U.S. patent application number 16/683763 was filed with the patent office on 2020-05-07 for multiplex detection of nucleic acids.
The applicant listed for this patent is Vanadis Diagnostics. Invention is credited to Carl Oscar Fredrik Dahl, Olof John Ericsson.
Application Number | 20200140922 16/683763 |
Document ID | / |
Family ID | 49979622 |
Filed Date | 2020-05-07 |
![](/patent/app/20200140922/US20200140922A1-20200507-D00001.png)
![](/patent/app/20200140922/US20200140922A1-20200507-D00002.png)
![](/patent/app/20200140922/US20200140922A1-20200507-D00003.png)
![](/patent/app/20200140922/US20200140922A1-20200507-D00004.png)
![](/patent/app/20200140922/US20200140922A1-20200507-D00005.png)
![](/patent/app/20200140922/US20200140922A1-20200507-D00006.png)
![](/patent/app/20200140922/US20200140922A1-20200507-D00007.png)
![](/patent/app/20200140922/US20200140922A1-20200507-D00008.png)
United States Patent
Application |
20200140922 |
Kind Code |
A1 |
Dahl; Carl Oscar Fredrik ;
et al. |
May 7, 2020 |
Multiplex Detection of Nucleic Acids
Abstract
Described herein is a new approach in which a nucleic acid
species of interest (e.g. a chromosome) containing multiple unique
target sequences is detected using multiple specific probes that
are amplified by rolling circle amplification and detected.
Multiple probes are used to provide a detectable signal, where the
magnitude of the signal is proportional to the number of probes
recognising their target sequences. Individual signals from the
plurality of probes are converted into a single cumulative
detectable signal, amplifying the individual signals through the
multiplex probing. Ten or more probes produce a signal
amplification of ten-fold or more. The generated signals depend on
correctly reacted probes upon target recognition, using sequence
specific hybridisation and enzymatic catalysis to generate specific
products from which the signal is obtained.
Inventors: |
Dahl; Carl Oscar Fredrik;
(Sigtuna, SE) ; Ericsson; Olof John; (Uppsala,
SE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Vanadis Diagnostics |
Sollentuna |
|
SE |
|
|
Family ID: |
49979622 |
Appl. No.: |
16/683763 |
Filed: |
November 14, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15036778 |
May 13, 2016 |
10526643 |
|
|
PCT/IB2014/003062 |
Nov 26, 2014 |
|
|
|
16683763 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/682 20130101;
C12Q 1/6816 20130101; C12Q 1/682 20130101; C12Q 1/6816 20130101;
C12Q 2521/501 20130101; C12Q 2525/161 20130101; C12Q 2525/307
20130101; C12Q 2533/107 20130101; C12Q 2531/125 20130101; C12Q
2521/501 20130101; C12Q 2525/307 20130101; C12Q 2531/125 20130101;
C12Q 2537/143 20130101; C12Q 2533/107 20130101; C12Q 2525/161
20130101; C12Q 2537/143 20130101 |
International
Class: |
C12Q 1/682 20060101
C12Q001/682; C12Q 1/6816 20060101 C12Q001/6816 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 2, 2013 |
GB |
1321196.6 |
Claims
1-24. (canceled)
25. A method of quantifying labelled rolling circle amplification
(RCA) products, comprising: (a) spreading a mixture comprising at
least a first set of labelled RCA products and a second set of
labelled RCA products across the surface of a support, wherein the
first and second sets of labelled RCA products are distinguishably
labelled; (b) counting the number of RCA products in the first set
on the support, to provide a first count; (c) counting the number
of RCA products in the second set on the support, to provide a
second count; and (d) comparing the first and second counts,
thereby determining the relative quantities of the RCA products in
the first and second sets of RCA products.
26. The method of claim 25, wherein the counting of (b) and (c)
comprises: (i) imaging the first and second sets of labeled RCA
products on the support to produce one or more images, wherein the
labeled RCA products of the first set and the second set are
spatially separated in the one or more images; and (ii) determining
the number of labeled RCA products of the first set and the second
set, in the image.
27. The method of claim 25, wherein at least some of the labeled
RCA products comprise a sequence of a fragment of human genomic
DNA.
28. The method of claim 27, wherein the fragment is in a range of
10 to 30 nucleotides in length.
29. The method of claim 28, wherein the fragment is a fragment of
human chromosome 21.
30. The method of claim 29, wherein the fragment is a restriction
fragment.
31. The method of claim 25, wherein the first and second sets of
labelled RCA products are fluorescently labelled.
32. The method of claim 31, wherein the fluorescently labelled RCA
products are made by hybridizing distinguishably labelled
oligonucleotides to a population of unlabelled RCA products,
wherein the hybridizing is done in solution and wherein the
labelled oligonucleotides hybridize to sequences that are repeated
in the RCA products.
33. The method of claim 25, wherein the first and second sets of
labelled RCA products each comprise at least 1,000 labelled RCA
products.
34. The method of claim 25, wherein the support is a planar
support.
Description
CROSS-REFERENCING
[0001] This application claims the benefit of UK Application No:
1321196.6, filed on Dec. 2, 2013, which application is incorporated
by reference herein.
FIELD OF THE INVENTION
[0002] The invention relates to multiplex methods of detecting
multiple nucleic acid sequences in parallel using probes that bind
specific sequences. The invention also relates to quantification of
species of nucleic acid, for example determining the relative
quantities of two different chromosomes in a sample, including use
of such methods in non-invasive pre-natal diagnosis of foetal
aneuploidies.
BACKGROUND
[0003] Many diseases are caused or characterised by an imbalance in
the number of chromosomes (aneuploidy) or an imbalance in the
number of chromosomal segments (partial aneuploidy) in cells of an
individual compared with the normal number of chromosomes or
chromosomal segments for the species. The human diploid genome has
23 pairs of chromosomes; paired chromosomes 1 to 22 and the sex
chromosomes XX or XY. The terms monosomy and trisomy refer to a
missing or extra chromosome, while partial monosomy and partial
trisomy refer to an imbalance of genetic material caused by loss or
gain respectively of part of a chromosome. Aneuploidy and partial
aneuploidy in an individual's genome are associated with congenital
disorders such as Down's syndrome (trisomy of human chromosome 21)
and Turner syndrome (monosomy or partial monosomy of the sex
chromosome), Aneuploidy and partial aneuploidy may also arise
through somatic mutation in adult tissues. For example, many cancer
cells exhibit chromosomal fragility leading to translocations of
chromosomal fragments and aneuploidy of tumour cells.
[0004] Methods have been developed for diagnosing diseases
associated with chromosomal defects. Traditional methods of
karyotyping included obtaining a tissue sample, staining the
chromosomes and examining them under a light microscope. Schrock et
al. (Science 273(5274):494-497 1996) described multicolour spectral
karyotyping, using fluorescence in situ hybridisation (FISH) to
simultaneously visualise all human chromosomes in different
colours. Fluorescently labelled probes were made for each
chromosome by labelling chromosome-specific DNA with different
fluorophores. Because there are a limited number of spectrally
distinct fluorophores, a combinatorial labelling method was used to
generate the required number of different emission spectra.
Spectral differences generated by combinatorial labelling were
captured and analysed using an interferometer attached to a
fluorescence microscope. Image processing software then assigned a
colour to each spectrally different combination, allowing the
visualisation of the individually coloured chromosomes.
[0005] Comparative genomic hybridisation (CGH) involves the
isolation of DNA from the two sources to be compared, most commonly
a test and reference source, independent labelling of each DNA
sample with fluorophores of different colours (usually red and
green), denaturation of the DNA so that it is single stranded, and
the hybridisation of the two resultant samples in a 1:1 ratio to a
normal metaphase spread of chromosomes, to which the labelled DNA
samples will bind at their locus of origin. Using a fluorescence
microscope and computer software, the differentially coloured
fluorescent signals are then compared along the length of each
chromosome for identification of chromosomal differences between
the two sources. A higher intensity of the test sample colour in a
specific region of a chromosome indicates the gain of material of
that region in the corresponding source sample, while a higher
intensity of the reference sample colour indicates the loss of
material in the test sample in that specific region. A neutral
colour (yellow when the fluorophore labels are red and green)
indicates no difference between the two samples in that location.
CGH was described by Kallioniemi et al., Science 258(5083):818-21
1992 and Pinkel et al., Nat Genet. 20(2):207-11 1998.
[0006] More recently, digital or virtual karyotyping methods have
been developed to quantify copy number on a genomic scale (Wang et
al., PNAS 99(25):16156-16161 2002). Digital karyotyping allows
differences in copy number to be detected at higher resolution
compared with conventional karyotyping or chromosome-based CGH.
Short sequences of DNA from specific loci all over the genome are
isolated and enumerated. Tags of 21 bp each can be obtained from
specific locations in the genome and generally contain sufficient
information to uniquely identify the genomic loci from which they
were derived. Tags can thus be matched to precise chromosomal
locations and tag densities can be evaluated over moving windows to
detect abnormalities in DNA sequence content. Methods of matching
the sequence tags to their chromosomal locations include high
throughput sequencing, use of array-comparative genomic
hybridisation and SNP arrays.
[0007] Arrays are composed of hundreds to millions of probes which
are complementary to a region of interest in the genome. DNA from
the test sample is fragmented, labelled, and hybridised to the
array. The hybridisation signal intensities for each probe are
quantified for each position on the array. Knowing the address of
each probe on the array and the address of each probe in the
genome, an algorithm is used to line up the probes in chromosomal
order and reconstruct the genome in silica. The resolution of
digital karyotyping depends on the density of probes on the
array.
[0008] One area where high precision analysis is required is in
non-invasive prenatal karyotyping. Pregnant mothers carry cell-free
circulating DNA in their blood, of which 4-30% is derived from the
foetus. It is possible to determine the karyotype of the foetus by
determining the abundance of cell free DNA originating from each
chromosome. For example, if the cell free DNA consists of 95%
maternal and 5% foetal DNA, and if the foetus has trisomy of
chromosome 21 (Down's syndrome) then the total amount of cell free
DNA from chromosome 21 should exceed that of any other genomic
region of the same size by 2.5%. Observing a chromosomal aneuploidy
in the foetal DNA requires a very precise measurement to detect
such slight imbalances in the relative quantities of different
chromosomes. The difficulty is compounded by a need to work with
relatively small samples in order to provide a method that is
convenient and acceptable for patients and clinicians.
[0009] Analysis of specific targets from single or a few DNA
molecules has traditionally been a technical challenge. Methods to
copy DNA are typically required to achieve sufficient signal for
downstream analysis procedures. Analysis methods such as DNA
sequencing, gel electrophoresis, and DNA microarrays typically
require a signal amplification of the DNA in the sample provided.
The most common amplification method to amplify specific DNA
targets is PCR, which can provide millions (or billions) of copies
of specific targets from a DNA sample. However, when it is desired
to amplify many regions of a genomic sample for analysis,
amplification artefacts can arise as a result of performing
multiple different amplifications together in the same reaction
mixture. Also, an amplification step can result in loss of
information regarding relative quantities of sequences in the
sample, since the original difference in relative quantity may be
tiny compared with the absolute magnitude of the amplified nucleic
acid products, and since different sequences may be amplified with
different efficiencies.
SUMMARY OF THE INVENTION
[0010] Some embodiments of the method described herein introduce a
novel approach in which a nucleic acid species of interest (e.g. a
chromosome) containing multiple unique target sequences is detected
using multiple specific probes. Multiple probes are used to provide
a detectable signal, where the magnitude of the signal is
proportional to the number of probes recognising their target
sequences. Individual signals from the plurality of probes are
converted into a single cumulative detectable signal, amplifying
the individual signals through the multiplex probing. Ten or more
probes produce a signal amplification of ten-fold or more. The
generated signals depend on correctly reacted probes upon target
recognition, using sequence specific hybridisation and enzymatic
catalysis to generate specific products from which the signal is
obtained.
[0011] Some embodiments use detection of multiple loci on a nucleic
acid species of interest target molecule as a signal amplification
step, and therefore enables signal generation and detection without
requiring amplification of the products of the reacted probes. The
signal from the multiplex products may however be optionally
amplified by traditional signal amplification steps. Clonal
amplification of the signal may be performed. Suitable
amplification techniques include rolling circle amplification,
bridge PCR, emPCR and digital PCR.
[0012] Each probe that recognises its target sequence generates a
ligation product, and the ligation products produced by each probe
hybridisation may be individually detectable, so that an individual
signal is obtainable from each. However, an elegant feature of some
implementations of the present method is that these individual
signals need not be individually detected, but instead are merged
into a cumulative signal and the cumulative signal is detected. The
cumulative signal is a combination of the individual signals and
can thus be used to detect and/or quantify the ligation products,
representing the presence or quantity of the nucleic acid species
under investigation. This allows an earlier merging of the probe
signals compared with methods involving sequencing and microarrays,
in which individual signals are generated for multiple probes
across a region and then the signal is merged in the analysis to
represent a region. The signal can be merged before detection, so
that individual signals are not separately mapped or interrogated.
This enables a simpler readout format.
[0013] The method of signal amplification by multiplexing can be
used to detect nucleic acid species of interest in a sample, for
example where a nucleic acid species is a minor or trace component
in a complex nucleic acid sample. The amplification by multiplexing
enables reliable detection. This may be used for example to detect
microbial nucleic acid in samples, such as patient samples, for
diagnostic purposes. Samples may be probed with probes specific for
microbial nucleic acids of multiple species, to detect and identify
those present. This is useful for detection of agents of infectious
disease, such as bacteria, viruses and fungi. Specific nucleic acid
transcripts may be detected. Amplification by multiplexing may also
be used to quantify the nucleic acid species. By probing two or
more species of nucleic acid--one or more species of interest and
one or more reference nucleic acid species--the present method
enables quantification of the relative amounts of the two species
in the sample. The method is especially useful when applied to the
detection or quantification of chromosomes or chromosomal loci, for
example for chromosomal copy number detection. An application of
particular value is the use of such methods for identifying
chromosomal defects, including for the diagnosis of cancers and
congenital aneuploidies. Use for non-invasive prenatal diagnosis
(NIPT) is specifically described. The present method is of
particular use when large nucleic acids that comprise a multitude
of target sequences are interrogated/detected, especially if these
nucleic acids are present in a low molar amount, and when they must
measured or quantified with very high precision, as is the case in
NIPT.
[0014] A species of nucleic acid in a sample may be detected by
contacting the sample with a set of probes, wherein each probe
specifically recognises a distinct target sequence in the species
of nucleic acid to be detected, and wherein recognition of each
target sequence by each probe generates a product, arid detecting a
cumulative signal which is a combination of the signals from the
products, wherein detection of the signal indicates the presence of
the species of nucleic acid in the sample. The species of nucleic
acid may be quantified by quantifying the cumulative signal to
determine a signal level, wherein the signal level is proportional
to the quantity of the species of nucleic acid in the sample, and
thereby determining the quantity of the species of nucleic acid in
the sample. A first species of nucleic acid may be quantified
relative to a second or reference species of nucleic acid by
contacting the sample with a first set of probes and a second set
of probes, wherein the probes of the first set each specifically
recognise a distinct target sequence within the first species of
nucleic acid and wherein the probes of the second set each
specifically recognise a distinct target sequence within the second
or reference species of nucieic acid. First and second cumulative
signals are detected, the first cumulative signal being a
combination of individual signals from products generated by probes
of the first set recognising their target sequences, and the second
cumulative signal being a combination of individual signals from
products generated by probes of the second set recognising their
target sequences. The first and second signals are quantified to
determine first and second signal levels respectively, these being
proportional to the quantities of the first and second species of
nucleic acid in the sample. The relative quantities of the first
and second nucleic acid species in the sample may thus be
determined by comparing the first and second signal levels.
[0015] For example, the cumulative signal may be the summarised
enumeration of clonally amplified and/or labelled products of the
probes that recognise their target sequences, for example products
of rolling circle amplification, or a fluorescent signal emitted
from all the products where each product emits a fluorescent
signal. For quantifying relative amounts of multiple species of
nucieic acids, different signals are used for each species, for
example products of one set of probes may emit a different
wavelength or spectrum of fluorescence compared with products of
another set of probes.
[0016] Advantages are obtained when the probe target recognition
relies on both hybridisation and enzymatic discrimination, so that
the signal output is dependent on correct enzymatic probe reaction.
Preferably, recognition of the target sequence by the probe
comprises hybridisation of the probe to the target sequence and
generation of a ligation product, where the generation of the
ligation product is dependent on the specific hybridisation of the
probe to its target sequence. Probes which are designed to be
especially suitable for use in the present method are described
herein. However, the probes are not limited to any one design of
probe, and a variety of known nucleic acid probes may be
conveniently used, including for example padlock probes, selector
probes, oligonucleotide ligation probes, molecular inversion
probes, and tandem probes.
[0017] A first aspect of the this disclosure provides a method of
detecting a species of nucleic acid in a sample, comprising
[0018] contacting the sample with a set of probes, wherein each
probe specifically recognises a distinct target sequence within the
species of nucleic acid to be detected,
[0019] providing conditions under which the target sequences in the
species of nucleic acid are at least partially single stranded,
[0020] providing conditions for annealing and ligation, under which
conditions the probes hybridise to their target sequences and
generate ligation products, each ligation product comprising a
ligation junction, and
[0021] detecting a cumulative signal which is a combination of
individual signals from all ligation products,
[0022] wherein detection of the signal indicates the presence of
the species of nucleic acid in the sample.
