U.S. patent application number 16/517965 was filed with the patent office on 2020-05-07 for anti-il-6 antibodies for the treatment of anemia.
The applicant listed for this patent is ALDERBIO HOLDINGS LLC. Invention is credited to Jeffrey T.L. Smith.
Application Number | 20200140539 16/517965 |
Document ID | / |
Family ID | 46064554 |
Filed Date | 2020-05-07 |
View All Diagrams
United States Patent
Application |
20200140539 |
Kind Code |
A1 |
Smith; Jeffrey T.L. |
May 7, 2020 |
ANTI-IL-6 ANTIBODIES FOR THE TREATMENT OF ANEMIA
Abstract
The present invention is directed to therapeutic methods using
IL-6 antagonists such as anti-IL-6 antibodies and fragments thereof
having binding specificity for IL-6 to prevent or treat anemia
(e.g., anemia associated with chemotherapy) including persons on a
treatment regimen with a drug or chemotherapy and/or radiation for
cancer (e.g., head and neck cancer) that is associated with
increased risk of anemia.
Inventors: |
Smith; Jeffrey T.L.;
(Bellevue, WA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ALDERBIO HOLDINGS LLC |
LAS VEGAS |
NV |
US |
|
|
Family ID: |
46064554 |
Appl. No.: |
16/517965 |
Filed: |
July 22, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15055005 |
Feb 26, 2016 |
|
|
|
16517965 |
|
|
|
|
13304233 |
Nov 23, 2011 |
9304134 |
|
|
15055005 |
|
|
|
|
61511797 |
Jul 26, 2011 |
|
|
|
61489857 |
May 25, 2011 |
|
|
|
61416363 |
Nov 23, 2010 |
|
|
|
61416343 |
Nov 23, 2010 |
|
|
|
61416332 |
Nov 23, 2010 |
|
|
|
61416351 |
Nov 23, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 16/248 20130101;
A61P 35/00 20180101; C07K 2317/76 20130101; A61K 31/713 20130101;
A61P 1/08 20180101; C07K 2317/92 20130101; A61K 2039/545 20130101;
A61K 31/454 20130101; A61P 1/00 20180101; G01N 33/57484 20130101;
A61P 7/06 20180101; A61K 39/3955 20130101; G01N 33/57407 20130101;
C07K 2317/565 20130101; A61P 1/12 20180101; A61K 31/7105 20130101;
C07K 2317/94 20130101; G01N 2800/52 20130101; A61P 7/00 20180101;
A61K 2039/505 20130101; A61K 45/06 20130101; C07K 2317/34 20130101;
C07K 2317/24 20130101; A61P 35/02 20180101; A61K 38/204
20130101 |
International
Class: |
C07K 16/24 20060101
C07K016/24; A61K 31/454 20060101 A61K031/454; A61K 31/7105 20060101
A61K031/7105; A61K 31/713 20060101 A61K031/713; A61K 38/20 20060101
A61K038/20; G01N 33/574 20060101 G01N033/574; A61K 39/395 20060101
A61K039/395; A61K 45/06 20060101 A61K045/06 |
Claims
1. A method of treating or preventing anemia comprising
administration of a composition comprising an effective amount of
IL-6 antagonist.
2-418. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This patent application is a continuation of U.S. patent
application Ser. No. 15/055,005 filed Feb. 26, 2016, which is a
divisional of U.S. patent application Ser. No. 13/304,233 filed
Nov. 23, 2011 (now U.S. Pat. No. 9,304,134) and claims priority to
U.S. Provisional Patent Application No. 61/416,332, filed Nov. 23,
2010; U.S. Provisional Patent Application No. 61/416,343, filed
Nov. 23, 2010; U.S. Provisional Patent Application No. 61/416,351,
filed Nov. 23, 2010; U.S. Provisional Patent Application No.
61/416,363, filed Nov. 23, 2010; U.S. Provisional Patent
Application No. 61/511,797, filed Jul. 26, 2011; and U.S.
Provisional Patent Application No. 61/489,857, filed May 25, 2011,
the disclosures of each of which are herein incorporated by
reference in their entirety. The sequence listing in the file named
"56256o2811.txt" having a size of 343,904 bytes that was created
Jul. 22, 2019 is hereby incorporated by reference in its
entirety.
FIELD OF THE INVENTION
[0002] IL-6 antagonists, including anti-IL-6 antibodies and
antigen-binding fragments thereof, may be used to reduce C-reactive
protein ("CRP levels") and inflammation and in methods and
compositions for the treatment and prevention of anemia, including
anemia associated with chemotherapy or radiography.
BACKGROUND OF THE INVENTION
Interleukin-6 (IL-6)
[0003] Interleukin-6 ("IL-6") is a multifunctional cytokine
involved in numerous biological processes such as the regulation of
the acute inflammatory response, the modulation of specific immune
responses including B- and T-cell differentiation, bone metabolism,
thrombopoiesis, epidermal proliferation, menses, neuronal cell
differentiation, neuroprotection, aging, cancer, and the
inflammatory reaction occurring in Alzheimer's disease. See
Papassotiropoulos, et al. (2001) Neurobiology of Aging 22:
863-871.
[0004] IL-6 is a member of a family of cytokines that promote
cellular responses through a receptor complex consisting of at
least one subunit of the signal-transducing glycoprotein gp130 and
the IL-6 receptor ("IL-6R") (also known as gp80). The IL-6R may
also be present in a soluble form ("slL-6R"). IL-6 binds to IL-6R,
which then dimerizes the signal-transducing receptor gp130. See
Jones (2005) Immunology 175: 3463-3468.
[0005] IL-6 is a pleiotropic pro-inflammatory cytokine, which
regulates the acute phase response and the transition from the
innate to the adaptive immune response. IL-6 increases hepatic
synthesis of proteins that are involved in the `acute phase
response` leading to symptoms such as fever, chills, and fatigue.
It stimulates B cell differentiation and secretion of antibodies
and prevents apoptosis of activated B cells. IL-6 activates and
induces proliferation of T cells and in the presence of IL-2,
induces differentiation of mature and immature CD8 T cells into
cytotoxic T cells. IL-6 is also involved in the differentiation of
Th17 cells and IL-17 production and inhibits regulatory T cells
(Treg) differentiation. IL-6 also activates osteoclasts,
synoviocytes, neutrophils, and other hematopoietic cells. Park, et
al. (2007) Bulletin of the NYU Hospital for Joint Diseases 65
(suppl 1): S4-10; Guerne, et al. (1989) J Clin Invest. 83(2):
585-92; Houssiau, et al. (1988) Arthritis Rheum. 31(6): 784-8;
Nishimotor, et al. (2006) Nat Clin Pract Rheumatol. 2(11): 619-26;
Kishimoto (1989) Blood 74(1): 1-10; and Van Snick (1990) Annu Rev
Immunol. 8: 253-78.
[0006] In humans, the gene encoding IL-6 is organized in five exons
and four introns, and maps to the short arm of chromosome 7 at
7p21. Translation of IL-6 RNA and post-translational processing
result in the formation of a 21 to 28 kDa protein with 184 amino
acids in its mature form. See Papassotiropoulos, et al. (2001)
Neurobiology of Aging 22:863-871.
[0007] The function of IL-6 is not restricted to the immune
response as it acts in hematopoiesis, thrombopoiesis, osteoclast
formation, elicitation of hepatic acute phase response resulting in
the elevation of C-reactive protein (CRP) and serum amyloid A (SAA)
protein. It is known to be a growth factor for epidermal
keratinocytes, renal mesangial cells, myeloma and plasmacytoma
cells. Grossman, et al. (1989) Prot Natl Acad Sci. 86(16):
6367-6371; Horii, et al. (1989) J Immunol. 143(12): 3949-3955; and
Kawano, et al. (1988) Nature 332: 83-85. IL-6 is produced by a wide
range of cell types including monocytes/macrophages, fibroblasts,
epidermal keratinocytes, vascular endothelial cells, renal
mesangial cells, glial cells, condrocytes, T and B-cells and some
tumor cells. Akira, et al. (1990) FASEB J. 4(11): 2860-2867. Except
for tumor cells that constitutively produce IL-6, normal cells do
not express IL-6 unless appropriately stimulated.
[0008] Elevated IL-6 levels have been observed in many types of
cancer, including breast cancer, leukemia, ovarian cancer, prostate
cancer, pancreatic cancer, lymphoma, lung cancer, renal cell
carcinoma, colorectal cancer, and multiple myeloma. See, e.g.,
Chopra, et al. (2004) MJAFI 60:45-49; Songur, et al. (2004) Tumori
90:196-200; Blay, et al. (1992) Cancer Research 52: 3317-3322;
Nikiteas, et al. (2005) World J. Gasterenterol. 11:1639-1643;
reviewed in Heikkila, et al. (2008) Eur J Cancer 44:937-945.
Clinical studies (reviewed in Trikha, et al. (2003) Clinical Cancer
Research 9: 4653-4665) have shown some improvement in patient
outcomes due to administration of various anti-IL-6 antibodies,
particularly in those cancers in which IL-6 plays a direct role
promoting cancer cell proliferation or survival.
[0009] As noted above, IL-6 stimulates the hepatic acute phase
response, resulting in increased production of CRP and elevated
serum CRP levels. For this reason, C-reactive protein (CRP) has
been reported to comprise a surrogate marker of IL-6 activity.
Thus, elevated IL-6 activity can be detected through measurement of
serum CRP. Conversely, effective suppression of IL-6 activity,
e.g., through administration of a neutralizing anti-IL-6 antibody,
can be detected by the resulting decrease in serum CRP levels.
[0010] IL-6 is believed to play a role in the development of a
multitude of diseases and disorders, including but not limited to
fatigue, cachexia, autoimmune diseases, diseases of the skeletal
system, cancer, heart disease, obesity, diabetes, asthma,
Alzheimer's disease and multiple sclerosis. See, e.g., WO
2011/066374, WO 2011/066371, WO 2011/066378, and WO
2011/066369.
[0011] A recent clinical trial demonstrated that administration of
rosuvastatin to apparently healthy individuals having elevated CRP
(greater than 2.0 mg/1) reduced their CRP levels by 37% and greatly
decreased the incidence of myocardial infarction, stroke, arterial
revascularization, hospitalization for unstable angina, or death
from cardiovascular causes. Ridker et al., N Engl J Med. 2008 Nov.
9 [Epub ahead of print].
[0012] In addition to its direct role in pathogenesis of some
cancers and other diseases, chronically elevated IL-6 levels appear
to adversely affect patient well-being and quality of life. For
example, elevated IL-6 levels have been reported to be associated
with cachexia and fever, and reduced serum albumin. Gauldie, et al.
(1987) PNAS 84: 7251-7253; Heinric, et al. (1990) Biochem J.
265(3): 621-636; Zamir, et al. (1993) Metabolism 42: 204-208;
Zamir, et al. (1992) Arch Surg 127: 170-174. Inhibition of IL-6 by
a neutralizing antibody has been reported to ameliorate fever and
cachexia in cancer patients, though improvement in these patients'
serum albumin level has not been reported. Emille, et al. (1994)
Blood 84: 2472-2479; Blay, et al. (1992) Cancer Research 52:
3317-3322; Bataille, et al. (1995) Blood 86: 685-691.
Anemia
[0013] Anemia is a condition where a decrease in the number of red
blood cells (RBCs) or hemoglobin results in a diminished ability of
the blood to carry oxygen. A cardinal sign of anemia is a serum
hemoglobin level less than about 14.0 g/dL for men and less than
12.0 g/dL for women (or less than about 11.0 g/L hemoglobin for
both men and women). See Auerbach, et al. (2004) Journal of
Clinical Oncology 22(7): 1301-1307. Symptoms of anemia generally
include fatigue, lack of energy, lightheadedness or dizziness,
especially when sitting up rapidly, or standing, shortness of
breath, headaches, a pale appearance, rapid heart rate or
palpitations, and chest pain. Anemia may be experienced in patients
with cancer (e.g., cancer-related anemia), as well as patients
undergoing chemotherapy (e.g., chemotherapy-related anemia),
radiotherapy (e.g., intensity-modulated radiotherapy (IMRT)), or
drug therapy (e.g., drug-induced immune hemolytic anemia (DIIHA)).
Garratty (2009) Hematology 1: 73-79; Hinkel, et al. (2010) Journal
of the National Comprehensive Cancer Network 8(7): S-38-S-55;
[0014] Anemia is common in cancer where about 30% of
newly-diagnosed untreated cancer patients exhibit anemia and 75% of
cancer patients suffering from anemia at some time during the
illness. Over 62% of cancer patients experience anemia during
treatment and 38% suffer from anemia during follow-up.
Cancer-related anemia has been linked to IL-6 expression in mouse
models inoculated with IL-6 producing tumor cells. This
cancer-related anemia was successfully prevented by blocking the
IL-6 receptor by administration of an anti-IL-6 receptor antibody.
Mori, et al. (2009) Biomedical Research 30(1): 47-51; Groopman
& Itri (1999) Journal of National Cancer Institute 91(19):
1616-1634; and Prabhash, et al. (2011) Indian J Cancer 48:
1-10.
[0015] Anemia a major side effects of chemotherapy. Common symptoms
of anemia include fatigue, lack of energy, dizziness, headaches,
diminished sex drive, rapid heartbeat, inability to concentrate,
paleness, and shortness of breath. Seventy-eight percent of
chemotherapy patients experience fatigue. "Chemotherapy-Related
Anemia Guide." Patient Advocate Foundation Website (2011). In
response to chemotherapy the patient experiences an inflammatory
response including the production of IL-6 which acts on the liver
to produce hepcidin which, in turn, inhibits ferroportin,
macrophage iron release, and intestinal iron absorption. Thus, IL-6
production, via hepcidin, causes to a drop in iron level and leads
to anemia. Inflammatory cytokines also appear to affect other
important elements of iron metabolism, including decreasing
ferroportin expression, and probably directly blunting
erythropoiesis by decreasing the ability of the bone marrow to
respond to erythropoietin. Nemeth, et al. (2004) J Clinical Invest.
113(9): 1251-3 and Andrews (2004) The Journal of Clinical
Investigation 113(9: 1251-1253; See also Atkins, et al. (1995)
Blood 86(4): 1288-1291.
[0016] Treatment of anemia includes blood transfusion, iron
supplements (e.g., oral or intravenous), and medications that
stimulate the formation of red blood cells (e.g., Epoetin alfa
(Epogen.RTM., Procrit.RTM.) and Darbepoetin alfa (Aranesp.RTM.).
See Groopman & Itri (1999) Journal of the National Cancer
Institute 91(19): 1616-1634. However, many patients with anemia,
including chemotherapy-associated anemia do not response well to
blood transfusion, iron supplements, or erthyropoietin therapy.
See, e.g., Auerbach, et al. (2004) Journal of Clinical Oncology
22(7): 1301-1307 and Smith, et al. (2008) Journal of Clinical
Oncology 26(7): 1040-1050. Therefore, a need exists for an improved
therapeutics for anemia including chemotherapy-associated anemia.
The invention described herein provides compositions IL-6
antagonists, including anti-IL-6 antibodies and antibody fragments
thereof, and methods of use which may be used for the prevention
and treatment of anemia, including anemia associated with
chemotherapy, anemia associated with radiotherapy, and drug-induced
immune hemolytic anemia (DIIHA).
SUMMARY OF THE INVENTION
[0017] The present invention provides compositions comprising IL-6
antagonists and methods of use thereof for treating anemia. In one
embodiment, the anemia may be associated with cancer, chemotherapy,
radiotherapy, the combination of chemotherapy and radiotherapy, or
drug-induced immune hemolytic anemia (DIIHA). In one embodiment of
the invention, the IL-6 antagonist may target IL-6, IL-6 receptor
alpha, gp130, p.sup.38 MAP kinase, JAK1, JAK2, JAK3, STAT3, SYK, or
any combination thereof. In one embodiment of the invention, the
IL-6 antagonist may be an antibody, an antibody fragment, a
peptide, a glycoalkoid, an antisense nucleic acid, a ribozyme, a
retinoid, an avemir, a small molecule, or any combination thereof.
