U.S. patent application number 16/749293 was filed with the patent office on 2020-05-14 for modulatory polynucleotides.
The applicant listed for this patent is VOYAGER THERAPEUTICS, INC.. Invention is credited to Jinzhao Hou, Mathieu E. Nonnenmacher, Dinah Wen-Yee Sah.
Application Number | 20200149045 16/749293 |
Document ID | / |
Family ID | 60325551 |
Filed Date | 2020-05-14 |
![](/patent/app/20200149045/US20200149045A1-20200514-D00000.png)
![](/patent/app/20200149045/US20200149045A1-20200514-D00001.png)
![](/patent/app/20200149045/US20200149045A1-20200514-D00002.png)
United States Patent
Application |
20200149045 |
Kind Code |
A1 |
Sah; Dinah Wen-Yee ; et
al. |
May 14, 2020 |
MODULATORY POLYNUCLEOTIDES
Abstract
The invention relates to compositions and methods for the
preparation, manufacture and therapeutic use of modulatory
polynucleotides.
Inventors: |
Sah; Dinah Wen-Yee;
(Cambridge, MA) ; Hou; Jinzhao; (Cambridge,
MA) ; Nonnenmacher; Mathieu E.; (Cambridge,
MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
VOYAGER THERAPEUTICS, INC. |
CAMBRIDGE |
MA |
US |
|
|
Family ID: |
60325551 |
Appl. No.: |
16/749293 |
Filed: |
January 22, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16302146 |
Nov 16, 2018 |
10584337 |
|
|
PCT/US2017/033268 |
May 18, 2017 |
|
|
|
16749293 |
|
|
|
|
62338137 |
May 18, 2016 |
|
|
|
62485050 |
Apr 13, 2017 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/111 20130101;
C12N 2310/533 20130101; C12N 2320/52 20130101; C12N 2750/14143
20130101; C12N 2310/141 20130101; C12N 15/85 20130101; C12N 2310/14
20130101; C12N 15/113 20130101; A61P 43/00 20180101; C12N 2310/531
20130101; C12N 2310/3519 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; C12N 15/85 20060101 C12N015/85; C12N 15/11 20060101
C12N015/11 |
Claims
1. A modulatory polynucleotide for targeting the expression of an
Htt gene, comprising: (a) a stem and a loop which form a stem-loop
structure, the sequence of said stem-loop structure comprising,
from 5' to 3': (i) a 5' stem arm comprising a passenger strand and
a 5' spacer sequence; (ii) a loop region between 4-30 nucleotides
in length, wherein the loop region comprises a nucleotide sequence
which is at least 85% identical to SEQ ID NO: 16; (iii) a 3' stem
arm comprising a guide strand and a 3' spacer sequence, wherein the
guide strand is at least 60% complementary to a target RNA, and
wherein the target RNA is expressed from the Htt gene; (b) a first
flanking region located 5' to said passenger strand, said first
flanking region comprising the 5' spacer sequence and a 5' flanking
sequence, wherein the first flanking region comprises a nucleotide
sequence which is at least 90% identical to SEQ ID NO: 5; and c) a
second flanking region located 3' to said guide strand, said second
flanking region comprising the 3' spacer sequence and a 3' flanking
sequence, wherein said second flanking region comprises a
nucleotide sequence which is at least 90% identical to SEQ ID NO:
21.
2. The modulatory polynucleotide of claim 1, wherein the loop
region comprises SEQ ID NO: 16.
3. The modulatory polynucleotide of claim 1, wherein the first
flanking region comprises SEQ ID NO: 5.
4. The modulatory polynucleotide of claim 1, wherein the second
flanking region comprises SEQ ID NO: 21.
5. The modulatory polynucleotide of claim 1, wherein the loop
region comprises SEQ ID NO: 16, wherein the first flanking region
comprises SEQ ID NO: 5, and wherein the second flanking region
comprises SEQ ID NO: 21.
6. The modulatory polynucleotide of claim 5, wherein the guide
strand comprises a microRNA seed sequence comprising positions 2-7,
2-8 or 2-9 of the guide strand.
7. The modulatory polynucleotide of claim 5, wherein the guide
strand is 20-22 nucleotides in length.
8. The modulatory polynucleotide of claim 7, wherein the passenger
strand is between 15-30 nucleotides in length; wherein the 5'
spacer sequence is between 8-20 nucleotides in length; wherein the
guide strand is between 15-30 nucleotides in length; and wherein
the 3' spacer sequence is between 8-20 nucleotides in length.
9. An adeno-associated virus (AAV) vector genome encoding the
modulatory polynucleotide of claim 8.
10. An AAV particle comprising the AAV vector genome of claim 9 and
an AAV1 capsid.
11. A modulatory polynucleotide for targeting the expression of an
Htt gene, comprising: (a) a stem and a loop which form a stem-loop
structure, the sequence of said stem-loop structure comprising,
from 5' to 3': (i) a 5' stem arm comprising a guide strand and a 5'
spacer sequence, wherein the guide strand is at least 60%
complementary to a target RNA, and wherein the target RNA is
expressed from an Htt gene; (ii) a loop region between 4-30
nucleotides in length, wherein the loop region comprises a
nucleotide sequence which is at least 85% identical to SEQ ID NO:
16; (iii) a 3' stem arm comprising a passenger strand and a 3'
spacer sequence; (b) a first flanking region located 5' to said
guide strand, said first flanking region comprising the 5' spacer
sequence and a 5' flanking sequence, wherein the first flanking
region comprises a nucleotide sequence which is at least 90%
identical to SEQ ID NO: 5; and (c) a second flanking region located
3' to said passenger strand, said second flanking region comprising
the 3' spacer sequence and a 3' flanking sequence, wherein said
second flanking region comprises a nucleotide sequence which is at
least 90% identical to SEQ ID NO: 21.
12. The modulatory polynucleotide of claim 11, wherein the loop
region comprises SEQ ID NO: 16.
13. The modulatory polynucleotide of claim 11, wherein the first
flanking region comprises SEQ ID NO: 5.
14. The modulatory polynucleotide of claim 11, wherein the second
flanking region comprises SEQ ID NO: 21.
15. The modulatory polynucleotide of claim 11, wherein the loop
region comprises SEQ ID NO: 16, wherein the first flanking region
comprises SEQ ID NO: 5, and wherein the second flanking region
comprises SEQ ID NO: 21.
16. The modulatory polynucleotide of claim 15, wherein the guide
strand comprises a microRNA seed sequence comprising positions 2-7,
2-8 or 2-9 of the guide strand.
17. The modulatory polynucleotide of claim 15, wherein the guide
strand is 20-22 nucleotides in length.
18. The modulatory polynucleotide of claim 17, wherein the
passenger strand is between 15-30 nucleotides in length; wherein
the 5' spacer sequence is between 8-20 nucleotides in length;
wherein the guide strand is between 15-30 nucleotides in length;
and wherein the 3' spacer sequence is between 8-20 nucleotides in
length.
19. An adeno-associated virus (AAV) vector genome encoding the
modulatory polynucleotide of claim 18.
20. An AAV particle comprising the AAV vector genome of claim 19
and an AAV1 capsid.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application which claims
the benefit of U.S. patent application Ser. No. 16/302,146, filed
Nov. 16, 2018 and entitled Modulatory Polynucleotides; which is a
national stage filing under 35 U.S.C. .sctn. 371 of International
Application No. PCT/US2017/033268, filed May 18, 2017 and entitled
Modulatory Polynucleotides; which claims priority to US Provisional
Patent Application No. 62/338,137, filed on May 18, 2016, entitled
Modulatory Polynucleotides, and US Provisional Patent Application
No. 62/485,050, filed on Apr. 13, 2017, entitled Modulatory
Polynucleotides, the contents each of which are herein incorporated
by reference in their entireties.
REFERENCE TO THE SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled 20571039USCONSL.txt, created on Jan. 22, 2020, which
is 4,262,116 bytes in size. The information in the electronic
format of the sequence listing is incorporated herein by reference
in its entirety.
FIELD OF THE INVENTION
[0003] The invention relates to compositions, methods, processes,
kits and devices for the design, preparation, manufacture and/or
formulation of modulatory polynucleotides. In some embodiments such
modulatory polynucleotides may be encoded by or within recombinant
adeno-associated viruses (AAV) and may comprise artificial
microRNAs, artificial pre-microRNAs and/or artificial
pri-microRNAs.
BACKGROUND OF THE INVENTION
[0004] MicroRNAs (or miRNAs or miRs) are small, non-coding, single
stranded ribonucleic acid molecules (RNAs), which are usually 19-25
nucleotides in length. More than a thousand microRNAs have been
identified in mammalian genomes. The mature microRNAs primarily
bind to the 3' untranslated region (3'-UTR) of target messenger
RNAs (mRNAs) through partially or fully pairing with the
complementary sequences of target mRNAs, promoting the degradation
of target mRNAs at a post-transcriptional level, and in some cases,
inhibiting the initiation of translation. MicroRNAs play a critical
role in many key biological processes, such as the regulation of
cell cycle and growth, apoptosis, cell proliferation and tissue
development.
[0005] miRNA genes are generally transcribed as long primary
transcripts of miRNAs (i.e. pri-miRNAs). The pri-miRNA is cleaved
into a precursor of a miRNA (i.e. pre-miRNA) which is further
processed to generate the mature and functional miRNA.
[0006] While many target expression strategies employ nucleic acid
based modalities, there remains a need for improved nucleic acid
modalities which have higher specificity and with fewer off target
effects.
[0007] The present invention provides such improved modalities in
the form of artificial pri-, pre- and mature microRNA constructs
and methods of their design. These novel constructs may be
synthetic stand-alone molecules or be encoded in a plasmid or
expression vector for delivery to cells. Such vectors include, but
are not limited to adeno-associated viral vectors such as vector
genomes of any of the AAV serotypes or other viral delivery
vehicles such as lentivirus, etc.
SUMMARY OF THE INVENTION
[0008] Described herein are compositions, methods, processes, kits
and devices for the design, preparation, manufacture and/or
formulation of modulatory polynucleotides.
[0009] In some embodiments such modulatory polynucleotides may be
encoded by or contained within plasmids or vectors or recombinant
adeno-associated viruses (AAV) and may comprise artificial
microRNAs, artificial pre-microRNAs and/or artificial
pri-microRNAs.
[0010] The details of various embodiments of the invention are set
forth in the description below. Other features, objects, and
advantages of the invention will be apparent from the description
and the drawings, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] The foregoing and other objects, features and advantages
will be apparent from the following description of particular
embodiments of the invention, as illustrated in the accompanying
drawings in which like reference characters refer to the same parts
throughout the different views. The drawings are not necessarily to
scale, emphasis instead being placed upon illustrating the
principles of various embodiments of the invention.
[0012] FIG. 1 is a schematic of an artificial pri-microRNA that is
part of a viral genome packaged in an AAV vector according to the
present invention. FIG. 1 discloses SEQ ID NO: 943.
[0013] FIG. 2 is a diagram showing the location of the modulatory
polynucleotide (MP) in relation to the ITRs, the intron (I) and the
polyA (P).
DETAILED DESCRIPTION
I. Compositions of the Invention
Modulatory Polynucleotides
[0014] According to the present invention, modulatory
polynucleotides are provided which function as artificial
microRNAs. As used herein a "modulatory polynucleotide" is any
nucleic acid polymer which functions to modulate (either increase
or decrease) the level or amount of a target gene. Modulatory
polynucleotides include precursor molecules which are processed
inside the cell prior to modulation. Modulatory polynucleotides or
the processed forms thereof may be encoded in a plasmid, vector,
genome or other nucleic acid expression vector for delivery to a
cell.
[0015] In one embodiment, the modulatory polynucleotides may
comprise at least one nucleic acid sequence encoding at least one
siRNA molecule. The nucleic acids may, independently if there is
more than one, encode 1, 2, 3, 4, 5, 6, 7, 8, 9, or more than 9
siRNA molecules.
[0016] In some embodiments modulatory polynucleotides are designed
as primary microRNA (pri-miRs) or precursor microRNAs (pre-miRs)
which are processed within the cell to produce highly specific
artificial microRNAs.
[0017] The modulatory polynucleotides, especially the artificial
microRNAs of the invention, may be designed based on the sequence
or structure scaffold of a canonical or known microRNA,
pri-microRNA or pre-microRNA. Such sequences may correspond to any
known microRNA or its precursor such as those taught in US
Publication US2005/0261218 and US Publication US2005/0059005, the
contents of which are incorporated herein by reference in their
entirety.
[0018] microRNAs (or miRNA or miRs) are 19-25 nucleotide long
noncoding RNAs that bind to the 3'UTR of nucleic acid molecules and
down-regulate gene expression either by reducing nucleic acid
molecule stability or by inhibiting translation. The modulatory
polynucleotides of the invention may comprise one or more microRNA
sequences, microRNA seeds or artificial microRNAs, e.g., sequences
which function as a microRNA.
[0019] A microRNA sequence comprises a "seed" region, i.e., a
sequence in the region of positions 2-9 of the mature microRNA,
which sequence has perfect Watson-Crick complementarity to the
miRNA target sequence. A microRNA seed may comprise positions 2-8
or 2-7 or 2-9 of the mature microRNA. In some embodiments, a
microRNA seed may comprise 7 nucleotides (e.g., nucleotides 2-8 of
the mature microRNA), wherein the seed-complementary site in the
corresponding miRNA target is flanked by an adenine (A) opposed to
microRNA position 1. In some embodiments, a microRNA seed may
comprise 6 nucleotides (e.g., nucleotides 2-7 of the mature
microRNA), wherein the seed-complementary site in the corresponding
miRNA target is flanked by an adenine (A) opposed to microRNA
position 1. See for example, Grimson A, Farh KK , Johnston W K,
Garrett-Engele P, Lim L P, Bartel D P; Mol Cell. 2007 Jul. 6;
27(1):91-105; each of which is herein incorporated by reference in
their entirety. In naturally occurring microRNA, the bases of the
microRNA seed have complete complementarity with the target
sequence.
[0020] As taught herein, design parameters, or rules, have been
identified and applied to design modulatory polynucleotides (e.g.,
artificial microRNAs) which have superior target gene modulatory
properties with limited off target effects.
[0021] In one embodiment, the molecular scaffold of the modulatory
polynucleotide described herein may be designed and optimized to
create a modulatory polynucleotide that has the desired target gene
modulatory properties. As a non-limiting example, the modulatory
polynucleotide can have superior target gene modulatory properties
with limited off target effects.
[0022] In one embodiment, the modulatory polynucleotides of the
invention, such as artificial miRs, are comprised of modular
elements or sequence motifs assembled according to a set of rules
that result in highly specific target recognition and low
guide/passenger ratio. Such modules or sequence motifs include, but
are not limited to, double stranded regions, flanking regions,
loops, optimized loops, UGUG loops, GU domains, spacers (to control
proximal and distal motif or module spacing or to introduce
structural elements such as turns, loops or bulges), CNNC motifs,
and thermodynamic asymmetry regions which may embrace loops,
bulges, mismatches, wobbles, and/or combinations thereof. Non
limiting examples of rules which may be applied alone or in
combination when constructing artificial miRs include those taught
in Seitz et al. Silence 2011, 2:4; Gu, et al., Cell 151, 900-911,
Nov. 9, 2012; Schwartz, et al., Cell, Vol. 115, 199-208, Oct. 17,
2003; Park, et al., Nature, Vol. 475, 101, 14 Jul. 2011; Ketley et
al., 2013, PLoS ONE 8(6); Liu, et al., Nucleic Acids Research,
2008, Vol. 36, No. 9 2811-2824; Dow, et al., 2013, Nat Protoc.;
7(2): 374-393. doi:10.1038/nprot.2011.446; Auyeung, et al., Cell
152, 844-858, Feb. 14, 2013; Gu et al., Cell 2012 Nov. 9,
151(4):900-11; Fellmann et al. Molecular Cell 41, 733-746, 2011;
Han et al. Cell 125, 887-907, 2006; Betancur et al. Frontiers in
Genetics, Vol. 3, Art. 127, 1-6 Jul. 2012; Schwarz et al. Cell Vol
115, 199-208, 2003; the contents of each of which are herein
incorporated by reference in their entirety.
[0023] In one embodiment, any of the known RNAi constructs or RNAi
agents may serve as the starting construct for the design of the
passenger and/or guide strand of a modulatory polynucleotides or
artificial microRNAs of the invention. These include canonical
siRNAs, small interfering RNAs (siRNA), double stranded RNAs
(dsRNAs), inverted repeats, short hairpin RNAs (shRNAs), small
temporally regulated RNAs (stRNA), clustered inhibitory RNAs
(cRNAs), including radial clustered inhibitory RNA, asymmetric
clustered inhibitory RNA, linear clustered inhibitory RNA, and
complex or compound clustered inhibitory RNA, dicer substrates,
DNA-directed RNAi (ddRNAi), single-stranded RNAi (ssRNAi), microRNA
(miRNA) antagonists, microRNA mimics, microRNA agonists, blockmirs
(a.k.a. Xmirs), microRNA mimetics, microRNA addbacks, supermiRs,
the oligomeric constructs disclosed in PCT Publication
WO/2005/013901 the contents of which are incorporated herein in
their entirety, tripartite RNAi constructs such as those disclosed
in US Publication 20090131360, the contents of which are
incorporated herein in their entirety, the solo-rxRNA constructs
disclosed in PCT Publication WO/2010/011346, the contents of which
are incorporated herein by reference in their entirety; the
sd-rxRNA constructs disclosed in PCT Publication WO/2010/033247 the
contents of which are incorporated herein by reference in their
entirety, dual acting RNAi constructs which reduce RNA levels and
also modulate the immune response as disclosed in PCT Publications
WO/2010/002851 and WO/2009/141146 the contents of which are
incorporated herein by reference in their entirety and antigene
RNAs (agRNA) or small activating RNAs (saRNAs) which increase
expression of the target to which they are designed disclosed in
PCT Publications WO/2006/130201, WO/2007/086990, WO/2009/046397,
WO/2009/149182, WO/2009/086428 the contents of which are
incorporated herein by reference in their entirety.
[0024] Likewise, any pri- or pre-microRNA precursor of the above
listed microRNA may also serve as the molecular scaffold of the
modulatory polynucleotides of the invention.
[0025] In one embodiment, the starting construct may be derived
from any relevant species such as, not limited to, mouse, rat, dog,
monkey or human.
[0026] In one embodiment, the modulatory polynucleotide may be
located in an expression vector downstream of a promoter such as,
but not limited to, CMV, U6, H1, CBA or a CBA promoter with a SV40
or a human betaGlobin intron. Further, the modulatory
polynucleotide may also be located upstream of the polyadenylation
sequence in an expression vector. As a non-limiting example, the
modulatory polynucleotide may be located within 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides downstream
from the promoter and/or upstream of the polyadenylation sequence
in an expression vector. As another non-limiting example, the
modulatory polynucleotide may be located within 1-5, 1-10, 1-15,
1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20,
10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30
nucleotides downstream from the promoter and/or upstream of the
polyadenylation sequence in an expression vector. As a non-limiting
example, the modulatory polynucleotide may be located within the
first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or
more than 25% of the nucleotides downstream from the promoter
and/or upstream of the polyadenylation sequence in an expression
vector. As another non-limiting example, the modulatory
polynucleotide may be located with the first 1-5%, 1-10%, 1-15%,
1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%,
15-20%, 15-25%, or 20-25% downstream from the promoter and/or
upstream of the polyadenylation sequence in an expression
vector.
[0027] In one embodiment, the modulatory polynucleotide may be
located upstream of the polyadenylation sequence in an expression
vector. Further, the modulatory polynucleotide may be located
downstream of a promoter such as, but not limited to, CMV, U6, H1,
CBA or a CBA promoter with a SV40 or a human betaGlobin intron in
an expression vector. As a non-limiting example, the modulatory
polynucleotide may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30 or more than 30 nucleotides downstream from the promoter
and/or upstream of the polyadenylation sequence in an expression
vector. As another non-limiting example, the modulatory
polynucleotide may be located within 1-5, 1-10, 1-15, 1-20, 1-25,
1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30,
15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 nucleotides downstream
from the promoter and/or upstream of the polyadenylation sequence
in an expression vector. As a non-limiting example, the modulatory
polynucleotide may be located within the first 1%, 2%, 3%, 4%, 5%,
6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the
nucleotides downstream from the promoter and/or upstream of the
polyadenylation sequence in an expression vector. As another
non-limiting example, the modulatory polynucleotide may be located
with the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%,
5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25%
downstream from the promoter and/or upstream of the polyadenylation
sequence in an expression vector.
[0028] In one embodiment, the modulatory polynucleotide may be
located in a scAAV.
[0029] In one embodiment, the modulatory polynucleotide may be
located in an ssAAV.
[0030] In one embodiment, the modulatory polynucleotide may be
located near the 5' end of the flip ITR in an expression vector. In
another embodiment, the modulatory polynucleotide may be located
near the 3'end of the flip ITR in an expression vector. In yet
another embodiment, the modulatory polynucleotide may be located
near the 5' end of the flop ITR in an expression vector. In yet
another embodiment, the modulatory polynucleotide may be located
near the 3' end of the flop ITR in an expression vector. In one
embodiment, the modulatory polynucleotide may be located between
the 5' end of the flip ITR and the 3' end of the flop ITR in an
expression vector. In one embodiment, the modulatory polynucleotide
may be located between (e.g., half-way between the 5' end of the
flip ITR and 3' end of the flop ITR or the 3' end of the flop ITR
and the 5' end of the flip ITR), the 3' end of the flip ITR and the
5' end of the flip ITR in an expression vector. As a non-limiting
example, the modulatory polynucleotide may be located within 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides
downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR)
in an expression vector. As a non-limiting example, the modulatory
polynucleotide may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30 or more than 30 nucleotides upstream from the 5' or 3'
end of an ITR (e.g., Flip or Flop ITR) in an expression vector. As
another non-limiting example, the modulatory polynucleotide may be
located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20,
5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25,
20-30 or 25-30 nucleotides downstream from the 5' or 3' end of an
ITR (e.g., Flip or Flop ITR) in an expression vector. As another
non-limiting example, the modulatory polynucleotide may be located
within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25,
5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30
or 25-30 upstream from the 5' or 3' end of an ITR (e.g., Flip or
Flop ITR) in an expression vector. As a non-limiting example, the
modulatory polynucleotide may be located within the first 1%, 2%,
3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of
the nucleotides upstream from the 5' or 3' end of an ITR (e.g.,
Flip or Flop ITR) in an expression vector. As another non-limiting
example, the modulatory polynucleotide may be located with the
first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%,
10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25.degree. A
downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR)
in an expression vector.
[0031] In addition to the modules or sequence motifs, modulatory
polynucleotides comprise at least one of or both a passenger and
guide strand. The passenger and guide strand may be positioned or
located on the 5' arm or 3' arm of a stem loop structure of the
modulatory polynucleotide.
[0032] In one embodiment, the 3' stem arm of the modulatory
polynucleotides may have 11 nucleotides downstream of the 3' end of
the guide strand which have complementarity to the 11 of the 13
nucleotides upstream of the 5' end of the passenger strand in the
5' stem arm.
[0033] In one embodiment, the modulatory polynucleotides may have a
cysteine which is 6 nucleotides downstream of the 3' end of the 3'
stem arm of the modulatory polynucleotide.
[0034] In one embodiment, the modulatory polynucleotides comprise a
miRNA seed match for the guide strand. In another embodiment, the
modulatory polynucleotides comprise a miRNA seed match for the
passenger strand. In yet another embodiment, the modulatory
polynucleotides do no comprise a seed match for the guide or
passenger strand.
[0035] In one embodiment, the modulatory polynucleotides may have
almost no significant full-length off targets for the guide strand.
In another embodiment, the modulatory polynucleotides may have
almost no significant full-length off targets for the passenger
strand. In yet another embodiment, the modulatory polynucleotides
may have almost no significant full-length off targets for the
guide strand or the passenger strand.
[0036] In one embodiment, the modulatory polynucleotides may have
high activity in vitro. In another embodiment, the modulatory
polynucleotides may have low activity in vitro. In yet another
embodiment, the modulatory polynucleotides may have high guide
strand activity and low passenger strand activity in vitro.
[0037] In one embodiment, the modulatory polynucleotides have a
high guide strand activity and low passenger strand activity in
vitro. The target knock-down (KD) by the guide strand may be at
least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5% or 100%.
The target knock-down by the guide strand may be 60-65%, 60-70%,
60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 60-99%, 60-99.5%, 60-100%,
65-70%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 65-99%, 65-99.5%,
65-100%, 70-75%, 70-80%, 70-85%, 70-90%, 70-95%, 70-99%, 70-99.5%,
70-100%, 75-80%, 75-85%, 75-90%, 75-95%, 75-99%, 75-99.5%, 75-100%,
80-85%, 80-90%, 80-95%, 80-99%, 80-99.5%, 80-100%, 85-90%, 85-95%,
85-99%, 85-99.5%, 85-100%, 90-95%, 90-99%, 90-99.5%, 90-100%,
95-99%, 95-99.5%, 95-100%, 99-99.5%, 99-100% or 99.5-100%. As a
non-limiting example, the target knock-down (KD) by the guide
strand is greater than 70%.
[0038] In one embodiment, the IC50 of the passenger strand for the
nearest off target is greater than 100 multiplied by the IC50 of
the guide strand for the target. As a non-limiting example, if the
IC50 of the passenger strand for the nearest off target is greater
than 100 multiplied by the IC50 of the guide strand for the target
then the modulatory polynucleotide is said to have high guide
strand activity and a low passenger strand activity in vitro.
[0039] In one embodiment, the 5' processing of the guide strand has
a correct start (n) at the 5' end at least 75%, 80%, 85%, 90%, 95%,
99% or 100% of the time in vitro or in vivo. As a non-limiting
example, the 5' processing of the guide strand is precise and has a
correct start (n) at the 5' end at least 99% of the time in vitro.
As a non-limiting example, the 5' processing of the guide strand is
precise and has a correct start (n) at the 5' end at least 99% of
the time in vivo.
[0040] In one embodiment, the guide-to-passenger (G:P) strand ratio
is 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1;1, 2:10, 2:9,
2:8, 2:7, 2:6, 2:5, 2:4, 2:3, 2:2, 2:1, 3:10, 3:9, 3:8, 3:7, 3:6,
3:5, 3:4, 3:3, 3:2, 3:1, 4:10, 4:9, 4:8, 4:7, 4:6, 4:5, 4:4, 4:3,
4:2, 4:1, 5:10, 5:9, 5:8, 5:7, 5:6, 5:5, 5:4, 5:3, 5:2, 5:1, 6:10,
6:9, 6:8, 6:7, 6:6, 6:5, 6:4, 6:3, 6:2, 6:1, 7:10, 7:9, 7:8, 7:7,
7:6, 7:5, 7:4, 7:3, 7:2, 7:1, 8:10, 8:9, 8:8, 8:7, 8:6, 8:5, 8:4,
8:3, 8:2, 8:1, 9:10, 9:9, 9:8, 9:7, 9:6, 9:5, 9:4, 9:3, 9:2, 9:1,
10:10, 10:9, 10:8, 10:7, 10:6, 10:5, 10:4, 10:3, 10:2, 10:1, 1:99,
5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55,
50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10,
95:5, or 99:1 in vitro or in vivo.
[0041] The guide to passenger ratio refers to the ratio of the
guide strands to the passenger strands after the excision of the
guide strand. For example, a 80:20 guide to passenger ratio would
have 8 guide strands to every 2 passenger strands clipped out of
the precursor. As a non-limiting example, the guide-to-passenger
strand ratio is 8:2 in vitro. As a non-limiting example, the
guide-to-passenger strand ratio is 8:2 in vivo. As a non-limiting
example, the guide-to-passenger strand ratio is 9:1 in vitro. As a
non-limiting example, the guide-to-passenger strand ratio is 9:1 in
vivo.
[0042] In one embodiment, the guide to passenger (G:P) (also
referred to as the antisense to sense) strand ratio expressed is
greater than 1.
[0043] In one embodiment, the guide to passenger (G:P) (also
referred to as the antisense to sense) strand ratio expressed is
greater than 2.
[0044] In one embodiment, the guide to passenger (G:P) (also
referred to as the antisense to sense) strand ratio expressed is
greater than 5.
[0045] In one embodiment, the guide to passenger (G:P) (also
referred to as the antisense to sense) strand ratio expressed is
greater than 10.
[0046] In one embodiment, the guide to passenger (G:P) (also
referred to as the antisense to sense) strand ratio expressed is
greater than 20.
[0047] In one embodiment, the guide to passenger (G:P) (also
referred to as the antisense to sense) strand ratio expressed is
greater than 50.
[0048] In one embodiment, the guide to passenger (G:P) (also
referred to as the antisense to sense) strand ratio expressed is at
least 3:1.
[0049] In one embodiment, the guide to passenger (G:P) (also
referred to as the antisense to sense) strand ratio expressed is at
least 5:1.
[0050] In one embodiment, the guide to passenger (G:P) (also
referred to as the antisense to sense) strand ratio expressed is at
least 10:1.
[0051] In one embodiment, the guide to passenger (G:P) (also
referred to as the antisense to sense) strand ratio expressed is at
least 20:1.
[0052] In one embodiment, the guide to passenger (G:P) (also
referred to as the antisense to sense) strand ratio expressed is at
least 50:1.
[0053] In one embodiment, the passenger to guide (P:G) (also
referred to as the sense to antisense) strand ratio expressed is
1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1;1, 2:10, 2:9, 2:8,
2:7, 2:6, 2:5, 2:4, 2:3, 2:2, 2:1, 3:10, 3:9, 3:8, 3:7, 3:6, 3:5,
3:4, 3:3, 3:2, 3:1, 4:10, 4:9, 4:8, 4:7, 4:6, 4:5, 4:4, 4:3, 4:2,
4:1, 5:10, 5:9, 5:8, 5:7, 5:6, 5:5, 5:4, 5:3, 5:2, 5:1, 6:10, 6:9,
6:8, 6:7, 6:6, 6:5, 6:4, 6:3, 6:2, 6:1, 7:10, 7:9, 7:8, 7:7, 7:6,
7:5, 7:4, 7:3, 7:2, 7:1, 8:10, 8:9, 8:8, 8:7, 8:6, 8:5, 8:4, 8:3,
8:2, 8:1, 9:10, 9:9, 9:8, 9:7, 9:6, 9:5, 9:4, 9:3, 9:2, 9:1, 10:10,
10:9, 10:8, 10:7, 10:6, 10:5, 10:4, 10:3, 10:2, 10:1, 1:99, 5:95,
10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55, 50:50,
55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10, 95:5, or
99:1 in vitro or in vivo. The passenger to guide ratio refers to
the ratio of the passenger strands to the guide strands after the
excision of the guide strand. For example, a 80:20 passenger to
guide ratio would have 8 passenger strands to every 2 guide strands
clipped out of the precursor. As a non-limiting example, the
passenger-to-guide strand ratio is 80:20 in vitro. As a
non-limiting example, the passenger-to-guide strand ratio is 80:20
in vivo. As a non-limiting example, the passenger-to-guide strand
ratio is 8:2 in vitro. As a non-limiting example, the
passenger-to-guide strand ratio is 8:2 in vivo. As a non-limiting
example, the passenger-to-guide strand ratio is 9:1 in vitro. As a
non-limiting example, the passenger-to-guide strand ratio is 9:1 in
vivo.
[0054] In one embodiment, the passenger to guide (P:G) (also
referred to as the sense to antisense) strand ratio expressed is
greater than 1.
[0055] In one embodiment, the passenger to guide (P:G) (also
referred to as the sense to antisense) strand ratio expressed is
greater than 2.
[0056] In one embodiment, the passenger to guide (P:G) (also
referred to as the sense to antisense) strand ratio expressed is
greater than 5.
[0057] In one embodiment, the passenger to guide (P:G) (also
referred to as the sense to antisense) strand ratio expressed is
greater than 10.
[0058] In one embodiment, the passenger to guide (P:G) (also
referred to as the sense to antisense) strand ratio expressed is
greater than 20.
[0059] In one embodiment, the passenger to guide (P:G) (also
referred to as the sense to antisense) strand ratio expressed is
greater than 50.
[0060] In one embodiment, the passenger to guide (P:G) (also
referred to as the sense to antisense) strand ratio expressed is at
least 3:1.
[0061] In one embodiment, the passenger to guide (P:G) (also
referred to as the sense to antisense) strand ratio expressed is at
least 5:1.
[0062] In one embodiment, the passenger to guide (P:G) (also
referred to as the sense to antisense) strand ratio expressed is at
least 10:1.
[0063] In one embodiment, the passenger to guide (P:G) (also
referred to as the sense to antisense) strand ratio expressed is at
least 20:1.
[0064] In one embodiment, the passenger to guide (P:G) (also
referred to as the sense to antisense) strand ratio expressed is at
least 50:1.
[0065] In one embodiment, a passenger-guide strand duplex is
considered effective when the pri- or pre-microRNAs demonstrate,
but methods known in the art and described herein, greater than
2-fold guide to passenger strand ratio when processing is measured.
As a non-limiting examples, the pri- or pre-microRNAs demonstrate
great than 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold,
9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, or 2
to 5-fold, 2 to 10-fold, 2 to 15-fold, 3 to 5-fold, 3 to 10-fold, 3
to 15-fold, 4 to 5-fold, 4 to 10-fold, 4 to 15-fold, 5 to 10-fold,
5 to 15-fold, 6 to 10-fold, 6 to 15-fold, 7 to 10-fold, 7 to
15-fold, 8 to 10-fold, 8 to 15-fold, 9 to 10-fold, 9 to 15-fold, 10
to 15-fold, 11 to 15-fold, 12 to 15-fold, 13 to 15-fold, or 14 to
15-fold guide to passenger strand ratio when processing is
measured.
[0066] In one embodiment, the integrity of the vector genome is at
least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more than 99%
of the full length of the construct.
[0067] Target Nucleic Acids
[0068] The modulatory polynucleotides of the invention may be
targeted to any gene or nucleic acid construct including coding and
non-coding genes. Genes (DNA or mRNA) that encode human or primate
proteins may be targeted. Further, non-coding genes may also be
targeted, e.g., long noncoding RNAs (lncRNA).
[0069] Examples of such lncRNA molecules and RNAi constructs
designed to target such lncRNA any of which may be targeted by or
encoded in the modulatory polynucleotides, respectively are taught
in International Publication, WO2012/018881 A2, the contents of
which are incorporated herein by reference in their entirety.
[0070] In one embodiment, the modulatory polynucleotides of the
invention may target any gene known in the art. As a non-limiting
example, the gene may be SOD1.
[0071] In one embodiment, the modulatory polynucleotides of the
invention may target any gene known in the art. As a non-limiting
example, the gene may be Htt.
[0072] In one embodiment, the modulatory polynucleotide may be
designed to target any gene or mRNA in the human genome, e.g.,
genes associated with CNS disorders such as, but not limited to,
Huntington's Disease, ALS and the like.
Molecular Scaffolds
[0073] In some embodiments the starting molecular scaffold of the
modulatory polynucleotide is a known or wild type pri- or
pre-microRNA. In other embodiments the molecular scaffold of the
modulatory polynucleotides is designed ab initio. (See Cullen, Gene
Therapy (2006) 13, 503-508 work with miR30; Chung, et al., Nucleic
Acids Research, 2006, Vol. 34, No. 7 working with miR-155; the
contents of which are herein incorporated by reference in their
entirety).
[0074] As used herein a "molecular scaffold" is a framework or
starting molecule that forms the sequence or structural basis
against which to design or make a subsequent molecule.
[0075] The modulatory polynucleotides of the present invention may
be designed as a pri-miR as shown in FIG. 1. In the figure, a
pri-miR molecular scaffold is shown. The modulatory polynucleotide
which comprises the payload (e.g., siRNA, miRNA or other RNAi agent
described herein) comprises a leading 5' flanking sequence which
may be of any length and may be derived in whole or in part from
wild type microRNA sequence or be completely artificial.
[0076] In one embodiment, the molecular scaffold comprises at least
one 5' flanking region. As a non-limiting example, the 5' flanking
region may comprise a 5' flanking sequence which may be of any
length and may be derived in whole or in part from wild type
microRNA sequence or be a completely artificial sequence.
[0077] In one embodiment, the molecular scaffold comprises at least
one 3' flanking region. As a non-limiting example, the 3' flanking
region may comprise a 3' flanking sequence which may be of any
length and may be derived in whole or in part from wild type
microRNA sequence or be a completely artificial sequence.
[0078] In one embodiment, the molecular scaffold comprises at least
one loop motif region. As a non-limiting example, the loop motif
region may comprise a sequence which may be of any length.
[0079] In one embodiment, the molecular scaffold comprises a 5'
flanking region, a loop motif region and/or a 3' flanking
region.
[0080] In one embodiment, at least one payload (e.g., siRNA, miRNA
or other RNAi agent described herein) may be encoded by a
modulatory polynucleotide which may also comprise at least one
molecular scaffold. The molecular scaffold may comprise a 5'
flanking sequence and/or a 3' flanking sequence which may be of any
length and may be derived in whole or in part from wild type
microRNA sequence or be completely artificial. The 3' flanking
sequence may mirror the 5' flanking sequence in size and origin.
Either flanking sequence may be absent. The 3' flanking sequence
may optionally contain one or more CNNC motifs, where "N"
represents any nucleotide.
[0081] Forming the stem of the stem loop structure shown is a
minimum of the modulatory polynucleotide encoding at least one
payload sequence. In some embodiments the payload sequence
comprises at least one nucleic acid sequence which is in part
complementary or will hybridize to a target sequence. In some
embodiments the payload is a wild type microRNA. In some
embodiments the payload is an siRNA molecule or fragment of an
siRNA molecule. In some embodiments the payload is a substantially
double stranded construct which may comprise one or more microRNAs,
artificial microRNAs or siRNAs.
[0082] In some embodiments, the 5' arm of the stem loop of the
modulatory polynucleotide comprises a nucleic acid sequence
encoding a passenger strand. This strand is also known as the sense
strand in that it reflects an identity to a target. The passenger
strand may be between 15-30 nucleotides in length. It may be 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30
nucleotides in length.
[0083] In some embodiments, the 3' arm of the stem loop of the
modulatory polynucleotide comprises a nucleic acid sequence
encoding a guide strand. This strand is also known as the antisense
strand in that it reflects homology to a target. The guide strand
may be between 15-30 nucleotides in length, 21-25 nucleotides or 22
nucleotides in length. It may be 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. The guide
strand, in some instances, comprises a "G" nucleotide at the 5'
most end.
[0084] In some embodiments, where the guide strand comprises a
microRNA, or artificial microRNAs, the guide strand may comprise
one or more microRNA seed sequences. The seed sequence may be
located at positions 2-7, 2-8 or 2-9 of the guide strand relative
to the first 5' nucleotide of the guide strand or relative to a
dicer cleavage site.
[0085] In other embodiments, the passenger strand may reside on the
3' arm while the guide strand resides on the 5' arm of the stem of
the stem loop structure of the modulatory polynucleotide.
[0086] The passenger and guide strands may be completely
complementary across a substantial portion of their length. In
other embodiments the passenger strand and guide strand may be at
least 70, 80, 90, 95 or 99% complementary across independently at
least 50, 60, 70, 80, 85, 90, 95, or 99% of the length of the
strands.
[0087] Neither the identity of the passenger strand nor the
homology of the guide strand need be 100% complementary to the
target sequence.
[0088] In one embodiment, separating the passenger and guide strand
of the stem loop structure of the modulatory polynucleotide is a
loop sequence (also known as a loop motif, linker or linker motif).
The loop sequence may be of any length, between 4-30 nucleotides,
between 4-20 nucleotides, between 4-15 nucleotides, between 5-15
nucleotides, between 6-12 nucleotides, 6 nucleotides, 7,
nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11
nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, and/or
15 nucleotides.
[0089] In some embodiments the loop sequence comprises a nucleic
acid sequence encoding at least one UGUG motif. In some
embodiments, the nucleic acid sequence encoding the UGUG motif is
located at the 5' terminus of the loop sequence.
[0090] In one embodiment, spacer regions may be present in the
modulatory polynucleotide to separate one or more modules (e.g., 5'
flanking region, loop motif region, 3' flanking region, sense
sequences, antisense sequence) from one another. There may be one
or more such spacer regions present.
[0091] In one embodiment a spacer region of between 8-20, i.e., 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides may be
present between the passenger strand and a flanking region
sequence.
[0092] In one embodiment, the length of the spacer region is 13
nucleotides and is located between the 5' terminus of the passenger
strand and the 3' terminus of the flanking sequence. In one
embodiment a spacer is of sufficient length to form approximately
one helical turn of the sequence.
[0093] In one embodiment a spacer region of between 8-20, i.e., 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides may be
present between the guide strand and a flanking sequence.
[0094] In one embodiment, the spacer sequence is between 10-13,
i.e., 10, 11, 12 or 13 nucleotides and is located between the 3'
terminus of the guide strand and the 5' terminus of a flanking
sequence. In one embodiment a spacer is of sufficient length to
form approximately one helical turn of the sequence.
[0095] In one embodiment the modulatory polynucleotide comprises at
least one UG motif at the base of the stem whereby the G nucleotide
is paired and the U nucleotide is unpaired. In some embodiments the
unpaired U nucleotide is located in a flanking sequence.
[0096] In one embodiment, the modulatory polynucleotide comprises
in the 5' to 3' direction, a 5' flanking sequence, a 5' arm, a loop
motif, a 3' arm and a 3' flanking sequence. As a non-limiting
example, the 5' arm may comprise a passenger strand and the 3' arm
comprises the guide strand. In another non-limiting example, the 5'
arm comprises the guide strand and the 3' arm comprises the
passenger strand.
[0097] In one embodiment, the 5' arm, payload (e.g., passenger
and/or guide strand), loop motif and/or 3' arm sequence may be
altered (e.g., substituting 1 or more nucleotides, adding
nucleotides and/or deleting nucleotides). The alteration may cause
a beneficial change in the function of the construct (e.g.,
increase knock-down of the target sequence, reduce degradation of
the construct, reduce off target effect, increase efficiency of the
payload, and reduce degradation of the payload).
[0098] In one embodiment, the passenger strand sequence may be
altered (e.g., substituting 1 or more nucleotides, adding
nucleotides and/or deleting nucleotides). As a non-limiting
example, the passenger strand sequence may comprise 1 or 2
substitutions within the last 4 nucleotides of the sequence (e.g.,
C substituted for a G). As another non-limiting example, the
passenger strand sequence may comprise 1 or 2 substitutions within
the 7-15 nucleotides from the 5'end of the sequence (e.g., U
substituted for an A or C substituted for a G).
[0099] In one embodiment, the 3' arm strand sequence may be altered
(e.g., substituting 1 or more nucleotides, adding nucleotides
and/or deleting nucleotides). As a non-limiting example, the
sequence of the 3' arm may comprise 1 or 2 substitutions within the
first 4 nucleotides of the sequence (e.g., A substituted for a
U).
[0100] In one embodiment, the molecular scaffold of the payload
construct may comprise a 5' flanking region, a loop motif and a 3'
flanking region. Between the 5' flanking region and the loop motif
may be a first payload region and between the loop motif and the 3'
flanking region may be a second payload region. The first and
second payload regions may comprise siRNA, miRNA or other RNAi
agents, fragments or variants described herein. The first and
second payload regions may also comprise a sequence which is the
same, different or complementary to each other. As a non-limiting
example, the first payload region sequence may be a passenger
strand of a siRNA construct and the second payload region sequence
may be a guide strand of an siRNA construct. The passenger and
guide sequences may be substantially complementary to each other.
As another non-limiting example, the first payload region sequence
may be a guide strand of a siRNA construct and the second payload
region sequence may be a passenger strand of an siRNA construct.
The passenger and guide sequences may be substantially
complementary to each other.
[0101] In one embodiment, the molecular scaffold of the modulatory
polynucleotides described herein may comprise a 5' flanking region,
a loop motif region and a 3' flanking region. Non-limiting examples
of the sequences for the 5' flanking region, loop motif region and
the 3' flanking region which may be encoded by the modulatory
polynucleotide described herein are shown in Tables 1-3.
TABLE-US-00001 TABLE 1 5' Flanking Regions for Molecular Scaffold
5' 5' Flanking Flanking Region Region SEQ Name 5' Flanking Region
Sequence ID NO 5F1 UUUAUGCCUCAUCCUCUGAGUGCUGAA 1
GGCUUGCUGUAGGCUGUAUGCUG 5F2 GUGCUGGGCGGGGGGCGGCGGGCCCUC 2
CCGCAGAACACCAUGCGCUCUUCGGAA 5F3 GAAGCAAAGAAGGGGCAGAGGGAGCCC 3
GUGAGCUGAGUGGGCCAGGGACUGGGA GAAGGAGUGAGGAGGCAGGGCCGGCAU
GCCUCUGCUGCUGGCCAGA 5F4 GUGCUGGGCGGGGGGCGGCGGGCCCUC 4
CCGCAGAACACCAUGCGCUCUUCGGGA 5F5 GUGCUGGGCGGGGGGCGGCGGGCCCUC 5
CCGCAGAACACCAUGCGCUCCACGGAA 5F6 GGGCCCUCCCGCAGAACACCAUGCGCU 6
CCACGGAA 5F7 CUCCCGCAGAACACCAUGCGCUCCACG 7 GAA 5F8
GUGCUGGGCGGGGGGCGGCGGGCCCUC 8 CCGCAGAACACCAUGCGCUCCACGGAA G 5F9
GUGCUGGGCGGGGGGCGGCGGGCCCUC 9 CCGCAGAACACCAUGCGCUCCUCGGAA
TABLE-US-00002 TABLE 2 Loop Motif Regions for Molecular Scaffold
Loop Motif Loop Motif Loop Motif Region SEQ Region Name Region
Sequence ID NO L1 UGUGACCUGG 10 L2 UGUGAUUUGG 11 L3 UAUAAUUUGG 12
L4 CCUGACCCAGU 13 L5 GUCUGCACCUGUCACUAG 14 L6 GUGACCCAAG 15 L7
GUGGCCACUGAGAAG 16 L8 GUGACCCAAU 17 L9 GUGACCCAAC 18 L10
GUGGCCACUGAGAAA 19
TABLE-US-00003 TABLE 3 3'Flanking Regions for Molecular Scaffold 3'
3' Flanking Flanking Region Region SEQ Name 3' Flanking Region
Sequence ID NO 3F1 AGUGUAUGAUGCCUGUUACUAGCAUUC 20
ACAUGGAACAAAUUGCUGCCGUG 3F2 CUGAGGAGCGCCUUGACAGCAGCCAUG 21
GGAGGGCCGCCCCCUACCUCAGUGA 3F3 CUGUGGAGCGCCUUGACAGCAGCCAUG 22
GGAGGGCCGCCCCCUACCUCAGUGA 3F4 UGGCCGUGUAGUGCUACCCAGCGCUGG 23
CUGCCUCCUCAGCAUUGCAAUUCCUCU CCCAUCUGGGCACCAGUCAGCUACCCU
GGUGGGAAUCUGGGUAGCC 3F5 GGCCGUGUAGUGCUACCCAGCGCUGGC 24
UGCCUCCUCAGCAUUGCAAUUCCUCUC CCAUCUGGGCACCAGUCAGCUACCCUG
GUGGGAAUCUGGGUAGCC 3F6 UCCUGAGGAGCGCCUUGACAGCAGCCA 25
UGGGAGGGCCGCCCCCUACCUCAGUGA 3F7 CUGAGGAGCGCCUUGACAGCAGCCAUG 26
GGAGGGCC 3F8 CUGCGGAGCGCCUUGACAGCAGCCAUG 27
GGAGGGCCGCCCCCUACCUCAGUGA
[0102] Any of the regions described in Tables 1-3, where U is T,
may be used as modules in the molecular scaffolds described
herein.
[0103] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5' flanking
region listed in Table 1. As a non-limiting example, the 5'
flanking region may be 5F1, 5F2, 5F3, 5F4, 5F5, 5F6, 5F7, 5F8 or
5F9.
[0104] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 flanking
region.
[0105] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 flanking
region.
[0106] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 flanking
region.
[0107] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 flanking
region.
[0108] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 flanking
region.
[0109] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 flanking
region.
[0110] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 flanking
region.
[0111] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 flanking
region.
[0112] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 flanking
region.
[0113] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one one loop
motif region listed in Table 2. As a non-limiting example, the loop
motif region may be L1, L2, L3, L4, L5, L6, L7, L8, L9, or L10.
[0114] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one L1 loop motif
region.
[0115] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one L2 loop motif
region.
[0116] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one L3 loop motif
region.
[0117] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one L4 loop motif
region.
[0118] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one L5 loop motif
region.
[0119] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one L6 loop motif
region.
[0120] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one L7 loop motif
region.
[0121] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one L8 loop motif
region.
[0122] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one L9 loop motif
region.
[0123] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one L10 loop
motif region.
[0124] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 3' flanking
region listed in Table 3. As a non-limiting example, the molecular
scaffold may comprise the 3' flanking region 3F1, 3F2, 3F3, 3F4,
3F5, 3F6, 3F7 or 3F8.
[0125] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 3F1 flanking
region.
[0126] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 3F2 flanking
region.
[0127] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 3F3 flanking
region.
[0128] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 3F4 flanking
region.
[0129] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 3F5 flanking
region.
[0130] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 3F6 flanking
region.
[0131] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 3F7 flanking
region.
[0132] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 3F8 flanking
region.
[0133] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5' flanking
region and at least one loop motif region as described in Tables 1
and 2. As a non-limiting example, the 5' flanking region and the
loop motif region may be 5F1 and L1, 5F1 and L2, 5F1 and L3, 5F1
and L4, 5F1 and L5, 5F1 and L6, 5F1 and L7, 5F1 and L8, 5F1 and L9,
5F1 and L10, 5F1 and L11, 5F2 and L1, 5F2 and L2, 5F2 and L3, 5F2
and L4, 5F2 and L5, 5F2 and L6, 5F2 and L7, 5F2 and L8, 5F2 and L9,
5F2 and L10, 5F2 and L11, 5F3 and L1, 5F3 and L2, 5F3 and L3, 5F3
and L4, 5F3 and L5, 5F3 and L6, 5F3 and L7, 5F3 and L8, 5F3 and L9,
5F3 and L10, 5F3 and L11, 5F4 and L1, 5F4 and L2, 5F4 and L3, 5F4
and L4, 5F4 and L5, 5F4 and L6, 5F4 and L7, 5F4 and L8, 5F4 and L9,
5F4 and L10, 5F4 and L11, 5F5 and L1, 5F5 and L2, 5F5 and L3, 5F5
and L4, 5F5 and L5, 5F5 and L6, 5F5 and L7, 5F5 and L8, 5F5 and L9,
5F5 and L10, 5F5 and L11, 5F6 and L1, 5F6 and L2, 5F6 and L3, 5F6
and L4, 5F6 and L5, 5F6 and L6, 5F6 and L7, 5F6 and L8, 5F6 and L9,
5F6 and L10, 5F6 and L11, 5F7 and L1, 5F7 and L2, 5F7 and L3, 5F7
and L4, 5F7 and L5, 5F7 and L6, 5F7 and L7, 5F7 and L8, 5F7 and L9,
5F7 and L10, 5F7 and L11, 5F8 and L1, 5F8 and L2, 5F8 and L3, 5F8
and L4, 5F8 and L5, 5F8 and L6, 5F8 and L7, 5F8 and L8, 5F8 and L9,
5F8 and L10, 5F8 and L11, 5F9 and L1, 5F9 and L2, 5F9 and L3, 5F9
and L4, 5F9 and L5, 5F9 and L6, 5F9 and L7, 5F9 and L8, 5F9 and L9,
5F9 and L10, or 5F9 and L11.
