-2609,
2459-2610, 2459-2611, 2459-2612, 2459-2613, 2459-2614, 2459-2615,
2459-2616, 2459-2617, 2459-2618, 2459-2619, 2459-2620, 2459-2621,
2459-2622, 2459-2623, 2459-2624, 2459-2625, 2459-2626, 2459-2627,
2459-2628, 2459-2629, 2459-2630, 2459-2631, 2461-2476, 2461-2566,
2461-2570, 2461-2571, 2461-2572, 2461-2573, 2461-2574, 2461-2575,
2461-2576, 2461-2577, 2461-2578, 2461-2579, 2461-2580, 2461-2581,
2461-2582, 2461-2583, 2461-2584, 2461-2585, 2461-2586, 2461-2587,
2461-2588, 2461-2589, 2461-2590, 2461-2591, 2461-2592, 2461-2593,
2461-2594, 2461-2595, 2461-2596, 2461-2597, 2461-2598, 2461-2599,
2461-2600, 2461-2601, 2461-2602, 2461-2603, 2461-2604, 2461-2605,
2461-2606, 2461-2607, 2461-2608, 2461-2609, 2461-2610, 2461-2611,
2461-2612, 2461-2613, 2461-2614, 2461-2615, 2461-2616, 2461-2617,
2461-2618, 2461-2619, 2461-2620, 2461-2621, 2461-2622, 2461-2623,
2461-2624, 2461-2625, 2461-2626, 2461-2627, 2461-2628, 2461-2629,
2461-2630, 2461-2631, 2551-2566, 2551-2570, 2551-2571, 2551-2572,
2551-2573, 2551-2574, 2551-2575, 2551-2576, 2551-2577, 2551-2578,
2551-2579, 2551-2580, 2551-2581, 2551-2582, 2551-2583, 2551-2584,
2551-2585, 2551-2586, 2551-2587, 2551-2588, 2551-2589, 2551-2590,
2551-2591, 2551-2592, 2551-2593, 2551-2594, 2551-2595, 2551-2596,
2551-2597, 2551-2598, 2551-2599, 2551-2600, 2551-2601, 2551-2602,
2551-2603, 2551-2604, 2551-2605, 2551-2606, 2551-2607, 2551-2608,
2551-2609, 2551-2610, 2551-2611, 2551-2612, 2551-2613, 2551-2614,
2551-2615, 2551-2616, 2551-2617, 2551-2618, 2551-2619, 2551-2620,
2551-2621, 2551-2622, 2551-2623, 2551-2624, 2551-2625, 2551-2626,
2551-2627, 2551-2628, 2551-2629, 2551-2630, 2551-2631, 2553-2570,
2553-2571, 2553-2572, 2553-2573, 2553-2574, 2553-2575, 2553-2576,
2553-2577, 2553-2578, 2553-2579, 2553-2580, 2553-2581, 2553-2582,
2553-2583, 2553-2584, 2553-2585, 2553-2586, 2553-2587, 2553-2588,
2553-2589, 2553-2590, 2553-2591, 2553-2592, 2553-2593, 2553-2594,
2553-2595, 2553-2596, 2553-2597, 2553-2598, 2553-2599, 2553-2600,
2553-2601, 2553-2602, 2553-2603, 2553-2604, 2553-2605, 2553-2606,
2553-2607, 2553-2608, 2553-2609, 2553-2610, 2553-2611, 2553-2612,
2553-2613, 2553-2614, 2553-2615, 2553-2616, 2553-2617, 2553-2618,
2553-2619, 2553-2620, 2553-2621, 2553-2622, 2553-2623, 2553-2624,
2553-2625, 2553-2626, 2553-2627, 2553-2628, 2553-2629, 2553-2630,
2553-2631, 2554-2573, 2554-2574, 2554-2575, 2554-2576, 2554-2577,
2554-2578, 2554-2579, 2554-2580, 2554-2581, 2554-2582, 2554-2583,
2554-2584, 2554-2585, 2554-2586, 2554-2587, 2554-2588, 2554-2589,
2554-2590, 2554-2591, 2554-2592, 2554-2593, 2554-2594, 2554-2595,
2554-2596, 2554-2597, 2554-2598, 2554-2599, 2554-2600, 2554-2601,
2554-2602, 2554-2603, 2554-2604, 2554-2605, 2554-2606, 2554-2607,
2554-2608, 2554-2609, 2554-2610, 2554-2611, 2554-2612, 2554-2613,
2554-2614, 2554-2615, 2554-2616, 2554-2617, 2554-2618, 2554-2619,
2554-2620, 2554-2621, 2554-2622, 2554-2623, 2554-2624, 2554-2625,
2554-2626, 2554-2627, 2554-2628, 2554-2629, 2554-2630, 2554-2631,
2555-2572, 2555-2573, 2555-2574, 2555-2575, 2555-2576, 2555-2577,
2555-2578, 2555-2579, 2555-2580, 2555-2581, 2555-2582, 2555-2583,
2555-2584, 2555-2585, 2555-2586, 2555-2587, 2555-2588, 2555-2589,
2555-2590, 2555-2591, 2555-2592, 2555-2593, 2555-2594, 2555-2595,
2555-2596, 2555-2597, 2555-2598, 2555-2599, 2555-2600, 2555-2601,
2555-2602, 2555-2603, 2555-2604, 2555-2605, 2555-2606, 2555-2607,
2555-2608, 2555-2609, 2555-2610, 2555-2611, 2555-2612, 2555-2613,
2555-2614, 2555-2615, 2555-2616, 2555-2617, 2555-2618, 2555-2619,
2555-2620, 2555-2621, 2555-2622, 2555-2623, 2555-2624, 2555-2625,
2555-2626, 2555-2627, 2555-2628, 2555-2629, 2555-2630, 2555-2631,
2556-2573, 2556-2574, 2556-2575, 2556-2576, 2556-2577, 2556-2578,
2556-2579, 2556-2580, 2556-2581, 2556-2582, 2556-2583, 2556-2584,
2556-2585, 2556-2586, 2556-2587, 2556-2588, 2556-2589, 2556-2590,
2556-2591, 2556-2592, 2556-2593, 2556-2594, 2556-2595, 2556-2596,
2556-2597, 2556-2598, 2556-2599, 2556-2600, 2556-2601, 2556-2602,
2556-2603, 2556-2604, 2556-2605, 2556-2606, 2556-2607, 2556-2608,
2556-2609, 2556-2610, 2556-2611, 2556-2612, 2556-2613, 2556-2614,
2556-2615, 2556-2616, 2556-2617, 2556-2618, 2556-2619, 2556-2620,
2556-2621, 2556-2622, 2556-2623, 2556-2624, 2556-2625, 2556-2626,
2556-2627, 2556-2628, 2556-2629, 2556-2630, 2556-2631, 2557-2574,
2557-2575, 2557-2576, 2557-2577, 2557-2578, 2557-2579, 2557-2580,
2557-2581, 2557-2582, 2557-2583, 2557-2584, 2557-2585, 2557-2586,
2557-2587, 2557-2588, 2557-2589, 2557-2590, 2557-2591, 2557-2592,
2557-2593, 2557-2594, 2557-2595, 2557-2596, 2557-2597, 2557-2598,
2557-2599, 2557-2600, 2557-2601, 2557-2602, 2557-2603, 2557-2604,
2557-2605, 2557-2606, 2557-2607, 2557-2608, 2557-2609, 2557-2610,
2557-2611, 2557-2612, 2557-2613, 2557-2614, 2557-2615, 2557-2616,
2557-2617, 2557-2618, 2557-2619, 2557-2620, 2557-2621, 2557-2622,
2557-2623, 2557-2624, 2557-2625, 2557-2626, 2557-2627, 2557-2628,
2557-2629, 2557-2630, 2557-2631, 2558-2575, 2558-2576, 2558-2577,
2558-2578, 2558-2579, 2558-2580, 2558-2581, 2558-2582, 2558-2583,
2558-2584, 2558-2585, 2558-2586, 2558-2587, 2558-2588, 2558-2589,
2558-2590, 2558-2591, 2558-2592, 2558-2593, 2558-2594, 2558-2595,
2558-2596, 2558-2597, 2558-2598, 2558-2599, 2558-2600, 2558-2601,
2558-2602, 2558-2603, 2558-2604, 2558-2605, 2558-2606, 2558-2607,
2558-2608, 2558-2609, 2558-2610, 2558-2611, 2558-2612, 2558-2613,
2558-2614, 2558-2615, 2558-2616, 2558-2617, 2558-2618, 2558-2619,
2558-2620, 2558-2621, 2558-2622, 2558-2623, 2558-2624, 2558-2625,
2558-2626, 2558-2627, 2558-2628, 2558-2629, 2558-2630, 2558-2631,
2559-2576, 2559-2577, 2559-2578, 2559-2579, 2559-2580, 2559-2581,
2559-2582, 2559-2583, 2559-2584, 2559-2585, 2559-2586, 2559-2587,
2559-2588, 2559-2589, 2559-2590, 2559-2591, 2559-2592, 2559-2593,
2559-2594, 2559-2595, 2559-2596, 2559-2597, 2559-2598, 2559-2599,
2559-2600, 2559-2601, 2559-2602, 2559-2603, 2559-2604, 2559-2605,
2559-2606, 2559-2607, 2559-2608, 2559-2609, 2559-2610, 2559-2611,
2559-2612, 2559-2613, 2559-2614, 2559-2615, 2559-2616, 2559-2617,
2559-2618, 2559-2619, 2559-2620, 2559-2621, 2559-2622, 2559-2623,
2559-2624, 2559-2625, 2559-2626, 2559-2627, 2559-2628, 2559-2629,
2559-2630, 2559-2631, 2560-2577, 2560-2578, 2560-2579, 2560-2580,
2560-2581, 2560-2582, 2560-2583, 2560-2584, 2560-2585, 2560-2586,
2560-2587, 2560-2588, 2560-2589, 2560-2590, 2560-2591, 2560-2592,
2560-2593, 2560-2594, 2560-2595, 2560-2596, 2560-2597, 2560-2598,
2560-2599, 2560-2600, 2560-2601, 2560-2602, 2560-2603, 2560-2604,
2560-2605, 2560-2606, 2560-2607, 2560-2608, 2560-2609, 2560-2610,
2560-2611, 2560-2612, 2560-2613, 2560-2614, 2560-2615, 2560-2616,
2560-2617, 2560-2618, 2560-2619, 2560-2620, 2560-2621, 2560-2622,
2560-2623, 2560-2624, 2560-2625, 2560-2626, 2560-2627, 2560-2628,
2560-2629, 2560-2630, 2560-2631, 2561-2578, 2561-2579, 2561-2580,
2561-2581, 2561-2582, 2561-2583, 2561-2584, 2561-2585, 2561-2586,
2561-2587, 2561-2588, 2561-2589, 2561-2590, 2561-2591, 2561-2592,
2561-2593, 2561-2594, 2561-2595, 2561-2596, 2561-2597, 2561-2598,
2561-2599, 2561-2600, 2561-2601, 2561-2602, 2561-2603, 2561-2604,
2561-2605, 2561-2606, 2561-2607, 2561-2608, 2561-2609, 2561-2610,
2561-2611, 2561-2612, 2561-2613, 2561-2614, 2561-2615, 2561-2616,
2561-2617, 2561-2618, 2561-2619, 2561-2620, 2561-2621, 2561-2622,
2561-2623, 2561-2624, 2561-2625, 2561-2626, 2561-2627, 2561-2628,
2561-2629, 2561-2630, 2561-2631, 2562-2577, 2562-2578, 2562-2579,
2562-2580, 2562-2581, 2562-2582, 2562-2583, 2562-2584, 2562-2585,
2562-2586, 2562-2587, 2562-2588, 2562-2589, 2562-2590, 2562-2591,
2562-2592, 2562-2593, 2562-2594, 2562-2595, 2562-2596, 2562-2597,
2562-2598, 2562-2599, 2562-2600, 2562-2601, 2562-2602, 2562-2603,
2562-2604, 2562-2605, 2562-2606, 2562-2607, 2562-2608, 2562-2609,
2562-2610, 2562-2611, 2562-2612, 2562-2613, 2562-2614, 2562-2615,
2562-2616, 2562-2617, 2562-2618, 2562-2619, 2562-2620, 2562-2621,
2562-2622, 2562-2623, 2562-2624, 2562-2625, 2562-2626, 2562-2627,
2562-2628, 2562-2629, 2562-2630, 2562-2631, 2563-2580, 2563-2581,
2563-2582, 2563-2583, 2563-2584, 2563-2585, 2563-2586, 2563-2587,
2563-2588, 2563-2589, 2563-2590, 2563-2591, 2563-2592, 2563-2593,
2563-2594, 2563-2595, 2563-2596, 2563-2597, 2563-2598, 2563-2599,
2563-2600, 2563-2601, 2563-2602, 2563-2603, 2563-2604, 2563-2605,
2563-2606, 2563-2607, 2563-2608, 2563-2609, 2563-2610, 2563-2611,
2563-2612, 2563-2613, 2563-2614, 2563-2615, 2563-2616, 2563-2617,
2563-2618, 2563-2619, 2563-2620, 2563-2621, 2563-2622, 2563-2623,
2563-2624, 2563-2625, 2563-2626, 2563-2627, 2563-2628, 2563-2629,
2563-2630, 2563-2631, 2564-2581, 2564-2582, 2564-2583, 2564-2584,
2564-2585, 2564-2586, 2564-2587, 2564-2588, 2564-2589, 2564-2590,
2564-2591, 2564-2592, 2564-2593, 2564-2594, 2564-2595, 2564-2596,
2564-2597, 2564-2598, 2564-2599, 2564-2600, 2564-2601, 2564-2602,
2564-2603, 2564-2604, 2564-2605, 2564-2606, 2564-2607, 2564-2608,
2564-2609, 2564-2610, 2564-2611, 2564-2612, 2564-2613, 2564-2614,
2564-2615, 2564-2616, 2564-2617, 2564-2618, 2564-2619, 2564-2620,
2564-2621, 2564-2622, 2564-2623, 2564-2624, 2564-2625, 2564-2626,
2564-2627, 2564-2628, 2564-2629, 2564-2630, 2564-2631, 2565-2584,
2565-2585, 2565-2586, 2565-2587, 2565-2588, 2565-2589, 2565-2590,
2565-2591, 2565-2592, 2565-2593, 2565-2594, 2565-2595, 2565-2596,
2565-2597, 2565-2598, 2565-2599, 2565-2600, 2565-2601, 2565-2602,
2565-2603, 2565-2604, 2565-2605, 2565-2606, 2565-2607, 2565-2608,
2565-2609, 2565-2610, 2565-2611, 2565-2612, 2565-2613, 2565-2614,
2565-2615, 2565-2616, 2565-2617, 2565-2618, 2565-2619, 2565-2620,
2565-2621, 2565-2622, 2565-2623, 2565-2624, 2565-2625, 2565-2626,
2565-2627, 2565-2628, 2565-2629, 2565-2630, 2565-2631, 2566-2583,
2566-2584, 2566-2585, 2566-2586, 2566-2587, 2566-2588, 2566-2589,
2566-2590, 2566-2591, 2566-2592, 2566-2593, 2566-2594, 2566-2595,
2566-2596, 2566-2597, 2566-2598, 2566-2599, 2566-2600, 2566-2601,
2566-2602, 2566-2603, 2566-2604, 2566-2605, 2566-2606, 2566-2607,
2566-2608, 2566-2609, 2566-2610, 2566-2611, 2566-2612, 2566-2613,
2566-2614, 2566-2615, 2566-2616, 2566-2617, 2566-2618, 2566-2619,
2566-2620, 2566-2621, 2566-2622, 2566-2623, 2566-2624, 2566-2625,
2566-2626, 2566-2627, 2566-2628, 2566-2629, 2566-2630, 2566-2631,
2567-2584, 2567-2585, 2567-2586, 2567-2587, 2567-2588, 2567-2589,
2567-2590, 2567-2591, 2567-2592, 2567-2593, 2567-2594, 2567-2595,
2567-2596, 2567-2597, 2567-2598, 2567-2599, 2567-2600, 2567-2601,
2567-2602, 2567-2603, 2567-2604, 2567-2605, 2567-2606, 2567-2607,
2567-2608, 2567-2609, 2567-2610, 2567-2611, 2567-2612, 2567-2613,
2567-2614, 2567-2615, 2567-2616, 2567-2617, 2567-2618, 2567-2619,
2567-2620, 2567-2621, 2567-2622, 2567-2623, 2567-2624, 2567-2625,
2567-2626, 2567-2627, 2567-2628, 2567-2629, 2567-2630, 2567-2631,
2568-2585, 2568-2586, 2568-2587, 2568-2588, 2568-2589, 2568-2590,
2568-2591, 2568-2592, 2568-2593, 2568-2594, 2568-2595, 2568-2596,
2568-2597, 2568-2598, 2568-2599, 2568-2600, 2568-2601, 2568-2602,
2568-2603, 2568-2604, 2568-2605, 2568-2606, 2568-2607, 2568-2608,
2568-2609, 2568-2610, 2568-2611, 2568-2612, 2568-2613, 2568-2614,
2568-2615, 2568-2616, 2568-2617, 2568-2618, 2568-2619, 2568-2620,
2568-2621, 2568-2622, 2568-2623, 2568-2624, 2568-2625, 2568-2626,
2568-2627, 2568-2628, 2568-2629, 2568-2630, 2568-2631, 2569-2586,
2569-2587, 2569-2588, 2569-2589, 2569-2590, 2569-2591, 2569-2592,
2569-2593, 2569-2594, 2569-2595, 2569-2596, 2569-2597, 2569-2598,
2569-2599, 2569-2600, 2569-2601, 2569-2602, 2569-2603, 2569-2604,
2569-2605, 2569-2606, 2569-2607, 2569-2608, 2569-2609, 2569-2610,
2569-2611, 2569-2612, 2569-2613, 2569-2614, 2569-2615, 2569-2616,
2569-2617, 2569-2618, 2569-2619, 2569-2620, 2569-2621, 2569-2622,
2569-2623, 2569-2624, 2569-2625, 2569-2626, 2569-2627, 2569-2628,
2569-2629, 2569-2630, 2569-2631, 2569-2586, 2569-2587, 2569-2588,
2569-2589, 2569-2590, 2569-2591, 2569-2592, 2569-2593, 2569-2594,
2569-2595, 2569-2596, 2569-2597, 2569-2598, 2569-2599, 2569-2600,
2569-2601, 2569-2602, 2569-2603, 2569-2604, 2569-2605, 2569-2606,
2569-2607, 2569-2608, 2569-2609, 2569-2610, 2569-2611, 2569-2612,
2569-2613, 2569-2614, 2569-2615, 2569-2616, 2569-2617, 2569-2618,
2569-2619, 2569-2620, 2569-2621, 2569-2622, 2569-2623, 2569-2624,
2569-2625, 2569-2626, 2569-2627, 2569-2628, 2569-2629, 2569-2630,
2569-2631, 2571-2588, 2571-2589, 2571-2590, 2571-2591, 2571-2592,
2571-2593, 2571-2594, 2571-2595, 2571-2596, 2571-2597, 2571-2598,
2571-2599, 2571-2600, 2571-2601, 2571-2602, 2571-2603, 2571-2604,
2571-2605, 2571-2606, 2571-2607, 2571-2608, 2571-2609, 2571-2610,
2571-2611, 2571-2612, 2571-2613, 2571-2614, 2571-2615, 2571-2616,
2571-2617, 2571-2618, 2571-2619, 2571-2620, 2571-2621, 2571-2622,
2571-2623, 2571-2624, 2571-2625, 2571-2626, 2571-2627, 2571-2628,
2571-2629, 2571-2630, 2571-2631, 2572-2589, 2572-2590, 2572-2591,
2572-2592, 2572-2593, 2572-2594, 2572-2595, 2572-2596, 2572-2597,
2572-2598, 2572-2599, 2572-2600, 2572-2601, 2572-2602, 2572-2603,
2572-2604, 2572-2605, 2572-2606, 2572-2607, 2572-2608, 2572-2609,
2572-2610, 2572-2611, 2572-2612, 2572-2613, 2572-2614, 2572-2615,
2572-2616, 2572-2617, 2572-2618, 2572-2619, 2572-2620, 2572-2621,
2572-2622, 2572-2623, 2572-2624, 2572-2625, 2572-2626, 2572-2627,
2572-2628, 2572-2629, 2572-2630, 2572-2631, 2573-2590, 2573-2591,
2573-2592, 2573-2593, 2573-2594, 2573-2595, 2573-2596, 2573-2597,
2573-2598, 2573-2599, 2573-2600, 2573-2601, 2573-2602, 2573-2603,
2573-2604, 2573-2605, 2573-2606, 2573-2607, 2573-2608, 2573-2609,
2573-2610, 2573-2611, 2573-2612, 2573-2613, 2573-2614, 2573-2615,
2573-2616, 2573-2617, 2573-2618, 2573-2619, 2573-2620, 2573-2621,
2573-2622, 2573-2623, 2573-2624, 2573-2625, 2573-2626, 2573-2627,
2573-2628, 2573-2629, 2573-2630, 2573-2631, 2574-2591, 2574-2592,
2574-2593, 2574-2594, 2574-2595, 2574-2596, 2574-2597, 2574-2598,
2574-2599, 2574-2600, 2574-2601, 2574-2602, 2574-2603, 2574-2604,
2574-2605, 2574-2606, 2574-2607, 2574-2608, 2574-2609, 2574-2610,
2574-2611, 2574-2612, 2574-2613, 2574-2614, 2574-2615, 2574-2616,
2574-2617, 2574-2618, 2574-2619, 2574-2620, 2574-2621, 2574-2622,
2574-2623, 2574-2624, 2574-2625, 2574-2626, 2574-2627, 2574-2628,
2574-2629, 2574-2630, 2574-2631, 2575-2592, 2575-2593, 2575-2594,
2575-2595, 2575-2596, 2575-2597, 2575-2598, 2575-2599, 2575-2600,
2575-2601, 2575-2602, 2575-2603, 2575-2604, 2575-2605, 2575-2606,
2575-2607, 2575-2608, 2575-2609, 2575-2610, 2575-2611, 2575-2612,
2575-2613, 2575-2614, 2575-2615, 2575-2616, 2575-2617, 2575-2618,
2575-2619, 2575-2620, 2575-2621, 2575-2622, 2575-2623, 2575-2624,
2575-2625, 2575-2626, 2575-2627, 2575-2628, 2575-2629, 2575-2630,
2575-2631, 2576-2593, 2576-2594, 2576-2595, 2576-2596, 2576-2597,
2576-2598, 2576-2599, 2576-2600, 2576-2601, 2576-2602, 2576-2603,
2576-2604, 2576-2605, 2576-2606, 2576-2607, 2576-2608, 2576-2609,
2576-2610, 2576-2611, 2576-2612, 2576-2613, 2576-2614, 2576-2615,
2576-2616, 2576-2617, 2576-2618, 2576-2619, 2576-2620, 2576-2621,
2576-2622, 2576-2623, 2576-2624, 2576-2625, 2576-2626, 2576-2627,
2576-2628, 2576-2629, 2576-2630, 2576-2631, 2577-2594, 2577-2595,
2577-2596, 2577-2597, 2577-2598, 2577-2599, 2577-2600, 2577-2601,
2577-2602, 2577-2603, 2577-2604, 2577-2605, 2577-2606, 2577-2607,
2577-2608, 2577-2609,
2577-2610, 2577-2611, 2577-2612, 2577-2613, 2577-2614, 2577-2615,
2577-2616, 2577-2617, 2577-2618, 2577-2619, 2577-2620, 2577-2621,
2577-2622, 2577-2623, 2577-2624, 2577-2625, 2577-2626, 2577-2627,
2577-2628, 2577-2629, 2577-2630, 2577-2631, 2578-2597, 2578-2598,
2578-2599, 2578-2600, 2578-2601, 2578-2602, 2578-2603, 2578-2604,
2578-2605, 2578-2606, 2578-2607, 2578-2608, 2578-2609, 2578-2610,
2578-2611, 2578-2612, 2578-2613, 2578-2614, 2578-2615, 2578-2616,
2578-2617, 2578-2618, 2578-2619, 2578-2620, 2578-2621, 2578-2622,
2578-2623, 2578-2624, 2578-2625, 2578-2626, 2578-2627, 2578-2628,
2578-2629, 2578-2630, 2578-2631, 2579-2598, 2579-2599, 2579-2600,
2579-2601, 2579-2602, 2579-2603, 2579-2604, 2579-2605, 2579-2606,
2579-2607, 2579-2608, 2579-2609, 2579-2610, 2579-2611, 2579-2612,
2579-2613, 2579-2614, 2579-2615, 2579-2616, 2579-2617, 2579-2618,
2579-2619, 2579-2620, 2579-2621, 2579-2622, 2579-2623, 2579-2624,
2579-2625, 2579-2626, 2579-2627, 2579-2628, 2579-2629, 2579-2630,
2579-2631, 2580-2598, 2580-2599, 2580-2600, 2580-2601, 2580-2602,
2580-2603, 2580-2604, 2580-2605, 2580-2606, 2580-2607, 2580-2608,
2580-2609, 2580-2610, 2580-2611, 2580-2612, 2580-2613, 2580-2614,
2580-2615, 2580-2616, 2580-2617, 2580-2618, 2580-2619, 2580-2620,
2580-2621, 2580-2622, 2580-2623, 2580-2624, 2580-2625, 2580-2626,
2580-2627, 2580-2628, 2580-2629, 2580-2630, 2580-2631, 2581-2597,
2581-2598, 2581-2599, 2581-2600, 2581-2601, 2581-2602, 2581-2603,
2581-2604, 2581-2605, 2581-2606, 2581-2607, 2581-2608, 2581-2609,
2581-2610, 2581-2611, 2581-2612, 2581-2613, 2581-2614, 2581-2615,
2581-2616, 2581-2617, 2581-2618, 2581-2619, 2581-2620, 2581-2621,
2581-2622, 2581-2623, 2581-2624, 2581-2625, 2581-2626, 2581-2627,
2581-2628, 2581-2629, 2581-2630, 2581-2631, 2582-2600, 2582-2601,
2582-2602, 2582-2603, 2582-2604, 2582-2605, 2582-2606, 2582-2607,
2582-2608, 2582-2609, 2582-2610, 2582-2611, 2582-2612, 2582-2613,
2582-2614, 2582-2615, 2582-2616, 2582-2617, 2582-2618, 2582-2619,
2582-2620, 2582-2621, 2582-2622, 2582-2623, 2582-2624, 2582-2625,
2582-2626, 2582-2627, 2582-2628, 2582-2629, 2582-2630, 2582-2631,
2583-2601, 2583-2602, 2583-2603, 2583-2604, 2583-2605, 2583-2606,
2583-2607, 2583-2608, 2583-2609, 2583-2610, 2583-2611, 2583-2612,
2583-2613, 2583-2614, 2583-2615, 2583-2616, 2583-2617, 2583-2618,
2583-2619, 2583-2620, 2583-2621, 2583-2622, 2583-2623, 2583-2624,
2583-2625, 2583-2626, 2583-2627, 2583-2628, 2583-2629, 2583-2630,
2583-2631, 2585-2603, 2585-2604, 2585-2605, 2585-2606, 2585-2607,
2585-2608, 2585-2609, 2585-2610, 2585-2611, 2585-2612, 2585-2613,
2585-2614, 2585-2615, 2585-2616, 2585-2617, 2585-2618, 2585-2619,
2585-2620, 2585-2621, 2585-2622, 2585-2623, 2585-2624, 2585-2625,
2585-2626, 2585-2627, 2585-2628, 2585-2629, 2585-2630, 2585-2631,
2586-2604, 2586-2605, 2586-2606, 2586-2607, 2586-2608, 2586-2609,
2586-2610, 2586-2611, 2586-2612, 2586-2613, 2586-2614, 2586-2615,
2586-2616, 2586-2617, 2586-2618, 2586-2619, 2586-2620, 2586-2621,
2586-2622, 2586-2623, 2586-2624, 2586-2625, 2586-2626, 2586-2627,
2586-2628, 2586-2629, 2586-2630, 2586-2631, 2587-2605, 2587-2606,
2587-2607, 2587-2608, 2587-2609, 2587-2610, 2587-2611, 2587-2612,
2587-2613, 2587-2614, 2587-2615, 2587-2616, 2587-2617, 2587-2618,
2587-2619, 2587-2620, 2587-2621, 2587-2622, 2587-2623, 2587-2624,
2587-2625, 2587-2626, 2587-2627, 2587-2628, 2587-2629, 2587-2630,
2587-2631, 2588-2606, 2588-2607, 2588-2608, 2588-2609, 2588-2610,
2588-2611, 2588-2612, 2588-2613, 2588-2614, 2588-2615, 2588-2616,
2588-2617, 2588-2618, 2588-2619, 2588-2620, 2588-2621, 2588-2622,
2588-2623, 2588-2624, 2588-2625, 2588-2626, 2588-2627, 2588-2628,
2588-2629, 2588-2630, 2588-2631, 2589-2607, 2589-2608, 2589-2609,
2589-2610, 2589-2611, 2589-2612, 2589-2613, 2589-2614, 2589-2615,
2589-2616, 2589-2617, 2589-2618, 2589-2619, 2589-2620, 2589-2621,
2589-2622, 2589-2623, 2589-2624, 2589-2625, 2589-2626, 2589-2627,
2589-2628, 2589-2629, 2589-2630, 2589-2631, 2590-2606, 2590-2607,
2590-2608, 2590-2609, 2590-2610, 2590-2611, 2590-2612, 2590-2613,
2590-2614, 2590-2615, 2590-2616, 2590-2617, 2590-2618, 2590-2619,
2590-2620, 2590-2621, 2590-2622, 2590-2623, 2590-2624, 2590-2625,
2590-2626, 2590-2627, 2590-2628, 2590-2629, 2590-2630, 2590-2631,
2591-2610, 2591-2611, 2591-2612, 2591-2613, 2591-2614, 2591-2615,
2591-2616, 2591-2617, 2591-2618, 2591-2619, 2591-2620, 2591-2621,
2591-2622, 2591-2623, 2591-2624, 2591-2625, 2591-2626, 2591-2627,
2591-2628, 2591-2629, 2591-2630, 2591-2631, 2592-2611, 2592-2612,
2592-2613, 2592-2614, 2592-2615, 2592-2616, 2592-2617, 2592-2618,
2592-2619, 2592-2620, 2592-2621, 2592-2622, 2592-2623, 2592-2624,
2592-2625, 2592-2626, 2592-2627, 2592-2628, 2592-2629, 2592-2630,
2592-2631, 2593-2608, 2593-2612, 2593-2613, 2593-2614, 2593-2615,
2593-2616, 2593-2617, 2593-2618, 2593-2619, 2593-2620, 2593-2621,
2593-2622, 2593-2623, 2593-2624, 2593-2625, 2593-2626, 2593-2627,
2593-2628, 2593-2629, 2593-2630, 2593-2631, 2594-2612, 2594-2613,
2594-2614, 2594-2615, 2594-2616, 2594-2617, 2594-2618, 2594-2619,
2594-2620, 2594-2621, 2594-2622, 2594-2623, 2594-2624, 2594-2625,
2594-2626, 2594-2627, 2594-2628, 2594-2629, 2594-2630, 2594-2631,
2595-2611, 2595-2612, 2595-2613, 2595-2614, 2595-2615, 2595-2616,
2595-2617, 2595-2618, 2595-2619, 2595-2620, 2595-2621, 2595-2622,
2595-2623, 2595-2624, 2595-2625, 2595-2626, 2595-2627, 2595-2628,
2595-2629, 2595-2630, 2595-2631, 2596-2614, 2596-2615, 2596-2616,
2596-2617, 2596-2618, 2596-2619, 2596-2620, 2596-2621, 2596-2622,
2596-2623, 2596-2624, 2596-2625, 2596-2626, 2596-2627, 2596-2628,
2596-2629, 2596-2630, 2596-2631, 2597-2612, 2597-2613, 2597-2614,
2597-2615, 2597-2616, 2597-2617, 2597-2618, 2597-2619, 2597-2620,
2597-2621, 2597-2622, 2597-2623, 2597-2624, 2597-2625, 2597-2626,
2597-2627, 2597-2628, 2597-2629, 2597-2630, 2597-2631, 2598-2613,
2598-2614, 2598-2615, 2598-2616, 2598-2617, 2598-2618, 2598-2619,
2598-2620, 2598-2621, 2598-2622, 2598-2623, 2598-2624, 2598-2625,
2598-2626, 2598-2627, 2598-2628, 2598-2629, 2598-2630, 2598-2631,
2599-2614, 2599-2615, 2599-2616, 2599-2617, 2599-2618, 2599-2619,
2599-2620, 2599-2621, 2599-2622, 2599-2623, 2599-2624, 2599-2625,
2599-2626, 2599-2627, 2599-2628, 2599-2629, 2599-2630, 2599-2631,
2600-2615, 2600-2616, 2600-2617, 2600-2618, 2600-2619, 2600-2620,
2600-2621, 2600-2622, 2600-2623, 2600-2624, 2600-2625, 2600-2626,
2600-2627, 2600-2628, 2600-2629, 2600-2630, 2600-2631, 2601-2616,
2601-2617, 2601-2618, 2601-2619, 2601-2620, 2601-2621, 2601-2622,
2601-2623, 2601-2624, 2601-2625, 2601-2626, 2601-2627, 2601-2628,
2601-2629, 2601-2630, 2601-2631, 2602-2618, 2602-2619, 2602-2620,
2602-2621, 2602-2622, 2602-2623, 2602-2624, 2602-2625, 2602-2626,
2602-2627, 2602-2628, 2602-2629, 2602-2630, 2602-2631, 2603-2620,
2603-2621, 2603-2622, 2603-2623, 2603-2624, 2603-2625, 2603-2626,
2603-2627, 2603-2628, 2603-2629, 2603-2630, 2603-2631, 2604-2619,
2604-2620, 2604-2621, 2604-2622, 2604-2623, 2604-2624, 2604-2625,
2604-2626, 2604-2627, 2604-2628, 2604-2629, 2604-2630, 2604-2631,
2605-2620, 2605-2621, 2605-2622, 2605-2623, 2605-2624, 2605-2625,
2605-2626, 2605-2627, 2605-2628, 2605-2629, 2605-2630, 2605-2631,
2606-2621, 2606-2622, 2606-2623, 2606-2624, 2606-2625, 2606-2626,
2606-2627, 2606-2628, 2606-2629, 2606-2630, 2606-2631, 2607-2622,
2607-2623, 2607-2624, 2607-2625, 2607-2626, 2607-2627, 2607-2628,
2607-2629, 2607-2630, 2607-2631, 2608-2623, 2608-2624, 2608-2625,
2608-2626, 2608-2627, 2608-2628, 2608-2629, 2608-2630, 2608-2631,
2609-2624, 2609-2625, 2609-2626, 2609-2627, 2609-2628, 2609-2629,
2609-2630, 2609-2631, 2610-2625, 2610-2626, 2610-2627, 2610-2628,
2610-2629, 2610-2630, 2610-2631, 2611-2626, 2611-2627, 2611-2628,
2611-2629, 2611-2630, 2611-2631, 2612-2627, 2612-2628, 2612-2629,
2612-2630, 2612-2631, 2613-2628, 2613-2629, 2613-2630, 2613-2631,
2614-2629, 2614-2630, 2614-2631, 2615-2630, 2615-2631, or 2616-2631
of a CFB nucleic acid having the nucleobase sequence of SEQ ID NO:
1, wherein the nucleobase sequence of the modified oligonucleotide
is complementary to SEQ ID NO: 1.
8-94. (canceled)
Description
SEQUENCE LISTING
[0001] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled BIOL0183USC2SEQ_ST25.txt created Jun. 10, 2019, which
is 225 kb in size. The information in the electronic format of the
sequence listing is incorporated herein by reference in its
entirety.
FIELD
[0002] The present embodiments provide methods, compounds, and
compositions for treating, preventing, or ameliorating a disease
associated with dysregulation of the complement alternative pathway
by administering a Complement Factor B (CFB) specific inhibitor to
a subject.
BACKGROUND
[0003] The complement system is part of the host innate immune
system involved in lysing foreign cells, enhancing phagocytosis of
antigens, clumping antigen-bearing agents, and attracting
macrophages and neutrophils. The complement system is divided into
three initiation pathways--the classical, lectin, and alternative
pathways--that converge at component C3 to generate an enzyme
complex known as C3 convertase, which cleaves C3 into C3a and C3b.
C3b associates with C3 convertase mediated by CFB and results in
generation of C5 convertase, which cleaves C5 into C5a and C5b,
which initiates the membrane attack pathway resulting in the
formation of the membrane attack complex (MAC) comprising
components C5b, C6, C7, C8, and C9. The membrane-attack complex
(MAC) forms transmembrane channels and disrupts the phospholipid
bilayer of target cells, leading to cell lysis.
[0004] In the homeostatic state, the alternative pathway is
continuously activated at a low "tickover" level as a result of
activation of the alternative pathway by spontaneous hydrolysis of
C3 and the production of C3b, which generates C5 convertase.
SUMMARY
[0005] The complement system mediates innate immunity and plays an
important role in normal inflammatory response to injury, but its
dysregulation may cause severe injury. Activation of the
alternative complement pathway beyond its constitutive "tickover"
level can lead to unrestrained hyperactivity and manifest as
diseases of complement dysregulation.
[0006] Certain embodiments provided herein relate to methods of
treating, preventing, or ameliorating a disease associated with
dysregulation of the complement alternative pathway in a subject by
administration of a Complement Factor B (CFB) specific inhibitor.
Several embodiments provided herein are drawn to a method of
inhibiting expression of CFB in a subject having, or at risk of
having, a disease associated with dysregulation of the complement
alternative pathway by administering a CFB specific inhibitor to
the subject. In certain embodiments, a method of reducing or
inhibiting accumulation of C3 deposits in the eye of a subject
having, or at risk of having, a disease associated with
dysregulation of the complement alternative pathway comprises
administering a CFB specific inhibitor to the subject. In several
embodiments, a method of reducing or inhibiting accumulation of C3
deposits in the kidney of a subject having, or at risk of having, a
disease associated with dysregulation of the complement alternative
pathway comprises administering a CFB specific inhibitor to the
subject.
DETAILED DESCRIPTION
[0007] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed. Herein, the use of the singular includes the plural unless
specifically stated otherwise. As used herein, the use of"or" means
"and/or" unless stated otherwise. Furthermore, the use of the term
"including" as well as other forms, such as "includes" and
"included", is not limiting. Also, terms such as "element" or
"component" encompass both elements and components comprising one
unit and elements and components that comprise more than one
subunit, unless specifically stated otherwise.
[0008] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
this application, including, but not limited to, patents, patent
applications, articles, books, and treatises, are hereby expressly
incorporated by reference for the portions of the document
discussed herein, as well as in their entirety.
Unless otherwise indicated, the following terms have the following
meanings:
[0009] "2'-O-methoxyethyl" (also 2'-MOE and
2'-O(CH.sub.2).sub.2--OCH.sub.3) refers to an O-methoxy-ethyl
modification at the 2' position of a furanose ring. A
2'-O-methoxyethyl modified sugar is a modified sugar.
[0010] "2'-MOE nucleoside" (also 2'-O-methoxyethyl nucleoside)
means a nucleoside comprising a 2'-MOE modified sugar moiety.
[0011] "2'-substituted nucleoside" means a nucleoside comprising a
substituent at the 2'-position of the furanosyl ring other than H
or OH. In certain embodiments, 2' substituted nucleosides include
nucleosides with bicyclic sugar modifications.
[0012] "3' target site" refers to the nucleotide of a target
nucleic acid which is complementary to the 3'-most nucleotide of a
particular antisense compound.
[0013] "5' target site" refers to the nucleotide of a target
nucleic acid which is complementary to the 5'-most nucleotide of a
particular antisense compound.
[0014] "5-methylcytosine" means a cytosine modified with a methyl
group attached to the 5 position. A 5-methylcytosine is a modified
nucleobase.
[0015] "About" means within +10% of a value. For example, if it is
stated, "the compounds affected at least about 70% inhibition of
CFB", it is implied that CFB levels are inhibited within a range of
60% and 80%.
[0016] "Administration" or "administering" refers to routes of
introducing an antisense compound provided herein to a subject to
perform its intended function. An example of a route of
administration that can be used includes, but is not limited to
parenteral administration, such as subcutaneous, intravenous, or
intramuscular injection or infusion.
[0017] "Amelioration" refers to a lessening of at least one
indicator, sign, or symptom of an associated disease, disorder, or
condition. In certain embodiments, amelioration includes a delay or
slowing in the progression of one or more indicators of a condition
or disease. The severity of indicators may be determined by
subjective or objective measures, which are known to those skilled
in the art.
[0018] "Animal" refers to a human or non-human animal, including,
but not limited to, mice, rats, rabbits, dogs, cats, pigs, and
non-human primates, including, but not limited to, monkeys and
chimpanzees.
[0019] "Antisense activity" means any detectable or measurable
activity attributable to the hybridization of an antisense compound
to its target nucleic acid. In certain embodiments, antisense
activity is a decrease in the amount or expression of a target
nucleic acid or protein encoded by such target nucleic acid.
[0020] "Antisense compound" means an oligomeric compound that is is
capable of undergoing hybridization to a target nucleic acid
through hydrogen bonding. Examples of antisense compounds include
single-stranded and double-stranded compounds, such as, antisense
oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based
compounds.
[0021] "Antisense inhibition" means reduction of target nucleic
acid levels in the presence of an antisense compound complementary
to a target nucleic acid compared to target nucleic acid levels in
the absence of the antisense compound.
[0022] "Antisense mechanisms" are all those mechanisms involving
hybridization of a compound with target nucleic acid, wherein the
outcome or effect of the hybridization is either target degradation
or target occupancy with concomitant stalling of the cellular
machinery involving, for example, transcription or splicing.
[0023] "Antisense oligonucleotide" means a single-stranded
oligonucleotide having a nucleobase sequence that permits
hybridization to a corresponding region or segment of a target
nucleic acid.
[0024] "Base complementarity" refers to the capacity for the
precise base pairing of nucleobases of an antisense oligonucleotide
with corresponding nucleobases in a target nucleic acid (i.e.,
hybridization), and is mediated by Watson-Crick, Hoogsteen or
reversed Hoogsteen hydrogen binding between corresponding
nucleobases.
[0025] "Bicyclic sugar moiety" means a modified sugar moiety
comprising a 4 to 7 membered ring (including but not limited to a
furanosyl) comprising a bridge connecting two atoms of the 4 to 7
membered ring to form a second ring, resulting in a bicyclic
structure. In certain embodiments, the 4 to 7 membered ring is a
sugar ring. In certain embodiments the 4 to 7 membered ring is a
furanosyl. In certain such embodiments, the bridge connects the
2'-carbon and the 4'-carbon of the furanosyl.
[0026] "Bicyclic nucleic acid" or "BNA" or "BNA nucleosides" means
nucleic acid monomers having a bridge connecting two carbon atoms
between the 4' and 2'position of the nucleoside sugar unit, thereby
forming a bicyclic sugar. Examples of such bicyclic sugar include,
but are not limited to A) .alpha.-L-Methyleneoxy
(4'-CH.sub.2--O-2') LNA, (B) .beta.-D-Methyleneoxy
(4'-CH.sub.2--O-2') LNA, (C) Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') LNA, (D) Aminooxy
(4'-CH.sub.2--O--N(R)-2') LNA and (E) Oxyamino
(4'-CH.sub.2--N(R)--O-2') LNA, as depicted below.
##STR00001##
[0027] As used herein, LNA compounds include, but are not limited
to, compounds having at least one bridge between the 4' and the 2'
position of the sugar wherein each of the bridges independently
comprises 1 or from 2 to 4 linked groups independently selected
from --[C(R.sub.1)(R.sub.2)]--, --C(R.sub.1).dbd.C(R.sub.2)--,
--C(R.sub.1).dbd.N--, --C(.dbd.NR.sub.1)--, --C(.dbd.O)--,
--C(.dbd.S)--, --O--, --Si(R.sub.1).sub.2--, --S(.dbd.O).sub.x--
and --N(R.sub.1)--; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4;
each R.sub.1 and R.sub.2 is, independently, H, a protecting group,
hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12
alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12
alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12
alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl,
a heterocycle radical, a substituted heterocycle radical,
heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic
radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen,
OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl
(C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12
alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12
alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12
alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20
aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(.dbd.O)--H),
substituted acyl, a heterocycle radical, a substituted heterocycle
radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12
aminoalkyl or a protecting group.
[0028] Examples of 4'-2' bridging groups encompassed within the
definition of LNA include, but are not limited to one of formulae:
--[C(R.sub.1)(R.sub.2)].sub.n--,
--[C(R.sub.1)(R.sub.2)].sub.n--O--,
--C(R.sub.1R.sub.2)--N(R.sub.1)--O-- or
--C(R.sub.1R.sub.2)--O--N(R.sub.1)--. Furthermore, other bridging
groups encompassed with the definition of LNA are 4'-CH.sub.2-2',
4'-(CH.sub.2).sub.2-2', 4'-(CH.sub.2).sub.3-2', 4'-CH.sub.2--O-2',
4'-(CH.sub.2).sub.2--O-2', 4'-CH.sub.2--O--N(R.sub.1)-2' and
4'-CH.sub.2--N(R.sub.1)--O-2'- bridges, wherein each R.sub.1 and
R.sub.2 is, independently, H, a protecting group or
C.sub.1-C.sub.12 alkyl.
[0029] Also included within the definition of LNA according to the
invention are LNAs in which the 2'-hydroxyl group of the ribosyl
sugar ring is connected to the 4' carbon atom of the sugar ring,
thereby forming a methyleneoxy (4'-CH.sub.2--O-2') bridge to form
the bicyclic sugar moiety. The bridge can also be a methylene
(--CH.sub.2--) group connecting the 2' oxygen atom and the 4'
carbon atom, for which the term methyleneoxy (4'-CH.sub.2--O-2')
LNA is used. Furthermore; in the case of the bicylic sugar moiety
having an ethylene bridging group in this position, the term
ethyleneoxy (4'-CH.sub.2CH.sub.2--O-2') LNA is used.
.alpha.-L-methyleneoxy (4'-CH.sub.2--O-2'), an isomer of
methyleneoxy (4'-CH.sub.2--O-2') LNA is also encompassed within the
definition of LNA, as used herein.
[0030] "Cap structure" or "terminal cap moiety" means chemical
modifications, which have been incorporated at either terminus of
an antisense compound.
[0031] "cEt" or "constrained ethyl" means a bicyclic sugar moiety
comprising a bridge connecting the 4'-carbon and the 2'-carbon,
wherein the bridge has the formula: 4'-CH(CH.sub.3)--O-2'.
[0032] "Constrained ethyl nucleoside" (also cEt nucleoside) means a
nucleoside comprising a bicyclic sugar moiety comprising a
4'-CH(CH.sub.3)--O-2' bridge.
[0033] "Complement Factor B (CFB)" means any nucleic acid or
protein of CFB. "CFB nucleic acid" means any nucleic acid encoding
CFB. For example, in certain embodiments, a CFB nucleic acid
includes a DNA sequence encoding CFB, an RNA sequence transcribed
from DNA encoding CFB (including genomic DNA comprising introns and
exons), including a non-protein encoding (i.e. non-coding) RNA
sequence, and an mRNA sequence encoding CFB. "CFB mRNA" means an
mRNA encoding a CFB protein.
[0034] "CFB specific inhibitor" refers to any agent capable of
specifically inhibiting CFB RNA and/or CFB protein expression or
activity at the molecular level. For example, CFB specific
inhibitors include nucleic acids (including antisense compounds),
peptides, antibodies, small molecules, and other agents capable of
inhibiting the expression of CFB RNA and/or CFB protein.
[0035] "Chemically distinct region" refers to a region of an
antisense compound that is in some way chemically different than
another region of the same antisense compound. For example, a
region having 2'-O-methoxyethyl nucleotides is chemically distinct
from a region having nucleotides without 2'-O-methoxyethyl
modifications.
[0036] "Chimeric antisense compounds" means antisense compounds
that have at least 2 chemically distinct regions, each position
having a plurality of subunits.
[0037] "Complementarity" means the capacity for pairing between
nucleobases of a first nucleic acid and a second nucleic acid.
[0038] "Comprise," "comprises" and "comprising" will be understood
to imply the inclusion of a stated step or element or group of
steps or elements but not the exclusion of any other step or
element or group of steps or elements.
[0039] "Contiguous nucleobases" means nucleobases immediately
adjacent to each other.
[0040] "Deoxyribonucleotide" means a nucleotide having a hydrogen
at the 2' position of the sugar portion of the nucleotide.
Deoxyribonucleotides may be modified with any of a variety of
substituents.
[0041] "Designing" or "Designed to" refer to the process of
designing an oligomeric compound that specifically hybridizes with
a selected nucleic acid molecule.
[0042] "Effective amount" means the amount of active pharmaceutical
agent sufficient to effectuate a desired physiological outcome in
an individual in need of the agent. The effective amount may vary
among individuals depending on the health and physical condition of
the individual to be treated, the taxonomic group of the
individuals to be treated, the formulation of the composition,
assessment of the individual's medical condition, and other
relevant factors.
[0043] "Efficacy" means the ability to produce a desired
effect.
[0044] "Expression" includes all the functions by which a gene's
coded information is converted into structures present and
operating in a cell. Such structures include, but are not limited
to the products of transcription and translation.
[0045] "Fully complementary" or "100% complementary" means each
nucleobase of a first nucleic acid has a complementary nucleobase
in a second nucleic acid. In certain embodiments, a first nucleic
acid is an antisense compound and a target nucleic acid is a second
nucleic acid.
[0046] "Gapmer" means a chimeric antisense compound in which an
internal region having a plurality of nucleosides that support
RNase H cleavage is positioned between external regions having one
or more nucleosides, wherein the nucleosides comprising the
internal region are chemically distinct from the nucleoside or
nucleosides comprising the external regions. The internal region
may be referred to as the "gap" and the external regions may be
referred to as the "wings."
[0047] "Hybridization" means the annealing of complementary nucleic
acid molecules. In certain embodiments, complementary nucleic acid
molecules include, but are not limited to, an antisense compound
and a nucleic acid target. In certain embodiments, complementary
nucleic acid molecules include, but are not limited to, an
antisense oligonucleotide and a nucleic acid target.
[0048] "Identifying an animal having, or at risk for having, a
disease, disorder and/or condition" means identifying an animal
having been diagnosed with the disease, disorder and/or condition
or identifying an animal predisposed to develop the disease,
disorder and/or condition. Such identification may be accomplished
by any method including evaluating an individual's medical history
and standard clinical tests or assessments.
[0049] "Immediately adjacent" means there are no intervening
elements between the immediately adjacent elements.
[0050] "Individual" means a human or non-human animal selected for
treatment or therapy.
[0051] "Inhibiting the expression or activity" refers to a
reduction, blockade of the expression or activity and does not
necessarily indicate a total elimination of expression or
activity.
[0052] "Internucleoside linkage" refers to the chemical bond
between nucleosides.
[0053] "Lengthened" antisense oligonucleotides are those that have
one or more additional nucleosides relative to an antisense
oligonucleotide disclosed herein.
[0054] "Linked deoxynucleoside" means a nucleic acid base (A, G, C,
T, U) substituted by deoxyribose linked by a phosphate ester to
form a nucleotide.
[0055] "Linked nucleosides" means adjacent nucleosides linked
together by an internucleoside linkage.
[0056] "Mismatch" or "non-complementary nucleobase" refers to the
case when a nucleobase of a first nucleic acid is not capable of
pairing with the corresponding nucleobase of a second or target
nucleic acid.
[0057] "Modified internucleoside linkage" refers to a substitution
or any change from a naturally occurring internucleoside bond (i.e.
a phosphodiester internucleoside bond).
[0058] "Modified nucleobase" means any nucleobase other than
adenine, cytosine, guanine, thymidine, or uracil. An "unmodified
nucleobase" means the purine bases adenine (A) and guanine (G), and
the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
[0059] "Modified nucleoside" means a nucleoside having,
independently, a modified sugar moiety and/or modified
nucleobase.
[0060] "Modified nucleotide" means a nucleotide having,
independently, a modified sugar moiety, modified internucleoside
linkage, or modified nucleobase.
[0061] "Modified oligonucleotide" means an oligonucleotide
comprising at least one modified internucleoside linkage, a
modified sugar, and/or a modified nucleobase.
[0062] "Modified sugar" means substitution and/or any change from a
natural sugar moiety.
[0063] "Modulating" refers to changing or adjusting a feature in a
cell, tissue, organ or organism. For example, modulating CFB mRNA
can mean to increase or decrease the level of CFB mRNA and/or CFB
protein in a cell, tissue, organ or organism. A "modulator" effects
the change in the cell, tissue, organ or organism. For example, a
CFB antisense compound can be a modulator that decreases the amount
of CFB mRNA and/or CFB protein in a cell, tissue, organ or
organism.
[0064] "Monomer" refers to a single unit of an oligomer. Monomers
include, but are not limited to, nucleosides and nucleotides,
whether naturally occurring or modified.
[0065] "Motif" means the pattern of unmodified and modified
nucleosides in an antisense compound.
[0066] "Natural sugar moiety" means a sugar moiety found in DNA
(2'-H) or RNA (2'-OH).
[0067] "Naturally occurring internucleoside linkage" means a 3' to
5' phosphodiester linkage.
[0068] "Non-complementary nucleobase" refers to a pair of
nucleobases that do not form hydrogen bonds with one another or
otherwise support hybridization.
[0069] "Nucleic acid" refers to molecules composed of monomeric
nucleotides. A nucleic acid includes, but is not limited to,
ribonucleic acids (RNA), deoxyribonucleic acids (DNA),
single-stranded nucleic acids, and double-stranded nucleic
acids.
[0070] "Nucleobase" means a heterocyclic moiety capable of pairing
with a base of another nucleic acid.
[0071] "Nucleobase complementarity" refers to a nucleobase that is
capable of base pairing with another nucleobase. For example, in
DNA, adenine (A) is complementary to thymine (T). For example, in
RNA, adenine (A) is complementary to uracil (U). In certain
embodiments, complementary nucleobase refers to a nucleobase of an
antisense compound that is capable of base pairing with a
nucleobase of its target nucleic acid. For example, if a nucleobase
at a certain position of an antisense compound is capable of
hydrogen bonding with a nucleobase at a certain position of a
target nucleic acid, then the position of hydrogen bonding between
the oligonucleotide and the target nucleic acid is considered to be
complementary at that nucleobase pair.
[0072] "Nucleobase sequence" means the order of contiguous
nucleobases independent of any sugar, linkage, and/or nucleobase
modification.
[0073] "Nucleoside" means a nucleobase linked to a sugar.
[0074] "Nucleoside mimetic" includes those structures used to
replace the sugar or the sugar and the base and not necessarily the
linkage at one or more positions of an oligomeric compound such as
for example nucleoside mimetics having morpholino, cyclohexenyl,
cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics,
e.g., non furanose sugar units. Nucleotide mimetic includes those
structures used to replace the nucleoside and the linkage at one or
more positions of an oligomeric compound such as for example
peptide nucleic acids or morpholinos (morpholinos linked by
--N(H)--C(.dbd.O)--O--or other non-phosphodiester linkage). Sugar
surrogate overlaps with the slightly broader term nucleoside
mimetic but is intended to indicate replacement of the sugar unit
(furanose ring) only. The tetrahydropyranyl rings provided herein
are illustrative of an example of a sugar surrogate wherein the
furanose sugar group has been replaced with a tetrahydropyranyl
ring system. "Mimetic" refers to groups that are substituted for a
sugar, a nucleobase, and/or internucleoside linkage. Generally, a
mimetic is used in place of the sugar or sugar-internucleoside
linkage combination, and the nucleobase is maintained for
hybridization to a selected target.
[0075] "Nucleotide" means a nucleoside having a phosphate group
covalently linked to the sugar portion of the nucleoside.
[0076] "Oligomeric compound" means a polymer of linked monomeric
subunits which is capable of hybridizing to at least a region of a
nucleic acid molecule.
[0077] "Oligonucleoside" means an oligonucleotide in which the
internucleoside linkages do not contain a phosphorus atom.
[0078] "Oligonucleotide" means a polymer of linked nucleosides each
of which can be modified or unmodified, independent one from
another.
[0079] "Parenteral administration" means administration through
injection or infusion. Parenteral administration includes
subcutaneous administration, intravenous administration,
intramuscular administration, intraarterial administration,
intraperitoneal administration, or intracranial administration,
e.g. intrathecal or intracerebroventricular administration.
[0080] "Pharmaceutical composition" means a mixture of substances
suitable for administering to an individual. For example, a
pharmaceutical composition may comprise one or more active
pharmaceutical agents and a sterile aqueous solution.
[0081] "Pharmaceutically acceptable salts" means physiologically
and pharmaceutically acceptable salts of antisense compounds, i.e.,
salts that retain the desired biological activity of the parent
oligonucleotide and do not impart undesired toxicological effects
thereto.
[0082] "Phosphorothioate linkage" means a linkage between
nucleosides where the phosphodiester bond is modified by replacing
one of the non-bridging oxygen atoms with a sulfur atom. A
phosphorothioate linkage is a modified internucleoside linkage.
[0083] "Portion" means a defined number of contiguous (i.e.,
linked) nucleobases of a nucleic acid. In certain embodiments, a
portion is a defined number of contiguous nucleobases of a target
nucleic acid. In certain embodiments, a portion is a defined number
of contiguous nucleobases of an antisense compound
[0084] "Prevent" refers to delaying or forestalling the onset,
development or progression of a disease, disorder, or condition for
a period of time from minutes to indefinitely. Prevent also means
reducing the risk of developing a disease, disorder, or
condition.
[0085] "Prophylactically effective amount" refers to an amount of a
pharmaceutical agent that provides a prophylactic or preventative
benefit to an animal.
[0086] "Region" is defined as a portion of the target nucleic acid
having at least one identifiable structure, function, or
characteristic.
[0087] "Ribonucleotide" means a nucleotide having a hydroxy at the
2' position of the sugar portion of the nucleotide. Ribonucleotides
may be modified with any of a variety of substituents.
[0088] "Segments" are defined as smaller or sub-portions of regions
within a target nucleic acid.
[0089] "Side effects" means physiological disease and/or conditions
attributable to a treatment other than the desired effects. In
certain embodiments, side effects include injection site reactions,
liver function test abnormalities, renal function abnormalities,
liver toxicity, renal toxicity, central nervous system
abnormalities, myopathies, and malaise. For example, increased
aminotransferase levels in serum may indicate liver toxicity or
liver function abnormality. For example, increased bilirubin may
indicate liver toxicity or liver function abnormality.
[0090] "Sites," as used herein, are defined as unique nucleobase
positions within a target nucleic acid.
[0091] "Slows progression" means decrease in the development of the
said disease.
[0092] "Specifically hybridizable" refers to an antisense compound
having a sufficient degree of complementarity between an antisense
oligonucleotide and a target nucleic acid to induce a desired
effect, while exhibiting minimal or no effects on non-target
nucleic acids under conditions in which specific binding is
desired, i.e., under physiological conditions in the case of in
vivo assays and therapeutic treatments.
[0093] "Stringent hybridization conditions" or "stringent
conditions" refer to conditions under which an oligomeric compound
will hybridize to its target sequence, but to a minimal number of
other sequences.
[0094] "Subject" means a human or non-human animal selected for
treatment or therapy.
[0095] "Target" refers to a protein, the modulation of which is
desired.
[0096] "Target gene" refers to a gene encoding a target.
[0097] "Targeting" means the process of design and selection of an
antisense compound that will specifically hybridize to a target
nucleic acid and induce a desired effect.
[0098] "Target nucleic acid," "target RNA," "target RNA transcript"
and "nucleic acid target" all mean a nucleic acid capable of being
targeted by antisense compounds.
[0099] "Target region" means a portion of a target nucleic acid to
which one or more antisense compounds is targeted.
[0100] "Target segment" means the sequence of nucleotides of a
target nucleic acid to which an antisense compound is targeted. "5'
target site" refers to the 5'-most nucleotide of a target segment.
"3' target site" refers to the 3'-most nucleotide of a target
segment.
[0101] "Therapeutically effective amount" means an amount of a
pharmaceutical agent that provides a therapeutic benefit to an
individual.
[0102] "Treat" refers to administering a pharmaceutical composition
to an animal in order to effect an alteration or improvement of a
disease, disorder, or condition in the animal. In certain
embodiments, one or more pharmaceutical compositions can be
administered to the animal.
[0103] "Unmodified" nucleobases mean the purine bases adenine (A)
and guanine (G), and the pyrimidine bases thymine (T), cytosine (C)
and uracil (U).
[0104] "Unmodified nucleotide" means a nucleotide composed of
naturally occurring nucleobases, sugar moieties, and
internucleoside linkages. In certain embodiments, an unmodified
nucleotide is an RNA nucleotide (i.e. .beta.-D-ribonucleosides) or
a DNA nucleotide (i.e. .beta.-D-deoxyribonucleoside).
Certain Embodiments
[0105] Certain embodiments provide methods, compounds and
compositions for inhibiting Complement Factor B (CFB)
expression.
[0106] Certain embodiments provide antisense compounds targeted to
a CFB nucleic acid. In certain embodiments, the CFB nucleic acid
has the sequence set forth in GENBANK Accession No. NM_001710.5
(incorporated herein as SEQ ID NO: 1), GENBANK Accession No.
NT_007592.15 truncated from nucleotides 31852000 to 31861000
(incorporated herein as SEQ ID NO: 2), GENBANK Accession No
NW_001116486.1 truncated from nucleotides 536000 to 545000
(incorporated herein as SEQ ID NO: 3), GENBANK Accession No.
XM_001113553.2 (incorporated herein as SEQ ID NO: 4), or GENBANK
Accession No. NM_008198.2 (incorporated herein as SEQ ID NO:
5).
[0107] Certain embodiments provide a compound comprising a modified
oligonucleotide consisting of 10 to 30 linked nucleosides and
having a nucleobase sequence comprising at least 8 contiguous
nucleobases of any of the nucleobase sequences of SEQ ID NOs:
6-808.
[0108] Certain embodiments provide a compound comprising a modified
oligonucleotide consisting of 10 to 30 linked nucleosides and
having a nucleobase sequence comprising at least 9 contiguous
nucleobases of any of the nucleobase sequences of SEQ ID NOs:
6-808.
[0109] Certain embodiments provide a compound comprising a modified
oligonucleotide consisting of 10 to 30 linked nucleosides and
having a nucleobase sequence comprising at least 10 contiguous
nucleobases of any of the nucleobase sequences of SEQ ID NOs:
6-808.
[0110] Certain embodiments provide a compound comprising a modified
oligonucleotide consisting of 10 to 30 linked nucleosides and
having a nucleobase sequence comprising at least 11 contiguous
nucleobases of any of the nucleobase sequences of SEQ ID NOs:
6-808.
[0111] Certain embodiments provide a compound comprising a modified
oligonucleotide consisting of 10 to 30 linked nucleosides and
having a nucleobase sequence comprising at least 12 contiguous
nucleobases of any of the nucleobase sequences of SEQ ID NOs:
6-808.
[0112] Certain embodiments provide a compound comprising a modified
oligonucleotide consisting of 10 to 30 linked nucleosides and
having a nucleobase sequence comprising the nucleobase sequence of
any one of SEQ ID NOs: 6-808.
[0113] Certain embodiments provide a compound comprising a modified
oligonucleotide consisting of the nucleobase sequence of any one of
SEQ ID NOs: 6-808.
[0114] Certain embodiments provide a compound comprising a modified
oligonucleotide consisting of 10 to 30 linked nucleosides
complementary within nucleobases 30-49, 48-63, 150-169, 151-170,
152-171, 154-169, 154-173, 156-171, 156-175, 157-176, 158-173,
158-177, 480-499, 600-619, 638-657, 644-663, 738-757, 1089-1108,
1135-1154, 1141-1160, 1147-1166, 1150-1169, 1153-1172, 1159-1178,
1162-1181, 1165-1184, 1171-1186, 1171-1190, 1173-1188, 1173-1192,
1175-1190, 1175-1194, 1177-1196, 1183-1202, 1208-1227, 1235-1254,
1298-1317, 1304-1323, 1310-1329, 1316-1335, 1319-1338, 1322-1341,
1328-1347, 1349-1368, 1355-1374, 1393-1412, 1396-1415, 1399-1418,
1405-1424, 1421-1440, 1621-1640, 1646-1665, 1646-1665, 1647-1666,
1689-1708, 1749-1768, 1763-1782, 1912-1931, 2073-2092, 2085-2104,
2166-2185, 2172-2191, 2189-2208, 2191-2210, 2193-2212, 2195-2210,
2195-2214, 2196-2215, 2197-2212, 2197-2216, 2202-2221, 2223-2238,
2223-2242, 2225-2240, 2226-2245, 2227-2242, 2227-2246, 2238-2257,
2241-2260, 2267-2286, 2361-2380, 2388-2407, 2397-2416, 2448-2467,
2453-2472, 2455-2474, 2457-2472, 2457-2476, 2459-2474, 2459-2478,
2461-2476, 2461-2480, 2532-2551, 2550-2569, 2551-2566, 2551-2570,
2552-2568, 2552-2570, 2552-2571, 2553-2568, 2553-2570, 2553-2571,
2553-2572, 2554-2571, 2554-2572, 2554-2573, 2555-2570, 2555-2572,
2555-2574, 2556-2573, 2556-2574, 2556-2575, 2557-2573, 2557-2574,
2557-2575, 2557-2576, 2558-2575, 2558-2576, 2558-2577, 2559-2576,
2559-2577, 2559-2578, 2560-2577, 2560-2578, 2560-2579, 2561-2576,
2561-2578, 2561-2579, 2561-2580, 2562-2577, 2562-2579, 2562-2581,
2563-2578, 2563-2580, 2563-2582, 2564-2581, 2564-2583, 2565-2584,
2566-2583, 2566-2585, 2567-2582, 2567-2584, 2567-2586, 2568-2583,
2568-2585, 2568-2587, 2569-2586, 2569-2588, 2570-2585, 2570-2587,
2570-2589, 2571-2586, 2571-2588, 2571-2590, 2572-2589, 2572-2590,
2572-2591, 2573-2590, 2573-2592, 2574-2590, 2574-2591, 2574-2593,
2575-2590, 2575-2591, 2575-2592, 2575-2594, 2576-2593, 2576-2595,
2577-2594, 2577-2595, 2577-2596, 2578-2594, 2578-2596, 2578-2597,
2579-2598, 2580-2596, 2580-2597, 2580-2598, 2580-2599, 2581-2597,
2581-2598, 2581-2599, 2581-2600, 2582-2598, 2582-2599, 2582-2600,
2582-2601, 2583-2599, 2583-2600, 2583-2601, 2583-2602, 2584-2600,
2584-2601, 2584-2602, 2584-2603, 2585-2601, 2585-2603, 2585-2604,
2586-2601, 2586-2602, 2586-2604, 2586-2605, 2587-2602, 2587-2603,
2587-2605, 2587-2606, 2588-2603, 2588-2604, 2588-2605, 2588-2606,
2588-2607, 2589-2604, 2589-2605, 2589-2606, 2589-2607, 2589-2608,
2590-2605, 2590-2606, 2590-2607, 2590-2608, 2590-2609, 2590-2609,
2591-2607, 2591-2608, 2591-2609, 2591-2610, 2592-2607, 2592-2608,
2592-2609, 2592-2610, 2592-2611, 2593-2608, 2593-2609, 2593-2610,
2593-2612, 2594-2609, 2594-2610, 2594-2611, 2594-2612, 2594-2613,
2595-2610, 2595-2611, 2595-2612, 2595-2613, 2595-2614, 2596-2611,
2596-2612, 2596-2613, 2596-2614, 2596-2615, 2597-2612, 2597-2612,
2597-2613, 2597-2614, 2597-2615, 2597-2616, 2598-2613, 2598-2614,
2598-2615, 2598-2616, 2598-2617, 2599-2614, 2599-2615, 2599-2616,
2599-2617, 2599-2618, 2600-2615, 2600-2616, 2600-2617, 2600-2618,
2600-2619, 2601-2616, 2601-2617, 2601-2618, 2601-2619, 2601-2620,
2602-2617, 2602-2618, 2602-2619, 2602-2620, 2602-2621, 2603-2618,
2603-2619, 2603-2620, 2603-2621, 2603-2622, 2604-2619, 2604-2620,
2604-2621, 2604-2622, 2604-2623, 2605-2620, 2605-2621, 2605-2622,
2605-2623, 2605-2624, 2606-2621, 2606-2622, 2606-2623, 2606-2624,
2606-2625, 2607-2622, 2607-2623, 2607-2624, 2607-2625, 2607-2626,
2608-2623, 2608-2624, 2608-2625, 2608-2626, 2608-2627, 2609-2624,
2609-2625, 2609-2626, 2609-2627, 2609-2628, 2610-2625, 2610-2626,
2610-2627, 2610-2628, 2610-2629, 2611-2626, 2611-2627, 2611-2628,
2611-2629, 2611-2630, 2612-2627, 2612-2628, 2612-2629, 2612-2630,
2612-2631, 2613-2628, 2613-2629, 2613-2630, 2613-2631, 2614-2629,
2614-2630, 2614-2631, 2615-2630, 2615-2631, or 2616-2631 of SEQ ID
NO: 1, wherein said modified oligonucleotide is at least 85%, at
least 90%, at least 95%, or 100% complementary to SEQ ID NO: 1.
[0115] Certain embodiments provide a compound comprising a modified
oligonucleotide consisting of 10 to 30 linked nucleosides having a
nucleobase sequence comprising a portion of at least 8 contiguous
nucleobases complementary to an equal length portion of nucleobases
30-49, 48-63, 150-169, 151-170, 152-171, 154-169, 154-173, 156-171,
156-175, 157-176, 158-173, 158-177, 480-499, 600-619, 638-657,
644-663, 738-757, 1089-1108, 1135-1154, 1141-1160, 1147-1166,
1150-1169, 1153-1172, 1159-1178, 1162-1181, 1165-1184, 1171-1186,
1171-1190, 1173-1188, 1173-1192, 1175-1190, 1175-1194, 1177-1196,
1183-1202, 1208-1227, 1235-1254, 1298-1317, 1304-1323, 1310-1329,
1316-1335, 1319-1338, 1322-1341, 1328-1347, 1349-1368, 1355-1374,
1393-1412, 1396-1415, 1399-1418, 1405-1424, 1421-1440, 1621-1640,
1646-1665, 1646-1665, 1647-1666, 1689-1708, 1749-1768, 1763-1782,
1912-1931, 2073-2092, 2085-2104, 2166-2185, 2172-2191, 2189-2208,
2191-2210, 2193-2212, 2195-2210, 2195-2214, 2196-2215, 2197-2212,
2197-2216, 2202-2221, 2223-2238, 2223-2242, 2225-2240, 2226-2245,
2227-2242, 2227-2246, 2238-2257, 2241-2260, 2267-2286, 2361-2380,
2388-2407, 2397-2416, 2448-2467, 2453-2472, 2455-2474, 2457-2472,
2457-2476, 2459-2474, 2459-2478, 2461-2476, 2461-2480, 2532-2551,
2550-2569, 2551-2566, 2551-2570, 2552-2568, 2552-2570, 2552-2571,
2553-2568, 2553-2570, 2553-2571, 2553-2572, 2554-2571, 2554-2572,
2554-2573, 2555-2570, 2555-2572, 2555-2574, 2556-2573, 2556-2574,
2556-2575, 2557-2573, 2557-2574, 2557-2575, 2557-2576, 2558-2575,
2558-2576, 2558-2577, 2559-2576, 2559-2577, 2559-2578, 2560-2577,
2560-2578, 2560-2579, 2561-2576, 2561-2578, 2561-2579, 2561-2580,
2562-2577, 2562-2579, 2562-2581, 2563-2578, 2563-2580, 2563-2582,
2564-2581, 2564-2583, 2565-2584, 2566-2583, 2566-2585, 2567-2582,
2567-2584, 2567-2586, 2568-2583, 2568-2585, 2568-2587, 2569-2586,
2569-2588, 2570-2585, 2570-2587, 2570-2589, 2571-2586, 2571-2588,
2571-2590, 2572-2589, 2572-2590, 2572-2591, 2573-2590, 2573-2592,
2574-2590, 2574-2591, 2574-2593, 2575-2590, 2575-2591, 2575-2592,
2575-2594, 2576-2593, 2576-2595, 2577-2594, 2577-2595, 2577-2596,
2578-2594, 2578-2596, 2578-2597, 2579-2598, 2580-2596, 2580-2597,
2580-2598, 2580-2599, 2581-2597, 2581-2598, 2581-2599, 2581-2600,
2582-2598, 2582-2599, 2582-2600, 2582-2601, 2583-2599, 2583-2600,
2583-2601, 2583-2602, 2584-2600, 2584-2601, 2584-2602, 2584-2603,
2585-2601, 2585-2603, 2585-2604, 2586-2601, 2586-2602, 2586-2604,
2586-2605, 2587-2602, 2587-2603, 2587-2605, 2587-2606, 2588-2603,
2588-2604, 2588-2605, 2588-2606, 2588-2607, 2589-2604, 2589-2605,
2589-2606, 2589-2607, 2589-2608, 2590-2605, 2590-2606, 2590-2607,
2590-2608, 2590-2609, 2590-2609, 2591-2607, 2591-2608, 2591-2609,
2591-2610, 2592-2607, 2592-2608, 2592-2609, 2592-2610, 2592-2611,
2593-2608, 2593-2609, 2593-2610, 2593-2612, 2594-2609, 2594-2610,
2594-2611, 2594-2612, 2594-2613, 2595-2610, 2595-2611, 2595-2612,
2595-2613, 2595-2614, 2596-2611, 2596-2612, 2596-2613, 2596-2614,
2596-2615, 2597-2612, 2597-2612, 2597-2613, 2597-2614, 2597-2615,
2597-2616, 2598-2613, 2598-2614, 2598-2615, 2598-2616, 2598-2617,
2599-2614, 2599-2615, 2599-2616, 2599-2617, 2599-2618, 2600-2615,
2600-2616, 2600-2617, 2600-2618, 2600-2619, 2601-2616, 2601-2617,
2601-2618, 2601-2619, 2601-2620, 2602-2617, 2602-2618, 2602-2619,
2602-2620, 2602-2621, 2603-2618, 2603-2619, 2603-2620, 2603-2621,
2603-2622, 2604-2619, 2604-2620, 2604-2621, 2604-2622, 2604-2623,
2605-2620, 2605-2621, 2605-2622, 2605-2623, 2605-2624, 2606-2621,
2606-2622, 2606-2623, 2606-2624, 2606-2625, 2607-2622, 2607-2623,
2607-2624, 2607-2625, 2607-2626, 2608-2623, 2608-2624, 2608-2625,
2608-2626, 2608-2627, 2609-2624, 2609-2625, 2609-2626, 2609-2627,
2609-2628, 2610-2625, 2610-2626, 2610-2627, 2610-2628, 2610-2629,
2611-2626, 2611-2627, 2611-2628, 2611-2629, 2611-2630, 2612-2627,
2612-2628, 2612-2629, 2612-2630, 2612-2631, 2613-2628, 2613-2629,
2613-2630, 2613-2631, 2614-2629, 2614-2630, 2614-2631, 2615-2630,
2615-2631, or 2616-2631 of SEQ ID NO: 1, wherein the nucleobase
sequence of the modified oligonucleotide is at least 85%, at least
90%, at least 95%, or 100% complementary to SEQ ID NO: 1.
[0116] Certain embodiments provide a compound comprising a modified
oligonucleotide consisting of 10 to 30 linked nucleosides
complementary within nucleobases 1608-1627, 1685-1704, 1686-1705,
1751-1770, 1769-1784, 1871-1890, 1872-1891, 1873-1892, 1875-1890,
1875-1894, 1877-1892, 1877-1896, 1878-1897, 1879-1894, 1879-1898,
2288-2307, 2808-2827, 2846-2865, 2852-2871, 2946-2965, 3773-3792,
3819-3838, 3825-3844, 3831-3850, 3834-3853, 3837-3856, 3843-3862,
4151-4166, 4151-4170, 4153-4172, 4159-4178, 4184-4203, 4211-4230,
4609-4628, 4612-4631, 4615-4634, 4621-4640, 4642-4661, 4648-4667,
4686-4705, 4689-4708, 4692-4711, 4698-4717, 4714-4733, 5270-5289,
5295-5314, 5296-5315, 5830-5849, 5890-5909, 5904-5923, 6406-6425,
6662-6681, 6674-6693, 6954-6973, 6960-6979, 6977-6996, 6979-6998,
6981-7000, 6983-6998, 6983-7002, 6984-7003, 6985-7000, 6985-7004,
6990-7009, 7122-7141, 7125-7144, 7151-7170, 7353-7372, 7362-7381,
7683-7702, 7688-7707, 7690-7709, 7692-7707, 7692-7711, 7694-7709,
7694-7713, 7696-7711, 7696-7715, 7767-7786, 7785-7804, 7786-7801,
7787-7803, 7787-7805, 7787-7806, 7788-7803, 7788-7805, 7788-7806,
7788-7807, 7789-7806, 7789-7807, 7789-7808, 7790-7805, 7790-7807,
7790-7809, 7791-7808, 7791-7809, 7791-7810, 7792-7808, 7792-7809,
7792-7810, 7792-7811, 7793-7810, 7793-7811, 7793-7812, 7794-7811,
7794-7812, 7794-7813, 7795-7812, 7795-7813, 7795-7814, 7796-7811,
7796-7813, 7796-7814, 7796-7815, 7797-7812, 7797-7814, 7797-7816,
7798-7813, 7798-7815, 7798-7817, 7799-7816, 7799-7818, 7800-7819,
7801-7818, 7801-7820, 7802-7817, 7802-7819, 7802-7821, 7803-7818,
7803-7820, 7803-7822, 7804-7821, 7804-7823, 7805-7820, 7805-7822,
7805-7824, 7806-7821, 7806-7823, 7806-7825, 7807-7824, 7807-7825,
7807-7826, 7808-7825, 7808-7827, 7809-7825, 7809-7826, 7809-7828,
7810-7825, 7810-7826, 7810-7827, 7810-7829, 7811-7828, 7811-7830,
7812-7829, 7812-7830, 7812-7831, 7813-7829, 7813-7831, 7813-7832,
7814-7833, 7815-7831, 7815-7832, 7815-7833, 7815-7834, 7816-7832,
7816-7833, 7816-7834, 7816-7835, 7817-7833, 7817-7834, 7817-7835,
7817-7836, 7818-7834, 7818-7835, 7818-7836, 7818-7837, 7819-7835,
7819-7836, 7819-7837, 7819-7838, 7820-7836, 7820-7838, 7820-7839,
7821-7836, 7821-7837, 7821-7839, 7821-7840, 7822-7837, 7822-7838,
7822-7840, 7822-7841, 7823-7838, 7823-7839, 7823-7839, 7823-7840,
7823-7841, 7823-7842, 7824-7839, 7824-7840, 7824-7840, 7824-7841,
7824-7842, 7824-7843, 7825-7840, 7825-7841, 7825-7842, 7825-7843,
7825-7844, 7826-7842, 7826-7843, 7826-7844, 7826-7845, 7827-7842,
7827-7843, 7827-7844, 7827-7845, 7827-7846, 7828-7843, 7828-7844,
7828-7845, 7828-7847, 7829-7844, 7829-7845, 7829-7846, 7829-7847,
7829-7848, 7830-7845, 7830-7846, 7830-7847, 7830-7848, 7830-7849,
7831-7846, 7831-7847, 7831-7848, 7831-7849, 7831-7850, 7832-7847,
7832-7848, 7832-7849, 7832-7850, 7832-7851, 7833-7848, 7833-7849,
7833-7850, 7833-7851, 7833-7852, 7834-7849, 7834-7850, 7834-7851,
7834-7852, 7834-7853, 7835-7850, 7835-7851, 7835-7852, 7835-7853,
7835-7854, 7836-7851, 7836-7852, 7836-7853, 7836-7854, 7836-7855,
7837-7852, 7837-7853, 7837-7854, 7837-7855, 7837-7856, 7838-7853,
7838-7854, 7838-7855, 7838-7856, 7838-7857, 7839-7854, 7839-7855,
7839-7856, 7839-7857, 7839-7858, 7840-7855, 7840-7856, 7840-7857,
7840-7858, 7840-7859, 7841-7856, 7841-7857, 7841-7858, 7841-7859,
7841-7860, 7842-7857, 7842-7858, 7842-7859, 7842-7860, 7842-7861,
7843-7858, 7843-7859, 7843-7860, 7843-7861, 7843-7862, 7844-7859,
7844-7860, 7844-7861, 7844-7862, 7845-7860, 7845-7861, 7845-7862,
7846-7861, or 7846-7862 of SEQ ID NO: 2, wherein said modified
oligonucleotide is at least 85%, at least 90%, at least 95%, or
100% complementary to SEQ ID NO: 2.
[0117] Certain embodiments provide a compound comprising a modified
oligonucleotide consisting of 10 to 30 linked nucleosides having a
nucleobase sequence comprising a portion of at least 8 contiguous
nucleobases complementary to an equal length portion of nucleobases
1608-1627, 1685-1704, 1686-1705, 1751-1770, 1769-1784, 1871-1890,
1872-1891, 1873-1892, 1875-1890, 1875-1894, 1877-1892, 1877-1896,
1878-1897, 1879-1894, 1879-1898, 2288-2307, 2808-2827, 2846-2865,
2852-2871, 2946-2965, 3773-3792, 3819-3838, 3825-3844, 3831-3850,
3834-3853, 3837-3856, 3843-3862, 4151-4166, 4151-4170, 4153-4172,
4159-4178, 4184-4203, 4211-4230, 4609-4628, 4612-4631, 4615-4634,
4621-4640, 4642-4661, 4648-4667, 4686-4705, 4689-4708, 4692-4711,
4698-4717, 4714-4733, 5270-5289, 5295-5314, 5296-5315, 5830-5849,
5890-5909, 5904-5923, 6406-6425, 6662-6681, 6674-6693, 6954-6973,
6960-6979, 6977-6996, 6979-6998, 6981-7000, 6983-6998, 6983-7002,
6984-7003, 6985-7000, 6985-7004, 6990-7009, 7122-7141, 7125-7144,
7151-7170, 7353-7372, 7362-7381, 7683-7702, 7688-7707, 7690-7709,
7692-7707, 7692-7711, 7694-7709, 7694-7713, 7696-7711, 7696-7715,
7767-7786, 7785-7804, 7786-7801, 7787-7803, 7787-7805, 7787-7806,
7788-7803, 7788-7805, 7788-7806, 7788-7807, 7789-7806, 7789-7807,
7789-7808, 7790-7805, 7790-7807, 7790-7809, 7791-7808, 7791-7809,
7791-7810, 7792-7808, 7792-7809, 7792-7810, 7792-7811, 7793-7810,
7793-7811, 7793-7812, 7794-7811, 7794-7812, 7794-7813, 7795-7812,
7795-7813, 7795-7814, 7796-7811, 7796-7813, 7796-7814, 7796-7815,
7797-7812, 7797-7814, 7797-7816, 7798-7813, 7798-7815, 7798-7817,
7799-7816, 7799-7818, 7800-7819, 7801-7818, 7801-7820, 7802-7817,
7802-7819, 7802-7821, 7803-7818, 7803-7820, 7803-7822, 7804-7821,
7804-7823, 7805-7820, 7805-7822, 7805-7824, 7806-7821, 7806-7823,
7806-7825, 7807-7824, 7807-7825, 7807-7826, 7808-7825, 7808-7827,
7809-7825, 7809-7826, 7809-7828, 7810-7825, 7810-7826, 7810-7827,
7810-7829, 7811-7828, 7811-7830, 7812-7829, 7812-7830, 7812-7831,
7813-7829, 7813-7831, 7813-7832, 7814-7833, 7815-7831, 7815-7832,
7815-7833, 7815-7834, 7816-7832, 7816-7833, 7816-7834, 7816-7835,
7817-7833, 7817-7834, 7817-7835, 7817-7836, 7818-7834, 7818-7835,
7818-7836, 7818-7837, 7819-7835, 7819-7836, 7819-7837, 7819-7838,
7820-7836, 7820-7838, 7820-7839, 7821-7836, 7821-7837, 7821-7839,
7821-7840, 7822-7837, 7822-7838, 7822-7840, 7822-7841, 7823-7838,
7823-7839, 7823-7839, 7823-7840, 7823-7841, 7823-7842, 7824-7839,
7824-7840, 7824-7840, 7824-7841, 7824-7842, 7824-7843, 7825-7840,
7825-7841, 7825-7842, 7825-7843, 7825-7844, 7826-7842, 7826-7843,
7826-7844, 7826-7845, 7827-7842, 7827-7843, 7827-7844, 7827-7845,
7827-7846, 7828-7843, 7828-7844, 7828-7845, 7828-7847, 7829-7844,
7829-7845, 7829-7846, 7829-7847, 7829-7848, 7830-7845, 7830-7846,
7830-7847, 7830-7848, 7830-7849, 7831-7846, 7831-7847, 7831-7848,
7831-7849, 7831-7850, 7832-7847, 7832-7848, 7832-7849, 7832-7850,
7832-7851, 7833-7848, 7833-7849, 7833-7850, 7833-7851, 7833-7852,
7834-7849, 7834-7850, 7834-7851, 7834-7852, 7834-7853, 7835-7850,
7835-7851, 7835-7852, 7835-7853, 7835-7854, 7836-7851, 7836-7852,
7836-7853, 7836-7854, 7836-7855, 7837-7852, 7837-7853, 7837-7854,
7837-7855, 7837-7856, 7838-7853, 7838-7854, 7838-7855, 7838-7856,
7838-7857, 7839-7854, 7839-7855, 7839-7856, 7839-7857, 7839-7858,
7840-7855, 7840-7856, 7840-7857, 7840-7858, 7840-7859, 7841-7856,
7841-7857, 7841-7858, 7841-7859, 7841-7860, 7842-7857, 7842-7858,
7842-7859, 7842-7860, 7842-7861, 7843-7858, 7843-7859, 7843-7860,
7843-7861, 7843-7862, 7844-7859, 7844-7860, 7844-7861, 7844-7862,
7845-7860, 7845-7861, 7845-7862, 7846-7861, and 7846-7862 of SEQ ID
NO: 2, wherein the nucleobase sequence of the modified
oligonucleotide is at least 85%, at least 90%, at least 95%, or
100% complementary to SEQ ID NO: 2.
[0118] In certain embodiments, antisense compounds or
oligonucleotides target a region of a CFB nucleic acid. In certain
embodiments, such compounds or oligonucleotides targeted to a
region of a CFB nucleic acid have a contiguous nucleobase portion
that is complementary to an equal length nucleobase portion of the
region.
[0119] For example, the portion can be at least an 8, 9, 10, 11,
12, 13, 14, 15, or 16 contiguous nucleobase portion complementary
to an equal length portion of a region recited herein. In certain
embodiments, such compounds or oligonucleotide target the following
nucleotide regions of SEQ ID NO: 1: 30-49, 48-63, 150-169, 151-170,
152-171, 154-169, 154-173, 156-171, 156-175, 157-176, 158-173,
158-177, 480-499, 600-619, 638-657, 644-663, 738-757, 1089-1108,
1135-1154, 1141-1160, 1147-1166, 1150-1169, 1153-1172, 1159-1178,
1162-1181, 1165-1184, 1171-1186, 1171-1190, 1173-1188, 1173-1192,
1175-1190, 1175-1194, 1177-1196, 1183-1202, 1208-1227, 1235-1254,
1298-1317, 1304-1323, 1310-1329, 1316-1335, 1319-1338, 1322-1341,
1328-1347, 1349-1368, 1355-1374, 1393-1412, 1396-1415, 1399-1418,
1405-1424, 1421-1440, 1621-1640, 1646-1665, 1646-1665, 1647-1666,
1689-1708, 1749-1768, 1763-1782, 1912-1931, 2073-2092, 2085-2104,
2166-2185, 2172-2191, 2189-2208, 2191-2210, 2193-2212, 2195-2210,
2195-2214, 2196-2215, 2197-2212, 2197-2216, 2202-2221, 2223-2238,
2223-2242, 2225-2240, 2226-2245, 2227-2242, 2227-2246, 2238-2257,
2241-2260, 2267-2286, 2361-2380, 2388-2407, 2397-2416, 2448-2467,
2453-2472, 2455-2474, 2457-2472, 2457-2476, 2459-2474, 2459-2478,
2461-2476, 2461-2480, 2532-2551, 2550-2569, 2551-2566, 2551-2570,
2552-2568, 2552-2570, 2552-2571, 2553-2568, 2553-2570, 2553-2571,
2553-2572, 2554-2571, 2554-2572, 2554-2573, 2555-2570, 2555-2572,
2555-2574, 2556-2573, 2556-2574, 2556-2575, 2557-2573, 2557-2574,
2557-2575, 2557-2576, 2558-2575, 2558-2576, 2558-2577, 2559-2576,
2559-2577, 2559-2578, 2560-2577, 2560-2578, 2560-2579, 2561-2576,
2561-2578, 2561-2579, 2561-2580, 2562-2577, 2562-2579, 2562-2581,
2563-2578, 2563-2580, 2563-2582, 2564-2581, 2564-2583, 2565-2584,
2566-2583, 2566-2585, 2567-2582, 2567-2584, 2567-2586, 2568-2583,
2568-2585, 2568-2587, 2569-2586, 2569-2588, 2570-2585, 2570-2587,
2570-2589, 2571-2586, 2571-2588, 2571-2590, 2572-2589, 2572-2590,
2572-2591, 2573-2590, 2573-2592, 2574-2590, 2574-2591, 2574-2593,
2575-2590, 2575-2591, 2575-2592, 2575-2594, 2576-2593, 2576-2595,
2577-2594, 2577-2595, 2577-2596, 2578-2594, 2578-2596, 2578-2597,
2579-2598, 2580-2596, 2580-2597, 2580-2598, 2580-2599, 2581-2597,
2581-2598, 2581-2599, 2581-2600, 2582-2598, 2582-2599, 2582-2600,
2582-2601, 2583-2599, 2583-2600, 2583-2601, 2583-2602, 2584-2600,
2584-2601, 2584-2602, 2584-2603, 2585-2601, 2585-2603, 2585-2604,
2586-2601, 2586-2602, 2586-2604, 2586-2605, 2587-2602, 2587-2603,
2587-2605, 2587-2606, 2588-2603, 2588-2604, 2588-2605, 2588-2606,
2588-2607, 2589-2604, 2589-2605, 2589-2606, 2589-2607, 2589-2608,
2590-2605, 2590-2606, 2590-2607, 2590-2608, 2590-2609, 2590-2609,
2591-2607, 2591-2608, 2591-2609, 2591-2610, 2592-2607, 2592-2608,
2592-2609, 2592-2610, 2592-2611, 2593-2608, 2593-2609, 2593-2610,
2593-2612, 2594-2609, 2594-2610, 2594-2611, 2594-2612, 2594-2613,
2595-2610, 2595-2611, 2595-2612, 2595-2613, 2595-2614, 2596-2611,
2596-2612, 2596-2613, 2596-2614, 2596-2615, 2597-2612, 2597-2612,
2597-2613, 2597-2614, 2597-2615, 2597-2616, 2598-2613, 2598-2614,
2598-2615, 2598-2616, 2598-2617, 2599-2614, 2599-2615, 2599-2616,
2599-2617, 2599-2618, 2600-2615, 2600-2616, 2600-2617, 2600-2618,
2600-2619, 2601-2616, 2601-2617, 2601-2618, 2601-2619, 2601-2620,
2602-2617, 2602-2618, 2602-2619, 2602-2620, 2602-2621, 2603-2618,
2603-2619, 2603-2620, 2603-2621, 2603-2622, 2604-2619, 2604-2620,
2604-2621, 2604-2622, 2604-2623, 2605-2620, 2605-2621, 2605-2622,
2605-2623, 2605-2624, 2606-2621, 2606-2622, 2606-2623, 2606-2624,
2606-2625, 2607-2622, 2607-2623, 2607-2624, 2607-2625, 2607-2626,
2608-2623, 2608-2624, 2608-2625, 2608-2626, 2608-2627, 2609-2624,
2609-2625, 2609-2626, 2609-2627, 2609-2628, 2610-2625, 2610-2626,
2610-2627, 2610-2628, 2610-2629, 2611-2626, 2611-2627, 2611-2628,
2611-2629, 2611-2630, 2612-2627, 2612-2628, 2612-2629, 2612-2630,
2612-2631, 2613-2628, 2613-2629, 2613-2630, 2613-2631, 2614-2629,
2614-2630, 2614-2631, 2615-2630, 2615-2631, and 2616-2631.
[0120] In certain embodiments, antisense compounds or
oligonucleotides target a region of a CFB nucleic acid. In certain
embodiments, such compounds or oligonucleotides targeted to a
region of a CFB nucleic acid have a contiguous nucleobase portion
that is complementary to an equal length nucleobase portion of the
region.
[0121] For example, the portion can be at least an 8, 9, 10, 11,
12, 13, 14, 15, or 16 contiguous nucleobase portion complementary
to an equal length portion of a region recited herein. In certain
embodiments, such compounds or oligonucleotide target the following
nucleotide regions of SEQ ID NO: 2: 1608-1627, 1685-1704,
1686-1705, 1751-1770, 1769-1784, 1871-1890, 1872-1891, 1873-1892,
1875-1890, 1875-1894, 1877-1892, 1877-1896, 1878-1897, 1879-1894,
1879-1898, 2288-2307, 2808-2827, 2846-2865, 2852-2871, 2946-2965,
3773-3792, 3819-3838, 3825-3844, 3831-3850, 3834-3853, 3837-3856,
3843-3862, 4151-4166, 4151-4170, 4153-4172, 4159-4178, 4184-4203,
4211-4230, 4609-4628, 4612-4631, 4615-4634, 4621-4640, 4642-4661,
4648-4667, 4686-4705, 4689-4708, 4692-4711, 4698-4717, 4714-4733,
5270-5289, 5295-5314, 5296-5315, 5830-5849, 5890-5909, 5904-5923,
6406-6425, 6662-6681, 6674-6693, 6954-6973, 6960-6979, 6977-6996,
6979-6998, 6981-7000, 6983-6998, 6983-7002, 6984-7003, 6985-7000,
6985-7004, 6990-7009, 7122-7141, 7125-7144, 7151-7170, 7353-7372,
7362-7381, 7683-7702, 7688-7707, 7690-7709, 7692-7707, 7692-7711,
7694-7709, 7694-7713, 7696-7711, 7696-7715, 7767-7786, 7785-7804,
7786-7801, 7787-7803, 7787-7805, 7787-7806, 7788-7803, 7788-7805,
7788-7806, 7788-7807, 7789-7806, 7789-7807, 7789-7808, 7790-7805,
7790-7807, 7790-7809, 7791-7808, 7791-7809, 7791-7810, 7792-7808,
7792-7809, 7792-7810, 7792-7811, 7793-7810, 7793-7811, 7793-7812,
7794-7811, 7794-7812, 7794-7813, 7795-7812, 7795-7813, 7795-7814,
7796-7811, 7796-7813, 7796-7814, 7796-7815, 7797-7812, 7797-7814,
7797-7816, 7798-7813, 7798-7815, 7798-7817, 7799-7816, 7799-7818,
7800-7819, 7801-7818, 7801-7820, 7802-7817, 7802-7819, 7802-7821,
7803-7818, 7803-7820, 7803-7822, 7804-7821, 7804-7823, 7805-7820,
7805-7822, 7805-7824, 7806-7821, 7806-7823, 7806-7825, 7807-7824,
7807-7825, 7807-7826, 7808-7825, 7808-7827, 7809-7825, 7809-7826,
7809-7828, 7810-7825, 7810-7826, 7810-7827, 7810-7829, 7811-7828,
7811-7830, 7812-7829, 7812-7830, 7812-7831, 7813-7829, 7813-7831,
7813-7832, 7814-7833, 7815-7831, 7815-7832, 7815-7833, 7815-7834,
7816-7832, 7816-7833, 7816-7834, 7816-7835, 7817-7833, 7817-7834,
7817-7835, 7817-7836, 7818-7834, 7818-7835, 7818-7836, 7818-7837,
7819-7835, 7819-7836, 7819-7837, 7819-7838, 7820-7836, 7820-7838,
7820-7839, 7821-7836, 7821-7837, 7821-7839, 7821-7840, 7822-7837,
7822-7838, 7822-7840, 7822-7841, 7823-7838, 7823-7839, 7823-7839,
7823-7840, 7823-7841, 7823-7842, 7824-7839, 7824-7840, 7824-7840,
7824-7841, 7824-7842, 7824-7843, 7825-7840, 7825-7841, 7825-7842,
7825-7843, 7825-7844, 7826-7842, 7826-7843, 7826-7844, 7826-7845,
7827-7842, 7827-7843, 7827-7844, 7827-7845, 7827-7846, 7828-7843,
7828-7844, 7828-7845, 7828-7847, 7829-7844, 7829-7845, 7829-7846,
7829-7847, 7829-7848, 7830-7845, 7830-7846, 7830-7847, 7830-7848,
7830-7849, 7831-7846, 7831-7847, 7831-7848, 7831-7849, 7831-7850,
7832-7847, 7832-7848, 7832-7849, 7832-7850, 7832-7851, 7833-7848,
7833-7849, 7833-7850, 7833-7851, 7833-7852, 7834-7849, 7834-7850,
7834-7851, 7834-7852, 7834-7853, 7835-7850, 7835-7851, 7835-7852,
7835-7853, 7835-7854, 7836-7851, 7836-7852, 7836-7853, 7836-7854,
7836-7855, 7837-7852, 7837-7853, 7837-7854, 7837-7855, 7837-7856,
7838-7853, 7838-7854, 7838-7855, 7838-7856, 7838-7857, 7839-7854,
7839-7855, 7839-7856, 7839-7857, 7839-7858, 7840-7855, 7840-7856,
7840-7857, 7840-7858, 7840-7859, 7841-7856, 7841-7857, 7841-7858,
7841-7859, 7841-7860, 7842-7857, 7842-7858, 7842-7859, 7842-7860,
7842-7861, 7843-7858, 7843-7859, 7843-7860, 7843-7861, 7843-7862,
7844-7859, 7844-7860, 7844-7861, 7844-7862, 7845-7860, 7845-7861,
7845-7862, 7846-7861, and 7846-7862.
[0122] In certain embodiments, antisense compounds or
oligonucleotides target the 3'UTR of a CFB nucleic acid. In certain
embodiments, antisense compounds or oligonucleotides target within
nucleotides 2574-2626 of a CFB nucleic acid having the nucleobase
sequence of SEQ ID NO: 1. In certain embodiments, antisense
compounds or oligonucleotides have at least an 8, 9, 10, 11, 12,
13, 14, 15, or 16 contiguous nucleobase portion complementary to an
equal length portion within nucleotides 2574-2626 of a CFB nucleic
acid having the nucleobase sequence of SEQ ID NO: 1.