In one embodiment of the invention, the IL-6 antagonist may be an
anti-IL-6R, anti-gp130, anti-p38 MAP kinase, anti-JAK1, anti-JAK2,
anti-JAK3, anti-STAT3, or anti-SYK antibody or antibody fragment.
In one embodiment of the invention, the IL-6 antagonist may be a
small molecule comprising thalidomide, lenalidomide, or any
combination thereof. In one embodiment of the invention, the IL-6
antagonist may be is an anti-IL-6 antibody or antibody
fragment.
[0018] The present invention provides compositions comprising
humanized monoclonal antibodies that selectively bind IL-6 and
methods of treating anemia. In one embodiment, anti-IL-6 antibodies
(e.g., ALD518 antibodies, also known as Ab1) may be used in methods
for the treatment of anemia. In this embodiment of the invention
anti-IL-6 antibody or antibody fragment may be administered
prophylactically to patients at significant risk of developing
anemia. The invention also provides for humanized monoclonal
anti-IL-6 antibodies may be used in the treatment of anemia. The
present invention further includes the prevention or treatment of
inflammatory conditions by administration of anti-IL-6 antibodies
according to the invention.
[0019] In one embodiment, the invention provides for a method of
treating or preventing anemia comprising administration of a
composition comprising an effective amount of an IL-6 antagonist.
In another embodiment, a method of treating or preventing
drug-induced immune hemolytic anemia (DIIHA) may comprise
administration of a composition comprising an effective amount of
an IL-6 antagonist. In another embodiment, a method of treating or
preventing anemia associated with chemotherapy may comprise
administration of a composition comprising an effective amount of
an IL-6 antagonist. In another embodiment, a method of treating or
preventing anemia associated with radiotherapy may comprise
administration of a composition comprising an effective amount of
an IL-6 antagonist. In another embodiment, a method of treating or
preventing anemia associated with cancer may comprise
administration of a composition comprising an effective amount of
an IL-6 antagonist.
[0020] In one embodiment, the invention provides for the use of an
IL-6 antagonist in the manufacture of a medicament for the
treatment or prevention of anemia. In further embodiment, the
invention provides for the use of an IL-6 antagonist in the
manufacture of a medicament for the treatment or prevention of
drug-induced immune hemolytic anemia (DIIHA). In further
embodiment, the invention provides for the use of an IL-6
antagonist in the manufacture of a medicament for the treatment or
prevention of anemia associated with chemotherapy. In further
embodiment, the invention provides for the use of an IL-6
antagonist in the manufacture of a medicament for the treatment or
prevention of anemia associated with radiotherapy. In further
embodiment, the invention provides for the use of an IL-6
antagonist in the manufacture of a medicament for the treatment or
prevention of anemia associated with cancer.
[0021] The invention provides a method of treating or preventing
anemia comprising administration of a composition comprising an
effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9,
Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20,
Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31,
Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antibody fragment
thereof, to a subject in need thereof, wherein the antibody, or
antibody fragment thereof, specifically binds to IL-6.
[0022] The invention also provides a method of treating anemia
comprising administration of a composition comprising an effective
amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10,
Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21,
Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32,
Ab33, Ab34, Ab35, or Ab36 antibody, or an antibody fragment
thereof, to a subject in need thereof, wherein the antibody, or
antibody fragment thereof, specifically binds to IL-6.
[0023] The invention further provides a method of preventing anemia
comprising administration of a composition comprising an effective
amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10,
Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21,
Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32,
Ab33, Ab34, Ab35, or Ab36 antibody, or an antibody fragment
thereof, to a subject in need thereof, wherein the antibody, or
antibody fragment thereof, specifically binds to IL-6.
[0024] The invention provides a composition for the treatment or
prevention of anemia comprising an effective amount of an Ab1, Ab2,
Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14,
Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25,
Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36
antibody, or an antibody fragment thereof, to a subject in need
thereof, wherein the antibody, or antibody fragment thereof,
specifically binds to IL-6.
[0025] The invention also provides a composition for the treatment
of anemia comprising an effective amount of an Ab1, Ab2, Ab3, Ab4,
Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16,
Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27,
Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody,
or an antibody fragment thereof, to a subject in need thereof,
wherein the antibody, or antibody fragment thereof, specifically
binds to IL-6.
[0026] The invention further provides a composition for the
prevention of anemia comprising an effective amount of an Ab1, Ab2,
Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14,
Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25,
Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36
antibody, or an antibody fragment thereof, to a subject in need
thereof, wherein the antibody, or antibody fragment thereof,
specifically binds to IL-6.
[0027] The invention provides a composition comprising an effective
amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10,
Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21,
Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32,
Ab33, Ab34, Ab35, or Ab36 antibody, or an antibody fragment
thereof, to a subject in need thereof, wherein the antibody, or
antibody fragment thereof, specifically binds to IL-6.
[0028] The invention also provides for a pharmaceutical composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6.
[0029] The invention provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the treatment or
prevention of anemia. In a further embodiment, said composition may
be formulated for subcutaneous administration.
[0030] The invention also provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the treatment of
anemia. In a further embodiment, said composition may be formulated
for subcutaneous administration.
[0031] The invention provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the prevention of
anemia. In a further embodiment, said composition may be formulated
for subcutaneous administration.
[0032] The invention provides a method of treating or preventing
drug-induced immune hemolytic anemia (DIIHA) comprising
administration of a composition comprising an effective amount of
an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12,
Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23,
Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34,
Ab35, or Ab36 antibody, or an antibody fragment thereof, to a
subject in need thereof, wherein the antibody, or antibody fragment
thereof, specifically binds to IL-6.
[0033] The invention also provides a method of treating
drug-induced immune hemolytic anemia (DIIHA) comprising
administration of a composition comprising an effective amount of
an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12,
Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23,
Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34,
Ab35, or Ab36 antibody, or an antibody fragment thereof, to a
subject in need thereof, wherein the antibody, or antibody fragment
thereof, specifically binds to IL-6.
[0034] The invention further provides a method of preventing
drug-induced immune hemolytic anemia (DIIHA) comprising
administration of a composition comprising an effective amount of
an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12,
Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23,
Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34,
Ab35, or Ab36 antibody, or an antibody fragment thereof, to a
subject in need thereof, wherein the antibody, or antibody fragment
thereof, specifically binds to IL-6.
[0035] The invention provides a composition for the treatment or
prevention of drug-induced immune hemolytic anemia (DIIHA)
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6.
[0036] The invention also provides a composition for the treatment
of drug-induced immune hemolytic anemia (DIIHA) comprising an
effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9,
Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20,
Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31,
Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antibody fragment
thereof, to a subject in need thereof, wherein the antibody, or
antibody fragment thereof, specifically binds to IL-6.
[0037] The invention further provides a composition for the
prevention of drug-induced immune hemolytic anemia (DIIHA)
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6.
[0038] The invention provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the treatment or
prevention of drug-induced immune hemolytic anemia (DIIHA). In a
further embodiment, said composition may be formulated for
subcutaneous administration.
[0039] The invention also provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the treatment of
drug-induced immune hemolytic anemia (DIIHA). In a further
embodiment, said composition may be formulated for subcutaneous
administration.
[0040] The invention provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the prevention of
drug-induced immune hemolytic anemia (DIIHA). In a further
embodiment, said composition may be formulated for subcutaneous
administration.
[0041] The invention provides a method of treating or preventing
anemia associated with chemotherapy comprising administration of a
composition comprising an effective amount of an Ab1, Ab2, Ab3,
Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15,
Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26,
Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36
antibody, or an antibody fragment thereof, to a subject in need
thereof, wherein the antibody, or antibody fragment thereof,
specifically binds to IL-6.
[0042] The invention also provides a method of treating anemia
associated with chemotherapy comprising administration of a
composition comprising an effective amount of an Ab1, Ab2, Ab3,
Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10O, Ab11, Ab12, Ab13, Ab14, Ab15,
Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26,
Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36
antibody, or an antibody fragment thereof, to a subject in need
thereof, wherein the antibody, or antibody fragment thereof,
specifically binds to IL-6.
[0043] The invention further provides a method of preventing anemia
associated with chemotherapy comprising administration of a
composition comprising an effective amount of an Ab1, Ab2, Ab3,
Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15,
Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26,
Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36
antibody, or an antibody fragment thereof, to a subject in need
thereof, wherein the antibody, or antibody fragment thereof,
specifically binds to IL-6.
[0044] The invention provides a composition for the treatment or
prevention of anemia associated with chemotherapy comprising an
effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9,
Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20,
Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31,
Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antibody fragment
thereof, to a subject in need thereof, wherein the antibody, or
antibody fragment thereof, specifically binds to IL-6.
[0045] The invention also provides a composition for the treatment
of anemia associated with chemotherapy comprising an effective
amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10,
Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21,
Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32,
Ab33, Ab34, Ab35, or Ab36 antibody, or an antibody fragment
thereof, to a subject in need thereof, wherein the antibody, or
antibody fragment thereof, specifically binds to IL-6.
[0046] The invention further provides a composition for the
prevention of anemia associated with chemotherapy comprising an
effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9,
Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20,
Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31,
Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antibody fragment
thereof, to a subject in need thereof, wherein the antibody, or
antibody fragment thereof, specifically binds to IL-6.
[0047] The invention provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the treatment or
prevention of anemia associated with chemotherapy. In a further
embodiment, said composition may be formulated for subcutaneous
administration.
[0048] The invention also provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the treatment of
anemia associated with chemotherapy. In a further embodiment, said
composition may be formulated for subcutaneous administration.
[0049] The invention provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the prevention of
anemia associated with chemotherapy In a further embodiment, said
composition may be formulated for subcutaneous administration.
[0050] The invention provides a method of treating or preventing
anemia associated with radiotherapy comprising administration of a
composition comprising an effective amount of an Ab1, Ab2, Ab3,
Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15,
Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26,
Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36
antibody, or an antibody fragment thereof, to a subject in need
thereof, wherein the antibody, or antibody fragment thereof,
specifically binds to IL-6.
[0051] The invention also provides a method of treating anemia
associated with radiotherapy comprising administration of a
composition comprising an effective amount of an Ab1, Ab2, Ab3,
Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15,
Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26,
Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36
antibody, or an antibody fragment thereof, to a subject in need
thereof, wherein the antibody, or antibody fragment thereof,
specifically binds to IL-6.
[0052] The invention further provides a method of preventing anemia
associated with radiotherapy comprising administration of a
composition comprising an effective amount of an Ab1, Ab2, Ab3,
Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15,
Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26,
Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36
antibody, or an antibody fragment thereof, to a subject in need
thereof, wherein the antibody, or antibody fragment thereof,
specifically binds to IL-6.
[0053] The invention provides a composition for the treatment or
prevention of anemia associated with radiotherapy comprising an
effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9,
Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20,
Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31,
Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antibody fragment
thereof, to a subject in need thereof, wherein the antibody, or
antibody fragment thereof, specifically binds to IL-6.
[0054] The invention also provides a composition for the treatment
of anemia associated with radiotherapy comprising an effective
amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10,
Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21,
Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32,
Ab33, Ab34, Ab35, or Ab36 antibody, or an antibody fragment
thereof, to a subject in need thereof, wherein the antibody, or
antibody fragment thereof, specifically binds to IL-6.
[0055] The invention further provides a composition for the
prevention of anemia associated with radiotherapy comprising an
effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9,
Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20,
Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31,
Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antibody fragment
thereof, to a subject in need thereof, wherein the antibody, or
antibody fragment thereof, specifically binds to IL-6.
[0056] The invention provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the treatment or
prevention of anemia associated with radiotherapy. In a further
embodiment, said composition may be formulated for subcutaneous
administration.
[0057] The invention also provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the treatment of
anemia associated with radiotherapy s. In a further embodiment,
said composition may be formulated for subcutaneous
administration.
[0058] The invention provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the prevention of
anemia associated with radiotherapy. In a further embodiment, said
composition may be formulated for subcutaneous administration.
[0059] The invention provides a method of treating or preventing
anemia associated with cancer comprising administration of a
composition comprising an effective amount of an Ab1, Ab2, Ab3,
Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15,
Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26,
Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36
antibody, or an antibody fragment thereof, to a subject in need
thereof, wherein the antibody, or antibody fragment thereof,
specifically binds to IL-6.
[0060] The invention also provides a method of treating anemia
associated with cancer comprising administration of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6.
[0061] The invention further provides a method of preventing anemia
associated with cancer comprising administration of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
11-6.
[0062] The invention provides a composition for the treatment or
prevention of anemia associated with cancer comprising an effective
amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10,
Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21,
Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32,
Ab33, Ab34, Ab35, or Ab36 antibody, or an antibody fragment
thereof, to a subject in need thereof, wherein the antibody, or
antibody fragment thereof, specifically binds to IL-6.
[0063] The invention also provides a composition for the treatment
of anemia associated with cancer comprising an effective amount of
an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12,
Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23,
Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34,
Ab35, or Ab36 antibody, or an antibody fragment thereof, to a
subject in need thereof, wherein the antibody, or antibody fragment
thereof, specifically binds to 11-6.
[0064] The invention further provides a composition for the
prevention of anemia associated with cancer comprising an effective
amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10,
Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21,
Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32,
Ab33, Ab34, Ab35, or Ab36 antibody, or an antibody fragment
thereof, to a subject in need thereof, wherein the antibody, or
antibody fragment thereof, specifically binds to 11-6.
[0065] The invention provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the treatment or
prevention of anemia associated with cancer. In a further
embodiment, said composition may be formulated for subcutaneous
administration.
[0066] The invention also provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the treatment of
anemia associated with cancer. In a further embodiment, said
composition may be formulated for subcutaneous administration.
[0067] The invention provides for the use of a composition
comprising an effective amount of an Ab1, Ab2, Ab3, Ab4, Ab5, Ab6,
Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17,
Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28,
Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antibody fragment thereof, to a subject in need thereof, wherein
the antibody, or antibody fragment thereof, specifically binds to
IL-6, for the manufacture of a medicament for the prevention of
anemia associated with cancer. In a further embodiment, said
composition may be formulated for subcutaneous administration.
[0068] In one embodiment, the antibody may comprise at least one
light chain selected from the group consisting of an amino acid
sequence with at least about 90% sequence identity to an amino acid
sequence of SEQ ID NO: 2, 20, 21, 37, 53, 69, 85, 101, 119, 122,
138, 154, 170, 186, 202, 218, 234, 250, 266, 282, 298, 314, 330,
346, 362, 378, 394, 410, 426, 442, 458, 474, 490, 506, 522, 538,
554, 570, 647, 648, 649, 650, 651, 655, 660, 666, 667, 671, 675,
679, 683, 687, 693, 699, 702, 706, or 709. In a further embodiment,
the antibody may comprise at least one light chain selected from
the group consisting of an amino acid sequence of SEQ ID NO: 2, 20,
21, 37, 53, 69, 85, 101, 119, 122, 138, 154, 170, 186, 202, 218,
234, 250, 266, 282, 298, 314, 330, 346, 362, 378, 394, 410, 426,
442, 458, 474, 490, 506, 522, 538, 554, 570, 647, 648, 649, 650,
651, 655, 660, 666, 667, 671, 675, 679, 683, 687, 693, 699, 702,
706, or 709. In another embodiment, the antibody may comprise at
least one light chain selected from the group consisting of nucleic
acid sequences with at least 90% sequence identity to a nucleic
acid sequence of SEQ ID NO: 10, 29, 45, 61, 77, 93, 109, 130, 146,
162, 178, 194, 210, 226, 242, 258, 274, 290, 306, 322, 338, 354,
370, 386, 402, 418, 434, 450, 466, 482, 498, 514, 530, 546, 562,
578, 662, 669, 673, 677, 681, 685, 689, 698, 701, 705, 720, 721,
722, or 723, wherein said nucleic acid sequence encodes said light
chain. In further embodiment, the antibody may comprise at least
one light chain selected from the group consisting of nucleic acid
sequences of SEQ ID NO: 10, 29, 45, 61, 77, 93, 109, 130, 146, 162,
178, 194, 210, 226, 242, 258, 274, 290, 306, 322, 338, 354, 370,
386, 402, 418, 434, 450, 466, 482, 498, 514, 530, 546, 562, 578,
662, 669, 673, 677, 681, 685, 689, 698, 701, 705, 720, 721, 722, or
723, wherein said nucleic acid sequence encodes said light
chain.