[0134] In one embodiment, the molecular scaffold may comprise at
least one 3' flanking region and at least one loop motif region as
described in Tables 2 and 3. As a non-limiting example, the
molecular scaffold may comprise 3F1 and L1, 3F1 and L2, 3F1 and L3,
3F1 and L4, 3F1 and L5, 3F1 and L6, 3F1 and L7, 3F1 and L8, 3F1 and
L9, 3F1 and L10, 3F1 and L11, 3F2 and L1, 3F2 and L2, 3F2 and L3,
3F2 and L4, 3F2 and L5, 3F2 and L6, 3F2 and L7, 3F2 and L8, 3F2 and
L9, 3F2 and L10, 3F2 and L11, 3F3 and L1, 3F3 and L2, 3F3 and L3,
3F3 and L4, 3F3 and L5, 3F3 and L6, 3F3 and L7, 3F3 and L8, 3F3 and
L9, 3F3 and L10, 3F3 and L11, 3F4 and L1, 3F4 and L2, 3F4 and L3,
3F4 and L4, 3F4 and L5, 3F4 and L6, 3F4 and L7, 3F4 and L8, 3F4 and
L9, 3F4 and L10, 3F4 and L11, 3F5 and L1, 3F5 and L2, 3F5 and L3,
3F5 and L4, 3F5 and L5, 3F5 and L6, 3F5 and L7, 3F5 and L8, 3F5 and
L9, 3F5 and L10, 3F5 and L11, 3F6 and L1, 3F6 and L2, 3F6 and L3,
3F6 and L4, 3F6 and L5, 3F6 and L6, 3F6 and L7, 3F6 and L8, 3F6 and
L9, 3F6 and L10, 3F6 and L11, 3F7 and L1, 3F7 and L2, 3F7 and L3,
3F7 and L4, 3F7 and L5, 3F7 and L6, 3F7 and L7, 3F7 and L8, 3F7 and
L9, 3F7 and L10, 3F7 and L11, 3F8 and L1, 3F8 and L2, 3F8 and L3,
3F8 and L4, 3F8 and L5, 3F8 and L6, 3F8 and L7, 3F8 and L8, 3F8 and
L9, 3F8 and L10, or 3F8 and L11.
[0135] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 flanking
region and at least one nucleic acid sequence encoding at least one
L1 loop motif region.
[0136] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 flanking
region and at least one nucleic acid sequence encoding at least one
L2 loop motif region.
[0137] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 flanking
region and at least one nucleic acid sequence encoding at least one
L3 loop motif region.
[0138] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 flanking
region and at least one nucleic acid sequence encoding at least one
L4 loop motif region.
[0139] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 flanking
region and at least one nucleic acid sequence encoding at least one
L5 loop motif region.
[0140] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 flanking
region and at least one nucleic acid sequence encoding at least one
L6 loop motif region.
[0141] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 flanking
region and at least one nucleic acid sequence encoding at least one
L7 loop motif region.
[0142] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 flanking
region and at least one nucleic acid sequence encoding at least one
L8 loop motif region.
[0143] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 flanking
region and at least one nucleic acid sequence encoding at least one
L9 loop motif region.
[0144] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 flanking
region and at least one nucleic acid sequence encoding at least one
L10 loop motif region.
[0145] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 flanking
region and at least one nucleic acid sequence encoding at least one
L11 loop motif region.
[0146] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 flanking
region and at least one nucleic acid sequence encoding at least one
L1 loop motif region.
[0147] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 flanking
region and at least one nucleic acid sequence encoding at least one
L2 loop motif region.
[0148] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 flanking
region and at least one nucleic acid sequence encoding at least one
L3 loop motif region.
[0149] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 flanking
region and at least one nucleic acid sequence encoding at least one
L4 loop motif region.
[0150] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 flanking
region and at least one nucleic acid sequence encoding at least one
L5 loop motif region.
[0151] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 flanking
region and at least one nucleic acid sequence encoding at least one
L6 loop motif region.
[0152] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 flanking
region and at least one nucleic acid sequence encoding at least one
L7 loop motif region.
[0153] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 flanking
region and at least one nucleic acid sequence encoding at least one
L8 loop motif region.
[0154] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 flanking
region and at least one nucleic acid sequence encoding at least one
L9 loop motif region.
[0155] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 flanking
region and at least one nucleic acid sequence encoding at least one
L10 loop motif region.
[0156] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 flanking
region and at least one nucleic acid sequence encoding at least one
L11 loop motif region.
[0157] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 flanking
region and at least one nucleic acid sequence encoding at least one
L1 loop motif region.
[0158] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 flanking
region and at least one nucleic acid sequence encoding at least one
L2 loop motif region.
[0159] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 flanking
region and at least one nucleic acid sequence encoding at least one
L3 loop motif region.
[0160] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 flanking
region and at least one nucleic acid sequence encoding at least one
L4 loop motif region.
[0161] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 flanking
region and at least one nucleic acid sequence encoding at least one
L5 loop motif region.
[0162] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 flanking
region and at least one nucleic acid sequence encoding at least one
L6 loop motif region.
[0163] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 flanking
region and at least one nucleic acid sequence encoding at least one
L7 loop motif region.
[0164] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 flanking
region and at least one nucleic acid sequence encoding at least one
L8 loop motif region.
[0165] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 flanking
region and at least one nucleic acid sequence encoding at least one
L9 loop motif region.
[0166] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 flanking
region and at least one nucleic acid sequence encoding at least one
L10 loop motif region.
[0167] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 flanking
region and at least one nucleic acid sequence encoding at least one
L11 loop motif region.
[0168] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 flanking
region and at least one nucleic acid sequence encoding at least one
L1 loop motif region.
[0169] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 flanking
region and at least one nucleic acid sequence encoding at least one
L2 loop motif region.
[0170] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 flanking
region and at least one nucleic acid sequence encoding at least one
L3 loop motif region.
[0171] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 flanking
region and at least one nucleic acid sequence encoding at least one
L4 loop motif region.
[0172] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 flanking
region and at least one nucleic acid sequence encoding at least one
L5 loop motif region.
[0173] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 flanking
region and at least one nucleic acid sequence encoding at least one
L6 loop motif region.
[0174] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 flanking
region and at least one nucleic acid sequence encoding at least one
L7 loop motif region.
[0175] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 flanking
region and at least one nucleic acid sequence encoding at least one
L8 loop motif region.
[0176] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 flanking
region and at least one nucleic acid sequence encoding at least one
L9 loop motif region.
[0177] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 flanking
region and at least one nucleic acid sequence encoding at least one
L10 loop motif region.
[0178] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 flanking
region and at least one nucleic acid sequence encoding at least one
L11 loop motif region.
[0179] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 flanking
region and at least one nucleic acid sequence encoding at least one
L1 loop motif region.
[0180] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 flanking
region and at least one nucleic acid sequence encoding at least one
L2 loop motif region.
[0181] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 flanking
region and at least one nucleic acid sequence encoding at least one
L3 loop motif region.
[0182] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 flanking
region and at least one nucleic acid sequence encoding at least one
L4 loop motif region.
[0183] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 flanking
region and at least one nucleic acid sequence encoding at least one
L5 loop motif region.
[0184] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 flanking
region and at least one nucleic acid sequence encoding at least one
L6 loop motif region.
[0185] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 flanking
region and at least one nucleic acid sequence encoding at least one
L7 loop motif region.
[0186] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 flanking
region and at least one nucleic acid sequence encoding at least one
L8 loop motif region.
[0187] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 flanking
region and at least one nucleic acid sequence encoding at least one
L9 loop motif region.
[0188] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 flanking
region and at least one nucleic acid sequence encoding at least one
L10 loop motif region.
[0189] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 flanking
region and at least one nucleic acid sequence encoding at least one
L11 loop motif region.
[0190] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 flanking
region and at least one nucleic acid sequence encoding at least one
L1 loop motif region.
[0191] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 flanking
region and at least one nucleic acid sequence encoding at least one
L2 loop motif region.
[0192] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 flanking
region and at least one nucleic acid sequence encoding at least one
L3 loop motif region.
[0193] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 flanking
region and at least one nucleic acid sequence encoding at least one
L4 loop motif region.
[0194] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 flanking
region and at least one nucleic acid sequence encoding at least one
L5 loop motif region.
[0195] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 flanking
region and at least one nucleic acid sequence encoding at least one
L6 loop motif region.
[0196] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 flanking
region and at least one nucleic acid sequence encoding at least one
L7 loop motif region.
[0197] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 flanking
region and at least one nucleic acid sequence encoding at least one
L8 loop motif region.
[0198] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 flanking
region and at least one nucleic acid sequence encoding at least one
L9 loop motif region.
[0199] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 flanking
region and at least one nucleic acid sequence encoding at least one
L10 loop motif region.
[0200] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 flanking
region and at least one nucleic acid sequence encoding at least one
L11 loop motif region.
[0201] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 flanking
region and at least one nucleic acid sequence encoding at least one
L1 loop motif region.
[0202] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 flanking
region and at least one nucleic acid sequence encoding at least one
L2 loop motif region.
[0203] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 flanking
region and at least one nucleic acid sequence encoding at least one
L3 loop motif region.
[0204] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 flanking
region and at least one nucleic acid sequence encoding at least one
L4 loop motif region.
[0205] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 flanking
region and at least one nucleic acid sequence encoding at least one
L5 loop motif region.
[0206] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 flanking
region and at least one nucleic acid sequence encoding at least one
L6 loop motif region.
[0207] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 flanking
region and at least one nucleic acid sequence encoding at least one
L7 loop motif region.
[0208] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 flanking
region and at least one nucleic acid sequence encoding at least one
L8 loop motif region.
[0209] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 flanking
region and at least one nucleic acid sequence encoding at least one
L9 loop motif region.
[0210] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 flanking
region and at least one nucleic acid sequence encoding at least one
L10 loop motif region.
[0211] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 flanking
region and at least one nucleic acid sequence encoding at least one
L11 loop motif region.
[0212] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 flanking
region and at least one nucleic acid sequence encoding at least one
L1 loop motif region.
[0213] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 flanking
region and at least one nucleic acid sequence encoding at least one
L2 loop motif region.
[0214] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 flanking
region and at least one nucleic acid sequence encoding at least one
L3 loop motif region.
[0215] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 flanking
region and at least one nucleic acid sequence encoding at least one
L4 loop motif region.
[0216] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 flanking
region and at least one nucleic acid sequence encoding at least one
L5 loop motif region.
[0217] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 flanking
region and at least one nucleic acid sequence encoding at least one
L6 loop motif region.
[0218] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 flanking
region and at least one nucleic acid sequence encoding at least one
L7 loop motif region.
[0219] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 flanking
region and at least one nucleic acid sequence encoding at least one
L8 loop motif region.
[0220] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 flanking
region and at least one nucleic acid sequence encoding at least one
L9 loop motif region.
[0221] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 flanking
region and at least one nucleic acid sequence encoding at least one
L10 loop motif region.
[0222] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 flanking
region and at least one nucleic acid sequence encoding at least one
L11 loop motif region.
[0223] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 flanking
region and at least one nucleic acid sequence encoding at least one
L1 loop motif region.
[0224] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 flanking
region and at least one nucleic acid sequence encoding at least one
L2 loop motif region.
[0225] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 flanking
region and at least one nucleic acid sequence encoding at least one
L3 loop motif region.
[0226] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 flanking
region and at least one nucleic acid sequence encoding at least one
L4 loop motif region.
[0227] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 flanking
region and at least one nucleic acid sequence encoding at least one
L5 loop motif region.
[0228] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 flanking
region and at least one nucleic acid sequence encoding at least one
L6 loop motif region.
[0229] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 flanking
region and at least one nucleic acid sequence encoding at least one
L7 loop motif region.
[0230] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 flanking
region and at least one nucleic acid sequence encoding at least one
L8 loop motif region.
[0231] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 flanking
region and at least one nucleic acid sequence encoding at least one
L9 loop motif region.
[0232] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 flanking
region and at least one nucleic acid sequence encoding at least one
L10 loop motif region.
[0233] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 flanking
region and at least one nucleic acid sequence encoding at least one
L11 loop motif region.
[0234] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5' flanking
region and at least one nucleic acid sequence encoding at least 3'
flanking region as described in Tables 1 and 3. As a non-limiting
example, the molecular scaffold may comprise 5F1 and 3F1, 5F1 and
3F2, 5F1 and 3F3, 5F1 and 3F4, 5F1 and 3F5, 5F1 and 3F6, 5F1 and
3F7, 5F1 and 3F8, 5F2 and 3F1, 5F2 and 3F2, 5F2 and 3F3, 5F2 and
3F4, 5F2 and 3F5, 5F2 and 3F6, 5F2 and 3F7, 5F2 and 3F8, 5F3 and
3F1, 5F3 and 3F2, 5F3 and 3F3, 5F3 and 3F4, 5F3 and 3F5, 5F3 and
3F6, 5F3 and 3F7, 5F3 and 3F8, 5F4 and 3F1, 5F4 and 3F2, 5F4 and
3F3, 5F4 and 3F4, 5F4 and 3F5, 5F4 and 3F6, 5F4 and 3F7, 5F4 and
3F8, 5F5 and 3F1, 5F5 and 3F2, 5F5 and 3F3, 5F5 and 3F4, 5F5 and
3F5, 5F5 and 3F6, 5F5 and 3F7, 5F5 and 3F8, 5F6 and 3F1, 5F6 and
3F2, 5F6 and 3F3, 5F6 and 3F4, 5F6 and 3F5, 5F6 and 3F6, 5F6 and
3F7, 5F6 and 3F8, 5F7 and 3F1, 5F7 and 3F2, 5F7 and 3F3, 5F7 and
3F4, 5F7 and 3F5, 5F7 and 3F6, 5F7 and 3F7, 5F7 and 3F8, 5F8 and
3F1, 5F8 and 3F2, 5F8 and 3F3, 5F8 and 3F4, 5F8 and 3F5, 5F8 and
3F6, 5F8 and 3F7, 5F8 and 3F8, 5F9 and 3F1, 5F9 and 3F2, 5F9 and
3F3, 5F9 and 3F4, 5F9 and 3F5, 5F9 and 3F6, 5F9 and 3F7, or 5F9 and
3F8.
[0235] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F1 3' flanking region.
[0236] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F2 3' flanking region.
[0237] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F3 3' flanking region.
[0238] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F4 3' flanking region.
[0239] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F5 3' flanking region.
[0240] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F6 3' flanking region.
[0241] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F7 3' flanking region.
[0242] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F8 3' flanking region.
[0243] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F1 3' flanking region.
[0244] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F2 3' flanking region.
[0245] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F3 3' flanking region.
[0246] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F4 3' flanking region.
[0247] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F5 3' flanking region.
[0248] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F6 3' flanking region.
[0249] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F7 3' flanking region.
[0250] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F8 3' flanking region.
[0251] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F1 3' flanking region.
[0252] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F2 3' flanking region.
[0253] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F3 3' flanking region.
[0254] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F4 3' flanking region.
[0255] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F5 3' flanking region.
[0256] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F6 3' flanking region.
[0257] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F7 3' flanking region.
[0258] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F8 3' flanking region.
[0259] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F1 3' flanking region.
[0260] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F2 3' flanking region.
[0261] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F3 3' flanking region.
[0262] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F4 3' flanking region.
[0263] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F5 3' flanking region.
[0264] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F6 3' flanking region.
[0265] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F7 3' flanking region.
[0266] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F8 3' flanking region.
[0267] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F1 3' flanking region.
[0268] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F2 3' flanking region.
[0269] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F3 3' flanking region.
[0270] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F4 3' flanking region.
[0271] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F5 3' flanking region.
[0272] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F6 3' flanking region.
[0273] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one SFS 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F7 3' flanking region.
[0274] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one SFS 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F8 3' flanking region.
[0275] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F1 3' flanking region.
[0276] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F2 3' flanking region.
[0277] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F3 3' flanking region.
[0278] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F4 3' flanking region.
[0279] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F5 3' flanking region.
[0280] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F6 3' flanking region.
[0281] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F7 3' flanking region.
[0282] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F8 3' flanking region.
[0283] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F1 3' flanking region.
[0284] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F2 3' flanking region.
[0285] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F3 3' flanking region.
[0286] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F4 3' flanking region.
[0287] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F5 3' flanking region.
[0288] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F6 3' flanking region.
[0289] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F7 3' flanking region.
[0290] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F8 3' flanking region.
[0291] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F1 3' flanking region.
[0292] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F2 3' flanking region.
[0293] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F3 3' flanking region.
[0294] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F4 3' flanking region.
[0295] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F5 3' flanking region.
[0296] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F6 3' flanking region.
[0297] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F7 3' flanking region.
[0298] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F8 3' flanking region.
[0299] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F1 3' flanking region.
[0300] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F2 3' flanking region.
[0301] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F3 3' flanking region.
[0302] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F4 3' flanking region.
[0303] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F5 3' flanking region.
[0304] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F6 3' flanking region.
[0305] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F7 3' flanking region.
[0306] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region and at least one nucleic acid sequence encoding at
least one 3F8 3' flanking region.
[0307] In one embodiment, the molecular scaffold may comprise at
least one 5' flanking region, at least one loop motif region and at
least one 3' flanking region. As a non-limiting example, the
molecular scaffold may comprise 5F1, L1 and 3F1; 5F1, L1 and 3F2;
5F1, L1 and 3F3; 5F1, L1 and 3F4; 5F1, L1 and 3F5; 5F1, L1 and 3F6;
5F1, L1 and 3F7; 5F1, L1 and 3F8; 5F2, L1 and 3F1; 5F2, L1 and 3F2;
5F2, L1 and 3F3; 5F2, L1 and 3F4; 5F2, L1 and 3F5; 5F2, L1 and 3F6;
5F2, L1 and 3F7; 5F2, L1 and 3F8; 5F3, L1 and 3F1; 5F3, L1 and 3F2;
5F3, L1 and 3F3; 5F3, L1 and 3F4; 5F3, L1 and 3F5; 5F3, L1 and 3F6;
5F3, L1 and 3F7; 5F3, L1 and 3F8; 5F4, L1 and 3F1; 5F4, L1 and 3F2;
5F4, L1 and 3F3; 5F4, L1 and 3F4; 5F4, L1 and 3F5; 5F4, L1 and 3F6;
5F4, L1 and 3F7; 5F4, L1 and 3F8; 5F5, L1 and 3F1; 5F5, L1 and 3F2;
5F5, L1 and 3F3; 5F5, L1 and 3F4; 5F5, L1 and 3F5; 5F5, L1 and 3F6;
5F5, L1 and 3F7; 5F5, L1 and 3F8; 5F6, L1 and 3F1; 5F6, L1 and 3F2;
5F6, L1 and 3F3; 5F6, L1 and 3F4; 5F6, L1 and 3F5; 5F6, L1 and 3F6;
5F6, L1 and 3F7; 5F6, L1 and 3F8; 5F7, L1 and 3F1; 5F7, L1 and 3F2;
5F7, L1 and 3F3; 5F7, L1 and 3F4; 5F7, L1 and 3F5; 5F7, L1 and 3F6;
5F7, L1 and 3F7; 5F7, L1 and 3F8; 5F8, L1 and 3F1; 5F8, L1 and 3F2;
5F8, L1 and 3F3; 5F8, L1 and 3F4; 5F8, L1 and 3F5; 5F8, L1 and 3F6;
5F8, L1 and 3F7; 5F8, L1 and 3F8; 5F9, L1 and 3F1; 5F9, L1 and 3F2;
5F9, L1 and 3F3; 5F9, L1 and 3F4; 5F9, L1 and 3F5; 5F9, L1 and 3F6;
5F9, L1 and 3F7; 5F9, L1 and 3F8; 5F1, L2 and 3F1; 5F1, L2 and 3F2;
5F1, L2 and 3F3; 5F1, L2 and 3F4; 5F1, L2 and 3F5; 5F1, L2 and 3F6;
5F1, L2 and 3F7; 5F1, L2 and 3F8; 5F2, L2 and 3F1; 5F2, L2 and 3F2;
5F2, L2 and 3F3; 5F2, L2 and 3F4; 5F2, L2 and 3F5; 5F2, L2 and 3F6;
5F2, L2 and 3F7; 5F2, L2 and 3F8; 5F3, L2 and 3F1; 5F3, L2 and 3F2;
5F3, L2 and 3F3; 5F3, L2 and 3F4; 5F3, L2 and 3F5; 5F3, L2 and 3F6;
5F3, L2 and 3F7; 5F3, L2 and 3F8; 5F4, L2 and 3F1; 5F4, L2 and 3F2;
5F4, L2 and 3F3; 5F4, L2 and 3F4; 5F4, L2 and 3F5; 5F4, L2 and 3F6;
5F4, L2 and 3F7; 5F4, L2 and 3F8; 5F5, L2 and 3F1; 5F5, L2 and 3F2;
5F5, L2 and 3F3; 5F5, L2 and 3F4; 5F5, L2 and 3F5; 5F5, L2 and 3F6;
5F5, L2 and 3F7; 5F5, L2 and 3F8; 5F6, L2 and 3F1; 5F6, L2 and 3F2;
5F6, L2 and 3F3; 5F6, L2 and 3F4; 5F6, L2 and 3F5; 5F6, L2 and 3F6;
5F6, L2 and 3F7; 5F6, L2 and 3F8; 5F7, L2 and 3F1; 5F7, L2 and 3F2;
5F7, L2 and 3F3; 5F7, L2 and 3F4; 5F7, L2 and 3F5; 5F7, L2 and 3F6;
5F7, L2 and 3F7; 5F7, L2 and 3F8; 5F8, L2 and 3F1; 5F8, L2 and 3F2;
5F8, L2 and 3F3; 5F8, L2 and 3F4; 5F8, L2 and 3F5; 5F8, L2 and 3F6;
5F8, L2 and 3F7; 5F8, L2 and 3F8; 5F9, L2 and 3F1; 5F9, L2 and 3F2;
5F9, L2 and 3F3; 5F9, L2 and 3F4; 5F9, L2 and 3F5; 5F9, L2 and 3F6;
5F9, L2 and 3F7; 5F9, L2 and 3F8; 5F1, L3 and 3F1; 5F1, L3 and 3F2;
5F1, L3 and 3F3; 5F1, L3 and 3F4; 5F1, L3 and 3F5; 5F1, L3 and 3F6;
5F1, L3 and 3F7; 5F1, L3 and 3F8; 5F2, L3 and 3F1; 5F2, L3 and 3F2;
5F2, L3 and 3F3; 5F2, L3 and 3F4; 5F2, L3 and 3F5; 5F2, L3 and 3F6;
5F2, L3 and 3F7; 5F2, L3 and 3F8; 5F3, L3 and 3F1; 5F3, L3 and 3F2;
5F3, L3 and 3F3; 5F3, L3 and 3F4; 5F3, L3 and 3F5; 5F3, L3 and 3F6;
5F3, L3 and 3F7; 5F3, L3 and 3F8; 5F4, L3 and 3F1; 5F4, L3 and 3F2;
5F4, L3 and 3F3; 5F4, L3 and 3F4; 5F4, L3 and 3F5; 5F4, L3 and 3F6;
5F4, L3 and 3F7; 5F4, L3 and 3F8; 5F5, L3 and 3F1; 5F5, L3 and 3F2;
5F5, L3 and 3F3; 5F5, L3 and 3F4; 5F5, L3 and 3F5; 5F5, L3 and 3F6;
5F5, L3 and 3F7; 5F5, L3 and 3F8; 5F6, L3 and 3F1; 5F6, L3 and 3F2;
5F6, L3 and 3F3; 5F6, L3 and 3F4; 5F6, L3 and 3F5; 5F6, L3 and 3F6;
5F6, L3 and 3F7; 5F6, L3 and 3F8; 5F7, L3 and 3F1; 5F7, L3 and 3F2;
5F7, L3 and 3F3; 5F7, L3 and 3F4; 5F7, L3 and 3F5; 5F7, L3 and 3F6;
5F7, L3 and 3F7; 5F7, L3 and 3F8; 5F8, L3 and 3F1; 5F8, L3 and 3F2;
5F8, L3 and 3F3; 5F8, L3 and 3F4; 5F8, L3 and 3F5; 5F8, L3 and 3F6;
5F8, L3 and 3F7; 5F8, L3 and 3F8; 5F9, L3 and 3F1; 5F9, L3 and 3F2;
5F9, L3 and 3F3; 5F9, L3 and 3F4; 5F9, L3 and 3F5; 5F9, L3 and 3F6;
5F9, L3 and 3F7; 5F9, L3 and 3F8; 5F1, L4 and 3F1; 5F1, L4 and 3F2;
5F1, L4 and 3F3; 5F1, L4 and 3F4; 5F1, L4 and 3F5; 5F1, L4 and 3F6;
5F1, L4 and 3F7; 5F1, L4 and 3F8; 5F2, L4 and 3F1; 5F2, L4 and 3F2;
5F2, L4 and 3F3; 5F2, L4 and 3F4; 5F2, L4 and 3F5; 5F2, L4 and 3F6;
5F2, L4 and 3F7; 5F2, L4 and 3F8; 5F3, L4 and 3F1; 5F3, L4 and 3F2;
5F3, L4 and 3F3; 5F3, L4 and 3F4; 5F3, L4 and 3F5; 5F3, L4 and 3F6;
5F3, L4 and 3F7; 5F3, L4 and 3F8; 5F4, L4 and 3F1; 5F4, L4 and 3F2;
5F4, L4 and 3F3; 5F4, L4 and 3F4; 5F4, L4 and 3F5; 5F4, L4 and 3F6;
5F4, L4 and 3F7; 5F4, L4 and 3F8; 5F5, L4 and 3F1; 5F5, L4 and 3F2;
5F5, L4 and 3F3; 5F5, L4 and 3F4; 5F5, L4 and 3F5; 5F5, L4 and 3F6;
5F5, L4 and 3F7; 5F5, L4 and 3F8; 5F6, L4 and 3F1; 5F6, L4 and 3F2;
5F6, L4 and 3F3; 5F6, L4 and 3F4; 5F6, L4 and 3F5; 5F6, L4 and 3F6;
5F6, L4 and 3F7; 5F6, L4 and 3F8; 5F7, L4 and 3F1; 5F7, L4 and 3F2;
5F7, L4 and 3F3; 5F7, L4 and 3F4; 5F7, L4 and 3F5; 5F7, L4 and 3F6;
5F7, L4 and 3F7; 5F7, L4 and 3F8; 5F8, L4 and 3F1; 5F8, L4 and 3F2;
5F8, L4 and 3F3; 5F8, L4 and 3F4; 5F8, L4 and 3F5; 5F8, L4 and 3F6;
5F8, L4 and 3F7; 5F8, L4 and 3F8; 5F9, L4 and 3F1; 5F9, L4 and 3F2;
5F9, L4 and 3F3; 5F9, L4 and 3F4; 5F9, L4 and 3F5; 5F9, L4 and 3F6;
5F9, L4 and 3F7; 5F9, L4 and 3F8; 5F1, L5 and 3F1; 5F1, L5 and 3F2;
5F1, L5 and 3F3; 5F1, L5 and 3F4; 5F1, L5 and 3F5; 5F1, L5 and 3F6;
5F1, L5 and 3F7; 5F1, L5 and 3F8; 5F2, L5 and 3F1; 5F2, L5 and 3F2;
5F2, L5 and 3F3; 5F2, L5 and 3F4; 5F2, L5 and 3F5; 5F2, L5 and 3F6;
5F2, L5 and 3F7; 5F2, L5 and 3F8; 5F3, L5 and 3F1; 5F3, L5 and 3F2;
5F3, L5 and 3F3; 5F3, L5 and 3F4; 5F3, L5 and 3F5; 5F3, L5 and 3F6;
5F3, L5 and 3F7; 5F3, L5 and 3F8; 5F4, L5 and 3F1; 5F4, L5 and 3F2;
5F4, L5 and 3F3; 5F4, L5 and 3F4; 5F4, L5 and 3F5; 5F4, L5 and 3F6;
5F4, L5 and 3F7; 5F4, L5 and 3F8; 5F5, L5 and 3F1; 5F5, L5 and 3F2;
5F5, L5 and 3F3; 5F5, L5 and 3F4; 5F5, L5 and 3F5; 5F5, L5 and 3F6;
5F5, L5 and 3F7; 5F5, L5 and 3F8; 5F6, L5 and 3F1; 5F6, L5 and 3F2;
5F6, L5 and 3F3; 5F6, L5 and 3F4; 5F6, L5 and 3F5; 5F6, L5 and 3F6;
5F6, L5 and 3F7; 5F6, L5 and 3F8; 5F7, L5 and 3F1; 5F7, L5 and 3F2;
5F7, L5 and 3F3; 5F7, L5 and 3F4; 5F7, L5 and 3F5; 5F7, L5 and 3F6;
5F7, L5 and 3F7; 5F7, L5 and 3F8; 5F8, L5 and 3F1; 5F8, L5 and 3F2;
5F8, L5 and 3F3; 5F8, L5 and 3F4; 5F8, L5 and 3F5; 5F8, L5 and 3F6;
5F8, L5 and 3F7; 5F8, L5 and 3F8; 5F9, L5 and 3F1; 5F9, L5 and 3F2;
5F9, L5 and 3F3; 5F9, L5 and 3F4; 5F9, L5 and 3F5; 5F9, L5 and 3F6;
5F9, L5 and 3F7; or 5F9, L5 and 3F8.
[0308] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0309] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0310] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0311] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0312] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0313] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0314] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0315] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0316] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0317] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0318] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0319] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0320] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0321] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0322] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0323] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0324] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0325] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0326] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0327] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0328] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0329] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0330] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0331] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0332] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0333] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0334] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0335] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0336] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0337] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0338] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0339] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0340] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one SFS 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0341] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0342] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0343] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0344] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0345] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0346] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0347] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0348] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0349] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0350] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0351] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0352] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0353] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0354] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0355] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0356] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0357] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0358] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0359] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0360] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0361] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0362] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0363] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0364] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0365] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0366] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0367] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0368] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0369] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0370] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0371] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0372] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0373] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0374] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0375] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0376] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0377] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0378] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0379] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L1 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0380] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0381] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0382] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0383] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0384] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0385] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0386] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0387] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0388] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0389] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0390] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0391] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0392] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0393] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0394] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0395] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0396] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0397] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0398] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0399] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0400] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0401] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0402] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0403] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0404] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0405] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0406] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0407] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0408] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0409] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0410] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0411] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0412] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0413] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one SFS 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0414] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0415] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0416] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0417] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0418] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0419] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0420] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0421] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0422] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0423] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0424] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0425] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0426] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0427] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0428] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0429] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0430] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0431] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0432] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0433] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0434] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0435] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0436] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0437] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0438] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0439] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0440] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0441] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0442] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0443] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0444] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0445] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0446] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0447] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0448] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0449] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0450] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0451] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L2 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0452] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0453] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0454] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0455] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0456] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0457] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0458] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0459] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0460] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0461] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0462] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0463] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0464] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0465] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0466] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0467] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0468] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0469] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0470] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0471] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0472] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0473] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0474] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0475] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0476] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0477] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0478] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0479] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0480] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0481] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0482] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0483] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0484] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0485] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0486] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one SFS 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0487] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one SFS 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0488] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0489] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0490] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0491] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0492] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0493] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0494] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0495] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0496] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0497] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0498] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0499] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0500] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0501] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0502] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0503] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0504] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0505] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0506] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0507] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0508] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0509] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0510] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0511] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0512] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0513] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0514] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0515] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0516] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0517] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0518] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0519] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0520] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0521] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0522] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0523] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L3 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0524] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0525] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0526] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0527] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0528] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0529] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0530] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0531] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0532] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0533] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0534] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0535] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0536] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0537] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0538] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0539] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0540] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0541] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0542] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0543] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0544] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0545] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0546] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0547] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0548] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0549] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0550] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0551] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0552] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0553] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0554] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0555] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0556] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0557] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0558] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0559] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0560] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one SFS 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0561] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0562] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0563] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0564] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0565] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0566] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0567] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0568] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0569] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0570] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0571] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0572] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0573] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0574] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0575] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0576] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0577] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0578] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0579] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0580] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0581] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0582] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0583] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0584] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0585] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0586] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0587] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0588] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0589] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0590] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0591] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0592] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0593] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0594] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0595] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L4 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0596] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0597] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0598] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0599] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0600] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0601] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0602] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0603] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F1 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0604] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0605] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0606] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0607] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0608] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0609] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0610] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0611] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F2 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0612] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0613] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0614] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0615] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0616] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0617] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0618] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0619] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F3 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0620] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0621] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0622] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0623] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0624] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0625] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0626] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0627] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F4 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0628] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one LS loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0629] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0630] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0631] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0632] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0633] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one SFS 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0634] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one SFS 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0635] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F5 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0636] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0637] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0638] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0639] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0640] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0641] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0642] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0643] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F6 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0644] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0645] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0646] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0647] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0648] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0649] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0650] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0651] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F7 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0652] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0653] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0654] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0655] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0656] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0657] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0658] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0659] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F8 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0660] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F1 3' flanking region.
[0661] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F2 3' flanking region.
[0662] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F3 3' flanking region.
[0663] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F4 3' flanking region.
[0664] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F5 3' flanking region.
[0665] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F6 3' flanking region.
[0666] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F7 3' flanking region.
[0667] In one embodiment, the molecular scaffold may comprise at
least one nucleic acid sequence encoding at least one 5F9 5'
flanking region, at least one nucleic acid sequence encoding at
least one L5 loop motif region, and at least one nucleic acid
sequence encoding at least one 3F8 3' flanking region.
[0668] In one embodiment, the molecular scaffold may comprise one
or more linkers known in the art. The linkers may separate regions
or one molecular scaffold from another. As a non-limiting example,
the molecular scaffold may be polycistronic.
[0669] In one embodiment, the modulatory polynucleotide is designed
using at least one of the following properties: loop variant, seed
mismatch/bulge/wobble variant, stem mismatch, loop variant and
vassal stem mismatch variant, seed mismatch and basal stem mismatch
variant, stem mismatch and basal stem mismatch variant, seed wobble
and basal stem wobble variant, or a stem sequence variant.
[0670] In one embodiment, the molecular scaffold may be located
between the two ITRs of an expression vector. As a non-limiting
example, the molecular scaffold may be inserted into an expression
vector at at least one of six different locations as shown in FIG.
2. In FIG. 2, "ITR" is the inverted terminal repeat, "I" represents
intron, "P" is the polyA and "MP" is the modulatory
polynucleotide.
[0671] In one embodiment, the molecular scaffold may be located
downstream of a promoter such as, but not limited to, CMV, U6, H1,
CBA or a CBA promoter with a SV40 or a human betaGlobin intron.
Further, the molecular scaffold may also be located upstream of the
polyadenylation sequence. As a non-limiting example, the molecular
scaffold may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30 or more than 30 nucleotides downstream from the promoter
and/or upstream of the polyadenylation sequence. As another
non-limiting example, the molecular scaffold may be located within
1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30,
10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or
25-30 nucleotides downstream from the promoter and/or upstream of
the polyadenylation sequence. As a non-limiting example, the
molecular scaffold may be located within the first 1%, 2%, 3%, 4%,
5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the
nucleotides downstream from the promoter and/or upstream of the
polyadenylation sequence. As another non-limiting example, the
molecular scaffold may be located with the first 1-5%, 1-10%,
1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%,
10-25%, 15-20%, 15-25%, or 20-25% downstream from the promoter
and/or upstream of the polyadenylation sequence.
[0672] In one embodiment, the molecular scaffold may be located
upstream of the polyadenylation sequence. Further, the molecular
scaffold may be located downstream of a promoter such as, but not
limited to, CMV, U6, H1, CBA or a CBA promoter with a SV40 or a
human betaGlobin intron. As a non-limiting example, the molecular
scaffold may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30 or more than 30 nucleotides downstream from the promoter
and/or upstream of the polyadenylation sequence. As another
non-limiting example, the molecular scaffold may be located within
1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30,
10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or
25-30 nucleotides downstream from the promoter and/or upstream of
the polyadenylation sequence. As a non-limiting example, the
molecular scaffold may be located within the first 1%, 2%, 3%, 4%,
5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the
nucleotides downstream from the promoter and/or upstream of the
polyadenylation sequence. As another non-limiting example, the
molecular scaffold may be located with the first 1-5%, 1-10%,
1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%,
10-25%, 15-20%, 15-25%, or 20-25% downstream from the promoter
and/or upstream of the polyadenylation sequence.
[0673] In one embodiment, the molecular scaffold may be located in
a scAAV.
[0674] In one embodiment, the molecular scaffold may be located in
an ssAAV.
[0675] In one embodiment, the molecular scaffold may be located
near the 5' end of the flip ITR. In another embodiment, the
molecular scaffold may be located near the 3'end of the flip ITR.
In yet another embodiment, the molecular scaffold may be located
near the 5' end of the flop ITR. In yet another embodiment, the
molecular scaffold may be located near the 3' end of the flop ITR.
In one embodiment, the molecular scaffold may be located between
the 5' end of the flip ITR and the 3' end of the flop ITR. In one
embodiment, the molecular scaffold may be located between (e.g.,
half-way between the 5' end of the flip ITR and 3' end of the flop
ITR or the 3' end of the flop ITR and the 5' end of the flip ITR),
the 3' end of the flip ITR and the 5' end of the flip ITR. As a
non-limiting example, the molecular scaffold may be located within
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30
nucleotides downstream from the 5' or 3' end of an ITR (e.g., Flip
or Flop ITR). As a non-limiting example, the molecular scaffold may
be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or
more than 30 nucleotides upstream from the 5' or 3' end of an ITR
(e.g., Flip or Flop ITR). As another non-limiting example, the
molecular scaffold may be located within 1-5, 1-10, 1-15, 1-20,
1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25,
10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 nucleotides
downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop
ITR). As another non-limiting example, the molecular scaffold may
be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15,
5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30,
20-25, 20-30 or 25-30 upstream from the 5' or 3' end of an ITR
(e.g., Flip or Flop ITR). As a non-limiting example, the molecular
scaffold may be located within the first 1%, 2%, 3%, 4%, 5%, 6%,
7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the nucleotides
upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR).
As another non-limiting example, the molecular scaffold may be
located with the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%,
5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or
20-25% downstream from the 5' or 3' end of an ITR (e.g., Flip or
Flop ITR).
Vectors
[0676] In some embodiments, the siRNA molecules described herein
can be encoded by vectors such as plasmids or viral vectors. In one
embodiment, the siRNA molecules are encoded by viral vectors. Viral
vectors may be, but are not limited to, Herpesvirus (HSV) vectors,
retroviral vectors, adenoviral vectors, adeno-associated viral
vectors, lentiviral vectors, and the like. In some specific
embodiments, the viral vectors are AAV vectors.
Retroviral Vectors
[0677] In some embodiments, the siRNA duplex targeting SOD1 or HTT
may be encoded by a retroviral vector (See, e.g., U.S. Pat. Nos.
5,399,346; 5,124,263; 4,650,764 and 4,980,289; the content of each
of which are incorporated herein by reference in their
entirety).
Adenoviral Vectors
[0678] Adenoviruses are eukaryotic DNA viruses that can be modified
to efficiently deliver a nucleic acid to a variety of cell types in
vivo, and have been used extensively in gene therapy protocols,
including for targeting genes to neural cells. Various replication
defective adenovirus and minimum adenovirus vectors have been
described for nucleic acid therapeutics (See, e.g., PCT Patent
Publication Nos. WO199426914, WO 199502697, WO199428152,
WO199412649, WO199502697 and WO199622378; the content of each of
which is incorporated by reference in their entirety). Such
adenoviral vectors may also be used to deliver siRNA molecules of
the present invention to cells.
Adeno-Associated Viral (AAV) Vectors
[0679] An adeno-associated virus (AAV) is a dependent parvovirus
(like other parvoviruses) which is a single stranded non-enveloped
DNA virus having a genome of about 5000 nucleotides in length and
which contains two open reading frames encoding the proteins
responsible for replication (Rep) and the structural protein of the
capsid (Cap). The open reading frames are flanked by two Inverted
Terminal Repeat (ITR) sequences, which serve as the origin of
replication of the viral genome. Furthermore, the AAV genome
contains a packaging sequence, allowing packaging of the viral
genome into an AAV capsid. The AAV vector requires a co-helper
(e.g., adenovirus) to undergo productive infection in infected
cells. In the absence of such helper functions, the AAV virions
essentially enter host cells but do not integrate into the cells'
genome.
[0680] AAV vectors have been investigated for siRNA delivery
because of several unique features. Non-limiting examples of the
features include (i) the ability to infect both dividing and
non-dividing cells; (ii) a broad host range for infectivity,
including human cells; (iii) wild-type AAV has not been associated
with any disease and has not been shown to replicate in infected
cells; (iv) the lack of cell-mediated immune response against the
vector and (v) the non-integrative nature in a host chromosome
thereby reducing potential for long-term genetic alterations.
Moreover, infection with AAV vectors has minimal influence on
changing the pattern of cellular gene expression (Stilwell and
Samulski et al., Biotechniques, 2003, 34, 148).
[0681] Typically, AAV vectors for siRNA delivery may be recombinant
viral vectors which are replication defective as they lack
sequences encoding functional Rep and Cap proteins within the viral
genome. In some cases, the defective AAV vectors may lack most or
all coding sequences and essentially only contains one or two AAV
ITR sequences and a packaging sequence.
[0682] In one embodiment, the AAV vectors comprising a nucleic acid
sequence encoding the siRNA molecules of the present invention may
be introduced into mammalian cells.
[0683] AAV vectors may be modified to enhance the efficiency of
delivery. Such modified AAV vectors comprising the nucleic acid
sequence encoding the siRNA molecules of the present invention can
be packaged efficiently and can be used to successfully infect the
target cells at high frequency and with minimal toxicity.
[0684] In some embodiments, the AAV vector comprising a nucleic
acid sequence encoding the siRNA molecules of the present invention
may be a human serotype AAV vector. Such human AAV vector may be
derived from any known serotype, e.g., from any one of serotypes
AAV1-AAV11. As non-limiting examples, AAV vectors may be vectors
comprising an AAV1-derived genome in an AAV1-derived capsid;
vectors comprising an AAV2-derived genome in an AAV2-derived
capsid; vectors comprising an AAV4-derived genome in an AAV4
derived capsid; vectors comprising an AAV6-derived genome in an
AAV6 derived capsid or vectors comprising an AAV9-derived genome in
an AAV9 derived capsid.
[0685] In other embodiments, the AAV vector comprising a nucleic
acid sequence for encoding siRNA molecules of the present invention
may be a pseudotyped hybrid or chimeric AAV vector which contains
sequences and/or components originating from at least two different
AAV serotypes. Pseudotyped AAV vectors may be vectors comprising an
AAV genome derived from one AAV serotype and a capsid protein
derived at least in part from a different AAV serotype. As
non-limiting examples, such pseudotyped AAV vectors may be vectors
comprising an AAV2-derived genome in an AAV1-derived capsid; or
vectors comprising an AAV2-derived genome in an AAV6-derived
capsid; or vectors comprising an AAV2-derived genome in an
AAV4-derived capsid; or an AAV2-derived genome in an AAV9-derived
capsid. In like fashion, the present invention contemplates any
hybrid or chimeric AAV vector.
[0686] In other embodiments, AAV vectors comprising a nucleic acid
sequence encoding the siRNA molecules of the present invention may
be used to deliver siRNA molecules to the central nervous system
(e.g., U.S. Pat. No. 6,180,613; the contents of which is herein
incorporated by reference in its entirety).
[0687] In some aspects, the AAV vectors comprising a nucleic acid
sequence encoding the siRNA molecules of the present invention may
further comprise a modified capsid including peptides from
non-viral origin. In other aspects, the AAV vector may contain a
CNS specific chimeric capsid to facilitate the delivery of encoded
siRNA duplexes into the brain and the spinal cord. For example, an
alignment of cap nucleotide sequences from AAV variants exhibiting
CNS tropism may be constructed to identify variable region (VR)
sequence and structure.
[0688] In one embodiment, the AAV vector comprising a nucleic acid
sequence encoding the siRNA molecules of the present invention may
encode siRNA molecules which are polycistronic molecules. The siRNA
molecules may additionally comprise one or more linkers between
regions of the siRNA molecules.
Self-Complemtary and Single Strand Vectors
[0689] In one embodiment, the AAV vector used in the present
invention is a single strand vector (ssAAV).
[0690] In another embodiment, the AAV vectors may be
self-complementary AAV vectors (scAAVs). scAAV vectors contain both
DNA strands which anneal together to form double stranded DNA. By
skipping second strand synthesis, scAAVs allow for rapid expression
in the cell.
[0691] In one embodiment, the AAV vector used in the present
invention is a scAAV.
[0692] Methods for producing and/or modifying AAV vectors are
disclosed in the art such as pseudotyped AAV vectors (International
Patent Publication Nos. WO200028004; WO200123001; WO2004112727; WO
2005005610 and WO 2005072364, the content of each of which are
incorporated herein by reference in their entirety).
AAV Serotypes
[0693] AAV particles of the present invention may comprise or be
derived from any natural or recombinant AAV serotype. According to
the present invention, the AAV particles may utilize or be based on
a serotype selected from any of the following AAV1, AAV2, AAV2G9,
AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAVS, AAV6, AAV6.1,
AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13,
AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84,
AAV9.9, AAV10, AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12,
AAV42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b,
AAV42-6b, AAV42-8, AAV42-10, AAV42-11, AAV42-12, AAV42-13,
AAV42-15, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21,
AAV43-23, AAV43-25, AAV43-5, AAV44.1, AAV44.2, AAV44.5, AAV223.1,
AAV223.2, AAV223.4, AAV223.5, AAV223.6, AAV223.7, AAV1-7/rh.48,
AAV1-8/rh.49, AAV2-15/rh.62, AAV2-3/rh.61, AAV2-4/rh.50,
AAV2-5/rh.51, AAV3.1/hu.6, AAV3.1/hu.9, AAV3-9/rh.52,
AAV3-11/rh.53, AAV4-8/r11.64, AAV4-9/rh.54, AAV4-19/rh.55,
AAVS-3/rh.57, AAVS-22/rh.58, AAV7.3/hu.7, AAV16.8/hu.10,
AAV16.12/hu.11, AAV29.3/bb.1, AAV29.5/bb.2, AAV106.1/hu.37,
AAV114.3/hu.40, AAV127.2/hu.41, AAV127.5/hu.42, AAV128.3/hu.44,
AAV130.4/hu.48, AAV145.1/hu.53, AAV145.5/hu.54, AAV145.6/hu.55,
AAV161.10/hu.60, AAV161.6/hu.61, AAV33 .12/hu. 17, AAV33.4/hu.15,
AAV33.8/hu.16, AAV52/hu.19, AAV52.1/hu.20, AAV58.2/hu.25, AAVA3.3,
AAVA3.4, AAVA3.5, AAVA3.7, AAVC1, AAVC2, AAVCS, AAV-DJ, AAV-DJ8,
AAVF3, AAVFS, AAVH2, AAVrh.72, AAVhu.8, AAVrh.68, AAVrh.70,
AAVpi.1, AAVpi.3, AAVpi.2, AAVrh.60, AAVrh.44, AAVrh.65, AAVrh.55,
AAVrh.47, AAVrh.69, AAVrh.45, AAVrh.59, AAVhu.12, AAVH6, AAVLK03,
AAVH-1/hu.1, AAVH-5/hu.3, AAVLG-10/rh.40, AAVLG-4/rh.38,
AAVLG-9/hu.39, AAVN721-8/rh.43, AAVCh.5, AAVCh.5R1, AAVcy.2,
AAVcy.3, AAVcy.4, AAVcy.5, AAVCy.5R1, AAVCy.5R2, AAVCy.5R3,
AAVCy.5R4, AAVcy.6, AAVhu.1, AAVhu.2, AAVhu.3, AAVhu.4, AAVhu.5,
AAVhu.6, AAVhu.7, AAVhu.9, AAVhu.10, AAVhu.11, AAVhu.13, AAVhu.15,
AAVhu.16, AAVhu.17, AAVhu.18, AAVhu.20, AAVhu.21, AAVhu.22,
AAVhu.23.2, AAVhu.24, AAVhu.25, AAVhu.27, AAVhu.28, AAVhu.29,
AAVhu.29R, AAVhu.31, AAVhu.32, AAVhu.34, AAVhu.35, AAVhu.37,
AAVhu.39, AAVhu.40, AAVhu.41, AAVhu.42, AAVhu.43, AAVhu.44,
AAVhu.44R1, AAVhu.44R2, AAVhu.44R3, AAVhu.45, AAVhu.46, AAVhu.47,
AAVhu.48, AAVhu.48R1, AAVhu.48R2, AAVhu.48R3, AAVhu.49, AAVhu.51,
AAVhu.52, AAVhu.54, AAVhu.55, AAVhu.56, AAVhu.57, AAVhu.58,
AAVhu.60, AAVhu.61, AAVhu.63, AAVhu.64, AAVhu.66, AAVhu.67,
AAVhu.14/9, AAVhu.t 19, AAVrh.2, AAVrh.2R, AAVrh.8, AAVrh.8R,
AAVrh.10, AAVrh.12, AAVrh.13, AAVrh.13R, AAVrh.14, AAVrh.17,
AAVrh.18, AAVrh.19, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23,
AAVrh.24, AAVrh.25, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34,
AAVrh.35, AAVrh.36, AAVrh.37, AAVrh.37R2, AAVrh.38, AAVrh.39,
AAVrh.40, AAVrh.46, AAVrh.48, AAVrh.48.1, AAVrh.48.1.2, AAVrh.48.2,
AAVrh.49, AAVrh.51, AAVrh.52, AAVrh.53, AAVrh.54, AAVrh.56,
AAVrh.57, AAVrh.58, AAVrh.61, AAVrh.64, AAVrh.64R1, AAVrh.64R2,
AAVrh.67, AAVrh.73, AAVrh.74, AAVrh8R, AAVrh8R A586R mutant,
AAVrh8R R533A mutant, AAAV, BAAV, caprine AAV, bovine AAV,
AAVhE1.1, AAVhEr1.5, AAVhER1.14, AAVhEr1.8, AAVhEr1.16, AAVhEr1.18,
AAVhEr1.35, AAVhEr1.7, AAVhEr1.36, AAVhEr2.29, AAVhEr2.4,
AAVhEr2.16, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhER1.23,
AAVhEr3.1, AAV2.5T , AAV-PAEC, AAV-LK01, AAV-LK02, AAV-LK03,
AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09,
AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15,
AAV-LK16, AAV-LK17, AAV-LK18, AAV-LK19, AAV-PAEC2, AAV-PAEC4,
AAV-PAEC6, AAV-PAEC7, AAV-PAEC8, AAV-PAEC11, AAV-PAEC12,
AAV-2-pre-miRNA-101, AAV-8h, AAV-8b, AAV-h, AAV-b, AAV SM 10-2 ,
AAV Shuffle 100-1, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV
Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV Shuffle
100-2, AAV SM 10-1, AAV SM 10-8 , AAV SM 100-3, AAV SM 100-10,
BNP61 AAV, BNP62 AAV, BNP63 AAV, AAVrh.50, AAVrh.43, AAVrh.62,
AAVrh.48, AAVhu.19, AAVhu.11, AAVhu.53, AAV4-8/rh.64,
AAVLG-9/hu.39, AAV54.5/hu.23, AAV54.2/hu.22, AAV54.7/hu.24,
AAV54.1/hu.21, AAV54.4R/hu.27, AAV46.2/hu.28, AAV46.6/hu.29,
AAV128.1/hu.43, true type AAV (ttAAV), UPENN AAV 10, Japanese AAV
10 serotypes, AAV CBr-7.1, AAV CBr-7.10, AAV CBr-7.2, AAV CBr-7.3,
AAV CBr-7.4, AAV CBr-7.5, AAV CBr-7.7, AAV CBr-7.8, AAV CBr-B7.3,
AAV CBr-B7.4, AAV CBr-E1, AAV CBr-E2, AAV CBr-E3, AAV CBr-E4, AAV
CBr-E5, AAV CBr-e5, AAV CBr-E6, AAV CBr-E7, AAV CBr-E8, AAV CHt-1,
AAV CHt-2, AAV CHt-3, AAV CHt-6.1, AAV CHt-6.10, AAV CHt-6.5, AAV
CHt-6.6, AAV CHt-6.7, AAV CHt-6.8, AAV CHt-P1, AAV CHt-P2, AAV
CHt-P5, AAV CHt-P6, AAV CHt-P8, AAV CHt-P9, AAV CKd-1, AAV CKd-10,
AAV CKd-2, AAV CKd-3, AAV CKd-4, AAV CKd-6, AAV CKd-7, AAV CKd-8,
AAV CKd-B1, AAV CKd-B2, AAV CKd-B3, AAV CKd-B4, AAV CKd-B5, AAV
CKd-B6, AAV CKd-B7, AAV CKd-B8, AAV CKd-H1, AAV CKd-H2, AAV CKd-H3,
AAV CKd-H4, AAV CKd-H5, AAV CKd-H6, AAV CKd-N3, AAV CKd-N4, AAV
CKd-N9, AAV CLg-F1, AAV CLg-F2, AAV CLg-F3, AAV CLg-F4, AAV CLg-F5,
AAV CLg-F6, AAV CLg-F7, AAV CLg-F8, AAV CLv-1, AAV CLv1-1, AAV
Clv1-10, AAV CLv1-2, AAV CLv-12, AAV CLv1-3, AAV CLv-13, AAV
CLv1-4, AAV Clv1-7, AAV Clv1-8, AAV Clv1-9, AAV CLv-2, AAV CLv-3,
AAV CLv-4, AAV CLv-6, AAV CLv-8, AAV CLv-D1, AAV CLv-D2, AAV
CLv-D3, AAV CLv-D4, AAV CLv-D5, AAV CLv-D6, AAV CLv-D7, AAV CLv-D8,
AAV CLv-E1, AAV CLv-K1, AAV CLv-K3, AAV CLv-K6, AAV CLv-L4, AAV
CLv-L5, AAV CLv-L6, AAV CLv-M1, AAV CLv-M11, AAV CLv-M2, AAV
CLv-M5, AAV CLv-M6, AAV CLv-M7, AAV CLv-M8, AAV CLv-M9, AAV CLv-R1,
AAV CLv-R2, AAV CLv-R3, AAV CLv-R4, AAV CLv-R5, AAV CLv-R6, AAV
CLv-R7, AAV CLv-R8, AAV CLv-R9, AAV CSp-1, AAV CSp-10, AAV CSp-11,
AAV CSp-2, AAV CSp-3, AAV CSp-4, AAV CSp-6, AAV CSp-7, AAV CSp-8,
AAV CSp-8.10, AAV CSp-8.2, AAV CSp-8.4, AAV CSp-8.5, AAV CSp-8.6,
AAV CSp-8.7, AAV CSp-8.8, AAV CSp-8.9, AAV CSp-9, AAV.hu.48R3,
AAV.VR-355, AAV3B, AAV4, AAVS, AAVF1/HSC1, AAVF11/HSC11,
AAVF12/HSC12, AAVF13/HSC13, AAVF14/HSC14, AAVF15/HSC15,
AAVF16/HSC16, AAVF17/HSC17, AAVF2/HSC2, AAVF3/HSC3, AAVF4/HSC4,
AAVFS/HSC5, AAVF6/HSC6, AAVF7/HSC7, AAVF8/HSC8, AAVF9/HSC9,
AAV-PHP.B (PHP.B), AAV-PHP.A (PHP.A), G2B-26, G2B-13, TH1.1-32
and/or TH1.1-35, and variants thereof. As a non-limiting example,
the capsid of the recombinant AAV virus is AAV2. As a non-limiting
example, the capsid of the recombinant AAV virus is AAVrh10. As a
non-limiting example, the capsid of the recombinant AAV virus is
AAV9(hul4). As a non-limiting example, the capsid of the
recombinant AAV virus is AAV-DJ. As a non-limiting example, the
capsid of the recombinant AAV virus is AAV9.47. As a non-limiting
example, the capsid of the recombinant AAV virus is AAV-DJ8. As a
non-limiting example, the capsid of the recombinant AAV virus is
AAV-PHP.B. As a non-limiting example, the capsid of the recombinant
AAV virus is AAV-PHP.A.