In certain embodiments, antisense compounds or oligonucleotides
target a region of a CFB nucleic acid having the nucleobase
sequence of SEQ ID NO: 1 within nucleobases 2457-2631, 2457-2472,
2457-2474, 2457-2476, 2457-2566, 2457-2570, 2457-2571, 2457-2572,
2457-2573, 2457-2574, 2457-2575, 2457-2576, 2457-2577, 2457-2578,
2457-2579, 2457-2580, 2457-2581, 2457-2582, 2457-2583, 2457-2584,
2457-2585, 2457-2586, 2457-2587, 2457-2588, 2457-2589, 2457-2590,
2457-2591, 2457-2592, 2457-2593, 2457-2594, 2457-2595, 2457-2596,
2457-2597, 2457-2598, 2457-2599, 2457-2600, 2457-2601, 2457-2602,
2457-2603, 2457-2604, 2457-2605, 2457-2606, 2457-2607, 2457-2608,
2457-2609, 2457-2610, 2457-2611, 2457-2612, 2457-2613, 2457-2614,
2457-2615, 2457-2616, 2457-2617, 2457-2618, 2457-2619, 2457-2620,
2457-2621, 2457-2622, 2457-2623, 2457-2624, 2457-2625, 2457-2626,
2457-2627, 2457-2628, 2457-2629, 2457-2630, 2457-2631, 2459-2474,
2459-2476, 2459-2566, 2459-2570, 2459-2571, 2459-2572, 2459-2573,
2459-2574, 2459-2575, 2459-2576, 2459-2577, 2459-2578, 2459-2579,
2459-2580, 2459-2581, 2459-2582, 2459-2583, 2459-2584, 2459-2585,
2459-2586, 2459-2587, 2459-2588, 2459-2589, 2459-2590, 2459-2591,
2459-2592, 2459-2593, 2459-2594, 2459-2595, 2459-2596, 2459-2597,
2459-2598, 2459-2599, 2459-2600, 2459-2601, 2459-2602, 2459-2603,
2459-2604, 2459-2605, 2459-2606, 2459-2607, 2459-2608, 2459-2609,
2459-2610, 2459-2611, 2459-2612, 2459-2613, 2459-2614, 2459-2615,
2459-2616, 2459-2617, 2459-2618, 2459-2619, 2459-2620, 2459-2621,
2459-2622, 2459-2623, 2459-2624, 2459-2625, 2459-2626, 2459-2627,
2459-2628, 2459-2629, 2459-2630, 2459-2631, 2461-2476, 2461-2566,
2461-2570, 2461-2571, 2461-2572, 2461-2573, 2461-2574, 2461-2575,
2461-2576, 2461-2577, 2461-2578, 2461-2579, 2461-2580, 2461-2581,
2461-2582, 2461-2583, 2461-2584, 2461-2585, 2461-2586, 2461-2587,
2461-2588, 2461-2589, 2461-2590, 2461-2591, 2461-2592, 2461-2593,
2461-2594, 2461-2595, 2461-2596, 2461-2597, 2461-2598, 2461-2599,
2461-2600, 2461-2601, 2461-2602, 2461-2603, 2461-2604, 2461-2605,
2461-2606, 2461-2607, 2461-2608, 2461-2609, 2461-2610, 2461-2611,
2461-2612, 2461-2613, 2461-2614, 2461-2615, 2461-2616, 2461-2617,
2461-2618, 2461-2619, 2461-2620, 2461-2621, 2461-2622, 2461-2623,
2461-2624, 2461-2625, 2461-2626, 2461-2627, 2461-2628, 2461-2629,
2461-2630, 2461-2631, 2551-2566, 2551-2570, 2551-2571, 2551-2572,
2551-2573, 2551-2574, 2551-2575, 2551-2576, 2551-2577, 2551-2578,
2551-2579, 2551-2580, 2551-2581, 2551-2582, 2551-2583, 2551-2584,
2551-2585, 2551-2586, 2551-2587, 2551-2588, 2551-2589, 2551-2590,
2551-2591, 2551-2592, 2551-2593, 2551-2594, 2551-2595, 2551-2596,
2551-2597, 2551-2598, 2551-2599, 2551-2600, 2551-2601, 2551-2602,
2551-2603, 2551-2604, 2551-2605, 2551-2606, 2551-2607, 2551-2608,
2551-2609, 2551-2610, 2551-2611, 2551-2612, 2551-2613, 2551-2614,
2551-2615, 2551-2616, 2551-2617, 2551-2618, 2551-2619, 2551-2620,
2551-2621, 2551-2622, 2551-2623, 2551-2624, 2551-2625, 2551-2626,
2551-2627, 2551-2628, 2551-2629, 2551-2630, 2551-2631, 2553-2570,
2553-2571, 2553-2572, 2553-2573, 2553-2574, 2553-2575, 2553-2576,
2553-2577, 2553-2578, 2553-2579, 2553-2580, 2553-2581, 2553-2582,
2553-2583, 2553-2584, 2553-2585, 2553-2586, 2553-2587, 2553-2588,
2553-2589, 2553-2590, 2553-2591, 2553-2592, 2553-2593, 2553-2594,
2553-2595, 2553-2596, 2553-2597, 2553-2598, 2553-2599, 2553-2600,
2553-2601, 2553-2602, 2553-2603, 2553-2604, 2553-2605, 2553-2606,
2553-2607, 2553-2608, 2553-2609, 2553-2610, 2553-2611, 2553-2612,
2553-2613, 2553-2614, 2553-2615, 2553-2616, 2553-2617, 2553-2618,
2553-2619, 2553-2620, 2553-2621, 2553-2622, 2553-2623, 2553-2624,
2553-2625, 2553-2626, 2553-2627, 2553-2628, 2553-2629, 2553-2630,
2553-2631, 2554-2573, 2554-2574, 2554-2575, 2554-2576, 2554-2577,
2554-2578, 2554-2579, 2554-2580, 2554-2581, 2554-2582, 2554-2583,
2554-2584, 2554-2585, 2554-2586, 2554-2587, 2554-2588, 2554-2589,
2554-2590, 2554-2591, 2554-2592, 2554-2593, 2554-2594, 2554-2595,
2554-2596, 2554-2597, 2554-2598, 2554-2599, 2554-2600, 2554-2601,
2554-2602, 2554-2603, 2554-2604, 2554-2605, 2554-2606, 2554-2607,
2554-2608, 2554-2609, 2554-2610, 2554-2611, 2554-2612, 2554-2613,
2554-2614, 2554-2615, 2554-2616, 2554-2617, 2554-2618, 2554-2619,
2554-2620, 2554-2621, 2554-2622, 2554-2623, 2554-2624, 2554-2625,
2554-2626, 2554-2627, 2554-2628, 2554-2629, 2554-2630, 2554-2631,
2555-2572, 2555-2573, 2555-2574, 2555-2575, 2555-2576, 2555-2577,
2555-2578, 2555-2579, 2555-2580, 2555-2581, 2555-2582, 2555-2583,
2555-2584, 2555-2585, 2555-2586, 2555-2587, 2555-2588, 2555-2589,
2555-2590, 2555-2591, 2555-2592, 2555-2593, 2555-2594, 2555-2595,
2555-2596, 2555-2597, 2555-2598, 2555-2599, 2555-2600, 2555-2601,
2555-2602, 2555-2603, 2555-2604, 2555-2605, 2555-2606, 2555-2607,
2555-2608, 2555-2609, 2555-2610, 2555-2611, 2555-2612, 2555-2613,
2555-2614, 2555-2615, 2555-2616, 2555-2617, 2555-2618, 2555-2619,
2555-2620, 2555-2621, 2555-2622, 2555-2623, 2555-2624, 2555-2625,
2555-2626, 2555-2627, 2555-2628, 2555-2629, 2555-2630, 2555-2631,
2556-2573, 2556-2574, 2556-2575, 2556-2576, 2556-2577, 2556-2578,
2556-2579, 2556-2580, 2556-2581, 2556-2582, 2556-2583, 2556-2584,
2556-2585, 2556-2586, 2556-2587, 2556-2588, 2556-2589, 2556-2590,
2556-2591, 2556-2592, 2556-2593, 2556-2594, 2556-2595, 2556-2596,
2556-2597, 2556-2598, 2556-2599, 2556-2600, 2556-2601, 2556-2602,
2556-2603, 2556-2604, 2556-2605, 2556-2606, 2556-2607, 2556-2608,
2556-2609, 2556-2610, 2556-2611, 2556-2612, 2556-2613, 2556-2614,
2556-2615, 2556-2616, 2556-2617, 2556-2618, 2556-2619, 2556-2620,
2556-2621, 2556-2622, 2556-2623, 2556-2624, 2556-2625, 2556-2626,
2556-2627, 2556-2628, 2556-2629, 2556-2630, 2556-2631, 2557-2574,
2557-2575, 2557-2576, 2557-2577, 2557-2578, 2557-2579, 2557-2580,
2557-2581, 2557-2582, 2557-2583, 2557-2584, 2557-2585, 2557-2586,
2557-2587, 2557-2588, 2557-2589, 2557-2590, 2557-2591, 2557-2592,
2557-2593, 2557-2594, 2557-2595, 2557-2596, 2557-2597, 2557-2598,
2557-2599, 2557-2600, 2557-2601, 2557-2602, 2557-2603, 2557-2604,
2557-2605, 2557-2606, 2557-2607, 2557-2608, 2557-2609, 2557-2610,
2557-2611, 2557-2612, 2557-2613, 2557-2614, 2557-2615, 2557-2616,
2557-2617, 2557-2618, 2557-2619, 2557-2620, 2557-2621, 2557-2622,
2557-2623, 2557-2624, 2557-2625, 2557-2626, 2557-2627, 2557-2628,
2557-2629, 2557-2630, 2557-2631, 2558-2575, 2558-2576, 2558-2577,
2558-2578, 2558-2579, 2558-2580, 2558-2581, 2558-2582, 2558-2583,
2558-2584, 2558-2585, 2558-2586, 2558-2587, 2558-2588, 2558-2589,
2558-2590, 2558-2591, 2558-2592, 2558-2593, 2558-2594, 2558-2595,
2558-2596, 2558-2597, 2558-2598, 2558-2599, 2558-2600, 2558-2601,
2558-2602, 2558-2603, 2558-2604, 2558-2605, 2558-2606, 2558-2607,
2558-2608, 2558-2609, 2558-2610, 2558-2611, 2558-2612, 2558-2613,
2558-2614, 2558-2615, 2558-2616, 2558-2617, 2558-2618, 2558-2619,
2558-2620, 2558-2621, 2558-2622, 2558-2623, 2558-2624, 2558-2625,
2558-2626, 2558-2627, 2558-2628, 2558-2629, 2558-2630, 2558-2631,
2559-2576, 2559-2577, 2559-2578, 2559-2579, 2559-2580, 2559-2581,
2559-2582, 2559-2583, 2559-2584, 2559-2585, 2559-2586, 2559-2587,
2559-2588, 2559-2589, 2559-2590, 2559-2591, 2559-2592, 2559-2593,
2559-2594, 2559-2595, 2559-2596, 2559-2597, 2559-2598, 2559-2599,
2559-2600, 2559-2601, 2559-2602, 2559-2603, 2559-2604, 2559-2605,
2559-2606, 2559-2607, 2559-2608, 2559-2609, 2559-2610, 2559-2611,
2559-2612, 2559-2613, 2559-2614, 2559-2615, 2559-2616, 2559-2617,
2559-2618, 2559-2619, 2559-2620, 2559-2621, 2559-2622, 2559-2623,
2559-2624, 2559-2625, 2559-2626, 2559-2627, 2559-2628, 2559-2629,
2559-2630, 2559-2631, 2560-2577, 2560-2578, 2560-2579, 2560-2580,
2560-2581, 2560-2582, 2560-2583, 2560-2584, 2560-2585, 2560-2586,
2560-2587, 2560-2588, 2560-2589, 2560-2590, 2560-2591, 2560-2592,
2560-2593, 2560-2594, 2560-2595, 2560-2596, 2560-2597, 2560-2598,
2560-2599, 2560-2600, 2560-2601, 2560-2602, 2560-2603, 2560-2604,
2560-2605, 2560-2606, 2560-2607, 2560-2608, 2560-2609, 2560-2610,
2560-2611, 2560-2612, 2560-2613, 2560-2614, 2560-2615, 2560-2616,
2560-2617, 2560-2618, 2560-2619, 2560-2620, 2560-2621, 2560-2622,
2560-2623, 2560-2624, 2560-2625, 2560-2626, 2560-2627, 2560-2628,
2560-2629, 2560-2630, 2560-2631, 2561-2578, 2561-2579, 2561-2580,
2561-2581, 2561-2582, 2561-2583, 2561-2584, 2561-2585, 2561-2586,
2561-2587, 2561-2588, 2561-2589, 2561-2590, 2561-2591, 2561-2592,
2561-2593, 2561-2594, 2561-2595, 2561-2596, 2561-2597, 2561-2598,
2561-2599, 2561-2600, 2561-2601, 2561-2602, 2561-2603, 2561-2604,
2561-2605, 2561-2606, 2561-2607, 2561-2608, 2561-2609, 2561-2610,
2561-2611, 2561-2612, 2561-2613, 2561-2614, 2561-2615, 2561-2616,
2561-2617, 2561-2618, 2561-2619, 2561-2620, 2561-2621, 2561-2622,
2561-2623, 2561-2624, 2561-2625, 2561-2626, 2561-2627, 2561-2628,
2561-2629, 2561-2630, 2561-2631, 2562-2577, 2562-2578, 2562-2579,
2562-2580, 2562-2581, 2562-2582, 2562-2583, 2562-2584, 2562-2585,
2562-2586, 2562-2587, 2562-2588, 2562-2589, 2562-2590, 2562-2591,
2562-2592, 2562-2593, 2562-2594, 2562-2595, 2562-2596, 2562-2597,
2562-2598, 2562-2599, 2562-2600, 2562-2601, 2562-2602, 2562-2603,
2562-2604, 2562-2605, 2562-2606, 2562-2607, 2562-2608, 2562-2609,
2562-2610, 2562-2611, 2562-2612, 2562-2613, 2562-2614, 2562-2615,
2562-2616, 2562-2617, 2562-2618, 2562-2619, 2562-2620, 2562-2621,
2562-2622, 2562-2623, 2562-2624, 2562-2625, 2562-2626, 2562-2627,
2562-2628, 2562-2629, 2562-2630, 2562-2631, 2563-2580, 2563-2581,
2563-2582, 2563-2583, 2563-2584, 2563-2585, 2563-2586, 2563-2587,
2563-2588, 2563-2589, 2563-2590, 2563-2591, 2563-2592, 2563-2593,
2563-2594, 2563-2595, 2563-2596, 2563-2597, 2563-2598, 2563-2599,
2563-2600, 2563-2601, 2563-2602, 2563-2603, 2563-2604, 2563-2605,
2563-2606, 2563-2607, 2563-2608, 2563-2609, 2563-2610, 2563-2611,
2563-2612, 2563-2613, 2563-2614, 2563-2615, 2563-2616, 2563-2617,
2563-2618, 2563-2619, 2563-2620, 2563-2621, 2563-2622, 2563-2623,
2563-2624, 2563-2625, 2563-2626, 2563-2627, 2563-2628, 2563-2629,
2563-2630, 2563-2631, 2564-2581, 2564-2582, 2564-2583, 2564-2584,
2564-2585, 2564-2586, 2564-2587, 2564-2588, 2564-2589, 2564-2590,
2564-2591, 2564-2592, 2564-2593, 2564-2594, 2564-2595, 2564-2596,
2564-2597, 2564-2598, 2564-2599, 2564-2600, 2564-2601, 2564-2602,
2564-2603, 2564-2604, 2564-2605, 2564-2606, 2564-2607, 2564-2608,
2564-2609, 2564-2610, 2564-2611, 2564-2612, 2564-2613, 2564-2614,
2564-2615, 2564-2616, 2564-2617, 2564-2618, 2564-2619, 2564-2620,
2564-2621, 2564-2622, 2564-2623, 2564-2624, 2564-2625, 2564-2626,
2564-2627, 2564-2628, 2564-2629, 2564-2630, 2564-2631, 2565-2584,
2565-2585, 2565-2586, 2565-2587, 2565-2588, 2565-2589, 2565-2590,
2565-2591, 2565-2592, 2565-2593, 2565-2594, 2565-2595, 2565-2596,
2565-2597, 2565-2598, 2565-2599, 2565-2600, 2565-2601, 2565-2602,
2565-2603, 2565-2604, 2565-2605, 2565-2606, 2565-2607, 2565-2608,
2565-2609, 2565-2610, 2565-2611, 2565-2612, 2565-2613, 2565-2614,
2565-2615, 2565-2616, 2565-2617, 2565-2618, 2565-2619, 2565-2620,
2565-2621, 2565-2622, 2565-2623, 2565-2624, 2565-2625, 2565-2626,
2565-2627, 2565-2628, 2565-2629, 2565-2630, 2565-2631, 2566-2583,
2566-2584, 2566-2585, 2566-2586, 2566-2587, 2566-2588, 2566-2589,
2566-2590, 2566-2591, 2566-2592, 2566-2593, 2566-2594, 2566-2595,
2566-2596, 2566-2597, 2566-2598, 2566-2599, 2566-2600, 2566-2601,
2566-2602, 2566-2603, 2566-2604, 2566-2605, 2566-2606, 2566-2607,
2566-2608, 2566-2609, 2566-2610, 2566-2611, 2566-2612, 2566-2613,
2566-2614, 2566-2615, 2566-2616, 2566-2617, 2566-2618, 2566-2619,
2566-2620, 2566-2621, 2566-2622, 2566-2623, 2566-2624, 2566-2625,
2566-2626, 2566-2627, 2566-2628, 2566-2629, 2566-2630, 2566-2631,
2567-2584, 2567-2585, 2567-2586, 2567-2587, 2567-2588, 2567-2589,
2567-2590, 2567-2591, 2567-2592, 2567-2593, 2567-2594, 2567-2595,
2567-2596, 2567-2597, 2567-2598, 2567-2599, 2567-2600, 2567-2601,
2567-2602, 2567-2603, 2567-2604, 2567-2605, 2567-2606, 2567-2607,
2567-2608, 2567-2609, 2567-2610, 2567-2611, 2567-2612, 2567-2613,
2567-2614, 2567-2615, 2567-2616, 2567-2617, 2567-2618, 2567-2619,
2567-2620, 2567-2621, 2567-2622, 2567-2623, 2567-2624, 2567-2625,
2567-2626, 2567-2627, 2567-2628, 2567-2629, 2567-2630, 2567-2631,
2568-2585, 2568-2586, 2568-2587, 2568-2588, 2568-2589, 2568-2590,
2568-2591, 2568-2592, 2568-2593, 2568-2594, 2568-2595, 2568-2596,
2568-2597, 2568-2598, 2568-2599, 2568-2600, 2568-2601, 2568-2602,
2568-2603, 2568-2604, 2568-2605, 2568-2606, 2568-2607, 2568-2608,
2568-2609, 2568-2610, 2568-2611, 2568-2612, 2568-2613, 2568-2614,
2568-2615, 2568-2616, 2568-2617, 2568-2618, 2568-2619, 2568-2620,
2568-2621, 2568-2622, 2568-2623, 2568-2624, 2568-2625, 2568-2626,
2568-2627, 2568-2628, 2568-2629, 2568-2630, 2568-2631, 2569-2586,
2569-2587, 2569-2588, 2569-2589, 2569-2590, 2569-2591, 2569-2592,
2569-2593, 2569-2594, 2569-2595, 2569-2596, 2569-2597, 2569-2598,
2569-2599, 2569-2600, 2569-2601, 2569-2602, 2569-2603, 2569-2604,
2569-2605, 2569-2606, 2569-2607, 2569-2608, 2569-2609, 2569-2610,
2569-2611, 2569-2612, 2569-2613, 2569-2614, 2569-2615, 2569-2616,
2569-2617, 2569-2618, 2569-2619, 2569-2620, 2569-2621, 2569-2622,
2569-2623, 2569-2624, 2569-2625, 2569-2626, 2569-2627, 2569-2628,
2569-2629, 2569-2630, 2569-2631, 2569-2586, 2569-2587, 2569-2588,
2569-2589, 2569-2590, 2569-2591, 2569-2592, 2569-2593, 2569-2594,
2569-2595, 2569-2596, 2569-2597, 2569-2598, 2569-2599, 2569-2600,
2569-2601, 2569-2602, 2569-2603, 2569-2604, 2569-2605, 2569-2606,
2569-2607, 2569-2608, 2569-2609, 2569-2610, 2569-2611, 2569-2612,
2569-2613, 2569-2614, 2569-2615, 2569-2616, 2569-2617, 2569-2618,
2569-2619, 2569-2620, 2569-2621, 2569-2622, 2569-2623, 2569-2624,
2569-2625, 2569-2626, 2569-2627, 2569-2628, 2569-2629, 2569-2630,
2569-2631, 2571-2588, 2571-2589, 2571-2590, 2571-2591, 2571-2592,
2571-2593, 2571-2594, 2571-2595, 2571-2596, 2571-2597, 2571-2598,
2571-2599, 2571-2600, 2571-2601, 2571-2602, 2571-2603, 2571-2604,
2571-2605, 2571-2606, 2571-2607, 2571-2608, 2571-2609, 2571-2610,
2571-2611, 2571-2612, 2571-2613, 2571-2614, 2571-2615, 2571-2616,
2571-2617, 2571-2618, 2571-2619, 2571-2620, 2571-2621, 2571-2622,
2571-2623, 2571-2624, 2571-2625, 2571-2626, 2571-2627, 2571-2628,
2571-2629, 2571-2630, 2571-2631, 2572-2589, 2572-2590, 2572-2591,
2572-2592, 2572-2593, 2572-2594, 2572-2595, 2572-2596, 2572-2597,
2572-2598, 2572-2599, 2572-2600, 2572-2601, 2572-2602, 2572-2603,
2572-2604, 2572-2605, 2572-2606, 2572-2607, 2572-2608, 2572-2609,
2572-2610, 2572-2611, 2572-2612, 2572-2613, 2572-2614, 2572-2615,
2572-2616, 2572-2617, 2572-2618, 2572-2619, 2572-2620, 2572-2621,
2572-2622, 2572-2623, 2572-2624, 2572-2625, 2572-2626, 2572-2627,
2572-2628, 2572-2629, 2572-2630, 2572-2631, 2573-2590, 2573-2591,
2573-2592, 2573-2593, 2573-2594, 2573-2595, 2573-2596, 2573-2597,
2573-2598, 2573-2599, 2573-2600, 2573-2601, 2573-2602, 2573-2603,
2573-2604, 2573-2605, 2573-2606, 2573-2607, 2573-2608, 2573-2609,
2573-2610, 2573-2611, 2573-2612, 2573-2613, 2573-2614, 2573-2615,
2573-2616, 2573-2617, 2573-2618, 2573-2619, 2573-2620, 2573-2621,
2573-2622, 2573-2623, 2573-2624, 2573-2625, 2573-2626, 2573-2627,
2573-2628, 2573-2629, 2573-2630, 2573-2631, 2574-2591, 2574-2592,
2574-2593, 2574-2594, 2574-2595, 2574-2596, 2574-2597, 2574-2598,
2574-2599, 2574-2600, 2574-2601, 2574-2602, 2574-2603, 2574-2604,
2574-2605, 2574-2606, 2574-2607, 2574-2608, 2574-2609, 2574-2610,
2574-2611, 2574-2612, 2574-2613, 2574-2614, 2574-2615, 2574-2616,
2574-2617, 2574-2618, 2574-2619, 2574-2620, 2574-2621, 2574-2622,
2574-2623, 2574-2624, 2574-2625, 2574-2626, 2574-2627, 2574-2628,
2574-2629, 2574-2630, 2574-2631, 2575-2592, 2575-2593, 2575-2594,
2575-2595, 2575-2596, 2575-2597, 2575-2598, 2575-2599, 2575-2600,
2575-2601, 2575-2602, 2575-2603, 2575-2604, 2575-2605, 2575-2606,
2575-2607, 2575-2608, 2575-2609, 2575-2610, 2575-2611, 2575-2612,
2575-2613, 2575-2614, 2575-2615, 2575-2616, 2575-2617, 2575-2618,
2575-2619, 2575-2620, 2575-2621, 2575-2622, 2575-2623, 2575-2624,
2575-2625, 2575-2626, 2575-2627, 2575-2628, 2575-2629, 2575-2630,
2575-2631, 2576-2593, 2576-2594, 2576-2595, 2576-2596, 2576-2597,
2576-2598, 2576-2599, 2576-2600, 2576-2601, 2576-2602, 2576-2603,
2576-2604, 2576-2605, 2576-2606, 2576-2607, 2576-2608, 2576-2609,
2576-2610, 2576-2611, 2576-2612, 2576-2613, 2576-2614, 2576-2615,
2576-2616, 2576-2617, 2576-2618, 2576-2619, 2576-2620, 2576-2621,
2576-2622, 2576-2623, 2576-2624, 2576-2625, 2576-2626, 2576-2627,
2576-2628, 2576-2629, 2576-2630, 2576-2631, 2577-2594, 2577-2595,
2577-2596, 2577-2597, 2577-2598, 2577-2599, 2577-2600, 2577-2601,
2577-2602, 2577-2603, 2577-2604, 2577-2605, 2577-2606, 2577-2607,
2577-2608, 2577-2609, 2577-2610, 2577-2611, 2577-2612, 2577-2613,
2577-2614, 2577-2615,
2577-2616, 2577-2617, 2577-2618, 2577-2619, 2577-2620, 2577-2621,
2577-2622, 2577-2623, 2577-2624, 2577-2625, 2577-2626, 2577-2627,
2577-2628, 2577-2629, 2577-2630, 2577-2631, 2578-2597, 2578-2598,
2578-2599, 2578-2600, 2578-2601, 2578-2602, 2578-2603, 2578-2604,
2578-2605, 2578-2606, 2578-2607, 2578-2608, 2578-2609, 2578-2610,
2578-2611, 2578-2612, 2578-2613, 2578-2614, 2578-2615, 2578-2616,
2578-2617, 2578-2618, 2578-2619, 2578-2620, 2578-2621, 2578-2622,
2578-2623, 2578-2624, 2578-2625, 2578-2626, 2578-2627, 2578-2628,
2578-2629, 2578-2630, 2578-2631, 2579-2598, 2579-2599, 2579-2600,
2579-2601, 2579-2602, 2579-2603, 2579-2604, 2579-2605, 2579-2606,
2579-2607, 2579-2608, 2579-2609, 2579-2610, 2579-2611, 2579-2612,
2579-2613, 2579-2614, 2579-2615, 2579-2616, 2579-2617, 2579-2618,
2579-2619, 2579-2620, 2579-2621, 2579-2622, 2579-2623, 2579-2624,
2579-2625, 2579-2626, 2579-2627, 2579-2628, 2579-2629, 2579-2630,
2579-2631, 2580-2598, 2580-2599, 2580-2600, 2580-2601, 2580-2602,
2580-2603, 2580-2604, 2580-2605, 2580-2606, 2580-2607, 2580-2608,
2580-2609, 2580-2610, 2580-2611, 2580-2612, 2580-2613, 2580-2614,
2580-2615, 2580-2616, 2580-2617, 2580-2618, 2580-2619, 2580-2620,
2580-2621, 2580-2622, 2580-2623, 2580-2624, 2580-2625, 2580-2626,
2580-2627, 2580-2628, 2580-2629, 2580-2630, 2580-2631, 2581-2597,
2581-2598, 2581-2599, 2581-2600, 2581-2601, 2581-2602, 2581-2603,
2581-2604, 2581-2605, 2581-2606, 2581-2607, 2581-2608, 2581-2609,
2581-2610, 2581-2611, 2581-2612, 2581-2613, 2581-2614, 2581-2615,
2581-2616, 2581-2617, 2581-2618, 2581-2619, 2581-2620, 2581-2621,
2581-2622, 2581-2623, 2581-2624, 2581-2625, 2581-2626, 2581-2627,
2581-2628, 2581-2629, 2581-2630, 2581-2631, 2582-2600, 2582-2601,
2582-2602, 2582-2603, 2582-2604, 2582-2605, 2582-2606, 2582-2607,
2582-2608, 2582-2609, 2582-2610, 2582-2611, 2582-2612, 2582-2613,
2582-2614, 2582-2615, 2582-2616, 2582-2617, 2582-2618, 2582-2619,
2582-2620, 2582-2621, 2582-2622, 2582-2623, 2582-2624, 2582-2625,
2582-2626, 2582-2627, 2582-2628, 2582-2629, 2582-2630, 2582-2631,
2583-2601, 2583-2602, 2583-2603, 2583-2604, 2583-2605, 2583-2606,
2583-2607, 2583-2608, 2583-2609, 2583-2610, 2583-2611, 2583-2612,
2583-2613, 2583-2614, 2583-2615, 2583-2616, 2583-2617, 2583-2618,
2583-2619, 2583-2620, 2583-2621, 2583-2622, 2583-2623, 2583-2624,
2583-2625, 2583-2626, 2583-2627, 2583-2628, 2583-2629, 2583-2630,
2583-2631, 2585-2603, 2585-2604, 2585-2605, 2585-2606, 2585-2607,
2585-2608, 2585-2609, 2585-2610, 2585-2611, 2585-2612, 2585-2613,
2585-2614, 2585-2615, 2585-2616, 2585-2617, 2585-2618, 2585-2619,
2585-2620, 2585-2621, 2585-2622, 2585-2623, 2585-2624, 2585-2625,
2585-2626, 2585-2627, 2585-2628, 2585-2629, 2585-2630, 2585-2631,
2586-2604, 2586-2605, 2586-2606, 2586-2607, 2586-2608, 2586-2609,
2586-2610, 2586-2611, 2586-2612, 2586-2613, 2586-2614, 2586-2615,
2586-2616, 2586-2617, 2586-2618, 2586-2619, 2586-2620, 2586-2621,
2586-2622, 2586-2623, 2586-2624, 2586-2625, 2586-2626, 2586-2627,
2586-2628, 2586-2629, 2586-2630, 2586-2631, 2587-2605, 2587-2606,
2587-2607, 2587-2608, 2587-2609, 2587-2610, 2587-2611, 2587-2612,
2587-2613, 2587-2614, 2587-2615, 2587-2616, 2587-2617, 2587-2618,
2587-2619, 2587-2620, 2587-2621, 2587-2622, 2587-2623, 2587-2624,
2587-2625, 2587-2626, 2587-2627, 2587-2628, 2587-2629, 2587-2630,
2587-2631, 2588-2606, 2588-2607, 2588-2608, 2588-2609, 2588-2610,
2588-2611, 2588-2612, 2588-2613, 2588-2614, 2588-2615, 2588-2616,
2588-2617, 2588-2618, 2588-2619, 2588-2620, 2588-2621, 2588-2622,
2588-2623, 2588-2624, 2588-2625, 2588-2626, 2588-2627, 2588-2628,
2588-2629, 2588-2630, 2588-2631, 2589-2607, 2589-2608, 2589-2609,
2589-2610, 2589-2611, 2589-2612, 2589-2613, 2589-2614, 2589-2615,
2589-2616, 2589-2617, 2589-2618, 2589-2619, 2589-2620, 2589-2621,
2589-2622, 2589-2623, 2589-2624, 2589-2625, 2589-2626, 2589-2627,
2589-2628, 2589-2629, 2589-2630, 2589-2631, 2590-2606, 2590-2607,
2590-2608, 2590-2609, 2590-2610, 2590-2611, 2590-2612, 2590-2613,
2590-2614, 2590-2615, 2590-2616, 2590-2617, 2590-2618, 2590-2619,
2590-2620, 2590-2621, 2590-2622, 2590-2623, 2590-2624, 2590-2625,
2590-2626, 2590-2627, 2590-2628, 2590-2629, 2590-2630, 2590-2631,
2591-2610, 2591-2611, 2591-2612, 2591-2613, 2591-2614, 2591-2615,
2591-2616, 2591-2617, 2591-2618, 2591-2619, 2591-2620, 2591-2621,
2591-2622, 2591-2623, 2591-2624, 2591-2625, 2591-2626, 2591-2627,
2591-2628, 2591-2629, 2591-2630, 2591-2631, 2592-2611, 2592-2612,
2592-2613, 2592-2614, 2592-2615, 2592-2616, 2592-2617, 2592-2618,
2592-2619, 2592-2620, 2592-2621, 2592-2622, 2592-2623, 2592-2624,
2592-2625, 2592-2626, 2592-2627, 2592-2628, 2592-2629, 2592-2630,
2592-2631, 2593-2608, 2593-2612, 2593-2613, 2593-2614, 2593-2615,
2593-2616, 2593-2617, 2593-2618, 2593-2619, 2593-2620, 2593-2621,
2593-2622, 2593-2623, 2593-2624, 2593-2625, 2593-2626, 2593-2627,
2593-2628, 2593-2629, 2593-2630, 2593-2631, 2594-2612, 2594-2613,
2594-2614, 2594-2615, 2594-2616, 2594-2617, 2594-2618, 2594-2619,
2594-2620, 2594-2621, 2594-2622, 2594-2623, 2594-2624, 2594-2625,
2594-2626, 2594-2627, 2594-2628, 2594-2629, 2594-2630, 2594-2631,
2595-2611, 2595-2612, 2595-2613, 2595-2614, 2595-2615, 2595-2616,
2595-2617, 2595-2618, 2595-2619, 2595-2620, 2595-2621, 2595-2622,
2595-2623, 2595-2624, 2595-2625, 2595-2626, 2595-2627, 2595-2628,
2595-2629, 2595-2630, 2595-2631, 2596-2614, 2596-2615, 2596-2616,
2596-2617, 2596-2618, 2596-2619, 2596-2620, 2596-2621, 2596-2622,
2596-2623, 2596-2624, 2596-2625, 2596-2626, 2596-2627, 2596-2628,
2596-2629, 2596-2630, 2596-2631, 2597-2612, 2597-2613, 2597-2614,
2597-2615, 2597-2616, 2597-2617, 2597-2618, 2597-2619, 2597-2620,
2597-2621, 2597-2622, 2597-2623, 2597-2624, 2597-2625, 2597-2626,
2597-2627, 2597-2628, 2597-2629, 2597-2630, 2597-2631, 2598-2613,
2598-2614, 2598-2615, 2598-2616, 2598-2617, 2598-2618, 2598-2619,
2598-2620, 2598-2621, 2598-2622, 2598-2623, 2598-2624, 2598-2625,
2598-2626, 2598-2627, 2598-2628, 2598-2629, 2598-2630, 2598-2631,
2599-2614, 2599-2615, 2599-2616, 2599-2617, 2599-2618, 2599-2619,
2599-2620, 2599-2621, 2599-2622, 2599-2623, 2599-2624, 2599-2625,
2599-2626, 2599-2627, 2599-2628, 2599-2629, 2599-2630, 2599-2631,
2600-2615, 2600-2616, 2600-2617, 2600-2618, 2600-2619, 2600-2620,
2600-2621, 2600-2622, 2600-2623, 2600-2624, 2600-2625, 2600-2626,
2600-2627, 2600-2628, 2600-2629, 2600-2630, 2600-2631, 2601-2616,
2601-2617, 2601-2618, 2601-2619, 2601-2620, 2601-2621, 2601-2622,
2601-2623, 2601-2624, 2601-2625, 2601-2626, 2601-2627, 2601-2628,
2601-2629, 2601-2630, 2601-2631, 2602-2618, 2602-2619, 2602-2620,
2602-2621, 2602-2622, 2602-2623, 2602-2624, 2602-2625, 2602-2626,
2602-2627, 2602-2628, 2602-2629, 2602-2630, 2602-2631, 2603-2620,
2603-2621, 2603-2622, 2603-2623, 2603-2624, 2603-2625, 2603-2626,
2603-2627, 2603-2628, 2603-2629, 2603-2630, 2603-2631, 2604-2619,
2604-2620, 2604-2621, 2604-2622, 2604-2623, 2604-2624, 2604-2625,
2604-2626, 2604-2627, 2604-2628, 2604-2629, 2604-2630, 2604-2631,
2605-2620, 2605-2621, 2605-2622, 2605-2623, 2605-2624, 2605-2625,
2605-2626, 2605-2627, 2605-2628, 2605-2629, 2605-2630, 2605-2631,
2606-2621, 2606-2622, 2606-2623, 2606-2624, 2606-2625, 2606-2626,
2606-2627, 2606-2628, 2606-2629, 2606-2630, 2606-2631, 2607-2622,
2607-2623, 2607-2624, 2607-2625, 2607-2626, 2607-2627, 2607-2628,
2607-2629, 2607-2630, 2607-2631, 2608-2623, 2608-2624, 2608-2625,
2608-2626, 2608-2627, 2608-2628, 2608-2629, 2608-2630, 2608-2631,
2609-2624, 2609-2625, 2609-2626, 2609-2627, 2609-2628, 2609-2629,
2609-2630, 2609-2631, 2610-2625, 2610-2626, 2610-2627, 2610-2628,
2610-2629, 2610-2630, 2610-2631, 2611-2626, 2611-2627, 2611-2628,
2611-2629, 2611-2630, 2611-2631, 2612-2627, 2612-2628, 2612-2629,
2612-2630, 2612-2631, 2613-2628, 2613-2629, 2613-2630, 2613-2631,
2614-2629, 2614-2630, 2614-2631, 2615-2630, 2615-2631, or
2616-2631. In certain embodiments, antisense compounds or
oligonucleotides target at least an 8, 9, 10, 11, 12, 13, 14, 15,
or 16 contiguous nucleobases within the aforementioned nucleobase
regions.
[0124] In certain embodiments, the following nucleotide regions of
SEQ ID NO: 1, when targeted by antisense compounds or
oligonucleotides, display at least 50% inhibition: 30-49, 48-63,
150-169, 151-170, 152-171, 154-169, 154-173, 156-171, 156-175,
157-176, 158-173, 158-177, 480-499, 600-619, 638-657, 644-663,
738-757, 1089-1108, 1135-1154, 1141-1160, 1147-1166, 1150-1169,
1153-1172, 1159-1178, 1162-1181, 1165-1184, 1171-1186, 1171-1190,
1173-1188, 1173-1192, 1175-1190, 1175-1194, 1177-1196, 1183-1202,
1208-1227, 1235-1254, 1298-1317, 1304-1323, 1310-1329, 1316-1335,
1319-1338, 1322-1341, 1328-1347, 1349-1368, 1355-1374, 1393-1412,
1396-1415, 1399-1418, 1405-1424, 1421-1440, 1621-1640, 1646-1665,
1646-1665, 1647-1666, 1689-1708, 1749-1768, 1763-1782, 1912-1931,
2073-2092, 2085-2104, 2166-2185, 2172-2191, 2189-2208, 2191-2210,
2193-2212, 2195-2210, 2195-2214, 2196-2215, 2197-2212, 2197-2216,
2202-2221, 2223-2238, 2223-2242, 2225-2240, 2226-2245, 2227-2242,
2227-2246, 2238-2257, 2241-2260, 2267-2286, 2361-2380, 2388-2407,
2397-2416, 2448-2467, 2453-2472, 2455-2474, 2457-2472, 2457-2476,
2459-2474, 2459-2478, 2461-2476, 2461-2480, 2532-2551, 2550-2569,
2551-2566, 2551-2570, 2552-2568, 2552-2570, 2552-2571, 2553-2568,
2553-2570, 2553-2571, 2553-2572, 2554-2571, 2554-2572, 2554-2573,
2555-2570, 2555-2572, 2555-2574, 2556-2573, 2556-2574, 2556-2575,
2557-2573, 2557-2574, 2557-2575, 2557-2576, 2558-2575, 2558-2576,
2558-2577, 2559-2576, 2559-2577, 2559-2578, 2560-2577, 2560-2578,
2560-2579, 2561-2576, 2561-2578, 2561-2579, 2561-2580, 2562-2577,
2562-2579, 2562-2581, 2563-2578, 2563-2580, 2563-2582, 2564-2581,
2564-2583, 2565-2584, 2566-2583, 2566-2585, 2567-2582, 2567-2584,
2567-2586, 2568-2583, 2568-2585, 2568-2587, 2569-2586, 2569-2588,
2570-2585, 2570-2587, 2570-2589, 2571-2586, 2571-2588, 2571-2590,
2572-2589, 2572-2590, 2572-2591, 2573-2590, 2573-2592, 2574-2590,
2574-2591, 2574-2593, 2575-2590, 2575-2591, 2575-2592, 2575-2594,
2576-2593, 2576-2595, 2577-2594, 2577-2595, 2577-2596, 2578-2594,
2578-2596, 2578-2597, 2579-2598, 2580-2596, 2580-2597, 2580-2598,
2580-2599, 2581-2597, 2581-2598, 2581-2599, 2581-2600, 2582-2598,
2582-2599, 2582-2600, 2582-2601, 2583-2599, 2583-2600, 2583-2601,
2583-2602, 2584-2600, 2584-2601, 2584-2602, 2584-2603, 2585-2601,
2585-2603, 2585-2604, 2586-2601, 2586-2602, 2586-2604, 2586-2605,
2587-2602, 2587-2603, 2587-2605, 2587-2606, 2588-2603, 2588-2604,
2588-2605, 2588-2606, 2588-2607, 2589-2604, 2589-2605, 2589-2606,
2589-2607, 2589-2608, 2590-2605, 2590-2606, 2590-2607, 2590-2608,
2590-2609, 2590-2609, 2591-2607, 2591-2608, 2591-2609, 2591-2610,
2592-2607, 2592-2608, 2592-2609, 2592-2610, 2592-2611, 2593-2608,
2593-2609, 2593-2610, 2593-2612, 2594-2609, 2594-2610, 2594-2611,
2594-2612, 2594-2613, 2595-2610, 2595-2611, 2595-2612, 2595-2613,
2595-2614, 2596-2611, 2596-2612, 2596-2613, 2596-2614, 2596-2615,
2597-2612, 2597-2612, 2597-2613, 2597-2614, 2597-2615, 2597-2616,
2598-2613, 2598-2614, 2598-2615, 2598-2616, 2598-2617, 2599-2614,
2599-2615, 2599-2616, 2599-2617, 2599-2618, 2600-2615, 2600-2616,
2600-2617, 2600-2618, 2600-2619, 2601-2616, 2601-2617, 2601-2618,
2601-2619, 2601-2620, 2602-2617, 2602-2618, 2602-2619, 2602-2620,
2602-2621, 2603-2618, 2603-2619, 2603-2620, 2603-2621, 2603-2622,
2604-2619, 2604-2620, 2604-2621, 2604-2622, 2604-2623, 2605-2620,
2605-2621, 2605-2622, 2605-2623, 2605-2624, 2606-2621, 2606-2622,
2606-2623, 2606-2624, 2606-2625, 2607-2622, 2607-2623, 2607-2624,
2607-2625, 2607-2626, 2608-2623, 2608-2624, 2608-2625, 2608-2626,
2608-2627, 2609-2624, 2609-2625, 2609-2626, 2609-2627, 2609-2628,
2610-2625, 2610-2626, 2610-2627, 2610-2628, 2610-2629, 2611-2626,
2611-2627, 2611-2628, 2611-2629, 2611-2630, 2612-2627, 2612-2628,
2612-2629, 2612-2630, 2612-2631, 2613-2628, 2613-2629, 2613-2630,
2613-2631, 2614-2629, 2614-2630, 2614-2631, 2615-2630, 2615-2631,
and 2616-2631.
[0125] In certain embodiments, the following nucleotide regions of
SEQ ID NO: 2, when targeted by antisense compounds or
oligonucleotides, display at least 50% inhibition: 1608-1627,
1685-1704, 1686-1705, 1751-1770, 1769-1784, 1871-1890, 1872-1891,
1873-1892, 1875-1890, 1875-1894, 1877-1892, 1877-1896, 1878-1897,
1879-1894, 1879-1898, 2288-2307, 2808-2827, 2846-2865, 2852-2871,
2946-2965, 3773-3792, 3819-3838, 3825-3844, 3831-3850, 3834-3853,
3837-3856, 3843-3862, 4151-4166, 4151-4170, 4153-4172, 4159-4178,
4184-4203, 4211-4230, 4609-4628, 4612-4631, 4615-4634, 4621-4640,
4642-4661, 4648-4667, 4686-4705, 4689-4708, 4692-4711, 4698-4717,
4714-4733, 5270-5289, 5295-5314, 5296-5315, 5830-5849, 5890-5909,
5904-5923, 6406-6425, 6662-6681, 6674-6693, 6954-6973, 6960-6979,
6977-6996, 6979-6998, 6981-7000, 6983-6998, 6983-7002, 6984-7003,
6985-7000, 6985-7004, 6990-7009, 7122-7141, 7125-7144, 7151-7170,
7353-7372, 7362-7381, 7683-7702, 7688-7707, 7690-7709, 7692-7707,
7692-7711, 7694-7709, 7694-7713, 7696-7711, 7696-7715, 7767-7786,
7785-7804, 7786-7801, 7787-7803, 7787-7805, 7787-7806, 7788-7803,
7788-7805, 7788-7806, 7788-7807, 7789-7806, 7789-7807, 7789-7808,
7790-7805, 7790-7807, 7790-7809, 7791-7808, 7791-7809, 7791-7810,
7792-7808, 7792-7809, 7792-7810, 7792-7811, 7793-7810, 7793-7811,
7793-7812, 7794-7811, 7794-7812, 7794-7813, 7795-7812, 7795-7813,
7795-7814, 7796-7811, 7796-7813, 7796-7814, 7796-7815, 7797-7812,
7797-7814, 7797-7816, 7798-7813, 7798-7815, 7798-7817, 7799-7816,
7799-7818, 7800-7819, 7801-7818, 7801-7820, 7802-7817, 7802-7819,
7802-7821, 7803-7818, 7803-7820, 7803-7822, 7804-7821, 7804-7823,
7805-7820, 7805-7822, 7805-7824, 7806-7821, 7806-7823, 7806-7825,
7807-7824, 7807-7825, 7807-7826, 7808-7825, 7808-7827, 7809-7825,
7809-7826, 7809-7828, 7810-7825, 7810-7826, 7810-7827, 7810-7829,
7811-7828, 7811-7830, 7812-7829, 7812-7830, 7812-7831, 7813-7829,
7813-7831, 7813-7832, 7814-7833, 7815-7831, 7815-7832, 7815-7833,
7815-7834, 7816-7832, 7816-7833, 7816-7834, 7816-7835, 7817-7833,
7817-7834, 7817-7835, 7817-7836, 7818-7834, 7818-7835, 7818-7836,
7818-7837, 7819-7835, 7819-7836, 7819-7837, 7819-7838, 7820-7836,
7820-7838, 7820-7839, 7821-7836, 7821-7837, 7821-7839, 7821-7840,
7822-7837, 7822-7838, 7822-7840, 7822-7841, 7823-7838, 7823-7839,
7823-7839, 7823-7840, 7823-7841, 7823-7842, 7824-7839, 7824-7840,
7824-7840, 7824-7841, 7824-7842, 7824-7843, 7825-7840, 7825-7841,
7825-7842, 7825-7843, 7825-7844, 7826-7842, 7826-7843, 7826-7844,
7826-7845, 7827-7842, 7827-7843, 7827-7844, 7827-7845, 7827-7846,
7828-7843, 7828-7844, 7828-7845, 7828-7847, 7829-7844, 7829-7845,
7829-7846, 7829-7847, 7829-7848, 7830-7845, 7830-7846, 7830-7847,
7830-7848, 7830-7849, 7831-7846, 7831-7847, 7831-7848, 7831-7849,
7831-7850, 7832-7847, 7832-7848, 7832-7849, 7832-7850, 7832-7851,
7833-7848, 7833-7849, 7833-7850, 7833-7851, 7833-7852, 7834-7849,
7834-7850, 7834-7851, 7834-7852, 7834-7853, 7835-7850, 7835-7851,
7835-7852, 7835-7853, 7835-7854, 7836-7851, 7836-7852, 7836-7853,
7836-7854, 7836-7855, 7837-7852, 7837-7853, 7837-7854, 7837-7855,
7837-7856, 7838-7853, 7838-7854, 7838-7855, 7838-7856, 7838-7857,
7839-7854, 7839-7855, 7839-7856, 7839-7857, 7839-7858, 7840-7855,
7840-7856, 7840-7857, 7840-7858, 7840-7859, 7841-7856, 7841-7857,
7841-7858, 7841-7859, 7841-7860, 7842-7857, 7842-7858, 7842-7859,
7842-7860, 7842-7861, 7843-7858, 7843-7859, 7843-7860, 7843-7861,
7843-7862, 7844-7859, 7844-7860, 7844-7861, 7844-7862, 7845-7860,
7845-7861, 7845-7862, 7846-7861, and 7846-7862.
[0126] In certain embodiments, the following nucleotide regions of
SEQ ID NO: 1, when targeted by antisense compounds or
oligonucleotides, display at least 60% inhibition: 48-63, 150-169,
152-171, 154-169, 154-173, 156-171, 156-175, 158-173, 158-177,
600-619, 1135-1154, 1141-1160, 1147-1166, 1153-1172, 1171-1186,
1173-1188, 1175-1190, 1749-1768, 1763-1782, 1763-1782, 1912-1931,
2189-2208, 2191-2210, 2193-2212, 2195-2210, 2195-2214, 2197-2212,
2197-2216, 2223-2238, 2225-2240, 2227-2242, 2238-2257, 2448-2467,
2453-2472, 2455-2474, 2457-2472, 2457-2476, 2459-2474, 2459-2478,
2461-2476, 2461-2480, 2550-2569, 2551-2566, 2552-2571, 2553-2568,
2553-2570, 2553-2571, 2553-2572, 2554-2571, 2554-2572, 2554-2573,
2555-2572, 2555-2574, 2556-2573, 2556-2574, 2556-2575, 2557-2574,
2557-2575, 2557-2576, 2558-2575, 2558-2576, 2558-2577, 2559-2576,
2559-2577, 2559-2578, 2560-2577, 2560-2578, 2560-2579, 2561-2578,
2561-2579, 2561-2580, 2562-2577, 2562-2579, 2562-2581, 2563-2578,
2563-2580, 2563-2582, 2564-2581, 2564-2583, 2565-2584, 2566-2583,
2566-2585, 2567-2582, 2567-2584, 2567-2586, 2568-2583, 2568-2585,
2568-2587, 2569-2586, 2569-2588, 2570-2587, 2570-2589, 2571-2588,
2572-2590, 2572-2591, 2573-2590, 2573-2592, 2574-2591, 2574-2593,
2575-2590, 2575-2592, 2575-2594, 2576-2593, 2576-2595, 2577-2594,
2577-2595, 2577-2596, 2578-2594, 2578-2597, 2579-2598, 2580-2596,
2580-2597, 2580-2598, 2580-2599, 2581-2597, 2581-2598, 2581-2599,
2581-2600, 2582-2598, 2582-2599, 2582-2600, 2582-2601, 2583-2599,
2583-2600, 2583-2601, 2583-2602, 2584-2600, 2584-2602, 2584-2603,
2585-2601, 2585-2603, 2585-2604, 2586-2602, 2586-2604, 2586-2605,
2587-2603, 2587-2605, 2587-2606, 2588-2603, 2588-2604, 2588-2606,
2588-2607, 2589-2605, 2589-2606, 2589-2607, 2589-2608, 2590-2605,
2590-2606, 2590-2607, 2590-2608, 2590-2609, 2591-2607, 2591-2609,
2591-2610, 2592-2608, 2592-2609, 2592-2611, 2593-2608, 2593-2609,
2593-2612, 2594-2609, 2594-2610, 2594-2611, 2594-2612, 2594-2613,
2595-2610, 2595-2611, 2595-2612, 2595-2613, 2595-2614, 2596-2611,
2596-2612, 2596-2613, 2596-2614, 2596-2615, 2597-2612, 2597-2613,
2597-2614, 2597-2615, 2597-2616, 2598-2613, 2598-2614, 2598-2615,
2598-2616, 2598-2617, 2599-2614, 2599-2615, 2599-2616, 2599-2617,
2599-2618, 2600-2615, 2600-2616, 2600-2617, 2600-2618, 2600-2619,
2601-2616, 2601-2617, 2601-2618, 2601-2619, 2601-2620, 2602-2617,
2602-2618, 2602-2619, 2602-2620, 2602-2621, 2603-2618, 2603-2619,
2603-2620, 2603-2621, 2603-2622, 2604-2619, 2604-2620, 2604-2621,
2604-2622, 2604-2623, 2605-2620, 2605-2621, 2605-2622, 2605-2623,
2605-2624, 2606-2621, 2606-2622, 2606-2623, 2606-2624, 2606-2625,
2607-2622, 2607-2623, 2607-2624, 2607-2625, 2607-2626, 2608-2623,
2608-2624, 2608-2625, 2608-2625, 2608-2626, 2608-2627, 2609-2624,
2609-2625, 2609-2626, 2609-2627, 2609-2628, 2610-2625, 2610-2626,
2610-2627, 2610-2628, 2610-2629, 2611-2626, 2611-2626, 2611-2627,
2611-2628, 2611-2629, 2611-2630, 2612-2627, 2612-2628, 2612-2629,
2612-2630, 2612-2631, 2613-2628, 2613-2629, 2613-2630, 2613-2631,
2614-2629, 2614-2630, 2614-2631, 2615-2630, 2615-2630, 2615-2631,
2615-2631, and 2616-2631.
[0127] In certain embodiments, the following nucleotide regions of
SEQ ID NO: 2, when targeted by antisense compounds or
oligonucleotides, display at least 60% inhibition: 1685-1704,
1686-1705, 1769-1784, 1871-1890, 1873-1892, 1875-1890, 1875-1894,
1877-1892, 1877-1896, 1879-1894, 1879-1898, 2808-2827, 3819-3838,
3825-3844, 3831-3850, 3837-3856, 4151-4166, 5890-5909, 5904-5923,
5904-5923, 6406-6425, 6977-6996, 6979-6998, 6981-7000, 6983-6998,
6983-7002, 6985-7000, 6985-7004, 7122-7141, 7683-7702, 7688-7707,
7690-7709, 7692-7707, 7692-7711, 7694-7709, 7696-7711, 7696-7715,
7786-7801, 7787-7806, 7788-7803, 7788-7805, 7788-7806, 7788-7807,
7789-7806, 7789-7807, 7789-7808, 7790-7807, 7790-7809, 7791-7808,
7791-7809, 7791-7810, 7792-7809, 7792-7810, 7792-7811, 7793-7810,
7793-7811, 7793-7812, 7794-7811, 7794-7812, 7794-7813, 7795-7812,
7795-7813, 7795-7814, 7796-7813, 7796-7814, 7796-7815, 7797-7812,
7797-7814, 7797-7816, 7798-7813, 7798-7815, 7798-7817, 7799-7816,
7799-7818, 7800-7819, 7801-7818, 7801-7820, 7802-7817, 7802-7819,
7802-7821, 7803-7818, 7803-7820, 7803-7822, 7804-7821, 7804-7823,
7805-7822, 7805-7824, 7806-7823, 7806-7825, 7807-7824, 7807-7825,
7807-7826, 7808-7825, 7808-7827, 7809-7826, 7809-7828, 7810-7825,
7810-7827, 7810-7829, 7811-7828, 7811-7830, 7812-7829, 7812-7830,
7812-7831, 7813-7829, 7813-7832, 7814-7833, 7815-7831, 7815-7832,
7815-7833, 7815-7834, 7816-7832, 7816-7833, 7816-7834, 7816-7835,
7817-7833, 7817-7834, 7817-7835, 7817-7836, 7818-7834, 7818-7835,
7818-7836, 7818-7837, 7819-7835, 7819-7837, 7819-7838, 7820-7836,
7820-7838, 7820-7839, 7821-7837, 7821-7839, 7821-7840, 7822-7838,
7822-7840, 7822-7841, 7823-7838, 7823-7839, 7823-7841, 7823-7842,
7824-7840, 7824-7841, 7824-7842, 7824-7843, 7825-7840, 7825-7841,
7825-7842, 7825-7843, 7825-7844, 7826-7842, 7826-7844, 7826-7845,
7827-7843, 7827-7844, 7827-7846, 7828-7843, 7828-7844, 7828-7847,
7829-7844, 7829-7845, 7829-7846, 7829-7847, 7829-7848, 7830-7845,
7830-7846, 7830-7847, 7830-7848, 7830-7849, 7831-7846, 7831-7847,
7831-7848, 7831-7849, 7831-7850, 7832-7847, 7832-7848, 7832-7849,
7832-7850, 7832-7851, 7833-7848, 7833-7849, 7833-7850, 7833-7851,
7833-7852, 7834-7849, 7834-7850, 7834-7851, 7834-7852, 7834-7853,
7835-7850, 7835-7851, 7835-7852, 7835-7853, 7835-7854, 7836-7851,
7836-7852, 7836-7853, 7836-7854, 7836-7855, 7837-7852, 7837-7853,
7837-7854, 7837-7855, 7837-7856, 7838-7853, 7838-7854, 7838-7855,
7838-7856, 7838-7857, 7839-7854, 7839-7855, 7839-7856, 7839-7857,
7839-7858, 7840-7855, 7840-7856, 7840-7857, 7840-7858, 7840-7859,
7841-7856, 7841-7857, 7841-7858, 7841-7859, 7841-7860, 7842-7857,
7842-7858, 7842-7859, 7842-7860, 7842-7861, 7843-7858, 7843-7859,
7843-7860, 7843-7861, 7843-7862, 7844-7859, 7844-7860, 7844-7861,
7844-7862, 7845-7860, 7845-7861, 7845-7862, 7846-7861, 7846-7862,
and 7847-7862.
[0128] In certain embodiments, the following nucleotide regions of
SEQ ID NO: 1, when targeted by antisense compounds or
oligonucleotides, display at least 70% inhibition: 48-63, 150-169,
152-171, 154-169, 154-173, 156-171, 156-175, 158-173, 158-177,
1135-1154, 1141-1160, 1147-1166, 1171-1186, 1173-1188, 1175-1190,
1749-1768, 1763-1782, 1912-1931, 2193-2212, 2195-2210, 2195-2214,
2197-2212, 2197-2216, 2223-2238, 2225-2240, 2227-2242, 2453-2472,
2455-2474, 2457-2472, 2457-2476, 2459-2474, 2461-2476, 2461-2480,
2550-2569, 2551-2566, 2552-2571, 2553-2570, 2553-2571, 2553-2572,
2554-2571, 2554-2572, 2554-2573, 2554-2573, 2555-2572, 2555-2574,
2555-2574, 2556-2573, 2556-2574, 2556-2575, 2557-2574, 2557-2576,
2558-2575, 2558-2576, 2558-2577, 2559-2576, 2559-2577, 2559-2578,
2560-2577, 2560-2578, 2560-2579, 2561-2578, 2561-2579, 2561-2580,
2562-2577, 2562-2579, 2562-2581, 2563-2578, 2563-2580, 2563-2582,
2564-2581, 2564-2583, 2565-2584, 2566-2583, 2566-2585, 2567-2582,
2567-2584, 2567-2586, 2568-2585, 2568-2587, 2569-2586, 2569-2588,
2570-2587, 2570-2589, 2571-2588, 2571-2590, 2572-2589, 2572-2591,
2573-2590, 2573-2592, 2574-2591, 2574-2593, 2575-2592, 2575-2594,
2576-2593, 2576-2595, 2577-2594, 2577-2596, 2578-2597, 2579-2598,
2580-2596, 2580-2598, 2580-2599, 2581-2597, 2581-2600, 2582-2598,
2582-2600, 2582-2601, 2583-2599, 2583-2601, 2583-2602, 2584-2600,
2584-2602, 2584-2603, 2585-2601, 2585-2603, 2585-2604, 2586-2605,
2587-2606, 2588-2604, 2588-2606, 2588-2607, 2589-2605, 2589-2606,
2589-2607, 2589-2608, 2590-2605, 2590-2606, 2590-2607, 2590-2609,
2591-2607, 2591-2610, 2592-2611, 2593-2608, 2593-2612, 2594-2609,
2594-2610, 2594-2612, 2594-2613, 2595-2610, 2595-2611, 2595-2612,
2595-2613, 2595-2614, 2596-2611, 2596-2614, 2596-2615, 2597-2612,
2597-2613, 2597-2614, 2597-2615, 2597-2616, 2598-2613, 2598-2614,
2598-2615, 2598-2616, 2598-2617, 2599-2614, 2599-2615, 2599-2616,
2599-2617, 2599-2618, 2600-2615, 2600-2616, 2600-2617, 2600-2618,
2600-2619, 2601-2616, 2601-2617, 2601-2618, 2601-2619, 2601-2620,
2602-2617, 2602-2618, 2602-2619, 2602-2620, 2602-2621, 2603-2619,
2603-2620, 2603-2621, 2603-2622, 2604-2619, 2604-2620, 2604-2621,
2604-2622, 2604-2623, 2605-2620, 2605-2621, 2605-2622, 2605-2623,
2605-2624, 2606-2621, 2606-2622, 2606-2623, 2606-2624, 2606-2625,
2607-2622, 2607-2623, 2607-2624, 2607-2625, 2607-2626, 2608-2623,
2608-2624, 2608-2625, 2608-2626, 2608-2627, 2609-2624, 2609-2625,
2609-2626, 2609-2627, 2609-2628, 2610-2625, 2610-2626, 2610-2627,
2610-2628, 2610-2629, 2611-2626, 2611-2627, 2611-2629, 2611-2630,
2612-2627, 2612-2628, 2612-2629, 2612-2630, 2612-2631, 2613-2628,
2613-2629, 2613-2630, 2613-2631, 2614-2629, 2614-2630, 2614-2631,
2615-2630, 2615-2630, 2615-2631, and 2616-2631.
[0129] In certain embodiments, the following nucleotide regions of
SEQ ID NO: 2, when targeted by antisense compounds or
oligonucleotides, display at least 70% inhibition: 1685-1704,
1686-1705, 1769-1784, 1871-1890, 1873-1892, 1875-1890, 1875-1894,
1877-1892, 1877-1896, 1879-1894, 1879-1898, 3819-3838, 3825-3844,
3831-3850, 4151-4166, 5890-5909, 5904-5923, 5904-5923, 6406-6425,
6983-6998, 6983-7002, 6985-7000, 6985-7004, 7688-7707, 7690-7709,
7692-7707, 7692-7711, 7694-7709, 7696-7711, 7696-7715, 7786-7801,
7787-7806, 7788-7805, 7788-7806, 7788-7807, 7789-7806, 7789-7807,
7789-7808, 7790-7807, 7790-7809, 7791-7808, 7791-7809, 7791-7810,
7792-7809, 7792-7811, 7793-7810, 7793-7811, 7793-7812, 7794-7811,
7794-7812, 7794-7813, 7795-7812, 7795-7813, 7795-7814, 7796-7813,
7796-7814, 7796-7815, 7797-7812, 7797-7814, 7797-7816, 7798-7813,
7798-7815, 7798-7817, 7799-7816, 7799-7818, 7800-7819, 7801-7818,
7801-7820, 7802-7817, 7802-7819, 7802-7821, 7803-7820, 7803-7822,
7804-7821, 7804-7823, 7805-7822, 7805-7824, 7806-7823, 7806-7825,
7807-7824, 7807-7826, 7808-7825, 7808-7827, 7809-7826, 7809-7828,
7810-7827, 7811-7828, 7811-7830, 7812-7829, 7812-7831, 7813-7832,
7814-7833, 7815-7831, 7815-7833, 7815-7834, 7816-7832, 7816-7835,
7817-7833, 7817-7835, 7817-7836, 7818-7834, 7818-7836, 7818-7837,
7819-7835, 7819-7837, 7819-7838, 7820-7836, 7820-7838, 7820-7839,
7821-7840, 7822-7841, 7823-7839, 7823-7841, 7823-7842, 7824-7840,
7824-7841, 7824-7842, 7824-7843, 7825-7840, 7825-7841, 7825-7842,
7825-7844, 7826-7842, 7826-7845, 7827-7846, 7828-7843, 7828-7847,
7829-7844, 7829-7845, 7829-7847, 7829-7848, 7830-7845, 7830-7846,
7830-7847, 7830-7848, 7830-7849, 7831-7846, 7831-7849, 7831-7850,
7832-7847, 7832-7848, 7832-7849, 7832-7850, 7832-7851, 7833-7848,
7833-7849, 7833-7850, 7833-7851, 7833-7852, 7834-7849, 7834-7850,
7834-7851, 7834-7852, 7834-7853, 7835-7850, 7835-7851, 7835-7852,
7835-7853, 7835-7854, 7836-7851, 7836-7852, 7836-7853, 7836-7854,
7836-7855, 7837-7852, 7837-7853, 7837-7854, 7837-7855, 7837-7856,
7838-7854, 7838-7855, 7838-7856, 7838-7857, 7839-7854, 7839-7855,
7839-7856, 7839-7857, 7839-7858, 7840-7855, 7840-7856, 7840-7857,
7840-7858, 7840-7859, 7841-7856, 7841-7857, 7841-7858, 7841-7859,
7841-7860, 7842-7857, 7842-7858, 7842-7859, 7842-7860, 7842-7861,
7843-7858, 7843-7859, 7843-7860, 7843-7861, 7843-7862, 7844-7859,
7844-7860, 7844-7861, 7844-7862, 7845-7860, 7845-7861, 7845-7862,
7846-7861, 7846-7862, and 7847-7862.
[0130] In certain embodiments, the following nucleotide regions of
SEQ ID NO: 1, when targeted by antisense compounds or
oligonucleotides, display at least 80% inhibition: 152-171,
154-169, 156-171, 158-173, 1135-1154, 1171-1186, 1173-1188,
1175-1190, 1763-1782, 1912-1931, 2197-2212, 2223-2238, 2225-2240,
2227-2242, 2457-2472, 2459-2474, 2461-2476, 2551-2566, 2553-2570,
2553-2571, 2553-2572, 2554-2573, 2555-2572, 2555-2574, 2556-2573,
2556-2574, 2556-2575, 2557-2574, 2557-2576, 2558-2575, 2558-2576,
2559-2577, 2559-2578, 2560-2577, 2560-2578, 2560-2579, 2561-2578,
2561-2579, 2561-2580, 2562-2577, 2562-2579, 2562-2581, 2563-2580,
2563-2582, 2564-2581, 2564-2583, 2565-2584, 2566-2583, 2567-2584,
2567-2586, 2568-2585, 2568-2587, 2569-2586, 2569-2588, 2570-2587,
2571-2588, 2571-2590, 2572-2589, 2572-2591, 2573-2590, 2573-2592,
2574-2591, 2574-2593, 2575-2592, 2576-2593, 2576-2595, 2577-2594,
2577-2596, 2578-2597, 2580-2598, 2580-2599, 2581-2597, 2581-2600,
2582-2601, 2583-2602, 2584-2603, 2585-2604, 2586-2605, 2587-2606,
2588-2607, 2589-2608, 2590-2606, 2590-2607, 2590-2609, 2591-2610,
2592-2611, 2593-2608, 2593-2612, 2594-2613, 2595-2611, 2595-2614,
2596-2615, 2597-2612, 2597-2613, 2597-2614, 2597-2615, 2597-2616,
2598-2613, 2598-2613, 2598-2614, 2598-2615, 2598-2616, 2598-2617,
2599-2614, 2599-2617, 2599-2618, 2600-2615, 2600-2617, 2600-2618,
2600-2619, 2601-2616, 2601-2617, 2601-2619, 2601-2620, 2602-2618,
2602-2621, 2603-2620, 2603-2621, 2603-2622, 2604-2619, 2604-2620,
2604-2621, 2604-2622, 2604-2623, 2605-2620, 2605-2621, 2605-2622,
2605-2623, 2605-2624, 2606-2621, 2606-2622, 2606-2623, 2606-2624,
2606-2625, 2607-2622, 2607-2623, 2607-2624, 2607-2625, 2607-2626,
2608-2623, 2608-2624, 2608-2625, 2608-2627, 2609-2624, 2609-2626,
2609-2627, 2609-2628, 2610-2625, 2610-2626, 2610-2628, 2610-2629,
2611-2626, 2611-2627, 2611-2629, 2611-2630, 2612-2627, 2612-2628,
2612-2630, 2612-2631, 2613-2628, 2613-2629, 2613-2631, 2614-2629,
2614-2630, 2614-2631, 2615-2630, and 2616-2631.
[0131] In certain embodiments, the following nucleotide regions of
SEQ ID NO: 2, when targeted by antisense compounds or
oligonucleotides, display at least 80% inhibition: 1685-1704,
1686-1705, 1873-1892, 1875-1890, 1877-1892, 1879-1894, 3819-3838,
4151-4166, 5904-5923, 6406-6425, 6985-7000, 7692-7707, 7694-7709,
7696-7711, 7786-7801, 7788-7805, 7788-7806, 7788-7807, 7789-7808,
7790-7807, 7790-7809, 7791-7808, 7791-7809, 7791-7810, 7792-7809,
7792-7811, 7793-7810, 7793-7811, 7794-7812, 7794-7813, 7795-7812,
7795-7813, 7795-7814, 7796-7813, 7796-7814, 7796-7815, 7797-7812,
7797-7814, 7797-7816, 7798-7815, 7798-7817, 7799-7816, 7799-7818,
7800-7819, 7801-7818, 7802-7819, 7802-7821, 7803-7820, 7803-7822,
7804-7821, 7804-7823, 7805-7822, 7806-7823, 7806-7825, 7807-7824,
7807-7826, 7808-7825, 7808-7827, 7809-7826, 7809-7828, 7810-7827,
7811-7828, 7812-7829, 7812-7831, 7813-7832, 7814-7833, 7815-7834,
7816-7832, 7816-7835, 7817-7836, 7818-7837, 7819-7838, 7820-7839,
7821-7840, 7822-7841, 7823-7842, 7824-7843, 7825-7841, 7825-7842,
7825-7844, 7826-7845, 7827-7846, 7828-7843, 7828-7847, 7829-7848,
7830-7846, 7830-7849, 7831-7850, 7832-7847, 7832-7848, 7832-7849,
7832-7850, 7832-7851, 7833-7848, 7833-7849, 7833-7850, 7833-7851,
7833-7852, 7834-7849, 7834-7852, 7834-7853, 7835-7850, 7835-7852,
7835-7853, 7835-7854, 7836-7851, 7836-7852, 7836-7854, 7836-7855,
7837-7853, 7837-7856, 7838-7855, 7838-7856, 7838-7857, 7839-7854,
7839-7855, 7839-7856, 7839-7857, 7839-7858, 7840-7855, 7840-7856,
7840-7857, 7840-7858, 7840-7859, 7841-7856, 7841-7857, 7841-7858,
7841-7859, 7841-7860, 7842-7857, 7842-7858, 7842-7859, 7842-7860,
7842-7861, 7843-7858, 7843-7859, 7843-7860, 7843-7862, 7844-7859,
7844-7861, 7844-7862, 7845-7860, 7845-7861, 7846-7862, and
7847-7862.
[0132] In certain embodiments, the following nucleotide regions of
SEQ ID NO: 1, when targeted by antisense compounds or
oligonucleotides, display at least 90% inhibition: 154-169,
156-171, 158-173, 1135-1154, 1171-1186, 1173-1188, 1763-1782,
1912-1931, 2223-2238, 2227-2242, 2459-2474, 2461-2476, 2554-2573,
2555-2574, 2560-2577, 2561-2578, 2561-2579, 2562-2581, 2563-2580,
2563-2582, 2564-2581, 2566-2583, 2567-2584, 2568-2585, 2568-2587,
2569-2586, 2570-2587, 2576-2593, 2577-2594, 2577-2596, 2578-2597,
2580-2599, 2581-2600, 2582-2601, 2583-2602, 2584-2603, 2586-2605,
2587-2605, 2587-2606, 2588-2607, 2589-2608, 2590-2607, 2590-2609,
2592-2611, 2595-2614, 2596-2615, 2597-2612, 2597-2613, 2597-2615,
2597-2616, 2598-2613, 2598-2613, 2598-2617, 2599-2614, 2599-2618,
2600-2615, 2600-2619, 2601-2617, 2601-2620, 2602-2621, 2603-2622,
2604-2623, 2605-2621, 2605-2622, 2605-2624, 2606-2625, 2607-2626,
2608-2623, 2608-2625, 2609-2628, 2611-2627, 2611-2630, 2612-2628,
2612-2631, 2613-2629, 2614-2629, 2615-2630, and 2616-2631.
[0133] In certain embodiments, the following nucleotide regions of
SEQ ID NO: 2, when targeted by antisense compounds or
oligonucleotides, display at least 90% inhibition: 1685-1704,
1686-1705, 1875-1890, 1877-1892, 1879-1894, 3819-3838, 5904-5923,
6406-6425, 7694-7709, 7696-7711, 7789-7808, 7790-7809, 7795-7812,
7795-7813, 7796-7813, 7796-7814, 7797-7814, 7797-7816, 7798-7815,
7798-7817, 7799-7816, 7801-7818, 7802-7819, 7803-7820, 7803-7822,
7804-7821, 7805-7822, 7811-7828, 7812-7829, 7812-7831, 7813-7832,
7815-7834, 7818-7837, 7819-7838, 7821-7840, 7822-7840, 7822-7841,
7825-7842, 7832-7847, 7832-7848, 7832-7850, 7833-7848, 7833-7852,
7834-7849, 7834-7853, 7835-7850, 7836-7852, 7836-7855, 7837-7856,
7838-7856, 7839-7857, 7839-7858, 7840-7856, 7840-7857, 7840-7859,
7843-7858, 7843-7860, and 7846-7862.
[0134] In certain embodiments, the following antisense compounds or
oligonucleotides target a region of a CFB nucleic acid and effect
at least a 50% inhibition of a CFB mRNA, ISIS NOs: 516350, 532614,
532632, 532635, 532638, 532639, 532686, 532687, 532688, 532689,
532690, 532691, 532692, 532692, 532693, 532694, 532695, 532696,
532697, 532698, 532699, 532700, 532701, 532702, 532703, 532704,
532705, 532706, 532707, 532770, 532775, 532778, 532780, 532791,
532800, 532809, 532810, 532811, 532917, 532952, 588509, 588510,
588511, 588512, 588513, 588514, 588515, 588516, 588517, 588518,
588519, 588520, 588522, 588523, 588524, 588525, 588527, 588528,
588529, 588530, 588531, 588532, 588533, 588534, 588535, 588536,
588537, 588538, 588539, 588540, 588541, 588542, 588543, 588544,
588545, 588546, 588547, 588548, 588549, 588550, 588551, 588552,
588553, 588554, 588555, 588556, 588557, 588558, 588559, 588560,
588561, 588562, 588563, 588564, 588565, 588566, 588567, 588568,
588569, 588570, 588571, 588572, 588573, 588574, 588575, 588576,
588577, 588580, 588581, 588585, 588586, 588589, 588590, 588599,
588603, 588606, 588608, 588610, 588614, 588616, 588628, 588631,
588632, 588634, 588636, 588638, 588640, 588645, 588646, 588654,
588656, 588658, 588660, 588662, 588664, 588670, 588672, 588676,
588682, 588688, 588696, 588698, 588807, 588808, 588809, 588813,
588814, 588815, 588819, 588820, 588822, 588823, 588838, 588839,
588840, 588841, 588842, 588846, 588847, 588848, 588849, 588850,
588851, 588852, 588853, 588854, 588855, 588856, 588857, 588858,
588859, 588860, 588861, 588862, 588863, 588864, 588865, 588866,
588867, 588868, 588870, 588871, 588872, 588873, 588874, 588875,
588876, 588877, 588878, 588879, 588880, 588881, 588882, 588883,
588884, 598999, 599000, 599001, 599002, 599003, 599004, 599005,
599006, 599007, 599008, 599009, 599010, 599011, 599012, 599013,
599014, 599015, 599018, 599019, 599023, 599024, 599025, 599026,
599027, 599028, 599029, 599030, 599031, 599032, 599033, 599034,
599035, 599058, 599062, 599063, 599064, 599065, 599070, 599071,
599072, 599073, 599074, 599076, 599077, 599078, 599079, 599080,
599081, 599082, 599083, 599084, 599085, 599086, 599087, 599088,
599089, 599090, 599091, 599092, 599093, 599094, 599095, 599096,
599097, 599098, 599102, 599119, 599123, 599124, 599125, 599126,
599127, 599128, 599132, 599133, 599134, 599135, 599136, 599137,
599138, 599139, 599140, 599141, 599142, 599143, 599144, 599145,
599147, 599148, 599149, 599150, 599151, 599152, 599153, 599154,
599155, 599156, 599157, 599158, 599159, 599178, 599179, 599180,
599181, 599182, 599186, 599187, 599188, 599189, 599190, 599191,
599192, 599193, 599194, 599195, 599196, 599197, 599198, 599199,
599200, 599201, 599202, 599203, 599204, 599205, 599206, 599207,
599208, 599209, 599210, 599211, 599212, 599213, 599214, 599215,
599216, 599217, 599218, 599219, 599220, 599221, 599221, 599222,
599223, 599224, 599225, 599226, 599227, 599228, 599229, 599230,
599231, 599232, 599233, 599234, 599235, 599236, 599241, 599247,
599248, 599249, 599255, 599256, 599257, 599258, 599260, 599261,
599262, 599263, 599264, 599265, 599266, 599267, 599268, 599269,
599270, 599271, 599272, 599273, 599274, 599275, 599276, 599277,
599278, 599279, 599280, 599297, 599299, 599306, 599307, 599308,
599309, 599311, 599312, 599313, 599314, 599315, 599316, 599317,
599318, 599319, 599320, 599321, 599322, 599323, 599324, 599325,
599326, 599327, 599328, 599329, 599330, 599338, 599349, 599353,
599354, 599355, 599356, 599357, 599358, 599359, 599360, 599361,
599362, 599363, 599364, 599369, 599371, 599372, 599373, 599376,
599378, 599379, 599382, 599383, 599384, 599385, 599386, 599387,
599388, 599389, 599390, 599391, 599392, 599393, 599394, 599395,
599396, 599397, 599398, 599399, 599400, 599401, 599402, 599403,
599404, 599405, 599406, 599407, 599408, 599409, 599410, 599412,
599413, 599414, 599415, 599416, 599417, 599418, 599419, 599420,
599421, 599422, 599423, 599424, 599425, 599426, 599433, 599434,
599435, 599436, 599437, 599438, 599439, 599440, 599441, 599442,
599443, 599444, 599445, 599446, 599447, 599448, 599450, 599454,
599455, 599456, 599467, 599468, 599469, 599471, 599472, 599473,
599474, 599475, 599476, 599477, 599478, 599479, 599480, 599481,
599482, 599483, 599484, 599485, 599486, 599487, 599488, 599489,
599490, 599491, 599492, 599493, 599494, 599495, 599496, 599497,
599498, 599499, 599500, 599501, 599502, 599503, 599504, 599505,
599506, 599507, 599508, 599509, 599512, 599515, 599518, 599531,
599541, 599541, 599546, 599547, 599548, 599549, 599550, 599552,
599553, 599554, 599555, 599557, 599558, 599561, 599562, 599563,
599564, 599565, 599566, 599567, 599568, 599569, 599570, 599577,
599578, 599579, 599580, 599581, 599581, 599582, 599584, 599585,
599586, 599587, 599588, 599589, 599590, 599591, 599592, 599593,
599594, 599595, 601321, 601322, 601323, 601325, 601327, 601328,
601329, 601330, 601332, 601333, 601334, 601335, 601336, 601337,
601338, 601339, 601341, 601342, 601343, 601344, 601345, 601346,
601347, 601348, 601349, 601362, 601367, 601368, 601369, 601371,
601372, 601373, 601374, 601375, 601377, 601378, 601380, 601381,
601382, 601383, 601384, 601385, 601386, 601387, and 601388.
[0135] In certain embodiments, the following antisense compounds or
oligonucleotides target a region of a CFB nucleic acid and effect
at least a 50% inhibition of a CFB mRNA, SEQ ID NOs: 12, 30, 33,
36, 37, 84, 85, 86, 87, 88, 89, 90, 90, 91, 92, 93, 94, 95, 96, 97,
98, 99, 100, 101, 102, 103, 104, 105, 198, 203, 206, 208, 219, 228,
237, 238, 239, 317, 395, 396, 397, 398, 399, 400, 401, 402, 403,
404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416,
417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429,
430, 431, 432, 433, 434, 434, 435, 436, 437, 438, 439, 440, 441,
442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454,
455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 468, 472,
473, 475, 478, 479, 488, 492, 494, 495, 498, 499, 500, 502, 503,
509, 510, 511, 512, 513, 514, 515, 517, 518, 522, 523, 524, 525,
529, 530, 531, 534, 535, 537, 540, 541, 542, 543, 544, 545, 546,
547, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 563,
564, 565, 569, 570, 572, 573, 577, 588, 589, 590, 591, 592, 594,
595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607,
608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 623,
640, 641, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654,
655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667,
668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680,
681, 682, 683, 684, 685, 686, 687, 688, 689, 700, 704, 705, 706,
707, 708, 709, 711, 712, 713, 714, 715, 716, 717, 718, 720, 721,
722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734,
735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 745, 746,
747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 758, 759, 760,
761, 762, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776,
777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789,
790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 813, 833, 834,
841, 846, 849, 850, 867, and 873.
[0136] In certain embodiments, the following antisense compounds or
oligonucleotides target a region of a CFB nucleic acid and effect
at least a 60% inhibition of a CFB mRNA, ISIS NOs: 516350, 532614,
532635, 532686, 532687, 532688, 532689, 532770, 532800, 532809,
532810, 532811, 532917, 532952, 588512, 588513, 588514, 588515,
588516, 588517, 588518, 588519, 588522, 588523, 588524, 588525,
588527, 588528, 588529, 588530, 588531, 588532, 588533, 588534,
588535, 588536, 588537, 588538, 588539, 588540, 588541, 588542,
588543, 588544, 588545, 588546, 588547, 588548, 588549, 588550,
588551, 588552, 588553, 588554, 588555, 588556, 588557, 588558,
588559, 588560, 588561, 588562, 588563, 588564, 588565, 588566,
588567, 588568, 588569, 588570, 588571, 588572, 588573, 588574,
588575, 588576, 588577, 588636, 588638, 588640, 588664, 588676,
588696, 588698, 588807, 588808, 588814, 588815, 588819, 588820,
588840, 588842, 588846, 588847, 588848, 588849, 588850, 588851,
588852, 588853, 588854, 588855, 588856, 588857, 588858, 588859,
588860, 588861, 588862, 588863, 588864, 588866, 588867, 588868,
588870, 588871, 588872, 588873, 588874, 588875, 588876, 588877,
588878, 588879, 588880, 588881, 588882, 588883, 588884, 598999,
599000, 599001, 599002, 599003, 599004, 599005, 599006, 599007,
599008, 599009, 599010, 599011, 599012, 599013, 599014, 599015,
599019, 599024, 599025, 599026, 599027, 599028, 599029, 599030,
599031, 599032, 599033, 599034, 599035, 599064, 599065, 599071,
599072, 599077, 599078, 599079, 599080, 599083, 599084, 599085,
599086, 599087, 599088, 599089, 599090, 599091, 599092, 599093,
599094, 599095, 599096, 599097, 599125, 599126, 599127, 599133,
599134, 599135, 599136, 599138, 599139, 599140, 599141, 599142,
599148, 599149, 599150, 599151, 599152, 599154, 599155, 599156,
599157, 599158, 599159, 599178, 599179, 599180, 599181, 599187,
599188, 599190, 599192, 599193, 599194, 599195, 599196, 599197,
599198, 599199, 599200, 599201, 599202, 599203, 599204, 599205,
599206, 599207, 599208, 599209, 599210, 599211, 599212, 599213,
599214, 599215, 599216, 599217, 599218, 599219, 599220, 599221,
599222, 599223, 599224, 599225, 599226, 599227, 599228, 599229,
599230, 599231, 599232, 599233, 599234, 599235, 599236, 599247,
599255, 599256, 599257, 599263, 599264, 599265, 599266, 599270,
599271, 599272, 599273, 599274, 599275, 599276, 599277, 599278,
599279, 599280, 599306, 599307, 599308, 599311, 599312, 599313,
599314, 599315, 599316, 599317, 599318, 599319, 599320, 599321,
599322, 599323, 599324, 599325, 599327, 599328, 599329, 599330,
599349, 599353, 599355, 599356, 599357, 599358, 599359, 599360,
599361, 599362, 599363, 599364, 599369, 599371, 599372, 599373,
599376, 599378, 599379, 599382, 599384, 599386, 599387, 599388,
599389, 599390, 599391, 599392, 599393, 599394, 599395, 599396,
599397, 599398, 599399, 599400, 599401, 599402, 599403, 599404,
599405, 599406, 599407, 599408, 599409, 599410, 599412, 599413,
599414, 599415, 599416, 599417, 599418, 599419, 599420, 599421,
599422, 599423, 599424, 599425, 599433, 599434, 599435, 599436,
599437, 599438, 599439, 599440, 599441, 599442, 599443, 599444,
599445, 599446, 599447, 599448, 599456, 599467, 599468, 599471,
599472, 599473, 599474, 599475, 599476, 599477, 599478, 599479,
599480, 599481, 599482, 599483, 599484, 599485, 599486, 599487,
599488, 599489, 599490, 599491, 599492, 599493, 599494, 599495,
599496, 599497, 599498, 599499, 599500, 599501, 599502, 599503,
599504, 599505, 599506, 599507, 599508, 599512, 599531, 599547,
599548, 599549, 599552, 599553, 599554, 599555, 599557, 599558,
599562, 599563, 599564, 599565, 599566, 599567, 599568, 599569,
599570, 599577, 599578, 599579, 599580, 599581, 599582, 599584,
599585, 599586, 599587, 599588, 599589, 599590, 599591, 599592,
599593, 599594, 599595, 601323, 601327, 601329, 601332, 601333,
601333, 601334, 601335, 601336, 601338, 601339, 601341, 601342,
601343, 601344, 601345, 601346, 601347, 601348, 601349, 601368,
601369, 601371, 601372, 601374, 601375, 601377, 601378, 601380,
601381, 601382, 601383, 601384, 601385, 601386, 601387, and
601388.
[0137] In certain embodiments, the following antisense compounds or
oligonucleotides target a region of a CFB nucleic acid and effect
at least a 60% inhibition of a CFB mRNA, SEQ ID NOs: 12, 33, 84,
85, 86, 87, 198, 228, 237, 238, 239, 317, 395, 396, 397, 398, 399,
400, 401, 402, 403, 404, 405, 406, 407, 408, 410, 411, 412, 413,
414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426,
427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439,
440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452,
453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465,
472, 473, 513, 514, 515, 531, 537, 541, 542, 543, 544, 545, 546,
547, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 564, 565,
569, 570, 577, 590, 592, 595, 596, 597, 598, 599, 600, 601, 602,
603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615,
616, 617, 618, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653,
654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666,
667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679,
680, 682, 683, 684, 685, 686, 687, 688, 689, 700, 704, 706, 707,
708, 709, 711, 712, 713, 714, 715, 716, 717, 720, 721, 722, 723,
724, 725, 726, 727, 727, 728, 729, 730, 731, 732, 733, 734, 736,
737, 738, 739, 740, 741, 742, 743, 744, 745, 745, 746, 747, 748,
749, 750, 751, 752, 753, 754, 755, 756, 758, 759, 760, 761, 767,
768, 770, 772, 773, 774, 775, 775, 776, 776, 777, 777, 778, 779,
780, 781, 782, 783, 783, 784, 784, 785, 786, 787, 788, 789, 790,
791, 792, 793, 794, 795, 796, 797, 798, 799, 813, 833, 834, 841,
846, 849, and 850.
[0138] In certain embodiments, the following antisense compounds or
oligonucleotides target a region of a CFB nucleic acid and effect
at least a 70% inhibition of a CFB mRNA, ISIS NOs: 516350, 532614,
532686, 532687, 532688, 532770, 532800, 532809, 532810, 532811,
532917, 532952, 588512, 588513, 588514, 588515, 588516, 588517,
588518, 588524, 588529, 588530, 588531, 588532, 588533, 588534,
588535, 588536, 588537, 588538, 588539, 588540, 588541, 588542,
588543, 588544, 588545, 588546, 588547, 588548, 588549, 588550,
588551, 588552, 588553, 588554, 588555, 588556, 588557, 588558,
588559, 588560, 588561, 588562, 588563, 588564, 588565, 588568,
588569, 588570, 588571, 588572, 588573, 588574, 588575, 588577,
588636, 588638, 588640, 588696, 588698, 588807, 588814, 588815,
588819, 588842, 588847, 588848, 588849, 588850, 588851, 588852,
588853, 588856, 588857, 588858, 588859, 588860, 588861, 588862,
588863, 588866, 588867, 588870, 588871, 588872, 588873, 588874,
588875, 588876, 588877, 588878, 588879, 588880, 588881, 588882,
588883, 588884, 599000, 599001, 599003, 599004, 599005, 599008,
599009, 599010, 599011, 599014, 599015, 599024, 599025, 599027,
599028, 599029, 599030, 599031, 599032, 599033, 599034, 599072,
599077, 599080, 599085, 599086, 599087, 599088, 599089, 599090,
599091, 599093, 599094, 599095, 599096, 599097, 599125, 599126,
599134, 599138, 599139, 599148, 599149, 599150, 599151, 599152,
599154, 599155, 599156, 599157, 599158, 599187, 599188, 599193,
599195, 599196, 599197, 599198, 599199, 599200, 599201, 599202,
599203, 599204, 599205, 599206, 599207, 599208, 599210, 599211,
599212, 599213, 599214, 599215, 599216, 599217, 599218, 599219,
599220, 599221, 599222, 599223, 599224, 599225, 599226, 599227,
599228, 599229, 599230, 599231, 599232, 599233, 599234, 599235,
599236, 599266, 599272, 599272, 599273, 599274, 599275, 599277,
599278, 599279, 599280, 599280, 599306, 599311, 599312, 599313,
599314, 599315, 599316, 599317, 599318, 599319, 599320, 599321,
599322, 599323, 599325, 599327, 599328, 599329, 599330, 599355,
599357, 599358, 599359, 599360, 599361, 599362, 599363, 599364,
599369, 599371, 599372, 599373, 599378, 599379, 599382, 599384,
599386, 599387, 599388, 599389, 599390, 599391, 599392, 599393,
599394, 599395, 599396, 599397, 599398, 599399, 599400, 599401,
599402, 599403, 599404, 599405, 599406, 599407, 599408, 599409,
599410, 599413, 599414, 599415, 599416, 599417, 599418, 599419,
599420, 599421, 599422, 599423, 599424, 599433, 599434, 599435,
599436, 599437, 599438, 599439, 599440, 599441, 599442, 599443,
599445, 599446, 599447, 599448, 599472, 599473, 599474, 599475,
599476, 599477, 599478, 599479, 599480, 599481, 599482, 599483,
599484, 599485, 599486, 599487, 599488, 599489, 599490, 599491,
599492, 599493, 599494, 599495, 599496, 599497, 599498, 599499,
599500, 599501, 599502, 599503, 599504, 599505, 599506, 599507,
599508, 599512, 599547, 599548, 599552, 599553, 599554, 599555,
599558, 599562, 599563, 599564, 599566, 599567, 599568, 599569,
599570, 599577, 599578, 599579, 599580, 599581, 599582, 599585,
599586, 599587, 599588, 599589, 599590, 599591, 599592, 599593,
599594, 599595, 601332, 601335, 601341, 601343, 601344, 601345,
601346, 601347, 601348, 601349, 601371, 601372, 601380, 601382,
601383, 601384, 601385, 601386, and 601387.
[0139] In certain embodiments, the following antisense compounds or
oligonucleotides target a region of a CFB nucleic acid and effect
at least a 70% inhibition of a CFB mRNA, SEQ ID NOs: 12, 84, 85,
86, 198, 228, 237, 238, 239, 317, 395, 396, 397, 398, 399, 402,
403, 404, 405, 407, 408, 410, 411, 412, 412, 413, 414, 415, 416,
417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429,
430, 431, 432, 433, 433, 434, 435, 436, 437, 438, 439, 440, 441,
442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454,
455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 464, 465, 472,
473, 513, 514, 515, 541, 542, 543, 544, 545, 546, 547, 549, 550,
551, 552, 553, 554, 555, 556, 557, 564, 565, 569, 592, 595, 596,
597, 598, 599, 600, 601, 602, 603, 604, 606, 607, 608, 609, 610,
611, 612, 613, 614, 615, 616, 617, 618, 645, 646, 647, 648, 649,
650, 653, 654, 655, 656, 659, 660, 662, 663, 664, 665, 666, 668,
669, 670, 671, 672, 673, 674, 675, 676, 677, 677, 678, 679, 680,
682, 683, 684, 686, 687, 688, 689, 706, 708, 709, 711, 712, 713,
714, 715, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730,
731, 732, 733, 734, 736, 737, 738, 739, 740, 741, 742, 743, 744,
745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 767,
768, 773, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785,
786, 787, 788, 789, 790, 791, 792, 793, 793, 794, 795, 797, 798,
799, 813, 833, 834, 841, 846, 849, 867, and 873.
[0140] In certain embodiments, the following antisense compounds or
oligonucleotides target a region of a CFB nucleic acid and effect
at least an 80% inhibition of a CFB mRNA, ISIS NOs: 532686, 532809,
532810, 532811, 532917, 532952, 588512, 588517, 588518, 588533,
588534, 588535, 588536, 588537, 588538, 588539, 588540, 588542,
588543, 588544, 588545, 588546, 588547, 588548, 588549, 588550,
588551, 588552, 588553, 588554, 588555, 588556, 588557, 588558,
588559, 588560, 588561, 588562, 588563, 588564, 588565, 588571,
588638, 588640, 588696, 588698, 588807, 588814, 588849, 588850,
588851, 588853, 588857, 588858, 588859, 588860, 588861, 588862,
588863, 588866, 588867, 588871, 588872, 588873, 588874, 588875,
588876, 588877, 588878, 588879, 588880, 588881, 588882, 588883,
599001, 599024, 599025, 599033, 599086, 599087, 599088, 599089,
599093, 599094, 599095, 599096, 599134, 599139, 599148, 599149,
599151, 599154, 599155, 599156, 599158, 599188, 599195, 599196,
599198, 599201, 599202, 599203, 599204, 599205, 599206, 599207,
599212, 599213, 599215, 599216, 599217, 599218, 599219, 599220,
599221, 599222, 599223, 599224, 599225, 599226, 599227, 599228,
599229, 599230, 599231, 599232, 599233, 599234, 599235, 599236,
599272, 599273, 599275, 599277, 599278, 599279, 599280, 599311,
599313, 599314, 599316, 599317, 599318, 599320, 599321, 599322,
599323, 599327, 599328, 599329, 599330, 599355, 599357, 599358,
599359, 599360, 599361, 599362, 599363, 599364, 599371, 599372,
599373, 599378, 599379, 599382, 599384, 599386, 599387, 599388,
599389, 599390, 599391, 599392, 599393, 599397, 599398, 599399,
599400, 599401, 599403, 599404, 599405, 599407, 599408, 599409,
599410, 599413, 599414, 599415, 599416, 599417, 599418, 599419,
599420, 599421, 599422, 599423, 599424, 599433, 599434, 599435,
599436, 599437, 599438, 599439, 599440, 599441, 599445, 599446,
599447, 599448, 599474, 599476, 599477, 599479, 599481, 599482,
599483, 599485, 599486, 599487, 599488, 599489, 599490, 599491,
599492, 599494, 599495, 599496, 599497, 599498, 599499, 599500,
599502, 599503, 599504, 599505, 599506, 599507, 599508, 599547,
599552, 599553, 599554, 599558, 599563, 599567, 599568, 599569,
599570, 599577, 599578, 599581, 599582, 599585, 599587, 599588,
599590, 599591, 599592, 599593, 599594, 601332, 601344, 601345,
601382, 601383, and 601385.
[0141] In certain embodiments, the following antisense compounds or
oligonucleotides target a region of a CFB nucleic acid and effect
at least a 80% inhibition of a CFB mRNA, SEQ ID NOs: 84, 237, 238,
239, 317, 395, 397, 411, 412, 413, 414, 415, 417, 418, 419, 420,
421, 422, 423, 425, 426, 427, 429, 430, 431, 433, 434, 435, 436,
437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449,
450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462,
463, 464, 465, 472, 473, 514, 515, 542, 543, 544, 545, 546, 547,
550, 551, 552, 553, 554, 555, 556, 557, 564, 595, 599, 600, 601,
602, 603, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616,
617, 618, 646, 655, 660, 662, 663, 666, 669, 670, 671, 672, 673,
675, 676, 677, 678, 679, 682, 684, 686, 687, 688, 689, 706, 708,
709, 711, 712, 713, 714, 715, 720, 722, 723, 724, 725, 726, 727,
729, 730, 731, 732, 733, 736, 737, 738, 739, 740, 741, 742, 743,
744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756,
768, 775, 776, 778, 781, 782, 783, 784, 785, 787, 788, 789, 790,
791, 792, 793, 794, 799, 813, 833, 834, 841, 849, 867, and 873.
[0142] In certain embodiments, the following antisense compounds or
oligonucleotides target a region of a CFB nucleic acid and effect
at least a 90% inhibition of a CFB mRNA, ISIS NOs: 532686, 532811,
532917, 588536, 588537, 588538, 588539, 588544, 588545, 588546,
588548, 588551, 588552, 588553, 588554, 588555, 588556, 588557,
588558, 588559, 588560, 588561, 588562, 588564, 588638, 588640,
588696, 588698, 588849, 588850, 588851, 588860, 588866, 588867,
588872, 588873, 588874, 588876, 588877, 588878, 588879, 588881,
588883, 599149, 599188, 599203, 599206, 599220, 599221, 599222,
599223, 599224, 599225, 599226, 599227, 599228, 599229, 599235,
599236, 599279, 599280, 599314, 599321, 599362, 599378, 599390,
599391, 599398, 599399, 599404, 599413, 599414, 599416, 599419,
599420, 599422, 599435, 599437, 599438, 599441, 599483, 599494,
599508, 599552, 599553, 599554, 599568, 599570, 599577, 599581,
599591, 599592, and 599593.
[0143] In certain embodiments, the following antisense compounds or
oligonucleotides target a region of a CFB nucleic acid and effect
at least a 90% inhibition of a CFB mRNA, SEQ ID NOs: 84, 238, 239,
317, 412, 413, 420, 421, 426, 434, 436, 437, 438, 439, 440, 442,
443, 444, 445, 446, 448, 451, 452, 453, 454, 455, 456, 457, 458,
459, 460, 461, 462, 464, 465, 472, 473, 514, 515, 542, 543, 544,
545, 546, 551, 553, 555, 556, 599, 600, 601, 602, 610, 616, 617,
618, 662, 666, 670, 676, 677, 678, 688, 689, 713, 723, 729, 730,
740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 755, 756, 768,
783, 793, 833, and 867.
[0144] In certain embodiments, a compound comprises a modified
oligonucleotide consisting of 10 to 30 linked nucleosides
complementary within nucleotides 2193-2212, 2195-2210, 2457-2476,
2571-2590, 2584-2603, 2588-2607, 2592-2611, 2594-2613, 2597-2616,
2600-2619, or 2596-2611 of SEQ ID NO: 1.
[0145] In certain embodiments, a compound comprises a modified
oligonucleotide consisting of 10 to 30 linked nucleosides having a
nucleobase sequence comprising any one of SEQ ID NOs: 198, 228,
237, 440, 444, 448, 450, 453, 455, 549, and 598.
[0146] In certain embodiments, a compound comprises a modified
oligonucleotide having a nucleobase sequence consisting of any one
of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549,
and 598.
[0147] In certain embodiments, any of the foregoing compounds or
oligonucleotides comprises at least one modified internucleoside
linkage, at least one modified sugar, and/or at least one modified
nucleobase.
[0148] In certain embodiments, any of the foregoing compounds or
oligonucleotides comprises at least one modified sugar. In certain
embodiments, at least one modified sugar comprises a
2'-O-methoxyethyl group. In certain embodiments, at least one
modified sugar is a bicyclic sugar, such as a 4'-CH(CH.sub.3)--O-2'
group, a 4'-CH.sub.2--O-2' group, or a
4'-(CH.sub.2).sub.2--O-2'group.
[0149] In certain embodiments, the modified oligonucleotide
comprises at least one modified internucleoside linkage, such as a
phosphorothioate internucleoside linkage.
[0150] In certain embodiments, any of the foregoing compounds or
oligonucleotides comprises at least one modified nucleobase, such
as 5-methylcytosine.
[0151] In certain embodiments, any of the foregoing compounds or
oligonucleotides comprises: [0152] a gap segment consisting of
linked deoxynucleosides; [0153] a 5' wing segment consisting of
linked nucleosides; and [0154] a 3' wing segment consisting of
linked nucleosides;
[0155] wherein the gap segment is positioned between the 5' wing
segment and the 3' wing segment and wherein each nucleoside of each
wing segment comprises a modified sugar. In certain embodiments,
the oligonucleotide consists of 10 to 30 linked nucleosides having
a nucleobase sequence comprising the sequence recited in SEQ ID NO:
198, 228, 237, 440, 444, 448, 450, 453, 455, 549, or 598.