[0023] A second aspect of this disclosure provides a method is a
method of quantifying a species of nucleic acid in a sample,
comprising
[0024] contacting the sample with a set of probes, wherein each
probe specifically recognises a distinct target sequence within the
species of nucleic acid to be quantified,
[0025] providing conditions under which the target sequences in the
species of nucleic acid are at least partially single stranded,
[0026] providing conditions for annealing and ligation, under which
conditions the probes hybridise to their target sequences and
generate ligation products, each ligation product comprising a
ligation junction, and
[0027] detecting a cumulative signal which is a combination of
individual signals from all ligation products,
[0028] quantifying the cumulative signal to determine a signal
level, wherein the signal level is proportional to the quantity of
the species of nucleic acid in the sample, and
[0029] thereby determining the quantity of the species of nucleic
acid in the sample.
[0030] The method may be used to quantify a first species of
nucleic acid relative to a second species of nucleic acid in a
sample. Accordingly, the method may comprise
[0031] contacting the sample with a first set of probes and a
second set of probes, wherein the probes of the first set each
specifically recognise a distinct target sequence within the first
species of nucleic acid and wherein the probes of the second set
each specifically recognise a distinct target sequence within the
second species of nucleic acid,
[0032] providing conditions under which the target sequences in the
first and second species of nucleic acid are at least partially
single stranded,
[0033] providing conditions for annealing and ligation, under which
conditions the probes hybridise to their target sequences and
generate ligation products, each ligation product comprising a
ligation junction,
[0034] detecting a first cumulative signal which is a combination
of individual signals from the ligation products generated by
probes of the first set, and quantifying it to determine a first
signal level, wherein the first signal level is proportional to the
quantity of the first species of nucleic acid in the sample,
[0035] detecting a second cumulative signal which is a combination
of individual signals from the ligation products generated by
probes of the second set, and quantifying it to determine a second
signal level, wherein the second signal level is proportional to
the quantity of the second species of nucleic acid in the sample,
and
[0036] comparing the first and second signal levels, thereby
determining the relative quantities of the first and second nucleic
acid species in the sample.
[0037] Another aspect provides a method of quantifying a first
chromosome or chromosomal locus relative to a second chromosome or
chromosomal locus in a sample, comprising
[0038] contacting the sample with a first set of probes and a
second set of probes, wherein the probes of the first set each
specifically recognise a distinct target sequence within the first
chromosome or chromosomal locus and wherein the probes of the
second set each specifically recognise a distinct target sequence
within the second chromosome or chromosomal locus,
[0039] providing conditions under which the target sequences in the
first and second chromosome or chromosomal locus are at least
partially single stranded,
[0040] providing conditions for annealing and ligation, under which
conditions the probes hybridise to their target sequences and
generate ligation products, each ligation product being a circle of
nucleic acid comprising a ligation junction,
[0041] providing conditions for rolling circle replication of the
circles of nucleic acid,
[0042] counting the number of first rolling circle replication
products, wherein rolling circle replication products are amplified
from the ligation products generated by probes of the first set to
provide a first count,
[0043] counting the number of second rolling circle replication
products, wherein the second rolling circle replication products
are amplified from the ligation products generated by probes of the
second set to provide a second count, and
[0044] comparing the first and second counts, thereby determining
the relative quantities of the first and second nucleic acid
species in the sample.
[0045] In these embodiments, the rolling circle amplification
products may be individually counted by: (a) obtaining a substrate
comprising a plurality of complexes distributed on the surface of
the substrate, wherein each of the complexes comprises a single RCA
product and a plurality of labelled oligonucleotide probes that are
hybridized to the RCA product, wherein the complexes corresponding
to the first rolling circle amplification products and the
complexes corresponding to the second rolling circle amplification
products are distinguishably labelled; and (b) counting the number
first RCA products and, independently, counting the number of
second RCA products, that are present in an area of the substrate.
In this embodiment, the oligonucleotides may be fluorescently
labelled.
[0046] Generally, the number of probes will be at least ten for
each species of nucleic acid to be detected or quantified. The
number of course refers to the number of different probes, rather
than the absolute number of molecules of the probe. Accordingly,
the nucleic acid will contain at least ten different specific
target sequences, and the cumulative signal is a combination of
individual signals of at least ten unique probes, this cumulative
signal representing the one species of nucleic acid. High levels of
multiplex can be used to obtain correspondingly high levels of
signal amplification. For example, at least 100, at least 1,000, at
least 10,000 or even greater numbers of probes may be used for each
species of nucleic acid to be detected or quantified.
[0047] As noted, a variety of probe designs are suitable for use in
the present method. Probes that generate ligation products
following correct hybridisation to their target sequences
include:
[0048] a) Padlock probes, where the probe circularises by
hybridising to the target sequence, and a circle of probe nucleic
acid is generated by ligation. Padlock probes are described in U.S.
Pat. No. 5,854,033 (Lizardi), WO99/49079 (Landegren) and U.S. Pat.
No. 5,871,921 (Landegren & Kwiatkowski). A version of the
padlock probe known as the inversion probe is described in U.S.
Pat. No. 6,858,412 (Willis et al.). Inversion probes are padlock
probes containing a cleavage site in the probe backbone, allowing
the circularised probe to be cleaved to form a linear product,
which may then be amplified and detected.
[0049] b) Tandem probes, which circularise together with a bridging
oligonucleotide on binding to the target sequence. The target
sequence templates ligation of two probe sequences with a bridging
oligonucleotide between them. The two probe sequences are then
ligated to form a circle. Probes of this type are described in
US2013/0172212 (Ariosa). Tandem probes are similar to the padlock
probes but circularise the probe in a separate step after ligation
instead of during ligation.
[0050] c) Target circularising probes. In probes of this type, a
target sequence fragment is circularised by a template
oligonucleotide. Ends of the target sequence can be ligated
together, optionally with an intervening sequence between them.
Target circularising probes are described in WO2008/033442
(Stanford). EP1997909 (derived from WO99/49079) describes a probe
having two adjacent sequences complementary to a defined 5' target
sequence and a defined 3' target sequence, so that hybridisation of
the target fragment to the probe brings the target ends together to
template ligation of the target ends to circularise the target
nucleic acid.
[0051] d) Selector probes, which are double stranded selector
constructs having one or two protruding ends complementary to ends
of the target sequence, which hybridise to the target sequence and
are ligated to each end of the target sequence, forming a circular
or linear ligation product containing probe nucleic acid and the
target sequence. A variety of selector probes are known. Selectors
are described for example in WO2005/111236 (Dahl); WO2011/009941
(Olink Genomics); WO2011/087378 (Olink Genomics) and WO2008/153492
(Agilent).
[0052] e) OLA (oligonucleotide ligation assay) probes. These probes
have been described for use in SNP genotyping. Each probe comprises
a pair of oligonucleotides which hybridise to adjacent regions of a
target sequence so that a 5' end of one oligonucleotide anneals
adjacent to a 3' end of the other nucleotide and the ends are then
ligated. Versions of OLA probe approaches include upstream gap fill
polymerisation (golden gate assay) or gap fill by ligation of an
additional oligonucleotide in between the two flanking probes
(DANSR assay). The golden gate assay was described in Fan, J. B. et
al. Highly parallel SNP genotyping. Cold Spring Harb. Symp. Quant.
Biol. 68, 69-78 (2003). The DANSR assay was described in A. B.
Sparks, E. T. Wang, C. A. Struble et al, Selective analysis of
cell-free DNA in maternal blood for evaluation of fetal trisomy,
Prenat Diagn (2012).
[0053] In general, desirable probes for use in the present method
are probes that hybridise to the target sequence and generate a
ligation product, where the generation of the ligation product is
dependent on the specific hybridisation of the probe to its target
sequence. This includes all the example probes listed above.
Preferably, the ligation product is a product of double ligation
(e.g. selector probes and tandem probes). Preferably, the ligation
product includes the target sequence itself--for example where the
target sequence is a fragment of the nucleic acid species, the
fragment itself is ligated to the probe and so incorporated into
the ligation product. This allows the target sequence to be
verified by sequencing the product. A ligation product may be
circular or linear nucleic acid, but there are certain advantages
with a circular product (e.g. using padlock probes, selector probes
or target circularising probes) such as the ability to clonally
amplify and detect the products of rolling circle replication.
[0054] In some cases, therefore, probes used in the present method
will have one or more of the above features.
[0055] Described herein is a new design of probe which is ideal for
use in the methods of the present method. The probes have an
especially desirable combination of features, including (in various
embodiments) all of the above attributes. These novel probes
comprise
[0056] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0057] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream and downstream flanking sequences respectively.
[0058] Under conditions for annealing arid ligation, the head and
tail sequences hybridise to the flanking sequences, and the target
fragment, if present, hybridises to the target-complementary
sequence, thereby positioning the ends of the target fragment in
juxtaposition with the 5' end of the head sequence and the 3' end
of the tail sequence. The 5' end of the head sequence and the 3'
end of the target fragment hybridise to adjacent nucleotides of the
targeting oligonucleotide, and the 3' end of the tail sequence and
the 5' end of the target fragment hybridise to adjacent nucleotides
of the targeting oligonucleotide. If the target fragment is
present, the 3' end of the target fragment is ligated to the 5' end
of the head sequence to form a first ligation junction, and the 5'
end of the target fragment is ligated to the 3' end of the tail
sequence to form a second ligation junction, producing a product of
double ligation comprising a continuous strand of nucleic acid
comprising the head and tail sequences and the target fragment.
[0059] The product of double ligation may be circular or linear,
according to the specific probe design, which is elaborated
elsewhere herein.
[0060] Provided herein is method of sample analysis. In certain
embodiments, the method comprises: a) hybridizing a sample
comprising fragmented DNA (e.g., a sample that has been digested by
a restriction enzyme) with a probe mix comprising a first set of
probes, wherein the probes of the first set of probes hybridize to
different sites (i.e., different sequences) in a first chromosome
and form non-covalently circular products containing ligatably
adjacent junctions when hybridized to DNA fragments from the first
chromosome. In this context, the term "ligatably adjacent" is
intended to mean that there are no intervening nucleotides between
two oligonucleotides and they can be ligated to one another using a
ligase. Examples of such probes are described in greater detail
above and below. Examples of such probes are illustrated by example
in FIGS. 3 and 4. Next, as shown in FIG. 2, the method comprises:
b) ligating the ligatably adjacent junctions together to produce a
plurality of covalently circular ligation products. As such, the
next step of the method comprises: c) amplifying the covalently
circular ligation products by rolling circle amplification (RCA) to
produce a plurality of RCA product molecules. The RCA products can
then be labelled and quantified, thereby, thereby providing an
estimate of the amount of DNA corresponding to the first chromosome
in the sample. Circularlized products provide a significant
advantage for detection because they can be amplified by rolling
circle amplification (RCA). RCA produces hundreds or thousands of
copies of a circularized product in a single molecule, thereby
effectively amplifying the circularized product and making it
relatively easy to detect them individually using, e.g., labelled
oligonucleotides that hybridize to a motif in the product.
Quantifying signals from individual RCA products is significant
because, in many applications (e.g., non-invasive pre-natal
diagnosis by analysis of cell free DNA), the number of fragments
corresponding to particular chromosomes (e.g., chromosome 21) needs
to be determined quite accurately and without bias. Typical
analysis methods use PCR which, as is well known, is a very biased
procedure in that some sequences are amplified much higher
efficiencies than others. This makes PCR-based strategies
impractical for many diagnostic efforts.
[0061] FIG. 8 illustrates how the rolling circle amplification
products can be quantified. In this method, the quantifying step
may be done by separating individual rolling circle amplification
product molecules produced in step c) from one another, and
counting the number of individual rolling circle amplification
product molecules in a defined area or volume. As shown in FIG. 8,
the circularized products 22 (composed circularized products 22a,
22b, 22c and 22d) that comprise target sequence X and flanking
sequences A and B are amplified by primer 52 to produce a set of
RCA products. The RCA products are then distributed on the surface,
and the number of RCA products can be directly counted by
microscopy, where the term "distributing" is intended to mean that
the RCA products are deposited on the surface of a planar
substrate, and allowed to spread out. The RCA products do not need
to be bound to the substrate, but they can be in certain cases
(e.g., via biotin or the like).
[0062] In these embodiments, the quantifying step may be done by:
i. hybridizing a labelled oligonucleotide to the RCA product
molecules, wherein the labelled oligonucleotide hybridizes to a
sequence that is repeated in the RCA product, thereby producing a
plurality of complexes that each comprise a single RCA product and
a plurality of labelled oligonucleotides that are hybridized to the
RCA product; and ii. counting the number of labelled complexes in a
defined area on the surface of the substrate. As shown in FIG. 2,
at the point of detection, an RCA product is part of a complex
containing the RCA product itself, a single circularized product,
and a plurality of labelled oligonucleotides that hybridize to a
sequence that is repeated in the RCA product.
[0063] As would be recognized, the RCA products can be labelled
before or after they are distributed on the substrate. As such, in
these embodiments, the quantifying step may be done by: (a)
obtaining a substrate comprising the labeled complexes distributed
on the surface of the substrate; and (b) counting the number of RCA
products that are present in the first area of the substrate. The
method may be multiplexed so that other cyclic products can be
quantified at the same time. For example, the sets of probes used
in the method may contain distinguishable sequence (for example,
chromosome 21 probes may contain a first sequence and chromosome 18
probes may contain a second sequence), and the different sets of
RCA products made as a result of circularization of those probes
can be distinguished using distinguishably labelled
oligonucleotides that hybridize to the first and second
sequences.
[0064] In these embodiments, the method may comprise: (a) obtaining
a substrate comprising a first and second pluralities of complexes
distributed on the surface of the substrate, wherein each of the
complexes comprises a single RCA product and a plurality of
labelled oligonucleotide probes that are hybridized to the RCA
product, the first and second pluralities of complexes are
distinguishably labelled, and the first and second pluralities of
complexes correspond to different chromosomes; and (b) counting the
number of the first plurality of RCA products and, independently,
counting the number of the second plurality of RCA products, that
are present in the first area of the substrate. In this embodiment,
the oligonucleotides may be fluorescently labeled. Suitable
distinguishable fluorescent label pairs useful in the subject
methods include Cy-3 and Cy-5 (Arnersharn Inc., Piscataway, N.J.),
Quasar 570 and Quasar 670 (Biosearch Technology, Novato Calif.),
Alexafluor555 and Alexafluor647 (Molecular Probes, Eugene, Oreg.),
BODIPY V-1002 and BODIPY V1005 (Molecular Probes, Eugene, Oreg.),
POPO-3 and TOTO-3 (Molecular Probes, Eugene, Oreg.), and POPRO3
TOPRO3 (Molecular Probes, Eugene, Oreg.). Further suitable
distinguishable detectable labels may be found in Kricka et al.
(Ann Clin Biochem. 39:114-29, 2002).
[0065] In some embodiments, the sample may contain fragments of
genomic DNA, e.g., genomic DNA from virtually any organism,
including, but not limited to, plants, animals (e.g., reptiles,
mammals, insects, worms, fish, etc.), tissue samples, bacteria,
fungi (e.g., yeast), phage, viruses, cadaveric tissue,
archaeological/ancient samples, etc. In certain embodiments, the
genomic DNA used in the method may be derived from a mammal, where
in certain embodiments the mammal is a human. In exemplary
embodiments, the genomic sample may contain genomic DNA from a
mammalian cell, such as, a human, mouse, rat, or monkey cell. The
sample may be made from cultured cells or cells of a clinical
sample, e.g., a tissue biopsy, scrape or lavage or cells of a
forensic sample (i.e., cells of a sample collected at a crime
scene). In particular embodiments, the nucleic acid sample may be
obtained from a biological sample such as cells, tissues, bodily
fluids, and stool. Bodily fluids of interest include but are not
limited to, blood, serum, plasma, saliva, mucous, phlegm, cerebral
spinal fluid, pleural fluid, tears, lactal duct fluid, lymph,
sputum, cerebrospinal fluid, synovial fluid, urine, amniotic fluid,
and semen. In particular embodiments, a sample may be obtained from
a subject, e.g., a human. In some embodiments, the sample analyzed
may be a sample of cell-free DNA obtained from blood, e.g., from
the blood of a pregnant female. In certain embodiments, the genomic
DNA may be amplified, e.g., using a whole genome amplification
method, prior to fragmentation. The sample may contain microbial
DNA, e.g., DNA from the genorne of a virus or bacteria.
[0066] In any embodiment, the probe mix may comprises a second set
of probes, wherein the probes of the second set of probes hybridize
to different sites in a second chromosome and form non-covalently
circular products containing ligatably adjacent junctions when
hybridized to DNA fragments from the second chromosome. In this
method, the quantifying step may comprise separately quantifying
the number of rolling circle amplification product molecules that
correspond to the first and second chromosomes, thereby providing
an estimate of the relative amount of DNA corresponding to the
first and second chromosomes in the sample. As noted above, the RCA
products corresponding to the first and second chromosomes can be
separately quantified by hybridizing distinguishably labelled
oligonucleotides to them and distributing them on the surface of a
support, e.g., a microscope slide.
[0067] The method may be used to examine sub-chromosomal regions,
too. In these embodiments, the first set of probes may hybridize to
different sites in a first region of a chromosome. In these
embodiments, the probe mix may comprises a second set of probes,
wherein the probes of the second set of probes hybridize to
different sites in a second region in the first chromosome and form
non-covalently circular products containing ligatably adjacent
junctions when hybridized to DNA fragments from the second
chromosome. In this method, the quantifying step may comprise
comprise separately quantifying the number of rolling circle
amplification product molecules that correspond to the first and
second regions of the first chromosomes, thereby providing an
estimate of the relative amount of DNA corresponding to the first
and second regions of a chromosome in the sample. As noted above,
the RCA products corresponding to the first and second chromosomes
can be separately quantified by hybridizing distinguishably
labelled oligonucleotides to them and distributing them on the
surface of a support, e.g., a microscope slide.
[0068] For non-invasive pre-natal testing embodiments, the target
fragment may be from human chromosome 21, 13 or 18, for example,
although other chromosomal abnormalities (e.g., other trimosomies,
or deletions or insertions of a particular region) can be examined.