[0694] In some embodiments, the AAV serotype may be, or have, a
sequence as described in United States Publication No.
US20030138772, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, AAV1 (SEQ
ID NO: 6 and 64 of US20030138772), AAV2 (SEQ ID NO: 7 and 70 of
US20030138772), AAV3 (SEQ ID NO: 8 and 71 of US20030138772), AAV4
(SEQ ID NO: 63 of US20030138772), AAV5 (SEQ ID NO: 114 of
US20030138772), AAV6 (SEQ ID NO: 65 of US20030138772), AAV7 (SEQ ID
NO: 1-3 of US20030138772), AAV8 (SEQ ID NO: 4 and 95 of
US20030138772), AAV9 (SEQ ID NO: 5 and 100 of US20030138772), AAV10
(SEQ ID NO: 117 of US20030138772), AAV11 (SEQ ID NO: 118 of
US20030138772), AAV12 (SEQ ID NO: 119 of US20030138772), AAVrh10
(amino acids 1 to 738 of SEQ ID NO: 81 of US20030138772), AAV16.3
(US20030138772 SEQ ID NO: 10), AAV29.3/bb.1 (US20030138772 SEQ ID
NO: 11), AAV29.4 (US20030138772 SEQ ID NO: 12), AAV29.5/bb.2
(US20030138772 SEQ ID NO: 13), AAV1.3 (US20030138772 SEQ ID NO:
14), AAV13.3 (US20030138772 SEQ ID NO: 15), AAV24.1 (US20030138772
SEQ ID NO: 16), AAV27.3 (US20030138772 SEQ ID NO: 17), AAV7.2
(US20030138772 SEQ ID NO: 18), AAVC1 (US20030138772 SEQ ID NO: 19),
AAVC3 (US20030138772 SEQ ID NO: 20), AAVCS (US20030138772 SEQ ID
NO: 21), AAVF1 (US20030138772 SEQ ID NO: 22), AAVF3 (US20030138772
SEQ ID NO: 23), AAVFS (US20030138772 SEQ ID NO: 24), AAVH6
(US20030138772 SEQ ID NO: 25), AAVH2 (US20030138772 SEQ ID NO: 26),
AAV42-8 (US20030138772 SEQ ID NO: 27), AAV42-15 (US20030138772 SEQ
ID NO: 28), AAV42-5b (US20030138772 SEQ ID NO: 29), AAV42-lb
(US20030138772 SEQ ID NO: 30), AAV42-13 (US20030138772 SEQ ID NO:
31), AAV42-3a (US20030138772 SEQ ID NO: 32), AAV42-4 (US20030138772
SEQ ID NO: 33), AAV42-5a (US20030138772 SEQ ID NO: 34), AAV42-10
(US20030138772 SEQ ID NO: 35), AAV42-3b (US20030138772 SEQ ID NO:
36), AAV42-11 (US20030138772 SEQ ID NO: 37), AAV42-6b
(US20030138772 SEQ ID NO: 38), AAV43-1 (US20030138772 SEQ ID NO:
39), AAV43-5 (US20030138772 SEQ ID NO: 40), AAV43-12 (US20030138772
SEQ ID NO: 41), AAV43-20 (US20030138772 SEQ ID NO: 42), AAV43-21
(US20030138772 SEQ ID NO: 43), AAV43-23 (US20030138772 SEQ ID NO:
44), AAV43-25 (US20030138772 SEQ ID NO: 45), AAV44.1 (US20030138772
SEQ ID NO: 46), AAV44.5 (US20030138772 SEQ ID NO: 47), AAV223.1
(US20030138772 SEQ ID NO: 48), AAV223.2 (US20030138772 SEQ ID NO:
49), AAV223.4 (US20030138772 SEQ ID NO: 50), AAV223.5
(US20030138772 SEQ ID NO: 51), AAV223.6 (US20030138772 SEQ ID NO:
52), AAV223.7 (US20030138772 SEQ ID NO: 53), AAVA3.4 (US20030138772
SEQ ID NO: 54), AAVA3.5 (US20030138772 SEQ ID NO: 55), AAVA3.7
(US20030138772 SEQ ID NO: 56), AAVA3.3 (US20030138772 SEQ ID NO:
57), AAV42.12 (US20030138772 SEQ ID NO: 58), AAV44.2 (US20030138772
SEQ ID NO: 59), AAV42-2 (US20030138772 SEQ ID NO: 9), or variants
thereof.
[0695] In some embodiments, the AAV serotype may be, or have, a
sequence as described in United States Publication No.
US20150159173, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, AAV2 (SEQ
ID NO: 7 and 23 of US20150159173), rh20 (SEQ ID NO: 1 of
US20150159173), rh32/33 (SEQ ID NO: 2 of US20150159173), rh39 (SEQ
ID NO: 3, 20 and 36 of US20150159173), rh46 (SEQ ID NO: 4 and 22 of
US20150159173), rh73 (SEQ ID NO: 5 of US20150159173), rh74 (SEQ ID
NO: 6 of US20150159173), AAV6.1 (SEQ ID NO: 29 of US20150159173),
rh.8 (SEQ ID NO: 41 of US20150159173), rh.48.1 (SEQ ID NO: 44 of
US20150159173), hu.44 (SEQ ID NO: 45 of US20150159173), hu.29 (SEQ
ID NO: 42 of US20150159173), hu.48 (SEQ ID NO: 38 of
US20150159173), rh54 (SEQ ID NO: 49 of US20150159173), AAV2 (SEQ ID
NO: 7 of US20150159173), cy.5 (SEQ ID NO: 8 and 24 of
US20150159173), rh.10 (SEQ ID NO: 9 and 25 of US20150159173), rh.13
(SEQ ID NO: 10 and 26 of US20150159173), AAV1 (SEQ ID NO: 11 and 27
of US20150159173), AAV3 (SEQ ID NO: 12 and 28 of US20150159173),
AAV6 (SEQ ID NO: 13 and 29 of US20150159173), AAV7 (SEQ ID NO: 14
and 30 of US20150159173), AAV8 (SEQ ID NO: 15 and 31 of
US20150159173), hu.13 (SEQ ID NO: 16 and 32 of US20150159173),
hu.26 (SEQ ID NO: 17 and 33 of US20150159173), hu.37 (SEQ ID NO: 18
and 34 of US20150159173), hu.53 (SEQ ID NO: 19 and 35 of
US20150159173), rh.43 (SEQ ID NO: 21 and 37 of US20150159173), rh2
(SEQ ID NO: 39 of US20150159173), rh.37 (SEQ ID NO: 40 of
US20150159173), rh.64 (SEQ ID NO: 43 of US20150159173), rh.48 (SEQ
ID NO: 44 of US20150159173), ch.5 (SEQ ID NO 46 of US20150159173),
rh.67 (SEQ ID NO: 47 of US20150159173), rh.58 (SEQ ID NO: 48 of
US20150159173), or variants thereof including, but not limited to
Cy5R1, Cy5R2, Cy5R3, Cy5R4, rh.13R, rh.37R2, rh.2R, rh.8R, rh.48.1,
rh.48.2, rh.48.1.2, hu.44R1, hu.44R2, hu.44R3, hu.29R, ch.5R1,
rh64R1, rh64R2, AAV6.2, AAV6.1, AAV6.12, hu.48R1, hu.48R2, and
hu.48R3.
[0696] In some embodiments, the AAV serotype may be, or have, a
sequence as described in United States Patent No. U.S. Pat. No.
7,198,951, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, AAV9 (SEQ
ID NO: 1-3 of U.S. Pat. No. 7,198,951), AAV2 (SEQ ID NO: 4 of U.S.
Pat. No. 7,198,951), AAV1 (SEQ ID NO: 5 of U.S. Pat. No.
7,198,951), AAV3 (SEQ ID NO: 6 of U.S. Pat. No. 7,198,951), and
AAV8 (SEQ ID NO: 7 of U.S. Pat. No. 7,198,951).
[0697] In some embodiments, the AAV serotype may be, or have, a
mutation in the AAV9 sequence as described by N Pulicherla et al.
(Molecular Therapy 19(6):1070-1078 (2011), herein incorporated by
reference in its entirety), such as but not limited to, AAV9.9,
AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61,
AAV9.68, AAV9.84.
[0698] In some embodiments, the AAV serotype may be, or have, a
sequence as described in United States Patent No. U.S. Pat. No.
6,156,303, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, AAV3B
(SEQ ID NO: 1 and 10 of U.S. Pat. No. 6,156,303), AAV6 (SEQ ID NO:
2, 7 and 11 of U.S. Pat. No. 6,156,303), AAV2 (SEQ ID NO: 3 and 8
of U.S. Pat. No. 6,156,303), AAV3A (SEQ ID NO: 4 and 9, of U.S.
Pat. No. 6,156,303), or derivatives thereof.
[0699] In some embodiments, the AAV serotype may be, or have, a
sequence as described in United States Publication No.
US20140359799, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, AAV8 (SEQ
ID NO: 1 of US20140359799), AAVDJ (SEQ ID NO: 2 and 3 of
US20140359799), or variants thereof.
[0700] In some embodiments, the serotype may be AAVDJ or a variant
thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al.
(Journal of Virology 82(12): 5887-5911 (2008), herein incorporated
by reference in its entirety). The amino acid sequence of AAVDJ8
may comprise two or more mutations in order to remove the heparin
binding domain (HBD). As a non-limiting example, the AAV-DJ
sequence described as SEQ ID NO: 1 in U.S. Pat. No. 7,588,772, the
contents of which are herein incorporated by reference in their
entirety, may comprise two mutations: (1) R587Q where arginine (R;
Arg) at amino acid 587 is changed to glutamine (Q; Gln) and (2)
R590T where arginine (R; Arg) at amino acid 590 is changed to
threonine (T; Thr). As another non-limiting example, may comprise
three mutations: (1) K406R where lysine (K; Lys) at amino acid 406
is changed to arginine (R; Arg), (2) R587Q where arginine (R; Arg)
at amino acid 587 is changed to glutamine (Q; Gln) and (3) R590T
where arginine (R; Arg) at amino acid 590 is changed to threonine
(T; Thr).
[0701] In some embodiments, the AAV serotype may be, or have, a
sequence of AAV4 as described in International Publication No.
WO1998011244, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to AAV4 (SEQ
ID NO: 1-20 of WO1998011244).
[0702] In some embodiments, the AAV serotype may be, or have, a
mutation in the AAV2 sequence to generate AAV2G9 as described in
International Publication No. WO2014144229 and herein incorporated
by reference in its entirety.
[0703] In some embodiments, the AAV serotype may be, or have, a
sequence as described in International Publication No.
WO2005033321, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to AAV3-3
(SEQ ID NO: 217 of WO2005033321), AAV1 (SEQ ID NO: 219 and 202 of
WO2005033321), AAV106.1/hu.37 (SEQ ID No: 10 of WO2005033321),
AAV114.3/hu.40 (SEQ ID No: 11 of WO2005033321), AAV127.2/hu.41 (SEQ
ID NO:6 and 8 of WO2005033321), AAV128.3/hu.44 (SEQ ID No: 81 of
WO2005033321), AAV130.4/hu.48 (SEQ ID NO: 78 of WO2005033321),
AAV145.1/hu.53 (SEQ ID No: 176 and 177 of WO2005033321),
AAV145.6/hu.56 (SEQ ID NO: 168 and 192 of WO2005033321),
AAV16.12/hu.11 (SEQ ID NO: 153 and 57 of WO2005033321),
AAV16.8/hu.10 (SEQ ID NO: 156 and 56 of WO2005033321),
AAV161.10/hu.60 (SEQ ID No: 170 of WO2005033321), AAV161.6/hu.61
(SEQ ID No: 174 of WO2005033321), AAV1-7/rh.48 (SEQ ID NO: 32 of
WO2005033321), AAV1-8/rh.49 (SEQ ID NOs: 103 and 25 of
WO2005033321), AAV2 (SEQ ID NO: 211 and 221 of WO2005033321),
AAV2-15/rh.62 (SEQ ID No: 33 and 114 of WO2005033321), AAV2-3/rh.61
(SEQ ID NO: 21 of WO2005033321), AAV2-4/rh.50 (SEQ ID No: 23 and
108 of WO2005033321), AAV2-5/rh.51 (SEQ ID NO: 104 and 22 of
WO2005033321), AAV3.1/hu.6 (SEQ ID NO: 5 and 84 of WO2005033321),
AAV3.1/hu.9 (SEQ ID NO: 155 and 58 of WO2005033321), AAV3-11/rh.53
(SEQ ID NO: 186 and 176 of WO2005033321), AAV3-3 (SEQ ID NO: 200 of
WO2005033321), AAV33.12/hu.17 (SEQ ID NO:4 of WO2005033321),
AAV33.4/hu.15 (SEQ ID No: 50 of WO2005033321), AAV33.8/hu.16 (SEQ
ID No: 51 of WO2005033321), AAV3-9/rh.52 (SEQ ID NO: 96 and 18 of
WO2005033321), AAV4-19/rh.55 (SEQ ID NO: 117 of WO2005033321),
AAV4-4 (SEQ ID NO: 201 and 218 of WO2005033321), AAV4-9/rh.54 (SEQ
ID NO: 116 of WO2005033321), AAVS (SEQ ID NO: 199 and 216 of
WO2005033321), AAV52.1/hu.20 (SEQ ID NO: 63 of WO2005033321),
AAV52/hu.19 (SEQ ID NO: 133 of WO2005033321), AAVS-22/rh.58 (SEQ ID
No: 27 of WO2005033321), AAVS-3/rh.57 (SEQ ID NO: 105 of
WO2005033321), AAVS-3/rh.57 (SEQ ID No: 26 of WO2005033321),
AAV58.2/hu.25 (SEQ ID No: 49 of WO2005033321), AAV6 (SEQ ID NO: 203
and 220 of WO2005033321), AAV7 (SEQ ID NO: 222 and 213 of
WO2005033321), AAV7.3/hu.7 (SEQ ID No: 55 of WO2005033321), AAV8
(SEQ ID NO: 223 and 214 of WO2005033321), AAVH-1/hu.1 (SEQ ID No:
46 of WO2005033321), AAVH-5/hu.3 (SEQ ID No: 44 of WO2005033321),
AAVhu.1 (SEQ ID NO: 144 of WO2005033321), AAVhu.10 (SEQ ID NO: 156
of WO2005033321), AAVhu.11 (SEQ ID NO: 153 of WO2005033321),
AAVhu.12 (WO2005033321 SEQ ID NO: 59), AAVhu.13 (SEQ ID NO: 129 of
WO2005033321), AAVhu.14/AAV9 (SEQ ID NO: 123 and 3 of
WO2005033321), AAVhu.15 (SEQ ID NO: 147 of WO2005033321), AAVhu.16
(SEQ ID NO: 148 of WO2005033321), AAVhu.17 (SEQ ID NO: 83 of
WO2005033321), AAVhu.18 (SEQ ID NO: 149 of WO2005033321), AAVhu.19
(SEQ ID NO: 133 of WO2005033321), AAVhu.2 (SEQ ID NO: 143 of
WO2005033321), AAVhu.20 (SEQ ID NO: 134 of WO2005033321), AAVhu.21
(SEQ ID NO: 135 of WO2005033321), AAVhu.22 (SEQ ID NO: 138 of
WO2005033321), AAVhu.23.2 (SEQ ID NO: 137 of WO2005033321),
AAVhu.24 (SEQ ID NO: 136 of WO2005033321), AAVhu.25 (SEQ ID NO: 146
of WO2005033321), AAVhu.27 (SEQ ID NO: 140 of WO2005033321),
AAVhu.29 (SEQ ID NO: 132 of WO2005033321), AAVhu.3 (SEQ ID NO: 145
of WO2005033321), AAVhu.31 (SEQ ID NO: 121 of WO2005033321),
AAVhu.32 (SEQ ID NO: 122 of WO2005033321), AAVhu.34 (SEQ ID NO: 125
of WO2005033321), AAVhu.35 (SEQ ID NO: 164 of WO2005033321),
AAVhu.37 (SEQ ID NO: 88 of WO2005033321), AAVhu.39 (SEQ ID NO: 102
of WO2005033321), AAVhu.4 (SEQ ID NO: 141 of WO2005033321),
AAVhu.40 (SEQ ID NO: 87 of WO2005033321), AAVhu.41 (SEQ ID NO: 91
of WO2005033321), AAVhu.42 (SEQ ID NO: 85 of WO2005033321),
AAVhu.43 (SEQ ID NO: 160 of WO2005033321), AAVhu.44 (SEQ ID NO: 144
of WO2005033321), AAVhu.45 (SEQ ID NO: 127 of WO2005033321),
AAVhu.46 (SEQ ID NO: 159 of WO2005033321), AAVhu.47 (SEQ ID NO: 128
of WO2005033321), AAVhu.48 (SEQ ID NO: 157 of WO2005033321),
AAVhu.49 (SEQ ID NO: 189 of WO2005033321), AAVhu.51 (SEQ ID NO: 190
of WO2005033321), AAVhu.52 (SEQ ID NO: 191 of WO2005033321),
AAVhu.53 (SEQ ID NO: 186 of WO2005033321), AAVhu.54 (SEQ ID NO: 188
of WO2005033321), AAVhu.55 (SEQ ID NO: 187 of WO2005033321),
AAVhu.56 (SEQ ID NO: 192 of WO2005033321), AAVhu.57 (SEQ ID NO: 193
of WO2005033321), AAVhu.58 (SEQ ID NO: 194 of WO2005033321),
AAVhu.6 (SEQ ID NO: 84 of WO2005033321), AAVhu.60 (SEQ ID NO: 184
of WO2005033321), AAVhu.61 (SEQ ID NO: 185 of WO2005033321),
AAVhu.63 (SEQ ID NO: 195 of WO2005033321), AAVhu.64 (SEQ ID NO: 196
of WO2005033321), AAVhu.66 (SEQ ID NO: 197 of WO2005033321),
AAVhu.67 (SEQ ID NO: 198 of WO2005033321), AAVhu.7 (SEQ ID NO: 150
of WO2005033321), AAVhu.8 (WO2005033321 SEQ ID NO: 12), AAVhu.9
(SEQ ID NO: 155 of WO2005033321), AAVLG-10/rh.40 (SEQ ID No: 14 of
WO2005033321), AAVLG-4/rh.38 (SEQ ID NO: 86 of WO2005033321),
AAVLG-4/rh.38 (SEQ ID No: 7 of WO2005033321), AAVN721-8/rh.43 (SEQ
ID NO: 163 of WO2005033321), AAVN721-8/rh.43 (SEQ ID No: 43 of
WO2005033321), AAVpi.1 (WO2005033321 SEQ ID NO: 28), AAVpi.2
(WO2005033321 SEQ ID NO: 30), AAVpi.3 (WO2005033321 SEQ ID NO: 29),
AAVrh.38 (SEQ ID NO: 86 of WO2005033321), AAVrh.40 (SEQ ID NO: 92
of WO2005033321), AAVrh.43 (SEQ ID NO: 163 of WO2005033321),
AAVrh.44 (WO2005033321 SEQ ID NO: 34), AAVrh.45 (WO2005033321 SEQ
ID NO: 41), AAVrh.47 (WO2005033321 SEQ ID NO: 38), AAVrh.48 (SEQ ID
NO: 115 of WO2005033321), AAVrh.49 (SEQ ID NO: 103 of
WO2005033321), AAVrh.50 (SEQ ID NO: 108 of WO2005033321), AAVrh.51
(SEQ ID NO: 104 of WO2005033321), AAVrh.52 (SEQ ID NO: 96 of
WO2005033321), AAVrh.53 (SEQ ID NO: 97 of WO2005033321), AAVrh.55
(WO2005033321 SEQ ID NO: 37), AAVrh.56 (SEQ ID NO: 152 of
WO2005033321), AAVrh.57 (SEQ ID NO: 105 of WO2005033321), AAVrh.58
(SEQ ID NO: 106 of WO2005033321), AAVrh.59 (WO2005033321 SEQ ID NO:
42), AAVrh.60 (WO2005033321 SEQ ID NO: 31), AAVrh.61 (SEQ ID NO:
107 of WO2005033321), AAVrh.62 (SEQ ID NO: 114 of WO2005033321),
AAVrh.64 (SEQ ID NO: 99 of WO2005033321), AAVrh.65 (WO2005033321
SEQ ID NO: 35), AAVrh.68 (WO2005033321 SEQ ID NO: 16), AAVrh.69
(WO2005033321 SEQ ID NO: 39), AAVrh.70 (WO2005033321 SEQ ID NO:
20), AAVrh.72 (WO2005033321 SEQ ID NO: 9), or variants thereof
including, but not limited to, AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5,
AAVcy.6, AAVrh.12, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.21,
AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.25/42 15, AAVrh.31,
AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37,
AAVrh14. Non limiting examples of variants include SEQ ID NO: 13,
15, 17, 19, 24, 36, 40, 45, 47, 48, 51-54, 60-62, 64-77, 79, 80,
82, 89, 90, 93-95, 98, 100, 101-109-113, 118-120, 124, 126, 131,
139, 142, 151,154, 158, 161, 162, 165-183, 202, 204-212, 215, 219,
224-236, of WO2005033321, the contents of which are herein
incorporated by reference in their entirety.
[0704] In some embodiments, the AAV serotype may be, or have, a
sequence as described in International Publication No.
WO2015168666, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, AAVrh8R
(SEQ ID NO: 9 of WO2015168666), AAVrh8R A586R mutant (SEQ ID NO: 10
of WO2015168666), AAVrh8R R533A mutant (SEQ ID NO: 11 of
WO2015168666), or variants thereof.
[0705] In some embodiments, the AAV serotype may be, or have, a
sequence as described in United States Patent No. U.S. Pat. No.
9,233,131, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, AAVhE1.1
(SEQ ID NO:44 of U.S. Pat. No. 9,233,131), AAVhEr1.5 (SEQ ID NO:45
of U.S. Pat. No. 9,233,131), AAVhER1.14 (SEQ ID NO:46 of U.S. Pat.
No. 9,233,131), AAVhEr1.8 (SEQ ID NO:47 of U.S. Pat. No.
9,233,131), AAVhEr1.16 (SEQ ID NO:48 of U.S. Pat. No. 9,233,131),
AAVhEr1.18 (SEQ ID NO:49 of U.S. Pat. No. 9,233,131), AAVhEr1.35
(SEQ ID NO:50 of U.S. Pat. No. 9,233,131), AAVhEr1.7 (SEQ ID NO:51
of U.S. Pat. No. 9,233,131), AAVhEr1.36 (SEQ ID NO:52 of U.S. Pat.
No. 9,233,131), AAVhEr2.29 (SEQ ID NO:53 of U.S. Pat. No.
9,233,131), AAVhEr2.4 (SEQ ID NO:54 of U.S. Pat. No. 9,233,131),
AAVhEr2.16 (SEQ ID NO:55 of U.S. Pat. No. 9,233,131), AAVhEr2.30
(SEQ ID NO:56 of U.S. Pat. No. 9,233,131), AAVhEr2.31 (SEQ ID NO:58
of U.S. Pat. No. 9,233,131), AAVhEr2.36 (SEQ ID NO:57 of U.S. Pat.
No. 9,233,131), AAVhER1.23 (SEQ ID NO:53 of U.S. Pat. No.
9,233,131), AAVhEr3.1 (SEQ ID NO:59 of U.S. Pat. No. 9,233,131),
AAV2.5T (SEQ ID NO:42 of U.S. Pat. No. 9,233,131), or variants
thereof.
[0706] In some embodiments, the AAV serotype may be, or have, a
sequence as described in United States Patent Publication No.
US20150376607, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, AAV-PAEC
(SEQ ID NO:1 of US20150376607), AAV-LK01 (SEQ ID NO:2 of
US20150376607), AAV-LKO2 (SEQ ID NO:3 of US20150376607), AAV-LKO3
(SEQ ID NO:4 of US20150376607), AAV-LKO4 (SEQ ID NO:5 of
US20150376607), AAV-LKO5 (SEQ ID NO:6 of US20150376607), AAV-LKO6
(SEQ ID NO:7 of US20150376607), AAV-LKO7 (SEQ ID NO:8 of
US20150376607), AAV-LKO8 (SEQ ID NO:9 of US20150376607), AAV-LKO9
(SEQ ID NO:10 of US20150376607), AAV-LK10 (SEQ ID NO:11 of
US20150376607), AAV-LK11 (SEQ ID NO:12 of US20150376607), AAV-LK12
(SEQ ID NO:13 of US20150376607), AAV-LK13 (SEQ ID NO:14 of
US20150376607), AAV-LK14 (SEQ ID NO:15 of US20150376607), AAV-LK15
(SEQ ID NO:16 of US20150376607), AAV-LK16 (SEQ ID NO:17 of
US20150376607), AAV-LK17 (SEQ ID NO:18 of US20150376607), AAV-LK18
(SEQ ID NO:19 of US20150376607), AAV-LK19 (SEQ ID NO:20 of
US20150376607), AAV-PAEC2 (SEQ ID NO:21 of US20150376607),
AAV-PAEC4 (SEQ ID NO:22 of US20150376607), AAV-PAEC6 (SEQ ID NO:23
of US20150376607), AAV-PAEC7 (SEQ ID NO:24 of US20150376607),
AAV-PAEC8 (SEQ ID NO:25 of US20150376607), AAV-PAEC11 (SEQ ID NO:26
of US20150376607), AAV-PAEC12 (SEQ ID NO:27, of US20150376607), or
variants thereof.
[0707] In some embodiments, the AAV serotype may be, or have, a
sequence as described in United States Patent No. U.S. Pat. No.
9,163,261, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to,
AAV-2-pre-miRNA-101 (SEQ ID NO: 1 U.S. Pat. No. 9,163,261), or
variants thereof.
[0708] In some embodiments, the AAV serotype may be, or have, a
sequence as described in United States Patent Publication No.
US20150376240, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, AAV-8h
(SEQ ID NO: 6 of US20150376240), AAV-8b (SEQ ID NO: 5 of
US20150376240), AAV-h (SEQ ID NO: 2 of US20150376240), AAV-b (SEQ
ID NO: 1 of US20150376240), or variants thereof.
[0709] In some embodiments, the AAV serotype may be, or have, a
sequence as described in United States Patent Publication No.
US20160017295, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, AAV SM
10-2 (SEQ ID NO: 22 of US20160017295), AAV Shuffle 100-1 (SEQ ID
NO: 23 of US20160017295), AAV Shuffle 100-3 (SEQ ID NO: 24 of
US20160017295), AAV Shuffle 100-7 (SEQ ID NO: 25 of US20160017295),
AAV Shuffle 10-2 (SEQ ID NO: 34 of US20160017295), AAV Shuffle 10-6
(SEQ ID NO: 35 of US20160017295), AAV Shuffle 10-8 (SEQ ID NO: 36
of US20160017295), AAV Shuffle 100-2 (SEQ ID NO: 37 of
US20160017295), AAV SM 10-1 (SEQ ID NO: 38 of US20160017295), AAV
SM 10-8 (SEQ ID NO: 39 of US20160017295), AAV SM 100-3 (SEQ ID NO:
40 of US20160017295), AAV SM 100-10 (SEQ ID NO: 41 of
US20160017295), or variants thereof.
[0710] In some embodiments, the AAV serotype may be, or have, a
sequence as described in United States Patent Publication No.
US20150238550, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, BNP61 AAV
(SEQ ID NO: 1 of US20150238550), BNP62 AAV (SEQ ID NO: 3 of
US20150238550), BNP63 AAV (SEQ ID NO: 4 of US20150238550), or
variants thereof.
[0711] In some embodiments, the AAV serotype may be or may have a
sequence as described in United States Patent Publication No.
US20150315612, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, AAVrh.50
(SEQ ID NO: 108 of US20150315612), AAVrh.43 (SEQ ID NO: 163 of
US20150315612), AAVrh.62 (SEQ ID NO: 114 of US20150315612),
AAVrh.48 (SEQ ID NO: 115 of US20150315612), AAVhu.19 (SEQ ID NO:
133 of US20150315612), AAVhu.11 (SEQ ID NO: 153 of US20150315612),
AAVhu.53 (SEQ ID NO: 186 of US20150315612), AAV4-8/rh.64 (SEQ ID
No: 15 of US20150315612), AAVLG-9/hu.39 (SEQ ID No: 24 of
US20150315612), AAV54.5/hu.23 (SEQ ID No: 60 of US20150315612),
AAV54.2/hu.22 (SEQ ID No: 67 of US20150315612), AAV54.7/hu.24 (SEQ
ID No: 66 of US20150315612), AAV54.1/hu.21 (SEQ ID No: 65 of
US20150315612), AAV54.4R/hu.27 (SEQ ID No: 64 of US20150315612),
AAV46.2/hu.28 (SEQ ID No: 68 of US20150315612), AAV46.6/hu.29 (SEQ
ID No: 69 of US20150315612), AAV128.1/hu.43 (SEQ ID No: 80 of
US20150315612), or variants thereof.
[0712] In some embodiments, the AAV serotype may be, or have, a
sequence as described in International Publication No.
WO2015121501, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, true type
AAV (ttAAV) (SEQ ID NO: 2 of WO2015121501), "UPenn AAV10" (SEQ ID
NO: 8 of WO2015121501), "Japanese AAV10" (SEQ ID NO: 9 of
WO2015121501), or variants thereof.
[0713] According to the present invention, AAV capsid serotype
selection or use may be from a variety of species. In one
embodiment, the AAV may be an avian AAV (AAAV). The AAAV serotype
may be, or have, a sequence as described in United States Patent
No. U.S. Pat. No. 9,238,800, the contents of which are herein
incorporated by reference in their entirety, such as, but not
limited to, AAAV (SEQ ID NO: 1, 2, 4, 6, 8, 10, 12, and 14 of U.S.
Pat. No. 9,238,800), or variants thereof.
[0714] In one embodiment, the AAV may be a bovine AAV (BAAV). The
BAAV serotype may be, or have, a sequence as described in United
States Patent No. U.S. Pat. No. 9,193,769, the contents of which
are herein incorporated by reference in their entirety, such as,
but not limited to, BAAV (SEQ ID NO: 1 and 6 of U.S. Pat. No.
9,193,769), or variants thereof. The BAAV serotype may be or have a
sequence as described in United States Patent No. U.S. Pat. No.
7,427,396, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, BAAV (SEQ
ID NO: 5 and 6 of U.S. Pat. No. 7,427,396), or variants
thereof.
[0715] In one embodiment, the AAV may be a caprine AAV. The caprine
AAV serotype may be, or have, a sequence as described in United
States Patent No. U.S. Pat. No. 7,427,396, the contents of which
are herein incorporated by reference in their entirety, such as,
but not limited to, caprine AAV (SEQ ID NO: 3 of U.S. Pat. No.
7,427,396), or variants thereof.
[0716] In other embodiments the AAV may be engineered as a hybrid
AAV from two or more parental serotypes. In one embodiment, the AAV
may be AAV2G9 which comprises sequences from AAV2 and AAV9. The
AAV2G9 AAV serotype may be, or have, a sequence as described in
United States Patent Publication No. US20160017005, the contents of
which are herein incorporated by reference in its entirety.
[0717] In one embodiment, the AAV may be a serotype generated by
the AAV9 capsid library with mutations in amino acids 390-627 (VP1
numbering) as described by Pulicherla et al. (Molecular Therapy
19(6):1070-1078 (2011), the contents of which are herein
incorporated by reference in their entirety. The serotype and
corresponding nucleotide and amino acid substitutions may be, but
is not limited to, AAV9.1 (G1594C; D532H), AAV6.2 (T1418A and
T1436X; V473D and I479K), AAV9.3 (T1238A; F413Y), AAV9.4 (T1250C
and A1617T; F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R,
T548A, A587V), AAV9.6 (T1231A; F411I), AAV9.9 (G1203A, G1785T;
W595C), AAV9.10 (A1500G, T1676C; M559T), AAV9.11 (A1425T, A1702C,
A1769T; T568P, Q590L), AAV9.13 (A1369C, A1720T; N457H, T574S),
AAV9.14 (T1340A, T1362C, T1560C, G1713A; L447H), AAV9.16 (A1775T;
Q592L), AAV9.24 (T1507C, T1521G; W503R), AAV9.26 (A1337G, A1769C;
Y446C, Q590P), AAV9.33 (A1667C; D556A), AAV9.34 (A1534G, C1794T;
N512D), AAV9.35 (A1289T, T1450A, C1494T, A1515T, C1794A, G1816A;
Q430L, Y484N, N98K, V6061), AAV9.40 (A1694T, E565V), AAV9.41
(A1348T, T1362C; T450S), AAV9.44 (A1684C, A1701T, A1737G; N562H,
K567N), AAV9.45 (A1492T, C1804T; N498Y, L602F), AAV9.46 (G1441C,
T1525C, T1549G; G481R, W509R, L517V), 9.47 (G1241A, G1358A, A1669G,
C1745T; S414N, G453D, K557E, T582I), AAV9.48 (C1445T, A1736T;
P482L, Q579L), AAV9.50 (A1638T, C1683T, T1805A; Q546H, L602H),
AAV9.53 (G1301A, A1405C, C1664T, G1811T; R134Q, S469R, A555V,
G604V), AAV9.54 (C1531A, T1609A; L511I, L537M), AAV9.55 (T1605A;
F535L), AAV9.58 (C1475T, C1579A; T492I, H527N), AAV.59 (T1336C;
Y446H), AAV9.61 (A1493T; N498I), AAV9.64 (C1531A, A1617T; L511I),
AAV9.65 (C1335T, T1530C, C1568A; A523D), AAV9.68 (C1510A; P504T),
AAV9.80 (G1441A,;G481R), AAV9.83 (C1402A, A1500T; P468T, E500D),
AAV9.87 (T1464C, T1468C; S490P), AAV9.90 (A1196T; Y399F), AAV9.91
(T1316G, A1583T, C1782G, T1806C; L439R, K528I), AAV9.93 (A1273G,
A1421G, A1638C, C1712T, G1732A, A1744T, A1832T; S425G, Q474R,
Q546H, P571L, G578R, T582S, D611V), AAV9.94 (A1675T; M559L) and
AAV9.95 (T1605A; F535L).
[0718] In some embodiments, the AAV serotype may be, or have, a
sequence as described in International Publication No.
WO2016049230, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to AAVF1/HSC1
(SEQ ID NO: 2 and 20 of WO2016049230), AAVF2/HSC2 (SEQ ID NO: 3 and
21 of WO2016049230), AAVF3/HSC3 (SEQ ID NO: 5 and 22 of
WO2016049230), AAVF4/HSC4 (SEQ ID NO: 6 and 23 of WO2016049230),
AAVF5/HSC5 (SEQ ID NO: 11 and 25 of WO2016049230), AAVF6/HSC6 (SEQ
ID NO: 7 and 24 of WO2016049230), AAVF7/HSC7 (SEQ ID NO: 8 and 27
of WO2016049230), AAVF8/HSC8 (SEQ ID NO: 9 and 28 of WO2016049230),
AAVF9/HSC9 (SEQ ID NO: 10 and 29 of WO2016049230), AAVF11/HSC11
(SEQ ID NO: 4 and 26 of WO2016049230), AAVF12/HSC12 (SEQ ID NO: 12
and 30 of WO2016049230), AAVF13/HSC13 (SEQ ID NO: 14 and 31 of
WO2016049230), AAVF14/HSC14 (SEQ ID NO: 15 and 32 of WO2016049230),
AAVF15/HSC15 (SEQ ID NO: 16 and 33 of WO2016049230), AAVF16/HSC16
(SEQ ID NO: 17 and 34 of WO2016049230), AAVF17/HSC17 (SEQ ID NO: 13
and 35 of WO2016049230), or variants or derivatives thereof.
[0719] In some embodiments, the AAV serotype may be, or have, a
sequence as described in United States Patent No. U.S. Pat. No.
8,734,809, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, AAV
CBr-E1 (SEQ ID NO: 13 and 87 of U.S. Pat. No. 8,734,809), AAV
CBr-E2 (SEQ ID NO: 14 and 88 of U.S. Pat. No. 8,734,809), AAV
CBr-E3 (SEQ ID NO: 15 and 89 of U.S. Pat. No. 8,734,809), AAV
CBr-E4 (SEQ ID NO: 16 and 90 of U.S. Pat. No. 8,734,809), AAV
CBr-E5 (SEQ ID NO: 17 and 91 of U.S. Pat. No. 8,734,809), AAV
CBr-e5 (SEQ ID NO: 18 and 92 of U.S. Pat. No. 8,734,809), AAV
CBr-E6 (SEQ ID NO: 19 and 93 of U.S. Pat. No. 8,734,809), AAV
CBr-E7 (SEQ ID NO: 20 and 94 of U.S. Pat. No. 8,734,809), AAV
CBr-E8 (SEQ ID NO: 21 and 95 of U.S. Pat. No. 8,734,809), AAV
CLv-D1 (SEQ ID NO: 22 and 96 of U.S. Pat. No. 8,734,809), AAV
CLv-D2 (SEQ ID NO: 23 and 97 of US8734809), AAV CLv-D3 (SEQ ID NO:
24 and 98 of U.S. Pat. No. 8,734,809), AAV CLv-D4 (SEQ ID NO: 25
and 99 of U.S. Pat. No. 8,734,809), AAV CLv-D5 (SEQ ID NO: 26 and
100 of U.S. Pat. No. 8,734,809), AAV CLv-D6 (SEQ ID NO: 27 and 101
of U.S. Pat. No. 8,734,809), AAV CLv-D7 (SEQ ID NO: 28 and 102 of
U.S. Pat. No. 8,734,809), AAV CLv-D8 (SEQ ID NO: 29 and 103 of U.S.
Pat. No. 8,734,809), AAV CLv-E1 (SEQ ID NO: 13 and 87 of U.S. Pat.
No. 8,734,809), AAV CLv-R1 (SEQ ID NO: 30 and 104 of U.S. Pat. No.
8,734,809), AAV CLv-R2 (SEQ ID NO: 31 and 105 of U.S. Pat. No.
8,734,809), AAV CLv-R3 (SEQ ID NO: 32 and 106 of U.S. Pat. No.
8,734,809), AAV CLv-R4 (SEQ ID NO: 33 and 107 of U.S. Pat. No.
8,734,809), AAV CLv-R5 (SEQ ID NO: 34 and 108 of U.S. Pat. No.
8,734,809), AAV CLv-R6 (SEQ ID NO: 35 and 109 of U.S. Pat. No.
8,734,809), AAV CLv-R7 (SEQ ID NO: 36 and 110 of U.S. Pat. No.
8,734,809), AAV CLv-R8 (SEQ ID NO: 37 and 111 of U.S. Pat. No.
8,734,809), AAV CLv-R9 (SEQ ID NO: 38 and 112 of U.S. Pat. No.
8,734,809), AAV CLg-F1 (SEQ ID NO: 39 and 113 of U.S. Pat. No.
8,734,809), AAV CLg-F2 (SEQ ID NO: 40 and 114 of U.S. Pat. No.
8,734,809), AAV CLg-F3 (SEQ ID NO: 41 and 115 of U.S. Pat. No.
8,734,809), AAV CLg-F4 (SEQ ID NO: 42 and 116 of U.S. Pat. No.
8,734,809), AAV CLg-F5 (SEQ ID NO: 43 and 117 of U.S. Pat. No.
8,734,809), AAV CLg-F6 (SEQ ID NO: 43 and 117 of U.S. Pat. No.
8,734,809), AAV CLg-F7 (SEQ ID NO: 44 and 118 of U.S. Pat. No.
8,734,809), AAV CLg-F8 (SEQ ID NO: 43 and 117 of U.S. Pat. No.
8,734,809), AAV CSp-1 (SEQ ID NO: 45 and 119 of U.S. Pat. No.
8,734,809), AAV CSp-10 (SEQ ID NO: 46 and 120 of U.S. Pat. No.
8,734,809), AAV CSp-11 (SEQ ID NO: 47 and 121 of U.S. Pat. No.
8,734,809), AAV CSp-2 (SEQ ID NO: 48 and 122 of U.S. Pat. No.
8,734, 809), AAV CSp-3 (SEQ ID NO: 49 and 123 of U.S. Pat. No.
8,734,809), AAV CSp-4 (SEQ ID NO: 50 and 124 of U.S. Pat. No.
8,734,809), AAV CSp-6 (SEQ ID NO: 51 and 125 of U.S. Pat. No.
8,734,809), AAV CSp-7 (SEQ ID NO: 52 and 126 of U.S. Pat. No.
8,734,809), AAV CSp-8 (SEQ ID NO: 53 and 127 of U.S. Pat. No.
8,734,809), AAV CSp-9 (SEQ ID NO: 54 and 128 of U.S. Pat. No.
8,734,809), AAV CHt-2 (SEQ ID NO: 55 and 129 of U.S. Pat. No.
8,734,809), AAV CHt-3 (SEQ ID NO: 56 and 130 of U.S. Pat. No.
8,734,809), AAV CKd-1 (SEQ ID NO: 57 and 131 of U.S. Pat. No.
8,734,809), AAV CKd-10 (SEQ ID NO: 58 and 132 of U.S. Pat. No.
8,734,809), AAV CKd-2 (SEQ ID NO: 59 and 133 of U.S. Pat. No.
8,734,809), AAV CKd-3 (SEQ ID NO: 60 and 134 of U.S. Pat. No.
8,734,809), AAV CKd-4 (SEQ ID NO: 61 and 135 of U.S. Pat. No.
8,734,809), AAV CKd-6 (SEQ ID NO: 62 and 136 of U.S. Pat. No.
8,734,809), AAV CKd-7 (SEQ ID NO: 63 and 137 of U.S. Pat. No.
8,734,809), AAV CKd-8 (SEQ ID NO: 64 and 138 of U.S. Pat. No.
8,734,809), AAV CLv-1 (SEQ ID NO: 35 and 139 of U.S. Pat. No.
8,734,809), AAV CLv-12 (SEQ ID NO: 66 and 140 of U.S. Pat. No.
8,734,809), AAV CLv-13 (SEQ ID NO: 67 and 141 of U.S. Pat. No.
8,734,809), AAV CLv-2 (SEQ ID NO: 68 and 142 of U.S. Pat. No.
8,734,809), AAV CLv-3 (SEQ ID NO: 69 and 143 of U.S. Pat. No.
8,734,809), AAV CLv-4 (SEQ ID NO: 70 and 144 of U.S. Pat. No.
8,734,809), AAV CLv-6 (SEQ ID NO: 71 and 145 of U.S. Pat. No.
8,734,809), AAV CLv-8 (SEQ ID NO: 72 and 146 of U.S. Pat. No.
8,734,809), AAV CKd-B1 (SEQ ID NO: 73 and 147 of U.S. Pat. No.
8,734,809), AAV CKd-B2 (SEQ ID NO: 74 and 148 of U.S. Pat. No.
8,734,809), AAV CKd-B3 (SEQ ID NO: 75 and 149 of U.S. Pat. No.
8,734,809), AAV CKd-B4 (SEQ ID NO: 76 and 150 of U.S. Pat. No.
8,734,809), AAV CKd-B5 (SEQ ID NO: 77 and 151 of U.S. Pat. No.
8,734,809), AAV CKd-B6 (SEQ ID NO: 78 and 152 of U.S. Pat. No.
8,734,809), AAV CKd-B7 (SEQ ID NO: 79 and 153 of U.S. Pat. No.
8,734,809), AAV CKd-B8 (SEQ ID NO: 80 and 154 of U.S. Pat. No.
8,734,809), AAV CKd-H1 (SEQ ID NO: 81 and 155 of U.S. Pat. No.
8,734,809), AAV CKd-H2 (SEQ ID NO: 82 and 156 of U.S. Pat. No.
8,734,809), AAV CKd-H3 (SEQ ID NO: 83 and 157 of U.S. Pat. No.
8,734,809), AAV CKd-H4 (SEQ ID NO: 84 and 158 of U.S. Pat. No.
8,734,809), AAV CKd-H5 (SEQ ID NO: 85 and 159 of U.S. Pat. No.
8,734,809), AAV CKd-H6 (SEQ ID NO: 77 and 151 of U.S. Pat. No.
8,734,809), AAV CHt-1 (SEQ ID NO: 86 and 160 of U.S. Pat. No.
8,734,809), AAV CLv1-1 (SEQ ID NO: 171 of U.S. Pat. No. 8,734,809),
AAV CLv1-2 (SEQ ID NO: 172 of U.S. Pat. No. 8,734,809), AAV CLv1-3
(SEQ ID NO: 173 of U.S. Pat. No. 8,734,809), AAV CLv1-4 (SEQ ID NO:
174 of U.S. Pat. No. 8,734,809), AAV Clv1-7 (SEQ ID NO: 175 of U.S.
Pat. No. 8,734,809), AAV Clv1-8 (SEQ ID NO: 176 of U.S. Pat. No.
8,734,809), AAV Clv1-9 (SEQ ID NO: 177 of U.S. Pat. No. 8,734,809),
AAV Clv1-10 (SEQ ID NO: 178 of U.S. Pat. No. 8,734,809), AAV.VR-355
(SEQ ID NO: 181 of U.S. Pat. No. 8734809), AAV.hu.48R3 (SEQ ID NO:
183 of U.S. Pat. No. 8,734,809), or variants or derivatives
thereof.
[0720] In some embodiments, the AAV serotype may be, or have, a
sequence as described in International Publication No.
WO2016065001, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to AAV CHt-P2
(SEQ ID NO: 1 and 51 of WO2016065001), AAV CHt-P5 (SEQ ID NO: 2 and
52 of WO2016065001), AAV CHt-P9 (SEQ ID NO: 3 and 53 of
WO2016065001), AAV CBr-7.1 (SEQ ID NO: 4 and 54 of WO2016065001),
AAV CBr-7.2 (SEQ ID NO: 5 and 55 of WO2016065001), AAV CBr-7.3 (SEQ
ID NO: 6 and 56 of WO2016065001), AAV CBr-7.4 (SEQ ID NO: 7 and 57
of WO2016065001), AAV CBr-7.5 (SEQ ID NO: 8 and 58 of
WO2016065001), AAV CBr-7.7 (SEQ ID NO: 9 and 59 of WO2016065001),
AAV CBr-7.8 (SEQ ID NO: 10 and 60 of WO2016065001), AAV CBr-7.10
(SEQ ID NO: 11 and 61 of WO2016065001), AAV CKd-N3 (SEQ ID NO: 12
and 62 of WO2016065001), AAV CKd-N4 (SEQ ID NO: 13 and 63 of
WO2016065001), AAV CKd-N9 (SEQ ID NO: 14 and 64 of WO2016065001),
AAV CLv-L4 (SEQ ID NO: 15 and 65 of WO2016065001), AAV CLv-L5 (SEQ
ID NO: 16 and 66 of WO2016065001), AAV CLv-L6 (SEQ ID NO: 17 and 67
of WO2016065001), AAV CLv-K1 (SEQ ID NO: 18 and 68 of
WO2016065001), AAV CLv-K3 (SEQ ID NO: 19 and 69 of WO2016065001),
AAV CLv-K6 (SEQ ID NO: 20 and 70 of WO2016065001), AAV CLv-M1 (SEQ
ID NO: 21 and 71 of WO2016065001), AAV CLv-M11 (SEQ ID NO: 22 and
72 of WO2016065001), AAV CLv-M2 (SEQ ID NO: 23 and 73 of
WO2016065001), AAV CLv-M5 (SEQ ID NO: 24 and 74 of WO2016065001),
AAV CLv-M6 (SEQ ID NO: 25 and 75 of WO2016065001), AAV CLv-M7 (SEQ
ID NO: 26 and 76 of WO2016065001), AAV CLv-M8 (SEQ ID NO: 27 and 77
of WO2016065001), AAV CLv-M9 (SEQ ID NO: 28 and 78 of
WO2016065001), AAV CHt-P1 (SEQ ID NO: 29 and 79 of WO2016065001),
AAV CHt-P6 (SEQ ID NO: 30 and 80 of WO2016065001), AAV CHt-P8 (SEQ
ID NO: 31 and 81 of WO2016065001), AAV CHt-6.1 (SEQ ID NO: 32 and
82 of WO2016065001), AAV CHt-6.10 (SEQ ID NO: 33 and 83 of
WO2016065001), AAV CHt-6.5 (SEQ ID NO: 34 and 84 of WO2016065001),
AAV CHt-6.6 (SEQ ID NO: 35 and 85 of WO2016065001), AAV CHt-6.7
(SEQ ID NO: 36 and 86 of WO2016065001), AAV CHt-6.8 (SEQ ID NO: 37
and 87 of WO2016065001), AAV CSp-8.10 (SEQ ID NO: 38 and 88 of
WO2016065001), AAV CSp-8.2 (SEQ ID NO: 39 and 89 of WO2016065001),
AAV CSp-8.4 (SEQ ID NO: 40 and 90 of WO2016065001), AAV CSp-8.5
(SEQ ID NO: 41 and 91 of WO2016065001), AAV CSp-8.6 (SEQ ID NO: 42
and 92 of WO2016065001), AAV CSp-8.7 (SEQ ID NO: 43 and 93 of
WO2016065001), AAV CSp-8.8 (SEQ ID NO: 44 and 94 of WO2016065001),
AAV CSp-8.9 (SEQ ID NO: 45 and 95 of WO2016065001), AAV CBr-B7.3
(SEQ ID NO: 46 and 96 of WO2016065001), AAV CBr-B7.4 (SEQ ID NO: 47
and 97 of WO2016065001), AAV3B (SEQ ID NO: 48 and 98 of
WO2016065001), AAV4 (SEQ ID NO: 49 and 99 of WO2016065001), AAVS
(SEQ ID NO: 50 and 100 of WO2016065001), or variants or derivatives
thereof.