[0156] In certain embodiments, the modified oligonucleotide has a
nucleobase sequence comprising the sequence recited in SEQ ID NO:
198, 228, 237, 440, 444, 448, 450, 453, or 455, wherein the
modified oligonucleotide comprises
[0157] a gap segment consisting often linked deoxynucleosides;
[0158] a 5' wing segment consisting of five linked nucleosides;
and
[0159] a 3' wing segment consisting of five linked nucleosides;
[0160] wherein the gap segment is positioned between the 5' wing
segment and the 3' wing segment, wherein each nucleoside of each
wing segment comprises a 2'-O-methoxyethyl sugar; wherein each
internucleoside linkage is a phosphorothioate linkage and wherein
each cytosine is a 5-methylcytosine.
[0161] In certain embodiments, a compound comprises or consists of
a single-stranded modified oligonucleotide consisting of 20 linked
nucleosides having a nucleobase sequence consisting of the sequence
recited in SEQ ID NO: 198, 228, 237, 440, 444, 448, 450, 453, or
455, wherein the oligonucleotide comprises:
[0162] a gap segment consisting often linked deoxynucleosides;
[0163] a 5' wing segment consisting of five linked nucleosides;
and
[0164] a 3' wing segment consisting of five linked nucleosides;
[0165] wherein the gap segment is positioned between the 5' wing
segment and the 3' wing segment, wherein each nucleoside of each
wing segment comprises a 2'-O-methoxyethyl sugar; wherein each
internucleoside linkage is a phosphorothioate linkage; and wherein
each cytosine is a 5-methylcytosine.
[0166] In certain embodiments, a compound comprises ISIS 588540. In
certain embodiments, a compound consists of ISIS 588540. In certain
embodiments, ISIS 588540 has the following chemical structure:
##STR00002##
[0167] In certain embodiments, a compound comprises or consists of
a single-stranded modified oligonucleotide consisting of 16 linked
nucleosides having a nucleobase sequence consisting of the sequence
recited in SEQ ID NO: 549, wherein the modified oligonucleotide
comprises a gap segment consisting often linked
deoxynucleosides;
[0168] a 5' wing segment consisting of three linked nucleosides;
and
[0169] a 3' wing segment consisting of three linked
nucleosides;
[0170] wherein the gap segment is positioned between the 5' wing
segment and the 3' wing segment; wherein each nucleoside of each
wing segment comprises a cEt sugar; wherein each internrnucleoside
linkage is a phosphorothioate linkage; and wherein each cytosine is
a 5-methylcytosine.
[0171] In certain embodiments, a compound comprises or consists of
a single-stranded modified oligonucleotide consisting of 16 linked
nucleosides having a nucleobase sequence comprising the sequence
recited in SEQ ID NO: 598, wherein the modified oligonucleotide
comprises
[0172] a gap segment consisting often linked deoxynucleosides;
[0173] a 5' wing segment consisting of three linked nucleosides;
and
[0174] a 3' wing segment consisting of three linked
nucleosides;
[0175] wherein the gap segment is positioned between the 5' wing
segment and the 3' wing segment; wherein the 5' wing segment
comprises a 2'-O-methoxyethyl sugar, 2'-O-methoxyethyl sugar, and
cEt sugar in the 5' to 3' direction; wherein the 3' wing segment
comprises a cEt sugar, cEt sugar, and 2'-O-methoxyethyl sugar in
the 5' to 3' direction; wherein each internucleoside linkage is a
phosphorothioate linkage; and wherein each cytosine is a
5-methylcytosine.
[0176] In any of the foregoing embodiments, the compound or
oligonucleotide can be at least 85%, at least 90%, at least 95%, at
least 98%, at least 99%, or 100% complementary to a nucleic acid
encoding CFB.
[0177] In any of the foregoing embodiments, the compound or
oligonucleotide can be single-stranded.
[0178] In certain embodiments, the compounds or compositions as
described herein are efficacious by virtue of having at least one
of an in vitro IC.sub.50 of less than 250 nM, less than 200 nM,
less than 150 nM, less than 100 nM, less than 90 nM, less than 80
nM, less than 70 nM, less than 65 nM, less than 60 nM, less than 55
nM, less than 50 nM, less than 45 nM, less than 40 nM, less than 35
nM, less than 30 nM, less than 25 nM, or less than 20 nM.
[0179] In certain embodiments, the compounds or compositions as
described herein are highly tolerable as demonstrated by having at
least one of an increase an ALT or AST value of no more than 4
fold, 3 fold, or 2 fold over saline treated animals or an increase
in liver, spleen, or kidney weight of no more than 30%, 20%, 15%,
12%, 10%, 5%, or 2%. In certain embodiments, the compounds or
compositions as described herein are highly tolerable as
demonstrated by having no increase of ALT or AST over saline
treated animals. In certain embodiments, the compounds or
compositions as described herein are highly tolerable as
demonstrated by having no increase in liver, spleen, or kidney
weight over saline treated animals.
[0180] Certain embodiments provide a composition comprising the
compound of any of the aforementioned embodiments or salt thereof
and at least one of a pharmaceutically acceptable carrier or
diluent. In certain embodiments, the composition has a viscosity
less than about 40 centipoise (cP), less than about 30 centipose
(cP), less than about 20 centipose (cP), less than about 15
centipose (cP), or less than about 10 centipose (cP). In certain
embodiments, the composition having any of the aforementioned
viscosities comprises a compound provided herein at a concentration
of about 100 mg/mL, about 125 mg/mL, about 150 mg/mL, about 175
mg/mL, about 200 mg/mL, about 225 mg/mL, about 250 mg/mL, about 275
mg/mL, or about 300 mg/mL. In certain embodiments, the composition
having any of the aforementioned viscosities and/or compound
concentrations has a temperature of room temperature or about
20.degree. C., about 21.degree. C., about 22.degree. C., about
23.degree. C., about 24.degree. C., about 25.degree. C., about
26.degree. C., about 27.degree. C., about 28.degree. C., about
29.degree. C., or about 30.degree. C.
[0181] In certain embodiments, a method of treating, preventing, or
ameliorating a disease associated with dysregulation of the
complement alternative pathway in a subject comprises administering
to the subject a specific inhibitor of Complement Factor B (CFB),
thereby treating, preventing, or ameliorating the disease. In
certain embodiments, the complement alternative pathway is
activated greater than normal. In certain embodiments, the CFB
specific inhibitor is an antisense compound targeted to CFB, such
as an antisense oligonucleotide targeted to CFB. In certain
embodiments, the CFB specific inhibitor is a compound comprising or
consisting of modified oligonucleotide consisting of 10 to 30
linked nucleosides and having a nucleobase sequence comprising at
least 8 contiguous nucleobases of any of the nucleobase sequences
of SEQ ID NOs: 6-808. In certain embodiments, the CFB specific
inhibitor is a compound comprising or consisting of a modified
oligonucleotide consisting of 10 to 30 linked nucleosides having a
nucleobase sequence comprising or consisting of any one of SEQ ID
NOs: 6-808. In certain embodiments, the CFB specific inhibitor is a
compound comprising or consisting of a modified oligonucleotide
consisting of 10 to 30 linked nucleosides having a nucleobase
sequence comprising or consisting of any one of SEQ ID NOs: 198,
228, 237, 440, 444, 448, 450, 453, 455, 549, and 598. In certain
embodiments, the CFB specific inhibitor is a compound comprising or
consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548,
588550, 588553, 588555, 588848, or 594430. In certain embodiments,
the CFB specific inhibitor is a compound comprising or consisting
of ISIS 588540, which has the following chemical structure:
##STR00003##
In certain embodiments, the disease is macular degeneration, such
as age related macular degeneration (AMD), which can be wet AMD or
dry AMD. In certain embodiments, dry AMD can be Geographic Atrophy.
In certain embodiments, the disease is a kidney disease such as
lupus nephritis, systemic lupus erythematosus (SLE), dense deposit
disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or
atypical hemolytic uremic syndrome (aHUS), or any combination
thereof.
[0182] In certain embodiments, a method of treating, preventing, or
ameliorating macular degeneration, such as age-related macular
degeneration (AMD) in a subject comprises administering to the
subject a CFB specific inhibitor, thereby treating, preventing, or
ameliorating AMD, such as wet AMD and dry AMD. In certain
embodiments, dry AMD can be Geographic Atrophy. Geographic Atrophy
is considered an advanced form of dry AMD involving degeneration of
the retina. In certain embodiments, the subject has a complement
alternative pathway that is activated greater than normal. In
certain embodiments, administering the antisense compound reduces
or inhibits accumulation of ocular C3 levels, such as C3 protein
levels. In certain embodiments, administering the antisense
compound reduces the level of ocular C3 deposits or inhibits
accumulation of ocular C3 deposits. In certain embodiments, the CFB
specific inhibitor is an antisense compound targeted to CFB, such
as an antisense oligonucleotide targeted to CFB. In certain
embodiments, the CFB specific inhibitor is a compound comprising or
consisting of modified oligonucleotide consisting of 10 to 30
linked nucleosides and having a nucleobase sequence comprising at
least 8 contiguous nucleobases of any of the nucleobase sequences
of SEQ ID NOs: 6-808. In certain embodiments, the CFB specific
inhibitor is a compound comprising or consisting of a modified
oligonucleotide consisting of 10 to 30 linked nucleosides having a
nucleobase sequence comprising or consisting of any one of SEQ ID
NOs: 6-808. In certain embodiments, the CFB specific inhibitor is a
compound comprising or consisting of a modified oligonucleotide
consisting of 10 to 30 linked nucleosides having a nucleobase
sequence comprising or consisting of any one of SEQ ID NOs: 198,
228, 237, 440, 444, 448, 450, 453, 455, 549, and 598. In certain
embodiments, the CFB specific inhibitor is a compound comprising or
consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548,
588550, 588553, 588555, 588848, or 594430. In certain embodiments,
the compound is administered to the subject parenterally.
[0183] In certain embodiments, a method of treating, preventing, or
ameliorating a kidney disease associated with dysregulation of the
complement alternative pathway in a subject comprises administering
to the subject a specific inhibitor of Complement Factor B (CFB),
thereby treating, preventing, or ameliorating the kidney disease.
In certain embodiments, the complement alternative pathway is
activated greater than normal. In certain embodiments, the CFB
specific inhibitor is an antisense compound targeted to CFB, such
as an antisense oligonucleotide targeted to CFB. In certain
embodiments, the CFB specific inhibitor is a compound comprising or
consisting of modified oligonucleotide consisting of 10 to 30
linked nucleosides and having a nucleobase sequence comprising at
least 8 contiguous nucleobases of any of the nucleobase sequences
of SEQ ID NOs: 6-808. In certain embodiments, the CFB specific
inhibitor is a compound comprising or consisting of a modified
oligonucleotide consisting of 10 to 30 linked nucleosides having a
nucleobase sequence comprising or consisting of any one of SEQ ID
NOs: 6-808. In certain embodiments, the CFB specific inhibitor is a
compound comprising or consisting of a modified oligonucleotide
consisting of 10 to 30 linked nucleosides having a nucleobase
sequence comprising or consisting of any one of SEQ ID NOs: 198,
228, 237, 440, 444, 448, 450, 453, 455, 549, and 598. In certain
embodiments, the CFB specific inhibitor is a compound comprising or
consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548,
588550, 588553, 588555, 588848, or 594430. In certain embodiments,
the compound is administered to the subject parenterally. In
certain embodiments, the kidney disease is lupus nephritis,
systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3
glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic
uremic syndrome (aHUS), or any combination thereof. In certain
embodiments, the kidney disease is associated with C3 deposits,
such as C3 deposits in the glomerulus. In certain embodiments, the
kidney disease is associated with lower than normal circulating C3
levels, such as serum or plasma C3 levels. In certain embodiments,
administering the compound reduces or inhibits accumulation of C3
levels in the kidney, such as C3 protein levels. In certain
embodiments, administering the compound reduces the level of kidney
C3 deposits or inhibits accumulation of kidney C3 deposits, such as
C3 levels in the glomerulus. In certain embodiments, the subject is
identified as having or at risk of having a disease associated with
dysregulation of the complement alternative pathway, for example by
detecting complement levels or membrane-attack complex levels in
the subject's blood and/or performing a genetic test for gene
mutations of complement factors associated with the disease.
[0184] In certain embodiments, a method of inhibiting expression of
Complement Factor B (CFB) in a subject having, or at risk of
having, a disease associated with dysregulation of the complement
alternative pathway comprises administering a Complement Factor B
(CFB) specific inhibitor to the subject, thereby inhibiting
expression of CFB in the subject. In certain embodiments,
administering the inhibitor inhibits expression of CFB in the eye.
In certain embodiments, the subject has, or is at risk of having,
age related macular degeneration (AMD), such as wet AMD and dry
AMD. In certain embodiments, dry AMD can be Geographic Atrophy. In
certain embodiments, administering the inhibitor inhibits
expression of CFB in the kidney, such as in the glomerulus. In
certain embodiments, the subject has, or is at risk of having,
lupus nephritis, systemic lupus erythematosus (SLE), dense deposit
disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or
atypical hemolytic uremic syndrome (aHUS), or any combination
thereof. In certain embodiments, the CFB specific inhibitor is a
compound comprising or consisting of modified oligonucleotide
consisting of 10 to 30 linked nucleosides and having a nucleobase
sequence comprising at least 8 contiguous nucleobases of any of the
nucleobase sequences of SEQ ID NOs: 6-808. In certain embodiments,
the CFB specific inhibitor is a compound comprising or consisting
of a modified oligonucleotide consisting of 10 to 30 linked
nucleosides having a nucleobase sequence comprising or consisting
of any one of SEQ ID NOs: 6-808. In certain embodiments, the CFB
specific inhibitor is a compound comprising or consisting of a
modified oligonucleotide consisting of 10 to 30 linked nucleosides
having a nucleobase sequence comprising or consisting of any one of
SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and
598. In certain embodiments, the CFB specific inhibitor is a
compound comprising or consisting of ISIS 532770, 532800, 532809,
588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430.
In certain embodiments, the compound is administered to the subject
parenterally.
[0185] In certain embodiments, a method of reducing or inhibiting
accumulation of C3 deposits in the eye of a subject having, or at
risk of having, a disease associated with dysregulation of the
complement alternative pathway comprises administering a Complement
Factor B (CFB) specific inhibitor to the subject, thereby reducing
or inhibiting accumulation of C3 deposits in the eye of the
subject. In certain embodiments, the subject has, or is at risk of
having, age related macular degeneration (AMD), such as wet AMD and
dry AMD. In certain embodiments, dry AMD can be Geographic Atrophy.
In certain embodiments, the inhibitor is an antisense compound
targeted to CFB. In certain embodiments, the CFB specific inhibitor
is a compound comprising or consisting of modified oligonucleotide
consisting of 10 to 30 linked nucleosides and having a nucleobase
sequence comprising at least 8 contiguous nucleobases of any of the
nucleobase sequences of SEQ ID NOs: 6-808. In certain embodiments,
the CFB specific inhibitor is a compound comprising or consisting
of a modified oligonucleotide consisting of 10 to 30 linked
nucleosides having a nucleobase sequence comprising or consisting
of any one of SEQ ID NOs: 6-808. In certain embodiments, the CFB
specific inhibitor is a compound comprising or consisting of a
modified oligonucleotide consisting of 10 to 30 linked nucleosides
having a nucleobase sequence comprising or consisting of any one of
SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and
598. In certain embodiments, the CFB specific inhibitor is a
compound comprising or consisting of ISIS 532770, 532800, 532809,
588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430.
In certain embodiments, the compound is administered to the subject
parenterally.
[0186] In certain embodiments, a method of reducing or inhibiting
accumulation of C3 deposits in the kidney of a subject having, or
at risk of having, a disease associated with dysregulation of the
complement alternative pathway comprises administering a Complement
Factor B (CFB) specific inhibitor to the subject, thereby reducing
or inhibiting accumulation of C3 deposits in the kidney of the
subject. In certain embodiments, the subject has, or is at risk of
having, lupus nephritis, systemic lupus erythematosus (SLE), dense
deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5
nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any
combination thereof. In certain embodiments, the inhibitor is an
antisense compound targeted to CFB. In certain embodiments, the CFB
specific inhibitor is a compound comprising or consisting of
modified oligonucleotide consisting of 10 to 30 linked nucleosides
and having a nucleobase sequence comprising at least 8 contiguous
nucleobases of any of the nucleobase sequences of SEQ ID NOs:
6-808. In certain embodiments, the CFB specific inhibitor is a
compound comprising or consisting of a modified oligonucleotide
consisting of 10 to 30 linked nucleosides having a nucleobase
sequence comprising or consisting of any one of SEQ ID NOs: 6-808.
In certain embodiments, the CFB specific inhibitor is a compound
comprising or consisting of a modified oligonucleotide consisting
of 10 to 30 linked nucleosides having a nucleobase sequence
comprising or consisting of any one of SEQ ID NOs: 198, 228, 237,
440, 444, 448, 450, 453, 455, 549, and 598. In certain embodiments,
the CFB specific inhibitor is a compound comprising or consisting
of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550,
588553, 588555, 588848, or 594430. In certain embodiments, the
compound is administered to the subject parenterally.
[0187] Certain embodiments are drawn to a compound or composition
described herein for use in therapy. Certain embodiments are drawn
to a compound comprising or consisting of modified oligonucleotide
consisting of 10 to 30 linked nucleosides and having a nucleobase
sequence comprising at least 8 contiguous nucleobases of any of the
nucleobase sequences of SEQ ID NOs: 6-808 for use in therapy.
Certain embodiments are drawn to a compound comprising or
consisting of a modified oligonucleotide consisting of 10 to 30
linked nucleosides having a nucleobase sequence comprising or
consisting of any one of SEQ ID NOs: 6-808 for use in therapy.
Certain embodiments are drawn to a compound comprising or
consisting of a modified oligonucleotide consisting of 10 to 30
linked nucleosides having a nucleobase sequence comprising or
consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448,
450, 453, 455, 549, and 598, for use in therapy. Certain
embodiments are drawn to a compound comprising or consisting of
ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550,
588553, 588555, 588848, or 594430 for use in therapy.
[0188] Certain embodiments are drawn to a compound or composition
described herein for use in treating a disease associated with
dysregulation of the complement alternative pathway. Certain
embodiments are drawn to a compound comprising or consisting of
modified oligonucleotide consisting of 10 to 30 linked nucleosides
and having a nucleobase sequence comprising at least 8 contiguous
nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808
for use in treating a disease associated with dysregulation of the
complement alternative pathway. Certain embodiments are drawn to a
compound comprising or consisting of a modified oligonucleotide
consisting of 10 to 30 linked nucleosides having a nucleobase
sequence comprising or consisting of any one of SEQ ID NOs: 6-808
for use in treating a disease associated with dysregulation of the
complement alternative pathway. Certain embodiments are drawn to a
compound comprising or consisting of a modified oligonucleotide
consisting of 10 to 30 linked nucleosides having a nucleobase
sequence comprising or consisting of any one of SEQ ID NOs: 198,
228, 237, 440, 444, 448, 450, 453, 455, 549, and 598, for use in
treating a disease associated with dysregulation of the complement
alternative pathway. Certain embodiments are drawn to a compound
comprising or consisting of ISIS 532770, 532800, 532809, 588540,
588544, 588548, 588550, 588553, 588555, 588848, or 594430 for use
in treating a disease associated with dysregulation of the
complement alternative pathway. In certain embodiments, the
complement alternative pathway is activated greater than normal. In
certain embodiments, the disease is macular degeneration, such as
age related macular degeneration (AMD), which can be wet AMD or dry
AMD. In certain embodiments, dry AMD can be Geographic Atrophy. In
certain embodiments, the disease is a kidney disease such as lupus
nephritis, systemic lupus erythematosus (SLE), dense deposit
disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or
atypical hemolytic uremic syndrome (aHUS), or any combination
thereof.
[0189] Certain embodiments are drawn to a compound comprising or
consisting of ISIS 588540, which has the following chemical
structure:
##STR00004##
for use in treating a disease associated with dysregulation of the
complement alternative pathway. In certain embodiments, the
complement alternative pathway is activated greater than normal. In
certain embodiments, the disease is macular degeneration, such as
age related macular degeneration (AMD), which can be wet AMD or dry
AMD. In certain embodiments, dry AMD can be Geographic Atrophy. In
certain embodiments, the disease is a kidney disease such as lupus
nephritis, systemic lupus erythematosus (SLE), dense deposit
disease (DDD), C3 glomemrulonephritis (C3GN), CFHR5 nephropathy, or
atypical hemolytic uremic syndrome (aHUS), or any combination
thereof.
[0190] Certain embodiments are drawn to use of a compound or
composition described herein for the manufacture of a medicament
for treating a disease associated with dysregulation of the
complement alternative pathway. Certain embodiments are drawn to
use of a compound comprising or consisting of modified
oligonucleotide consisting of 10 to 30 linked nucleosides and
having a nucleobase sequence comprising at least 8 contiguous
nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808
for the manufacture of a medicament for treating disease associated
with dysregulation of the complement alternative pathway. Certain
embodiments are drawn to use of a compound comprising or consisting
of a modified oligonucleotide consisting of 10 to 30 linked
nucleosides having a nucleobase sequence comprising or consisting
of any one of SEQ ID NOs: 6-808 for the manufacture of a medicament
for treating a disease associated with dysregulation of the
complement alternative pathway. Certain embodiments are drawn to
use of a compound comprising or consisting of a modified
oligonucleotide consisting of 10 to 30 linked nucleosides having a
nucleobase sequence comprising or consisting of any one of SEQ ID
NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598, for
the manufacture of a medicament for treating a disease associated
with dysregulation of the complement alternative pathway. Certain
embodiments are drawn to use of a compound comprising or consisting
of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550,
588553, 588555, 588848, or 594430 for the manufacture of a
medicament for treating a disease associated with dysregulation of
the complement alternative pathway. In certain embodiments, the
complement alternative pathway is activated greater than normal. In
certain embodiments, the disease is macular degeneration, such as
age related macular degeneration (AMD), which can be wet AMD or dry
AMD. In certain embodiments, dry AMD can be Geographic Atrophy. In
certain embodiments, the disease is a kidney disease such as lupus
nephritis, systemic lupus erythematosus (SLE), dense deposit
disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or
atypical hemolytic uremic syndrome (aHUS), or any combination
thereof.
[0191] Certain embodiments are drawn to use of a compound
comprising or consisting of ISIS 588540, which has the following
chemical structure:
##STR00005##
for the manufacture of a medicament for treating a disease
associated with dysregulation of the complement alternative
pathway. In certain embodiments, the complement alternative pathway
is activated greater than normal. In certain embodiments, the
disease is macular degeneration, such as age related macular
degeneration (AMD), which can be wet AMD or dry AMD. In certain
embodiments, dry AMD can be Geographic Atrophy. In certain
embodiments, the disease is a kidney disease such as lupus
nephritis, systemic lupus erythematosus (SLE), dense deposit
disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or
atypical hemolytic uremic syndrome (aHUS), or any combination
thereof.
[0192] In any of the foregoing embodiments, the CFB specific
inhibitor can be an antisense compound targeted to CFB. In certain
embodiments, the antisense compound comprises an antisense
oligonucleotide, for example an antisense oligonucleotide
consisting of 8 to 80 linked nucleosides, 12 to 30 linked
nucleosides, or 20 linked nucleosides. In certain embodiments, the
antisense oligonucleotide is at least 80%, 85%, 90%, 95% or 100%
complementary to any of the nucleobase sequences recited in SEQ ID
NOs: 1-5. In certain embodiments, the antisense oligonucleotide
comprises at least one modified internucleoside linkage, at least
one modified sugar and/or at least one modified nucleobase. In
certain embodiments, the modified internucleoside linkage is a
phosphorothioate internucleoside linkage, the modified sugar is a
bicyclic sugar or a 2'-O-methoxyethyl, and the modified nucleobase
is a 5-methylcytosine. In certain embodiments, the modified
oligonucleotide comprises a gap segment consisting of linked
deoxynucleosides; a 5' wing segment consisting of linked
nucleosides; and a 3' wing segment consisting of linked
nucleosides, wherein the gap segment is positioned immediately
adjacent to and between the 5' wing segment and the 3' wing segment
and wherein each nucleoside of each wing segment comprises a
modified sugar. In certain embodiments, the antisense
oligonucleotide is administered parenterally. For example, in
certain embodiments the antisense oligonucleotide can be
administered through injection or infusion. Parenteral
administration includes subcutaneous administration, intravenous
administration, intramuscular administration, intraarterial
administration, intraperitoneal administration, or intracranial
administration, e.g. intrathecal or intracerebroventricular
administration.
Antisense Compounds
[0193] Oligomeric compounds include, but are not limited to,
oligonucleotides, oligonucleosides, oligonucleotide analogs,
oligonucleotide mimetics, antisense compounds, antisense
oligonucleotides, and siRNAs. An oligomeric compound may be
"antisense" to a target nucleic acid, meaning that is is capable of
undergoing hybridization to a target nucleic acid through hydrogen
bonding.
[0194] In certain embodiments, an antisense compound has a
nucleobase sequence that, when written in the 5' to 3' direction,
comprises the reverse complement of the target segment of a target
nucleic acid to which it is targeted.
[0195] In certain embodiments, an antisense compound is 10 to 30
subunits in length. In certain embodiments, an antisense compound
is 12 to 30 subunits in length. In certain embodiments, an
antisense compound is 12 to 22 subunits in length. In certain
embodiments, an antisense compound is 14 to 30 subunits in length.
In certain embodiments, an antisense compound is 14 to 20 subunits
in length. In certain embodiments, an antisense compoun is 15 to 30
subunits in length. In certain embodiments, an antisense compound
is 15 to 20 subunits in length. In certain embodiments, an
antisense compound is 16 to 30 subunits in length. In certain
embodiments, an antisense compound is 16 to 20 subunits in length.
In certain embodiments, an antisense compound is 17 to 30 subunits
in length. In certain embodiments, an antisense compound is 17 to
20 subunits in length. In certain embodiments, an antisense
compound is 18 to 30 subunits in length. In certain embodiments, an
antisense compound is 18 to 21 subunits in length. In certain
embodiments, an antisense compound is 18 to 20 subunits in length.
In certain embodiments, an antisense compound is 20 to 30 subunits
in length. In other words, such antisense compounds are from 12 to
30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15
to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20
subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits,
18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to
22 linked subunits, respectively. In certain embodiments, an
antisense compound is 14 subunits in length. In certain
embodiments, an antisense compound is 16 subunits in length. In
certain embodiments, an antisense compound is 17 subunits in
length. In certain embodiments, an antisense compound is 18
subunits in length. In certain embodiments, an antisense compound
is 19 subunits in length. In certain embodiments, an antisense
compound is 20 subunits in length. In other embodiments, the
antisense compound is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to
30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17
to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30,
19 to 50, or 20 to 30 linked subunits. In certain such embodiments,
the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51,
52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68,
69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits
in length, or a range defined by any two of the above values. In
some embodiments the antisense compound is an antisense
oligonucleotide, and the linked subunits are nucleotides.
[0196] In certain embodiments antisense oligonucleotides may be
shortened or truncated. For example, a single subunit may be
deleted from the 5' end (5' truncation), or alternatively from the
3' end (3' truncation). A shortened or truncated antisense compound
targeted to an CFB nucleic acid may have two subunits deleted from
the 5' end, or alternatively may have two subunits deleted from the
3' end, of the antisense compound. Alternatively, the deleted
nucleosides may be dispersed throughout the antisense compound, for
example, in an antisense compound having one nucleoside deleted
from the 5' end and one nucleoside deleted from the 3' end.
[0197] When a single additional subunit is present in a lengthened
antisense compound, the additional subunit may be located at the 5'
or 3' end of the antisense compound. When two or more additional
subunits are present, the added subunits may be adjacent to each
other, for example, in an antisense compound having two subunits
added to the 5' end (5' addition), or alternatively to the 3' end
(3' addition), of the antisense compound. Alternatively, the added
subunits may be dispersed throughout the antisense compound, for
example, in an antisense compound having one subunit added to the
5' end and one subunit added to the 3' end.
[0198] It is possible to increase or decrease the length of an
antisense compound, such as an antisense oligonucleotide, and/or
introduce mismatch bases without eliminating activity. For example,
in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a
series of antisense oligonucleotides 13-25 nucleobases in length
were tested for their ability to induce cleavage of a target RNA in
an oocyte injection model. Antisense oligonucleotides 25
nucleobases in length with 8 or 11 mismatch bases near the ends of
the antisense oligonucleotides were able to direct specific
cleavage of the target mRNA, albeit to a lesser extent than the
antisense oligonucleotides that contained no mismatches. Similarly,
target specific cleavage was achieved using 13 nucleobase antisense
oligonucleotides, including those with 1 or 3 mismatches.
[0199] Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March
2001) demonstrated the ability of an oligonucleotide having 100%
complementarity to the bcl-2 mRNA and having 3 mismatches to the
bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in
vitro and in vivo. Furthermore, this oligonucleotide demonstrated
potent anti-tumor activity in vivo.
[0200] Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988)
tested a series of tandem 14 nucleobase antisense oligonucleotides,
and a 28 and 42 nucleobase antisense oligonucleotides comprised of
the sequence of two or three of the tandem antisense
oligonucleotides, respectively, for their ability to arrest
translation of human DHFR in a rabbit reticulocyte assay. Each of
the three 14 nucleobase antisense oligonucleotides alone was able
to inhibit translation, albeit at a more modest level than the 28
or 42 nucleobase antisense oligonucleotides.
Certain Antisense Compound Motifs and Mechanisms
[0201] In certain embodiments, antisense compounds have chemically
modified subunits arranged in patterns, or motifs, to confer to the
antisense compounds properties such as enhanced inhibitory
activity, increased binding affinity for a target nucleic acid, or
resistance to degradation by in vivo nucleases.
[0202] Chimeric antisense compounds typically contain at least one
region modified so as to confer increased resistance to nuclease
degradation, increased cellular uptake, increased binding affinity
for the target nucleic acid, and/or increased inhibitory activity.
A second region of a chimeric antisense compound may confer another
desired property e.g., serve as a substrate for the cellular
endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA
duplex.
[0203] Antisense activity may result from any mechanism involving
the hybridization of the antisense compound (e.g., oligonucleotide)
with a target nucleic acid, wherein the hybridization ultimately
results in a biological effect. In certain embodiments, the amount
and/or activity of the target nucleic acid is modulated. In certain
embodiments, the amount and/or activity of the target nucleic acid
is reduced. In certain embodiments, hybridization of the antisense
compound to the target nucleic acid ultimately results in target
nucleic acid degradation. In certain embodiments, hybridization of
the antisense compound to the target nucleic acid does not result
in target nucleic acid degradation. In certain such embodiments,
the presence of the antisense compound hybridized with the target
nucleic acid (occupancy) results in a modulation of antisense
activity. In certain embodiments, antisense compounds having a
particular chemical motif or pattern of chemical modifications are
particularly suited to exploit one or more mechanisms. In certain
embodiments, antisense compounds function through more than one
mechanism and/or through mechanisms that have not been elucidated.
Accordingly, the antisense compounds described herein are not
limited by particular mechanism.
[0204] Antisense mechanisms include, without limitation, RNase H
mediated antisense; RNAi mechanisms, which utilize the RISC pathway
and include, without limitation, siRNA, ssRNA and microRNA
mechanisms; and occupancy based mechanisms. Certain antisense
compounds may act through more than one such mechanism and/or
through additional mechanisms.
[0205] RNase H-Mediated Antisense
[0206] In certain embodiments, antisense activity results at least
in part from degradation of target RNA by RNase H. RNase H is a
cellular endonuclease that cleaves the RNA strand of an RNA:DNA
duplex. It is known in the art that single-stranded antisense
compounds which are "DNA-like" elicit RNase H activity in mammalian
cells. Accordingly, antisense compounds comprising at least a
portion of DNA or DNA-like nucleosides may activate RNase H,
resulting in cleavage of the target nucleic acid. In certain
embodiments, antisense compounds that utilize RNase H comprise one
or more modified nucleosides. In certain embodiments, such
antisense compounds comprise at least one block of 1-8 modified
nucleosides. In certain such embodiments, the modified nucleosides
do not support RNase H activity. In certain embodiments, such
antisense compounds are gapmers, as described herein. In certain
such embodiments, the gap of the gapmer comprises DNA nucleosides.
In certain such embodiments, the gap of the gapmer comprises
DNA-like nucleosides. In certain such embodiments, the gap of the
gapmer comprises DNA nucleosides and DNA-like nucleosides.
[0207] Certain antisense compounds having a gapmer motif are
considered chimeric antisense compounds. In a gapmer an internal
region having a plurality of nucleotides that supports RNaseH
cleavage is positioned between external regions having a plurality
of nucleotides that are chemically distinct from the nucleosides of
the internal region. In the case of an antisense oligonucleotide
having a gapmer motif, the gap segment generally serves as the
substrate for endonuclease cleavage, while the wing segments
comprise modified nucleosides. In certain embodiments, the regions
of a gapmer are differentiated by the types of sugar moieties
comprising each distinct region. The types of sugar moieties that
are used to differentiate the regions of a gapmer may in some
embodiments include .beta.-D-ribonucleosides,
.beta.-D-deoxyribonucleosides, 2'-modified nucleosides (such
2'-modified nucleosides may include 2'-MOE and 2'-O--CH.sub.3,
among others), and bicyclic sugar modified nucleosides (such
bicyclic sugar modified nucleosides may include those having a
constrained ethyl). In certain embodiments, nucleosides in the
wings may include several modified sugar moieties, including, for
example 2'-MOE and bicyclic sugar moieties such as constrained
ethyl or LNA. In certain embodiments, wings may include several
modified and unmodified sugar moieties. In certain embodiments,
wings may include various combinations of 2'-MOE nucleosides,
bicyclic sugar moieties such as constrained ethyl nucleosides or
LNA nucleosides, and 2'-deoxynucleosides.
[0208] Each distinct region may comprise uniform sugar moieties,
variant, or alternating sugar moieties. The wing-gap-wing motif is
frequently described as "X--Y--Z", where "X" represents the length
of the 5'-wing, "Y" represents the length of the gap, and "Z"
represents the length of the 3'-wing. "X" and "Z" may comprise
uniform, variant, or alternating sugar moieties. In certain
embodiments, "X" and "Y" may include one or more
2'-deoxynucleosides. "Y" may comprise 2'-deoxynucleosides. As used
herein, a gapmer described as "X--Y--Z" has a configuration such
that the gap is positioned immediately adjacent to each of the
5'-wing and the 3' wing. Thus, no intervening nucleotides exist
between the 5'-wing and gap, or the gap and the 3'-wing. Any of the
antisense compounds described herein can have a gapmer motif. In
certain embodiments, "X" and "Z" are the same; in other embodiments
they are different. In certain embodiments, "Y" is between 8 and 15
nucleosides. X, Y, or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more
nucleosides.
[0209] In certain embodiments, the antisense compound targeted to a
CFB nucleic acid has a gapmer motif in which the gap consists of 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 linked nucleosides.
[0210] In certain embodiments, the antisense oligonucleotide has a
sugar motif described by Formula A as follows:
(J).sub.m-(B).sub.n-(J).sub.p-(B).sub.r-(A).sub.t-(D).sub.g-(A).sub.v-(B)-
.sub.w-(J).sub.x-(B).sub.y-(J).sub.z
[0211] wherein:
[0212] each A is independently a 2'-substituted nucleoside;
[0213] each B is independently a bicyclic nucleoside;
[0214] each J is independently either a 2'-substituted nucleoside
or a 2'-deoxynucleoside; each D is a 2'-deoxynucleoside;
[0215] m is 0-4; n is 0-2; p is 0-2; r is 0-2; t is 0-2; v is 0-2;
w is 0-4; x is 0-2; y is 0-2; z is 0-4; g is 6-14; provided
that:
[0216] at least one of m, n, and r is other than 0;
[0217] at least one of w and y is other than 0;
[0218] the sum of m, n, p, r, and t is from 2 to 5; and
[0219] the sum of v, w, x, y, and z is from 2 to 5.
[0220] RNAi Compounds
[0221] In certain embodiments, antisense compounds are interfering
RNA compounds (RNAi), which include double-stranded RNA compounds
(also referred to as short-interfering RNA or siRNA) and
single-stranded RNAi compounds (or ssRNA). Such compounds work at
least in part through the RISC pathway to degrade and/or sequester
a target nucleic acid (thus, include microRNA/microRNA-mimic
compounds). In certain embodiments, antisense compounds comprise
modifications that make them particularly suited for such
mechanisms.
[0222] i. ssRNA Compounds
[0223] In certain embodiments, antisense compounds including those
particularly suited for use as single-stranded RNAi compounds
(ssRNA) comprise a modified 5'-terminal end. In certain such
embodiments, the 5'-terminal end comprises a modified phosphate
moiety. In certain embodiments, such modified phosphate is
stabilized (e.g., resistant to degradation/cleavage compared to
unmodified 5'-phosphate). In certain embodiments, such 5'-terminal
nucleosides stabilize the 5'-phosphorous moiety. Certain modified
5'-terminal nucleosides may be found in the art, for example in
WO/2011/139702.
[0224] In certain embodiments, the 5'-nucleoside of an ssRNA
compound has Formula IIc:
##STR00006##
wherein:
[0225] T.sub.1 is an optionally protected phosphorus moiety;
[0226] T.sub.2 is an internucleoside linking group linking the
compound of Formula IIc to the oligomeric compound;
[0227] A has one of the formulas:
##STR00007##
[0228] Q.sub.1 and Q.sub.2 are each, independently, H, halogen,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy,
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, substituted C.sub.2-C.sub.6 alkynyl or
N(R.sub.3)(R.sub.4);
[0229] Q.sub.3 is O, S, N(R.sub.5) or C(R.sub.6)(R.sub.7);
[0230] each R.sub.3, R.sub.4 R.sub.5, R.sub.6 and R.sub.7 is,
independently, H, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy;
[0231] M.sub.3 is O, S, NR.sub.14, C(R.sub.15)(R.sub.16),
C(R.sub.15)(R.sub.16)C(R.sub.17)(R.sub.18),
C(R.sub.15).dbd.C(R.sub.17), OC(R.sub.15)(R.sub.16) or
OC(R.sub.15)(Bx.sub.2);
[0232] R.sub.14 is H, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, substituted
C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted
C.sub.2-C.sub.6 alkynyl;
[0233] R.sub.15, R.sub.16, R.sub.17 and R.sub.18 are each,
independently, H, halogen, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, substituted
C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted
C.sub.2-C.sub.6 alkynyl;
[0234] Bx.sub.1 is a heterocyclic base moiety;
[0235] or if Bx.sub.2 is present then Bx.sub.2 is a heterocyclic
base moiety and Bx.sub.1 is H, halogen, C.sub.1-C.sub.6 alkyl,
substituted C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy,
substituted C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkenyl,
substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or
substituted C.sub.2-C.sub.6 alkynyl;
[0236] J.sub.4, J.sub.5, J.sub.6 and J.sub.7 are each,
independently, H, halogen, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, substituted
C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted
C.sub.2-C.sub.6 alkynyl;
[0237] or J.sub.4 forms a bridge with one of J.sub.5 or J.sub.7
wherein said bridge comprises from 1 to 3 linked biradical groups
selected from O, S, NR.sub.19, C(R.sub.20)(R.sub.21),
C(R.sub.20).dbd.C(R.sub.21), C[.dbd.C(R.sub.20)(R.sub.21)] and
C(.dbd.O) and the other two of J.sub.5, J.sub.6 and J.sub.7 are
each, independently, H, halogen, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, substituted
C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted
C.sub.2-C.sub.6 alkynyl;
[0238] each R.sub.19, R.sub.20 and R.sub.21 is, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy,
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl;
[0239] G is H, OH, halogen or
O--[C(R.sub.8)(R.sub.9)].sub.n--[(C.dbd.O).sub.m--X.sub.1].sub.j--Z;
[0240] each R.sub.8 and R.sub.9 is, independently, H, halogen,
C.sub.1-C.sub.6 alkyl or substituted C.sub.1-C.sub.6 alkyl; X.sub.1
is O, S or N(E.sub.1);
[0241] Z is H, halogen, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted
C.sub.2-C.sub.6 alkynyl or N(E.sub.2)(E.sub.3);
[0242] E.sub.1, E.sub.2 and E.sub.3 are each, independently, H,
C.sub.1-C.sub.6 alkyl or substituted C.sub.1-C.sub.6 alkyl;
[0243] n is from 1 to about 6;
[0244] m is 0 or 1;
[0245] j is 0 or 1;
[0246] each substituted group comprises one or more optionally
protected substituent groups independently selected from halogen,
OJ.sub.1, N(J.sub.1)(J.sub.2), =NJ.sub.1, SJ.sub.1, N.sub.3, CN,
OC(.dbd.X.sub.2)J.sub.1, OC(.dbd.X.sub.2)N(J.sub.1)(J.sub.2) and
C(.dbd.X.sub.2)N(J.sub.1)(J.sub.2);
[0247] X.sub.2 is O, S or NJ.sub.3;
[0248] each J.sub.1, J.sub.2 and J.sub.3 is, independently, H or
C.sub.1-C.sub.6 alkyl;
[0249] when j is 1 then Z is other than halogen or
N(E.sub.2)(E.sub.3); and wherein said oligomeric compound comprises
from 8 to 40 monomeric subunits and is hybridizable to at least a
portion of a target nucleic acid.
[0250] In certain embodiments, M.sub.3 is O, CH.dbd.CH, OCH.sub.2
or OC(H)(Bx.sub.2). In certain embodiments, M.sub.3 is O.
[0251] In certain embodiments, J.sub.4, J.sub.5, J.sub.6 and
J.sub.7 are each H. In certain embodiments, J.sub.4 forms a bridge
with one of J.sub.5 or J.sub.7.
[0252] In certain embodiments, A has one of the formulas:
##STR00008##
wherein:
[0253] Q.sub.1 and Q.sub.2 are each, independently, H, halogen,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy or substituted C.sub.1-C.sub.6 alkoxy. In
certain embodiments, Q.sub.1 and Q.sub.2 are each H. In certain
embodiments, Q.sub.1 and Q.sub.2 are each, independently, H or
halogen. In certain embodiments, Q.sub.1 and Q.sub.2 is H and the
other of Q.sub.1 and Q.sub.2 is F, CH.sub.3 or OCH.sub.3.
[0254] In certain embodiments, T.sub.1 has the formula:
##STR00009##
wherein:
[0255] R.sub.a and R.sub.c are each, independently, protected
hydroxyl, protected thiol, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, substituted
C.sub.1-C.sub.6 alkoxy, protected amino or substituted amino;
and
[0256] R.sub.b is O or S. In certain embodiments, R.sub.b is O and
R.sub.a and R, are each, independently, OCH.sub.3,
OCH.sub.2CH.sub.3 or CH(CH.sub.3).sub.2.
[0257] In certain embodiments, G is halogen, OCH.sub.3, OCH.sub.2F,
OCHF.sub.2, OCF.sub.3, OCH.sub.2CH.sub.3, O(CH.sub.2).sub.2F,
OCH.sub.2CHF.sub.2, OCH.sub.2CF.sub.3, OCH.sub.2--CH.dbd.CH.sub.2,
O(CH.sub.2).sub.2--OCH.sub.3, O(CH.sub.2).sub.2--SCH.sub.3,
O(CH.sub.2).sub.2--OCF.sub.3,
O(CH.sub.2).sub.3--N(R.sub.10)(R.sub.11),
O(CH.sub.2).sub.2--ON(R.sub.10)(R.sub.11),
O(CH.sub.2).sub.2--O(CH.sub.2).sub.2--N(R.sub.10)(R.sub.1),
OCH.sub.2C(.dbd.O)--N(R.sub.10)(R.sub.11),
OCH.sub.2C(.dbd.O)--N(R.sub.12)--(CH.sub.2).sub.2--N(R.sub.10)(R.sub.11)
or
O(CH.sub.2).sub.2--N(R.sub.12)--C(.dbd.NR.sub.13)[N(R.sub.10)(R.sub.11-
)] wherein R.sub.10, R.sub.11, R.sub.12 and R.sub.13 are each,
independently, H or C.sub.1-C.sub.6 alkyl. In certain embodiments,
G is halogen, OCH.sub.3, OCF.sub.3, OCH.sub.2CH.sub.3,
OCH.sub.2CF.sub.3, OCH.sub.2--CH.dbd.CH.sub.2,
O(CH.sub.2).sub.2--OCH.sub.3,
O(CH.sub.2).sub.2--O(CH.sub.2).sub.2--N(CH.sub.3).sub.2,
OCH.sub.2C(.dbd.O)--N(H)CH.sub.3,
OCH.sub.2C(.dbd.O)--N(H)--(CH.sub.2).sub.2--N(CH.sub.3).sub.2 or
OCH.sub.2--N(H)--C(.dbd.NH)NH.sub.2. In certain embodiments, G is
F, OCH.sub.3 or O(CH.sub.2).sub.2--OCH.sub.3. In certain
embodiments, G is O(CH.sub.2).sub.2--OCH.sub.3.
[0258] In certain embodiments, the 5'-terminal nucleoside has
Formula IIe:
##STR00010##
[0259] In certain embodiments, antisense compounds, including those
particularly suitable for ssRNA comprise one or more type of
modified sugar moieties and/or naturally occurring sugar moieties
arranged along an oligonucleotide or region thereof in a defined
pattern or sugar modification motif. Such motifs may include any of
the sugar modifications discussed herein and/or other known sugar
modifications.
[0260] In certain embodiments, the oligonucleotides comprise or
consist of a region having uniform sugar modifications. In certain
such embodiments, each nucleoside of the region comprises the same
RNA-like sugar modification. In certain embodiments, each
nucleoside of the region is a 2'-F nucleoside. In certain
embodiments, each nucleoside of the region is a 2'-OMe nucleoside.
In certain embodiments, each nucleoside of the region is a 2'-MOE
nucleoside. In certain embodiments, each nucleoside of the region
is a cEt nucleoside. In certain embodiments, each nucleoside of the
region is an LNA nucleoside. In certain embodiments, the uniform
region constitutes all or essentially all of the oligonucleotide.
In certain embodiments, the region constitutes the entire
oligonucleotide except for 1-4 terminal nucleosides.
[0261] In certain embodiments, oligonucleotides comprise one or
more regions of alternating sugar modifications, wherein the
nucleosides alternate between nucleotides having a sugar
modification of a first type and nucleotides having a sugar
modification of a second type. In certain embodiments, nucleosides
of both types are RNA-like nucleosides. In certain embodiments the
alternating nucleosides are selected from: 2'-OMe, 2'-F, 2'-MOE,
LNA, and cEt. In certain embodiments, the alternating modifications
are 2'-F and 2'-OMe. Such regions may be contiguous or may be
interrupted by differently modified nucleosides or conjugated
nucleosides.
[0262] In certain embodiments, the alternating region of
alternating modifications each consist of a single nucleoside
(i.e., the pattern is (AB).sub.xA.sub.y wherein A is a nucleoside
having a sugar modification of a first type and B is a nucleoside
having a sugar modification of a second type; x is 1-20 and y is 0
or 1). In certain embodiments, one or more alternating regions in
an alternating motif includes more than a single nucleoside of a
type. For example, oligonucleotides may include one or more regions
of any of the following nucleoside motifs:
AABBAA;
ABBABB;
AABAAB;
ABBABAABB;
ABABAA;
AABABAB;
ABABAA;
ABBAABBABABAA;
BABBAABBABABAA; or
ABABBAABBABABAA;
[0263] wherein A is a nucleoside of a first type and B is a
nucleoside of a second type. In certain embodiments, A and B are
each selected from 2'-F, 2'-OMe, BNA, and MOE.
[0264] In certain embodiments, oligonucleotides having such an
alternating motif also comprise a modified 5' terminal nucleoside,
such as those of formula IIc or lie.
[0265] In certain embodiments, oligonucleotides comprise a region
having a 2-2-3 motif. Such regions comprises the following
motif:
-(A).sub.2-(B).sub.x-(A).sub.2-(C)-(A).sub.3-
[0266] wherein: A is a first type of modified nucleoside;
[0267] B and C, are nucleosides that are differently modified than
A, however, B and C may have the same or different modifications as
one another;
[0268] x and y are from 1 to 15.
[0269] In certain embodiments, A is a 2'-OMe modified nucleoside.
In certain embodiments, B and C are both 2'-F modified nucleosides.
In certain embodiments, A is a 2'-OMe modified nucleoside and B and
C are both 2'-F modified nucleosides.
[0270] In certain embodiments, oligonucleosides have the following
sugar motif:
5'-(Q)-(AB).sub.xA.sub.y-(D).sub.z
wherein:
[0271] Q is a nucleoside comprising a stabilized phosphate moiety.
In certain embodiments, Q is a nucleoside having Formula IIc or
IIe;
[0272] A is a first type of modified nucleoside;
[0273] B is a second type of modified nucleoside;
[0274] D is a modified nucleoside comprising a modification
different from the nucleoside adjacent to it. Thus, if y is 0, then
D must be differently modified than B and if y is 1, then D must be
differently modified than A. In certain embodiments, D differs from
both A and B.
[0275] X is 5-15;
[0276] Y is 0 or 1;
[0277] Z is 0-4.
[0278] In certain embodiments, oligonucleosides have the following
sugar motif:
5'-(Q)-(A).sub.x-(D).sub.z
wherein:
[0279] Q is a nucleoside comprising a stabilized phosphate moiety.
In certain embodiments, Q is a nucleoside having Formula IIc or
IIe;
[0280] A is a first type of modified nucleoside;
[0281] D is a modified nucleoside comprising a modification
different from A.
[0282] X is 11-30;
[0283] Z is 0-4.
[0284] In certain embodiments A, B, C, and D in the above motifs
are selected from: 2'-OMe, 2'-F, 2'-MOE, LNA, and cEt. In certain
embodiments, D represents terminal nucleosides. In certain
embodiments, such terminal nucleosides are not designed to
hybridize to the target nucleic acid (though one or more might
hybridize by chance). In certain embodiments, the nucleobase of
each D nucleoside is adenine, regardless of the identity of the
nucleobase at the corresponding position of the target nucleic
acid. In certain embodiments the nucleobase of each D nucleoside is
thymine.
[0285] In certain embodiments, antisense compounds, including those
particularly suited for use as ssRNA comprise modified
internucleoside linkages arranged along the oligonucleotide or
region thereof in a defined pattern or modified internucleoside
linkage motif. In certain embodiments, oligonucleotides comprise a
region having an alternating internucleoside linkage motif. In
certain embodiments, oligonucleotides comprise a region of
uniformly modified internucleoside linkages. In certain such
embodiments, the oligonucleotide comprises a region that is
uniformly linked by phosphorothioate internucleoside linkages. In
certain embodiments, the oligonucleotide is uniformly linked by
phosphorothioate internucleoside linkages. In certain embodiments,
each internucleoside linkage of the oligonucleotide is selected
from phosphodiester and phosphorothioate. In certain embodiments,
each internucleoside linkage of the oligonucleotide is selected
from phosphodiester and phosphorothioate and at least one
internucleoside linkage is phosphorothioate.
[0286] In certain embodiments, the oligonucleotide comprises at
least 6 phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least 8
phosphorothioate internucleoside linkages. In certain embodiments,
the oligonucleotide comprises at least 10 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least one block of at least 6
consecutive phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least one block of at
least 8 consecutive phosphorothioate internucleoside linkages. In
certain embodiments, the oligonucleotide comprises at least one
block of at least 10 consecutive phosphorothioate internucleoside
linkages. In certain embodiments, the oligonucleotide comprises at
least one block of at least one 12 consecutive phosphorothioate
internucleoside linkages. In certain such embodiments, at least one
such block is located at the 3' end of the oligonucleotide. In
certain such embodiments, at least one such block is located within
3 nucleosides of the 3' end of the oligonucleotide.
[0287] Oligonucleotides having any of the various sugar motifs
described herein, may have any linkage motif. For example, the
oligonucleotides, including but not limited to those described
above, may have a linkage motif selected from non-limiting the
table below:
TABLE-US-00001 5' most linkage Central region 3'-region PS
Alternating PO/PS 6 PS PS Alternating PO/PS 7 PS PS Alternating
PO/PS 8 PS
[0288] ii. siRNA Compounds
[0289] In certain embodiments, antisense compounds are
double-stranded RNAi compounds (siRNA). In such embodiments, one or
both strands may comprise any modification motif described above
for ssRNA. In certain embodiments, ssRNA compounds may be
unmodified RNA. In certain embodiments, siRNA compounds may
comprise unmodified RNA nucleosides, but modified internucleoside
linkages.
[0290] Several embodiments relate to double-stranded compositions
wherein each strand comprises a motif defined by the location of
one or more modified or unmodified nucleosides. In certain
embodiments, compositions are provided comprising a first and a
second oligomeric compound that are fully or at least partially
hybridized to form a duplex region and further comprising a region
that is complementary to and hybridizes to a nucleic acid target.
It is suitable that such a composition comprise a first oligomeric
compound that is an antisense strand having full or partial
complementarity to a nucleic acid target and a second oligomeric
compound that is a sense strand having one or more regions of
complementarity to and forming at least one duplex region with the
first oligomeric compound.
[0291] The compositions of several embodiments modulate gene
expression by hybridizing to a nucleic acid target resulting in
loss of its normal function. In certain embodiments, the
degradation of the targeted CFB is facilitated by an activated RISC
complex that is formed with compositions of the invention.
[0292] Several embodiments are directed to double-stranded
compositions wherein one of the strands is useful in, for example,
influencing the preferential loading of the opposite strand into
the RISC (or cleavage) complex. The compositions are useful for
targeting selected nucleic acid molecules and modulating the
expression of one or more genes. In some embodiments, the
compositions of the present invention hybridize to a portion of a
target RNA resulting in loss of normal function of the target
RNA.
[0293] Certain embodiments are drawn to double-stranded
compositions wherein both the strands comprises a hemimer motif, a
fully modified motif, a positionally modified motif or an
alternating motif. Each strand of the compositions of the present
invention can be modified to fulfil a particular role in for
example the siRNA pathway. Using a different motif in each strand
or the same motif with different chemical modifications in each
strand permits targeting the antisense strand for the RISC complex
while inhibiting the incorporation of the sense strand. Within this
model, each strand can be independently modified such that it is
enhanced for its particular role. The antisense strand can be
modified at the 5'-end to enhance its role in one region of the
RISC while the 3'-end can be modified differentially to enhance its
role in a different region of the RISC.
[0294] The double-stranded oligonucleotide molecules can be a
double-stranded polynucleotide molecule comprising
self-complementary sense and antisense regions, wherein the
antisense region comprises nucleotide sequence that is
complementary to nucleotide sequence in a target nucleic acid
molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. The double-stranded oligonucleotide
molecules can be assembled from two separate oligonucleotides,
where one strand is the sense strand and the other is the antisense
strand, wherein the antisense and sense strands are
self-complementary (i.e. each strand comprises nucleotide sequence
that is complementary to nucleotide sequence in the other strand;
such as where the antisense strand and sense strand form a duplex
or double-stranded structure, for example wherein the
double-stranded region is about 15 to about 30, e.g., about 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base
pairs; the antisense strand comprises nucleotide sequence that is
complementary to nucleotide sequence in a target nucleic acid
molecule or a portion thereof and the sense strand comprises
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof (e.g., about 15 to about 25 or more
nucleotides of the double-stranded oligonucleotide molecule are
complementary to the target nucleic acid or a portion thereof).
Alternatively, the double-stranded oligonucleotide is assembled
from a single oligonucleotide, where the self-complementary sense
and antisense regions of the siRNA are linked by means of a nucleic
acid based or non-nucleic acid-based linker(s).
[0295] The double-stranded oligonucleotide can be a polynucleotide
with a duplex, asymmetric duplex, hairpin or asymmetric hairpin
secondary structure, having self-complementary sense and antisense
regions, wherein the antisense region comprises nucleotide sequence
that is complementary to nucleotide sequence in a separate target
nucleic acid molecule or a portion thereof and the sense region
having nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. The double-stranded oligonucleotide
can be a circular single-stranded polynucleotide having two or more
loop structures and a stem comprising self-complementary sense and
antisense regions, wherein the antisense region comprises
nucleotide sequence that is complementary to nucleotide sequence in
a target nucleic acid molecule or a portion thereof and the sense
region having nucleotide sequence corresponding to the target
nucleic acid sequence or a portion thereof, and wherein the
circular polynucleotide can be processed either in vivo or in vitro
to generate an active siRNA molecule capable of mediating RNAi.
[0296] In certain embodiments, the double-stranded oligonucleotide
comprises separate sense and antisense sequences or regions,
wherein the sense and antisense regions are covalently linked by
nucleotide or non-nucleotide linkers molecules as is known in the
art, or are alternately non-covalently linked by ionic
interactions, hydrogen bonding, van der waals interactions,
hydrophobic interactions, and/or stacking interactions. In certain
embodiments, the double-stranded oligonucleotide comprises
nucleotide sequence that is complementary to nucleotide sequence of
a target gene. In another embodiment, the double-stranded
oligonucleotide interacts with nucleotide sequence of a target gene
in a manner that causes inhibition of expression of the target
gene.
[0297] As used herein, double-stranded oligonucleotides need not be
limited to those molecules containing only RNA, but further
encompasses chemically modified nucleotides and non-nucleotides. In
certain embodiments, the short interfering nucleic acid molecules
lack 2'-hydroxy (2'-OH) containing nucleotides. In certain
embodiments short interfering nucleic acids optionally do not
include any ribonucleotides (e.g., nucleotides having a 2'-OH
group). Such double-stranded oligonucleotides that do not require
the presence of ribonucleotides within the molecule to support RNAi
can however have an attached linker or linkers or other attached or
associated groups, moieties, or chains containing one or more
nucleotides with 2'-OH groups. Optionally, double-stranded
oligonucleotides can comprise ribonucleotides at about 5, 10, 20,
30, 40, or 50% of the nucleotide positions. As used herein, the
term siRNA is meant to be equivalent to other terms used to
describe nucleic acid molecules that are capable of mediating
sequence specific RNAi, for example short interfering RNA (siRNA),
double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA
(shRNA), short interfering oligonucleotide, short interfering
nucleic acid, short interfering modified oligonucleotide,
chemically modified siRNA, post-transcriptional gene silencing RNA
(ptgsRNA), and others. In addition, as used herein, the term RNAi
is meant to be equivalent to other terms used to describe sequence
specific RNA interference, such as post transcriptional gene
silencing, translational inhibition, or epigenetics. For example,
double-stranded oligonucleotides can be used to epigenetically
silence genes at both the post-transcriptional level and the
pre-transcriptional level. In a non-limiting example, epigenetic
regulation of gene expression by siRNA molecules of the invention
can result from siRNA mediated modification of chromatin structure
or methylation pattern to alter gene expression (see, for example,
Verdel et al., 2004, Science, 303, 672-676; Pal-Bhadra et al.,
2004, Science, 303, 669-672; Allshire, 2002, Science, 297,
1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein,
2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297,
2232-2237).
[0298] It is contemplated that compounds and compositions of
several embodiments provided herein can target CFB by a
dsRNA-mediated gene silencing or RNAi mechanism, including, e.g.,
"hairpin" or stem-loop double-stranded RNA effector molecules in
which a single RNA strand with self-complementary sequences is
capable of assuming a double-stranded conformation, or duplex dsRNA
effector molecules comprising two separate strands of RNA. In
various embodiments, the dsRNA consists entirely of ribonucleotides
or consists of a mixture of ribonucleotides and deoxynucleotides,
such as the RNA/DNA hybrids disclosed, for example, by WO 00/63364,
filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21,
1999. The dsRNA or dsRNA effector molecule may be a single molecule
with a region of self-complementarity such that nucleotides in one
segment of the molecule base pair with nucleotides in another
segment of the molecule. In various embodiments, a dsRNA that
consists of a single molecule consists entirely of ribonucleotides
or includes a region of ribonucleotides that is complementary to a
region of deoxyribonucleotides. Alternatively, the dsRNA may
include two different strands that have a region of complementarity
to each other.
[0299] In various embodiments, both strands consist entirely of
ribonucleotides, one strand consists entirely of ribonucleotides
and one strand consists entirely of deoxyribonucleotides, or one or
both strands contain a mixture of ribonucleotides and
deoxyribonucleotides. In certain embodiments, the regions of
complementarity are at least 70, 80, 90, 95, 98, or 100%
complementary to each other and to a target nucleic acid sequence.
In certain embodiments, the region of the dsRNA that is present in
a double-stranded conformation includes at least 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 50, 75, 100, 200, 500, 1000, 2000
or 5000 nucleotides or includes all of the nucleotides in a cDNA or
other target nucleic acid sequence being represented in the dsRNA.
In some embodiments, the dsRNA does not contain any single stranded
regions, such as single stranded ends, or the dsRNA is a hairpin.
In other embodiments, the dsRNA has one or more single stranded
regions or overhangs. In certain embodiments, RNA/DNA hybrids
include a DNA strand or region that is an antisense strand or
region (e.g, has at least 70, 80, 90, 95, 98, or 100%
complementarity to a target nucleic acid) and an RNA strand or
region that is a sense strand or region (e.g, has at least 70, 80,
90, 95, 98, or 100% identity to a target nucleic acid), and vice
versa.
[0300] In various embodiments, the RNA/DNA hybrid is made in vitro
using enzymatic or chemical synthetic methods such as those
described herein or those described in WO 00/63364, filed Apr. 19,
2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999. In other
embodiments, a DNA strand synthesized in vitro is complexed with an
RNA strand made in vivo or in vitro before, after, or concurrent
with the transformation of the DNA strand into the cell. In yet
other embodiments, the dsRNA is a single circular nucleic acid
containing a sense and an antisense region, or the dsRNA includes a
circular nucleic acid and either a second circular nucleic acid or
a linear nucleic acid (see, for example, WO 00/63364, filed Apr.
19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.)
Exemplary circular nucleic acids include lariat structures in which
the free 5' phosphoryl group of a nucleotide becomes linked to the
2' hydroxyl group of another nucleotide in a loop back fashion.
[0301] In other embodiments, the dsRNA includes one or more
modified nucleotides in which the 2' position in the sugar contains
a halogen (such as fluorine group) or contains an alkoxy group
(such as a methoxy group) which increases the half-life of the
dsRNA in vitro or in vivo compared to the corresponding dsRNA in
which the corresponding 2' position contains a hydrogen or an
hydroxyl group. In yet other embodiments, the dsRNA includes one or
more linkages between adjacent nucleotides other than a
naturally-occurring phosphodiester linkage. Examples of such
linkages include phosphoramide, phosphorothioate, and
phosphorodithioate linkages. The dsRNAs may also be chemically
modified nucleic acid molecules as taught in U.S. Pat. No.
6,673,661. In other embodiments, the dsRNA contains one or two
capped strands, as disclosed, for example, by WO 00/63364, filed
Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21,
1999.
[0302] In other embodiments, the dsRNA can be any of the at least
partially dsRNA molecules disclosed in WO 00/63364, as well as any
of the dsRNA molecules described in U.S. Provisional Application
60/399,998; and U.S. Provisional Application 60/419,532, and
PCT/US2003/033466, the teaching of which is hereby incorporated by
reference. Any of the dsRNAs may be expressed in vitro or in vivo
using the methods described herein or standard methods, such as
those described in WO 00/63364.
[0303] Occupancy
[0304] In certain embodiments, antisense compounds are not expected
to result in cleavage or the target nucleic acid via RNase H or to
result in cleavage or sequestration through the RISC pathway. In
certain such embodiments, antisense activity may result from
occupancy, wherein the presence of the hybridized antisense
compound disrupts the activity of the target nucleic acid. In
certain such embodiments, the antisense compound may be uniformly
modified or may comprise a mix of modifications and/or modified and
unmodified nucleosides.
Target Nucleic Acids, Target Regions and Nucleotide Sequences
[0305] Nucleotide sequences that encode Complement Factor B (CFB)
include, without limitation, the following: GENBANK Accession No.
NM_001710.5 (incorporated herein as SEQ ID NO: 1), GENBANK
Accession No. NT_007592.15 truncated from nucleotides 31852000 to
31861000 (incorporated herein as SEQ ID NO: 2), GENBANK Accession
No NW 001116486.1 truncated from nucleotides 536000 to 545000
(incorporated herein as SEQ ID NO: 3), GENBANK Accession No.
XM_001113553.2 (incorporated herein as SEQ ID NO: 4), or GENBANK
Accession No. NM_008198.2 (incorporated herein as SEQ ID NO:
5).
Hybridization
[0306] In some embodiments, hybridization occurs between an
antisense compound disclosed herein and a CFB nucleic acid. The
most common mechanism of hybridization involves hydrogen bonding
(e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen
bonding) between complementary nucleobases of the nucleic acid
molecules.
[0307] Hybridization can occur under varying conditions. Stringent
conditions are sequence-dependent and are determined by the nature
and composition of the nucleic acid molecules to be hybridized.
[0308] Methods of determining whether a sequence is specifically
hybridizable to a target nucleic acid are well known in the art. In
certain embodiments, the antisense compounds provided herein are
specifically hybridizable with a CFB nucleic acid.
Complementarity
[0309] An antisense compound and a target nucleic acid are
complementary to each other when a sufficient number of nucleobases
of the antisense compound can hydrogen bond with the corresponding
nucleobases of the target nucleic acid, such that a desired effect
will occur (e.g., antisense inhibition of a target nucleic acid,
such as a CFB nucleic acid).
[0310] Non-complementary nucleobases between an antisense compound
and a CFB nucleic acid may be tolerated provided that the antisense
compound remains able to specifically hybridize to a target nucleic
acid. Moreover, an antisense compound may hybridize over one or
more segments of a CFB nucleic acid such that intervening or
adjacent segments are not involved in the hybridization event
(e.g., a loop structure, mismatch or hairpin structure).
[0311] In certain embodiments, the antisense compounds provided
herein, or a specified portion thereof, are, or are at least, 70%,
80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99%, or 100% complementary to a CFB nucleic acid, a
target region, target segment, or specified portion thereof.
Percent complementarity of an antisense compound with a target
nucleic acid can be determined using routine methods.
[0312] For example, an antisense compound in which 18 of 20
nucleobases of the antisense compound are complementary to a target
region, and would therefore specifically hybridize, would represent
90 percent complementarity. In this example, the remaining
noncomplementary nucleobases may be clustered or interspersed with
complementary nucleobases and need not be contiguous to each other
or to complementary nucleobases. As such, an antisense compound
which is 18 nucleobases in length having four noncomplementary
nucleobases which are flanked by two regions of complete
complementarity with the target nucleic acid would have 77.8%
overall complementarity with the target nucleic acid and would thus
fall within the scope of the present invention. Percent
complementarity of an antisense compound with a region of a target
nucleic acid can be determined routinely using BLAST programs
(basic local alignment search tools) and PowerBLAST programs known
in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410;
Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology,
sequence identity or complementarity, can be determined by, for
example, the Gap program (Wisconsin Sequence Analysis Package,
Version 8 for Unix, Genetics Computer Group, University Research
Park, Madison Wis.), using default settings, which uses the
algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482
489).
[0313] In certain embodiments, the antisense compounds provided
herein, or specified portions thereof, are fully complementary
(i.e. 100% complementary) to a target nucleic acid, or specified
portion thereof. For example, an antisense compound may be fully
complementary to a CFB nucleic acid, or a target region, or a
target segment or target sequence thereof. As used herein, "fully
complementary" means each nucleobase of an antisense compound is
capable of precise base pairing with the corresponding nucleobases
of a target nucleic acid. For example, a 20 nucleobase antisense
compound is fully complementary to a target sequence that is 400
nucleobases long, so long as there is a corresponding 20 nucleobase
portion of the target nucleic acid that is fully complementary to
the antisense compound. Fully complementary can also be used in
reference to a specified portion of the first and/or the second
nucleic acid. For example, a 20 nucleobase portion of a 30
nucleobase antisense compound can be "fully complementary" to a
target sequence that is 400 nucleobases long. The 20 nucleobase
portion of the 30 nucleobase oligonucleotide is fully complementary
to the target sequence if the target sequence has a corresponding
20 nucleobase portion wherein each nucleobase is complementary to
the 20 nucleobase portion of the antisense compound. At the same
time, the entire 30 nucleobase antisense compound may or may not be
fully complementary to the target sequence, depending on whether
the remaining 10 nucleobases of the antisense compound are also
complementary to the target sequence.
[0314] The location of a non-complementary nucleobase may be at the
5' end or 3' end of the antisense compound. Alternatively, the
non-complementary nucleobase or nucleobases may be at an internal
position of the antisense compound. When two or more
non-complementary nucleobases are present, they may be contiguous
(i.e. linked) or non-contiguous. In one embodiment, a
non-complementary nucleobase is located in the wing segment of a
gapmer antisense oligonucleotide.
[0315] In certain embodiments, antisense compounds that are, or are
up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in
length comprise no more than 4, no more than 3, no more than 2, or
no more than 1 non-complementary nucleobase(s) relative to a target
nucleic acid, such as a CFB nucleic acid, or specified portion
thereof.
[0316] In certain embodiments, antisense compounds that are, or are
up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, or 30 nucleobases in length comprise no more than
6, no more than 5, no more than 4, no more than 3, no more than 2,
or no more than 1 non-complementary nucleobase(s) relative to a
target nucleic acid, such as a CFB nucleic acid, or specified
portion thereof.
[0317] The antisense compounds provided also include those which
are complementary to a portion of a target nucleic acid. As used
herein, "portion" refers to a defined number of contiguous (i.e.
linked) nucleobases within a region or segment of a target nucleic
acid. A "portion" can also refer to a defined number of contiguous
nucleobases of an antisense compound. In certain embodiments, the
antisense compounds, are complementary to at least an 8 nucleobase
portion of a target segment. In certain embodiments, the antisense
compounds are complementary to at least a 9 nucleobase portion of a
target segment. In certain embodiments, the antisense compounds are
complementary to at least a 10 nucleobase portion of a target
segment. In certain embodiments, the antisense compounds are
complementary to at least an 11 nucleobase portion of a target
segment. In certain embodiments, the antisense compounds are
complementary to at least a 12 nucleobase portion of a target
segment. In certain embodiments, the antisense compounds are
complementary to at least a 13 nucleobase portion of a target
segment. In certain embodiments, the antisense compounds are
complementary to at least a 14 nucleobase portion of a target
segment. In certain embodiments, the antisense compounds are
complementary to at least a 15 nucleobase portion of a target
segment. Also contemplated are antisense compounds that are
complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, or more nucleobase portion of a target segment, or a range
defined by any two of these values.
Identity
[0318] The antisense compounds provided herein may also have a
defined percent identity to a particular nucleotide sequence, SEQ
ID NO, or compound represented by a specific Isis number, or
portion thereof. As used herein, an antisense compound is identical
to the sequence disclosed herein if it has the same nucleobase
pairing ability. For example, a RNA which contains uracil in place
of thymidine in a disclosed DNA sequence would be considered
identical to the DNA sequence since both uracil and thymidine pair
with adenine.
[0319] Shortened and lengthened versions of the antisense compounds
described herein as well as compounds having non-identical bases
relative to the antisense compounds provided herein also are
contemplated. The non-identical bases may be adjacent to each other
or dispersed throughout the antisense compound. Percent identity of
an antisense compound is calculated according to the number of
bases that have identical base pairing relative to the sequence to
which it is being compared.
[0320] In certain embodiments, the antisense compounds, or portions
thereof, are, or are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%,
97%, 98%, 99% or 100% identical to one or more of the antisense
compounds or SEQ ID NOs, or a portion thereof, disclosed
herein.
[0321] In certain embodiments, a portion of the antisense compound
is compared to an equal length portion of the target nucleic acid.
In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to
an equal length portion of the target nucleic acid.
[0322] In certain embodiments, a portion of the antisense
oligonucleotide is compared to an equal length portion of the
target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase
portion is compared to an equal length portion of the target
nucleic acid.
Modifications
[0323] A nucleoside is a base-sugar combination. The nucleobase
(also known as base) portion of the nucleoside is normally a
heterocyclic base moiety. Nucleotides are nucleosides that further
include a phosphate group covalently linked to the sugar portion of
the nucleoside. For those nucleosides that include a pentofuranosyl
sugar, the phosphate group can be linked to the 2', 3' or 5'
hydroxyl moiety of the sugar. Oligonucleotides are formed through
the covalent linkage of adjacent nucleosides to one another, to
form a linear polymeric oligonucleotide. Within the oligonucleotide
structure, the phosphate groups are commonly referred to as forming
the internucleoside linkages of the oligonucleotide.
[0324] Modifications to antisense compounds encompass substitutions
or changes to internucleoside linkages, sugar moieties, or
nucleobases. Modified antisense compounds are often preferred over
native forms because of desirable properties such as, for example,
enhanced cellular uptake, enhanced affinity for nucleic acid
target, increased stability in the presence of nucleases, or
increased inhibitory activity.
[0325] Chemically modified nucleosides may also be employed to
increase the binding affinity of a shortened or truncated antisense
oligonucleotide for its target nucleic acid. Consequently,
comparable results can often be obtained with shorter antisense
compounds that have such chemically modified nucleosides.
Modified Internucleoside Linkages
[0326] The naturally occurring internucleoside linkage of RNA and
DNA is a 3' to 5' phosphodiester linkage. Antisense compounds
having one or more modified, i.e. non-naturally occurring,
internucleoside linkages are often selected over antisense
compounds having naturally occurring internucleoside linkages
because of desirable properties such as, for example, enhanced
cellular uptake, enhanced affinity for target nucleic acids, and
increased stability in the presence of nucleases.
[0327] Oligonucleotides having modified internucleoside linkages
include internucleoside linkages that retain a phosphorus atom as
well as internucleoside linkages that do not have a phosphorus
atom. Representative phosphorus containing internucleoside linkages
include, but are not limited to, phosphodiesters, phosphotriesters,
methylphosphonates, phosphoramidate, and phosphorothioates. Methods
of preparation of phosphorous-containing and
non-phosphorous-containing linkages are well known.
[0328] In certain embodiments, antisense compounds targeted to a
CFB nucleic acid comprise one or more modified internucleoside
linkages. In certain embodiments, the modified internucleoside
linkages are phosphorothioate linkages. In certain embodiments,
each internucleoside linkage of an antisense compound is a
phosphorothioate internucleoside linkage.
Modified Sugar Moieties
[0329] Antisense compounds can optionally contain one or more
nucleosides wherein the sugar group has been modified. Such sugar
modified nucleosides may impart enhanced nuclease stability,
increased binding affinity, or some other beneficial biological
property to the antisense compounds. In certain embodiments,
nucleosides comprise chemically modified ribofuranose ring
moieties. Examples of chemically modified ribofuranose rings
include without limitation, addition of substitutent groups
(including 5' and 2' substituent groups, bridging of non-geminal
ring atoms to form bicyclic nucleic acids (BNA), replacement of the
ribosyl ring oxygen atom with S, N(R), or C(R.sub.1)(R.sub.2) (R,
R.sub.1 and R.sub.2 are each independently H, C.sub.1-C.sub.12
alkyl or a protecting group) and combinations thereof. Examples of
chemically modified sugars include 2'-F-5'-methyl substituted
nucleoside (see PCT International Application WO 2008/101157
Published on Aug. 21, 2008 for other disclosed 5',2'-bis
substituted nucleosides) or replacement of the ribosyl ring oxygen
atom with S with further substitution at the 2'-position (see
published U.S. Patent Application US2005-0130923, published on Jun.
16, 2005) or alternatively 5'-substitution of a BNA (see PCT
International Application WO 2007/134181 Published on Nov. 22, 2007
wherein LNA is substituted with for example a 5'-methyl or a
5'-vinyl group).
[0330] Examples of nucleosides having modified sugar moieties
include without limitation nucleosides comprising 5'-vinyl,
5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH.sub.3, 2'-OCH.sub.2CH.sub.3,
2'-OCH.sub.2CH.sub.2F and 2'-O(CH.sub.2).sub.2OCH.sub.3 substituent
groups. The substituent at the 2' position can also be selected
from allyl, amino, azido, thio, O-allyl, O--C.sub.1-C.sub.10 alkyl,
OCF.sub.3, OCH.sub.2F, O(CH.sub.2).sub.2SCH.sub.3,
O(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n),
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), and
O--CH.sub.2--C(.dbd.O)--N(R.sub.l)--(CH.sub.2).sub.2--N(R.sub.m)(R.sub.n)-
, where each R.sub.l, R.sub.m and R.sub.n is, independently, H or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0331] As used herein, "bicyclic nucleosides" refer to modified
nucleosides comprising a bicyclic sugar moiety. Examples of
bicyclic nucleosides include without limitation nucleosides
comprising a bridge between the 4' and the 2' ribosyl ring atoms.
In certain embodiments, antisense compounds provided herein include
one or more bicyclic nucleosides comprising a 4' to 2' bridge.
Examples of such 4' to 2' bridged bicyclic nucleosides, include but
are not limited to one of the formulae: 4'-(CH.sub.2)--O-2' (LNA);
4'-(CH.sub.2)--S-2'; 4'-(CH.sub.2).sub.2-0-2' (ENA);
4'-CH(CH.sub.3)--O-2' (also referred to as constrained ethyl or
cEt) and 4'-CH(CH.sub.2OCH.sub.3)--O-2' (and analogs thereof see
U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008);
4'-C(CH.sub.3)(CH.sub.3)--O-2' (and analogs thereof see published
International Application WO/2009/006478, published Jan. 8, 2009);
4'-CH.sub.2--N(OCH.sub.3)-2' (and analogs thereof see published
International Application WO/2008/150729, published Dec. 11, 2008);
4'-CH.sub.2--O--N(CH.sub.3)-2' (see published U.S. Patent
Application US2004-0171570, published Sep. 2, 2004);
4'-CH.sub.2--N(R)--O-2', wherein R is H, C.sub.1-C.sub.12 alkyl, or
a protecting group (see U.S. Pat. No. 7,427,672, issued on Sep. 23,
2008); 4'-CH.sub.2--C(H)(CH.sub.3)-2' (see Chattopadhyaya et al.,
J. Org. Chem., 2009, 74, 118-134); and
4'-CH.sub.2--C(.dbd.CH.sub.2)-2' (and analogs thereof see published
International Application WO 2008/154401, published on Dec. 8,
2008).
[0332] Further reports related to bicyclic nucleosides can also be
found in published literature (see for example: Singh et al., Chem.
Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54,
3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A, 2000,
97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8,
2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039;
Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379;
Elayadi et al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561;
Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr.
Opinion Mol. Ther., 2001, 3, 239-243; U.S. Pat. Nos. 6,268,490;
6,525,191; 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207;
7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication No.
US2008-0039618; US2009-0012281; U.S. Patent Ser. Nos. 60/989,574;
61/026,995; 61/026,998; 61/056,564; 61/086,231; 61/097,787; and
61/099,844; Published PCT International applications WO
1994/014226; WO 2004/106356; WO 2005/021570; WO 2007/134181; WO
2008/150729; WO 2008/154401; and WO 2009/006478. Each of the
foregoing bicyclic nucleosides can be prepared having one or more
stereochemical sugar configurations including for example
.alpha.-L-ribofuranose and .beta.-D-ribofuranose (see PCT
international application PCT/DK98/00393, published on Mar. 25,
1999 as WO 99/14226).
[0333] In certain embodiments, bicyclic sugar moieties of BNA
nucleosides include, but are not limited to, compounds having at
least one bridge between the 4' and the 2' position of the
pentofuranosyl sugar moiety wherein such bridges independently
comprises 1 or from 2 to 4 linked groups independently selected
from --[C(R.sub.a)(R.sub.b)].sub.n--,
--C(R.sub.a).dbd.C(R.sub.b)--, --C(R.sub.a).dbd.N--, --C(.dbd.O)--,
--C(.dbd.NR.sub.a)--, --C(.dbd.S)--, --O--, --Si(R.sub.a).sub.2--,
--S(.dbd.O).sub.x--, and --N(R.sub.a)--;
[0334] wherein:
[0335] x is 0, 1, or 2;
[0336] n is 1, 2, 3, or 4;
[0337] each R.sub.a and R.sub.b is, independently, H, a protecting
group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle
radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7
alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical,
halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1,
acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
[0338] each J.sub.1 and J.sub.2 is, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group.
[0339] In certain embodiments, the bridge of a bicyclic sugar
moiety is --[C(R.sub.a)(R.sub.b)].sub.n--,
--[C(R.sub.a)(R.sub.b)].sub.n--O--C(R.sub.aR.sub.b)--N(R)--O-- or
--C(R.sub.aR.sub.b)--O--N(R)--. In certain embodiments, the bridge
is 4'-CH.sub.2-2', 4'-(CH.sub.2).sub.2-2', 4'-(CH.sub.2).sub.3-2',
4'-CH.sub.2--O-2', 4'-(CH.sub.2).sub.2--O-2',
4'-CH.sub.2--O--N(R)-2' and 4'-CH.sub.2--N(R)--O-2'-wherein each R
is, independently, H, a protecting group or C.sub.1-C.sub.12
alkyl.
[0340] In certain embodiments, bicyclic nucleosides are further
defined by isomeric configuration. For example, a nucleoside
comprising a 4'-2' methylene-oxy bridge, may be in the .alpha.-L
configuration or in the f3-D configuration. Previously,
.alpha.-L-methyleneoxy (4'-CH.sub.2--O-2') BNA's have been
incorporated into antisense oligonucleotides that showed antisense
activity (Frieden et al., Nucleic Acids Research, 2003, 21,
6365-6372).
[0341] In certain embodiments, bicyclic nucleosides include, but
are not limited to, (A) .alpha.-L-methyleneoxy (4'-CH.sub.2--O-2')
BNA, (B) .beta.-D-methyleneoxy (4'-CH.sub.2--O-2') BNA, (C)
ethyleneoxy (4'-(CH.sub.2).sub.2--O-2') BNA, (D) aminooxy
(4'-CH.sub.2--O--N(R)-2') BNA, (E) oxyamino
(4'-CH.sub.2--N(R)--O-2') BNA, and (F) methyl(methyleneoxy)
(4'-CH(CH.sub.3)--O-2') BNA, (G) methylene-thio (4'-CH.sub.2--S-2')
BNA, (H) methylene-amino (4'-CH.sub.2--N(R)-2') BNA, (I) methyl
carbocyclic (4'-CH.sub.2--CH(CH.sub.3)-2') BNA, (J) propylene
carbocyclic (4'-(CH.sub.2).sub.3-2') BNA and (K) vinyl BNA as
depicted below:
##STR00011## ##STR00012##
[0342] wherein Bx is the base moiety and R is independently H, a
protecting group, C.sub.1-C.sub.12 alkyl or C.sub.1-C.sub.12
alkoxy.
[0343] In certain embodiments, bicyclic nucleosides are provided
having Formula I:
##STR00013##
wherein:
[0344] Bx is a heterocyclic base moiety;
[0345] -Q.sub.a-Q.sub.b-Q.sub.c- is
--CH.sub.2--N(R.sub.c)--CH.sub.2--,
--C(.dbd.O)--N(R.sub.c)--CH.sub.2--, --CH.sub.2--O--N(R.sub.c)--,
--CH.sub.2--N(R.sub.c)--O-- or --N(R.sub.c)--O--CH.sub.2;
[0346] R.sub.c is C.sub.1-C.sub.12 alkyl or an amino protecting
group; and
[0347] T.sub.a and T.sub.b are each, independently H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety or a covalent attachment to a support medium.
[0348] In certain embodiments, bicyclic nucleosides are provided
having Formula II:
##STR00014##
wherein:
[0349] Bx is a heterocyclic base moiety;
[0350] T.sub.a and T.sub.b are each, independently H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety or a covalent attachment to a support medium;
[0351] Z.sub.a is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl,
substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6
alkynyl, acyl, substituted acyl, substituted amide, thiol or
substituted thio.
[0352] In one embodiment, each of the substituted groups is,
independently, mono or poly substituted with substituent groups
independently selected from halogen, oxo, hydroxyl, OJ.sub.c,
NJ.sub.cJ.sub.d, SJ.sub.c, N.sub.3, OC(.dbd.X)J.sub.c, and
NJ.sub.eC(.dbd.X)NJ.sub.cJ.sub.d, wherein each J.sub.c, J.sub.d and
J.sub.e is, independently, H, C.sub.1-C.sub.6 alkyl, or substituted
C.sub.1-C.sub.6 alkyl and X is O or NJ.sub.c.
[0353] In certain embodiments, bicyclic nucleosides are provided
having Formula III:
##STR00015##
wherein:
[0354] Bx is a heterocyclic base moiety;
[0355] T.sub.a and T.sub.b are each, independently H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety or a covalent attachment to a support medium;
[0356] Z.sub.b is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl,
substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6
alkynyl or substituted acyl (C(.dbd.O)--).
[0357] In certain embodiments, bicyclic nucleosides are provided
having Formula IV:
##STR00016##
wherein:
[0358] Bx is a heterocyclic base moiety;
[0359] T.sub.a and T.sub.b are each, independently H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety or a covalent attachment to a support medium;
[0360] R.sub.d is C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted
C.sub.2-C.sub.6 alkynyl;
[0361] each q.sub.a, q.sub.b, q.sub.c and q.sub.d is,
independently, H, halogen, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted
C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxyl, substituted
C.sub.1-C.sub.6 alkoxyl, acyl, substituted acyl, C.sub.1-C.sub.6
aminoalkyl or substituted C.sub.1-C.sub.6 aminoalkyl;
[0362] In certain embodiments, bicyclic nucleosides are provided
having Formula V:
##STR00017##
wherein:
[0363] Bx is a heterocyclic base moiety;
[0364] T.sub.a and T.sub.b are each, independently H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety or a covalent attachment to a support medium;
[0365] q.sub.a, q.sub.b, q.sub.e and q.sub.f are each,
independently, hydrogen, halogen, C.sub.1-C.sub.12 alkyl,
substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl,
substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl,
substituted C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxy,
substituted C.sub.1-C.sub.12 alkoxy, OJ.sub.j, SJ.sub.j, SOJ.sub.j,
SO.sub.2J.sub.j, NJ.sub.iJ.sub.k, N.sub.3, CN, C(.dbd.O)OJ.sub.j,
C(.dbd.O)NJ.sub.jJ.sub.k, C(.dbd.O)J.sub.j,
O--C(.dbd.O)NJ.sub.jJ.sub.k, N(H)C(.dbd.NH)NJ.sub.jJ.sub.k,
N(H)C(.dbd.O)NJ.sub.jJ.sub.k or N(H)C(.dbd.S)NJ.sub.jJ.sub.k;
[0366] or q.sub.e and q.sub.f together are
.dbd.C(q.sub.g)(q.sub.h);
[0367] q.sub.g and q.sub.h are each, independently, H, halogen,
C.sub.1-C.sub.12 alkyl or substituted C.sub.1-C.sub.12 alkyl.
[0368] The synthesis and preparation of the methyleneoxy
(4'-CH.sub.2--O-2') BNA monomers adenine, cytosine, guanine,
5-methyl-cytosine, thymine and uracil, along with their
oligomerization, and nucleic acid recognition properties have been
described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs
and preparation thereof are also described in WO 98/39352 and WO
99/14226.
[0369] Analogs of methyleneoxy (4'-CH.sub.2--O-2') BNA and
2'-thio-BNAs, have also been prepared (Kumar et al., Bioorg. Med.
Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside
analogs comprising oligodeoxyribonucleotide duplexes as substrates
for nucleic acid polymerases has also been described (Wengel et
al., WO 99/14226). Furthermore, synthesis of 2'-amino-BNA, a novel
comformationally restricted high-affinity oligonucleotide analog
has been described in the art (Singh et al., J Org. Chem., 1998,
63, 10035-10039). In addition, 2'-amino- and 2'-methylamino-BNA's
have been prepared and the thermal stability of their duplexes with
complementary RNA and DNA strands has been previously reported.
[0370] In certain embodiments, bicyclic nucleosides are provided
having Formula VI:
##STR00018##
wherein:
[0371] Bx is a heterocyclic base moiety;
[0372] T.sub.a and T.sub.b are each, independently H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety or a covalent attachment to a support medium;
[0373] each q.sub.i, q.sub.j, q.sub.k and q.sub.i is,
independently, H, halogen, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxyl, substituted
C.sub.1-C.sub.12 alkoxyl, OJ.sub.j, SJ.sub.j, SOJ.sub.j,
SO.sub.2J.sub.j, NJ.sub.iJ.sub.k, N.sub.3, CN, C(.dbd.O)OJ.sub.j,
C(.dbd.O)NJ.sub.jJ.sub.k, C(.dbd.O)J.sub.j,
O--C(.dbd.O)NJ.sub.jJ.sub.k, N(H)C(.dbd.NH)NJ.sub.jJ.sub.k,
N(H)C(.dbd.O)NJ.sub.jJ.sub.k or N(H)C(.dbd.S)NJ.sub.jJ.sub.k;
and
[0374] q.sub.i and q.sub.j or q.sub.i and q.sub.k together are
.dbd.C(q.sub.g)(q.sub.h), wherein q.sub.g and q.sub.h are each,
independently, H, halogen, C.sub.1-C.sub.12 alkyl or substituted
C.sub.1-C.sub.12 alkyl.
[0375] One carbocyclic bicyclic nucleoside having a
4'-(CH.sub.2).sub.3-2' bridge and the alkenyl analog bridge
4'-CH.dbd.CH--CH.sub.2-2' have been described (Freier et al.,
Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al.,
J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation
of carbocyclic bicyclic nucleosides along with their
oligomerization and biochemical studies have also been described
(Srivastava et al., J Am. Chem. Soc., 2007, 129(26),
8362-8379).
[0376] As used herein, "4'-2' bicyclic nucleoside" or "4' to 2'
bicyclic nucleoside" refers to a bicyclic nucleoside comprising a
furanose ring comprising a bridge connecting two carbon atoms of
the furanose ring connects the 2' carbon atom and the 4' carbon
atom of the sugar ring.
[0377] As used herein, "monocylic nucleosides" refer to nucleosides
comprising modified sugar moieties that are not bicyclic sugar
moieties. In certain embodiments, the sugar moiety, or sugar moiety
analogue, of a nucleoside may be modified or substituted at any
position.
[0378] As used herein, "2'-modified sugar" means a furanosyl sugar
modified at the 2' position. In certain embodiments, such
modifications include substituents selected from: a halide,
including, but not limited to substituted and unsubstituted alkoxy,
substituted and unsubstituted thioalkyl, substituted and
unsubstituted amino alkyl, substituted and unsubstituted alkyl,
substituted and unsubstituted allyl, and substituted and
unsubstituted alkynyl. In certain embodiments, 2' modifications are
selected from substituents including, but not limited to:
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nNH.sub.2,
O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nF,
O(CH.sub.2).sub.nONH.sub.2, OCH.sub.2C(.dbd.O)N(H)CH.sub.3, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3].sub.2, where n and m
are from 1 to about 10. Other 2'-substituent groups can also be
selected from: C.sub.1-C.sub.12 alkyl, substituted alkyl, alkenyl,
alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3,
OCN, Cl, Br, CN, F, CF.sub.3, OCF.sub.3, SOCH.sub.3,
SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, an RNA cleaving group, a
reporter group, an intercalator, a group for improving
pharmacokinetic properties, or a group for improving the
pharmacodynamic properties of an antisense compound, and other
substituents having similar properties. In certain embodiments,
modified nucleosides comprise a 2'-MOE side chain (Baker et al., J
Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE substitution have
been described as having improved binding affinity compared to
unmodified nucleosides and to other modified nucleosides, such as
2'-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having
the 2'-MOE substituent also have been shown to be antisense
inhibitors of gene expression with promising features for in vivo
use (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al.,
Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans.,
1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides,
1997, 16, 917-926).
[0379] As used herein, a "modified tetrahydropyran nucleoside" or
"modified THP nucleoside" means a nucleoside having a six-membered
tetrahydropyran "sugar" substituted in for the pentofuranosyl
residue in normal nucleosides (a sugar surrogate). Modified THP
nucleosides include, but are not limited to, what is referred to in
the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA),
manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002,
10, 841-854) or fluoro HNA (F-HNA) having a tetrahydropyran ring
system as illustrated below:
##STR00019##
[0380] In certain embodiments, sugar surrogates are selected having
Formula VII:
##STR00020##
wherein independently for each of said at least one tetrahydropyran
nucleoside analog of Formula VII:
[0381] Bx is a heterocyclic base moiety;
[0382] T.sub.a and T.sub.b are each, independently, an
internucleoside linking group linking the tetrahydropyran
nucleoside analog to the antisense compound or one of T.sub.a and
T.sub.b is an internucleoside linking group linking the
tetrahydropyran nucleoside analog to the antisense compound and the
other of T.sub.a and T.sub.b is H, a hydroxyl protecting group, a
linked conjugate group or a 5' or 3'-terminal group;
[0383] q.sub.i, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and
q.sub.7 are each independently, H, C.sub.1-C.sub.6 alkyl,
substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or
substituted C.sub.2-C.sub.6 alkynyl; and each of R.sub.1 and
R.sub.2 is selected from hydrogen, hydroxyl, halogen, substituted
or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3,
OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 and CN, wherein X is O, S or
NJ.sub.1 and each J.sub.1, J.sub.2 and J.sub.3 is, independently, H
or C.sub.1-C.sub.6 alkyl.
[0384] In certain embodiments, the modified THP nucleosides of
Formula VII are provided wherein q.sub.1, q.sub.2, q.sub.3,
q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain
embodiments, at least one of q.sub.i, q.sub.2, q.sub.3, q.sub.4,
q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain
embodiments, at least one of q.sub.i, q.sub.2, q.sub.3, q.sub.4,
q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, THP
nucleosides of Formula VII are provided wherein one of R.sub.1 and
R.sub.2 is fluoro. In certain embodiments, R.sub.1 is fluoro and
R.sub.2 is H; R.sub.1 is methoxy and R.sub.2 is H, and R.sub.1 is
methoxyethoxy and R.sub.2 is H.
[0385] In certain embodiments, sugar surrogates comprise rings
having more than 5 atoms and more than one heteroatom. For example
nucleosides comprising morpholino sugar moieties and their use in
oligomeric compounds has been reported (see for example: Braasch et
al., Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos.
5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used here, the
term "morpholino" means a sugar surrogate having the following
formula:
##STR00021##
In certain embodiments, morpholinos may be modified, for example by
adding or altering various substituent groups from the above
morpholino structure. Such sugar surrogates are referred to herein
as "modified morpholinos."
[0386] Combinations of modifications are also provided without
limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT
International Application WO 2008/101157 published on Aug. 21, 2008
for other disclosed 5', 2'-bis substituted nucleosides) and
replacement of the ribosyl ring oxygen atom with S and further
substitution at the 2'-position (see published U.S. Patent
Application US2005-0130923, published on Jun. 16, 2005) or
alternatively 5'-substitution of a bicyclic nucleic acid (see PCT
International Application WO 2007/134181, published on Nov. 22,
2007 wherein a 4'-CH.sub.2--O-2' bicyclic nucleoside is further
substituted at the 5' position with a 5'-methyl or a 5'-vinyl
group). The synthesis and preparation of carbocyclic bicyclic
nucleosides along with their oligomerization and biochemical
studies have also been described (see, e.g., Srivastava et al., J.
Am. Chem. Soc. 2007, 129(26), 8362-8379).
[0387] In certain embodiments, antisense compounds comprise one or
more modified cyclohexenyl nucleosides, which is a nucleoside
having a six-membered cyclohexenyl in place of the pentofuranosyl
residue in naturally occurring nucleosides. Modified cyclohexenyl
nucleosides include, but are not limited to those described in the
art (see for example commonly owned, published PCT Application WO
2010/036696, published on Apr. 10, 2010, Robeyns et al., J. Am.
Chem. Soc., 2008, 130(6), 1979-1984; Horvath et al., Tetrahedron
Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem.
Soc., 2007, 129(30), 9340-9348; Gu et al., Nucleosides, Nucleotides
& Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al.,
Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al.,
Acta Crystallographica, Section F: Structural Biology and
Crystallization Communications, 2005, F61(6), 585-586; Gu et al.,
Tetrahedron, 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides,
2003, 13(6), 479-489; Wang et al., J. Org. Chem., 2003, 68,
4499-4505; Verbeure et al., Nucleic Acids Research, 2001, 29(24),
4941-4947; Wang et al., J. Org. Chem., 2001, 66, 8478-82; Wang et
al., Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7),
785-788; Wang et al., J. Am. Chem., 2000, 122, 8595-8602; Published
PCT application, WO 06/047842; and Published PCT Application WO
01/049687; the text of each is incorporated by reference herein, in
their entirety). Certain modified cyclohexenyl nucleosides have
Formula X.
##STR00022##
[0388] wherein independently for each of said at least one
cyclohexenyl nucleoside analog of Formula X:
[0389] Bx is a heterocyclic base moiety;
[0390] T.sub.3 and T.sub.4 are each, independently, an
internucleoside linking group linking the cyclohexenyl nucleoside
analog to an antisense compound or one of T.sub.3 and T.sub.4 is an
internucleoside linking group linking the tetrahydropyran
nucleoside analog to an antisense compound and the other of T.sub.3
and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate
group, or a 5'- or 3'-terminal group; and
[0391] q.sub.i, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6,
q.sub.7, q.sub.8 and q.sub.9 are each, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, substituted C.sub.2-C.sub.6 alkynyl or
other sugar substituent group.
[0392] As used herein, "2'-modified" or "2'-substituted" refers to
a nucleoside comprising a sugar comprising a substituent at the 2'
position other than H or OH. 2'-modified nucleosides, include, but
are not limited to, bicyclic nucleosides wherein the bridge
connecting two carbon atoms of the sugar ring connects the 2'
carbon and another carbon of the sugar ring; and nucleosides with
non-bridging 2'substituents, such as allyl, amino, azido, thio,
O-allyl, O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), or
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. 2'-modified nucleosides may further
comprise other modifications, for example at other positions of the
sugar and/or at the nucleobase.
[0393] As used herein, "2'-F" refers to a nucleoside comprising a
sugar comprising a fluoro group at the 2' position of the sugar
ring.
[0394] As used herein, "2'-OMe" or "2'-OCH.sub.3" or "2'-O-methyl"
each refers to a nucleoside comprising a sugar comprising an
--OCH.sub.3 group at the 2' position of the sugar ring.
[0395] As used herein, "MOE" or "2'-MOE" or
"2'-OCH.sub.2CH.sub.2OCH.sub.3" or "2'-O-methoxyethyl" each refers
to a nucleoside comprising a sugar comprising a
--OCH.sub.2CH.sub.2OCH.sub.3 group at the 2' position of the sugar
ring.
[0396] As used herein, "oligonucleotide" refers to a compound
comprising a plurality of linked nucleosides. In certain
embodiments, one or more of the plurality of nucleosides is
modified. In certain embodiments, an oligonucleotide comprises one
or more ribonucleosides (RNA) and/or deoxyribonucleosides
(DNA).
[0397] Many other bicyclo and tricyclo sugar surrogate ring systems
are also known in the art that can be used to modify nucleosides
for incorporation into antisense compounds (see for example review
article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854). Such ring
systems can undergo various additional substitutions to enhance
activity.
[0398] Methods for the preparations of modified sugars are well
known to those skilled in the art. Some representative U.S. patents
that teach the preparation of such modified sugars include without
limitation, U.S.: 4,981,957; 5,118,800; 5,319,080; 5,359,044;
5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811;
5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873;
5,646,265; 5,670,633; 5,700,920; 5,792,847 and 6,600,032 and
International Application PCT/US2005/019219, filed Jun. 2, 2005 and
published as WO 2005/121371 on Dec. 22, 2005, and each of which is
herein incorporated by reference in its entirety.
[0399] In nucleotides having modified sugar moieties, the
nucleobase moieties (natural, modified or a combination thereof)
are maintained for hybridization with an appropriate nucleic acid
target.