Copy-number variations are alterations of genomic DNA that
correspond to relatively large regions of the genome that have been
deleted or amplified on certain chromosomes. CNVs can be caused by
genomic rearrangements such as deletions, duplications, inversions,
and translocations. Copy number variation has been associated with
various forms of cancer (Cappuzzo F, Hirsch, et al. (2005) 97 (9):
643-655) neurological disorders (Sebat, J., et al. (2007) Science
316 (5823): 445-9, including autism (Sebat, J., et al. (2007)
Science 316 (5823): 445-9), and schizophrenia St Clair D (2008).
Schizophr Bull 35 (1): 9-12. Detection of copy number variants of a
chromosome of interest or a portion thereof in a specific cell
population can be a powerful tool to identify genetic diagnostic or
prognostic indicators of a disease or disorder. In some
embodiments, the first chromosome is chromosome 21 and the second
chromosome is selected from chromosome 13 and chromosome 18.
[0069] In any embodiment, each of the non-covalently circular
products comprises a fragment of DNA from the sample. In the
implementations shown in FIGS. 3 and 4, the probes used in the
method may comprise: i. a head sequence and a tail sequence,
wherein the head and tail sequences are at the ends of a first
oligonucleotide molecule; and ii. a splint sequence comprising, in
order: an upstream flanking sequence that is complementary to the
head sequence; a target complementary sequence that is
complementary to a target fragment; and a downstream flanking
sequence that is complementary to the tail sequence. In these
embodiments, in the non-covalently circular products, the ends of
the target fragment are ligatably adjacent to the ends of the head
and tail sequences in the first oligonucleotide molecule. In these
embodiments, the splint sequence may be in the first
oligonucleotide molecule. Alternatively, the splint sequence may be
in a second oligonucleotide molecule.
[0070] In some embodiments, the method comprises hybridizing the
sample with a set of at least 50 (e.g., at least 100, at least 200,
at least 500, at least 1,000, at least 2,000 or at least 5,000) of
said probes, wherein said probes target different fragments on the
same chromosome (e.g., human chromosome 21, 13 or 18), and wherein
the method results in a plurality of cyclic products that comprises
the target fragments. The number of cyclic products produced can be
quantified by, e.g., amplifying them using RCA and counting the
number of RCA products, as described above.
BRIEF DESCRIPTION OF THE DRAWINGS
[0071] The skilled artisan will understand that the drawings,
described below, are for illustration purposes only. The drawings
are not intended to limit the scope of the present teachings in any
way.
[0072] FIG. 1 schematically illustrates one embodiment of the
subject method in which a DNA target species of interest is
contacted with multiple labelled linear probes and the cumulative
signal from the bound labels is detected.
[0073] FIG. 2 schematically illustrates one embodiment of the
subject method in which a DNA target species of interest is
contacted with multiple circularising probes which are clonally
amplified by rolling circle amplification and the cumulative signal
of the amplified products is detected.
[0074] FIG. 3 shows a probe comprising a circularised backbone
oligonucleotide bound to its target fragment. The probe is
illustrated in two versions, A and B.
[0075] FIG. 4 shows a circularised single oligonucleotide probe
with bound target fragment.
[0076] FIG. 5 shows a circularised double looped probe composed of
a targeting oligonucleotide and a looped backbone oligonucleotide,
with bound target fragment.
[0077] FIG. 6 shows a linear looped probe composed of a targeting
oligonucleotide and a linear backbone oligonucleotide, with bound
target fragment.
[0078] FIG. 7 shows a linear probe comprising two backbone
oligonucleotides, with bound target fragment.
[0079] FIG. 8 shows a method by which RCA products can be
counted.
[0080] FIG. 9 is an image of a gel showing the specificity of the
method described herein.
[0081] FIG. 10 is a graph showing the precision of the method
described herein.
[0082] FIG. 11 panel A shows an image of labeled RCA products on
the surface of a slide; panel B shows how ratios of fragments from
different chromosomes can be accurately determined by counting
individual RCA products.
DETAILED DESCRIPTION
Multiplex Recognition of Target Sequences
[0083] The species of nucleic acid to be detected or quantified
includes multiple target sequences. These target sequences are
distinct from one another. They will therefore represent spatially
distinct locations on the nucleic acid, although they may be
overlapping. Target sequences within a given species of nucleic
acid may be overlapping, non-overlapping, or a there may be a
mixture of overlapping and non-overlapping target sequences.
Preferably the target sequences are non-overlapping. Effectively,
the set of target sequences for a species of nucleic acid represent
different epitopes for detection of the same species of nucleic
acid.
[0084] Usually there will be at least 10, at least 100, at least
1,000 or at least 10,000 distinct target sequences in the nucleic
acid, and each of these may be probed.
[0085] Suitable concentrations of probes may be determined based on
the concentration (or expected concentration) of the species of
nucleic acid in the sample. As illustrated in the Examples, probes
may be added to the sample at a concentration of 10 pM per probe.
Where a sample is contacted with multiple probes (e.g, a set of
probes), concentrations of the individual probes may be 10 pM.
Preferably, probes are used in excess of the expected concentration
of the nucleic acid species of interest to be detected or
quantified. Use of excess probe should ensure that all copies of
target sequences present in the sample are recognised. This
maximises the sensitivity of detection. Also, where methods involve
quantification, it ensures that the detection of the ligation
products or cumulative signal from a set of probes is proportional
to the quantity of target sequences in the sample.
[0086] Where one species of nucleic acid is to be quantified
relative to another, the target sequences are specific to the
species of nucleic acid, i.e., not found in the other species of
nucleic acid, and preferably not found in any other species of
nucleic acid that may be in the sample.
[0087] For many diagnostic and other applications, the species of
nucleic acid is a chromosome or chromosomal locus, e.g., a human
chromosome or chromosomal locus. Each target sequence fragment may
thus be specific to that one chromosome of an organism's genome. In
other words, it may be found only in one chromosome of the genorne
and not in other chromosomes of that genome. Commonly, the present
method will be used for analysis of the human genome, in which case
the target sequence may be a fragment specific to one human
chromosome, i.e., found in that chromosome and not in other human
chromosomes. For example, target sequences may he specific to
chromosome 21. The target sequences may be specific to one locus of
a chromosome. Accordingly, they may be found in that chromosomal
locus and not in other loci of the same chromosome or other
chromosomes of the same genome. For example, the target sequences
may be specific to one locus of a human chromosome.
[0088] A given species of nucleic acid in a sample may encompass
some variability, for example a sample may comprise chromosomes of
different individuals, such as nucleic acid obtained from maternal
blood which contains maternal DNA and foetal DNA. Here the species
of interest may be a particular chromosome, but it is convenient to
detect all copies of that chromosome whether of foetal or maternal
origin. Thus, a species of interest may be one chromosome or
chromosomal locus, and the target sequences are found in that
chromosome or locus in both maternal and foetal copies of the
chromosome or chromosomal locus.
[0089] The species of nucleic acid may be fragmented. The target
sequences may be sequences of fragments of the species of nucleic
acid, i.e., target fragments.
[0090] Preferably, the target sequences are fragments whose
sequence is pre-defined. The sequence of the entire fragment
including the ends may be known. Known fragments of pre-defined
sequence can be produced by specific, rather than random,
fragmentation of the species of nucleic acid. Specific
fragmentation methods include digestion with restriction enzymes,
PCR (e.g., multiplex PCR), and other methods of sequence directed
fragment end definition, including other enzymes, ribozymes, or a
combination of such techniques,
[0091] A preferred method of fragmentation is digestion with a
restriction endonuclease or a combination of two or more
restriction endonucleases. Thus, the sample may be a restriction
enzyme digest of nucleic acid and the target sequences may be
restriction fragments.
[0092] A variety of specific nucleic acid cleaving enzymes are
known and any suitable enzyme may be used in the present method,
including enzymes which cleave at a pre-defined position within a
specific nucleic acid sequence, or endonucleolytic enzymes which
cleave either after or before a specific nucleic acid recognition
sequence and nicking enzymes (side-cutting enzymes). Catalytic
nucleic acids, such as ribozymes, can be used as well for DNA
fragmentation. The enzymes may cleave double stranded nucleic acid
to produce a blunt end or a sticky end, or may cleave a single
strand of nucleic acid. Various types of restriction enzymes are
known, including Type I, Type II, Type III, Type IV and Type V.
Suitable enzymes or combinations of enzymes can be selected for use
in the present method as desired. For example, nucleic acid in a
sample (e.g. 10 ng of DNA) may be digested with restriction enzyme
(e.g. 1 U) in corresponding compatible restriction enzyme buffer.
The reaction may be incubated under suitable conditions (e.g.
37.degree. C. for 1 hour), followed by enzymatic deactivation (e.g.
at 80.degree. C. for 20 minutes).
[0093] Another convenient method of providing fragmented nucleic
acid is to use primers for amplification of specific linear
sequences from the species of nucleic acid. Multiplex PCR can be
used, treating the nucleic acid with multiple specific primer pairs
to amplify multiple specific fragments. In this case, the ends of
the target sequences correspond to the sequences of the pair of
primers.
[0094] Samples of nucleic acid may be provided in any suitable way,
for example as samples of biological tissue or fluid from patients.
Samples may be blood samples, whole blood, plasma, or serum, tissue
samples, e.g., formalin fixed paraffin embedded samples of tissue,
or may be samples of nucleic acid extracted from blood or
tissue.
[0095] The sample may be any sample that contains nucleic acid. The
nucleic acid contained in the sample may be DNA and/or RNA. The
sample may be complex, e.g. whole genomic DNA, or cDNA from a whole
organism, tissue or cell population, or a fraction thereof. In this
regard it may, for example, be a direct product of a nucleic acid
isolation procedure, or of a cell lysis procedure, or it may be
further be fractionated or purified in some way, e.g. it may
contain nucleic acids which have been partially or fully separated
in some way, or treated in any way, e.g. RNA to produce cDNA. The
sample may be from any eukaryotic or prokaryotic or viral source,
e.g. may be microbial (for example bacterial or fungal), plant, or
animal. Thus, for example, the species of nucleic acid to be
detected or quantified may be microbial DNA. Preferably the sample
is of human origin, e.g., human genomic DNA. The sample may be a
tissue or blood sample from an animal, where the nucleic acid to be
detected is microbial, e.g., bacterial, viral or fungal. For many
diagnostic and other applications, the sample is a sample of
fragmented chromosomes (e.g., human chromosomes or microbial
chromosomes). For methods relating to non-invasive prenatal
diagnostics, the sample is derived from the blood of a pregnant
woman and comprises foetal DNA. In other examples, the nucleic acid
to be detected or quantified is tumour associated DNA.
[0096] A given species of nucleic acid in a sample may encompass
some variability, for example a sample may comprise chromosomes of
different individuals, such as nucleic acid obtained from maternal
blood which contains maternal DNA and foetal DNA. Here the species
of interest may be a particular chromosome, but it is convenient to
detect all copies of that chromosome whether of foetal or maternal
origin. Thus, a species of interest may be one chromosome or
chromosomal locus, and the target fragments are obtained from that
chromosome or locus in both maternal and foetal copies of the
chromosome or chromosomal locus.
[0097] The present method may be performed on the samples in vitro.
Accordingly, the methods generally do not include diagnosis carried
out in vivo on the human or animal body or methods of treatment of
the human or animal body by surgery or therapy. Nevertheless, the
results of the in vitro diagnostic methods may be used to inform
the subsequent treatment of patients.
Denaturing the Target Nucleic Acid
[0098] The probe recognises and binds the target sequence in at
least partially single stranded form, through hybridisation. For
some designs of probe the target sequence should be fully single
stranded, particularly those which hybridise to the full length of
the target sequence. For other probes, e.g., those which hybridise
to only regions of the target sequence, only partially single
stranded target nucleic acid is required. Accordingly, suitable
conditions should be provided to expose the binding site of the
target sequence to the probe, depending on the type of probe
employed.
[0099] If the target sequence in the sample is not already single
stranded or at least partially single stranded, conditions should
be provided to separate the single stranded target sequence from
its complementary nucleic acid strand. Such conditions may be
denaturing conditions or, in some cases, treatment with
exonuclease.
[0100] The denaturing conditions may be a sufficiently high
temperature to separate the target sequence from its complementary
sequence. Denaturing conditions may be incubation at 95.degree. C.
for a suitable time, e.g. 10 minutes. Alternatively chemical
denaturation may be performed.
Complementarity and Hybridisation
[0101] Specific binding between the probe and its target sequence
is an important feature of the methods of the present method. A
probe preferably comprises a single target complementary sequence
which recognises the target sequence. However, as illustrated by
padlock probes and selector probes for example, probes may comprise
multiple sequences complementary to different regions of a target
sequence.
[0102] Maximum specificity for the target sequence is achieved if
the probe comprises a target complementary sequence which is the
exact complement of the target sequence or region of the target
sequence, so that there is perfect hybridisation between the probe
and the target sequence. However, this is not essential in all
cases, and a small degree of mismatching may be accepted, for
example to allow detection of sequences which exhibit allelic
variation where it is desired to detect the target sequence
regardless of the exact allele present in the sample.
Alternatively, multiple probes can be designed for variant
sequences. This can enable both detection and discrimination of
different alleles or mutations. It is envisaged that the majority
of probes will have perfect complementarity for their target
sequences but some probes may bind targets with minor
mismatches.
[0103] In some embodiments, the probes used in the present method
each comprise a target complementary sequence having fewer than 5
base pair mismatches with the target sequence or region of target
sequence. There may optionally be one, two, three or four base pair
mismatches between the target sequence or region and the target
complementary sequence. A mismatch may be a point at which a
corresponding base is absent from one sequence, so that the
complementary sequence forms a loop at the mismatched point, or may
occur where a non-complementary nucleotide is present in one
sequence and so does not pair with the base at the corresponding
position of the other sequence. Where there is an incorrect base
pairing, i.e., a pairing of A or T with C or G, hydrogen bonding
does not take place between the bases of the two strands, although
hybridisation will still take place between the target sequence and
the target complementary sequence of the targeting oligonucleotide
due to base-pairing between the nucleotides neighbouring the
mismatch. Mismatches may be wobble bases. A wobble base would
normally correspond to a position in the target complementary
sequence that pairs with a position of known genetic variation in
the target fragment. The probe may be synthesised by adding one or
several dideoxynucleotides during the specific synthesis cycle for
the wobble base position. This is typically the case for
traditional oiigonucieotide synthesis. Alternatively multiple
separate probes may be produced, one for each genetic variant. This
is typically the case if probes are synthesised using microarray
based synthesis. A wobble base may correspond to single nucleotide
differences between codons, where the different codons encode the
same amino acid.
[0104] In general, longer target complementary sequences for
hybridising longer target sequences or regions thereof may tolerate
a higher number of mismatches compared with shorter target
complementary sequences. The target complementary sequence may, for
example, have at most 1 in 8, 1 in 9 or 1 in 10 base pair
mismatches with the target sequence or region thereof. Any such
mismatches should be restricted to the internal region of the
target complementary sequence and target sequence or region, so
that they do not inhibit ligation or sequence specific target
fragmentation by e.g. restriction enzyme digestion. Accordingly,
preferably there is perfect complementarity between the target
sequence and the target complementary sequence in the terminal 6 to
8 nucleotides, preferably the terminal 10 nucleotides at each end
of the target sequence.
[0105] Preferably, a probe comprises a single target complementary
sequence which is the same length as the target sequence. The full
length of the target sequence is thus bound by the target
complementary sequence. Hybridisation of the target sequence to the
targeting oligonucleotide represents a single binding event between
the two nucleic acid molecules, contrasting with probes which bind
the two ends of a target molecule or to two non-adjacent regions of
the target.
[0106] The target complementary sequence may have a length of at
least 10 nucleotides, for example at least 15 nucleotides. It may
be up to 20, 25, 30, 35 or 40 nucleotides long. Preferred ranges
include 10-20 nucleotides, 10-30 nucleotides, and 10-40
nucleotides. Such relatively short target complementary sequences
are suitable for binding correspondingly short target sequences.
The short sequence contributes to the specificity of the double
ligation reaction, since DNA ligase is sensitive to base pair
mismatches and will preferentially ligate perfectly matched
sequences. Where mismatches are present in the footprint of DNA
ligase bound to the double stranded sequence, the sequences may not
be ligated, which provides an additional proofreading step ensuring
high specificity in detecting the target sequence in preference to
sequences of different but similar sequence. DNA ligase typically
has a footprint of 6 to 8 bases on each side of the nick.
Therefore, if the target sequence is 20 bases, 12 to 16 of the
bases will be covered by ligase specificity.
[0107] The probe hybridisation will discriminate against mismatches
especially in the central part of the hybridised sequence while the
ligation will discriminate against mismatches at the ends of the
target. Together this generates a highly specific detection.
[0108] As described in more detail elsewhere herein, a probe
preferably comprises:
[0109] a targeting oligonucleotide which is longer than the target
sequence and contains an internal target complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target sequence forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0110] head and tail sequences having tree 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream and downstream flanking sequences respectively.
[0111] These probes are particularly suitable for use where the
species of nucleic acid is fragmented and the target sequences are
fragments of defined sequence. The targeting oligonucieotide is
longer than the target sequence since it includes the flanking
sequences as well as the target complementary sequence. The
upstream flanking region is upstream of or 5' of the target
complementary sequence in the targeting oligonucleotide. The
downstream flanking region is downstream of or 3' of the target
complementary sequence in the targeting oligonucleotide.
Accordingly, the target complementary sequence is internal to the
targeting oligonucleotide and does not include an end of the
targeting oligonucleotide, since it is flanked by the upstream and
downstream flanking sequences.