[0721] In one embodiment, the AAV may be a serotype comprising at
least one AAV capsid CD8+ T-cell epitope. As a non-limiting
example, the serotype may be AAV1, AAV2 or AAV8.
[0722] In one embodiment, the AAV may be a serotype selected from
any of those found in Table 4.
[0723] In one embodiment, the AAV may comprise a sequence, fragment
or variant thereof, of the sequences in Table 4.
[0724] In one embodiment, the AAV may be encoded by a sequence,
fragment or variant as described in Table 4.
TABLE-US-00004 TABLE 4 AAV Serotypes SEQ Serotype ID NO Reference
Information AAV1 28 US20150159173 SEQ ID NO: 11, US20150315612 SEQ
ID NO: 202 AAV1 29 US20160017295 SEQ ID NO: 1US20030138772 SEQ ID
NO: 64, US20150159173 SEQ ID NO: 27, US20150315612 SEQ ID NO: 219,
U.S. Pat. No. 7,198,951 SEQ ID NO: 5 AAV1 30 US20030138772 SEQ ID
NO: 6 AAV1.3 31 US20030138772 SEQ ID NO: 14 AAV10 32 US20030138772
SEQ ID NO: 117 AAV10 33 WO2015121501 SEQ ID NO: 9 AAV10 34
WO2015121501 SEQ ID NO: 8 AAV11 35 US20030138772 SEQ ID NO: 118
AAV12 36 US20030138772 SEQ ID NO: 119 AAV2 37 US20150159173 SEQ ID
NO: 7, US20150315612 SEQ ID NO: 211 AAV2 38 US20030138772 SEQ ID
NO: 70, US20150159173 SEQ ID NO: 23, US20150315612 SEQ ID NO: 221,
US20160017295 SEQ ID NO: 2, U.S. Pat. No. 6,156,303 SEQ ID NO: 4,
U.S. Pat. No. 7,198,951 SEQ ID NO: 4, WO2015121501 SEQ ID NO: 1
AAV2 39 U.S. Pat. No. 6,156,303 SEQ ID NO: 8 AAV2 40 US20030138772
SEQ ID NO: 7 AAV2 41 U.S. Pat. No. 6,156,303 SEQ ID NO: 3 AAV2.5T
42 U.S. Pat. No. 9,233,131 SEQ ID NO: 42 AAV223.10 43 US20030138772
SEQ ID NO: 75 AAV223.2 44 US20030138772 SEQ ID NO: 49 AAV223.2 45
US20030138772 SEQ ID NO: 76 AAV223.4 46 US20030138772 SEQ ID NO: 50
AAV223.4 47 US20030138772 SEQ ID NO: 73 AAV223.5 48 US20030138772
SEQ ID NO: 51 AAV223.5 49 US20030138772 SEQ ID NO: 74 AAV223.6 50
US20030138772 SEQ ID NO: 52 AAV223.6 51 US20030138772 SEQ ID NO: 78
AAV223.7 52 US20030138772 SEQ ID NO: 53 AAV223.7 53 US20030138772
SEQ ID NO: 77 AAV29.3 54 US20030138772 SEQ ID NO: 82 AAV29.4 55
US20030138772 SEQ ID NO: 12 AAV29.5 56 US20030138772 SEQ ID NO: 83
AAV29.5 57 US20030138772 SEQ ID NO: 13 (AAVbb.2) AAV3 58
US20150159173 SEQ ID NO: 12 AAV3 59 US20030138772 SEQ ID NO: 71,
US20150159173 SEQ ID NO: 28, US20160017295 SEQ ID NO: 3, U.S. Pat.
No. 7,198,951 SEQ ID NO: 6 AAV3 60 US20030138772 SEQ ID NO: 8
AAV3.3b 61 US20030138772 SEQ ID NO: 72 AAV3-3 62 US20150315612 SEQ
ID NO: 200 AAV3-3 63 US20150315612 SEQ ID NO: 217 AAV3a 64 U.S.
Pat. No. 6,156,303 SEQ ID NO: 5 AAV3a 65 U.S. Pat. No. 6,156,303
SEQ ID NO: 9 AAV3b 66 U.S. Pat. No. 6,156,303 SEQ ID NO: 6 AAV3b 67
U.S. Pat. No. 6,156,303 SEQ ID NO: 10 AAV3b 68 U.S. Pat. No.
6,156,303 SEQ ID NO: 1 AAV4 69 US20140348794 SEQ ID NO: 17 AAV4 70
US20140348794 SEQ ID NO: 5 AAV4 71 US20140348794 SEQ ID NO: 3 AAV4
72 US20140348794 SEQ ID NO: 14 AAV4 73 US20140348794 SEQ ID NO: 15
AAV4 74 US20140348794 SEQ ID NO: 19 AAV4 75 US20140348794 SEQ ID
NO: 12 AAV4 76 US20140348794 SEQ ID NO: 13 AAV4 77 US20140348794
SEQ ID NO: 7 AAV4 78 US20140348794 SEQ ID NO: 8 AAV4 79
US20140348794 SEQ ID NO: 9 AAV4 80 US20140348794 SEQ ID NO: 2 AAV4
81 US20140348794 SEQ ID NO: 10 AAV4 82 US20140348794 SEQ ID NO: 11
AAV4 83 US20140348794 SEQ ID NO: 18 AAV4 84 US20030138772 SEQ ID
NO: 63, US20160017295 SEQ ID NO: 4, US20140348794 SEQ ID NO: 4 AAV4
85 US20140348794 SEQ ID NO: 16 AAV4 86 US20140348794 SEQ ID NO: 20
AAV4 87 US20140348794 SEQ ID NO: 6 AAV4 88 US20140348794 SEQ ID NO:
1 AAV42.2 89 US20030138772 SEQ ID NO: 9 AAV42.2 90 US20030138772
SEQ ID NO: 102 AAV42.3b 91 US20030138772 SEQ ID NO: 36 AAV42.3B 92
US20030138772 SEQ ID NO: 107 AAV42.4 93 US20030138772 SEQ ID NO: 33
AAV42.4 94 US20030138772 SEQ ID NO: 88 AAV42.8 95 US20030138772 SEQ
ID NO: 27 AAV42.8 96 US20030138772 SEQ ID NO: 85 AAV43.1 97
US20030138772 SEQ ID NO: 39 AAV43.1 98 US20030138772 SEQ ID NO: 92
AAV43.12 99 US20030138772 SEQ ID NO: 41 AAV43.12 100 US20030138772
SEQ ID NO: 93 AAV43.20 101 US20030138772 SEQ ID NO: 42 AAV43.20 102
US20030138772 SEQ ID NO: 99 AAV43.21 103 US20030138772 SEQ ID NO:
43 AAV43.21 104 US20030138772 SEQ ID NO: 96 AAV43.23 105
US20030138772 SEQ ID NO: 44 AAV43.23 106 US20030138772 SEQ ID NO:
98 AAV43.25 107 US20030138772 SEQ ID NO: 45 AAV43.25 108
US20030138772 SEQ ID NO: 97 AAV43.5 109 US20030138772 SEQ ID NO: 40
AAV43.5 110 US20030138772 SEQ ID NO: 94 AAV4-4 111 US20150315612
SEQ ID NO: 201 AAV4-4 112 US20150315612 SEQ ID NO: 218 AAV44.1 113
US20030138772 SEQ ID NO: 46 AAV44.1 114 US20030138772 SEQ ID NO: 79
AAV44.5 115 US20030138772 SEQ ID NO: 47 AAV44.5 116 US20030138772
SEQ ID NO: 80 AAV4407 117 US20150315612 SEQ ID NO: 90 AAV5 118 U.S.
Pat. No. 7,427,396 SEQ ID NO: 1 AAV5 119 US20030138772 SEQ ID NO:
114 AAV5 120 US20160017295 SEQ ID NO: 5, U.S. Pat. No. 7,427,396
SEQ ID NO: 2, US20150315612 SEQ ID NO: 216 AAV5 121 US20150315612
SEQ ID NO: 199 AAV6 122 US20150159173 SEQ ID NO: 13 AAV6 123
US20030138772 SEQ ID NO: 65, US20150159173 SEQ ID NO: 29,
US20160017295 SEQ ID NO: 6, U.S. Pat. No. 6,156,303 SEQ ID NO: 7
AAV6 124 U.S. Pat. No. 6,156,303 SEQ ID NO: 11 AAV6 125 U.S. Pat.
No. 6,156,303 SEQ ID NO: 2 AAV6 126 US20150315612 SEQ ID NO: 203
AAV6 127 US20150315612 SEQ ID NO: 220 AAV6.1 128 US20150159173
AAV6.12 129 US20150159173 AAV6.2 130 US20150159173 AAV7 131
US20150159173 SEQ ID NO: 14 AAV7 132 US20150315612 SEQ ID NO: 183
AAV7 133 US20030138772 SEQ ID NO: 2, US20150159173 SEQ ID NO: 30,
US20150315612 SEQ ID NO: 181, US20160017295 SEQ ID NO: 7 AAV7 134
US20030138772 SEQ ID NO: 3 AAV7 135 US20030138772 SEQ ID NO: 1,
US20150315612 SEQ ID NO: 180 AAV7 136 US20150315612 SEQ ID NO: 213
AAV7 137 US20150315612 SEQ ID NO: 222 AAV8 138 US20150159173 SEQ ID
NO: 15 AAV8 139 US20150376240 SEQ ID NO: 7 AAV8 140 US20030138772
SEQ ID NO: 4, US20150315612 SEQ ID NO: 182 AAV8 141 US20030138772
SEQ ID NO: 95, US20140359799 SEQ ID NO: 1, US20150159173 SEQ ID NO:
31, US20160017295 SEQ ID NO: 8, U.S. Pat. No. 7,198,951 SEQ ID NO:
7, US20150315612 SEQ ID NO: 223 AAV8 142 US20150376240 SEQ ID NO: 8
AAV8 143 US20150315612 SEQ ID NO: 214 AAV-8b 144 US20150376240 SEQ
ID NO: 5 AAV-8b 145 US20150376240 SEQ ID NO: 3 AAV-8h 146
US20150376240 SEQ ID NO: 6 AAV-8h 147 US20150376240 SEQ ID NO: 4
AAV9 148 US20030138772 SEQ ID NO: 5 AAV9 149 U.S. Pat. No.
7,198,951 SEQ ID NO: 1 AAV9 150 US20160017295 SEQ ID NO: 9 AAV9 151
US20030138772 SEQ ID NO: 100, U.S. Pat. No. 7,198,951 SEQ ID NO: 2
AAV9 152 U.S. Pat. No. 7,198,951 SEQ ID NO: 3 AAV9 153 U.S. Pat.
No. 7,906,111 SEQ ID NO: 3; (AAVhu.14) WO2015038958 SEQ ID NO: 11
AAV9 154 U.S. Pat. No. 7,906,111 (AAVhu.14) SEQ ID NO: 123;
WO2015038958 SEQ ID NO: 2 AAVA3.1 155 US20030138772 SEQ ID NO: 120
AAVA3.3 156 US20030138772 SEQ ID NO: 57 AAVA3.3 157 US20030138772
SEQ ID NO: 66 AAVA3.4 158 US20030138772 SEQ ID NO: 54 AAVA3.4 159
US20030138772 SEQ ID NO: 68 AAVA3.5 160 US20030138772 SEQ ID NO: 55
AAVA3.5 161 US20030138772 SEQ ID NO: 69 AAVA3.7 162 US20030138772
SEQ ID NO: 56 AAVA3.7 163 US20030138772 SEQ ID NO: 67 AAV29.3 164
US20030138772 SEQ ID NO: 11 (AAVbb.1) AAVC2 165 US20030138772 SEQ
ID NO: 61 AAVCh.5 166 US20150159173 SEQ ID NO: 46, US20150315612
SEQ ID NO: 234 AAVcy.2 167 US20030138772 SEQ ID NO: 15 (AAV13.3)
AAV24.1 168 US20030138772 SEQ ID NO: 101 AAVcy.3 169 US20030138772
SEQ ID NO: 16 (AAV24.1) AAV27.3 170 US20030138772 SEQ ID NO: 104
AAVcy.4 171 US20030138772 SEQ ID NO: 17 (AAV27.3) AAVcy.5 172
US20150315612 SEQ ID NO: 227 AAV7.2 173 US20030138772 SEQ ID NO:
103 AAVcy.5 174 US20030138772 SEQ ID NO: 18 (AAV7.2) AAV16.3 175
US20030138772 SEQ ID NO: 105 AAVcy.6 176 US20030138772 SEQ ID NO:
10 (AAV16.3) AAVcy.5 177 US20150159173 SEQ ID NO: 8 AAVcy.5 178
US20150159173 SEQ ID NO: 24 AAVCy.5R1 179 US20150159173 AAVCy.5R2
180 US20150159173 AAVCy.5R3 181 US20150159173 AAVCy.5R4 182
US20150159173 AAVDJ 183 US20140359799 SEQ ID NO: 3, U.S. Pat. No.
7,588,772 SEQ ID NO: 2 AAVDJ 184 US20140359799 SEQ ID NO: 2, U.S.
Pat. No. 7,588,772 SEQ ID NO: 1 AAVDJ-8 185 U.S. Pat. No.
7,588,772; Grimm et al 2008 AAVDJ-8 186 U.S. Pat. No. 7,588,772;
Grimm et al 2008 AAVF5 187 US20030138772 SEQ ID NO: 110 AAVH2 188
US20030138772 SEQ ID NO: 26 AAVH6 189 US20030138772 SEQ ID NO: 25
AAVhE1.1 190 U.S. Pat. No. 9,233,131 SEQ ID NO: 44 AAVhEr1.14 191
U.S. Pat. No. 9,233,131 SEQ ID NO: 46 AAVhEr1.16 192 U.S. Pat. No.
9,233,131 SEQ ID NO: 48 AAVhEr1.18 193 U.S. Pat. No. 9,233,131 SEQ
ID NO: 49 AAVhEr1.23 194 U.S. Pat. No. 9,233,131 SEQ ID NO: 53
(AAVhEr2.29) AAVhEr1.35 195 U.S. Pat. No. 9,233,131 SEQ ID NO: 50
AAVhEr1.36 196 U.S. Pat. No. 9,233,131 SEQ ID NO: 52 AAVhEr1.5 197
U.S. Pat. No. 9,233,131 SEQ ID NO: 45 AAVhEr1.7 198 U.S. Pat. No.
9,233,131 SEQ ID NO: 51 AAVhEr1.8 199 U.S. Pat. No. 9,233,131 SEQ
ID NO: 47 AAVhEr2.16 200 U.S. Pat. No. 9,233,131 SEQ ID NO: 55
AAVhEr2.30 201 U.S. Pat. No. 9,233,131 SEQ ID NO: 56 AAVhEr2.31 202
U.S. Pat. No. 9,233,131 SEQ ID NO: 58 AAVhEr2.36 203 U.S. Pat. No.
9,233,131 SEQ ID NO: 57 AAVhEr2.4 204 U.S. Pat. No. 9,233,131 SEQ
ID NO: 54 AAVhEr3.1 205 U.S. Pat. No. 9,233,131 SEQ ID NO: 59
AAVhu.1 206 US20150315612 SEQ ID NO: 46 AAVhu.1 207 US20150315612
SEQ ID NO: 144 AAVhu.10 208 US20150315612 SEQ ID NO: 56 (AAV16.8)
AAVhu.10 209 US20150315612 SEQ ID NO: 156 (AAV16.8) AAVhu.11 210
US20150315612 SEQ ID NO: 57 (AAV16.12) AAVhu.11 211 US20150315612
SEQ ID NO: 153 (AAV16.12) AAVhu.12 212 US20150315612 SEQ ID NO: 59
AAVhu.12 213 US20150315612 SEQ ID NO: 154 AAVhu.13 214
US20150159173 SEQ ID NO: 16, US20150315612 SEQ ID NO: 71 AAVhu.13
215 US20150159173 SEQ ID NO: 32, US20150315612 SEQ ID NO: 129
AAVhu.136.1 216 US20150315612 SEQ ID NO: 165
AAVhu.140.1 217 US20150315612 SEQ ID NO: 166 AAVhu.140.2 218
US20150315612 SEQ ID NO: 167 AAVhu.145.6 219 US20150315612 SEQ ID
No: 178 AAVhu.15 220 US20150315612 SEQ ID NO: 147 AAVhu.15 221
US20150315612 SEQ ID NO: 50 (AAV33.4) AAVhu.156.1 222 US20150315612
SEQ ID No: 179 AAVhu.16 223 US20150315612 SEQ ID NO: 148 AAVhu.16
224 US20150315612 SEQ ID NO: 51 (AAV33.8) AAVhu.17 225
US20150315612 SEQ ID NO: 83 AAVhu.17 226 US20150315612 SEQ ID NO: 4
(AAV33.12) AAVhu.172.1 227 US20150315612 SEQ ID NO: 171 AAVhu.172.2
228 US20150315612 SEQ ID NO: 172 AAVhu.173.4 229 US20150315612 SEQ
ID NO: 173 AAVhu.173.8 230 US20150315612 SEQ ID NO: 175 AAVhu.18
231 US20150315612 SEQ ID NO: 52 AAVhu.18 232 US20150315612 SEQ ID
NO: 149 AAVhu.19 233 US20150315612 SEQ ID NO: 62 AAVhu.19 234
US20150315612 SEQ ID NO: 133 AAVhu.2 235 US20150315612 SEQ ID NO:
48 AAVhu.2 236 US20150315612 SEQ ID NO: 143 AAVhu.20 237
US20150315612 SEQ ID NO: 63 AAVhu.20 238 US20150315612 SEQ ID NO:
134 AAVhu.21 239 US20150315612 SEQ ID NO: 65 AAVhu.21 240
US20150315612 SEQ ID NO: 135 AAVhu.22 241 US20150315612 SEQ ID NO:
67 AAVhu.22 242 US20150315612 SEQ ID NO: 138 AAVhu.23 243
US20150315612 SEQ ID NO: 60 AAVhu.23.2 244 US20150315612 SEQ ID NO:
137 AAVhu.24 245 US20150315612 SEQ ID NO: 66 AAVhu.24 246
US20150315612 SEQ ID NO: 136 AAVhu.25 247 US20150315612 SEQ ID NO:
49 AAVhu.25 248 US20150315612 SEQ ID NO: 146 AAVhu.26 249
US20150159173 SEQ ID NO: 17, US20150315612 SEQ ID NO: 61 AAVhu.26
250 US20150159173 SEQ ID NO: 33, US20150315612 SEQ ID NO: 139
AAVhu.27 251 US20150315612 SEQ ID NO: 64 AAVhu.27 252 US20150315612
SEQ ID NO: 140 AAVhu.28 253 US20150315612 SEQ ID NO: 68 AAVhu.28
254 US20150315612 SEQ ID NO: 130 AAVhu.29 255 US20150315612 SEQ ID
NO: 69 AAVhu.29 256 US20150159173 SEQ ID NO: 42, US20150315612 SEQ
ID NO: 132 AAVhu.29 257 US20150315612 SEQ ID NO: 225 AAVhu.29R 258
US20150159173 AAVhu.3 259 US20150315612 SEQ ID NO: 44 AAVhu.3 260
US20150315612 SEQ ID NO: 145 AAVhu.30 261 US20150315612 SEQ ID NO:
70 AAVhu.30 262 US20150315612 SEQ ID NO: 131 AAVhu.31 263
US20150315612 SEQ ID NO: 1 AAVhu.31 264 US20150315612 SEQ ID NO:
121 AAVhu.32 265 US20150315612 SEQ ID NO: 2 AAVhu.32 266
US20150315612 SEQ ID NO: 122 AAVhu.33 267 US20150315612 SEQ ID NO:
75 AAVhu.33 268 US20150315612 SEQ ID NO: 124 AAVhu.34 269
US20150315612 SEQ ID NO: 72 AAVhu.34 270 US20150315612 SEQ ID NO:
125 AAVhu.35 271 US20150315612 SEQ ID NO: 73 AAVhu.35 272
US20150315612 SEQ ID NO: 164 AAVhu.36 273 US20150315612 SEQ ID NO:
74 AAVhu.36 274 US20150315612 SEQ ID NO: 126 AAVhu.37 275
US20150159173 SEQ ID NO: 34, US20150315612 SEQ ID NO: 88 AAVhu.37
276 US20150315612 SEQ ID NO: 10, (AAV106.1) US20150159173 SEQ ID
NO: 18 AAVhu.38 277 US20150315612 SEQ ID NO: 161 AAVhu.39 278
US20150315612 SEQ ID NO: 102 AAVhu.39 279 US20150315612 SEQ ID NO:
24 (AAVLG-9) AAVhu.4 280 US20150315612 SEQ ID NO: 47 AAVhu.4 281
US20150315612 SEQ ID NO: 141 AAVhu.40 282 US20150315612 SEQ ID NO:
87 AAVhu.40 283 US20150315612 SEQ ID No: 11 (AAV114.3) AAVhu.41 284
US20150315612 SEQ ID NO: 91 AAVhu.41 285 US20150315612 SEQ ID NO: 6
(AAV127.2) AAVhu.42 286 US20150315612 SEQ ID NO: 85 AAVhu.42 287
US20150315612 SEQ ID NO: 8 (AAV127.5) AAVhu.43 288 US20150315612
SEQ ID NO: 160 AAVhu.43 289 US20150315612 SEQ ID NO: 236 AAVhu.43
290 US20150315612 SEQ ID NO: 80 (AAV128.1) AAVhu.44 291
US20150159173 SEQ ID NO: 45, US20150315612 SEQ ID NO: 158 AAVhu.44
292 US20150315612 SEQ ID NO: 81 (AAV128.3) AAVhu.44R1 293
US20150159173 AAVhu.44R2 294 US20150159173 AAVhu.44R3 295
US20150159173 AAVhu.45 296 US20150315612 SEQ ID NO: 76 AAVhu.45 297
US20150315612 SEQ ID NO: 127 AAVhu.46 298 US20150315612 SEQ ID NO:
82 AAVhu.46 299 US20150315612 SEQ ID NO: 159 AAVhu.46 300
US20150315612 SEQ ID NO: 224 AAVhu.47 301 US20150315612 SEQ ID NO:
77 AAVhu.47 302 US20150315612 SEQ ID NO: 128 AAVhu.48 303
US20150159173 SEQ ID NO: 38 AAVhu.48 304 US20150315612 SEQ ID NO:
157 AAVhu.48 305 US20150315612 SEQ ID NO: 78 (AAV130.4) AAVhu.48R1
306 US20150159173 AAVhu.48R2 307 US20150159173 AAVhu.48R3 308
US20150159173 AAVhu.49 309 US20150315612 SEQ ID NO: 209 AAVhu.49
310 US20150315612 SEQ ID NO: 189 AAVhu.5 311 US20150315612 SEQ ID
NO: 45 AAVhu.5 312 US20150315612 SEQ ID NO: 142 AAVhu.51 313
US20150315612 SEQ ID NO: 208 AAVhu.51 314 US20150315612 SEQ ID NO:
190 AAVhu.52 315 US20150315612 SEQ ID NO: 210 AAVhu.52 316
US20150315612 SEQ ID NO: 191 AAVhu.53 317 US20150159173 SEQ ID NO:
19 AAVhu.53 318 US20150159173 SEQ ID NO: 35 AAVhu.53 319
US20150315612 SEQ ID NO: 176 (AAV145.1) AAVhu.54 320 US20150315612
SEQ ID NO: 188 AAVhu.54 321 US20150315612 SEQ ID No: 177 (AAV145.5)
AAVhu.55 322 US20150315612 SEQ ID NO: 187 AAVhu.56 323
US20150315612 SEQ ID NO: 205 AAVhu.56 324 US20150315612 SEQ ID NO:
168 (AAV145.6) AAVhu.56 325 US20150315612 SEQ ID NO: 192 (AAV145.6)
AAVhu.57 326 US20150315612 SEQ ID NO: 206 AAVhu.57 327
US20150315612 SEQ ID NO: 169 AAVhu.57 328 US20150315612 SEQ ID NO:
193 AAVhu.58 329 US20150315612 SEQ ID NO: 207 AAVhu.58 330
US20150315612 SEQ ID NO: 194 AAVhu.6 331 US20150315612 SEQ ID NO: 5
(AAV3.1) AAVhu.6 332 US20150315612 SEQ ID NO: 84 (AAV3.1) AAVhu.60
333 US20150315612 SEQ ID NO: 184 AAVhu.60 334 US20150315612 SEQ ID
NO: 170 (AAV161.10) AAVhu.61 335 US20150315612 SEQ ID NO: 185
AAVhu.61 336 US20150315612 SEQ ID NO: 174 (AAV161.6) AAVhu.63 337
US20150315612 SEQ ID NO: 204 AAVhu.63 338 US20150315612 SEQ ID NO:
195 AAVhu.64 339 US20150315612 SEQ ID NO: 212 AAVhu.64 340
US20150315612 SEQ ID NO: 196 AAVhu.66 341 US20150315612 SEQ ID NO:
197 AAVhu.67 342 US20150315612 SEQ ID NO: 215 AAVhu.67 343
US20150315612 SEQ ID NO: 198 AAVhu.7 344 US20150315612 SEQ ID NO:
226 AAVhu.7 345 US20150315612 SEQ ID NO: 150 AAVhu.7 346
US20150315612 SEQ ID NO: 55 (AAV7.3) AAVhu.71 347 US20150315612 SEQ
ID NO: 79 AAVhu.8 348 US20150315612 SEQ ID NO: 53 AAVhu.8 349
US20150315612 SEQ ID NO: 12 AAVhu.8 350 US20150315612 SEQ ID NO:
151 AAVhu.9 351 US20150315612 SEQ ID NO: 58 (AAV3.1) AAVhu.9 352
US20150315612 SEQ ID NO: 155 (AAV3.1) AAV-LK01 353 US20150376607
SEQ ID NO: 2 AAV-LK01 354 US20150376607 SEQ ID NO: 29 AAV-LK02 355
US20150376607 SEQ ID NO: 3 AAV-LK02 356 US20150376607 SEQ ID NO: 30
AAV-LK03 357 US20150376607 SEQ ID NO: 4 AAV-LK03 358 WO2015121501
SEQ ID NO: 12, US20150376607 SEQ ID NO: 31 AAV-LK04 359
US20150376607 SEQ ID NO: 5 AAV-LK04 360 US20150376607 SEQ ID NO: 32
AAV-LK05 361 US20150376607 SEQ ID NO: 6 AAV-LK05 362 US20150376607
SEQ ID NO: 33 AAV-LK06 363 US20150376607 SEQ ID NO: 7 AAV-LK06 364
US20150376607 SEQ ID NO: 34 AAV-LK07 365 US20150376607 SEQ ID NO: 8
AAV-LK07 366 US20150376607 SEQ ID NO: 35 AAV-LK08 367 US20150376607
SEQ ID NO: 9 AAV-LK08 368 US20150376607 SEQ ID NO: 36 AAV-LK09 369
US20150376607 SEQ ID NO: 10 AAV-LK09 370 US20150376607 SEQ ID NO:
37 AAV-LK10 371 US20150376607 SEQ ID NO: 11 AAV-LK10 372
US20150376607 SEQ ID NO: 38 AAV-LK11 373 US20150376607 SEQ ID NO:
12 AAV-LK11 374 US20150376607 SEQ ID NO: 39 AAV-LK12 375
US20150376607 SEQ ID NO: 13 AAV-LK12 376 US20150376607 SEQ ID NO:
40 AAV-LK13 377 US20150376607 SEQ ID NO: 14 AAV-LK13 378
US20150376607 SEQ ID NO: 41 AAV-LK14 379 US20150376607 SEQ ID NO:
15 AAV-LK14 380 US20150376607 SEQ ID NO: 42 AAV-LK15 381
US20150376607 SEQ ID NO: 16 AAV-LK15 382 US20150376607 SEQ ID NO:
43 AAV-LK16 383 US20150376607 SEQ ID NO: 17 AAV-LK16 384
US20150376607 SEQ ID NO: 44 AAV-LK17 385 US20150376607 SEQ ID NO:
18 AAV-LK17 386 US20150376607 SEQ ID NO: 45 AAV-LK18 387
US20150376607 SEQ ID NO: 19 AAV-LK18 388 US20150376607 SEQ ID NO:
46 AAV-LK19 389 US20150376607 SEQ ID NO: 20 AAV-LK19 390
US20150376607 SEQ ID NO: 47 AAV-PAEC 391 US20150376607 SEQ ID NO: 1
AAV-PAEC 392 US20150376607 SEQ ID NO: 48 AAV-PAEC11 393
US20150376607 SEQ ID NO: 26 AAV-PAEC11 394 US20150376607 SEQ ID NO:
54 AAV-PAEC12 395 US20150376607 SEQ ID NO: 27 AAV-PAEC12 396
US20150376607 SEQ ID NO: 51 AAV-PAEC13 397 US20150376607 SEQ ID NO:
28 AAV-PAEC13 398 US20150376607 SEQ ID NO: 49 AAV-PAEC2 399
US20150376607 SEQ ID NO: 21 AAV-PAEC2 400 US20150376607 SEQ ID NO:
56 AAV-PAEC4 401 US20150376607 SEQ ID NO: 22 AAV-PAEC4 402
US20150376607 SEQ ID NO: 55 AAV-PAEC6 403 US20150376607 SEQ ID NO:
23 AAV-PAEC6 404 US20150376607 SEQ ID NO: 52 AAV-PAEC7 405
US20150376607 SEQ ID NO: 24 AAV-PAEC7 406 US20150376607 SEQ ID NO:
53 AAV-PAEC8 407 US20150376607 SEQ ID NO: 25 AAV-PAEC8 408
US20150376607 SEQ ID NO: 50 AAVpi.1 409 US20150315612 SEQ ID NO: 28
AAVpi.1 410 US20150315612 SEQ ID NO: 93 AAVpi.2 411 US20150315612
SEQ ID NO: 30 AAVpi.2 412 US20150315612 SEQ ID NO: 95 AAVpi.3 413
US20150315612 SEQ ID NO: 29 AAVpi.3 414 US20150315612 SEQ ID NO: 94
AAVrh.10 415 US20150159173 SEQ ID NO: 9 AAVrh.10 416 US20150159173
SEQ ID NO: 25 AAV44.2 417 US20030138772 SEQ ID NO: 59 AAVrh.10 418
US20030138772 SEQ ID NO: 81 (AAV44.2) AAV42.1B 419 US20030138772
SEQ ID NO: 90 AAVrh.12 420 US20030138772 SEQ ID NO: 30 (AAV42.1b)
AAVrh.13 421 US20150159173 SEQ ID NO: 10 AAVrh.13 422 US20150159173
SEQ ID NO: 26 AAVrh.13 423 US20150315612 SEQ ID NO: 228 AAVrh.13R
424 US20150159173 AAV42.3A 425 US20030138772 SEQ ID NO: 87 AAVrh.14
426 US20030138772 SEQ ID NO: 32 (AAV42.3a) AAV42.5A 427
US20030138772 SEQ ID NO: 89 AAVrh.17 428 US20030138772 SEQ ID NO:
34 (AAV42.5a) AAV42.5B 429 US20030138772 SEQ ID NO: 91 AAVrh.18 430
US20030138772 SEQ ID NO: 29 (AAV42.5b) AAV42.6B 431 US20030138772
SEQ ID NO: 112 AAVrh.19 432 US20030138772 SEQ ID NO: 38 (AAV42.6b)
AAVrh.2 433 US20150159173 SEQ ID NO: 39
AAVrh.2 434 US20150315612 SEQ ID NO: 231 AAVrh.20 435 US20150159173
SEQ ID NO: 1 AAV42.10 436 US20030138772 SEQ ID NO: 106 AAVrh.21 437
US20030138772 SEQ ID NO: 35 (AAV42.10) AAV42.11 438 US20030138772
SEQ ID NO: 108 AAVrh.22 439 US20030138772 SEQ ID NO: 37 (AAV42.11)
AAV42.12 440 US20030138772 SEQ ID NO: 113 AAVrh.23 441
US20030138772 SEQ ID NO: 58 (AAV42.12) AAV42.13 442 US20030138772
SEQ ID NO: 86 AAVrh.24 443 US20030138772 SEQ ID NO: 31 (AAV42.13)
AAV42.15 444 US20030138772 SEQ ID NO: 84 AAVrh.25 445 US20030138772
SEQ ID NO: 28 (AAV42.15) AAVrh.2R 446 US20150159173 AAVrh.31 447
US20030138772 SEQ ID NO: 48 (AAV223.1) AAVC1 448 US20030138772 SEQ
ID NO: 60 AAVrh.32 449 US20030138772 SEQ ID NO: 19 (AAVC1)
AAVrh.32/33 450 US20150159173 SEQ ID NO: 2 AAVrh.33 451
US20030138772 SEQ ID NO: 20 (AAVC3) AAVC5 452 US20030138772 SEQ ID
NO: 62 AAVrh.34 453 US20030138772 SEQ ID NO: 21 (AAVC5) AAVF1 454
US20030138772 SEQ ID NO: 109 AAVrh.35 455 US20030138772 SEQ ID NO:
22 (AAVF1) AAVF3 456 US20030138772 SEQ ID NO: 111 AAVrh.36 457
US20030138772 SEQ ID NO: 23 (AAVF3) AAVrh.37 458 US20030138772 SEQ
ID NO: 24 AAVrh.37 459 US20150159173 SEQ ID NO: 40 AAVrh.37 460
US20150315612 SEQ ID NO: 229 AAVrh.37R2 461 US20150159173 AAVrh.38
462 US20150315612 SEQ ID NO: 7 (AAVLG-4) AAVrh.38 463 US20150315612
SEQ ID NO: 86 (AAVLG-4) AAVrh.39 464 US20150159173 SEQ ID NO: 20,
US20150315612 SEQ ID NO: 13 AAVrh.39 465 US20150159173 SEQ ID NO:
3, US20150159173 SEQ ID NO: 36, US20150315612 SEQ ID NO: 89
AAVrh.40 466 US20150315612 SEQ ID NO: 92 AAVrh.40 467 US20150315612
SEQ ID No: 14 (AAVLG-10) AAVrh.43 468 US20150315612 SEQ ID NO: 43,
(AAVN721-8) US20150159173 SEQ ID NO: 21 AAVrh.43 469 US20150315612
SEQ ID NO: 163, (AAVN721-8) US20150159173 SEQ ID NO: 37 AAVrh.44
470 US20150315612 SEQ ID NO: 34 AAVrh.44 471 US20150315612 SEQ ID
NO: 111 AAVrh.45 472 US20150315612 SEQ ID NO: 41 AAVrh.45 473
US20150315612 SEQ ID NO: 109 AAVrh.46 474 US20150159173 SEQ ID NO:
22, US20150315612 SEQ ID NO: 19 AAVrh.46 475 US20150159173 SEQ ID
NO: 4, US20150315612 SEQ ID NO: 101 AAVrh.47 476 US20150315612 SEQ
ID NO: 38 AAVrh.47 477 US20150315612 SEQ ID NO: 118 AAVrh.48 478
US20150159173 SEQ ID NO: 44, US20150315612 SEQ ID NO: 115
AAVrh.48.1 479 US20150159173 AAVrh.48.1.2 480 US20150159173
AAVrh.48.2 481 US20150159173 AAVrh.48 482 US20150315612 SEQ ID NO:
32 (AAV1-7) AAVrh.49 483 US20150315612 SEQ ID NO: 25 (AAV1-8)
AAVrh.49 484 US20150315612 SEQ ID NO: 103 (AAV1-8) AAVrh.50 485
US20150315612 SEQ ID NO: 23 (AAV2-4) AAVrh.50 486 US20150315612 SEQ
ID NO: 108 (AAV2-4) AAVrh.51 487 US20150315612 SEQ ID No: 22
(AAV2-5) AAVrh.51 488 US20150315612 SEQ ID NO: 104 (AAV2-5)
AAVrh.52 489 US20150315612 SEQ ID NO: 18 (AAV3-9) AAVrh.52 490
US20150315612 SEQ ID NO: 96 (AAV3-9) AAVrh.53 491 US20150315612 SEQ
ID NO: 97 AAVrh.53 492 US20150315612 SEQ ID NO: 17 (AAV3-11)
AAVrh.53 493 US20150315612 SEQ ID NO: 186 (AAV3-11) AAVrh.54 494
US20150315612 SEQ ID NO: 40 AAVrh.54 495 US20150159173 SEQ ID NO:
49, US20150315612 SEQ ID NO: 116 AAVrh.55 496 US20150315612 SEQ ID
NO: 37 AAVrh.55 497 US20150315612 SEQ ID NO: 117 (AAV4-19) AAVrh.56
498 US20150315612 SEQ ID NO: 54 AAVrh.56 499 US20150315612 SEQ ID
NO: 152 AAVrh.57 500 US20150315612 SEQ ID NO: 26 AAVrh.57 501
US20150315612 SEQ ID NO: 105 AAVrh.58 502 US20150315612 SEQ ID NO:
27 AAVrh.58 503 US20150159173 SEQ ID NO: 48, US20150315612 SEQ ID
NO: 106 AAVrh.58 504 US20150315612 SEQ ID NO: 232 AAVrh.59 505
US20150315612 SEQ ID NO: 42 AAVrh.59 506 US20150315612 SEQ ID NO:
110 AAVrh.60 507 US20150315612 SEQ ID NO: 31 AAVrh.60 508
US20150315612 SEQ ID NO: 120 AAVrh.61 509 US20150315612 SEQ ID NO:
107 AAVrh.61 510 US20150315612 SEQ ID NO: 21 (AAV2-3) AAVrh.62 511
US20150315612 SEQ ID No: 33 (AAV2-15) AAVrh.62 512 US20150315612
SEQ ID NO: 114 (AAV2-15) AAVrh.64 513 US20150315612 SEQ ID No: 15
AAVrh.64 514 US20150159173 SEQ ID NO: 43, US20150315612 SEQ ID NO:
99 AAVrh.64 515 US20150315612 SEQ ID NO: 233 AAVRh.64R1 516
US20150159173 AAVRh.64R2 517 US20150159173 AAVrh.65 518
US20150315612 SEQ ID NO: 35 AAVrh.65 519 US20150315612 SEQ ID NO:
112 AAVrh.67 520 US20150315612 SEQ ID NO: 36 AAVrh.67 521
US20150315612 SEQ ID NO: 230 AAVrh.67 522 US20150159173 SEQ ID NO:
47, US20150315612 SEQ ID NO: 113 AAVrh.68 523 US20150315612 SEQ ID
NO: 16 AAVrh.68 524 US20150315612 SEQ ID NO: 100 AAVrh.69 525
US20150315612 SEQ ID NO: 39 AAVrh.69 526 US20150315612 SEQ ID NO:
119 AAVrh.70 527 US20150315612 SEQ ID NO: 20 AAVrh.70 528
US20150315612 SEQ ID NO: 98 AAVrh.71 529 US20150315612 SEQ ID NO:
162 AAVrh.72 530 US20150315612 SEQ ID NO: 9 AAVrh.73 531
US20150159173 SEQ ID NO: 5 AAVrh.74 532 US20150159173 SEQ ID NO: 6
AAVrh.8 533 US20150159173 SEQ ID NO: 41 AAVrh.8 534 US20150315612
SEQ ID NO: 235 AAVrh.8R 535 US20150159173, WO2015168666 SEQ ID NO:
9 AAVrh.8R 536 WO2015168666 SEQ ID NO: 10 A586R mutant AAVrh.8R 537
WO2015168666 SEQ ID NO: 11 R533A mutant BAAV 538 U.S. Pat. No.
9,193,769 SEQ ID NO: 8 (bovine AAV) BAAV 539 U.S. Pat. No.
9,193,769 SEQ ID NO: 10 (bovine AAV) BAAV 540 U.S. Pat. No.
9,193,769 SEQ ID NO: 4 (bovine AAV) BAAV 541 U.S. Pat. No.
9,193,769 SEQ ID NO: 2 (bovine AAV) BAAV 542 U.S. Pat. No.
9,193,769 SEQ ID NO: 6 (bovine AAV) BAAV 543 U.S. Pat. No.
9,193,769 SEQ ID NO: 1 (bovine AAV) BAAV 544 U.S. Pat. No.
9,193,769 SEQ ID NO: 5 (bovine AAV) BAAV 545 U.S. Pat. No.
9,193,769 SEQ ID NO: 3 (bovine AAV) BAAV 546 U.S. Pat. No.
9,193,769 SEQ ID NO: 11 (bovine AAV) BAAV 547 U.S. Pat. No.
7,427,396 SEQ ID NO: 5 (bovine AAV) BAAV 548 U.S. Pat. No.
7,427,396 SEQ ID NO: 6 (bovine AAV) BAAV 549 U.S. Pat. No.
9,193,769 SEQ ID NO: 7 (bovine AAV) BAAV 550 U.S. Pat. No.
9,193,769 SEQ ID NO: 9 (bovine AAV) BNP61 AAV 551 US20150238550 SEQ
ID NO: 1 BNP61 AAV 552 US20150238550 SEQ ID NO: 2 BNP62 AAV 553
US20150238550 SEQ ID NO: 3 BNP63 AAV 554 US20150238550 SEQ ID NO: 4
caprine AAV 555 U.S. Pat. No. 7,427,396 SEQ ID NO: 3 caprine AAV
556 U.S. Pat. No. 7,427,396 SEQ ID NO: 4 true type AAV 557
WO2015121501 SEQ ID NO: 2 (ttAAV) AAAV 558 U.S. Pat. No. 9,238,800
SEQ ID NO: 12 (Avian AAV) AAAV 559 U.S. Pat. No. 9,238,800 SEQ ID
NO: 2 (Avian AAV) AAAV 560 U.S. Pat. No. 9,238,800 SEQ ID NO: 6
(Avian AAV) AAAV 561 U.S. Pat. No. 9,238,800 SEQ ID NO: 4 (Avian
AAV) AAAV 562 U.S. Pat. No. 9,238,800 SEQ ID NO: 8 (Avian AAV) AAAV
563 U.S. Pat. No. 9,238,800 SEQ ID NO: 14 (Avian AAV) AAAV 564 U.S.
Pat. No. 9,238,800 SEQ ID NO: 10 (Avian AAV) AAAV 565 U.S. Pat. No.
9,238,800 SEQ ID NO: 15 (Avian AAV) AAAV 566 U.S. Pat. No.
9,238,800 SEQ ID NO: 5 (Avian AAV) AAAV 567 U.S. Pat. No. 9,238,800
SEQ ID NO: 9 (Avian AAV) AAAV 568 U.S. Pat. No. 9,238,800 SEQ ID
NO: 3 (Avian AAV) AAAV 569 U.S. Pat. No. 9,238,800 SEQ ID NO: 7
(Avian AAV) AAAV 570 U.S. Pat. No. 9,238,800 SEQ ID NO: 11 (Avian
AAV) AAAV 571 U.S. Pat. No. 9,238,800 SEQ ID NO: 13 (Avian AAV)
AAAV 572 U.S. Pat. No. 9,238,800 SEQ ID NO: 1 (Avian AAV) AAV
Shuffle 573 US20160017295 SEQ ID NO: 23 100-1 AAV Shuffle 574
US20160017295 SEQ ID NO: 11 100-1 AAV Shuffle 575 US20160017295 SEQ
ID NO: 37 100-2 AAV Shuffle 576 US20160017295 SEQ ID NO: 29 100-2
AAV Shuffle 577 US20160017295 SEQ ID NO: 24 100-3 AAV Shuffle 578
US20160017295 SEQ ID NO: 12 100-3 AAV Shuffle 579 US20160017295 SEQ
ID NO: 25 100-7 AAV Shuffle 580 US20160017295 SEQ ID NO: 13 100-7
AAV Shuffle 10-2 581 US20160017295 SEQ ID NO: 34 AAV Shuffle 10-2
582 US20160017295 SEQ ID NO: 26 AAV Shuffle 10-6 583 US20160017295
SEQ ID NO: 35 AAV Shuffle 10-6 584 US20160017295 SEQ ID NO: 27 AAV
Shuffle 10-8 585 US20160017295 SEQ ID NO: 36 AAV Shuffle 10-8 586
US20160017295 SEQ ID NO: 28 AAV SM 100-10 587 US20160017295 SEQ ID
NO: 41 AAV SM 100-10 588 US20160017295 SEQ ID NO: 33 AAV SM 100-3
589 US20160017295 SEQ ID NO: 40 AAV SM 100-3 590 US20160017295 SEQ
ID NO: 32 AAV SM 10-1 591 US20160017295 SEQ ID NO: 38 AAV SM 10-1
592 US20160017295 SEQ ID NO: 30 AAV SM 10-2 593 US20160017295 SEQ
ID NO: 10 AAV SM 10-2 594 US20160017295 SEQ ID NO: 22 AAV SM 10-8
595 US20160017295 SEQ ID NO: 39 AAV SM 10-8 596 US20160017295 SEQ
ID NO: 31 AAV SM 100-10 587 US20160017295 SEQ ID NO: 41 AAV SM
100-10 588 US20160017295 SEQ ID NO: 33 AAV SM 100-3 589
US20160017295 SEQ ID NO: 40 AAV SM 100-3 590 US20160017295 SEQ ID
NO: 32 AAV SM 10-1 591 US20160017295 SEQ ID NO: 38 AAV SM 10-1 592
US20160017295 SEQ ID NO: 30 AAV SM 10-2 593 US20160017295 SEQ ID
NO: 10
AAV SM 10-2 594 US20160017295 SEQ ID NO: 22 AAV SM 10-8 595
US20160017295 SEQ ID NO: 39 AAV SM 10-8 596 US20160017295 SEQ ID
NO: 31 AAVF1/HSC1 597 WO2016049230 SEQ ID NO: 20 AAVF2/HSC2 598
WO2016049230 SEQ ID NO: 21 AAVF3/HSC3 599 WO2016049230 SEQ ID NO:
22 AAVF4/HSC4 600 WO2016049230 SEQ ID NO: 23 AAVF5/HSC5 601
WO2016049230 SEQ ID NO: 25 AAVF6/HSC6 602 WO2016049230 SEQ ID NO:
24 AAVF7/HSC7 603 WO2016049230 SEQ ID NO: 27 AAVF8/HSC8 604
WO2016049230 SEQ ID NO: 28 AAVF9/HSC9 605 WO2016049230 SEQ ID NO:
29 AAVF11/HSC11 606 WO2016049230 SEQ ID NO: 26 AAVF12/HSC12 607
WO2016049230 SEQ ID NO: 30 AAVF13/HSC13 608 WO2016049230 SEQ ID NO:
31 AAVF14/HSC14 609 WO2016049230 SEQ ID NO: 32 AAVF15/HSC15 610
WO2016049230 SEQ ID NO: 33 AAVF16/HSC16 611 WO2016049230 SEQ ID NO:
34 AAVF17/HSC17 612 WO2016049230 SEQ ID NO: 35 AAVF1/HSC1 613
WO2016049230 SEQ ID NO: 2 AAVF2/HSC2 614 WO2016049230 SEQ ID NO: 3
AAVF3/HSC3 615 WO2016049230 SEQ ID NO: 5 AAVF4/HSC4 616
WO2016049230 SEQ ID NO: 6 AAVF5/HSC5 617 WO2016049230 SEQ ID NO: 11
AAVF6/HSC6 618 WO2016049230 SEQ ID NO: 7 AAVF7/HSC7 619
WO2016049230 SEQ ID NO: 8 AAVF8/HSC8 620 WO2016049230 SEQ ID NO: 9
AAVF9/HSC9 621 WO2016049230 SEQ ID NO: 10 AAVF11/HSC11 622
WO2016049230 SEQ ID NO: 4 AAVF12/HSC12 623 WO2016049230 SEQ ID NO:
12 AAVF13/HSC13 624 WO2016049230 SEQ ID NO: 14 AAVF14/HSC14 625
WO2016049230 SEQ ID NO: 15 AAVF15/HSC15 626 WO2016049230 SEQ ID NO:
16 AAVF16/HSC16 627 WO2016049230 SEQ ID NO: 17 AAVF17/HSC17 628
WO2016049230 SEQ ID NO: 13 AAV CBr-E1 629 U.S. Pat. No. 8,734,809
SEQ ID NO: 13 AAV CBr-E2 630 U.S. Pat. No. 8,734,809 SEQ ID NO: 14
AAV CBr-E3 631 U.S. Pat. No. 8,734,809 SEQ ID NO: 15 AAV CBr-E4 632
U.S. Pat. No. 8,734,809 SEQ ID NO: 16 AAV CBr-E5 633 U.S. Pat. No.
8,734,809 SEQ ID NO: 17 AAV CBr-e5 634 U.S. Pat. No. 8,734,809 SEQ
ID NO: 18 AAV CBr-E6 635 U.S. Pat. No. 8,734,809 SEQ ID NO: 19 AAV
CBr-E7 636 U.S. Pat. No. 8,734,809 SEQ ID NO: 20 AAV CBr-E8 637
U.S. Pat. No. 8,734,809 SEQ ID NO: 21 AAV CLv-D1 638 U.S. Pat. No.
8,734,809 SEQ ID NO: 22 AAV CLv-D2 639 U.S. Pat. No. 8,734,809 SEQ
ID NO: 23 AAV CLv-D3 640 U.S. Pat. No. 8,734,809 SEQ ID NO: 24 AAV
CLv-D4 641 U.S. Pat. No. 8,734,809 SEQ ID NO: 25 AAV CLv-D5 642
U.S. Pat. No. 8,734,809 SEQ ID NO: 26 AAV CLv-D6 643 U.S. Pat. No.
8,734,809 SEQ ID NO: 27 AAV CLv-D7 644 U.S. Pat. No. 8,734,809 SEQ
ID NO: 28 AAV CLv-D8 645 U.S. Pat. No. 8,734,809 SEQ ID NO: 29 AAV
CLv-E1 646 U.S. Pat. No. 8,734,809 SEQ ID NO: 13 AAV CLv-R1 647
U.S. Pat. No. 8,734,809 SEQ ID NO: 30 AAV CLv-R2 648 U.S. Pat. No.
8,734,809 SEQ ID NO: 31 AAV CLv-R3 649 U.S. Pat. No. 8,734,809 SEQ
ID NO: 32 AAV CLv-R4 650 U.S. Pat. No. 8,734,809 SEQ ID NO: 33 AAV
CLv-R5 651 U.S. Pat. No. 8,734,809 SEQ ID NO: 34 AAV CLv-R6 652
U.S. Pat. No. 8,734,809 SEQ ID NO: 35 AAV CLv-R7 653 U.S. Pat. No.
8,734,809 SEQ ID NO: 36 AAV CLv-R8 654 U.S. Pat. No. 8,734,809 SEQ
ID NO: 37 AAV CLv-R9 655 U.S. Pat. No. 8,734,809 SEQ ID NO: 38 AAV
CLg-F1 656 U.S. Pat. No. 8,734,809 SEQ ID NO: 39 AAV CLg-F2 657
U.S. Pat. No. 8,734,809 SEQ ID NO: 40 AAV CLg-F3 658 U.S. Pat. No.
8,734,809 SEQ ID NO: 41 AAV CLg-F4 659 U.S. Pat. No. 8,734,809 SEQ
ID NO: 42 AAV CLg-F5 660 U.S. Pat. No. 8,734,809 SEQ ID NO: 43 AAV
CLg-F6 661 U.S. Pat. No. 8,734,809 SEQ ID NO: 43 AAV CLg-F7 662
U.S. Pat. No. 8,734,809 SEQ ID NO: 44 AAV CLg-F8 663 U.S. Pat. No.
8,734,809 SEQ ID NO: 43 AAV CSp-1 664 U.S. Pat. No. 8,734,809 SEQ
ID NO: 45 AAV CSp-10 665 U.S. Pat. No. 8,734,809 SEQ ID NO: 46 AAV
CSp-11 666 U.S. Pat. No. 8,734,809 SEQ ID NO: 47 AAV CSp-2 667 U.S.
Pat. No. 8,734,809 SEQ ID NO: 48 AAV CSp-3 668 U.S. Pat. No.
8,734,809 SEQ ID NO: 49 AAV CSp-4 669 U.S. Pat. No. 8,734,809 SEQ
ID NO: 50 AAV CSp-6 670 U.S. Pat. No. 8,734,809 SEQ ID NO: 51 AAV
CSp-7 671 U.S. Pat. No. 8,734,809 SEQ ID NO: 52 AAV CSp-8 672 U.S.