[0069] In one embodiment, the antibody may comprise at least one
heavy chain selected from the group consisting of an amino acid
sequence with at least about 90% sequence identity to an amino acid
sequence of SEQ ID NO: 3, 18, 19, 22, 38, 54, 70, 86, 102, 117,
118, 123, 139, 155, 171, 187, 203, 219, 235, 251, 267, 283, 299,
315, 331, 347, 363, 379, 395, 411, 427, 443, 459, 475, 491, 507,
523, 539, 555, 571, 652, 653, 654, 655, 656, 657, 658, 661, 664,
665, 668, 672, 676, 680, 684, 688, 691, 692, 704, or 708. In
further embodiment, the antibody may comprise at least one heavy
chain selected from the group consisting of an amino acid sequence
of SEQ ID NO: 3, 18, 19, 22, 38, 54, 70, 86, 102, 117, 118, 123,
139, 155, 171, 187, 203, 219, 235, 251, 267, 283, 299, 315, 331,
347, 363, 379, 395, 411, 427, 443, 459, 475, 491, 507, 523, 539,
555, 571, 652, 653, 654, 655, 656, 657, 658, 661, 664, 665, 668,
672, 676, 680, 684, 688, 691, 692, 704, or 708. In another
embodiment, the antibody may comprise at least one heavy chain
selected from the group consisting of nucleic acid sequences with
at least 90% sequence identity to a nucleic acid sequence of SEQ ID
NO: 11, 30, 46, 62, 78, 94, 110, 131, 147, 163, 179, 195, 211, 227,
243, 259, 275, 291, 307, 323, 339, 355, 371, 387, 403, 419, 435,
451, 467, 483, 499, 515, 531, 547, 563, 579, 663, 670, 674, 678,
682, 686, 690, 700, 703, 707, 724, or 725, wherein said nucleic
acid sequence encodes said heavy chain. In further embodiment, the
antibody may comprise at least one heavy chain selected from the
group consisting of SEQ ID NO: 11, 30, 46, 62, 78, 94, 110, 131,
147, 163, 179, 195, 211, 227, 243, 259, 275, 291, 307, 323, 339,
355, 371, 387, 403, 419, 435, 451, 467, 483, 499, 515, 531, 547,
563, 579, 663, 670, 674, 678, 682, 686, 690, 700, 703, 707, 724, or
725, wherein said nucleic acid sequence encodes said heavy
chain.
[0070] In one embodiment, the antibody may comprise at least one
CDR sequence selected from the group consisting of an amino acid
sequence with at least about 90% sequence identity to an amino acid
sequence of SEQ ID NO: 4, 7, 23, 26, 39, 42, 55, 58, 71, 74, 87,
90, 103, 106, 124, 127, 140, 143, 156, 159, 172, 175, 188, 191,
204, 207, 220, 223, 236, 239, 252, 255, 268, 271, 284, 287, 300,
303, 316, 319, 332, 335, 348, 351, 364, 367, 380, 383, 396, 399,
412, 415, 428, 431, 444, 447, 460, 463, 476, 479, 492, 495, 508,
511, 524, 527, 540, 543, 556, 559, 572, 575, 710, 711, 712, 716, 5,
8, 24, 27, 40, 43, 56, 59, 72, 75, 88, 91, 104, 107, 120, 121, 125,
128, 141, 144, 157, 160, 173, 176, 189, 192, 205, 208, 221, 224,
237, 240, 253, 256, 269, 272, 285, 288, 301, 304, 317, 320, 333,
336, 349, 352, 365, 368, 381, 384, 397, 400, 413, 416, 429, 432,
445, 448, 461, 464, 477, 480, 493, 496, 509, 512, 525, 528, 541,
544, 557, 560, 573, 576, 659, 713, 714, 715, 717, 718, 6, 9, 25,
28, 41, 44, 57, 60, 73, 76, 89, 92, 105, 108, 126, 129, 142, 145,
158, 161, 174, 177, 190, 193, 206, 209, 222, 225, 238, 241, 254,
257, 270, 273, 286, 289, 302, 305, 318, 321, 334, 337, 350, 353,
366, 369, 382, 385, 398, 401, 414, 417, 430, 433, 446, 449, 462,
465, 478, 481, 494, 497, 510, 513, 526, 529, 542, 545, 558, 561,
574, or 577. In another embodiment, the antibody may comprise at
least one CDR sequence selected from the group consisting of an
amino acid sequence of SEQ ID NO: 4, 7, 23, 26, 39, 42, 55, 58, 71,
74, 87, 90, 103, 106, 124, 127, 140, 143, 156, 159, 172, 175, 188,
191, 204, 207, 220, 223, 236, 239, 252, 255, 268, 271, 284, 287,
300, 303, 316, 319, 332, 335, 348, 351, 364, 367, 380, 383, 396,
399, 412, 415, 428, 431, 444, 447, 460, 463, 476, 479, 492, 495,
508, 511, 524, 527, 540, 543, 556, 559, 572, 575, 710, 711, 712,
716, 5, 8, 24, 27, 40, 43, 56, 59, 72, 75, 88, 91, 104, 107, 120,
121, 125, 128, 141, 144, 157, 160, 173, 176, 189, 192, 205, 208,
221, 224, 237, 240, 253, 256, 269, 272, 285, 288, 301, 304, 317,
320, 333, 336, 349, 352, 365, 368, 381, 384, 397, 400, 413, 416,
429, 432, 445, 448, 461, 464, 477, 480, 493, 496, 509, 512, 525,
528, 541, 544, 557, 560, 573, 576, 659, 713, 714, 715, 717, 718, 6,
9, 25, 28, 41, 44, 57, 60, 73, 76, 89, 92, 105, 108, 126, 129, 142,
145, 158, 161, 174, 177, 190, 193, 206, 209, 222, 225, 238, 241,
254, 257, 270, 273, 286, 289, 302, 305, 318, 321, 334, 337, 350,
353, 366, 369, 382, 385, 398, 401, 414, 417, 430, 433, 446, 449,
462, 465, 478, 481, 494, 497, 510, 513, 526, 529, 542, 545, 558,
561, 574, or 577.
[0071] In one embodiment, the antibody may comprise at least one
CDR selected from the group consisting of nucleic acid sequences
with at least about 90% sequence identity to a nucleic acid
sequence of SEQ ID NO: 12, 15, 31, 34, 47, 50, 63, 66, 79, 82, 95,
98, 111, 114, 132, 135, 148, 151, 164, 167, 180, 183, 196, 199,
212, 215, 228, 231, 244, 247, 260, 263, 276, 279, 292, 295, 308,
311, 324, 327, 340, 343, 356, 359, 372, 375, 388, 391, 404, 407,
420, 423, 436, 439, 452, 455, 468, 471, 484, 487, 500, 503, 516,
519, 532, 535, 548, 551, 564, 567, 580, 583, 694, 13, 16, 32, 35,
48, 51, 64, 67, 80, 83, 96, 99, 112, 115, 133, 136, 149, 152, 165,
168, 181, 184, 197, 200, 213, 216, 229, 232, 245, 248, 261, 264,
277, 280, 293, 296, 309, 312, 325, 328, 341, 344, 357, 360, 373,
376, 389, 392, 405, 408, 421, 424, 437, 440, 453, 456, 469, 472,
485, 488, 501, 504, 517, 520, 533, 536, 549, 552, 565, 568, 581,
584, 696, 14, 17, 33, 36, 49, 52, 65, 68, 81, 84, 97, 100, 113,
116, 134, 137, 150, 153, 166, 169, 182, 185, 198, 201, 214, 217,
230, 233, 246, 249, 262, 265, 278, 281, 294, 297, 310, 313, 326,
329, 342, 345, 358, 361, 374, 377, 390, 393, 406, 409, 422, 425,
438, 441, 454, 457, 470, 473, 486, 489, 502, 505, 518, 521, 534,
537, 550, 553, 566, 569, 582, 585, 695, or 697, wherein said
nucleic acid sequence encodes said CDR sequence. In a further
embodiment, the antibody may comprise at least one CDR selected
from the group consisting of nucleic acid sequences of SEQ ID NO:
12, 15, 31, 34, 47, 50, 63, 66, 79, 82, 95, 98, 111, 114, 132, 135,
148, 151, 164, 167, 180, 183, 196, 199, 212, 215, 228, 231, 244,
247, 260, 263, 276, 279, 292, 295, 308, 311, 324, 327, 340, 343,
356, 359, 372, 375, 388, 391, 404, 407, 420, 423, 436, 439, 452,
455, 468, 471, 484, 487, 500, 503, 516, 519, 532, 535, 548, 551,
564, 567, 580, 583, 694, 13, 16, 32, 35, 48, 51, 64, 67, 80, 83,
96, 99, 112, 115, 133, 136, 149, 152, 165, 168, 181, 184, 197, 200,
213, 216, 229, 232, 245, 248, 261, 264, 277, 280, 293, 296, 309,
312, 325, 328, 341, 344, 357, 360, 373, 376, 389, 392, 405, 408,
421, 424, 437, 440, 453, 456, 469, 472, 485, 488, 501, 504, 517,
520, 533, 536, 549, 552, 565, 568, 581, 584, 696, 14, 17, 33, 36,
49, 52, 65, 68, 81, 84, 97, 100, 113, 116, 134, 137, 150, 153, 166,
169, 182, 185, 198, 201, 214, 217, 230, 233, 246, 249, 262, 265,
278, 281, 294, 297, 310, 313, 326, 329, 342, 345, 358, 361, 374,
377, 390, 393, 406, 409, 422, 425, 438, 441, 454, 457, 470, 473,
486, 489, 502, 505, 518, 521, 534, 537, 550, 553, 566, 569, 582,
585, 695, or 697, wherein said nucleic acid sequence encodes said
CDR sequence.
[0072] In another embodiment, the antibody or antibody fragment
thereof may comprise at least one light chain CDR polypeptide
selected from the group consisting of an amino acid sequence with
at least about 90% sequence identity to an amino acid sequence of
SEQ ID NO: 4, 23, 39, 55, 71, 74, 87, 103, 124, 140, 156, 172, 188,
204, 220, 236, 252, 268, 284, 300, 316, 332, 348, 364, 380, 396,
412, 428, 444, 460, 476, 492, 508, 524, 540, 556, 572, 710, 711,
712, 5, 24, 40, 56, 72, 88, 104, 125, 141, 157, 173, 189, 205, 221,
237, 253, 269, 285, 301, 317, 333, 349, 365, 381, 397, 413, 429,
445, 461, 477, 493, 509, 525, 541, 557, 573, 713, 714, 715, 718,
25, 41, 57, 73, 89, 105, 126, 142, 158, 174, 190, 206, 222, 238,
254, 270, 286, 302, 318, 334, 350, 366, 382, 398, 414, 430, 446,
462, 478, 494, 510, 526, 542, 558, or 574. In another embodiment,
the antibody or antibody fragment thereof may comprise at least one
light chain CDR1 polypeptide selected from the group consisting of
an amino acid sequence with at least about 90% sequence identity to
an amino acid sequence of SEQ ID NO: 4, 23, 39, 55, 71, 74, 87,
103, 124, 140, 156, 172, 188, 204, 220, 236, 252, 268, 284, 300,
316, 332, 348, 364, 380, 396, 412, 428, 444, 460, 476, 492, 508,
524, 540, 556, 572, 710, 711, or 712. In another embodiment, the
antibody or antibody fragment thereof may comprise at least one
light chain CDR2 polypeptide selected from the group consisting of
an amino acid sequence with at least about 90% sequence identity to
an amino acid sequence of SEQ ID NO: 5, 24, 40, 56, 72, 88, 104,
125, 141, 157, 173, 189, 205, 221, 237, 253, 269, 285, 301, 317,
333, 349, 365, 381, 397, 413, 429, 445, 461, 7 477, 493, 509, 525,
541, 557, 573, 713, 714, 715, or 718. In another embodiment, the
antibody or antibody fragment thereof may comprise at least one
light chain CDR3 polypeptide selected from the group consisting of
an amino acid sequence with at least about 90% sequence identity to
an amino acid sequence of SEQ ID NO: 6, 25, 41, 57, 73, 89, 105,
126, 142, 158, 174, 190, 206, 222, 238, 254, 270, 286, 302, 318,
334, 350, 366, 382, 398, 414, 430, 446, 462, 478, 494, 510, 526,
542, 558, or 574. In another embodiment, the antibody or antibody
fragment thereof may comprise at least two light chain CDR
polypeptides. In another embodiment, the antibody or antibody
fragment thereof may comprise three light chain CDR
polypeptides.
[0073] In another embodiment, the antibody or antibody fragment
thereof may comprise at least one heavy chain CDR polypeptide
selected from the group consisting of an amino acid sequence with
at least about 90% sequence identity to an amino acid sequence of
SEQ ID NO: 7, 26, 42, 58, 74, 90, 106, 127, 143, 159, 175, 191,
207, 223, 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399,
415, 431, 447, 463, 479, 495, 511, 527, 543, 559, 575, 716, 8, 27,
43, 59, 75, 91, 107, 120, 121, 128, 144, 160, 176, 192, 208, 224,
240, 256, 272, 288, 304, 320, 336, 352, 368, 384, 400, 416, 432,
448, 464, 480, 496, 512, 528, 544, 560, 576, 659, 717, 718, 9, 28,
44, 60, 76, 92, 108, 129, 145, 161, 177, 193, 209, 225, 241, 257,
273, 289, 305, 321, 337, 353, 369, 385, 401, 417, 433, 449, 465,
481, 497, 513, 529, 545, 561, or 577. In a further embodiment, the
antibody or antibody fragment thereof may comprise at least one
heavy chain CDR1 polypeptide selected from the group consisting of
an amino acid sequence with at least about 90% sequence identity to
an amino acid sequence of SEQ ID NO: 7, 26, 42, 58, 74, 90, 106,
127, 143, 159, 175, 191, 207, 223, 239, 255, 271, 287, 303, 319,
335, 351, 367, 383, 399, 415, 431, 447, 463, 479, 495, 511, 527,
543, 559, 575, or 716. In a further embodiment, the antibody or
antibody fragment thereof may comprise at least one heavy chain
CDR2 polypeptide selected from the group consisting of an amino
acid sequence with at least about 90% sequence identity to an amino
acid sequence of SEQ ID NO: 8, 27, 43, 59, 75, 91, 107, 120, 121,
128, 144, 160, 176, 192, 208, 224, 240, 256, 272, 288, 304, 320,
336, 352, 368, 384, 400, 416, 432, 448, 464, 480, 496, 512, 528,
544, 560, 576, 659, 717, or 718. In a further embodiment, the
antibody or antibody fragment thereof may comprise at least one
heavy chain CDR3 polypeptide selected from the group consisting of
an amino acid sequence with at least about 90% sequence identity to
an amino acid sequence of SEQ ID NO: 9, 28, 44, 60, 76, 92, 108,
129, 145, 161, 177, 193, 209, 225, 241, 257, 273, 289, 305, 321,
337, 353, 369, 385, 401, 417, 433, 449, 465, 481, 497, 513, 529,
545, 561, or 577. In a further embodiment, the antibody or antibody
fragment thereof may comprise at least two heavy chain CDR
polypeptides. In a further embodiment, the antibody or antibody
fragment thereof may comprise three heavy chain CDR
polypeptides.