[0400] In certain embodiments, antisense compounds comprise one or
more nucleosides having modified sugar moieties. In certain
embodiments, the modified sugar moiety is 2'-MOE. In certain
embodiments, the 2'-MOE modified nucleosides are arranged in a
gapmer motif. In certain embodiments, the modified sugar moiety is
a bicyclic nucleoside having a (4'-CH(CH.sub.3)--O-2') bridging
group. In certain embodiments, the (4'-CH(CH.sub.3)--O-2') modified
nucleosides are arranged throughout the wings of a gapmer
motif.
Modified Nucleobases
[0401] Nucleobase (or base) modifications or substitutions are
structurally distinguishable from, yet functionally interchangeable
with, naturally occurring or synthetic unmodified nucleobases. Both
natural and modified nucleobases are capable of participating in
hydrogen bonding. Such nucleobase modifications can impart nuclease
stability, binding affinity or some other beneficial biological
property to antisense compounds. Modified nucleobases include
synthetic and natural nucleobases such as, for example,
5-methylcytosine (5-me-C). Certain nucleobase substitutions,
including 5-methylcytosine substitutions, are particularly useful
for increasing the binding affinity of an antisense compound for a
target nucleic acid. For example, 5-methylcytosine substitutions
have been shown to increase nucleic acid duplex stability by
0.6-1.2.degree. C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B.,
eds., Antisense Research and Applications, CRC Press, Boca Raton,
1993, pp. 276-278).
[0402] Additional modified nucleobases include 5-hydroxymethyl
cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and
other alkyl derivatives of adenine and guanine, 2-propyl and other
alkyl derivatives of adenine and guanine, 2-thiouracil,
2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine,
5-propynyl (--C.dbd.C--CH.sub.3) uracil and cytosine and other
alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine.
[0403] Heterocyclic base moieties can also include those in which
the purine or pyrimidine base is replaced with other heterocycles,
for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and
2-pyridone. Nucleobases that are particularly useful for increasing
the binding affinity of antisense compounds include 5-substituted
pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted
purines, including 2 aminopropyladenine, 5-propynyluracil and
5-propynylcytosine.
[0404] In certain embodiments, antisense compounds targeted to a
CFB nucleic acid comprise one or more modified nucleobases. In
certain embodiments, shortened or gap-widened antisense
oligonucleotides targeted to a CFB nucleic acid comprise one or
more modified nucleobases. In certain embodiments, the modified
nucleobase is 5-methylcytosine. In certain embodiments, each
cytosine is a 5-methylcytosine.
Conjugated Antisense Compounds
[0405] Antisense compounds may be covalently linked to one or more
moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the resulting antisense
oligonucleotides. Typical conjugate groups include cholesterol
moieties and lipid moieties. Additional conjugate groups include
carbohydrates, phospholipids, biotin, phenazine, folate,
phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines,
coumarins, and dyes.
[0406] Antisense compounds can also be modified to have one or more
stabilizing groups that are generally attached to one or both
termini of antisense compounds to enhance properties such as, for
example, nuclease stability. Included in stabilizing groups are cap
structures. These terminal modifications protect the antisense
compound having terminal nucleic acid from exonuclease degradation,
and can help in delivery and/or localization within a cell. The cap
can be present at the 5'-terminus (5'-cap), or at the 3'-terminus
(3'-cap), or can be present on both termini. Cap structures are
well known in the art and include, for example, inverted deoxy
abasic caps. Further 3' and 5'-stabilizing groups that can be used
to cap one or both ends of an antisense compound to impart nuclease
stability include those disclosed in WO 03/004602 published on Jan.
16, 2003.
[0407] In certain embodiments, antisense compounds, including, but
not limited to those particularly suited for use as ssRNA, are
modified by attachment of one or more conjugate groups. In general,
conjugate groups modify one or more properties of the attached
oligonucleotide, including but not limited to pharmacodynamics,
pharmacokinetics, stability, binding, absorption, cellular
distribution, cellular uptake, charge and clearance. Conjugate
groups are routinely used in the chemical arts and are linked
directly or via an optional conjugate linking moiety or conjugate
linking group to a parent compound such as an oligonucleotide.
Conjugate groups includes without limitation, intercalators,
reporter molecules, polyamines, polyamides, polyethylene glycols,
thioethers, polyethers, cholesterols, thiocholesterols, cholic acid
moieties, folate, lipids, phospholipids, biotin, phenazine,
phenanthridine, anthraquinone, adamantane, acridine, fluoresceins,
rhodamines, coumarins and dyes. Certain conjugate groups have been
described previously, for example: cholesterol moiety (Letsinger et
al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid
(Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a
thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y.
Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med.
Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et
al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain,
e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al.,
EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990,
259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0408] For additional conjugates including those useful for ssRNA
and their placement within antisense compounds, see e.g., U.S.
Application No. 61/583,963.
In Vitro Testing of Antisense Oligonucleotides
[0409] Described herein are methods for treatment of cells with
antisense oligonucleotides, which can be modified appropriately for
treatment with other antisense compounds.
[0410] Cells may be treated with antisense oligonucleotides when
the cells reach approximately 60-80% confluency in culture.
[0411] One reagent commonly used to introduce antisense
oligonucleotides into cultured cells includes the cationic lipid
transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, Calif.).
Antisense oligonucleotides may be mixed with LIPOFECTIN in OPTI-MEM
1 (Invitrogen, Carlsbad, Calif.) to achieve the desired final
concentration of antisense oligonucleotide and a LIPOFECTIN
concentration that may range from 2 to 12 ug/mL per 100 nM
antisense oligonucleotide.
[0412] Another reagent used to introduce antisense oligonucleotides
into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad,
Calif.). Antisense oligonucleotide is mixed with LIPOFECTAMINE in
OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to
achieve the desired concentration of antisense oligonucleotide and
a LIPOFECTAMINE concentration that may range from 2 to 12 ug/mL per
100 nM antisense oligonucleotide.
[0413] Another technique used to introduce antisense
oligonucleotides into cultured cells includes electroporation.
[0414] Yet another technique used to introduce antisense
oligonucleotides into cultured cells includes free uptake of the
oligonucleotides by the cells.
[0415] Cells are treated with antisense oligonucleotides by routine
methods. Cells may be harvested 16-24 hours after antisense
oligonucleotide treatment, at which time RNA or protein levels of
target nucleic acids are measured by methods known in the art and
described herein. In general, when treatments are performed in
multiple replicates, the data are presented as the average of the
replicate treatments.
[0416] The concentration of antisense oligonucleotide used varies
from cell line to cell line. Methods to determine the optimal
antisense oligonucleotide concentration for a particular cell line
are well known in the art. Antisense oligonucleotides are typically
used at concentrations ranging from 1 nM to 300 nM when transfected
with LIPOFECTAMINE. Antisense oligonucleotides are used at higher
concentrations ranging from 625 to 20,000 nM when transfected using
electroporation.
RNA Isolation
[0417] RNA analysis can be performed on total cellular RNA or
poly(A)+ mRNA. Methods of RNA isolation are well known in the art.
RNA is prepared using methods well known in the art, for example,
using the TRIZOL Reagent (Invitrogen, Carlsbad, Calif.) according
to the manufacturer's recommended protocols.
Certain Indications
[0418] Certain embodiments provided herein relate to methods of
treating, preventing, or ameliorating a disease associated with
dysregulation of the complement alternative pathway in a subject by
administration of a CFB specific inhibitor, such as an antisense
compound targeted to CFB.
[0419] Examples of renal diseases associated with dysregulation of
the complement alternative pathway treatable, preventable, and/or
ameliorable with the methods provided herein include C3
glomerulopathy, atypical hemolytic uremic syndrome (aHUS), dense
deposit disease (DDD; also known as MPGN Type II or C3Neph), and
CFHR5 nephropathy.
[0420] Additional renal diseases associated with dysregulation of
the complement alternative pathway treatable, preventable, and/or
ameliorable with the methods provided herein include IgA
nephropathy; mesangiocapillary (membranoproliferative)
glomerulonephritis (MPGN); autoimmune disorders including lupus
nephritis and systemic lupus erythematosus (SLE); infection-induced
glomerulonephritis (also known as Postinfectious
glomerulonephritis); and renal ischemia-reperfusion injury, for
example post-transplant renal ischemia-reperfusion injury.
[0421] Examples of non-renal disorders associated with
dysregulation of the complement alternative pathway treatable
and/or preventable with the methods provided herein include ocular
diseases such as macular degeneration, for example age-related
macular degeneration (AMD), including wet AMD and dry AMD, such as
Geographic Atrophy; neuromyelitis optica; corneal disease, such as
corneal inflammation; autoimmune uveitis; and diabetic retinopathy.
It has been reported that complement system is involved in ocular
diseases. Jha P, et al., Mol Immunol (2007) 44(16): 3901-3908.
Additional examples of non-renal disorders associated with
dysregulation of the complement alternative pathway treatable
and/or preventable with the methods provided herein include
ANCA-assocaited vasculitis, antiphospholipid syndrome (also known
as antiphospholipid antibody syndrome (APS)), asthma, rheumatoid
arthritis, Myasthenia Gravis, and multiple sclerosis.
[0422] Certain embodiments provided herein relate to methods of
treating, preventing, or ameliorating a renal disease associated
with dysregulation of the complement alternative pathway in a
subject by administration of a CFB specific inhibitor, such as an
antisense compound targeted to CFB. In certain embodiments, the
renal disease is lupus nephritis, systemic lupus erythematosus
(SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN),
CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or
any combination thereof.
[0423] Certain embodiments provided herein relate to methods of
treating, preventing, or ameliorating macular degeneration, such as
age-related macular degeneration (AMD), in a subject by
administration of a CFB specific inhibitor, such as an antisense
compound targeted to CFB. In certain embodiments, the AMD is wet
AMD or dry AMD. In certain embodiments, dry AMD can be Geographic
Atrophy. Studies have demonstrated the association of complement
alternative pathway dysregulation and AMD. Complement components
are common constituents of ocular drusen, the extracellular
material that accumulates in the macula of AMD patients.
Furthermore, it has been reported that CFH and CFB variants account
for nearly 75% of AMD cases in northern Europe and North America.
It has also been found that a specific CFB polymorphism confers
protection against AMD. Patel, N. et al., Eye (2008) 22(6):768-76.
Additionally, CFB homozygous null mice have lower complement
pathway activity, exhibit smaller ocular lesions, and choroidal
neovascularization (CNV) after laser photocoagulation. Rohrer, B.
et al., Invest Ophthalmol Vis Sci. (2009) 50(7):3056-64.
Furthermore, CFB siRNA treatment protects mice from laser induced
CNV. Bora, N S et al., J Immunol. (2006) 177(3): 1872-8. Studies
have also shown that the kidney and eye share developmental
pathways and structural features including basement membrane
collagen IV protomer composition and vascularity. Savige et al., J
Am Soc Nephrol. (2011) 22(8):1403-15. There is evidence that the
complement pathway is involved in renal and ocular diseases. For
instance, inherited complement regulatory protein deficiency causes
predisposition to atypical hemolytic uremic syndrome and AMD.
Richards A et al., Adv Immunol. (2007) 96:141-77. Additionally,
chronic kidney disease has been associated with AMD. Nitsch, D. et
al., Ophthalmic Epidemiol. (2009) 16(3): 181-6; Choi, J. et al,
Ophthalmic Epidemiol. (2011) 18(6):259-63. Dense deposit disease
(DDD), a kidney disease associated with dysregulated complement
alternative pathway, is characterized by acute nephritic syndrome
and ocular drusen. Cruz and Smith, GeneReviews (2007) July 20.
Moreover, mice harboring genetic deletion of a component of the
complement alternative pathway have coexisting renal and ocular
disease phenotypes. It has been reported that CFH homozygous null
mice develop DDD and present retinal abnormalities and visual
dysfunction. Pickering et al., Nat Genet. (2002) 31(4):424-8. Mouse
models of renal diseases associated with dysregulation of the
complement alternative pathway are also accepted as models of AMD.
Pennesi M E et al., Mol Apects Med (2012) 33:487-509. CFH null
mice, for example, are an accepted model for renal diseases, such
as DDD, and AMD. Furthermore, it has been reported that AMD is
associated with the systemic source of complement factors, which
accumulate locally in the eye to drive alternative pathway
complement activation. Loyet et al., Invest Ophthalmol Vis Sci.
(2012) 53(10):6628-37.
EXAMPLES
Non-Limiting Disclosure and Incorporation by Reference
[0424] While certain compounds, compositions and methods described
herein have been described with specificity in accordance with
certain embodiments, the following examples serve only to
illustrate the compounds described herein and are not intended to
limit the same. Each of the references recited in the present
application is incorporated herein by reference in its
entirety.
[0425] It is understood that the sequence set forth in each SEQ ID
NO in the examples contained herein is independent of any
modification to a sugar moiety, an internucleoside linkage, or a
nucleobase. As such, antisense compounds defined by a SEQ ID NO may
comprise, independently, one or more modifications to a sugar
moiety, an internucleoside linkage, or a nucleobase. Antisense
compounds described by Isis Number (Isis No) indicate a combination
of nucleobase sequence and motif.
Example 1: Antisense Inhibition of Human Complement Factor B (CFB)
in HepG2 Cells by MOE Gapmers
[0426] Antisense oligonucleotides were designed targeting human
Complement Factor B (CFB) nucleic acid and were tested for their
effects on CFB mRNA in vitro. The antisense oligonucleotides were
tested in a series of experiments that had similar culture
conditions. The results for each experiment are presented in
separate tables shown below. Cultured HepG2 cells at a density of
20,000 cells per well were transfected using electroporation with
4,500 nM antisense oligonucleotide. After a treatment period of
approximately 24 hours, RNA was isolated from the cells and CFB
mRNA levels were measured by quantitative real-time PCR. Human
primer probe set RTS3459 (forward sequence AGTCTCTGTGGCATGGTTTGG,
designated herein as SEQ ID NO: 810; reverse sequence
GGGCGAATGACTGAGATCTTG, designated herein as SEQ ID NO: 811; probe
sequence TACCGATTACCACAAGCAACCATGGCA, designated herein as SEQ ID
NO: 812) was used to measure mRNA levels. CFB mRNA levels were
adjusted according to total RNA content, as measured by
RIBOGREEN.RTM.. Results are presented as percent inhibition of CFB,
relative to untreated control cells.
[0427] The newly designed chimeric antisense oligonucleotides in
the Tables below were designed as 5-10-5 MOE gapmers. The 5-10-5
MOE gapmers are 20 nucleosides in length, wherein the central gap
segment comprises often 2'-deoxynucleosides and is flanked by wing
segments on the 5' direction and the 3' direction comprising five
nucleosides each. Each nucleoside in the 5' wing segment and each
nucleoside in the 3' wing segment has a 2'-MOE modification. The
internucleoside linkages throughout each gapmer are
phosphorothioate (P.dbd.S) linkages. All cytosine residues
throughout each gapmer are 5-methylcytosines. "Start site"
indicates the 5'-most nucleoside to which the gapmer is targeted in
the human gene sequence. "Stop site" indicates the 3'-most
nucleoside to which the gapmer is targeted human gene sequence.
Each gapmer listed in the Tables below is targeted to either the
human CFB mRNA, designated herein as SEQ ID NO: 1 (GENBANK
Accession No. NM_001710.5) or the human CFB genomic sequence,
designated herein as SEQ ID NO: 2 (GENBANK Accession No.
NT_007592.15 truncated from nucleotides 31852000 to 31861000), or
both. `n/a` indicates that the antisense oligonucleotide does not
target that particular gene sequence with 100% complementarity.
TABLE-US-00002 TABLE 1 Inhibition of CFB mRNA by 5-10-5 MOE gapmers
targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: NO:
NO: NO: 1 1 2 2 SEQ: ISIS start stop Target % start stop ID NO site
site Region Sequence inhibition site site NO: 532608 20 39 Exon 1
GCTGAGCTGCCAGTCAAGGA 36 1741 1760 6 532609 26 45 Exon 1
GGCCCCGCTGAGCTGCCAGT 16 1747 1766 7 532610 45 64 Exon 1
CGGAACATCCAAGCGGGAGG 11 1766 1785 8 532611 51 70 Exon 1
CTTTCCCGGAACATCCAAGC 26 1772 1791 9 532612 100 119 Exon 1
ATCTGTGTTCTGGCACCTGC 25 1821 1840 10 532613 148 167 Exon 1
GTCACATTCCCTTCCCCTGC 39 1869 1888 11 532614 154 173 Exon 1
GACCTGGTCACATTCCCTTC 71 1875 1894 12 532615 160 179 Exon 1
GACCTAGACCTGGTCACATT 35 1881 1900 13 532616 166 185 Exon 1
ACTCCAGACCTAGACCTGGT 39 1887 1906 14 532617 172 191 Exon 1
GCTGAAACTCCAGACCTAGA 27 1893 1912 15 532618 178 197 Exon 1
GTCCAAGCTGAAACTCCAGA 29 1899 1918 16 532619 184 203 Exon 1
CTCAGTGTCCAAGCTGAAAC 21 1905 1924 17 532620 246 265 Exon 1
AGGAGAGAAGCTGGGCCTGG 31 1967 1986 18 532621 252 271 Exon 1
GAAGGCAGGAGAGAAGCTGG 25 1973 1992 19 532622 336 355 Exon 1-
GTGGTGGTCACACCTCCAGA 28 n/a n/a 20 2 Junction 532623 381 400 Exon 2
CCCTCCAGAGAGCAGGATCC 22 2189 2208 21 532624 387 406 Exon 2
TCTACCCCCTCCAGAGAGCA 37 2195 2214 22 532625 393 412 Exon 2
TTGATCTCTACCCCCTCCAG 30 2201 2220 23 532626 417 436 Exon 2
TGGAGAAGTCGGAAGGAGCC 35 2225 2244 24 532627 423 442 Exon 2
CCCTCTTGGAGAAGTCGGAA 37 2231 2250 25 532628 429 448 Exon 2
GCCTGGCCCTCTTGGAGAAG 0 2237 2256 26 532629 435 454 Exon 2
TCCAGTGCCTGGCCCTCTTG 26 2243 2262 27 532630 458 477 Exon 2
AGAAGCCAGAAGGACACACG 30 2266 2285 28 532631 464 483 Exon 2
ACGGGTAGAAGCCAGAAGGA 43 2272 2291 29 532632 480 499 Exon 2
CGTGTCTGCACAGGGTACGG 57 2288 2307 30 532633 513 532 Exon 2
AGGGTGCTCCAGGACCCCGT 27 2321 2340 31 532634 560 579 Exon 2-
TTGCTCTGCACTCTGCCTTC 41 n/a n/a 32 3 Junction 532635 600 619 Exon 3
TATTCCCCGTTCTCGAAGTC 67 2808 2827 33 532636 626 645 Exon 3
CATTGTAGTAGGGAGACCGG 24 2834 2853 34 532637 632 651 Exon 3
CACTCACATTGTAGTAGGGA 49 2840 2859 35 532638 638 657 Exon 3
TCTCATCACTCACATTGTAG 50 2846 2865 36 532639 644 663 Exon 3
AAGAGATCTCATCACTCACA 52 2852 2871 37 532640 650 669 Exon 3
AGTGGAAAGAGATCTCATCA 34 2858 2877 38 532641 656 675 Exon 3
CATAGCAGTGGAAAGAGATC 32 2864 2883 39 532642 662 681 Exon 3
AACCGTCATAGCAGTGGAAA 45 2870 2889 40 532643 668 687 Exon 3
GAGTGTAACCGTCATAGCAG 36 2876 2895 41 532644 674 693 Exon 3
CCCGGAGAGTGTAACCGTCA 30 2882 2901 42 532645 680 699 Exon 3
CAGAGCCCCGGAGAGTGTAA 27 2888 2907 43 532646 686 705 Exon 3
GATTGGCAGAGCCCCGGAGA 20 2894 2913 44 532647 692 711 Exon 3
AGGTGCGATTGGCAGAGCCC 28 2900 2919 45 532648 698 717 Exon 3
CTTGGCAGGTGCGATTGGCA 24 2906 2925 46 532649 704 723 Exon 3
CATTCACTTGGCAGGTGCGA 28 2912 2931 47 532650 729 748 Exon 3
ATCGCTGTCTGCCCACTCCA 44 2937 2956 48 532651 735 754 Exon 3
TCACAGATCGCTGTCTGCCC 44 2943 2962 49 532652 741 760 Exon 3
CCGTTGTCACAGATCGCTGT 27 2949 2968 50 532653 747 766 Exon 3-
CCCGCTCCGTTGTCACAGAT 28 n/a n/a 51 4 Junction 532654 753 772 Exon
3- CAGTACCCCGCTCCGTTGTC 13 n/a n/a 52 4 Junction 532655 759 778
Exon 3- TTGGAGCAGTACCCCGCTCC 8 n/a n/a 53 4 Junction 532656 789 808
Exon 4 ACCTTCCTTGTGCCAATGGG 40 3152 3171 54 532657 795 814 Exon 4
CTGCCCACCTTCCTTGTGCC 41 3158 3177 55 532658 818 837 Exon 4
CGCTGTCTTCAAGGCGGTAC 33 3181 3200 56 532659 835 854 Exon 4
GCTGCAGTGGTAGGTGACGC 32 3198 3217 57 532660 841 860 Exon 4
CCCCCGGCTGCAGTGGTAGG 17 3204 3223 58 532661 847 866 Exon 4
GGTAAGCCCCCGGCTGCAGT 28 3210 3229 59 532662 853 872 Exon 4
ACGCAGGGTAAGCCCCCGGC 13 3216 3235 60 532663 859 878 Exon 4
GGAGCCACGCAGGGTAAGCC 33 3222 3241 61 532664 866 885 Exon 4
GCCGCTGGGAGCCACGCAGG 10 3229 3248 62 532665 891 910 Exon 4
CAAGAGCCACCTTCCTGACA 17 3254 3273 63 532666 897 916 Exon 4
CCGCTCCAAGAGCCACCTTC 25 3260 3279 64 532667 903 922 Exon 4
TCCGTCCCGCTCCAAGAGCC 29 3266 3285 65 532668 909 928 Exon 4
GAAGGCTCCGTCCCGCTCCA 14 3272 3291 66 532669 915 934 Exon 4
TGGCAGGAAGGCTCCGTCCC 18 3278 3297 67 532670 921 940 Exon 4-
GAGTCTTGGCAGGAAGGCTC 20 n/a n/a 68 5 Junction 532671 927 946 Exon
4- ATGAAGGAGTCTTGGCAGGA 14 n/a n/a 69 5 Junction 532672 956 975
Exon 5 CTTCGGCCACCTCTTGAGGG 45 3539 3558 70 532673 962 981 Exon 5
GGAAAGCTTCGGCCACCTCT 37 3545 3564 71 532674 968 987 Exon 5
AAGACAGGAAAGCTTCGGCC 28 3551 3570 72 532675 974 993 Exon 5
TCAGGGAAGACAGGAAAGCT 16 3557 3576 73 532676 996 1015 Exon 5
TCGACTCCTTCTATGGTCTC 31 3579 3598 74 532677 1033 1052 Exon 5-
CTTCTGTTGTTCCCCTGGGC 36 n/a n/a 75 6 Junction 532678 1068 1087 Exon
6 TTCATGGAGCCTGAAGGGTC 19 3752 3771 76 532679 1074 1093 Exon 6
TAGATGTTCATGGAGCCTGA 24 3758 3777 77 532680 1080 1099 Exon 6
ACCAGGTAGATGTTCATGGA 13 3764 3783 78 532681 1086 1105 Exon 6
TCTAGCACCAGGTAGATGTT 20 3770 3789 79 532682 1092 1111 Exon 6
GATCCATCTAGCACCAGGTA 33 3776 3795 80 532683 1098 1117 Exon 6
CTGTCTGATCCATCTAGCAC 44 3782 3801 81 532684 1104 1123 Exon 6
CCAATGCTGTCTGATCCATC 29 3788 3807 82 532685 1129 1148 Exon 6
TTTGGCTCCTGTGAAGTTGC 40 3813 3832 83
TABLE-US-00003 TABLE 2 Inhibition of CFB mRNA by 5-10-5 MOE gapmers
targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: NO:
NO: NO: 1 1 2 2 ISIS start stop Target % start stop SEQ No site
site region Sequence inhibition site site ID NO: 532686 1135 1154
Exon 6 ACACTTTTTGGCTCCTGTGA 91 3819 3838 84 532687 1141 1160 Exon 6
GACTAGACACTTTTTGGCTC 77 3825 3844 85 532688 1147 1166 Exon 6
TAAGTTGACTAGACACTTTT 70 3831 3850 86 532689 1153 1172 Exon 6
CTCAATTAAGTTGACTAGAC 61 3837 3856 87 532690 1159 1178 Exon 6-7
CACCTTCTCAATTAAGTTGA 57 3843 3862 88 Junction 532691 1165 1184 Exon
6-7 ACTTGCCACCTTCTCAATTA 56 n/a n/a 89 Junction 532692 1171 1190
Exon 6-7 ACCATAACTTGCCACCTTCT 56 n/a n/a 90 Junction 532693 1177
1196 Exon 7 CTTCACACCATAACTTGCCA 56 4153 4172 91 532694 1183 1202
Exon 7 TCTTGGCTTCACACCATAAC 55 4159 4178 92 532695 1208 1227 Exon 7
ATGTGGCATATGTCACTAGA 55 4184 4203 93 532696 1235 1254 Exon 7
CAGACACTTTGACCCAAATT 55 4211 4230 94 532697 1298 1317 Exon 7-8
GGTCTTCATAATTGATTTCA 53 n/a n/a 95 Junction 532698 1304 1323 Exon
7-8 ACTTGTGGTCTTCATAATTG 53 n/a n/a 96 Junction 532699 1310 1329
Exon 7-8 ACTTCAACTTGTGGTCTTCA 52 n/a n/a 97 Junction 532700 1316
1335 Exon 8 TCCCTGACTTCAACTTGTGG 52 4609 4628 98 532701 1322 1341
Exon 8 TGTTAGTCCCTGACTTCAAC 52 4615 4634 99 532702 1328 1347 Exon 8
TCTTGGTGTTAGTCCCTGAC 51 4621 4640 100 532703 1349 1368 Exon 8
TGTACACTGCCTGGAGGGCC 51 4642 4661 101 532704 1355 1374 Exon 8
TCATGCTGTACACTGCCTGG 51 4648 4667 102 532705 1393 1412 Exon 8
GTTCCAGCCTTCAGGAGGGA 50 4686 4705 103 532706 1399 1418 Exon 8
GGTGCGGTTCCAGCCTTCAG 50 4692 4711 104 532707 1405 1424 Exon 8
ATGGCGGGTGCGGTTCCAGC 50 4698 4717 105 532708 1411 1430 Exon 8
GATGACATGGCGGGTGCGGT 49 4704 4723 106 532709 1417 1436 Exon 8
GAGGATGATGACATGGCGGG 49 4710 4729 107 532710 1443 1462 Exon 8-9
CCCATGTTGTGCAATCCATC 48 n/a n/a 108 Junction 532711 1449 1468 Exon
9 TCCCCGCCCATGTTGTGCAA 48 5023 5042 109 532712 1455 1474 Exon 9
ATTGGGTCCCCGCCCATGTT 48 5029 5048 110 532713 1461 1480 Exon 9
ACAGTAATTGGGTCCCCGCC 48 5035 5054 111 532714 1467 1486 Exon 9
TCAATGACAGTAATTGGGTC 47 5041 5060 112 532715 1473 1492 Exon 9
ATCTCATCAATGACAGTAAT 47 5047 5066 113 532716 1479 1498 Exon 9
TCCCGGATCTCATCAATGAC 46 5053 5072 114 532717 1533 1552 Exon 9-10
ACATCCAGATAATCCTCCCT 46 n/a n/a 115 Junction 532718 1539 1558 Exon
9-10 ACATAGACATCCAGATAATC 46 n/a n/a 116 Junction 532719 1545 1564
Exon 9-10 CCAAACACATAGACATCCAG 46 n/a n/a 117 Junction 532720 1582
1601 Exon 10 AGCATTGATGTTCACTTGGT 46 5231 5250 118 532721 1588 1607
Exon 10 AGCCAAAGCATTGATGTTCA 45 5237 5256 119 532722 1594 1613 Exon
10 CTTGGAAGCCAAAGCATTGA 45 5243 5262 120 532723 1600 1619 Exon 10
GTCTTTCTTGGAAGCCAAAG 45 5249 5268 121 532724 1606 1625 Exon 10
CTCATTGTCTTTCTTGGAAG 44 5255 5274 122 532725 1612 1631 Exon 10
ATGTTGCTCATTGTCTTTCT 44 5261 5280 123 532726 1618 1637 Exon 10
GAACACATGTTGCTCATTGT 44 5267 5286 124 532727 1624 1643 Exon 10
GACTTTGAACACATGTTGCT 43 5273 5292 125 532728 1630 1649 Exon 10
ATCCTTGACTTTGAACACAT 43 5279 5298 126 532729 1636 1655 Exon 10
TTCCATATCCTTGACTTTGA 43 5285 5304 127 532730 1642 1661 Exon 10
CAGGTTTTCCATATCCTTGA 42 5291 5310 128 532731 1686 1705 Exon 11
CTCAGAGACTGGCTTTCATC 42 5827 5846 129 532732 1692 1711 Exon 11
CAGAGACTCAGAGACTGGCT 42 5833 5852 130 516252 1698 1717 Exon 11
ATGCCACAGAGACTCAGAGA 42 5839 5858 131 532733 1704 1723 Exon 11
CAAACCATGCCACAGAGACT 41 5845 5864 132 532734 1710 1729 Exon 11
TGTTCCCAAACCATGCCACA 41 5851 5870 133 532735 1734 1753 Exon 11
TTGTGGTAATCGGTACCCTT 41 5875 5894 134 532736 1740 1759 Exon 11
GGTTGCTTGTGGTAATCGGT 40 5881 5900 135 532737 1746 1765 Exon 11
TGCCATGGTTGCTTGTGGTA 40 5887 5906 136 532738 1752 1771 Exon 11
TTGGCCTGCCATGGTTGCTT 40 5893 5912 137 532739 1758 1777 Exon 11
GAGATCTTGGCCTGCCATGG 38 5899 5918 138 532740 1803 1822 Exon 12
ACAGCCCCCATACAGCTCTC 38 6082 6101 139 532741 1809 1828 Exon 12
GACACCACAGCCCCCATACA 38 6088 6107 140 532742 1815 1834 Exon 12
TACTCAGACACCACAGCCCC 38 6094 6113 141 532743 1821 1840 Exon 12
ACAAAGTACTCAGACACCAC 37 6100 6119 142 532744 1827 1846 Exon 12
GTCAGCACAAAGTACTCAGA 37 6106 6125 143 532745 1872 1891 Exon 12
TTGATTGAGTGTTCCTTGTC 36 6151 6170 144 532746 1878 1897 Exon 12
CTGACCTTGATTGAGTGTTC 35 6157 6176 145 532747 1909 1928 Exon 13
TATCTCCAGGTCCCGCTTCT 35 6403 6422 146 532748 1967 1986 Exon 13
GAATTCCTGCTTCTTTTTTC 32 6461 6480 147 532749 1973 1992 Exon 13
ATTCAGGAATTCCTGCTTCT 32 6467 6486 148 532750 1979 1998 Exon 13
CATAAAATTCAGGAATTCCT 32 6473 6492 149 532751 1985 2004 Exon 13
CATAGTCATAAAATTCAGGA 31 6479 6498 150 532752 2006 2025 Exon 13
TGAGCTTGATCAGGGCAACG 30 6500 6519 151 532753 2012 2031 Exon 13
TATTCTTGAGCTTGATCAGG 30 6506 6525 152 532754 2048 2067 Exon 13-
GACAAATGGGCCTGATAGTC 30 n/a n/a 153 14 Junction 532755 2070 2089
Exon 14 GTTGTTCCCTCGGTGCAGGG 29 6659 6678 154 532756 2076 2095 Exon
14 GCTCGAGTTGTTCCCTCGGT 28 6665 6684 155 532757 2082 2101 Exon 14
CTCAAAGCTCGAGTTGTTCC 28 6671 6690 156 532758 2088 2107 Exon 14
GGAAGCCTCAAAGCTCGAGT 25 6677 6696 157 532759 2094 2113 Exon 14
GTTGGAGGAAGCCTCAAAGC 23 6683 6702 158 532760 2100 2119 Exon 14
GTGGTAGTTGGAGGAAGCCT 23 6689 6708 159 532761 2106 2125 Exon 14
TGGCAAGTGGTAGTTGGAGG 18 6695 6714 160 532762 2112 2131 Exon 14
TGTTGCTGGCAAGTGGTAGT 14 6701 6720 161
TABLE-US-00004 TABLE 3 Inhibition of CFB mRNA by 5-10-5 MOE gapmers
targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ ID ID ID NO: NO: NO: 1 1
SEQ ID 2 SEQ ISIS start stop Target % NO: 2 start stop ID NO site
site Region Sequence inhibition site site NO: 532812 n/a n/a Exon 1
TCCAGCTCACTCCCCTGTTG 19 1593 1612 162 532813 n/a n/a Exon 1
TAAGGATCCAGCTCACTCCC 40 1599 1618 163 532814 n/a n/a Exon 1
CAGAAATAAGGATCCAGCTC 39 1605 1624 164 532815 n/a n/a Exon 1
AGGGACCAGAAATAAGGATC 0 1611 1630 165 532816 n/a n/a Exon 1
CCACTTAGGGACCAGAAATA 27 1617 1636 166 532817 n/a n/a Exon 1
TCCAGGACTCTCCCCTTCAG 39 1682 1701 167 532818 n/a n/a Exon 1
AAGTCCCACCCTTTGCTGCC 15 1707 1726 168 532819 n/a n/a Exon 1
CTGCAGAAGTCCCACCCTTT 26 1713 1732 169 532820 n/a n/a Exon 1
CAGAAACTGCAGAAGTCCCA 8 1719 1738 170 532821 n/a n/a Exon 2 -
AACCTCTGCACTCTGCCTTC 39 2368 2387 171 Intron 2 532822 n/a n/a Exon
2 - CCCTCAAACCTCTGCACTCT 3 2374 2393 172 Intron 2 532823 n/a n/a
Exon 2 - TCATTGCCCTCAAACCTCTG 19 2380 2399 173 Intron 2 532824 n/a
n/a Intron 2 CCACACTCATTGCCCTCAAA 37 2386 2405 174 532825 n/a n/a
Intron 2 CACTGCCCACACTCATTGCC 23 2392 2411 175 532826 n/a n/a
Intron 2 TTAGGCCACTGCCCACACTC 15 2398 2417 176 532827 n/a n/a
Intron 2 CTAGTCCTGACCTTGCTGCC 28 2436 2455 177 532828 n/a n/a
Intron 2 CTCATCCTAGTCCTGACCTT 25 2442 2461 178 532829 n/a n/a
Intron 2 CCTAGTCTCATCCTAGTCCT 23 2448 2467 179 532830 n/a n/a
Intron 2 ACCCTGCCTAGTCTCATCCT 30 2454 2473 180 532831 n/a n/a
Intron 2 CTTGTCACCCTGCCTAGTCT 34 2460 2479 181 532832 n/a n/a
Intron 2 GCCCACCTTGTCACCCTGCC 36 2466 2485 182 532833 n/a n/a
Intron 2 CCTAAAACTGCTCCTACTCC 9 2492 2511 183 532834 n/a n/a Intron
4 GAGTCAGAAATGAGGTCAAA 19 3494 3513 184 532835 n/a n/a Intron
CCCTACTCCCATTTCACCTT 16 5971 5990 185 11 532836 n/a n/a Intron 8 -
TGTTGTGCAATCCTGCAGAA 25 5013 5032 186 Exon 9 532837 n/a n/a Intron
1 AAAGGCTGATGAAGCCTGGC 18 2123 2142 187 532838 n/a n/a Intron 7
CCTTTGACCACAAAGTGGCC 21 4461 4480 188 532839 n/a n/a Intron
AGGTACCACCTCTTTGTGGG 29 6362 6381 189 12 532840 n/a n/a Intron 1 -
TGGTGGTCACACCTGAAGAG 34 2143 2162 190 Exon 2 532763 2133 2152 Exon
GCAGGGAGCAGCTCTTCCTT 40 n/a n/a 191 14-15 Junction 532764 2139 2158
Exon 15 TCCTGTGCAGGGAGCAGCTC 28 6927 6946 192 532765 2145 2164 Exon
15 TTGATATCCTGTGCAGGGAG 41 6933 6952 193 532766 2151 2170 Exon 15
AGAGCTTTGATATCCTGTGC 36 6939 6958 194 532767 2157 2176 Exon 15
ACAAACAGAGCTTTGATATC 33 6945 6964 195 532768 2163 2182 Exon 15
TCAGACACAAACAGAGCTTT 41 6951 6970 196 532769 2169 2188 Exon 15
TCCTCCTCAGACACAAACAG 49 6957 6976 197 532770 2193 2212 Exon 15
ACCTCCTTCCGAGTCAGCTT 61 6981 7000 198 532771 2199 2218 Exon 15
ATGTAGACCTCCTTCCGAGT 39 6987 7006 199 532772 2205 2224 Exon 15
TTCTTGATGTAGACCTCCTT 30 6993 7012 200 532773 2211 2230 Exon 15
TCCCCATTCTTGATGTAGAC 31 6999 7018 201 532774 2217 2236 Exon
TTCTTATCCCCATTCTTGAT 36 n/a n/a 202 15-16 Junction 532775 2223 2242
Exon CTGCCTTTCTTATCCCCATT 56 n/a n/a 203 15-16 Junction 532776 2229
2248 Exon TCACAGCTGCCTTTCTTATC 33 n/a n/a 204 15-16 Junction 532777
2235 2254 Exon 16 TCTCTCTCACAGCTGCCTTT 38 7119 7138 205 532778 2241
2260 Exon 16 TGAGCATCTCTCTCACAGCT 51 7125 7144 206 532779 2247 2266
Exon 16 GCATATTGAGCATCTCTCTC 39 7131 7150 207 532780 2267 2286 Exon
16 TGACTTTGTCATAGCCTGGG 56 7151 7170 208 532781 2273 2292 Exon 16
TGTCCTTGACTTTGTCATAG 36 7157 7176 209 532782 2309 2328 Exon 16
CAGTACAAAGGAACCGAGGG 30 7193 7212 210 532783 2315 2334 Exon 16
CTCCTCCAGTACAAAGGAAC 21 7199 7218 211 532784 2321 2340 Exon 16
GACTCACTCCTCCAGTACAA 31 7205 7224 212 532785 2327 2346 Exon 16
CATAGGGACTCACTCCTCCA 30 7211 7230 213 532786 2333 2352 Exon 16
GGTCAGCATAGGGACTCACT 31 7217 7236 214 532787 2352 2371 Exon
TCACCTCTGCAAGTATTGGG 42 7236 7255 215 16-17 Junction 532788 2358
2377 Exon CCAGAATCACCTCTGCAAGT 32 n/a n/a 216 16-17 Junction 532789
2364 2383 Exon GGGCCGCCAGAATCACCTCT 35 n/a n/a 217 16-17 Junction
532790 2382 2401 Exon 17 CTCTTGTGAACTATCAAGGG 33 7347 7366 218
532791 2388 2407 Exon 17 CGACTTCTCTTGTGAACTAT 52 7353 7372 219
532792 2394 2413 Exon 17 ATGAAACGACTTCTCTTGTG 16 7359 7378 220
532793 2400 2419 Exon ACTTGAATGAAACGACTTCT 45 7365 7384 221 17-18
Junction 532794 2406 2425 Exon ACACCAACTTGAATGAAACG 18 n/a n/a 222
17-18 Junction 532795 2427 2446 Exon 18 TCCACTACTCCCCAGCTGAT 30
7662 7681 223 532796 2433 2452 Exon 18 CAGACATCCACTACTCCCCA 38 7668
7687 224 532797 2439 2458 Exon 18 TTTTTGCAGACATCCACTAC 35 7674 7693
225 532798 2445 2464 Exon 18 TTCTGGTTTTTGCAGACATC 45 7680 7699 226
532799 2451 2470 Exon 18 TGCCGCTTCTGGTTTTTGCA 47 7686 7705 227
532800 2457 2476 Exon 18 TGCTTTTGCCGCTTCTGGTT 61 7692 7711 228
532801 2463 2482 Exon 18 GGTACCTGCTTTTGCCGCTT 47 7698 7717 229
532802 2469 2488 Exon 18 TGAGCAGGTACCTGCTTTTG 31 7704 7723 230
532803 2517 2536 Exon 18 TTCAGCCAGGGCAGCACTTG 41 7752 7771 231
532804 2523 2542 Exon 18 TTCTCCTTCAGCCAGGGCAG 44 7758 7777 232
532805 2529 2548 Exon 18 TGGAGTTTCTCCTTCAGCCA 46 7764 7783 233
532806 2535 2554 Exon 18 TCATCTTGGAGTTTCTCCTT 49 7770 7789 234
532807 2541 2560 Exon 18 AAATCCTCATCTTGGAGTTT 30 7776 7795 235
532808 2547 2566 Exon 18 AAACCCAAATCCTCATCTTG 20 7782 7801 236
532809 2571 2590 Exon 18 GTCCAGCAGGAAACCCCTTA 65 7806 7825 237
532810 2577 2596 Exon 18 GCCCCTGTCCAGCAGGAAAC 74 7812 7831 238
532811 2599 2618 Exon 18 AGCTGTTTTAATTCAATCCC 96 7834 7853 239
TABLE-US-00005 TABLE 4 Inhibition of CFB mRNA by 5-10-5 MOE gapmers
targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO:
1 NO: 2 NO: 2 SEQ ISIS start stop Target start stop % ID NO site
site region Sequence site site inhibition NO: 532841 n/a n/a Intron
6- AACTTGCCACCTGTGGGTGA 4142 4161 11 240 Exon 7 532842 n/a n/a Exon
15 - TCACCTTATCCCCATTCTTG 7007 7026 16 241 Intron 15 532843 n/a n/a
Intron 11 TCAACTTTCACAAACCACCA 6015 6034 19 242 532844 n/a n/a
Intron 16 - CCGCCAGAATCACCTGCAAG 7326 7345 33 243 Exon 17 532845
n/a n/a Intron 10 AGGAGGAATGAAGAAGGCTT 5431 5450 29 244 532846 n/a
n/a Intron 13 GCCTTTCCTCAGGGATCTGG 6561 6580 26 245 532847 n/a n/a
Intron 4 AAATGTCTGGGAGTGTCAGG 3477 3496 18 246 532848 n/a n/a
Intron 15 GCCTAGAGTGCCTCCTTAGG 7038 7057 20 247 532849 n/a n/a
Intron 17 GGCATCTCCCCAGATAGGAA 7396 7415 16 248 532850 n/a n/a
Intron 6 AGGGAGCTAGTCCTGGAAGA 3906 3925 14 249 532851 n/a n/a
Intron 1 - ACACCTGAAGAGAAAGGCTG 2135 2154 6 250 Exon 2 532852 n/a
n/a Intron 7 CCCTTTGACCACAAAGTGGC 4462 4481 25 251 532853 n/a n/a
Intron 7 GCCCTCAAGGTAGTCTCATG 4354 4373 26 252 532854 n/a n/a
Intron 6 AAGGGAAGGAGGACAGAATA 3977 3996 18 253 532855 n/a n/a
Intron 1 AAAGGCCAAGGAGGGATGCT 2099 2118 9 254 532856 n/a n/a Exon 8
- AGAGGTCCCTTCTGACCATC 4736 4755 4 255 Intron 8 532857 n/a n/a
Intron 8 GCTGGGACAGGAGAGAGGTC 4749 4768 0 256 532858 n/a n/a Intron
4 TCAAATGTCTGGGAGTGTCA 3479 3498 13 257 532859 n/a n/a Intron 10
AGAAGGAGAATGTGCTGAAA 5801 5820 20 258 532860 n/a n/a Intron 17
TGCTGACCACTTGGCATCTC 7408 7427 20 259 532861 n/a n/a Intron 11
CAACTTTCACAAACCACCAT 6014 6033 18 260 532862 n/a n/a Intron 10
AGCTCTGTGATTCTAAGGTT 5497 5516 15 261 532863 n/a n/a Intron 6-
CCACCTGTGGGTGAGGAGAA 4136 4155 16 262 Exon 7 532864 n/a n/a Exon 17
- GAGGACTCACTTGAATGAAA 7373 7392 21 263 Intron 17 532865 n/a n/a
Intron 6 TGGAATGATCAGGGAGCTAG 3916 3935 30 264 532866 n/a n/a
Intron 5 GTCCCTTCTCCATTTTCCCC 3659 3678 26 265 532867 n/a n/a
Intron 7 TCAACTTTTTAAGTTAATCA 4497 4516 14 266 532868 n/a n/a
Intron 6 GGGTGAGGAGAACAAGGCGC 4128 4147 21 267 532869 n/a n/a
Intron 7 CTTCCAAGCCATCTTTTAAC 4553 4572 5 268 532870 n/a n/a Exon
17 - AGGACTCACTTGAATGAAAC 7372 7391 18 269 Intron 17 532871 n/a n/a
Intron 10 TTCCAGGCAACTAGAGCTTC 5412 5431 15 270 532872 n/a n/a Exon
1 CAGAGTCCAGCCACTGTTTG 1557 1576 13 271 532873 n/a n/a Intron 17 -
CCAACCTGCAGAGGCAGTGG 7638 7657 23 272 Exon 18 532874 n/a n/a Intron
16 TGCAAGGAGAGGAGAAGCTG 7312 7331 10 273 532875 n/a n/a Exon 9 -
CTAGGCAGGTTACTCACCCA 5120 5139 21 274 Intron 9 532876 n/a n/a
Intron 6- CACCATAACTTGCCACCTGT 4148 4167 41 275 Exon 7 532877 n/a
n/a Intron 12 TAGGTACCACCTCTTTGTGG 6363 6382 27 276 532878 n/a n/a
Intron 11 CTTGACCTCACCTCCCCCAA 5954 5973 13 277 532879 n/a n/a
Intron 12 CCACCTCTTTGTGGGCAGCT 6357 6376 33 278 532880 n/a n/a
Intron 11 TTCACAAACCACCATCTCTT 6009 6028 8 279 532881 n/a n/a Exon
3 - TTCTCACCTCCGTTGTCACA 2958 2977 17 280 Intron 3 532882 n/a n/a
Intron 12 GAAAGTGGGAGGTGTTGCCT 6225 6244 19 281 532883 n/a n/a
Intron 1 ACAGCAGGAAGGGAAGGTTA 2075 2094 34 282 532884 n/a n/a
Intron 17 CATGCTGACCACTTGGCATC 7410 7429 18 283 532885 n/a n/a Exon
4 - GGTCACCTTGGCAGGAAGGC 3286 3305 0 284 Intron 4 532886 n/a n/a
Intron 8 GTATAGTGTTACAAGTGGAC 4804 4823 13 285 532887 n/a n/a
Intron 7 GGACTTCCCTTTGACCACAA 4468 4487 18 286 532888 n/a n/a
Intron 11 TCACCTTGACCTCACCTCCC 5958 5977 20 287 532889 n/a n/a
Intron 15 TAGAGTGCCTCCTTAGGATG 7035 7054 27 288 532890 n/a n/a
Intron 7 TGACTTCAACTTGTGGTCTG 4605 4624 16 289 532891 n/a n/a
Intron 10 CAGAGAAGGAGAATGTGCTG 5804 5823 25 290 532892 n/a n/a
Intron 14 - AGGGAGCAGCTCTTCCTCTG 6919 6938 47 291 Exon 15 532893
n/a n/a Intron 5 - TGTTCCCCTGGGTGCCAGGA 3710 3729 24 292 Exon 6
532894 n/a n/a Intron 10 GGCCTGGCTGTTTTCAAGCC 5612 5631 15 293
532895 n/a n/a Intron 10 - GACTGGCTTTCATCTGGCAG 5821 5840 25 294
Exon 11 532896 n/a n/a Intron 10 GAAGGCTTTCCAGGCAACTA 5419 5438 19
295 532897 n/a n/a Exon 17 - TCACTTGAATGAAACGACTT 7367 7386 11 296
Intron 17 532898 n/a n/a Intron 1 GGCCCCAAAAGGCCAAGGAG 2106 2125 5
297 532899 n/a n/a Intron 16 - AATCACCTGCAAGGAGAGGA 7319 7338 19
298 Exon 17 532900 n/a n/a Intron 12 GACCTTCAGTTGCATCCTTA 6183 6202
25 299 532901 n/a n/a Intron 1 TGATGAAGCCTGGCCCCAAA 2117 2136 0 300
532902 n/a n/a Intron 12 TAGAAAGTGGGAGGTGTTGC 6227 6246 0 301
532903 n/a n/a Intron 12 CCCATCCCTGACTGGTCTGG 6295 6314 14 302
532904 n/a n/a Intron 8 CCATGGGTATAGTGTTACAA 4810 4829 13 303
532905 n/a n/a Intron 2 GTGTTCTCTTGACTTCCAGG 2586 2605 23 304
532906 n/a n/a Intron 13 GGCCTGCTCCTCACCCCAGT 6597 6616 27 305
532907 n/a n/a Intron 10 GAGGCCTGGCTGTTTTCAAG 5614 5633 32 306
532908 n/a n/a Exon 1 GACTCTCCCCTTCAGTACCT 1677 1696 16 307 532909
n/a n/a Intron 8 CATGGGTATAGTGTTACAAG 4809 4828 10 308 532910 n/a
n/a Intron 10 GAAGGAGAATGTGCTGAAAA 5800 5819 0 309 532911 n/a n/a
Intron 7 TCACCTGGTCTTCCAAGCCA 4562 4581 0 310 532912 n/a n/a Intron
17 CTCCCCAGATAGGAAAGGGA 7391 7410 0 311 532913 n/a n/a Exon 17 -
GGACTCACTTGAATGAAACG 7371 7390 0 312 Intron 17 532914 n/a n/a
Intron 16 - GGCCGCCAGAATCACCTGCA 7328 7347 30 313 Exon 17 532915
n/a n/a Exon 17 - CTCACTTGAATGAAACGACT 7368 7387 22 314 Intron 17
532916 n/a n/a Intron 13 CTTTCCCAGCCTTTCCTCAG 6569 6588 28 315
532918 n/a n/a Intron 12 AGAAAGTGGGAGGTGTTGCC 6226 6245 3 316
532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 7839 7858 90 317
TABLE-US-00006 TABLE 5 Inhibition of CFB mRNA by 5-10-5 MOE gapmers
targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO:
1 NO: 2 NO: 2 SEQ ISIS start stop Target start stop % ID NO site
site region Sequence site site inhibition NO: 532919 n/a n/a Exon 1
CCAGGACTCTCCCCTTCAGT 1681 1700 4 318 532920 n/a n/a Intron 6
AGGGAAGGAGGACAGAATAG 3976 3995 25 319 532921 n/a n/a Intron 4
GAAATGAGGTCAAATGTCTG 3488 3507 30 320 532922 n/a n/a Intron 4
GGAGAGTCAGAAATGAGGTC 3497 3516 25 321 532923 n/a n/a Intron 12
GTAGAAAGTGGGAGGTGTTG 6228 6247 26 322 532924 n/a n/a Intron 10
TAGAAAGATCTCTGAAGTGC 5521 5540 24 323 532925 n/a n/a Intron 13
CTGCTCCTCACCCCAGTCCT 6594 6613 26 324 532926 n/a n/a Intron 11
CTACTGGGATTCTGTGCTTA 5927 5946 30 325 532927 n/a n/a Intron 1
CCCAAAAGGCCAAGGAGGGA 2103 2122 13 326 532928 n/a n/a Intron 17
TGACCACTTGGCATCTCCCC 7405 7424 27 327 532929 n/a n/a Intron 16 -
CCTGCAAGGAGAGGAGAAGC 7314 7333 29 328 Exon 17 532930 n/a n/a Exon
16 - CTCTCACCTCTGCAAGTATT 7239 7258 44 329 Intron 16 532931 n/a n/a
Intron 1 CCCCAAAAGGCCAAGGAGGG 2104 2123 21 330 532932 n/a n/a
Intron 7 GTCTTCCAAGCCATCTTTTA 4555 4574 20 331 532933 n/a n/a
Intron 8 GTTACAAGTGGACTTAAGGG 4797 4816 30 332 532934 n/a n/a
Intron 8 - CCCATGTTGTGCAATCCTGC 5017 5036 30 333 Exon 9 532935 n/a
n/a Intron 15 GAGGTGGGAAGCATGGAGAA 7091 7110 17 334 532936 n/a n/a
Intron 14 TGCTCCCACCACTGTCATCT 6874 6893 21 335 532937 n/a n/a Exon
9 - AGGCAGGTTACTCACCCAGA 5118 5137 18 336 Intron 9 532938 n/a n/a
Intron 11 TACTGGGATTCTGTGCTTAC 5926 5945 15 337 532939 n/a n/a
Intron 13 GCCTTTCCCAGCCTTTCCTC 6571 6590 27 338 532940 n/a n/a
Intron 8 - GTGCAATCCTGCAGAAGAGA 5009 5028 21 339 Exon 9 532941 n/a
n/a Intron 8 ACAGGAGAGAGGTCCCTTCT 4743 4762 20 340 532942 n/a n/a
Intron 10 CCCAAAAGGAGAAAGGGAAA 5717 5736 14 341 532943 n/a n/a
Intron 2 AAGCCCAGGGTAAATGCTTA 2557 2576 32 342 532944 n/a n/a
Intron 1 GATGAAGCCTGGCCCCAAAA 2116 2135 22 343 532945 n/a n/a
Intron 10 TGGCAGAGAAGGAGAATGTG 5807 5826 22 344 532946 n/a n/a
Intron 13 TTCCCAGCCTTTCCTCAGGG 6567 6586 35 345 532947 n/a n/a
Intron 10 GGCAGAGAAGGAGAATGTGC 5806 5825 30 346 532948 n/a n/a
Intron 10 ACAGTGCCAGGAAACAAGAA 5471 5490 25 347 532949 n/a n/a Exon
9 - TAGGCAGGTTACTCACCCAG 5119 5138 22 348 Intron 9 532950 n/a n/a
Intron 2 TTCTCTTGACTTCCAGGGCT 2583 2602 22 349 532951 n/a n/a
Intron 13 CCTGCTCCTCACCCCAGTCC 6595 6614 16 350 532953 n/a n/a
Intron 7 TCCCACTAACCTCCATTGCC 4422 4441 14 351 532954 n/a n/a
Intron 7 TTCCCTTTGACCACAAAGTG 4464 4483 16 352 532955 n/a n/a
Intron 9 CTGGGTCCTAGGCAGGTTAC 5127 5146 30 353 532956 n/a n/a
Intron 10 TCCAGGCAACTAGAGCTTCA 5411 5430 20 354 532957 n/a n/a
Intron 8 - GCCCATGTTGTGCAATCCTG 5018 5037 45 355 Exon 9 532958 n/a
n/a Intron 7 GGTTCCCACTAACCTCCATT 4425 4444 18 356 532959 n/a n/a
Intron 3 AGGTAGAGAGCAAGAGTTAC 3052 3071 26 357 532960 n/a n/a
Intron 7 CCACTAACCTCCATTGCCCA 4420 4439 10 358 532961 n/a n/a
Intron 11 TCACAAACCACCATCTCTTA 6008 6027 40 359 532962 n/a n/a Exon
9 - TACTCACCCAGATAATCCTC 5110 5129 27 360 Intron 9 532963 n/a n/a
Intron 13 TGCTCCTCACCCCAGTCCTC 6593 6612 24 361 532964 n/a n/a
Intron 15 - TCTCACAGCTGCCTTTCTGT 7115 7134 25 362 Exon 16 532965
n/a n/a Exon 17 - GAAAGGGAGGACTCACTTGA 7379 7398 11 363 Intron 17
532966 n/a n/a Intron 7 CCATCTTTTAACCCCAGAGA 4545 4564 18 364
532967 n/a n/a Intron 13 TCCTCACCCCAGTCCTCCAG 6590 6609 27 365
532968 n/a n/a Intron 10 CTGGCAGAGAAGGAGAATGT 5808 5827 15 366
532969 n/a n/a Intron 17 TCTCCCCAGATAGGAAAGGG 7392 7411 23 367
532970 n/a n/a Intron 14 ACTTCAGCTGCTCCCACCAC 6882 6901 18 368
532971 n/a n/a Intron 1 GACAGCAGGAAGGGAAGGTT 2076 2095 13 369
532972 n/a n/a Intron 13 - GGAGACAAATGGGCCTATAA 6640 6659 33 370
Exon 14 532973 n/a n/a Intron 14 CTGCTCCCACCACTGTCATC 6875 6894 11
371 532974 n/a n/a Intron 10 AGGAATGAAGAAGGCTTTCC 5428 5447 21 372
532975 n/a n/a Intron 14 GGGATCTCATCCTTATCCTC 6741 6760 31 373
532976 n/a n/a Intron 9 GTGCTGGGTCCTAGGCAGGT 5130 5149 16 374
532977 n/a n/a Intron 1 CAAAAGGCCAAGGAGGGATG 2101 2120 14 375
532978 n/a n/a Intron 17 CCATGCTGACCACTTGGCAT 7411 7430 20 376
532979 n/a n/a Intron 8 GGAGGCTGGGACAGGAGAGA 4753 4772 25 377
532980 n/a n/a Intron 14 - GGAGCAGCTCTTCCTCTGGA 6917 6936 36 378
Exon 15 532981 n/a n/a Exon 3 - TCTCACCTCCGTTGTCACAG 2957 2976 20
379 Intron 3 532982 n/a n/a Intron 13 CAGTCCTCCAGCCTTTCCCA 6581
6600 21 380 532983 n/a n/a Intron 13 AGTCCTCCAGCCTTTCCCAG 6580 6599
22 381 532984 n/a n/a Intron 4 - TGAAGGAGTCTGGGAGAGTC 3509 3528 12
382 Exon 5 532985 n/a n/a Intron 16 - CAGAATCACCTGCAAGGAGA 7322
7341 20 383 Exon 17 532986 n/a n/a Exon 17 - TAGGAAAGGGAGGACTCACT
7382 7401 3 384 Intron 17 532987 n/a n/a Exon 4 -
ACCTTGGCAGGAAGGCTCCG 3282 3301 12 385 Intron 4 532988 n/a n/a
Intron 13 - GAGACAAATGGGCCTATAAA 6639 6658 15 386 Exon 14 532989
n/a n/a Intron 1 CTGAAGAGAAAGGCTGATGA 2131 2150 17 387 532990 n/a
n/a Intron 6 AATGATCAGGGAGCTAGTCC 3913 3932 30 388 532991 n/a n/a
Intron 17 CTTAGCTGACCTAAAGGAAT 7557 7576 22 389 532992 n/a n/a
Intron 8 TGGGTATAGTGTTACAAGTG 4807 4826 17 390 532993 n/a n/a
Intron 1 TGAAGAGAAAGGCTGATGAA 2130 2149 19 391 532994 n/a n/a
Intron 8 GTGTTACAAGTGGACTTAAG 4799 4818 25 392 532995 n/a n/a
Intron 6 ACCTGTGGGTGAGGAGAACA 4134 4153 24 393 532996 n/a n/a Exon
9 - TCACCCAGATAATCCTCCCT 5107 5126 36 394 Intron 9 532952 2608 2627
Exon 18 TGTTGTCGCAGCTGTTTTAA 7843 7862 90 395
Example 2: Antisense Inhibition of Human Complement Factor B (CFB)
in HepG2 Cells by MOE Gapmers
[0428] Additional antisense oligonucleotides were designed
targeting human Complement Factor B (CFB) nucleic acid and were
tested for their effects on CFB mRNA in vitro. Cultured HepG2 cells
at a density of 20,000 cells per well were transfected using
electroporation with 4,500 nM antisense oligonucleotide. After a
treatment period of approximately 24 hours, RNA was isolated from
the cells and CFB mRNA levels were measured by quantitative
real-time PCR. Human primer probe set RTS3460_MGB (forward sequence
CGAAGCAGCTCAATGAAATCAA, designated herein as SEQ ID NO: 813;
reverse sequence TGCCTGGAGGGCCTTCTT, designated herein as SEQ ID
NO: 814; probe sequence AGACCACAAGTTGAAGTC, designated herein as
SEQ ID NO: 815) was used to measure mRNA levels. CFB mRNA levels
were adjusted according to total RNA content, as measured by
RIBOGREEN.RTM.. Results are presented as percent inhibition of CFB,
relative to untreated control cells.
[0429] The newly designed chimeric antisense oligonucleotides in
the Tables below were designed as 5-10-5 MOE gapmers. The 5-10-5
MOE gapmers are 20 nucleosides in length, wherein the central gap
segment comprises often 2'-deoxynucleosides and is flanked by wing
segments on the 5' direction and the 3' direction comprising five
nucleosides each. Each nucleoside in the 5' wing segment and each
nucleoside in the 3' wing segment has a 2'-MOE modification. The
internucleoside linkages throughout each gapmer are
phosphorothioate (P.dbd.S) linkages. All cytosine residues
throughout each gapmer are 5-methylcytosines. "Start site"
indicates the 5'-most nucleoside to which the gapmer is targeted in
the human gene sequence. "Stop site" indicates the 3'-most
nucleoside to which the gapmer is targeted human gene sequence.
Each gapmer listed in the Tables below is targeted to either the
human CFB mRNA, designated herein as SEQ ID NO: 1 (GENBANK
Accession No. NM_001710.5) or the human CFB genomic sequence,
designated herein as SEQ ID NO: 2 (GENBANK Accession No.
NT_007592.15 truncated from nucleotides 31852000 to 31861000), or
both. `n/a` indicates that the antisense oligonucleotide does not
target that particular gene sequence with 100% complementarity.
TABLE-US-00007 TABLE 6 Inhibition of CFB mRNA by 5-10-5 MOE gapmers
targeting SEQ ID NO: 1 and 2 SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO:
1 NO: 2 NO: 2 SEQ ISIS start stop Target % start stop ID NO site
site region Sequence inhibition site site NO: 532686 1135 1154 Exon
6 ACACTTTTTGGCTCCTGTGA 48 3819 3838 84 532687 1141 1160 Exon 6
GACTAGACACTTTTTGGCTC 63 3825 3844 85 532688 1147 1166 Exon 6
TAAGTTGACTAGACACTTTT 47 3831 3850 86 532689 1153 1172 Exon 6
CTCAATTAAGTTGACTAGAC 57 3837 3856 87 532690 1159 1178 Exon 6-7
CACCTTCTCAATTAAGTTGA 49 3843 3862 88 Junction 532691 1165 1184 Exon
6-7 ACTTGCCACCTTCTCAATTA 33 n/a n/a 89 Junction 532692 1171 1190
Exon 6-7 ACCATAACTTGCCACCTTCT 67 n/a n/a 90 Junction 532693 1177
1196 Exon 7 CTTCACACCATAACTTGCCA 56 4153 4172 91 532694 1183 1202
Exon 7 TCTTGGCTTCACACCATAAC 50 4159 4178 92 532695 1208 1227 Exon 7
ATGTGGCATATGTCACTAGA 53 4184 4203 93 532696 1235 1254 Exon 7
CAGACACTTTGACCCAAATT 52 4211 4230 94 532697 1298 1317 Exon 7-8
GGTCTTCATAATTGATTTCA 59 n/a n/a 95 Junction 532698 1304 1323 Exon
7-8 ACTTGTGGTCTTCATAATTG 52 n/a n/a 96 Junction 532699 1310 1329
Exon 7-8 ACTTCAACTTGTGGTCTTCA 85 n/a n/a 97 Junction 532700 1316
1335 Exon 8 TCCCTGACTTCAACTTGTGG 96 4609 4628 98 532701 1322 1341
Exon 8 TGTTAGTCCCTGACTTCAAC 56 4615 4634 99 532702 1328 1347 Exon 8
TCTTGGTGTTAGTCCCTGAC 86 4621 4640 100 532703 1349 1368 Exon 8
TGTACACTGCCTGGAGGGCC 35 4642 4661 101 532704 1355 1374 Exon 8
TCATGCTGTACACTGCCTGG 12 4648 4667 102 532705 1393 1412 Exon 8
GTTCCAGCCTTCAGGAGGGA 27 4686 4705 103 532706 1399 1418 Exon 8
GGTGCGGTTCCAGCCTTCAG 67 4692 4711 104 532707 1405 1424 Exon 8
ATGGCGGGTGCGGTTCCAGC 26 4698 4717 105 532708 1411 1430 Exon 8
GATGACATGGCGGGTGCGGT 28 4704 4723 106 532709 1417 1436 Exon 8
GAGGATGATGACATGGCGGG 6 4710 4729 107 532710 1443 1462 Exon 8-9
CCCATGTTGTGCAATCCATC 35 n/a n/a 108 Junction 532711 1449 1468 Exon
9 TCCCCGCCCATGTTGTGCAA 28 5023 5042 109 532712 1455 1474 Exon 9
ATTGGGTCCCCGCCCATGTT 19 5029 5048 110 532713 1461 1480 Exon 9
ACAGTAATTGGGTCCCCGCC 29 5035 5054 111 532714 1467 1486 Exon 9
TCAATGACAGTAATTGGGTC 49 5041 5060 112 532715 1473 1492 Exon 9
ATCTCATCAATGACAGTAAT 45 5047 5066 113 532716 1479 1498 Exon 9
TCCCGGATCTCATCAATGAC 54 5053 5072 114 532717 1533 1552 Exon 9-
ACATCCAGATAATCCTCCCT 22 n/a n/a 115 10 Junction 532718 1539 1558
Exon 9- ACATAGACATCCAGATAATC 8 n/a n/a 116 10 Junction 532719 1545
1564 Exon 9- CCAAACACATAGACATCCAG 30 n/a n/a 117 10 Junction 532720
1582 1601 Exon 10 AGCATTGATGTTCACTTGGT 62 5231 5250 118 532721 1588
1607 Exon 10 AGCCAAAGCATTGATGTTCA 46 5237 5256 119 532722 1594 1613
Exon 10 CTTGGAAGCCAAAGCATTGA 35 5243 5262 120 532723 1600 1619 Exon
10 GTCTTTCTTGGAAGCCAAAG 43 5249 5268 121 532724 1606 1625 Exon 10
CTCATTGTCTTTCTTGGAAG 40 5255 5274 122 532725 1612 1631 Exon 10
ATGTTGCTCATTGTCTTTCT 49 5261 5280 123 532726 1618 1637 Exon 10
GAACACATGTTGCTCATTGT 68 5267 5286 124 532727 1624 1643 Exon 10
GACTTTGAACACATGTTGCT 54 5273 5292 125 532728 1630 1649 Exon 10
ATCCTTGACTTTGAACACAT 61 5279 5298 126 532729 1636 1655 Exon 10
TTCCATATCCTTGACTTTGA 55 5285 5304 127 532730 1642 1661 Exon 10
CAGGTTTTCCATATCCTTGA 51 5291 5310 440 532731 1686 1705 Exon 10-
CTCAGAGACTGGCTTTCATC 41 5827 5846 129 11 Junction 532732 1692 1711
Exon 11 CAGAGACTCAGAGACTGGCT 59 5833 5852 130 516252 1698 1717 Exon
11 ATGCCACAGAGACTCAGAGA 57 5839 5858 131 532733 1704 1723 Exon 11
CAAACCATGCCACAGAGACT 34 5845 5864 132 532734 1710 1729 Exon 11
TGTTCCCAAACCATGCCACA 51 5851 5870 133 532735 1734 1753 Exon 11
TTGTGGTAATCGGTACCCTT 50 5875 5894 134 532736 1740 1759 Exon 11
GGTTGCTTGTGGTAATCGGT 64 5881 5900 135 532737 1746 1765 Exon 11
TGCCATGGTTGCTTGTGGTA 40 5887 5906 136 532738 1752 1771 Exon 11
TTGGCCTGCCATGGTTGCTT 49 5893 5912 137 532739 1758 1777 Exon 11
GAGATCTTGGCCTGCCATGG 47 5899 5918 138 532740 1803 1822 Exon 12
ACAGCCCCCATACAGCTCTC 48 6082 6101 139 532741 1809 1828 Exon 12
GACACCACAGCCCCCATACA 40 6088 6107 140 532742 1815 1834 Exon 12
TACTCAGACACCACAGCCCC 33 6094 6113 141 532743 1821 1840 Exon 12
ACAAAGTACTCAGACACCAC 39 6100 6119 142 532744 1827 1846 Exon 12
GTCAGCACAAAGTACTCAGA 45 6106 6125 143 532745 1872 1891 Exon 12
TTGATTGAGTGTTCCTTGTC 42 6151 6170 144 532746 1878 1897 Exon 12
CTGACCTTGATTGAGTGTTC 53 6157 6176 145 532747 1909 1928 Exon 13
TATCTCCAGGTCCCGCTTCT 31 6403 6422 146 532748 1967 1986 Exon 13
GAATTCCTGCTTCTTTTTTC 30 6461 6480 147 532749 1973 1992 Exon 13
ATTCAGGAATTCCTGCTTCT 40 6467 6486 148 532750 1979 1998 Exon 13
CATAAAATTCAGGAATTCCT 45 6473 6492 149 532751 1985 2004 Exon 13
CATAGTCATAAAATTCAGGA 43 6479 6498 150 532752 2006 2025 Exon 13
TGAGCTTGATCAGGGCAACG 61 6500 6519 151 532753 2012 2031 Exon 13
TATTCTTGAGCTTGATCAGG 47 6506 6525 152 532754 2048 2067 Exon 13 -
GACAAATGGGCCTGATAGTC 35 n/a n/a 153 14 Junction 532755 2070 2089
Exon 14 GTTGTTCCCTCGGTGCAGGG 43 6659 6678 154 532756 2076 2095 Exon
14 GCTCGAGTTGTTCCCTCGGT 51 6665 6684 155 532757 2082 2101 Exon 14
CTCAAAGCTCGAGTTGTTCC 36 6671 6690 156 532758 2088 2107 Exon 14
GGAAGCCTCAAAGCTCGAGT 54 6677 6696 157 532759 2094 2113 Exon 14
GTTGGAGGAAGCCTCAAAGC 52 6683 6702 158 532760 2100 2119 Exon 14
GTGGTAGTTGGAGGAAGCCT 22 6689 6708 159 532761 2106 2125 Exon 14
TGGCAAGTGGTAGTTGGAGG 34 6695 6714 160 532762 2112 2131 Exon 14
TGTTGCTGGCAAGTGGTAGT 52 6701 6720 161
Example 3: Antisense Inhibition of Human Complement Factor B (CFB)
in HepG2 Cells by MOE Gapmers
[0430] Additional antisense oligonucleotides were designed
targeting human Complement Factor B (CFB) nucleic acid and were
tested for their effects on CFB mRNA in vitro. The antisense
oligonucleotides were tested in a series of experiments that had
similar culture conditions. The results for each experiment are
presented in separate tables shown below. Cultured HepG2 cells at a
density of 20,000 cells per well were transfected using
electroporation with 5,000 nM antisense oligonucleotide. After a
treatment period of approximately 24 hours, RNA was isolated from
the cells and CFB mRNA levels were measured by quantitative
real-time PCR. Human primer probe set RTS3459 was used to measure
mRNA levels. CFB mRNA levels were adjusted according to total RNA
content, as measured by RIBOGREEN.RTM.. Results are presented as
percent inhibition of CFB, relative to untreated control cells.
[0431] The newly designed chimeric antisense oligonucleotides in
the Tables below were designed as 5-10-5 MOE gapmers. The gapmers
are 20 nucleosides in length, wherein the central gap segment
comprises often 2'-deoxynucleosides and is flanked by wing segments
on the 5' direction and the 3' direction comprising five
nucleosides each. Each nucleoside in the 5' wing segment and each
nucleoside in the 3' wing segment has a 2'-MOE modification. The
internucleoside linkages throughout each gapmer are
phosphorothioate (P.dbd.S) linkages. All cytosine residues
throughout each gapmer are 5-methylcytosines. "Start site"
indicates the 5'-most nucleoside to which the gapmer is targeted in
the human gene sequence. "Stop site" indicates the 3'-most
nucleoside to which the gapmer is targeted human gene sequence.
Each gapmer listed in the Tables below is targeted to either the
human CFB mRNA, designated herein as SEQ ID NO: 1 (GENBANK
Accession No. NM_001710.5) or the human CFB genomic sequence,
designated herein as SEQ ID NO: 2 (GENBANK Accession No.
NT_007592.15 truncated from nucleotides 31852000 to 31861000), or
both. `n/a` indicates that the antisense oligonucleotide does not
target that particular gene sequence with 100% complementarity. In
case the sequence alignment for a target gene in a particular table
is not shown, it is understood that none of the oligonucleotides
presented in that table align with 100% complementarity with that
target gene.
TABLE-US-00008 TABLE 7 Inhibition of CFB mRNA by 5-10-5 MOE gapmers
targeting SEQ ID NO: 1 SEQ ID SEQ ID SEQ ISIS NO: 1 NO: 1 stop
Target % ID NO start site site region Sequence inhibition NO:
588570 150 169 Exon 1 TGGTCACATTCCCTTCCCCT 54 396 588571 152 171
Exon 1 CCTGGTCACATTCCCTTCCC 63 397 532614 154 173 Exon 1
GACCTGGTCACATTCCCTTC 64 12 588572 156 175 Exon 1
TAGACCTGGTCACATTCCCT 62 398 588573 158 177 Exon 1
CCTAGACCTGGTCACATTCC 53 399 588566 2189 2208 Exon 15
CCTTCCGAGTCAGCTTTTTC 60 400 588567 2191 2210 Exon 15
CTCCTTCCGAGTCAGCTTTT 61 401 532770 2193 2212 Exon 15
ACCTCCTTCCGAGTCAGCTT 77 198 588568 2195 2214 Exon 15
AGACCTCCTTCCGAGTCAGC 72 402 588569 2197 2216 Exon 15
GTAGACCTCCTTCCGAGTCA 46 403 588574 2453 2472 Exon 18
TTTGCCGCTTCTGGTTTTTG 46 404 588575 2455 2474 Exon 18
CTTTTGCCGCTTCTGGTTTT 41 405 532800 2457 2476 Exon 18
TGCTTTTGCCGCTTCTGGTT 69 228 588576 2459 2478 Exon 18
CCTGCTTTTGCCGCTTCTGG 61 406 588577 2461 2480 Exon 18
TACCTGCTTTTGCCGCTTCT 51 407 516350 2550 2569 Exon 18
AGAAAACCCAAATCCTCATC 71 408 588509 2551 2570 Exon 18
TAGAAAACCCAAATCCTCAT 58 409 588510 2552 2571 Exon 18
ATAGAAAACCCAAATCCTCA 57 410 588511 2553 2572 Exon 18
TATAGAAAACCCAAATCCTC 57 411 588512 2554 2573 Exon 18
TTATAGAAAACCCAAATCCT 44 412 588513 2555 2574 Exon 18
CTTATAGAAAACCCAAATCC 37 413 588514 2556 2575 Exon 18
CCTTATAGAAAACCCAAATC 50 414 588515 2557 2576 Exon 18
CCCTTATAGAAAACCCAAAT 45 415 588516 2558 2577 Exon 18
CCCCTTATAGAAAACCCAAA 60 416 588517 2559 2578 Exon 18
ACCCCTTATAGAAAACCCAA 67 417 588518 2560 2579 Exon 18
AACCCCTTATAGAAAACCCA 57 418 588519 2561 2580 Exon 18
AAACCCCTTATAGAAAACCC 61 419 588520 2562 2581 Exon 18
GAAACCCCTTATAGAAAACC 27 420 588521 2563 2582 Exon 18
GGAAACCCCTTATAGAAAAC 25 421 588522 2564 2583 Exon 18
AGGAAACCCCTTATAGAAAA 36 422 588523 2565 2584 Exon 18
CAGGAAACCCCTTATAGAAA 36 423 588524 2566 2585 Exon 18
GCAGGAAACCCCTTATAGAA 46 424 588525 2567 2586 Exon 18
AGCAGGAAACCCCTTATAGA 38 425 588526 2568 2587 Exon 18
CAGCAGGAAACCCCTTATAG 47 426 588527 2569 2588 Exon 18
CCAGCAGGAAACCCCTTATA 68 427 588528 2570 2589 Exon 18
TCCAGCAGGAAACCCCTTAT 63 428 532809 2571 2590 Exon 18
GTCCAGCAGGAAACCCCTTA 85 237 588529 2572 2591 Exon 18
TGTCCAGCAGGAAACCCCTT 76 429 588530 2573 2592 Exon 18
CTGTCCAGCAGGAAACCCCT 74 430 588531 2574 2593 Exon 18
CCTGTCCAGCAGGAAACCCC 75 431 588532 2575 2594 Exon 18
CCCTGTCCAGCAGGAAACCC 73 432 588533 2576 2595 Exon 18
CCCCTGTCCAGCAGGAAACC 82 433 532810 2577 2596 Exon 18
GCCCCTGTCCAGCAGGAAAC 88 238 588534 2578 2597 Exon 18
CGCCCCTGTCCAGCAGGAAA 86 434 588535 2579 2598 Exon 18
ACGCCCCTGTCCAGCAGGAA 86 435 588536 2580 2599 Exon 18
CACGCCCCTGTCCAGCAGGA 93 436 588537 2581 2600 Exon 18
CCACGCCCCTGTCCAGCAGG 92 437 588538 2582 2601 Exon 18
CCCACGCCCCTGTCCAGCAG 94 438 588539 2583 2602 Exon 18
TCCCACGCCCCTGTCCAGCA 96 439 588540 2584 2603 Exon 18
ATCCCACGCCCCTGTCCAGC 88 440 588541 2585 2604 Exon 18
AATCCCACGCCCCTGTCCAG 79 441 588542 2586 2605 Exon 18
CAATCCCACGCCCCTGTCCA 83 442 588543 2587 2606 Exon 18
TCAATCCCACGCCCCTGTCC 86 443 588544 2588 2607 Exon 18
TTCAATCCCACGCCCCTGTC 90 444 588545 2589 2608 Exon 18
ATTCAATCCCACGCCCCTGT 92 445 588546 2590 2609 Exon 18
AATTCAATCCCACGCCCCTG 92 446 588547 2591 2610 Exon 18
TAATTCAATCCCACGCCCCT 88 447 588548 2592 2611 Exon 18
TTAATTCAATCCCACGCCCC 93 448 588549 2593 2612 Exon 18
TTTAATTCAATCCCACGCCC 88 449 588550 2594 2613 Exon 18
TTTTAATTCAATCCCACGCC 89 450 588551 2595 2614 Exon 18
GTTTTAATTCAATCCCACGC 94 451 588552 2596 2615 Exon 18
TGTTTTAATTCAATCCCACG 93 452 588553 2597 2616 Exon 18
CTGTTTTAATTCAATCCCAC 96 453 588554 2598 2617 Exon 18
GCTGTTTTAATTCAATCCCA 98 454 532811 2599 2618 Exon 18
AGCTGTTTTAATTCAATCCC 97 239 532811 2599 2618 Exon 18
AGCTGTTTTAATTCAATCCC 95 239 588555 2600 2619 Exon 18
CAGCTGTTTTAATTCAATCC 93 455 588556 2601 2620 Exon 18
GCAGCTGTTTTAATTCAATC 96 456 588557 2602 2621 Exon 18
CGCAGCTGTTTTAATTCAAT 98 457 588558 2603 2622 Exon 18
TCGCAGCTGTTTTAATTCAA 95 458 532917 2604 2623 Exon 18
GTCGCAGCTGTTTTAATTCA 97 317 588559 2605 2624 Exon 18
TGTCGCAGCTGTTTTAATTC 95 459 588560 2606 2625 Exon 18
TTGTCGCAGCTGTTTTAATT 92 460 588561 2607 2626 Exon 18
GTTGTCGCAGCTGTTTTAAT 93 461 532952 2608 2627 Exon 18
TGTTGTCGCAGCTGTTTTAA 88 395 588562 2609 2628 Exon 18 /
TTGTTGTCGCAGCTGTTTTA 90 462 Repeat 588563 2610 2629 Exon 18 /
TTTGTTGTCGCAGCTGTTTT 89 463 Repeat 588564 2611 2630 Exon 18 /
TTTTGTTGTCGCAGCTGTTT 92 464 Repeat 588565 2612 2631 Exon 18/
TTTTTGTTGTCGCAGCTGTT 88 465 Repeat
TABLE-US-00009 TABLE 8 Inhibition of CFB mRNA by 5-10-5 MOE gapmers
targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ SEQ ID ID SEQ ID NO:
1 NO: 1 ID NO NO: 2 SEQ ISIS start stop Target % 2: start stop ID
NO site site region Sequence inhibition site site NO: 588685 n/a
n/a Exon 1 GGATCCAGCTCACTCCCCTG 48 1596 1615 466 588686 n/a n/a
Exon 1 AAATAAGGATCCAGCTCACT 29 1602 n/a 467 588688 n/a n/a Exon 1
GACCAGAAATAAGGATCCAG 58 1608 1627 468 588690 n/a n/a Exon 1
CTTAGGGACCAGAAATAAGG 45 1614 1633 469 588692 n/a n/a Exon 1
CACCCACTTAGGGACCAGAA 36 1620 1639 470 588694 n/a n/a Exon 1
ACCACCCACTTAGGGACCAG 47 1622 1641 471 588696 n/a n/a Exon 1
AGGTCCAGGACTCTCCCCTT 96 1685 1704 472 588698 n/a n/a Exon 1
AAGGTCCAGGACTCTCCCCT 96 1686 1705 473 588700 n/a n/a Exon 1
AAACTGCAGAAGTCCCACCC 2 1716 1735 474 588586 30 49 Exon 1
GGAGGGCCCCGCTGAGCTGC 59 1751 1770 475 588587 48 67 Exon 1
TCCCGGAACATCCAAGCGGG 45 1769 1788 476 588588 56 75 Exon 1
CATCACTTTCCCGGAACATC 39 1777 n/a 477 588589 151 170 Exon 1
CTGGTCACATTCCCTTCCCC 29 1872 1891 478 588590 157 176 Exon 1
CTAGACCTGGTCACATTCCC 47 1878 1897 479 588591 339 358 Exon 1-2
GGAGTGGTGGTCACACCTCC 44 n/a n/a 480 Junction 588592 384 403 Exon 2
ACCCCCTCCAGAGAGCAGGA 43 2192 2211 481 588593 390 409 Exon 2
ATCTCTACCCCCTCCAGAGA 34 2198 2217 482 588594 467 486 Exon 2
GGTACGGGTAGAAGCCAGAA 17 2275 2294 483 588595 671 690 Exon 3
GGAGAGTGTAACCGTCATAG 37 2879 2898 484 588596 689 708 Exon 3
TGCGATTGGCAGAGCCCCGG 18 2897 2916 485 588597 695 714 Exon 3
GGCAGGTGCGATTGGCAGAG 32 2903 2922 486 588598 707 726 Exon 3
GGCCATTCACTTGGCAGGTG 45 2915 2934 487 588599 738 757 Exon 3
TTGTCACAGATCGCTGTCTG 52 2946 2965 488 588600 924 943 Exon 4-5
AAGGAGTCTTGGCAGGAAGG 39 n/a n/a 489 Junction 588601 931 950 Exon
4-5 GTACATGAAGGAGTCTTGGC 37 n/a n/a 490 Junction 588602 959 978
Exon 5 AAGCTTCGGCCACCTCTTGA 21 3542 3561 491 588603 1089 1108 Exon
6 CCATCTAGCACCAGGTAGAT 22 3773 3792 492 588604 1108 1127 Exon 6
GGCCCCAATGCTGTCTGATC 21 3792 3811 493 588606 1150 1169 Exon 6
AATTAAGTTGACTAGACACT 56 3834 3853 494 588608 1162 1181 Exon 6-7
TGCCACCTTCTCAATTAAGT 50 19 495 Junction 588578 1167 1186 Exon 6-7
TAACTTGCCACCTTCTCAAT 23 n/a n/a 496 Junction 588579 1169 1188 Exon
6-7 CATAACTTGCCACCTTCTCA 23 n/a n/a 497 Junction 532692 1171 1190
Exon 6-7 ACCATAACTTGCCACCTTCT 15 n/a n/a 90 Junction 588580 1173
1192 Exon 6-7 ACACCATAACTTGCCACCTT 16 n/a n/a 498 Junction 588581
1175 1194 Exon 6-7 TCACACCATAACTTGCCACC 14 4151 4170 499 Junction
588610 1319 1338 Exon 8 TAGTCCCTGACTTCAACTTG 50 4612 4631 500
588612 1325 1344 Exon 8 TGGTGTTAGTCCCTGACTTC 47 4618 4637 501
588614 1396 1415 Exon 8 GCGGTTCCAGCCTTCAGGAG 47 4689 4708 502
588616 1421 1440 Exon 8 TCATGAGGATGATGACATGG 51 4714 4733 503
588618 1446 1465 Exon 9 CCGCCCATGTTGTGCAATCC 18 5020 5039 504
588620 1458 1477 Exon 9 GTAATTGGGTCCCCGCCCAT 40 5032 5051 505
588623 1482 1501 Exon 9 AAGTCCCGGATCTCATCAAT 40 5056 5075 506
588624 1542 1561 Exon 9- AACACATAGACATCCAGATA 45 n/a n/a 507 10
Junction 588626 1585 1604 Exon 10 CAAAGCATTGATGTTCACTT 43 5234 5253
508 588628 1621 1640 Exon 10 TTTGAACACATGTTGCTCAT 45 5270 5289 509
588631 1646 1665 Exon 10 CTTCCAGGTTTTCCATATCC 53 5295 5314 510
588632 1647 1666 Exon 10 TCTTCCAGGTTTTCCATATC 56 5296 5315 511
588634 1689 1708 Exon 11 AGACTCAGAGACTGGCTTTC 35 5830 5849 512
588636 1749 1768 Exon 11 GCCTGCCATGGTTGCTTGTG 55 5890 5909 513
588638 1763 1782 Exon 11 TGACTGAGATCTTGGCCTGC 78 5904 5923 514
588640 1912 1931 Exon 13 TTCTATCTCCAGGTCCCGCT 95 6406 6425 515
588642 1982 2001 Exon 13 AGTCATAAAATTCAGGAATT 44 6476 6495 516
588645 2073 2092 Exon 14 CGAGTTGTTCCCTCGGTGCA 40 6662 6681 517
588646 2085 2104 Exon 14 AGCCTCAAAGCTCGAGTTGT 57 6674 6693 518
588648 2091 2110 Exon 14 GGAGGAAGCCTCAAAGCTCG 48 6680 6699 519
588651 2097 2116 Exon 14 GTAGTTGGAGGAAGCCTCAA 40 6686 6705 520
588652 2103 2122 Exon 14 CAAGTGGTAGTTGGAGGAAG 43 6692 6711 521
588654 2166 2185 Exon 15 TCCTCAGACACAAACAGAGC 13 6954 6973 522
588656 2172 2191 Exon 15 TTCTCCTCCTCAGACACAAA 55 6960 6979 523
588658 2196 2215 Exon 15 TAGACCTCCTTCCGAGTCAG 44 6984 7003 524
588660 2202 2221 Exon 15 TTGATGTAGACCTCCTTCCG 50 6990 7009 525
588582 2219 2238 Exon 15 - CTTTCTTATCCCCATTCTTG 19 n/a n/a 526 16
Junction 588583 2221 2240 Exon 15 - GCCTTTCTTATCCCCATTCT 14 n/a n/a
527 16 Junction 532775 2223 2242 Exon 15 - CTGCCTTTCTTATCCCCATT 3
n/a n/a 203 16 Junction 588584 2225 2244 Exon 15 -
AGCTGCCTTTCTTATCCCCA 18 n/a n/a 528 16 Junction 588662 2226 2245
Exon 15 - CAGCTGCCTTTCTTATCCCC 27 n/a n/a 529 16 Junction 588585
2227 2246 Exon 15 - ACAGCTGCCTTTCTTATCCC 59 n/a n/a 530 16 Junction
588664 2238 2257 Exon 16 GCATCTCTCTCACAGCTGCC 49 7122 7141 531
588666 2276 2295 Exon 16 AGATGTCCTTGACTTTGTCA 41 7160 7179 532
588668 2330 2349 Exon 16 CAGCATAGGGACTCACTCCT 41 7214 7233 533
588670 2361 2380 Exon 16- CCGCCAGAATCACCTCTGCA 43 n/a n/a 534 17
Junction 588672 2397 2416 Exon 17 TGAATGAAACGACTTCTCTT 52 7362 7381
535 588674 2430 2449 Exon 18 ACATCCACTACTCCCCAGCT 39 7665 7684 536
588676 2448 2467 Exon 18 CGCTTCTGGTTTTTGCAGAC 69 7683 7702 537
588678 2454 2473 Exon 18 TTTTGCCGCTTCTGGTTTTT 46 7689 7708 538
588680 2466 2485 Exon 18 GCAGGTACCTGCTTTTGCCG 47 7701 7720 539
588682 2532 2551 Exon 18 TCTTGGAGTTTCTCCTTCAG 58 7767 7786 540
532811 2599 2618 Exon 18 AGCTGTTTTAATTCAATCCC 10 7834 7853 239
532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 11 7839 7858 317
Example 4: Antisense Inhibition of Human Complement Factor B (CFB)
in HepG2 Cells by MOE Gapmers
[0432] Antisense oligonucleotides were designed targeting human
Complement Factor B (CFB) nucleic acid and were tested for their
effects on CFB mRNA in vitro. The antisense oligonucleotides were
tested in a series of experiments that had similar culture
conditions. The results for each experiment are presented in
separate tables shown below. Cultured HepG2 cells at a density of
20,000 cells per well were transfected using electroporation with
3,000 nM antisense oligonucleotide. After a treatment period of
approximately 24 hours, RNA was isolated from the cells and CFB
mRNA levels were measured by quantitative real-time PCR. Human
primer probe set RTS3459 was used to measure mRNA levels. CFB mRNA
levels were adjusted according to total RNA content, as measured by
RIBOGREEN. Results are presented as percent inhibition of CFB,
relative to untreated control cells.
[0433] The newly designed chimeric antisense oligonucleotides in
the Tables below were designed as 4-8-5 MOE, 5-9-5 MOE, 5-10-5 MOE,
3-10-4 MOE, 3-10-7 MOE, 6-7-6-MOE, 6-8-6 MOE, or 5-7-5 MOE gapmers,
or as deoxy, MOE, and cEt oligonucleotides.
[0434] The 4-8-5 MOE gapmers are 17 nucleosides in length, wherein
the central gap segment comprises of eight 2'-deoxynucleosides and
is flanked by wing segments on the 5' direction and the 3'
direction comprising four and five nucleosides respectively. The
5-9-5 MOE gapmers are 19 nucleosides in length, wherein the central
gap segment comprises of nine 2'-deoxynucleosides and is flanked by
wing segments on the 5' direction and the 3' direction comprising
five nucleosides each. The 5-10-5 MOE gapmers are 20 nucleosides in
length, wherein the central gap segment comprises often
2'-deoxynucleosides and is flanked by wing segments on the 5'
direction and the 3' direction comprising five nucleosides each.
The 5-7-5 MOE gapmers are 17 nucleosides in length, wherein the
central gap segment comprises of seven 2'-deoxynucleosides and is
flanked by wing segments on the 5' direction and the 3' direction
comprising five nucleosides each. The 3-10-4 MOE gapmers are 17
nucleosides in length, wherein the central gap segment comprises
often 2'-deoxynucleosides and is flanked by wing segments on the 5'
direction and the 3' direction comprising three and four
nucleosides respectively. The 3-10-7 MOE gapmers are 20 nucleosides
in length, wherein the central gap segment comprises often
2'-deoxynucleosides and is flanked by wing segments on the 5'
direction and the 3' direction comprising three and seven
nucleosides respectively. The 6-7-6 MOE gapmers are 19 nucleosides
in length, wherein the central gap segment comprises of seven
2'-deoxynucleosides and is flanked by wing segments on the 5'
direction and the 3' direction comprising six nucleosides each. The
6-8-6 MOE gapmers are 20 nucleosides in length, wherein the central
gap segment comprises of eight 2'-deoxynucleosides and is flanked
by wing segments on the 5' direction and the 3' direction
comprising six nucleosides each. The internucleoside linkages
throughout each gapmer are phosphorothioate (P.dbd.S) linkages. All
cytosine residues throughout each gapmer are 5-methylcytosines.
[0435] The deoxy, MOE and cEt oligonucleotides are 16 nucleosides
in length wherein the nucleoside have either a MOE sugar
modification, an cEt sugar modification, or a deoxy modification.
The `Chemistry` column describes the sugar modifications of each
oligonucleotide. `k` indicates an cEt sugar modification; `d`
indicates deoxyribose; and `e` indicates a MOE modification.
[0436] "Start site" indicates the 5'-most nucleoside to which the
gapmer is targeted in the human gene sequence. "Stop site"
indicates the 3'-most nucleoside to which the gapmer is targeted
human gene sequence. Each gapmer listed in the Tables below is
targeted to either the human CFB mRNA, designated herein as SEQ ID
NO: 1 (GENBANK Accession No. NM_001710.5) or the human CFB genomic
sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No.
NT_007592.15 truncated from nucleotides 31852000 to 31861000), or
both. `n/a` indicates that the antisense oligonucleotide does not
target that particular gene sequence with 100% complementarity.