Pat. No. 8,734,809 SEQ ID NO: 53 AAV CSp-9 673 U.S. Pat. No.
8,734,809 SEQ ID NO: 54 AAV CHt-2 674 U.S. Pat. No. 8,734,809 SEQ
ID NO: 55 AAV CHt-3 675 U.S. Pat. No. 8,734,809 SEQ ID NO: 56 AAV
CKd-1 676 U.S. Pat. No. 8,734,809 SEQ ID NO: 57 AAV CKd-10 677 U.S.
Pat. No. 8,734,809 SEQ ID NO: 58 AAV CKd-2 678 U.S. Pat. No.
8,734,809 SEQ ID NO: 59 AAV CKd-3 679 U.S. Pat. No. 8,734,809 SEQ
ID NO: 60 AAV CKd-4 680 U.S. Pat. No. 8,734,809 SEQ ID NO: 61 AAV
CKd-6 681 U.S. Pat. No. 8,734,809 SEQ ID NO: 62 AAV CKd-7 682 U.S.
Pat. No. 8,734,809 SEQ ID NO: 63 AAV CKd-8 683 U.S. Pat. No.
8,734,809 SEQ ID NO: 64 AAV CLv-1 684 U.S. Pat. No. 8,734,809 SEQ
ID NO: 65 AAV CLv-12 685 U.S. Pat. No. 8,734,809 SEQ ID NO: 66 AAV
CLv-13 686 U.S. Pat. No. 8,734,809 SEQ ID NO: 67 AAV CLv-2 687 U.S.
Pat. No. 8,734,809 SEQ ID NO: 68 AAV CLv-3 688 U.S. Pat. No.
8,734,809 SEQ ID NO: 69 AAV CLv-4 689 U.S. Pat. No. 8,734,809 SEQ
ID NO: 70 AAV CLv-6 690 U.S. Pat. No. 8,734,809 SEQ ID NO: 71 AAV
CLv-8 691 U.S. Pat. No. 8,734,809 SEQ ID NO: 72 AAV CKd-B1 692 U.S.
Pat. No. 8,734,809 SEQ ID NO: 73 AAV CKd-B2 693 U.S. Pat. No.
8,734,809 SEQ ID NO: 74 AAV CKd-B3 694 U.S. Pat. No. 8,734,809 SEQ
ID NO: 75 AAV CKd-B4 695 U.S. Pat. No. 8,734,809 SEQ ID NO: 76 AAV
CKd-B5 696 U.S. Pat. No. 8,734,809 SEQ ID NO: 77 AAV CKd-B6 697
U.S. Pat. No. 8,734,809 SEQ ID NO: 78 AAV CKd-B7 698 U.S. Pat. No.
8,734,809 SEQ ID NO: 79 AAV CKd-B8 699 U.S. Pat. No. 8,734,809 SEQ
ID NO: 80 AAV CKd-H1 700 U.S. Pat. No. 8,734,809 SEQ ID NO: 81 AAV
CKd-H2 701 U.S. Pat. No. 8,734,809 SEQ ID NO: 82 AAV CKd-H3 702
U.S. Pat. No. 8,734,809 SEQ ID NO: 83 AAV CKd-H4 703 U.S. Pat. No.
8,734,809 SEQ ID NO: 84 AAV CKd-H5 704 U.S. Pat. No. 8,734,809 SEQ
ID NO: 85 AAV CKd-H6 705 U.S. Pat. No. 8,734,809 SEQ ID NO: 77 AAV
CHt-1 706 U.S. Pat. No. 8,734,809 SEQ ID NO: 86 AAV CLv1-1 707 U.S.
Pat. No. 8,734,809 SEQ ID NO: 171 AAV CLv1-2 708 U.S. Pat. No.
8,734,809 SEQ ID NO: 172 AAV CLv1-3 709 U.S. Pat. No. 8,734,809 SEQ
ID NO: 173 AAV CLv1-4 710 U.S. Pat. No. 8,734,809 SEQ ID NO: 174
AAV Clv1-7 711 U.S. Pat. No. 8,734,809 SEQ ID NO: 175 AAV Clv1-8
712 U.S. Pat. No. 8,734,809 SEQ ID NO: 176 AAV Clv1-9 713 U.S. Pat.
No. 8,734,809 SEQ ID NO: 177 AAV Clv1-10 714 U.S. Pat. No.
8,734,809 SEQ ID NO: 178 AAV. VR-355 715 U.S. Pat. No. 8,734,809
SEQ ID NO: 181 AAV.hu.48R3 716 U.S. Pat. No. 8,734,809 SEQ ID NO:
183 AAV CBr-E1 717 U.S. Pat. No. 8,734,809 SEQ ID NO: 87 AAV CBr-E2
718 U.S. Pat. No. 8,734,809 SEQ ID NO: 88 AAV CBr-E3 719 U.S. Pat.
No. 8,734,809 SEQ ID NO: 89 AAV CBr-E4 720 U.S. Pat. No. 8,734,809
SEQ ID NO: 90 AAV CBr-E5 721 U.S. Pat. No. 8,734,809 SEQ ID NO: 91
AAV CBr-e5 722 U.S. Pat. No. 8,734,809 SEQ ID NO: 92 AAV CBr-E6 723
U.S. Pat. No. 8,734,809 SEQ ID NO: 93 AAV CBr-E7 724 U.S. Pat. No.
8,734,809 SEQ ID NO: 94 AAV CBr-E8 725 U.S. Pat. No. 8,734,809 SEQ
ID NO: 95 AAV CLv-D1 726 U.S. Pat. No. 8,734,809 SEQ ID NO: 96 AAV
CLv-D2 727 U.S. Pat. No. 8,734,809 SEQ ID NO: 97 AAV CLv-D3 728
U.S. Pat. No. 8,734,809 SEQ ID NO: 98 AAV CLv-D4 729 U.S. Pat. No.
8,734,809 SEQ ID NO: 99 AAV CLv-D5 730 U.S. Pat. No. 8,734,809 SEQ
ID NO: 100 AAV CLv-D6 731 U.S. Pat. No. 8,734,809 SEQ ID NO: 101
AAV CLv-D7 732 U.S. Pat. No. 8,734,809 SEQ ID NO: 102 AAV CLv-D8
733 U.S. Pat. No. 8,734,809 SEQ ID NO: 103 AAV CLv-E1 734 U.S. Pat.
No. 8,734,809 SEQ ID NO: 87 AAV CLv-R1 735 U.S. Pat. No. 8,734,809
SEQ ID NO: 104 AAV CLv-R2 736 U.S. Pat. No. 8,734,809 SEQ ID NO:
105 AAV CLv-R3 737 U.S. Pat. No. 8,734,809 SEQ ID NO: 106 AAV
CLv-R4 738 U.S. Pat. No. 8,734,809 SEQ ID NO: 107 AAV CLv-R5 739
U.S. Pat. No. 8,734,809 SEQ ID NO: 108 AAV CLv-R6 740 U.S. Pat. No.
8,734,809 SEQ ID NO: 109 AAV CLv-R7 741 U.S. Pat. No. 8,734,809 SEQ
ID NO: 110 AAV CLv-R8 742 U.S. Pat. No. 8,734,809 SEQ ID NO: 111
AAV CLv-R9 743 U.S. Pat. No. 8,734,809 SEQ ID NO: 112 AAV CLg-F1
744 U.S. Pat. No. 8,734,809 SEQ ID NO: 113 AAV CLg-F2 745 U.S. Pat.
No. 8,734,809 SEQ ID NO: 114 AAV CLg-F3 746 U.S. Pat. No. 8,734,809
SEQ ID NO: 115 AAV CLg-F4 747 U.S. Pat. No. 8,734,809 SEQ ID NO:
116 AAV CLg-F5 748 U.S. Pat. No. 8,734,809 SEQ ID NO: 117 AAV
CLg-F6 749 U.S. Pat. No. 8,734,809 SEQ ID NO: 117 AAV CLg-F7 750
U.S. Pat. No. 8,734,809 SEQ ID NO: 118 AAV CLg-F8 751 U.S. Pat. No.
8,734,809 SEQ ID NO: 117 AAV CSp-1 752 U.S. Pat. No. 8,734,809 SEQ
ID NO: 119 AAV CSp-10 753 U.S. Pat. No. 8,734,809 SEQ ID NO: 120
AAV CSp-11 754 U.S. Pat. No. 8,734,809 SEQ ID NO: 121 AAV CSp-2 755
U.S. Pat. No. 8,734,809 SEQ ID NO: 122 AAV CSp-3 756 U.S. Pat. No.
8,734,809 SEQ ID NO: 123 AAV CSp-4 757 U.S. Pat. No. 8,734,809 SEQ
ID NO: 124 AAV CSp-6 758 U.S. Pat. No. 8,734,809 SEQ ID NO: 125 AAV
CSp-7 759 U.S. Pat. No. 8,734,809 SEQ ID NO: 126 AAV CSp-8 760 U.S.
Pat. No. 8,734,809 SEQ ID NO: 127 AAV CSp-9 761 U.S. Pat. No.
8,734,809 SEQ ID NO: 128 AAV CHt-2 762 U.S. Pat. No. 8,734,809 SEQ
ID NO: 129 AAV CHt-3 763 U.S. Pat. No. 8,734,809 SEQ ID NO: 130 AAV
CKd-1 764 U.S. Pat. No. 8,734,809 SEQ ID NO: 131 AAV CKd-10 765
U.S. Pat. No. 8,734,809 SEQ ID NO: 132 AAV CKd-2 766 U.S. Pat. No.
8,734,809 SEQ ID NO: 133 AAV CKd-3 767 U.S. Pat. No. 8,734,809 SEQ
ID NO: 134 AAV CKd-4 768 U.S. Pat. No. 8,734,809 SEQ ID NO: 135 AAV
CKd-6 769 U.S. Pat. No. 8,734,809 SEQ ID NO: 136 AAV CKd-7 770 U.S.
Pat. No. 8,734,809 SEQ ID NO: 137 AAV CKd-8 771 U.S. Pat. No.
8,734,809 SEQ ID NO: 138 AAV CLv-1 772 U.S. Pat. No. 8,734,809 SEQ
ID NO: 139 AAV CLv-12 773 U.S. Pat. No. 8,734,809 SEQ ID NO: 140
AAV CLv-13 774 U.S. Pat. No. 8,734,809 SEQ ID NO: 141 AAV CLv-2 775
U.S. Pat. No. 8,734,809 SEQ ID NO: 142 AAV CLv-3 776 U.S. Pat. No.
8,734,809 SEQ ID NO: 143 AAV CLv-4 777 U.S. Pat. No. 8,734,809 SEQ
ID NO: 144 AAV CLv-6 778 U.S. Pat. No. 8,734,809 SEQ ID NO: 145 AAV
CLv-8 779 U.S. Pat. No. 8,734,809 SEQ ID NO: 146 AAV CKd-B1 780
U.S. Pat. No. 8,734,809 SEQ ID NO: 147 AAV CKd-B2 781 U.S. Pat. No.
8,734,809 SEQ ID NO: 148 AAV CKd-B3 782 U.S. Pat. No. 8,734,809 SEQ
ID NO: 149 AAV CKd-B4 783 U.S. Pat. No. 8,734,809 SEQ ID NO: 150
AAV CKd-B5 784 U.S. Pat. No. 8,734,809 SEQ ID NO: 151 AAV CKd-B6
785 U.S. Pat. No. 8,734,809 SEQ ID NO: 152 AAV CKd-B7 786 U.S. Pat.
No. 8,734,809 SEQ ID NO: 153 AAV CKd-B8 787 U.S. Pat. No. 8,734,809
SEQ ID NO: 154 AAV CKd-H1 788 U.S. Pat. No. 8,734,809 SEQ ID NO:
155 AAV CKd-H2 789 U.S. Pat. No. 8,734,809 SEQ ID NO: 156 AAV
CKd-H3 790 U.S. Pat. No. 8,734,809 SEQ ID NO: 157 AAV CKd-H4 791
U.S. Pat. No. 8,734,809 SEQ ID NO: 158 AAV CKd-H5 792 U.S. Pat. No.
8,734,809 SEQ ID NO: 159 AAV CKd-H6 793 U.S. Pat. No. 8,734,809 SEQ
ID NO: 151 AAV CHt-1 794 U.S. Pat. No. 8,734,809 SEQ ID NO: 160 AAV
CHt-P2 795 WO2016065001 SEQ ID NO: 1 AAV CHt-P5 796 WO2016065001
SEQ ID NO: 2 AAV CHt-P9 797 WO2016065001 SEQ ID NO: 3 AAV CBr-7.1
798 WO2016065001 SEQ ID NO: 4 AAV CBr-7.2 799 WO2016065001 SEQ ID
NO: 5 AAV CBr-7.3 800 WO2016065001 SEQ ID NO: 6 AAV CBr-7.4 801
WO2016065001 SEQ ID NO: 7 AAV CBr-7.5 802 WO2016065001 SEQ ID NO: 8
AAV CBr-7.7 803 WO2016065001 SEQ ID NO: 9 AAV CBr-7.8 804
WO2016065001 SEQ ID NO: 10 AAV CBr-7.10 805 WO2016065001 SEQ ID NO:
11 AAV CKd-N3 806 WO2016065001 SEQ ID NO: 12 AAV CKd-N4 807
WO2016065001 SEQ ID NO: 13 AAV CKd-N9 808 WO2016065001 SEQ ID NO:
14 AAV CLv-L4 809 WO2016065001 SEQ ID NO: 15 AAV CLv-L5 810
WO2016065001 SEQ ID NO: 16 AAV CLv-L6 811 WO2016065001 SEQ ID NO:
17 AAV CLv-K1 812 WO2016065001 SEQ ID NO: 18 AAV CLv-K3 813
WO2016065001 SEQ ID NO: 19 AAV CLv-K6 814 WO2016065001 SEQ ID NO:
20 AAV CLv-M1 815 WO2016065001 SEQ ID NO: 21 AAV CLv-M11 816
WO2016065001 SEQ ID NO: 22 AAV CLv-M2 817 WO2016065001 SEQ ID NO:
23 AAV CLv-M5 818 WO2016065001 SEQ ID NO: 24 AAV CLv-M6 819
WO2016065001 SEQ ID NO: 25 AAV CLv-M7 820 WO2016065001 SEQ ID NO:
26 AAV CLv-M8 821 WO2016065001 SEQ ID NO: 27 AAV CLv-M9 822
WO2016065001 SEQ ID NO: 28 AAV CHt-P1 823 WO2016065001 SEQ ID NO:
29 AAV CHt-P6 824 WO2016065001 SEQ ID NO: 30 AAV CHt-P8 825
WO2016065001 SEQ ID NO: 31 AAV CHt-6.1 826 WO2016065001 SEQ ID NO:
32 AAV CHt-6.10 827 WO2016065001 SEQ ID NO: 33 AAV CHt-6.5 828
WO2016065001 SEQ ID NO: 34 AAV CHt-6.6 829 WO2016065001 SEQ ID NO:
35 AAV CHt-6.7 830 WO2016065001 SEQ ID NO: 36 AAV CHt-6.8 831
WO2016065001 SEQ ID NO: 37 AAV CSp-8.10 832 WO2016065001 SEQ ID NO:
38 AAV CSp-8.2 833 WO2016065001 SEQ ID NO: 39 AAV CSp-8.4 834
WO2016065001 SEQ ID NO: 40 AAV CSp-8.5 835 WO2016065001 SEQ ID NO:
41 AAV CSp-8.6 836 WO2016065001 SEQ ID NO: 42 AAV CSp-8.7 837
WO2016065001 SEQ ID NO: 43 AAV CSp-8.8 838 WO2016065001 SEQ ID NO:
44 AAV CSp-8.9 839 WO2016065001 SEQ ID NO: 45 AAV CBr-B7.3 840
WO2016065001 SEQ ID NO: 46 AAV CBr-B7.4 841 WO2016065001 SEQ ID NO:
47 AAV3B 842 WO2016065001 SEQ ID NO: 48 AAV4 843 WO2016065001 SEQ
ID NO: 49 AAV5 844 WO2016065001 SEQ ID NO: 50
AAV CHt-P2 845 WO2016065001 SEQ ID NO: 51 AAV CHt-P5 846
WO2016065001 SEQ ID NO: 52 AAV CHt-P9 847 WO2016065001 SEQ ID NO:
53 AAV CBr-7.1 848 WO2016065001 SEQ ID NO: 54 AAV CBr-7.2 849
WO2016065001 SEQ ID NO: 55 AAV CBr-7.3 850 WO2016065001 SEQ ID NO:
56 AAV CBr-7.4 851 WO2016065001 SEQ ID NO: 57 AAV CBr-7.5 852
WO2016065001 SEQ ID NO: 58 AAV CBr-7.7 853 WO2016065001 SEQ ID NO:
59 AAV CBr-7.8 854 WO2016065001 SEQ ID NO: 60 AAV CBr-7.10 855
WO2016065001 SEQ ID NO: 61 AAV CKd-N3 856 WO2016065001 SEQ ID NO:
62 AAV CKd-N4 857 WO2016065001 SEQ ID NO: 63 AAV CKd-N9 858
WO2016065001 SEQ ID NO: 64 AAV CLv-L4 859 WO2016065001 SEQ ID NO:
65 AAV CLv-L5 860 WO2016065001 SEQ ID NO: 66 AAV CLv-L6 861
WO2016065001 SEQ ID NO: 67 AAV CLv-K1 862 WO2016065001 SEQ ID NO:
68 AAV CLv-K3 863 WO2016065001 SEQ ID NO: 69 AAV CLv-K6 864
WO2016065001 SEQ ID NO: 70 AAV CLv-M1 865 WO2016065001 SEQ ID NO:
71 AAV CLv-M11 866 WO2016065001 SEQ ID NO: 72 AAV CLv-M2 867
WO2016065001 SEQ ID NO: 73 AAV CLv-M5 868 WO2016065001 SEQ ID NO:
74 AAV CLv-M6 869 WO2016065001 SEQ ID NO: 75 AAV CLv-M7 870
WO2016065001 SEQ ID NO: 76 AAV CLv-M8 871 WO2016065001 SEQ ID NO:
77 AAV CLv-M9 872 WO2016065001 SEQ ID NO: 78 AAV CHt-P1 873
WO2016065001 SEQ ID NO: 79 AAV CHt-P6 874 WO2016065001 SEQ ID NO:
80 AAV CHt-P8 875 WO2016065001 SEQ ID NO: 81 AAV CHt-6.1 876
WO2016065001 SEQ ID NO: 82 AAV CHt-6.10 877 WO2016065001 SEQ ID NO:
83 AAV CHt-6.5 878 WO2016065001 SEQ ID NO: 84 AAV CHt-6.6 879
WO2016065001 SEQ ID NO: 85 AAV CHt-6.7 880 WO2016065001 SEQ ID NO:
86 AAV CHt-6.8 881 WO2016065001 SEQ ID NO: 87 AAV CSp-8.10 882
WO2016065001 SEQ ID NO: 88 AAV CSp-8.2 883 WO2016065001 SEQ ID NO:
89 AAV CSp-8.4 884 WO2016065001 SEQ ID NO: 90 AAV CSp-8.5 885
WO2016065001 SEQ ID NO: 91 AAV CSp-8.6 886 WO2016065001 SEQ ID NO:
92 AAV CSp-8.7 887 WO2016065001 SEQ ID NO: 93 AAV CSp-8.8 888
WO2016065001 SEQ ID NO: 94 AAV CSp-8.9 889 WO2016065001 SEQ ID NO:
95 AAV CBr-B7.3 890 WO2016065001 SEQ ID NO: 96 AAV CBr-B7.4 891
WO2016065001 SEQ ID NO: 97 AAV3B 892 WO2016065001 SEQ ID NO: 98
AAV4 893 WO2016065001 SEQ ID NO: 99 AAV5 894 WO2016065001 SEQ ID
NO: 100 AAVPHP.B or 895 WO2015038958 SEQ ID NO: G2B-26 8 and 13;
GenBankALU85156.1 AAVPHP.B 896 WO2015038958 SEQ ID NO: 9 AAVG2B-13
897 WO2015038958 SEQ ID NO: 12 AAVTH1.1-32 898 WO2015038958 SEQ ID
NO: 14 AAVTH1.1-35 899 WO2015038958 SEQ ID NO: 15
[0725] Each of the patents, applications and/or publications listed
in Table 4 are hereby incorporated by reference in their
entirety.
[0726] In one embodiment, the AAV serotype may be, or may have a
sequence as described in International Patent Publication
WO2015038958, the contents of which are herein incorporated by
reference in their entirety, such as, but not limited to, AAV9 (SEQ
ID NO: 2 and 11 of WO2015038958 or SEQ ID NO: 153 and 154
respectively herein), PHP.B (SEQ ID NO: 8 and 9 of WO2015038958,
herein SEQ ID NO: 895 and 896), G2B-13 (SEQ ID NO: 12 of
WO2015038958, herein SEQ ID NO: 897), G2B-26 (SEQ ID NO: 13 of
WO2015038958, herein SEQ ID NO: 895 and 896), TH1.1-32 (SEQ ID NO:
14 of WO2015038958, herein SEQ ID NO: 898), TH1.1-35 (SEQ ID NO: 15
of WO2015038958, herein SEQ ID NO: 899) or variants thereof.
Further, any of the targeting peptides or amino acid inserts
described in WO2015038958, may be inserted into any parent AAV
serotype, such as, but not limited to, AAV9 (SEQ ID NO: 153 for the
DNA sequence and SEQ ID NO: 154 for the amino acid sequence). In
one embodiment, the amino acid insert is inserted between amino
acids 586-592 of the parent AAV (e.g., AAV9). In another
embodiment, the amino acid insert is inserted between amino acids
588-589 of the parent AAV sequence. The amino acid insert may be,
but is not limited to, any of the following amino acid sequences,
TLAVPFK (SEQ ID NO: 1 of WO2015038958; herein SEQ ID NO: 900),
KFPVALT (SEQ ID NO: 3 of WO2015038958; herein SEQ ID NO: 901),
LAVPFK (SEQ ID NO: 31 of WO2015038958; herein SEQ ID NO: 902),
AVPFK (SEQ ID NO: 32 of WO2015038958; herein SEQ ID NO: 903), VPFK
(SEQ ID NO: 33 of WO2015038958; herein SEQ ID NO: 904), TLAVPF (SEQ
ID NO: 34 of WO2015038958; herein SEQ ID NO: 905), TLAVP (SEQ ID
NO: 35 of WO2015038958; herein SEQ ID NO: 906), TLAV (SEQ ID NO: 36
of WO2015038958; herein SEQ ID NO: 907), SVSKPFL (SEQ ID NO: 28 of
WO2015038958; herein SEQ ID NO: 908), FTLTTPK (SEQ ID NO: 29 of
WO2015038958; herein SEQ ID NO: 909), MNATKNV (SEQ ID NO: 30 of
WO2015038958; herein SEQ ID NO: 910), QSSQTPR (SEQ ID NO: 54 of
WO2015038958; herein SEQ ID NO: 911), ILGTGTS (SEQ ID NO: 55 of
WO2015038958; herein SEQ ID NO: 912), TRTNPEA (SEQ ID NO: 56 of
WO2015038958; herein SEQ ID NO: 913), NGGTSSS (SEQ ID NO: 58 of
WO2015038958; herein SEQ ID NO: 914), or YTLSQGW (SEQ ID NO: 60 of
WO2015038958; herein SEQ ID NO: 915). Non-limiting examples of
nucleotide sequences that may encode the amino acid inserts include
the following, AAGTTTCCTGTGGCGTTGACT (for SEQ ID NO: 3 of
WO2015038958; herein SEQ ID NO: 916), ACTTTGGCGGTGCCTTTTAAG (SEQ ID
NO: 24 and 49 of WO2015038958; herein SEQ ID NO: 917),
AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 25 of WO2015038958; herein SEQ ID
NO: 918), TTTACGTTGACGACGCCTAAG (SEQ ID NO: 26 of WO2015038958;
herein SEQ ID NO: 919), ATGAATGCTACGAAGAATGTG (SEQ ID NO: 27 of
WO2015038958; herein SEQ ID NO: 920), CAGTCGTCGCAGACGCCTAGG (SEQ ID
NO: 48 of WO2015038958; herein SEQ ID NO: 921),
ATTCTGGGGACTGGTACTTCG (SEQ ID NO: 50 and 52 of WO2015038958; herein
SEQ ID NO: 922), ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51 of
WO2015038958; herein SEQ ID NO: 923), AATGGGGGGACTAGTAGTTCT (SEQ ID
NO: 53 of WO2015038958; herein SEQ ID NO: 924), or
TATACTTTGTCGCAGGGTTGG (SEQ ID NO: 59 of WO2015038958; herein SEQ ID
NO: 925).
[0727] In one embodiment, the AAV serotype may be engineered to
comprise at least one AAV capsid CD8+ T-cell epitope. Hui et al.
(Molecular Therapy--Methods & Clinical Development (2015) 2,
15029 doi:10.1038/mtm.2015.29; the contents of which are herein
incorporated by reference in its entirety) identified AAV
capsid-specific CD8+ T-cell epitopes for AAV1 and AAV2 (see e.g.,
Table 2 in the publication). As a non-limiting example, the
capsid-specific CD8+ T-cell epitope may be for an AAV2 serotype. As
a non-limiting example, the capsid-specific CD8+ T-cell epitope may
be for an AAV1 serotype.
[0728] In one embodiment, the AAV serotype may be engineered to
comprise at least one AAV capsid CD8+ T-cell epitope for AAV2 such
as, but not limited to, SADNNNSEY (SEQ ID NO: 926), LIDQYLYYL (SEQ
ID NO: 927), VPQYGYLTL (SEQ ID NO: 928), TTSTRTWAL (SEQ ID NO:
929), YHLNGRDSL (SEQ ID NO: 930), SQAVGRSSF (SEQ ID NO: 931),
VPANPSTTF (SEQ ID NO: 932), FPQSGVLIF (SEQ ID NO: 933),
YFDFNRFHCHFSPRD (SEQ ID NO: 934), VGNSSGNWHCDSTWM (SEQ ID NO: 935),
QFSQAGASDIRDQSR (SEQ ID NO: 936), GASDIRQSRNWLP (SEQ ID NO: 937)
and GNRQAATADVNTQGV (SEQ ID NO: 938).
[0729] In one embodiment, the AAV serotype may be engineered to
comprise at least one AAV capsid CD8+ T-cell epitope for AAV1 such
as, but not limited to, LDRLMNPLI (SEQ ID NO: 939), TTSTRTWAL (SEQ
ID NO: 929), and QPAKKRLNF (SEQ ID NO: 940)).
[0730] In one embodiment, peptides for inclusion in an AAV serotype
may be identified using the methods described by Hui et al.
(Molecular Therapy--Methods & Clinical Development (2015) 2,
15029 doi:10.1038/mtm.2015.29; the contents of which are herein
incorporated by reference in its entirety). As a non-limiting
example, the procedure includes isolating human splenocytes,
restimulating the splenocytes in vitro using individual peptides
spanning the amino acid sequence of the AAV capsid protein,
IFN-gamma ELISpot with the individual peptides used for the in
vitro restimulation, bioinformatics analysis to determine the HLA
restriction of 15-mers identified by IFN-gamma ELISpot,
idenification of candidate reactive 9-mer epitopes for a given HLA
allele, synthesis candidate 9-mers, second IFN-gamma ELISpot
screening of splenocytes from subjects carrying the HLA alleles to
which identified AAV epitopes are predicted to bind, determine the
AAV capsid-reactive CD8+ T cell epitopes and determine the
frequency of subjects reacting to a given AAV epitope.
[0731] In one embodiment, the AAV may be a serotype generated by
Cre-recombination-based AAV targeted evolution (CREATE) as
described by Deverman et al., (Nature Biotechnology 34(2):204-209
(2016)), the contents of which are herein incorporated by reference
in their entirety. In one embodiment, AAV serotypes generated in
this manner have improved CNS transduction and/or neuronal and
astrocytic tropism, as compared to other AAV serotypes. As
non-limiting examples, the AAV serotype may be PHP.B, PHP.B2,
PHP.B3, PHP.A, G2Al2, G2A15. In one embodiment, these AAV serotypes
may be AAV9 (SEQ ID NO: 153 and 154) derivatives with a 7-amino
acid insert between amino acids 588-589. Non-limiting examples of
these 7-amino acid inserts include TLAVPFK (SEQ ID NO: 900),
SVSKPFL (SEQ ID NO: 908), FTLTTPK (SEQ ID NO: 909), YTLSQGW (SEQ ID
NO: 915), QAVRTSL (SEQ ID NO: 941) and/or LAKERLS (SEQ ID NO:
942).
[0732] In one embodiment, the AAV serotype may be as described in
Jackson et al (Frontiers in Molecular Neuroscience 9:154 (2016)),
the contents of which are herein incorporated by reference in their
entirety. In some embodiments, the AAV serotype is PHP.B or AAV9.
In some embodiments, the AAV serotype is paired with a synapsin
promoter to enhance neuronal transduction, as compared to when more
ubiquitous promoters are used (i.e., CBA or CMV).
[0733] In one embodiment, peptides for inclusion in an AAV serotype
may be identified by isolating human splenocytes, restimulating the
splenocytes in vitro using individual peptides spanning the amino
acid sequence of the AAV capsid protein, IFN-gamma ELISpot with the
individual peptides used for the in vitro restimulation,
bioinformatics analysis to determine the given allele restriction
of 15-mers identified by IFN-gamma ELISpot, idenification of
candidate reactive 9-mer epitopes for a given allele, synthesis
candidate 9-mers, second IFN-gamma ELISpot screening of splenocytes
from subjects carrying the specific alleles to which identified AAV
epitopes are predicted to bind, determine the AAV capsid-reactive
CD8+ T cell epitopes and determine the frequency of subjects
reacting to a given AAV epitope.
[0734] AAV vectors comprising the nucleic acid sequence for the
siRNA molecules may be prepared or derived from various serotypes
of AAVs, including, but not limited to, AAV1, AAV2, AAV3, AAV4,
AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hul4), AAV10, AAV11,
AAV12, AAVrh8, AAVrh10, AAV-DJ8, AAV-DJ, AAV-PHP.A, and/or
AAV-PHP.B. In some cases, different serotypes of AAVs may be mixed
together or with other types of viruses to produce chimeric AAV
vectors. As a non-limiting example, the AAV vector is derived from
the AAV9 serotype.
Viral Genome Component: Inverted Terminal Repeats (ITRs)
[0735] The AAV particles of the present invention comprise a viral
genome with at least one ITR region and a payload region. In one
embodiment the viral genome has two ITRs. These two ITRs flank the
payload region at the 5' and 3' ends. The ITRs function as origins
of replication comprising recognition sites for replication. ITRs
comprise sequence regions which can be complementary and
symmetrically arranged. ITRs incorporated into viral genomes of the
invention may be comprised of naturally occurring polynucleotide
sequences or recombinantly derived polynucleotide sequences.
[0736] The ITRs may be derived from the same serotype as the
capsid, selected from any of the serotypes listed in Table 6, or a
derivative thereof. The ITR may be of a different serotype than the
capsid. In one embodiment the AAV particle has more than one ITR.
In a non-limiting example, the AAV particle has a viral genome
comprising two ITRs. In one embodiment the ITRs are of the same
serotype as one another. In another embodiment the ITRs are of
different serotypes. Non-limiting examples include zero, one or
both of the ITRs having the same serotype as the capsid. In one
embodiment both ITRs of the viral genome of the AAV particle are
AAV2 ITRs.
[0737] Independently, each ITR may be about 100 to about 150
nucleotides in length. An ITR may be about 100-105 nucleotides in
length, 106-110 nucleotides in length, 111-115 nucleotides in
length, 116-120 nucleotides in length, 121-125 nucleotides in
length, 126-130 nucleotides in length, 131-135 nucleotides in
length, 136-140 nucleotides in length, 141-145 nucleotides in
length or 146-150 nucleotides in length. In one embodiment the ITRs
are 140-142 nucleotides in length. Non limiting examples of ITR
length are 102, 140, 141, 142, 145 nucleotides in length, and those
having at least 95% identity thereto.
[0738] In one embodiment, the encoded siRNA molecule may be located
near the 5' end of the flip ITR in an expression vector. In another
embodiment, the encoded siRNA molecule may be located near the 3'
end of the flip ITR in an expression vector. In yet another
embodiment, the encoded siRNA molecule may be located near the 5'
end of the flop ITR in an expression vector. In yet another
embodiment, the encoded siRNA molecule may be located near the 3'
end of the flop ITR in an expression vector. In one embodiment, the
encoded siRNA molecule may be located between the 5' end of the
flip ITR and the 3' end of the flop ITR in an expression vector. In
one embodiment, the encoded siRNA molecule may be located between
(e.g., half-way between the 5' end of the flip ITR and 3' end of
the flop ITR or the 3' end of the flop ITR and the 5' end of the
flip ITR), the 3' end of the flip ITR and the 5' end of the flip
ITR in an expression vector. As a non-limiting example, the encoded
siRNA molecule may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30 or more than 30 nucleotides downstream from the 5' or 3'
end of an ITR (e.g., Flip or Flop ITR) in an expression vector. As
a non-limiting example, the encoded siRNA molecule may be located
within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30
nucleotides upstream from the 5' or 3' end of an ITR (e.g., Flip or
Flop ITR) in an expression vector. As another non-limiting example,
the encoded siRNA molecule may be located within 1-5, 1-10, 1-15,
1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20,
10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30
nucleotides downstream from the 5' or 3' end of an ITR (e.g., Flip
or Flop ITR) in an expression vector. As another non-limiting
example, the encoded siRNA molecule may be located within 1-5,
1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15,
10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30
upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR)
in an expression vector. As a non-limiting example, the encoded
siRNA molecule may be located within the first 1%, 2%, 3%, 4%, 5%,
6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the
nucleotides upstream from the 5' or 3' end of an ITR (e.g., Flip or
Flop ITR) in an expression vector. As another non-limiting example,
the encoded siRNA molecule may be located with the first 1-5%,
1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%,
10-20%, 10-25%, 15-20%, 15-25%, or 20-25% downstream from the 5' or
3' end of an ITR (e.g., Flip or Flop ITR) in an expression
vector.
Viral Genome Component: Promoters
[0739] A person skilled in the art may recognize that a target cell
may require a specific promoter including but not limited to a
promoter that is species specific, inducible, tissue-specific, or
cell cycle-specific (Parr et al., Nat. Med.3:1145-9 (1997); the
contents of which are herein incorporated by reference in its
entirety).
[0740] In one embodiment, the promoter is a promoter deemed to be
efficient to drive the expression of the modulatory
polynucleotide.
[0741] In one embodiment, the promoter is a promoter having a
tropism for the cell being targeted.
[0742] In one embodiment, the promoter is a weak promoter which
provides expression of a payload e.g., a modulatory polynucleotide,
e.g., siRNA or dsRNA, for a period of time in targeted tissues such
as, but not limited to, nervous system tissues. Expression may be
for a period of 1 hour, 2, hours, 3 hours, 4 hours, 5 hours, 6
hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13
hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours,
20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4
days, 5 days, 6 days, 1 week, 8 days, 9 days, 10 days, 11 days, 12
days, 13 days, 2 weeks, 15 days, 16 days, 17 days, 18 days, 19
days, 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26
days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2
months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months,
9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15
months, 16 months, 17 months, 18 months, 19 months, 20 months, 21
months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6
years, 7 years, 8 years, 9 years, 10 years or more than 10 years.
Expression may be for 1-5 hours, 1-12 hours, 1-2 days, 1-5 days,
1-2 weeks, 1-3 weeks, 1-4 weeks, 1-2 months, 1-4 months, 1-6
months, 2-6 months, 3-6 months, 3-9 months, 4-8 months, 6-12
months, 1-2 years, 1-5 years, 2-5 years, 3-6 years, 3-8 years, 4-8
years or 5-10 years. As a non-limiting example, the promoter is a
weak promoter for sustained expression of a payload in nervous
tissues.
[0743] In one embodiment, the promoter may be a promoter which is
less than 1 kb. The promoter may have a length of 200, 210, 220,
230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350,
360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480,
490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610,
620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740,
750, 760, 770, 780, 790, 800 or more than 800. The promoter may
have a length between 200-300, 200-400, 200-500, 200-600, 200-700,
200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500,
400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700,
600-800 or 700-800.
[0744] In one embodiment, the promoter may be a combination of two
or more components such as, but not limited to, CMV and CBA. Each
component may have a length of 200, 210, 220, 230, 240, 250, 260,
270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 381,
382, 383, 384, 385, 386, 387, 388, 389, 390, 400, 410, 420, 430,
440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560,
570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690,
700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 or more than
800. Each component may have a length between 200-300, 200-400,
200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600,
300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600,
500-700, 500-800, 600-700, 600-800 or 700-800. As a non-limiting
example, the promoter is a combination of a 382 nucleotide
CMV-enhancer sequence and a 260 nucleotide CBA-promoter
sequence.
[0745] In one embodiment, the vector genome comprises at least one
element to enhance the target specificity and expression (See e.g.,
Powell et al. Viral Expression Cassette Elements to Enhance
Transgene Target Specificity and Expression in Gene Therapy, 2015;
the contents of which are herein incorporated by reference in its
entirety). Non-limiting examples of elements to enhance the
transgene target specificity and expression include promoters,
endogenous miRNAs, post-transcriptional regulatory elements (PREs),
polyadenylation (PolyA) signal sequences and upstream enhancers
(USEs), CMV enhancers and introns.
[0746] In one embodiment, the vector genome comprises at least one
element to enhance the target specificity and expression (See e.g.,
Powell et al. Viral Expression Cassette Elements to Enhance
Transgene Target Specificity and Expression in Gene Therapy, 2015;
the contents of which are herein incorporated by reference in its
entirety) such as promoters.
[0747] Promoters for which promote expression in most tissues
include, but are not limited to, human elongation factor
1.alpha.-subunit (EF1.alpha.), immediate-early cytomegalovirus
(CMV), chicken .beta.-actin (CBA) and its derivative CAG, the
.beta. glucuronidase (GUSB), or ubiquitin C (UBC). Tissue-specific
expression elements can be used to restrict expression to certain
cell types such as, but not limited to, nervous system promoters
which can be used to restrict expression to neurons, astrocytes, or
oligodendrocytes. Non-limiting example of tissue-specific
expression elements for neurons include neuron-specific enolase
(NSE), platelet-derived growth factor (PDGF), platelet-derived
growth factor B-chain (PDGF-.beta.), the synapsin (Syn), the
methyl-CpG binding protein 2 (MeCP2), CaMKII, mGluR2, NFL, NFH,
nf32, PPE, Enk and EAAT2 promoters. A non-limiting example of
tissue-specific expression elements for astrocytes include the
glial fibrillary acidic protein (GFAP) and EAAT2 promoters. A
non-limiting example of a tissue-specific expression element for
oligodendrocytes include the myelin basic protein (MBP)
promoter.
[0748] In one embodiment, the vector genome comprises a ubiquitous
promoter. Non-limiting examples of ubiquitous promoters include H1,
U6, CMV, CBA (including derivatives CAG, CBh, etc.), EF-1.alpha.,
PGK, UBC, GUSB (hGBp), and UCOE (promoter of HNRPA2B1-CBX3). Yu et
al. (Molecular Pain 2011, 7:63; the contents of which are herein
incorporated by reference in its entirety) evaluated the expression
of eGFP under the CAG, EFIa, PGK and UBC promoters in rat DRG cells
and primary DRG cells using lentiviral vectors and found that UBC
showed weaker expression than the other 3 promoters and there was
only 10-12% glia expression seen for all promoters. Soderblom et
al. (E. Neuro 2015; the contents of which are herein incorporated
by reference in its entirety) the expression of eGFP in AAV8 with
CMV and UBC promoters and AAV2 with the CMV promoter after
injection in the motor cortex. Intranasal administration of a
plasmid containing a UBC or EFIa promoter showed a sustained airway
expression greater than the expression with the CMV promoter (See
e.g., Gill et al., Gene Therapy 2001, Vol. 8, 1539-1546; the
contents of which are herein incorporated by reference in its
entirety). Husain et al. (Gene Therapy 2009; the contents of which
are herein incorporated by reference in its entirety) evaluated a
H.beta.H construct with a hGUSB promoter, a HSV-1LAT promoter and a
NSE promoter and found that the H.beta.H construct showed weaker
expression than NSE in mice brain. Passini and Wolfe (J. Virol.
2001, 12382-12392, the contents of which are herein incorporated by
reference in its entirety) evaluated the long term effects of the
Hf3H vector following an intraventricular injection in neonatal
mice and found that there was sustained expression for at least 1
year. Low expression in all brain regions was found by Xu et al.
(Gene Therapy 2001, 8, 1323-1332; the contents of which are herein
incorporated by reference in its entirety) when NF-L and NF-H
promoters were used as compared to the CMV-lacZ, CMV-luc, EF, GFAP,
hENK, nAChR, PPE, PPE +wpre, NSE (0.3 kb), NSE (1.8 kb) and NSE
(1.8 kb+wpre). Xu et al. found that the promoter activity in
descending order was NSE (1.8 kb), EF, NSE (0.3 kb), GFAP, CMV,
hENK, PPE, NFL and NFH. NFL is a 650 nucleotide promoter and NFH is
a 920 nucleotide promoter which are both absent in the liver but
NFH is abundant in the sensory proprioceptive neurons, brain and
spinal cord and NFH is present in the heart. Scn8a is a 470
nucleotide promoter which expresses throughout the DRG, spinal cord
and brain with particularly high expression seen in the hippocampal
neurons and cerebellar Purkinje cells, cortex, thalamus and
hypothalamus (See e.g., Drews et al. 2007 and Raymond et al. 2004;
the contents of each of which are herein incorporated by reference
in their entireties).
[0749] In one embodiment, the vector genome comprises an UBC
promoter. The UBC promoter may have a size of 300-350 nucleotides.
As a non-limiting example, the UBC promoter is 332 nucleotides.
[0750] In one embodiment, the vector genome comprises a GUSB
promoter. The GUSB promoter may have a size of 350-400 nucleotides.
As a non-limiting example, the GUSB promoter is 378 nucleotides. As
a non-limiting example, the construct may be
AAV-promoter-CMV/globin intron-modulatory polynucleotide-RBG, where
the AAV may be self-complementary and the AAV may be the DJ
serotype.
[0751] In one embodiment, the vector genome comprises a NFL
promoter. The NFL promoter may have a size of 600-700 nucleotides.
As a non-limiting example, the NFL promoter is 650 nucleotides. As
a non-limiting example, the construct may be
AAV-promoter-CMV/globin intron-modulatory polynucleotide-RBG, where
the AAV may be self-complementary and the AAV may be the DJ
serotype.
[0752] In one embodiment, the vector genome comprises a NFH
promoter. The NFH promoter may have a size of 900-950 nucleotides.
As a non-limiting example, the NFH promoter is 920 nucleotides. As
a non-limiting example, the construct may be
AAV-promoter-CMV/globin intron-modulatory polynucleotide-RBG, where
the AAV may be self-complementary and the AAV may be the DJ
serotype.
[0753] In one embodiment, the vector genome comprises a scn8a
promoter. The scn8a promoter may have a size of 450-500
nucleotides. As a non-limiting example, the scn8a promoter is 470
nucleotides. As a non-limiting example, the construct may be
AAV-promoter-CMV/globin intron-modulatory polynucleotide-RBG, where
the AAV may be self-complementary and the AAV may be the DJ
serotype.
[0754] In one embodiment, the vector genome comprises a FXN
promoter.
[0755] In one embodiment, the vector genome comprises a PGK
promoter.
[0756] In one embodiment, the vector genome comprises a CBA
promoter.
[0757] In one embodiment, the vector genome comprises a CMV
promoter.
[0758] In one embodiment, the vector genome comprises a H1
promoter.
[0759] In one embodiment, the vector genome comprises a U6
promoter.
[0760] In one embodiment, the vector genome comprises a liver or a
skeletal muscle promoter. Non-limiting examples of liver promoters
include hAAT and TBG. Non-limiting examples of skeletal muscle
promoters include Desmin, MCK and C5-12.
[0761] In one embodiment, the AAV vector comprises an enhancer
element, a promoter and/or a 5'UTR intron. The enhancer may be, but
is not limited to, a CMV enhancer, the promoter may be, but is not
limited to, a CMV, CBA, UBC, GUSB, NSE, Synapsin, MeCP2, and GFAP
promoter and the 5'UTR/intron may be, but is not limited to, SV40,
and CBA-MVM. As a non-limiting example, the enhancer, promoter
and/or intron used in combination may be: (1) CMV enhancer, CMV
promoter, SV40 5'UTR intron; (2) CMV enhancer, CBA promoter, SV 40
5'UTR intron; (3) CMV enhancer, CBA promoter, CBA-MVM 5'UTR intron;
(4) UBC promoter; (5) GUSB promoter; (6) NSE promoter; (7) Synapsin
promoter; (8) MeCP2 promoter; (9) GFAP promoter, (10) H1 promoter;
and (11) U6 promoter.
[0762] In one embodiment, the AAV vector has an engineered
promoter.
Viral Genome Component: Introns
[0763] In one embodiment, the vector genome comprises at least one
element to enhance the transgene target specificity and expression
(See e.g., Powell et al. Viral Expression Cassette Elements to
Enhance Transgene Target Specificity and Expression in Gene
Therapy, 2015; the contents of which are herein incorporated by
reference in its entirety) such as an intron. Non-limiting examples
of introns include, MVM (67-97 bps), F.IX truncated intron 1 (300
bps), .beta.-globin SD/immunoglobulin heavy chain splice acceptor
(250 bps), adenovirus splice donor/immunoglobin splice acceptor
(500 bps), SV40 late splice donor/splice acceptor (19S/16S) (180
bps) and hybrid adenovirus splice donor/IgG splice acceptor (230
bps).
[0764] In one embodiment, the intron may be 100-500 nucleotides in
length. The intron may have a length of 80, 90, 100, 110, 120, 130,
140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179,
180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300,
310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430,
440, 450, 460, 470, 480, 490 or 500. The promoter may have a length
between 80-100, 80-120, 80-140, 80-160, 80-180, 80-200, 80-250,
80-300, 80-350, 80-400, 80-450, 80-500, 200-300, 200-400, 200-500,
300-400, 300-500, or 400-500.
[0765] In one embodiment, the AAV vector may comprise an SV40
intron or fragment or variant thereof. As a non-limiting example,
the promoter may be CMV. As another non-limiting example, the
promoter may be CBA. As yet another non-limiting example, the
promoter may be H1.
[0766] In one embodiment, the AAV vector may comprise a beta-globin
intron or a frament or variant thereof. As a non-limiting example,
the promoter may be CMV. As another non-limiting example, the
promoter may be CBA. As yet another non-limiting example, the
promoter may be H1.
[0767] In one embodiment, the encoded siRNA molecule may be located
downstream of an intron in an expression vector such as, but not
limited to, SV40 intron or beta globin intron or others known in
the art. Further, the encoded siRNA molecule may also be located
upstream of the polyadenylation sequence in an expression vector.
As a non-limiting example, the encoded siRNA molecule may be
located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more
than 30 nucleotides downstream from the promoter with an intron
and/or upstream of the polyadenylation sequence in an expression
vector. As another non-limiting example, the encoded siRNA molecule
may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10,
5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25,
15-30, 20-25, 20-30 or 25-30 nucleotides downstream from the intron
and/or upstream of the polyadenylation sequence in an expression
vector. As a non-limiting example, the encoded siRNA molecule may
be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%,
10%, 15%, 20%, 25% or more than 25% of the nucleotides downstream
from the intron and/or upstream of the polyadenylation sequence in
an expression vector. As another non-limiting example, the encoded
siRNA molecule may be located with the first 1-5%, 1-10%, 1-15%,
1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%,
15-20%, 15-25%, or 20-25% of the sequence downstream from the
intron and/or upstream of the polyadenylation sequence in an
expression vector.
Viral Genome Component: Polyadenylation Sequence
[0768] In one embodiment, the viral genome of the AAV particles of
the present invention comprise at least one polyadenylation
sequence. The viral genome of the AAV particle may comprise a
polyadenylation sequence between the 3' end of the payload coding
sequence and the 5' end of the 3' ITR.
[0769] In one embodiment, the polyadenylation sequence or "polyA
sequence" may range from absent to about 500 nucleotides in length.
The polyadenylation sequence may be, but is not limited to, 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37,
38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54,
55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71,
72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88,
89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103,
104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116,
117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129,
130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142,
143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155,
156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168,
169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181,
182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194,
195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207,
208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220,
221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233,
234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246,
247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259,
260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272,
273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285,
286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298,
299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311,
312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324,
325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337,
338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350,
351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363,
364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376,
377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389,
390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402,
403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415,
416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428,
429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441,
442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454,
455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467,
468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480,
481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493,
494, 495, 496, 497, 498, 499, and 500 nucleotides in length.
[0770] In one embodiment, the polyadenylation sequence is 50-100
nucleotides in length.
[0771] In one embodiment, the polyadenylation sequence is 50-150
nucleotides in length.
[0772] In one embodiment, the polyadenylation sequence is 50-160
nucleotides in length.
[0773] In one embodiment, the polyadenylation sequence is 50-200
nucleotides in length.
[0774] In one embodiment, the polyadenylation sequence is 60-100
nucleotides in length.
[0775] In one embodiment, the polyadenylation sequence is 60-150
nucleotides in length.
[0776] In one embodiment, the polyadenylation sequence is 60-160
nucleotides in length.
[0777] In one embodiment, the polyadenylation sequence is 60-200
nucleotides in length.
[0778] In one embodiment, the polyadenylation sequence is 70-100
nucleotides in length.
[0779] In one embodiment, the polyadenylation sequence is 70-150
nucleotides in length.
[0780] In one embodiment, the polyadenylation sequence is 70-160
nucleotides in length.
[0781] In one embodiment, the polyadenylation sequence is 70-200
nucleotides in length.
[0782] In one embodiment, the polyadenylation sequence is 80-100
nucleotides in length.
[0783] In one embodiment, the polyadenylation sequence is 80-150
nucleotides in length.
[0784] In one embodiment, the polyadenylation sequence is 80-160
nucleotides in length.
[0785] In one embodiment, the polyadenylation sequence is 80-200
nucleotides in length.
[0786] In one embodiment, the polyadenylation sequence is 90-100
nucleotides in length.
[0787] In one embodiment, the polyadenylation sequence is 90-150
nucleotides in length.
[0788] In one embodiment, the polyadenylation sequence is 90-160
nucleotides in length.
[0789] In one embodiment, the polyadenylation sequence is 90-200
nucleotides in length.
[0790] In one embodiment, the encoded siRNA molecule may be located
upstream of the polyadenylation sequence in an expression vector.
Further, the encoded siRNA molecule may be located downstream of a
promoter such as, but not limited to, CMV, U6, H1, CBA or a CBA
promoter with a SV40 or a human betaglobin intron in an expression
vector. As a non-limiting example, the encoded siRNA molecule may
be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or
more than 30 nucleotides downstream from the promoter and/or
upstream of the polyadenylation sequence in an expression vector.
As another non-limiting example, the encoded siRNA molecule may be
located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20,
5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25,
20-30 or 25-30 nucleotides downstream from the promoter and/or
upstream of the polyadenylation sequence in an expression vector.
As a non-limiting example, the encoded siRNA molecule may be
located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,
15%, 20%, 25% or more than 25% of the nucleotides downstream from
the promoter and/or upstream of the polyadenylation sequence in an
expression vector. As another non-limiting example, the encoded
siRNA molecule may be located with the first 1-5%, 1-10%, 1-15%,
1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%,
15-20%, 15-25%, or 20-25% downstream from the promoter and/or
upstream of the polyadenylation sequence in an expression
vector.
Expression Vector
[0791] In one embodiment, an expression vector (e.g., AAV vector)
may comprise at least one of the modulatory polynucleotides
encoding at least one of the siRNA sequences or duplexes described
herein.
[0792] In one embodiment, an expression vector may comprise, from
ITR to ITR recited 5' to 3', an ITR, a promoter, an intron, a
modulatory polynucleotide, a polyA sequence and an ITR.
Genome Size
[0793] In one embodiment, the vector genome which comprises a
nucleic acid sequence encoding the modulatory polynucleotides
described herein may be single stranded or double stranded vector
genome. The size of the vector genome may be small, medium, large
or the maximum size. Additionally, the vector genome may comprise a
promoter and a polyA tail.