[0074] In one embodiment, the light chain of said antibody may be
selected from the amino acid sequences of light chains listed in
TABLE 4. In one embodiment, the light chain of said antibody may be
selected from the amino acid sequences of heavy chains listed in
TABLE 4. In one embodiment, at least one CDR of said antibody may
be selected from the amino acid sequences of CDRs listed in TABLE
4. In another embodiment, the light chain may have at least 90%
sequence identity to an amino acid sequence listed in TABLE 4. In
another embodiment, the light chain may have at least 95% sequence
identity to an amino acid sequence listed in TABLE 4. In another
embodiment, the light chain may comprise an amino acid sequence
listed in TABLE 4. In further embodiment, the heavy chain may have
at least 90% sequence identity to an amino acid sequence listed in
TABLE 4. In further embodiment, the heavy chain may have at least
95% sequence identity to an amino acid sequence listed in TABLE 4.
In further embodiment, the heavy chain may comprise an amino acid
sequence listed in TABLE 4. In a still further embodiment, the CDR
sequence of the antibody may have at least 90% sequence identity to
an amino acid sequence listed in TABLE 4. In a still further
embodiment, the CDR sequence of the antibody may have at least 95%
sequence identity to an amino acid sequence listed in TABLE 4. In a
still further embodiment, the CDR sequence of the antibody may
comprise an amino acid sequence listed in TABLE 4.
[0075] In one embodiment, the antibody or antibody fragment
thereof, comprises at least one of the CDRs contained in the
V.sub.H polypeptide sequences comprising: SEQ ID NO: 3, 18, 19, 22,
38, 54, 70, 86, 102, 117, 118, 123, 139, 155, 171, 187, 203, 219,
235, 251, 267, 283, 299, 315, 331, 347, 363, 379, 395, 411, 427,
443, 459, 475, 491, 507, 523, 539, 555, 571, 652, 656, 657, 658,
661, 664, 665, 668, 672, 676, 680, 684, 688, 691, 692, 704, or 708
and/or at least one of the CDRs contained in the V.sub.L
polypeptide sequence consisting of: 2, 20, 21, 37, 53, 69, 85, 101,
119, 122, 138, 154, 170, 186, 202, 218, 234, 250, 266, 282, 298,
314, 330, 346, 362, 378, 394, 410, 426, 442, 458, 474, 490, 506,
522, 538, 554, 570, 647, 651, 660, 666, 667, 671, 675, 679, 683,
687, 693, 699, 702, 706, or 709.
[0076] In one embodiment, the antibody may be an Ab1 antibody. In
one embodiment, the antibody may comprise a light chain comprising
the amino acid sequence of SEQ ID NO: 2, 20, 647, 648, 649, 650,
651, 660, 666, 699, 702, 706, or 709. In one embodiment, the
antibody may comprise a humanized light chain comprising the amino
acid sequence of SEQ ID NO: 648, 649, and 650. In one embodiment,
the antibody may comprise at least one light chain CDR comprising
the amino acid sequence selected from the group consisting of SEQ
ID NO: 4, 5, 6, 710, 711, 712, 713, 714, and 715. In one
embodiment, the antibody may comprise at least one humanized light
chain CDR comprising the amino acid sequence selected from the
group consisting of SEQ ID NO: 710, 711, 712, 713, 714, and 715. In
another embodiment, the antibody may comprise a heavy chain
comprising the amino acid sequence of SEQ ID NO: 3, 18, 19, 652,
653, 654, 655, 656, 657, 658, 661, 664, 665, 704, 708. In another
embodiment, the antibody may comprise a humanized heavy chain
comprising the amino acid sequence of SEQ ID NO: 653, 654, and 655.
In another embodiment, the antibody may comprise at least one heavy
chain CDR comprising the amino acid sequence selected from the
group consisting of SEQ ID NO: 7, 9, 74, 716, 8, 120, 659, 717, and
718. In another embodiment, the antibody may comprise at least one
humanized heavy chain CDR comprising the amino acid sequence
selected from the group consisting of SEQ ID NO: 74, 716, 717, and
718. In a further embodiment, the Ab1 antibody may comprise a light
chain comprising the amino acid sequence of SEQ ID NO: 709 and a
heavy chain comprising the amino acid sequence of SEQ ID NO: 657.
In a further embodiment, the Ab1 antibody may comprise a light
chain comprising the amino acid sequence of SEQ ID NO: 20 and a
heavy chain comprising the amino acid sequence of SEQ ID NO:
19.
[0077] In one embodiment, the antibody or antibody fragment thereof
may be administered to the subject in the form of at least one
nucleic acids that encode the antibody. In one embodiment, the
light chain of said antibody or antibody fragment thereof may be
encoded by at least one of the following nucleic acid sequences of
SEQ ID NOs: 10, 29, 45, 61, 77, 93, 109, 130, 146, 162, 178, 194,
210, 226, 242, 258, 274, 290, 306, 322, 338, 354, 370, 386, 402,
418, 434, 450, 466, 482, 498, 514, 530, 546, 562, 578, 662, 669,
673, 677, 681, 685, 689, 698, 701, 705, 720, 721, 722, or 723. In
another embodiment, the heavy chain of said antibody or antibody
fragment thereof may be encoded by at least one of the following
nucleic acid sequences of SEQ ID NOs: 11, 30, 46, 62, 78, 94, 110,
131, 147, 163, 179, 195, 211, 227, 243, 259, 275, 291, 307, 323,
339, 355, 371, 387, 403, 419, 435, 451, 467, 483, 499, 515, 531,
547, 563, 579, 663, 670, 674, 678, 682, 686, 690, 700, 703, 707,
724, or 725. In another embodiment, at least one of the CDRs of
said antibody or antibody fragment thereof may be encoded by at
least one of the following nucleic acid sequences of SEQ ID NOs:
12, 15, 31, 34, 47, 50, 63, 66, 79, 82, 95, 98, 111, 114, 132, 135,
148, 151, 164, 167, 180, 183, 196, 199, 212, 215, 228, 231, 244,
247, 260, 263, 276, 279, 292, 295, 308, 311, 324, 327, 340, 343,
356, 359, 372, 375, 388, 391, 404, 407, 420, 423, 436, 439, 452,
455, 468, 471, 484, 487, 500, 503, 516, 519, 532, 535, 548, 551,
564, 567, 580, 583, 694, 13, 16, 32, 35, 48, 51, 64, 67, 80, 83,
96, 99, 112, 115, 133, 136, 149, 152, 165, 168, 181, 184, 197, 200,
213, 216, 229, 232, 245, 248, 261, 264, 277, 280, 293, 296, 309,
312, 325, 328, 341, 344, 357, 360, 373, 376, 389, 392, 405, 408,
421, 424, 437, 440, 453, 456, 469, 472, 485, 488, 501, 504, 517,
520, 533, 536, 549, 552, 565, 568, 581, 584, 696, 14, 17, 33, 36,
49, 52, 65, 68, 81, 84, 97, 100, 113, 116, 134, 137, 150, 153, 166,
169, 182, 185, 198, 201, 214, 217, 230, 233, 246, 249, 262, 265,
278, 281, 294, 297, 310, 313, 326, 329, 342, 345, 358, 361, 374,
377, 390, 393, 406, 409, 422, 425, 438, 441, 454, 457, 470, 473,
486, 489, 502, 505, 518, 521, 534, 537, 550, 553, 566, 569, 582,
585, 695, or 697. In another embodiment, at least one nucleic acids
may comprise the heavy and light chain polynucleotide sequences of
SEQ ID NO: 723 and SEQ ID NO: 700; SEQ ID NO: 701 and SEQ ID NO:
703; SEQ ID NO: 705 and SEQ ID NO: 707; SEQ ID NO: 720 and SEQ ID
NO: 724; and SEQ ID NO: 10 and SEQ ID NO: 11.
[0078] In one embodiment, the antibody or antibody fragment thereof
may be asialated. In one embodiment, the antibody or antibody
fragment thereof may be humanized. In one embodiment, the antibody
or antibody fragment thereof may have a half-life of at least about
30 days. In one embodiment, the antibody or antibody fragment
thereof may comprise the humanized variable light sequence of amino
acid sequence of SEQ ID NO: 709. In one embodiment, the antibody or
antibody fragment thereof may comprise humanized variable heavy
sequence of amino acid sequence of SEQ ID NO: 657. In another
embodiment, the antibody or antibody fragment thereof may comprise
at least one light chain CDRs as set forth in the amino acid
sequence of SEQ ID NOs: 4, 5, or 6. In another embodiment, the
antibody or antibody fragment thereof may comprise at least one
heavy chain CDRs as set forth in the amino acid sequence of SEQ ID
NOs: 7, 120, or 9. In further embodiment, the antibody or antibody
fragment thereof may be an asialated, humanized anti-IL-6
monoclonal antibody with a half-life of .about.30 days comprising
the humanized variable light and heavy sequences as set forth in
SEQ ID NO: 20 and 19. In further embodiment, the antibody or
antibody fragment thereof may be an asialated, humanized anti-IL-6
monoclonal antibody with a half-life of .about.30 days comprising
the humanized variable light and heavy sequences as set forth in
SEQ ID NO: 709 and 657.
[0079] In a preferred embodiment this is effected by the
administration of the antibodies described herein, comprising the
sequences of the V.sub.H, V.sub.L and CDR polypeptides described in
Table 4, or humanized or chimeric or single chain versions thereof
containing at least one of the CDRs of the exemplified anti-IL-6
antibody sequences and the polynucleotides encoding them.
Preferably these antibodies will be aglycosylated. In more specific
embodiments of the invention these antibodies will block gp130
activation and/or possess binding affinities (Kds) less than 50
picomolar and/or K.sub.off values less than or equal to 10.sup.-4
S.sup.-1.
[0080] The invention also contemplates methods of making said
humanized anti-IL-6 or anti-IL-6/IL-6R complex antibodies and
binding fragments and variants thereof. In one embodiment, binding
fragments include, but are not limited to, Fab, Fab', F(ab').sub.2,
Fv and scFv fragments.
[0081] In one embodiment, the anti-IL-6 antibodies block the
effects of IL-6. In another embodiment, the anti-IL-6 antibody is a
humanized monoclonal antibody that binds to free human IL-6 and
soluble IL-6R/IL-6 complex with an affinity of at least about 4 pM.
In another embodiment, the anti-IL-6 antibody, has a serum
half-life about at least 30 days. In another embodiment, the
anti-IL-6 antibody is based on a consensus human IgG1 kappa
framework that had asparagines modified to alanine to eliminate
N-glycosylation sites.
[0082] In another embodiment, the antibodies and humanized versions
may be derived from rabbit immune cells (B lymphocytes) and may be
selected based on their homology (sequence identity) to human germ
line sequences. These antibodies may require minimal or no sequence
modifications, thereby facilitating retention of functional
properties after humanization. In exemplary embodiments, the
humanized antibodies may comprise human frameworks which are highly
homologous (possess high level of sequence identity) to that of a
parent (e.g. rabbit) antibody.
[0083] In an embodiment of the invention, the anti-IL-6 antibody or
antibody fragment or variant thereof may specifically bind to the
same linear or conformational epitopes on an intact IL-6
polypeptide or fragment thereof which may include at least
fragments selected from those encompassing amino acid residues
37-51, amino acid residues 70-84, amino acid residues 169-183,
amino acid residues 31-45 and/or amino acid residues 58-72.
[0084] In a preferred exemplary embodiment, the anti-IL-6 antibody
will comprise at least one of the CDRs in listed in Table 4. In a
more preferred embodiment the anti-IL-6 antibody will comprise the
variable heavy and light chain sequences in SEQ ID NO: 657 and SEQ
ID NO: 709, or variants thereof.
[0085] In a preferred embodiment the humanized anti-IL-6 antibody
will comprise the variable heavy and variable light chain sequences
respectively set forth in SEQ ID NO: 657 and SEQ ID NO: 709, and
preferably further comprising the heavy chain and light chain
constant regions respectively set forth in SEQ ID NO: 588 and SEQ
ID NO: 586, and variants thereof comprising at least one amino acid
substitutions or deletions that do not substantially affect IL-6
binding and/or desired effector function. This embodiment also
contemplates polynucleotides comprising, or alternatively
consisting of, at least one of the nucleic acids encoding the
variable heavy chain (SEQ ID NO: 700) and variable light chain (SEQ
ID NO: 723) sequences and the constant region heavy chain (SEQ ID
NO: 589) and constant region light chain (SEQ ID NO: 587)
sequences. This embodiment further contemplates nucleic acids
encoding variants comprising at least one amino acid substitutions
or deletions to the variable heavy and variable light chain
sequences respectively set forth in SEQ ID NO: 657 and SEQ ID NO:
709 and the heavy chain and light chain constant regions
respectively set forth in SEQ ID NO: 588 and SEQ ID NO: 586, that
do not substantially affect IL-6 binding and/or desired effector
function.
[0086] In an embodiment of the invention, the anti-IL-6 antibody or
antibody fragment or variant thereof may be aglycosylated or
substantially aglycosylated, e.g., as a result of one or more
modifications in the Fc region of the antibody.
[0087] In an embodiment of the invention, the anti-IL-6 antibody or
antibody fragment or variant thereof may contain an Fc region that
has been modified to alter effector function, half-life,
proteolysis, and/or glycosylation. Preferably the Fc region is
modified to eliminate glycosylation.
[0088] In an embodiment of the invention, the anti-IL-6 antibody or
antibody fragment or variant thereof may be a human, humanized,
single chain or chimeric antibody.
[0089] In an embodiment of the invention, the anti-IL-6 antibody or
antibody fragment or variant thereof may be a humanized antibody
derived from a rabbit (parent) anti-IL-6 antibody.
[0090] In an embodiment of the invention, the framework regions
(FRs) in the variable light region and the variable heavy regions
of said anti-IL-6 antibody or antibody fragment or variant thereof
respectively may be human FRs which are unmodified or which have
been modified by the substitution of at most 2 or 3 human FR
residues in the variable light or heavy chain region with the
corresponding FR residues of the parent rabbit antibody, and the
human FRs may have been derived from human variable heavy and light
chain antibody sequences which have been selected from a library of
human germline antibody sequences based on their high level of
homology to the corresponding rabbit variable heavy or light chain
regions relative to other human germline antibody sequences
contained in the library. As disclosed in detail infra in a
preferred embodiment the antibody will comprise human FRs which are
selected based on their high level of homology (degree of sequence
identity) to that of the parent antibody that is humanized.
[0091] In one embodiment of the invention, the anti-IL-6 antibody
or antibody fragment or variant thereof may comprise a heavy chain
polypeptide sequence comprising: SEQ ID NO: 3, 18, 19, 652, 656,
657, 658, 661, 664, 665, 704, or 708; and may further comprise a VL
polypeptide sequence comprising: SEQ ID NO: 2, 20, 647, 651, 660,
666, 699, 702, 706, or 709 or a variant thereof wherein at least
one of the framework residues (FR residues) in said VH or VL
polypeptide may have been substituted with another amino acid
residue resulting in an anti-IL-6 antibody or antibody fragment or
variant thereof that specifically binds human IL-6, or may comprise
a polypeptide wherein the CDRs therein are incorporated into a
human framework homologous to said sequence. Preferably the
variable heavy and light sequences comprise those in SEQ ID NO: 657
and 709.
[0092] In an embodiment of the invention, at least one of said FR
residues may be substituted with an amino acid present at the
corresponding site in a parent rabbit anti-IL-6 antibody from which
the complementarity determining regions (CDRs) contained in said VH
or VL polypeptides have been derived or by a conservative amino
acid substitution.
[0093] In an embodiment of the invention, said anti-IL-6 antibody,
or antibody fragment or variant thereof, may be humanized. In an
embodiment of the invention, said anti-IL-6 antibody, or antibody
fragment or variant thereof, may be chimeric.
[0094] In an embodiment of the invention, said anti-IL-6 antibody,
or antibody fragment or variant thereof, further may comprise a
human Fc, e.g., an Fc region comprised of the variable heavy and
light chain constant regions set forth in SEQ ID NO: 704 and
702.
[0095] In an embodiment of the invention, said human Fc may be
derived from IgG1, IgG2, IgG3, IgG4, IgG5, IgG6, IgG7, IgG8, IgG9,
IgG10, IgG11, IgG12, IgG13, IgG14, IgG15, IgG16, IgG17, IgG18 or
IgG19.