TABLE-US-00010 TABLE 9 Inhibition of CFB mRNA by deoxy, MOE and cEt
oligonucleotides targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ ID SEQ
ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ Start stop Target %
Start Stop ID ISIS NO site site region Sequence inhibition site
site Motif NO: 532811 2599 2618 Exon 18 AGCTGTTTTAATTCAA 10 7834
7853 eeeeedddddddddde 239 TCCC eeee 588884 48 63 Exon 1
GGAACATCCAAGCGGG 79 1769 1784 eekddddddddddkke 541 588872 154 169
Exon 1 TGGTCACATTCCCTTC 91 1875 1890 eekddddddddddkke 542 588873
156 171 Exon 1 CCTGGTCACATTCCCT 91 1877 1892 eekddddddddddkke 543
588874 158 173 Exon 1 GACCTGGTCACATTCC 91 1879 1894
eekddddddddddkke 544 588878 1171 1186 Exon 6-7 TAACTTGCCACCTTCT 92
n/a n/a eekddddddddddkke 545 Junction 588879 1173 1188 Exon 6-7
CATAACTTGCCACCTT 94 n/a n/a eekddddddddddkke 546 Junction 588880
1175 1190 Exon 6-7 ACCATAACTTGCCACC 89 4151 4166 eekddddddddddkke
547 Junction 588869 2193 2208 Exon 15 CCTTCCGAGTCAGCTT 17 6981 6996
eekddddddddddkke 548 588870 2195 2210 Exon 15 CTCCTTCCGAGTCAGC 78
6983 6998 eekddddddddddkke 549 588871 2197 2212 Exon 15
ACCTCCTTCCGAGTCA 80 6985 7000 eekddddddddddkke 550 588881 2223 2238
Exon 15- CTTTCTTATCCCCATT 93 n/a n/a eekddddddddddkke 551 16
Junction 588882 2225 2240 Exon 15- GCCTTTCTTATCCCCA 88 n/a n/a
eekddddddddddkke 552 16 Junction 588883 2227 2242 Exon 15-
CTGCCTTTCTTATCCC 90 n/a n/a eekddddddddddkke 553 16 Junction 588875
2457 2472 Exon 18 TTTGCCGCTTCTGGTT 81 7692 7707 eekddddddddddkke
554 588876 2459 2474 Exon 18 CTTTTGCCGCTTCTGG 95 7694 7709
eekddddddddddkke 555 588877 2461 2476 Exon 18 TGCTTTTGCCGCTTCT 91
7696 7711 eekddddddddddkke 556 588807 2551 2566 Exon 18
AAACCCAAATCCTCAT 82 7786 7801 eekddddddddddkke 557 588808 2553 2568
Exon 18 GAAAACCCAAATCCTC 69 7788 7803 eekddddddddddkke 558 588809
2555 2570 Exon 18 TAGAAAACCCAAATCC 51 7790 7805 eekddddddddddkke
559 588810 2556 2571 Exon 18 ATAGAAAACCCAAATC 23 7791 7806
eekddddddddddkke 560 588811 2559 2574 Exon 18 CTTATAGAAAACCCAA 13
7794 7809 eekddddddddddkke 561 588812 2560 2575 Exon 18
CCTTATAGAAAACCCA 29 7795 7810 eekddddddddddkke 562 588813 2561 2576
Exon 18 CCCTTATAGAAAACCC 53 7796 7811 eekddddddddddkke 563 588814
2562 2577 Exon 18 CCCCTTATAGAAAACC 86 7797 7812 eekddddddddddkke
564 588815 2563 2578 Exon 18 ACCCCTTATAGAAAAC 76 7798 7813
eekddddddddddkke 565 588816 2564 2579 Exon 18 AACCCCTTATAGAAAA 33
7799 7814 eekddddddddddkke 566 588817 2565 2580 Exon 18
AAACCCCTTATAGAAA 48 7800 7815 eekddddddddddkke 567 588818 2566 2581
Exon 18 GAAACCCCTTATAGAA 44 7801 7816 eekddddddddddkke 568 588819
2567 2582 Exon 18 GGAAACCCCTTATAGA 74 7802 7817 eekddddddddddkke
569 588820 2568 2583 Exon 18 AGGAAACCCCTTATAG 68 7803 7818
eekddddddddddkke 570 588821 2569 2584 Exon 18 CAGGAAACCCCTTATA 45
7804 7819 eekddddddddddkke 571 588822 2570 2585 Exon 18
GCAGGAAACCCCTTAT 50 7805 7820 eekddddddddddkke 572 588823 2571 2586
Exon 18 AGCAGGAAACCCCTTA 54 7806 7821 eekddddddddddkke 573 588824
2572 2587 Exon 18 CAGCAGGAAACCCCTT 35 7807 7822 eekddddddddddkke
574 588825 2573 2588 Exon 18 CCAGCAGGAAACCCCT 11 7808 7823
eekddddddddddkke 575 588826 2574 2589 Exon 18 TCCAGCAGGAAACCCC 19
7809 7824 eekddddddddddkke 576 588827 2575 2590 Exon 18
GTCCAGCAGGAAACCC 42 7810 7825 eekddddddddddkke 577 588828 2576 2591
Exon 18 TGTCCAGCAGGAAACC 0 7811 7826 eekddddddddddkke 578 588829
2577 2592 Exon 18 CTGTCCAGCAGGAAAC 49 7812 7827 eekddddddddddkke
579 588830 2578 2593 Exon 18 CCTGTCCAGCAGGAAA 11 7813 7828
eekddddddddddkke 580 588831 2579 2594 Exon 18 CCCTGTCCAGCAGGAA 20
7814 7829 eekddddddddddkke 581 588832 2580 2595 Exon 18
CCCCTGTCCAGCAGGA 19 7815 7830 eekddddddddddkke 582 588833 2581 2596
Exon 18 GCCCCTGTCCAGCAGG 12 7816 7831 eekddddddddddkke 583 588834
2582 2597 Exon 18 CGCCCCTGTCCAGCAG 10 7817 7832 eekddddddddddkke
584 588835 2583 2598 Exon 18 ACGCCCCTGTCCAGCA 13 7818 7833
eekddddddddddkke 585 588836 2584 2599 Exon 18 CACGCCCCTGTCCAGC 13
7819 7834 eekddddddddddkke 586 588837 2585 2600 Exon 18
CCACGCCCCTGTCCAG 39 7820 7835 eekddddddddddkke 587 588838 2586 2601
Exon 18 CCCACGCCCCTGTCCA 54 7821 7836 eekddddddddddkke 588 588839
2587 2602 Exon 18 TCCCACGCCCCTGTCC 51 7822 7837 eekddddddddddkke
589 588840 2588 2603 Exon 18 ATCCCACGCCCCTGTC 65 7823 7838
eekddddddddddkke 590 588841 2589 2604 Exon 18 AATCCCACGCCCCTGT 59
7824 7839 eekddddddddddkke 591 588842 2590 2605 Exon 18
CAATCCCACGCCCCTG 70 7825 7840 eekddddddddddkke 592 588843 2591 2606
Exon 18 TCAATCCCACGCCCCT 0 7826 7841 eekddddddddddkke 593 588844
2592 2607 Exon 18 TTCAATCCCACGCCCC 48 7827 7842 eekddddddddddkke
594 588845 2593 2608 Exon 18 ATTCAATCCCACGCCC 46 7828 7843
eekddddddddddkke 595 588846 2594 2609 Exon 18 AATTCAATCCCACGCC 67
7829 7844 eekddddddddddkke 596 588847 2595 2610 Exon 18
TAATTCAATCCCACGC 75 7830 7845 eekddddddddddkke 597 588848 2596 2611
Exon 18 TTAATTCAATCCCACG 76 7831 7846 eekddddddddddkke 598 588849
2597 2612 Exon 18 TTTAATTCAATCCCAC 94 7832 7847 eekddddddddddkke
599 588850 2598 2613 Exon 18 TTTTAATTCAATCCCA 91 7833 7848
eekddddddddddkke 600 588851 2599 2614 Exon 18 GTTTTAATTCAATCCC 91
7834 7849 eekddddddddddkke 601 588852 2600 2615 Exon 18
TGTTTTAATTCAATCC 78 7835 7850 eekddddddddddkke 602 588853 2601 2616
Exon 18 CTGTTTTAATTCAATC 81 7836 7851 eekddddddddddkke 603 588854
2602 2617 Exon 18 GCTGTTTTAATTCAAT 63 7837 7852 eekddddddddddkke
604 588855 2603 2618 Exon 18 AGCTGTTTTAATTCAA 65 7838 7853
eekddddddddddkke 605 588856 2604 2619 Exon 18 CAGCTGTTTTAATTCA 76
7839 7854 eekddddddddddkke 606 588857 2605 2620 Exon 18
GCAGCTGTTTTAATTC 89 7840 7855 eekddddddddddkke 607 588858 2606 2621
Exon 18 CGCAGCTGTTTTAATT 89 7841 7856 eekddddddddddkke 608 588859
2607 2622 Exon 18 TCGCAGCTGTTTTAAT 89 7842 7857 eekddddddddddkke
609 588860 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 76 7843 7858
eekddddddddddkke 610 588861 2609 2624 Exon 18 TGTCGCAGCTGTTTTA 87
7844 7859 eekddddddddddkke 611 588862 2610 2625 Exon 18
TTGTCGCAGCTGTTTT 85 7845 7860 eekddddddddddkke 612 588863 2611 2626
Exon 18 GTTGTCGCAGCTGTTT 87 7846 7861 eekddddddddddkke 613 588864
2612 2627 Exon 18 TGTTGTCGCAGCTGTT 67 7847 7862 eekddddddddddkke
614 588865 2613 2628 Exon 18 TTGTTGTCGCAGCTGT 51 n/a n/a
eekddddddddddkke 615 588866 2614 2629 Exon 18 TTTGTTGTCGCAGCTG 95
n/a n/a eekddddddddddkke 616 588867 2615 2630 Exon 18
TTTTGTTGTCGCAGCT 92 n/a n/a eekddddddddddkke 617 588868 2616 2631
Exon 18 TTTTTGTTGTCGCAGC 66 n/a n/a eekddddddddddkke 618
TABLE-US-00011 TABLE 10 Inhibition of CFB mRNA by 5-10-5 MOE
gapmers targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ ID ID NO:
SEQ SEQ NO: 1 1 ID NO: ID NO: SEQ ISIS start stop Target % 2 start
2 stop ID NO site site region Sequence inhibition site site NO:
588685 n/a n/a Exon 1 GGATCCAGCTCACTCCCCTG 14 1596 1615 466 588686
n/a n/a Exon 1 AAATAAGGATCCAGCTCACT 2 1602 1621 467 588688 n/a n/a
Exon 1 GACCAGAAATAAGGATCCAG 3 1608 1627 468 588690 n/a n/a Exon 1
CTTAGGGACCAGAAATAAGG 10 1614 1633 469 588692 n/a n/a Exon 1
CACCCACTTAGGGACCAGAA 23 1620 1639 470 588694 n/a n/a Exon 1
ACCACCCACTTAGGGACCAG 23 1622 1641 471 588696 n/a n/a Exon 1
AGGTCCAGGACTCTCCCCTT 15 1685 1704 472 588698 n/a n/a Exon 1
AAGGTCCAGGACTCTCCCCT 19 1686 1705 473 588700 n/a n/a Exon 1
AAACTGCAGAAGTCCCACCC 16 1716 1735 474 588586 30 49 Exon 1
GGAGGGCCCCGCTGAGCTGC 11 1751 1770 475 588587 48 67 Exon 1
TCCCGGAACATCCAAGCGGG 14 1769 1788 476 588588 56 75 Exon 1
CATCACTTTCCCGGAACATC 18 1777 1796 477 588589 151 170 Exon 1
CTGGTCACATTCCCTTCCCC 59 1872 1891 478 588590 157 176 Exon 1
CTAGACCTGGTCACATTCCC 59 1878 1897 479 588591 339 358 Exon 1-2
GGAGTGGTGGTCACACCTCC 45 n/a n/a 480 Junction 588592 384 403 Exon 2
ACCCCCTCCAGAGAGCAGGA 39 2192 2211 481 588593 390 409 Exon 2
ATCTCTACCCCCTCCAGAGA 29 2198 2217 482 588594 467 486 Exon 2
GGTACGGGTAGAAGCCAGAA 47 2275 2294 483 588595 671 690 Exon 3
GGAGAGTGTAACCGTCATAG 44 2879 2898 484 588596 689 708 Exon 3
TGCGATTGGCAGAGCCCCGG 43 2897 2916 638 588597 695 714 Exon 3
GGCAGGTGCGATTGGCAGAG 34 2903 2922 486 588598 707 726 Exon 3
GGCCATTCACTTGGCAGGTG 17 2915 2934 487 588599 738 757 Exon 3
TTGTCACAGATCGCTGTCTG 37 2946 2965 488 588600 924 943 Exon 3-4
AAGGAGTCTTGGCAGGAAGG 18 n/a n/a 489 Junction 588601 931 950 Exon
3-4 GTACATGAAGGAGTCTTGGC 32 n/a n/a 490 Junction 588602 959 978
Exon 5 AAGCTTCGGCCACCTCTTGA 45 3542 3561 491 588603 1089 1108 Exon
6 CCATCTAGCACCAGGTAGAT 52 3773 3792 492 588604 1108 1127 Exon 6
GGCCCCAATGCTGTCTGATC 39 3792 3811 493 588606 1150 1169 Exon 6
AATTAAGTTGACTAGACACT 37 3834 3853 494 588608 1162 1181 Exon 6-7
TGCCACCTTCTCAATTAAGT 21 n/a n/a 648 Junction 588578 1167 1186 Exon
6-7 TAACTTGCCACCTTCTCAAT 22 n/a n/a 496 Junction 588579 1169 1188
Exon 6-7 CATAACTTGCCACCTTCTCA 21 n/a n/a 497 Junction 532692 1171
1190 Exon 6-7 ACCATAACTTGCCACCTTCT 56 n/a n/a 90 Junction 588580
1173 1192 Exon 6-7 ACACCATAACTTGCCACCTT 50 n/a n/a 498 Junction
588581 1175 1194 Exon 7 TCACACCATAACTTGCCACC 50 4151 4170 499
588610 1319 1338 Exon 8 TAGTCCCTGACTTCAACTTG 47 4612 4631 500
588612 1325 1344 Exon 8 TGGTGTTAGTCCCTGACTTC 47 4618 4637 501
588614 1396 1415 Exon 8 GCGGTTCCAGCCTTCAGGAG 51 4689 4708 502
588616 1421 1440 Exon 8 TCATGAGGATGATGACATGG 18 4714 4733 503
588618 1446 1465 Exon 9 CCGCCCATGTTGTGCAATCC 40 5020 5039 504
588620 1458 1477 Exon 9 GTAATTGGGTCCCCGCCCAT 40 5032 5051 505
588623 1482 1501 Exon 9 AAGTCCCGGATCTCATCAAT 45 5056 5075 506
588624 1542 1561 Exon 9-10 AACACATAGACATCCAGATA 43 n/a n/a 507
Junction 588626 1585 1604 Exon 10 CAAAGCATTGATGTTCACTT 45 5234 5253
508 588628 1621 1640 Exon 10 TTTGAACACATGTTGCTCAT 53 5270 5289 509
588631 1646 1665 Exon 10 CTTCCAGGTTTTCCATATCC 56 5295 5314 510
588632 1647 1666 Exon 10 TCTTCCAGGTTTTCCATATC 35 5296 5315 511
588634 1689 1708 Exon 11 AGACTCAGAGACTGGCTTTC 55 5830 5849 512
588636 1749 1768 Exon 11 GCCTGCCATGGTTGCTTGTG 78 5890 5909 513
588638 1763 1782 Exon 11 TGACTGAGATCTTGGCCTGC 95 5904 5923 514
588640 1912 1931 Exon 13 TTCTATCTCCAGGTCCCGCT 44 6406 6425 515
588642 1982 2001 Exon 13 AGTCATAAAATTCAGGAATT 40 6476 6495 516
588645 2073 2092 Exon 14 CGAGTTGTTCCCTCGGTGCA 57 6662 6681 517
588646 2085 2104 Exon 14 AGCCTCAAAGCTCGAGTTGT 48 6674 6693 518
588648 2091 2110 Exon 14 GGAGGAAGCCTCAAAGCTCG 40 6680 6699 519
588651 2097 2116 Exon 14 GTAGTTGGAGGAAGCCTCAA 43 6686 6705 520
588652 2103 2122 Exon 14 CAAGTGGTAGTTGGAGGAAG 13 6692 6711 521
588654 2166 2185 Exon 15 TCCTCAGACACAAACAGAGC 55 6954 6973 522
588656 2172 2191 Exon 15 TTCTCCTCCTCAGACACAAA 44 6960 6979 523
588658 2196 2215 Exon 15 TAGACCTCCTTCCGAGTCAG 50 6984 7003 524
588660 2202 2221 Exon 15 TTGATGTAGACCTCCTTCCG 27 6990 7009 525
588582 2219 2238 Exon 15- CTTTCTTATCCCCATTCTTG 49 n/a n/a 526 16
Junction 588583 2221 2240 Exon 15- GCCTTTCTTATCCCCATTCT 41 n/a n/a
527 16 Junction 532775 2223 2242 Exon 15 - CTGCCTTTCTTATCCCCATT 41
n/a n/a 203 16 Junction 588584 2225 2244 Exon 15 -
AGCTGCCTTTCTTATCCCCA 43 n/a n/a 528 16 Junction 588662 2226 2245
Exon 15 - CAGCTGCCTTTCTTATCCCC 52 n/a n/a 529 16 Junction 588585
2227 2246 Exon 15 - ACAGCTGCCTTTCTTATCCC 39 n/a n/a 530 16 Junction
588664 2238 2257 Exon 16 GCATCTCTCTCACAGCTGCC 69 7122 7141 531
588666 2276 2295 Exon 16 AGATGTCCTTGACTTTGTCA 46 7160 7179 532
588668 2330 2349 Exon 16 CAGCATAGGGACTCACTCCT 47 7214 7233 533
588670 2361 2380 Exon 16- CCGCCAGAATCACCTCTGCA 58 n/a n/a 534 17
Junction 588672 2397 2416 Exon 17 TGAATGAAACGACTTCTCTT 48 7362 7381
535 588674 2430 2449 Exon 18 ACATCCACTACTCCCCAGCT 29 7665 7684 536
588676 2448 2467 Exon 18 CGCTTCTGGTTTTTGCAGAC 58 7683 7702 537
588678 2454 2473 Exon 18 TTTTGCCGCTTCTGGTTTTT 45 7689 7708 538
588680 2466 2485 Exon 18 GCAGGTACCTGCTTTTGCCG 36 7701 7720 539
588682 2532 2551 Exon 18 TCTTGGAGTTTCTCCTTCAG 47 7767 7786 540
532811 2599 2618 Exon 18 AGCTGTTTTAATTCAATCCC 96 7834 7853 239
532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 96 7839 7858 317
TABLE-US-00012 TABLE 11 Inhibition of CFB mRNA by MOE gapmers
targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ SEQ SEQ ID ID ID ID
NO: NO: NO: NO: 1 1 2 2 SEQ ISIS start stop Target % start stop ID
NO site site region Sequence inhibition site site Motif NO: 598973
2552 2568 Exon 18 GAAAACCCAAATCCTCA 40 7787 7803 3-10-4 619 599036
2552 2568 Exon 18 GAAAACCCAAATCCTCA 18 7787 7803 5-7-5 619 598974
2553 2569 Exon 18 AGAAAACCCAAATCCTC 28 7788 7804 3-10-4 620 599037
2553 2569 Exon 18 AGAAAACCCAAATCCTC 19 7788 7804 5-7-5 620 598975
2554 2570 Exon 18 TAGAAAACCCAAATCCT 15 7789 7805 3-10-4 621 599038
2554 2570 Exon 18 TAGAAAACCCAAATCCT 32 7789 7805 5-7-5 621 598976
2555 2571 Exon 18 ATAGAAAACCCAAATCC 12 7790 7806 3-10-4 622 599039
2555 2571 Exon 18 ATAGAAAACCCAAATCC 7 7790 7806 5-7-5 622 598977
2557 2573 Exon 18 TTATAGAAAACCCAAAT 13 7792 7808 3-10-4 623 599040
2557 2573 Exon 18 TTATAGAAAACCCAAAT 13 7792 7808 5-7-5 623 598978
2558 2574 Exon 18 CTTATAGAAAACCCAAA 0 7793 7809 3-10-4 624 599041
2558 2574 Exon 18 CTTATAGAAAACCCAAA 0 7793 7809 5-7-5 624 598979
2559 2575 Exon 18 CCTTATAGAAAACCCAA 8 7794 7810 3-10-4 625 599042
2559 2575 Exon 18 CCTTATAGAAAACCCAA 19 7794 7810 5-7-5 625 598980
2560 2576 Exon 18 CCCTTATAGAAAACCCA 42 7795 7811 3-10-4 626 599043
2560 2576 Exon 18 CCCTTATAGAAAACCCA 10 7795 7811 5-7-5 626 598981
2561 2577 Exon 18 CCCCTTATAGAAAACCC 20 7796 7812 3-10-4 627 599044
2561 2577 Exon 18 CCCCTTATAGAAAACCC 12 7796 7812 5-7-5 627 598982
2562 2578 Exon 18 ACCCCTTATAGAAAACC 10 7797 7813 3-10-4 628 599045
2562 2578 Exon 18 ACCCCTTATAGAAAACC 3 7797 7813 5-7-5 628 598983
2563 2579 Exon 18 AACCCCTTATAGAAAAC 0 7798 7814 3-10-4 629 599046
2563 2579 Exon 18 AACCCCTTATAGAAAAC 18 7798 7814 5-7-5 629 598984
2564 2580 Exon 18 AAACCCCTTATAGAAAA 0 7799 7815 3-10-4 630 599047
2564 2580 Exon 18 AAACCCCTTATAGAAAA 7 7799 7815 5-7-5 630 598985
2565 2581 Exon 18 GAAACCCCTTATAGAAA 0 7800 7816 3-10-4 631 599048
2565 2581 Exon 18 GAAACCCCTTATAGAAA 9 7800 7816 5-7-5 631 598986
2566 2582 Exon 18 GGAAACCCCTTATAGAA 0 7801 7817 3-10-4 632 599049
2566 2582 Exon 18 GGAAACCCCTTATAGAA 18 7801 7817 5-7-5 632 598988
2567 2583 Exon 18 AGGAAACCCCTTATAGA 0 7802 7818 3-10-4 633 599050
2567 2583 Exon 18 AGGAAACCCCTTATAGA 8 7802 7818 5-7-5 633 598989
2568 2584 Exon 18 CAGGAAACCCCTTATAG 0 7803 7819 3-10-4 634 598990
2569 2585 Exon 18 GCAGGAAACCCCTTATA 8 7804 7820 3-10-4 635 598991
2570 2586 Exon 18 AGCAGGAAACCCCTTAT 25 7805 7821 3-10-4 636 598992
2571 2587 Exon 18 CAGCAGGAAACCCCTTA 12 7806 7822 3-10-4 637 598993
2572 2588 Exon 18 CCAGCAGGAAACCCCTT 37 7807 7823 3-10-4 638 598994
2573 2589 Exon 18 TCCAGCAGGAAACCCCT 29 7808 7824 3-10-4 639 598995
2574 2590 Exon 18 GTCCAGCAGGAAACCCC 42 7809 7825 3-10-4 640 598996
2575 2591 Exon 18 TGTCCAGCAGGAAACCC 36 7810 7826 3-10-4 641 598997
2576 2592 Exon 18 CTGTCCAGCAGGAAACC 18 7811 7827 3-10-4 642 598998
2577 2593 Exon 18 CCTGTCCAGCAGGAAAC 27 7812 7828 3-10-4 643 598999
2578 2594 Exon 18 CCCTGTCCAGCAGGAAA 61 7813 7829 3-10-4 644 599000
2580 2596 Exon 18 GCCCCTGTCCAGCAGGA 71 7815 7831 3-10-4 645 599001
2581 2597 Exon 18 CGCCCCTGTCCAGCAGG 80 7816 7832 3-10-4 646 599002
2582 2598 Exon 18 ACGCCCCTGTCCAGCAG 68 7817 7833 3-10-4 647 599003
2583 2599 Exon 18 CACGCCCCTGTCCAGCA 71 7818 7834 3-10-4 648 599004
2584 2600 Exon 18 CCACGCCCCTGTCCAGC 76 7819 7835 3-10-4 649 599005
2585 2601 Exon 18 CCCACGCCCCTGTCCAG 70 7820 7836 3-10-4 650 599006
2586 2602 Exon 18 TCCCACGCCCCTGTCCA 65 7821 7837 3-10-4 651 599007
2587 2603 Exon 18 ATCCCACGCCCCTGTCC 60 7822 7838 3-10-4 652 599008
2588 2604 Exon 18 AATCCCACGCCCCTGTC 72 7823 7839 3-10-4 653 599009
2589 2605 Exon 18 CAATCCCACGCCCCTGT 79 7824 7840 3-10-4 654 599010
2590 2606 Exon 18 TCAATCCCACGCCCCTG 73 7825 7841 3-10-4 655 599011
2591 2607 Exon 18 TTCAATCCCACGCCCCT 79 7826 7842 3-10-4 656 599012
2592 2608 Exon 18 ATTCAATCCCACGCCCC 67 7827 7843 3-10-4 657 599013
2593 2609 Exon 18 AATTCAATCCCACGCCC 65 7828 7844 3-10-4 658 599014
2594 2610 Exon 18 TAATTCAATCCCACGCC 74 7829 7845 3-10-4 659 599015
2595 2611 Exon 18 TTAATTCAATCCCACGC 71 7830 7846 3-10-4 660 599016
2596 2612 Exon 18 TTTAATTCAATCCCACG 48 7831 7847 3-10-4 661 599017
2597 2613 Exon 18 TTTTAATTCAATCCCAC 34 7832 7848 3-10-4 662 599018
2598 2614 Exon 18 GTTTTAATTCAATCCCA 56 7833 7849 3-10-4 663 599019
2599 2615 Exon 18 TGTTTTAATTCAATCCC 60 7834 7850 3-10-4 664 599020
2600 2616 Exon 18 CTGTTTTAATTCAATCC 0 7835 7851 3-10-4 665 599021
2601 2617 Exon 18 GCTGTTTTAATTCAATC 33 7836 7852 3-10-4 666 599022
2602 2618 Exon 18 AGCTGTTTTAATTCAAT 17 7837 7853 3-10-4 667 599023
2603 2619 Exon 18 CAGCTGTTTTAATTCAA 52 7838 7854 3-10-4 668 532917
2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 86 7839 7858 5-10-5 317
599024 2604 2620 Exon 18 GCAGCTGTTTTAATTCA 88 7839 7855 3-10-4 669
599025 2605 2621 Exon 18 CGCAGCTGTTTTAATTC 85 7840 7856 3-10-4 670
599026 2606 2622 Exon 18 TCGCAGCTGTTTTAATT 69 7841 7857 3-10-4 671
599027 2607 2623 Exon 18 GTCGCAGCTGTTTTAAT 77 7842 7858 3-10-4 672
599028 2608 2624 Exon 18 TGTCGCAGCTGTTTTAA 73 7843 7859 3-10-4 673
599029 2609 2625 Exon 18 TTGTCGCAGCTGTTTTA 78 7844 7860 3-10-4 674
599030 2610 2626 Exon 18 GTTGTCGCAGCTGTTTT 75 7845 7861 3-10-4 675
599031 2611 2627 Exon 18 TGTTGTCGCAGCTGTTT 77 7846 7862 3-10-4 676
599032 2612 2628 Exon 18 / TTGTTGTCGCAGCTGTT 79 n/a n/a 3-10-4 677
Repeat 599033 2613 2629 Exon 18 / TTTGTTGTCGCAGCTGT 80 n/a n/a
3-10-4 678 Repeat 599034 2614 2630 Exon 18 / TTTTGTTGTCGCAGCTG 78
n/a n/a 3-10-4 679 Repeat 599035 2615 2631 Exon 18 /
TTTTTGTTGTCGCAGCT 63 n/a n/a 3-10-4 680 Repeat
TABLE-US-00013 TABLE 12 Inhibition of CFB mRNA by MOE gapmers
targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ SEQ SEQ ID ID ID ID
NO: NO: NO: NO: 1 1 2 2 SEQ ISIS start stop Target % start stop ID
NO site site region Sequence inhibition site site Motif NO: 599098
2552 2568 Exon 18 GAAAACCCAAATCCTCA 57 7787 7803 4-8-5 619 599099
2553 2569 Exon 18 AGAAAACCCAAATCCTC 33 7788 7804 4-8-5 620 599100
2554 2570 Exon 18 TAGAAAACCCAAATCCT 32 7789 7805 4-8-5 621 599101
2555 2571 Exon 18 ATAGAAAACCCAAATCC 47 7790 7806 4-8-5 622 599102
2557 2573 Exon 18 TTATAGAAAACCCAAAT 59 7792 7808 4-8-5 623 599103
2558 2574 Exon 18 CTTATAGAAAACCCAAA 10 7793 7809 4-8-5 624 599104
2559 2575 Exon 18 CCTTATAGAAAACCCAA 3 7794 7810 4-8-5 625 599105
2560 2576 Exon 18 CCCTTATAGAAAACCCA 45 7795 7811 4-8-5 626 599106
2561 2577 Exon 18 CCCCTTATAGAAAACCC 49 7796 7812 4-8-5 627 599107
2562 2578 Exon 18 ACCCCTTATAGAAAACC 35 7797 7813 4-8-5 628 599108
2563 2579 Exon 18 AACCCCTTATAGAAAAC 17 7798 7814 4-8-5 629 599109
2564 2580 Exon 18 AAACCCCTTATAGAAAA 36 7799 7815 4-8-5 630 599110
2565 2581 Exon 18 GAAACCCCTTATAGAAA 20 7800 7816 4-8-5 631 599111
2566 2582 Exon 18 GGAAACCCCTTATAGAA 20 7801 7817 4-8-5 632 599112
2567 2583 Exon 18 AGGAAACCCCTTATAGA 15 7802 7818 4-8-5 633 599113
2568 2584 Exon 18 CAGGAAACCCCTTATAG 19 7803 7819 4-8-5 634 599051
2568 2584 Exon 18 CAGGAAACCCCTTATAG 26 7803 7819 5-7-5 634 599114
2569 2585 Exon 18 GCAGGAAACCCCTTATA 18 7804 7820 4-8-5 635 599052
2569 2585 Exon 18 GCAGGAAACCCCTTATA 21 7804 7820 5-7-5 635 599115
2570 2586 Exon 18 AGCAGGAAACCCCTTAT 31 7805 7821 4-8-5 636 599053
2570 2586 Exon 18 AGCAGGAAACCCCTTAT 25 7805 7821 5-7-5 636 599116
2571 2587 Exon 18 CAGCAGGAAACCCCTTA 39 7806 7822 4-8-5 637 599054
2571 2587 Exon 18 CAGCAGGAAACCCCTTA 36 7806 7822 5-7-5 637 599117
2572 2588 Exon 18 CCAGCAGGAAACCCCTT 46 7807 7823 4-8-5 638 599055
2572 2588 Exon 18 CCAGCAGGAAACCCCTT 22 7807 7823 5-7-5 638 599118
2573 2589 Exon 18 TCCAGCAGGAAACCCCT 40 7808 7824 4-8-5 639 599056
2573 2589 Exon 18 TCCAGCAGGAAACCCCT 32 7808 7824 5-7-5 639 599119
2574 2590 Exon 18 GTCCAGCAGGAAACCCC 50 7809 7825 4-8-5 640 599057
2574 2590 Exon 18 GTCCAGCAGGAAACCCC 46 7809 7825 5-7-5 640 599120
2575 2591 Exon 18 TGTCCAGCAGGAAACCC 30 7810 7826 4-8-5 641 599058
2575 2591 Exon 18 TGTCCAGCAGGAAACCC 52 7810 7826 5-7-5 641 599121
2576 2592 Exon 18 CTGTCCAGCAGGAAACC 31 7811 7827 4-8-5 642 599059
2576 2592 Exon 18 CTGTCCAGCAGGAAACC 24 7811 7827 5-7-5 642 599122
2577 2593 Exon 18 CCTGTCCAGCAGGAAAC 23 7812 7828 4-8-5 643 599060
2577 2593 Exon 18 CCTGTCCAGCAGGAAAC 37 7812 7828 5-7-5 643 599123
2578 2594 Exon 18 CCCTGTCCAGCAGGAAA 51 7813 7829 4-8-5 644 599061
2578 2594 Exon 18 CCCTGTCCAGCAGGAAA 34 7813 7829 5-7-5 644 599124
2580 2596 Exon 18 GCCCCTGTCCAGCAGGA 56 7815 7831 4-8-5 645 599062
2580 2596 Exon 18 GCCCCTGTCCAGCAGGA 51 7815 7831 5-7-5 645 599125
2581 2597 Exon 18 CGCCCCTGTCCAGCAGG 70 7816 7832 4-8-5 646 599063
2581 2597 Exon 18 CGCCCCTGTCCAGCAGG 56 7816 7832 5-7-5 646 599126
2582 2598 Exon 18 ACGCCCCTGTCCAGCAG 76 7817 7833 4-8-5 647 599064
2582 2598 Exon 18 ACGCCCCTGTCCAGCAG 61 7817 7833 5-7-5 647 599127
2583 2599 Exon 18 CACGCCCCTGTCCAGCA 67 7818 7834 4-8-5 648 599065
2583 2599 Exon 18 CACGCCCCTGTCCAGCA 64 7818 7834 5-7-5 648 599066
2584 2600 Exon 18 CCACGCCCCTGTCCAGC 40 7819 7835 5-7-5 649 599067
2585 2601 Exon 18 CCCACGCCCCTGTCCAG 37 7820 7836 5-7-5 650 599068
2586 2602 Exon 18 TCCCACGCCCCTGTCCA 31 7821 7837 5-7-5 651 599069
2587 2603 Exon 18 ATCCCACGCCCCTGTCC 39 7822 7838 5-7-5 652 599070
2588 2604 Exon 18 AATCCCACGCCCCTGTC 59 7823 7839 5-7-5 653 599071
2589 2605 Exon 18 CAATCCCACGCCCCTGT 63 7824 7840 5-7-5 657 599072
2590 2606 Exon 18 TCAATCCCACGCCCCTG 74 7825 7841 5-7-5 655 599073
2591 2607 Exon 18 TTCAATCCCACGCCCCT 53 7826 7842 5-7-5 656 599074
2592 2608 Exon 18 ATTCAATCCCACGCCCC 56 7827 7843 5-7-5 657 599075
2593 2609 Exon 18 AATTCAATCCCACGCCC 49 7828 7844 5-7-5 658 599076
2594 2610 Exon 18 TAATTCAATCCCACGCC 54 7829 7845 5-7-5 659 599077
2595 2611 Exon 18 TTAATTCAATCCCACGC 79 7830 7846 5-7-5 660 599078
2596 2612 Exon 18 TTTAATTCAATCCCACG 67 7831 7847 5-7-5 661 599079
2597 2613 Exon 18 TTTTAATTCAATCCCAC 69 7832 7848 5-7-5 662 599080
2598 2614 Exon 18 GTTTTAATTCAATCCCA 79 7833 7849 5-7-5 663 599081
2599 2615 Exon 18 TGTTTTAATTCAATCCC 57 7834 7850 5-7-5 664 599082
2600 2616 Exon 18 CTGTTTTAATTCAATCC 50 7835 7851 5-7-5 665 599083
2601 2617 Exon 18 GCTGTTTTAATTCAATC 67 7836 7852 5-7-5 666 599084
2602 2618 Exon 18 AGCTGTTTTAATTCAAT 60 7837 7853 5-7-5 667 599085
2603 2619 Exon 18 CAGCTGTTTTAATTCAA 71 7838 7854 5-7-5 668 532917
2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 82 7839 7858 5-10-5 317
599086 2604 2620 Exon 18 GCAGCTGTTTTAATTCA 81 7839 7855 5-7-5 669
599087 2605 2621 Exon 18 CGCAGCTGTTTTAATTC 88 7840 7856 5-7-5 670
599088 2606 2622 Exon 18 TCGCAGCTGTTTTAATT 84 7841 7857 5-7-5 671
599089 2607 2623 Exon 18 GTCGCAGCTGTTTTAAT 81 7842 7858 5-7-5 672
599090 2608 2624 Exon 18 TGTCGCAGCTGTTTTAA 77 7843 7859 5-7-5 673
599091 2609 2625 Exon 18 TTGTCGCAGCTGTTTTA 74 7844 7860 5-7-5 674
599092 2610 2626 Exon 18 GTTGTCGCAGCTGTTTT 66 7845 7861 5-7-5 675
599093 2611 2627 Exon 18 TGTTGTCGCAGCTGTTT 89 7846 7862 5-7-5 676
599094 2612 2628 Exon 18 / TTGTTGTCGCAGCTGTT 82 n/a n/a 5-7-5 677
Repeat 599095 2613 2629 Exon 18 / TTTGTTGTCGCAGCTGT 87 n/a n/a
5-7-5 678 Repeat 599096 2614 2630 Exon 18 / TTTTGTTGTCGCAGCTG 85
n/a n/a 5-7-5 679 Repeat 599097 2615 2631 Exon 18 /
TTTTTGTTGTCGCAGCT 78 n/a n/a 5-7-5 680 Repeat
TABLE-US-00014 TABLE 13 Inhibition of CFB mRNA by MOE gapmers
targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ SEQ SEQ ID ID ID ID
NO: 1 NO: 1 NO: 2 NO: 2 SEQ ISIS start stop Target % start stop ID
NO site site region Sequence inhibition site site Motif NO: 599510
2552 2570 Exon 18 TAGAAAACCCAAATCCTCA 45 7787 7805 5-9-5 681 599331
2553 2571 Exon 18 ATAGAAAACCCAAATCCTC 46 7788 7806 5-9-5 682 599332
2554 2572 Exon 18 TATAGAAAACCCAAATCCT 38 7789 7807 5-9-5 683 599333
2556 2574 Exon 18 CTTATAGAAAACCCAAATC 1 7791 7809 5-9-5 684 599334
2557 2575 Exon 18 CCTTATAGAAAACCCAAAT 5 7792 7810 5-9-5 685 599335
2558 2576 Exon 18 CCCTTATAGAAAACCCAAA 34 7793 7811 5-9-5 686 599336
2559 2577 Exon 18 CCCCTTATAGAAAACCCAA 40 7794 7812 5-9-5 687 599337
2560 2578 Exon 18 ACCCCTTATAGAAAACCCA 39 7795 7813 5-9-5 688 599338
2561 2579 Exon 18 AACCCCTTATAGAAAACCC 57 7796 7814 5-9-5 689 599339
2562 2580 Exon 18 AAACCCCTTATAGAAAACC 26 7797 7815 5-9-5 690 599281
2562 2580 Exon 18 AAACCCCTTATAGAAAACC 15 7797 7815 6-7-6 690 599340
2563 2581 Exon 18 GAAACCCCTTATAGAAAAC 17 7798 7816 5-9-5 691 599282
2563 2581 Exon 18 GAAACCCCTTATAGAAAAC 12 7798 7816 6-7-6 691 599341
2564 2582 Exon 18 GGAAACCCCTTATAGAAAA 23 7799 7817 5-9-5 692 599283
2564 2582 Exon 18 GGAAACCCCTTATAGAAAA 18 7799 7817 6-7-6 692 599342
2565 2583 Exon 18 AGGAAACCCCTTATAGAAA 10 7800 7818 5-9-5 693 599284
2565 2583 Exon 18 AGGAAACCCCTTATAGAAA 14 7800 7818 6-7-6 693 599343
2566 2584 Exon 18 CAGGAAACCCCTTATAGAA 10 7801 7819 5-9-5 694 599285
2566 2584 Exon 18 CAGGAAACCCCTTATAGAA 13 7801 7819 6-7-6 694 599344
2567 2585 Exon 18 GCAGGAAACCCCTTATAGA 22 7802 7820 5-9-5 695 599286
2567 2585 Exon 18 GCAGGAAACCCCTTATAGA 31 7802 7820 6-7-6 695 599345
2568 2586 Exon 18 AGCAGGAAACCCCTTATAG 19 7803 7821 5-9-5 696 599287
2568 2586 Exon 18 AGCAGGAAACCCCTTATAG 12 7803 7821 6-7-6 696 599346
2569 2587 Exon 18 CAGCAGGAAACCCCTTATA 30 7804 7822 5-9-5 697 599288
2569 2587 Exon 18 CAGCAGGAAACCCCTTATA 28 7804 7822 6-7-6 697 599347
2570 2588 Exon 18 CCAGCAGGAAACCCCTTAT 46 7805 7823 5-9-5 698 599289
2570 2588 Exon 18 CCAGCAGGAAACCCCTTAT 32 7805 7823 6-7-6 698 599348
2571 2589 Exon 18 TCCAGCAGGAAACCCCTTA 44 7806 7824 5-9-5 699 599290
2571 2589 Exon 18 TCCAGCAGGAAACCCCTTA 24 7806 7824 6-7-6 699 599349
2572 2590 Exon 18 GTCCAGCAGGAAACCCCTT 60 7807 7825 5-9-5 700 599291
2572 2590 Exon 18 GTCCAGCAGGAAACCCCTT 38 7807 7825 6-7-6 700 599350
2573 2591 Exon 18 TGTCCAGCAGGAAACCCCT 49 7808 7826 5-9-5 701 599292
2573 2591 Exon 18 TGTCCAGCAGGAAACCCCT 35 7808 7826 6-7-6 701 599351
2575 2593 Exon 18 CCTGTCCAGCAGGAAACCC 46 7810 7828 5-9-5 702 599293
2575 2593 Exon 18 CCTGTCCAGCAGGAAACCC 12 7810 7828 6-7-6 702 599352
2576 2594 Exon 18 CCCTGTCCAGCAGGAAACC 49 7811 7829 5-9-5 703 599294
2576 2594 Exon 18 CCCTGTCCAGCAGGAAACC 38 7811 7829 6-7-6 703 599353
2577 2595 Exon 18 CCCCTGTCCAGCAGGAAAC 64 7812 7830 5-9-5 704 599295
2577 2595 Exon 18 CCCCTGTCCAGCAGGAAAC 33 7812 7830 6-7-6 704 599354
2578 2596 Exon 18 GCCCCTGTCCAGCAGGAAA 56 7813 7831 5-9-5 705 599296
2578 2596 Exon 18 GCCCCTGTCCAGCAGGAAA 13 7813 7831 6-7-6 705 599355
2580 2598 Exon 18 ACGCCCCTGTCCAGCAGGA 81 7815 7833 5-9-5 706 599297
2580 2598 Exon 18 ACGCCCCTGTCCAGCAGGA 57 7815 7833 6-7-6 706 599356
2581 2599 Exon 18 CACGCCCCTGTCCAGCAGG 64 7816 7834 5-9-5 707 599298
2581 2599 Exon 18 CACGCCCCTGTCCAGCAGG 39 7816 7834 6-7-6 707 599299
2582 2600 Exon 18 CCACGCCCCTGTCCAGCAG 55 7817 7835 6-7-6 708 599300
2583 2601 Exon 18 CCCACGCCCCTGTCCAGCA 45 7818 7836 6-7-6 709 599301
2584 2602 Exon 18 TCCCACGCCCCTGTCCAGC 39 7819 7837 6-7-6 710 599302
2585 2603 Exon 18 ATCCCACGCCCCTGTCCAG 27 7820 7838 6-7-6 711 599303
2586 2604 Exon 18 AATCCCACGCCCCTGTCCA 35 7821 7839 6-7-6 712 599304
2587 2605 Exon 18 CAATCCCACGCCCCTGTCC 16 7822 7840 6-7-6 713 599305
2588 2606 Exon 18 TCAATCCCACGCCCCTGTC 41 7823 7841 6-7-6 714 599306
2589 2607 Exon 18 TTCAATCCCACGCCCCTGT 70 7824 7842 6-7-6 715 599307
2590 2608 Exon 18 ATTCAATCCCACGCCCCTG 66 7825 7843 6-7-6 716 599308
2591 2609 Exon 18 AATTCAATCCCACGCCCCT 68 7826 7844 6-7-6 717 599309
2592 2610 Exon 18 TAATTCAATCCCACGCCCC 52 7827 7845 6-7-6 718 599310
2593 2611 Exon 18 TTAATTCAATCCCACGCCC 39 7828 7846 6-7-6 719 599311
2594 2612 Exon 18 TTTAATTCAATCCCACGCC 83 7829 7847 6-7-6 720 599312
2595 2613 Exon 18 TTTTAATTCAATCCCACGC 72 7830 7848 6-7-6 721 599313
2596 2614 Exon 18 GTTTTAATTCAATCCCACG 86 7831 7849 6-7-6 722 599314
2597 2615 Exon 18 TGTTTTAATTCAATCCCAC 91 7832 7850 6-7-6 723 599315
2598 2616 Exon 18 CTGTTTTAATTCAATCCCA 71 7833 7851 6-7-6 724 599316
2599 2617 Exon 18 GCTGTTTTAATTCAATCCC 89 7834 7852 6-7-6 725 599317
2600 2618 Exon 18 AGCTGTTTTAATTCAATCC 87 7835 7853 6-7-6 726 599318
2601 2619 Exon 18 CAGCTGTTTTAATTCAATC 81 7836 7854 6-7-6 727 599319
2602 2620 Exon 18 GCAGCTGTTTTAATTCAAT 75 7837 7855 6-7-6 728 599320
2603 2621 Exon 18 CGCAGCTGTTTTAATTCAA 84 7838 7856 6-7-6 729 532917
2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 92 7839 7858 5-10-5 317
599321 2604 2622 Exon 18 TCGCAGCTGTTTTAATTCA 90 7839 7857 6-7-6 730
599322 2605 2623 Exon 18 GTCGCAGCTGTTTTAATTC 89 7840 7858 6-7-6 731
599323 2606 2624 Exon 18 TGTCGCAGCTGTTTTAATT 81 7841 7859 6-7-6 732
599324 2607 2625 Exon 18 TTGTCGCAGCTGTTTTAAT 68 7842 7860 6-7-6 733
599325 2608 2626 Exon 18 GTTGTCGCAGCTGTTTTAA 71 7843 7861 6-7-6 734
599326 2609 2627 Exon 18 TGTTGTCGCAGCTGTTTTA 52 7844 7862 6-7-6 735
599327 2610 2628 Exon 18 / TTGTTGTCGCAGCTGTTTT 88 n/a n/a 6-7-6 736
Repeat 599328 2611 2629 Exon 18 / TTTGTTGTCGCAGCTGTTT 87 n/a n/a
6-7-6 737 Repeat 599329 2612 2630 Exon 18 / TTTTGTTGTCGCAGCTGTT 84
n/a n/a 6-7-6 738 Repeat 599330 2613 2631 Exon 18 /
TTTTTGTTGTCGCAGCTGT 87 n/a n/a 6-7-6 739 Repeat
TABLE-US-00015 TABLE 14 Inhibition of CFB mRNA by MOE gapmers
targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ SEQ SEQ ID ID ID ID
NO: NO: NO: NO: 1 1 2 2 SEQ ISIS start stop Target % start stop ID
NO site site region Sequence inhibition site site Motif NO: 599512
2552 2571 Exon 18 ATAGAAAACCCAAATCCTCA 74 7787 7806 3-10-7 410
599449 2553 2572 Exon 18 TATAGAAAACCCAAATCCTC 43 7788 7807 3-10-7
411 599450 2554 2573 Exon 18 TTATAGAAAACCCAAATCCT 51 7789 7808
3-10-7 412 599451 2555 2574 Exon 18 CTTATAGAAAACCCAAATCC 35 7790
7809 3-10-7 413 599452 2556 2575 Exon 18 CCTTATAGAAAACCCAAATC 34
7791 7810 3-10-7 414 599453 2557 2576 Exon 18 CCCTTATAGAAAACCCAAAT
44 7792 7811 3-10-7 415 599454 2558 2577 Exon 18
CCCCTTATAGAAAACCCAAA 54 7793 7812 3-10-7 416 599455 2559 2578 Exon
18 ACCCCTTATAGAAAACCCAA 53 7794 7813 3-10-7 417 599456 2560 2579
Exon 18 AACCCCTTATAGAAAACCCA 69 7795 7814 3-10-7 418 599457 2561
2580 Exon 18 AAACCCCTTATAGAAAACCC 46 7796 7815 3-10-7 419 599458
2562 2581 Exon 18 GAAACCCCTTATAGAAAACC 0 7797 7816 3-10-7 420
599459 2563 2582 Exon 18 GGAAACCCCTTATAGAAAAC 12 7798 7817 3-10-7
421 599460 2564 2583 Exon 18 AGGAAACCCCTTATAGAAAA 17 7799 7818
3-10-7 422 599461 2565 2584 Exon 18 CAGGAAACCCCTTATAGAAA 24 7800
7819 3-10-7 423 599462 2566 2585 Exon 18 GCAGGAAACCCCTTATAGAA 33
7801 7820 3-10-7 424 599463 2567 2586 Exon 18 AGCAGGAAACCCCTTATAGA
38 7802 7821 3-10-7 425 599464 2568 2587 Exon 18
CAGCAGGAAACCCCTTATAG 33 7803 7822 3-10-7 426 599465 2569 2588 Exon
18 CCAGCAGGAAACCCCTTATA 49 7804 7823 3-10-7 427 599466 2570 2589
Exon 18 TCCAGCAGGAAACCCCTTAT 45 7805 7824 3-10-7 428 599467 2571
2590 Exon 18 GTCCAGCAGGAAACCCCTTA 60 7806 7825 3-10-7 237 599468
2572 2591 Exon 18 TGTCCAGCAGGAAACCCCTT 61 7807 7826 3-10-7 429
599469 2573 2592 Exon 18 CTGTCCAGCAGGAAACCCCT 52 7808 7827 3-10-7
430 599470 2574 2593 Exon 18 CCTGTCCAGCAGGAAACCCC 45 7809 7828
3-10-7 431 599471 2575 2594 Exon 18 CCCTGTCCAGCAGGAAACCC 67 7810
7829 3-10-7 432 599472 2576 2595 Exon 18 CCCCTGTCCAGCAGGAAACC 79
7811 7830 3-10-7 433 599473 2577 2596 Exon 18 GCCCCTGTCCAGCAGGAAAC
72 7812 7831 3-10-7 238 599474 2578 2597 Exon 18
CGCCCCTGTCCAGCAGGAAA 87 7813 7832 3-10-7 434 599475 2579 2598 Exon
18 ACGCCCCTGTCCAGCAGGAA 76 7814 7833 3-10-7 435 599476 2580 2599
Exon 18 CACGCCCCTGTCCAGCAGGA 81 7815 7834 3-10-7 436 599477 2581
2600 Exon 18 CCACGCCCCTGTCCAGCAGG 83 7816 7835 3-10-7 437 599478
2582 2601 Exon 18 CCCACGCCCCTGTCCAGCAG 72 7817 7836 3-10-7 438
599479 2583 2602 Exon 18 TCCCACGCCCCTGTCCAGCA 81 7818 7837 3-10-7
439 599480 2584 2603 Exon 18 ATCCCACGCCCCTGTCCAGC 77 7819 7838
3-10-7 440 599481 2585 2604 Exon 18 AATCCCACGCCCCTGTCCAG 83 7820
7839 3-10-7 441 599482 2586 2605 Exon 18 CAATCCCACGCCCCTGTCCA 87
7821 7840 3-10-7 442 599483 2587 2606 Exon 18 TCAATCCCACGCCCCTGTCC
90 7822 7841 3-10-7 443 599484 2588 2607 Exon 18
TTCAATCCCACGCCCCTGTC 72 7823 7842 3-10-7 444 599485 2589 2608 Exon
18 ATTCAATCCCACGCCCCTGT 82 7824 7843 3-10-7 445 599486 2590 2609
Exon 18 AATTCAATCCCACGCCCCTG 84 7825 7844 3-10-7 446 599487 2591
2610 Exon 18 TAATTCAATCCCACGCCCCT 84 7826 7845 3-10-7 447 599488
2592 2611 Exon 18 TTAATTCAATCCCACGCCCC 87 7827 7846 3-10-7 448
599489 2593 2612 Exon 18 TTTAATTCAATCCCACGCCC 87 7828 7847 3-10-7
449 599490 2594 2613 Exon 18 TTTTAATTCAATCCCACGCC 86 7829 7848
3-10-7 450 599491 2595 2614 Exon 18 GTTTTAATTCAATCCCACGC 87 7830
7849 3-10-7 451 599492 2596 2615 Exon 18 TGTTTTAATTCAATCCCACG 88
7831 7850 3-10-7 452 599493 2597 2616 Exon 18 CTGTTTTAATTCAATCCCAC
75 7832 7851 3-10-7 453 599433 2597 2616 Exon 18
CTGTTTTAATTCAATCCCAC 89 7832 7851 6-8-6 453 599494 2598 2617 Exon
18 GCTGTTTTAATTCAATCCCA 90 7833 7852 3-10-7 454 599434 2598 2617
Exon 18 GCTGTTTTAATTCAATCCCA 89 7833 7852 6-8-6 454 599495 2599
2618 Exon 18 AGCTGTTTTAATTCAATCCC 88 7834 7853 3-10-7 239 599435
2599 2618 Exon 18 AGCTGTTTTAATTCAATCCC 91 7834 7853 6-8-6 239
599496 2600 2619 Exon 18 CAGCTGTTTTAATTCAATCC 89 7835 7854 3-10-7
455 599436 2600 2619 Exon 18 CAGCTGTTTTAATTCAATCC 89 7835 7854
6-8-6 455 599497 2601 2620 Exon 18 GCAGCTGTTTTAATTCAATC 89 7836
7855 3-10-7 456 599437 2601 2620 Exon 18 GCAGCTGTTTTAATTCAATC 91
7836 7855 6-8-6 456 599498 2602 2621 Exon 18 CGCAGCTGTTTTAATTCAAT
88 7837 7856 3-10-7 457 599438 2602 2621 Exon 18
CGCAGCTGTTTTAATTCAAT 90 7837 7856 6-8-6 457 599499 2603 2622 Exon
18 TCGCAGCTGTTTTAATTCAA 81 7838 7857 3-10-7 458 599439 2603 2622
Exon 18 TCGCAGCTGTTTTAATTCAA 88 7838 7857 6-8-6 458 532917 2604
2623 Exon 18 GTCGCAGCTGTTTTAATTCA 90 7839 7858 5-10-5 317 599500
2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 88 7839 7858 3-10-7 317
599440 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 88 7839 7858 6-8-6
317 599501 2605 2624 Exon 18 TGTCGCAGCTGTTTTAATTC 78 7840 7859
3-10-7 459 599441 2605 2624 Exon 18 TGTCGCAGCTGTTTTAATTC 90 7840
7859 6-8-6 459 599502 2606 2625 Exon 18 TTGTCGCAGCTGTTTTAATT 87
7841 7860 3-10-7 460 599442 2606 2625 Exon 18 TTGTCGCAGCTGTTTTAATT
76 7841 7860 6-8-6 460 599503 2607 2626 Exon 18
GTTGTCGCAGCTGTTTTAAT 83 7842 7861 3-10-7 461 599443 2607 2626 Exon
18 GTTGTCGCAGCTGTTTTAAT 77 7842 7861 6-8-6 461 599504 2608 2627
Exon 18 TGTTGTCGCAGCTGTTTTAA 89 7843 7862 3-10-7 395 599444 2608
2627 Exon 18 TGTTGTCGCAGCTGTTTTAA 69 7843 7862 6-8-6 395 599505
2609 2628 Exon 19 / TTGTTGTCGCAGCTGTTTTA 83 n/a n/a 3-10-7 462
Repeat 599445 2609 2628 Exon 19 / TTGTTGTCGCAGCTGTTTTA 85 n/a n/a
6-8-6 462 Repeat 599506 2610 2629 Exon 19 / TTTGTTGTCGCAGCTGTTTT 89
n/a n/a 3-10-7 463 Repeat 599446 2610 2629 Exon 19 /
TTTGTTGTCGCAGCTGTTTT 85 n/a n/a 6-8-6 463 Repeat 599507 2611 2630
Exon 19 / TTTTGTTGTCGCAGCTGTTT 82 n/a n/a 3-10-7 464 Repeat 599447
2611 2630 Exon 19 / TTTTGTTGTCGCAGCTGTTT 83 n/a n/a 6-8-6 464
Repeat 599508 2612 2631 Exon 19 / TTTTTGTTGTCGCAGCTGTT 90 n/a n/a
3-10-7 465 Repeat 599448 2612 2631 Exon 19 / TTTTTGTTGTCGCAGCTGTT
87 n/a n/a 6-8-6 465 Repeat
Example 5: Antisense Inhibition of Human Complement Factor B (CFB)
in HepG2 Cells by MOE Gapmers
[0437] Additional antisense oligonucleotides were designed
targeting human Complement Factor B (CFB) nucleic acid and were
tested for their effects on CFB mRNA in vitro. The antisense
oligonucleotides were tested in a series of experiments that had
similar culture conditions. The results for each experiment are
presented in separate tables shown below. Cultured HepG2 cells at a
density of 20,000 cells per well were transfected using
electroporation with 2,000 nM antisense oligonucleotide. After a
treatment period of approximately 24 hours, RNA was isolated from
the cells and CFB mRNA levels were measured by quantitative
real-time PCR. Human primer probe set RTS3459 was used to measure
mRNA levels. CFB mRNA levels were adjusted according to total RNA
content, as measured by RIBOGREEN.RTM.. Results are presented as
percent inhibition of CFB, relative to untreated control cells.
[0438] The newly designed chimeric antisense oligonucleotides in
the Tables below were designed as 4-8-5 MOE, 5-8-5 MOE, 5-9-5 MOE,
5-10-5 MOE, 6-7-6-MOE, 3-10-5 MOE, or 6-8-6 MOE gapmers.
[0439] The 4-8-5 MOE gapmers are 17 nucleosides in length, wherein
the central gap segment comprises of eight 2'-deoxynucleosides and
is flanked by wing segments on the 5' direction and the 3'
direction comprising four and five nucleosides respectively. The
5-8-5 MOE gapmers are 18 nucleosides in length, wherein the central
gap segment comprises of eight 2'-deoxynucleosides and is flanked
by wing segments on the 5' direction and the 3' direction
comprising five nucleosides each. The 5-9-5 MOE gapmers are 19
nucleosides in length, wherein the central gap segment comprises of
nine 2'-deoxynucleosides and is flanked by wing segments on the 5'
direction and the 3' direction comprising five nucleosides each.
The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the
central gap segment comprises often 2'-deoxynucleosides and is
flanked by wing segments on the 5' direction and the 3' direction
comprising five nucleosides each. The 3-10-5 MOE gapmers are 18
nucleosides in length, wherein the central gap segment comprises
often 2'-deoxynucleosides and is flanked by wing segments on the 5'
direction and the 3' direction comprising three and five
nucleosides respectively. The 6-7-6 MOE gapmers are 19 nucleosides
in length, wherein the central gap segment comprises of seven
2'-deoxynucleosides and is flanked by wing segments on the 5'
direction and the 3' direction comprising six nucleosides each. The
6-8-6 MOE gapmers are 20 nucleosides in length, wherein the central
gap segment comprises of eight 2'-deoxynucleosides and is flanked
by wing segments on the 5' direction and the 3' direction
comprising six nucleosides each. Each nucleoside in the 5' wing
segment and each nucleoside in the 3' wing segment has a 2'-MOE
modification. The internucleoside linkages throughout each gapmer
are phosphorothioate (P.dbd.S) linkages. All cytosine residues
throughout each gapmer are 5-methylcytosines.
[0440] "Start site" indicates the 5'-most nucleoside to which the
gapmer is targeted in the human gene sequence. "Stop site"
indicates the 3'-most nucleoside to which the gapmer is targeted
human gene sequence. Each gapmer listed in the Tables below is
targeted to either the human CFB mRNA, designated herein as SEQ ID
NO: 1 (GENBANK Accession No. NM_001710.5) or the human CFB genomic
sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No.
NT_007592.15 truncated from nucleotides 31852000 to 31861000), or
both. `n/a` indicates that the antisense oligonucleotide does not
target that particular gene sequence with 100% complementarity.
TABLE-US-00016 TABLE 15 Inhibition of CFB mRNA by MOE gapmers
targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ SEQ SEQ ID ID ID ID
NO: NO: NO: NO: 1 1 2 2 SEQ ISIS start stop Target % start stop ID
NO site site region Sequence inhibition site site Motif NO: 599160
2560 2577 Exon 18 CCCCTTATAGAAAACCCA 26 7795 7812 5-8-5 740 599161
2561 2578 Exon 18 ACCCCTTATAGAAAACCC 20 7796 7813 5-8-5 741 599162
2562 2579 Exon 18 AACCCCTTATAGAAAACC 12 7797 7814 5-8-5 742 599163
2563 2580 Exon 18 AAACCCCTTATAGAAAAC 11 7798 7815 5-8-5 743 599164
2564 2581 Exon 18 GAAACCCCTTATAGAAAA 11 7799 7816 5-8-5 744 599165
2566 2583 Exon 18 AGGAAACCCCTTATAGAA 0 7801 7818 5-8-5 745 599166
2567 2584 Exon 18 CAGGAAACCCCTTATAGA 12 7802 7819 5-8-5 746 599167
2568 2585 Exon 18 GCAGGAAACCCCTTATAG 14 7803 7820 5-8-5 747 599168
2569 2586 Exon 18 AGCAGGAAACCCCTTATA 16 7804 7821 5-8-5 748 599169
2570 2587 Exon 18 CAGCAGGAAACCCCTTAT 24 7805 7822 5-8-5 749 599170
2571 2588 Exon 18 CCAGCAGGAAACCCCTTA 37 7806 7823 5-8-5 750 599171
2572 2589 Exon 18 TCCAGCAGGAAACCCCTT 30 7807 7824 5-8-5 751 599172
2573 2590 Exon 18 GTCCAGCAGGAAACCCCT 43 7808 7825 5-8-5 752 599173
2574 2591 Exon 18 TGTCCAGCAGGAAACCCC 47 7809 7826 5-8-5 753 599174
2575 2592 Exon 18 CTGTCCAGCAGGAAACCC 27 7810 7827 5-8-5 754 599175
2576 2593 Exon 18 CCTGTCCAGCAGGAAACC 30 7811 7828 5-8-5 755 599176
2577 2594 Exon 18 CCCTGTCCAGCAGGAAAC 34 7812 7829 5-8-5 756 599177
2578 2595 Exon 18 CCCCTGTCCAGCAGGAAA 41 7813 7830 5-8-5 757 599178
2580 2597 Exon 18 CGCCCCTGTCCAGCAGGA 67 7815 7832 5-8-5 758 599179
2581 2598 Exon 18 ACGCCCCTGTCCAGCAGG 61 7816 7833 5-8-5 759 599180
2582 2599 Exon 18 CACGCCCCTGTCCAGCAG 62 7817 7834 5-8-5 760 599181
2583 2600 Exon 18 CCACGCCCCTGTCCAGCA 63 7818 7835 5-8-5 761 599128
2584 2600 Exon 18 CCACGCCCCTGTCCAGC 55 7819 7835 4-8-5 649 599182
2584 2601 Exon 18 CCCACGCCCCTGTCCAGC 58 7819 7836 5-8-5 762 599129
2585 2601 Exon 18 CCCACGCCCCTGTCCAG 41 7820 7836 4-8-5 650 599183
2585 2602 Exon 18 TCCCACGCCCCTGTCCAG 43 7820 7837 5-8-5 763 599130
2586 2602 Exon 18 TCCCACGCCCCTGTCCA 46 7821 7837 4-8-5 651 599184
2586 2603 Exon 18 ATCCCACGCCCCTGTCCA 32 7821 7838 5-8-5 764 599131
2587 2603 Exon 18 ATCCCACGCCCCTGTCC 30 7822 7838 4-8-5 652 599185
2587 2604 Exon 18 AATCCCACGCCCCTGTCC 35 7822 7839 5-8-5 765 599132
2588 2604 Exon 18 AATCCCACGCCCCTGTC 52 7823 7839 4-8-5 653 599186
2588 2605 Exon 18 CAATCCCACGCCCCTGTC 55 7823 7840 5-8-5 766 599133
2589 2605 Exon 18 CAATCCCACGCCCCTGT 66 7824 7840 4-8-5 654 599187
2589 2606 Exon 18 TCAATCCCACGCCCCTGT 72 7824 7841 5-8-5 767 599134
2590 2606 Exon 18 TCAATCCCACGCCCCTG 80 7825 7841 4-8-5 655 599188
2590 2607 Exon 18 TTCAATCCCACGCCCCTG 92 7825 7842 5-8-5 768 599135
2591 2607 Exon 18 TTCAATCCCACGCCCCT 61 7826 7842 4-8-5 656 599189
2591 2608 Exon 18 ATTCAATCCCACGCCCCT 52 7826 7843 5-8-5 769 599136
2592 2608 Exon 18 ATTCAATCCCACGCCCC 68 7827 7843 4-8-5 657 599190
2592 2609 Exon 18 AATTCAATCCCACGCCCC 62 7827 7844 5-8-5 770 599137
2593 2609 Exon 18 AATTCAATCCCACGCCC 51 7828 7844 4-8-5 658 599191
2593 2610 Exon 18 TAATTCAATCCCACGCCC 54 7828 7845 5-8-5 771 599138
2594 2610 Exon 18 TAATTCAATCCCACGCC 71 7829 7845 4-8-5 659 599192
2594 2611 Exon 18 TTAATTCAATCCCACGCC 66 7829 7846 5-8-5 772 599139
2595 2611 Exon 18 TTAATTCAATCCCACGC 80 7830 7846 4-8-5 660 599193
2595 2612 Exon 18 TTTAATTCAATCCCACGC 74 7830 7847 5-8-5 773 599140
2596 2612 Exon 18 TTTAATTCAATCCCACG 66 7831 7847 4-8-5 786 599194
2596 2613 Exon 18 TTTTAATTCAATCCCACG 66 7831 7848 5-8-5 774 599141
2597 2613 Exon 18 TTTTAATTCAATCCCAC 63 7832 7848 4-8-5 662 599195
2597 2614 Exon 18 GTTTTAATTCAATCCCAC 86 7832 7849 5-8-5 775 599142
2598 2614 Exon 18 GTTTTAATTCAATCCCA 69 7833 7849 4-8-5 663 599196
2598 2615 Exon 18 TGTTTTAATTCAATCCCA 82 7833 7850 5-8-5 776 599143
2599 2615 Exon 18 TGTTTTAATTCAATCCC 59 7834 7850 4-8-5 664 599197
2599 2616 Exon 18 CTGTTTTAATTCAATCCC 79 7834 7851 5-8-5 777 599144
2600 2616 Exon 18 CTGTTTTAATTCAATCC 52 7835 7851 4-8-5 665 599198
2600 2617 Exon 18 GCTGTTTTAATTCAATCC 86 7835 7852 5-8-5 778 599145
2601 2617 Exon 18 GCTGTTTTAATTCAATC 53 7836 7852 4-8-5 666 599199
2601 2618 Exon 18 AGCTGTTTTAATTCAATC 72 7836 7853 5-8-5 779 599146
2602 2618 Exon 18 AGCTGTTTTAATTCAAT 42 7837 7853 4-8-5 667 599200
2602 2619 Exon 18 CAGCTGTTTTAATTCAAT 76 7837 7854 5-8-5 780 599147
2603 2619 Exon 18 CAGCTGTTTTAATTCAA 55 7838 7854 4-8-5 668 599201
2603 2620 Exon 18 GCAGCTGTTTTAATTCAA 87 7838 7855 5-8-5 781 532917
2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 93 7839 7858 5-10-5 317
599148 2604 2620 Exon 18 GCAGCTGTTTTAATTCA 84 7839 7855 4-8-5 669
599202 2604 2621 Exon 18 CGCAGCTGTTTTAATTCA 89 7839 7856 5-8-5 782
599149 2605 2621 Exon 18 CGCAGCTGTTTTAATTC 92 7840 7856 4-8-5 670
599203 2605 2622 Exon 18 TCGCAGCTGTTTTAATTC 90 7840 7857 5-8-5 783
599150 2606 2622 Exon 18 TCGCAGCTGTTTTAATT 75 7841 7857 4-8-5 671
599151 2607 2623 Exon 18 GTCGCAGCTGTTTTAAT 80 7842 7858 4-8-5 672
599152 2608 2624 Exon 18 TGTCGCAGCTGTTTTAA 76 7843 7859 4-8-5 673
599153 2609 2625 Exon 18 TTGTCGCAGCTGTTTTA 56 7844 7860 4-8-5 674
599154 2610 2626 Exon 18 GTTGTCGCAGCTGTTTT 85 7845 7861 4-8-5 675
599155 2611 2627 Exon 18 TGTTGTCGCAGCTGTTT 89 7846 7862 4-8-5 676
599156 2612 2628 Exon 18 / TTGTTGTCGCAGCTGTT 83 n/a n/a 4-8-5 813
Repeat 599157 2613 2629 Exon 18 / TTTGTTGTCGCAGCTGT 78 n/a n/a
4-8-5 678 Repeat 599158 2614 2630 Exon 18 / TTTTGTTGTCGCAGCTG 83
n/a n/a 4-8-5 679 Repeat 599159 2615 2631 Exon 18 /
TTTTTGTTGTCGCAGCT 65 n/a n/a 4-8-5 680 Repeat 599204 2606 2623 Exon
18 GTCGCAGCTGTTTTAATT 83 7841 7858 5-8-5 784
TABLE-US-00017 TABLE 16 Inhibition of CFB mRNA by MOE gapmers
targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ SEQ SEQ ID ID ID ID
NO: NO: NO: NO: 1 1 2 2 SEQ ISIS start stop Target % start stop ID
NO site site region Sequence inhibition site site Motif NO: 599509
2552 2570 Exon 18 TAGAAAACCCAAATCCTCA 45 7787 7805 6-7-6 681 599213
2553 2570 Exon 18 TAGAAAACCCAAATCCTC 89 7788 7805 3-10-5 785 599273
2553 2571 Exon 18 ATAGAAAACCCAAATCCTC 85 7788 7806 6-7-6 682 599214
2554 2571 Exon 18 ATAGAAAACCCAAATCCT 79 7789 7806 3-10-5 786 599274
2554 2572 Exon 18 TATAGAAAACCCAAATCCT 75 7789 7807 6-7-6 683 599215
2555 2572 Exon 18 TATAGAAAACCCAAATCC 81 7790 7807 3-10-5 787 599216
2556 2573 Exon 18 TTATAGAAAACCCAAATC 87 7791 7808 3-10-5 788 599275
2556 2574 Exon 18 CTTATAGAAAACCCAAATC 84 7791 7809 6-7-6 684 599217
2557 2574 Exon 18 CTTATAGAAAACCCAAAT 84 7792 7809 3-10-5 789 599276
2557 2575 Exon 18 CCTTATAGAAAACCCAAAT 68 7792 7810 6-7-6 685 599218
2558 2575 Exon 18 CCTTATAGAAAACCCAAA 82 7793 7810 3-10-5 790 599277
2558 2576 Exon 18 CCCTTATAGAAAACCCAAA 82 7793 7811 6-7-6 686 599219
2559 2576 Exon 18 CCCTTATAGAAAACCCAA 81 7794 7811 3-10-5 791 599278
2559 2577 Exon 18 CCCCTTATAGAAAACCCAA 84 7794 7812 6-7-6 687 599220
2560 2577 Exon 18 CCCCTTATAGAAAACCCA 92 7795 7812 3-10-5 740 599279
2560 2578 Exon 18 ACCCCTTATAGAAAACCCA 92 7795 7813 6-7-6 688 599221
2561 2578 Exon 18 ACCCCTTATAGAAAACCC 93 7796 7813 3-10-5 741 599280
2561 2579 Exon 18 AACCCCTTATAGAAAACCC 90 7796 7814 6-7-6 689 599222
2562 2579 Exon 18 AACCCCTTATAGAAAACC 95 7797 7814 3-10-5 742 599223
2563 2580 Exon 18 AAACCCCTTATAGAAAAC 93 7798 7815 3-10-5 743 599224
2564 2581 Exon 18 GAAACCCCTTATAGAAAA 90 7799 7816 3-10-5 744 599225
2566 2583 Exon 18 AGGAAACCCCTTATAGAA 93 7801 7818 3-10-5 745 599226
2567 2584 Exon 18 CAGGAAACCCCTTATAGA 95 7802 7819 3-10-5 746 599227
2568 2585 Exon 18 GCAGGAAACCCCTTATAG 94 7803 7820 3-10-5 747 599228
2569 2586 Exon 18 AGCAGGAAACCCCTTATA 96 7804 7821 3-10-5 748 599229
2570 2587 Exon 18 CAGCAGGAAACCCCTTAT 92 7805 7822 3-10-5 749 599230
2571 2588 Exon 18 CCAGCAGGAAACCCCTTA 88 7806 7823 3-10-5 750 599231
2572 2589 Exon 18 TCCAGCAGGAAACCCCTT 83 7807 7824 3-10-5 751 599232
2573 2590 Exon 18 GTCCAGCAGGAAACCCCT 89 7808 7825 3-10-5 752 599233
2574 2591 Exon 18 TGTCCAGCAGGAAACCCC 83 7809 7826 3-10-5 753 599234
2575 2592 Exon 18 CTGTCCAGCAGGAAACCC 88 7810 7827 3-10-5 754 599235
2576 2593 Exon 18 CCTGTCCAGCAGGAAACC 91 7811 7828 3-10-5 755 599236
2577 2594 Exon 18 CCCTGTCCAGCAGGAAAC 90 7812 7829 3-10-5 756 599237
2578 2595 Exon 18 CCCCTGTCCAGCAGGAAA 34 7813 7830 3-10-5 757 599238
2580 2597 Exon 18 CGCCCCTGTCCAGCAGGA 14 7815 7832 3-10-5 758 599239
2581 2598 Exon 18 ACGCCCCTGTCCAGCAGG 10 7816 7833 3-10-5 759 599240
2582 2599 Exon 18 CACGCCCCTGTCCAGCAG 26 7817 7834 3-10-5 760 599241
2583 2600 Exon 18 CCACGCCCCTGTCCAGCA 11 7818 7835 3-10-5 761 599242
2584 2601 Exon 18 CCCACGCCCCTGTCCAGC 24 7819 7836 3-10-5 762 599243
2585 2602 Exon 18 TCCCACGCCCCTGTCCAG 23 7820 7837 3-10-5 763 599244
2586 2603 Exon 18 ATCCCACGCCCCTGTCCA 29 7821 7838 3-10-5 764 599245
2587 2604 Exon 18 AATCCCACGCCCCTGTCC 11 7822 7839 3-10-5 765 599246
2588 2605 Exon 18 CAATCCCACGCCCCTGTC 0 7823 7840 3-10-5 766 599247
2589 2606 Exon 18 TCAATCCCACGCCCCTGT 21 7824 7841 3-10-5 767 599248
2590 2607 Exon 18 TTCAATCCCACGCCCCTG 0 7825 7842 3-10-5 768 599249
2591 2608 Exon 18 ATTCAATCCCACGCCCCT 9 7826 7843 3-10-5 769 599250
2592 2609 Exon 18 AATTCAATCCCACGCCCC 4 7827 7844 3-10-5 770 599251
2593 2610 Exon 18 TAATTCAATCCCACGCCC 12 7828 7845 3-10-5 771 599252
2594 2611 Exon 18 TTAATTCAATCCCACGCC 2 7829 7846 3-10-5 772 599253
2595 2612 Exon 18 TTTAATTCAATCCCACGC 28 7830 7847 3-10-5 773 599254
2596 2613 Exon 18 TTTTAATTCAATCCCACG 27 7831 7848 3-10-5 774 599255
2597 2614 Exon 18 GTTTTAATTCAATCCCAC 38 7832 7849 3-10-5 775 599256
2598 2615 Exon 18 TGTTTTAATTCAATCCCA 36 7833 7850 3-10-5 776 599257
2599 2616 Exon 18 CTGTTTTAATTCAATCCC 48 7834 7851 3-10-5 777 599258
2600 2617 Exon 18 GCTGTTTTAATTCAATCC 19 7835 7852 3-10-5 778 599259
2601 2618 Exon 18 AGCTGTTTTAATTCAATC 36 7836 7853 3-10-5 779 599260
2602 2619 Exon 18 CAGCTGTTTTAATTCAAT 58 7837 7854 3-10-5 780 599261
2603 2620 Exon 18 GCAGCTGTTTTAATTCAA 35 7838 7855 3-10-5 781 532917
2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 96 7839 7858 5-10-5 317
599262 2604 2621 Exon 18 CGCAGCTGTTTTAATTCA 52 7839 7856 3-10-5 782
599263 2605 2622 Exon 18 TCGCAGCTGTTTTAATTC 66 7840 7857 3-10-5 783
599264 2606 2623 Exon 18 GTCGCAGCTGTTTTAATT 48 7841 7858 3-10-5 784
599265 2607 2624 Exon 18 TGTCGCAGCTGTTTTAAT 46 7842 7859 3-10-5 792
599205 2607 2624 Exon 18 TGTCGCAGCTGTTTTAAT 83 7842 7859 5-8-5 792
599266 2608 2625 Exon 18 TTGTCGCAGCTGTTTTAA 76 7843 7860 3-10-5 793
599206 2608 2625 Exon 18 TTGTCGCAGCTGTTTTAA 90 7843 7860 5-8-5 793
599267 2609 2626 Exon 18 GTTGTCGCAGCTGTTTTA 53 7844 7861 3-10-5 794
599207 2609 2626 Exon 18 GTTGTCGCAGCTGTTTTA 82 7844 7861 5-8-5 794
599268 2610 2627 Exon 18 TGTTGTCGCAGCTGTTTT 58 7845 7862 3-10-5 795
599208 2610 2627 Exon 18 TGTTGTCGCAGCTGTTTT 70 7845 7862 5-8-5 795
599269 2611 2628 Exon 18 / TTGTTGTCGCAGCTGTTT 38 n/a n/a 3-10-5 796
Repeat 599209 2611 2628 Exon 18 / TTGTTGTCGCAGCTGTTT 50 n/a n/a
5-8-5 796 Repeat 599270 2612 2629 Exon 18 / TTTGTTGTCGCAGCTGTT 46
n/a n/a 3-10-5 797 Repeat 599210 2612 2629 Exon 18 /
TTTGTTGTCGCAGCTGTT 76 n/a n/a 5-8-5 797 Repeat 599271 2613 2630
Exon 18 / TTTTGTTGTCGCAGCTGT 64 n/a n/a 3-10-5 798 Repeat 599211
2613 2630 Exon 18 / TTTTGTTGTCGCAGCTGT 78 n/a n/a 5-8-5 798 Repeat
599272 2614 2631 Exon 18 / TTTTTGTTGTCGCAGCTG 89 n/a n/a 3-10-5 799
Repeat 599212 2614 2631 Exon 18 / TTTTTGTTGTCGCAGCTG 84 n/a n/a
5-8-5 799 Repeat
TABLE-US-00018 TABLE 17 Inhibition of CFB mRNA by MOE gapmers
targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ SEQ SEQ ID ID ID ID
NO: NO: NO: NO: 1 1 2 2 SEQ ISIS start stop Target % start stop ID
NO site site region Sequence inhibition site site Motif NO: 599511
2552 2571 Exon 18 ATAGAAAACCCAAATCCTCA 38 7787 7806 6-8-6 410
599389 2553 2572 Exon 18 TATAGAAAACCCAAATCCTC 80 7788 7807 6-8-6
411 599390 2554 2573 Exon 18 TTATAGAAAACCCAAATCCT 92 7789 7808
6-8-6 412 599391 2555 2574 Exon 18 CTTATAGAAAACCCAAATCC 90 7790
7809 6-8-6 413 599392 2556 2575 Exon 18 CCTTATAGAAAACCCAAATC 87
7791 7810 6-8-6 414 599393 2557 2576 Exon 18 CCCTTATAGAAAACCCAAAT
87 7792 7811 6-8-6 415 599394 2558 2577 Exon 18
CCCCTTATAGAAAACCCAAA 74 7793 7812 6-8-6 416 599395 2559 2578 Exon
18 ACCCCTTATAGAAAACCCAA 78 7794 7813 6-8-6 417 599396 2560 2579
Exon 18 AACCCCTTATAGAAAACCCA 77 7795 7814 6-8-6 418 599397 2561
2580 Exon 18 AAACCCCTTATAGAAAACCC 89 7796 7815 6-8-6 419 599398
2562 2581 Exon 18 GAAACCCCTTATAGAAAACC 90 7797 7816 6-8-6 420
599399 2563 2582 Exon 18 GGAAACCCCTTATAGAAAAC 91 7798 7817 6-8-6
421 599400 2564 2583 Exon 18 AGGAAACCCCTTATAGAAAA 88 7799 7818
6-8-6 422 599401 2565 2584 Exon 18 CAGGAAACCCCTTATAGAAA 85 7800
7819 6-8-6 423 599402 2566 2585 Exon 18 GCAGGAAACCCCTTATAGAA 77
7801 7820 6-8-6 424 599403 2567 2586 Exon 18 AGCAGGAAACCCCTTATAGA
85 7802 7821 6-8-6 425 599404 2568 2587 Exon 18
CAGCAGGAAACCCCTTATAG 90 7803 7822 6-8-6 426 599405 2569 2588 Exon
18 CCAGCAGGAAACCCCTTATA 89 7804 7823 6-8-6 427 599406 2570 2589
Exon 18 TCCAGCAGGAAACCCCTTAT 72 7805 7824 6-8-6 428 599407 2571
2590 Exon 18 GTCCAGCAGGAAACCCCTTA 87 7806 7825 6-8-6 237 599408
2572 2591 Exon 18 TGTCCAGCAGGAAACCCCTT 87 7807 7826 6-8-6 429
599409 2573 2592 Exon 18 CTGTCCAGCAGGAAACCCCT 83 7808 7827 6-8-6
430 599410 2574 2593 Exon 18 CCTGTCCAGCAGGAAACCCC 88 7809 7828
6-8-6 431 599411 2575 2594 Exon 18 CCCTGTCCAGCAGGAAACCC 45 7810
7829 6-8-6 432 599412 2576 2595 Exon 18 CCCCTGTCCAGCAGGAAACC 66
7811 7830 6-8-6 433 599413 2577 2596 Exon 18 GCCCCTGTCCAGCAGGAAAC
92 7812 7831 6-8-6 238 599414 2578 2597 Exon 18
CGCCCCTGTCCAGCAGGAAA 92 7813 7832 6-8-6 434 599415 2579 2598 Exon
18 ACGCCCCTGTCCAGCAGGAA 87 7814 7833 6-8-6 435 599416 2580 2599
Exon 18 CACGCCCCTGTCCAGCAGGA 91 7815 7834 6-8-6 436 599417 2581
2600 Exon 18 CCACGCCCCTGTCCAGCAGG 84 7816 7835 6-8-6 437 599357
2582 2600 Exon 18 CCACGCCCCTGTCCAGCAG 88 7817 7835 5-9-5 708 599418
2582 2601 Exon 18 CCCACGCCCCTGTCCAGCAG 85 7817 7836 6-8-6 438
599358 2583 2601 Exon 18 CCCACGCCCCTGTCCAGCA 86 7818 7836 5-9-5 709
599419 2583 2602 Exon 18 TCCCACGCCCCTGTCCAGCA 91 7818 7837 6-8-6
833 599359 2584 2602 Exon 18 TCCCACGCCCCTGTCCAGC 85 7819 7837 5-9-5
834 599420 2584 2603 Exon 18 ATCCCACGCCCCTGTCCAGC 91 7819 7838
6-8-6 440 599360 2585 2603 Exon 18 ATCCCACGCCCCTGTCCAG 89 7820 7838
5-9-5 711 599421 2585 2604 Exon 18 AATCCCACGCCCCTGTCCAG 87 7820
7839 6-8-6 441 599361 2586 2604 Exon 18 AATCCCACGCCCCTGTCCA 89 7821
7839 5-9-5 712 599422 2586 2605 Exon 18 CAATCCCACGCCCCTGTCCA 90
7821 7840 6-8-6 442 599362 2587 2605 Exon 18 CAATCCCACGCCCCTGTCC 94
7822 7840 5-9-5 713 599423 2587 2606 Exon 18 TCAATCCCACGCCCCTGTCC
85 7822 7841 6-8-6 841 599363 2588 2606 Exon 18 TCAATCCCACGCCCCTGTC
88 7823 7841 5-9-5 714 599424 2588 2607 Exon 18
TTCAATCCCACGCCCCTGTC 88 7823 7842 6-8-6 444 599364 2589 2607 Exon
18 TTCAATCCCACGCCCCTGT 88 7824 7842 5-9-5 715 599425 2589 2608 Exon
18 ATTCAATCCCACGCCCCTGT 68 7824 7843 6-8-6 445 599365 2590 2608
Exon 18 ATTCAATCCCACGCCCCTG 48 7825 7843 5-9-5 716 599426 2590 2609
Exon 18 AATTCAATCCCACGCCCCTG 55 7825 7844 6-8-6 446 599366 2591
2609 Exon 18 AATTCAATCCCACGCCCCT 28 7826 7844 5-9-5 717 599427 2591
2610 Exon 18 TAATTCAATCCCACGCCCCT 13 7826 7845 6-8-6 849 599367
2592 2610 Exon 18 TAATTCAATCCCACGCCCC 21 7827 7845 5-9-5 718 599428
2592 2611 Exon 18 TTAATTCAATCCCACGCCCC 39 7827 7846 6-8-6 448
599368 2593 2611 Exon 18 TTAATTCAATCCCACGCCC 20 7828 7846 5-9-5 719
599429 2593 2612 Exon 18 TTTAATTCAATCCCACGCCC 18 7828 7847 6-8-6
449 599369 2594 2612 Exon 18 TTTAATTCAATCCCACGCC 78 7829 7847 5-9-5
720 599430 2594 2613 Exon 18 TTTTAATTCAATCCCACGCC 24 7829 7848
6-8-6 450 599370 2595 2613 Exon 18 TTTTAATTCAATCCCACGC 25 7830 7848
5-9-5 721 599431 2595 2614 Exon 18 GTTTTAATTCAATCCCACGC 30 7830
7849 6-8-6 451 599371 2596 2614 Exon 18 GTTTTAATTCAATCCCACG 84 7831
7849 5-9-5 722 599432 2596 2615 Exon 18 TGTTTTAATTCAATCCCACG 29
7831 7850 6-8-6 452 599372 2597 2615 Exon 18 TGTTTTAATTCAATCCCAC 83
7832 7850 5-9-5 723 599373 2598 2616 Exon 18 CTGTTTTAATTCAATCCCA 81
7833 7851 5-9-5 724 599374 2599 2617 Exon 18 GCTGTTTTAATTCAATCCC 26
7834 7852 5-9-5 725 599375 2600 2618 Exon 18 AGCTGTTTTAATTCAATCC 26
7835 7853 5-9-5 726 599376 2601 2619 Exon 18 CAGCTGTTTTAATTCAATC 62
7836 7854 5-9-5 727 599377 2602 2620 Exon 18 GCAGCTGTTTTAATTCAAT 21
7837 7855 5-9-5 728 599378 2603 2621 Exon 18 CGCAGCTGTTTTAATTCAA 90
7838 7856 5-9-5 729 532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA
95 7839 7858 5-10-5 867 599379 2604 2622 Exon 18
TCGCAGCTGTTTTAATTCA 88 7839 7857 5-9-5 730 599380 2605 2623 Exon 18
GTCGCAGCTGTTTTAATTC 37 7840 7858 5-9-5 869 599381 2606 2624 Exon 18
TGTCGCAGCTGTTTTAATT 33 7841 7859 5-9-5 732 599382 2607 2625 Exon 18
TTGTCGCAGCTGTTTTAAT 81 7842 7860 5-9-5 733 599383 2608 2626 Exon 18
GTTGTCGCAGCTGTTTTAA 54 7843 7861 5-9-5 734 599384 2609 2627 Exon 18
TGTTGTCGCAGCTGTTTTA 85 7844 7862 5-9-5 873 599385 2610 2628 Exon 18
/ TTGTTGTCGCAGCTGTTTT 59 n/a n/a 5-9-5 736 Repeat 599386 2611 2629
Exon 18 / TTTGTTGTCGCAGCTGTTT 81 n/a n/a 5-9-5 737 Repeat 599387
2612 2630 Exon 18 / TTTTGTTGTCGCAGCTGTT 80 n/a n/a 5-9-5 738 Repeat
599388 2613 2631 Exon 18 / TTTTTGTTGTCGCAGCTGT 84 n/a n/a 5-9-5 739
Repeat
Example 6: Antisense Inhibition of Human Complement Factor B (CFB)
in HepG2 Cells
[0441] Additional antisense oligonucleotides were designed
targeting human Complement Factor B (CFB) nucleic acid and were
tested for their effects on CFB mRNA in vitro. Cultured HepG2 cells
at a density of 20,000 cells per well were transfected using
electroporation with 1,000 nM antisense oligonucleotide. After a
treatment period of approximately 24 hours, RNA was isolated from
the cells and CFB mRNA levels were measured by quantitative
real-time PCR. Human primer probe set RTS3459 was used to measure
mRNA levels. CFB mRNA levels were adjusted according to total RNA
content, as measured by RIBOGREEN.RTM.. Results are presented as
percent inhibition of CFB, relative to untreated control cells.
[0442] The newly designed chimeric antisense oligonucleotides in
the Tables below were designed as deoxy, MOE and cEt
oligonucleotides. The deoxy, MOE and cEt oligonucleotides are 16
nucleosides in length wherein the nucleoside have either a MOE
sugar modification, an cEt sugar modification, or a deoxy
modification. The `Chemistry` column describes the sugar
modifications of each oligonucleotide. `k` indicates an cEt sugar
modification; `d` indicates deoxyribose; and `e` indicates a MOE
modification.
[0443] "Start site" indicates the 5'-most nucleoside to which the
gapmer is targeted in the human gene sequence. "Stop site"
indicates the 3'-most nucleoside to which the gapmer is targeted
human gene sequence. Each gapmer listed in the Tables below is
targeted to either the human CFB mRNA, designated herein as SEQ ID
NO: 1 (GENBANK Accession No. NM_001710.5) or the human CFB genomic
sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No.
NT_007592.15 truncated from nucleotides 31852000 to 31861000), or
both. `n/a` indicates that the antisense oligonucleotide does not
target that particular gene sequence with 100% complementarity.
TABLE-US-00019 TABLE 18 Inhibition of CFB mRNA by deoxy, MOE and
cEt oligonucleotides targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ
SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ start stop Target %
start stop ID ISIS NO site site region Sequence inhibition site
site Motif NO: 599513 2551 2566 Exon 18 AAACCCAAATCCTCAT 11 7786
7801 ekkeekkdddddddkk 557 599514 2553 2568 Exon 18 GAAAACCCAAATCCTC
13 7788 7803 ekkeekkdddddddkk 801 599515 2555 2570 Exon 18
TAGAAAACCCAAATCC 54 7790 7805 ekkeekkdddddddkk 559 599516 2559 2574
Exon 18 CTTATAGAAAACCCAA 16 7794 7809 ekkeekkdddddddkk 561 599517
2560 2575 Exon 18 CCTTATAGAAAACCCA 29 7795 7810 ekkeekkdddddddkk
562 599518 2561 2576 Exon 18 CCCTTATAGAAAACCC 55 7796 7811
ekkeekkdddddddkk 563 599519 2562 2577 Exon 18 CCCCTTATAGAAAACC 31
7797 7812 ekkeekkdddddddkk 564 599520 2563 2578 Exon 18
ACCCCTTATAGAAAAC 14 7798 7813 ekkeekkdddddddkk 565 599521 2564 2579
Exon 18 AACCCCTTATAGAAAA 9 7799 7814 ekkeekkdddddddkk 566 599522
2565 2580 Exon 18 AAACCCCTTATAGAAA 8 7800 7815 ekkeekkdddddddkk 567
599523 2566 2581 Exon 18 GAAACCCCTTATAGAA 6 7801 7816
ekkeekkdddddddkk 568 599524 2567 2582 Exon 18 GGAAACCCCTTATAGA 14
7802 7817 ekkeekkdddddddkk 569 599525 2568 2583 Exon 18
AGGAAACCCCTTATAG 6 7803 7818 ekkeekkdddddddkk 570 599526 2569 2584
Exon 18 CAGGAAACCCCTTATA 16 7804 7819 ekkeekkdddddddkk 571 599527
2570 2585 Exon 18 GCAGGAAACCCCTTAT 0 7805 7820 ekkeekkdddddddkk 572
599528 2571 2586 Exon 18 AGCAGGAAACCCCTTA 6 7806 7821
ekkeekkdddddddkk 573 599529 2572 2587 Exon 18 CAGCAGGAAACCCCTT 6
7807 7822 ekkeekkdddddddkk 574 599530 2574 2589 Exon 18
TCCAGCAGGAAACCCC 29 7809 7824 ekkeekkdddddddkk 576 599531 2575 2590
Exon 18 GTCCAGCAGGAAACCC 64 7810 7825 ekkeekkdddddddkk 577 599532
2576 2591 Exon 18 TGTCCAGCAGGAAACC 43 7811 7826 ekkeekkdddddddkk
578 599533 2577 2592 Exon 18 CTGTCCAGCAGGAAAC 25 7812 7827
ekkeekkdddddddkk 820 599534 2578 2593 Exon 18 CCTGTCCAGCAGGAAA 12
7813 7828 ekkeekkdddddddkk 580 599535 2580 2595 Exon 18
CCCCTGTCCAGCAGGA 16 7815 7830 ekkeekkdddddddkk 582 599536 2582 2597
Exon 18 CGCCCCTGTCCAGCAG 27 7817 7832 ekkeekkdddddddkk 584 599537
2583 2598 Exon 18 ACGCCCCTGTCCAGCA 35 7818 7833 ekkeekkdddddddkk
585 599538 2584 2599 Exon 18 CACGCCCCTGTCCAGC 26 7819 7834
ekkeekkdddddddkk 586 599539 2585 2600 Exon 18 CCACGCCCCTGTCCAG 33
7820 7835 ekkeekkdddddddkk 587 599540 2586 2601 Exon 18
CCCACGCCCCTGTCCA 27 7821 7836 ekkeekkdddddddkk 588 599541 2587 2602
Exon 18 TCCCACGCCCCTGTCC 52 7822 7837 ekkeekkdddddddkk 589 599542
2588 2603 Exon 18 ATCCCACGCCCCTGTC 16 7823 7838 ekkeekkdddddddkk
590 599543 2589 2604 Exon 18 AATCCCACGCCCCTGT 19 7824 7839
ekkeekkdddddddkk 591 599544 2590 2605 Exon 18 CAATCCCACGCCCCTG 33
7825 7840 ekkeekkdddddddkk 831 599545 2591 2606 Exon 18
TCAATCCCACGCCCCT 24 7826 7841 ekkeekkdddddddkk 593 599546 2592 2607
Exon 18 TTCAATCCCACGCCCC 54 7827 7842 ekkeekkdddddddkk 594 599547
2593 2608 Exon 18 ATTCAATCCCACGCCC 87 7828 7843 ekkeekkdddddddkk
595 599548 2594 2609 Exon 18 AATTCAATCCCACGCC 79 7829 7844
ekkeekkdddddddkk 596 599549 2595 2610 Exon 18 TAATTCAATCCCACGC 62
7830 7845 ekkeekkdddddddkk 597 599550 2596 2611 Exon 18
TTAATTCAATCCCACG 52 7831 7846 ekkeekkdddddddkk 598 599551 2597 2612
Exon 18 TTTAATTCAATCCCAC 27 7832 7847 ekkeekkdddddddkk 599 599577
2597 2613 Exon 18 TTTTAATTCAATCCCAC 90 7832 7848 eeekkdddddddkkeee
662 599552 2598 2613 Exon 18 TTTTAATTCAATCCCA 92 7833 7848
ekkeekkdddddddkk 600 599578 2598 2614 Exon 18 GTTTTAATTCAATCCCA 88
7833 7849 eeekkdddddddkkeee 663 599553 2599 2614 Exon 18
GTTTTAATTCAATCCC 91 7834 7849 ekkeekkdddddddkk 601 599579 2599 2615
Exon 18 TGTTTTAATTCAATCCC 79 7834 7850 eeekkdddddddkkeee 664 599554
2600 2615 Exon 18 TGTTTTAATTCAATCC 90 7835 7850 ekkeekkdddddddkk
602 599580 2600 2616 Exon 18 CTGTTTTAATTCAATCC 79 7835 7851
eeekkdddddddkkeee 665 599555 2601 2616 Exon 18 CTGTTTTAATTCAATC 79
7836 7851 ekkeekkdddddddkk 846 599581 2601 2617 Exon 18
GCTGTTTTAATTCAATC 90 7836 7852 eeekkdddddddkkeee 666 599556 2602
2617 Exon 18 GCTGTTTTAATTCAAT 47 7837 7852 ekkeekkdddddddkk 604
599582 2602 2618 Exon 18 AGCTGTTTTAATTCAAT 89 7837 7853
eeekkdddddddkkeee 849 599557 2603 2618 Exon 18 AGCTGTTTTAATTCAA 67
7838 7853 ekkeekkdddddddkk 850 599583 2603 2619 Exon 18
CAGCTGTTTTAATTCAA 49 7838 7854 eeekkdddddddkkeee 668 532917 2604
2623 Exon 18 GTCGCAGCTGTTTTAATTCA 78 7839 7858 eeeeeddddddddddeee
317 ee 599558 2604 2619 Exon 18 CAGCTGTTTTAATTCA 80 7839 7854
ekkeekkdddddddkk 606 599584 2604 2620 Exon 18 GCAGCTGTTTTAATTCA 66
7839 7855 eeekkdddddddkkeee 669 599559 2605 2620 Exon 18
GCAGCTGTTTTAATTC 38 7840 7855 ekkeekkdddddddkk 607 599585 2605 2621
Exon 18 CGCAGCTGTTTTAATTC 80 7840 7856 eeekkdddddddkkeee 670 599560
2606 2621 Exon 18 CGCAGCTGTTTTAATT 16 7841 7856 ekkeekkdddddddkk
608 599586 2606 2622 Exon 18 TCGCAGCTGTTTTAATT 78 7841 7857
eeekkdddddddkkeee 671 599561 2607 2622 Exon 18 TCGCAGCTGTTTTAAT 58
7842 7857 ekkeekkdddddddkk 609 599587 2607 2623 Exon 18
GTCGCAGCTGTTTTAAT 81 7842 7858 eeekkdddddddkkeee 672 588860 2608
2623 Exon 18 GTCGCAGCTGTTTTAA 92 7843 7858 eekddddddddddkke 610
599562 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 78 7843 7858
ekkeekkdddddddkk 610 599588 2608 2624 Exon 18 TGTCGCAGCTGTTTTAA 81
7843 7859 eeekkdddddddkkeee 673 599563 2609 2624 Exon 18
TGTCGCAGCTGTTTTA 86 7844 7859 ekkeekkdddddddkk 611 599589 2609 2625
Exon 18 TTGTCGCAGCTGTTTTA 75 7844 7860 eeekkdddddddkkeee 674 599564
2610 2625 Exon 18 TTGTCGCAGCTGTTTT 75 7845 7860 ekkeekkdddddddkk
612 599590 2610 2626 Exon 18 GTTGTCGCAGCTGTTTT 88 7845 7861
eeekkdddddddkkeee 675 599565 2611 2626 Exon 18 GTTGTCGCAGCTGTTT 65
7846 7861 ekkeekkdddddddkk 613 599591 2611 2627 Exon 18
TGTTGTCGCAGCTGTTT 94 7846 7862 eeekkdddddddkkeee 676 599566 2612
2627 Exon 18 TGTTGTCGCAGCTGTT 72 7847 7862 ekkeekkdddddddkk 614
599592 2612 2628 Exon 18 / TTGTTGTCGCAGCTGTT 90 n/a n/a
eeekkdddddddkkeee 677 Repeat 599567 2613 2628 Exon 18 /
TTGTTGTCGCAGCTGT 82 n/a n/a ekkeekkdddddddkk 615 Repeat 599593 2613
2629 Exon 18 / TTTGTTGTCGCAGCTGT 95 n/a n/a eeekkdddddddkkeee 678
Repeat 599568 2614 2629 Exon 18 / TTTGTTGTCGCAGCTG 92 n/a n/a
ekkeekkdddddddkk 616 Repeat 599594 2614 2630 Exon 18 /
TTTTGTTGTCGCAGCTG 86 n/a n/a eeekkdddddddkkeee 679 Repeat 599569
2615 2630 Exon 18 / TTTTGTTGTCGCAGCT 89 n/a n/a ekkeekkdddddddkk
617 Repeat 599595 2615 2631 Exon 18 / TTTTTGTTGTCGCAGCT 76 n/a n/a
eeekkdddddddkkeee
680 Repeat 599570 2616 2631 Exon 18 / TTTTTGTTGTCGCAGC 95 n/a n/a
ekkeekkdddddddkk 618 Repeat
Example 7: Antisense Inhibition of Human Complement Factor B (CFB)
in HepG2 Cells
[0444] Additional antisense oligonucleotides were designed
targeting human Complement Factor B (CFB) nucleic acid and were
tested for their effects on CFB mRNA in vitro. The antisense
oligonucleotides were tested in a series of experiments that had
similar culture conditions. The results for each experiment are
presented in separate tables shown below. Cultured HepG2 cells at a
density of 20,000 cells per well were transfected using
electroporation with 500 nM antisense oligonucleotide. After a
treatment period of approximately 24 hours, RNA was isolated from
the cells and CFB mRNA levels were measured by quantitative
real-time PCR. Human primer probe set RTS3459 was used to measure
mRNA levels. CFB mRNA levels were adjusted according to total RNA
content, as measured by RIBOGREEN.RTM.. Results are presented as
percent inhibition of CFB, relative to untreated control cells.
[0445] The newly designed chimeric antisense oligonucleotides in
the Tables below were designed as deoxy, MOE and cEt
oligonucleotides, or as 5-8-5 MOE, 5-9-5 MOE, 5-10-5 MOE,
6-7-6-MOE, 3-10-5 MOE, or 6-8-6 MOE gapmers.
[0446] The deoxy, MOE and cEt oligonucleotides are 16 nucleosides
in length wherein the nucleoside have either a MOE sugar
modification, an cEt sugar modification, or a deoxy modification.
The `Chemistry` column describes the sugar modifications of each
oligonucleotide. `k` indicates an cEt sugar modification; `d`
indicates deoxyribose; and `e` indicates a MOE modification.
[0447] The 5-8-5 MOE gapmers are 18 nucleosides in length, wherein
the central gap segment comprises of eight 2'-deoxynucleosides and
is flanked by wing segments on the 5' direction and the 3'
direction comprising five nucleosides each. The 5-9-5 MOE gapmers
are 19 nucleosides in length, wherein the central gap segment
comprises of nine 2'-deoxynucleosides and is flanked by wing
segments on the 5' direction and the 3' direction comprising five
nucleosides each. The 5-10-5 MOE gapmers are 20 nucleosides in
length, wherein the central gap segment comprises often
2'-deoxynucleosides and is flanked by wing segments on the 5'
direction and the 3' direction comprising five nucleosides each.
The 3-10-5 MOE gapmers are 18 nucleosides in length, wherein the
central gap segment comprises often 2'-deoxynucleosides and is
flanked by wing segments on the 5' direction and the 3' direction
comprising three and five nucleosides respectively. The 6-7-6 MOE
gapmers are 19 nucleosides in length, wherein the central gap
segment comprises of seven 2'-deoxynucleosides and is flanked by
wing segments on the 5' direction and the 3' direction comprising
six nucleosides each. The 6-8-6 MOE gapmers are 20 nucleosides in
length, wherein the central gap segment comprises of eight
2'-deoxynucleosides and is flanked by wing segments on the 5'
direction and the 3' direction comprising six nucleosides each.
Each nucleoside in the 5' wing segment and each nucleoside in the
3' wing segment has a 2'-MOE modification. The internucleoside
linkages throughout each gapmer are phosphorothioate (P.dbd.S)
linkages. All cytosine residues throughout each gapmer are
5-methylcytosines.
[0448] "Start site" indicates the 5'-most nucleoside to which the
gapmer is targeted in the human gene sequence. "Stop site"
indicates the 3'-most nucleoside to which the gapmer is targeted
human gene sequence. Each gapmer listed in the Tables below is
targeted to either the human CFB mRNA, designated herein as SEQ ID
NO: 1 (GENBANK Accession No. NM_001710.5) or the human CFB genomic
sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No.
NT_007592.15 truncated from nucleotides 31852000 to 31861000), or
both. `n/a` indicates that the antisense oligonucleotide does not
target that particular gene sequence with 100% complementarity.