[0794] In one embodiment, the vector genome which comprises a
nucleic acid sequence encoding the modulatory polynucleotides
described herein may be a small single stranded vector genome. A
small single stranded vector genome may be 2.7 to 3.5 kb in size
such as about 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, and 3.5 kb in
size. As a non-limiting example, the small single stranded vector
genome may be 3.2 kb in size. Additionally, the vector genome may
comprise a promoter and a polyA tail.
[0795] In one embodiment, the vector genome which comprises a
nucleic acid sequence encoding the modulatory polynucleotides
described herein may be a small double stranded vector genome. A
small double stranded vector genome may be 1.3 to 1.7 kb in size
such as about 1.3, 1.4, 1.5, 1.6, and 1.7 kb in size. As a
non-limiting example, the small double stranded vector genome may
be 1.6 kb in size. Additionally, the vector genome may comprise a
promoter and a polyA tail.
[0796] In one embodiment, the vector genome which comprises a
nucleic acid sequence encoding the modulatory polynucleotides
described herein e.g., siRNA or dsRNA, may be a medium single
stranded vector genome. A medium single stranded vector genome may
be 3.6 to 4.3 kb in size such as about 3.6, 3.7, 3.8, 3.9, 4.0,
4.1, 4.2 and 4.3 kb in size. As a non-limiting example, the medium
single stranded vector genome may be 4.0 kb in size. Additionally,
the vector genome may comprise a promoter and a polyA tail.
[0797] In one embodiment, the vector genome which comprises a
nucleic acid sequence encoding the modulatory polynucleotides
described herein may be a medium double stranded vector genome. A
medium double stranded vector genome may be 1.8 to 2.1 kb in size
such as about 1.8, 1.9, 2.0, and 2.1 kb in size. As a non-limiting
example, the medium double stranded vector genome may be 2.0 kb in
size. Additionally, the vector genome may comprise a promoter and a
polyA tail.
[0798] In one embodiment, the vector genome which comprises a
nucleic acid sequence encoding the modulatory polynucleotides
described herein may be a large single stranded vector genome. A
large single stranded vector genome may be 4.4 to 6.0 kb in size
such as about 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3,
5.4, 5.5, 5.6, 5.7, 5.8, 5.9 and 6.0 kb in size. As a non-limiting
example, the large single stranded vector genome may be 4.7 kb in
size. As another non-limiting example, the large single stranded
vector genome may be 4.8 kb in size. As yet another non-limiting
example, the large single stranded vector genome may be 6.0 kb in
size. Additionally, the vector genome may comprise a promoter and a
polyA tail.
[0799] In one embodiment, the vector genome which comprises a
nucleic acid sequence encoding the modulatory polynucleotides
described herein may be a large double stranded vector genome. A
large double stranded vector genome may be 2.2 to 3.0 kb in size
such as about 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 and 3.0 kb in
size. As a non-limiting example, the large double stranded vector
genome may be 2.4 kb in size. Additionally, the vector genome may
comprise a promoter and a polyA tail.
Viral Production
[0800] The present disclosure provides a method for the generation
of parvoviral particles, e.g. AAV particles, by viral genome
replication in a viral replication cell comprising contacting the
viral replication cell with an AAV polynucleotide or AAV
genome.
[0801] The present disclosure provides a method for producing an
AAV particle having enhanced (increased, improved) transduction
efficiency comprising the steps of: 1) co-transfecting competent
bacterial cells with a bacmid vector and either a viral construct
vector and/or AAV payload construct vector, 2) isolating the
resultant viral construct expression vector and AAV payload
construct expression vector and separately transfecting viral
replication cells, 3) isolating and purifying resultant payload and
viral construct particles comprising viral construct expression
vector or AAV payload construct expression vector, 4) co-infecting
a viral replication cell with both the AAV payload and viral
construct particles comprising viral construct expression vector or
AAV payload construct expression vector, 5) harvesting and
purifying the viral particle comprising a parvoviral genome.
[0802] In one embodiment, the present invention provides a method
for producing an AAV particle comprising the steps of 1)
simultaneously co-transfecting mammalian cells, such as, but not
limited to HEK293 cells, with a payload region, a construct
expressing rep and cap genes and a helper construct, 2) harvesting
and purifying the AAV particle comprising a viral genome.
Cells
[0803] The present disclosure provides a cell comprising an AAV
polynucleotide and/or AAV genome.
[0804] Viral production disclosed herein describes processes and
methods for producing AAV particles that contact a target cell to
deliver a payload construct, e.g. a recombinant viral construct,
which comprises a nucleotide encoding a payload molecule.
[0805] In one embodiment, the AAV particles may be produced in a
viral replication cell that comprises an insect cell.
[0806] Growing conditions for insect cells in culture, and
production of heterologous products in insect cells in culture are
well-known in the art, see U.S. Pat. No. 6,204,059, the contents of
which are herein incorporated by reference in their entirety.
[0807] Any insect cell which allows for replication of parvovirus
and which can be maintained in culture can be used in accordance
with the present invention. Cell lines may be used from Spodoptera
frugiperda, including, but not limited to the Sf9 or Sf21 cell
lines, Drosophila cell lines, or mosquito cell lines, such as Aedes
albopictus derived cell lines. Use of insect cells for expression
of heterologous proteins is well documented, as are methods of
introducing nucleic acids, such as vectors, e.g., insect-cell
compatible vectors, into such cells and methods of maintaining such
cells in culture. See, for example, Methods in Molecular Biology,
ed. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus
Expression Vectors, A Laboratory Manual, Oxford Univ. Press (1994);
Samulski et al., J. Vir.63:3822-8 (1989); Kajigaya et al., Proc.
Nat'l. Acad. Sci. USA 88: 4646-50 (1991); Ruffing et al., J. Vir.
66:6922-30 (1992); Kimbauer et al., Vir.219:37-44 (1996); Zhao et
al., Vir.272:382-93 (2000); and Samulski et al., U.S. Pat. No.
6,204,059, the contents of each of which is herein incorporated by
reference in its entirety.
[0808] The viral replication cell may be selected from any
biological organism, including prokaryotic (e.g., bacterial) cells,
and eukaryotic cells, including, insect cells, yeast cells and
mammalian cells. Viral replication cells may comprise mammalian
cells such as A549, WEH1, 3T3, 10T1/2, BHK, MDCK, COS 1, COS 7, BSC
1, BSC 40, BMT 10, VERO. W138, HeLa, HEK293, Saos, C2C12, L cells,
HT1080, HepG2 and primary fibroblast, hepatocyte and myoblast cells
derived from mammals. Viral replication cells comprise cells
derived from mammalian species including, but not limited to,
human, monkey, mouse, rat, rabbit, and hamster or cell type,
including but not limited to fibroblast, hepatocyte, tumor cell,
cell line transformed cell, etc.
Small Scale Production of AAV Particles
[0809] Viral production disclosed herein describes processes and
methods for producing AAV particles that contact a target cell to
deliver a payload, e.g. a recombinant viral construct, which
comprises a nucleotide encoding a payload.
[0810] In one embodiment, the AAV particles may be produced in a
viral replication cell that comprises a mammalian cell.
[0811] Viral replication cells commonly used for production of
recombinant AAV particles include, but are not limited to 293
cells, COS cells, HeLa cells, KB cells, and other mammalian cell
lines as described in U.S. Pat. Nos. 6,156,303, 5,387,484,
5,741,683, 5,691,176, and 5,688,676; U.S. patent application
2002/0081721, and International Patent Applications WO 00/47757, WO
00/24916, and WO 96/17947, the contents of each of which are herein
incorporated by reference in their entireties.
[0812] In one embodiment, AAV particles are produced in
mammalian-cells wherein all three VP proteins are expressed at a
stoichiometry approaching 1:1:10 (VP1:VP2:VP3). The regulatory
mechanisms that allow this controlled level of expression include
the production of two mRNAs, one for VP1, and the other for VP2 and
VP3, produced by differential splicing.
[0813] In another embodiment, AAV particles are produced in
mammalian cells using a triple transfection method wherein a
payload construct, parvoviral Rep and parvoviral Cap and a helper
construct are comprised within three different constructs. The
triple transfection method of the three components of AAV particle
production may be utilized to produce small lots of virus for
assays including transduction efficiency, target tissue (tropism)
evaluation, and stability.
Baculovirus
[0814] Particle production disclosed herein describes processes and
methods for producing AAV particles that contact a target cell to
deliver a payload construct which comprises a nucleotide encoding a
payload.
[0815] Briefly, the viral construct vector and the AAV payload
construct vector are each incorporated by a transposon
donor/acceptor system into a bacmid, also known as a baculovirus
plasmid, by standard molecular biology techniques known and
performed by a person skilled in the art. Transfection of separate
viral replication cell populations produces two baculoviruses, one
that comprises the viral construct expression vector, and another
that comprises the AAV payload construct expression vector. The two
baculoviruses may be used to infect a single viral replication cell
population for production of AAV particles.
[0816] Baculovirus expression vectors for producing viral particles
in insect cells, including but not limited to Spodoptera frugiperda
(Sf9) cells, provide high titers of viral particle product.
Recombinant baculovirus encoding the viral construct expression
vector and AAV payload construct expression vector initiates a
productive infection of viral replicating cells. Infectious
baculovirus particles released from the primary infection
secondarily infect additional cells in the culture, exponentially
infecting the entire cell culture population in a number of
infection cycles that is a function of the initial multiplicity of
infection, see Urabe, M. et al., J Virol. 2006 February; 80
(4):1874-85, the contents of which are herein incorporated by
reference in their entirety.
[0817] Production of AAV particles with baculovirus in an insect
cell system may address known baculovirus genetic and physical
instability. In one embodiment, the production system addresses
baculovirus instability over multiple passages by utilizing a
titerless infected-cells preservation and scale-up system. Small
scale seed cultures of viral producing cells are transfected with
viral expression constructs encoding the structural,
non-structural, components of the viral particle.
Baculovirus-infected viral producing cells are harvested into
aliquots that may be cryopreserved in liquid nitrogen; the aliquots
retain viability and infectivity for infection of large scale viral
producing cell culture Wasilko D J et al., Protein Expr Purif. 2009
June; 65(2):122-32, the contents of which are herein incorporated
by reference in their entirety.
[0818] A genetically stable baculovirus may be used to produce
source of the one or more of the components for producing AAV
particles in invertebrate cells. In one embodiment, defective
baculovirus expression vectors may be maintained episomally in
insect cells. In such an embodiment the bacmid vector is engineered
with replication control elements, including but not limited to
promoters, enhancers, and/or cell-cycle regulated replication
elements.
[0819] In one embodiment, baculoviruses may be engineered with a
(non-) selectable marker for recombination into the
chitinase/cathepsin locus. The chia/v-cath locus is non-essential
for propagating baculovirus in tissue culture, and the V-cath (EC
3.4.22.50) is a cysteine endoprotease that is most active on
Arg-Arg dipeptide containing substrates. The Arg-Arg dipeptide is
present in densovirus and parvovirus capsid structural proteins but
infrequently occurs in dependovirus VP1.
[0820] In one embodiment, stable viral replication cells permissive
for baculovirus infection are engineered with at least one stable
integrated copy of any of the elements necessary for AAV
replication and viral particle production including, but not
limited to, the entire AAV genome, Rep and Cap genes, Rep genes,
Cap genes, each Rep protein as a separate transcription cassette,
each VP protein as a separate transcription cassette, the AAP
(assembly activation protein), or at least one of the baculovirus
helper genes with native or non-native promoters.
Large-Scale Production
[0821] In some embodiments, AAV particle production may be modified
to increase the scale of production. Large scale viral production
methods according to the present disclosure may include any of
those taught in U.S. Pat. Nos. 5,756,283, 6,258,595, 6,261,551,
6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966,
6,943,019, 6,953,690, 7,022,519, 7,238,526, 7,291,498 and 7,491,508
or International Publication Nos. WO1996039530, WO1998010088,
WO1999014354, WO1999015685, WO1999047691, WO2000055342,
WO2000075353 and WO2001023597, the contents of each of which are
herein incorporated by reference in their entirety. Methods of
increasing viral particle production scale typically comprise
increasing the number of viral replication cells. In some
embodiments, viral replication cells comprise adherent cells. To
increase the scale of viral particle production by adherent viral
replication cells, larger cell culture surfaces are required. In
some cases, large-scale production methods comprise the use of
roller bottles to increase cell culture surfaces. Other cell
culture substrates with increased surface areas are known in the
art. Examples of additional adherent cell culture products with
increased surface areas include, but are not limited to
CellSTACK.RTM., CellCube.RTM. (Corning Corp., Corning, N.Y.) and
Nunc.TM. Cell Factory.TM. (Thermo Scientific, Waltham, Mass.) In
some cases, large-scale adherent cell surfaces may comprise from
about 1,000 cm2 to about 100,000 cm2. In some cases, large-scale
adherent cell cultures may comprise from about 107 to about 109
cells, from about 108 to about 1010 cells, from about 109 to about
1012 cells or at least 1012 cells. In some cases, large-scale
adherent cultures may produce from about 109 to about 10.sup.12,
from about 1010 to about 10.sup.13, from about 1011 to about 1014,
from about 1012 to about 1015 or at least 1015 viral particles.
[0822] In some embodiments, large-scale viral production methods of
the present disclosure may comprise the use of suspension cell
cultures. Suspension cell culture allows for significantly
increased numbers of cells. Typically, the number of adherent cells
that can be grown on about 10-50 cm2 of surface area can be grown
in about 1 cm3 volume in suspension.
[0823] Transfection of replication cells in large-scale culture
formats may be carried out according to any methods known in the
art. For large-scale adherent cell cultures, transfection methods
may include, but are not limited to the use of inorganic compounds
(e.g. calcium phosphate), organic compounds [e.g. polyethyleneimine
(PEI)] or the use of non-chemical methods (e.g. electroporation.)
With cells grown in suspension, transfection methods may include,
but are not limited to the use of calcium phosphate and the use of
PEI. In some cases, transfection of large scale suspension cultures
may be carried out according to the section entitled "Transfection
Procedure" described in Feng, L. et al., 2008. Biotechnol Appl.
Biochem. 50:121-32, the contents of which are herein incorporated
by reference in their entirety. According to such embodiments,
PEI-DNA complexes may be formed for introduction of plasmids to be
transfected. In some cases, cells being transfected with PEI-DNA
complexes may be `shocked` prior to transfection. This comprises
lowering cell culture temperatures to 4.degree. C. for a period of
about 1 hour. In some cases, cell cultures may be shocked for a
period of from about 10 minutes to about 5 hours. In some cases,
cell cultures may be shocked at a temperature of from about
0.degree. C. to about 20.degree. C.
[0824] In some cases, transfections may include one or more vectors
for expression of an RNA effector molecule to reduce expression of
nucleic acids from one or more AAV payload construct. Such methods
may enhance the production of viral particles by reducing cellular
resources wasted on expressing payload constructs. In some cases,
such methods may be carried according to those taught in US
Publication No. US2014/0099666, the contents of which are herein
incorporated by reference in their entirety.
Bioreactors
[0825] In some embodiments, cell culture bioreactors may be used
for large scale viral production. In some cases, bioreactors
comprise stirred tank reactors. Such reactors generally comprise a
vessel, typically cylindrical in shape, with a stirrer (e.g.
impeller.) In some embodiments, such bioreactor vessels may be
placed within a water jacket to control vessel temperature and/or
to minimize effects from ambient temperature changes. Bioreactor
vessel volume may range in size from about 500 ml to about 2 L,
from about 1 L to about 5 L, from about 2.5 L to about 20 L, from
about 10 L to about 50 L, from about 25 L to about 100 L, from
about 75 L to about 500 L, from about 250 L to about 2,000 L, from
about 1,000 L to about 10,000 L, from about 5,000 L to about 50,000
L or at least 50,000 L. Vessel bottoms may be rounded or flat. In
some cases, animal cell cultures may be maintained in bioreactors
with rounded vessel bottoms.
[0826] In some cases, bioreactor vessels may be warmed through the
use of a thermocirculator. Thermocirculators pump heated water
around water jackets. In some cases, heated water may be pumped
through pipes (e.g. coiled pipes) that are present within
bioreactor vessels. In some cases, warm air may be circulated
around bioreactors, including, but not limited to air space
directly above culture medium. Additionally, pH and CO2 levels may
be maintained to optimize cell viability.
[0827] In some cases, bioreactors may comprise hollow-fiber
reactors. Hollow-fiber bioreactors may support the culture of both
anchorage dependent and anchorage independent cells. Further
bioreactors may include, but are not limited to packed-bed or
fixed-bed bioreactors. Such bioreactors may comprise vessels with
glass beads for adherent cell attachment. Further packed-bed
reactors may comprise ceramic beads.
[0828] In some cases, viral particles are produced through the use
of a disposable bioreactor. In some embodiments, such bioreactors
may include WaveTM disposable bioreactors.
[0829] In some embodiments, AAV particle production in animal cell
bioreactor cultures may be carried out according to the methods
taught in U.S. Pat. Nos. 5,064764, 6,194,191, 6,566,118, 8,137,948
or US Patent Application No. US2011/0229971, the contents of each
of which are herein incorporated by reference in their
entirety.
Cell Lysis
[0830] Cells of the invention, including, but not limited to viral
production cells, may be subjected to cell lysis according to any
methods known in the art. Cell lysis may be carried out to obtain
one or more agents (e.g. viral particles) present within any cells
of the invention. In some embodiments, cell lysis may be carried
out according to any of the methods listed in U.S. Pat. Nos.
7,326,555, 7,579,181, 7,048,920, 6,410,300, 6,436,394, 7,732,129,
7,510,875, 7,445,930, 6,726,907, 6,194,191, 7,125,706, 6,995,006,
6,676,935, 7,968,333, 5,756,283, 6,258,595, 6,261,551, 6,270,996,
6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019,
6,953,690, 7,022,519, 7,238,526, 7,291,498 and 7,491,508 or
International Publication Nos. WO1996039530, WO1998010088,
WO1999014354, WO1999015685, WO1999047691, WO2000055342,
WO2000075353 and WO2001023597, the contents of each of which are
herein incorporated by reference in their entirety. Cell lysis
methods may be chemical or mechanical. Chemical cell lysis
typically comprises contacting one or more cells with one or more
lysis agent. Mechanical lysis typically comprises subjecting one or
more cells to one or more lysis condition and/or one or more lysis
force.
[0831] In some embodiments, chemical lysis may be used to lyse
cells. As used herein, the term "lysis agent" refers to any agent
that may aid in the disruption of a cell. In some cases, lysis
agents are introduced in solutions, termed lysis solutions or lysis
buffers. As used herein, the term "lysis solution" refers to a
solution (typically aqueous) comprising one or more lysis agent. In
addition to lysis agents, lysis solutions may include one or more
buffering agents, solubilizing agents, surfactants, preservatives,
cryoprotectants, enzymes, enzyme inhibitors and/or chelators. Lysis
buffers are lysis solutions comprising one or more buffering agent.
Additional components of lysis solutions may include one or more
solubilizing agent. As used herein, the term "solubilizing agent"
refers to a compound that enhances the solubility of one or more
components of a solution and/or the solubility of one or more
entities to which solutions are applied. In some cases,
solubilizing agents enhance protein solubility. In some cases,
solubilizing agents are selected based on their ability to enhance
protein solubility while maintaining protein conformation and/or
activity.
[0832] Exemplary lysis agents may include any of those described in
U.S. Pat. Nos. 8,685,734, 7,901,921, 7,732,129, 7,223,585,
7,125,706, 8,236,495, 8,110,351, 7,419,956, 7,300,797, 6,699,706
and 6,143,567, the contents of each of which are herein
incorporated by reference in their entirety. In some cases, lysis
agents may be selected from lysis salts, amphoteric agents,
cationic agents, ionic detergents and non-ionic detergents. Lysis
salts may include, but are not limited to sodium chloride (NaCl)
and potassium chloride (KC1.) Further lysis salts may include any
of those described in U.S. Pat. Nos. 8,614,101, 7,326,555,
7,579,181, 7,048,920, 6,410,300, 6,436,394, 7,732,129, 7,510,875,
7,445,930, 6,726,907, 6,194,191, 7,125,706, 6,995,006, 6,676,935
and 7,968,333, the contents of each of which are herein
incorporated by reference in their entirety. Concentrations of
salts may be increased or decreased to obtain an effective
concentration for rupture of cell membranes. Amphoteric agents, as
referred to herein, are compounds capable of reacting as an acid or
a base. Amphoteric agents may include, but are not limited to
lysophosphatidylcholine, 3-((3-Cholamidopropyl)
dimethylammonium)-1-propanesulfonate (CHAPS), Zwittergent.RTM. and
the like. Cationic agents may include, but are not limited to
cetyltrimethylammonium bromide (C (16) TAB) and Benzalkonium
chloride. Lysis agents comprising detergents may include ionic
detergents or non-ionic detergents. Detergents may function to
break apart or dissolve cell structures including, but not limited
to cell membranes, cell walls, lipids, carbohydrates, lipoproteins
and glycoproteins. Exemplary ionic detergents include any of those
taught in U.S. Pat. Nos. 7,625,570 and 6,593,123 or US Publication
No. US2014/0087361, the contents of each of which are herein
incorporated by reference in their entirety. Some ionic detergents
may include, but are not limited to sodium dodecyl sulfate (SDS),
cholate and deoxycholate. In some cases, ionic detergents may be
included in lysis solutions as a solubilizing agent. Non-ionic
detergents may include, but are not limited to octylglucoside,
digitonin, lubrol, C12E8, TWEEN.RTM.-20, TWEEN.RTM.-80, Triton
X-100 and Noniodet P-40. Non-ionic detergents are typically weaker
lysis agents, but may be included as solubilizing agents for
solubilizing cellular and/or viral proteins. Further lysis agents
may include enzymes and urea. In some cases, one or more lysis
agents may be combined in a lysis solution in order to enhance one
or more of cell lysis and protein solubility. In some cases, enzyme
inhibitors may be included in lysis solutions in order to prevent
proteolysis that may be triggered by cell membrane disruption.
[0833] In some embodiments, mechanical cell lysis is carried out.
Mechanical cell lysis methods may include the use of one or more
lysis condition and/or one or more lysis force. As used herein, the
term "lysis condition" refers to a state or circumstance that
promotes cellular disruption. Lysis conditions may comprise certain
temperatures, pressures, osmotic purity, salinity and the like. In
some cases, lysis conditions comprise increased or decreased
temperatures. According to some embodiments, lysis conditions
comprise changes in temperature to promote cellular disruption.
Cell lysis carried out according to such embodiments may include
freeze-thaw lysis. As used herein, the term "freeze-thaw lysis"
refers to cellular lysis in which a cell solution is subjected to
one or more freeze-thaw cycle. According to freeze-thaw lysis
methods, cells in solution are frozen to induce a mechanical
disruption of cellular membranes caused by the formation and
expansion of ice crystals. Cell solutions used according
freeze-thaw lysis methods, may further comprise one or more lysis
agents, solubilizing agents, buffering agents, cryoprotectants,
surfactants, preservatives, enzymes, enzyme inhibitors and/or
chelators. Once cell solutions subjected to freezing are thawed,
such components may enhance the recovery of desired cellular
products. In some cases, one or more cyroprotectants are included
in cell solutions undergoing freeze-thaw lysis. As used herein, the
term "cryoprotectant" refers to an agent used to protect one or
more substance from damage due to freezing. Cryoprotectants may
include any of those taught in US Publication No. US2013/0323302 or
U.S. Pat. Nos. 6,503,888, 6,180,613, 7,888,096, 7,091,030, the
contents of each of which are herein incorporated by reference in
their entirety. In some cases, cryoprotectants may include, but are
not limited to dimethyl sulfoxide, 1,2-propanediol, 2,3-butanediol,
formamide, glycerol, ethylene glycol, 1,3-propanediol and
n-dimethyl formamide, polyvinylpyrrolidone, hydroxyethyl starch,
agarose, dextrans, inositol, glucose, hydroxyethylstarch, lactose,
sorbitol, methyl glucose, sucrose and urea. In some embodiments,
freeze-thaw lysis may be carried out according to any of the
methods described in U.S. Pat. No. 7,704,721, the contents of which
are herein incorporated by reference in their entirety.
[0834] As used herein, the term "lysis force" refers to a physical
activity used to disrupt a cell. Lysis forces may include, but are
not limited to mechanical forces, sonic forces, gravitational
forces, optical forces, electrical forces and the like. Cell lysis
carried out by mechanical force is referred to herein as
"mechanical lysis." Mechanical forces that may be used according to
mechanical lysis may include high shear fluid forces. According to
such methods of mechanical lysis, a microfluidizer may be used.
Microfluidizers typically comprise an inlet reservoir where cell
solutions may be applied. Cell solutions may then be pumped into an
interaction chamber via a pump (e.g. high-pressure pump) at high
speed and/or pressure to produce shear fluid forces. Resulting
lysates may then be collected in one or more output reservoir. Pump
speed and/or pressure may be adjusted to modulate cell lysis and
enhance recovery of products (e.g. viral particles.) Other
mechanical lysis methods may include physical disruption of cells
by scraping.
[0835] Cell lysis methods may be selected based on the cell culture
format of cells to be lysed. For example, with adherent cell
cultures, some chemical and mechanical lysis methods may be used.
Such mechanical lysis methods may include freeze-thaw lysis or
scraping. In another example, chemical lysis of adherent cell
cultures may be carried out through incubation with lysis solutions
comprising surfactant, such as Triton-X-100. In some cases, cell
lysates generated from adherent cell cultures may be treated with
one more nuclease to lower the viscosity of the lysates caused by
liberated DNA.
[0836] In one embodiment, a method for harvesting AAV particles
without lysis may be used for efficient and scalable AAV particle
production. In a non-limiting example, AAV particles may be
produced by culturing an AAV particle lacking a heparin binding
site, thereby allowing the AAV particle to pass into the
supernatant, in a cell culture, collecting supernatant from the
culture; and isolating the AAV particle from the supernatant, as
described in US Patent Application 20090275107, the contents of
which are incorporated herein by reference in their entirety.
Clarification
[0837] Cell lysates comprising viral particles may be subjected to
clarification. Clarification refers to initial steps taken in
purification of viral particles from cell lysates. Clarification
serves to prepare lysates for further purification by removing
larger, insoluble debris. Clarification steps may include, but are
not limited to centrifugation and filtration. During clarification,
centrifugation may be carried out at low speeds to remove larger
debris, only. Similarly, filtration may be carried out using
filters with larger pore sizes so that only larger debris is
removed. In some cases, tangential flow filtration may be used
during clarification. Objectives of viral clarification include
high throughput processing of cell lysates and to optimize ultimate
viral recovery. Advantages of including a clarification step
include scalability for processing of larger volumes of lysate. In
some embodiments, clarification may be carried out according to any
of the methods presented in U.S. Pat. Nos. 8,524,446, 5,756,283,
6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769,
6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526,
7,291,498, 7,491,508, US Publication Nos. US2013/0045186,
US2011/0263027, US2011/0151434, US2003/0138772, and International
Publication Nos. WO2002012455, WO1996039530, WO1998010088,
WO1999014354, WO1999015685, WO1999047691, WO2000055342,
WO2000075353 and WO2001023597, the contents of each of which are
herein incorporated by reference in their entirety.
[0838] Methods of cell lysate clarification by filtration are well
understood in the art and may be carried out according to a variety
of available methods including, but not limited to passive
filtration and flow filtration. Filters used may comprise a variety
of materials and pore sizes. For example, cell lysate filters may
comprise pore sizes of from about 1 .mu.M to about 5 .mu.M, from
about 0.5 .mu.M to about 2 .mu.M, from about 0.1 .mu.M to about 1
.mu.M from about 0.05 .mu.M to about 0.05 .mu.M and from about
0.001 .mu.M to about 0.1 .mu.M. Exemplary pore sizes for cell
lysate filters may include, but are not limited to, 2.0, 1.9, 1.8,
1.7, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4,
0.3, 0.2, 0.1, 0.95, 0.9, 0.85, 0.8, 0.75, 0.7, 0.65, 0.6, 0.55,
0.5, 0.45, 0.4, 0.35, 0.3, 0.25, 0.2, 0.15, 0.1, 0.05, 0.22, 0.21,
0.20, 0.19, 0.18, 0.17, 0.16, 0.15, 0.14, 0.13, 0.12, 0.11, 0.1,
0.09, 0.08, 0.07, 0.06, 0.05, 0.04, 0.03, 0.02, 0.01, 0.02, 0.019,
0.018, 0.017, 0.016, 0.015, 0.014, 0.013, 0.012, 0.011, 0.01,
0.009, 0.008, 0.007, 0.006, 0.005, 0.004, 0.003, 0.002, 0.001 and
0.001 .mu.M. In one embodiment, clarification may comprise
filtration through a filter with 2.0 .mu.M pore size to remove
large debris, followed by passage through a filter with 0.45 .mu.M
pore size to remove intact cells.
[0839] Filter materials may be composed of a variety of materials.
Such materials may include, but are not limited to polymeric
materials and metal materials (e.g. sintered metal and pored
aluminum.) Exemplary materials may include, but are not limited to
nylon, cellulose materials (e.g. cellulose acetate), polyvinylidene
fluoride (PVDF), polyethersulfone, polyamide, polysulfone,
polypropylene, and polyethylene terephthalate. In some cases,
filters useful for clarification of cell lysates may include, but
are not limited to ULTIPLEAT PROFILE.TM. filters (Pall Corporation,
Port Washington, N.Y.), SUPOR.TM. membrane filters (Pall
Corporation, Port Washington, N.Y.)
[0840] In some cases, flow filtration may be carried out to
increase filtration speed and/or effectiveness. In some cases, flow
filtration may comprise vacuum filtration. According to such
methods, a vacuum is created on the side of the filter opposite
that of cell lysate to be filtered. In some cases, cell lysates may
be passed through filters by centrifugal forces. In some cases, a
pump is used to force cell lysate through clarification filters.
Flow rate of cell lysate through one or more filters may be
modulated by adjusting one of channel size and/or fluid
pressure.
[0841] According to some embodiments, cell lysates may be clarified
by centrifugation. Centrifugation may be used to pellet insoluble
particles in the lysate. During clarification, centrifugation
strength [expressed in terms of gravitational units (g), which
represents multiples of standard gravitational force] may be lower
than in subsequent purification steps. In some cases,
centrifugation may be carried out on cell lysates at from about 200
g to about 800 g, from about 500 g to about 1500 g, from about 1000
g to about 5000 g, from about 1200 g to about 10000 g or from about
8000 g to about 15000 g. In some embodiments, cell lysate
centrifugation is carried out at 8000 g for 15 minutes. In some
cases, density gradient centrifugation may be carried out in order
to partition particulates in the cell lysate by sedimentation rate.
Gradients used according to methods of the present disclosure may
include, but are not limited to cesium chloride gradients and
iodixanol step gradients.
Purification: Chromatography
[0842] In some cases, AAV particles may be purified from clarified
cell lysates by one or more methods of chromatography.
Chromatography refers to any number of methods known in the art for
separating out one or more elements from a mixture. Such methods
may include, but are not limited to ion exchange chromatography
(e.g. cation exchange chromatography and anion exchange
chromatography), immunoaffinity chromatography and size-exclusion
chromatography. In some embodiments, methods of viral
chromatography may include any of those taught in U.S. Pat. Nos.
5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394,
6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519,
7,238,526, 7,291,498 and 7,491,508 or International Publication
Nos. WO1996039530, WO1998010088, WO1999014354, WO1999015685,
WO1999047691, WO2000055342, WO2000075353 and WO2001023597, the
contents of each of which are herein incorporated by reference in
their entirety.
[0843] In some embodiments, ion exchange chromatography may be used
to isolate viral particles. Ion exchange chromatography is used to
bind viral particles based on charge-charge interactions between
capsid proteins and charged sites present on a stationary phase,
typically a column through which viral preparations (e.g. clarified
lysates) are passed. After application of viral preparations, bound
viral particles may then be eluted by applying an elution solution
to disrupt the charge-charge interactions. Elution solutions may be
optimized by adjusting salt concentration and/or pH to enhance
recovery of bound viral particles. Depending on the charge of viral
capsids being isolated, cation or anion exchange chromatography
methods may be selected. Methods of ion exchange chromatography may
include, but are not limited to any of those taught in U.S. Pat.
Nos. 7,419,817, 6,143,548, 7,094,604, 6,593,123, 7,015,026 and
8,137,948, the contents of each of which are herein incorporated by
reference in their entirety.
[0844] In some embodiments, immunoaffinity chromatography may be
used. Immunoaffinity chromatography is a form of chromatography
that utilizes one or more immune compounds (e.g. antibodies or
antibody-related structures) to retain viral particles. Immune
compounds may bind specifically to one or more structures on viral
particle surfaces, including, but not limited to one or more viral
coat protein. In some cases, immune compounds may be specific for a
particular viral variant. In some cases, immune compounds may bind
to multiple viral variants. In some embodiments, immune compounds
may include recombinant single-chain antibodies. Such recombinant
single chain antibodies may include those described in Smith, R. H.
et al., 2009. Mol. Ther. 17(11):1888-96, the contents of which are
herein incorporated by reference in their entirety. Such immune
compounds are capable of binding to several AAV capsid variants,
including, but not limited to AAV1, AAV2, AAV6 and AAV8.
[0845] In some embodiments, size-exclusion chromatography (SEC) may
be used. SEC may comprise the use of a gel to separate particles
according to size. In viral particle purification, SEC filtration
is sometimes referred to as "polishing." In some cases, SEC may be
carried out to generate a final product that is near-homogenous.
Such final products may in some cases be used in pre-clinical
studies and/or clinical studies (Kotin, R. M. 2011. Human Molecular
Genetics. 20(1):R2-R6, the contents of which are herein
incorporated by reference in their entirety.) In some cases, SEC
may be carried out according to any of the methods taught in U.S.
Pat. Nos. 6,143,548, 7,015,026, 8,476,418, 6,410,300, 8,476,418,
7,419,817, 7,094,604, 6,593,123, and 8,137,948, the contents of
each of which are herein incorporated by reference in their
entirety.
[0846] In one embodiment, the compositions comprising at least one
AAV particle may be isolated or purified using the methods
described in US Patent No. U.S. Pat. No. 6,146,874, the contents of
which are herein incorporated by reference in its entirety.
[0847] In one embodiment, the compositions comprising at least one
AAV particle may be isolated or purified using the methods
described in US Patent No. U.S. Pat. No. 6,660,514, the contents of
which are herein incorporated by reference in its entirety.
[0848] In one embodiment, the compositions comprising at least one
AAV particle may be isolated or purified using the methods
described in US Patent No. U.S. Pat. No. 8,283,151, the contents of
which are herein incorporated by reference in its entirety.
[0849] In one embodiment, the compositions comprising at least one
AAV particle may be isolated or purified using the methods
described in US Patent No. U.S. Pat. No. 8,524,446, the contents of
which are herein incorporated by reference in its entirety.
II. Formulation and Delivery
Pharmaceutical Compositions and Formulation
[0850] Although the descriptions of pharmaceutical compositions,
e.g., those modulatory polynucleotides (including the encoding
plasmids or expression vectors, such as viruses, e.g., AAV)
comprising a payload to be delivered, provided herein are
principally directed to pharmaceutical compositions which are
suitable for administration to humans, it will be understood by the
skilled artisan that such compositions are generally suitable for
administration to any other animal, e.g., to non-human animals,
e.g. non-human mammals. Modification of pharmaceutical compositions
suitable for administration to humans in order to render the
compositions suitable for administration to various animals is well
understood, and the ordinarily skilled veterinary pharmacologist
can design and/or perform such modification with merely ordinary,
if any, experimentation. Subjects to which administration of the
pharmaceutical compositions is contemplated include, but are not
limited to, humans and/or other primates; mammals, including
commercially relevant mammals such as cattle, pigs, horses, sheep,
cats, dogs, mice, and/or rats; and/or birds, including commercially
relevant birds such as poultry, chickens, ducks, geese, and/or
turkeys.
[0851] In some embodiments, compositions are administered to
humans, human patients or subjects. For the purposes of the present
disclosure, the phrase "active ingredient" generally refers either
to the viral vector carrying the payload or to the modulatory
polynucleotide payload molecule delivered by a viral vector as
described herein.
[0852] Formulations of the pharmaceutical compositions described
herein may be prepared by any method known or hereafter developed
in the art of pharmacology. In general, such preparatory methods
include the step of bringing the active ingredient into association
with an excipient and/or one or more other accessory ingredients,
and then, if necessary and/or desirable, dividing, shaping and/or
packaging the product into a desired single- or multi-dose
unit.
[0853] Relative amounts of the active ingredient, the
pharmaceutically acceptable excipient, and/or any additional
ingredients in a pharmaceutical composition in accordance with the
invention will vary, depending upon the identity, size, and/or
condition of the subject treated and further depending upon the
route by which the composition is to be administered.
[0854] The modulatory polynucleotides or viral vectors encoding
them can be formulated using one or more excipients to: (1)
increase stability; (2) increase cell transfection or transduction;
(3) permit the sustained or delayed release; or (4) alter the
biodistribution (e.g., target the viral vector to specific tissues
or cell types).
[0855] Formulations of the present invention can include, without
limitation, saline, lipidoids, liposomes, lipid nanoparticles,
polymers, lipoplexes, core-shell nanoparticles, peptides, proteins,
cells transfected with viral vectors (e.g., for transplantation
into a subject), nanoparticle mimics and combinations thereof.
Further, the viral vectors of the present invention may be
formulated using self-assembled nucleic acid nanoparticles.
[0856] Formulations of the pharmaceutical compositions described
herein may be prepared by any method known or hereafter developed
in the art of pharmacology. In general, such preparatory methods
include the step of associating the active ingredient with an
excipient and/or one or more other accessory ingredients.
[0857] A pharmaceutical composition in accordance with the present
disclosure may be prepared, packaged, and/or sold in bulk, as a
single unit dose, and/or as a plurality of single unit doses. As
used herein, a "unit dose" refers to a discrete amount of the
pharmaceutical composition comprising a predetermined amount of the
active ingredient. The amount of the active ingredient is generally
equal to the dosage of the active ingredient which would be
administered to a subject and/or a convenient fraction of such a
dosage such as, for example, one-half or one-third of such a
dosage.
[0858] Relative amounts of the active ingredient, the
pharmaceutically acceptable excipient, and/or any additional
ingredients in a pharmaceutical composition in accordance with the
present disclosure may vary, depending upon the identity, size,
and/or condition of the subject being treated and further depending
upon the route by which the composition is to be administered. For
example, the composition may comprise between 0.1% and 99% (w/w) of
the active ingredient. By way of example, the composition may
comprise between 0.1% and 100%, e.g., between .5 and 50%, between
1-30%, between 5-80%, at least 80% (w/w) active ingredient.
[0859] In some embodiments, the formulations described herein may
contain at least one payload molecule. As a non-limiting example,
the formulations may contain 1, 2, 3, 4 or 5 modulatory
polynucleotide payload molecules. In one embodiment the formulation
may contain a modulatory polynucleotide payload construct targeting
proteins selected from categories such as, but not limited to,
human proteins, veterinary proteins, bacterial proteins, biological
proteins, antibodies, immunogenic proteins, therapeutic peptides
and proteins, secreted proteins, plasma membrane proteins,
cytoplasmic and cytoskeletal proteins, intracellular membrane bound
proteins, nuclear proteins, proteins associated with human disease
and/or proteins associated with non-human diseases. In one
embodiment, the formulation contains at least three payload
construct targeting proteins.
[0860] In some embodiments, a pharmaceutically acceptable excipient
may be at least 95%, at least 96%, at least 97%, at least 98%, at
least 99%, or 100% pure. In some embodiments, an excipient is
approved for use for humans and for veterinary use. In some
embodiments, an excipient may be approved by the United States Food
and Drug Administration. In some embodiments, an excipient may be
of pharmaceutical grade. In some embodiments, an excipient may meet
the standards of the United States Pharmacopoeia (USP), the
European Pharmacopoeia (EP), the British Pharmacopoeia, and/or the
International Pharmacopoeia.
[0861] Excipients, which, as used herein, includes, but is not
limited to, any and all solvents, dispersion media, diluents, or
other liquid vehicles, dispersion or suspension aids, surface
active agents, isotonic agents, thickening or emulsifying agents,
preservatives, and the like, as suited to the particular dosage
form desired. Various excipients for formulating pharmaceutical
compositions and techniques for preparing the composition are known
in the art (see Remington: The Science and Practice of Pharmacy,
21.sup.st Edition, A. R. Gennaro, Lippincott, Williams &
Wilkins, Baltimore, Md., 2006; incorporated herein by reference in
its entirety). The use of a conventional excipient medium may be
contemplated within the scope of the present disclosure, except
insofar as any conventional excipient medium may be incompatible
with a substance or its derivatives, such as by producing any
undesirable biological effect or otherwise interacting in a
deleterious manner with any other component(s) of the
pharmaceutical composition.
[0862] Exemplary diluents include, but are not limited to, calcium
carbonate, sodium carbonate, calcium phosphate, dicalcium
phosphate, calcium sulfate, calcium hydrogen phosphate, sodium
phosphate lactose, sucrose, cellulose, microcrystalline cellulose,
kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch,
cornstarch, powdered sugar, etc., and/or combinations thereof.
Inactive Ingredients
[0863] In some embodiments, modulatory polynucleotide formulations
may comprise at least one excipient which is an inactive
ingredient. As used herein, the term "inactive ingredient" refers
to one or more inactive agents included in formulations. In some
embodiments, all, none or some of the inactive ingredients which
may be used in the formulations of the present invention may be
approved by the US Food and Drug Administration (FDA).
[0864] Formulations of viral vectors carrying modulatory
polynucleotide disclosed herein may include cations or anions. In
one embodiment, the formulations include metal cations such as, but
not limited to, Zn2+, Ca2+, Cu2+, Mg+ and combinations thereof. As
a non-limiting example, formulations may include polymers and
modulatory polynucleotides complexed with a metal cation (See e.g.,
U.S. Pat. Nos. 6,265,389 and 6,555,525, each of which is herein
incorporated by reference in its entirety).
Delivery
[0865] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for the delivery of AAV virions described in European Patent
Application No. EP1857552, the contents of which are herein
incorporated by reference in their entirety.
[0866] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering proteins using AAV vectors described in European
Patent Application No. EP2678433, the contents of which are herein
incorporated by reference in their entirety.
[0867] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering DNA molecules using AAV vectors described in US
Patent No. U.S. Pat. No. 5,858,351, the contents of which are
herein incorporated by reference in their entirety.
[0868] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering DNA to the bloodstream described in US Patent No.
U.S. Pat. No. 6,211,163, the contents of which are herein
incorporated by reference in their entirety.
[0869] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering AAV virions described in US Patent No. U.S. Pat. No.
6,325,998, the contents of which are herein incorporated by
reference in their entirety.
[0870] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering DNA to muscle cells described in US Patent No. U.S.
Pat. No. 6,335,011, the contents of which are herein incorporated
by reference in their entirety.
[0871] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering DNA to muscle cells and tissues described in US
Patent No. U.S. Pat. No. 6,610,290, the contents of which are
herein incorporated by reference in their entirety.
[0872] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering DNA to muscle cells described in US Patent No. U.S.
Pat. No. 7,704,492, the contents of which are herein incorporated
by reference in their entirety.
[0873] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering a payload to skeletal muscles described in US Patent
No. U.S. Pat. No. 7,112,321, the contents of which are herein
incorporated by reference in their entirety.
[0874] In one embodiment, the viral vector may be administered or
delivered using the methods for delivering a payload to the central
nervous system described in US Patent No. U.S. Pat. No. 7,588,757,
the contents of which are herein incorporated by reference in their
entirety.
[0875] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering a payload described in US Patent No. U.S. Pat. No.
8,283,151, the contents of which are herein incorporated by
reference in their entirety.
[0876] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering a payload for the treatment of Alzheimer disease
described in US Patent No. U.S. Pat. No. 8,318,687, the contents of
which are herein incorporated by reference in their entirety.
[0877] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering a payload described in International Patent
Publication No. WO2012144446, the contents of which are herein
incorporated by reference in their entirety.
[0878] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering a payload using a glutamic acid decarboxylase (GAD)
delivery vector described in International Patent Publication No.
WO2001089583, the contents of which are herein incorporated by
reference in their entirety.
[0879] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering a payload described in International Patent
Publication No. WO2001096587, the contents of which are herein
incorporated by reference in their entirety.
[0880] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering a payload to muscle tissue described in
International Patent Publication No. WO2002014487, the contents of
which are herein incorporated by reference in their entirety.
[0881] In one embodiment, the viral vector comprising a modulatory
polynucleotide may be administered or delivered using the methods
for delivering a payload to neural cells described in International
Patent Publication No. WO2012057363, the contents of which are
herein incorporated by reference in their entirety.
[0882] The pharmaceutical compositions of viral vectors described
herein may be characterized by one or more of bioavailability,
therapeutic window and/or volume of distribution.
[0883] In one embodiment, the viral vectors comprising a modulatory
polynucleotide may be formulated. As a non-limiting example the
baricity and/or osmolality of the formulation may be optimized to
ensure optimal drug distribution in the central nervous system or a
region or component of the central nervous system.
[0884] In one embodiment, the viral vectors comprising a modulatory
polynucleotide may be delivered to a subject via a single route
administration.
[0885] In one embodiment, the viral vectors comprising a modulatory
polynucleotide may be delivered to a subject via a multi-site route
of administration. A subject may be administered the viral vectors
comprising a modulatory polynucleotide at 2, 3, 4, 5 or more than 5
sites.
[0886] In one embodiment, a subject may be administered the viral
vectors comprising a modulatory polynucleotide described herein
using a bolus infusion.
[0887] In one embodiment, a subject may be administered the viral
vectors comprising a modulatory polynucleotide described herein
using sustained delivery over a period of minutes, hours or days.
The infusion rate may be changed depending on the subject,
distribution, formulation or another delivery parameter.
[0888] In one embodiment, the catheter may be located at more than
one site in the spine for multi-site delivery. The viral vectors
comprising a modulatory polynucleotide may be delivered in a
continuous and/or bolus infusion. Each site of delivery may be a
different dosing regimen or the same dosing regimen may be used for
each site of delivery. As a non-limiting example, the sites of
delivery may be in the cervical and the lumbar region. As another
non-limiting example, the sites of delivery may be in the cervical
region. As another non-limiting example, the sites of delivery may
be in the lumbar region.
[0889] In one embodiment, a subject may be analyzed for spinal
anatomy and pathology prior to delivery of the viral vectors
comprising a modulatory polynucleotide described herein. As a
non-limiting example, a subject with scoliosis may have a different
dosing regimen and/or catheter location compared to a subject
without scoliosis.
[0890] In one embodiment, the orientation of the spine subject
during delivery of the viral vectors comprising a modulatory
polynucleotide may be vertical to the ground.
[0891] In another embodiment, the orientation of the spine of the
subject during delivery of the viral vectors comprising a
modulatory polynucleotide may be horizontal to the ground.
[0892] In one embodiment, the spine of the subject may be at an
angle as compared to the ground during the delivery of the viral
vectors comprising a modulatory polynucleotide subject. The angle
of the spine of the subject as compared to the ground may be at
least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140,
150 or 180 degrees.
[0893] In one embodiment, the delivery method and duration is
chosen to provide broad transduction in the spinal cord. As a
non-limiting example, intrathecal delivery is used to provide broad
transduction along the rostral-caudal length of the spinal cord. As
another non-limiting example, multi-site infusions provide a more
uniform transduction along the rostral-caudal length of the spinal
cord. As yet another non-limiting example, prolonged infusions
provide a more uniform transduction along the rostral-caudal length
of the spinal cord.
Introduction Into Cells
[0894] The modulatory polynucleotides of the invention can be
introduced into host cells using any of a variety of approaches.
Infection with a viral vector comprising the modulatory
polynucleotide can be affected. Examples of suitable viral vectors
include replication defective retroviral vectors, adenoviral
vectors, adeno-associated vectors and lentiviral vectors.
[0895] According to the present invention, viral vectors for use in
therapeutics and/or diagnostics comprise a virus that has been
distilled or reduced to the minimum components necessary for
transduction of a nucleic acid payload or cargo of interest.
[0896] In this manner, viral vectors are engineered as vehicles for
specific delivery while lacking the deleterious replication and/or
integration features found in wild-type virus.
[0897] As used herein, a "vector" is any molecule or moiety which
transports, transduces or otherwise acts as a carrier of a
heterologous molecule such as the modulatory polynucleotides of the
invention. A "viral vector" is a vector which comprises one or more
polynucleotide regions encoding or comprising payload molecules of
interest, e.g., a transgene, a polynucleotide encoding a
polypeptide or multi-polypeptide or a modulatory nucleic acid.
Viral vectors of the present invention may be produced
recombinantly and may be based on adeno-associated virus (AAV)
parent or reference sequences. Serotypes which may be useful in the
present invention include any of those arising from AAV1, AAV2,
AAV3, AAV4, AAVS, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hul4),
AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ, AAV-DJ8, AAV-PHP.A
and/or AAV-PHP.B.
[0898] In one embodiment, the serotype which may be useful in the
present invention may be AAV-DJ8. The amino acid sequence of
AAV-DJ8 may comprise two or more mutations in order to remove the
heparin binding domain (HBD). As a non-limiting example, the AAV-DJ
sequence described as SEQ ID NO: 1 in U.S. Pat. No. 7,588,772, the
contents of which are herein incorporated by reference in their
entirety, may comprise two mutations: (1) R587Q where arginine (R;
Arg) at amino acid 587 is changed to glutamine (Q; Gln) and (2)
R590T where arginine (R; Arg) at amino acid 590 is changed to
threonine (T; Thr). As another non-limiting example, may comprise
three mutations: (1) K406R where lysine (K; Lys) at amino acid 406
is changed to arginine (R; Arg), (2) R587Q where arginine (R; Arg)
at amino acid 587 is changed to glutamine (Q; Gln) and (3) R590T
where arginine (R; Arg) at amino acid 590 is changed to threonine
(T; Thr).
[0899] AAV vectors may also comprise self-complementary AAV vectors
(scAAVs). scAAV vectors contain both DNA strands which anneal
together to form double stranded DNA. By skipping second strand
synthesis, scAAVs allow for rapid expression in the cell.
[0900] In one embodiment, the AAV vector used in the present
invention is a scAAV.
[0901] In one embodiment, the modulatory polynucleotides may be
introduced into cells from any relevant species, such as, but not
limited to, human, dog, mouse, rat or monkey.
[0902] In one embodiment, the modulatory polynucleotides may be
introduced into cells which are relevant to the disease to be
treated. As a non-limiting example, the disease is ALS and the
target cells are motor neurons and astrocytes.
[0903] In one embodiment, the modulatory polynucleotides may be
introduced into cells which have a high level of endogenous
expression of the target sequence.
[0904] In another embodiment, the modulatory polynucleotides may be
introduced into cells which have a low level of endogenous
expression of the target sequence.
[0905] In one embodiment, the cells may be those which have a high
efficiency of AAV transduction.
[0906] In one embodiment, the cells which may be used for in vitro
analysis of the modulatory polynucleotides include, but are not
limited to, HEK293, HeLa, human primary astrocytes, human astrocyte
cell line (U251MG), SH-SY5Y-neurons and human iPSC-derived motor
neuron progenitors.