[0112] The double stranded sequence produced by hybridisation of
the target sequence and the target-complementary sequence may be
considered a hybrid double stranded sequence, since it is a hybrid
of the target and the probe. Typically the double stranded sequence
adopts a double helical conformation, in which the target sequence
is one strand and the targeting oligonucleotide is the other strand
of the double helix. The hybrid double stranded sequence is flanked
by the upstream and downstream flanking sequences of the targeting
oligonucleotide, which in turn hybridise to the head and tail
sequences to produce double stranded sequences. Again, these
typically adopt the normal double helical conformation of double
stranded nucleic acid.
[0113] The upstream and downstream flanking sequences are
preferably different from each other, i.e., preferably have
different sequences. It is preferred that the head sequence is
complementary to the upstream flanking sequence but not to the
downstream flanking sequence, and that the tail sequence is
complementary to the downstream flanking sequence but not to the
upstream flanking sequence. This ensures that the head and tail
sequences hybridise only to the upstream and downstream flanking
sequences respectively.
[0114] The head sequence will usually be the same length as the
upstream flanking sequence. The tail sequence will usually be the
same length as the downstream flanking sequence.
[0115] Normal lengths for the flanking sequences are between 10 and
40 nucleotides, for example 10-20 or 10-30 nucleotides. The
flanking sequences may be the same length as each other. One or
both flanking sequences may be the same length as the
target-complementary sequence. The upstream and/or downstream
flanking sequence may thus have a length of at least 10
nucleotides, for example at least 15 nucleotides. It may be up to
20, 25, 30, 35 or 40 nucleotides long.
[0116] Preferably, the head sequence is the complement of the
upstream sequence. Preferably, the tail sequence is the complement
of the downstream sequence. Perfect matching of the sequences is
desirable for optimum binding of the probe so that the head and
tail sequences are correctly positioned for ligation to the target
sequence. Optionally, however, there may be one, two three or four
base pair mismatches between the head sequence and the upstream
flanking sequence, and/or between the tail sequence and the
downstream flanking sequence. Preferably, there are fewer than 5
base pair mismatches.
[0117] Other than the target complementary sequence, probes should
usually not be complementary to the target sequence or to other
nucleic acids that may be present in the sample. This is to avoid
unwanted hybridisation of the probe to nucleic acid other than the
target. Thus, if the probe is for binding a sequence of human
genomic DNA, the probe may be designed so that sequences other than
the target complementary sequence are not complementary to human
genomic DNA, so that the probe only hybridises to the target
sequence and not to other nucleic acid in the sample.
[0118] Probes may include one or more custom sequences. A custom
sequence is not complementary to other regions of the probe or to
the target sequence--in other words it does not hybridise to other
regions of the probe (outside the custom sequence) or to the target
sequence under annealing conditions. The custom sequences may be
used for detection, e.g. as barcodes or labels to identify probes
belonging to a set, as described elsewhere herein,
Generation of Ligation Products
[0119] Under conditions for annealing and ligation, probes
hybridise to eir target sequences and are ligated to generate
ligation products. Hybridisation of each probe results in
generation of a ligation product. Accordingly, generation of the
ligation product is dependent on the specific hybridisation of the
probe to its target sequence.
[0120] The ligation product may comprise or consist of probe
nucleic acid or target nucleic acid, or may comprise both probe and
target nucleic acid. The ligation product comprises a ligation
junction which is formed by the ligation of a 5' end of nucleic
acid to a 3' end of nucleic acid. Where multiple nucleic acids are
ligated together, there may be two ligation junctions.
[0121] The type of ligation product which is formed depends on the
type of probe used. Ligation products may be are circles of nucleic
acid or may be linear nucleic acid molecules.
[0122] An example of a probe which forms circular ligation product
is the padlock probe. Various types of padlock probe are known,
e.g. standard, gapf ill, molecular inversion probes (MIP). Padlock
probes are linear oligonucleotides with target complementary
sequences at the ends and a non-target complementary sequence in
between. Under the conditions for annealing and ligation, the
target complementary sequences are brought together head to tail to
hybridise to adjacent regions of the target sequence and are
ligated form a circle of nucleic acid. Thus, the probe circularises
by hybridising to the target sequence, and the ligation product is
a circle of probe nucleic acid. The circular ligation product
typically contains one ligation junction where the 5' and 3' ends
of the linear probe are ligated together. Variations including
bridging oligonucleotides and gap-fill probes are known. The probes
may contain a cleavage site in the probe backbone, allowing the
circularised ligation product to be cleaved to form a linear
product, which may then be amplified and detected (MIPs).
[0123] Preferably, hybridisation of the probe to the target
sequence positions an oligonucleotide ol the probe for ligation to
the target sequence. Accordingly, the target sequence may be
incorporated into the ligation product. This is an advantage over
probes such as padlock probes since it allows the target sequences
to be verified by sequencing the ligation products. Preferably, the
probe is ligated to each end of its target sequence, forming a
ligation junction at each end of the target sequence. In such
methods, the species of nucleic acid to be detected or quantified
will preferably be fragmented to produce target fragments
corresponding to the target sequences. Ends of the target fragment
can then be ligated to ends of the probe, capturing the target
sequence within the ligation product. In such cases, the target
fragment is ligated in a highly specific reaction at both ends.
Since the target fragment is typically the product of a specific
fragmentation of nucleic acid, these ends will usually have a
specific, pre-determined sequence. In the ligation step, these ends
are specifically detected by sequence-dependent ligation to the
head and tail sequences respectively. Preferably, binding of the
target fragment to the probe creates two perfectly matched
ligatable junctions, one between the 3' end or the target fragment
and the 5' end of the head sequence and one between the 5' end of
the target fragment and the 3' end of the tail sequence.
[0124] Ligation of a 5' end of nucleic acid to a 3' end of nucleic
acid can occur when the two ends are base paired to adjacent
nucleotides of a complementary sequence. Base pairing of the
respective end nucleotides to the adjacent nucleotides forms a
nucleic acid strand containing a nick between the two ends.
Ligation of the two ends can be catalysed by DNA ligase. Providing
conditions for ligation will therefore usually comprise providing a
DNA ligase enzyme and reaction conditions under which the DNA
ligase ligates the two ends to form a continuous nucleic acid
strand, closing the nick. A number of ligase enzymes are
commercially available, such as Ampligase (Epicentre), for which
suitable conditions are to add 1 U enzyme and incubate at
55.degree. C. for 1 hour in ligase buffer.
[0125] An examples of a probe which generates a ligation product
incorporating the target sequence is the selector probe. These
probes are double stranded selector constructs having one or two
protruding ends complementary to ends of the target sequence, which
hybridise to the target sequence and are ligated to each end of the
target sequence, forming a circular or linear ligation product
containing probe nucleic acid and the target sequence. Under the
conditions for annealing and ligation, the end sequences of the
selectors hybridise to the end sequences of the fragments and are
ligated to the selectors. Where a probe comprises a pair of
selector constructs each having a protruding end, each may be
ligated to one end of a target fragment so that the ligation
product is a linear nucleic acid comprising the target sequence
between two probe sequences. Where a probe comprises a single
selector construct having two protruding ends, it may be ligated to
each end of the target fragment so that the ligation product is a
circular nucleic acid comprising the target sequence and probe
nucleic acid. In both cases, the ligation product includes two
ligation junctions.
[0126] Numerous other examples of suitable probes are described
elsewhere herein.
[0127] In some embodiments, the present method may use probes which
comprise:
[0128] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0129] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream arid downstream flanking sequences respectively,
wherein
[0130] under the conditions for annealing and ligation, the head
and tail sequences hybridise to the flanking sequences, and the
target fragment, if present, hybridises to the target-complementary
sequence, thereby positioning the ends of the target fragment in
juxtaposition with the 5' end of the head sequence and the 3' end
of the tail sequence, wherein the 3' end of the target fragment is
ligated to the 5' end of the head sequence to form a first ligation
junction, and the 5' end of the target fragment is ligated to the
3' end of the tail sequence to form a second ligation junction,
producing a product of double ligation comprising a continuous
strand of nucleic acid comprising the head and tail sequences and
the target fragment.
[0131] In these probes, the targeting oligonucleotide templates the
target fragment for ligation to the head and tail sequences, due to
the location of the target-complementary sequence between the
flanking sequences. Under annealing conditions in the presence of
the target fragment, the head and tail sequences hybridise to the
flanking sequences, defining a gap between the 5' end of the head
sequence and the 3' end of the tail sequence. The target fragment
hybridises to the target-complementary sequence in the gap. Thus,
hybridisation of the head and tail sequences and the target
fragment to the targeting oligonucleotide positions the 3' end of
the target fragment in juxtaposition with the 5' end of the head
sequence, and positions the 5' end of the target fragment in
juxtaposition with the 3' end of the tail sequence.
[0132] Positioning of two ends in juxtaposition provides a
substrate for DNA ligase to ligate the ends together. It is
preferable that the 5' end of the head sequence and the 3' end of
the target fragment hybridise to adjacent nucleotides of the
targeting oligonucleotide, and the 3' end of the tail sequence and
the 5' end of the target fragment hybridise to adjacent nucleotides
of the targeting oligonucleotide. Accordingly, the upstream
flanking sequence may be immediately adjacent to the
target-complementary sequence, with no intervening nucleotides.
Similarly, the downstream flanking sequence may be immediately
adjacent to the target-complementary sequence, with no intervening
nucleotides. Adjacent 3' and 5' ends can be directly ligated by DNA
ligase sealing the nick between them to form a continuous nucleic
acid strand.
[0133] The product of the double ligation, i.e., the product of
ligating both the head sequence and the tail sequence to the target
fragment, is a continuous strand of nucleic acid. It is continuous
in the sense that it contains no nicks or gaps, so all nucleotides
in the strand are covalently joined.
[0134] The probe may be designed so that the continuous strand of
nucleic acid comprising the head and tail sequences and the target
fragment is a circle of nucleic acid. The term circle here refers
to the topology of the strand being a closed loop, with no free
end.
[0135] Under annealing conditions in the presence of the target
fragment, the head and tail sequences hybridise to the flanking
sequences, defining a gap between the 5' end of the head sequence
and the 3' end of the tail sequence. The target fragment hybridises
to the target-complementary sequence in the gap, thereby
positioning the ends of the target fragment in juxtaposition with
the 5' end of the head sequence and the 3' end of the tail
sequences, and completing a circle of nucleic acid which comprises
the target fragment and the head and tail sequences.
[0136] The nucleic acid molecules which form the circle have their
ends in juxtaposition. Ligation of the ends produces the continuous
circular strand of nucleic acid comprising at least the head and
tail sequences and the target fragment.
[0137] Probes which form a circle of nucleic acid include probes in
which the head and tail sequences are provided on a single nucleic
acid molecule. For example, in addition to the targeting
oligonucleotide the probe may comprise a backbone oligonucleotide
having the head and tail sequences at its 5' end 3' ends
respectively, wherein the head and tail sequences of the backbone
oligonucleotide bind in trans to the flanking sequences of the
targeting oligonucleotide under the annealing conditions. The
backbone oligonucleotide may comprise a custom sequence between the
head and tail sequences. FIG. 3 illustrates embodiments of such
probes. Alternatively, the head and tail sequences of the backbone
oligonucleotide may be adjacent, with no custom sequence between
them.
[0138] In another example, the head and tail sequences may be at
ends of the targeting oligonucleotide and bind in cis to the
flanking sequences under the annealing conditions. The targeting
oligonucleotide may comprise a custom sequence between the
targeting oligonucleotide and the head and/or tail sequence. FIG. 4
illustrates an embodiment of such a probe.
[0139] Probes which form a circle of nucleic acid also include
probes in which the head and tail sequences are provided on
different nucleic acid molecules. In such cases, the circle of
nucleic acid which forms under the annealing conditions will
comprise at least three nucleic acid molecules--the target
fragment, the head sequence and the tail sequence. The ends of the
nucleic acid molecules will all be in juxtaposition, as previously
noted. More than two ligation reactions are required to form the
continuous circular strand of nucleic acid in such cases. An
example is where the tail sequence is the 3' end of the targeting
oligonucleotide, and the probe comprises a backbone oligonucleotide
having the head sequence at its 5' end. Under the annealing
conditions the tail sequence binds in cis to the downstream
flanking sequence of the targeting oligonucleotide, and the head
sequence of the backbone oligonucleotide binds in trans to the
upstream flanking sequence of the targeting oligonucleotide.
Binding in cis means that the binding takes place on the same
nucleic acid molecule, i.e., a single strand of nucleic acid forms
a three dimensional structure in which different regions are
brought together and hybridise. Binding in trans means that the
binding takes place between different nucleic acid molecules.
Optionally, the backbone oligonucleotide comprises a pair of
inverted repeat sequences which form a hairpin structure under
annealing conditions, thereby positioning the 3' end of the
backbone oligonucleotide in juxtaposition with the 5' end of the
targeting oligonucleotide. There is a nick between the two ends. A
probe of this type is illustrated in FIG. 5. When conditions for
ligation are provided, the 5' end of the targeting oligonucleotide
is ligated to the 3' end of the backbone oligonucleotide. The
product of double ligation is a circle of nucleic acid comprising
the targeting oligonucleotide, the target fragment and the backbone
oligonucleotide. Alternatively, where there is a gap between the 5'
end of the targeting oligonucleotide and the 3' end of the backbone
oligonucleotide, the probe shown in FIG. 5 will not be circularised
by ligation--instead the continuous strand of nucleic acid
comprising the head and tail sequences and the target fragment is a
linear strand of nucleic acid.
[0140] The probe may alternatively be arranged in the opposite
orientation so that the head sequence is at the 5' end of the
targeting oligonucleotide and the probe comprises a backbone
oligonucleotide having the tail sequence at its 3' end. In this
case, under the annealing conditions the head sequence binds in cis
to the upstream flanking sequence of the targeting oligonucleotide,
and the tail sequence of the backbone oligonucleotide binds in
trans to the downstream flanking sequence of the targeting
oligonucleotide. Again, the backbone oligonucleotide may comprise a
pair of inverted repeat sequences which form a hairpin structure
under annealing conditions to position the 5' end of the backbone
oligonucleotide in juxtaposition with the 3' end of the targeting
oligonucleotide. The 3' end of the targeting oligonucleotide is
then ligated to the 5' end of the backbone oligonucleotide so that
the product of double ligation is a circle of nucleic acid
comprising the targeting oligonucleotide, the target fragment and
the backbone oligonucleotide. Alternatively, as noted above, the
annealing may position the 5' end of the backbone oligonucleotide
near the 3' end of the targeting oligonucleotide but separated by a
gap of one or more nucleotides. The ligated product will then be a
continuous linear strand of nucleic acid comprising the head and
tail sequences and the target fragment.
[0141] The backbone oligonucleotide may comprise a custom sequence
between the inverted repeat sequence, so that under the annealing
conditions the backbone oligonucleotide forms a hairpin loop, as
illustrated in FIG. 5.
[0142] As noted, probes may be designed so that the continuous
strand of nucleic acid comprising the head and tail sequences and
the target fragment is a linear strand of nucleic acid. Under
annealing conditions in the presence of the target fragment, the
head and tail sequences hybridise to the flanking sequences,
defining a gap between the 5' end of the head sequence and the 3'
end of the tail sequence. The target iragment hybridises to the
target-complementary sequence in the gap, thereby positioning the
ends of the target fragment in juxtaposition with the 5' end of the
head sequence and the 3' end of the tail sequences, and completing
a strand of nucleic acid which comprises the target fragment and
the head and tail sequences. The nucleic acid molecules which form
the strand have their ends in juxtaposition. The term juxtaposition
has been discussed elsewhere. There is a nick between the ends to
be ligated. Ligation of the ends produces the continuous strand of
nucleic acid comprising at least the head and tail sequences and
the target fragment.
[0143] The probe may comprise a targeting oligonucleotide having
the tail sequence at its 3' end and a linear backbone
oligonucleotide having the head sequence at its 5' end. Under
annealing conditions, the tail sequence binds in cis to the
downstream flanking sequence of the targeting oligonucleotide, and
the head sequence of the backbone oligonucleotide binds in trans to
the upstream flanking sequence of the targeting oligonucleotide.
The targeting oligonucleotide may comprise a custom sequence
between the downstream flanking sequence and the tail sequence, so
that under the annealing conditions the targeting oligonucleotide
forms a hairpin loop. The linear strand of nucleic acid formed
under annealing conditions comprises the backbone oligonucleotide,
the target fragment and the targeting oligonucleotide. FIG. 6
illustrates this arrangement.
[0144] The probe may equally be arranged in the reverse
orientation, where the head sequence is at the 5' end of the
targeting oligonucleotide, and the probe comprises a backbone
oligonucleotide having the tail sequence at its 3' end. In this
case the head sequence binds in cis to the upstream flanking
sequence of the targeting oligonucleotide and the tail sequence of
the backbone oligonucleotide binds in trans to the downstream
flanking sequence of the targeting oligonucleotide.
[0145] Another form of probe which forms a linear nucleic acid
strand as the product of ligation is a probe comprising the head
and tail sequences on separate backbone oligonucleotides. Such a
probe may comprise a backbone oligonucleotide comprising a head
sequence having a free 5' end, and a backbone oligonucleotide
comprising a tail sequence having a free 3' end, wherein under the
annealing conditions the head and tail sequences bind in trans to
the flanking sequences of the targeting oligonucleotide. One or
both backbone oligonucleotides may further comprise a custom
sequence. FIG. 7 illustrates probes of this type.
[0146] Preferably, the oligonucleotides of the probe in its
unligated form are linear. So, preferably the targeting
oligonucleotide is a linear nucleic acid molecule. For probes
including one or more backbone oligonucleotides, these are also
preferably linear. This allows convenient differentiation between
ligated and unligated probes where a circle of DNA is formed only
as a result of successful ligation of the circularising embodiments
of the probe. Linear nucleic acid molecules are not amplified by
rolling circle replication.