TABLE-US-00020 TABLE 19 Inhibition of CFB mRNA by deoxy, MOE and
cEt oligonucleotides targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ
SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ start stop Target %
start stop ID ISIS NO site site region Sequence inhibition site
site Motif NO: 601152 2551 2566 Exon 18 AAACCCAAATCCTCAT 22 7786
7801 eekkddddddddkkee 557 601218 2551 2566 Exon 18 AAACCCAAATCCTCAT
21 7786 7801 ekkkddddddddkeee 557 601153 2552 2567 Exon 18
AAAACCCAAATCCTCA 27 7787 7802 eekkddddddddkkee 800 601219 2552 2567
Exon 18 AAAACCCAAATCCTCA 19 7787 7802 ekkkddddddddkeee 800 601154
2553 2568 Exon 18 GAAAACCCAAATCCTC 23 7788 7803 eekkddddddddkkee
558 601220 2553 2568 Exon 18 GAAAACCCAAATCCTC 24 7788 7803
ekkkddddddddkeee 558 601155 2554 2569 Exon 18 AGAAAACCCAAATCCT 20
7789 7804 eekkddddddddkkee 801 601221 2554 2569 Exon 18
AGAAAACCCAAATCCT 0 7789 7804 ekkkddddddddkeee 801 601156 2555 2570
Exon 18 TAGAAAACCCAAATCC 11 7790 7805 eekkddddddddkkee 559 601222
2555 2570 Exon 18 TAGAAAACCCAAATCC 23 7790 7805 ekkkddddddddkeee
559 601157 2556 2571 Exon 18 ATAGAAAACCCAAATC 9 7791 7806
eekkddddddddkkee 560 601223 2556 2571 Exon 18 ATAGAAAACCCAAATC 0
7791 7806 ekkkddddddddkeee 560 601158 2557 2572 Exon 18
TATAGAAAACCCAAAT 0 7792 7807 eekkddddddddkkee 802 601224 2557 2572
Exon 18 TATAGAAAACCCAAAT 0 7792 7807 ekkkddddddddkeee 802 601159
2558 2573 Exon 18 TTATAGAAAACCCAAA 2 7793 7808 eekkddddddddkkee 803
601225 2558 2573 Exon 18 TTATAGAAAACCCAAA 0 7793 7808
ekkkddddddddkeee 803 601160 2559 2574 Exon 18 CTTATAGAAAACCCAA 0
7794 7809 eekkddddddddkkee 561 601226 2559 2574 Exon 18
CTTATAGAAAACCCAA 0 7794 7809 ekkkddddddddkeee 561 601161 2560 2575
Exon 18 CCTTATAGAAAACCCA 1 7795 7810 eekkddddddddkkee 562 601227
2560 2575 Exon 18 CCTTATAGAAAACCCA 14 7795 7810 ekkkddddddddkeee
562 601162 2561 2576 Exon 18 CCCTTATAGAAAACCC 9 7796 7811
eekkddddddddkkee 563 601228 2561 2576 Exon 18 CCCTTATAGAAAACCC 9
7796 7811 ekkkddddddddkeee 563 601163 2562 2577 Exon 18
CCCCTTATAGAAAACC 0 7797 7812 eekkddddddddkkee 564 601164 2563 2578
Exon 18 ACCCCTTATAGAAAAC 3 7798 7813 eekkddddddddkkee 565 601165
2564 2579 Exon 18 AACCCCTTATAGAAAA 0 7799 7814 eekkddddddddkkee 566
601166 2565 2580 Exon 18 AAACCCCTTATAGAAA 0 7800 7815
eekkddddddddkkee 567 601167 2566 2581 Exon 18 GAAACCCCTTATAGAA 0
7801 7816 eekkddddddddkkee 568 601168 2567 2582 Exon 18
GGAAACCCCTTATAGA 0 7802 7817 eekkddddddddkkee 569 601169 2568 2583
Exon 18 AGGAAACCCCTTATAG 0 7803 7818 eekkddddddddkkee 570 601170
2569 2584 Exon 18 CAGGAAACCCCTTATA 10 7804 7819 eekkddddddddkkee
571 601171 2570 2585 Exon 18 GCAGGAAACCCCTTAT 9 7805 7820
eekkddddddddkkee 572 601172 2571 2586 Exon 18 AGCAGGAAACCCCTTA 15
7806 7821 eekkddddddddkkee 573 601173 2572 2587 Exon 18
CAGCAGGAAACCCCTT 29 7807 7822 eekkddddddddkkee 574 601174 2573 2588
Exon 18 CCAGCAGGAAACCCCT 25 7808 7823 eekkddddddddkkee 575 601175
2574 2589 Exon 18 TCCAGCAGGAAACCCC 15 7809 7824 eekkddddddddkkee
576 601176 2575 2590 Exon 18 GTCCAGCAGGAAACCC 18 7810 7825
eekkddddddddkkee 577 601177 2576 2591 Exon 18 TGTCCAGCAGGAAACC 10
7811 7826 eekkddddddddkkee 578 601178 2577 2592 Exon 18
CTGTCCAGCAGGAAAC 11 7812 7827 eekkddddddddkkee 579 601179 2578 2593
Exon 18 CCTGTCCAGCAGGAAA 19 7813 7828 eekkddddddddkkee 580 601180
2579 2594 Exon 18 CCCTGTCCAGCAGGAA 7 7814 7829 eekkddddddddkkee 581
601181 2580 2595 Exon 18 CCCCTGTCCAGCAGGA 3 7815 7830
eekkddddddddkkee 582 601182 2581 2596 Exon 18 GCCCCTGTCCAGCAGG 0
7816 7831 eekkddddddddkkee 583 601183 2582 2597 Exon 18
CGCCCCTGTCCAGCAG 4 7817 7832 eekkddddddddkkee 584 601184 2583 2598
Exon 18 ACGCCCCTGTCCAGCA 14 7818 7833 eekkddddddddkkee 585 601185
2584 2599 Exon 18 CACGCCCCTGTCCAGC 26 7819 7834 eekkddddddddkkee
586 601186 2585 2600 Exon 18 CCACGCCCCTGTCCAG 8 7820 7835
eekkddddddddkkee 587 601187 2586 2601 Exon 18 CCCACGCCCCTGTCCA 18
7821 7836 eekkddddddddkkee 588 601188 2587 2602 Exon 18
TCCCACGCCCCTGTCC 20 7822 7837 eekkddddddddkkee 589 601189 2588 2603
Exon 18 ATCCCACGCCCCTGTC 12 7823 7838 eekkddddddddkkee 590 601190
2589 2604 Exon 18 AATCCCACGCCCCTGT 33 7824 7839 eekkddddddddkkee
591 601191 2590 2605 Exon 18 CAATCCCACGCCCCTG 52 7825 7840
eekkddddddddkkee 592 601192 2591 2606 Exon 18 TCAATCCCACGCCCCT 46
7826 7841 eekkddddddddkkee 593 601193 2592 2607 Exon 18
TTCAATCCCACGCCCC 30 7827 7842 eekkddddddddkkee 594 601194 2593 2608
Exon 18 ATTCAATCCCACGCCC 41 7828 7843 eekkddddddddkkee 595 601195
2594 2609 Exon 18 AATTCAATCCCACGCC 40 7829 7844 eekkddddddddkkee
596 601196 2595 2610 Exon 18 TAATTCAATCCCACGC 71 7830 7845
eekkddddddddkkee 597 601197 2596 2611 Exon 18 TTAATTCAATCCCACG 42
7831 7846 eekkddddddddkkee 598 601198 2597 2612 Exon 18
TTTAATTCAATCCCAC 63 7832 7847 eekkddddddddkkee 599 601199 2598 2613
Exon 18 TTTTAATTCAATCCCA 51 7833 7848 eekkddddddddkkee 600 601200
2599 2614 Exon 18 GTTTTAATTCAATCCC 65 7834 7849 eekkddddddddkkee
601 601201 2600 2615 Exon 18 TGTTTTAATTCAATCC 49 7835 7850
eekkddddddddkkee 602 601202 2601 2616 Exon 18 CTGTTTTAATTCAATC 33
7836 7851 eekkddddddddkkee 603 601203 2602 2617 Exon 18
GCTGTTTTAATTCAAT 63 7837 7852 eekkddddddddkkee 604 601204 2603 2618
Exon 18 AGCTGTTTTAATTCAA 69 7838 7853 eekkddddddddkkee 605 532917
2604 2623 Exon 18 GTCGCAGCTGTTTTAATT 73 7839 7858
eeeeeddddddddddeeee 317 CA e 601205 2604 2619 Exon 18
CAGCTGTTTTAATTCA 51 7839 7854 eekkddddddddkkee 606 601206 2605 2620
Exon 18 GCAGCTGTTTTAATTC 43 7840 7855 eekkddddddddkkee 607 601207
2606 2621 Exon 18 CGCAGCTGTTTTAATT 52 7841 7856 eekkddddddddkkee
608 601208 2607 2622 Exon 18 TCGCAGCTGTTTTAAT 61 7842 7857
eekkddddddddkkee 609 588860 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 75
7843 7858 eekddddddddddkke 610 601209 2608 2623 Exon 18
GTCGCAGCTGTTTTAA 73 7843 7858 eekkddddddddkkee 610 601210 2609 2624
Exon 18 TGTCGCAGCTGTTTTA 80 7844 7859 eekkddddddddkkee 611 601211
2610 2625 Exon 18 TTGTCGCAGCTGTTTT 64 7845 7860 eekkddddddddkkee
612 601212 2611 2626 Exon 18 GTTGTCGCAGCTGTTT 86 7846 7861
eekkddddddddkkee 613 601213 2612 2627 Exon 18 TGTTGTCGCAGCTGTT 87
7847 7862 eekkddddddddkkee 614 601214 2613 2628 Exon 18 /
TTGTTGTCGCAGCTGT 84 n/a n/a eekkddddddddkkee 615 Repeat 601215 2614
2629 Exon 18 / TTTGTTGTCGCAGCTG 78 n/a n/a eekkddddddddkkee 616
Repeat 601216 2615 2630 Exon 18 / TTTTGTTGTCGCAGCT 73 n/a n/a
eekkddddddddkkee 617 Repeat 601217 2616 2631 Exon 18 /
TTTTTGTTGTCGCAGC 66 n/a n/a eekkddddddddkkee
618 Repeat
TABLE-US-00021 TABLE 20 Inhibition of CFB mRNA by deoxy, MOE and
cEt oligonucleotides targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ
SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ start stop Target %
start stop ID ISIS NO site site region Sequence inhibition site
site Motif NO: 601284 2551 2566 Exon 18 AAACCCAAATCCTCAT 8 7786
7801 ekkddddddddkkeee 557 601285 2552 2567 Exon 18 AAAACCCAAATCCTCA
15 7787 7802 ekkddddddddkkeee 800 601286 2553 2568 Exon 18
GAAAACCCAAATCCTC 21 7788 7803 ekkddddddddkkeee 558 601287 2554 2569
Exon 18 AGAAAACCCAAATCCT 9 7789 7804 ekkddddddddkkeee 801 601288
2555 2570 Exon 18 TAGAAAACCCAAATCC 0 7790 7805 ekkddddddddkkeee 559
601289 2556 2571 Exon 18 ATAGAAAACCCAAATC 40 7791 7806
ekkddddddddkkeee 560 601290 2557 2572 Exon 18 TATAGAAAACCCAAAT 16
7792 7807 ekkddddddddkkeee 802 601291 2558 2573 Exon 18
TTATAGAAAACCCAAA 15 7793 7808 ekkddddddddkkeee 803 601292 2559 2574
Exon 18 CTTATAGAAAACCCAA 5 7794 7809 ekkddddddddkkeee 561 601293
2560 2575 Exon 18 CCTTATAGAAAACCCA 15 7795 7810 ekkddddddddkkeee
562 601294 2561 2576 Exon 18 CCCTTATAGAAAACCC 3 7796 7811
ekkddddddddkkeee 563 601229 2562 2577 Exon 18 CCCCTTATAGAAAACC 15
7797 7812 ekkdddddddddkeee 564 601295 2562 2577 Exon 18
CCCCTTATAGAAAACC 5 7797 7812 ekkddddddddkkeee 564 601230 2563 2578
Exon 18 ACCCCTTATAGAAAAC 14 7798 7813 ekkdddddddddkeee 565 601296
2563 2578 Exon 18 ACCCCTTATAGAAAAC 0 7798 7813 ekkddddddddkkeee 565
601231 2564 2579 Exon 18 AACCCCTTATAGAAAA 14 7799 7814
ekkdddddddddkeee 566 601297 2564 2579 Exon 18 AACCCCTTATAGAAAA 14
7799 7814 ekkddddddddkkeee 566 601232 2565 2580 Exon 18
AAACCCCTTATAGAAA 15 7800 7815 ekkdddddddddkeee 567 601298 2565 2580
Exon 18 AAACCCCTTATAGAAA 7 7800 7815 ekkddddddddkkeee 567 601233
2566 2581 Exon 18 GAAACCCCTTATAGAA 0 7801 7816 ekkdddddddddkeee 568
601299 2566 2581 Exon 18 GAAACCCCTTATAGAA 0 7801 7816
ekkddddddddkkeee 568 601234 2567 2582 Exon 18 GGAAACCCCTTATAGA 0
7802 7817 ekkdddddddddkeee 569 601300 2567 2582 Exon 18
GGAAACCCCTTATAGA 9 7802 7817 ekkddddddddkkeee 569 601235 2568 2583
Exon 18 AGGAAACCCCTTATAG 3 7803 7818 ekkdddddddddkeee 570 601301
2568 2583 Exon 18 AGGAAACCCCTTATAG 14 7803 7818 ekkddddddddkkeee
570 601236 2569 2584 Exon 18 CAGGAAACCCCTTATA 0 7804 7819
ekkdddddddddkeee 571 601302 2569 2584 Exon 18 CAGGAAACCCCTTATA 0
7804 7819 ekkddddddddkkeee 571 601237 2570 2585 Exon 18
GCAGGAAACCCCTTAT 16 7805 7820 ekkdddddddddkeee 572 601303 2570 2585
Exon 18 GCAGGAAACCCCTTAT 16 7805 7820 ekkddddddddkkeee 572 601238
2571 2586 Exon 18 AGCAGGAAACCCCTTA 11 7806 7821 ekkdddddddddkeee
573 601304 2571 2586 Exon 18 AGCAGGAAACCCCTTA 10 7806 7821
ekkddddddddkkeee 573 601239 2572 2587 Exon 18 CAGCAGGAAACCCCTT 21
7807 7822 ekkdddddddddkeee 574 601305 2572 2587 Exon 18
CAGCAGGAAACCCCTT 7 7807 7822 ekkddddddddkkeee 574 601240 2573 2588
Exon 18 CCAGCAGGAAACCCCT 6 7808 7823 ekkdddddddddkeee 575 601241
2574 2589 Exon 18 TCCAGCAGGAAACCCC 10 7809 7824 ekkdddddddddkeee
576 601242 2575 2590 Exon 18 GTCCAGCAGGAAACCC 19 7810 7825
ekkdddddddddkeee 577 601243 2576 2591 Exon 18 TGTCCAGCAGGAAACC 10
7811 7826 ekkdddddddddkeee 578 601244 2577 2592 Exon 18
CTGTCCAGCAGGAAAC 28 7812 7827 ekkdddddddddkeee 579 601245 2578 2593
Exon 18 CCTGTCCAGCAGGAAA 5 7813 7828 ekkdddddddddkeee 580 601246
2579 2594 Exon 18 CCCTGTCCAGCAGGAA 18 7814 7829 ekkdddddddddkeee
581 601247 2580 2595 Exon 18 CCCCTGTCCAGCAGGA 4 7815 7830
ekkdddddddddkeee 582 601248 2581 2596 Exon 18 GCCCCTGTCCAGCAGG 6
7816 7831 ekkdddddddddkeee 583 601249 2582 2597 Exon 18
CGCCCCTGTCCAGCAG 18 7817 7832 ekkdddddddddkeee 584 601250 2583 2598
Exon 18 ACGCCCCTGTCCAGCA 26 7818 7833 ekkdddddddddkeee 585 601251
2584 2599 Exon 18 CACGCCCCTGTCCAGC 27 7819 7834 ekkdddddddddkeee
586 601252 2585 2600 Exon 18 CCACGCCCCTGTCCAG 21 7820 7835
ekkdddddddddkeee 587 601253 2586 2601 Exon 18 CCCACGCCCCTGTCCA 0
7821 7836 ekkdddddddddkeee 588 601254 2587 2602 Exon 18
TCCCACGCCCCTGTCC 31 7822 7837 ekkdddddddddkeee 589 601255 2588 2603
Exon 18 ATCCCACGCCCCTGTC 3 7823 7838 ekkdddddddddkeee 590 601256
2589 2604 Exon 18 AATCCCACGCCCCTGT 21 7824 7839 ekkdddddddddkeee
591 601257 2590 2605 Exon 18 CAATCCCACGCCCCTG 47 7825 7840
ekkdddddddddkeee 592 601258 2591 2606 Exon 18 TCAATCCCACGCCCCT 48
7826 7841 ekkdddddddddkeee 593 601259 2592 2607 Exon 18
TTCAATCCCACGCCCC 38 7827 7842 ekkdddddddddkeee 594 601260 2593 2608
Exon 18 ATTCAATCCCACGCCC 33 7828 7843 ekkdddddddddkeee 595 601261
2594 2609 Exon 18 AATTCAATCCCACGCC 17 7829 7844 ekkdddddddddkeee
596 601262 2595 2610 Exon 18 TAATTCAATCCCACGC 40 7830 7845
ekkdddddddddkeee 597 601263 2596 2611 Exon 18 TTAATTCAATCCCACG 31
7831 7846 ekkdddddddddkeee 598 601264 2597 2612 Exon 18
TTTAATTCAATCCCAC 72 7832 7847 ekkkddddddddkeee 599 601265 2598 2613
Exon 18 TTTTAATTCAATCCCA 48 7833 7848 ekkkddddddddkeee 600 601266
2599 2614 Exon 18 GTTTTAATTCAATCCC 64 7834 7849 ekkkddddddddkeee
601 601267 2600 2615 Exon 18 TGTTTTAATTCAATCC 43 7835 7850
ekkkddddddddkeee 602 601268 2601 2616 Exon 18 CTGTTTTAATTCAATC 44
7836 7851 ekkkddddddddkeee 603 601269 2602 2617 Exon 18
GCTGTTTTAATTCAAT 66 7837 7852 ekkkddddddddkeee 604 601270 2603 2618
Exon 18 AGCTGTTTTAATTCAA 47 7838 7853 ekkkddddddddkeee 605 532917
2604 2623 Exon 18 GTCGCAGCTGTTTTAATT 3 7839 7858
eeeeeddddddddddeeee 317 CA e 601271 2604 2619 Exon 18
CAGCTGTTTTAATTCA 26 7839 7854 ekkkddddddddkeee 606 601272 2605 2620
Exon 18 GCAGCTGTTTTAATTC 33 7840 7855 ekkkddddddddkeee 607 601273
2606 2621 Exon 18 CGCAGCTGTTTTAATT 34 7841 7856 ekkkddddddddkeee
608 601274 2607 2622 Exon 18 TCGCAGCTGTTTTAAT 39 7842 7857
ekkkddddddddkeee 609 588860 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 72
7843 7858 eekddddddddddkke 610 601275 2608 2623 Exon 18
GTCGCAGCTGTTTTAA 65 7843 7858 ekkkddddddddkeee 610 601276 2609 2624
Exon 18 TGTCGCAGCTGTTTTA 65 7844 7859 ekkkddddddddkeee 611 601277
2610 2625 Exon 18 TTGTCGCAGCTGTTTT 51 7845 7860 ekkkddddddddkeee
612 601278 2611 2626 Exon 18 GTTGTCGCAGCTGTTT 78 7846 7861
ekkkddddddddkeee 613 601279 2612 2627 Exon 18 TGTTGTCGCAGCTGTT 79
7847 7862 ekkkddddddddkeee 614 601280 2613 2628 Exon 18 /
TTGTTGTCGCAGCTGT 70 n/a n/a ekkkddddddddkeee 615 Repeat 601281 2614
2629 Exon 18 / TTTGTTGTCGCAGCTG 78 n/a n/a ekkkddddddddkeee 616
Repeat 601282 2615 2630 Exon 18 / TTTTGTTGTCGCAGCT 68 n/a n/a
ekkkddddddddkeee 617 Repeat 601283 2616 2631 Exon 18 /
TTTTTGTTGTCGCAGC 61 n/a n/a ekkkddddddddkeee
618 Repeat
TABLE-US-00022 TABLE 21 Inhibition of CFB mRNA by deoxy, MOE and
cEt oligonucleotides targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ
SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 SEQ start stop Target %
start stop ID ISIS NO site site region Sequence inhibition site
site Motif NO: 601306 2573 2588 Exon 18 CCAGCAGGAAACCCCT 22 7808
7823 ekkddddddddkkeee 575 601307 2574 2589 Exon 18 TCCAGCAGGAAACCCC
22 7809 7824 ekkddddddddkkeee 576 601308 2575 2590 Exon 18
GTCCAGCAGGAAACCC 33 7810 7825 ekkddddddddkkeee 577 601309 2576 2591
Exon 18 TGTCCAGCAGGAAACC 33 7811 7826 ekkddddddddkkeee 578 601310
2577 2592 Exon 18 CTGTCCAGCAGGAAAC 28 7812 7827 ekkddddddddkkeee
579 601311 2578 2593 Exon 18 CCTGTCCAGCAGGAAA 33 7813 7828
ekkddddddddkkeee 580 601312 2579 2594 Exon 18 CCCTGTCCAGCAGGAA 13
7814 7829 ekkddddddddkkeee 581 601313 2580 2595 Exon 18
CCCCTGTCCAGCAGGA 32 7815 7830 ekkddddddddkkeee 582 601314 2581 2596
Exon 18 GCCCCTGTCCAGCAGG 0 7816 7831 ekkddddddddkkeee 583 601315
2582 2597 Exon 18 CGCCCCTGTCCAGCAG 36 7817 7832 ekkddddddddkkeee
584 601316 2583 2598 Exon 18 ACGCCCCTGTCCAGCA 39 7818 7833
ekkddddddddkkeee 585 601317 2584 2599 Exon 18 CACGCCCCTGTCCAGC 33
7819 7834 ekkddddddddkkeee 586 601356 2584 2599 Exon 18
CACGCCCCTGTCCAGC 27 7819 7834 kkkddddddddkeeee 586 601318 2585 2600
Exon 18 CCACGCCCCTGTCCAG 35 7820 7835 ekkddddddddkkeee 587 601357
2585 2600 Exon 18 CCACGCCCCTGTCCAG 26 7820 7835 kkkddddddddkeeee
587 601319 2586 2601 Exon 18 CCCACGCCCCTGTCCA 33 7821 7836
ekkddddddddkkeee 588 601358 2586 2601 Exon 18 CCCACGCCCCTGTCCA 26
7821 7836 kkkddddddddkeeee 588 601320 2587 2602 Exon 18
TCCCACGCCCCTGTCC 25 7822 7837 ekkddddddddkkeee 589 601359 2587 2602
Exon 18 TCCCACGCCCCTGTCC 23 7822 7837 kkkddddddddkeeee 589 601321
2588 2603 Exon 18 ATCCCACGCCCCTGTC 50 7823 7838 ekkddddddddkkeee
590 601360 2588 2603 Exon 18 ATCCCACGCCCCTGTC 33 7823 7838
kkkddddddddkeeee 590 601322 2589 2604 Exon 18 AATCCCACGCCCCTGT 52
7824 7839 ekkddddddddkkeee 591 601361 2589 2604 Exon 18
AATCCCACGCCCCTGT 48 7824 7839 kkkddddddddkeeee 591 601323 2590 2605
Exon 18 CAATCCCACGCCCCTG 67 7825 7840 ekkddddddddkkeee 592 601362
2590 2605 Exon 18 CAATCCCACGCCCCTG 51 7825 7840 kkkddddddddkeeee
592 601324 2591 2606 Exon 18 TCAATCCCACGCCCCT 42 7826 7841
ekkddddddddkkeee 593 601363 2591 2606 Exon 18 TCAATCCCACGCCCCT 42
7826 7841 kkkddddddddkeeee 593 601325 2592 2607 Exon 18
TTCAATCCCACGCCCC 52 7827 7842 ekkddddddddkkeee 594 601364 2592 2607
Exon 18 TTCAATCCCACGCCCC 48 7827 7842 kkkddddddddkeeee 594 601326
2593 2608 Exon 18 ATTCAATCCCACGCCC 27 7828 7843 ekkddddddddkkeee
595 601365 2593 2608 Exon 18 ATTCAATCCCACGCCC 36 7828 7843
kkkddddddddkeeee 595 601327 2594 2609 Exon 18 AATTCAATCCCACGCC 66
7829 7844 ekkddddddddkkeee 596 601366 2594 2609 Exon 18
AATTCAATCCCACGCC 49 7829 7844 kkkddddddddkeeee 596 601328 2595 2610
Exon 18 TAATTCAATCCCACGC 55 7830 7845 ekkddddddddkkeee 597 601367
2595 2610 Exon 18 TAATTCAATCCCACGC 57 7830 7845 kkkddddddddkeeee
597 601329 2596 2611 Exon 18 TTAATTCAATCCCACG 69 7831 7846
ekkddddddddkkeee 598 601368 2596 2611 Exon 18 TTAATTCAATCCCACG 68
7831 7846 kkkddddddddkeeee 598 601330 2597 2612 Exon 18
TTTAATTCAATCCCAC 58 7832 7847 ekkddddddddkkeee 599 601369 2597 2612
Exon 18 TTTAATTCAATCCCAC 65 7832 7847 kkkddddddddkeeee 599 601331
2598 2613 Exon 18 TTTTAATTCAATCCCA 45 7833 7848 ekkddddddddkkeee
600 601370 2598 2613 Exon 18 TTTTAATTCAATCCCA 42 7833 7848
kkkddddddddkeeee 600 601332 2599 2614 Exon 18 GTTTTAATTCAATCCC 84
7834 7849 ekkddddddddkkeee 601 601371 2599 2614 Exon 18
GTTTTAATTCAATCCC 79 7834 7849 kkkddddddddkeeee 601 601333 2600 2615
Exon 18 TGTTTTAATTCAATCC 61 7835 7850 ekkddddddddkkeee 602 601372
2600 2615 Exon 18 TGTTTTAATTCAATCC 71 7835 7850 kkkddddddddkeeee
602 601334 2601 2616 Exon 18 CTGTTTTAATTCAATC 61 7836 7851
ekkddddddddkkeee 603 601373 2601 2616 Exon 18 CTGTTTTAATTCAATC 57
7836 7851 kkkddddddddkeeee 603 601335 2602 2617 Exon 18
GCTGTTTTAATTCAAT 73 7837 7852 ekkddddddddkkeee 604 601374 2602 2617
Exon 18 GCTGTTTTAATTCAAT 66 7837 7852 kkkddddddddkeeee 604 601336
2603 2618 Exon 18 AGCTGTTTTAATTCAA 64 7838 7853 ekkddddddddkkeee
605 601375 2603 2618 Exon 18 AGCTGTTTTAATTCAA 61 7838 7853
kkkddddddddkeeee 605 532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATT 66
7839 7858 eeeeedddddddddde 317 CA eeee 601337 2604 2619 Exon 18
CAGCTGTTTTAATTCA 53 7839 7854 ekkddddddddkkeee 606 601376 2604 2619
Exon 18 CAGCTGTTTTAATTCA 39 7839 7854 kkkddddddddkeeee 606 601338
2605 2620 Exon 18 GCAGCTGTTTTAATTC 67 7840 7855 ekkddddddddkkeee
607 601377 2605 2620 Exon 18 GCAGCTGTTTTAATTC 67 7840 7855
kkkddddddddkeeee 607 601339 2606 2621 Exon 18 CGCAGCTGTTTTAATT 63
7841 7856 ekkddddddddkkeee 608 601378 2606 2621 Exon 18
CGCAGCTGTTTTAATT 60 7841 7856 kkkddddddddkeeee 608 601340 2607 2622
Exon 18 TCGCAGCTGTTTTAAT 40 7842 7857 ekkddddddddkkeee 609 601379
2607 2622 Exon 18 TCGCAGCTGTTTTAAT 36 7842 7857 kkkddddddddkeeee
609 588860 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 84 7843 7858
eekddddddddddkke 610 601341 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 74
7843 7858 ekkddddddddkkeee 610 601380 2608 2623 Exon 18
GTCGCAGCTGTTTTAA 78 7843 7858 kkkddddddddkeeee 610 601342 2609 2624
Exon 18 TGTCGCAGCTGTTTTA 68 7844 7859 ekkddddddddkkeee 611 601381
2609 2624 Exon 18 TGTCGCAGCTGTTTTA 66 7844 7859 kkkddddddddkeeee
611 601343 2610 2625 Exon 18 TTGTCGCAGCTGTTTT 71 7845 7860
ekkddddddddkkeee 612 601382 2610 2625 Exon 18 TTGTCGCAGCTGTTTT 84
7845 7860 kkkddddddddkeeee 612 601344 2611 2626 Exon 18
GTTGTCGCAGCTGTTT 87 7846 7861 ekkddddddddkkeee 613 601383 2611 2626
Exon 18 GTTGTCGCAGCTGTTT 85 7846 7861 kkkddddddddkeeee 613 601345
2612 2627 Exon 18 TGTTGTCGCAGCTGTT 82 7847 7862 ekkddddddddkkeee
614 601384 2612 2627 Exon 18 TGTTGTCGCAGCTGTT 79 7847 7862
kkkddddddddkeeee 614 601346 2613 2628 Exon 18 / TTGTTGTCGCAGCTGT 73
n/a n/a ekkddddddddkkeee 615 Repeat 601385 2613 2628 Exon 18 /
TTGTTGTCGCAGCTGT 84 n/a n/a kkkddddddddkeeee 615 Repeat 601347 2614
2629 Exon 18 / TTTGTTGTCGCAGCTG 70 n/a n/a ekkddddddddkkeee 616
Repeat 601386 2614 2629 Exon 18 / TTTGTTGTCGCAGCTG 71 n/a n/a
kkkddddddddkeeee 616 Repeat 601348 2615 2630 Exon 18 /
TTTTGTTGTCGCAGCT 71 n/a n/a ekkddddddddkkeee 617 Repeat 601387 2615
2630 Exon 18 / TTTTGTTGTCGCAGCT 76 n/a n/a kkkddddddddkeeee 617
Repeat 601349 2616 2631 Exon 18 / TTTTTGTTGTCGCAGC 71 n/a n/a
ekkddddddddkkeee
618 Repeat 601388 2616 2631 Exon 18 / TTTTTGTTGTCGCAGC 67 n/a n/a
kkkddddddddkeeee 618 Repeat
TABLE-US-00023 TABLE 22 Inhibition of CFB mRNA by MOE gapmers
targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ SEQ SEQ ID ID ID ID
NO: NO: NO: NO: 1 1 2 2 SEQ ISIS start stop Target % start stop ID
NO site site region Sequence inhibition site site Motif NO: 599357
2582 2600 Exon 18 CCACGCCCCTGTCCAGCAG 26 7817 7835 5-9-5 708 599358
2583 2601 Exon 18 CCCACGCCCCTGTCCAGCA 22 7818 7836 5-9-5 709 599359
2584 2602 Exon 18 TCCCACGCCCCTGTCCAGC 13 7819 7837 5-9-5 710 599360
2585 2603 Exon 18 ATCCCACGCCCCTGTCCAG 7 7820 7838 5-9-5 711 599361
2586 2604 Exon 18 AATCCCACGCCCCTGTCCA 11 7821 7839 5-9-5 712 599362
2587 2605 Exon 18 CAATCCCACGCCCCTGTCC 14 7822 7840 5-9-5 713 599363
2588 2606 Exon 18 TCAATCCCACGCCCCTGTC 17 7823 7841 5-9-5 714 599364
2589 2607 Exon 18 TTCAATCCCACGCCCCTGT 20 7824 7842 5-9-5 715 599365
2590 2608 Exon 18 ATTCAATCCCACGCCCCTG 22 7825 7843 5-9-5 716 599366
2591 2609 Exon 18 AATTCAATCCCACGCCCCT 13 7826 7844 5-9-5 717 599367
2592 2610 Exon 18 TAATTCAATCCCACGCCCC 11 7827 7845 5-9-5 718 599368
2593 2611 Exon 18 TTAATTCAATCCCACGCCC 10 7828 7846 5-9-5 719 599369
2594 2612 Exon 18 TTTAATTCAATCCCACGCC 19 7829 7847 5-9-5 720 599370
2595 2613 Exon 18 TTTTAATTCAATCCCACGC 23 7830 7848 5-9-5 721 599371
2596 2614 Exon 18 GTTTTAATTCAATCCCACG 4 7831 7849 5-9-5 722 599372
2597 2615 Exon 18 TGTTTTAATTCAATCCCAC 16 7832 7850 5-9-5 723 599373
2598 2616 Exon 18 CTGTTTTAATTCAATCCCA 3 7833 7851 5-9-5 724 599374
2599 2617 Exon 18 GCTGTTTTAATTCAATCCC 10 7834 7852 5-9-5 725 599375
2600 2618 Exon 18 AGCTGTTTTAATTCAATCC 17 7835 7853 5-9-5 726 599376
2601 2619 Exon 18 CAGCTGTTTTAATTCAATC 18 7836 7854 5-9-5 727 599377
2602 2620 Exon 18 GCAGCTGTTTTAATTCAAT 22 7837 7855 5-9-5 728 599378
2603 2621 Exon 18 CGCAGCTGTTTTAATTCAA 11 7838 7856 5-9-5 729 599511
2552 2571 Exon 18 ATAGAAAACCCAAATCCTCA 7 7787 7806 6-8-6 410 599389
2553 2572 Exon 18 TATAGAAAACCCAAATCCTC 22 7788 7807 6-8-6 411
599390 2554 2573 Exon 18 TTATAGAAAACCCAAATCCT 21 7789 7808 6-8-6
412 599391 2555 2574 Exon 18 CTTATAGAAAACCCAAATCC 27 7790 7809
6-8-6 413 599392 2556 2575 Exon 18 CCTTATAGAAAACCCAAATC 30 7791
7810 6-8-6 414 599393 2557 2576 Exon 18 CCCTTATAGAAAACCCAAAT 30
7792 7811 6-8-6 415 599394 2558 2577 Exon 18 CCCCTTATAGAAAACCCAAA
28 7793 7812 6-8-6 416 599395 2559 2578 Exon 18
ACCCCTTATAGAAAACCCAA 23 7794 7813 6-8-6 417 599396 2560 2579 Exon
18 AACCCCTTATAGAAAACCCA 53 7795 7814 6-8-6 418 599397 2561 2580
Exon 18 AAACCCCTTATAGAAAACCC 33 7796 7815 6-8-6 419 599398 2562
2581 Exon 18 GAAACCCCTTATAGAAAACC 58 7797 7816 6-8-6 420 599399
2563 2582 Exon 18 GGAAACCCCTTATAGAAAAC 23 7798 7817 6-8-6 421
599400 2564 2583 Exon 18 AGGAAACCCCTTATAGAAAA 54 7799 7818 6-8-6
422 599401 2565 2584 Exon 18 CAGGAAACCCCTTATAGAAA 30 7800 7819
6-8-6 423 599402 2566 2585 Exon 18 GCAGGAAACCCCTTATAGAA 25 7801
7820 6-8-6 424 599403 2567 2586 Exon 18 AGCAGGAAACCCCTTATAGA 17
7802 7821 6-8-6 425 599404 2568 2587 Exon 18 CAGCAGGAAACCCCTTATAG
20 7803 7822 6-8-6 426 599405 2569 2588 Exon 18
CCAGCAGGAAACCCCTTATA 12 7804 7823 6-8-6 427 599406 2570 2589 Exon
18 TCCAGCAGGAAACCCCTTAT 51 7805 7824 6-8-6 428 599407 2571 2590
Exon 18 GTCCAGCAGGAAACCCCTTA 39 7806 7825 6-8-6 237 599408 2572
2591 Exon 18 TGTCCAGCAGGAAACCCCTT 53 7807 7826 6-8-6 429 599409
2573 2592 Exon 18 CTGTCCAGCAGGAAACCCCT 65 7808 7827 6-8-6 430
599410 2574 2593 Exon 18 CCTGTCCAGCAGGAAACCCC 56 7809 7828 6-8-6
431 599411 2575 2594 Exon 18 CCCTGTCCAGCAGGAAACCC 60 7810 7829
6-8-6 432 599412 2576 2595 Exon 18 CCCCTGTCCAGCAGGAAACC 61 7811
7830 6-8-6 433 599413 2577 2596 Exon 18 GCCCCTGTCCAGCAGGAAAC 40
7812 7831 6-8-6 238 599414 2578 2597 Exon 18 CGCCCCTGTCCAGCAGGAAA
41 7813 7832 6-8-6 434 599415 2579 2598 Exon 18
ACGCCCCTGTCCAGCAGGAA 37 7814 7833 6-8-6 435 599416 2580 2599 Exon
18 CACGCCCCTGTCCAGCAGGA 54 7815 7834 6-8-6 436 599417 2581 2600
Exon 18 CCACGCCCCTGTCCAGCAGG 36 7816 7835 6-8-6 437 599418 2582
2601 Exon 18 CCCACGCCCCTGTCCAGCAG 53 7817 7836 6-8-6 438 599419
2583 2602 Exon 18 TCCCACGCCCCTGTCCAGCA 54 7818 7837 6-8-6 439
599420 2584 2603 Exon 18 ATCCCACGCCCCTGTCCAGC 50 7819 7838 6-8-6
440 599421 2585 2604 Exon 18 AATCCCACGCCCCTGTCCAG 48 7820 7839
6-8-6 441 599422 2586 2605 Exon 18 CAATCCCACGCCCCTGTCCA 55 7821
7840 6-8-6 442 599423 2587 2606 Exon 18 TCAATCCCACGCCCCTGTCC 75
7822 7841 6-8-6 443 599424 2588 2607 Exon 18 TTCAATCCCACGCCCCTGTC
69 7823 7842 6-8-6 444 599425 2589 2608 Exon 18
ATTCAATCCCACGCCCCTGT 77 7824 7843 6-8-6 445 599426 2590 2609 Exon
18 AATTCAATCCCACGCCCCTG 60 7825 7844 6-8-6 446 599427 2591 2610
Exon 18 TAATTCAATCCCACGCCCCT 72 7826 7845 6-8-6 447 599428 2592
2611 Exon 18 TTAATTCAATCCCACGCCCC 81 7827 7846 6-8-6 448 599429
2593 2612 Exon 18 TTTAATTCAATCCCACGCCC 68 7828 7847 6-8-6 449
599430 2594 2613 Exon 18 TTTTAATTCAATCCCACGCC 58 7829 7848 6-8-6
450 599431 2595 2614 Exon 18 GTTTTAATTCAATCCCACGC 70 7830 7849
6-8-6 451 599432 2596 2615 Exon 18 TGTTTTAATTCAATCCCACG 85 7831
7850 6-8-6 452 532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 85
7839 7858 5-10-5 317 599379 2604 2622 Exon 18 TCGCAGCTGTTTTAATTCA
73 7839 7857 5-9-5 730 599380 2605 2623 Exon 18 GTCGCAGCTGTTTTAATTC
77 7840 7858 5-9-5 731 599381 2606 2624 Exon 18 TGTCGCAGCTGTTTTAATT
69 7841 7859 5-9-5 732 599382 2607 2625 Exon 18 TTGTCGCAGCTGTTTTAAT
58 7842 7860 5-9-5 733 599383 2608 2626 Exon 18 GTTGTCGCAGCTGTTTTAA
52 7843 7861 5-9-5 734 599384 2609 2627 Exon 18 TGTTGTCGCAGCTGTTTTA
63 7844 7862 5-9-5 735 599385 2610 2628 Exon 18 /
TTGTTGTCGCAGCTGTTTT 53 n/a n/a 5-9-5 736 Repeat 599386 2611 2629
Exon 18 / TTTGTTGTCGCAGCTGTTT 63 n/a n/a 5-9-5 737 Repeat 599387
2612 2630 Exon 18 / TTTTGTTGTCGCAGCTGTT 64 n/a n/a 5-9-5 438 Repeat
599388 2613 2631 Exon 18 / TTTTTGTTGTCGCAGCTGT 66 n/a n/a 5-9-5 739
Repeat
TABLE-US-00024 TABLE 23 Inhibition of CFB mRNA by MOE gapmers
targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ ID ID SEQ SEQ NO: 1
NO: 1 ID NO: ID NO: SEQ ISIS start stop Target % 2 start 2 stop ID
NO site site region Sequence inhibition site site Motif NO: 599213
2553 2570 Exon 18 TAGAAAACCCAAATCCTC 0 7788 7805 3-10-5 785 599214
2554 2571 Exon 18 ATAGAAAACCCAAATCCT 0 7789 7806 3-10-5 786 599215
2555 2572 Exon 18 TATAGAAAACCCAAATCC 36 7790 7807 3-10-5 787 599216
2556 2573 Exon 18 TTATAGAAAACCCAAATC 8 7791 7808 3-10-5 788 599217
2557 2574 Exon 18 CTTATAGAAAACCCAAAT 5 7792 7809 3-10-5 789 599218
2558 2575 Exon 18 CCTTATAGAAAACCCAAA 0 7793 7810 3-10-5 790 599219
2559 2576 Exon 18 CCCTTATAGAAAACCCAA 8 7794 7811 3-10-5 791 599220
2560 2577 Exon 18 CCCCTTATAGAAAACCCA 0 7795 7812 3-10-5 740 599221
2561 2578 Exon 18 ACCCCTTATAGAAAACCC 54 7796 7813 3-10-5 741 599222
2562 2579 Exon 18 AACCCCTTATAGAAAACC 3 7797 7814 3-10-5 742 599223
2563 2580 Exon 18 AAACCCCTTATAGAAAAC 0 7798 7815 3-10-5 743 599224
2564 2581 Exon 18 GAAACCCCTTATAGAAAA 0 7799 7816 3-10-5 744 599225
2566 2583 Exon 18 AGGAAACCCCTTATAGAA 60 7801 7818 3-10-5 745 599226
2567 2584 Exon 18 CAGGAAACCCCTTATAGA 0 7802 7819 3-10-5 746 599227
2568 2585 Exon 18 GCAGGAAACCCCTTATAG 37 7803 7820 3-10-5 747 599228
2569 2586 Exon 18 AGCAGGAAACCCCTTATA 0 7804 7821 3-10-5 748 599229
2570 2587 Exon 18 CAGCAGGAAACCCCTTAT 39 7805 7822 3-10-5 749 599230
2571 2588 Exon 18 CCAGCAGGAAACCCCTTA 10 7806 7823 3-10-5 750 599231
2572 2589 Exon 18 TCCAGCAGGAAACCCCTT 16 7807 7824 3-10-5 751 599232
2573 2590 Exon 18 GTCCAGCAGGAAACCCCT 9 7808 7825 3-10-5 752 599233
2574 2591 Exon 18 TGTCCAGCAGGAAACCCC 44 7809 7826 3-10-5 753 599234
2575 2592 Exon 18 CTGTCCAGCAGGAAACCC 14 7810 7827 3-10-5 754 599235
2576 2593 Exon 18 CCTGTCCAGCAGGAAACC 0 7811 7828 3-10-5 755 599236
2577 2594 Exon 18 CCCTGTCCAGCAGGAAAC 43 7812 7829 3-10-5 756 599237
2578 2595 Exon 18 CCCCTGTCCAGCAGGAAA 0 7813 7830 3-10-5 757 599238
2580 2597 Exon 18 CGCCCCTGTCCAGCAGGA 9 7815 7832 3-10-5 758 599239
2581 2598 Exon 18 ACGCCCCTGTCCAGCAGG 36 7816 7833 3-10-5 759 599240
2582 2599 Exon 18 CACGCCCCTGTCCAGCAG 11 7817 7834 3-10-5 760 599241
2583 2600 Exon 18 CCACGCCCCTGTCCAGCA 51 7818 7835 3-10-5 761 599242
2584 2601 Exon 18 CCCACGCCCCTGTCCAGC 7 7819 7836 3-10-5 762 599243
2585 2602 Exon 18 TCCCACGCCCCTGTCCAG 47 7820 7837 3-10-5 763 599244
2586 2603 Exon 18 ATCCCACGCCCCTGTCCA 37 7821 7838 3-10-5 764 599245
2587 2604 Exon 18 AATCCCACGCCCCTGTCC 35 7822 7839 3-10-5 765 599246
2588 2605 Exon 18 CAATCCCACGCCCCTGTC 21 7823 7840 3-10-5 766 599247
2589 2606 Exon 18 TCAATCCCACGCCCCTGT 61 7824 7841 3-10-5 767 599248
2590 2607 Exon 18 TTCAATCCCACGCCCCTG 51 7825 7842 3-10-5 768 599249
2591 2608 Exon 18 ATTCAATCCCACGCCCCT 58 7826 7843 3-10-5 769 599250
2592 2609 Exon 18 AATTCAATCCCACGCCCC 49 7827 7844 3-10-5 770 599251
2593 2610 Exon 18 TAATTCAATCCCACGCCC 46 7828 7845 3-10-5 771 599252
2594 2611 Exon 18 TTAATTCAATCCCACGCC 32 7829 7846 3-10-5 772 599253
2595 2612 Exon 18 TTTAATTCAATCCCACGC 23 7830 7847 3-10-5 773 599254
2596 2613 Exon 18 TTTTAATTCAATCCCACG 0 7831 7848 3-10-5 774 599255
2597 2614 Exon 18 GTTTTAATTCAATCCCAC 61 7832 7849 3-10-5 775 599256
2598 2615 Exon 18 TGTTTTAATTCAATCCCA 64 7833 7850 3-10-5 776 599257
2599 2616 Exon 18 CTGTTTTAATTCAATCCC 66 7834 7851 3-10-5 777 599258
2600 2617 Exon 18 GCTGTTTTAATTCAATCC 59 7835 7852 3-10-5 778 599259
2601 2618 Exon 18 AGCTGTTTTAATTCAATC 40 7836 7853 3-10-5 779 599260
2602 2619 Exon 18 CAGCTGTTTTAATTCAAT 38 7837 7854 3-10-5 780 599261
2603 2620 Exon 18 GCAGCTGTTTTAATTCAA 54 7838 7855 3-10-5 781 599509
2552 2570 Exon 18 TAGAAAACCCAAATCCTCA 54 7787 7805 6-7-6 681 599273
2553 2571 Exon 18 ATAGAAAACCCAAATCCTC 0 7788 7806 6-7-6 682 599274
2554 2572 Exon 18 TATAGAAAACCCAAATCCT 57 7789 7807 6-7-6 683 599275
2556 2574 Exon 18 CTTATAGAAAACCCAAATC 0 7791 7809 6-7-6 684 599276
2557 2575 Exon 18 CCTTATAGAAAACCCAAAT 44 7792 7810 6-7-6 685 599277
2558 2576 Exon 18 CCCTTATAGAAAACCCAAA 0 7793 7811 6-7-6 686 599278
2559 2577 Exon 18 CCCCTTATAGAAAACCCAA 0 7794 7812 6-7-6 687 599279
2560 2578 Exon 18 ACCCCTTATAGAAAACCCA 20 7795 7813 6-7-6 688 599280
2561 2579 Exon 18 AACCCCTTATAGAAAACCC 70 7796 7814 6-7-6 689 532917
2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 85 7839 7858 5-10-5 317
599262 2604 2621 Exon 18 CGCAGCTGTTTTAATTCA 49 7839 7856 3-10-5 782
599263 2605 2622 Exon 18 TCGCAGCTGTTTTAATTC 49 7840 7857 3-10-5 783
599264 2606 2623 Exon 18 GTCGCAGCTGTTTTAATT 62 7841 7858 3-10-5 784
599265 2607 2624 Exon 18 TGTCGCAGCTGTTTTAAT 63 7842 7859 3-10-5 792
599266 2608 2625 Exon 18 TTGTCGCAGCTGTTTTAA 41 7843 7860 3-10-5 793
599267 2609 2626 Exon 18 GTTGTCGCAGCTGTTTTA 52 7844 7861 3-10-5 794
599268 2610 2627 Exon 18 TGTTGTCGCAGCTGTTTT 51 7845 7862 3-10-5 795
599269 2611 2628 Exon 18 / TTGTTGTCGCAGCTGTTT 58 n/a n/a 3-10-5 796
Repeat 599270 2612 2629 Exon 18 / TTTGTTGTCGCAGCTGTT 69 n/a n/a
3-10-5 797 Repeat 599271 2613 2630 Exon 18 / TTTTGTTGTCGCAGCTGT 69
n/a n/a 3-10-5 798 Repeat 599272 2614 2631 Exon 18 /
TTTTTGTTGTCGCAGCTG 72 n/a n/a 3-10-5 799 Repeat 599205 2607 2624
Exon 18 TGTCGCAGCTGTTTTAAT 54 7842 7859 5-8-5 792 599206 2608 2625
Exon 18 TTGTCGCAGCTGTTTTAA 62 7843 7860 5-8-5 793 599207 2609 2626
Exon 18 GTTGTCGCAGCTGTTTTA 62 7844 7861 5-8-5 794 599208 2610 2627
Exon 18 TGTTGTCGCAGCTGTTTT 66 7845 7862 5-8-5 795 599209 2611 2628
Exon 18 / TTGTTGTCGCAGCTGTTT 60 n/a n/a 5-8-5 796 Repeat 599210
2612 2629 Exon 18 / TTTGTTGTCGCAGCTGTT 62 n/a n/a 5-8-5 797 Repeat
599211 2613 2630 Exon 18 / TTTTGTTGTCGCAGCTGT 65 n/a n/a 5-8-5 798
Repeat 599212 2614 2631 Exon 18 / TTTTTGTTGTCGCAGCTG 67 n/a n/a
5-8-5 799 Repeat
TABLE-US-00025 TABLE 24 Inhibition of CFB mRNA by 5-10-5 MOE
gapmers targeting SEQ ID NO: 1 or SEQ ID NO: 2 SEQ SEQ ID ID SEQ
SEQ NO: NO: ID ID 1 1 NO: 2 NO: 2 SEQ ISIS start stop Target %
start stop ID NO site site region Sequence inhibition site site NO:
588570 150 169 Exon 1 TGGTCACATTCCCTTCCCCT 72 1871 1890 396 588571
152 171 Exon 1 CCTGGTCACATTCCCTTCCC 80 1873 1892 397 532614 154 173
Exon 1 GACCTGGTCACATTCCCTTC 65 1875 1894 12 588572 156 175 Exon 1
TAGACCTGGTCACATTCCCT 74 1877 1896 398 588573 158 177 Exon 1
CCTAGACCTGGTCACATTCC 72 1879 1898 399 588566 2189 2208 Exon 15
CCTTCCGAGTCAGCTTTTTC 66 6977 6996 400 588567 2191 2210 Exon 15
CTCCTTCCGAGTCAGCTTTT 66 6979 6998 401 532770 2193 2212 Exon 15
ACCTCCTTCCGAGTCAGCTT 64 6981 7000 198 588568 2195 2214 Exon 15
AGACCTCCTTCCGAGTCAGC 78 6983 7002 402 588569 2197 2216 Exon 15
GTAGACCTCCTTCCGAGTCA 74 6985 7004 403 588574 2453 2472 Exon 18
TTTGCCGCTTCTGGTTTTTG 71 7688 7707 404 588575 2455 2474 Exon 18
CTTTTGCCGCTTCTGGTTTT 72 7690 7709 405 532800 2457 2476 Exon 18
TGCTTTTGCCGCTTCTGGTT 71 7692 7711 228 588576 2459 2478 Exon 18
CCTGCTTTTGCCGCTTCTGG 59 7694 7713 406 588577 2461 2480 Exon 18
TACCTGCTTTTGCCGCTTCT 76 7696 7715 407 516350 2550 2569 Exon 18
AGAAAACCCAAATCCTCATC 58 7785 7804 408 588509 2551 2570 Exon 18
TAGAAAACCCAAATCCTCAT 6 7786 7805 409 588510 2552 2571 Exon 18
ATAGAAAACCCAAATCCTCA 10 7787 7806 410 588511 2553 2572 Exon 18
TATAGAAAACCCAAATCCTC 9 7788 7807 411 588512 2554 2573 Exon 18
TTATAGAAAACCCAAATCCT 80 7789 7808 412 588513 2555 2574 Exon 18
CTTATAGAAAACCCAAATCC 70 7790 7809 413 588514 2556 2575 Exon 18
CCTTATAGAAAACCCAAATC 71 7791 7810 414 588515 2557 2576 Exon 18
CCCTTATAGAAAACCCAAAT 78 7792 7811 415 588516 2558 2577 Exon 18
CCCCTTATAGAAAACCCAAA 72 7793 7812 416 588517 2559 2578 Exon 18
ACCCCTTATAGAAAACCCAA 80 7794 7813 417 588518 2560 2579 Exon 18
AACCCCTTATAGAAAACCCA 80 7795 7814 418 588519 2561 2580 Exon 18
AAACCCCTTATAGAAAACCC 62 7796 7815 419 588520 2562 2581 Exon 18
GAAACCCCTTATAGAAAACC 59 7797 7816 420 588521 2563 2582 Exon 18
GGAAACCCCTTATAGAAAAC 40 7798 7817 421 588522 2564 2583 Exon 18
AGGAAACCCCTTATAGAAAA 66 7799 7818 422 588523 2565 2584 Exon 18
CAGGAAACCCCTTATAGAAA 63 7800 7819 423 588524 2566 2585 Exon 18
GCAGGAAACCCCTTATAGAA 70 7801 7820 424 588525 2567 2586 Exon 18
AGCAGGAAACCCCTTATAGA 67 7802 7821 425 588526 2568 2587 Exon 18
CAGCAGGAAACCCCTTATAG 0 7803 7822 426 588527 2569 2588 Exon 18
CCAGCAGGAAACCCCTTATA 11 7804 7823 427 588528 2570 2589 Exon 18
TCCAGCAGGAAACCCCTTAT 15 7805 7824 428 532809 2571 2590 Exon 18
GTCCAGCAGGAAACCCCTTA 75 7806 7825 237 588529 2572 2591 Exon 18
TGTCCAGCAGGAAACCCCTT 16 7807 7826 429 588530 2573 2592 Exon 18
CTGTCCAGCAGGAAACCCCT 16 7808 7827 430 588531 2574 2593 Exon 18
CCTGTCCAGCAGGAAACCCC 19 7809 7828 431 588532 2575 2594 Exon 18
CCCTGTCCAGCAGGAAACCC 15 7810 7829 432 588533 2576 2595 Exon 18
CCCCTGTCCAGCAGGAAACC 29 7811 7830 433 532810 2577 2596 Exon 18
GCCCCTGTCCAGCAGGAAAC 74 7812 7831 238 588534 2578 2597 Exon 18
CGCCCCTGTCCAGCAGGAAA 21 7813 7832 434 588535 2579 2598 Exon 18
ACGCCCCTGTCCAGCAGGAA 16 7814 7833 435 588536 2580 2599 Exon 18
CACGCCCCTGTCCAGCAGGA 0 7815 7834 436 588537 2581 2600 Exon 18
CCACGCCCCTGTCCAGCAGG 8 7816 7835 437 588538 2582 2601 Exon 18
CCCACGCCCCTGTCCAGCAG 10 7817 7836 438 588539 2583 2602 Exon 18
TCCCACGCCCCTGTCCAGCA 23 7818 7837 439 588540 2584 2603 Exon 18
ATCCCACGCCCCTGTCCAGC 16 7819 7838 440 588541 2585 2604 Exon 18
AATCCCACGCCCCTGTCCAG 16 7820 7839 441 588542 2586 2605 Exon 18
CAATCCCACGCCCCTGTCCA 12 7821 7840 442 588543 2587 2606 Exon 18
TCAATCCCACGCCCCTGTCC 26 7822 7841 443 588544 2588 2607 Exon 18
TTCAATCCCACGCCCCTGTC 26 7823 7842 444 588545 2589 2608 Exon 18
ATTCAATCCCACGCCCCTGT 31 7824 7843 445 588546 2590 2609 Exon 18
AATTCAATCCCACGCCCCTG 22 7825 7844 446 588547 2591 2610 Exon 18
TAATTCAATCCCACGCCCCT 12 7826 7845 447 588548 2592 2611 Exon 18
TTAATTCAATCCCACGCCCC 20 7827 7846 448 588549 2593 2612 Exon 18
TTTAATTCAATCCCACGCCC 26 7828 7847 449 588550 2594 2613 Exon 18
TTTTAATTCAATCCCACGCC 32 7829 7848 450 588551 2595 2614 Exon 18
GTTTTAATTCAATCCCACGC 48 7830 7849 451 588552 2596 2615 Exon 18
TGTTTTAATTCAATCCCACG 57 7831 7850 452 588553 2597 2616 Exon 18
CTGTTTTAATTCAATCCCAC 49 7832 7851 453 588554 2598 2617 Exon 18
GCTGTTTTAATTCAATCCCA 64 7833 7852 454 532811 2599 2618 Exon 18
AGCTGTTTTAATTCAATCCC 78 7834 7853 239 588555 2600 2619 Exon 18
CAGCTGTTTTAATTCAATCC 48 7835 7854 455 588556 2601 2620 Exon 18
GCAGCTGTTTTAATTCAATC 55 7836 7855 456 588557 2602 2621 Exon 18
CGCAGCTGTTTTAATTCAAT 51 7837 7856 457 588558 2603 2622 Exon 18
TCGCAGCTGTTTTAATTCAA 51 7838 7857 458 532917 2604 2623 Exon 18
GTCGCAGCTGTTTTAATTCA 82 7839 7858 317 588559 2605 2624 Exon 18
TGTCGCAGCTGTTTTAATTC 58 7840 7859 459 588560 2606 2625 Exon 18
TTGTCGCAGCTGTTTTAATT 72 7841 7860 460 588561 2607 2626 Exon 18
GTTGTCGCAGCTGTTTTAAT 75 7842 7861 461 532952 2608 2627 Exon 18
TGTTGTCGCAGCTGTTTTAA 39 7843 7862 395 588562 2609 2628 Exon 18 /
TTGTTGTCGCAGCTGTTTTA 53 n/a n/a 462 Repeat 588563 2610 2629 Exon 18
/ TTTGTTGTCGCAGCTGTTTT 62 n/a n/a 463 Repeat 588564 2611 2630 Exon
18 / TTTTGTTGTCGCAGCTGTTT 63 n/a n/a 464 Repeat 588565 2612 2631
Exon 18 / TTTTTGTTGTCGCAGCTGTT 64 n/a n/a 465 Repeat
Example 8: Dose-Dependent Antisense Inhibition of Human CFB in
HepG2 Cells by 5-10-5 MOE Gapmers
[0449] Gapmers from studies described above exhibiting in vitro
inhibition of CFB mRNA were selected and tested at various doses in
HepG2 cells. Cells were plated at a density of 20,000 cells per
well and transfected using electroporation with 0.313 .mu.M, 0.625
.mu.M, 1.25 .mu.M, 2.50 .mu.M, 5.00 .mu.M, or 10.00 .mu.M
concentrations of antisense oligonucleotide, as specified in the
Table below. After a treatment period of approximately 16 hours,
RNA was isolated from the cells and CFB mRNA levels were measured
by quantitative real-time PCR. Human primer probe set RTS3459 was
used to measure mRNA levels. CFB mRNA levels were adjusted
according to total RNA content, as measured by RIBOGREEN.RTM..
Results are presented as percent inhibition of CFB, relative to
untreated control cells.
[0450] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented. CFB mRNA levels were
reduced in a dose-dependent manner in antisense oligonucleotide
treated cells.
TABLE-US-00026 TABLE 25 0.313 0.625 1.25 2.50 5.00 10.00 IC.sub.50
ISIS No .mu.M .mu.M .mu.M .mu.M .mu.M .mu.M (.mu.M) 532614 7 13 43
72 65 71 2.2 532635 12 0 3 28 0 0 >10 532692 26 0 12 52 55 74
3.7 532770 21 18 32 73 64 88 1.8 532775 8 0 26 35 47 59 6.2 532800
0 5 30 65 50 75 3.1 532809 12 30 28 40 46 66 4.6 532810 28 44 32 69
84 95 1.2 532811 66 83 90 94 97 99 <0.3 532917 64 85 88 96 97 99
<0.3 532952 50 53 68 80 91 94 0.4
Example 9: Dose-Dependent Antisense Inhibition of Human CFB in
HepG2 Cells
[0451] Gapmers from studies described above exhibiting in vitro
inhibition of CFB mRNA were selected and tested at various doses in
HepG2 cells. The antisense oligonucleotides were tested in a number
of experiments with similar culture conditions. The results for
each experiment are presented in separate tables shown below. Cells
were plated at a density of 20,000 cells per well and transfected
using electroporation with 0.08 .mu.M, 0.25 .mu.M, 0.74 .mu.M, 2.22
.mu.M, 6.67 .mu.M, and 20.00 .mu.M concentrations of antisense
oligonucleotide, as specified in the Table below. After a treatment
period of approximately 16 hours, RNA was isolated from the cells
and CFB mRNA levels were measured by quantitative real-time PCR.
Human primer probe set RTS3459 was used to measure mRNA levels. CFB
mRNA levels were adjusted according to total RNA content, as
measured by RIBOGREEN.RTM.. Results are presented as percent
inhibition of CFB, relative to untreated control cells.
[0452] The half maximal inhibitory concentration (ICso) of each
oligonucleotide is also presented. CFB mRNA levels were reduced in
a dose-dependent manner in antisense oligonucleotide treated
cells.
TABLE-US-00027 TABLE 26 0.08 0.25 0.74 2.22 6.67 20.00 IC.sub.50
ISIS No .mu.M .mu.M .mu.M .mu.M .mu.M .mu.M (.mu.M) 532811 19 53 81
87 96 97 0.2 588834 7 42 64 92 98 98 0.5 588835 11 30 66 89 97 97
0.5 588836 14 40 61 91 97 97 0.5 588837 6 39 67 89 96 97 0.5 588838
0 27 41 81 87 97 1.0 588842 17 51 68 86 93 95 0.3 588843 21 38 72
90 95 96 0.4 588870 9 31 56 88 95 97 0.6 588871 14 25 47 79 93 97
0.7 588872 18 28 59 84 92 97 0.6
TABLE-US-00028 TABLE 27 0.08 0.25 0.74 2.22 6.67 20.00 IC.sub.50
ISIS No .mu.M .mu.M .mu.M .mu.M .mu.M .mu.M (.mu.M) 532811 31 70 89
94 97 97 0.1 588844 31 60 77 91 95 96 0.1 588846 32 52 78 89 95 97
0.2 588847 22 52 77 91 95 97 0.2 588848 20 40 73 91 96 98 0.3
588851 40 52 82 94 97 97 0.1 588854 17 55 59 84 94 96 0.4 588855 10
32 56 82 93 96 0.6 588856 13 46 75 90 96 97 0.3 588857 11 52 73 94
96 97 0.3 588858 19 48 75 94 97 98 0.3
TABLE-US-00029 TABLE 28 0.08 0.25 0.74 2.22 6.67 20.00 IC.sub.50
ISIS No .mu.M .mu.M .mu.M .mu.M .mu.M .mu.M (.mu.M) 532811 42 66 88
96 97 98 0.1 588859 18 46 66 90 96 97 0.4 588860 55 80 94 97 97 97
<0.1 588861 24 61 86 93 96 97 0.2 588862 25 64 85 94 96 98 0.1
588863 50 73 89 96 96 98 <0.1 588864 52 80 92 96 98 98 <0.1
588865 46 72 91 96 96 99 <0.1 588866 47 76 88 96 97 98 <0.1
588867 43 69 83 92 96 99 0.1 588868 43 56 65 84 93 97 0.1
TABLE-US-00030 TABLE 29 0.08 0.25 0.74 2.22 6.67 20.00 IC.sub.50
ISIS No .mu.M .mu.M .mu.M .mu.M .mu.M .mu.M (.mu.M) 532810 0 14 38
72 89 96 1.2 532811 18 54 79 93 96 97 0.3 532952 19 34 73 87 94 96
0.4 588534 17 13 44 77 93 97 0.9 588544 12 43 69 86 89 93 0.4
588545 17 55 67 86 91 93 0.3 588546 10 32 67 85 91 93 0.6 588552 27
54 76 90 94 97 0.2 588553 32 68 87 93 95 97 0.1 588560 16 54 76 90
94 96 0.3 588561 18 45 68 85 93 96 0.4
TABLE-US-00031 TABLE 30 0.08 0.25 0.74 2.22 6.67 20.00 IC.sub.50
ISIS No .mu.M .mu.M .mu.M .mu.M .mu.M .mu.M (.mu.M) 532811 22 60 82
94 97 98 0.2 588536 2 38 65 90 96 97 0.6 588537 12 38 63 87 94 97
0.5 588547 19 35 61 86 93 97 0.5 588548 19 36 75 88 95 96 0.4
588554 0 76 92 95 97 97 <0.1 588555 31 61 89 96 97 98 0.1 588556
33 56 82 95 94 97 0.1 588562 12 39 71 87 94 97 0.4 588563 25 48 72
86 94 96 0.3 588564 15 33 63 89 91 97 0.5
TABLE-US-00032 TABLE 31 0.08 0.25 0.74 2.22 6.67 20.00 IC.sub.50
ISIS No .mu.M .mu.M .mu.M .mu.M .mu.M .mu.M (.mu.M) 532811 39 68 86
96 98 98 0.1 588538 0 40 82 94 97 98 0.3 588539 34 65 88 95 98 98
0.1 588540 30 51 81 91 97 98 0.2 588549 31 57 82 95 96 98 0.1
588550 34 65 88 96 98 98 0.1 588551 47 66 87 96 98 99 <0.1
588557 40 84 95 98 98 98 <0.1 588558 45 73 93 97 98 99 <0.1
588559 51 69 83 96 98 99 <0.1 588565 19 56 81 92 96 98 0.2
Example 10: Dose-Dependent Antisense Inhibition of Human CFB in
HepG2 Cells
[0453] Gapmers from studies described above exhibiting in vitro
inhibition of CFB mRNA were selected and tested at various doses in
HepG2 cells. The antisense oligonucleotides were tested in a number
of experiments with similar culture conditions. The results for
each experiment are presented in separate tables shown below. Cells
were plated at a density of 20,000 cells per well and transfected
using electroporation with 0.06 .mu.M, 0.25 .mu.M, 1.00 .mu.M, and
4.00 .mu.M concentrations of antisense oligonucleotide, as
specified in the Table below. After a treatment period of
approximately 16 hours, RNA was isolated from the cells and CFB
mRNA levels were measured by quantitative real-time PCR. Human
primer probe set RTS3459 was used to measure mRNA levels. CFB mRNA
levels were adjusted according to total RNA content, as measured by
RIBOGREEN.RTM.. Results are presented as percent inhibition of CFB,
relative to untreated control cells.
[0454] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented. CFB mRNA levels were
reduced in a dose-dependent manner in antisense oligonucleotide
treated cells.
TABLE-US-00033 TABLE 32 ISIS No 0.06 .mu.M 0.25 .mu.M 1.00 .mu.M
4.00 .mu.M IC.sub.50 (.mu.M) 532917 31 58 87 92 0.2 588860 18 50 79
93 0.3 599001 16 28 69 90 0.5 599024 14 32 74 90 0.4 599025 0 31 56
92 0.7 599032 28 44 62 88 0.3 599033 28 46 80 92 0.2 599077 8 20 59
80 0.8 599080 9 33 48 76 0.9 599086 7 22 53 83 0.8 599087 21 31 74
87 0.4 599088 13 37 69 82 0.5 599089 3 36 55 79 0.7 599093 25 59 79
88 0.2 599094 19 29 75 89 0.4 599095 29 43 67 87 0.3 599096 23 51
70 88 0.3 599149 20 53 82 92 0.3 599188 0 21 62 85 0.8
TABLE-US-00034 TABLE 33 ISIS No 0.06 .mu.M 0.25 .mu.M 1.00 .mu.M
4.00 .mu.M IC.sub.50 (.mu.M) 532917 0 42 81 91 0.4 588860 17 49 74
92 0.3 599155 29 52 67 87 0.3 599198 3 25 64 89 0.6 599201 13 26 67
91 0.5 599202 0 44 72 87 0.5 599203 22 41 75 88 0.3 599314 12 34 71
84 0.5 599316 7 37 66 88 0.5 599317 8 1 54 83 1.0 599321 8 33 70 85
0.5 599322 24 38 66 87 0.4 599327 22 32 66 89 0.4 599328 0 31 59 88
0.7 599330 5 43 67 84 0.5 599374 23 42 80 91 0.3 599378 21 57 80 93
0.2 599380 23 56 82 93 0.2 599432 17 37 73 93 0.4
TABLE-US-00035 TABLE 34 ISIS No 0.06 .mu.M 0.25 .mu.M 1.00 .mu.M
4.00 .mu.M IC.sub.50 (.mu.M) 532917 23 65 76 93 0.2 588860 17 60 76
90 0.3 601282 48 68 81 88 0.1 601269 18 59 80 94 0.2 601276 34 64
81 91 0.1 601275 14 39 78 90 0.4 601344 52 84 92 94 <0.06 601383
53 81 86 94 <0.06 601382 41 76 88 94 0.1 601385 52 74 89 91
<0.06 601332 41 69 86 94 0.1 601345 36 75 86 95 0.1 601371 34 72
91 93 0.1 601384 50 78 91 95 <0.06 601380 28 57 83 92 0.2 601387
48 61 82 88 0.1 601341 28 65 83 91 0.2 601346 31 69 82 93 0.1
601335 24 56 85 92 0.2
TABLE-US-00036 TABLE 35 ISIS No 0.06 .mu.M 0.25 .mu.M 1.00 .mu.M
4.00 .mu.M IC.sub.50 (.mu.M) 532917 31 66 86 93 0.1 588860 28 62 85
94 0.2 599208 24 50 71 89 0.3 599261 31 49 81 94 0.2 599267 41 48
80 88 0.2 599268 28 56 75 92 0.2 599313 14 24 71 92 0.5 599441 24
57 80 87 0.2 599494 13 55 86 94 0.3 599552 30 69 93 95 0.1 599553
34 71 93 96 0.1 599554 30 74 93 96 0.1 599568 40 77 90 97 0.1
599570 61 82 93 96 <0.06 599577 18 62 81 93 0.2 599581 27 60 80
94 0.2 599591 49 74 93 96 <0.06 599592 46 76 90 94 0.1 599593 44
72 91 95 0.1
TABLE-US-00037 TABLE 36 ISIS No 0.06 .mu.M 0.25 .mu.M 1.00 .mu.M
4.00 .mu.M IC.sub.50 (.mu.M) 532917 25 56 84 92 0.2 588860 11 51 80
92 0.3 599547 23 60 82 90 0.2 599569 42 73 85 88 0.1 599578 29 49
82 89 0.2 599582 21 56 78 91 0.2 599590 24 62 80 90 0.2 601209 21
49 85 88 0.3 601210 34 64 86 92 0.1 601212 46 68 88 90 0.1 601213
54 80 90 92 <0.06 601214 38 77 88 95 0.1 601215 42 64 85 92 0.1
601216 45 57 76 89 0.1 601264 29 58 86 95 0.2 601278 51 82 83 93
<0.06 601279 44 80 92 96 0.1 601280 44 73 87 94 0.1 601281 51 80
91 94 <0.06
Example 11: Dose-Dependent Antisense Inhibition of Human CFB in
HepG2 Cells
[0455] Gapmers from studies described above exhibiting in vitro
inhibition of CFB mRNA were selected and tested at various doses in
HepG2 cells. Additionally, a deoxy, MOE and cEt oligonucleotide,
ISIS 594430, was designed with the same sequence (CTCCTTCCGAGTCAGC,
SEQ ID NO: 549) and target region (target start site 2195 of SEQ ID
NO: 1 and target start site 6983 of SED ID NO: 2) as ISIS 588870,
another deoxy, MOE, and cEt oligonucleotide. ISIS 594430 is a
3-10-3 cEt gapmer.
[0456] Cells were plated at a density of 20,000 cells per well and
transfected using electroporation with 0.01 .mu.M, 0.04 .mu.M, 0.12
.mu.M, 0.37 .mu.M, 1.11 .mu.M, 3.33 .mu.M, and 10.00 .mu.M
concentrations of antisense oligonucleotide, as specified in the
Table below. After a treatment period of approximately 16 hours,
RNA was isolated from the cells and CFB mRNA levels were measured
by quantitative real-time PCR. Human primer probe set RTS3459 was
used to measure mRNA levels. CFB mRNA levels were adjusted
according to total RNA content, as measured by RIBOGREEN.RTM..
Results are presented as percent inhibition of CFB, relative to
untreated control cells.
[0457] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented. CFB mRNA levels were
reduced in a dose-dependent manner in antisense oligonucleotide
treated cells.
TABLE-US-00038 TABLE 37 0.01 0.04 0.12 0.37 1.11 3.33 10.00
IC.sub.50 ISIS No .mu.M .mu.M .mu.M .mu.M .mu.M .mu.M .mu.M (.mu.M)
588536 0 0 0 5 45 73 94 1.4 588548 0 0 0 19 52 78 90 1.2 588553 0 0
9 42 76 85 94 0.6 588555 0 52 23 58 78 83 95 0.3 588847 4 1 18 45
67 84 96 0.5 588848 0 3 13 38 67 83 95 0.6 594430 0 0 10 34 50 55
84 1.4
Example 12: Tolerability of MOE Gapmers Targeting Human CFB in CD1
Mice
[0458] CD1.RTM. mice (Charles River, Mass.) are a multipurpose
mouse model, frequently utilized for safety and efficacy testing.
The mice were treated with ISIS antisense oligonucleotides selected
from studies described above and evaluated for changes in the
levels of various plasma chemistry markers.
Study 1 (with 5-10-5 MOE Gapmers)
[0459] Groups of seven-week old male CD1 mice were injected
subcutaneously once a week for 6 weeks with 100 mg/kg of ISIS
oligonucleotide. A group of male CD1 mice was injected
subcutaneously once a week for 6 weeks with PBS. One group of mice
was injected with subcutaneously once a week for 6 weeks with 100
mg/kg of control oligonucleotide ISIS 141923 (CCTTCCCTGAAGGTTCCTCC,
designated herein as SEQ ID NO: 809, 5-10-5 MOE gapmer with no
known murine target). Mice were euthanized 48 hours after the last
dose, and organs and plasma were harvested for further
analysis.
Plasma Chemistry Markers
[0460] To evaluate the effect of ISIS oligonucleotides on liver and
kidney function, plasma levels of transaminases, and BUN were
measured using an automated clinical chemistry analyzer (Hitachi
Olympus AU400e, Melville, N.Y.). The results are presented in the
Table below. ISIS oligonucleotides that caused changes in the
levels of any of the liver or kidney function markers outside the
expected range for antisense oligonucleotides were excluded in
further studies.
TABLE-US-00039 TABLE 38 Plasma chemistry markers in CD1 mice plasma
on day 40 ALT AST BUN (IU/L) (IU/L) (mg/dL) PBS 25 46 20 ISIS
532614 513 407 22 ISIS 532692 131 130 24 ISIS 532770 36 53 25 ISIS
532775 193 158 23 ISIS 532800 127 110 25 ISIS 532809 36 42 22 ISIS
532810 229 286 26 ISIS 532811 197 183 21 ISIS 532917 207 204 27
ISIS 532952 246 207 25 ISIS 141923 39 67 23
Weights
[0461] Body weights of the mice were measured on day 40 before
sacrificing the mice. Weights of organs, liver, kidney, and spleen
were also measured after the mice were sacrificed. The results are
presented in the Table below. ISIS oligonucleotides that caused
changes in the weights outside the expected range for antisense
oligonucleotides were excluded in further studies.
TABLE-US-00040 TABLE 39 Weights (g) of CD1 mice on day 40 Body
Kidney Liver Spleen PBS 44 0.8 2.0 0.1 ISIS 532614 43 0.7 4.3 0.2
ISIS 532692 42 0.7 2.6 0.2 ISIS 532770 42 0.6 2.3 0.2 ISIS 532775
42 0.7 2.5 0.2 ISIS 532800 43 0.6 2.8 0.3 ISIS 532809 42 0.6 2.2
0.1 ISIS 532810 43 0.6 2.3 0.2 ISIS 532811 41 0.7 2.4 0.2 ISIS
532917 42 0.7 3.0 0.2 ISIS 532952 44 0.8 2.5 0.3 ISIS 141923 41 0.6
2.0 0.1
Study 2 (with 5-10-5 MOE Gapmers)
[0462] Groups of six- to eight-week old male CD1 mice were injected
subcutaneously once a week for 6 weeks with 100 mg/kg of ISIS
oligonucleotide. Two groups of male CD1 mice were injected
subcutaneously once a week for 6 weeks with PBS. One group of mice
was injected with subcutaneously once a week for 6 weeks with 100
mg/kg of control oligonucleotide ISIS 141923. Mice were euthanized
48 hours after the last dose, and organs and plasma were harvested
for further analysis.
Plasma Chemistry Markers
[0463] To evaluate the effect of ISIS oligonucleotides on liver and
kidney function, plasma levels of transaminases, albumin, and BUN
were measured using an automated clinical chemistry analyzer
(Hitachi Olympus AU400e, Melville, N.Y.). The results are presented
in the Table below. ISIS oligonucleotides that caused changes in
the levels of any of the liver or kidney function markers outside
the expected range for antisense oligonucleotides were excluded in
further studies.
TABLE-US-00041 TABLE 40 Plasma chemistry markers in CD1 mice plasma
on day 45 ALT AST Albumin BUN (IU/L) (IU/L) (g/dL) (mg/dL) PBS 39
53 2.9 29 PBS 50 97 2.9 30 ISIS 141923 163 174 4.1 25 ISIS 532810
321 297 2.5 26 ISIS 532952 182 199 2.7 27 ISIS 588534 276 248 2.6
29 ISIS 588536 48 60 2.9 31 ISIS 588537 72 79 4.0 25 ISIS 588538 63
67 4.5 29 ISIS 588539 238 177 3.9 28 ISIS 588545 496 256 4.4 24
ISIS 588547 323 210 4.4 25 ISIS 588548 61 63 4.2 27 ISIS 588549 127
132 4.1 23 ISIS 588551 302 282 4.2 22 ISIS 588552 76 98 4.0 30 ISIS
588558 1066 521 3.9 27 ISIS 588559 76 94 4.1 26 ISIS 588561 502 500
4.4 26 ISIS 588563 50 99 4.4 28
Weights
[0464] Body weights of the mice were measured on day 42. Weights of
organs, liver, kidney, and spleen were also measured after the mice
were sacrificed on day 45. The results are presented in the Table
below. ISIS oligonucleotides that caused changes in the weights
outside the expected range for antisense oligonucleotides were
excluded in further studies.
TABLE-US-00042 TABLE 41 Weights (g) of CD1 mice on day 40 Body
Kidney Liver Spleen PBS 44 0.7 2.4 0.1 PBS 43 0.7 2.4 0.2 ISIS
141923 43 0.6 2.4 0.2 ISIS 532810 41 0.6 1.9 0.1 ISIS 532952 43 0.6
2.4 0.2 ISIS 588534 44 0.7 2.8 0.2 ISIS 588536 43 0.7 2.7 0.2 ISIS
588537 43 0.7 2.4 0.2 ISIS 588538 44 0.7 2.8 0.2 ISIS 588539 44 0.6
2.7 0.2 ISIS 588545 44 0.8 3.3 0.3 ISIS 588547 42 0.6 3.3 0.3 ISIS
588548 43 0.6 2.8 0.2 ISIS 588549 42 0.6 2.8 0.3 ISIS 588551 39 0.6
2.2 0.2 ISIS 588552 41 0.6 2.2 0.2 ISIS 588558 44 0.7 3.3 0.3 ISIS
588559 43 0.6 2.7 0.3 ISIS 588561 40 0.7 2.4 0.3 ISIS 588563 41 0.7
2.4 0.2
Study 3 (with 5-10-5 MOE Gapmers)
[0465] Groups of six- to eight-week old male CD1 mice were injected
subcutaneously once a week for 6 weeks with 100 mg/kg of ISIS
oligonucleotide. Two groups of male CD1 mice were injected
subcutaneously once a week for 6 weeks with PBS. Mice were
euthanized 48 hours after the last dose, and organs and plasma were
harvested for further analysis.
Plasma Chemistry Markers
[0466] To evaluate the effect of ISIS oligonucleotides on liver and
kidney function, plasma levels of transaminases, albumin, and BUN
were measured using an automated clinical chemistry analyzer
(Hitachi Olympus AU400e, Melville, N.Y.). The results are presented
in the Table below. ISIS oligonucleotides that caused changes in
the levels of any of the liver or kidney function markers outside
the expected range for antisense oligonucleotides were excluded in
further studies.
TABLE-US-00043 TABLE 42 Plasma chemistry markers in CD1 mice plasma
on day 42 ALT AST Albumin BUN (IU/L) (IU/L) (g/dL) (mg/dL) PBS 37
108 3.1 30 PBS 45 51 3.0 27 ISIS 588544 209 168 2.9 26 ISIS 588546
526 279 3.0 22 ISIS 588550 82 136 2.7 25 ISIS 588553 79 105 3.0 24
ISIS 588554 112 220 3.2 19 ISIS 588555 95 162 2.8 25 ISIS 588556
345 236 3.0 26 ISIS 588557 393 420 2.8 24 ISIS 588560 109 148 2.7
27 ISIS 588562 279 284 2.8 22 ISIS 588564 152 188 3.0 23 ISIS
588565 247 271 2.8 28
Weights
[0467] Body weights of the mice were measured on day 42. Weights of
organs, liver, kidney, and spleen were also measured after the mice
were sacrificed on day 42. The results are presented in the Table
below. ISIS oligonucleotides that caused changes in the weights
outside the expected range for antisense oligonucleotides were
excluded in further studies.
TABLE-US-00044 TABLE 43 Weights (g) of CD1 mice on day 40 Body
Kidney Liver Spleen PBS 42 0.7 2.4 0.1 PBS 41 0.7 2.4 0.2 ISIS
588544 44 0.6 1.9 0.1 ISIS 588546 43 0.6 2.4 0.2 ISIS 588550 41 0.7
2.8 0.2 ISIS 588553 44 0.7 2.7 0.2 ISIS 588554 40 0.7 2.4 0.2 ISIS
588555 44 0.7 2.8 0.2 ISIS 588556 39 0.6 2.7 0.2 ISIS 588557 41 0.8
3.3 0.3 ISIS 588560 38 0.6 3.2 0.3 ISIS 588562 41 0.6 2.8 0.2 ISIS
588564 40 0.6 2.8 0.3 ISIS 588565 39 0.6 2.2 0.2
Study 4 (with (S) cEt Gapmers and Deoxy, MOE and cEt
Oligonucleotides)
[0468] Groups often-week old male CD1 mice were injected
subcutaneously once a week for 6 weeks with 50 mg/kg of ISIS
oligonucleotide from the studies described above. In addition, two
oligonucleotides, ISIS 594431 and ISIS 594432, were designed as
3-10-3 cEt gapmers and were also tested in this study. ISIS 594431
(ACCTCCTTCCGAGTCA, SEQ ID NO: 550) targets the same region as ISIS
588871, a deoxy, MOE and cEt gapmer (target start site 2197 of SEQ
ID NO: 1 and target start site 6985 of SEQ ID NO: 2). ISIS 594432
(TGGTCACATTCCCTTC, SEQ ID NO: 542) targets the same region as ISIS
588872 a deoxy, MOE and cEt gapmer (target start site 154 of SEQ ID
NO: 1 and target start site 1875 of SEQ ID NO: 2).
[0469] Two groups of male CD1 mice were injected subcutaneously
once a week for 6 weeks with PBS. Mice were euthanized 48 hours
after the last dose, and organs and plasma were harvested for
further analysis.
Plasma Chemistry Markers
[0470] To evaluate the effect of ISIS oligonucleotides on liver and
kidney function, plasma levels of transaminases, albumin,
creatinine, and BUN were measured using an automated clinical
chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). The
results are presented in the Table below. ISIS oligonucleotides
that caused changes in the levels of any of the liver or kidney
function markers outside the expected range for antisense
oligonucleotides were excluded in further studies.
TABLE-US-00045 TABLE 44 Plasma chemistry markers in CD1 mice plasma
on day 42 AST Albumin Creatinine BUN Chemistry ALT (IU/L) (IU/L)
(g/dL) (mg/dL) (mg/dL) PBS -- 71 77 2.7 0.2 29 PBS -- 30 36 2.7 0.2
26 ISIS 588834 Deoxy, MOE and cEt 436 510 2.8 0.2 25 ISIS 588835
Deoxy, MOE and cEt 70 98 3.0 0.2 27 ISIS 588836 Deoxy, MOE and cEt
442 312 2.7 0.2 27 ISIS 588846 Deoxy, MOE and cEt 50 75 2.5 0.1 28
ISIS 588847 Deoxy, MOE and cEt 44 71 2.6 0.1 24 ISIS 588848 Deoxy,
MOE and cEt 47 70 2.4 0.1 27 ISIS 588857 Deoxy, MOE and cEt 1287
655 2.7 0.2 26 ISIS 588858 Deoxy, MOE and cEt 1169 676 2.5 0.2 26
ISIS 588859 Deoxy, MOE and cEt 1036 1300 3.2 0.2 25 ISIS 588861
Deoxy, MOE and cEt 749 466 3.1 0.1 24 ISIS 588862 Deoxy, MOE and
cEt 1564 1283 2.9 0.2 22 ISIS 588863 Deoxy, MOE and cEt 477 362 2.8
0.1 23 ISIS 588864 Deoxy, MOE and cEt 118 165 2.9 0.2 27 ISIS
588866 Deoxy, MOE and cEt 843 784 3.2 0.2 25 ISIS 594430 3-10-3 cEt
89 99 2.4 0.1 28 ISIS 594431 3-10-3 cEt 590 433 3.0 0.2 24 ISIS
594432 3-10-3 cEt 2595 2865 2.4 0.1 25
Weights
[0471] Body weights of the mice were measured on day 39. Weights of
organs, liver, kidney, and spleen were also measured after the mice
were sacrificed on day 42. The results are presented in the Table
below. ISIS oligonucleotides that caused changes in the weights
outside the expected range for antisense oligonucleotides were
excluded in further studies.
TABLE-US-00046 TABLE 45 Weights (g) of CD1 mice Chemistry Body
Kidney Liver Spleen PBS -- 37 0.6 2.1 0.1 PBS -- 45 0.7 2.5 0.2
ISIS 588834 Deoxy, MOE and cEt 40 0.6 3.2 0.2 ISIS 588835 Deoxy,
MOE and cEt 38 0.7 2.8 0.3 ISIS 588836 Deoxy, MOE and cEt 41 0.7
2.3 0.2 ISIS 588837 Deoxy, MOE and cEt 38 0.6 2.4 0.3 ISIS 588846
Deoxy, MOE and cEt 39 0.6 2.3 0.2 ISIS 588847 Deoxy, MOE and cEt 40
0.7 2.5 0.2 ISIS 588848 Deoxy, MOE and cEt 43 0.7 2.6 0.3 ISIS
588857 Deoxy, MOE and cEt 39 0.6 3.3 0.2 ISIS 588858 Deoxy, MOE and
cEt 37 0.6 3.4 0.2 ISIS 588859 Deoxy, MOE and cEt 41 0.7 2.5 0.3
ISIS 588861 Deoxy, MOE and cEt 39 0.6 2.6 0.4 ISIS 588862 Deoxy,
MOE and cEt 34 0.6 2.5 0.4 ISIS 588863 Deoxy, MOE and cEt 40 0.6
2.7 0.3 ISIS 588864 Deoxy, MOE and cEt 40 0.7 2.3 0.2 ISIS 588866
Deoxy, MOE and cEt 45 0.7 3.0 0.2 ISIS 594430 3-10-3 cEt 39 0.6 2.2
0.2 ISIS 594431 3-10-3 cEt 36 0.6 3.2 0.2 ISIS 594432 3-10-3 cEt 31
0.4 1.9 0.1
Study 5 (with MOE Gapmers, (S) cEt Gapmers and Deoxy, MOE and cEt
Oligonucleotides)
[0472] Groups of eight- to nine-week old male CD1 mice were
injected subcutaneously once a week for 6 weeks with 50 mg/kg of
ISIS oligonucleotide. Two groups of male CD1 mice were injected
subcutaneously once a week for 6 weeks with PBS. Mice were
euthanized 48 hours after the last dose, and organs and plasma were
harvested for further analysis.
Plasma Chemistry Markers
[0473] To evaluate the effect of ISIS oligonucleotides on liver and
kidney function, plasma levels of transaminases, albumin,
creatinine, and BUN were measured using an automated clinical
chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). The
results are presented in the Table below. ISIS oligonucleotides
that caused changes in the levels of any of the liver or kidney
function markers outside the expected range for antisense
oligonucleotides were excluded in further studies.
TABLE-US-00047 TABLE 46 Plasma chemistry markers in CD1 mice plasma
on day 42 AST Albumin Creatinine BUN Chemistry ALT (IU/L) (IU/L)
(g/dL) (mg/dL) (mg/dL) PBS -- 33 84 2.9 0.2 28 PBS -- 32 65 2.5 0.1
27 ISIS 532692 5-10-5 MOE 363 281 3.0 0.2 30 ISIS 532770 5-10-5 MOE
69 100 2.9 0.1 28 ISIS 532775 5-10-5 MOE 371 333 2.6 0.1 29 ISIS
532800 5-10-5 MOE 104 106 2.7 0.1 31 ISIS 532809 5-10-5 MOE 69 127
2.8 0.1 26 ISIS 588540 5-10-5 MOE 66 110 2.8 0.1 26 ISIS 588838
3-10-3 cEt 391 330 2.9 0.1 25 ISIS 588842 Deoxy, MOE and cEt 224
264 2.6 0.1 26 ISIS 588843 3-10-3 cEt 185 160 2.8 0.1 24 ISIS
588844 Deoxy, MOE and cEt 304 204 2.7 0.1 25 ISIS 588851 Deoxy, MOE
and cEt 186 123 2.7 0.1 31 ISIS 588854 Deoxy, MOE and cEt 1232 925
2.7 0.1 25 ISIS 588855 Deoxy, MOE and cEt 425 321 2.7 0.1 28 ISIS
588856 Deoxy, MOE and cEt 78 101 2.4 0.1 31 ISIS 588865 Deoxy, MOE
and cEt 126 145 2.5 0.1 23 ISIS 588867 Deoxy, MOE and cEt 108 112
2.5 0.1 32 ISIS 588868 Deoxy, MOE and cEt 61 124 2.5 0.1 28 ISIS
588870 Deoxy, MOE and cEt 48 69 2.4 0.1 31 ISIS 588871 Deoxy, MOE
and cEt 723 881 2.5 0.1 24 ISIS 588872 Deoxy, MOE and cEt 649 654
2.7 0.1 26
Weights
[0474] Body weights of the mice were measured on day 40. Weights of
organs, liver, kidney, and spleen were also measured after the mice
were sacrificed on day 42. The results are presented in the Table
below. ISIS oligonucleotides that caused changes in the weights
outside the expected range for antisense oligonucleotides were
excluded in further studies.
TABLE-US-00048 TABLE 47 Weights (g) of CD1 mice Chemistry Body
Kidney Liver Spleen PBS -- 46 0.7 2.3 0.2 PBS -- 44 0.7 2.3 0.2
ISIS 532692 5-10-5 MOE 44 0.6 2.8 0.2 ISIS 532770 5-10-5 MOE 43 0.6
2.2 0.2 ISIS 532775 5-10-5 MOE 43 0.6 2.8 0.2 ISIS 532800 5-10-5
MOE 47 0.7 2.9 0.2 ISIS 532809 5-10-5 MOE 44 0.7 2.6 0.2 ISIS
588540 5-10-5 MOE 44 0.7 2.5 0.2 ISIS 588838 3-10-3 cEt 45 0.7 3.1
0.2 ISIS 588842 Deoxy, MOE and cEt 41 0.6 2.6 0.2 ISIS 588843
3-10-3 cEt 43 0.7 2.9 0.2 ISIS 588844 Deoxy, MOE and cEt 43 0.7 2.8
0.2 ISIS 588851 Deoxy, MOE and cEt 46 0.6 2.6 0.2 ISIS 588854
Deoxy, MOE and cEt 45 0.7 4.1 0.2 ISIS 588855 Deoxy, MOE and cEt 44
0.7 2.9 0.3 ISIS 588856 Deoxy, MOE and cEt 44 0.7 3.2 0.2 ISIS
588865 Deoxy, MOE and cEt 45 0.7 2.6 0.3 ISIS 588867 Deoxy, MOE and
cEt 46 0.7 3.2 0.3 ISIS 588868 Deoxy, MOE and cEt 42 0.7 2.9 0.3
ISIS 588870 Deoxy, MOE and cEt 43 0.6 2.2 0.2 ISIS 588871 Deoxy,
MOE and cEt 41 0.7 3.1 0.2 ISIS 588872 Deoxy, MOE and cEt 39 0.6
3.2 0.3
Study 6 (with Deoxy, MOE and cEt Oligonucleotides)
[0475] Groups of eight- to nine-week old male CD1 mice were
injected subcutaneously once a week for 6 weeks with 50 mg/kg of
deoxy, MOE, and cEt oligonucleotides. Two groups of male CD1 mice
were injected subcutaneously once a week for 6 weeks with PBS. Mice
were euthanized 48 hours after the last dose, and organs and plasma
were harvested for further analysis.
Plasma Chemistry Markers
[0476] To evaluate the effect of ISIS oligonucleotides on liver and
kidney function, plasma levels of transaminases, albumin,
creatinine, bilirubin, and BUN were measured using an automated
clinical chemistry analyzer (Hitachi Olympus AU400e, Melville,
N.Y.). The results are presented in the Table below. ISIS
oligonucleotides that caused changes in the levels of any of the
liver or kidney function markers outside the expected range for
antisense oligonucleotides were excluded in further studies.
TABLE-US-00049 TABLE 48 Plasma chemistry markers in CD1 mice plasma
on day 45 Albumin Creatinine Bilirubin BUN ALT (IU/L) AST (IU/L)
(g/dL) (mg/dL) (mg/dL) (mg/dL) PBS 39 78 3.4 0.2 0.2 31 PBS 37 59
2.9 0.1 0.2 27 ISIS 599552 167 208 3.0 0.1 0.2 32 ISIS 599553 43 86
2.9 0.1 0.2 28 ISIS 599554 57 101 2.2 0.2 0.2 31 ISIS 599569 469
530 3.5 0.2 0.3 27 ISIS 599577 37 84 2.9 0.1 0.1 31 ISIS 599578 45
104 2.8 0.1 0.2 30 ISIS 599581 54 88 3.1 0.1 0.2 31 ISIS 599590
1741 1466 3.1 0.1 0.3 25 ISIS 599591 2230 1183 3.2 0.1 0.3 27 ISIS
601209 68 104 2.9 0.1 0.2 30 ISIS 601212 1795 968 3.2 0.1 0.3 22
ISIS 601215 424 385 3.1 0.1 0.4 25 ISIS 601216 90 125 2.9 0.1 0.2
29 ISIS 601276 946 366 2.9 0.1 0.5 31 ISIS 601282 831 540 3.3 0.2
0.2 32
Weights
[0477] Body weights of the mice were measured on day 40. Weights of
organs, liver, kidney, and spleen were also measured after the mice
were sacrificed on day 45. The results are presented in the Table
below. ISIS oligonucleotides that caused changes in the weights
outside the expected range for antisense oligonucleotides were
excluded in further studies.
TABLE-US-00050 TABLE 49 Weights (g) of CD1 mice Body Kidney Liver
Spleen PBS 40 0.7 2.1 0.2 PBS 42 0.8 2.3 0.2 ISIS 599552 38 0.6 2.3
0.2 ISIS 599553 39 0.7 2.2 0.2 ISIS 599554 39 0.7 2.4 0.2 ISIS
599569 39 0.7 2.2 0.2 ISIS 599577 41 0.7 2.5 0.2 ISIS 599578 37 0.6
2.0 0.2 ISIS 599581 40 0.6 2.5 0.2 ISIS 599590 34 0.6 3.5 0.2 ISIS
599591 38 0.8 2.7 0.2 ISIS 601209 42 0.7 2.6 0.3 ISIS 601212 38 0.6
2.9 0.2 ISIS 601215 36 0.7 2.6 0.2 ISIS 601216 42 0.6 2.7 0.2 ISIS
601276 42 0.7 3.2 0.2 ISIS 601282 38 0.7 3.2 0.2
Study 7 (with MOE Gapmers and Deoxy, MOE and cEt
Oligonucleotides)
[0478] Groups of eight- to nine-week old male CD1 mice were
injected subcutaneously once a week for 6 weeks with 100 mg/kg of
ISIS oligonucleotides. One group of male CD1 mice was injected
subcutaneously once a week for 6 weeks with PBS. Mice were
euthanized 48 hours after the last dose, and organs and plasma were
harvested for further analysis.
Plasma Chemistry Markers
[0479] To evaluate the effect of ISIS oligonucleotides on liver and
kidney function, plasma levels of transaminases, albumin,
creatinine, and BUN were measured using an automated clinical
chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). The
results are presented in the Table below. ISIS oligonucleotides
that caused changes in the levels of any of the liver or kidney
function markers outside the expected range for antisense
oligonucleotides were excluded in further studies.
TABLE-US-00051 TABLE 50 Plasma chemistry markers in CD1 mice plasma
on day 45 AST Albumin Creatinine BUN Chemistry ALT (IU/L) (IU/L)
(g/dL) (mg/dL) (mg/dL) PBS -- 20 102 2.7 0.2 26 ISIS 588842 Deoxy,
MOE and cEt 177 164 2.7 0.1 23 ISIS 588843 Deoxy, MOE and cEt 98
194 2.7 0.1 24 ISIS 588851 Deoxy, MOE and cEt 91 142 2.6 0.1 23
ISIS 588856 Deoxy, MOE and cEt 78 110 2.7 0.1 23 ISIS 599024 3-10-4
MOE 91 108 2.7 0.1 23 ISIS 599087 5-7-5 MOE 198 183 2.6 0.2 28 ISIS
599093 5-7-5 MOE 3285 2518 2.6 0.2 24 ISIS 599149 4-8-5 MOE 30 64
2.9 0.2 25 ISIS 599155 4-8-5 MOE 145 189 2.6 0.2 25 ISIS 599202
5-8-5 MOE 150 128 2.8 0.2 23 ISIS 599203 5-8-5 MOE 111 127 2.8 0.2
24 ISIS 599208 5-8-5 MOE 146 178 2.9 0.2 22 ISIS 599261 3-10-5 MOE
144 165 2.8 0.2 26 ISIS 599267 3-10-5 MOE 96 132 2.6 0.2 27 ISIS
599268 3-10-5 MOE 87 115 2.6 0.1 23 ISIS 599322 6-7-6 MOE 115 138
2.7 0.1 22 ISIS 599374 5-9-5 MOE 375 271 2.6 0.1 21 ISIS 599378
5-9-5 MOE 77 99 2.7 0.1 23 ISIS 599441 6-8-6 MOE 150 250 2.9 0.1
23
Weights
[0480] Body weights of the mice were measured on day 44. Weights of
organs, liver, kidney, and spleen were also measured after the mice
were sacrificed on day 49. The results are presented in the Table
below. ISIS oligonucleotides that caused changes in the weights
outside the expected range for antisense oligonucleotides were
excluded in further studies.
TABLE-US-00052 TABLE 51 Weights (g) of CD1 mice Chemistry Body
Kidney Liver Spleen PBS -- 39 0.6 1.9 0.1 ISIS 588842 Deoxy, MOE
and cEt 38 0.5 2.1 0.1 ISIS 588843 Deoxy, MOE and cEt 41 0.6 2.4
0.2 ISIS 588851 Deoxy, MOE and cEt 42 0.6 2.2 0.2 ISIS 588856
Deoxy, MOE and cEt 42 0.7 2.6 0.2 ISIS 599024 3-10-4 MOE 41 0.6 4.0
0.2 ISIS 599087 5-7-5 MOE 44 0.8 2.6 0.3 ISIS 599093 5-7-5 MOE 39
0.6 2.3 0.2 ISIS 599149 4-8-5 MOE 42 0.7 2.8 0.2 ISIS 599155 4-8-5
MOE 41 0.7 2.1 0.2 ISIS 599202 5-8-5 MOE 43 0.6 2.6 0.2 ISIS 599203
5-8-5 MOE 42 0.6 2.6 0.2 ISIS 599208 5-8-5 MOE 40 0.6 2.1 0.2 ISIS
599261 3-10-5 MOE 39 0.7 3.4 0.3 ISIS 599267 3-10-5 MOE 42 0.8 2.5
0.3 ISIS 599268 3-10-5 MOE 41 0.7 2.1 0.2 ISIS 599322 6-7-6 MOE 43
0.6 2.2 0.2 ISIS 599374 5-9-5 MOE 37 0.6 2.2 0.2 ISIS 599378 5-9-5
MOE 43 0.7 2.7 0.2 ISIS 599441 6-8-6 MOE 42 0.6 2.5 0.3
Study 8 (with MOE Gapmers, Deoxy, MOE and cEt Oligonucleotides, and
cEt Gapmers)
[0481] Groups of eight- to nine-week old male CD1 mice were
injected subcutaneously once a week for 6 weeks with 100 mg/kg of
MOE gapmers, or 50 mg/kg of deoxy, MOE and cEt oligonucleotides or
cEt gapmers. One group of male CD1 mice was injected subcutaneously
once a week for 6 weeks with PBS. Mice were euthanized 48 hours
after the last dose, and organs and plasma were harvested for
further analysis.