III. Administration and Dosing
Administration
[0907] The viral vectors comprising modulatory polynucleotides of
the present invention may be administered by any route which
results in a therapeutically effective outcome. These include, but
are not limited to enteral (into the intestine), gastroenteral,
epidural (into the dura matter), oral (by way of the mouth),
transdermal, peridural, intracerebral (into the cerebrum),
intracerebroventricular (into the cerebral ventricles),
epicutaneous (application onto the skin), intradermal, (into the
skin itself), subcutaneous (under the skin), nasal administration
(through the nose), intravenous (into a vein), intravenous bolus,
intravenous drip, intraarterial (into an artery), intramuscular
(into a muscle), intracardiac (into the heart), intraosseous
infusion (into the bone marrow), intrathecal (into the spinal
canal), subpial (between the pia and the underlying tissue),
intraperitoneal, (infusion or injection into the peritoneum),
intravesical infusion, intravitreal, (through the eye),
intracavernous injection (into a pathologic cavity) intracavitary
(into the base of the penis), intravaginal administration,
intrauterine, extra-amniotic administration, transdermal (diffusion
through the intact skin for systemic distribution), transmucosal
(diffusion through a mucous membrane), transvaginal, insufflation
(snorting), sublingual, sublabial, enema, eye drops (onto the
conjunctiva), in ear drops, auricular (in or by way of the ear),
buccal (directed toward the cheek), conjunctival, cutaneous, dental
(to a tooth or teeth), electro-osmosis, endocervical, endosinusial,
endotracheal, extracorporeal, hemodialysis, infiltration,
interstitial, intra-abdominal, intra-amniotic, intra-articular,
intrabiliary, intrabronchial, intrabursal, intracartilaginous
(within a cartilage), intracaudal (within the cauda equine),
intracisternal (within the cisterna magna cerebellomedularis),
intracorneal (within the cornea), dental intracornal, intracoronary
(within the coronary arteries), intracorporus cavernosum (within
the dilatable spaces of the corporus cavernosa of the penis),
intradiscal (within a disc), intraductal (within a duct of a
gland), intraduodenal (within the duodenum), intradural (within or
beneath the dura), intraepidermal (to the epidermis),
intraesophageal (to the esophagus), intragastric (within the
stomach), intragingival (within the gingivae), intraileal (within
the distal portion of the small intestine), intralesional (within
or introduced directly to a localized lesion), intraluminal (within
a lumen of a tube), intralymphatic (within the lymph),
intramedullary (within the marrow cavity of a bone), intrameningeal
(within the meninges), intraocular (within the eye), intraovarian
(within the ovary), intrapericardial (within the pericardium),
intrapleural (within the pleura), intraprostatic (within the
prostate gland), intrapulmonary (within the lungs or its bronchi),
intrasinal (within the nasal or periorbital sinuses), intraspinal
(within the vertebral column), intrasynovial (within the synovial
cavity of a joint), intratendinous (within a tendon),
intratesticular (within the testicle), intrathecal (within the
cerebrospinal fluid at any level of the cerebrospinal axis),
intrathoracic (within the thorax), intratubular (within the tubules
of an organ), intratumor (within a tumor), intratympanic (within
the aurus media), intravascular (within a vessel or vessels),
intraventricular (within a ventricle), iontophoresis (by means of
electric current where ions of soluble salts migrate into the
tissues of the body), irrigation (to bathe or flush open wounds or
body cavities), laryngeal (directly upon the larynx), nasogastric
(through the nose and into the stomach), occlusive dressing
technique (topical route administration which is then covered by a
dressing which occludes the area), ophthalmic (to the external
eye), oropharyngeal (directly to the mouth and pharynx),
parenteral, percutaneous, periarticular, peridural, perineural,
periodontal, rectal, respiratory (within the respiratory tract by
inhaling orally or nasally for local or systemic effect),
retrobulbar (behind the pons or behind the eyeball), soft tissue,
subarachnoid, subconjunctival, submucosal, topical, transplacental
(through or across the placenta), transtracheal (through the wall
of the trachea), transtympanic (across or through the tympanic
cavity), ureteral (to the ureter), urethral (to the urethra),
vaginal, caudal block, diagnostic, nerve block, biliary perfusion,
cardiac perfusion, photopheresis or spinal. In specific
embodiments, compositions may be administered in a way which allows
them to cross the blood-brain barrier, vascular barrier, or other
epithelial barrier. In one embodiment, a formulation for a route of
administration may include at least one inactive ingredient.
Dosing
[0908] The present invention provides methods comprising
administering viral vectors and their modulatory polynucleotide
payload or complexes in accordance with the invention to a subject
in need thereof. Viral vector pharmaceutical, imaging, diagnostic,
or prophylactic compositions thereof, may be administered to a
subject using any amount and any route of administration effective
for preventing, treating, diagnosing, or imaging a disease,
disorder, and/or condition (e.g., a disease, disorder, and/or
condition relating to working memory deficits). The exact amount
required will vary from subject to subject, depending on the
species, age, and general condition of the subject, the severity of
the disease, the particular composition, its mode of
administration, its mode of activity, and the like. Compositions in
accordance with the invention are typically formulated in unit
dosage form for ease of administration and uniformity of dosage. It
will be understood, however, that the total daily usage of the
compositions of the present invention may be decided by the
attending physician within the scope of sound medical judgment. The
specific therapeutically effective, prophylactically effective, or
appropriate imaging dose level for any particular patient will
depend upon a variety of factors including the disorder being
treated and the severity of the disorder; the activity of the
specific compound employed; the specific composition employed; the
age, body weight, general health, sex and diet of the patient; the
time of administration, route of administration, and rate of
excretion of the specific modulatory polynucleotide payload
employed; the duration of the treatment; drugs used in combination
or coincidental with the specific compound employed; and like
factors well known in the medical arts.
[0909] In certain embodiments, viral vector pharmaceutical
compositions in accordance with the present invention may be
administered at modulatory polynucleotide dosage levels sufficient
to deliver from about 0.0001 mg/kg to about 100 mg/kg, from about
0.001 mg/kg to about 0.05 mg/kg, from about 0.005 mg/kg to about
0.05 mg/kg, from about 0.001 mg/kg to about 0.005 mg/kg, from about
0.05 mg/kg to about 0.5 mg/kg, from about 0.01 mg/kg to about 50
mg/kg, from about 0.1 mg/kg to about 40 mg/kg, from about 0.5 mg/kg
to about 30 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from
about 0.1 mg/kg to about 10 mg/kg, or from about 1 mg/kg to about
25 mg/kg, of subject body weight per day, one or more times a day,
to obtain the desired therapeutic, diagnostic, prophylactic, or
imaging effect (see e.g., the range of unit doses described in
International Publication No WO2013078199, herein incorporated by
reference in its entirety). The desired modulatory polynucleotide
dosage may be delivered more than once (e.g., more than one
administration in a day). In certain embodiments, the desired
modulatory polynucleotide dosage may be delivered using multiple
administrations (e.g., two, three, four, five, six, seven, eight,
nine, ten, eleven, twelve, thirteen, fourteen, or more
administrations). When multiple administrations are employed, split
dosing regimens such as those described herein may be used. As used
herein, a "split dose" is the division of single unit dose or total
daily dose into two or more doses, e.g., two or more
administrations of the single unit dose. As used herein, a "single
unit dose" is a dose of any modulatory polynucleotide therapeutic
administered in one dose/at one time/single route/single point of
contact, i.e., single administration event. As used herein, a
"total daily dose" is an amount given or prescribed in 24 hour
period. It may be administered as a single unit dose. In one
embodiment, the viral vectors comprising the modulatory
polynucleotides of the present invention are administered to a
subject in split doses. They may be formulated in buffer only or in
a formulation described herein.
[0910] In one embodiment, delivery of the compositions in
accordance with the present invention to cells comprises a rate of
delivery defined by [VG/hour=mL/hour*VG/mL] wherein VG is viral
genomes, VG/mL is composition concentration, and mL/hour is rate of
prolonged delivery.
[0911] In one embodiment, delivery of compositions in accordance
with the present invention to cells may comprise a total
concentration per subject between about 1.times.10.sup.6 VG and
about 1.times.10.sup.16 VG. In some embodiments, delivery may
comprise a composition concentration of about 1.times.10.sup.6,
2.times.10.sup.6, 3.times.10.sup.6, 4.times.10.sup.6,
5.times.10.sup.6, 6.times.10.sup.6, 7.times.10.sup.6,
8.times.10.sup.6, 9.times.10.sup.6, 1.times.10.sup.7,
2.times.10.sup.7, 3.times.10.sup.7, 4.times.10.sup.7,
5.times.10.sup.7, 6.times.10.sup.7, 7.times.10.sup.7,
8.times.10.sup.7, 9.times.10.sup.7, 1.times.10.sup.8,
2.times.10.sup.8, 3.times.10.sup.8, 4.times.10.sup.8,
5.times.10.sup.8, 6.times.10.sup.8, 7.times.10.sup.8,
8.times.10.sup.8, 9.times.10.sup.8, 1.times.10.sup.9,
2.times.10.sup.9, 3.times.10.sup.9, 4.times.10.sup.9 ,
5.times.10.sup.9, 6.times.10.sup.9, 7.times.10.sup.9,
8.times.10.sup.9, 9.times.10.sup.9, 1.times.10.sup.10,
2.times.10.sup.10, 3.times.10.sup.10, 4.times.10.sup.10,
5.times.10.sup.10, 6.times.10.sup.10, 7.times.10.sup.10,
8.times.10.sup.10, 9.times.10.sup.10, 1.times.10.sup.11,
1.1.times.10.sup.11, 1.2.times.10.sup.11, 1.3.times.10.sup.11,
1.4.times.10.sup.11, 1.5.times.10.sup.11, 1.6.times.10.sup.11,
1.7.times.10.sup.11, 1.8.times.10.sup.11, 1.9.times.10.sup.11,
2.times.10.sup.11, 2.1.times.10.sup.11, 2.2.times.10.sup.11,
2.3.times.10.sup.11, 2.4.times.10.sup.11, 2.5.times.10.sup.11,
2.6.times.10.sup.11, 2.7.times.10.sup.11, 2.8.times.10.sup.11,
2.9.times.10.sup.11, 3.times.10.sup.11, 4.times.10.sup.11,
5.times.10.sup.11, 6.times.10.sup.11, 7.times.10.sup.11,
7.1.times.10.sup.11, 7.2.times.10.sup.11, 7.3.times.10.sup.11,
7.4.times.10.sup.11, 7.5.times.10.sup.11, 7.6.times.10.sup.11,
7.7.times.10.sup.11, 7.8.times.10.sup.11, 7.9.times.10.sup.11,
8.times.10.sup.11, 9.times.10.sup.11, 1.times.10.sup.12,
1.1.times.10.sup.12, 1.2.times.10.sup.12, 1.3.times.10.sup.12,
1.4.times.10.sup.12, 1.5.times.10.sup.12, 1.6.times.10.sup.12,
1.7.times.10.sup.12, 1.8.times.10.sup.12, 1.9.times.10.sup.12,
2.times.10.sup.12, 2.1.times.10.sup.12, 2.2.times.10.sup.12,
2.3.times.10.sup.12, 2.4.times.10.sup.12, 2.5.times.10.sup.12,
2.6.times.10.sup.12, 2.7.times.10.sup.12, 2.8.times.10.sup.12,
2.9.times.10.sup.12, 3.times.10.sup.12, 3.1.times.10.sup.12,
3.2.times.10.sup.12, 3.3.times.10.sup.12, 3.4.times.10.sup.12,
3.5.times.10.sup.12, 3.6.times.10.sup.12, 3.7.times.10.sup.12,
3.8.times.10.sup.12, 3.9.times.10.sup.12, 4.times.10.sup.12,
4.1.times.10.sup.12, 4.2.times.10.sup.12, 4.3.times.10.sup.12,
4.4.times.10.sup.12, 4.5.times.10.sup.12, 4.6.times.10.sup.12,
4.7.times.10.sup.12, 4.8.times.10.sup.12, 4.9.times.10.sup.12 ,
5.times.10.sup.12, 6.times.10.sup.12, 6.1.times.10.sup.12,
6.2.times.10.sup.12, 6.3.times.10.sup.12, 6.4.times.10.sup.12,
6.5.times.10.sup.12, 6.6.times.10.sup.12, 6.7.times.10.sup.12,
6.8.times.10.sup.12, 6.9.times.10.sup.12, 7.times.10.sup.12,
8.times.10.sup.12, 8.1.times.10.sup.12, 8.2.times.10.sup.12,
8.3.times.10.sup.12, 8.4.times.10.sup.12, 8.5.times.10.sup.12,
8.6.times.10.sup.12, 8.7.times.10.sup.12, 8.8 .times.10.sup.12,
8.9.times.10.sup.12, 9.times.10.sup.12, 1.times.10.sup.13,
1.1.times.10.sup.13, 1.2.times.10.sup.13, 1.3.times.10.sup.13,
1.4.times.10.sup.13, 1.5.times.10.sup.13, 1.6.times.10.sup.13,
1.7.times.10.sup.13, 1.8.times.10.sup.13, 1.9.times.10.sup.13,
2.times.10.sup.13, 3.times.10.sup.13, 4.times.10.sup.13,
5.times.10.sup.23, 6.times.10.sup.13, 6.7.times.10.sup.13,
7.times.10.sup.13, 8.times.10.sup.13, 9.times.10.sup.13,
1.times.10.sup.14, 2.times.10.sup.10, 3.times.10.sup.14,
4.times.10.sup.14, 5.times.10.sup.14, 6.times.10.sup.14,
7.times.10.sup.14, 8.times.10.sup.14, 9.times.10.sup.14,
1.times.10.sup.15, 2.times.10.sup.15, 3.times.10.sup.15,
4.times.10.sup.15, 5.times.10.sup.15, 6.times.10.sup.15,
7.times.10.sup.15, 8.times.10.sup.15, 9.times.10.sup.15, or
1.times.10.sup.16 VG/subject.
[0912] In one embodiment, delivery of compositions in accordance
with the present invention to cells may comprise a total
concentration per subject between about 1.times.10.sup.6 VG/kg and
about 1.times.10.sup.16 VG/kg. In some embodiments, delivery may
comprise a composition concentration of about 1.times.10.sup.6,
2.times.10.sup.6 , 3.times.10.sup.6, 4.times.10.sup.6 ,
5.times.10.sup.6, 6.times.10.sup.6, 7.times.10.sup.6,
8.times.10.sup.6, 9.times.10.sup.6, 1.times.10.sup.7,
2.times.10.sup.7 , 3.times.10.sup.7, 4.times.10.sup.7 ,
5.times.10.sup.7, 6.times.10.sup.7, 7.times.10.sup.7,
8.times.10.sup.7, 9.times.10.sup.7, 1.times.10.sup.8,
2.times.10.sup.8 , 3.times.10.sup.8, 4.times.10.sup.8 ,
5.times.10.sup.8, 6.times.10.sup.8, 7.times.10.sup.8,
8.times.10.sup.8, 9.times.10.sup.8, 1.times.10.sup.9,
2.times.10.sup.9, 3.times.10.sup.9, 4.times.10.sup.9,
5.times.10.sup.9, 6.times.10.sup.9, 7.times.10.sup.9,
8.times.10.sup.9, 9.times.10.sup.9, 1.times.10.sup.10,
2.times.10.sup.10, 3.times.10.sup.10, 4.times.10.sup.10,
5.times.10.sup.10, 6.times.10.sup.10, 7.times.10.sup.10,
8.times.10.sup.10, 9.times.10.sup.10, 1.times.10.sup.11,
1.1.times.10.sup.11, 1.2.times.10.sup.11, 1.3.times.10.sup.11,
1.4.times.10.sup.11, 1.5.times.10.sup.11, 1.6.times.10.sup.11,
1.7.times.10.sup.11, 1.8.times.10.sup.11, 1.9.times.10.sup.11,
2.times.10.sup.11, 2.1.times.10.sup.11, 2.2.times.10.sup.11,
2.3.times.10.sup.11, 2.4.times.10.sup.11, 2.5.times.10.sup.11,
2.6.times.10.sup.11, 2.7.times.10.sup.11, 2.8.times.10.sup.11,
2.9.times.10.sup.11, 3.times.10.sup.11, 4.times.10.sup.11,
5.times.10.sup.11, 6.times.10.sup.11, 7.times.10.sup.11,
7.1.times.10.sup.11, 7.2.times.10.sup.11, 7.3.times.10.sup.11,
7.4.times.10.sup.11, 7.5.times.10.sup.11, 7.6.times.10.sup.11,
7.7.times.10.sup.11, 7.8.times.10.sup.11, 7.9.times.10.sup.11,
8.times.10.sup.11, 9.times.10.sup.11, 1.times.10.sup.12, 1.1
.times.10.sup.12, 1.2.times.10.sup.12, 1.3.times.10.sup.12,
1.4.times.10.sup.12, 1.5.times.10.sup.12, 1.6.times.10.sup.12,
1.7.times.10.sup.12, 1.8.times.10.sup.12, 1.9.times.10.sup.12,
2.times.10.sup.12, 2.1.times.10.sup.12, 2.2.times.10.sup.12,
2.3.times.10.sup.11, 2.4.times.10.sup.12, 2.5.times.10.sup.12,
2.6.times.10.sup.12, 2.7.sup.10.sup.12, 2.8.times.10.sup.12,
2.9.times.10.sup.12, 3.times.10.sup.12, 3.1.times.10.sup.12,
3.2.times.10.sup.12, 3.3.times.10.sup.12, 3.4.times.10.sup.12,
3.5.times.10.sup.12, 3.6.times.10.sup.12, 3.7.times.10.sup.12,
3.8.times.10.sup.12, 3.9.times.10.sup.12, 4.times.10.sup.12,
4.1.times.10.sup.12, 4.2.times.10.sup.12, 4.3.times.10.sup.12,
4.4.times.10.sup.12, 4.5.times.10.sup.12, 4.6.times.10.sup.12,
4.7.times.10.sup.12, 4.8.times.10.sup.12, 4.9.times.10.sup.12,
5.times.10.sup.12, 6.times.10.sup.12, 6.1.times.10.sup.12,
6.2.times.10.sup.12, 6.3.times.10.sup.12, 6.4.times.10.sup.12,
6.5.times.10.sup.12, 6.6.times.10.sup.12, 6.7.times.10.sup.12,
6.8.times.10.sup.12, 6.9.times.10.sup.12, 7.times.10.sup.12,
8.times.10.sup.12, 8.1.times.10.sup.11, 8.2.times.10.sup.12,
8.3.times.10.sup.12, 8.4.times.10.sup.12, 8.5.times.10.sup.11,
8.6.times.10.sup.11, 8.7.times.10.sup.12, 8.8 .times.10.sup.12,
8.9.times.10.sup.12, 9.times.10.sup.12, 1.times.10.sup.13,
1.1.times.10.sup.13, 1.2.times.10.sup.13, 1.3.times.10.sup.13,
1.4.times.10.sup.13, 1.5.times.10.sup.13, 1.6.times.10.sup.13,
1.7.times.10.sup.13, 1.8.times.10.sup.13, 1.9.times.10.sup.13,
2.times.10.sup.13, 3.times.10.sup.13, 4.times.10.sup.13,
5.times.10.sup.13, 6.times.10.sup.13, 6.7.times.10.sup.13,
7.times.10.sup.13, 8.times.10.sup.13, 9.times.10.sup.13,
1.times.10.sup.14, 2.times.10.sup.11, 3.times.10.sup.14,
4.times.10.sup.15, 3.times.10.sup.15, 4.times.10.sup.15,
5.times.10.sup.15, 6.times.10.sup.15, 4.times.10.sup.14,
5.times.10.sup.14, 6.times.10.sup.14, 7.times.10.sup.14,
8.times.10.sup.14, 9.times.10.sup.14, 1.times.10.sup.15,
2.times.10.sup.15, 3.times.10.sup.15, 4.times.10.sup.15,
5.times.10.sup.15, 6.times.10.sup.15, 7.times.10.sup.15,
8.times.10.sup.15, 9.times.10.sup.15, or 1.times.10.sup.16
VG/kg.
[0913] In one embodiment, about 10.sup.5 to 10.sup.6 viral genome
(unit) may be administered per dose.
[0914] In one embodiment, delivery of the compositions in
accordance with the present invention to cells may comprise a total
concentration between about 1.times.10.sup.6 VG/mL and about
1.times.10.sup.16 VG/mL. In some embodiments, delivery may comprise
a composition concentration of about 1.times.10.sup.6,
2.times.10.sup.6, 3.times.10.sup.6, 4.times.10.sup.6 ,
5.times.10.sup.6, 6.times.10.sup.6, 7.times.10.sup.6,
8.times.10.sup.6, 9.times.10.sup.16, 1.times.10.sup.7,
2.times.10.sup.7, 3.times.10.sup.7, 4.times.10.sup.7,
5.times.10.sup.7, 6.times.10.sup.7, 7.times.10.sup.7,
8.times.10.sup.7, 9.times.10.sup.7, 1.times.10.sup.8,
2.times.10.sup.8, 3.times.10.sup.8, 4.times.10.sup.8,
5.times.10.sup.8, 6.times.10.sup.8, 7.times.10.sup.8,
8.times.10.sup.8, 9.times.10.sup.8, 1.times.10.sup.9,
2.times.10.sup.9, 3.times.10.sup.9, 4.times.10.sup.9,
5.times.10.sup.9, 6.times.10.sup.9, 7.times.10.sup.9,
8.times.10.sup.9, 9.times.10.sup.9, 1.times.10.sup.10,
2.times.10.sup.10, 3.times.10.sup.10, 4.times.10.sup.10,
5.times.10.sup.10, 6.times.10.sup.10, 7.times.10.sup.10,
8.times.10.sup.th, 9.times.10.sup.10, 1.times.10.sup.11,
1.1.times.10.sup.11, 1.2.times.10.sup.11, 1.3.times.10.sup.11,
1.4.times.10.sup.11, 1.5.times.10.sup.11, 1.6.times.10.sup.11,
1.7.times.10.sup.11, 1.8.times.10.sup.11, 1.9.times.10.sup.11,
2.times.10.sup.11, 3.times.10.sup.11, 4.times.10.sup.11,
5.times.10.sup.11, 6.times.10.sup.11, 7.times.10.sup.11,
8.times.10.sup.11, 9.times.10.sup.11, 1.times.10.sup.12,
1.1.times.10.sup.12, 1.2.times.10.sup.12, 1.3.times.10.sup.12,
1.4.times.10.sup.12, 1.5.times.10.sup.12, 1.6.times.10.sup.12,
1.7.times.10.sup.12, 1.8.times.10.sup.12, 1.9.times.10.sup.12,
2.times.10.sup.12, 2.1.times.10.sup.12, 2.2.times.10.sup.12,
2.3.times.10.sup.12, 2.4.times.10.sup.12, 2.5.times.10.sup.12,
2.6.times.10.sup.12, 2.7.times.10.sup.12, 2.8.times.10.sup.12,
2.9.times.10.sup.12, 3.times.10.sup.12, 3.1.times.10.sup.12,
3.2.times.10.sup.12, 3.3.times.10.sup.12, 3.4.times.10.sup.12,
3.5.times.10.sup.12, 3.6.times.10.sup.12, 3.7.times.10.sup.12,
3.8.times.10.sup.12, 3.9.times.10.sup.12, 4.times.10.sup.12,
4.1.times.10.sup.12, 4.2.times.10.sup.11, 4.3.times.10.sup.11,
4.4.times.10.sup.12, 4.5.times.10.sup.12, 4.6.times.10.sup.12,
4.7.times.10.sup.12, 4.8.times.10.sup.12, 4.9.times.10.sup.12,
5.times.10.sup.12, 6.times.10.sup.12, 6.1.times.10.sup.12,
6.2.times.10.sup.12, 6.3.times.10.sup.12, 6.4.times.10.sup.12,
6.5.times.10.sup.12, 6.6.times.10.sup.12, 6.7.times.10.sup.12,
6.8.times.10.sup.12, 6.9.times.10.sup.12, 7.times.10.sup.12,
8.times.10.sup.12, 9.times.10.sup.12, 1.times.10.sup.13,
1.1.times.10.sup.13, 1.2.times.10.sup.13, 1.3.times.10.sup.13,
1.4.times.10.sup.13, 1.5.times.10.sup.13, 1.6.times.10.sup.13,
1.7.times.10.sup.13, 1.8.times.10.sup.13, 1.9.times.10.sup.13,
2.times.10.sup.13, 3.times.10.sup.13, 4.times.10.sup.13,
5.times.10.sup.13, 6.times.10.sup.13, 6.7.times.10.sup.13,
7.times.10.sup.11, 8.times.10.sup.13, 9.times.10.sup.13,
1.times.10.sup.14, 2.times.10.sup.14, 3.times.10.sup.14,
4.times.10.sup.14, 5.times.10.sup.14, 6.times.10.sup.14,
7.times.10, 8.times.1.sup.14, 9.times.10.sup.11, 1.times.10.sup.15,
2.times.10.sup.15, 3.times.10.sup.15, 4.times.10.sup.15,
5.times.10.sup.15, 6.times.10.sup.15, 7.times.10.sup.15,
8.times.10.sup.15, 9.times.10.sup.15, or 1.times.10.sup.16
VG/mL.
Bioavailability
[0915] Viral vectors comprising a modulatory polynucleotide of the
present invention, when formulated into compositions with
delivery/formulation agents or vehicles as described herein, may
exhibit increased bioavailability as compared to compositions
lacking delivery agents as described herein. As used herein, the
term "bioavailability" refers to the systemic availability of a
given amount of a particular agent administered to a subject.
Bioavailability may be assessed by measuring the area under the
curve (AUC) or the maximum serum or plasma concentration
(C.sub.max) of the unchanged form of a compound following
administration of the compound to a mammal. AUC is a determination
of the area under the curve plotting the serum or plasma
concentration of a compound along the ordinate (Y-axis) against
time along the abscissa (X-axis). Generally, the AUC for a
particular compound may be calculated using methods known to those
of ordinary skill in the art and as described in G. S. Banker,
Modern Pharmaceutics, Drugs and the Pharmaceutical Sciences, v. 72,
Marcel Dekker, New York, Inc., 1996, the contents of which are
herein incorporated by reference in their entirety.
[0916] C.sub.max values are maximum concentrations of compounds
achieved in serum or plasma of a subject following administration
of compounds to the subject. C.sub.max values of particular
compounds may be measured using methods known to those of ordinary
skill in the art. As used herein, the phrases "increasing
bioavailability" or "improving the pharmacokinetics," refer to
actions that may increase the systemic availability of a viral
vector of the present invention (as measured by AUC, C.sub.max, or
C.sub.min) in a subject. In some embodiments, such actions may
comprise co-administration with one or more delivery agents as
described herein. In some embodiments, the bioavailability of viral
vectors may increase by at least about 2%, at least about 5%, at
least about 10%, at least about 15%, at least about 20%, at least
about 25%, at least about 30%, at least about 35%, at least about
40%, at least about 45%, at least about 50%, at least about 55%, at
least about 60%, at least about 65%, at least about 70%, at least
about 75%, at least about 80%, at least about 85%, at least about
90%, at least about 95% or about 100%.
Therapeutic Window
[0917] Viral vectors comprising a modulatory polynucleotide of the
present invention, when formulated with one or more delivery agents
as described herein, may exhibit increases in the therapeutic
window of compound and/or composition administration as compared to
the therapeutic window of viral vectors administered without one or
more delivery agents as described herein. As used herein, the term
"therapeutic window" refers to the range of plasma concentrations,
or the range of levels of therapeutically active substance at the
site of action, with a high probability of eliciting a therapeutic
effect. In some embodiments, therapeutic windows of viral vectors
when administered in a formulation may increase by at least about
2%, at least about 5%, at least about 10%, at least about 15%, at
least about 20%, at least about 25%, at least about 30%, at least
about 35%, at least about 40%, at least about 45%, at least about
50%, at least about 55%, at least about 60%, at least about 65%, at
least about 70%, at least about 75%, at least about 80%, at least
about 85%, at least about 90%, at least about 95% or about
100%.
Volume of Distribution
[0918] Viral vectors comprising a modulatory polynucleotide of the
present invention, when formulated with one or more delivery agents
as described herein, may exhibit an improved volume of distribution
(V.sub.dist), e.g., reduced or targeted, relative to formulations
lacking one or more delivery agents as described herein. V.sub.dist
relates the amount of an agent in the body to the concentration of
the same agent in the blood or plasma. As used herein, the term
"volume of distribution" refers to the fluid volume that would be
required to contain the total amount of an agent in the body at the
same concentration as in the blood or plasma: V.sub.dist equals the
amount of an agent in the body/concentration of the agent in blood
or plasma. For example, for a 10 mg dose of a given agent and a
plasma concentration of 10 mg/L, the volume of distribution would
be 1 liter. The volume of distribution reflects the extent to which
an agent is present in the extravascular tissue. Large volumes of
distribution reflect the tendency of agents to bind to the tissue
components as compared with plasma proteins. In clinical settings,
V.sub.dist may be used to determine loading doses to achieve steady
state concentrations. In some embodiments, volumes of distribution
of viral vector compositions of the present invention when
co-administered with one or more delivery agents as described
herein may decrease at least about 2%, at least about 5%, at least
about 10%, at least about 15%, at least about 20%, at least about
25%, at least about 30%, at least about 35%, at least about 40%, at
least about 45%, at least about 50%, at least about 55%, at least
about 60%, at least about 65%, at least about 70%.
Combinations
[0919] The viral vectors comprising the modulatory polynucleotide
may be used in combination with one or more other therapeutic,
prophylactic, diagnostic, or imaging agents. By "in combination
with," it is not intended to imply that the agents must be
administered at the same time and/or formulated for delivery
together, although these methods of delivery are within the scope
of the present disclosure. Compositions can be administered
concurrently with, prior to, or subsequent to, one or more other
desired therapeutics or medical procedures. In general, each agent
will be administered at a dose and/or on a time schedule determined
for that agent. In some embodiments, the present disclosure
encompasses the delivery of pharmaceutical, prophylactic,
diagnostic, or imaging compositions in combination with agents that
may improve their bioavailability, reduce and/or modify their
metabolism, inhibit their excretion, and/or modify their
distribution within the body.
IV. Methods of Use
Reduce Expression of a Target Gene
[0920] In some embodiments, the present invention provides methods
for inhibiting/silencing gene expression in a cell. Accordingly,
the modulatory polynucleotides encoding siRNA duplexes or encoded
dsRNA can be used to substantially inhibit gene expression in a
cell, in particular in a neuron. In some aspects, the inhibition of
gene expression refers to an inhibition by at least about 15%, such
as by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%,
25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%,
38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%,
51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%,
64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%,
77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%,
15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%,
20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%,
20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%,
30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%,
50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%,
55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%,
60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%,
90-95%, 90-100% or 95-100%. Accordingly, the protein product of the
targeted gene may be inhibited by at least about 15%, preferably by
at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%,
26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%,
39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%,
52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%,
65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%,
78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%,
15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%,
20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%,
30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%,
40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%,
50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%,
60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%,
80-100%, 90-95%, 90-100% or 95-100%.
[0921] In some embodiments, the present invention provides methods
for inhibiting/silencing gene expression in a cell, in particular
in a medium spiny neuron. In some aspects, the inhibition of gene
expression refers to an inhibition by at least about 15%, such as
by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%,
26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%,
39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%,
52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%,
65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%,
78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%,
15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%,
20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%,
30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%,
40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%,
50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%,
55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%,
70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%,
90-100% or 95-100%. Accordingly, the protein product of the
targeted gene may be inhibited by at least about 15%, preferably by
at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%,
26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%,
39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%,
52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%,
65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%,
78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%,
15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%,
20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%,
30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%,
40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%,
50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%,
55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%,
70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%,
90-100% or 95-100%.
[0922] In some embodiments, the present invention provides methods
for inhibiting/silencing gene expression in a cell, in particular
in a motor neuron. In some aspects, the inhibition of gene
expression refers to an inhibition by at least about 15%, such as
by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%,
26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%,
39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%,
52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%,
65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%,
78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%,
15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%,
20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%,
30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%,
40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%,
50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%,
55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%,
70-80%, 70-90%, 70-95% , 70-100%, 80-90%, 80-95%, 80-100%, 90-95%,
90-100% or 95-100%. Accordingly, the protein product of the
targeted gene may be inhibited by at least about 15%, preferably by
at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%,
26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%,
39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%,
52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%,
65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%,
78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%,
15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%,
20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%,
30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%,
40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%,
50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%,
55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%,
70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%,
90-100% or 95-100%.
[0923] In some embodiments, the present invention provides methods
for inhibiting/silencing gene expression in a cell, in particular
in an astrocyte. In some aspects, the inhibition of gene expression
refers to an inhibition by at least about 15%, such as by at least
about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%,
28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%,
41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%,
54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%,
67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%,
80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%,
15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%,
20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%,
30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%,
40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%,
50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%,
55-95.sup.0 0, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%,
70-80%, 70-90%, 70-95% , 70-100%, 80-90%, 80-95%, 80-100%, 90-95%,
90-100% or 95-100%. Accordingly, the protein product of the
targeted gene may be inhibited by at least about 15%, preferably by
at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%,
26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%,
39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%,
52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%,
65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%,
78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%,
15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%,
20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%,
30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%,
40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%,
50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%,
55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%,
70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%,
90-100% or 95-100%.
[0924] In one embodiment, the siRNA duplexes or encoded dsRNA may
be used to reduce the expression of protein by at least about 15%,
16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%,
29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%,
42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%,
55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%,
68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%,
85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%,
15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%,
20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%,
30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%,
40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%,
50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%,
55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%,
70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or
95-100%. As a non-limiting example, the expression of protein
expression may be reduced by 50-90%. As a non-limiting example, the
expression of protein expression may be reduced by 30-70%. As a
non-limiting example, the expression of protein expression may be
reduced by 20-70%. As a non-limting example, the expression of
protein expression may be reduced by 15-30%.
[0925] In one embodiment, the modulatory polynucleotides encoding
siRNA duplexes or encoded dsRNA may be used to reduce the
expression of mRNA by at least about 15%, 16%, 17%, 18%, 19%, 20%,
21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%,
34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%,
47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%,
60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%,
73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or
at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%,
15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%,
20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%,
30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%,
40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%,
55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%,
60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%,
80-95%, 80-100%, 90-95%, 90-100% or 95-100%. As a non-limiting
example, the expression of mRNA expression may be reduced by
50-90%. As a non-limiting example, the expression of mRNA
expression may be reduced by30-70%. As a non-limiting example, the
expression of mRNA expression may be reduced by20-70%. As a
non-limiting example, the expression of mRNA expression may be
reduced by 15-30%.
[0926] In one embodiment, the siRNA duplexes or encoded dsRNA may
be used to reduce the expression of protein and/or mRNA in at least
one region of the CNS such as, but not limited to the midbrain. The
expression of protein and/or mRNA is reduced by at least about 15%,
16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%,
29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%,
42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%,
55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%,
68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%,
85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%,
15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%,
20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%,
30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%,
40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%,
50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%,
55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%,
70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or
95-100.degree. A in at least one region of the CNS. As a
non-limiting example, the expression of protein and mRNA in the
striatum and/or cortex is reduced by 50-90%. As a non-limiting
example, the expression of protein and mRNA in the striatum is
reduced by 40-50%. As a non-limiting example, the expression of
protein and mRNA in the striatum is reduced by 20-50%. As a
non-limiting example, the expression of protein and mRNA in the
striatum is reduced by 15-50%. As a non-limiting example, the
expression of protein and mRNA in the cortex is reduced by 40-50%.
As a non-limiting example, the expression of protein and mRNA in
the cortex is reduced by 30-70%. As a non-limiting example, the
expression of protein and mRNA in the cortex is reduced by 20-70%.
As a non-limiting example, the expression of protein and mRNA in
the cortex is reduced by 15-70%. As a non-limiting example, the
expression of protein and mRNA in the striatum and/or cortex is
reduced by 20-70%. As a non-limiting example, the expression of
protein and mRNA in the striatum and/or cortex is reduced by
20-70%. As a non-limiting example, the expression of protein and
mRNA in the striatum and/or cortex is reduced by 15-70%. As a
non-limiting example, the expression of protein and mRNA in the
striatum and/or cortex is reduced by 40-70%. As a non-limiting
example, the expression of protein and mRNA in the striatum and/or
cortex is reduced by 40-50%. As a non-limiting example, the
expression of protein and mRNA in the striatum and/or cortex is
reduced by 50-70%. As a non-limiting example, the expression of
protein and mRNA in the striatum and/or cortex is reduced by
50-60%. As a non-limiting example, the expression of protein and
mRNA in the striatum and/or cortex is reduced by 50%. As a
non-limiting example, the expression of protein and mRNA in the
striatum and/or cortex is reduced by 51%. As a non-limiting
example, the expression of protein and mRNA in the striatum and/or
cortex is reduced by 52%. As a non-limiting example, the expression
of protein and mRNA in the striatum and/or cortex is reduced by
53%. As a non-limiting example, the expression of protein and mRNA
in the striatum and/or cortex is reduced by 54%. As a non-limiting
example, the expression of protein and mRNA in the striatum and/or
cortex is reduced by 55%. As a non-limiting example, the expression
of protein and mRNA in the striatum and/or cortex is reduced by
56%. As a non-limiting example, the expression of protein and mRNA
in the striatum and/or cortex is reduced by 57%. As a non-limiting
example, the expression of protein and mRNA in the striatum and/or
cortex is reduced by 58%. As a non-limiting example, the expression
of protein and mRNA in the striatum and/or cortex is reduced by
59%. As a non-limiting example, the expression of protein and mRNA
in the striatum and/or cortex is reduced by 60%.
[0927] In one embodiment, the modulatory polynucleotides encoding
siRNA duplexes or encoded dsRNA may be used to reduce the
expression of protein and/or mRNA in at least one region of the CNS
such as, but not limited to the forebrain. The expression of
protein and/or mRNA is reduced by at least about 15%, 16%, 17%,
18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%,
31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%,
44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%,
57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%,
70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%,
95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%,
15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%,
20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%,
30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%,
40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%,
50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%,
60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%,
70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100% in at
least one region of the CNS. As a non-limiting example, the
expression of protein and mRNA in the putamen is reduced by 50-90%.
As a non-limiting example, the expression of protein and mRNA in
the striatum is reduced by 40-50%. As a non-limiting example, the
expression of protein and mRNA in the cortex is reduced by 40-50%.
As a non-limiting example, the expression of protein and mRNA in
the cortex is reduced by 30-70%. As a non-limiting example, the
expression of protein and mRNA in the cortex is reduced by 20-70%.
As a non-limiting example, the expression of protein and mRNA in
the cortex is reduced by 15-70%. As a non-limiting example, the
expression of protein and mRNA in the striatum and/or cortex is
reduced by 20-70%. As a non-limiting example, the expression of
protein and mRNA in the striatum and/or cortex is reduced by
15-70%. As a non-limiting example, the expression of protein and
mRNA in the striatum and/or cortex is reduced by 40-70%. As a
non-limiting example, the expression of protein and mRNA in the
striatum and/or cortex is reduced by 40-50%. As a non-limiting
example, the expression of protein and mRNA in the striatum and/or
cortex is reduced by 50-70%. As a non-limiting example, the
expression of protein and mRNA in the striatum and/or cortex is
reduced by 50-60%. As a non-limiting example, the expression of
protein and mRNA in the striatum and/or cortex is reduced by 50%.
As a non-limiting example, the expression of protein and mRNA in
the striatum and/or cortex is reduced by 51%. As a non-limiting
example, the expression of protein and mRNA in the striatum and/or
cortex is reduced by 52%. As a non-limiting example, the expression
of protein and mRNA in the striatum and/or cortex is reduced by
53%. As a non-limiting example, the expression of protein and mRNA
in the striatum and/or cortex is reduced by 54%. As a non-limiting
example, the expression of protein and mRNA in the striatum and/or
cortex is reduced by 55%. As a non-limiting example, the expression
of protein and mRNA in the striatum and/or cortex is reduced by
56%. As a non-limiting example, the expression of protein and mRNA
in the striatum and/or cortex is reduced by 57%. As a non-limiting
example, the expression of protein and mRNA in the striatum and/or
cortex is reduced by 58%. As a non-limiting example, the expression
of protein and mRNA in the striatum and/or cortex is reduced by
59%. As a non-limiting example, the expression of protein and mRNA
in the striatum and/or cortex is reduced by 60%. As a non-limiting
example, the expression of protein and mRNA in the striatum and/or
cortex is reduced by 61%. As a non-limiting example, the expression
of protein and mRNA in the striatum and/or cortex is reduced by
62%. As a non-limiting example, the expression of protein and mRNA
in the striatum and/or cortex is reduced by 63%. As a non-limiting
example, the expression of protein and mRNA in the striatum and/or
cortex is reduced by 64%. As a non-limiting example, the expression
of protein and mRNA in the striatum and/or cortex is reduced by
65%. As a non-limiting example, the expression of protein and mRNA
in the striatum and/or cortex is reduced by 66%. As a non-limiting
example, the expression of protein and mRNA in the striatum and/or
cortex is reduced by 67%. As a non-limiting example, the expression
of protein and mRNA in the striatum and/or cortex is reduced by
68%. As a non-limiting example, the expression of protein and mRNA
in the striatum and/or cortex is reduced by 69%. As a non-limiting
example, the expression of protein and mRNA in the striatum and/or
cortex is reduced by 70%.
[0928] In one embodiment, the modulatory polynucleotides encoding
siRNA duplexes or encoded dsRNA may be used to reduce the
expression of protein and/or mRNA in the putamen. The expression of
protein and/or mRNA is reduced by at least about 15%, 16%, 17%,
18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%,
31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%,
44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%,
57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%,
70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%,
95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%,
15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%,
20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%,
30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%,
40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%,
50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%,
60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%,
70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100% in at
least one region of the CNS. As a non-limiting example, the
expression of protein and mRNA in the putamen is reduced by 40-70%.
As a non-limiting example, the expression of protein and mRNA in
the putamen is reduced by 40-50%. As a non-limiting example, the
expression of protein and mRNA in the putamen is reduced by 50-70%.
As a non-limiting example, the expression of protein and mRNA in
the putamen is reduced by 50-60%. As a non-limiting example, the
expression of protein and mRNA in the putamen is reduced by 50%. As
a non-limiting example, the expression of protein and mRNA in the
putamen is reduced by 51%. As a non-limiting example, the
expression of protein and mRNA in the putamen is reduced by 52%. As
a non-limiting example, the expression of protein and mRNA in the
putamen is reduced by 53%. As a non-limiting example, the
expression of protein and mRNA in the putamen is reduced by 54%. As
a non-limiting example, the expression of protein and mRNA in the
putamen is reduced by 55%. As a non-limiting example, the
expression of protein and mRNA in the putamen is reduced by 56%. As
a non-limiting example, the expression of protein and mRNA in the
putamen is reduced by 57%. As a non-limiting example, the
expression of protein and mRNA in the putamen is reduced by 58%. As
a non-limiting example, the expression of protein and mRNA in the
putamen is reduced by 59%. As a non-limiting example, the
expression of protein and mRNA in the putamen is reduced by 60%. As
a non-limiting example, the expression of protein and mRNA in the
putamen is reduced by 61%. As a non-limiting example, the
expression of protein and mRNA in the putamen is reduced by 62%. As
a non-limiting example, the expression of protein and mRNA in the
putamen is reduced by 63%. As a non-limiting example, the
expression of protein and mRNA in the putamen is reduced by 64%. As
a non-limiting example, the expression of protein and mRNA in the
putamen is reduced by 65%. As a non-limiting example, the
expression of protein and mRNA in the putamen is reduced by 66%. As
a non-limiting example, the expression of protein and mRNA in the
putamen is reduced by 67%. As a non-limiting example, the
expression of protein and mRNA in the putamen is reduced by 68%. As
a non-limiting example, the expression of protein and mRNA in the
putamen is reduced by 69%. As a non-limiting example, the
expression of protein and mRNA in the putamen is reduced by
70%.
[0929] In one embodiment, the modulatory polynucleotides encoding
siRNA duplexes or encoded dsRNA may be used to reduce the
expression of protein and/or mRNA in the cortex. The expression of
protein and/or mRNA is reduced by at least about 15%, 16%, 17%,
18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%,
31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%,
44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%,
57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%,
70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%,
95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%,
15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%,
20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%,
30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%,
40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%,
50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%,
70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100%
or 95-100%. As a non-limiting example, the expression of protein
and mRNA in the cortex is reduced by 40-50%. As a non-limiting
example, the expression of protein and mRNA in the cortex is
reduced by 30-70%. As a non-limiting example, the expression of
protein and mRNA in the cortex is reduced by at least 30%. As a
non-limiting example, the expression of protein and mRNA in the
cortex is reduced by 40-70%. As a non-limiting example, the
expression of protein and mRNA in the cortex is reduced by 40-50%.
As a non-limiting example, the expression of protein and mRNA in
the cortex is reduced by 50-70%. As a non-limiting example, the
expression of protein and mRNA in the cortex is reduced by 50-60%.
As a non-limiting example, the expression of protein and mRNA in
the cortex is reduced by 50%. As a non-limiting example, the
expression of protein and mRNA in the cortex is reduced by 51%. As
a non-limiting example, the expression of protein and mRNA in the
cortex is reduced by 52%. As a non-limiting example, the expression
of protein and mRNA in the cortex is reduced by 53%. As a
non-limiting example, the expression of protein and mRNA in the
cortex is reduced by 54%. As a non-limiting example, the expression
of protein and mRNA in the cortex is reduced by 55%. As a
non-limiting example, the expression of protein and mRNA in the
cortex is reduced by 56%. As a non-limiting example, the expression
of protein and mRNA in the cortex is reduced by 57%. As a
non-limiting example, the expression of protein and mRNA in the
cortex is reduced by 58%. As a non-limiting example, the expression
of protein and mRNA in the cortex is reduced by 59%. As a
non-limiting example, the expression of protein and mRNA in the
cortex is reduced by 60%. As a non-limiting example, the expression
of protein and mRNA in the cortex is reduced by 61%. As a
non-limiting example, the expression of protein and mRNA in the
cortex is reduced by 62%. As a non-limiting example, the expression
of protein and mRNA in the cortex is reduced by 63%. As a
non-limiting example, the expression of protein and mRNA in the
cortex is reduced by 64%. As a non-limiting example, the expression
of protein and mRNA in the cortex is reduced by 65%. As a
non-limiting example, the expression of protein and mRNA in the
cortex is reduced by 66%. As a non-limiting example, the expression
of protein and mRNA in the cortex is reduced by 67%. As a
non-limiting example, the expression of protein and mRNA in the
cortex is reduced by 68%. As a non-limiting example, the expression
of protein and mRNA in the cortex is reduced by 69%. As a
non-limiting example, the expression of protein and mRNA in the
cortex is reduced by 70%.
[0930] In one embodiment, the modulatory polynucleotides encoding
siRNA duplexes or encoded dsRNA may be used to reduce the
expression of protein and/or mRNA in the motor cortex. The
expression of protein and/or mRNA is reduced by at least about 15%,
16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%,
29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%,
42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%,
55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%,
68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%,
85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%,
15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%,
20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%,
30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%,
40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%,
50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%,
70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%,
90-100% or 95-100%. As a non-limiting example, the expression of
protein and mRNA in the motor cortex is reduced by 40-50%. As a
non-limiting example, the expression of protein and mRNA in the
motor cortex is reduced by 30-70%. As a non-limiting example, the
expression of protein and mRNA in the motor cortex is reduced by
20-70%. As a non-limiting example, the expression of protein and
mRNA in the motor cortex is reduced by 15-70%. As a non-limiting
example, the expression of protein and mRNA in the motor cortex is
reduced by at least 30%. As a non-limiting example, the expression
of protein and mRNA in the motor cortex is reduced by 40-70%. As a
non-limiting example, the expression of protein and mRNA in the
motor cortex is reduced by 50-70%. As a non-limiting example, the
expression of protein and mRNA in the motor cortex is reduced by
50-60%. As a non-limiting example, the expression of protein and
mRNA in the motor cortex is reduced by 50%. As a non-limiting
example, the expression of protein and mRNA in the motor cortex is
reduced by 51%. As a non-limiting example, the expression of
protein and mRNA in the motor cortex is reduced by 52%. As a
non-limiting example, the expression of protein and mRNA in the
motor cortex is reduced by 53%. As a non-limiting example, the
expression of protein and mRNA in the motor cortex is reduced by
54%. As a non-limiting example, the expression of protein and mRNA
in the motor cortex is reduced by 55%. As a non-limiting example,
the expression of protein and mRNA in the motor cortex is reduced
by 56%. As a non-limiting example, the expression of protein and
mRNA in the motor cortex is reduced by 57%. As a non-limiting
example, the expression of protein and mRNA in the motor cortex is
reduced by 58%. As a non-limiting example, the expression of
protein and mRNA in the motor cortex is reduced by 59%. As a
non-limiting example, the expression of protein and mRNA in the
motor cortex is reduced by 60%. As a non-limiting example, the
expression of protein and mRNA in the motor cortex is reduced by
61%. As a non-limiting example, the expression of protein and mRNA
in the motor cortex is reduced by 62%. As a non-limiting example,
the expression of protein and mRNA in the motor cortex is reduced
by 63%. As a non-limiting example, the expression of protein and
mRNA in the motor cortex is reduced by 64%. As a non-limiting
example, the expression of protein and mRNA in the motor cortex is
reduced by 65%. As a non-limiting example, the expression of
protein and mRNA in the motor cortex is reduced by 66%. As a
non-limiting example, the expression of protein and mRNA in the
motor cortex is reduced by 67%. As a non-limiting example, the
expression of protein and mRNA in the motor cortex is reduced by
68%. As a non-limiting example, the expression of protein and mRNA
in the motor cortex is reduced by 69%. As a non-limiting example,
the expression of protein and mRNA in the motor cortex is reduced
by 70%.
[0931] In one embodiment, the modulatory polynucleotides encoding
siRNA duplexes or encoded dsRNA may be used to reduce the
expression of protein and/or mRNA in the somatosensory cortex. The
expression of protein and/or mRNA is reduced by at least about 15%,
16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%,
29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%,
42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%,
55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%,
68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%,
85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%,
15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%,
20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%,
30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%,
40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%,
50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%,
70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%,
90-100% or 95-100%. As a non-limiting example, the expression of
protein and mRNA in the somatosensory cortex is reduced by 40-50%.
As a non-limiting example, the expression of protein and mRNA in
the somatosensory cortex is reduced by 30-70%. As a non-limiting
example, the expression of protein and mRNA in the somatosensory
cortex is reduced by 20-70%. As a non-limiting example, the
expression of protein and mRNA in the somatosensory cortex is
reduced by 15-70%. As a non-limiting example, the expression of
protein and mRNA in the somatosensory cortex is reduced by at least
30%. As a non-limiting example, the expression of protein and mRNA
in the somatosensory cortex is reduced by 40-70%. As a non-limiting
example, the expression of protein and mRNA in the somatosensory
cortex is reduced by 50-70%. As a non-limiting example, the
expression of protein and mRNA in the somatosensory cortex is
reduced by 50-60%. As a non-limiting example, the expression of
protein and mRNA in the somatosensory cortex is reduced by 50%. As
a non-limiting example, the expression of protein and mRNA in the
somatosensory cortex is reduced by 51%. As a non-limiting example,
the expression of protein and mRNA in the somatosensory cortex is
reduced by 52%. As a non-limiting example, the expression of
protein and mRNA in the somatosensory cortex is reduced by 53%. As
a non-limiting example, the expression of protein and mRNA in the
somatosensory cortex is reduced by 54%. As a non-limiting example,
the expression of protein and mRNA in the somatosensory cortex is
reduced by 55%. As a non-limiting example, the expression of
protein and mRNA in the somatosensory cortex is reduced by 56%. As
a non-limiting example, the expression of protein and mRNA in the
somatosensory cortex is reduced by 57%. As a non-limiting example,
the expression of protein and mRNA in the somatosensory cortex is
reduced by 58%. As a non-limiting example, the expression of
protein and mRNA in the somatosensory cortex is reduced by 59%. As
a non-limiting example, the expression of protein and mRNA in the
somatosensory cortex is reduced by 60%. As a non-limiting example,
the expression of protein and mRNA in the somatosensory cortex is
reduced by 61%. As a non-limiting example, the expression of
protein and mRNA in the somatosensory cortex is reduced by 62%. As
a non-limiting example, the expression of protein and mRNA in the
somatosensory cortex is reduced by 63%. As a non-limiting example,
the expression of protein and mRNA in the somatosensory cortex is
reduced by 64%. As a non-limiting example, the expression of
protein and mRNA in the somatosensory cortex is reduced by 65%. As
a non-limiting example, the expression of protein and mRNA in the
somatosensory cortex is reduced by 66%. As a non-limiting example,
the expression of protein and mRNA in the somatosensory cortex is
reduced by 67%. As a non-limiting example, the expression of
protein and mRNA in the somatosensory cortex is reduced by 68%. As
a non-limiting example, the expression of protein and mRNA in the
somatosensory cortex is reduced by 69%. As a non-limiting example,
the expression of protein and mRNA in the somatosensory cortex is
reduced by 70%.