Amplification of Products
[0147] Signal detection in the present method depends on signals
being generated by or from correctly reacted probes following
target recognition, using sequence specific hybridisation and
enzymatic catalysis to generate specific products from which the
signal is obtained. The present method uses detection of multiple
loci on a nucleic acid species of interest target molecule as a
signal amplification step, and therefore enables signal generation
and detection without requiring amplification of the products of
the reacted probes. Signals may be obtained and a cumulative signal
may be detected without amplifying the ligation products.
Optionally, however, the signal from the multiplex products may be
amplified by traditional signal amplification steps.
[0148] A method may include enriching the ligation products before
detection. Products may be enriched by amplification and/or by
solid phase chemistry. Circular nucleic acid products may be
selectively enriched by treating the sample with exonuclease (e.g.,
Lambda exonuclease) to digest linear nucleic acid products. In
general, exonuclease degradation may be used to enrich for ligation
products when the ligation products are protected from exonuclease
degradation. Exonuclease should then be deactivated (e.g. by heat)
before any subsequent step involving polymerisation, e.g. before
rolling circle amplification. As illustrated in Example 2, 1 U
Exonuclease may be added to remove non-reacted probes and
fragments. Suitable conditions are incubation at 37.degree. C. for
1 hour in corresponding exonuclease buffer, followed by enzyme
inactivation at 80.degree. C. for 20 minutes. Where capture/detect
methods are used, ligation products may be enriched by capturing
the products on a solid phase via the capture moiety. As
illustrated in Example 1, a solution containing linear ligation
products may be mixed with 10 ml M-280 streptavidin coated magnetic
beads (lnvitrogen) in Tris-HCl (pH 7.5), 3.5 mM EDTA and 0.07%
Tween-20 in a final volume of 200 ml, and incubated at room
temperature for 15 minutes. After incubation, the beads are
collected using a ring magnet and supenatant is removed. Other ways
of enriching for ligation products include specifically
size-selecting ligation products.
[0149] Ligation products may be amplified by clonal amplification.
Suitable amplification techniques include rolling circle
amplification (see below), bridge PCR (Adessi C, et al., Nucleic
Acids Res. 2000 Oct. 15; 28(20):E87), emulsion PCR (digital PCR in
emulsions was described by Dressman et al., Proc Natl Acad Sci USA.
2003 Jul. 22; 100(15):8817-22. Epub 2003 Jul. 11) and digital PCR
(Vogelstein & Kinzler, Proc Natl Acad Sci USA. 1999 Aug. 3;
96(16):9236-41). Clonal localised amplification in gels was
described by Mitra & Church, Nucleic Acids Res. 1999 Dec. 15;
27(24): e34. An embodiment of the present method may comprise
amplifying the ligation products and obtaining a cumulative signal
which is a combination of individual signals from the amplified
products. Preferably, ligation products are amplified across the
ligation junction or, for products of double ligation, across both
ligation junctions.
[0150] Where the ligation products are circles of nucleic acid,
amplification may comprise providing conditions for rolling circle
replication of the circles of nucleic acid and detecting the
products of rolling circle replication. Rolling circle replication
was described in U.S. Pat. No. 5,854,033 (Lizardi) and Fire &
Xu, Proc Natl Acad Sci USA. 1995 May 9; 92(10):4641 -5. Rolling
circle replication is an amplification of a circular nucleic acid
molecule using a strand displacing DNA polymerase, resulting in
large DNA molecules containing tandem repeats of the amplified
sequence. The DNA polymerase catalyses primer extension and strand
displacement in a processive rolling circle polymerisation reaction
that proceeds as long as desired. It results in an amplification of
the circularised probe sequence orders of magnitude higher than a
single cycle of FOR replication and other amplification techniques
in which each cycle is limited to a doubling of the number of
copies of a target sequence. Additional amplification can be
obtained using a cascade of strand displacement reactions. Rolling
circle replication may be hyper branched rolling circle
replication. Hyperbranched RCA was described by Lizardi et al., Nat
Genet. 1998 July; 19(3):225-32. Conditions for rolling circle
replication are illustrated in the Examples, for example incubation
with 1 U of phi29 polymerase (New England Biolabs) can be added in
corresponding phi29 buffer and nucleotides (dNTPs) at 37.degree. C.
for 1 hour.
Detection
[0151] Ligation products may be individually detectable, so that an
individual signal is obtainable from the ligation products
resulting from recognition of each target sequence by its
corresponding probe. However, in the present method, the ligation
products need not be individually detected. Individual signals from
the ligation products are merged into a cumulative signal and the
cumulative signal is detected.
[0152] The type of signal and the method of detection can be
suitably chosen based upon the type of probe, or the probe may be
designed to enable a desired signal type and detection method. The
method is not limited to particular types of signal or signal
detection means--rather, the method can be performed by any method
of converting individual signals from the plurality of probes into
a single cumulative detectable signal, thereby amplifying the
individual signals through the multiplex nature of the probing
step.
[0153] In general, detection of signals from ligation products is
dependent on formation of each product following binding of the
probe to its target sequence, thus indicating if the target
sequence was present in the sample. Signals may thus be
specifically obtained from products that include a ligation
junction or, for products of double ligation, both ligation
junctions. Individual signals may be obtainable from each ligation
junction, formed as a result of probe hybridisation to each target
sequence. So, for example, where a set of probes comprises 10
different probes that recognise 10 target sequences of the species
of interest, there will be 10 ligation products including ligation
junctions, and a cumulative signal may be detected, which is the
combination of individual signals from the 10 ligation products. Of
course, in this example the actual number of molecules probes,
target sequences and ligation products may be higher than 10
because there will usually be multiple copies of each target
sequence in a sample and the sample will be contacted with multiple
copies of each probe.
[0154] Ligation products generated by probes of a set may produce
individual signals characteristic of that set, and which differ
from signals obtained from ligation products generated by probes of
a different set, allowing the cumulative signals from each set of
probes to be distinguished and separately quantilied. For example,
probes within a set can share a custom sequence which is common to
that set and differs from the custom sequences of probes in other
sets, allowing the probes from each set to be conveniently
identified. Each set of probes may contain at least 500, 600, 700,
800, 900 or at least 1,000 different probes for binding a plurality
of target sequences specific to the species of nucleic acid. For
example, a method may use 1,000 different targeting
oligonucleotides to each of chromosomes 21, 13 and 18,
respectively, and three different sets of probes, each set labelled
with a unique custom sequence, one for each chromosome. If desired,
motifs encoding specific alleles and or loci can be incorporated in
the custom sequence in high multiplex.
[0155] Relative quantities of the two or more chromosomes in a
sample may be determined by detecting the cumulative signals from
the products of double ligation from each of two or more sets of
probes, each of which recognises target sequences specific to one
chromosome, and quantifying the different cumulative signals.
[0156] A convenient way to obtain signals from the products of
ligation is to provide conditions for amplification and to test for
the presence of the amplification product. Several amplification
approaches are possible, such as NASPA, LAMP, T7 amplification, PCR
or, where the ligation product is a circle, rolling circle
replication. Obtaining signals may involve amplification across a
ligation junctions and detecting signals from the amplification
products (e.g., by PCR or, for circularising embodiments of the
probe, rolling circle replication), or capturing the continuous
nucleic acid strand at one end and detecting its other end. Signals
may be obtained from amplified or non-amplified ligation products
using any of the conventional detection systems for nucleic acids
such as detection of fluorescent labels, enzyme-linked detection
systems, antibody-mediated label detection, and detection of
radioactive labels. Preferably, a roiling circle amplification
product is detected by hybridisation of a labelled detection
oligonucleotide to a motif in the RCA product, e.g. a motif in a
custom sequence of the probe. Because the amount of ligation
product is directly proportional to the amount of target sequence
present in a sample, quantitative measurements reliably represent
the amount of a target sequence in a sample. Major advantages of
this method are that the ligation step can be manipulated to obtain
allelic discrimination, the DNA replication step is isothermal, and
signals are strictly quantitative because the amplification
reaction is linear and is catalysed by a highly processive enzyme.
The primer oligonucleotide used for the DNA polymerase reaction can
be the same for all probes of a set or for multiple sets of probes
in a reaction mixture.
[0157] One example of signal detection employs a captureilabel
technique. Here, the ligation products comprise a capture moiety on
one side of a ligation junction and a label on the other side of
the ligation junction, and the method comprises obtaining signals
from the ligation products by capturing the ligation products on a
substrate via the capture moiety, washing the substrate and
retaining a captured fraction comprising the substrate and captured
ligation product, and detecting the labels on the ligation products
in the captured fraction. Such methods are especially suitable
where the ligation product is linear, so that one end of the
product is captured and the other is detected. However, the methods
can also he used where the ligation product is circular, by
including a step of cleaving the circle to convert it to a linear
product. The signal may be derived from a heterogeneous label or a
sequence of the probe, e.g., custom sequence.
[0158] Fluorescent signals may be used, for example by labelling
the probes of the first and second sets with different fluorescent
labels. Thus, a method may comprise contacting the nucleic acid in
the sample with a first set of probes and a second set of probes
and detecting first and second cumulative signals, wherein
[0159] the first cumulative signal is fluorescence at a first
wavelength emitted by ligation products generated by probes of the
first set, and wherein
[0160] the second cumulative signal is fluorescence at a second
wavelength emitted by ligation products generated by probes of the
second set.
[0161] In some of these embodiments, the the products of the
rolling circle replication of the ligation products generated by
probes of the first and second sets are distinguishably
labelled.
[0162] Capture/detect methods are particularly convenient for use
with probes comprising separate nucleic acid molecules, (e.g. head
and tail sequences on separate nucleic acid molecules). The
ligation product then contains sequences of both molecules (e.g.
the head and tail sequences) in a single nucleic acid molecule (the
ligation product), whereas unligated probes do not. Accordingly,
signals may be obtained from the ligation products by capturing the
nucleic acid molecule containing the one sequence (e.g. head
sequence), washing to remove unligated probe nucleic acid, then
detecting the presence of the other sequence (e.g. tail sequence)
in the captured fraction. Detection is specific to the ligated
probes, since in unligated probes the two sequences are connected
only by hybridisation between the nucleic acids and are separated
by washing, whereas the ligated probes contain the two sequences on
each side of a ligation junction in a continuous nucleic acid
strand, i.e., covalently joined.
[0163] As noted, probes may be modified to carry capture moieties.
The capture moiety may permit attachment to a solid substrate such
as a bead. A suitable capture moiety is biotin, which pairs with
streptavidin, allowing the modified probe nucleic acid to be
isolated on the solid substrate coated with streptavidin. It may be
convenient to provide the probe with the capture moiety before
combining the probe with the sample. Alternatively, the capture
moiety may be introduced after the ligation step.
[0164] Where a probe comprises a backbone oligonucleotide
containing either the head or tail sequence, and a separate nucleic
acid (targeting oligonucleotide, or a second backbone
oligonucleotide) containing the tail or head respectively, either
of these nucleic acid molecules may carry a capture moiety, for
example may be biotinylated.
[0165] Where one nucleic acid molecule of a probe carries a capture
moiety, the other may carry a label. It is possible to use the
nucleic acid sequence itself as a label, detecting a custom
sequence which identifies the nucleic acid molecules to be
detected, e.g. is present in all probes of a set but not probes of
another set. A complementary oligonucleotide may be used for
detection. Alternatively the nucleic acid may carry a heterogeneous
label such as a Iluorophore. The heterogeneous label is not part of
the nucleic acid itself. Other labels that can be used include
quantum dots, bioluminescence, signal generating enzyme cascades
like tyramide signal amplification, and radioactive moieties. The
method may then comprise detecting the presence of the label, e.g.,
detecting fluorescence, detecting the quantum dots, detecting
bioluminescence, detecting the signal generated by the enzyme, or
detecting radioactivity, respectively.
[0166] As an example, obtaining signals from the ligation products
may comprise capturing backbone oligonucleotides of the probes on a
substrate via the capture moiety, washing the substrate to remove
unligated probes and retaining a captured fraction comprising the
substrate and captured backbone oligonucleotides, and obtaining
signals from the products of double ligation in the captured
fraction. Where the product of double ligation carries a label,
this may comprise detecting the label in the captured fraction.
[0167] The capture moiety can be a biotin-molecule with affinity to
a strepavidin-substrate. Other suitable affinity tags include
polyhistidine-tags with affinity to immobilised metal ions, such as
cobalt, nickel, copper which can be used for the purification of
histidine containing sequences, e.g., backbone oligonucleotides.
The capture moiety may thus be part of the sequence to be captured,
e.g. a His-tag sequence, or it may be a heterogenous moiety which
is not part of the nucleic acid itself.
[0168] A suitable solid substrate is a bead, for example magnetic
beads to facilitate enrichment of the captured products using a
magnet. The substrate may be coated with a binding member for the
capture moiety, e.g. streptavidin coated magnetic beads may be used
with biotinylated probes.
Quantifying
[0169] Quantification determines the amount of the species of
nucleic acid in the sample. In some cases this amount may be
determined and compared with a known control, enabling
determination of the absolute or relative amount of nucleic acid in
the sample. In other cases multiple species of nucleic acid may be
probed within a sample, e.g., simultaneously. This enables one
species of nucleic acid to be used as a reference, quantifying the
different species of nucleic acid relative to each other, for
example determining that a sample contains more of chromosome 21
than chromosome 1.
[0170] Quantity may be expressed as concentration or amount (e.g.,
moles or mass), the two being interchangeable where the
concentration is the amount of nucleic acid divided by the volume
of the sample.
Probes
[0171] Examples of probes and their features have already been
described above. Some further features and examples are described
here.
[0172] The probe nucleic acid is preferably DNA. However, it may be
another nucleic acid, naturally occurring or not. The standard
bases of DNA are A, T, C and G, but probe nucleic acid of the
method may optionally include non-standard nucleotides.
[0173] In general, a probe for use in methods of the present method
may comprise a targeting oligonucleotide and head and tail
sequences. The head and tail sequences may be part of the targeting
oligonucleotide, or one or both of them may be on a different
nucleic acid molecule. Optionally, the probe comprises the
targeting oligonucleotide, a backbone oligonucleotide comprising
the head sequence and a backbone oligonucleotide comprising the
tail sequence. A probe may therefore comprise one, two or three
nucleic acid molecules in its non-ligated form.
[0174] Preferably, the probes are for hybridising to target
sequences which are fragments of defined sequence generated from
the species of nucleic acid to be quantified or identified. These
target sequences may be referred to as target fragments.
[0175] The targeting oligonucleotide is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide. The head and tail sequences have free 5' and 3'
ends respectively, and are complementary to the upstream and
downstream flanking sequences respectively. Under annealing
conditions in the presence of the target fragment, the head and
tail sequences hybridise to the flanking sequences, defining a gap
between the 5' end of the head sequence and the 3' end of the tail
sequence, wherein the target fragment hybridises to the
target-complementary sequence in the gap, thereby positioning the
ends of the target fragment in juxtaposition with the 5' end of the
head sequence and the 3' end of the tail sequences.
[0176] Probes of this type may be used to detect a species of
nucleic acid in a method comprising:
(i) providing a sample in which the species of nucleic acid is
fragmented into target fragments, (ii) providing denaturing
conditions under which the target fragments are single stranded
(iii) contacting the sample with a set of probes, wherein each
probe specifically recognises a distinct target sequence within the
species of nucleic acid to be detected, wherein the target
sequences are sequences of the target fragments, and wherein each
probe comprises
[0177] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0178] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream and downstream flanking sequences respectively,
(iv) providing annealing conditions under which the head and tail
sequences hybridise to the flanking sequences, and target
fragments, if present, hybridise to the target-complementary
sequence of the probes, thereby positioning the ends of the target
fragment in juxtaposition with the 5' end of the head sequence and
the 3' end of the tail sequence (v) providing conditions for
ligation so that, if a target fragment is present, the 3' end of
the target fragment is ligated to the 5' end of the head sequence
to form a first ligation junction, and the 5' end of the target
fragment is ligated to the 3' end of the tail sequence to form a
second ligation junction, producing a product of double ligation
comprising a continuous strand of nucleic acid comprising the head
and tail sequences and the target fragment, and (vi) detecting a
cumulative signal which is a combination of individual signals from
all the products,
[0179] wherein detection of the signal indicates the presence of
the species of nucleic acid in the sample.
[0180] The species of nucleic acid may be quantified by a method
comprising
[0181] (i) providing a sample in which the species of nucleic acid
is fragmented into target fragments
[0182] (ii) providing denaturing conditions under which the target
fragments are single stranded
[0183] (iii) contacting the sample with a set of probes, wherein
each probe specifically recognises a distinct target fragment of
the species of nucleic acid to be quantified, wherein each probe
comprises
[0184] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0185] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream and downstream flanking sequences respectively,
[0186] (iv) providing annealing conditions under which the head and
tail sequences hybridise to the flanking sequences, and target
fragments, if present, hybridise to the target-complementary
sequence of the probes, thereby positioning the ends of the target
fragment in juxtaposition with the 5' end of the head sequence and
the 3' end of the tail sequence
[0187] (v) providing conditions for ligation so that, if a target
fragment is present, the 3' end of the target fragment is ligated
to the 5' end of the head sequence to form a first ligation
junction, and the 5' end of the target fragment is ligated to the
3' end of the tail sequence to form a second ligation junction,
producing a product of double ligation comprising a continuous
strand of nucleic acid comprising the head and tail sequences and
the target fragment,
[0188] (vi) detecting a cumulative signal which is a combination of
individual signals from all ligation products, and
[0189] (vii) quantifying the cumulative signal to determine a
signal level, wherein the signal level is proportional to the
quantity of the species of nucleic acid in the sample, and
[0190] thereby determining the quantity of the species of nucleic
acid in the sample.