[0096] In an embodiment of the invention, the anti-IL-6 antibody or
antibody fragment or variant thereof may comprise a polypeptide
having at least about 90% sequence homology to at least one of the
polypeptide sequences of SEQ ID NO: 3, 18, 19, 652, 656, 657, 658,
661, 664, 665, 704, 708, 2, 20, 647, 651, 660, 666, 699, 702, 706,
and 709.
[0097] In an embodiment of the invention, the anti-IL-6 antibody or
antibody fragment or variant thereof may have an elimination
half-life of at least about 30 days.
[0098] In one embodiment, the antibody, or antibody fragment
thereof, may inhibit with at least one activity associated with
IL-6. In another embodiment, the at least one activity associated
with IL-6 may be an in vitro activity comprising stimulation of
proliferation of T1165 cells; binding of IL-6 to IL-6R; activation
(dimerization) of the gp130 signal-transducing glycoprotein;
formation of IL-6/L-6R/gp130 multimers; stimulation of haptoglobin
production by HepG2 cells modified to express human IL-6 receptor;
or any combination thereof. In one embodiment, prior to
administration of the antibody, or antibody fragment thereof, the
subject may have exhibited or may be at risk for developing at
least one of the following symptoms: elevated serum C-reactive
protein ("CRP"); elevated erythrocyte sedimentation rate; or a
combination thereof.
[0099] In one embodiment, the antibody or antibody fragment thereof
may comprise a Fab, Fab', F(ab').sub.2, Fv, scFv, IgNAR, SMIP,
camelbody, or nanobody. In one embodiment, the antibody or antibody
fragment thereof may have an in vivo half-life of at least about 30
days in a healthy human subject. In one embodiment, the antibody or
antibody fragment thereof may have a binding affinity (Kd) for IL-6
of less than about 50 picomolar, or a rate of dissociation
(K.sub.off) from IL-6 of less than or equal to 10.sup.-4 S.sup.-1.
In one embodiment, the antibody or antibody fragment thereof may
specifically binds to the same linear or conformational epitope(s)
and/or competes for binding to the same linear or conformational
epitope(s) on an intact human IL-6 polypeptide or fragment thereof
as an anti-IL-6 antibody comprising the polypeptides of SEQ ID NO:
702 and SEQ ID NO: 704 or the polypeptides of SEQ ID NO: 2 and SEQ
ID NO: 3. In one embodiment, the binding to the same linear or
conformational epitope(s) and/or competition for binding to the
same linear or conformational epitope(s) on an intact human IL-6
polypeptide or fragment thereof is ascertained by epitopic mapping
using overlapping linear peptide fragments which span the full
length of the native human IL-6 polypeptide and includes at least
one residues comprised in IL-6 fragments selected from those
respectively encompassing amino acid residues 37-51, amino acid
residues 70-84, amino acid residues 169-183, amino acid residues
31-45 and/or amino acid residues 58-72 of SEQ ID NO: 1.
[0100] In one embodiment, the antibody or antibody fragment
thereof, may be aglycosylated. In one embodiment, the antibody, or
antibody fragment thereof, may contain an Fc region that has been
modified to alter effector function, half-life, proteolysis, and/or
glycosylation. In one embodiment, the antibody, or antibody
fragment thereof, may be a human, humanized, single chain, or
chimeric antibody. In one embodiment, the antibody, or antibody
fragment thereof, may comprise a Fab, Fab', F(ab').sub.2, Fv, or
scFv. In one embodiment, the antibody, or antibody fragment
thereof, may further comprise a human F. In another embodiment, the
Fe may be derived from IgG1, IgG2, IgG3, IgG4, IgG5, IgG6, IgG7,
IgG8, IgG9, IgG10, IgG11, IgG12, IgG13, IgG14, IgG5, IgG16, IgG17,
IgG18, or IgG19.
[0101] In one embodiment, the composition may comprise at least
about 25, 80, 100, 160, 200, or 320 mg. In one embodiment, the
effective amount may be between about 0.1 and 100 mg/kg of body
weight of the subject. In one embodiment, the subject may be
administered at least 1, 2, 3, 4, or 5 doses. In one embodiment,
composition may be administered every 4 weeks. In one embodiment,
the subject may be administered 25 mg every 4 weeks. In one
embodiment, the subject may be administered 80 mg every 4 weeks. In
one embodiment, the subject may be administered 100 mg every 4
weeks. In one embodiment, the subject may be administered 160 mg
every 4 weeks. In one embodiment, the subject may be administered
200 mg every 4 weeks. In one embodiment, the subject may be
administered 320 mg every 4 weeks. In another embodiment, the
composition may be administered every 4 weeks for at least 16
weeks. In another embodiment, the composition may be administered
every 4 weeks for at least 24 weeks.
[0102] In this embodiment, anti-IL-6 antibodies, or antibody
fragments thereof may be administered at effective doses to less
inflammation, pain, and loss of mobility experienced from anemia,
optionally dosages ranging from about 25-500 mg, more preferably at
least about 25, 80, 100, 120, 160, 200, 240, or 320 mg dosages.
[0103] In one embodiment, the antibody may comprise a light chain
polypeptide that comprises at least one Ab1 light chain CDR
polypeptide comprising a light chain CDR1 having at least 72.7%
sequence identity to SEQ ID NO: 4; a light chain CDR2 having at
least 85.7% sequence identity to SEQ ID NO: 5; a light chain CDR3
having at least about 90% sequence identity to SEQ ID NO: 6; a
light chain CDR1 having at least 90.9% sequence identity to SEQ ID
NO: 4; a light chain CDR2 having at least 100% sequence identity to
SEQ ID NO: 5; or a light chain CDR3 having at least 66.6% sequence
identity to SEQ ID NO: 6; and wherein the heavy chain polypeptide
comprises at least one Ab1 heavy chain CDR polypeptide comprising a
heavy chain CDR1 having at least 80% sequence identity to SEQ ID
NO: 7; a heavy chain CDR2 having at least about 90% sequence
identity to SEQ ID NO: 120; a heavy chain CDR3 having at least
33.3% sequence identity to SEQ ID NO: 9; a heavy chain CDR1 having
at least 100% sequence identity to SEQ ID NO: 7; a heavy chain CDR2
having at least 56.2% sequence identity to SEQ ID NO: 120; or a
heavy chain CDR3 having at least 50% sequence identity to SEQ ID
NO: 9.
[0104] In a further embodiment, the antibody or antibody fragment
may comprise a light chain polypeptide comprises at least one Ab1
light chain CDR polypeptide comprising a light chain CDR1 having at
least 81.8% sequence identity to SEQ ID NO: 4; a light chain CDR2
having at least 71.4% sequence identity to SEQ ID NO: 5; or a light
chain CDR3 having at least 83.3% sequence identity to SEQ ID NO: 6;
and wherein the heavy chain polypeptide comprises at least one Ab1
heavy chain CDR polypeptide comprising a heavy chain CDR1 having at
least 60% sequence identity to SEQ ID NO: 7; a heavy chain CDR2
having at least 87.5% sequence identity to SEQ ID NO: 120; or a
heavy chain CDR3 having at least 83.3% sequence identity to SEQ ID
NO: 9. In a further embodiment, the antibody or antibody fragment
may comprise antibody or antibody fragment comprises at least two
of said light chain CDR polypeptides and at least two of said heavy
chain CDR polypeptides.
[0105] In a further embodiment, the antibody or antibody fragment
may comprise two or more Ab1 light chain CDR polypeptides
comprising a light chain CDR1 having at least 72.7% sequence
identity to SEQ ID NO: 4; a light chain CDR2 having at least 85.7%
sequence identity to SEQ ID NO: 5; or a light chain CDR3 having at
least about 90% sequence identity to SEQ ID NO: 6; and two or more
Ab1 heavy chain CDR polypeptide comprising a heavy chain CDR1
having at least 80% sequence identity (identical to at least 4 out
of 5 residues) to SEQ ID NO: 7; a heavy chain CDR2 having at least
about 90% sequence identity to SEQ ID NO: 120; or a heavy chain
CDR3 having at least 33.3% sequence identity to SEQ ID NO: 9;
wherein the Ab1 antibody or antibody fragment specifically binds to
IL-6 and antagonizes at least one activity associated with
IL-6.
[0106] In a further embodiment, the antibody or antibody fragment
may comprise two or more Ab1 light chain CDR polypeptides
comprising a light chain CDR1 having at least 90.9% sequence
identity to SEQ ID NO: 4; a light chain CDR2 having at least 100%
sequence identity to SEQ ID NO: 5; or a light chain CDR3 having at
least 66.6% sequence identity to SEQ ID NO: 6; and two or more Ab1
heavy chain CDR polypeptide comprising a heavy chain CDR1 having at
least 100% sequence identity to SEQ ID NO: 7; a heavy chain CDR2
having at least 56.2% sequence identity to SEQ ID NO: 120; or a
heavy chain CDR3 having at least 50% sequence identity to SEQ ID
NO: 9; wherein the Ab1 antibody or antibody fragment specifically
binds to IL-6 and antagonizes at least one activity associated with
IL-6.
[0107] In a further embodiment, the Ab1 antibody or antibody
fragment comprises said light chain CDR1, said light chain CDR3,
said heavy chain CDR2, and said heavy chain CDR3.
[0108] In one embodiment, the antibody or antibody fragment may
comprise antibody or antibody fragment thereof is administered to
the subject in the form of at least one nucleic acids that encode
the antibody or antibody fragment thereof.
[0109] In one embodiment, the antibody or antibody fragment may
comprise a light chain of encoded by at least one of the following
nucleic acid sequences of SEQ ID NOs: 10, 29, 45, 61, 77, 93, 109,
130, 146, 162, 178, 194, 210, 226, 242, 258, 274, 290, 306, 322,
338, 354, 370, 386, 402, 418, 434, 450, 466, 482, 498, 514, 530,
546, 562, 578, 662, 669, 673, 677, 681, 685, 689, 698, 701, 705,
720, 721, 722, or 723.
[0110] In one embodiment, the antibody or antibody fragment may
comprise a heavy chain of said antibody or antibody fragment
thereof is encoded by at least one of the following nucleic acid
sequences of SEQ ID NOs: 11, 30, 46, 62, 78, 94, 110, 131, 147,
163, 179, 195, 211, 227, 243, 259, 275, 291, 307, 323, 339, 355,
371, 387, 403, 419, 435, 451, 467, 483, 499, 515, 531, 547, 563,
579, 663, 670, 674, 678, 682, 686, 690, 700, 703, 707, 724, or
725.
[0111] In one embodiment, the antibody or antibody fragment may
comprise at least one of the CDRs of said antibody or antibody
fragment thereof is encoded by at least one of the following
nucleic acid sequences of SEQ ID NOs: 12, 15, 31, 34, 47, 50, 63,
66, 79, 82, 95, 98, 111, 114, 132, 135, 148, 151, 164, 167, 180,
183, 196, 199, 212, 215, 228, 231, 244, 247, 260, 263, 276, 279,
292, 295, 308, 311, 324, 327, 340, 343, 356, 359, 372, 375, 388,
391, 404, 407, 420, 423, 436, 439, 452, 455, 468, 471, 484, 487,
500, 503, 516, 519, 532, 535, 548, 551, 564, 567, 580, 583, 694,
13, 16, 32, 35, 48, 51, 64, 67, 80, 83, 96, 99, 112, 115, 133, 136,
149, 152, 165, 168, 181, 184, 197, 200, 213, 216, 229, 232, 245,
248, 261, 264, 277, 280, 293, 296, 309, 312, 325, 328, 341, 344,
357, 360, 373, 376, 389, 392, 405, 408, 421, 424, 437, 440, 453,
456, 469, 472, 485, 488, 501, 504, 517, 520, 533, 536, 549, 552,
565, 568, 581, 584, 696, 14, 17, 33, 36, 49, 52, 65, 68, 81, 84,
97, 100, 113, 116, 134, 137, 150, 153, 166, 169, 182, 185, 198,
201, 214, 217, 230, 233, 246, 249, 262, 265, 278, 281, 294, 297,
310, 313, 326, 329, 342, 345, 358, 361, 374, 377, 390, 393, 406,
409, 422, 425, 438, 441, 454, 457, 470, 473, 486, 489, 502, 505,
518, 521, 534, 537, 550, 553, 566, 569, 582, 585, 695, or 697.
[0112] In one embodiment, the antibody or antibody fragment may
comprise at least one of the nucleic acids comprise the heavy and
light chain polynucleotide sequences of SEQ ID NO: 723 and SEQ ID
NO: 700; SEQ ID NO: 701 and SEQ ID NO: 703; SEQ ID NO: 705 and SEQ
ID NO: 707; SEQ ID NO: 720 and SEQ ID NO: 724; and SEQ ID NO: 10
and SEQ ID NO: 11.
[0113] In one embodiment, the antibody or antibody fragment may
comprise a humanized variable light sequence of amino acid sequence
of SEQ ID NO: 709.
[0114] In one embodiment, the antibody or antibody fragment may
comprise a humanized variable heavy sequence of amino acid sequence
of SEQ ID NO: 657.
[0115] In one embodiment, the antibody or antibody fragment may
comprise at least one light chain CDRs as set forth in the amino
acid sequence of SEQ ID NOs: 4, 5, or 6.
[0116] In one embodiment, the antibody or antibody fragment may
comprise at least one heavy chain CDRs as set forth in the amino
acid sequence of SEQ ID NOs: 7, 120, or 9.
[0117] In one embodiment, the antibody or antibody fragment may be
an asialated, humanized anti-IL-6 monoclonal antibody with a
half-life of .about.30 days comprising the humanized variable light
and heavy sequences as set forth in SEQ ID NO: 20 and 19 or SEQ ID
NO: 709 or 657.
[0118] In one embodiment, the antibody or antibody fragment may be
expressed from a recombinant cell. In another embodiment, the cell
may be a mammalian, yeast, bacterial, and insect cell. In another
embodiment, the cell may be a yeast cell. In another embodiment,
the cell may be a diploidal yeast cell. In another embodiment, the
yeast cell may be a Pichia yeast. In one embodiment, the antibody
may be asialated. In one embodiment, the antibody may be
humanized.
[0119] In one embodiment, the antibody or antibody fragment thereof
may comprise a Fab, Fab', F(ab').sub.2, Fv, scFv, IgNAR, SMIP,
camelbody, or nanobody.
[0120] In one embodiment, the antibody or antibody fragment thereof
may have an in vivo half-life of at least about 30 days.
[0121] In one embodiment, the antibody or antibody fragment thereof
may have a binding affinity (Kd) for IL-6 of less than about 50
picomolar, or a rate of dissociation (K.sub.off) from IL-6 of less
than or equal to 10.sup.-4 S1'.
[0122] In one embodiment, the antibody or antibody fragment thereof
may specifically binds to the same linear or conformational
epitope(s) and/or competes for binding to the same linear or
conformational epitope(s) on an intact human IL-6 polypeptide or
fragment thereof as an anti-IL-6 antibody comprising the
polypeptides of SEQ ID NO: 702 and SEQ ID NO: 704 or the
polypeptides of SEQ ID NO: 2 and SEQ ID NO: 3.
[0123] In one embodiment, the antibody or antibody fragment thereof
may have binding to the same linear or conformational epitope(s)
and/or competition for binding to the same linear or conformational
epitope(s) on an intact human IL-6 polypeptide or fragment thereof
is ascertained by epitopic mapping using overlapping linear peptide
fragments which span the full length of the native human IL-6
polypeptide and includes at least one residues comprised in IL-6
fragments selected from those respectively encompassing amino acid
residues 37-51, amino acid residues 70-84, amino acid residues
169-183, amino acid residues 31-45 and/or amino acid residues 58-72
of SEQ ID NO: 1.