Plasma Chemistry Markers
[0482] To evaluate the effect of ISIS oligonucleotides on liver and
kidney function, plasma levels of transaminases, albumin,
creatinine, and BUN were measured using an automated clinical
chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). The
results are presented in the Table below.
TABLE-US-00053 TABLE 52 Plasma chemistry markers in CD1 mice plasma
on day 43 Dose ALT AST Albumin Creatinine BUN Chemistry (mg/kg/wk)
(IU/L) (IU/L) (g/dL) (mg/dL) (mg/dL) PBS -- -- 37 57 2.5 0.08 26
ISIS 532770 5-10-5 MOE 100 57 73 2.5 0.07 24 ISIS 532800 5-10-5 MOE
100 74 126 2.8 0.10 26 ISIS 532809 5-10-5 MOE 100 83 73 2.5 0.07 23
ISIS 588540 5-10-5 MOE 100 106 102 2.7 0.09 27 ISIS 588544 5-10-5
MOE 100 66 62 2.6 0.10 24 ISIS 588548 5-10-5 MOE 100 48 67 2.6 0.08
23 ISIS 588550 5-10-5 MOE 100 65 106 2.5 0.10 25 ISIS 588553 5-10-5
MOE 100 78 90 2.6 0.09 25 ISIS 588555 5-10-5 MOE 100 94 89 2.5 0.08
23 ISIS 588848 Deoxy, MOE 50 38 54 2.3 0.07 25 and cEt ISIS 594430
3-10-3 cEt 50 63 72 2.5 0.10 27
Weights
[0483] Body weights of the mice were measured on day 36. Weights of
organs, liver, kidney, and spleen were also measured after the mice
were sacrificed on day 43. The results for the organ weights were
expressed as a ratio to the body weights and normalized to the PBS
control ratio.
TABLE-US-00054 TABLE 53 Organ Weights/Body weight (BW) of CD1 mice
Dose Kidney/ Liver/ Spleen/ Chemistry (mg/kg/wk) BW BW BW PBS -- --
1.0 1.0 1.0 ISIS 532770 5-10-5 MOE 100 1.4 1.1 1.0 ISIS 532800
5-10-5 MOE 100 1.5 1.1 0.9 ISIS 532809 5-10-5 MOE 100 1.3 1.2 0.9
ISIS 588540 5-10-5 MOE 100 1.3 1.2 1.0 ISIS 588544 5-10-5 MOE 100
1.6 1.1 1.0 ISIS 588548 5-10-5 MOE 100 1.7 1.2 1.0 ISIS 588550
5-10-5 MOE 100 1.5 1.2 1.0 ISIS 588553 5-10-5 MOE 100 1.5 1.0 0.8
ISIS 588555 5-10-5 MOE 100 1.8 1.2 1.0 ISIS 588848 Deoxy, MOE 50
1.3 1.0 0.9 and cEt ISIS 594430 3-10-3 cEt 50 1.4 1.1 0.9
Cytokine Assays
[0484] Blood obtained from all mice groups were sent to Antech
Diagnostics for measurements of the various cytokine levels, such
as IL-6, MDC, MIP1.beta., IP-10, MCP1, MIP-1.alpha., and RANTES.
The results are presented in Table 54.
TABLE-US-00055 TABLE 54 Cytokine levels (pg/mL) in CD1 mice plasma
Chemistry IL-6 MDC MIP1.beta. IP-10 MCP1 MIP-1.alpha. RANTES PBS --
70 16 23 20 17 6 2 ISIS 532770 5-10-5 MOE 101 18 146 116 101 24 6
ISIS 532800 5-10-5 MOE 78 17 83 53 105 1 3 ISIS 532809 5-10-5 MOE
66 19 60 32 55 20 4 ISIS 588540 5-10-5 MOE 51 18 126 70 75 4 3 ISIS
588544 5-10-5 MOE 157 14 94 34 102 1 3 ISIS 588548 5-10-5 MOE 164
12 90 66 84 10 4 ISIS 588550 5-10-5 MOE 58 21 222 124 157 3 5 ISIS
588553 5-10-5 MOE 62 14 183 60 103 9 4 ISIS 588555 5-10-5 MOE 70 19
172 171 178 16 9 ISIS 588848 Deoxy, MOE 59 13 61 27 63 12 4 and cEt
ISIS 594430 3-10-3 cEt 48 14 56 38 85 10 3
Hematology Assays
[0485] Blood obtained from all mice groups were sent to Antech
Diagnostics for measurements of hematocrit (HCT), as well as of the
various blood cells, such as WBC, RBC, and platelets, and total
hemoglobin (Hb) content. The results are presented in Table 55.
TABLE-US-00056 TABLE 55 Hematology markers in CD1 mice plasma HCT
Hb WBC RBC Platelets Chemistry (%) (g/dL) (10.sup.3/.mu.L)
(10.sup.6/.mu.L) (10.sup.3/.mu.L) PBS -- 46 15 7 9 960 ISIS 532770
5-10-5 MOE 45 14 5 9 879 ISIS 532800 5-10-5 MOE 45 14 5 9 690 ISIS
532809 5-10-5 MOE 46 14 6 9 1005 ISIS 588540 5-10-5 MOE 49 15 6 10
790 ISIS 588544 5-10-5 MOE 36 11 7 7 899 ISIS 588548 5-10-5 MOE 46
14 6 9 883 ISIS 588550 5-10-5 MOE 42 13 8 8 721 ISIS 588553 5-10-5
MOE 45 14 6 9 719 ISIS 588555 5-10-5 MOE 43 13 8 9 838 ISIS 588848
Deoxy, MOE 40 15 8 10 840 and cEt ISIS 594430 3-10-3 cEt 45 14 8 9
993
Example 13: Tolerability of Antisense Oligonucleotides Targeting
Human CFB in Sprague-Dawley Rats
[0486] Sprague-Dawley rats are a multipurpose model used for safety
and efficacy evaluations. The rats were treated with ISIS antisense
oligonucleotides from the studies described in the Examples above
and evaluated for changes in the levels of various plasma chemistry
markers.
Study 1 (with 5-10-5 MOE Gapmers)
[0487] Male Sprague-Dawley rats, seven- to eight-week old, were
maintained on a 12-hour light/dark cycle and fed ad libitum with
Purina normal rat chow, diet 5001. Groups of 4 Sprague-Dawley rats
each were injected subcutaneously once a week for 6 weeks with 100
mg/kg of 5-10-5 MOE gapmers. One control group of 6 rats was
injected subcutaneously once a week for 6 weeks with PBS. Forty
eight hours after the last dose, rats were euthanized and organs
and plasma were harvested for further analysis.
Liver Function
[0488] To evaluate the effect of ISIS oligonucleotides on hepatic
function, plasma levels of transaminases were measured using an
automated clinical chemistry analyzer (Hitachi Olympus AU400e,
Melville, N.Y.). Plasma levels of ALT (alanine transaminase) and
AST (aspartate transaminase) were measured and the results are
presented in the Table below expressed in IU/L. ISIS
oligonucleotides that caused changes in the levels of any markers
of liver function outside the expected range for antisense
oligonucleotides were excluded in further studies.
TABLE-US-00057 TABLE 56 Liver function markers in Sprague-Dawley
rats ALT AST (IU/L) (IU/L) PBS 66 134 ISIS 588544 101 329 ISIS
588550 69 157 ISIS 588553 88 304 ISIS 588554 202 243 ISIS 588555 94
113 ISIS 588556 102 117 ISIS 588560 206 317 ISIS 588564 292 594
Kidney Function
[0489] To evaluate the effect of ISIS oligonucleotides on kidney
function, plasma levels of blood urea nitrogen (BUN) and creatinine
were measured using an automated clinical chemistry analyzer
(Hitachi Olympus AU400e, Melville, N.Y.). Results are presented in
the Table below, expressed in mg/dL. ISIS oligonucleotides that
caused changes in the levels of any of the kidney function markers
outside the expected range for antisense oligonucleotides were
excluded in further studies.
TABLE-US-00058 TABLE 57 Kidney function markers (mg/dL) in
Sprague-Dawley rats BUN Creatinine PBS 18 3.5 ISIS 588544 21 3.1
ISIS 588550 21 3.0 ISIS 588553 22 2.8 ISIS 588554 23 3.0 ISIS
588555 22 3.5 ISIS 588556 21 3.2 ISIS 588560 26 2.4 ISIS 588564 24
2.7
Weights
[0490] Body weight measurements were taken on day 39. Liver, heart,
spleen and kidney weights were measured at the end of the study on
day 42, and are presented in the Table below. ISIS oligonucleotides
that caused any changes in organ weights outside the expected range
for antisense oligonucleotides were excluded from further
studies.
TABLE-US-00059 TABLE 58 Weights (g) Body Liver Spleen Kidney PBS
422 16 1.2 3.9 ISIS 588544 353 15 1.7 2.9 ISIS 588550 321 14 2.1
3.2 ISIS 588553 313 15 2.3 3.2 ISIS 588554 265 11 1.6 2.7 ISIS
588555 345 14 1.4 3.3 ISIS 588556 328 13 1.7 3.1 ISIS 588560 270 13
2.4 3.0 ISIS 588564 253 12 2.9 3.0
Study 2 (with Deoxy, MOE and cEt Oligonucleotides)
[0491] Male Sprague-Dawley rats, nine- to ten-week old, were
maintained on a 12-hour light/dark cycle and fed ad libitum with
Purina normal rat chow, diet 5001. Groups of 4 Sprague-Dawley rats
each were injected subcutaneously once a week for 6 weeks with 100
mg/kg of deoxy, MOE, and cEt oligonucleotides. Two control groups
of 3 rats each were injected subcutaneously once a week for 6 weeks
with PBS. Forty eight hours after the last dose, rats were
euthanized and organs and plasma were harvested for further
analysis.
Liver Function
[0492] To evaluate the effect of ISIS oligonucleotides on hepatic
function, plasma levels of transaminases were measured on day 42
using an automated clinical chemistry analyzer (Hitachi Olympus
AU400e, Melville, N.Y.). Plasma levels of ALT (alanine
transaminase) and AST (aspartate transaminase), and albumin were
measured and the results are presented in the Table below. ISIS
oligonucleotides that caused changes in the levels of any markers
of liver function outside the expected range for antisense
oligonucleotides were excluded in further studies.
TABLE-US-00060 TABLE 59 Liver function markers in Sprague-Dawley
rats ALT AST Albumin (IU/L) (IU/L) (g/dL) PBS 55 150 3.4 PBS 64 91
3.5 ISIS 588554 52 92 3.2 ISIS 588835 971 844 4.1 ISIS 588842 317
359 3.8 ISIS 588843 327 753 2.9 ISIS 588846 70 111 3.2 ISIS 588847
65 100 3.0 ISIS 588864 91 109 3.0 ISIS 594430 85 106 3.7
Kidney Function
[0493] To evaluate the effect of ISIS oligonucleotides on kidney
function, plasma levels of blood urea nitrogen (BUN) and creatinine
were measured using an automated clinical chemistry analyzer
(Hitachi Olympus AU400e, Melville, N.Y.). Results are presented in
the Table below, expressed in mg/dL. ISIS oligonucleotides that
caused changes in the levels of any of the kidney function markers
outside the expected range for antisense oligonucleotides were
excluded in further studies.
TABLE-US-00061 TABLE 60 Kidney function markers (mg/dL) in
Sprague-Dawley rats BUN Creatinine PBS 17 0.4 PBS 21 0.4 ISIS
588554 20 0.4 ISIS 588835 23 0.5 ISIS 588842 22 0.4 ISIS 588843 51
0.4 ISIS 588846 25 0.5 ISIS 588847 23 0.5 ISIS 588864 23 0.4 ISIS
594430 22 0.5
Weights
[0494] Body weight measurements were taken on day 39. Liver, heart,
spleen and kidney weights were measured at the end of the study on
day 42, and are presented in the Table below. ISIS oligonucleotides
that caused any changes in organ weights outside the expected range
for antisense oligonucleotides were excluded from further
studies.
TABLE-US-00062 TABLE 61 Weights (g) Body Liver Spleen Kidney PBS
466 16 0.9 3.8 PBS 485 16 0.9 3.6 ISIS 588554 393 15 2.3 2.6 ISIS
588835 387 16 1.0 3.3 ISIS 588842 414 22 1.5 3.7 ISIS 588843 427 20
2.5 4.2 ISIS 588846 366 16 2.1 3.3 ISIS 588847 402 15 1.6 3.1 ISIS
588864 364 15 2.1 3.8 ISIS 594430 420 16 1.2 3.6
Study 3 (with MOE Gapmers)
[0495] Male Sprague-Dawley rats, nine- to ten-week old, were
maintained on a 12-hour light/dark cycle and fed ad libitum with
Purina normal rat chow, diet 5001. Groups of 4 Sprague-Dawley rats
each were injected subcutaneously once a week for 6 weeks with 100
mg/kg of MOE gapmers. One control group of 6 rats was injected
subcutaneously once a week for 6 weeks with PBS. Forty eight hours
after the last dose, rats were euthanized and organs and plasma
were harvested for further analysis.
Liver Function
[0496] To evaluate the effect of ISIS oligonucleotides on hepatic
function, plasma levels of transaminases were measured on day 43
using an automated clinical chemistry analyzer (Hitachi Olympus
AU400e, Melville, N.Y.). Plasma levels of ALT (alanine
transaminase) and AST (aspartate transaminase) were measured and
the results are presented in the Table below expressed in IU/L.
ISIS oligonucleotides that caused changes in the levels of any
markers of liver function outside the expected range for antisense
oligonucleotides were excluded in further studies.
TABLE-US-00063 TABLE 62 Liver function markers in Sprague-Dawley
rats ALT AST Albumin Chemistry (IU/L) (IU/L) (g/dL) PBS -- 52 110
3.7 ISIS 588563 5-10-5 MOE 175 291 2.9 ISIS 599024 3-10-4 MOE 139
173 1.4 ISIS 599093 5-7-5 MOE 116 238 2.6 ISIS 599149 4-8-5 MOE 232
190 3.4 ISIS 599155 4-8-5 MOE 108 215 2.5 ISIS 599202 5-8-5 MOE 65
86 3.5 ISIS 599203 5-8-5 MOE 71 97 3.1 ISIS 599208 5-8-5 MOE 257
467 1.9 ISIS 599261 3-10-5 MOE 387 475 1.5 ISIS 599267 3-10-5 MOE
201 337 2.7
Kidney Function
[0497] To evaluate the effect of ISIS oligonucleotides on kidney
function, plasma levels of blood urea nitrogen (BUN) and creatinine
were measured using an automated clinical chemistry analyzer
(Hitachi Olympus AU400e, Melville, N.Y.). Results are presented in
the Table below, expressed in mg/dL. ISIS oligonucleotides that
caused changes in the levels of any of the kidney function markers
outside the expected range for antisense oligonucleotides were
excluded in further studies.
TABLE-US-00064 TABLE 63 Kidney function markers (mg/dL) in
Sprague-Dawley rats Chemistry BUN Creatinine PBS -- 16 0.3 ISIS
588563 5-10-5 MOE 26 0.4 ISIS 599024 3-10-4 MOE 135 1.2 ISIS 599093
5-7-5 MOE 29 0.4 ISIS 599149 4-8-5 MOE 23 0.4 ISIS 599155 4-8-5 MOE
29 0.4 ISIS 599202 5-8-5 MOE 19 0.4 ISIS 599203 5-8-5 MOE 22 0.4
ISIS 599208 5-8-5 MOE 26 0.3 ISIS 599261 3-10-5 MOE 228 1.6 ISIS
599267 3-10-5 MOE 24 0.4
Weights
[0498] Body weight measurements were taken on day 39. Liver, heart,
spleen and kidney weights were measured at the end of the study on
day 42, and are presented in the Table below. ISIS oligonucleotides
that caused any changes in organ weights outside the expected range
for antisense oligonucleotides were excluded from further
studies.
TABLE-US-00065 TABLE 64 Weights (g) Chemistry Body Liver Spleen
Kidney PBS -- 471 16 1.0 4.1 ISIS 588563 5-10-5 MOE 311 16 3.4 4.1
ISIS 599024 3-10-4 MOE 297 11 1.0 3.5 ISIS 599093 5-7-5 MOE 332 18
4.1 5.0 ISIS 599149 4-8-5 MOE 388 16 2.3 3.7 ISIS 599155 4-8-5 MOE
290 15 2.9 4.5 ISIS 599202 5-8-5 MOE 359 13 1.3 3.2 ISIS 599203
5-8-5 MOE 334 14 1.8 3.3 ISIS 599208 5-8-5 MOE 353 29 4.7 4.6 ISIS
599261 3-10-5 MOE 277 10 0.9 3.2 ISIS 599267 3-10-5 MOE 344 21 3.9
4.7
Study 4 (with MOE Gapmers)
[0499] Male Sprague-Dawley rats, nine- to ten-week old, were
maintained on a 12-hour light/dark cycle and fed ad libitum with
Purina normal rat chow, diet 5001. Groups of 4 Sprague-Dawley rats
each were injected subcutaneously once a week for 6 weeks with 100
mg/kg of MOE gapmers. One control group of 6 rats was injected
subcutaneously once a week for 6 weeks with PBS. Forty eight hours
after the last dose, rats were euthanized and organs and plasma
were harvested for further analysis.
Liver Function
[0500] To evaluate the effect of ISIS oligonucleotides on hepatic
function, plasma levels of transaminases were measured on day 42
using an automated clinical chemistry analyzer (Hitachi Olympus
AU400e, Melville, N.Y.). Plasma levels of ALT (alanine
transaminase) and AST (aspartate transaminase) were measured and
the results are presented in the Table below expressed in IU/L.
ISIS oligonucleotides that caused changes in the levels of any
markers of liver function outside the expected range for antisense
oligonucleotides were excluded in further studies.
TABLE-US-00066 TABLE 65 Liver function markers in Sprague-Dawley
rats ALT AST Albumin Chemistry (IU/L) (IU/L) (g/dL) PBS -- 48 77
3.9 ISIS 532800 5-10-5 MOE 72 111 3.4 ISIS 532809 5-10-5 MOE 59 89
3.8 ISIS 588540 5-10-5 MOE 146 259 3.8 ISIS 599268 3-10-5 MOE 175
206 2.7 ISIS 599322 6-7-6 MOE 523 567 3.3 ISIS 599374 5-9-5 MOE 114
176 3.0 ISIS 599378 5-9-5 MOE 124 116 3.2 ISIS 599380 5-9-5 MOE 148
210 3.4 ISIS 599441 6-8-6 MOE 51 91 2.6
Kidney Function
[0501] To evaluate the effect of ISIS oligonucleotides on kidney
function, plasma levels of blood urea nitrogen (BUN) and creatinine
were measured using an automated clinical chemistry analyzer
(Hitachi Olympus AU400e, Melville, N.Y.). Results are presented in
the Table below, expressed in mg/dL. ISIS oligonucleotides that
caused changes in the levels of any of the kidney function markers
outside the expected range for antisense oligonucleotides were
excluded in further studies.
TABLE-US-00067 TABLE 66 Kidney function markers (mg/dL) in
Sprague-Dawley rats Chemistry BUN Creatinine PBS -- 15 0.4 ISIS
532800 5-10-5 MOE 26 0.5 ISIS 532809 5-10-5 MOE 18 0.5 ISIS 588540
5-10-5 MOE 22 0.5 ISIS 599268 3-10-5 MOE 28 0.5 ISIS 599322 6-7-6
MOE 24 0.5 ISIS 599374 5-9-5 MOE 29 0.5 ISIS 599378 5-9-5 MOE 22
0.4 ISIS 599380 5-9-5 MOE 26 0.5 ISIS 599441 6-8-6 MOE 24 0.4
Weights
[0502] Body weight measurements were taken on day 39. Liver, heart,
spleen and kidney weights were measured at the end of the study on
day 42, and are presented in the Table below. ISIS oligonucleotides
that caused any changes in organ weights outside the expected range
for antisense oligonucleotides were excluded from further
studies.
TABLE-US-00068 TABLE 67 Weights (g) Chemistry Body Liver Spleen
Kidney PBS -- 502 16 0.9 3.7 ISIS 532800 5-10-5 MOE 376 16 2.0 3.4
ISIS 532809 5-10-5 MOE 430 16 1.4 3.4 ISIS 588540 5-10-5 MOE 391 16
1.8 3.5 ISIS 599268 3-10-5 MOE 332 16 3.6 3.6 ISIS 599322 6-7-6 MOE
348 13 2.1 3.4 ISIS 599374 5-9-5 MOE 302 12 2.0 3.3 ISIS 599378
5-9-5 MOE 332 11 1.1 2.8 ISIS 599380 5-9-5 MOE 350 11 1.5 3.3 ISIS
599441 6-8-6 MOE 368 16 2.5 3.3
Study 5 (with MOE Gapmers and Deoxy, MOE and cEt
Oligonucleotides)
[0503] Male Sprague-Dawley rats, nine- to ten-week old, were
maintained on a 12-hour light/dark cycle and fed ad libitum with
Purina normal rat chow, diet 5001. Groups of 4 Sprague-Dawley rats
each were injected subcutaneously once a week for 6 weeks with 100
mg/kg of MOE gapmer or with 50 mg/kg of deoxy, MOE and cEt
oligonucleotides. One control group of 4 rats was injected
subcutaneously once a week for 6 weeks with PBS. Forty eight hours
after the last dose, rats were euthanized and organs and plasma
were harvested for further analysis.
Liver Function
[0504] To evaluate the effect of ISIS oligonucleotides on hepatic
function, plasma levels of transaminases were measured on day 42
using an automated clinical chemistry analyzer (Hitachi Olympus
AU400e, Melville, N.Y.). Plasma levels of ALT (alanine
transaminase) and AST (aspartate transaminase) were measured and
the results are presented in the Table below expressed in IU/L.
ISIS oligonucleotides that caused changes in the levels of any
markers of liver function outside the expected range for antisense
oligonucleotides were excluded in further studies.
TABLE-US-00069 TABLE 68 Liver function markers in Sprague-Dawley
rats ALT AST Albumin Chemistry (IU/L) (IU/L) (g/dL) PBS -- 49 74
3.3 ISIS 532770 5-10-5 MOE 95 132 3.3 ISIS 588851 Deoxy, MOE, and
cEt 47 72 3.1 ISIS 588856 Deoxy, MOE, and cEt 56 75 3.0 ISIS 588865
Deoxy, MOE, and cEt 62 84 2.9 ISIS 588867 Deoxy, MOE, and cEt 73
214 2.9 ISIS 588868 Deoxy, MOE, and cEt 59 83 3.1 ISIS 588870
Deoxy, MOE, and cEt 144 144 3.4
Kidney Function
[0505] To evaluate the effect of ISIS oligonucleotides on kidney
function, plasma and urine levels of blood urea nitrogen (BUN) and
creatinine were measured using an automated clinical chemistry
analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Results are
presented in the Tables below, expressed in mg/dL. ISIS
oligonucleotides that caused changes in the levels of any of the
kidney function markers outside the expected range for antisense
oligonucleotides were excluded in further studies.
TABLE-US-00070 TABLE 69 Kidney function markers (mg/dL) in the
plasma of Sprague-Dawley rats Chemistry BUN Creatinine PBS -- 18
0.3 ISIS 532770 5-10-5 MOE 20 0.4 ISIS 588851 Deoxy, MOE, and cEt
20 0.4 ISIS 588856 Deoxy, MOE, and cEt 22 0.4 ISIS 588865 Deoxy,
MOE, and cEt 24 0.5 ISIS 588867 Deoxy, MOE, and cEt 22 0.4 ISIS
588868 Deoxy, MOE, and cEt 19 0.4 ISIS 588870 Deoxy, MOE, and cEt
20 0.5
TABLE-US-00071 TABLE 70 Kidney function markers (mg/dL) in the
urine of Sprague-Dawley rats Total Chemistry protein Creatinine PBS
-- 80 92 ISIS 532770 5-10-5 MOE 466 69 ISIS 588851 Deoxy, MOE, and
cEt 273 64 ISIS 588856 Deoxy, MOE, and cEt 259 68 ISIS 588865
Deoxy, MOE, and cEt 277 67 ISIS 588867 Deoxy, MOE, and cEt 337 68
ISIS 588868 Deoxy, MOE, and cEt 326 75 ISIS 588870 Deoxy, MOE, and
cEt 388 82
Weights
[0506] Body weight measurements were taken on day 39. Liver, heart,
spleen and kidney weights were measured at the end of the study on
day 42, and are presented in the Table below. ISIS oligonucleotides
that caused any changes in organ weights outside the expected range
for antisense oligonucleotides were excluded from further
studies.
TABLE-US-00072 TABLE 71 Weights (g) Chemistry Body Liver Spleen
Kidney PBS -- 489 16 0.9 3.5 ISIS 532770 5-10-5 MOE 372 15 1.7 3.1
ISIS 588851 Deoxy, MOE, and cEt 285 14 1.4 3.2 ISIS 588856 Deoxy,
MOE, and cEt 415 15 1.1 3.3 ISIS 588865 Deoxy, MOE, and cEt 362 14
2.0 3.3 ISIS 588867 Deoxy, MOE, and cEt 406 15 2.4 3.4 ISIS 588868
Deoxy, MOE, and cEt 399 15 1.5 3.4 ISIS 588870 Deoxy, MOE, and cEt
446 14 1.4 3.3
Study 6 (with MOE Gapmers, Deoxy, MOE and cEt Oligonucleotides, and
cEt Gapmers)
[0507] Male rats were maintained on a 12-hour light/dark cycle and
fed ad libitum with Purina normal rat chow, diet 5001. Groups of 4
rats each were injected subcutaneously once a week for 6 weeks with
100 mg/kg of MOE gapmers or with 50 mg/kg of deoxy, MOE and cEt
oligonucleotide or cEt gapmer. One control group of 4 rats was
injected subcutaneously once a week for 6 weeks with PBS. Forty
eight hours after the last dose, rats were euthanized and organs
and plasma were harvested for further analysis.
Liver Function
[0508] To evaluate the effect of ISIS oligonucleotides on hepatic
function, plasma levels of transaminases were measured on day 42
using an automated clinical chemistry analyzer (Hitachi Olympus
AU400e, Melville, N.Y.). Plasma levels of ALT (alanine
transaminase) and AST (aspartate transaminase) were measured and
the results are presented in the Table below expressed in IU/L.
TABLE-US-00073 TABLE 72 Liver function markers Dose ALT AST Albumin
Chemistry (mg/kg/wk) (IU/L) (IU/L) (g/dL) PBS -- -- 54 73 4.3 ISIS
532770 5-10-5 MOE 100 57 114 4.4 ISIS 532800 5-10-5 MOE 100 176 180
4.3 ISIS 532809 5-10-5 MOE 100 71 132 4.1 ISIS 588540 5-10-5 MOE
100 89 202 4.4 ISIS 588544 5-10-5 MOE 100 75 152 3.9 ISIS 588548
5-10-5 MOE 100 50 71 4.1 ISIS 588550 5-10-5 MOE 100 80 133 3.6 ISIS
588553 5-10-5 MOE 100 59 112 3.9 ISIS 588555 5-10-5 MOE 100 97 142
3.8 ISIS 588848 Deoxy, MOE and cEt 50 53 82 3.9 ISIS 594430 3-10-3
cEt 50 198 172 4.4
Kidney Function
[0509] To evaluate the effect of ISIS oligonucleotides on kidney
function, urine levels of total protein and creatinine were
measured using an automated clinical chemistry analyzer (Hitachi
Olympus AU400e, Melville, N.Y.). Results are presented in the Table
below. ISIS oligonucleotides that caused changes in the levels of
any of the kidney function markers outside the expected range for
antisense oligonucleotides were excluded in further studies.
TABLE-US-00074 TABLE 73 Total protein/creatinine ratio in the urine
of rats Dose P/C Chemistry (mg/kg/wk) ratio PBS -- -- 1.1 ISIS
532770 5-10-5 MOE 100 8.3 ISIS 532800 5-10-5 MOE 100 6.5 ISIS
532809 5-10-5 MOE 100 6.1 ISIS 588540 5-10-5 MOE 100 10.1 ISIS
588544 5-10-5 MOE 100 7.9 ISIS 588548 5-10-5 MOE 100 6.6 ISIS
588550 5-10-5 MOE 100 7.6 ISIS 588553 5-10-5 MOE 100 7.0 ISIS
588555 5-10-5 MOE 100 6.2 ISIS 588848 Deoxy, MOE and cEt 50 5.2
ISIS 594430 3-10-3 cEt 50 5.3
Weights
[0510] Body weight measurements were taken on day 39. Liver, heart,
spleen and kidney weights were measured at the end of the study on
day 42, and are presented in the Table below. The results for the
organ weights were expressed as a ratio to the body weights and
normalized to the PBS control ratio.
TABLE-US-00075 TABLE 74 Organ weights/Body weight (BW) ratios Dose
Spleen/ Liver/ Kidney/ Chemistry (mg/kg/wk) BW BW BW PBS -- -- 1.0
1.0 1.0 ISIS 532770 5-10-5 MOE 100 2.0 1.2 1.0 ISIS 532800 5-10-5
MOE 100 2.8 1.3 1.0 ISIS 532809 5-10-5 MOE 100 2.2 1.1 1.0 ISIS
588540 5-10-5 MOE 100 2.2 1.4 1.0 ISIS 588544 5-10-5 MOE 100 2.5
1.3 1.1 ISIS 588548 5-10-5 MOE 100 2.1 1.3 1.1 ISIS 588550 5-10-5
MOE 100 3.9 1.4 1.1 ISIS 588553 5-10-5 MOE 100 4.1 1.4 1.4 ISIS
588555 5-10-5 MOE 100 1.8 1.3 1.0 ISIS 588848 Deoxy, MOE 50 3.1 1.3
1.1 and cEt ISIS 594430 3-10-3 cEt 50 1.7 1.0 1.1
Example 14: Efficacy of Antisense Oligonucleotides Against CFB mRNA
in hCFB Transgenic Mice
[0511] Selected compounds were tested for efficacy in human CFB
transgenic mice, founder line #6. The human CFB gene is located on
chromosome 6: position 31913721-31919861. A Fosmid
(ABC14-50933200C23) containing the CFB sequence was selected to
make transgenic mice expressing the human CFB gene. Cla I
(31926612) and Age I (31926815) restriction enzymes were used to
generate a 22,127 bp fragment containing the CFB gene for
pronuclear injection. DNA was confirmed by restriction enzyme
analysis using Pvu I. The 22,127 bp DNA fragment was injected into
C57BL/6NTac embryos. 6 positive founders were bred. Founder #6
expressed the liver human CFB mRNA and was crossbreed to the
3.sup.rd generation. Progeny from 3.sup.rd generation mice were
used to evaluate human CFB ASOs for human CFB mRNA reduction.
Treatment
[0512] Groups of 3 mice each were injected subcutaneously twice a
week for the first week with 50 mg/kg of ISIS oligonucleotides,
followed by once a week dosing with 50 mg/kg of ISIS
oligonucleotides for an additional three weeks. One control group
of 4 mice was injected subcutaneously twice a week for 2 weeks for
the first week with PBS for the first week for an additional three
weeks. Forty eight hours after the last dose, mice were euthanized
and organs and plasma were harvested for further analysis.
RNA Analysis
[0513] At the end of the dosing period, RNA was extracted from the
liver and kidney for real-time PCR analysis of CFB mRNA levels.
Human CFB mRNA levels were measured using the human primer probe
set RTS3459. CFB mRNA levels were normalized to RIBOGREEN.RTM., and
also to the housekeeping gene, Cyclophilin. Results were calculated
as percent inhibition of CFB mRNA expression compared to the
control. All the antisense oligonucleotides effected inhibition of
human CFB mRNA levels in the liver.
TABLE-US-00076 TABLE 75 Percent reduction of CFB mRNA levels in
hCFB mice Normalized to Normalized to ISIS No RIBOGREEN Cyclophilin
532770 86 87 532800 88 87 532809 69 69 588540 95 94 588544 91 91
588548 78 77 588550 89 88 588553 94 94 588555 94 94 588848 83 82
594430 78 76
Example 15: In Vivo Antisense Inhibition of Murine CFB
[0514] Several antisense oligonucleotides were designed that were
targeted to murine CFB mRNA (GENBANK Accession No. NM_008198.2,
incorporated herein as SEQ ID NO: 5). The target start sites and
sequences of each oligonucleotide are described in the table below.
The chimeric antisense oligonucleotides in the table below were
designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in
length, wherein the central gap segment is comprised of 10
2'-deoxynucleosides and is flanked on both sides (in the 5' and 3'
directions) by wings comprising 5 nucleosides each. Each nucleoside
in the 5' wing segment and each nucleoside in the 3' wing segment
has a 2'-MOE modification. The internucleoside linkages throughout
each gapmer are phosphorothioate (P.dbd.S) linkages. All cytosine
residues throughout each gapmer are 5-methylcytosines.
TABLE-US-00077 TABLE 76 Gapmers targeting murine CFB Target Start
Site on SEQ SEQ ID ISIS No Sequence ID NO: 5 NO 516269
GCATAAGAGGGTACCAGCTG 2593 804 516272 GTCCTTTAGCCAGGGCAGCA 2642 805
516323 TCCACCCATGTTGTGCAAGC 1568 806 516330 CCACACCATGCCACAGAGAC
1826 807 516341 TTCCGAGTCAGGCTCTTCCC 2308 808
Treatment
[0515] Groups of four C57BL/6 mice each were injected with 50 mg/kg
of ISIS 516269, ISIS 516272, ISIS 516323, ISIS 516330, or ISIS
516341 administered weekly for 3 weeks. A control group of mice was
injected with phosphate buffered saline (PBS) administered weekly
for 3 weeks.
CFB RNA Analysis
[0516] At the end of the study, RNA was extracted from liver tissue
for real-time PCR analysis of CFB, using primer probe set RTS3430
(forward sequence GGGCAAACAGCAATTTGTGA, designated herein as SEQ ID
NO: 816; reverse sequence TGGCTACCCACCTTCCTTGT, designated herein
as SEQ ID NO: 817; probe sequence CTGGATACTGTCCCAATCCCGGTATTCCX,
designated herein as SEQ ID NO: 818). The mRNA levels were
normalized using RIBOGREEN.RTM.. As shown in the Table below, some
of the antisense oligonucleotides achieved reduction of murine CFB
over the PBS control. Results are presented as percent inhibition
of CFB, relative to control.
TABLE-US-00078 TABLE 77 Percent inhibition of murine CFB mRNA in
C57BL/6 mice ISIS No % 516269 29 516272 72 516323 77 516330 62
516341 72
Protein Analysis
[0517] CFB protein levels were measured in the kidney, liver,
plasma, and in the eye by western Blot using goat anti-CFB antibody
(Sigma Aldrich). Results are presented as percent inhibition of
CFB, relative to PBS control. `n/a` indicates that measurements
were not taken for that sample. As shown in the Table below,
antisense inhibition of CFB by ISIS oligonucleotides resulted in a
reduction of CFB protein in various tissues. As shown in the Table
below, systemic administration of ISIS oligonucleotides was
effective in reducing CFB levels in the eye.
TABLE-US-00079 TABLE 78 Percent inhibition of murine CFB protein in
C57BL/6 mice ISIS No Kidney Liver Plasma Eye 516269 20 58 n/a 70
516272 48 74 n/a 99 516323 73 85 90 93 516330 77 80 n/a n/a 516341
80 88 68 n/a
Example 16: Dose-Dependent Antisense Inhibition of Murine CFB
[0518] Groups of four C57BL/6 mice each were injected with 25
mg/kg, 50 mg/kg, or 100 mg/kg of ISIS 516272, and ISIS 516323
administered weekly for 6 weeks. Another two groups of mice were
injected with 100 mg/kg of ISIS 516330 or ISIS 516341 administered
weekly for 6 weeks. Two control groups of mice were injected with
phosphate buffered saline (PBS) administered weekly for 6
weeks.
CFB RNA Analysis
[0519] RNA was extracted from liver and kidney tissues for
real-time PCR analysis of CFB, using primer probe set RTS3430. The
mRNA levels were normalized using RIBOGREEN.RTM.. As shown in the
Table below, the antisense oligonucleotides achieved dose-dependent
reduction of murine CFB over the PBS control. Results are presented
as percent inhibition of CFB, relative to control.
TABLE-US-00080 TABLE 79 Percent inhibition of murine CFB mRNA in
C57BL/6 mice Dose ISIS No (mg/kg/wk) Liver Kidney 516272 25 39 32
50 73 36 100 87 42 516323 25 36 41 50 65 47 100 79 71 516330 100 85
45 516341 200 89 65
Protein Analysis
[0520] CFB protein levels were measured in the plasma by western
Blot using goat anti-CFB antibody (Sigma Aldrich). As shown in the
table below, antisense inhibition of CFB by the ISIS
oligonucleotides resulted in a reduction of CFB protein. Results
are presented as percent inhibition of CFB, relative to PBS
control. `n/a` indicates that measurements were not taken for that
sample.
[0521] CFB protein levels were also measured in the eye by Western
Blot. All treatment groups demonstrated an inhibition of CFB by
95%, with some sample measurements being below detection levels of
the assay.
TABLE-US-00081 TABLE 80 Percent inhibition of murine CFB protein in
C57BL/6 mice Dose ISIS No (mg/kg/wk) Liver 516272 25 32 50 70 100
83 516323 25 43 50 80 100 90 516330 100 n/a 516341 200 n/a
Example 17: Effect of Antisense Inhibition of CFB in the NZB/W F1
Mouse Model
[0522] The NZB/W F1 is the oldest classical model of lupus, where
the mice develop severe lupus-like phenotypes comparable to that of
lupus patients (Theofilopoulos, A. N. and Dixon, F. J. Advances in
Immunology, vol. 37, pp. 269-390, 1985). These lupus-like
phenotypes include lymphadenopathy, splenomegaly, elevated serum
antinuclear autoantibodies (ANA) including anti-dsDNA IgG, a
majority of which are IgG2a and IgG3, and immune complex-mediated
glomerulonephritis (GN) that becomes apparent at 5-6 months of age,
leading to kidney failure and death at 10-12 months of age.
Study 1
[0523] A study was conducted to demonstrate that treatment with
antisense oligonucleotides targeting CFB would improve renal
pathology in the mouse model. Female NZB/W F1 mice, 17 weeks old,
were purchased from Jackson Laboratories. Groups of 16 mice each
received doses of 100 .mu.g/kg/week of ISIS 516272 or ISIS 516323
for 20 weeks. Another group of 16 mice received doses of 100
jg/kg/week of control oligonucleotide ISIS 141923 for 20 weeks.
Another group of 10 mice received doses of PBS for 20 weeks and
served as the control group to which all the other groups were
compared. Terminal endpoints were collected 48 hours after the last
dose was injected.
CFB RNA Analysis
[0524] RNA was extracted from liver and kidney tissue for real-time
PCR analysis of CFB, using primer probe set RTS3430. The mRNA
levels were normalized using RIBOGREEN. As shown in the Table
below, some of the antisense oligonucleotides achieved reduction of
murine CFB over the PBS control. Results are presented as percent
inhibition of CFB, relative to control.
TABLE-US-00082 TABLE 81 Percent inhibition of murine CFB mRNA in
NZB/W F1 mice ISIS No Liver Kidney 516272 55 25 516323 63 43 141923
0 0
Proteinuria
[0525] Proteinuria is expected in 60% of animals in this mouse
model. The cumulative incidence of severe proteinuria was measured
by calculating the total protein to creatinine ratio using a
clinical analyzer. The results are presented in the table below and
demonstrate that treatment with antisense oligonucleotides
targeting CFB achieved reduction of proteinuria in the mice
compared to the PBS control and the control oligonucleotide treated
mice.
TABLE-US-00083 TABLE 82 Percent cumulative incidence of severe
proteinuria in NZB/W F1 mice % PBS 40 ISIS 516272 6 ISIS 516323 0
ISIS 141923 25
Survival
[0526] Survival of the mice was monitored by keeping count of the
mice at the start of treatment and then again at week 20. The
results are presented in the table below and demonstrate that
treatment with antisense oligonucleotides targeting CFB increased
survival in the mice compared to the PBS control and the control
oligonucleotide treated mice.
TABLE-US-00084 TABLE 83 Number of surviving mice and % survival %
survival at Week 1 Week 20 week 20 PBS 10 6 60 ISIS 516272 16 15 94
ISIS 516323 16 16 100 ISIS 141923 16 12 75
Glomerular Deposition
[0527] The amount of C3 deposition, as well as IgG deposition, in
the glomeruli of the kidneys was measured by immunohistochemistry
with an anti-C3 antibody. The results are presented in the table
below and demonstrate that treatment with antisense
oligonucleotides targeting CFB achieved reduction of both C3 and
IgG depositions in the kidney glomeruli compared to the PBS control
and the control oligonucleotide treated mice.
TABLE-US-00085 TABLE 84 Percent inhibition of glomerula deposition
in NZB/W F1 mice ISIS No C3 IgG 516272 45 20 516323 48 2 141923 0
0
Study 2
[0528] Female NZB/W F1 mice, 16 weeks old, were purchased from
Jackson Laboratories. A group of 10 mice received doses of 100
.mu.g/kg/week of ISIS 516323 for 12 weeks. Another group of 10 mice
received doses of 100 .mu.g/kg/week of control oligonucleotide ISIS
141923 for 12 weeks. Another group of 10 mice received doses of PBS
for 12 weeks and served as the control group to which all the other
groups were compared. Terminal endpoints were collected 48 hours
after the last dose was injected.
CFB RNA Analysis
[0529] RNA was extracted from liver and kidney tissue for real-time
PCR analysis of CFB, using primer probe set RTS3430. As shown in
the table below, treatment with ISIS 516323 achieved reduction of
murine CFB over the PBS control. Results are presented as percent
inhibition of CFB, relative to control.
TABLE-US-00086 TABLE 85 Percent inhibition of murine CFB mRNA in
NZB/W F1 mice ISIS No Liver Kidney 516323 75 46 141923 0 6
Proteinuria
[0530] The cumulative incidence of severe proteinuria was assessed
by measuring urine total protein to creatinine ratio, as well as by
measuring total microalbumin levels. The results are presented in
the tables below and demonstrate that treatment with antisense
oligonucleotides targeting CFB reduced proteinuria in the mice
compared to the PBS control and the control oligonucleotide treated
mice.
TABLE-US-00087 TABLE 86 Proteinuria in NZB/W F1 mice measured as
urine microalbumin levels (mg/dl) ISIS No Week 0 Week 6 Week 8 Week
10 516323 0 0 5.4 0.4 141923 0 8.28 8.6 5.6
TABLE-US-00088 TABLE 87 Proteinuria in NZB/W F1 mice measured as
total protein to creatinine ratio ISIS No Week 0 Week 6 Week 8 Week
10 516323 5.5 7.8 8.6 7.2 141923 6.9 10.0 13.5 7.2
Survival
[0531] Survival of the mice was monitored by keeping count of the
mice at the start of treatment and then again at week 12. The
results are presented in the table below and demonstrate that
treatment with antisense oligonucleotides targeting CFB increased
survival in the mice compared to the PBS control and the control
oligonucleotide treated mice.
TABLE-US-00089 TABLE 88 Number of surviving mice Week 1 Week 12 PBS
10 9 ISIS 516323 10 10 ISIS 141923 10 9
Example 18: Effect of Antisense Inhibition of CFB in the MRL Mouse
Model
[0532] The MRL/lpr lupus nephritis mouse model develops an SLE-like
phenotype characterized by lymphadenopathy due to an accumulation
of double negative (CD4.sup.- CD8.sup.-) and B220.sup.+ T-cells.
These mice display an accelerated mortality rate. In addition, the
mice have high concentrations of circulating immunoglobulins, which
included elevated levels of autoantibodies such as ANA, anti-ssDNA,
anti-dsDNA, anti-Sm, and rheumatoid factors, resulting in large
amounts of immune complexes (Andrews, B. et al., J. Exp. Med. 148:
1198-1215, 1978).
Treatment
[0533] A study was conducted to investigate whether treatment with
antisense oligonucleotides targeting CFB would reverse renal
pathology in the mouse model. Female MRL/lpr mice, 14 weeks old,
were purchased from Jackson Laboratories. A group of 10 mice
received doses of 50 .mu.g/kg/week of ISIS 516323 for 7 weeks.
Another group of 10 mice received doses of 50 .mu.g/kg/week of
control oligonucleotide ISIS 141923 for 7 weeks. Another group of
10 mice received doses of PBS for 7 weeks and served as the control
group to which all the other groups were compared. Terminal
endpoints were collected 48 hours after the last dose was
injected.
CFB RNA Analysis
[0534] RNA was extracted from liver tissue for real-time PCR
analysis of CFB, using primer probe set RTS3430. As shown in the
Table below, ISIS 516323 reduced CFB over the PBS control. Results
are presented as percent inhibition of CFB, relative to
control.
TABLE-US-00090 TABLE 89 Percent inhibition of murine CFB mRNA in
MRL/lpr mice ISIS No % 516323 68 141923 4
Renal Pathology
[0535] Renal pathology was evaluated by two methods. Histological
sections of the kidney were stained with Haematoxylin & Eosin.
The PBS control demonstrated presence of multiglomerular crescents
tubular casts, which is a symptom of glomerulosclerosis. In
contrast, the sections from mice treated with ISIS 516323 showed
absent crescents tubular casts with minimal bowman capsule fibrotic
changes, moderate to severe segmental mesangial cell expansion and
glomerular basement membrane thickening.
[0536] Accumulation of C3 in the kidney was also assessed by
immunohistochemistry with anti-C3 antibodies. The whole kidney C3
immunohistochemistry intensity score was calculated by intensity
scoring system, which was computed by capturing 10 glomeruli per
kidney and calculation the intensity of positive C3 staining. The
results are presented in the table below and demonstrate that
treatment with ISIS 516323 reduced renal C3 accumulation compared
to the control groups.
TABLE-US-00091 TABLE 90 Renal C3 accumulation in MRL/lpr mice C3
quantification Whole kidney C3 (area/total area) % intensity score
of average PBS PBS 2.5 100 ISIS 516323 1.6 68 ISIS 141923 2.2
99
Plasma C3 Levels
[0537] Reduction of CFB inhibits activation of the alternative
complement pathway, preventing C3 consumption and leading to an
apparent elevation of plasma C3 levels. Plasma C3 levels from
terminal bleed were measured by clinical analyzer. The results are
presented in the table below and demonstrate that treatment with
ISIS 516323 increased C3 levels (p<0.001) in the plasma compared
to the control groups.
TABLE-US-00092 TABLE 91 Plasma C3 levels (mg/dL) in MRL/lpr mice
ISIS No C3 516323 28 141923 16
The results indicate that treatment with antisense oligonucleotides
targeting CFB reverses renal pathology in the lupus mouse
model.
Example 19: Effect of Antisense Inhibition of CFB in the CFH Het
Mouse Model
[0538] CFH heterozygous (CFH Het, CFH.sup.+/-) mouse model
expresses a mutant Factor H protein in combination with the
full-length mouse protein (Pickering, M. C. et al., J. Exp. Med.
2007. 204: 1249-56). Renal histology remains normal in these mice
up to six months old.
Study 1
[0539] Groups of 8 CFH.sup.+/- mice, 6 weeks old, each received
doses of 75 mg/kg/week of ISIS 516323 or ISIS 516341 for 6 weeks.
Another group of 8 mice received doses of 75 mg/kg/week of control
oligonucleotide ISIS 141923 for 6 weeks. Another group of 8 mice
received doses of PBS for 6 weeks and served as the control group
to which all the other groups were compared. Terminal endpoints
were collected 48 hours after the last dose was injected.
CFB RNA Analysis
[0540] RNA was extracted from liver and kidney tissue for real-time
PCR analysis of CFB, using primer probe set RTS3430. As shown in
the Table below, the antisense oligonucleotides reduced CFB over
the PBS control. Results are presented as percent inhibition of
CFB, relative to control.
TABLE-US-00093 TABLE 92 Percent inhibition of murine CFB mRNA in
CFH.sup.+/- mice ISIS No Liver Kidney 516323 80 38 516341 90 44
141923 0 17
Plasma C3 Levels
[0541] Reduction of CFB inhibits activation of the alternative
complement pathway, preventing C3 consumption and leading to an
apparent elevation of plasma C3 levels. Plasma C3 levels from
terminal plasma collection were measured by clinical analyzer. The
results are presented in the table below and demonstrate that
treatment with ISIS 516323 increased C3 to normal levels in the
plasma.
TABLE-US-00094 TABLE 93 Plasma C3 levels (mg/dL) in CFH.sup.+/-
mice ISIS No C3 516323 15 516341 17 141923 8
Study 2
[0542] Groups of 5 CFH.sup.+/- mice each received doses of 12.5
mg/kg/week, 25 mg/kg/week, 50 mg/kg/week, 75 mg/kg/week, or 100
mg/kg/week of ISIS 516323 or ISIS 516341 for 6 weeks. Another group
of 5 mice received doses of 75 .mu.g/kg/week of control
oligonucleotide ISIS 141923 for 6 weeks. Another group of 5 mice
received doses of PBS for 6 weeks and served as the control group
to which all the other groups were compared. Terminal endpoints
were collected 48 hours after the last dose was injected.
CFB RNA Analysis
[0543] RNA was extracted from liver and kidney tissue for real-time
PCR analysis of CFB, using primer probe set RTS3430. As shown in
the Table below, the antisense oligonucleotides reduced CFB over
the PBS control in a dose dependent manner. Results are presented
as percent inhibition of CFB, relative to control.
TABLE-US-00095 TABLE 94 Percent inhibition of murine CFB mRNA in
the liver of CFH.sup.+/- mice Dose ISIS No (mg/kg/week) % 516323
12.5 34 25 51 50 72 75 79 100 92 516341 12.5 38 25 57 50 89 75 92
100 90 141923 75 13
Plasma C3 Levels
[0544] Reduction of CFB inhibits activation of the alternative
complement pathway, preventing C3 consumption and leading to an
apparent elevation of plasma C3 levels. Plasma C3 levels from
terminal plasma collection were measured by clinical analyzer. The
results are presented in the table below and demonstrate that
treatment with ISIS oligonucleotides targeting CFB increased C3
levels in the plasma.
TABLE-US-00096 TABLE 95 Plasma C3 levels (mg/dL) in CFH.sup.+/-
mice Dose (mg/kg/week) C3 PBS -- 10.1 516323 12.5 11.4 25 15.5 50
17.0 75 18.3 100 18.8 516341 12.5 12.1 25 16.3 50 18.6 75 22.1 100
19.1 141923 75 8.9
Example 20: Effect of ISIS Antisense Oligonucleotides Targeting
Human CFB in Cynomolgus Monkeys
[0545] Cynomolgus monkeys were treated with ISIS antisense
oligonucleotides selected from studies described in the Examples
above. Antisense oligonucleotide efficacy and tolerability, as well
as their pharmacokinetic profile in the liver and kidney, were
evaluated.
[0546] At the time this study was undertaken, the cynomolgus monkey
genomic sequence was not available in the National Center for
Biotechnology Information (NCBI) database; therefore
cross-reactivity with the cynomolgus monkey gene sequence could not
be confirmed. Instead, the sequences of the ISIS antisense
oligonucleotides used in the cynomolgus monkeys was compared to a
rhesus monkey sequence for homology. The human antisense
oligonucleotides tested below are cross-reactive (with 0 or 1
mismatches) with the rhesus genomic sequence (GENBANK Accession No.
NW_001116486.1 truncated from nucleotides 536000 to 545000,
designated herein as SEQ ID NO: 3). The start and stop sites of
each oligonucleotide targeted to SEQ ID NO: 3 is presented in the
Table below. "Start site" indicates the 5'-most nucleotide to which
the gapmer is targeted in the rhesus monkey gene sequence.
`Mismatches` indicates the number of nucleobases in the human
oligonucleotide that are mismatched with the rhesus genomic
sequence.
TABLE-US-00097 TABLE 96 Antisense oligonucleotides complementary to
the rhesus CFB genomic sequence (SEQ ID NO: 3) Target SEQ ISIS No
Start Site Mismatches Chemistry ID NO 532770 6788 0 5-10-5 MOE 198
532800 7500 0 5-10-5 MOE 228 532809 7614 0 5-10-5 MOE 237 588540
7627 1 5-10-5 MOE 440 588544 7631 1 5-10-5 MOE 444 588548 7635 1
5-10-5 MOE 448 588550 7637 1 5-10-5 MOE 450 588553 7640 1 5-10-5
MOE 453 588555 7643 0 5-10-5 MOE 455 588848 7639 1 Deoxy, MOE and
cEt 598 594430 6790 0 3-10-3 cEt 549
Treatment
[0547] Prior to the study, the monkeys were kept in quarantine for
at least a 30 day period, during which the animals were observed
daily for general health. The monkeys were 2-4 years old and
weighed between 2 and 4 kg. Eleven groups of 4-6 randomly assigned
male cynomolgus monkeys each were injected subcutaneously with ISIS
oligonucleotide or PBS at four sites on the back in a clockwise
rotation (i.e. left, top, right, and bottom), one site per dose.
The monkeys were given four loading doses of PBS or 40 mg/kg of
ISIS 532800, ISIS 532809, ISIS 588540, ISIS 588544, ISIS 588548,
ISIS 588550, ISIS 588553, ISIS 588555, ISIS 588848, or ISIS 594430
for the first week (days 1, 3, 5, and 7), and were subsequently
dosed once a week for 12 weeks (days 14, 21, 28, 35, 42, 49, 56,
63, 70, 77, and 84) with PBS or 40 mg/kg of ISIS oligonucleotide.
ISIS 532770 was tested in a separate study with similar conditions
with two male and two female cynomolgus monkeys in the group.
Hepatic Target Reduction
RNA Analysis
[0548] On day 86, liver and kidney samples were collected in
duplicate (approximately 250 mg each) for CFB mRNA analysis. The
samples were flash frozen in liquid nitrogen at necropsy within
approximately 10 minutes of sacrifice.
[0549] RNA was extracted from liver and kidney for real-time PCR
analysis of measurement of mRNA expression of CFB. Results are
presented as percent change of mRNA, relative to PBS control,
normalized with RIBOGREEN. RNA levels were also normalized with the
house-keeping gene, Cyclophilin A. RNA levels were measured with
the primer probe sets RTS3459, described above, or RTS4445_MGB
(forward sequence CGAAGAAGCTCAGTGAAATCAA, designated herein as SEQ
ID NO: 819; reverse sequence TGCCTGGAGGGCCCTCTT, designated herein
as SEQ ID NO: 820; probe sequence AGACCACAAGTTGAAGTC, designated
herein as SEQ ID NO: 815).
[0550] As shown in the Tables below, treatment with ISIS antisense
oligonucleotides resulted in reduction of CFB mRNA in comparison to
the PBS control. Analysis of CFB mRNA levels revealed that several
of the ISIS oligonucleotides reduced CFB levels in liver and/or
kidney. Here `0` indicates that the expression levels were not
inhibited. `*` indicates that the oligonucleotide was tested in a
separate study with similar conditions.
TABLE-US-00098 TABLE 97 Percent inhibition of CFB mRNA in the
cynomolgus monkey liver relative to the PBS control RTS3459/
RTS3459/ RTS445_MGB/ RTS445_MGB/ ISIS No Cyclophilin A RIBOGREEN
Cyclophilin A RIBOGREEN 532770* 12 37 24 45 532800 54 45 56 46
588540 31 27 28 24 588548 68 67 68 67 588550 53 39 51 37 588553 74
59 74 59 588555 73 71 71 69 588848 9 0 6 0 594430 24 26 23 25
TABLE-US-00099 TABLE 98 Percent inhibition of CFB mRNA in the
cynomolgus monkey kidney relative to the PBS control RTS3459/
RTS3459/ RTS445_MGB/ RTS445_MGB/ ISIS No Cyclophilin A RIBOGREEN
Cyclophilin A RIBOGREEN 532770* 34 56 2 31 532800 36 30 43 37
588540 70 71 67 69 588548 83 84 82 83 588550 81 77 78 74 588553 86
84 86 85 588555 32 34 48 50 588848 89 91 87 90 594430 33 37 19
23
Protein Analysis
[0551] Approximately 1 mL of blood was collected from all available
animals at day 85 and placed in tubes containing the potassium salt
of EDTA. The blood samples were placed in wet-ice or Kryorack
immediately, and centrifuged (3000 rpm for 10 min at 4.degree. C.)
to obtain plasma (approximately 0.4 mL) within 60 minutes of
collection. Plasma levels of CFB were measured in the plasma by
radial immunodiffusion (RID), using a polyclonal anti-Factor B
antibody. The results are presented in the Table below. ISIS 532770
was tested in a separate study and plasma protein levels were
measured on day 91 or 92 in that group.
[0552] Analysis of plasma CFB revealed that several ISIS
oligonucleotides reduced protein levels in a sustained manner. ISIS
532770, which was tested in a separate study, reduced CFB protein
levels on day 91/92 by 50% compared to baseline values. The
reduction in plasma CFB protein levels correlates well with liver
CFB mRNA level reduction in the corresponding groups of
animals.
TABLE-US-00100 TABLE 99 Plasma protein levels (% baseline values)
in the cynomolgus monkey Day 1 Day 30 Day 58 Day 72 Day 86 PBS 113
115 95 83 86 ISIS 532800 117 68 52 39 34 ISIS 532809 104 121 100 80
71 ISIS 588540 108 72 61 40 38 ISIS 588544 118 74 53 33 29 ISIS
588548 110 41 28 20 16 ISIS 588550 104 64 54 38 37 ISIS 588553 97
42 35 18 16 ISIS 588555 107 35 37 18 18 ISIS 588848 116 95 92 69 71
ISIS 594430 104 64 59 45 46
Tolerability Studies
Body Weight Measurements
[0553] To evaluate the effect of ISIS oligonucleotides on the
overall health of the animals, body and organ weights were measured
and are presented in the Table below. `*` indicates that the
oligonucleotide was tested in a separate study with similar
conditions and is the average of the measurements from male and
female monkeys. The results indicate that effect of treatment with
antisense oligonucleotides on body and organ weights was within the
expected range for antisense oligonucleotides.
TABLE-US-00101 TABLE 100 Final body weights (g) in cynomolgus
monkey Day Day Day Day Day Day Day 1 14 28 42 56 70 84 PBS 2887
2953 3028 3094 3125 3143 3193 ISIS 532770* 2963 2947 2966 3050 3097
3138 3160 ISIS 532800 2886 2976 3072 3149 3220 3269 3265 ISIS
532809 2755 2836 2927 2983 3019 3071 3098 ISIS 588540 2779 2834
2907 2934 2981 3034 3057 ISIS 588544 2837 2896 3009 3064 3132 3163
3199 ISIS 588548 2694 2816 2882 2990 3073 3149 3161 ISIS 588550
2855 2988 3062 3188 3219 3282 3323 ISIS 588553 3033 3156 3256 3335
3379 3372 3442 ISIS 588555 2757 2863 2965 3022 3075 3088 3158 ISIS
588848 2850 3018 3032 3187 3230 3212 3291 ISIS 594430 2884 2963
2953 3149 3187 3204 3256
TABLE-US-00102 TABLE 101 Final organ weights (g) in cynomolgus
monkey Spleen Heart Kidney Liver PBS 2.8 11.6 11.9 55.8 ISIS
532770* 5.0 11.3 20.6 77.9 ISIS 532800 6.2 11.9 18.6 94.4 ISIS
588540 4.0 11.4 13.5 67.1 ISIS 588548 4.1 11.7 17.3 72.0 ISIS
588550 5.8 10.9 18.5 81.8 ISIS 588553 5.0 12.7 17.2 85.9 ISIS
588555 4.7 11.8 15.9 88.3 ISIS 588848 5.0 12.7 14.4 75.7 ISIS
594430 3.9 11.9 14.8 69.9
Liver Function
[0554] To evaluate the effect of ISIS oligonucleotides on hepatic
function, blood samples were collected from all the study groups.
The blood samples were collected from the cephalic, saphenous, or
femoral veins, 48 hours post-dosing. The monkeys were fasted
overnight prior to blood collection. Blood (1.5 mL) was collected
in tubes without anticoagulant for serum separation. The tubes were
kept at room temperature for a minimum of 90 minutes and then
centrifuged (approximately 3,000 rpm for 10 min) to obtain serum.
Levels of various liver function markers were measured using a
Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan).
[0555] Plasma levels of ALT and AST were measured and the results
are presented in the Table below, expressed in IU/L. Bilirubin, a
liver function marker, was similarly measured and is presented in
the Table below expressed in mg/dL. `*` indicates that the
oligonucleotide was tested in a separate study with similar
conditions and is the average of the measurements from male and
female monkeys. The results indicate that most of the antisense
oligonucleotides had no effect on liver function outside the
expected range for antisense oligonucleotides.
TABLE-US-00103 TABLE 102 Liver chemistry marker levels in
cynomolgus monkey plasma on day 86 ALT AST Bilirubin (IU/L) (IU/L)
(mg/dL) PBS 71 57 0.3 ISIS 532770* 59 58 0.1 ISIS 532800 65 86 0.1
ISIS 532809 35 58 0.1 ISIS 588540 70 88 0.2 ISIS 588544 55 97 0.2
ISIS 588548 61 85 0.2 ISIS 588550 94 84 0.2 ISIS 588553 44 65 0.2
ISIS 588555 63 84 0.2 ISIS 588848 69 65 0.2 ISIS 594430 86 53
0.2
Kidney Function
[0556] To evaluate the effect of ISIS oligonucleotides on kidney
function, blood samples were collected from all the study groups.
The blood samples were collected from the cephalic, saphenous, or
femoral veins, 48 hours post-dosing. The monkeys were fasted
overnight prior to blood collection. Blood was collected in tubes
without anticoagulant for serum separation. The tubes were kept at
room temperature for a minimum of 90 minutes and then centrifuged
(approximately 3,000 rpm for 10 min) to obtain serum. Levels of BUN
and creatinine were measured using a Toshiba 200FR NEO chemistry
analyzer (Toshiba Co., Japan). Results are presented in the Table
below, expressed in mg/dL. `*` indicates that the oligonucleotide
was tested in a separate study with similar conditions and is the
average of the measurements from male and female monkeys.
[0557] For urinalysis, fresh urine from all the animals was
collected in the morning using a clean cage pan on wet ice. Food
was removed overnight the day before urine collection but water was
supplied. Urine samples (approximately 1 mL) were analyzed for
protein to creatinine (P/C) ratio using a Toshiba 200FR NEO
automated chemistry analyzer (Toshiba Co., Japan). `n.d.` indicates
that the urine protein level was under the detection limit of the
analyzer.
[0558] The plasma and urine chemistry data indicate that most of
the ISIS oligonucleotides did not have any effect on the kidney
function outside the expected range for antisense
oligonucleotides.
TABLE-US-00104 TABLE 103 Renal chemistry marker levels (mg/dL) in
cynomolgus monkey plasma on day 86 Total BUN Creatinine protein PBS
28 0.9 8.0 ISIS 532770* 20 0.9 6.9 ISIS 532800 25 0.9 7.5 ISIS
532809 23 0.8 7.4 ISIS 588540 30 0.8 7.5 ISIS 588544 26 0.9 7.4
ISIS 588548 25 0.9 7.6 ISIS 588550 24 0.9 7.2 ISIS 588553 25 0.8
7.2 ISIS 588555 25 0.8 7.6 ISIS 588848 24 0.9 7.5 ISIS 594430 25
0.8 7.2
TABLE-US-00105 TABLE 104 Total Protein/Creatinine ratio in
cynomolgus monkey urine Day 44 Day 86 PBS 0.03 n.d. ISIS 532800
0.01 n.d. ISIS 532809 0.01 n.d. ISIS 588540 0.03 n.d. ISIS 588544
0.01 0.09 ISIS 588548 0.01 0.01 ISIS 588550 0.04 0.01 ISIS 588553
0.05 n.d. ISIS 588555 0.03 0.03 ISIS 588848 0.09 n.d. ISIS 594430
0.03 n.d.
Hematology
[0559] To evaluate any effect of ISIS oligonucleotides in
cynomolgus monkeys on hematologic parameters, blood samples of
approximately 0.5 mL of blood was collected from each of the
available study animals in tubes containing K.sub.2-EDTA. Samples
were analyzed for red blood cell (RBC) count, white blood cells
(WBC) count, individual white blood cell counts, such as that of
monocytes, neutrophils, lymphocytes, as well as for platelet count,
hemoglobin content and hematocrit, using an ADVIA120 hematology
analyzer (Bayer, USA). The data is presented in the Tables below.
`*` indicates that the oligonucleotide was tested in a separate
study with similar conditions and is the average of the
measurements from male and female monkeys.
[0560] The data indicate the oligonucleotides did not cause any
changes in hematologic parameters outside the expected range for
antisense oligonucleotides at this dose.
TABLE-US-00106 TABLE 105 Blood cell counts in cynomolgus monkeys
RBC Platelets WBC Neutrophils Lymphocytes Monocytes
(.times.10.sup.6/.mu.L) (.times.10.sup.3/.mu.L)
(.times.10.sup.3/.mu.L) (% WBC) (% total) (% total) PBS 5.8 347 9.4
42.7 53.1 3.0 ISIS 532770* 5.4 386 10.8 22.3 71.7 3.3 ISIS 532800
5.6 360 13.1 29.5 61.1 6.5 ISIS 532809 5.2 400 11.5 56.6 38.2 2.5
ISIS 588540 5.5 367 11.7 50.9 42.7 2.1 ISIS 588544 5.2 373 14.3
56.6 37.6 4.3 ISIS 588548 5.1 373 9.7 40.4 54.3 3.9 ISIS 588550 6.1
343 9.9 32.1 61.7 4.6 ISIS 588553 5.2 424 9.3 41.7 53.2 3.6 ISIS
588555 5.1 411 9.6 45.1 49.7 3.5 ISIS 588848 5.7 370 10.0 39.8 55.8
3.1 ISIS 594430 5.7 477 10.6 47.3 47.8 3.6
TABLE-US-00107 TABLE 106 Hematologic parameters in cynomolgus
monkeys Hemoglobin HCT (g/dL) (%) PBS 14.1 46.6 ISIS 532770* 12.4
40.9 ISIS 532800 12.3 40.5 ISIS 532809 12.2 40.4 ISIS 588540 12.5
41.5 ISIS 588544 11.9 38.1 ISIS 588548 12.3 39.6 ISIS 588550 13.4
45.0 ISIS 588553 12.6 39.8 ISIS 588555 11.6 38.1 ISIS 588848 13.2
42.7 ISIS 594430 13.4 43.1
Measurement of Oligonucleotide Concentration
[0561] The concentration of the full-length oligonucleotide was
measured in the kidney and liver tissues. The method used is a
modification of previously published methods (Leeds et al., 1996;
Geary et al., 1999) which consist of a phenol-chloroform
(liquid-liquid) extraction followed by a solid phase extraction.
Tissue sample concentrations were calculated using calibration
curves, with a lower limit of quantitation (LLOQ) of approximately
1.14 .mu.g/g. The results are presented in the Table below,
expressed as .mu.g/g liver or kidney tissue.
TABLE-US-00108 TABLE 107 Antisense oligonucleotide distribution
Kidney Liver Kidney/Liver (.mu.g/g) (.mu.g/g) ratio ISIS 532800
3881 1633 2.4 ISIS 588540 3074 1410 2.2 ISIS 588548 3703 1233 3.0
ISIS 588550 4242 860 4.9 ISIS 588553 3096 736 4.2 ISIS 588555 4147
1860 2.2 ISIS 588848 2235 738 3.0 ISIS 594430 1548 752 2.1
Sequence CWU 1
1
82012646DNAHomo sapiens 1gacttctgca gtttctgttt ccttgactgg
cagctcagcg gggccctccc gcttggatgt 60tccgggaaag tgatgtgggt aggacaggcg
gggcgagccg caggtgccag aacacagatt 120gtataaaagg ctgggggctg
gtggggagca ggggaaggga atgtgaccag gtctaggtct 180ggagtttcag
cttggacact gagccaagca gacaagcaaa gcaagccagg acacaccatc
240ctgccccagg cccagcttct ctcctgcctt ccaacgccat ggggagcaat
ctcagccccc 300aactctgcct gatgcccttt atcttgggcc tcttgtctgg
aggtgtgacc accactccat 360ggtctttggc ccggccccag ggatcctgct
ctctggaggg ggtagagatc aaaggcggct 420ccttccgact tctccaagag
ggccaggcac tggagtacgt gtgtccttct ggcttctacc 480cgtaccctgt
gcagacacgt acctgcagat ctacggggtc ctggagcacc ctgaagactc
540aagaccaaaa gactgtcagg aaggcagagt gcagagcaat ccactgtcca
agaccacacg 600acttcgagaa cggggaatac tggccccggt ctccctacta
caatgtgagt gatgagatct 660ctttccactg ctatgacggt tacactctcc
ggggctctgc caatcgcacc tgccaagtga 720atggccgatg gagtgggcag
acagcgatct gtgacaacgg agcggggtac tgctccaacc 780cgggcatccc
cattggcaca aggaaggtgg gcagccagta ccgccttgaa gacagcgtca
840cctaccactg cagccggggg cttaccctgc gtggctccca gcggcgaacg
tgtcaggaag 900gtggctcttg gagcgggacg gagccttcct gccaagactc
cttcatgtac gacacccctc 960aagaggtggc cgaagctttc ctgtcttccc
tgacagagac catagaagga gtcgatgctg 1020aggatgggca cggcccaggg
gaacaacaga agcggaagat cgtcctggac ccttcaggct 1080ccatgaacat
ctacctggtg ctagatggat cagacagcat tggggccagc aacttcacag
1140gagccaaaaa gtgtctagtc aacttaattg agaaggtggc aagttatggt
gtgaagccaa 1200gatatggtct agtgacatat gccacatacc ccaaaatttg
ggtcaaagtg tctgaagcag 1260acagcagtaa tgcagactgg gtcacgaagc
agctcaatga aatcaattat gaagaccaca 1320agttgaagtc agggactaac
accaagaagg ccctccaggc agtgtacagc atgatgagct 1380ggccagatga
cgtccctcct gaaggctgga accgcacccg ccatgtcatc atcctcatga
1440ctgatggatt gcacaacatg ggcggggacc caattactgt cattgatgag
atccgggact 1500tgctatacat tggcaaggat cgcaaaaacc caagggagga
ttatctggat gtctatgtgt 1560ttggggtcgg gcctttggtg aaccaagtga
acatcaatgc tttggcttcc aagaaagaca 1620atgagcaaca tgtgttcaaa
gtcaaggata tggaaaacct ggaagatgtt ttctaccaaa 1680tgatcgatga
aagccagtct ctgagtctct gtggcatggt ttgggaacac aggaagggta
1740ccgattacca caagcaacca tggcaggcca agatctcagt cattcgccct
tcaaagggac 1800acgagagctg tatgggggct gtggtgtctg agtactttgt
gctgacagca gcacattgtt 1860tcactgtgga tgacaaggaa cactcaatca
aggtcagcgt aggaggggag aagcgggacc 1920tggagataga agtagtccta
tttcacccca actacaacat taatgggaaa aaagaagcag 1980gaattcctga
attttatgac tatgacgttg ccctgatcaa gctcaagaat aagctgaaat
2040atggccagac tatcaggccc atttgtctcc cctgcaccga gggaacaact
cgagctttga 2100ggcttcctcc aactaccact tgccagcaac aaaaggaaga
gctgctccct gcacaggata 2160tcaaagctct gtttgtgtct gaggaggaga
aaaagctgac tcggaaggag gtctacatca 2220agaatgggga taagaaaggc
agctgtgaga gagatgctca atatgcccca ggctatgaca 2280aagtcaagga
catctcagag gtggtcaccc ctcggttcct ttgtactgga ggagtgagtc
2340cctatgctga ccccaatact tgcagaggtg attctggcgg ccccttgata
gttcacaaga 2400gaagtcgttt cattcaagtt ggtgtaatca gctggggagt
agtggatgtc tgcaaaaacc 2460agaagcggca aaagcaggta cctgctcacg
cccgagactt tcacatcaac ctctttcaag 2520tgctgccctg gctgaaggag
aaactccaag atgaggattt gggttttcta taaggggttt 2580cctgctggac
aggggcgtgg gattgaatta aaacagctgc gacaacaaaa aaaaaaaaaa 2640aaaaaa
264629001DNAHomo sapiens 2ggaggtgagg gtctcaggtt ggggatgctg
ggatccccct gtgacagctc ccagaatgtc 60tctcttcctt ctccaggtct ggctgctttc
tctctctgac gcgggtcacc cctcctccca 120agcctcacaa acctgctagg
tgtccctggg tctgcttatt ctttttttgt tgttattgag 180atggagtctt
gctctgtctc ccaggctgga gtgcagtggc acgacctcag ctcactgcaa
240cttctgcctc ctgggttcaa gcgattctcc tacttcagcc tcccgagtag
ctgagattac 300aggtgcccac caccacacca gctaattttt gtatttttag
tagagacggg atttcgccat 360gttggccagg atggtcttga actcctgacc
tcaagtgatc tgcctgcctc aacctcccaa 420agtgctgaga ttacaggcgt
gagccactgc acccacccgg gtctgcttat tctacccttc 480tctctggttc
cacccctgct gcagtggaca agctgtgccg aggttgtctc ccaagaaaaa
540accatgttcc ccaacttgac agatgtcagg gaggtggtga cagaccagtt
cctatgcagt 600gggacccagg aggatgagag tccctgcaag ggtgagtccc
tcaccatgcc tggattccca 660aggggaaggc cacctgtgtc tctgtggcca
gcatgcatgc cagaacacca gtccactgcc 720ctagatgaca ctgtctcctg
tcaccctttg ctggcaggag aatctggggg agcagttttc 780cttgagcgga
gattcaggtt ttttcaggtg agaaggtaga agcttgcagg acccaggggt
840tacaggatct cagccttgtt ggggggatga gggaggcctt tgagggatct
agggaggttg 900gggcttacag ttggggctgt ggcagcctcc cagccagttc
tctccttttc tccaggtggg 960tctggtgagc tggggtcttt acaacccctg
ccttggctct gctgacaaaa actcccgcaa 1020aagggcccct cgtagcaagg
tcccgccgcc acgagacttt cacatcaatc tcttccgcat 1080gcagccctgg
ctgaggcagc acctggggga tgtcctgaat tttttacccc tctagccatg
1140gccactgagc cctctgctgc cctgccagaa tctgccgccc ctccatcttc
tacctctgaa 1200tggccaccct tagaccctgt gatccatcct ctctcctagc
tgagtaaatc cgggtctcta 1260ggatgccaga ggcagcgcac acaagctggg
aaatcctcag ggctcctacc agcaggactg 1320cctcgctgcc ccacctcccg
ctccttggcc tgtccccaga ttccttccct ggttgacttg 1380actcatgctt
gtttcacttt cacatggaat ttcccagtta tgaaattaat aaaaatcaat
1440ggtttccaca tctctcagtg cctctatctg gaggccaggt agggctggcc
ttgggggagg 1500gggaggccag aatgactcca agagctacag gaaggcaggt
cagagacccc actggacaaa 1560cagtggctgg actctgcacc ataacacaca
atcaacaggg gagtgagctg gatccttatt 1620tctggtccct aagtgggtgg
tttgggctta ctggggagga gctaaggccg gagaggaggt 1680actgaagggg
agagtcctgg acctttggca gcaaagggtg ggacttctgc agtttctgtt
1740tccttgactg gcagctcagc ggggccctcc cgcttggatg ttccgggaaa
gtgatgtggg 1800taggacaggc ggggcgagcc gcaggtgcca gaacacagat
tgtataaaag gctgggggct 1860ggtggggagc aggggaaggg aatgtgacca
ggtctaggtc tggagtttca gcttggacac 1920tgagccaagc agacaagcaa
agcaagccag gacacaccat cctgccccag gcccagcttc 1980tctcctgcct
tccaacgcca tggggagcaa tctcagcccc caactctgcc tgatgccctt
2040tatcttgggc ctcttgtctg gaggtaagcg agggtaacct tcccttcctg
ctgtctccag 2100catccctcct tggccttttg gggccaggct tcatcagcct
ttctcttcag gtgtgaccac 2160cactccatgg tctttggccc ggccccaggg
atcctgctct ctggaggggg tagagatcaa 2220aggcggctcc ttccgacttc
tccaagaggg ccaggcactg gagtacgtgt gtccttctgg 2280cttctacccg
taccctgtgc agacacgtac ctgcagatct acggggtcct ggagcaccct
2340gaagactcaa gaccaaaaga ctgtcaggaa ggcagagtgc agaggtttga
gggcaatgag 2400tgtgggcagt ggcctaaggc agaaacaggg caggcggcag
caaggtcagg actaggatga 2460gactaggcag ggtgacaagg tgggctgacc
gggagtagga gcagttttag ggtggcaggc 2520ggaaaggggg caagaaaaag
cggagttaac ccttactaag catttaccct gggcttccag 2580gcagccctgg
aagtcaagag aacactcaga aatggggagg gagaagcagt ggaaatccat
2640atgggttgag gagtaggtaa gatgctgctt ctgcgggact gggaatgcgc
tgtttctcag 2700tgacatggtc tccgagacca ggagggatac acctaaggca
gcctttccct cttgatgact 2760tctacttgtc cccccttctc aaagcaatcc
actgtccaag accacacgac ttcgagaacg 2820gggaatactg gccccggtct
ccctactaca atgtgagtga tgagatctct ttccactgct 2880atgacggtta
cactctccgg ggctctgcca atcgcacctg ccaagtgaat ggccgatgga
2940gtgggcagac agcgatctgt gacaacggag gtgagaagca tcccctcccc
ctacattgct 3000gtctccctga cggcgcccag cccgaggagt gggcactcgg
ctccggacac tgtaactctt 3060gctctctacc ttgctcacgg ggcctcaggc
ttcagtgctt acctcgatgt ctcatacctc 3120tgcagcgggg tactgctcca
acccgggcat ccccattggc acaaggaagg tgggcagcca 3180gtaccgcctt
gaagacagcg tcacctacca ctgcagccgg gggcttaccc tgcgtggctc
3240ccagcggcga acgtgtcagg aaggtggctc ttggagcggg acggagcctt
cctgccaagg 3300tgacctttga cctgtacccc caggtcagat cctggtcttc
catcctactg tcttctctcc 3360ccacctcaac cctgctcttt cctcactttg
tttaaacctc cctgtacaac tatctcactt 3420ctgagccttt tataccctgg
aaacccatga tcccccgtct ctttggtcac tgtatccctg 3480acactcccag
acatttgacc tcatttctga ctctcccaga ctccttcatg tacgacaccc
3540ctcaagaggt ggccgaagct ttcctgtctt ccctgacaga gaccatagaa
ggagtcgatg 3600ctgaggatgg gcacggccca ggtttgaaga cagagaaggg
aggcagggca gggaactggg 3660ggaaaatgga gaagggacag aactgttaat
gctggagcct gagccactct cctggcaccc 3720aggggaacaa cagaagcgga
agatcgtcct ggacccttca ggctccatga acatctacct 3780ggtgctagat
ggatcagaca gcattggggc cagcaacttc acaggagcca aaaagtgtct
3840agtcaactta attgagaagg tggaatcctc ctatccctga actcggggga
atggaatctc 3900gctgatcttc caggactagc tccctgatca ttccagcccc
tctgaacaac agggccccag 3960gaaaatctcc aggtcctatt ctgtcctcct
tcccttttac ttgaagcagt ttcttgactg 4020gtaattcctc catgaacctc
agcccttgag cctcttactg agagcctccc tgtcccagca 4080aagtcgctga
aatctcccaa tcacagtatt ctattttcaa tgccatggcg ccttgttctc
4140ctcacccaca ggtggcaagt tatggtgtga agccaagata tggtctagtg
acatatgcca 4200cataccccaa aatttgggtc aaagtgtctg aagcagacag
cagtaatgca gactgggtca 4260cgaagcagct caatgaaatc aattatgaag
gtcagaggtt agggaatggt gggaggttca 4320ctttggggtc aggaggttca
gggtggaggg ggtcatgaga ctaccttgag ggcgacaggg 4380aggaccactt
tgtagtcaaa agttgaacag caggatcgtt gggcaatgga ggttagtggg
4440aacctgttgg gggctggaag ggccactttg tggtcaaagg gaagtccgtg
taatgatgat 4500taacttaaaa agttgaaaga tgtgggattt cagttgcaga
ttggtctctg gggttaaaag 4560atggcttgga agaccaggtg aggtgatggt
ctcttccctc tccacagacc acaagttgaa 4620gtcagggact aacaccaaga
aggccctcca ggcagtgtac agcatgatga gctggccaga 4680tgacgtccct
cctgaaggct ggaaccgcac ccgccatgtc atcatcctca tgactgatgg
4740tcagaaggga cctctctcct gtcccagcct ccccaccttc tcagaccagc
atgtggccct 4800taagtccact tgtaacacta tacccatggt tggggccctg
aatgtgactc atagctggct 4860gttcatctct cctgtgaccc ttcataagga
attcttccta agccctgtga tcaactatct 4920ctaacccttc ctcaacttgc
tcaccctgcc atgtgtatcc ctgcctttag ccagtttatc 4980ttccttatct
cctaccctca tggtcctgtc tcttctgcag gattgcacaa catgggcggg
5040gacccaatta ctgtcattga tgagatccgg gacttgctat acattggcaa
ggatcgcaaa 5100aacccaaggg aggattatct gggtgagtaa cctgcctagg
acccagcacc ccacttcctc 5160agggcttgga ccctcatcct tcctttttat
ccctcagatg tctatgtgtt tggggtcggg 5220cctttggtga accaagtgaa
catcaatgct ttggcttcca agaaagacaa tgagcaacat 5280gtgttcaaag
tcaaggatat ggaaaacctg gaagatgttt tctaccaaat gatcggtagg
5340gagatacaag ggaataaaga acacaactct cctcaggttc ccctgaagta
attcattctt 5400cctctacacc tgaagctcta gttgcctgga aagccttctt
cattcctcct tctctacctc 5460agtgtcacta ttcttgtttc ctggcactgt
tcacttaacc ttagaatcac agagctctga 5520gcacttcaga gatctttcta
tagtcctaca tttgacacgt ggaaacagaa gccaaaggag 5580gtcaagggac
agcaagttag caacaagggt gggcttgaaa acagccaggc ctctgacagc
5640ttgatcccaa gttctttccc ttttcagtcc accatagcag ttttctccta
acacgaggaa 5700acaaataccc gtggtctttc cctttctcct tttgggcctt
tgctccccat agactcctac 5760ccaaaaggct gctgccattt gggaatgaag
tgttccgagt tttcagcaca ttctccttct 5820ctgccagatg aaagccagtc
tctgagtctc tgtggcatgg tttgggaaca caggaagggt 5880accgattacc
acaagcaacc atggcaggcc aagatctcag tcattgtaag cacagaatcc
5940cagtagtggg gacttggggg aggtgaggtc aaggtgaaat gggagtaggg
gaaggaaaaa 6000atggccataa gagatggtgg tttgtgaaag ttgagctttc
cctctctact gttgtgtccc 6060cagcgccctt caaagggaca cgagagctgt
atgggggctg tggtgtctga gtactttgtg 6120ctgacagcag cacattgttt
cactgtggat gacaaggaac actcaatcaa ggtcagcgta 6180ggtaaggatg
caactgaagg tcctgggctg cacctatgct ctccaggcaa cacctcccac
6240tttctacaga tcctacactc cacccatcct caatgcagcc ccattccttg
caccccagac 6300cagtcaggga tgggggaaga cgtgaagtta ggaatgacac
ggggccagag gcaggaagct 6360gcccacaaag aggtggtacc tactctccta
cttcaggagg ggagaagcgg gacctggaga 6420tagaagtagt cctatttcac
cccaactaca acattaatgg gaaaaaagaa gcaggaattc 6480ctgaatttta
tgactatgac gttgccctga tcaagctcaa gaataagctg aaatatggcc
6540agactatcag gtgagagcgt ccagatccct gaggaaaggc tgggaaaggc
tggaggactg 6600gggtgaggag caggcctggt ttgctgttct ccttgtcctt
tataggccca tttgtctccc 6660ctgcaccgag ggaacaactc gagctttgag
gcttcctcca actaccactt gccagcaaca 6720aagtaagaca tacttggcaa
gaggataagg atgagatccc aagagacaag tggggcatga 6780gagggaggtg
caataggaag agatgatgcc tggcccagaa cctagctcta gaagggctta
6840ggggacatct actgagtgac aaaggcaatg gggagatgac agtggtggga
gcagctgaag 6900tgacgcagtc tattcgtcca gaggaagagc tgctccctgc
acaggatatc aaagctctgt 6960ttgtgtctga ggaggagaaa aagctgactc
ggaaggaggt ctacatcaag aatggggata 7020aggtgagaaa cgggcatcct
aaggaggcac tctaggcccc aatccttcct aagccacttc 7080tgttcattac
ttctccatgc ttcccacctc ccctacagaa aggcagctgt gagagagatg
7140ctcaatatgc cccaggctat gacaaagtca aggacatctc agaggtggtc
acccctcggt 7200tcctttgtac tggaggagtg agtccctatg ctgaccccaa
tacttgcaga ggtgagagaa 7260tgctctttgg ttgtgctaca agtgcccaag
gcccaacagt ccttttctct acagcttctc 7320ctctccttgc aggtgattct
ggcggcccct tgatagttca caagagaagt cgtttcattc 7380aagtgagtcc
tccctttcct atctggggag atgccaagtg gtcagcatgg gccccaaagc
7440aggaaagctc aatgcatgtg gctagtaatt cgaggtaggc agagcctgcc
tcaccttagg 7500accgcatgtc ttgcctgcgt gtgtcaagaa cgaggctgag
ctgggtccct agtctgattc 7560ctttaggtca gctaagacac aagcaggaac
agccatgctt ccaggattag gaattctact 7620gaatgatcca tggcacccca
ctgcctctgc aggttggtgt aatcagctgg ggagtagtgg 7680atgtctgcaa
aaaccagaag cggcaaaagc aggtacctgc tcacgcccga gactttcaca
7740tcaacctctt tcaagtgctg ccctggctga aggagaaact ccaagatgag
gatttgggtt 7800ttctataagg ggtttcctgc tggacagggg cgtgggattg
aattaaaaca gctgcgacaa 7860cacctgtgtt ccagatcctt ttggggcaag
ggagtgggga acaggcactg gccatgttgt 7920tacactgaga tcaaacctga
cagccgtttt taaaggttta accccaatcc caagtgctga 7980aaaaccagag
gctgagggag atgtgtaagc ttccacctca gtgttttact gagaccagca
8040ttggggcata tgaggcacaa ggaatccagc tctgttccct agaagccatc
cacaaggttt 8100tccttgtaga cgtcatcact gtagacaatc tgggtcctct
tgtcccggtg gcaaccctta 8160gggctgttct ggacagctag ggagggagga
gaggaacagt taaggtctaa aggagatcat 8220agaacagacc ctgaggctga
ctcctgacca cctcactcct ggccactggc ccctggaagc 8280ccagtttcca
cgctgccctc tggtggccag gatggcctgt cttccttagc tcctttgtgc
8340caacccatgg ccaagaaaag tataagtgga cattttgatg aatgttttgt
tcttagaaaa 8400atcccaaatg tcattgttga gacacgtgaa tgatattaac
ccactactta cagtcagtat 8460gtcagaagct aaaaactaga aaacctctgt
agcccttttt tgacatgctg gtcaattcta 8520gttcctttct tttgcctgaa
gggccactgt agctgagccc ttctttctgc tcactccttt 8580cccaggaaaa
tctactttca gggaaaatgg attattcaca ctaagaaatg ctactagctc
8640caccagaact cattcagggt gtagctttgg ccctcaccat tctctctcaa
gcctctagct 8700gtttcttccc cttcctcttt cctccctcca ccagacatgt
tactctcttc accccatcca 8760atggttccat ccccaccacc cttgagctac
agagaatctc tctcacccac tcccatcctg 8820tgatctctgt gcctcaacac
tgctggctac tccctctttc tcaaagtgtg tgtccttttg 8880cttcagtggc
ccaggcccct gcggtgctgc tcccagccct ccgacccctc ctcctgtctc
8940ctttgctaac gttaggctca acgttagcct aacatgtcag gacagctggg
gacatgtggg 9000g 900139001DNAMacaca mulatta 3gatggaatct tgctctgtct
cccacactgg agtgcagtgg cacgatcttg gctcactgcg 60acttctgcct cccagattta
agtgattctc ctacctcggc ctcccaagta gctgggatta 120taggtgcttg
ccaccacatg cagctaattt ttgtattttt agtagagaca ggattccgcc
180atgttggcca ggatggtctt gaactcctga cctcaagtga ttcgcccacc
tcagcctccc 240aaactgctgg gattacaggc gtgagccatt gcacccagtc
aggtctgctt attcttccct 300tctctctggt tccaccccta cggcagtgga
caagctgtgc cgaggtcgtc tcccaagaaa 360aaaccatgtt ccccaacttg
acagatgtca gggaggtggt gacagaccag tttctatgca 420gtgggaccca
ggaggatgag agtccctgca agggtgagtc cctcaccatg cctggattcc
480caaaggggaa ggccacctgt gtctctgtgg ccagggtgca tgccagaaca
ccagtccact 540gccctgtatg acgctgtctc ctgtcaccct ttgctggcag
gagaatctgg gggagcagtt 600ttccttgagc ggagattcag gttttttcag
gtgagaaggt ggaagcttgc aggacccagg 660ggttacagga tgtcagcctt
gttgggggga tgagggaggc ctttgaggga tctagggagg 720ttggggctta
cagctggagc tgtggcagcc tcccagccag ttctctcctt ttctccaggt
780gggtctggtg agctggggtc tttacaaccc ctgccttggc tctgctgaca
aaaactcccg 840caaaagggcc cctcgtagca aggtcccgcc gccacgagac
tttcacatca atctcttccg 900catgcagccc tggctgaggc agcacctggg
ggatgtcctg aattttttac ccctttagtc 960atggccactg agccctctgc
tgtcctgtta gaatccgccc cccctccatc ttctacctct 1020gaatgcccac
ccttagactc tgtgacccat gctgtctcct agttgagtaa atctgggtct
1080ctaggatgcc aggggcagcg cacacaagct gggaaatcct cagggctcct
accagcggga 1140ctgcctcgct gccccacctc ccgctccttg gcctgtcccc
aaattcctcc cctggttgac 1200ttgactcatg ctcatttcac tttcatatgg
aatttcccag ttatgaaatt aataaaaatc 1260agtggtttcc acatctgtct
gtgactctat ctggaggcca ggtagggctg gcctgggggg 1320aaggggaggc
cagaatgact ccaagagcca caggaaggca ggtcagagac cccactggac
1380aaacagtggc tggactctgt accataacac acaagcaaca ggggagtgag
ctggatcctt 1440atttctggtc cctaagtggg tggtctgggc ttgctgggga
ggagctgagg ccagaaggag 1500gtactgaagg ggagagtcct ggaccttggg
cagcaaaggg tgggacttct gcagtttctg 1560cttccttgac tggcagctca
gcggggccct cccgcttgga tgttccggga aagtgatgag 1620ggtaggacag
gcggggcaag ctgcaggtgc cagaacacag attgcataaa aggccgggag
1680ctggtggggg gcaggggaag ggaatgtgac caggtctagg tctggagttt
cagcttggac 1740actgagctaa gtagacaagc aaaacaagcc aggacacgcc
atcctgcccc aggcccagct 1800tctctcctgc cttctaacgc catggggagc
agtctcagcc cccagctcta cctgatgccc 1860ttcatcttgg gcctcttatc
tggaggtaag tgagggtaac cttcccttcc tgctgtcccc 1920agcatccctc
cttggccttt tggggccagg cttcatcagc ctttctcttc aggtgtgacc
1980accactccat tgtcttcggc ccagcctcaa ggatcctgct ctctggaggg
ggtagagatc 2040aaaggtggct ccttccgact tctccaagag ggccaggcac
tggaatacgt gtgtccttct 2100ggcttctacc cgtaccctgt gcagacacgt
acctgcagat ccacggggtc ctggagcacc 2160ctgcagactc aagatcgaaa
aactgtcaag aaggcagagt gcagaggttt gagggcaatg 2220agtgtgggca
gtggcctaag ggagaaacag ggcagatggc agcaaggtca ggactaggat
2280gagactaggc agggtgacaa ggtgggctga ccaggagtag gagcagtttt
agggttgtag 2340agggaaagga agggaaaaaa aaaggggagt taacctttag
taagcattta ccctgggctt 2400ccacgcagcc ctggaagtca agagaacact
cagcaatggg gagggaggag cagcggaaac 2460ccctatgggt tgaagggtag
gtaagatgca gcttctgcag gactgggaat gctctgtttc 2520tcagtgacct
ggtctctgag accaggaggg aaacacctaa ggcagccttt ccctcttaat
2580gacttctact tctcccctct tctcaaagca atccgctgtc cacgaccaca
ggacttcgag 2640aacggggaat accggccccg gtctccctac tacaatgtga
gtgatgagat ctctttccac 2700tgctatgacg gttacactct ccggggctct
gccaatcgca cctgccaagt gaatggccgg 2760tggagtgggc agacagcgat
ctgtgacaac ggaggtgaga agcatcctct ccccccacat 2820tgctgtctcc
ctgacagcgc ctagcctgag gagtgggcat ttgcccccgg acactgtaac
2880tcttgctctc taccttgccc tcggggcctc aggcttcagc gcttacctcc
atgtctcatg 2940cctctgcagc ggggtactgc tccaacccag gcatccccat
tggcacaagg aaggtgggca 3000gccggtaccg ccttgaagac agcgtcacct
accactgcag ccgggggctt accctgcgtg 3060gctcccagcg gcgaacatgt
caggaaggtg gctcttggag cgggacggag ccttcctgcc 3120aaggtgaccc
ttgacctgta cccccaggtc agatcctgat cttgcatcct actgtcttct
3180ctccccacct caaccctgct ctttcctcac ttcttttaaa ccttcctcta
gaactgtctc
3240acttctgagc cttttctacc ctggaaaccc acaatcccct gtctctttgg
tcactgtgtc 3300cctgacactc ccagacattt gacctcattt ctgactctcc
cagactcctt catgtacgac 3360acccctcaag aggtggccga agctttcctg
tcttccctga cggagaccat agaaggagtc 3420gatgccgagg atgggcacag
cccaggtttg aaggcagaga ggggaggcaa ggcagggaac 3480tgggggaaaa
tggagaaggg acaagataat cgttcatgct ggagcctgag tcactctcct
3540ggcacccagg ggaacaacag aagcggagga tcatcctaga cccttcaggc
tccatgaaca 3600tctacctggt gctagatgga tcagacagca ttggggccgg
caacttcaca ggagccaaaa 3660agtgtctagt caacttaatt gagaaggtgg
agtcctccta tccctgaact tgggggaatg 3720gaatcttgct gatcttccag
gactagctcc ctgatcattc cagcccctct gaaccgcagg 3780gccccaggaa
agtctccagg tcctattctg tcctccttcc cttgtacttg attcctccat
3840gaacctgtgc ttgagcctct tcctaagagc ctccctgtcc cagcaacgtt
gctgaagtct 3900cccaatcaca gtattctact ttcaatgcca tggcgccttg
ttctcctcac ccacaggtgg 3960caagttatgg tgtgaagcca agatatgctc
tagtgacata tgccacatac cccagaattt 4020gggtcaaagt gtctgaccaa
gagagcagca atgcagactg ggtcacgaag aagctcagtg 4080aaatcaatta
tgaaggtcag aggttaggga atggtgggag gttcactttg gggtcaggag
4140gttcaggagt gttgtgtgga gggggtcatg agactacctt gagggcaaca
gggggaccac 4200tttgtagtca aaggttgaac agcaggatca ttgggcaatg
gaggttagtg ggaacctgct 4260gagggctgga agggccactt tgtggtcaaa
gggaagtcca tatgatgatt aacttaaaaa 4320gttgaagatg tgagatttca
gttgcagatt ggtctctggg gttaaaagat ggcttggaag 4380accaggtgag
gcgatgctct cttccctccc cacagaccac aagttgaagt cagggactaa
4440caccaagagg gccctccagg cagtgtacag catgatgagt tggccagagg
acatccctcc 4500tgaaggctgg aaccgcaccc gccatgtcat catcctcatg
accgatggtc agaagggacc 4560tctctcctgt cccagcctcc ccaccttctc
agaccagcat gtggccctta agtccacttg 4620taacactata cccatggttg
gggccctgaa tgtgactcgt aactggctgt tcatctctcc 4680tgtgaccctt
cataaagaat tattcctaaa gccctgtgat caactacctc taacccttcc
4740tcaacttact caccctgcca cgtgtatcac tgcctctagc caatttatct
tatctcctac 4800cctcatggtc ccgtctcttc tgcaggattg cacaacatgg