[0191] The method may be used to quantify a first species of
nucleic acid relative to a second species of nucleic acid in a
sample. Accordingly, the method may comprise
[0192] (i) providing a sample in which the first and second species
of nucleic acid are fragmented into target fragments
[0193] (ii) providing denaturing conditions under which the target
fragments are single stranded
[0194] (iii) contacting the sample with a first set of probes and a
second set of probes, wherein the probes of the first set
specifically recognise distinct target fragments of the first
species of nucleic acid and wherein probes of the second set
specifically recognise distinct target fragments of the second
species of nucleic acid, wherein each probe comprises
[0195] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0196] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream and downstream flanking sequences respectively,
[0197] (iv) providing annealing conditions under which the head and
tail sequences hybridise to the flanking sequences, and target
fragments, if present, hybridise to the target-complementary
sequence of the probes, thereby positioning the ends of the target
fragment in juxtaposition with the 5' end of the head sequence and
the 3' end of the tail sequence
[0198] (v) providing conditions for ligation so that, if a target
fragment is present, the 3' end of the target fragment is ligated
to the 5' end of the head sequence to form a first ligation
junction, and the 5' end of the target fragment is ligated to the
3' end of the tail sequence to form a second ligation junction,
producing a product of double ligation comprising a continuous
strand of nucleic acid comprising the head and tail sequences and
the target fragment,
[0199] (vi) detecting a first cumulative signal which is a
combination of individual signals from the ligation products
generated by probes of the first set, and quantifying it to
determine a first signal level, wherein the first signal level is
proportional to the quantity of the first species of nucleic acid
in the sample,
[0200] (vii) detecting a second cumulative signal which is a
combination of individual signals from the ligation products
generated by probes of the second set, and quantifying it to
determine a second signal level, wherein the second signal level is
proportional to the quantity of the second species of nucleic acid
in the sample, and
[0201] (viii) comparing the first and second signal levels, thereby
determining the relative quantities of the first and second nucleic
acid species in the sample.
[0202] The probes may be designed so that hybridisation of the
target fragment in the gap completes a circle of nucleic acid, the
circle comprising the target fragment and the head and tail
sequences.
[0203] The head and/or tail sequence of the probe is preferably
joined to a custom sequence which is not complementary to other
regions of the probe or to the target fragment.
[0204] In some embodiments of the probe, a single nucleic acid
molecule comprises the head and tail sequences.
[0205] The head and tail sequences may be separate from the
targeting oligonucleotide so that they bind in trans to the
flanking sequences. For example, the head and tail sequences may be
at 5' and 3' ends respectively of a backbone oligonucleotide. A
custom sequence can be included between the head and tail sequences
of the backbone oligonucleotide. An example of such a probe is
shown in FIG. 3. Alternatively, the head and tail sequences of the
backbone oligonucleotide may be adjacent, with no intervening
nucleotide sequence. In such a case, the flanking sequences of the
targeting oligonucleotide hybridise along the full length of the
backbone oligonucleotide and may circularise it.
[0206] The probes may be designed so that the head sequence is a 5'
end of the targeting oligonucleotide and/or the tail sequence is a
3' end of the targeting oligonucleotide, so that hybridisation of
the target fragment in the gap completes a strand of nucleic acid
comprising the target fragment, the head arid tail sequences, the
target complementary sequence and the flanking sequences. The head
and tail sequences may be at ends of the targeting oligonucleotide
and bind in cis to the flanking sequences. An example of such a
probe is shown in FIG. 4. In this version of the probe, the head
and tail sequences and the target complementary sequence all become
circularised with the target fragment. Custom sequences can be
positioned in the loops of the oligonucleotide. The probe nucleic
acid is relatively long but has the advantage of joining the
oligonucleotide structure into one molecule that is pre-assembled
and does not require hybridisation of different probe nucleic acid
molecules.
[0207] Probes can also be designed with a backbone oligonucleotide,
which is a separate molecule of nucleic acid from the targeting
oligonucleotide. The tail sequence can be a 3' end of the targeting
oligonucleotide and the head sequence a 5' end of a backbone
oligonucleotide. Alternatively the head sequence can be a 5' end of
the targeting oligonucleotide and the tail sequence a 3' end of a
backbone oligonucleotide. A custom sequence can be introduced in
the targeting oligonucleotide, for example to provide a loop
between the head or tail sequence and the flanking sequence. An
advantage with using this probe approach is that a detection
sequence can be introduced in the loop and is associated with the
target complementary sequence, which can be advantageous for
multiplex methods, especially higher multiplexes with high-plex
detection schemes. The backbone oligonucleotide can further
comprise a custom sequence. By providing the probe in two
oligonucleotides, the probe nucleic acid molecules are shorter than
the single oligonucleotide version but maintain the same
function.
[0208] Another design of the probe provides the head and tail
sequences on two backbone oligonucleotides. Thus, the probe
comprises
[0209] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide,
[0210] a backbone oligonucleotide comprising a head sequence having
a free 5' end, and
[0211] a backbone oligonucleotide comprising a tail sequence having
a free 3' end,
[0212] wherein the head and tail oligonucleotide sequences are
complementary to the upstream and downstream flanking sequences
respectively.
[0213] One backbone oligonucleotide may carry a capture moiety, in
which case the other backbone oligonucleotide is used for detection
and may carry a heterogeneous label. One or both backbone
oligonucleotides may further comprise a custom sequence.
Alternatively or additionally, the targeting oligonucleotide may
include a custom sequence.
[0214] Under annealing conditions in the presence of the target
fragment, the head and tail sequences hybridise to the flanking
sequences, defining a gap between the 5' end of the head sequence
and the 3' end of the tail sequence, wherein the target fragment
hybridises to the target-complementary sequence in the gap, thereby
positioning the ends of the target fragment in juxtaposition with
the 5' end of the head sequence and the 3' end of the tail
sequences. Hybridisation of the target fragment in the gap
completes a strand of nucleic acid comprising the target fragment
and the head and tail sequences. The strand carries the capture
moiety and the label, permitting detection using the capture/detect
methods described elsewhere herein.
Digital Karyotyping and Non-Invasive Pre-Natal Diagnosis
[0215] Some implementations of the present method provide
particular advantages in fields where precise quantification of
target DNA is sought. This includes a number of nucleic acid based
diagnostic techniques. One such area is the analysis of cancer DNA
in a biological sample (e.g., blood) from a patient. Another such
area is non-invasive pre-natal diagnosis (NIPT) by analysis of cell
free DNA.
[0216] A challenge with NIPT is that a large number of specific
genome fragments must be counted in order to achieve the
statistical confidence required to diagnose an chromosomal
aneuploidies. Since the foetal DNA is mixed with the maternal DNA,
making up 4-30% of the genetic material in a pregnant woman's
bloodstream, observing a chromosomal aneuploidy in the foetal DNA
requires a very precise measurement.
[0217] The present method may be used for analysing free
circularising foetal DNA in samples of maternal blood. By using a
plurality of probes directed to different fragments of one
chromosome and a plurality of probes directed to different
fragments of a second chromosome, the method enables an imbalance
in the relative number of the two chromosomes in the sample to be
determined with high confidence. This allows chromosomal
aneuploidies such as trisomy to be diagnosed from foetal DNA even
against the high background of the maternal DNA.
[0218] The present method may be used for, e.g., testing maternal
blood samples from pregnant women to detect foetal nucleic acid for
the diagnosis of chromosomal abnormalities such as trisomy, testing
patient samples for tumour DNA for the diagnosis or monitoring of
the presence of a tumour in the patient. Other uses include testing
samples of material for the presence of microbial nucleic acid,
where detection of the microbial nucleic acid indicates infection
of the material by the microbe, which may be an infectious agent
such as a bacterium, virus or fungus. The sample may be a tissue or
blood sample from a patient.
[0219] More generally, by using hundreds or thousands of different
probes, some implementations of the present method can achieve high
precision by detecting hundreds or thousands of specific nucleic
acid fragments, providing advantages across a range of diagnostic
applications. Detecting a multitude of DNA fragments from the
chromosome or chromosomal loci associated with a particular disease
enables the amount of that chromosome or locus to be measured
relative to a control chromosome or locus, so that even slight
differences in a sample can be confidently detected.
[0220] By analysing short target fragments a large proportion, of
the highly lragrnented cell free DNA in maternal blood can be
analysed with high efficiency. This is important since very low
amounts of cell free DNA are available in maternal blood.
[0221] A method of quantifying a first chromosome or chromosomal
locus relative to a second chromosome or chromosomal locus in a
sample of nucleic acid obtained from an individual may comprise
[0222] contacting the sample with a first set of probes and a
second set of probes, wherein the probes of the first set each
specifically recognise a distinct target sequence within the first
chromosome or chromosomal locus and wherein the probes of the
second set each specifically recognise a distinct target sequence
within the second chromosome or chromosomal locus,
[0223] providing conditions under which the target sequences in the
first and second chromosomes or chromosomal loci are at least
partially single stranded,
[0224] providing conditions for annealing and ligation, under which
conditions the probes hybridise to their target sequences and
generate ligation products,
[0225] detecting a first cumulative signal which is a combination
of individual signals from the ligation products generated by
probes of the first set, and quantifying it to determine a first
signal level, wherein the first signal level is proportional to the
quantity of the first chromosome or chromosomal locus in the
sample,
[0226] detecting a second cumulative signal which is a combination
of individual signals from the ligation products generated by
probes of the second set, and quantifying it to determine a second
signal level, wherein the second signal level is proportional to
the quantity of the second chromosome or chromosomal locus in the
sample, and
[0227] comparing the first and second signal levels, thereby
determining the relative quantities of the first and second
chromosomes or first and second chromosomal loci in the sample,
[0228] The method may be used for diagnosing aneuploidy (e.g.
trisomy) in a foetus, where the sample of nucleic acid is a sample
obtained from maternal blood and contains cell free foetal DNA
mixed with maternal DNA, and wherein an unequal ratio of the first
and second signal levels is indicative of aneuploidy (e.g.
trisomy).
EXAMPLES
[0229] The following examples are provided in order to demonstrate
and further illustrate certain embodiments and aspects of the
present invention and are not to be construed as limiting the scope
thereof.
Example 1
[0230] This example illustrates detection and quantification of
free circularising foetal DNA in maternal blood using the present
method.
[0231] A blood sample is collected from the pregnant mother and
free circularising DNA is extracted from the blood plasma. The DNA
is then reacted with targeted specific DNA probes that specifically
react with DNA fragments originating from the chromosomes subjected
to analysis and quantification. In this example we illustrate the
use of the so-called "Lotus probes" to target and react with
specific fragments from chromosome 21 and a reference chromosome.
However, other probe-based technologies for targeting specific DNA
fragments could be used instead, such as padlock probes/Molecular
Inversion Probes (MIPs), selector probes, oligonucleotide ligation
probes.
[0232] Lotus probes are provided which target multiple fragments
from each of two chromosomes. Upon target recognition, the probes
generate a ligation product with their corresponding fragments,
having one end labelled with fluorescence and the other with a
biotin. The ligation products are labelled with two different
fluorophores, each representing the individual chromosomes being
targeted. The protocol can be illustrated as:
1) 10 ng of DNA is digested with 1 unit of restriction enzyme in
corresponding compatible restriction enzyme buffer. The reaction is
incubated in 37 C for 1 h, followed by enzymatic deactivation at
80.degree. C. for 20 min. 2) The DNA fragments are denatured to
single stranded fragments at 95.degree. C. for 10 min and mixed
with probes and ligase to form linear ligation products. The probe
pool are added in 10 pM individual concentration along with 1 U of
Ampligase (Epicentre) and incubated at 55.degree. C. for 1 h in
ligase buffer. 3) The ligation product is captured on magnetic
streptavidin beads. To remove non-reacted probes and fragments, the
solution is mixed with 10 ml M-280 streptavidin coated magnetic
beads (lnvitrogen) in Tris-HCl (pH 7.5), 3.5 mM EDTA and 0.07
Tween-20 in a final volume of 200 ml, and incubated at room
temperature for 15 min. After incubation, the beads are collected
using a ring magnet and supernatant removed. 4) The remaining
bead-bound probes are detected and quantified. The total
fluorescence intensity is measured for each of the two labels and
the relative intensity is measured between the two colours. 5) In
the case of prenatal diagnosis, the final result is based on the
relative quantity of fluorescence. A simplified example; if 1000
genome equivalents and 10% of all free circularizing DNA in
maternal blood is derived from the foetus, and 1000 chromosome 21
targeting probes are used to generate the total fluorescence, a
normal sample would generate a signal of 1,000,000 fluorophores
were as a sample with trisomy 21 foetus would generate a signal
corresponding of 1,050,000 fluorophores. Also, to achieve higher
statistical precision if 1000 probes are targeting "normalization"
regions not subjected to aneuploidy, and labelled with a second
fluorophore, a relative quantity can be measured.
Example 2
[0233] In the following example, the Lotus probes target multiple
fragments from each of two chromosomes. Upon target recognition,
the probes generate a circularised ligation product with their
corresponding fragments. The circularised ligation products contain
either of two sequence motifs that can be used for subsequent
labelling, each sequence motif corresponding to either of the two
chromosomes being targeted. The protocol can be illustrated as:
1) 10 ng of DNA is digested with 1 unit of restriction enzyme in
corresponding compatible restriction enzyme buffer. The reaction is
incubated in 37 C for 1 h, followed by enzymatic deactivation at
80.degree. C. for 20 min. 2) The DNA fragments are denatured to
single stranded fragments at 95.degree. C. for 10 min and mixed
with probes and ligase to form circles. The probe pool are added in
10 pM individual concentration along with 1 U of Ampligase
(Epicentre) and incubated at 55.degree. C. for 1 h in ligase
buffer. 3) 1 U Exonuclease is added to remove non-reacted probes
and fragments. I U of Lambda exonuclease (Epicentre) is added at
37.degree. C. for 1 h in corresponding exonuclease buffer followed
by enzyme inactivation at 80.degree. C. for 20 min. 4) The
remaining circles are copied by rolling circle amplification, RCA.
1 U of phi29 polymerase (New England Biolabs) is added in
corresponding phi29 buffer and nucleotides (dNTPs) at 37.degree. C.
for 1 h. Probes complementary to the RCA-products, each labelled
with either of two different fluorophores, are added to the
RCA-mix. The resulting labelled RCA-products are counted
individually and the relative number of RCA-products is measured
between the two colours. 5) In the case of prenatal diagnosis, the
final result is based on the relative quantity of fluorescence. A
simplified example; if 1000 genome equivalents and 10% of all free
circularizing DNA in maternal blood is derived from the foetus, and
1000 chromosome 21 targeting probes are used to generate the total
fluorescence, a normal sample would generate a signal of 1,000,000
fluorophores were as a sample with trisomy 21 foetus would generate
a signal corresponding of 1,050,000 fluorophores. Also, to achieve
higher statistical precision if 1000 probes are targeting
"normalization" regions not subjected to aneuploidy, and labelled
with a second fluorophore, a relative quantity can be measured.
Example 3
Materials and Methods
[0234] Sample preparation: 10 ml blood was collected from each
subject into a cell-free DNA tube (Streck, Omaha, Neb.). Plasma was
isolated from blood by a double centrifugation protocol (1600 g for
10 min, followed by 16000 g for 10 min, after a tube transfer
following the first spin). cfDNA was isolated by the Qiagen ccf
nucleic acid kit (Qiagen, Hilden, Germany) according to the
manufacturer's protocol. The resulting DNA was eluted in 50 ul of
buffer (part of the Qiagen kit).
[0235] Probe and backbone design: The multiplexed probe technology
herein described enables specific and simultaneous amplification of
thousands of chromosomal fragments. Probes were designed to capture
2500-5000 fragments (targets) from each of chromosomes 21, 18, and
13. Targets were selected to have unique sequence in the genome,
uniformed AT/GC composition, not include known polymorphism nor
CNVs in target sequence, and a size between 18-35 bp. Probes
targeting 2500 fragments from each chromosome 13 and 18 were pooled
together with 5000 probes targeting fragments from chromosome 21 to
create a single oligo probe pool.
Example sequence of probes, "N" represents target complementary
sequence:
TABLE-US-00001 (SEQ ID NO: 1)
ATGTGACCCTTCCGTCTGTTGAGTTAGGCCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTCGTGCCTTGTCATTCGGGAGCACTAACTGCTG
[0236] The backbones, with head and tail sequences complementary to
the ends of the probe, were designed to include sequence motifs for
both sequencing and digital counting. Two backbones were used in
the experiments outlined in the result section; one complementary
to probes targeting chromosome 13 and 18:
TABLE-US-00002 SEQ ID NO: 2
(/5Phos/CGCACACGATTAAGGTCCAGTCACAGGCAGAGATCGGAAG
AGCGTCGTGTAGGGAAAGAGTGTNNNNNNNNNNGTGTAGATCTCGGTG
GTCGCCGTATCATTTCATGCTGCTAACGGTCGAGTCGGACAGGTGGCT
CCACTAAATAGACGCA);,
and one backbone targeting chromosome 21:
TABLE-US-00003 SEQ ID NO: 3
(/5Phos/GGCCTAACTCAACAGACGGAAGGGTCACATAGATCGGAAG
AGCGTCGTGTAGGGAAAGAGTGTNNNNNNNNNNGTGTAGATCTCGGTG
GTCGCCGTATCATTTCATGCTGCTAACGGTCGAGCAGTTAGTGCTCCC
GAATGACAAGGCACGA);.
[0237] Biochemistry probe protocol: 50 ul of purified cfDNA was
digested with 5 U of Msel (New England Biolabs) in 1.times.NEB4
buffer (New England Biolabs) and 1.times.BSA in a total volume of
55 ul at 37 C in 30 min followed by heat inactivation at 65 C in 20
min. The digested DNA was then mix with ligation mix along with
probes and backbones. The 55 ul of digested DNA was mixed with
probes (1 pM/probe), backbones (60 nM each), 1.times. ligation
buffer (Epicentre), 100 U of Ampligase (Epicentre), 1 mM NAD, and 5
mM Mg.sup.2+ to a total volume of 70 ul. The digested fragments
were first denatured to single stranded DNA at 950 in 5 min
followed by 55 C hybridization and ligation in 16 h. The ligation
mix was then treated with exonucleases to remove any remaining
linear DNA molecules. The ligation reaction was mixed with 20 U of
Exol (NEB) and 5 U of ExoIII (NEB) and 1.times.BSA tot total volume
of 75 ul at 37 C for 60 min followed by heat inactivation at
65.degree. C.for 10 min.