[0932] In one embodiment, the modulatory polynucleotides encoding
siRNA duplexes or encoded dsRNA may be used to reduce the
expression of protein and/or mRNA in the temporal cortex. The
expression of protein and/or mRNA is reduced by at least about 15%,
16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%,
29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%,
42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%,
55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%,
68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%,
85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%,
15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%,
20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%,
30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%,
40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%,
50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%,
70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%,
90-100% or 95-100%. As a non-limiting example, the expression of
protein and mRNA in the temporal cortex is reduced by 40-50%. As a
non-limiting example, the expression of protein and mRNA in the
temporal cortex is reduced by 30-70%. As a non-limiting example,
the expression of protein and mRNA in the temporal cortex is
reduced by 20-70%. As a non-limiting example, the expression of
protein and mRNA in the temporal cortex is reduced by 15-70%. As a
non-limiting example, the expression of protein and mRNA in the
temporal cortex is reduced by at least 30%. As a non-limiting
example, the expression of protein and mRNA in the temporal cortex
is reduced by 40-70%. As a non-limiting example, the expression of
protein and mRNA in the temporal cortex is reduced by 50-70%. As a
non-limiting example, the expression of protein and mRNA in the
temporal cortex is reduced by 50-60%. As a non-limiting example,
the expression of protein and mRNA in the temporal cortex is
reduced by 50%. As a non-limiting example, the expression of
protein and mRNA in the temporal cortex is reduced by 51%. As a
non-limiting example, the expression of protein and mRNA in the
temporal cortex is reduced by 52%. As a non-limiting example, the
expression of protein and mRNA in the temporal cortex is reduced by
53%. As a non-limiting example, the expression of protein and mRNA
in the temporal cortex is reduced by 54%. As a non-limiting
example, the expression of protein and mRNA in the temporal cortex
is reduced by 55%. As a non-limiting example, the expression of
protein and mRNA in the temporal cortex is reduced by 56%. As a
non-limiting example, the expression of protein and mRNA in the
temporal cortex is reduced by 57%. As a non-limiting example, the
expression of protein and mRNA in the temporal cortex is reduced by
58%. As a non-limiting example, the expression of protein and mRNA
in the temporal cortex is reduced by 59%. As a non-limiting
example, the expression of protein and mRNA in the temporal cortex
is reduced by 60%. As a non-limiting example, the expression of
protein and mRNA in the temporal cortex is reduced by 61%. As a
non-limiting example, the expression of protein and mRNA in the
temporal cortex is reduced by 62%. As a non-limiting example, the
expression of protein and mRNA in the temporal cortex is reduced by
63%. As a non-limiting example, the expression of protein and mRNA
in the temporal cortex is reduced by 64%. As a non-limiting
example, the expression of protein and mRNA in the temporal cortex
is reduced by 65%. As a non-limiting example, the expression of
protein and mRNA in the temporal cortex is reduced by 66%. As a
non-limiting example, the expression of protein and mRNA in the
temporal cortex is reduced by 67%. As a non-limiting example, the
expression of protein and mRNA in the temporal cortex is reduced by
68%. As a non-limiting example, the expression of protein and mRNA
in the temporal cortex is reduced by 69%. As a non-limiting
example, the expression of protein and mRNA in the temporal cortex
is reduced by 70%.
[0933] In some embodiments, the present invention provides methods
for treating, or ameliorating a disease and/or disorder of the
central nervous system by inhibiting the expression of a gene
and/or protein in a subject in need of treatment, the method
comprising administering to the subject a pharmaceutically
effective amount of at least one modulatory polynucleotides
encoding siRNA duplex or a nucleic acid encoding an siRNA duplex
targeting the gene, delivering the modulatory polynucleotides
encoding siRNA duplex (or encoded duplex) into targeted cells,
inhibiting gene expression and protein production, and ameliorating
symptoms of the disease and/or disorder of the central nervous
system in the subject.
V. Kits and Devices
Kits
[0934] The invention provides a variety of kits for conveniently
and/or effectively carrying out methods of the present invention.
Typically, kits will comprise sufficient amounts and/or numbers of
components to allow a user to perform multiple treatments of a subj
ect(s) and/or to perform multiple experiments.
[0935] Any of the vectors, constructs, modulatory polynucleotides,
polynucleotides or polypeptides of the present invention may be
comprised in a kit. In some embodiments, kits may further include
reagents and/or instructions for creating and/or synthesizing
compounds and/or compositions of the present invention. In some
embodiments, kits may also include one or more buffers. In some
embodiments, kits of the invention may include components for
making protein or nucleic acid arrays or libraries and thus, may
include, for example, solid supports.
[0936] In some embodiments, kit components may be packaged either
in aqueous media or in lyophilized form. The container means of the
kits will generally include at least one vial, test tube, flask,
bottle, syringe or other container means, into which a component
may be placed, and preferably, suitably aliquotted. Where there are
more than one kit component, (labeling reagent and label may be
packaged together), kits may also generally contain second, third
or other additional containers into which additional components may
be separately placed. In some embodiments, kits may also comprise
second container means for containing sterile, pharmaceutically
acceptable buffers and/or other diluents. In some embodiments,
various combinations of components may be comprised in one or more
vial. Kits of the present invention may also typically include
means for containing compounds and/or compositions of the present
invention, e.g., proteins, nucleic acids, and any other reagent
containers in close confinement for commercial sale. Such
containers may include injection or blow-molded plastic containers
into which desired vials are retained.
[0937] In some embodiments, kit components are provided in one
and/or more liquid solutions. In some embodiments, liquid solutions
are aqueous solutions, with sterile aqueous solutions being
particularly preferred. In some embodiments, kit components may be
provided as dried powder(s). When reagents and/or components are
provided as dry powders, such powders may be reconstituted by the
addition of suitable volumes of solvent. In some embodiments, it is
envisioned that solvents may also be provided in another container
means. In some embodiments, labeling dyes are provided as dried
powders. In some embodiments, it is contemplated that 10, 20, 30,
40, 50, 60, 70, 80, 90, 100, 120, 120, 130, 140, 150, 160, 170,
180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 micrograms
or at least or at most those amounts of dried dye are provided in
kits of the invention. In such embodiments, dye may then be
resuspended in any suitable solvent, such as DMSO.
[0938] In some embodiments, kits may include instructions for
employing kit components as well the use of any other reagent not
included in the kit. Instructions may include variations that may
be implemented.
Devices
[0939] In some embodiments, compounds and/or compositions of the
present invention may be combined with, coated onto or embedded in
a device. Devices may include, but are not limited to, dental
implants, stents, bone replacements, artificial joints, valves,
pacemakers and/or other implantable therapeutic device.
[0940] The present invention provides for devices which may
incorporate viral vectors that encode one or more modulatory
polynucleotide payload molecules. These devices contain in a stable
formulation the viral vectors which may be immediately delivered to
a subject in need thereof, such as a human patient.
[0941] Devices for administration may be employed to deliver the
viral vectors comprising a modulatory polynucleotide of the present
invention according to single, multi- or split-dosing regimens
taught herein.
[0942] Method and devices known in the art for multi-administration
to cells, organs and tissues are contemplated for use in
conjunction with the methods and compositions disclosed herein as
embodiments of the present invention. These include, for example,
those methods and devices having multiple needles, hybrid devices
employing for example lumens or catheters as well as devices
utilizing heat, electric current or radiation driven
mechanisms.
[0943] The modulatory polynucleotides of the present invention may
be used in the treatment, prophylaxis or amelioration of any
disease or disorder characterized by aberrant or undesired target
expression.
VI. Definitions
[0944] At various places in the present specification, substituents
of compounds of the present disclosure are disclosed in groups or
in ranges. It is specifically intended that the present disclosure
include each and every individual subcombination of the members of
such groups and ranges.
[0945] About: As used herein, the term "about" means +/-10% of the
recited value.
[0946] Administered in combination: As used herein, the term
"administered in combination" or "combined administration" means
that two or more agents are administered to a subject at the same
time or within an interval such that there may be an overlap of an
effect of each agent on the patient. In some embodiments, they are
administered within about 60, 30, 15, 10, 5, or 1 minute of one
another. In some embodiments, the administrations of the agents are
spaced sufficiently closely together such that a combinatorial
(e.g., a synergistic) effect is achieved.
[0947] Animal: As used herein, the term "animal" refers to any
member of the animal kingdom. In some embodiments, "animal" refers
to humans at any stage of development. In some embodiments,
"animal" refers to non-human animals at any stage of development.
In certain embodiments, the non-human animal is a mammal (e.g., a
rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep,
cattle, a primate, or a pig). In some embodiments, animals include,
but are not limited to, mammals, birds, reptiles, amphibians, fish,
and worms. In some embodiments, the animal is a transgenic animal,
genetically-engineered animal, or a clone.
[0948] Approximately: As used herein, the term "approximately" or
"about," as applied to one or more values of interest, refers to a
value that is similar to a stated reference value. In certain
embodiments, the term "approximately" or "about" refers to a range
of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%,
13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in
either direction (greater than or less than) of the stated
reference value unless otherwise stated or otherwise evident from
the context (except where such number would exceed 100% of a
possible value).
[0949] Associated with: As used herein, the terms "associated
with," "conjugated," "linked," "attached," and "tethered," when
used with respect to two or more moieties, means that the moieties
are physically associated or connected with one another, either
directly or via one or more additional moieties that serves as a
linking agent, to form a structure that is sufficiently stable so
that the moieties remain physically associated under the conditions
in which the structure is used, e.g., physiological conditions. An
"association" need not be strictly through direct covalent chemical
bonding. It may also suggest ionic or hydrogen bonding or a
hybridization based connectivity sufficiently stable such that the
"associated" entities remain physically associated.
[0950] Bifunctional: As used herein, the term "bifunctional" refers
to any substance, molecule or moiety which is capable of or
maintains at least two functions. The functions may affect the same
outcome or a different outcome. The structure that produces the
function may be the same or different.
[0951] Biocompatible: As used herein, the term "biocompatible"
means compatible with living cells, tissues, organs or systems
posing little to no risk of injury, toxicity or rejection by the
immune system.
[0952] Biodegradable: As used herein, the term "biodegradable"
means capable of being broken down into innocuous products by the
action of living things.
[0953] Biologically active: As used herein, the phrase
"biologically active" refers to a characteristic of any substance
that has activity in a biological system and/or organism. For
instance, a substance that, when administered to an organism, has a
biological effect on that organism, is considered to be
biologically active. In particular embodiments, a modulatory
polynucleotide of the present invention may be considered
biologically active if even a portion of the polynucleotides is
biologically active or mimics an activity considered biologically
relevant.
[0954] Induced pluripotent stem cells: As used herein, "induced
pluripotent stem cells" are cells that may be induced to form any
of several distinct cell types.
[0955] Compound: As used herein, the term "compound," is meant to
include all stereoisomers, geometric isomers, tautomers, and
isotopes of the structures depicted.
[0956] The compounds described herein can be asymmetric (e.g.,
having one or more stereocenters). All stereoisomers, such as
enantiomers and diastereomers, are intended unless otherwise
indicated. Compounds of the present disclosure that contain
asymmetrically substituted carbon atoms can be isolated in
optically active or racemic forms. Methods on how to prepare
optically active forms from optically active starting materials are
known in the art, such as by resolution of racemic mixtures or by
stereoselective synthesis. Many geometric isomers of olefins,
C.dbd.N double bonds, and the like can also be present in the
compounds described herein, and all such stable isomers are
contemplated in the present disclosure. Cis and trans geometric
isomers of the compounds of the present disclosure are described
and may be isolated as a mixture of isomers or as separated
isomeric forms.
[0957] Compounds of the present disclosure also include tautomeric
forms. Tautomeric forms result from the swapping of a single bond
with an adjacent double bond and the concomitant migration of a
proton. Tautomeric forms include prototropic tautomers which are
isomeric protonation states having the same empirical formula and
total charge.
[0958] Compounds of the present disclosure also include all of the
isotopes of the atoms occurring in the intermediate or final
compounds. "Isotopes" refers to atoms having the same atomic number
but different mass numbers resulting from a different number of
neutrons in the nuclei. For example, isotopes of hydrogen include
tritium and deuterium.
[0959] The compounds and salts of the present disclosure can be
prepared in combination with solvent or water molecules to form
solvates and hydrates by routine methods.
[0960] Conserved: As used herein, the term "conserved" refers to
nucleotides or amino acid residues of a polynucleotide sequence or
polypeptide sequence, respectively, that are those that occur
unaltered in the same position of two or more sequences being
compared. Nucleotides or amino acids that are relatively conserved
are those that are conserved amongst more related sequences than
nucleotides or amino acids appearing elsewhere in the
sequences.
[0961] In some embodiments, two or more sequences are said to be
"completely conserved" if they are 100% identical to one another.
In some embodiments, two or more sequences are said to be "highly
conserved" if they are at least 70% identical, at least 80%
identical, at least 90% identical, or at least 95% identical to one
another. In some embodiments, two or more sequences are said to be
"highly conserved" if they are about 70% identical, about 80%
identical, about 90% identical, about 95%, about 98%, or about 99%
identical to one another. In some embodiments, two or more
sequences are said to be "conserved" if they are at least 30%
identical, at least 40% identical, at least 50% identical, at least
60% identical, at least 70% identical, at least 80% identical, at
least 90% identical, or at least 95% identical to one another. In
some embodiments, two or more sequences are said to be "conserved"
if they are about 30% identical, about 40% identical, about 50%
identical, about 60% identical, about 70% identical, about 80%
identical, about 90% identical, about 95% identical, about 98%
identical, or about 99% identical to one another. Conservation of
sequence may apply to the entire length of a polynucleotide or
polypeptide or may apply to a portion, region or feature
thereof.
[0962] Controlled Release: As used herein, the term "controlled
release" refers to a pharmaceutical composition or compound release
profile that conforms to a particular pattern of release to effect
a therapeutic outcome.
[0963] Cyclic or Cyclized: As used herein, the term "cyclic" refers
to the presence of a continuous loop. Cyclic molecules need not be
circular, only joined to form an unbroken chain of subunits.
[0964] Cytostatic: As used herein, "cytostatic" refers to
inhibiting, reducing, suppressing the growth, division, or
multiplication of a cell (e.g., a mammalian cell (e.g., a human
cell)), bacterium, virus, fungus, protozoan, parasite, prion, or a
combination thereof.
[0965] Cytotoxic: As used herein, "cytotoxic" refers to killing or
causing injurious, toxic, or deadly effect on a cell (e.g., a
mammalian cell (e.g., a human cell)), bacterium, virus, fungus,
protozoan, parasite, prion, or a combination thereof.
[0966] Delivery: As used herein, "delivery" refers to the act or
manner of delivering a compound, substance, entity, moiety, cargo
or payload.
[0967] Delivery Agent: As used herein, "delivery agent" refers to
any substance which facilitates, at least in part, the in vivo
delivery of a modulatory polynucleotide to targeted cells.
[0968] Destabilized: As used herein, the term "destable,"
"destabilize," or "destabilizing region" means a region or molecule
that is less stable than a starting, wild-type or native form of
the same region or molecule.
[0969] Detectable label: As used herein, "detectable label" refers
to one or more markers, signals, or moieties which are attached,
incorporated or associated with another entity that is readily
detected by methods known in the art including radiography,
fluorescence, chemiluminescence, enzymatic activity, absorbance and
the like. Detectable labels include radioisotopes, fluorophores,
chromophores, enzymes, dyes, metal ions, ligands such as biotin,
avidin, streptavidin and haptens, quantum dots, and the like.
Detectable labels may be located at any position in the peptides or
proteins disclosed herein. They may be within the amino acids, the
peptides, or proteins, or located at the N- or C-termini.
[0970] Diastereomer: As used herein, the term "diastereomer," means
stereoisomers that are not mirror images of one another and are
non-superimposable on one another.
[0971] Digest: As used herein, the term "digest" means to break
apart into smaller pieces or components. When referring to
polypeptides or proteins, digestion results in the production of
peptides.
[0972] Distal: As used herein, the term "distal" means situated
away from the center or away from a point or region of
interest.
[0973] Dosing regimen: As used herein, a "dosing regimen" is a
schedule of administration or physician determined regimen of
treatment, prophylaxis, or palliative care.
[0974] Enantiomer: As used herein, the term "enantiomer" means each
individual optically active form of a compound of the invention,
having an optical purity or enantiomeric excess (as determined by
methods standard in the art) of at least 80% (i.e., at least 90% of
one enantiomer and at most 10% of the other enantiomer), preferably
at least 90% and more preferably at least 98%.
[0975] Encapsulate: As used herein, the term "encapsulate" means to
enclose, surround or encase.
[0976] Engineered: As used herein, embodiments of the invention are
"engineered" when they are designed to have a feature or property,
whether structural or chemical, that varies from a starting point,
wild type or native molecule.
[0977] Effective Amount: As used herein, the term "effective
amount" of an agentis that amount sufficient to effect beneficial
or desired results, for example, clinical results, and, as such, an
"effective amount" depends upon the context in which it is being
applied. For example, in the context of administering an agent that
treats cancer, an effective amount of an agent is, for example, an
amount sufficient to achieve treatment, as defined herein, of
cancer, as compared to the response obtained without administration
of the agent.
[0978] Exosome: As used herein, "exosome" is a vesicle secreted by
mammalian cells or a complex involved in RNA degradation.
[0979] Expression: As used herein, "expression" of a nucleic acid
sequence refers to one or more of the following events: (1)
production of an RNA template from a DNA sequence (e.g., by
transcription); (2) processing of an RNA transcript (e.g., by
splicing, editing, 5` cap formation, and/or 3' end processing); (3)
translation of an RNA into a polypeptide or protein; and (4)
post-translational modification of a polypeptide or protein.
[0980] Feature: As used herein, a "feature" refers to a
characteristic, a property, or a distinctive element.
[0981] Formulation: As used herein, a "formulation" includes at
least one modulatory polynucleotide and a delivery agent.
[0982] Fragment: A "fragment," as used herein, refers to a portion.
For example, fragments of proteins may comprise polypeptides
obtained by digesting full-length protein isolated from cultured
cells.
[0983] Functional: As used herein, a "functional" biological
molecule is a biological molecule in a form in which it exhibits a
property and/or activity by which it is characterized.
[0984] Homology: As used herein, the term "homology" refers to the
overall relatedness between polymeric molecules, e.g. between
nucleic acid molecules (e.g. DNA molecules and/or RNA molecules)
and/or between polypeptide molecules. In some embodiments,
polymeric molecules are considered to be "homologous" to one
another if their sequences are at least 25%, 30%, 35%, 40%, 45%,
50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical
or similar. The term "homologous" necessarily refers to a
comparison between at least two sequences (polynucleotide or
polypeptide sequences). In accordance with the invention, two
polynucleotide sequences are considered to be homologous if the
polypeptides they encode are at least about 50%, 60%, 70%, 80%,
90%, 95%, or even 99% for at least one stretch of at least about 20
amino acids. In some embodiments, homologous polynucleotide
sequences are characterized by the ability to encode a stretch of
at least 4-5 uniquely specified amino acids. For polynucleotide
sequences less than 60 nucleotides in length, homology is
determined by the ability to encode a stretch of at least 4-5
uniquely specified amino acids. In accordance with the invention,
two protein sequences are considered to be homologous if the
proteins are at least about 50%, 60%, 70%, 80%, or 90% identical
for at least one stretch of at least about 20 amino acids.
[0985] Identity: As used herein, the term "identity" refers to the
overall relatedness between polymeric molecules, e.g., between
polynucleotide molecules (e.g. DNA molecules and/or RNA molecules)
and/or between polypeptide molecules. Calculation of the percent
identity of two polynucleotide sequences, for example, can be
performed by aligning the two sequences for optimal comparison
purposes (e.g., gaps can be introduced in one or both of a first
and a second nucleic acid sequences for optimal alignment and
non-identical sequences can be disregarded for comparison
purposes). In certain embodiments, the length of a sequence aligned
for comparison purposes is at least 30%, at least 40%, at least
50%, at least 60%, at least 70%, at least 80%, at least 90%, at
least 95%, or 100% of the length of the reference sequence. The
nucleotides at corresponding nucleotide positions are then
compared. When a position in the first sequence is occupied by the
same nucleotide as the corresponding position in the second
sequence, then the molecules are identical at that position. The
percent identity between the two sequences is a function of the
number of identical positions shared by the sequences, taking into
account the number of gaps, and the length of each gap, which needs
to be introduced for optimal alignment of the two sequences. The
comparison of sequences and determination of percent identity
between two sequences can be accomplished using a mathematical
algorithm. For example, the percent identity between two nucleotide
sequences can be determined using methods such as those described
in Computational Molecular Biology, Lesk, A. M., ed., Oxford
University Press, New York, 1988; Biocomputing: Informatics and
Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993;
Sequence Analysis in Molecular Biology, von Heinje, G., Academic
Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin,
A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994;
and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds.,
M Stockton Press, New York, 1991; each of which is incorporated
herein by reference. For example, the percent identity between two
nucleotide sequences can be determined using the algorithm of
Meyers and Miller (CABIOS, 1989, 4:11-17), which has been
incorporated into the ALIGN program (version 2.0) using a PAM120
weight residue table, a gap length penalty of 12 and a gap penalty
of 4. The percent identity between two nucleotide sequences can,
alternatively, be determined using the GAP program in the GCG
software package using an NWSgapdna.CMP matrix. Methods commonly
employed to determine percent identity between sequences include,
but are not limited to those disclosed in Carillo, H., and Lipman,
D., SIAM J Applied Math., 48:1073 (1988); incorporated herein by
reference. Techniques for determining identity are codified in
publicly available computer programs. Exemplary computer software
to determine homology between two sequences include, but are not
limited to, GCG program package, Devereux, J., et al., Nucleic
Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA
Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1990)).
[0986] Inhibit expression of a gene: As used herein, the phrase
"inhibit expression of a gene" means to cause a reduction in the
amount of an expression product of the gene. The expression product
can be an RNA transcribed from the gene (e.g., an mRNA) or a
polypeptide translated from an mRNA transcribed from the gene.
Typically a reduction in the level of an mRNA results in a
reduction in the level of a polypeptide translated therefrom. The
level of expression may be determined using standard techniques for
measuring mRNA or protein.
[0987] Isomer: As used herein, the term "isomer" means any
tautomer, stereoisomer, enantiomer, or diastereomer of any compound
of the invention. It is recognized that the compounds of the
invention can have one or more chiral centers and/or double bonds
and, therefore, exist as stereoisomers, such as double-bond isomers
(i.e., geometric E/Z isomers) or diastereomers (e.g., enantiomers
(i.e., (+) or (-)) or cis/trans isomers). According to the
invention, the chemical structures depicted herein, and therefore
the compounds of the invention, encompass all of the corresponding
stereoisomers, that is, both the stereomerically pure form (e.g.,
geometrically pure, enantiomerically pure, or diastereomerically
pure) and enantiomeric and stereoisomeric mixtures, e.g.,
racemates. Enantiomeric and stereoisomeric mixtures of compounds of
the invention can typically be resolved into their component
enantiomers or stereoisomers by well-known methods, such as
chiral-phase gas chromatography, chiral-phase high performance
liquid chromatography, crystallizing the compound as a chiral salt
complex, or crystallizing the compound in a chiral solvent.
Enantiomers and stereoisomers can also be obtained from
stereomerically or enantiomerically pure intermediates, reagents,
and catalysts by well-known asymmetric synthetic methods.
[0988] In vitro: As used herein, the term "in vitro" refers to
events that occur in an artificial environment, e.g., in a test
tube or reaction vessel, in cell culture, in a Petri dish, etc.,
rather than within an organism (e.g., animal, plant, or
microbe).
[0989] In vivo: As used herein, the term "in vivo" refers to events
that occur within an organism (e.g., animal, plant, or microbe or
cell or tissue thereof).
[0990] Isolated: As used herein, the term "isolated" refers to a
substance or entity that has been separated from at least some of
the components with which it was associated (whether in nature or
in an experimental setting). Isolated substances may have varying
levels of purity in reference to the substances from which they
have been associated. Isolated substances and/or entities may be
separated from at least about 10%, about 20%, about 30%, about 40%,
about 50%, about 60%, about 70%, about 80%, about 90%, or more of
the other components with which they were initially associated. In
some embodiments, isolated agents are more than about 80%, about
85%, about 90%, about 91%, about 92%, about 93%, about 94%, about
95%, about 96%, about 97%, about 98%, about 99%, or more than about
99% pure. As used herein, a substance is "pure" if it is
substantially free of other components.
[0991] Substantially isolated: By "substantially isolated" is meant
that the compound is substantially separated from the environment
in which it was formed or detected. Partial separation can include,
for example, a composition enriched in the compound of the present
disclosure. Substantial separation can include compositions
containing at least about 50%, at least about 60%, at least about
70%, at least about 80%, at least about 90%, at least about 95%, at
least about 97%, or at least about 99% by weight of the compound of
the present disclosure, or salt thereof. Methods for isolating
compounds and their salts are routine in the art.
[0992] Linker: As used herein, a linker refers to a group of atoms,
e.g., 10-1,000 atoms, and can be comprised of the atoms or groups
such as, but not limited to, carbon, amino, alkylamino, oxygen,
sulfur, sulfoxide, sulfonyl, carbonyl, and imine. The linker can be
attached to a modified nucleoside or nucleotide on the nucleobase
or sugar moiety at a first end, and to a payload, e.g., a
detectable or therapeutic agent, at a second end. The linker may be
of sufficient length as to not interfere with incorporation into a
nucleic acid sequence. The linker can be used for any useful
purpose, such as to form modulatory polynucleotide multimers (e.g.,
through linkage of two or more modulatory polynucleotides
molecules) or modulatory polynucleotides conjugates, as well as to
administer a payload, as described herein. Examples of chemical
groups that can be incorporated into the linker include, but are
not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether,
thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl,
each of which can be optionally substituted, as described herein.
Examples of linkers include, but are not limited to, unsaturated
alkanes, polyethylene glycols (e.g., ethylene or propylene glycol
monomeric units, e.g., diethylene glycol, dipropylene glycol,
triethylene glycol, tripropylene glycol, tetraethylene glycol, or
tetraethylene glycol), and dextran polymers and derivatives
thereof., Other examples include, but are not limited to, cleavable
moieties within the linker, such as, for example, a disulfide bond
(--S--S--) or an azo bond (--N.dbd.N--), which can be cleaved using
a reducing agent or photolysis. Non-limiting examples of a
selectively cleavable bond include an amido bond can be cleaved for
example by the use of tris(2-carboxyethyl)phosphine (TCEP), or
other reducing agents, and/or photolysis, as well as an ester bond
can be cleaved for example by acidic or basic hydrolysis.
[0993] MicroRNA (miRNA) binding site: As used herein, a microRNA
(miRNA) binding site represents a nucleotide location or region of
a nucleic acid transcript to which at least the "seed" region of a
miRNA binds.
[0994] Modified: As used herein "modified" refers to a changed
state or structure of a molecule of the invention. Molecules may be
modified in many ways including chemically, structurally, and
functionally.
[0995] Naturally occurring: As used herein, "naturally occurring"
means existing in nature without artificial aid.
[0996] Neutralizing antibody: As used herein, a "neutralizing
antibody" refers to an antibody which binds to its antigen and
defends a cell from an antigen or infectious agent by neutralizing
or abolishing any biological activity it has.
[0997] Non-human vertebrate: As used herein, a "non human
vertebrate" includes all vertebrates except Homo sapiens, including
wild and domesticated species. Examples of non-human vertebrates
include, but are not limited to, mammals, such as alpaca, banteng,
bison, camel, cat, cattle, deer, dog, donkey, gayal, goat, guinea
pig, horse, llama, mule, pig, rabbit, reindeer, sheep water
buffalo, and yak.
[0998] Off-target: As used herein, "off target" refers to any
unintended effect on any one or more target, gene, or cellular
transcript.
[0999] Open reading frame: As used herein, "open reading frame" or
"ORF" refers to a sequence which does not contain a stop codon in a
given reading frame.
[1000] Operably linked: As used herein, the phrase "operably
linked" refers to a functional connection between two or more
molecules, constructs, transcripts, entities, moieties or the
like.
[1001] Optionally substituted: Herein a phrase of the form
"optionally substituted X" (e.g., optionally substituted alkyl) is
intended to be equivalent to "X, wherein X is optionally
substituted" (e.g., "alkyl, wherein the alkyl is optionally
substituted"). It is not intended to mean that the feature "X"
(e.g. alkyl)per se is optional.
[1002] Peptide: As used herein, "peptide" is less than or equal to
50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45,
or 50 amino acids long.
[1003] Patient: As used herein, "patient" refers to a subject who
may seek or be in need of treatment, requires treatment, is
receiving treatment, will receive treatment, or a subject who is
under care by a trained professional for a particular disease or
condition.
[1004] Pharmaceutically acceptable: The phrase "pharmaceutically
acceptable" is employed herein to refer to those compounds,
materials, compositions, and/or dosage forms which are, within the
scope of sound medical judgment, suitable for use in contact with
the tissues of human beings and animals without excessive toxicity,
irritation, allergic response, or other problem or complication,
commensurate with a reasonable benefit/risk ratio.
[1005] Pharmaceutically acceptable excipients: The phrase
"pharmaceutically acceptable excipient," as used herein, refers any
ingredient other than the compounds described herein (for example,
a vehicle capable of suspending or dissolving the active compound)
and having the properties of being substantially nontoxic and
non-inflammatory in a patient. Excipients may include, for example:
antiadherents, antioxidants, binders, coatings, compression aids,
disintegrates, dyes (colors), emollients, emulsifiers, fillers
(diluents), film formers or coatings, flavors, fragrances, glidants
(flow enhancers), lubricants, preservatives, printing inks,
sorbents, suspensing or dispersing agents, sweeteners, and waters
of hydration. Exemplary excipients include, but are not limited to:
butylated hydroxytoluene (BHT), calcium carbonate, calcium
phosphate (dibasic), calcium stearate, croscarmellose, crosslinked
polyvinyl pyrrolidone, citric acid, crospovidone, cysteine,
ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl
methylcellulose, lactose, magnesium stearate, maltitol, mannitol,
methionine, methylcellulose, methyl paraben, microcrystalline
cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone,
pregelatinized starch, propyl paraben, retinyl palmitate, shellac,
silicon dioxide, sodium carboxymethyl cellulose, sodium citrate,
sodium starch glycolate, sorbitol, starch (corn), stearic acid,
sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C,
and xylitol.
[1006] Pharmaceutically acceptable salts: The present disclosure
also includes pharmaceutically acceptable salts of the compounds
described herein. As used herein, "pharmaceutically acceptable
salts" refers to derivatives of the disclosed compounds wherein the
parent compound is modified by converting an existing acid or base
moiety to its salt form (e.g., by reacting the free base group with
a suitable organic acid). Examples of pharmaceutically acceptable
salts include, but are not limited to, mineral or organic acid
salts of basic residues such as amines; alkali or organic salts of
acidic residues such as carboxylic acids; and the like.
Representative acid addition salts include acetate, acetic acid,
adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzene
sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate,
camphorsulfonate, citrate, cyclopentanepropionate, digluconate,
dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate,
glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide,
hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate,
lactobionate, lactate, laurate, lauryl sulfate, malate, maleate,
malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate,
nitrate, oleate, oxalate, palmitate, pamoate, pectinate,
persulfate, 3-phenylpropionate, phosphate, picrate, pivalate,
propionate, stearate, succinate, sulfate, tartrate, thiocyanate,
toluenesulfonate, undecanoate, valerate salts, and the like.
Representative alkali or alkaline earth metal salts include sodium,
lithium, potassium, calcium, magnesium, and the like, as well as
nontoxic ammonium, quaternary ammonium, and amine cations,
including, but not limited to ammonium, tetramethylammonium,
tetraethylammonium, methylamine, dimethylamine, trimethylamine,
triethylamine, ethylamine, and the like. The pharmaceutically
acceptable salts of the present disclosure include the conventional
non-toxic salts of the parent compound formed, for example, from
non-toxic inorganic or organic acids. The pharmaceutically
acceptable salts of the present disclosure can be synthesized from
the parent compound which contains a basic or acidic moiety by
conventional chemical methods. Generally, such salts can be
prepared by reacting the free acid or base forms of these compounds
with a stoichiometric amount of the appropriate base or acid in
water or in an organic solvent, or in a mixture of the two;
generally, nonaqueous media like ether, ethyl acetate, ethanol,
isopropanol, or acetonitrile are preferred. Lists of suitable salts
are found in Remington's Pharmaceutical Sciences, 17.sup.th ed.,
Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical
Salts: Properties, Selection, and Use, P. H. Stahl and C. G.
Wermuth (eds.), Wiley-V C H, 2008, and Berge et al., Journal of
Pharmaceutical Science, 66, 1-19 (1977), each of which is
incorporated herein by reference in its entirety.
[1007] Pharmaceutically acceptable solvate: The term
"pharmaceutically acceptable solvate," as used herein, means a
compound of the invention wherein molecules of a suitable solvent
are incorporated in the crystal lattice. A suitable solvent is
physiologically tolerable at the dosage administered. For example,
solvates may be prepared by crystallization, recrystallization, or
precipitation from a solution that includes organic solvents,
water, or a mixture thereof. Examples of suitable solvents are
ethanol, water (for example, mono-, di-, and tri-hydrates),
N-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO),
N,N'-dimethylformamide (DMF), N,N'-dimethylacetamide (DMAC),
1,3-dimethyl-2-imidazolidinone (DMEU),
1,3-dimethyl-3,4,5,6-tetrahydro-2-(1H)-pyrimidinone (DMPU),
acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl
alcohol, 2-pyrrolidone, benzyl benzoate, and the like. When water
is the solvent, the solvate is referred to as a "hydrate."
[1008] Pharmacokinetic: As used herein, "pharmacokinetic" refers to
any one or more properties of a molecule or compound as it relates
to the determination of the fate of substances administered to a
living organism. Pharmacokinetics is divided into several areas
including the extent and rate of absorption, distribution,
metabolism and excretion. This is commonly referred to as ADME
where: (A) Absorption is the process of a substance entering the
blood circulation; (D) Distribution is the dispersion or
dissemination of substances throughout the fluids and tissues of
the body; (M) Metabolism (or Biotransformation) is the irreversible
transformation of parent compounds into daughter metabolites; and
(E) Excretion (or Elimination) refers to the elimination of the
substances from the body. In rare cases, some drugs irreversibly
accumulate in body tissue.
[1009] Physicochemical: As used herein, "physicochemical" means of
or relating to a physical and/or chemical property.
[1010] Preventing: As used herein, the term "preventing" refers to
partially or completely delaying onset of an infection, disease,
disorder and/or condition; partially or completely delaying onset
of one or more symptoms, features, or clinical manifestations of a
particular infection, disease, disorder, and/or condition;
partially or completely delaying onset of one or more symptoms,
features, or manifestations of a particular infection, disease,
disorder, and/or condition; partially or completely delaying
progression from an infection, a particular disease, disorder
and/or condition; and/or decreasing the risk of developing
pathology associated with the infection, the disease, disorder,
and/or condition.
[1011] Prodrug: The present disclosure also includes prodrugs of
the compounds described herein. As used herein, "prodrugs" refer to
any substance, molecule or entity which is in a form predicate for
that substance, molecule or entity to act as a therapeutic upon
chemical or physical alteration. Prodrugs may by covalently bonded
or sequestered in some way and which release or are converted into
the active drug moiety prior to, upon or after administered to a
mammalian subject. Prodrugs can be prepared by modifying functional
groups present in the compounds in such a way that the
modifications are cleaved, either in routine manipulation or in
vivo, to the parent compounds. Prodrugs include compounds wherein
hydroxyl, amino, sulfhydryl, or carboxyl groups are bonded to any
group that, when administered to a mammalian subject, cleaves to
form a free hydroxyl, amino, sulfhydryl, or carboxyl group
respectively. Preparation and use of prodrugs is discussed in T.
Higuchi and V. Stella, "Pro-drugs as Novel Delivery Systems," Vol.
14 of the A. C. S. Symposium Series, and in Bioreversible Carriers
in Drug Design, ed. Edward B. Roche, American Pharmaceutical
Association and Pergamon Press, 1987, both of which are hereby
incorporated by reference in their entirety. In some embodiments,
the pri-miRs of the invention may be prodrugs of the pre-miRs.
Likewise either pri- or pre-miRs may be prodrugs of the artificial
miRs which are processed from them.
[1012] Proliferate: As used herein, the term "proliferate" means to
grow, expand or increase or cause to grow, expand or increase
rapidly. "Proliferative" means having the ability to proliferate.
"Anti-proliferative" means having properties counter to or
inapposite to proliferative properties.
[1013] Prophylactic: As used herein, "prophylactic" refers to a
therapeutic or course of action used to prevent the spread of
disease.
[1014] Prophylaxis: As used herein, a "prophylaxis" refers to a
measure taken to maintain health and prevent the spread of
disease.
[1015] Protein cleavage site: As used herein, "protein cleavage
site" refers to a site where controlled cleavage of the amino acid
chain can be accomplished by chemical, enzymatic or photochemical
means.
[1016] Protein cleavage signal: As used herein "protein cleavage
signal" refers to at least one amino acid that flags or marks a
polypeptide for cleavage.
[1017] Protein of interest: As used herein, the terms "proteins of
interest" or "desired proteins" include those provided herein and
fragments, mutants, variants, and alterations thereof.
[1018] Proximal: As used herein, the term "proximal" means situated
nearer to the center or to a point or region of interest.
[1019] Purified: As used herein, "purify," "purified,"
"purification" means to make substantially pure or clear from
unwanted components, material defilement, admixture or
imperfection.
[1020] Sample: As used herein, the term "sample" or "biological
sample" refers to a subset of its tissues, cells or component parts
(e.g. body fluids, including but not limited to blood, mucus,
lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva,
amniotic fluid, amniotic cord blood, urine, vaginal fluid and
semen). A sample further may include a homogenate, lysate or
extract prepared from a whole organism or a subset of its tissues,
cells or component parts, or a fraction or portion thereof,
including but not limited to, for example, plasma, serum, spinal
fluid, lymph fluid, the external sections of the skin, respiratory,
intestinal, and genitourinary tracts, tears, saliva, milk, blood
cells, tumors, organs. A sample further refers to a medium, such as
a nutrient broth or gel, which may contain cellular components,
such as proteins or nucleic acid molecule.
[1021] Signal Sequences: As used herein, the phrase "signal
sequences" refers to a sequence which can direct the transport or
localization of a protein.
[1022] Single unit dose: As used herein, a "single unit dose" is a
dose of any therapeutic administered in one dose/at one time/single
route/single point of contact, i.e., single administration
event.
[1023] Similarity: As used herein, the term "similarity" refers to
the overall relatedness between polymeric molecules, e.g. between
polynucleotide molecules (e.g. DNA molecules and/or RNA molecules)
and/or between polypeptide molecules. Calculation of percent
similarity of polymeric molecules to one another can be performed
in the same manner as a calculation of percent identity, except
that calculation of percent similarity takes into account
conservative substitutions as is understood in the art.
[1024] Split dose: As used herein, a "split dose" is the division
of single unit dose or total daily dose into two or more doses.
[1025] Stable: As used herein "stable" refers to a compound that is
sufficiently robust to survive isolation to a useful degree of
purity from a reaction mixture, and preferably capable of
formulation into an efficacious therapeutic agent.
[1026] Stabilized: As used herein, the term "stabilize",
"stabilized," "stabilized region" means to make or become
stable.
[1027] Stereoisomer: As used herein, the term "stereoisomer" refers
to all possible different isomeric as well as conformational forms
which a compound may possess (e.g., a compound of any formula
described herein), in particular all possible stereochemically and
conformationally isomeric forms, all diastereomers, enantiomers
and/or conformers of the basic molecular structure. Some compounds
of the present invention may exist in different tautomeric forms,
all of the latter being included within the scope of the present
invention.
[1028] Subject: As used herein, the term "subject" or "patient"
refers to any organism to which a composition in accordance with
the invention may be administered, e.g., for experimental,
diagnostic, prophylactic, and/or therapeutic purposes. Typical
subjects include animals (e.g., mammals such as mice, rats,
rabbits, non-human primates, and humans) and/or plants.
[1029] Substantially: As used herein, the term "substantially"
refers to the qualitative condition of exhibiting total or
near-total extent or degree of a characteristic or property of
interest. One of ordinary skill in the biological arts will
understand that biological and chemical phenomena rarely, if ever,
go to completion and/or proceed to completeness or achieve or avoid
an absolute result. The term "substantially" is therefore used
herein to capture the potential lack of completeness inherent in
many biological and chemical phenomena.
[1030] Substantially equal: As used herein as it relates to time
differences between doses, the term means plus/minus 2%.
[1031] Substantially simultaneously: As used herein and as it
relates to plurality of doses, the term means within 2 seconds.
[1032] Suffering from: An individual who is "suffering from" a
disease, disorder, and/or condition has been diagnosed with or
displays one or more symptoms of a disease, disorder, and/or
condition.
[1033] Susceptible to: An individual who is "susceptible to" a
disease, disorder, and/or condition has not been diagnosed with
and/or may not exhibit symptoms of the disease, disorder, and/or
condition but harbors a propensity to develop a disease or its
symptoms. In some embodiments, an individual who is susceptible to
a disease, disorder, and/or condition (for example, cancer) may be
characterized by one or more of the following: (1) a genetic
mutation associated with development of the disease, disorder,
and/or condition; (2) a genetic polymorphism associated with
development of the disease, disorder, and/or condition; (3)
increased and/or decreased expression and/or activity of a protein
and/or nucleic acid associated with the disease, disorder, and/or
condition; (4) habits and/or lifestyles associated with development
of the disease, disorder, and/or condition; (5) a family history of
the disease, disorder, and/or condition; and (6) exposure to and/or
infection with a microbe associated with development of the
disease, disorder, and/or condition. In some embodiments, an
individual who is susceptible to a disease, disorder, and/or
condition will develop the disease, disorder, and/or condition. In
some embodiments, an individual who is susceptible to a disease,
disorder, and/or condition will not develop the disease, disorder,
and/or condition.
[1034] Sustained release: As used herein, the term "sustained
release" refers to a pharmaceutical composition or compound release
profile that conforms to a release rate over a specific period of
time.
[1035] Synthetic: The term "synthetic" means produced, prepared,
and/or manufactured by the hand of man. Synthesis of
polynucleotides or polypeptides or other molecules of the present
invention may be chemical or enzymatic.
[1036] Targeted Cells: As used herein, "targeted cells" refers to
any one or more cells of interest. The cells may be found in vitro,
in vivo, in situ or in the tissue or organ of an organism. The
organism may be an animal, preferably a mammal, more preferably a
human and most preferably a patient.
[1037] Therapeutic Agent: The term "therapeutic agent" refers to
any agent that, when administered to a subject, has a therapeutic,
diagnostic, and/or prophylactic effect and/or elicits a desired
biological and/or pharmacological effect.
[1038] Therapeutically effective amount: As used herein, the term
"therapeutically effective amount" means an amount of an agent to
be delivered (e.g., nucleic acid, drug, therapeutic agent,
diagnostic agent, prophylactic agent, etc.) that is sufficient,
when administered to a subject suffering from or susceptible to an
infection, disease, disorder, and/or condition, to treat, improve
symptoms of, diagnose, prevent, and/or delay the onset of the
infection, disease, disorder, and/or condition.
[1039] Therapeutically effective outcome: As used herein, the term
"therapeutically effective outcome" means an outcome that is
sufficient in a subject suffering from or susceptible to an
infection, disease, disorder, and/or condition, to treat, improve
symptoms of, diagnose, prevent, and/or delay the onset of the
infection, disease, disorder, and/or condition.
[1040] Total daily dose: As used herein, a "total daily dose" is an
amount given or prescribed in 24 hour period. It may be
administered as a single unit dose.
[1041] Transfection: As used herein, the term "transfection" refers
to methods to introduce exogenous nucleic acids into a cell.
Methods of transfection include, but are not limited to, chemical
methods, physical treatments and cationic lipids or mixtures.
[1042] Treating: As used herein, the term "treating" refers to
partially or completely alleviating, ameliorating, improving,
relieving, delaying onset of, inhibiting progression of, reducing
severity of, and/or reducing incidence of one or more symptoms or
features of a particular infection, disease, disorder, and/or
condition. For example, "treating" cancer may refer to inhibiting
survival, growth, and/or spread of a tumor. Treatment may be
administered to a subject who does not exhibit signs of a disease,
disorder, and/or condition and/or to a subject who exhibits only
early signs of a disease, disorder, and/or condition for the
purpose of decreasing the risk of developing pathology associated
with the disease, disorder, and/or condition.
[1043] Unmodified: As used herein, "unmodified" refers to any
substance, compound or molecule prior to being changed in any way.
Unmodified may, but does not always, refer to the wild type or
native form of a biomolecule. Molecules may undergo a series of
modifications whereby each modified molecule may serve as the
"unmodified" starting molecule for a subsequent modification.
VII. Equivalents and Scope
[1044] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments in accordance with the
invention described herein. The scope of the present invention is
not intended to be limited to the above Description, but rather is
as set forth in the appended claims.
[1045] In the claims, articles such as "a," "an," and "the" may
mean one or more than one unless indicated to the contrary or
otherwise evident from the context. Claims or descriptions that
include "or" between one or more members of a group are considered
satisfied if one, more than one, or all of the group members are
present in, employed in, or otherwise relevant to a given product
or process unless indicated to the contrary or otherwise evident
from the context. The invention includes embodiments in which
exactly one member of the group is present in, employed in, or
otherwise relevant to a given product or process. The invention
includes embodiments in which more than one, or all of the group
members are present in, employed in, or otherwise relevant to a
given product or process.
[1046] It is also noted that the term "comprising" is intended to
be open and permits but does not require the inclusion of
additional elements or steps. When the term "comprising" is used
herein, the term "consisting of is thus also encompassed and
disclosed.
[1047] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Methods
and materials are described herein for use in the present
disclosure; other, suitable methods and materials known in the art
can also be used.
[1048] Where ranges are given, endpoints are included. Furthermore,
it is to be understood that unless otherwise indicated or otherwise
evident from the context and understanding of one of ordinary skill
in the art, values that are expressed as ranges can assume any
specific value or subrange within the stated ranges in different
embodiments of the invention, to the tenth of the unit of the lower
limit of the range, unless the context clearly dictates
otherwise.
[1049] In addition, it is to be understood that any particular
embodiment of the present invention that falls within the prior art
may be explicitly excluded from any one or more of the claims.
Since such embodiments are deemed to be known to one of ordinary
skill in the art, they may be excluded even if the exclusion is not
set forth explicitly herein. Any particular embodiment of the
compositions of the invention (e.g., any nucleic acid or protein
encoded thereby; any method of production; any method of use; etc.)
can be excluded from any one or more claims, for any reason,
whether or not related to the existence of prior art.
[1050] All cited sources, for example, references, publications,
databases, database entries, and art cited herein, are incorporated
into this application by reference, even if not expressly stated in
the citation. In case of conflicting statements of a cited source
and the instant application, the statement in the instant
application shall control.
[1051] Section and table headings are not intended to be
limiting.
[1052] While the present invention has been described at some
length and with some particularity with respect to the several
described embodiments, it is not intended that it should be limited
to any such particulars or embodiments or any particular
embodiment, but it is to be construed with references to the
appended claims so as to provide the broadest possible
interpretation of such claims in view of the prior art and,
therefore, to effectively encompass the intended scope of the
invention.
[1053] All publications, patent applications, patents, and other
references mentioned herein are incorporated by reference in their
entirety. In case of conflict, the present specification, including
definitions, will control. In addition, section headings, the
materials, methods, and examples are illustrative only and not
intended to be limiting.
VIII. EXAMPLES
Example 1
[1054] Design of Modulatory Polynucleotides (Artificial Pri- or
Pre-microRNAs)
[1055] Artificial pri- or pre-microRNAs are designed to contain
shRNA or stem loop structures encoding an artificial miR (or
artificial siRNA or mature miRNA) having at least one strand that
can at least partially hybridize with a target nucleic acid, e.g.,
RNA or DNA and one or more of the following features (a) UG motif
at the base of basal stem, (b) a UGUG motif at the 5' end of the
miRNA loop, (c) Uridine at the 5' end of guide strand, (d) a loop
structure derived from a canonical microRNA such as miR-22, (e) a
CNNC at the 3' flanking sequence, (f) flanking regions from a
canonical microRNA such as let-7b, (g) one or more wobble
base-pairs, bulges and mismatches in the stem after guide and
passenger stands, and/or (h) one or more wobble base-pairs, bulges
and mismatches between the passenger and guide strand.
[1056] Once designed, the sequence is engineered or synthesized or
inserted in a plasmid or vector and administered to a cell or
organism. Suitable plasmids or vectors are any which transfect or
transduce the target cell.
[1057] Adeno-associated viral vectors (AAV), viral particles or
entire viruses may be used.
[1058] Administration results in the processing of the modulatory
polynucleotide to generate the artificial microRNA which alters
expression levels of the target nucleic acid.
[1059] Effective knockdown of a target may be determined by methods
in the art and will show little if any off-target effects.
[1060] Effective passenger-guide strand duplexes of the modulatory
polynucleotides, e.g., pri- or pre-microRNAs demonstrate greater
than 8-10-fold guide to passenger strand ratio when processing is
measured.
Example 2
[1061] Passenger-Guide Strand Optimization
[1062] In order to achieve target knockdown or modulation of target
expression which is specific and potent, the passenger and guide
strands that will form the duplex stem of the stem-loop structure
of the pri- or pre-microRNA of the invention may be optimized
separately, for example as siRNA (small interfering RNAs).
[1063] siRNAs are designed against a target nucleic acid of choice
as canonical siRNAs having a 19 base pair central duplex with a
dinucleotide overhang on the 3' end of the strands of the duplex
and where the antisense strand (guide strand) has perfect
complementarity to the target nucleic acid over the 19 nucleotide
region.
[1064] Alternatively, siRNAs are designed whereby the sense strand
(passenger strand) comprises less than 19 nucleotide identity to
the target nucleic acid.
[1065] Modifications to the sense-antisense (passenger-guide)
strand duplex base pairing is made to introduce wobbles, bulges or
mismatches. Insertions or deletions or mismatches may be
incorporated at the 5' or 3' terminus of the sense strand
(passenter strand) and these insertions or deletions may or may not
be mirrored on the antisense strand (guide strand).
[1066] The resulting siRNA are tested by standard methods known in
the art for target knockdown and other relevant physiologic and
pharmacokinetic properties and for degree of off-target
effects.
[1067] siRNA exhibiting sufficient target knockdown with few off
target effects are then engineered, either with or without further
modifications, as the passenger and guide strands of the pri- or
pre-microRNAs of the invention.
Example 3
[1068] Pri and Pre-microRNAs Targeting HTT
[1069] The passenger-guide strand duplexes found to be efficacious
are engineered into expression vectors and transfected into cells
of the central nervous system or neuronal cell lines or
immortalized cell lines of other origins. Even though overhang
utilized in the siRNA knockdown study is a canonical dTdT for
siRNA, the overhang in the synthetic pri- or pre-miR may comprise
any dinucleotide overhang.
[1070] The cells used may be primary cells or derived from induced
pluripotent stem cells (iPS cells).
[1071] The knockdown of the target is then measured and deep
sequencing performed to determine the exact passenger and guide
strand processed from each pri- or pre-microRNA administered in the
expression vector.
[1072] A guide to passenger strand ratio is calculated to determine
the efficiency of assembly, e.g., assembly into RNA Induced
Silencing Complex (RISC).
[1073] The 5' end of guide and passenger strands are sequenced to
determine the cleavage site and to determine the 5' end processing
prcision. It is expected that processing precision will be higher
than 85 percent.
[1074] HeLa cells are co-transfected in a parallel study to analyze
in vitro knockdown of the target. In parallel, a cell-base
luciferase reporter assay is established; a luciferase construct
containing guide strand target site is used to assess on-target
effect and a construct with passenger strand target site is used to
determine off-target (passenger strand) effects.
[1075] Deep sequencing is again performed.
Example 4
[1076] Pri-miRNA Constructs in AAV-miRNA Vectors
[1077] Passenger-guide strand duplexes of the designed siRNA are
engineered into AAV-miRNA expression vectors. The construct from
ITR to ITR, recited 5' to 3', comprises a mutant or wild-type ITR,
a promoter (either a CMV, a H1, a U6 or the CBA promoter (which
includes a CMVie enhancer, a CB promoter and an SV40 or a human
betaGlobin intron)), the pri-miRNA construct for the target, a
rabbit globin or human growth hormone polyA and wildtype ITR. In
vitro and in vivo studies are performed to test the efficacy of the
AAV-miRNA expression vectors.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20200149045A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20200149045A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References