[0124] In one embodiment, the antibody or antibody fragment thereof
may be aglycosylated. In one embodiment, the antibody or antibody
fragment thereof may comprise an Fc region that has been modified
to alter effector function, half-life, proteolysis, and/or
glycosylation. In one embodiment, the antibody or antibody fragment
thereof may be a human, humanized, single chain, or chimeric
antibody. In one embodiment, the antibody or antibody fragment
thereof may further comprise a human F. The method or use of claim
126, wherein said human F.sub.c is derived from IgG1, IgG2, IgG3,
IgG4, IgG5, IgG6, IgG7, IgG8, IgG9, IgG10, IgG11, IgG12, IgG13,
IgG14, IgG15, IgG16, IgG17, IgG18, or IgG19.
[0125] In one embodiment, the chemotherapy may comprise
administration of a chemotherapy agent selected from the group
consisting of Alemtuzumab (Campath.RTM.), Asparaginase
(Elspar.RTM.), Bleomycin (Blenoxane.RTM.), Busulfan (Myleran.RTM.,
Busulfex.RTM.), Capecitabine (Xeloda.RTM.), Carboplatin
(Paraplatin.RTM.), Cisplatin (PLATINOL.RTM.), Cyclophosphamide
(Cytoxan.RTM.), Cytarabine (Cytosar-U.RTM.), Daunorubicin
(Cerubidine.RTM.), Docetaxel (Taxotere.RTM.), Doxorubicin
(Adriamycin.RTM.), Epirubicin (Ellence.RTM.), Etoposide
(VePesid.RTM.), Fluorouracil (5-FU.RTM.), Gemcitabine
(Gemzar.RTM.), Gemtuzumab ozogamicin (Mylotarg.RTM.), Hydroxyurea
(Hydrea.RTM.), Idarubicin (Idamycin.RTM.), Interleukin 2
(Proleukin.RTM.), Irinotecan (Camptosar.RTM.), Lomustine
(CeeNU.RTM.), Mechlorethamine (Mustargen.RTM.), Melphalan
(Alkeran.RTM.), Methotrexate (Rheumatrex.RTM.), Mitomycin
(Mutamycin.RTM.), Mitoxantrone (Novantrone.RTM.), Oxaliplatin
(Eloxatin.RTM.), Paclitaxel (Taxol.RTM.), Pemetrexed (Alimta.RTM.),
Pentostatin (Nipent.RTM.), Procarbazine (Matulane.RTM.), Thiotepa
(Thioplex.RTM.), Topotecan (Hycamtin.RTM.), Trastuzumab
(Herceptin.RTM.), Tretinoin (Vesanoid.RTM.), Vinblastine
(Velban.RTM.), or Vincristine (Oncovin.RTM.).
[0126] In one embodiment, the patient may have elevated C-reactive
protein ("CRP"). In one embodiment, the patient may have elevated
IL-6 serum level. In one embodiment, the patient may have elevated
IL-6 level in the joints.
[0127] In one embodiment, the IL-antagonist may inhibit at least
one activity associated with IL-6. In another embodiment, the at
least one activity associated with IL-6 is an in vitro activity
comprising stimulation of proliferation of T1165 cells; binding of
IL-6 to IL-6R; activation (dimerization) of the gp130
signal-transducing glycoprotein; formation of IL-6/IL-6R/gp130
multimers; stimulation of haptoglobin production by HepG2 cells
modified to express human IL-6 receptor; or any combination
thereof.
[0128] In another embodiment, prior to administration of the IL-6
antagonist, optionally an antibody or antibody fragment, the
subject has exhibited or is at risk for developing at least one of
the following symptoms: decreased serum albumin; elevated serum
C-reactive protein ("CRP"); elevated erythrocyte sedimentation
rate; fatigue; fever; anorexia (loss of appetite); weight loss;
cachexia; weakness; decreased Glasgow Prognostic Score ("GPS");
elevated serum D-dimer; abnormal coagulation profile; and any
combination thereof.
[0129] In another embodiment, the symptom may be a side-effect of
another therapeutic agent administered to the subject prior to,
concurrent with, or subsequent to administration of the antibody or
antibody fragment. In another embodiment, the method may further
comprise monitoring the subject to assess said symptom subsequent
to administration of the antibody. In another embodiment, the
symptom may be exhibited prior to administration of said IL-6
antagonist, optionally an anti-IL-6 antibody or antibody fragment.
In another embodiment, the symptom may be improved or restored to a
normal condition within about 1-5 weeks of administration of said
IL-6 antagonist, optionally an anti-IL-6 antibody or antibody
fragment. In another embodiment, the symptom may thereafter remains
improved for an entire period intervening two consecutive
administrations of said IL-6 antagonist, optionally an anti-IL-6
antibody or antibody fragment. In another embodiment, the patient
treated may have at least one symptom of anemia, drug-induced
immune hemolytic anemia (DIIHA), anemia associated with
chemotherapy, anemia associated with radiotherapy, or anemia
associated with cancer.
[0130] In another embodiment, the patient treated may have cancer
or is being treated for cancer. In one embodiment, the cancer is
selected from the group consisting of Acanthoma, Acinic cell
carcinoma, Acoustic neuroma, Acral lentiginous melanoma,
Acrospiroma, Acute eosinophilic leukemia, Acute lymphoblastic
leukemia, Acute megakaryoblastic leukemia, Acute monocytic
leukemia, Acute myeloblastic leukemia with maturation, Acute
myeloid dendritic cell leukemia, Acute myeloid leukemia, Acute
promyelocytic leukemia, Adamantinoma, Adenocarcinoma, Adenoid
cystic carcinoma, Adenoma, Adenomatoid odontogenic tumor,
Adrenocortical carcinoma, Adult T-cell leukemia, Aggressive NK-cell
leukemia, AIDS-Related Cancers, AIDS-related lymphoma, Alveolar
soft part sarcoma, Ameloblastic fibroma, Anal cancer, Anaplastic
large cell lymphoma, Anaplastic thyroid cancer, Angioimmunoblastic
T-cell lymphoma, Angiomyolipoma, Angiosarcoma, Appendix cancer,
Astrocytoma, Atypical teratoid rhabdoid tumor, Basal cell
carcinoma, Basal-like carcinoma, B-cell leukemia, B-cell lymphoma,
Bellini duct carcinoma, Biliary tract cancer, Bladder cancer,
Blastoma, Bone Cancer, Bone tumor, Brain Stem Glioma, Brain Tumor,
Breast Cancer, Brenner tumor, Bronchial Tumor, Bronchioloalveolar
carcinoma, Brown tumor, Burkitt's lymphoma, Cancer of Unknown
Primary Site, Carcinoid Tumor, Carcinoma, Carcinoma in situ,
Carcinoma of the penis, Carcinoma of Unknown Primary Site,
Carcinosarcoma, Castleman's Disease, Central Nervous System
Embryonal Tumor, Cerebellar Astrocytoma, Cerebral Astrocytoma,
Cervical Cancer, Cholangiocarcinoma, Chondroma, Chondrosarcoma,
Chordoma, Choriocarcinoma, Choroid plexus papilloma, Chronic
Lymphocytic Leukemia, Chronic monocytic leukemia, Chronic
myelogenous leukemia, Chronic Myeloproliferative Disorder, Chronic
neutrophilic leukemia, Clear-cell tumor, Colon Cancer, Colorectal
cancer, Craniopharyngioma, Cutaneous T-cell lymphoma, Degos
disease, Dermatofibrosarcoma protuberans, Dermoid cyst,
Desmoplastic small round cell tumor, Diffuse large B cell lymphoma,
Dysembryoplastic neuroepithelial tumor, Embryonal carcinoma,
Endodermal sinus tumor, Endometrial cancer, Endometrial Uterine
Cancer, Endometrioid tumor, Enteropathy-associated T-cell lymphoma,
Ependymoblastoma, Ependymoma, Epithelioid sarcoma, Erythroleukemia,
Esophageal cancer, Esthesioneuroblastoma, Ewing Family of Tumor,
Ewing Family Sarcoma, Ewing's sarcoma, Extracranial Germ Cell
Tumor, Extragonadal Germ Cell Tumor, Extrahepatic Bile Duct Cancer,
Extramammary Paget's disease, Fallopian tube cancer, Fetus in fetu,
Fibroma, Fibrosarcoma, Follicular lymphoma, Follicular thyroid
cancer, Gallbladder Cancer, Gallbladder cancer, Ganglioglioma,
Ganglioneuroma, Gastric Cancer, Gastric lymphoma, Gastrointestinal
cancer, Gastrointestinal Carcinoid Tumor, Gastrointestinal Stromal
Tumor, Gastrointestinal stromal tumor, Germ cell tumor, Germinoma,
Gestational choriocarcinoma, Gestational Trophoblastic Tumor, Giant
cell tumor of bone, Glioblastoma multiforme, Glioma, Gliomatosis
cerebri, Glomus tumor, Glucagonoma, Gonadoblastoma, Granulosa cell
tumor, Hairy Cell Leukemia, Hairy cell leukemia, Head and Neck
Cancer, Head and neck cancer, Heart cancer, Hemangioblastoma,
Hemangiopericytoma, Hemangiosarcoma, Hematological malignancy,
Hepatocellular carcinoma, Hepatosplenic T-cell lymphoma, Hereditary
breast-ovarian cancer syndrome, Hodgkin Lymphoma, Hodgkin's
lymphoma, Hypopharyngeal Cancer, Hypothalamic Glioma, Inflammatory
breast cancer, Intraocular Melanoma, Islet cell carcinoma, Islet
Cell Tumor, Juvenile myelomonocytic leukemia, Kaposi Sarcoma,
Kaposi's sarcoma, Kidney Cancer, Klatskin tumor, Krukenberg tumor,
Laryngeal Cancer, Laryngeal cancer, Lentigo maligna melanoma,
Leukemia, Leukemia, Lip and Oral Cavity Cancer, Liposarcoma, Lung
cancer, Luteoma, Lymphangioma, Lymphangiosarcoma,
Lymphoepithelioma, Lymphoid leukemia, Lymphoma, Macroglobulinemia,
Malignant Fibrous Histiocytoma, Malignant fibrous histiocytoma,
Malignant Fibrous Histiocytoma of Bone, Malignant Glioma, Malignant
Mesothelioma, Malignant peripheral nerve sheath tumor, Malignant
rhabdoid tumor, Malignant triton tumor, MALT lymphoma, Mantle cell
lymphoma, Mast cell leukemia, Mediastinal germ cell tumor,
Mediastinal tumor, Medullary thyroid cancer, Medulloblastoma,
Medulloblastoma, Medulloepithelioma, Melanoma, Melanoma,
Meningioma, Merkel Cell Carcinoma, Mesothelioma, Mesothelioma,
Metastatic Squamous Neck Cancer with Occult Primary, Metastatic
urothelial carcinoma, Mixed Mullerian tumor, Monocytic leukemia,
Mouth Cancer, Mucinous tumor, Multiple Endocrine Neoplasia
Syndrome, Multiple Myeloma, Multiple myeloma, Mycosis Fungoides,
Mycosis fungoides, Myelodysplastic Disease, Myelodysplastic
Syndromes, Myeloid leukemia, Myeloid sarcoma, Myeloproliferative
Disease, Myxoma, Nasal Cavity Cancer, Nasopharyngeal Cancer,
Nasopharyngeal carcinoma, Neoplasm, Neurinoma, Neuroblastoma,
Neuroblastoma, Neurofibroma, Neuroma, Nodular melanoma, Non-Hodgkin
Lymphoma, Non-Hodgkin lymphoma, Nonmelanoma Skin Cancer, Non-Small
Cell Lung Cancer, Ocular oncology, Oligoastrocytoma,
Oligodendroglioma, Oncocytoma, Optic nerve sheath meningioma, Oral
Cancer, Oral cancer, Oropharyngeal Cancer, Osteosarcoma,
Osteosarcoma, Ovarian Cancer, Ovarian cancer, Ovarian Epithelial
Cancer, Ovarian Germ Cell Tumor, Ovarian Low Malignant Potential
Tumor, Paget's disease of the breast, Pancoast tumor, Pancreatic
Cancer, Pancreatic cancer, Papillary thyroid cancer,
Papillomatosis, Paraganglioma, Paranasal Sinus Cancer, Parathyroid
Cancer, Penile Cancer, Perivascular epithelioid cell tumor,
Pharyngeal Cancer, Pheochromocytoma, Pineal Parenchymal Tumor of
Intermediate Differentiation, Pineoblastoma, Pituicytoma, Pituitary
adenoma, Pituitary tumor, Plasma Cell Neoplasm, Pleuropulmonary
blastoma, Polyembryoma, Precursor T-lymphoblastic lymphoma, Primary
central nervous system lymphoma, Primary effusion lymphoma, Primary
Hepatocellular Cancer, Primary Liver Cancer, Primary peritoneal
cancer, Primitive neuroectodermal tumor, Prostate cancer,
Pseudomyxoma peritonei, Rectal Cancer, Renal cell carcinoma,
Respiratory Tract Carcinoma Involving the NUT Gene on Chromosome
15, Retinoblastoma, Rhabdomyoma, Rhabdomyosarcoma, Richter's
transformation, Sacrococcygeal teratoma, Salivary Gland Cancer,
Sarcoma, Schwannomatosis, Sebaceous gland carcinoma, Secondary
neoplasm, Seminoma, Serous tumor, Sertoli-Leydig cell tumor, Sex
cord-stromal tumor, Sezary Syndrome, Signet ring cell carcinoma,
Skin Cancer, Small blue round cell tumor, Small cell carcinoma,
Small Cell Lung Cancer, Small cell lymphoma, Small intestine
cancer, Soft tissue sarcoma, Somatostatinoma, Soot wart, Spinal
Cord Tumor, Spinal tumor, Splenic marginal zone lymphoma, Squamous
cell carcinoma, Stomach cancer, Superficial spreading melanoma,
Supratentorial Primitive Neuroectodermal Tumor, Surface
epithelial-stromal tumor, Synovial sarcoma, T-cell acute
lymphoblastic leukemia, T-cell large granular lymphocyte leukemia,
T-cell leukemia, T-cell lymphoma, T-cell prolymphocytic leukemia,
Teratoma, Terminal lymphatic cancer, Testicular cancer, Thecoma,
Throat Cancer, Thymic Carcinoma, Thymoma, Thyroid cancer,
Transitional Cell Cancer of Renal Pelvis and Ureter, Transitional
cell carcinoma, Urachal cancer, Urethral cancer, Urogenital
neoplasm, Uterine sarcoma, Uveal melanoma, Vaginal Cancer, Verner
Morrison syndrome, Verrucous carcinoma, Visual Pathway Glioma,
Vulvar Cancer, Waldenstrom's macroglobulinemia, Warthin's tumor,
Wilms' tumor, and combination thereof. In one embodiment, the
cancer is Colorectal Cancer, Non-Small Cell Lung Cancer,
Cholangiocarcinoma, Mesothelioma, Castleman's disease, Renal Cell
Carcinoma, or any combination thereof. In one embodiment, the
patient may have a cancer selected from head and neck cancer,
esophageal cancer, throat cancer, lung cancer, gastrointestinal
cancers such as stomach cancer, colorectal cancer, pancreatic
cancer, as well as hematological cancers such as multiple myeloma,
leukemia, and lymphoma.