[0238] Analysis: For sequencing analysis, the exo treated circles
was amplified with sequencing primers complementary to the Illumina
sequencing instrument and subsequently loaded on the Illumina Miseq
instrument according to manufacturers protocol.
[0239] For digital analysis, the exo treated reactions was
subjected to a rolling circle amplification reaction (RCA) to
generate discrete DNA objects of concatemeric copies of the circle.
37.5 ul of exo treated circles were mixed with 4 mM DTT, 3 U of
phi29 polymerase (NEB), 0.1 uM primer, 1 mM dNTP mix (NEB) and
1.times.BSA in a total volume in 50 ul, and incubated at 37 C for 1
h followed by a heat inactivation at 650 for 10 min. The RCA
reaction was then labeled with fluorescently labeled
oligonucleotides complementary to the backbone sequence. 50 ul of
RCA products was mixed with 0.1% Tween 20 (Sigma), 5 nM labeled
oligonucleotides, and 2.times.SSC (Sigma) in a total volume of 100
ul. The labeled RCA-products were finally deposited on a microscope
slide coated with Poly-lysine (Sigma) and counted in a fluorescent
microscope.
Results
[0240] The probe method herein described was demonstrated on
illumine sequencing and a digital counting system. To demonstrate
the performance of the probe method, a DNA sample with trisomy 21
was mixed with DNA extracted from normal plasma samples (3-5 ml
plasma) in different concentrations. The samples was then carried
through the probe method and evaluated by sequencing.
[0241] For the results shown in FIG. 8, 100 ng of cell line DNA was
subjected to the protocol described above. 10,000 probes were mixed
in a pool to specifically circularize 10,000 corresponding
chromosomal fragments from chromosome 13, 18, and 21. The 10,000
resulting circles were then amplified with Illumina-corresponding
PCR primers and analyzed on gel prior sequencing. Lane 1
corresponds to DNA ladder, lane 2 the DNA sample after digestion,
and lane 3 the PCR product with 10,000 amplified fragments.
[0242] For the results shown in FIG. 9, 12 normal plasma samples
were analyzed in parallel with samples carry DNA with trisomy 21 in
different concentrations. DNA were extracted and processed through
the 10K-plex probe protocol and finally sequenced on Illumina
sequencer. Using a confidence interval providing 99% specificity,
the positive samples are detected with a 90% sensitivity based on
the estimated normal distributions.
Further Statements
[0243] The following clauses represent aspects of the invention and
are part of the description. 1. A method of detecting a species of
nucleic acid in a sample, comprising
[0244] contacting the sample with a set of probes, wherein each
probe specifically nises a distinct target sequence within the
species of nucleic acid to be detected,
[0245] providing conditions under which the target sequences in the
species of nucleic acid are at least partially single stranded,
[0246] providing conditions for annealing and ligation, under which
conditions the probes hybridise to their target sequences and
generate ligation products, each ligation product comprising a
ligation junction, and
[0247] detecting a cumulative signal which is a combination of
individual signals from all ligation products,
[0248] wherein detection of the signal indicates the presence of
the species of nucleic acid in the sample.
2. A method of quantifying a species of nucleic acid in a sample,
comprising
[0249] contacting the sample with a set of probes, wherein each
probe specifically recognises a distinct target sequence within the
species of nucleic acid to be quantified,
[0250] providing conditions under which the target sequences in the
species of nucleic acid are at least partially single stranded,
[0251] providing conditions for annealing and ligation, under which
conditions the probes hybridise to their target sequences and
generate ligation products, each ligation product comprising a
ligation junction, and
[0252] detecting a cumulative signal which is a combination of
individual signals from all ligation products,
[0253] quantifying the cumulative signal to determine a signal
level, wherein the signal level is proportional to the quantity of
the species of nucleic acid in the sample, and
[0254] thereby determining the quantity of the species of nucleic
acid in the sample.
3. A method of quantifying a first species of nucleic acid relative
to a second species of nucleic acid in a sample, comprising
[0255] contacting the sample with a first set of probes and a
second set of probes, wherein the probes of the first set each
specifically recognise a distinct target sequence within the first
species of nucleic acid and wherein the probes of the second set
each specifically recognise a distinct target sequence within the
second species of nucleic acid,
[0256] providing conditions under which the target sequences in the
first and second species of nucleic acid are at least partially
single stranded,
[0257] providing conditions for annealing and ligation, under which
conditions the probes hybridise to their target sequences and
generate ligation products, each ligation product comprising a
ligation junction,
[0258] detecting a first cumulative signal which is a combination
of individual signals from the ligation products generated by
probes of the first set, and quantifying it to determine a first
signal level, wherein the first signal level is proportional to the
quantity of the first species of nucleic acid in the sample,
[0259] detecting a second cumulative signal which is a combination
of individual signals from the ligation products generated by
probes of the second set, and quantifying it to determine a second
signal level, wherein the second signal level is proportional to
the quantity of the second species of nucleic acid in the sample,
and
[0260] comparing the first and second signal levels, thereby
determining the relative quantities of the first and second nucleic
acid species in the sample.
4. A method according to any of the preceding clauses, wherein the
target sequences are non-overlapping. 5. A method according to any
of the preceding clauses, wherein the set of probes comprises at
least 10 probes that each specifically recognise a distinct target
sequence. 6. A method according to clause 5, wherein the set of
probes comprises at least 100 probes that each specifically
recognise a distinct target sequence. 7. A method according to
clause 6, wherein the set of probes comprises at least 1,000 probes
that each specifically recognise a distinct target sequence. 8. A
method according to clause 7, wherein the set of probes comprises
at least 10,000 probes that each specifically recognise a distinct
target sequence. 9. A method according to any of the preceding
clauses, comprising amplifying the ligation products and obtaining
a cumulative signal which is a combination of individual signals
from the amplified products. 10. A method according to clause 9,
wherein the amplification is clonal amplification. 11. A method
according to clause 9 or clause 10 comprising amplifying the
ligation products across the ligation junction. 12. A method
according to any of the preceding clauses, wherein the ligation
products are products of double ligation, each comprising first and
second ligation junctions. 13. A method according to clause 12,
wherein the method comprises amplifying the ligation products
across the first and second ligation junctions. 14. A method
according to any of clauses 1 to 8, comprising obtaining a
cumulative signal which is a combination of individual signals from
the ligation products without amplifying the ligation products. 15.
A method according to any of clauses 1 to 13, wherein the ligation
products are circles ol nucleic acid. 16. A method according to
clause 15, comprising providing conditions for rolling circle
replication of the circles of nucleic acid and detecting the
products of rolling circle replication. 17. A method according to
clause 16, wherein the rolling circle replication is hyper branched
rolling circle replication. 18. A method according to any of
clauses 1 to 14, wherein the ligation products are linear nucleic
acids. 19. A method according to clause 18, wherein the ligation
products comprise a capture moiety on one side of a ligation
junction and a label on the other side of the ligation junction,
and the method comprises obtaining signals from the ligation
products by capturing the ligation products on a substrate via the
capture moiety, washing the substrate and retaining a captured
fraction comprising the substrate and captured ligation product,
and detecting the labels on the ligation products in the captured
fraction. 20. A method according to any of the preceding clauses,
wherein the signal is fluorescence. 21. A method according to
clause 20, comprising contacting the nucleic acid in the sample
with a first set of probes and a second set of probes and detecting
first and second cumulative signals, wherein
[0261] the first cumulative signal is fluorescence at a first
wavelength emitted by ligation products generated by probes of the
first set, and wherein
[0262] the second cumulative signal is fluorescence at a second
wavelength emitted by ligation products generated by probes of the
second set.
22. A method according to any of the preceding clauses, wherein the
probes are ligated to generate the ligation products. 23. A method
according to clause 22, wherein the probes and the target sequences
are ligated to generate the ligation products. 24. A method
according to any of the preceding clauses, wherein the ligation
products are circles of nucleic acid comprising the target
sequences. 25. A method according to any of the preceding clauses,
wherein the species of nucleic acid is fragmented. 26. A method
according to clause 25, wherein the target sequences are sequences
of fragments of the species of nucleic acid. 27. A method according
to clause 25 or clause 26, wherein the sample is a restriction
enzyme digest of nucleic acid and the target sequence is a
restriction fragment. 28. A method according to any of clauses 25
to 27, wherein the probe is ligated to each end of the target
sequence. 29. A method according to clause 28, wherein the probes
each comprise
[0263] a targeting oligonucleotide which is longer than the target
fragment arid contains an internal target-complementary sequence,
so that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0264] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream and downstream flanking sequences respectively,
wherein
[0265] under the conditions for annealing and ligation, the head
and tail sequences hybridise to the flanking sequences, and the
target fragment, if present, hybridises to the target-complementary
sequence, thereby positioning the ends of the target fragment in
juxtaposition with the 5' end of the head sequence and the 3' end
of the tail sequence, wherein the 3' end of the target fragment is
ligated to the 5' end of the head sequence to form a first ligation
junction, and the 5' end of the target fragment is ligated to the
3' end of the tail sequence to lorm a second ligation junction,
producing a product of double ligation comprising a continuous
strand of nucleic acid comprising the head and tail sequences and
the target fragment.
30. A method according to clause 29, wherein the sample of
fragmented nucleic acid is a restriction enzyme digest and the
target fragment is a restriction fragment. 31. A method according
to clause 28 or clause 29, wherein the step of detecting the
product of double ligation comprises providing conditions for
amplification across the first and second ligation junctions of the
continuous strand of nucleic acid, and detecting whether an
amplification product is present. 32. A method according to any of
clauses 29 to 31, wherein the continuous strand of nucleic acid
comprising the head and tail sequences and the target fragment is a
circle of nucleic acid. 33. A method according to clause 32,
wherein the step of detecting the product of double ligation
comprises providing conditions for rolling circle replication and
detecting whether a product of rolling circle replication is
present. 34. A method according to clause 33, wherein the rolling
circle replication is hyper branched rolling circle replication.
35. A method according to any of clauses 32 to 34, wherein the
probe comprises the head and tail sequences on one nucleic acid
molecule. 36. A method according to clause 35, wherein the probe
comprises a backbone oligonucleotide having the head and tail
sequences at its 5' end 3' ends respectively, wherein the head and
tail sequences of the backbone oligonucleotide bind in trans to the
flanking sequences of the targeting oligonucleotide under the
annealing conditions. 37. A method according to clause 36, wherein
the backbone oligonucleotide comprises a custom sequence between
the head and tail sequences, wherein the custom sequence is not
complementary to other regions of the probe or to the target
fragment. 38. A method according to clause 36, wherein the head and
tail sequences of the backbone oligonucleotide are adjacent. 39. A
method according to any of clauses 32 to 35, wherein the head and
tail sequences are at ends of the targeting oligonucleotide and
bind in cis to the flanking sequences under the annealing
conditions. 40. A method according to clause 39, wherein the
targeting oligonucleotide comprises a custom sequence between the
targeting oligonucleotide and the head and/or tail sequence,
wherein the custom sequence is not complementary to other regions
of the probe or to the target fragment. 41. A method according to
any of clauses 29 to 34, wherein the tail sequence is at the 3' end
of the targeting oligonucleotide, and the probe comprises a
backbone oligonucleotide having the head sequence at its 5'
end,
[0266] wherein under the annealing conditions the tail sequence
binds in cis to the downstream flanking sequence of the targeting
oligonucleotide, and the head sequence of the backbone
oligonucleotide binds in trans to the upstream flanking sequence of
the targeting oligonucleotide.
42. A method according to clause 41, wherein the backbone
oligonucleotide comprises a pair of inverted repeat sequences,
wherein
[0267] under the annealing conditions the inverted repeat sequences
form a hairpin structure, thereby positioning the 3' end of the
backbone oligonucleotide in juxtaposition with the 5' end of the
targeting oligonucleotide, and wherein
[0268] under the conditions for ligation, the 5' end of the
targeting oligonucleotide is ligated to the 3' end of the backbone
oligonucleotide, so that the product of double ligation is a circle
of nucleic acid comprising the targeting oligonucleotide, the
target fragment and the backbone oligonucleotide.
43. A method according to any of clauses 29 to 34, wherein the head
sequence is at the 5' end of the targeting oligonucleotide, and the
probe comprises a backbone oligonucleotide having the tail sequence
at its 3' end,
[0269] wherein under the annealing conditions the head sequence
binds in cis to the upstream flanking sequence of the targeting
oligonucleotide, and the tail sequence of the backbone
oligonucleotide binds in trans to the downstream flanking sequence
of the targeting oligonucleotide.
44. A method according to clause 43, wherein the backbone
oligonucleotide comprises a pair of inverted repeat sequences,
wherein
[0270] under the annealing conditions the inverted repeat sequences
form a hairpin structure, thereby positioning the 5' end of the
backbone oligonucleotide in juxtaposition with the 3' end of the
targeting oligonucleotide, and wherein
[0271] under the conditions for ligation, the 3' end of the
targeting oligonucleotide is ligated to the 5' end of the backbone
oligonucleotide, so that the product of double ligation is a circle
of nucleic acid comprising the targeting oligonucleotide, the
target fragment and the backbone oligonucieotide.
45. A method according to any of clauses 41 to 44, wherein the
backbone oligonucleotide comprises a custom sequence between the
inverted repeat sequence, so that under the annealing conditions
the backbone oligonucleotide forms a hairpin loop. 46. A method
according to any of clauses 29 to 33 wherein the continuous strand
of nucleic acid comprising the head and tail sequences and the
target fragment is a linear strand of nucleic acid. 47. A method
according to clause 46, wherein the tail sequence is at the 3' end
of the targeting oligonucleotide, and the probe comprises a
backbone oligonucleotide having the head sequence at its 5'
end,
[0272] wherein under the annealing conditions the tail sequence
binds in cis to the downstream flanking sequence of the targeting
oligonucleotide, and the head sequence of the backbone
oligonucieotide binds in trans to the upstream flanking sequence of
the targeting oligonucleotide.
48. A method according to any of clauses 41, 42 or 47, wherein the
targeting oligonucleotide comprises a custom sequence between the
downstream flanking sequence and the tail sequence, so that under
the annealing conditions the targeting oligonucleotide forms a
hairpin loop. 49. A method according clause 46, wherein the head
sequence is at the 5' end of the targeting oligonucleotide, and the
probe comprises a backbone oligonucleotide having the tail sequence
at its 3' end,
[0273] wherein under the annealing conditions the head sequence
binds in cis to the upstream flanking sequence of the targeting
oligonucleotide, and the tail sequence of the backbone
oligonucleotide binds in trans to the downstream flanking sequence
of the targeting oligonucieotide.
50. A method according to any of clauses 43, 44 or 49, wherein the
targeting oligonucleotide comprises a custom sequence between the
head sequence and the upstream flanking sequence, so that under the
annealing conditions the targeting oligonucleotide forms a hairpin
loop. 51. A method according to any of clauses 41 to 45 or 47 to
50, wherein the backbone oligonucleotide carries a capture moiety.
52. A method according to clause 46, wherein the probe comprises a
backbone oligonucieotide comprising a head sequence having a free
5' end, and a backbone oligonucieotide comprising a tail sequence
having a free 3' end, wherein under the annealing conditions the
head and tail sequences bind in trans to the flanking sequences of
the targeting oligonucleotide. 53. A method according to clause 52,
wherein one or both backbone oligonucleotides further comprise a
custom sequence, wherein the custom sequence is not complementary
to other regions of the probe or to the target fragment. 54. A
method according to clause 52 or clause 53, wherein one of the
backbone oligonucieotides carries a capture moiety. 55. A method
according to clause 54, wherein the other backbone oligonucleotide
carries a heterogeneous label. 56. A method according to clause 55,
wherein the label is a fluorophore. 57. A method according to
ciause 51 or any of clauses 54 to 56, wherein the step of detecting
whether the product of double ligation is present comprises
capturing the backbone oligonucieotide on a substrate via the
capture moiety, washing the substrate to remove unligated probes
and retaining a captured fraction comprising the substrate and
captured backbone oligonucleotide, and testing for the presence of
the product of double ligation in the captured fraction. 58. A
method according to ciause 55 or clause 56, wherein the step of
detecting whether the product of double ligation is present
comprises capturing the backbone oligonucleotide on a substrate via
the capture moiety, washing the substrate to remove unligated
probes and retaining a captured fraction comprising the substrate
and captured backbone oligonucleotide, and testing for the presence
of the label in the captured fraction. 59. A method according to
clause 51 or any of clauses 54 to 58, wherein the capture moiety is
biotin. 60. A method according to any of clauses 29 to 59, wherein
the target-complementary sequence has a length of 10 to 30
nucleotides. 61. A method according to any clauses 29 to 60,
wherein the target-complementary sequence has fewer than 5 base
pair mismatches with the target fragment. 62. A method according to
ciause 61, wherein the target-complementary sequence is the exact
complement of the target fragment. 63. A method according to any of
clauses 29 to 62 clause, wherein the flanking sequences each have a
length of 10 to 30 nucleotides. 64. A method according to any of
clauses 29 to 63, wherein the upstream and downstream flanking
sequences are different from each other. 65. A method according to
any of clauses 29 to 64 clause, wherein the head sequence has fewer
than 5 base pair mismatches with the upstream flanking sequence and
the tail sequence has fewer than 5 base pair mismatches with the
downstream flanking sequence. 66. A method according to clause 65,
wherein the head sequence is the exact complement of the upstream
flanking sequence and the tail sequence is the exact complement of
the downstream flanking sequence. 67. A method according to any of
clauses 29 to 66, wherein the targeting oligonucleotide is linear.