gcggggaccc aattactgtc 4860attgatgaga tccgggactt gttatacatc
ggcaaggatc gtaaaaaccc gagggaggat 4920tatctgggtg agtaacctgc
ctaggaccca gcaccctact tcctcagggc ttggaccgtc 4980atccttcctt
tttctccctc agatgtctat gtgtttgggg ttggaccttt ggtggaccaa
5040gtgaacatca atgctttggc ttccaagaaa gacaatgagc aacatgtgtt
caaagtcaag 5100gatatggaaa acctggaaga cgttttcttc caaatgattg
gtaggcagac acaagggaat 5160caagaacgca actctcctca gcttcccctg
aaataattca ttcttcctct acccctgaag 5220ctctagttgc ctggaaagcc
ttcttcattc ctccttctct acctcagtat cactattctt 5280gtttcctggc
actgtttgct tcttaacctt agaatcacag agctctaggc acttcagaga
5340tctttctatt gtcctacatt tgacacatgt ggaaacaaag gccaaaggag
gtcaaggggc 5400agcaagctag caacagggct gggcttgaaa acagccaggc
ctctgatagc ttgatcccaa 5460gttctttccc ttttcactcc accacagcag
ttttctccta acacgaggaa acaaatacct 5520gtggcctttc cctttctcct
tttgggcctc tgccccccac agacttctac ccaaaggctg 5580ctgccgtttg
ggaatgaagt gttccaagtt ttcagcacat tctccttctc tgccagatga
5640aagccagtct ctgagtctct gtggcatggt ttgggaacac agcaagggta
ccgattacca 5700caagcaacca tggcaggcca agatctcagt cactgtaagc
acagaatccc agtagtgagg 5760acttggggga ggtgaggtca aggtgaaatg
ggagtagggg aagggcaaaa tggccgtaag 5820agatggtggt ttgtgaaagt
tgagttttcc ctttctactg ttctgttccc agcgcccttc 5880gaagggacat
gagagctgta tgggggctgt ggtgtctgag tactttgtgc tgacagcagc
5940acattgtttt actgtggacg acaaggaaca ctcaatcaag gtcagcgtgg
gtaaggatgc 6000aactgaaggt cccgggctgc acctacgccc tccaggcaac
acctcccact ttctacagat 6060cccacactcc actcatctgc aatgcagccc
catcccttgc accccagacc agtcagggat 6120ggggaagact tgaagttagg
aatgacatgg ggccagaggc aagaagctgc ccacaaagag 6180gtggtaccta
ttctcctact tcaagggaag aagcgggacc tggagataga aaaagtccta
6240tttcaccccg actacaacat tagcgagaaa aaagaagcag gaattcctga
attttatgac 6300tatgacgttg ccctgatcaa gctcaagaat aagttgaatt
atgacccgac tatcaggtga 6360gagcatccag atccctgagg aaaggctggg
aaaggctgga ggactggggt gaggagcagg 6420cctagtttgc tgttctttct
ccatccttta taggcccatt tgtctcccct gcaccgaggg 6480aacaactcga
gctttgaggc ttcctccaac taccacttgc cagcaacaga gtaagacata
6540ctagggggga ggataaggat gagatcccga gacaagtgag gcatgagagg
gagatgcaat 6600aggaagagac gatgcctggc ccagaaccta gcactaggaa
gggcttaggg gacatctgct 6660gagtgacaaa gtcaataggg agatgacagt
ggtgggagca gctgaagtga tgcagtctat 6720ttgtccagag gaagagctgc
tccctgcaca ggatatcaaa gctctgtttg tgtctgagga 6780ggagaagaag
ctgactcgga aggaggtcta catcaagaat ggggataagg tgagaaatgg
6840gcatcctaag gaggcactct aggccctaat ccttcctaag ccacctctgt
tcattacctt 6900tctccatgct tcccacctcc cctacagaaa ggcagctgtg
agagagatgc tcaatatgcc 6960ccaggctatg acaaagtcaa ggacatctcg
gaggtggtca cccctcggtt cctttgtact 7020ggaggagtga gtccctatgc
tgaccccaat acttgcagag gtgagagaac gctctctggt 7080tgtgctccaa
gtgcccgagg gccaagagtc cttttcccta cagcttctcc tctccttgca
7140ggtgattctg gcggcccctt gatagttcac aagagaagtc gtttcattca
agtgagtcct 7200ccctttccta tctggggaga tgccaagtgg tcagcatggg
ccccaaagca ggaaagcaca 7260atgcatgtgg ctagtaattc gaggtgggca
gagcctgcct cactttagga ctgcatgtct 7320ggcctgtgtg tgtcaagaat
gaggctgagc tgggtcccta gcctgattcc tttaggtcag 7380ctaagacaca
atcaggaaca gtcatgcttc caggattagg aattctatga atgatccatg
7440gcaccccact gcctctgcag gttggtgtca tcagctgggg agtagtggat
gtctgcaaaa 7500accagaagcg gcaaaagcag gtacctgctc acgcccgaga
ctttcacgtc aacctcttcc 7560aagtgctgcc ctggctgaag gagaaactcc
aagatgagga tttgggtttt ctctaagggg 7620tttcctgctg gacaggggcg
cgggattgaa ttaaaacagc tgcgacaaca cttgtgttcc 7680agatcctttt
ggggcaaggg agtggggaac gggcactggc catgttgtta cactgagatc
7740aaacctgaca cccattttta aaggcttaac cccaatccca agtgctgaaa
aaccagaggc 7800tgagggagat atgtaagctt ccacctcagt gttttactga
gaccagcatt ggggcatttg 7860aggcacaagg aatccagctc tgttccctag
aagccatcca caaggttttc cttgtagacg 7920tcatcactgt agacaatctg
ggtcctcttg tcccggtggc aacccttagg gctgttctgg 7980acagctaggg
agggaggaga ggaacagtta aggtctaaag gagatcatag atcagaccct
8040gaggctgact cctgaccacc tcagtcctgg ctgctggccc ctggaaaccc
agtttccacg 8100ctgccctctg gtggccagga tggcctgtct tccttagctc
ctttgtgcca acccatggcc 8160aaggagagtg taagtggaca ttttgatgaa
tgttttgttc ttagaaaaat cccaaatgtc 8220attgttgaga tatatgaatg
atattaaccc actacttata gtcagtatgt cagaagctaa 8280aaactagaaa
acctctgtag ccctttattg acatgctggt caactctagt tcctttcttt
8340tgcctgaaag gccactgttg ctctgagtcc ttctttctgc tcactccttt
cccaggaaaa 8400tctactttca ggtaaatggg ttactcatac taaggaatgc
tactagctcc accagaactc 8460atccagcatg tagctttggc cctcaccatt
ctctctcaag cctctagctg tttcttcccc 8520ttcctctttt cctccctcca
ccagacatgt tactctcttc accccatcca aagattccat 8580ccccaccacc
cttgacctag agagaatctc tcccacccac ttctcatcct gtgatctctg
8640taccttgaca ctgctggcta ctccctcttt ctcaaagcat gtgtcctttc
gcttcagtgg 8700cccaggcccc tctggtgctg ctcccagccc tctgacccct
cctcctgtct cctttgctaa 8760cgttaggctc aacgttagcc taacgtgtca
ggagagctgg agacacgtgg ggcgtaaggt 8820ggacagtcct gtttcctaac
atagtccctg agtattcctc aagtctagtc ctgggtcgtt 8880ttttttctcc
gaaatcagtc tccctcatga tcggggagcc accctgtgat gcagatgact
8940taatctatgt tttcattcct tacctcacac ctgagttcca gacccctaat
ttcaaatact 9000t 900144086DNAMacaca mulatta 4atagatatat tagcatcagg
gagacagggc aaaggttcca cccttcagct cagtccccag 60tccctgctta ttatttccct
aacagaagac catccccctt gccactccct gggttttctt 120ctctggcagc
aatgaagcag ctgctgagcc agctctggtt ttcgggaagt cagatgacct
180tttccctccc gcggctctct gcctctcgct gtccctaggg aggacaccat
ggacccactg 240atggttcttt tttgcctgct gttcctgtac ccaggtccgg
cagactcggc tacctcctgc 300cctcagaacg tgaatatctc tggtggcacc
ttcaccctca gccatggctg ggcccctggg 360agccttctca tctactcctg
tccccagggc ctgtacccat ccccagcgtc acggctgtgc 420aagagcagcg
gacagtggca gaccccaaga gccacccggt ctctgactaa ggcggtctgc
480aaacctggcc actgccccaa ccccggcatt tcgctgggcg cggtgcggac
aggctcccgc 540tttggtcatg gggacaaggt ccgctatcgc tgctcctcga
atcttgtgct cacggggtct 600gcggagcggg agtgccaggg caacggggtc
tggagtggaa cggagcccat ctgccgccag 660ccctactctt atgacttccc
tgaggacgtg gcccctgccc tgggcacctc cttctcccac 720atgcttgggg
ccaccaatcc cacccagagg acaaaggatc atgaaaatgg aactgggact
780aacacctatg cagccctaaa cagtgtctat ctcatgatga acaatcaaat
gcaactcctt 840ggcatgaaaa cgatggcctg gcaggaaatc cgacatgcca
tcatccttct gacagatgga 900aagtccaata tgggtggctc tcccaaaaca
gctgttgacc aaatcagaga gatcttgaat 960atcaaccaga agaggaatga
ctatctggac atctatgcca tcggggtggg caagctggat 1020gtggactgga
gagaactgaa tgagctgggg tccaagaagg atggcgagag gcatgccttc
1080attctgcagg acacaaaggc tctgcaccag gtctttgaac atatgctgga
tgtctccaag 1140ctcacagaca ccatctgcgg ggtggggaac atgtcagcaa
acgcctctga ccaagagagg 1200acaccctggc atgtcactat taagcccaag
agccaagaga cctgccgggg agccctcatc 1260tccgaccaat gggtcctgac
agcggctcac tgcttccgcg atggcaacga ccactcccta 1320tggagggtca
atgtgggaga ccccaaatcc cagtggggca aagaattcct tattgagaag
1380gcagtgattt ccccaggatt tgatgtcttt gccaaaaaga accagggaat
cctggagttc 1440tatggtgatg acatcgccct gctgaagctg gcccagaaag
taaagatgtc cacccatgcc 1500aggcccatct gccttccctg caccatggag
gccaatctgg ctctgcggag acctcaaggc 1560agcacctgta gggaccatga
gaatgaactg ctgaacaaac agagtgttcc tgctcatttt 1620gtcgccttga
atgggagcaa actgaacatt aaccttaaga tgggagtgga gtggacaagc
1680tgtgccgagg tcgtctccca agaaaaaacc atgttcccca acttgacaga
tgtcagggag 1740gtggtgacag accagtttct atgcagtggg acccaggagg
atgagagtcc ctgcaagggt 1800gtgaccacca ctccattgtc ttcggcccag
cctcaaggat cctgctctct ggagggggta 1860gagatcaaag gtggctcctt
ccgacttctc caagagggcc aggcactgga atacgtgtgt 1920ccttctggct
tctacccgta ccctgtgcag acacgtacct gcagatccac ggggtcctgg
1980agcaccctgc agactcaaga tcgaaaaact gtcaagaagg cagagtgcag
agcaatccgc 2040tgtccacgac cacaggactt cgagaacggg gaataccggc
cccggtctcc ctactacaat 2100gtgagtgatg agatctcttt ccactgctat
gacggttaca ctctccgggg ctctgccaat 2160cgcacctgcc aagtgaatgg
ccggtggagt gggcagacag cgatctgtga caacggagcg 2220gggtactgct
ccaacccagg catccccatt ggcacaagga aggtgggcag ccggtaccgc
2280cttgaagaca gcgtcaccta ccactgcagc cgggggctta ccctgcgtgg
ctcccagcgg 2340cgaacatgtc aggaaggtgg ctcttggagc gggacggagc
cttcctgcca agactccttc 2400atgtacgaca cccctcaaga ggtggccgaa
gctttcctgt cttccctgac ggagaccata 2460gaaggagtcg atgccgagga
tgggcacagc ccaggggaac aacagaagcg gaggatcatc 2520ctagaccctt
caggctccat gaacatctac ctggtgctag atggatcaga cagcattggg
2580gccggcaact tcacaggagc caaaaagtgt ctagtcaact taattgagaa
ggtggcaagt 2640tatggtgtga agccaagata tgctctagtg acatatgcca
cataccccag aatttgggtc 2700aaagtgtctg accaagagag cagcaatgca
gactgggtca cgaagaagct cagtgaaatc 2760aattatgaag accacaagtt
gaagtcaggg actaacacca agagggccct ccaggcagtg 2820tacagcatga
tgagttggcc agaggacatc cctcctgaag gctggaaccg cacccgccat
2880gtcatcatcc tcatgaccga tggattgcac aacatgggcg gggacccaat
tactgtcatt 2940gatgagatcc gggacttgtt atacatcggc aaggatcgta
aaaacccgag ggaggattat 3000ctggatgtct atgtgtttgg ggttggacct
ttggtggacc aagtgaacat caatgctttg 3060gcttccaaga aagacaatga
gcaacatgtg ttcaaagtca aggatatgga aaacctggaa 3120gacgttttct
tccaaatgat tgatgaaagc cagtctctga gtctctgtgg catggtttgg
3180gaacacagca agggtaccga ttaccacaag caaccatggc aggccaagat
ctcagtcact 3240cgcccttcga agggacatga gagctgtatg ggggctgtgg
tgtctgagta ctttgtgctg 3300acagcagcac attgttttac tgtggacgac
aaggaacact caatcaaggt cagcgtggga 3360gggaagaagc gggacctgga
gatagaaaaa gtcctatttc accccgacta caacattagc 3420gagaaaaaag
aagcaggaat tcctgaattt tatgactatg acgttgccct gatcaagctc
3480aagaataagt tgaattatga cccgactatc aggcccattt gtctcccctg
caccgaggga 3540acaactcgag ctttgaggct tcctccaact accacttgcc
agcaacagaa ggaagagctg 3600ctccctgcac aggatatcaa agctctgttt
gtgtctgagg aggagaagaa gctgactcgg 3660aaggaggtct acatcaagaa
tggggataag aaaggcagct gtgagagaga tgctcaatat 3720gccccaggct
atgacaaagt caaggacatc tcggaggtgg tcacccctcg gttcctttgt
3780actggaggag tgagtcccta tgctgacccc aatacttgca gaggtgattc
tggcggcccc 3840ttgatagttc acaagagaag tcgtttcatt caagttggtg
tcatcagctg gggagtagtg 3900gatgtctgca aaaaccagaa gcggcaaaag
caggtacctg ctcacgcccg agactttcac 3960gtcaacctct tccaagtgct
gccctggctg aaggagaaac tccaagatga ggatttgggt 4020tttctctaag
gggtttcctg ctggacaggg gcgcgggatt gaattaaaac agctgcgaca 4080acactt
408652767DNAMus musculus 5gctccatcac acagtccatg gaaagactga
tcttttaaat tgggggtagt ggaggtggtg 60gtctgtgctt gttaggaggg gtctgggggc
taagagggag ctttgaaagg gaagttctgg 120cccttggtca gtcaagggtg
gggctcacat agtttctgtt tcctcagttg gcagttcagc 180tggggccctc
cttcatgaat gttccgggaa gcagtggctg cgtgcgcagg gtaggctggc
240caggctgcag atgccagagc agattgcata aaaggttagg ggacagtggg
aaaggggtgt 300agccagatcc agcatttggg tttcagtttg gacaggaggt
caaataggca cccagagtga 360cctggagagg gctttgggcc actggactct
ctggtgcttt ccatgacaat ggagagcccc 420cagctctgcc tcgtcctctt
ggtcttaggc ttctcctctg gaggtgtgag cgcaactcca 480gtgcttgagg
cccggcccca agtctcctgc tctctggagg gagtagagat caaaggcggc
540tcctttcaac ttctccaagg cggtcaggcc ctggagtacc tatgtccctc
tggcttctac 600ccataccccg tgcagactcg aacctgcaga tccacaggct
cctggagcga cctgcagacc 660cgagaccaaa agattgtcca gaaggcggaa
tgcagagcaa tacgctgccc acgaccgcag 720gactttgaaa atggggaatt
ctggccccgg tcccccttct acaacctgag tgaccagatt 780tcttttcaat
gctatgatgg ttacgttctc cggggctctg ctaatcgcac ctgccaagag
840aatggccggt gggatgggca aacagcaatt tgtgatgatg gagctggata
ctgtcccaat 900cccggtattc ctattgggac aaggaaggtg ggtagccaat
accgccttga agacattgtt 960acttaccact gcagccgggg acttgtcctg
cgtggctccc agaagcgaaa gtgtcaagaa 1020ggtggctcat ggagtgggac
agagccttcc tgccaagatt ccttcatgta tgacagccct 1080caagaagtgg
ccgaagcatt cctatcctcc ctgacagaga ccatcgaagg agccgatgct
1140gaggatgggc acagcccagg agaacagcag aagaggaaga ttgtcctaga
cccctcgggc 1200tccatgaata tctacctggt gctagatgga tcagacagca
tcggaagcag caacttcaca 1260ggggctaagc ggtgcctcac caacttgatt
gagaaggtgg cgagttacgg ggtgaggcca 1320cgatatggtc tcctgacata
tgctacagtc cccaaagtgt tggtcagagt gtctgatgag 1380aggagtagcg
atgccgactg ggtcacagag aagctcaacc aaatcagtta tgaagaccac
1440aagctgaagt cagggaccaa caccaagagg gctctccagg ctgtgtatag
catgatgagc 1500tgggcagggg atgccccgcc tgaaggctgg aatagaaccc
gccatgtcat catcattatg 1560actgatggct tgcacaacat gggtggaaac
cctgtcactg tcattcagga catccgagcc 1620ttgctggaca tcggcaggga
tcccaaaaat cccagggagg attacctgga tgtgtatgtg 1680tttggggtcg
ggcctctggt ggactccgtg aacatcaatg ccttagcttc caaaaaggac
1740aatgagcatc atgtgtttaa agtcaaggat atggaagacc tggagaatgt
tttctaccaa 1800atgattgatg aaaccaaatc tctgagtctc tgtggcatgg
tgtgggagca taaaaaaggc 1860aacgattatc ataagcaacc atggcaagcc
aagatctcag tcactcgccc tctgaaagga 1920catgagacct gtatgggggc
cgtggtgtct gagtacttcg tgctgacagc agcgcactgc 1980ttcatggtgg
atgatcagaa acattccatc aaggtcagcg tggggggtca gaggcgggac
2040ctggagattg aagaggtcct gttccacccc aaatacaata ttaatgggaa
aaaggcagaa 2100gggatccctg agttctatga ttatgatgtg gccctagtca
agctcaagaa caagctcaag 2160tatggccaga ctctcaggcc catctgtctc
ccctgcacgg agggaaccac acgagccttg 2220aggcttcctc agacagccac
ctgcaagcag cacaaggaac agttgctccc tgtgaaggat 2280gtcaaagctc
tgtttgtatc tgagcaaggg aagagcctga ctcggaagga ggtgtacatc
2340aagaatgggg acaagaaagc cagttgtgag agagatgcta caaaggccca
aggctatgag 2400aaggtcaaag atgcctctga ggtggtcact ccacggttcc
tctgcacagg aggggtggat 2460ccctatgctg accccaacac atgcaaagga
gattccgggg gccctctcat tgttcacaag 2520agaagccgct tcattcaagt
tggtgtgatt agctggggag tagtagatgt ctgcagagac 2580cagaggcggc
aacagctggt accctcttat gcccgggact tccacatcaa cctcttccag
2640gtgctgccct ggctaaagga caagctcaaa gatgaggatt tgggttttct
ataaagagct 2700tcctgcaggg agagtgtgag gacagattaa agcagttaca
ataacaaaaa aaaaaaaaaa 2760aaaaaaa 2767620DNAArtificial
sequenceSynthetic oligonucleotide 6gctgagctgc cagtcaagga
20720DNAArtificial sequenceSynthetic oligonucleotide 7ggccccgctg
agctgccagt 20820DNAArtificial sequenceSynthetic oligonucleotide
8cggaacatcc aagcgggagg 20920DNAArtificial sequenceSynthetic
oligonucleotide 9ctttcccgga acatccaagc 201020DNAArtificial
sequenceSynthetic oligonucleotide 10atctgtgttc tggcacctgc
201120DNAArtificial sequenceSynthetic oligonucleotide 11gtcacattcc
cttcccctgc 201220DNAArtificial sequenceSynthetic oligonucleotide
12gacctggtca cattcccttc 201320DNAArtificial sequenceSynthetic
oligonucleotide 13gacctagacc tggtcacatt 201420DNAArtificial
sequenceSynthetic oligonucleotide 14actccagacc tagacctggt
201520DNAArtificial sequenceSynthetic oligonucleotide 15gctgaaactc
cagacctaga 201620DNAArtificial sequenceSynthetic oligonucleotide
16gtccaagctg aaactccaga 201720DNAArtificial sequenceSynthetic
oligonucleotide 17ctcagtgtcc aagctgaaac 201820DNAArtificial
sequenceSynthetic oligonucleotide 18aggagagaag ctgggcctgg
201920DNAArtificial sequenceSynthetic oligonucleotide 19gaaggcagga
gagaagctgg 202020DNAArtificial sequenceSynthetic oligonucleotide
20gtggtggtca cacctccaga 202120DNAArtificial sequenceSynthetic
oligonucleotide 21ccctccagag agcaggatcc 202220DNAArtificial
sequenceSynthetic oligonucleotide 22tctaccccct ccagagagca
202320DNAArtificial sequenceSynthetic oligonucleotide 23ttgatctcta
ccccctccag 202420DNAArtificial sequenceSynthetic oligonucleotide
24tggagaagtc ggaaggagcc
202520DNAArtificial sequenceSynthetic oligonucleotide 25ccctcttgga
gaagtcggaa 202620DNAArtificial sequenceSynthetic oligonucleotide
26gcctggccct cttggagaag 202720DNAArtificial sequenceSynthetic
oligonucleotide 27tccagtgcct ggccctcttg 202820DNAArtificial
sequenceSynthetic oligonucleotide 28agaagccaga aggacacacg
202920DNAArtificial sequenceSynthetic oligonucleotide 29acgggtagaa
gccagaagga 203020DNAArtificial sequenceSynthetic oligonucleotide
30cgtgtctgca cagggtacgg 203120DNAArtificial sequenceSynthetic
oligonucleotide 31agggtgctcc aggaccccgt 203220DNAArtificial
sequenceSynthetic oligonucleotide 32ttgctctgca ctctgccttc
203320DNAArtificial sequenceSynthetic oligonucleotide 33tattccccgt
tctcgaagtc 203420DNAArtificial sequenceSynthetic oligonucleotide
34cattgtagta gggagaccgg 203520DNAArtificial sequenceSynthetic
oligonucleotide 35cactcacatt gtagtaggga 203620DNAArtificial
sequenceSynthetic oligonucleotide 36tctcatcact cacattgtag
203720DNAArtificial sequenceSynthetic oligonucleotide 37aagagatctc
atcactcaca 203820DNAArtificial sequenceSynthetic oligonucleotide
38agtggaaaga gatctcatca 203920DNAArtificial sequenceSynthetic
oligonucleotide 39catagcagtg gaaagagatc 204020DNAArtificial
sequenceSynthetic oligonucleotide 40aaccgtcata gcagtggaaa
204120DNAArtificial sequenceSynthetic oligonucleotide 41gagtgtaacc
gtcatagcag 204220DNAArtificial sequenceSynthetic oligonucleotide
42cccggagagt gtaaccgtca 204320DNAArtificial sequenceSynthetic
oligonucleotide 43cagagccccg gagagtgtaa 204420DNAArtificial
sequenceSynthetic oligonucleotide 44gattggcaga gccccggaga
204520DNAArtificial sequenceSynthetic oligonucleotide 45aggtgcgatt
ggcagagccc 204620DNAArtificial sequenceSynthetic oligonucleotide
46cttggcaggt gcgattggca 204720DNAArtificial sequenceSynthetic
oligonucleotide 47cattcacttg gcaggtgcga 204820DNAArtificial
sequenceSynthetic oligonucleotide 48atcgctgtct gcccactcca
204920DNAArtificial sequenceSynthetic oligonucleotide 49tcacagatcg
ctgtctgccc 205020DNAArtificial sequenceSynthetic oligonucleotide
50ccgttgtcac agatcgctgt 205120DNAArtificial sequenceSynthetic
oligonucleotide 51cccgctccgt tgtcacagat 205220DNAArtificial
sequenceSynthetic oligonucleotide 52cagtaccccg ctccgttgtc
205320DNAArtificial sequenceSynthetic oligonucleotide 53ttggagcagt
accccgctcc 205420DNAArtificial sequenceSynthetic oligonucleotide
54accttccttg tgccaatggg 205520DNAArtificial sequenceSynthetic
oligonucleotide 55ctgcccacct tccttgtgcc 205620DNAArtificial
sequenceSynthetic oligonucleotide 56cgctgtcttc aaggcggtac
205720DNAArtificial sequenceSynthetic oligonucleotide 57gctgcagtgg
taggtgacgc 205820DNAArtificial sequenceSynthetic oligonucleotide
58cccccggctg cagtggtagg 205920DNAArtificial sequenceSynthetic
oligonucleotide 59ggtaagcccc cggctgcagt 206020DNAArtificial
sequenceSynthetic oligonucleotide 60acgcagggta agcccccggc
206120DNAArtificial sequenceSynthetic oligonucleotide 61ggagccacgc
agggtaagcc 206220DNAArtificial sequenceSynthetic oligonucleotide
62gccgctggga gccacgcagg 206320DNAArtificial sequenceSynthetic
oligonucleotide 63caagagccac cttcctgaca 206420DNAArtificial
sequenceSynthetic oligonucleotide 64ccgctccaag agccaccttc
206520DNAArtificial sequenceSynthetic oligonucleotide 65tccgtcccgc
tccaagagcc 206620DNAArtificial sequenceSynthetic oligonucleotide
66gaaggctccg tcccgctcca 206720DNAArtificial sequenceSynthetic
oligonucleotide 67tggcaggaag gctccgtccc 206820DNAArtificial
sequenceSynthetic oligonucleotide 68gagtcttggc aggaaggctc
206920DNAArtificial sequenceSynthetic oligonucleotide 69atgaaggagt
cttggcagga 207020DNAArtificial sequenceSynthetic oligonucleotide
70cttcggccac ctcttgaggg 207120DNAArtificial sequenceSynthetic
oligonucleotide 71ggaaagcttc ggccacctct 207220DNAArtificial
sequenceSynthetic oligonucleotide 72aagacaggaa agcttcggcc
207320DNAArtificial sequenceSynthetic oligonucleotide 73tcagggaaga
caggaaagct 207420DNAArtificial sequenceSynthetic oligonucleotide
74tcgactcctt ctatggtctc 207520DNAArtificial sequenceSynthetic
oligonucleotide 75cttctgttgt tcccctgggc 207620DNAArtificial
sequenceSynthetic oligonucleotide 76ttcatggagc ctgaagggtc
207720DNAArtificial sequenceSynthetic oligonucleotide 77tagatgttca
tggagcctga 207820DNAArtificial sequenceSynthetic oligonucleotide
78accaggtaga tgttcatgga 207920DNAArtificial sequenceSynthetic
oligonucleotide 79tctagcacca ggtagatgtt 208020DNAArtificial
sequenceSynthetic oligonucleotide 80gatccatcta gcaccaggta
208120DNAArtificial sequenceSynthetic oligonucleotide 81ctgtctgatc
catctagcac 208220DNAArtificial sequenceSynthetic oligonucleotide
82ccaatgctgt ctgatccatc 208320DNAArtificial sequenceSynthetic
oligonucleotide 83tttggctcct gtgaagttgc 208420DNAArtificial
sequenceSynthetic oligonucleotide 84acactttttg gctcctgtga
208520DNAArtificial sequenceSynthetic oligonucleotide 85gactagacac
tttttggctc 208620DNAArtificial sequenceSynthetic oligonucleotide
86taagttgact agacactttt 208720DNAArtificial sequenceSynthetic
oligonucleotide 87ctcaattaag ttgactagac 208820DNAArtificial
sequenceSynthetic oligonucleotide 88caccttctca attaagttga
208920DNAArtificial sequenceSynthetic oligonucleotide 89acttgccacc
ttctcaatta 209020DNAArtificial sequenceSynthetic oligonucleotide
90accataactt gccaccttct 209120DNAArtificial sequenceSynthetic
oligonucleotide 91cttcacacca taacttgcca 209220DNAArtificial
sequenceSynthetic oligonucleotide 92tcttggcttc acaccataac
209320DNAArtificial sequenceSynthetic oligonucleotide 93atgtggcata
tgtcactaga 209420DNAArtificial sequenceSynthetic oligonucleotide
94cagacacttt gacccaaatt 209520DNAArtificial sequenceSynthetic
oligonucleotide 95ggtcttcata attgatttca 209620DNAArtificial
sequenceSynthetic oligonucleotide 96acttgtggtc ttcataattg
209720DNAArtificial sequenceSynthetic oligonucleotide 97acttcaactt
gtggtcttca 209820DNAArtificial sequenceSynthetic oligonucleotide
98tccctgactt caacttgtgg 209920DNAArtificial sequenceSynthetic
oligonucleotide 99tgttagtccc tgacttcaac 2010020DNAArtificial
sequenceSynthetic oligonucleotide 100tcttggtgtt agtccctgac
2010120DNAArtificial sequenceSynthetic oligonucleotide
101tgtacactgc ctggagggcc 2010220DNAArtificial sequenceSynthetic
oligonucleotide 102tcatgctgta cactgcctgg 2010320DNAArtificial
sequenceSynthetic oligonucleotide 103gttccagcct tcaggaggga
2010420DNAArtificial sequenceSynthetic oligonucleotide
104ggtgcggttc cagccttcag 2010520DNAArtificial sequenceSynthetic
oligonucleotide 105atggcgggtg cggttccagc 2010620DNAArtificial
sequenceSynthetic oligonucleotide 106gatgacatgg cgggtgcggt
2010720DNAArtificial sequenceSynthetic oligonucleotide
107gaggatgatg acatggcggg 2010820DNAArtificial sequenceSynthetic
oligonucleotide 108cccatgttgt gcaatccatc 2010920DNAArtificial
sequenceSynthetic oligonucleotide 109tccccgccca tgttgtgcaa
2011020DNAArtificial sequenceSynthetic oligonucleotide
110attgggtccc cgcccatgtt 2011120DNAArtificial sequenceSynthetic
oligonucleotide 111acagtaattg ggtccccgcc 2011220DNAArtificial
sequenceSynthetic oligonucleotide 112tcaatgacag taattgggtc
2011320DNAArtificial sequenceSynthetic oligonucleotide
113atctcatcaa tgacagtaat 2011420DNAArtificial sequenceSynthetic
oligonucleotide 114tcccggatct catcaatgac 2011520DNAArtificial
sequenceSynthetic oligonucleotide 115acatccagat aatcctccct
2011620DNAArtificial sequenceSynthetic oligonucleotide
116acatagacat ccagataatc 2011720DNAArtificial sequenceSynthetic
oligonucleotide 117ccaaacacat agacatccag 2011820DNAArtificial
sequenceSynthetic oligonucleotide 118agcattgatg ttcacttggt
2011920DNAArtificial sequenceSynthetic oligonucleotide
119agccaaagca ttgatgttca 2012020DNAArtificial sequenceSynthetic
oligonucleotide 120cttggaagcc aaagcattga 2012120DNAArtificial
sequenceSynthetic oligonucleotide 121gtctttcttg gaagccaaag
2012220DNAArtificial sequenceSynthetic oligonucleotide
122ctcattgtct ttcttggaag 2012320DNAArtificial sequenceSynthetic
oligonucleotide 123atgttgctca ttgtctttct 2012420DNAArtificial
sequenceSynthetic oligonucleotide 124gaacacatgt tgctcattgt
2012520DNAArtificial sequenceSynthetic oligonucleotide
125gactttgaac acatgttgct 2012620DNAArtificial sequenceSynthetic
oligonucleotide 126atccttgact ttgaacacat 2012720DNAArtificial
sequenceSynthetic oligonucleotide 127ttccatatcc ttgactttga
2012820DNAArtificial sequenceSynthetic oligonucleotide
128caggttttcc atatccttga 2012920DNAArtificial sequenceSynthetic
oligonucleotide 129ctcagagact ggctttcatc 2013020DNAArtificial
sequenceSynthetic oligonucleotide 130cagagactca gagactggct
2013120DNAArtificial sequenceSynthetic oligonucleotide
131atgccacaga gactcagaga 2013220DNAArtificial sequenceSynthetic
oligonucleotide 132caaaccatgc cacagagact 2013320DNAArtificial
sequenceSynthetic oligonucleotide 133tgttcccaaa ccatgccaca
2013420DNAArtificial sequenceSynthetic oligonucleotide
134ttgtggtaat cggtaccctt 2013520DNAArtificial sequenceSynthetic
oligonucleotide 135ggttgcttgt ggtaatcggt 2013620DNAArtificial
sequenceSynthetic oligonucleotide 136tgccatggtt gcttgtggta
2013720DNAArtificial sequenceSynthetic oligonucleotide
137ttggcctgcc atggttgctt 2013820DNAArtificial sequenceSynthetic
oligonucleotide 138gagatcttgg cctgccatgg 2013920DNAArtificial
sequenceSynthetic oligonucleotide 139acagccccca tacagctctc
2014020DNAArtificial sequenceSynthetic oligonucleotide
140gacaccacag cccccataca 2014120DNAArtificial sequenceSynthetic
oligonucleotide 141tactcagaca ccacagcccc 2014220DNAArtificial
sequenceSynthetic oligonucleotide 142acaaagtact cagacaccac
2014320DNAArtificial sequenceSynthetic oligonucleotide
143gtcagcacaa agtactcaga 2014420DNAArtificial sequenceSynthetic
oligonucleotide 144ttgattgagt gttccttgtc 2014520DNAArtificial
sequenceSynthetic oligonucleotide 145ctgaccttga ttgagtgttc
2014620DNAArtificial sequenceSynthetic oligonucleotide
146tatctccagg tcccgcttct 2014720DNAArtificial sequenceSynthetic
oligonucleotide 147gaattcctgc ttcttttttc 2014820DNAArtificial
sequenceSynthetic oligonucleotide 148attcaggaat tcctgcttct
2014920DNAArtificial sequenceSynthetic oligonucleotide
149cataaaattc aggaattcct 2015020DNAArtificial sequenceSynthetic
oligonucleotide 150catagtcata
aaattcagga 2015120DNAArtificial sequenceSynthetic oligonucleotide
151tgagcttgat cagggcaacg 2015220DNAArtificial sequenceSynthetic
oligonucleotide 152tattcttgag cttgatcagg 2015320DNAArtificial
sequenceSynthetic oligonucleotide 153gacaaatggg cctgatagtc
2015420DNAArtificial sequenceSynthetic oligonucleotide
154gttgttccct cggtgcaggg 2015520DNAArtificial sequenceSynthetic
oligonucleotide 155gctcgagttg ttccctcggt 2015620DNAArtificial
sequenceSynthetic oligonucleotide 156ctcaaagctc gagttgttcc
2015720DNAArtificial sequenceSynthetic oligonucleotide
157ggaagcctca aagctcgagt 2015820DNAArtificial sequenceSynthetic
oligonucleotide 158gttggaggaa gcctcaaagc 2015920DNAArtificial
sequenceSynthetic oligonucleotide 159gtggtagttg gaggaagcct
2016020DNAArtificial sequenceSynthetic oligonucleotide
160tggcaagtgg tagttggagg 2016120DNAArtificial sequenceSynthetic
oligonucleotide 161tgttgctggc aagtggtagt 2016220DNAArtificial
sequenceSynthetic oligonucleotide 162tccagctcac tcccctgttg
2016320DNAArtificial sequenceSynthetic oligonucleotide
163taaggatcca gctcactccc 2016420DNAArtificial sequenceSynthetic
oligonucleotide 164cagaaataag gatccagctc 2016520DNAArtificial
sequenceSynthetic oligonucleotide 165agggaccaga aataaggatc
2016620DNAArtificial sequenceSynthetic oligonucleotide
166ccacttaggg accagaaata 2016720DNAArtificial sequenceSynthetic
oligonucleotide 167tccaggactc tccccttcag 2016820DNAArtificial
sequenceSynthetic oligonucleotide 168aagtcccacc ctttgctgcc
2016920DNAArtificial sequenceSynthetic oligonucleotide
169ctgcagaagt cccacccttt 2017020DNAArtificial sequenceSynthetic
oligonucleotide 170cagaaactgc agaagtccca 2017120DNAArtificial
sequenceSynthetic oligonucleotide 171aacctctgca ctctgccttc
2017220DNAArtificial sequenceSynthetic oligonucleotide
172ccctcaaacc tctgcactct 2017320DNAArtificial sequenceSynthetic
oligonucleotide 173tcattgccct caaacctctg 2017420DNAArtificial
sequenceSynthetic oligonucleotide 174ccacactcat tgccctcaaa
2017520DNAArtificial sequenceSynthetic oligonucleotide
175cactgcccac actcattgcc 2017620DNAArtificial sequenceSynthetic
oligonucleotide 176ttaggccact gcccacactc 2017720DNAArtificial
sequenceSynthetic oligonucleotide 177ctagtcctga ccttgctgcc
2017820DNAArtificial sequenceSynthetic oligonucleotide
178ctcatcctag tcctgacctt 2017920DNAArtificial sequenceSynthetic
oligonucleotide 179cctagtctca tcctagtcct 2018020DNAArtificial
sequenceSynthetic oligonucleotide 180accctgccta gtctcatcct
2018120DNAArtificial sequenceSynthetic oligonucleotide
181cttgtcaccc tgcctagtct 2018220DNAArtificial sequenceSynthetic
oligonucleotide 182gcccaccttg tcaccctgcc 2018320DNAArtificial
sequenceSynthetic oligonucleotide 183cctaaaactg ctcctactcc
2018420DNAArtificial sequenceSynthetic oligonucleotide
184gagtcagaaa tgaggtcaaa 2018520DNAArtificial sequenceSynthetic
oligonucleotide 185ccctactccc atttcacctt 2018620DNAArtificial
sequenceSynthetic oligonucleotide 186tgttgtgcaa tcctgcagaa
2018720DNAArtificial sequenceSynthetic oligonucleotide
187aaaggctgat gaagcctggc 2018820DNAArtificial sequenceSynthetic
oligonucleotide 188cctttgacca caaagtggcc 2018920DNAArtificial
sequenceSynthetic oligonucleotide 189aggtaccacc tctttgtggg
2019020DNAArtificial sequenceSynthetic oligonucleotide
190tggtggtcac acctgaagag 2019120DNAArtificial sequenceSynthetic
oligonucleotide 191gcagggagca gctcttcctt 2019220DNAArtificial
sequenceSynthetic oligonucleotide 192tcctgtgcag ggagcagctc
2019320DNAArtificial sequenceSynthetic oligonucleotide
193ttgatatcct gtgcagggag 2019420DNAArtificial sequenceSynthetic
oligonucleotide 194agagctttga tatcctgtgc 2019520DNAArtificial
sequenceSynthetic oligonucleotide 195acaaacagag ctttgatatc
2019620DNAArtificial sequenceSynthetic oligonucleotide
196tcagacacaa acagagcttt 2019720DNAArtificial sequenceSynthetic
oligonucleotide 197tcctcctcag acacaaacag 2019820DNAArtificial
sequenceSynthetic oligonucleotide 198acctccttcc gagtcagctt
2019920DNAArtificial sequenceSynthetic oligonucleotide
199atgtagacct ccttccgagt 2020020DNAArtificial sequenceSynthetic
oligonucleotide 200ttcttgatgt agacctcctt 2020120DNAArtificial
sequenceSynthetic oligonucleotide 201tccccattct tgatgtagac
2020220DNAArtificial sequenceSynthetic oligonucleotide
202ttcttatccc cattcttgat 2020320DNAArtificial sequenceSynthetic
oligonucleotide 203ctgcctttct tatccccatt 2020420DNAArtificial
sequenceSynthetic oligonucleotide 204tcacagctgc ctttcttatc
2020520DNAArtificial sequenceSynthetic oligonucleotide
205tctctctcac agctgccttt 2020620DNAArtificial sequenceSynthetic
oligonucleotide 206tgagcatctc tctcacagct 2020720DNAArtificial
sequenceSynthetic oligonucleotide 207gcatattgag catctctctc
2020820DNAArtificial sequenceSynthetic oligonucleotide
208tgactttgtc atagcctggg 2020920DNAArtificial sequenceSynthetic
oligonucleotide 209tgtccttgac tttgtcatag 2021020DNAArtificial
sequenceSynthetic oligonucleotide 210cagtacaaag gaaccgaggg
2021120DNAArtificial sequenceSynthetic oligonucleotide
211ctcctccagt acaaaggaac 2021220DNAArtificial sequenceSynthetic
oligonucleotide 212gactcactcc tccagtacaa 2021320DNAArtificial
sequenceSynthetic oligonucleotide 213catagggact cactcctcca
2021420DNAArtificial sequenceSynthetic oligonucleotide
214ggtcagcata gggactcact 2021520DNAArtificial sequenceSynthetic
oligonucleotide 215tcacctctgc aagtattggg 2021620DNAArtificial
sequenceSynthetic oligonucleotide 216ccagaatcac ctctgcaagt
2021720DNAArtificial sequenceSynthetic oligonucleotide
217gggccgccag aatcacctct 2021820DNAArtificial sequenceSynthetic
oligonucleotide 218ctcttgtgaa ctatcaaggg 2021920DNAArtificial
sequenceSynthetic oligonucleotide 219cgacttctct tgtgaactat
2022020DNAArtificial sequenceSynthetic oligonucleotide
220atgaaacgac ttctcttgtg 2022120DNAArtificial sequenceSynthetic
oligonucleotide 221acttgaatga aacgacttct 2022220DNAArtificial
sequenceSynthetic oligonucleotide 222acaccaactt gaatgaaacg
2022320DNAArtificial sequenceSynthetic oligonucleotide
223tccactactc cccagctgat 2022420DNAArtificial sequenceSynthetic
oligonucleotide 224cagacatcca ctactcccca 2022520DNAArtificial
sequenceSynthetic oligonucleotide 225tttttgcaga catccactac
2022620DNAArtificial sequenceSynthetic oligonucleotide
226ttctggtttt tgcagacatc 2022720DNAArtificial sequenceSynthetic
oligonucleotide 227tgccgcttct ggtttttgca 2022820DNAArtificial
sequenceSynthetic oligonucleotide 228tgcttttgcc gcttctggtt
2022920DNAArtificial sequenceSynthetic oligonucleotide
229ggtacctgct tttgccgctt 2023020DNAArtificial sequenceSynthetic
oligonucleotide 230tgagcaggta cctgcttttg 2023120DNAArtificial
sequenceSynthetic oligonucleotide 231ttcagccagg gcagcacttg
2023220DNAArtificial sequenceSynthetic oligonucleotide
232ttctccttca gccagggcag 2023320DNAArtificial sequenceSynthetic
oligonucleotide 233tggagtttct ccttcagcca 2023420DNAArtificial
sequenceSynthetic oligonucleotide 234tcatcttgga gtttctcctt
2023520DNAArtificial sequenceSynthetic oligonucleotide
235aaatcctcat cttggagttt 2023620DNAArtificial sequenceSynthetic
oligonucleotide 236aaacccaaat cctcatcttg 2023720DNAArtificial
sequenceSynthetic oligonucleotide 237gtccagcagg aaacccctta
2023820DNAArtificial sequenceSynthetic oligonucleotide
238gcccctgtcc agcaggaaac 2023920DNAArtificial sequenceSynthetic
oligonucleotide 239agctgtttta attcaatccc 2024020DNAArtificial
sequenceSynthetic oligonucleotide 240aacttgccac ctgtgggtga
2024120DNAArtificial sequenceSynthetic oligonucleotide
241tcaccttatc cccattcttg 2024220DNAArtificial sequenceSynthetic
oligonucleotide 242tcaactttca caaaccacca 2024320DNAArtificial
sequenceSynthetic oligonucleotide 243ccgccagaat cacctgcaag
2024420DNAArtificial sequenceSynthetic oligonucleotide
244aggaggaatg aagaaggctt 2024520DNAArtificial sequenceSynthetic
oligonucleotide 245gcctttcctc agggatctgg 2024620DNAArtificial
sequenceSynthetic oligonucleotide 246aaatgtctgg gagtgtcagg
2024720DNAArtificial sequenceSynthetic oligonucleotide
247gcctagagtg cctccttagg 2024820DNAArtificial sequenceSynthetic
oligonucleotide 248ggcatctccc cagataggaa 2024920DNAArtificial
sequenceSynthetic oligonucleotide 249agggagctag tcctggaaga
2025020DNAArtificial sequenceSynthetic oligonucleotide
250acacctgaag agaaaggctg 2025120DNAArtificial sequenceSynthetic
oligonucleotide 251ccctttgacc acaaagtggc 2025220DNAArtificial
sequenceSynthetic oligonucleotide 252gccctcaagg tagtctcatg
2025320DNAArtificial sequenceSynthetic oligonucleotide
253aagggaagga ggacagaata 2025420DNAArtificial sequenceSynthetic
oligonucleotide 254aaaggccaag gagggatgct 2025520DNAArtificial
sequenceSynthetic oligonucleotide 255agaggtccct tctgaccatc
2025620DNAArtificial sequenceSynthetic oligonucleotide
256gctgggacag gagagaggtc 2025720DNAArtificial sequenceSynthetic
oligonucleotide 257tcaaatgtct gggagtgtca 2025820DNAArtificial
sequenceSynthetic oligonucleotide 258agaaggagaa tgtgctgaaa
2025920DNAArtificial sequenceSynthetic oligonucleotide
259tgctgaccac ttggcatctc 2026020DNAArtificial sequenceSynthetic
oligonucleotide 260caactttcac aaaccaccat 2026120DNAArtificial
sequenceSynthetic oligonucleotide 261agctctgtga ttctaaggtt
2026220DNAArtificial sequenceSynthetic oligonucleotide
262ccacctgtgg gtgaggagaa 2026320DNAArtificial sequenceSynthetic
oligonucleotide 263gaggactcac ttgaatgaaa 2026420DNAArtificial
sequenceSynthetic oligonucleotide 264tggaatgatc agggagctag
2026520DNAArtificial sequenceSynthetic oligonucleotide
265gtcccttctc cattttcccc 2026620DNAArtificial sequenceSynthetic
oligonucleotide 266tcaacttttt aagttaatca 2026720DNAArtificial
sequenceSynthetic oligonucleotide 267gggtgaggag aacaaggcgc
2026820DNAArtificial sequenceSynthetic oligonucleotide
268cttccaagcc atcttttaac 2026920DNAArtificial sequenceSynthetic
oligonucleotide 269aggactcact tgaatgaaac 2027020DNAArtificial
sequenceSynthetic oligonucleotide 270ttccaggcaa ctagagcttc
2027120DNAArtificial sequenceSynthetic oligonucleotide
271cagagtccag ccactgtttg 2027220DNAArtificial sequenceSynthetic
oligonucleotide 272ccaacctgca gaggcagtgg 2027320DNAArtificial
sequenceSynthetic oligonucleotide 273tgcaaggaga ggagaagctg
2027420DNAArtificial sequenceSynthetic oligonucleotide
274ctaggcaggt tactcaccca 2027520DNAArtificial sequenceSynthetic
oligonucleotide 275caccataact tgccacctgt
2027620DNAArtificial sequenceSynthetic oligonucleotide
276taggtaccac ctctttgtgg 2027720DNAArtificial sequenceSynthetic
oligonucleotide 277cttgacctca cctcccccaa 2027820DNAArtificial
sequenceSynthetic oligonucleotide 278ccacctcttt gtgggcagct
2027920DNAArtificial sequenceSynthetic oligonucleotide
279ttcacaaacc accatctctt 2028020DNAArtificial sequenceSynthetic
oligonucleotide 280ttctcacctc cgttgtcaca 2028120DNAArtificial
sequenceSynthetic oligonucleotide 281gaaagtggga ggtgttgcct
2028220DNAArtificial sequenceSynthetic oligonucleotide
282acagcaggaa gggaaggtta 2028320DNAArtificial sequenceSynthetic
oligonucleotide 283catgctgacc acttggcatc 2028420DNAArtificial
sequenceSynthetic oligonucleotide 284ggtcaccttg gcaggaaggc
2028520DNAArtificial sequenceSynthetic oligonucleotide
285gtatagtgtt acaagtggac 2028620DNAArtificial sequenceSynthetic
oligonucleotide 286ggacttccct ttgaccacaa 2028720DNAArtificial
sequenceSynthetic oligonucleotide 287tcaccttgac ctcacctccc
2028820DNAArtificial sequenceSynthetic oligonucleotide
288tagagtgcct ccttaggatg 2028920DNAArtificial sequenceSynthetic
oligonucleotide 289tgacttcaac ttgtggtctg 2029020DNAArtificial
sequenceSynthetic oligonucleotide 290cagagaagga gaatgtgctg
2029120DNAArtificial sequenceSynthetic oligonucleotide
291agggagcagc tcttcctctg 2029220DNAArtificial sequenceSynthetic
oligonucleotide 292tgttcccctg ggtgccagga 2029320DNAArtificial
sequenceSynthetic oligonucleotide 293ggcctggctg ttttcaagcc
2029420DNAArtificial sequenceSynthetic oligonucleotide
294gactggcttt catctggcag 2029520DNAArtificial sequenceSynthetic
oligonucleotide 295gaaggctttc caggcaacta 2029620DNAArtificial
sequenceSynthetic oligonucleotide 296tcacttgaat gaaacgactt
2029720DNAArtificial sequenceSynthetic oligonucleotide
297ggccccaaaa ggccaaggag 2029820DNAArtificial sequenceSynthetic
oligonucleotide 298aatcacctgc aaggagagga 2029920DNAArtificial
sequenceSynthetic oligonucleotide 299gaccttcagt tgcatcctta
2030020DNAArtificial sequenceSynthetic oligonucleotide
300tgatgaagcc tggccccaaa 2030120DNAArtificial sequenceSynthetic
oligonucleotide 301tagaaagtgg gaggtgttgc 2030220DNAArtificial
sequenceSynthetic oligonucleotide 302cccatccctg actggtctgg
2030320DNAArtificial sequenceSynthetic oligonucleotide
303ccatgggtat agtgttacaa 2030420DNAArtificial sequenceSynthetic
oligonucleotide 304gtgttctctt gacttccagg 2030520DNAArtificial
sequenceSynthetic oligonucleotide 305ggcctgctcc tcaccccagt
2030620DNAArtificial sequenceSynthetic oligonucleotide
306gaggcctggc tgttttcaag 2030720DNAArtificial sequenceSynthetic
oligonucleotide 307gactctcccc ttcagtacct 2030820DNAArtificial
sequenceSynthetic oligonucleotide 308catgggtata gtgttacaag
2030920DNAArtificial sequenceSynthetic oligonucleotide
309gaaggagaat gtgctgaaaa 2031020DNAArtificial sequenceSynthetic
oligonucleotide 310tcacctggtc ttccaagcca 2031120DNAArtificial
sequenceSynthetic oligonucleotide 311ctccccagat aggaaaggga
2031220DNAArtificial sequenceSynthetic oligonucleotide
312ggactcactt gaatgaaacg 2031320DNAArtificial sequenceSynthetic
oligonucleotide 313ggccgccaga atcacctgca 2031420DNAArtificial
sequenceSynthetic oligonucleotide 314ctcacttgaa tgaaacgact
2031520DNAArtificial sequenceSynthetic oligonucleotide
315ctttcccagc ctttcctcag 2031620DNAArtificial sequenceSynthetic
oligonucleotide 316agaaagtggg aggtgttgcc 2031720DNAArtificial
sequenceSynthetic oligonucleotide 317gtcgcagctg ttttaattca
2031820DNAArtificial sequenceSynthetic oligonucleotide
318ccaggactct ccccttcagt 2031920DNAArtificial sequenceSynthetic
oligonucleotide 319agggaaggag gacagaatag 2032020DNAArtificial
sequenceSynthetic oligonucleotide 320gaaatgaggt caaatgtctg
2032120DNAArtificial sequenceSynthetic oligonucleotide
321ggagagtcag aaatgaggtc 2032220DNAArtificial sequenceSynthetic
oligonucleotide 322gtagaaagtg ggaggtgttg 2032320DNAArtificial
sequenceSynthetic oligonucleotide 323tagaaagatc tctgaagtgc
2032420DNAArtificial sequenceSynthetic oligonucleotide
324ctgctcctca ccccagtcct 2032520DNAArtificial sequenceSynthetic
oligonucleotide 325ctactgggat tctgtgctta 2032620DNAArtificial
sequenceSynthetic oligonucleotide 326cccaaaaggc caaggaggga
2032720DNAArtificial sequenceSynthetic oligonucleotide
327tgaccacttg gcatctcccc 2032820DNAArtificial sequenceSynthetic
oligonucleotide 328cctgcaagga gaggagaagc 2032920DNAArtificial
sequenceSynthetic oligonucleotide 329ctctcacctc tgcaagtatt
2033020DNAArtificial sequenceSynthetic oligonucleotide
330ccccaaaagg ccaaggaggg 2033120DNAArtificial sequenceSynthetic
oligonucleotide 331gtcttccaag ccatctttta 2033220DNAArtificial
sequenceSynthetic oligonucleotide 332gttacaagtg gacttaaggg
2033320DNAArtificial sequenceSynthetic oligonucleotide
333cccatgttgt gcaatcctgc 2033420DNAArtificial sequenceSynthetic
oligonucleotide 334gaggtgggaa gcatggagaa 2033520DNAArtificial
sequenceSynthetic oligonucleotide 335tgctcccacc actgtcatct
2033620DNAArtificial sequenceSynthetic oligonucleotide
336aggcaggtta ctcacccaga 2033720DNAArtificial sequenceSynthetic
oligonucleotide 337tactgggatt ctgtgcttac 2033820DNAArtificial
sequenceSynthetic oligonucleotide 338gcctttccca gcctttcctc
2033920DNAArtificial sequenceSynthetic oligonucleotide
339gtgcaatcct gcagaagaga 2034020DNAArtificial sequenceSynthetic
oligonucleotide 340acaggagaga ggtcccttct 2034120DNAArtificial
sequenceSynthetic oligonucleotide 341cccaaaagga gaaagggaaa
2034220DNAArtificial sequenceSynthetic oligonucleotide
342aagcccaggg taaatgctta 2034320DNAArtificial sequenceSynthetic
oligonucleotide 343gatgaagcct ggccccaaaa 2034420DNAArtificial
sequenceSynthetic oligonucleotide 344tggcagagaa ggagaatgtg
2034520DNAArtificial sequenceSynthetic oligonucleotide
345ttcccagcct ttcctcaggg 2034620DNAArtificial sequenceSynthetic
oligonucleotide 346ggcagagaag gagaatgtgc 2034720DNAArtificial
sequenceSynthetic oligonucleotide 347acagtgccag gaaacaagaa
2034820DNAArtificial sequenceSynthetic oligonucleotide
348taggcaggtt actcacccag 2034920DNAArtificial sequenceSynthetic
oligonucleotide 349ttctcttgac ttccagggct 2035020DNAArtificial
sequenceSynthetic oligonucleotide 350cctgctcctc accccagtcc
2035120DNAArtificial sequenceSynthetic oligonucleotide
351tcccactaac ctccattgcc 2035220DNAArtificial sequenceSynthetic
oligonucleotide 352ttccctttga ccacaaagtg 2035320DNAArtificial
sequenceSynthetic oligonucleotide 353ctgggtccta ggcaggttac
2035420DNAArtificial sequenceSynthetic oligonucleotide
354tccaggcaac tagagcttca 2035520DNAArtificial sequenceSynthetic
oligonucleotide 355gcccatgttg tgcaatcctg 2035620DNAArtificial
sequenceSynthetic oligonucleotide 356ggttcccact aacctccatt
2035720DNAArtificial sequenceSynthetic oligonucleotide
357aggtagagag caagagttac 2035820DNAArtificial sequenceSynthetic
oligonucleotide 358ccactaacct ccattgccca 2035920DNAArtificial
sequenceSynthetic oligonucleotide 359tcacaaacca ccatctctta
2036020DNAArtificial sequenceSynthetic oligonucleotide
360tactcaccca gataatcctc 2036120DNAArtificial sequenceSynthetic
oligonucleotide 361tgctcctcac cccagtcctc 2036220DNAArtificial
sequenceSynthetic oligonucleotide 362tctcacagct gcctttctgt
2036320DNAArtificial sequenceSynthetic oligonucleotide
363gaaagggagg actcacttga 2036420DNAArtificial sequenceSynthetic
oligonucleotide 364ccatctttta accccagaga 2036520DNAArtificial
sequenceSynthetic oligonucleotide 365tcctcacccc agtcctccag
2036620DNAArtificial sequenceSynthetic oligonucleotide
366ctggcagaga aggagaatgt 2036720DNAArtificial sequenceSynthetic
oligonucleotide 367tctccccaga taggaaaggg 2036820DNAArtificial
sequenceSynthetic oligonucleotide 368acttcagctg ctcccaccac
2036920DNAArtificial sequenceSynthetic oligonucleotide
369gacagcagga agggaaggtt 2037020DNAArtificial sequenceSynthetic
oligonucleotide 370ggagacaaat gggcctataa 2037120DNAArtificial
sequenceSynthetic oligonucleotide 371ctgctcccac cactgtcatc
2037220DNAArtificial sequenceSynthetic oligonucleotide
372aggaatgaag aaggctttcc 2037320DNAArtificial sequenceSynthetic
oligonucleotide 373gggatctcat ccttatcctc 2037420DNAArtificial
sequenceSynthetic oligonucleotide 374gtgctgggtc ctaggcaggt
2037520DNAArtificial sequenceSynthetic oligonucleotide
375caaaaggcca aggagggatg 2037620DNAArtificial sequenceSynthetic
oligonucleotide 376ccatgctgac cacttggcat 2037720DNAArtificial
sequenceSynthetic oligonucleotide 377ggaggctggg acaggagaga
2037820DNAArtificial sequenceSynthetic oligonucleotide
378ggagcagctc ttcctctgga 2037920DNAArtificial sequenceSynthetic
oligonucleotide 379tctcacctcc gttgtcacag 2038020DNAArtificial
sequenceSynthetic oligonucleotide 380cagtcctcca gcctttccca
2038120DNAArtificial sequenceSynthetic oligonucleotide
381agtcctccag cctttcccag 2038220DNAArtificial sequenceSynthetic
oligonucleotide 382tgaaggagtc tgggagagtc 2038320DNAArtificial
sequenceSynthetic oligonucleotide 383cagaatcacc tgcaaggaga
2038420DNAArtificial sequenceSynthetic oligonucleotide
384taggaaaggg aggactcact 2038520DNAArtificial sequenceSynthetic
oligonucleotide 385accttggcag gaaggctccg 2038620DNAArtificial
sequenceSynthetic oligonucleotide 386gagacaaatg ggcctataaa
2038720DNAArtificial sequenceSynthetic oligonucleotide
387ctgaagagaa aggctgatga 2038820DNAArtificial sequenceSynthetic
oligonucleotide 388aatgatcagg gagctagtcc 2038920DNAArtificial
sequenceSynthetic oligonucleotide 389cttagctgac ctaaaggaat
2039020DNAArtificial sequenceSynthetic oligonucleotide
390tgggtatagt gttacaagtg 2039120DNAArtificial sequenceSynthetic
oligonucleotide 391tgaagagaaa ggctgatgaa 2039220DNAArtificial
sequenceSynthetic oligonucleotide 392gtgttacaag tggacttaag
2039320DNAArtificial sequenceSynthetic oligonucleotide
393acctgtgggt gaggagaaca 2039420DNAArtificial sequenceSynthetic
oligonucleotide 394tcacccagat aatcctccct 2039520DNAArtificial
sequenceSynthetic oligonucleotide 395tgttgtcgca gctgttttaa
2039620DNAArtificial sequenceSynthetic oligonucleotide
396tggtcacatt cccttcccct 2039720DNAArtificial sequenceSynthetic
oligonucleotide 397cctggtcaca ttcccttccc 2039820DNAArtificial
sequenceSynthetic oligonucleotide 398tagacctggt cacattccct
2039920DNAArtificial sequenceSynthetic oligonucleotide
399cctagacctg gtcacattcc 2040020DNAArtificial sequenceSynthetic
oligonucleotide 400ccttccgagt cagctttttc 2040120DNAArtificial
sequenceSynthetic oligonucleotide 401ctccttccga
gtcagctttt 2040220DNAArtificial sequenceSynthetic oligonucleotide
402agacctcctt ccgagtcagc 2040320DNAArtificial sequenceSynthetic
oligonucleotide 403gtagacctcc ttccgagtca 2040420DNAArtificial
sequenceSynthetic oligonucleotide 404tttgccgctt ctggtttttg
2040520DNAArtificial sequenceSynthetic oligonucleotide
405cttttgccgc ttctggtttt 2040620DNAArtificial sequenceSynthetic
oligonucleotide 406cctgcttttg ccgcttctgg 2040720DNAArtificial
sequenceSynthetic oligonucleotide 407tacctgcttt tgccgcttct
2040820DNAArtificial sequenceSynthetic oligonucleotide
408agaaaaccca aatcctcatc 2040920DNAArtificial sequenceSynthetic
oligonucleotide 409tagaaaaccc aaatcctcat 2041020DNAArtificial
sequenceSynthetic oligonucleotide 410atagaaaacc caaatcctca
2041120DNAArtificial sequenceSynthetic oligonucleotide
411tatagaaaac ccaaatcctc 2041220DNAArtificial sequenceSynthetic
oligonucleotide 412ttatagaaaa cccaaatcct 2041320DNAArtificial
sequenceSynthetic oligonucleotide 413cttatagaaa acccaaatcc
2041420DNAArtificial sequenceSynthetic oligonucleotide
414ccttatagaa aacccaaatc 2041520DNAArtificial sequenceSynthetic
oligonucleotide 415cccttataga aaacccaaat 2041620DNAArtificial
sequenceSynthetic oligonucleotide 416ccccttatag aaaacccaaa
2041720DNAArtificial sequenceSynthetic oligonucleotide
417accccttata gaaaacccaa 2041820DNAArtificial sequenceSynthetic
oligonucleotide 418aaccccttat agaaaaccca 2041920DNAArtificial
sequenceSynthetic oligonucleotide 419aaacccctta tagaaaaccc
2042020DNAArtificial sequenceSynthetic oligonucleotide
420gaaacccctt atagaaaacc 2042120DNAArtificial sequenceSynthetic
oligonucleotide 421ggaaacccct tatagaaaac 2042220DNAArtificial
sequenceSynthetic oligonucleotide 422aggaaacccc ttatagaaaa
2042320DNAArtificial sequenceSynthetic oligonucleotide
423caggaaaccc cttatagaaa 2042420DNAArtificial sequenceSynthetic
oligonucleotide 424gcaggaaacc ccttatagaa 2042520DNAArtificial
sequenceSynthetic oligonucleotide 425agcaggaaac cccttataga
2042620DNAArtificial sequenceSynthetic oligonucleotide
426cagcaggaaa ccccttatag 2042720DNAArtificial sequenceSynthetic
oligonucleotide 427ccagcaggaa accccttata 2042820DNAArtificial
sequenceSynthetic oligonucleotide 428tccagcagga aaccccttat
2042920DNAArtificial sequenceSynthetic oligonucleotide
429tgtccagcag gaaacccctt 2043020DNAArtificial sequenceSynthetic
oligonucleotide 430ctgtccagca ggaaacccct 2043120DNAArtificial
sequenceSynthetic oligonucleotide 431cctgtccagc aggaaacccc
2043220DNAArtificial sequenceSynthetic oligonucleotide
432ccctgtccag caggaaaccc 2043320DNAArtificial sequenceSynthetic
oligonucleotide 433cccctgtcca gcaggaaacc 2043420DNAArtificial
sequenceSynthetic oligonucleotide 434cgcccctgtc cagcaggaaa
2043520DNAArtificial sequenceSynthetic oligonucleotide
435acgcccctgt ccagcaggaa 2043620DNAArtificial sequenceSynthetic
oligonucleotide 436cacgcccctg tccagcagga 2043720DNAArtificial
sequenceSynthetic oligonucleotide 437ccacgcccct gtccagcagg
2043820DNAArtificial sequenceSynthetic oligonucleotide
438cccacgcccc tgtccagcag 2043920DNAArtificial sequenceSynthetic
oligonucleotide 439tcccacgccc ctgtccagca 2044020DNAArtificial
sequenceSynthetic oligonucleotide 440atcccacgcc cctgtccagc
2044120DNAArtificial sequenceSynthetic oligonucleotide
441aatcccacgc ccctgtccag 2044220DNAArtificial sequenceSynthetic
oligonucleotide 442caatcccacg cccctgtcca 2044320DNAArtificial
sequenceSynthetic oligonucleotide 443tcaatcccac gcccctgtcc
2044420DNAArtificial sequenceSynthetic oligonucleotide
444ttcaatccca cgcccctgtc 2044520DNAArtificial sequenceSynthetic
oligonucleotide 445attcaatccc acgcccctgt 2044620DNAArtificial
sequenceSynthetic oligonucleotide 446aattcaatcc cacgcccctg
2044720DNAArtificial sequenceSynthetic oligonucleotide
447taattcaatc ccacgcccct 2044820DNAArtificial sequenceSynthetic
oligonucleotide 448ttaattcaat cccacgcccc 2044920DNAArtificial
sequenceSynthetic oligonucleotide 449tttaattcaa tcccacgccc
2045020DNAArtificial sequenceSynthetic oligonucleotide
450ttttaattca atcccacgcc 2045120DNAArtificial sequenceSynthetic
oligonucleotide 451gttttaattc aatcccacgc 2045220DNAArtificial
sequenceSynthetic oligonucleotide 452tgttttaatt caatcccacg
2045320DNAArtificial sequenceSynthetic oligonucleotide
453ctgttttaat tcaatcccac 2045420DNAArtificial sequenceSynthetic
oligonucleotide 454gctgttttaa ttcaatccca 2045520DNAArtificial
sequenceSynthetic oligonucleotide 455cagctgtttt aattcaatcc
2045620DNAArtificial sequenceSynthetic oligonucleotide
456gcagctgttt taattcaatc 2045720DNAArtificial sequenceSynthetic
oligonucleotide 457cgcagctgtt ttaattcaat 2045820DNAArtificial
sequenceSynthetic oligonucleotide 458tcgcagctgt tttaattcaa
2045920DNAArtificial sequenceSynthetic oligonucleotide
459tgtcgcagct gttttaattc 2046020DNAArtificial sequenceSynthetic
oligonucleotide 460ttgtcgcagc tgttttaatt 2046120DNAArtificial
sequenceSynthetic oligonucleotide 461gttgtcgcag ctgttttaat
2046220DNAArtificial sequenceSynthetic oligonucleotide
462ttgttgtcgc agctgtttta 2046320DNAArtificial sequenceSynthetic
oligonucleotide 463tttgttgtcg cagctgtttt 2046420DNAArtificial
sequenceSynthetic oligonucleotide 464ttttgttgtc gcagctgttt
2046520DNAArtificial sequenceSynthetic oligonucleotide
465tttttgttgt cgcagctgtt 2046620DNAArtificial sequenceSynthetic
oligonucleotide 466ggatccagct cactcccctg 2046720DNAArtificial
sequenceSynthetic oligonucleotide 467aaataaggat ccagctcact
2046820DNAArtificial sequenceSynthetic oligonucleotide
468gaccagaaat aaggatccag 2046920DNAArtificial sequenceSynthetic
oligonucleotide 469cttagggacc agaaataagg 2047020DNAArtificial
sequenceSynthetic oligonucleotide 470cacccactta gggaccagaa
2047120DNAArtificial sequenceSynthetic oligonucleotide
471accacccact tagggaccag 2047220DNAArtificial sequenceSynthetic
oligonucleotide 472aggtccagga ctctcccctt 2047320DNAArtificial
sequenceSynthetic oligonucleotide 473aaggtccagg actctcccct
2047420DNAArtificial sequenceSynthetic oligonucleotide
474aaactgcaga agtcccaccc 2047520DNAArtificial sequenceSynthetic
oligonucleotide 475ggagggcccc gctgagctgc 2047620DNAArtificial
sequenceSynthetic oligonucleotide 476tcccggaaca tccaagcggg
2047720DNAArtificial sequenceSynthetic oligonucleotide
477catcactttc ccggaacatc 2047820DNAArtificial sequenceSynthetic
oligonucleotide 478ctggtcacat tcccttcccc 2047920DNAArtificial
sequenceSynthetic oligonucleotide 479ctagacctgg tcacattccc
2048020DNAArtificial sequenceSynthetic oligonucleotide
480ggagtggtgg tcacacctcc 2048120DNAArtificial sequenceSynthetic
oligonucleotide 481accccctcca gagagcagga 2048220DNAArtificial
sequenceSynthetic oligonucleotide 482atctctaccc cctccagaga
2048320DNAArtificial sequenceSynthetic oligonucleotide
483ggtacgggta gaagccagaa 2048420DNAArtificial sequenceSynthetic
oligonucleotide 484ggagagtgta accgtcatag 2048520DNAArtificial
sequenceSynthetic oligonucleotide 485tgcgattggc agagccccgg
2048620DNAArtificial sequenceSynthetic oligonucleotide
486ggcaggtgcg attggcagag 2048720DNAArtificial sequenceSynthetic
oligonucleotide 487ggccattcac ttggcaggtg 2048820DNAArtificial
sequenceSynthetic oligonucleotide 488ttgtcacaga tcgctgtctg
2048920DNAArtificial sequenceSynthetic oligonucleotide
489aaggagtctt ggcaggaagg 2049020DNAArtificial sequenceSynthetic
oligonucleotide 490gtacatgaag gagtcttggc 2049120DNAArtificial
sequenceSynthetic oligonucleotide 491aagcttcggc cacctcttga
2049220DNAArtificial sequenceSynthetic oligonucleotide
492ccatctagca ccaggtagat 2049320DNAArtificial sequenceSynthetic
oligonucleotide 493ggccccaatg ctgtctgatc 2049420DNAArtificial
sequenceSynthetic oligonucleotide 494aattaagttg actagacact
2049520DNAArtificial sequenceSynthetic oligonucleotide
495tgccaccttc tcaattaagt 2049620DNAArtificial sequenceSynthetic
oligonucleotide 496taacttgcca ccttctcaat 2049720DNAArtificial
sequenceSynthetic oligonucleotide 497cataacttgc caccttctca
2049820DNAArtificial sequenceSynthetic oligonucleotide
498acaccataac ttgccacctt 2049920DNAArtificial sequenceSynthetic
oligonucleotide 499tcacaccata acttgccacc 2050020DNAArtificial
sequenceSynthetic oligonucleotide 500tagtccctga cttcaacttg
2050120DNAArtificial sequenceSynthetic oligonucleotide
501tggtgttagt ccctgacttc 2050220DNAArtificial sequenceSynthetic
oligonucleotide 502gcggttccag ccttcaggag 2050320DNAArtificial
sequenceSynthetic oligonucleotide 503tcatgaggat gatgacatgg
2050420DNAArtificial sequenceSynthetic oligonucleotide
504ccgcccatgt tgtgcaatcc 2050520DNAArtificial sequenceSynthetic
oligonucleotide 505gtaattgggt ccccgcccat 2050620DNAArtificial
sequenceSynthetic oligonucleotide 506aagtcccgga tctcatcaat
2050720DNAArtificial sequenceSynthetic oligonucleotide
507aacacataga catccagata 2050820DNAArtificial sequenceSynthetic
oligonucleotide 508caaagcattg atgttcactt 2050920DNAArtificial
sequenceSynthetic oligonucleotide 509tttgaacaca tgttgctcat
2051020DNAArtificial sequenceSynthetic oligonucleotide
510cttccaggtt ttccatatcc 2051120DNAArtificial sequenceSynthetic
oligonucleotide 511tcttccaggt tttccatatc 2051220DNAArtificial
sequenceSynthetic oligonucleotide 512agactcagag actggctttc
2051320DNAArtificial sequenceSynthetic oligonucleotide
513gcctgccatg gttgcttgtg 2051420DNAArtificial sequenceSynthetic
oligonucleotide 514tgactgagat cttggcctgc 2051520DNAArtificial
sequenceSynthetic oligonucleotide 515ttctatctcc aggtcccgct
2051620DNAArtificial sequenceSynthetic oligonucleotide
516agtcataaaa ttcaggaatt 2051720DNAArtificial sequenceSynthetic
oligonucleotide 517cgagttgttc cctcggtgca 2051820DNAArtificial
sequenceSynthetic oligonucleotide 518agcctcaaag ctcgagttgt
2051920DNAArtificial sequenceSynthetic oligonucleotide
519ggaggaagcc tcaaagctcg 2052020DNAArtificial sequenceSynthetic
oligonucleotide 520gtagttggag gaagcctcaa 2052120DNAArtificial
sequenceSynthetic oligonucleotide 521caagtggtag ttggaggaag
2052220DNAArtificial sequenceSynthetic oligonucleotide
522tcctcagaca caaacagagc 2052320DNAArtificial sequenceSynthetic
oligonucleotide 523ttctcctcct cagacacaaa 2052420DNAArtificial
sequenceSynthetic oligonucleotide 524tagacctcct tccgagtcag
2052520DNAArtificial sequenceSynthetic oligonucleotide
525ttgatgtaga cctccttccg 2052620DNAArtificial sequenceSynthetic
oligonucleotide 526ctttcttatc cccattcttg
2052720DNAArtificial sequenceSynthetic oligonucleotide
527gcctttctta tccccattct 2052820DNAArtificial sequenceSynthetic
oligonucleotide 528agctgccttt cttatcccca 2052920DNAArtificial
sequenceSynthetic oligonucleotide 529cagctgcctt tcttatcccc
2053020DNAArtificial sequenceSynthetic oligonucleotide
530acagctgcct ttcttatccc 2053120DNAArtificial sequenceSynthetic
oligonucleotide 531gcatctctct cacagctgcc 2053220DNAArtificial
sequenceSynthetic oligonucleotide 532agatgtcctt gactttgtca
2053320DNAArtificial sequenceSynthetic oligonucleotide
533cagcataggg actcactcct 2053420DNAArtificial sequenceSynthetic
oligonucleotide 534ccgccagaat cacctctgca 2053520DNAArtificial
sequenceSynthetic oligonucleotide 535tgaatgaaac gacttctctt
2053620DNAArtificial sequenceSynthetic oligonucleotide
536acatccacta ctccccagct 2053720DNAArtificial sequenceSynthetic
oligonucleotide 537cgcttctggt ttttgcagac 2053820DNAArtificial
sequenceSynthetic oligonucleotide 538ttttgccgct tctggttttt
2053920DNAArtificial sequenceSynthetic oligonucleotide
539gcaggtacct gcttttgccg 2054020DNAArtificial sequenceSynthetic
oligonucleotide 540tcttggagtt tctccttcag 2054116DNAArtificial
sequenceSynthetic oligonucleotide 541ggaacatcca agcggg
1654216DNAArtificial sequenceSynthetic oligonucleotide
542tggtcacatt cccttc 1654316DNAArtificial sequenceSynthetic
oligonucleotide 543cctggtcaca ttccct 1654416DNAArtificial
sequenceSynthetic oligonucleotide 544gacctggtca cattcc
1654516DNAArtificial sequenceSynthetic oligonucleotide
545taacttgcca ccttct 1654616DNAArtificial sequenceSynthetic
oligonucleotide 546cataacttgc cacctt 1654716DNAArtificial
sequenceSynthetic oligonucleotide 547accataactt gccacc
1654816DNAArtificial sequenceSynthetic oligonucleotide
548ccttccgagt cagctt 1654916DNAArtificial sequenceSynthetic
oligonucleotide 549ctccttccga gtcagc 1655016DNAArtificial
sequenceSynthetic oligonucleotide 550acctccttcc gagtca
1655116DNAArtificial sequenceSynthetic oligonucleotide
551ctttcttatc cccatt 1655216DNAArtificial sequenceSynthetic
oligonucleotide 552gcctttctta tcccca 1655316DNAArtificial
sequenceSynthetic oligonucleotide 553ctgcctttct tatccc
1655416DNAArtificial sequenceSynthetic oligonucleotide
554tttgccgctt ctggtt 1655516DNAArtificial sequenceSynthetic
oligonucleotide 555cttttgccgc ttctgg 1655616DNAArtificial
sequenceSynthetic oligonucleotide 556tgcttttgcc gcttct
1655716DNAArtificial sequenceSynthetic oligonucleotide
557aaacccaaat cctcat 1655816DNAArtificial sequenceSynthetic
oligonucleotide 558gaaaacccaa atcctc 1655916DNAArtificial
sequenceSynthetic oligonucleotide 559tagaaaaccc aaatcc
1656016DNAArtificial sequenceSynthetic oligonucleotide
560atagaaaacc caaatc 1656116DNAArtificial sequenceSynthetic
oligonucleotide 561cttatagaaa acccaa 1656216DNAArtificial
sequenceSynthetic oligonucleotide 562ccttatagaa aaccca
1656316DNAArtificial sequenceSynthetic oligonucleotide
563cccttataga aaaccc 1656416DNAArtificial sequenceSynthetic
oligonucleotide 564ccccttatag aaaacc 1656516DNAArtificial
sequenceSynthetic oligonucleotide 565accccttata gaaaac
1656616DNAArtificial sequenceSynthetic oligonucleotide
566aaccccttat agaaaa 1656716DNAArtificial sequenceSynthetic
oligonucleotide 567aaacccctta tagaaa 1656816DNAArtificial
sequenceSynthetic oligonucleotide 568gaaacccctt atagaa
1656916DNAArtificial sequenceSynthetic oligonucleotide
569ggaaacccct tataga 1657016DNAArtificial sequenceSynthetic
oligonucleotide 570aggaaacccc ttatag 1657116DNAArtificial
sequenceSynthetic oligonucleotide 571caggaaaccc cttata
1657216DNAArtificial sequenceSynthetic oligonucleotide
572gcaggaaacc ccttat 1657316DNAArtificial sequenceSynthetic
oligonucleotide 573agcaggaaac ccctta 1657416DNAArtificial
sequenceSynthetic oligonucleotide 574cagcaggaaa cccctt
1657516DNAArtificial sequenceSynthetic oligonucleotide
575ccagcaggaa acccct 1657616DNAArtificial sequenceSynthetic
oligonucleotide 576tccagcagga aacccc 1657716DNAArtificial
sequenceSynthetic oligonucleotide 577gtccagcagg aaaccc
1657816DNAArtificial sequenceSynthetic oligonucleotide
578tgtccagcag gaaacc 1657916DNAArtificial sequenceSynthetic
oligonucleotide 579ctgtccagca ggaaac 1658016DNAArtificial
sequenceSynthetic oligonucleotide 580cctgtccagc aggaaa
1658116DNAArtificial sequenceSynthetic oligonucleotide
581ccctgtccag caggaa 1658216DNAArtificial sequenceSynthetic
oligonucleotide 582cccctgtcca gcagga 1658316DNAArtificial
sequenceSynthetic oligonucleotide 583gcccctgtcc agcagg
1658416DNAArtificial sequenceSynthetic oligonucleotide
584cgcccctgtc cagcag 1658516DNAArtificial sequenceSynthetic
oligonucleotide 585acgcccctgt ccagca 1658616DNAArtificial
sequenceSynthetic oligonucleotide 586cacgcccctg tccagc
1658716DNAArtificial sequenceSynthetic oligonucleotide
587ccacgcccct gtccag 1658816DNAArtificial sequenceSynthetic
oligonucleotide 588cccacgcccc tgtcca 1658916DNAArtificial
sequenceSynthetic oligonucleotide 589tcccacgccc ctgtcc
1659016DNAArtificial sequenceSynthetic oligonucleotide
590atcccacgcc cctgtc 1659116DNAArtificial sequenceSynthetic
oligonucleotide 591aatcccacgc ccctgt 1659216DNAArtificial
sequenceSynthetic oligonucleotide 592caatcccacg cccctg
1659316DNAArtificial sequenceSynthetic oligonucleotide
593tcaatcccac gcccct 1659416DNAArtificial sequenceSynthetic
oligonucleotide 594ttcaatccca cgcccc 1659516DNAArtificial
sequenceSynthetic oligonucleotide 595attcaatccc acgccc
1659616DNAArtificial sequenceSynthetic oligonucleotide
596aattcaatcc cacgcc 1659716DNAArtificial sequenceSynthetic
oligonucleotide 597taattcaatc ccacgc 1659816DNAArtificial
sequenceSynthetic oligonucleotide 598ttaattcaat cccacg
1659916DNAArtificial sequenceSynthetic oligonucleotide
599tttaattcaa tcccac 1660016DNAArtificial sequenceSynthetic
oligonucleotide 600ttttaattca atccca 1660116DNAArtificial
sequenceSynthetic oligonucleotide 601gttttaattc aatccc
1660216DNAArtificial sequenceSynthetic oligonucleotide
602tgttttaatt caatcc 1660316DNAArtificial sequenceSynthetic
oligonucleotide 603ctgttttaat tcaatc 1660416DNAArtificial
sequenceSynthetic oligonucleotide 604gctgttttaa ttcaat
1660516DNAArtificial sequenceSynthetic oligonucleotide
605agctgtttta attcaa 1660616DNAArtificial sequenceSynthetic
oligonucleotide 606cagctgtttt aattca 1660716DNAArtificial
sequenceSynthetic oligonucleotide 607gcagctgttt taattc
1660816DNAArtificial sequenceSynthetic oligonucleotide
608cgcagctgtt ttaatt 1660916DNAArtificial sequenceSynthetic
oligonucleotide 609tcgcagctgt tttaat 1661016DNAArtificial
sequenceSynthetic oligonucleotide 610gtcgcagctg ttttaa
1661116DNAArtificial sequenceSynthetic oligonucleotide
611tgtcgcagct gtttta 1661216DNAArtificial sequenceSynthetic
oligonucleotide 612ttgtcgcagc tgtttt 1661316DNAArtificial
sequenceSynthetic oligonucleotide 613gttgtcgcag ctgttt
1661416DNAArtificial sequenceSynthetic oligonucleotide
614tgttgtcgca gctgtt 1661516DNAArtificial sequenceSynthetic
oligonucleotide 615ttgttgtcgc agctgt 1661616DNAArtificial
sequenceSynthetic oligonucleotide 616tttgttgtcg cagctg
1661716DNAArtificial sequenceSynthetic oligonucleotide
617ttttgttgtc gcagct 1661816DNAArtificial sequenceSynthetic
oligonucleotide 618tttttgttgt cgcagc 1661917DNAArtificial
sequenceSynthetic oligonucleotide 619gaaaacccaa atcctca
1762017DNAArtificial sequenceSynthetic oligonucleotide
620agaaaaccca aatcctc 1762117DNAArtificial sequenceSynthetic
oligonucleotide 621tagaaaaccc aaatcct 1762217DNAArtificial
sequenceSynthetic oligonucleotide 622atagaaaacc caaatcc
1762317DNAArtificial sequenceSynthetic oligonucleotide
623ttatagaaaa cccaaat 1762417DNAArtificial sequenceSynthetic
oligonucleotide 624cttatagaaa acccaaa 1762517DNAArtificial
sequenceSynthetic oligonucleotide 625ccttatagaa aacccaa
1762617DNAArtificial sequenceSynthetic oligonucleotide
626cccttataga aaaccca 1762717DNAArtificial sequenceSynthetic
oligonucleotide 627ccccttatag aaaaccc 1762817DNAArtificial
sequenceSynthetic oligonucleotide 628accccttata gaaaacc
1762917DNAArtificial sequenceSynthetic oligonucleotide
629aaccccttat agaaaac 1763017DNAArtificial sequenceSynthetic
oligonucleotide 630aaacccctta tagaaaa 1763117DNAArtificial
sequenceSynthetic oligonucleotide 631gaaacccctt atagaaa
1763217DNAArtificial sequenceSynthetic oligonucleotide
632ggaaacccct tatagaa 1763317DNAArtificial sequenceSynthetic
oligonucleotide 633aggaaacccc ttataga 1763417DNAArtificial
sequenceSynthetic oligonucleotide 634caggaaaccc cttatag
1763517DNAArtificial sequenceSynthetic oligonucleotide
635gcaggaaacc ccttata 1763617DNAArtificial sequenceSynthetic
oligonucleotide 636agcaggaaac cccttat 1763717DNAArtificial
sequenceSynthetic oligonucleotide 637cagcaggaaa cccctta
1763817DNAArtificial sequenceSynthetic oligonucleotide
638ccagcaggaa acccctt 1763917DNAArtificial sequenceSynthetic
oligonucleotide 639tccagcagga aacccct 1764017DNAArtificial
sequenceSynthetic oligonucleotide 640gtccagcagg aaacccc
1764117DNAArtificial sequenceSynthetic oligonucleotide
641tgtccagcag gaaaccc 1764217DNAArtificial sequenceSynthetic
oligonucleotide 642ctgtccagca ggaaacc 1764317DNAArtificial
sequenceSynthetic oligonucleotide 643cctgtccagc aggaaac
1764417DNAArtificial sequenceSynthetic oligonucleotide
644ccctgtccag caggaaa 1764517DNAArtificial sequenceSynthetic
oligonucleotide 645gcccctgtcc agcagga 1764617DNAArtificial
sequenceSynthetic oligonucleotide 646cgcccctgtc cagcagg
1764717DNAArtificial sequenceSynthetic oligonucleotide
647acgcccctgt ccagcag 1764817DNAArtificial sequenceSynthetic
oligonucleotide 648cacgcccctg tccagca 1764917DNAArtificial
sequenceSynthetic oligonucleotide 649ccacgcccct gtccagc
1765017DNAArtificial sequenceSynthetic oligonucleotide
650cccacgcccc tgtccag 1765117DNAArtificial sequenceSynthetic
oligonucleotide 651tcccacgccc ctgtcca 1765217DNAArtificial
sequenceSynthetic oligonucleotide 652atcccacgcc
cctgtcc 1765317DNAArtificial sequenceSynthetic oligonucleotide
653aatcccacgc ccctgtc 1765417DNAArtificial sequenceSynthetic
oligonucleotide 654caatcccacg cccctgt 1765517DNAArtificial
sequenceSynthetic oligonucleotide 655tcaatcccac gcccctg
1765617DNAArtificial sequenceSynthetic oligonucleotide
656ttcaatccca cgcccct 1765717DNAArtificial sequenceSynthetic
oligonucleotide 657attcaatccc acgcccc 1765817DNAArtificial
sequenceSynthetic oligonucleotide 658aattcaatcc cacgccc
1765917DNAArtificial sequenceSynthetic oligonucleotide
659taattcaatc ccacgcc 1766017DNAArtificial sequenceSynthetic
oligonucleotide 660ttaattcaat cccacgc 1766117DNAArtificial
sequenceSynthetic oligonucleotide 661tttaattcaa tcccacg
1766217DNAArtificial sequenceSynthetic oligonucleotide
662ttttaattca atcccac 1766317DNAArtificial sequenceSynthetic
oligonucleotide 663gttttaattc aatccca 1766417DNAArtificial
sequenceSynthetic oligonucleotide 664tgttttaatt caatccc
1766517DNAArtificial sequenceSynthetic oligonucleotide
665ctgttttaat tcaatcc 1766617DNAArtificial sequenceSynthetic
oligonucleotide 666gctgttttaa ttcaatc 1766717DNAArtificial
sequenceSynthetic oligonucleotide 667agctgtttta attcaat
1766817DNAArtificial sequenceSynthetic oligonucleotide
668cagctgtttt aattcaa 1766917DNAArtificial sequenceSynthetic
oligonucleotide 669gcagctgttt taattca 1767017DNAArtificial
sequenceSynthetic oligonucleotide 670cgcagctgtt ttaattc
1767117DNAArtificial sequenceSynthetic oligonucleotide
671tcgcagctgt tttaatt 1767217DNAArtificial sequenceSynthetic
oligonucleotide 672gtcgcagctg ttttaat 1767317DNAArtificial
sequenceSynthetic oligonucleotide 673tgtcgcagct gttttaa
1767417DNAArtificial sequenceSynthetic oligonucleotide
674ttgtcgcagc tgtttta 1767517DNAArtificial sequenceSynthetic
oligonucleotide 675gttgtcgcag ctgtttt 1767617DNAArtificial
sequenceSynthetic oligonucleotide 676tgttgtcgca gctgttt
1767717DNAArtificial sequenceSynthetic oligonucleotide
677ttgttgtcgc agctgtt 1767817DNAArtificial sequenceSynthetic
oligonucleotide 678tttgttgtcg cagctgt 1767917DNAArtificial
sequenceSynthetic oligonucleotide 679ttttgttgtc gcagctg
1768017DNAArtificial sequenceSynthetic oligonucleotide
680tttttgttgt cgcagct 1768119DNAArtificial sequenceSynthetic
oligonucleotide 681tagaaaaccc aaatcctca 1968219DNAArtificial
sequenceSynthetic oligonucleotide 682atagaaaacc caaatcctc
1968319DNAArtificial sequenceSynthetic oligonucleotide
683tatagaaaac ccaaatcct 1968419DNAArtificial sequenceSynthetic
oligonucleotide 684cttatagaaa acccaaatc 1968519DNAArtificial
sequenceSynthetic oligonucleotide 685ccttatagaa aacccaaat
1968619DNAArtificial sequenceSynthetic oligonucleotide
686cccttataga aaacccaaa 1968719DNAArtificial sequenceSynthetic
oligonucleotide 687ccccttatag aaaacccaa 1968819DNAArtificial
sequenceSynthetic oligonucleotide 688accccttata gaaaaccca
1968919DNAArtificial sequenceSynthetic oligonucleotide
689aaccccttat agaaaaccc 1969019DNAArtificial sequenceSynthetic
oligonucleotide 690aaacccctta tagaaaacc 1969119DNAArtificial
sequenceSynthetic oligonucleotide 691gaaacccctt atagaaaac
1969219DNAArtificial sequenceSynthetic oligonucleotide
692ggaaacccct tatagaaaa 1969319DNAArtificial sequenceSynthetic
oligonucleotide 693aggaaacccc ttatagaaa 1969419DNAArtificial
sequenceSynthetic oligonucleotide 694caggaaaccc cttatagaa
1969519DNAArtificial sequenceSynthetic oligonucleotide
695gcaggaaacc ccttataga 1969619DNAArtificial sequenceSynthetic
oligonucleotide 696agcaggaaac cccttatag 1969719DNAArtificial
sequenceSynthetic oligonucleotide 697cagcaggaaa ccccttata
1969819DNAArtificial sequenceSynthetic oligonucleotide
698ccagcaggaa accccttat 1969919DNAArtificial sequenceSynthetic
oligonucleotide 699tccagcagga aacccctta 1970019DNAArtificial
sequenceSynthetic oligonucleotide 700gtccagcagg aaacccctt
1970119DNAArtificial sequenceSynthetic oligonucleotide
701tgtccagcag gaaacccct 1970219DNAArtificial sequenceSynthetic
oligonucleotide 702cctgtccagc aggaaaccc 1970319DNAArtificial
sequenceSynthetic oligonucleotide 703ccctgtccag caggaaacc
1970419DNAArtificial sequenceSynthetic oligonucleotide
704cccctgtcca gcaggaaac 1970519DNAArtificial sequenceSynthetic
oligonucleotide 705gcccctgtcc agcaggaaa 1970619DNAArtificial
sequenceSynthetic oligonucleotide 706acgcccctgt ccagcagga
1970719DNAArtificial sequenceSynthetic oligonucleotide
707cacgcccctg tccagcagg 1970819DNAArtificial sequenceSynthetic
oligonucleotide 708ccacgcccct gtccagcag 1970919DNAArtificial
sequenceSynthetic oligonucleotide 709cccacgcccc tgtccagca
1971019DNAArtificial sequenceSynthetic oligonucleotide
710tcccacgccc ctgtccagc 1971119DNAArtificial sequenceSynthetic
oligonucleotide 711atcccacgcc cctgtccag 1971219DNAArtificial
sequenceSynthetic oligonucleotide 712aatcccacgc ccctgtcca
1971319DNAArtificial sequenceSynthetic oligonucleotide
713caatcccacg cccctgtcc 1971419DNAArtificial sequenceSynthetic
oligonucleotide 714tcaatcccac gcccctgtc 1971519DNAArtificial
sequenceSynthetic oligonucleotide 715ttcaatccca cgcccctgt
1971619DNAArtificial sequenceSynthetic oligonucleotide
716attcaatccc acgcccctg 1971719DNAArtificial sequenceSynthetic
oligonucleotide 717aattcaatcc cacgcccct 1971819DNAArtificial
sequenceSynthetic oligonucleotide 718taattcaatc ccacgcccc
1971919DNAArtificial sequenceSynthetic oligonucleotide
719ttaattcaat cccacgccc 1972019DNAArtificial sequenceSynthetic
oligonucleotide 720tttaattcaa tcccacgcc 1972119DNAArtificial
sequenceSynthetic oligonucleotide 721ttttaattca atcccacgc
1972219DNAArtificial sequenceSynthetic oligonucleotide
722gttttaattc aatcccacg 1972319DNAArtificial sequenceSynthetic
oligonucleotide 723tgttttaatt caatcccac 1972419DNAArtificial
sequenceSynthetic oligonucleotide 724ctgttttaat tcaatccca
1972519DNAArtificial sequenceSynthetic oligonucleotide
725gctgttttaa ttcaatccc 1972619DNAArtificial sequenceSynthetic
oligonucleotide 726agctgtttta attcaatcc 1972719DNAArtificial
sequenceSynthetic oligonucleotide 727cagctgtttt aattcaatc
1972819DNAArtificial sequenceSynthetic oligonucleotide
728gcagctgttt taattcaat 1972919DNAArtificial sequenceSynthetic
oligonucleotide 729cgcagctgtt ttaattcaa 1973019DNAArtificial
sequenceSynthetic oligonucleotide 730tcgcagctgt tttaattca
1973119DNAArtificial sequenceSynthetic oligonucleotide
731gtcgcagctg ttttaattc 1973219DNAArtificial sequenceSynthetic
oligonucleotide 732tgtcgcagct gttttaatt 1973319DNAArtificial
sequenceSynthetic oligonucleotide 733ttgtcgcagc tgttttaat
1973419DNAArtificial sequenceSynthetic oligonucleotide
734gttgtcgcag ctgttttaa 1973519DNAArtificial sequenceSynthetic
oligonucleotide 735tgttgtcgca gctgtttta 1973619DNAArtificial
sequenceSynthetic oligonucleotide 736ttgttgtcgc agctgtttt
1973719DNAArtificial sequenceSynthetic oligonucleotide
737tttgttgtcg cagctgttt 1973819DNAArtificial sequenceSynthetic
oligonucleotide 738ttttgttgtc gcagctgtt 1973919DNAArtificial
sequenceSynthetic oligonucleotide 739tttttgttgt cgcagctgt
1974018DNAArtificial sequenceSynthetic oligonucleotide
740ccccttatag aaaaccca 1874118DNAArtificial sequenceSynthetic
oligonucleotide 741accccttata gaaaaccc 1874218DNAArtificial
sequenceSynthetic oligonucleotide 742aaccccttat agaaaacc
1874318DNAArtificial sequenceSynthetic oligonucleotide
743aaacccctta tagaaaac 1874418DNAArtificial sequenceSynthetic
oligonucleotide 744gaaacccctt atagaaaa 1874518DNAArtificial
sequenceSynthetic oligonucleotide 745aggaaacccc ttatagaa
1874618DNAArtificial sequenceSynthetic oligonucleotide
746caggaaaccc cttataga 1874718DNAArtificial sequenceSynthetic
oligonucleotide 747gcaggaaacc ccttatag 1874818DNAArtificial
sequenceSynthetic oligonucleotide 748agcaggaaac cccttata
1874918DNAArtificial sequenceSynthetic oligonucleotide
749cagcaggaaa ccccttat 1875018DNAArtificial sequenceSynthetic
oligonucleotide 750ccagcaggaa acccctta 1875118DNAArtificial
sequenceSynthetic oligonucleotide 751tccagcagga aacccctt
1875218DNAArtificial sequenceSynthetic oligonucleotide
752gtccagcagg aaacccct 1875318DNAArtificial sequenceSynthetic
oligonucleotide 753tgtccagcag gaaacccc 1875418DNAArtificial
sequenceSynthetic oligonucleotide 754ctgtccagca ggaaaccc
1875518DNAArtificial sequenceSynthetic oligonucleotide
755cctgtccagc aggaaacc 1875618DNAArtificial sequenceSynthetic
oligonucleotide 756ccctgtccag caggaaac 1875718DNAArtificial
sequenceSynthetic oligonucleotide 757cccctgtcca gcaggaaa
1875818DNAArtificial sequenceSynthetic oligonucleotide
758cgcccctgtc cagcagga 1875918DNAArtificial sequenceSynthetic
oligonucleotide 759acgcccctgt ccagcagg 1876018DNAArtificial
sequenceSynthetic oligonucleotide 760cacgcccctg tccagcag
1876118DNAArtificial sequenceSynthetic oligonucleotide
761ccacgcccct gtccagca 1876218DNAArtificial sequenceSynthetic
oligonucleotide 762cccacgcccc tgtccagc 1876318DNAArtificial
sequenceSynthetic oligonucleotide 763tcccacgccc ctgtccag
1876418DNAArtificial sequenceSynthetic oligonucleotide
764atcccacgcc cctgtcca 1876518DNAArtificial sequenceSynthetic
oligonucleotide 765aatcccacgc ccctgtcc 1876618DNAArtificial
sequenceSynthetic oligonucleotide 766caatcccacg cccctgtc
1876718DNAArtificial sequenceSynthetic oligonucleotide
767tcaatcccac gcccctgt 1876818DNAArtificial sequenceSynthetic
oligonucleotide 768ttcaatccca cgcccctg 1876918DNAArtificial
sequenceSynthetic oligonucleotide 769attcaatccc acgcccct
1877018DNAArtificial sequenceSynthetic oligonucleotide
770aattcaatcc cacgcccc 1877118DNAArtificial sequenceSynthetic
oligonucleotide 771taattcaatc ccacgccc 1877218DNAArtificial
sequenceSynthetic oligonucleotide 772ttaattcaat cccacgcc
1877318DNAArtificial sequenceSynthetic oligonucleotide
773tttaattcaa tcccacgc 1877418DNAArtificial sequenceSynthetic
oligonucleotide 774ttttaattca atcccacg 1877518DNAArtificial
sequenceSynthetic oligonucleotide 775gttttaattc aatcccac
1877618DNAArtificial sequenceSynthetic oligonucleotide
776tgttttaatt caatccca 1877718DNAArtificial sequenceSynthetic
oligonucleotide 777ctgttttaat tcaatccc
1877818DNAArtificial sequenceSynthetic oligonucleotide
778gctgttttaa ttcaatcc 1877918DNAArtificial sequenceSynthetic
oligonucleotide 779agctgtttta attcaatc 1878018DNAArtificial
sequenceSynthetic oligonucleotide 780cagctgtttt aattcaat
1878118DNAArtificial sequenceSynthetic oligonucleotide
781gcagctgttt taattcaa 1878218DNAArtificial sequenceSynthetic
oligonucleotide 782cgcagctgtt ttaattca 1878318DNAArtificial
sequenceSynthetic oligonucleotide 783tcgcagctgt tttaattc
1878418DNAArtificial sequenceSynthetic oligonucleotide
784gtcgcagctg ttttaatt 1878518DNAArtificial sequenceSynthetic
oligonucleotide 785tagaaaaccc aaatcctc 1878618DNAArtificial
sequenceSynthetic oligonucleotide 786atagaaaacc caaatcct
1878718DNAArtificial sequenceSynthetic oligonucleotide
787tatagaaaac ccaaatcc 1878818DNAArtificial sequenceSynthetic
oligonucleotide 788ttatagaaaa cccaaatc 1878918DNAArtificial
sequenceSynthetic oligonucleotide 789cttatagaaa acccaaat
1879018DNAArtificial sequenceSynthetic oligonucleotide
790ccttatagaa aacccaaa 1879118DNAArtificial sequenceSynthetic
oligonucleotide 791cccttataga aaacccaa 1879218DNAArtificial
sequenceSynthetic oligonucleotide 792tgtcgcagct gttttaat
1879318DNAArtificial sequenceSynthetic oligonucleotide
793ttgtcgcagc tgttttaa 1879418DNAArtificial sequenceSynthetic
oligonucleotide 794gttgtcgcag ctgtttta 1879518DNAArtificial
sequenceSynthetic oligonucleotide 795tgttgtcgca gctgtttt
1879618DNAArtificial sequenceSynthetic oligonucleotide
796ttgttgtcgc agctgttt 1879718DNAArtificial sequenceSynthetic
oligonucleotide 797tttgttgtcg cagctgtt 1879818DNAArtificial
sequenceSynthetic oligonucleotide 798ttttgttgtc gcagctgt
1879918DNAArtificial sequenceSynthetic oligonucleotide
799tttttgttgt cgcagctg 1880016DNAArtificial sequenceSynthetic
oligonucleotide 800aaaacccaaa tcctca 1680116DNAArtificial
sequenceSynthetic oligonucleotide 801agaaaaccca aatcct
1680216DNAArtificial sequenceSynthetic oligonucleotide
802tatagaaaac ccaaat 1680316DNAArtificial sequenceSynthetic
oligonucleotide 803ttatagaaaa cccaaa 1680420DNAArtificial
sequenceSynthetic oligonucleotide 804gcataagagg gtaccagctg
2080520DNAArtificial sequenceSynthetic oligonucleotide
805gtcctttagc cagggcagca 2080620DNAArtificial sequenceSynthetic
oligonucleotide 806tccacccatg ttgtgcaagc 2080720DNAArtificial
sequenceSynthetic oligonucleotide 807ccacaccatg ccacagagac
2080820DNAArtificial sequenceSynthetic oligonucleotide
808ttccgagtca ggctcttccc 2080920DNAArtificial sequenceSynthetic
oligonucleotide 809ccttccctga aggttcctcc 2081021DNAArtificial
sequencePrimer 810agtctctgtg gcatggtttg g 2181121DNAArtificial
sequencePrimer 811gggcgaatga ctgagatctt g 2181227DNAArtificial
sequenceProbe 812taccgattac cacaagcaac catggca 2781322DNAArtificial
sequencePrimer 813cgaagcagct caatgaaatc aa 2281418DNAArtificial
sequencePrimer 814tgcctggagg gccttctt 1881518DNAArtificial
sequenceProbe 815agaccacaag ttgaagtc 1881620DNAArtificial
sequencePrimer 816gggcaaacag caatttgtga 2081720DNAArtificial
sequencePrimer 817tggctaccca ccttccttgt 2081828DNAArtificial
sequenceProbe 818ctggatactg tcccaatccc ggtattcc
2881922DNAArtificial sequenceSynthetic oligonucleotide
819cgaagaagct cagtgaaatc aa 2282018DNAArtificial sequenceSynthetic
oligonucleotide 820tgcctggagg gccctctt 18
* * * * *