[0131] In one embodiment, the patient suffers from a disease or
disorder selected from the group consisting of general fatigue,
exercise-induced fatigue, cancer-related fatigue, inflammatory
disease-related fatigue, chronic fatigue syndrome, cancer-related
cachexia, cardiac-related cachexia, respiratory-related cachexia,
renal-related cachexia, age-related cachexia, rheumatoid arthritis,
systemic lupus erythematosis (SLE), systemic juvenile idiopathic
arthritis, psoriasis, psoriatic arthropathy, ankylosing
spondylitis, inflammatory bowel disease (IBD), polymyalgia
rheumatica, giant cell arteritis, autoimmune vasculitis, graft
versus host disease (GVHD), Sjogren's syndrome, adult onset Still's
disease, rheumatoid arthritis, systemic juvenile idiopathic
arthritis, osteoarthritis, osteoporosis, Paget's disease of bone,
osteoarthritis, multiple myeloma, Hodgkin's lymphoma, non-Hodgkin's
lymphoma, prostate cancer, leukemia, renal cell cancer,
multicentric Castleman's disease, ovarian cancer, drug resistance
in cancer chemotherapy, cancer chemotherapy toxicity, ischemic
heart disease, atherosclerosis, obesity, diabetes, asthma, multiple
sclerosis, Alzheimer's disease, cerebrovascular disease, fever,
acute phase response, allergies, anemia, anemia of inflammation
(anemia of chronic disease), hypertension, depression, depression
associated with a chronic illness, thrombosis, thrombocytosis,
acute heart failure, metabolic syndrome, miscarriage, obesity,
chronic prostatitis, glomerulonephritis, pelvic inflammatory
disease, reperfusion injury, transplant rejection, graft versus
host disease (GVHD), avian influenza, smallpox, pandemic influenza,
adult respiratory distress syndrome (ARDS), severe acute
respiratory syndrome (SARS), sepsis, and systemic inflammatory
response syndrome (SIRS).
[0132] In one embodiment, the patient has or is to receive
autologous stem cell or bone marrow transplant.
[0133] In one embodiment, the IL-6 antagonist, optionally an
anti-IL-6 antibody or antibody fragment, may be administered prior,
concurrent or after chemotherapy or radiotherapy. In one
embodiment, the chemotherapeutic is an EGFR inhibitor. In one
embodiment, the EGFR inhibitor is selected from the group
consisting of Cetuximab (Erbitux), Erlotinib (Tarceva), Gefitinib
(Iressa), Lapatinib (Tykerb), Panitimumab (Vectibox), Sunitinib or
Sutent
(N-(2-diethylaminoethyl)-5-[(Z)-(5-fluoro-2-oxo-1H-indol-3-ylidene)methyl-
]-2,4-dimethyl-1H-pyrrole-3-carboxamide), Gefitinib or
N-(3-chloro-4-fluoro-phenyl)-7-methoxy-6-(3-morpholin-4-ylpropoxy)quinazo-
lin-4-amine, and Zalutumumab. In one embodiment, the patient may
have a cancer that has exhibited resistance to said
chemotherapeutic or radiation after at least one round of
chemotherapy or radiation. In one embodiment, the chemotherapeutic
or radiation reduces or prevents the treated cancer from invading
or metastasizing to other sites in the body. In one embodiment, the
chemotherapeutic or radiation results in increased apoptosis of the
treated cancer cells.
[0134] In one embodiment, the treated cancer is selected from
advanced and non-advanced cancers including metastasized cancers
such as metastatic and non-metastatic lung cancer, breast cancer,
head and neck cancer, (HNSCC), pharyngeal cancer, pancreatic
cancer, colorectal cancer, anal cancer, glioblastoma multiforme,
epithelial cancers, renal cell carcinomas, acute or chronic
myelogenous leukemia and other leukemias.
[0135] In one embodiment, the results are used to facilitate design
of an appropriate therapeutic regimen for anemia, drug-induced
immune hemolytic anemia (DIIHA), anemia associated with
chemotherapy, anemia associated with radiotherapy, or anemia
associated with cancer or a disease associated with anemia,
drug-induced immune hemolytic anemia (DIIHA), anemia associated
with chemotherapy, anemia associated with radiotherapy, or anemia
associated with cancer.
[0136] In one embodiment, the IL-6 antagonist, optionally an
anti-IL-6 antibody or antibody fragment, is co-administered with
another therapeutic agent selected from the group consisting of
analgesics, antibiotics, anti-cachexia agents, anti-coagulants,
anti-cytokine agents, antiemetic agents, anti-fatigue agent,
anti-fever agent, anti-inflammatory agents, anti-nausea agents,
antipyretics, antiviral agents, anti-weakness agent, chemotherapy
agents, cytokine antagonist, cytokines, cytotoxic agents, gene
therapy agents, growth factors, IL-6 antagonists, immunosuppressive
agents, local anesthetic, statins, other therapeutic agents, or any
combination thereof.
[0137] In another embodiment, the analgesic is acetaminophen,
amitriptyline, benzocaine, carbamazepine, codeine, dyclonine
hydrochloride (HCl), dihydromorphine, fentanyl patch, Flupirtine,
fluriprofen, gabapentin, hydrocodone APAP, hydromorphone,
ibuprofen, ketoprofen, lidocaine, morphine, an opiate and
derivatives thereof, oxycodone, pentazocine, pethidine, phenacetin,
pregabalin, propoeylphene, propoyl APA, salicylamide, tramadol,
tramadol APAP, Ulcerease.RTM. (0.6% Phenol), or voltaren.
[0138] In another embodiment, the local anesthetic is amethocaine,
articaine, benzocaine, bupivacaine, mepivacaine, cocaine,
cinchocaine, chloroprocaine, cyclomethycaine, dibucaine,
dimethocaine, EMLA.RTM. (eutectic mixture of lidocaine and
prilocaine), etidocaine, larocaine, levobupivacaine, lidocaine,
lignocaine, procaine, piperocaine, prilocaine, proparacaine,
propoxycaine, ropivacaine, saxitoxin, tetracaine, tetrodotoxin, or
trimecaine.
[0139] In another embodiment, the anti-cachexia agent is cannabis,
dronabinol (Marinol.RTM.), nabilone (Cesamet), cannabidiol,
cannabichromene, tetrahydrocannabinol, Sativex, megestrol acetate,
or any combination thereof.
[0140] In another embodiment, the anti-coagulant is abciximab
(ReoPro.RTM.), acenocoumarol, antithrombin III, argatroban,
aspirin, bivalirudin (Angiomax.RTM.), clopidogrel, dabigatran,
dabigatran etexilate (Pradaxa.RTM./Pradax.RTM.), desirudin
(Revasc.RTM./Iprivask.RTM.), dipyridamole, eptifibatide
(Integrilin.RTM.), fondaparinux, heparin, hirudin, idraparinux,
lepirudin (Refludan.RTM.), low molecular weight heparin,
melagatran, phenindione, phenprocoumon, ticlopidine, tirofiban
(Aggrastat.RTM.), warfarin, ximelagatran, ximelagatran
(Exanta.RTM./Exarta.RTM.), or any combination thereof.
[0141] In another embodiment, the anti-inflammatory agent is
acetaminophen, azapropazone, diclofenac, diflunisal, etodolac,
fenbufen, fenoprofen, flurbiprofen, ibuprofen, indomethacin,
ketoprofen, ketorolac, mefenamic, meloxicam, nabumetone, naproxen,
phenylbutazone, piroxicam, a salicylate, sulindac, tenoxicam,
tiaprofenic acid, or tolfenamic acid. In still further embodiment,
the salicylate is acetylsalicylic acid, amoxiprin, benorylate,
choline magnesium salicylate, ethenzamide, faislamine, methyl
salicylate, magnesium salicylate, salicyl salicylate, or
salicylamide.
[0142] In another embodiment, the anti-nausea agent or antiemetic
agent is comprising 5-HT3 receptor antagonists, ajwain, alizapride,
anticholinergics, antihistamines, aprepitant, benzodiazepines,
cannabichromene, cannabidiol, cannabinoids, cannabis, casopitant,
chlorpromazine, cyclizine, dexamethasone, dexamethasone,
dimenhydrinate (Gravol.RTM.), diphenhydramine, dolasetron,
domperidone, dopamine antagonists, doxylamine, dronabinol
(Marinol.RTM.), droperidol, emetrol, ginger, granisetron,
haloperidol, hydroxyzine, hyoscine, lorazepam, meclizine,
metoclopramide, midazolam, muscimol, nabilone (Cesamet), nkl
receptor antagonists, ondansetron, palonosetron, peppermint,
Phenergan, prochlorperazine, Promacot, promethazine, Pentazine,
propofol, sativex, tetrahydrocannabinol, trimethobenzamide,
tropisetron, nandrolone, stilbestrol, thalidomide, lenalidomide,
ghrelin agonists, myostatin antagonists, anti-myostatin antibodies,
selective androgen receptor modulators, selective estrogen receptor
modulators, angiotensin AII antagonists, beta two adenergic
receptor agonists, beta three adenergic receptor agonists, or any
combination thereof.
[0143] In another embodiment, the antiviral agent is selected from
the group consisting of abacavir, aciclovir, acyclovir, adefovir,
amantadine, amprenavir, an antiretroviral fixed dose combination,
an antiretroviral synergistic enhancer, arbidol, atazanavir,
atripla, brivudine, cidofovir, combivir, darunavir, delavirdine,
didanosine, docosanol, edoxudine, efavirenz, emtricitabine,
enfuvirtide, entecavir, entry inhibitors, famciclovir, fomivirsen,
fosamprenavir, foscarnet, fosfonet, fusion inhibitor, ganciclovir,
gardasil, ibacitabine, idoxuridine, imiquimod, imunovir, indinavir,
inosine, integrase inhibitor, interferon, interferon type I,
interferon type II, interferon type III, lamivudine, lopinavir,
loviride, maraviroc, MK-0518, moroxydine, nelfinavir, nevirapine,
nexavir, nucleoside analogues, oseltamivir, penciclovir, peramivir,
pleconaril, podophyllotoxin, protease inhibitor, reverse
transcriptase inhibitor, ribavirin, rimantadine, ritonavir,
saquinavir, stavudine, tenofovir, tenofovir disoproxil, tipranavir,
trifluridine, trizivir, tromantadine, truvada, valaciclovir,
valganciclovir, vicriviroc, vidarabine, viramidine, zalcitabine,
zanamivir, zidovudine, or any combination thereof.
[0144] In another embodiment, the cytotoxic agent, chemotherapeutic
agent, or immunosuppressive agent is comprising
1-dehydrotestosterone, 1-methylnitrosourea, 5-fluorouracil,
6-mercaptopurine, 6-mercaptopurine, 6-thioguanine, Abatacept,
abraxane, acitretin, aclarubicin, Actinium-225 (.sup.225Ac),
actinomycin, Adalimumab, adenosine deaminase inhibitors,
Afelimomab, Aflibercept, Afutuzumab, Alefacept, alitretinoin, alkyl
sulfonates, alkylating agents, altretamine, alvocidib,
aminolevulinic acid/methyl aminolevulinate, aminopterin,
aminopterin, amrubicin, amsacrine, amsacrine, anagrelide, Anakinra,
anthracenediones, anthracyclines, anthracyclines, anthracyclines,
anthramycin (AMC); antimytotic agents, antibiotics, anti-CD20
antibodies, antifolates, Anti-lymphocyte globulin, Antimetabolites,
Anti-thymocyte globulin, arsenic trioxide, Aselizumab,
asparaginase, asparagine depleters, Astatine-211 (.sup.211At),
Atlizumab, Atorolimumab, atrasentan, Avastin.RTM., azacitidine,
Azathioprine, azelastine, aziridines, Basiliximab, BAYX antibodies,
Belatacept, Belimumab, belotecan, bendamustine, Bertilimumab,
bexarotene, bisantrene, Bismuth-213 (.sup.213Bi), Bismuth-212
(.sup.212Bi), bleomycin, bleomycin, bleomycin, BLyS antibodies,
bortezomib, busulfan, busulfan, Calcineurin inhibitors,
calicheamicin, camptothecin, camptothecins, capecitabine,
carboplatin (paraplatin), carboquone, carminomycin, carmofur,
carmustine, carmustine (BSNU), CAT antibodies, CD11a antibodies,
CD147/Basigin antibodies, CD 154 antibodies, CD18 antibodies, CD20
antibodies, CD23 antibodies, CD3 antibodies, CD4 antibodies, CD40
antibodies, CD62L/L-selectin antibodies, CD80 antibodies, CDK
inhibitors, Cedelizumab, celecoxib, Certolizumab pegol,
chlorambucil, chlorambucils, Ciclosporin, cis-dichlorodiamine
platinum (II) (DDP) cisplatin, cladribine, Clenoliximab,
clofarabine, colchicin, Complement component 5 antibodies,
Copper-67 (.sup.67Cu), corticosteroids, CTLA-4 antibodies, CTLA-4
fusion proteins, Cyclophilin inhibitors, cyclophosphamides,
cyclothosphamide, cytarabine, cytarabine, cytochalasin B, cytotoxic
ribonucleases, dacarbazine, Daclizumab, dactinomycin, dactinomycin
(actinomycin D), daunorubicin, daunorubicin, daunorubicin (formerly
daunomycin), decitabine, Deforolimus, demecolcine, detorubicin,
dibromomannitol, diethylcarbamazine, dihydrofolate reductase
inhibitors, dihydroxy anthracin dione, diphtheria toxin, DNA
polymerase inhibitors, docetaxel, Dorlimomab aritox, Dorlixizumab,
doxorubicin (adriamycin), DXL625, Eculizumab, Efalizumab,
efaproxiral, EGFR antagonists, elesclomol, elsamitrucin,
Elsilimomab, emetine, endothelin receptor antagonists,
epipodophyllotoxins, epirubicin, epothilones, Erbitux.RTM.,
Erlizumab, estramustine, Etanercept, ethidium bromide, etoglucid,
etoposide, etoposide phosphate, Everolimus, Faralimomab,
famesyltransferase inhibitors, FKBP inhibitors, floxuridine,
fludarabine, fluorouracil, Fontolizumab, fotemustine, Galiximab,
Gallium-67 (.sup.67Ga), Gantenerumab, Gavilimomab, gemcitabine,
glucocorticoids, Golimumab, Gomiliximab, gramicidin D, Gusperimus,
Herceptin.RTM., hydrazines, hydroxyurea, hypomethylating agents,
idarubicin, Idarubicine, ifosfamide, IL-1 antagonists, IL-1
receptor antagonists, IL-12, IL-12 antibodies, IL-12R antagonists,
IL-13 antibodies, IL-2, IL-2 inhibitors, IL-2 receptor/CD25
antibodies, IL-6 antibodies, imatinib mesylate, Immunoglobulin E
antibodies, IMP dehydrogenase inhibitors, Infliximab, Inolimomab,
Integrin antibodies, Interferon antibodies, interferons,
Interleukin 5 antibodies, Interleukin-6 receptor antibodies,
interleukins, Iodine-125 (.sup.125I), Iodine-131 (.sup.131I),
Ipilimumab, irinotecan, ixabepilone, Keliximab, larotaxel, Lead-212
(.sup.212Pb), Lebrilizumab, Leflunomide, Lenalidomide,
Lerdelimumab, leucovorine, LFA-1 antibodies, lidocaine,
lipoxygenase inhibitors, lomustine (CCNU), lonidamine, lucanthone,
Lumiliximab, Lutetium-177 (.sup.177Lu), Macrolides, mannosulfan,
Maslimomab, masoprocol, mechlorethamine, melphalan, Mepolizumab,
mercaptopurine, Metelimumab, Methotrexate, microtubule assembly
inhibitors, microtubule stability enhancers, mithramycin,
mitobronitol, mitoguazone, mitomycin, mitomycin C, mitotane,
mitoxantrone, Morolimumab, mTOR inhibitors, Muromonab-CD3,
mustines, Mycophenolic acid, mytotane (O,P'-(DDD)), Natalizumab,
nedaplatin, Nerelimomab, nimustine, nitrogen mustards,
nitrosoureas, nordihydroguaiaretic acid, oblimersen, ocrelizumab,
Ocrelizumab, Odulimomab, ofatumumab, olaparib, Omalizumab,
ortataxel, Otelixizumab, oxaliplatin, oxaliplatin, paclitaxel
(taxol), Pascolizumab, PDGF antagonists, pegaspargase, pemetrexed,
Pentostatin, Pertuzumab, Pexelizumab, phosphodiesterase inhibitors,
Phosphorus-32 (.sup.32P), Pimecrolimus Abetimus, pirarubicin,
pixantrone, platins, plicamycin, poly ADP ribose polymerase
inhibitors, porfimer sodium, porphyrin derivatives, prednimustine,
procaine, procarbazine, procarbazine, propranolol, proteasome
inhibitors, pseudomonas exotoxin, Pseudomonas toxin, purine
synthesis inhibitors, puromycin, pyrimidine synthesis inhibitors,
radionuclides, radiotherapy, raltitrexed, ranimustine, Reslizumab,
retinoid X receptor agonists, retinoids, Rhenium-186 (.sup.186Re),
Rhenium-188 (.sup.188Re), ribonucleotide reductase inhibitors,
ricin, Rilonacept, Rituxan.RTM., Rovelizumab, rubitecan,
Ruplizumab, Samarium-153 (.sup.153Sm), satraplatin, Scandium-47
(.sup.47Sc), selective androgen receptor modulators, selective
estrogen receptor modulators, seliciclib, semustine, sex hormone
antagonists, siplizumab, sirolimus, steroid aromatase inhibitors,
steroids, streptozocin, streptozotocin, Tacrolimus, talaporfin,
Talizumab, taxanes, taxols, tegafur, Telimomab aritox, temoporfin,
temozolomide, temsirolimus, Temsirolimus, Teneliximab, teniposide,
Teplizumab, Teriflunomide, tesetaxel, testolactone, tetracaine,
Thalidomide, thioepa chlorambucil, thiopurines thioguanine,
ThioTEPA, thymidylate synthase inhibitors, tiazofurin, tipifarnib,
T-lymphocyte antibodies, TNF antagonists, TNF antibodies, TNF
fusion proteins, TNF receptor fusion proteins, TNF-alpha
inhibitors, Tocilizumab, topoisomerase inhibitors, topotecan,
Toralizumab, trabectedin, Tremelimumab, treosulfan, tretinoin,
triazenes, triaziquone, triethylenemelamine, triplatin
tetranitrate, trofosfamide, tumor antigen specific monoclonal
antibodies, tyrosine kinase inhibitors, uramustine, Ustekinumab,
valrubicin, Valrubicine, Vapaliximab, VEGF antagonists,
Vepalimomab, verteporfin, vinblastine, vinca alkaloids,
vincristine, vindesine, vinflunine, vinorelbine, Visilizumab,
vorinostat, Yttrium-88 (.sup.88Y), Yttrium-90 (.sup.90Y),
Zanolimumab, zileuton, Ziralimumab, Zolimomab aritox, zorubicin,
Zotarolimus, or any combination thereof.