68. A method according to any of clauses 29 to 67 clause, wherein
the sample is a sample of fragmented human chromosomes. 69. A
method according to clause 68, wherein the species of nucleic acid
is a chromosome and the target sequences are human genome fragments
specific to that chromosome. 70. A method according to clause 68,
wherein the species of nucleic acid is a chromosomal locus and the
target fragments are specific to that locus of the human genome.
71. A method according to any of the preceding clauses, wherein the
probe nucleic acid is DNA. clause 72. A method according to clause
68 or clause 69, wherein the method comprises contacting a sample
of fragmented chromosomes with a set of probes for binding multiple
fragments of a chromosome, wherein each probe in the set is for
binding a different target fragment specific to that chromosome.
73. A method according to clause 72, wherein the probes share a
common custom sequence. 74. A method according to any of the
preceding clauses, wherein the method comprises contacting a sample
of fragmented chromosomes with two or more sets of probes for
binding multiple fragments of two or more chromosomes,
comprising:
[0274] a first set of probes is for binding a plurality of target
fragments specific to a first chromosome, and
[0275] a second set of probes is for binding a plurality of target
fragments specific to a second chromosome, and optionally
[0276] one or more further bsets of probes for binding a plurality
of target fragments specific to one or more further
chromosomes.
75. A method according to clause 74, wherein each set of probes
comprises at least 500 different probes for binding a plurality of
target fragments specific to the chromosome. 76. A method according
to clause 74 or clause 75, wherein the probes within a set share a
custom sequence which is common to that set and differs from the
custom sequences of probes in other sets. 77. A method according to
clause 76, comprising determining the relative quantities of the
two or more chromosomes in the sample by detecting and quantifying
cumulative signals from the custom sequences in the products of
double ligation for each set of probes. 78. A method according to
any of clauses 72 to 77, wherein the chromosome or chromosomes are
human. 79. A method according to clause 28, wherein the probes
comprise double stranded selector constructs, each individual
selector comprising one or two protruding end sequences
complementary to the ends of the target fragments, wherein
[0277] under the conditions for annealing and ligation, the end
sequences of the selectors hybridise to the end sequences of the
fragments and are ligated to the selectors.
80. A method according to clause 22, wherein the probes are padlock
probes, each comprising a linear oligonucleotides with target
complementary sequences at the ends and a non-target complementary
sequence in between, wherein
[0278] under the conditions for annealing and ligation, the target
complementary sequences are brought together head to tail to
hybridise to adjacent regions of the target sequence and are
ligated form a circle of nucleic acid.
81. A method according to any of the preceding clauses, wherein the
species of nucleic acid is a chromosome or chromosomal locus. 82. A
method according to any of the preceding clauses, wherein the
sample is a blood or tissue sample. 83. A method according to
clause 82, wherein the sample contains a mix of foetal and maternal
DNA from the blood of a pregnant woman. 84. A method according to
clause 81 or clause 82, wherein the species of nucleic acid to be
detected or quantified is tumour-associated DNA. 85. A method
according to clause 81 or clause 82, wherein the species of nucleic
acid to be detected or quantified is microbial DNA. 86. A method of
quantifying a first chromosome or chromosomal locus relative to a
second chromosome or chromosomal locus in a sample of nucleic acid
obtained from an individual, comprising
[0279] contacting the sample with a first set of probes and a
second set of probes, wherein the probes of the first set each
specifically recognise a distinct target sequence within the first
chromosome or chromosomal locus and wherein the probes of the
second set each specifically recognise a distinct target sequence
within the second chromosome or chromosomal locus,
[0280] providing conditions under which the target sequences in the
first and second chromosomes or chromosomal loci are at least
partially single stranded,
[0281] providing conditions for annealing and ligation, under which
conditions the probes hybridise to their target sequences and
generate ligation products,
[0282] detecting a first cumulative signal which is a combination
of individual signals from the ligation products generated by
probes of the first set, and quantifying it to determine a first
signal level, wherein the first signal level is proportional to the
quantity of the first chromosome or chromosomal locus in the
sample,
[0283] detecting a second cumulative signal which is a combination
of individual signals from the ligation products generated by
probes of the second set, and quantifying it to determine a second
signal level, wherein the second signal level is proportional to
the quantity of the second chromosome or chromosomal locus in the
sample, and
[0284] comparing the first and second signal levels, thereby
determining the relative quantities of the first and second
chromosomes or first and second chromosomal loci in the sample.
87. A method according to clause 83 or clause 86, for diagnosing
trisomy in a foetus, wherein the sample of nucleic acid is a sample
of cell free foetal DNA obtained from the mother's blood, and
wherein an unequal ratio of the first and second signal levels is
indicative of trisomy. 88. A nucleic acid probe for binding a
single stranded target nucleic acid fragment, wherein the probe
comprises
[0285] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0286] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail sequences are complementary
to the upstream and downstream flanking sequences respectively
[0287] so that under annealing conditions in the presence of the
target fragment, the head and tail sequences hybridise to the
flanking sequences, defining a gap between the 5' end of the head
sequence and the 3' end of the tail sequence, wherein the target
fragment hybridises to the target-complementary sequence in the
gap, thereby positioning the ends of the target fragment in
juxtaposition with the 5' end of the head sequence and the 3' end
of the tail sequences, and wherein
[0288] hybridisation of the target fragment in the gap completes a
circle of nucleic acid, the circle comprising the target fragment
and the head and tail sequences.
89. A nucleic acid probe according to clause 88, wherein the head
and/or tail sequence is joined to a custom sequence, wherein the
custom sequence is not complementary to other regions of the probe
or to the target fragment. 90. A nucleic acid probe according to
clause 88 or clause 89, wherein a single nucleic acid molecule
comprises the head and tail sequences. 91. A probe according to
clause 88 or clause 89, wherein the head and tail sequences are
separate from the targeting oligonucleotide and bind in trans to
the flanking sequences. 92. A probe according to clause 91, wherein
the head and tail sequences are at 5' and 3' ends respectively of a
backbone oligonucleotide. 93. A probe according to clause 92,
wherein the backbone oligonucleotide comprises a custom sequence
between the head and tail sequences, wherein the custom sequence is
not complementary to other regions of the probe or to the target
fragment. 94. A probe according to cause 92, wherein the head and
tail sequences of the backbone oligonucleotide are adjacent. 95. A
nucleic acid probe for binding a single stranded target nucleic
acid fragment, wherein the probe comprises
[0289] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide, and
[0290] head and tail sequences having free 5' and 3' ends
respectively, wherein the head and tail oligonucleotide sequences
are complementary to the upstream and downstream flanking sequences
respectively
[0291] so that under annealing conditions in the presence of the
target fragment, the head and tail sequences hybridise to the
flanking sequences, defining a gap between the 5' end of the head
sequence and the 3' end of the tail sequence, wherein the target
fragment hybridises to the target-complementary sequence in the
gap, thereby positioning the ends of the target fragment in
juxtaposition with the 5' end of the head sequence and the 3' end
of the tail sequences, and wherein
[0292] the head sequence is a 5' end of the targeting
oligonucleotide and/or the tail sequence is a 3' end of the
targeting oligonucleotide, so that hybridisation of the target
fragment in the gap completes a strand of nucleic acid comprising
the target fragment, the head and tail sequences, the target
complementary sequence and the flanking sequences.
96. A probe according to clause 88 or clause 95, wherein the head
and tail sequences are at ends of the targeting oligonucleotide and
bind in cis to the flanking sequences. 97. A probe according to
clause 88 or clause 95, wherein the tail sequence is a 3' end of
the targeting oligonucleotide and the head sequence is a 5' end of
a backbone oligonucleotide separate from the targeting
oligonucleotide. 98. A probe according to clause 88 or clause 95,
wherein the head sequence is a 5' end of the targeting
oligonucleotide and the tail sequence is a 3' end of a backbone
oligonucleotide separate from the targeting oligonucleotide. 99. A
probe according to clause 97 or clause 98, wherein the backbone
oligonucleotide further comprises a custom sequence, wherein the
custom sequence is not complementary to other regions of the probe
or to the target fragment. 100. A nucleic acid probe for binding a
single stranded target nucleic acid fragment, wherein the probe
comprises
[0293] a targeting oligonucleotide which is longer than the target
fragment and contains an internal target-complementary sequence, so
that hybridisation between the targeting oligonucleotide and the
target fragment forms a double stranded sequence located between
upstream and downstream flanking sequences of the targeting
oligonucleotide,
[0294] a backbone oligonucleotide comprising a head sequence having
a free 5' end, and
[0295] a backbone oligonucleotide comprising a tail sequence having
a free 3' end,
[0296] wherein the head and tail oligonucleotide sequences are
complementary to the upstream and downstream flanking sequences
respectively, and wherein
[0297] one backbone oligonucleotide carries a capture moiety and
the other backbone oligonucleotide carries a heterogeneous
label,
[0298] so that under annealing conditions in the presence of the
target fragment, the head and tail sequences hybridise to the
flanking sequences, defining a gap between the 5' end of the head
sequence and the 3' end of the tail sequence, wherein the target
fragment hybridises to the target-complementary sequence in the
gap, thereby positioning the ends of the target fragment in
juxtaposition with the 5' end 01 the head sequence and the 3' end
of the tail sequences, and wherein
[0299] hybridisation of the target fragment in the gap completes a
strand of nucleic acid comprising the target fragment and the head
and tail sequences, wherein the strand carries the capture moiety
and the label.
101. A probe according to clause 100, wherein the capture moiety is
biotin. 102. A probe according to clause 100 or clause 101, wherein
the label is a fluorophore. 103. A probe according to any of
clauses 100 to 102, wherein one or both backbone oligonucleotides
further comprise a custom sequence, wherein the custom sequence is
not complementary to other regions of the probe or to the target
fragment. 104. A probe according to any of clauses 88 to 103,
wherein the targeting oligonucleotide further comprises a custom
sequence which is not complementary to other regions of the probe
or to the target fragment. 105. A probe according to any of clauses
88 to 104 clause, wherein the target-complementary sequence has a
length of 10 to 30 nucleotides. 106. A probe according to any of
clauses 88 to 105, wherein the target-complementary sequence has
fewer than 5 base pair mismatches with the target fragment. 107. A
probe according to clause 106, wherein the target-complementary
sequence is the exact complement of the target fragment. 108. A
probe according to any of clauses 88 to 107, wherein the flanking
sequences each have a length of 10 to 30 nucleotides. 109. A probe
according to any of clauses 88 to 108, wherein the upstream and
downstream flanking sequences of the targeting oligonucleotide are
different from each other. 110. A probe according to any of clauses
88 to 109, wherein the head sequence has fewer than 5 base pair
mismatches with the upstream flanking sequence and the tail
sequence has fewer than 5 base pair mismatches with the downstream
flanking sequence. 111. A probe according to clause 110, wherein
the head and tail sequences are the exact complement of the
flanking sequences. 112. A probe according to any of clauses 88 to
111, wherein the targeting oligonucleotide is linear. 113. A probe
according to any of clauses 88 to 112, wherein the target fragment
is a restriction endonuclease fragment. 114. A probe according to
any of clauses 88 to 113, wherein the target fragment is a human
genome fragment. 115. A probe according to clause 114, wherein the
target fragment is a human genome fragment specific to one
chromosome. 116. A probe according to clause 115, wherein the
target fragment is specific to one locus of the human genome. 117.
A probe according to any of clauses 88 to 116, wherein the probe
nucleic acid is DNA. 118. A set of probes for binding single
stranded target nucleic acid fragments, comprising a plurality of
probes according to any of clauses 88 to 117, the probes having a
plurality of different target-complementary sequences for the
binding multiple different target fragments. 119. A set of probes
according to clause 118 which is for binding multiple fragments of
a human chromosome, wherein each probe in the set is for binding a
different target fragment specific to that chromosome. 120. A set
of probes according to clause 119, wherein the probes share a
common custom sequence. 121. Sets of probes for binding different
fragments of two or more human chromosomes, comprising:
[0300] a first set of probes for binding a plurality of target
fragments specific to a first chromosome, and
[0301] a second set of probes for binding a plurality of target
fragments specific to a second chromosome, and optionally
[0302] one or more further sets of probes for binding a plurality
of target fragments specific to one or more further
chromosomes.
122. Sets of probes according to clause 121, wherein the probes
within a set share a custom sequence which is common to that set
and differs from the custom sequences of probes in other sets. 123.
A kit comprising a set or sets of probes according to any of
clauses 118 to 122 in solution in one or more containers. 124. Use
of a probe according to any clauses 88 to 117, a set or sets of
probes according to any of clauses 118 to 122, or a kit according
to clause 123, for testing a sample for the presence of a species
of nucleic acid. 125. Use of a set of probes for testing a sample
for the presence of target fragments obtained from a species of
nucleic acid,
[0303] wherein each probe of the set comprises a targeting
oligonucleotide containing a sequence which is the exact complement
of a target fragment, and head and tail oligonucleotide sequences
which hybridise adjacent to the target fragment on the targeting
oligonucleotide,
[0304] wherein hybridisation between the target fragment and the
probe templates the target fragment for ligation to the head and
tail sequences.
[0305] An embodiment provides a method of sample analysis,
comprising:
[0306] a) hybridizing a sample comprising fragmented DNA with a
probe mix comprising a first set of probes, wherein the probes of
the first set of probes: [0307] i. hybridize to different sites in
a first chromosome; and [0308] ii. form non-covalently circular
products containing ligatably adjacent junctions when hybridized to
DNA fragments from the first chromosome;
[0309] b) ligating the ligatably adjacent junctions together to
produce a plurality of covalently circular ligation products;
[0310] c) amplifying the covalently circular ligation products by
rolling ircle amplification (RCA) to produce a plurality of RCA
product molecules;
[0311] d) labeling the RCA product molecules; and
[0312] e) quantifying the number of labeled RCA product molecules
produced in step d), thereby providing an estimate of the amount of
DNA corresponding to the first chromosome in the sample.
[0313] In any embodiment, the first chromosome may be chromosome
21, 13 or 18.
[0314] In any embodiment, the probe mix may comprises a second set
of probes, wherein the probes of the second set of probes hybridize
to different sites in a second chromosome and form non-covalently
circular products containing ligatably adjacent junctions when
hybridized to DNA fragments from the second chromosome; and step e)
comprises separately quantifying the number of rolling circle
amplification product molecules that correspond to the first and
second chromosomes, thereby providing an estimate of the relative
amount of DNA corresponding to the first and second chromosomes in
the sample.
[0315] In some embodiments, the first set of probes hybridize to
different sites in a first region of a first chromosome. In these
embodiments, the probe mix may comprises a second set of probes,
wherein the probes of the second set of probes hybridize to
different sites in a second region in the first chromosome and form
non-covalently circular products containing ligatably adjacent
junctions when hybridized to DNA fragments from the second
chromosome; and step e) comprises separately quantifying the number
of rolling circle amplification product molecules that correspond
to the first and second regions of the first chromosomes, thereby
providing an estimate of the relative amount of DNA corresponding
to the first and second regions of the first chromosome in the
sample.
[0316] In any embodiment, the first chromosome is chromosome 21 and
the second chromosome is selected from chromosome 13 and chromosome
18.
[0317] In any embodiment, each of the non-covalently circular
products comprises a fragment of DNA from the sample. In these
embodiments, the probes of step a) may comprise: [0318] i, a head
sequence and a tail sequence, wherein the head and tail sequences
are at the ends of a first oligonucleotide molecule; and [0319] ii.
a splint sequence comprising, in order: [0320] an upstream flanking
sequence that is complementary to the head sequence; [0321] a
target complementary sequence that is complementary to a target
fragment; and [0322] a downstream flanking sequence that is
complementary to the tail sequence; [0323] and, in the
non-covalently circular products, the ends of the target fragment
are ligatably adjacent to the ends of the head and tail sequences
in the first oligonucleotide molecule.
[0324] In these embodiments, the splint sequence may be in the
first oligonucleotide molecule. Alternatively, the splint sequence
may be in a second oligonucleotide molecule.
[0325] In any embodiment, the sample may digested with a
restriction enzyme.
[0326] In any embodiment, the sample comprises genomic DNA, e.g.,
cell-free DNA isolated from blood.
[0327] In any embodiment, the sample may comprise cell-free DNA
isolated from the bloodstream of a pregnant human.
[0328] In any embodiment, the chromosome may be isolated from a
tissue biopsy.
[0329] In any embodiment, the chromosome may be a microbial
chromosome.
[0330] In any embodiment, the quantifying step may be done by
separating individual rolling circle amplification product
molecules produced in step c) from one another, and counting tile
number of individual roiling circle amplification product molecules
in a defined area or volume.
[0331] In these embodiments, the quantifying step may be done
by:
[0332] i. hybridizing a labeled oligonucleotide to the RCA product
molecules, wherein the labeled oligonucleotide hybridizes to a
sequence that is repeated in the RCA product, thereby producing a
plurality of complexes that each comprise a single RCA product and
a plurality of labeled oligonucleotides that are hybridized to the
RCA product; and
[0333] ii. counting the number of labeled complexes.
[0334] In these embodiments, the quantifying step may be done
by:
[0335] (a) obtaining a substrate comprising the labeled complexes
distributed on the surface of the substrate; and
[0336] (b) counting the number of RCA products that are present in
the first area of the substrate.
[0337] In these embodiments, the method may comprise:
[0338] (a) obtaining a substrate comprising a first and second
pluralities of complexes distributed on the surface of the
substrate, wherein each of the complexes comprises a single RCA
product and a plurality of labeled oligonucleotide probes that are
hybridized to the RCA product, the first and second pluralities of
complexes are distinguish