[0145] In another embodiment, the chemotherapy agent is selected
from the group consisting of VEGF antagonists, EGFR antagonists,
platins including cisplatin and carboplatin, taxols, irinotecan,
5-fluorouracil, gemcytabine, leucovorine, steroids,
cyclophosphamide, melphalan, vinca alkaloids, vinblastine,
vincristine, vindesine, vinorelbine, mustines, tyrosine kinase
inhibitors, radiotherapy, sex hormone antagonists, selective
androgen receptor modulators, selective estrogen receptor
modulators, PDGF antagonists, TNF antagonists, IL-1 antagonists,
interleukins, IL-12, IL-2, IL-12R antagonists, Toxin conjugated
monoclonal antibodies, tumor antigen specific monoclonal
antibodies, Erbitux.RTM., Avastin.RTM., Pertuzumab, anti-CD20
antibodies, Rituxan.RTM., ocrelizumab, ofatumumab, DXL625,
Herceptin.RTM., or any combination thereof.
[0146] In another embodiment, the cytokine antagonist is an
antagonist of tumor necrosis factor-alpha, interferon gamma,
interleukin 1 alpha, interleukin 1 beta, interleukin 6,
TNF-.alpha., IL-1.alpha., IL-1.beta., IL-2, IL-4, IL-6, IL-10,
IL-12, IL-13, IL-18, IFN-.alpha., IFN-.gamma., BAFF, CXCL13, IP-10,
leukemia-inhibitory factor, or a combination thereof.
[0147] In another embodiment, the growth factor is VEGF, EPO, EGF,
HRG, Hepatocyte Growth Factor (HGF), Hepcidin, or any combination
thereof.
[0148] In another embodiment, the statin is comprising
atorvastatin, cerivastatin, fluvastatin, lovastatin, mevastatin,
pitavastatin, pravastatin, rosuvastatin, simvastatin, or any
combination thereof.
[0149] In another embodiment, the other therapeutic agent is an
antagonist of a factor comprising tumor necrosis factor-alpha,
Interferon gamma, Interleukin 1 alpha, Interleukin 1 beta,
Interleukin 6, proteolysis inducing factor, leukemia-inhibitory
factor, tamoxifen, BCL-2 antagonists, estrogen, bisphosphonates,
teriparatide, strontium ranelate, sodium alendronate (Fosamax),
risedronate (Actonel), raloxifene, ibandronate (Boniva), Obatoclax,
ABT-263, gossypol, gefitinib, epidermal growth factor receptor
tyrosine kinase inhibitors, erlotinib, epidermal growth factor
receptor inhibitors, psoralens, trioxysalen, methoxsalen,
bergapten, retinoids, etretinate, acitretin, infliximab
(Remicade.RTM.), adalimumab, infliximab, etanercept, Zenapax.RTM.,
Cyclosporine, Methotrexate, granulocyte-colony stimulating factor,
filgrastim, lenograstim, Neupogen, Neulasta, 2-Arylpropionic acids,
Aceclofenac, Acemetacin, Acetylsalicylic acid (Aspirin),
Alclofenac, Alminoprofen, Amoxiprin, Ampyrone, Arylalkanoic acids,
Azapropazone, Benorylate/Benorilate, Benoxaprofen, Bromfenac,
Carprofen, Celecoxib, Choline magnesium salicylate, Clofezone,
COX-2 inhibitors, Dexibuprofen, Dexketoprofen, Diclofenac,
Diflunisal, Droxicam, Ethenzamide, Etodolac, Etoricoxib,
Faislamine, fenamic acids, Fenbufen, Fenoprofen, Flufenamic acid,
Flunoxaprofen, Flurbiprofen, Ibuprofen, Ibuproxam, Indometacin,
Indoprofen, Kebuzone, Ketoprofen, Ketorolac, Lornoxicam,
Loxoprofen, Lumiracoxib, Magnesium salicylate, Meclofenamic acid,
Mefenamic acid, Meloxicam, Metamizole, Methyl salicylate,
Mofebutazone, Nabumetone, Naproxen, N-Arylanthranilic acids,
Oxametacin, Oxaprozin, Oxicams, Oxyphenbutazone, Parecoxib,
Phenazone, Phenylbutazone, Phenylbutazone, Piroxicam, Pirprofen,
profens, Proglumetacin, Pyrazolidine derivatives, Rofecoxib,
Salicyl salicylate, Salicylamide, Salicylates, Sulfinpyrazone,
Sulindac, Suprofen, Tenoxicam, Tiaprofenic acid, Tolfenamic acid,
Tolmetin, and Valdecoxib. Antibiotics include Amikacin,
Aminoglycosides, Amoxicillin, Ampicillin, Ansamycins, Arsphenamine,
Azithromycin, Azlocillin, Aztreonam, Bacitracin, Carbacephem,
Carbapenems, Carbenicillin, Cefaclor, Cefadroxil, Cefalexin,
Cefalothin, Cefalotin, Cefamandole, Cefazolin, Cefdinir,
Cefditoren, Cefepime, Cefixime, Cefoperazone, Cefotaxime,
Cefoxitin, Cefpodoxime, Cefprozil, Ceftazidime, Ceftibuten,
Ceftizoxime, Ceftobiprole, Ceftriaxone, Cefuroxime, Cephalosporins,
Chloramphenicol, Cilastatin, Ciprofloxacin, Clarithromycin,
Clindamycin, Cloxacillin, Colistin, Co-trimoxazole, Dalfopristin,
Demeclocycline, Dicloxacillin, Dirithromycin, Doripenem,
Doxycycline, Enoxacin, Ertapenem, Erythromycin, Ethambutol,
Flucloxacillin, Fosfomycin, Furazolidone, Fusidic acid,
Gatifloxacin, Geldanamycin, Gentamicin, Glycopeptides, Herbimycin,
Imipenem, Isoniazid, Kanamycin, Levofloxacin, Lincomycin,
Linezolid, Lomefloxacin, Loracarbef, Macrolides, Mafenide,
Meropenem, Meticillin, Metronidazole, Mezlocillin, Minocycline,
Monobactams, Moxifloxacin, Mupirocin, Nafcillin, Neomycin,
Netilmicin, Nitrofurantoin, Norfloxacin, Ofloxacin, Oxacillin,
Oxytetracycline, Paromomycin, Penicillin, Penicillins,
Piperacillin, Platensimycin, Polymyxin B, Polypeptides, Prontosil,
Pyrazinamide, Quinolones, Quinupristin, Rifampicin, Rifampin,
Roxithromycin, Spectinomycin, Streptomycin, Sulfacetamide,
Sulfamethizole, Sulfanilimide, Sulfasalazine, Sulfisoxazole,
Sulfonamides, Teicoplanin, Telithromycin, Tetracycline,
Tetracyclines, Ticarcillin, Tinidazole, Tobramycin, Trimethoprim,
Trimethoprim-Sulfamethoxazole, Troleandomycin, Trovafloxacin, and
Vancomycin. Active agents also include Aldosterone, Beclometasone,
Betamethasone, Corticosteroids, Cortisol, Cortisone acetate,
Deoxycorticosterone acetate, Dexamethasone, Fludrocortisone
acetate, Glucocorticoids, Hydrocortisone, Methylprednisolone,
Prednisolone, Prednisone, Steroids, and Triamcinolone, an agonist,
antagonist, or modulator of a factor comprising TNF-alpha, IL-2,
IL-4, IL-6, IL-10, IL-12, IL-13, IL-18, IFN-alpha, IFN-gamma, BAFF,
CXCL13, IP-10, VEGF, EPO, EGF, HRG, Hepatocyte Growth Factor (HGF),
Hepcidin, or any combination thereof.
[0150] In one embodiment, the IL-6 antagonist comprises anti-IL-6
antibodies or antibody fragments thereof, antisense nucleic acids,
polypeptides, small molecules, or any combination thereof. In
another embodiment, the antisense nucleic acid comprises at least
approximately 10 nucleotides of a sequence encoding IL-6, IL-6
receptor alpha, gp130, p38 MAP kinase, JAK1, JAK2, JAK3, STAT3, or
SYK. In another embodiment, the antisense nucleic acid comprises
DNA, RNA, peptide nucleic acid, locked nucleic acid, morpholino
(phosphorodiamidate morpholino oligo), glycerol nucleic acid,
threose nucleic acid, or any combination thereof. In another
embodiment, the IL-6 antagonist polypeptide comprises a fragment of
a polypeptide having a sequence selected from the group consisting
soluble IL-6, IL-6 receptor alpha, gp130, p38 MAP kinase, JAK1,
JAK2, JAK3, STAT3, and SYK.
[0151] In one embodiment, the antibody or antibody fragment may be
directly or indirectly coupled to a detectable label, half-life
increasing moiety, cytotoxic agent, therapeutic agent, or an
immunosuppressive agent. In another embodiment, the detectable
label is comprising fluorescent dyes, bioluminescent materials,
radioactive materials, chemiluminescent moieties, streptavidin,
avidin, biotin, radioactive materials, enzymes, substrates,
horseradish peroxidase, acetylcholinesterase, alkaline phosphatase,
3-galactosidase, luciferase, rhodamine, fluorescein, fluorescein
isothiocyanate, umbelliferone, dichlorotriazinylamine,
phycoerythrin, dansyl chloride, luminol, luciferin, aequorin,
Iodine 125 (.sup.125I), Carbon 14 (.sup.14C), Sulfur 35 (.sup.35S),
Tritium (.sup.3H), Phosphorus 32 (.sup.32p), or any combination
thereof.
[0152] In one embodiment, the subject may receive concomitant
chemotherapy. In another embodiment, the subject may receive
receiving concomitant radiotherapy.
[0153] In another embodiment, the antibody may be the Ab1
antibody.
[0154] In another embodiment, the composition may be administered
intravenously for at least about 1 hour. In another embodiment, the
effective amount is or medicament comprises between about 0.1 and
20 mg/kg of body weight of recipient subject of said IL-6
antagonist. In another embodiment, the effective amount is or
medicament comprises at least about 25, 80, 100, 160, 200, or 320
mg. In another embodiment, the effective amount is or medicament
comprises between about 0.1 and 100 mg/kg of body weight of the
subject.
[0155] In another embodiment, the subject may be administered at
least 1, 2, 3, 4, or 5 doses. In another embodiment, the
composition may be administered every 4 weeks. In another
embodiment, the composition may be administered 160 mg every 4
weeks for a total of 2 doses. In another embodiment, the
composition may be administered 160 mg every 4 weeks for a total of
2 doses. In another embodiment, the composition may be administered
320 mg every 4 weeks for a total of 2 doses.
[0156] In another embodiment, the anemia, drug-induced immune
hemolytic anemia (DIIHA), anemia associated with chemotherapy,
anemia associated with radiotherapy, or anemia associated with
cancer may be induced by chemoradiation (CRT) regimens or HSCT used
for the treatment of cancers of the head and neck.
[0157] In another embodiment, the method may further comprise
assessment of the status of the anemia, drug-induced immune
hemolytic anemia (DIIHA), anemia associated with chemotherapy,
anemia associated with radiotherapy, or anemia associated with
cancer.
[0158] In another embodiment, the assessment may comprise imaging
modality selected from the group consisting of CAT, PET, and MRI
exams.
[0159] In another embodiment, the subject may be administered
5-fluoracil (5-FU) or Irinotecan.
[0160] The invention also provides a method of identifying cancers
that are potentially resistant to the effects of a chemotherapeutic
or radiation by assaying for IL-6 using an antibody according to
the invention in order to detect whether elevated IL-6 levels are
present at the site of the treated cancer.
[0161] In another embodiment, a method for the reduction of anemia,
drug-induced immune hemolytic anemia (DIIHA), anemia associated
with chemotherapy, anemia associated with radiotherapy, or anemia
associated with cancer in subjects with head and neck cancer
receiving concomitant chemotherapy and radiotherapy comprises
administering an effective amount of a humanized monoclonal
antibody that selectively binds IL-6.
[0162] In another embodiment, a method for the treating anemia,
drug-induced immune hemolytic anemia (DIIHA), anemia associated
with chemotherapy, anemia associated with radiotherapy, or anemia
associated with cancer in a subject with head and neck cancer
receiving concomitant chemotherapy comprises administering an
effective amount of a humanized monoclonal antibody that
selectively binds IL-6, wherein said antibody is Ab1.
[0163] In another embodiment, a method for the treating anemia,
drug-induced immune hemolytic anemia (DIIHA), anemia associated
with chemotherapy, anemia associated with radiotherapy, or anemia
associated with cancer in a subject with head and neck cancer
receiving concomitant chemotherapy comprises administering an
effective amount of a humanized monoclonal antibody that
selectively binds IL-6, wherein said antibody is Ab1.
[0164] In another embodiment, a method for the treating anemia,
drug-induced immune hemolytic anemia (DIIHA), anemia associated
with chemotherapy, anemia associated with radiotherapy, or anemia
associated with cancer in a subject with head and neck cancer
receiving concomitant chemotherapy comprises administering an
effective amount of a humanized monoclonal antibody that
selectively binds IL-6, wherein said antibody is Ab1.
[0165] In another embodiment, the invention provides for the use of
an antibody according to the invention for preparing a diagnostic
composition for identifying cancers that are potentially resistant
to the effects of a chemotherapeutic or radiation by assaying for
IL-6 in order to detect whether elevated IL-6 levels are present at
the site of the treated cancer.
[0166] In another embodiment, the invention provides for the use of
an antibody according to the invention for preparing a composition
for the reduction of anemia, drug-induced immune hemolytic anemia
(DIIHA), anemia associated with chemotherapy, anemia associated
with radiotherapy, or anemia associated with cancer in subjects
with head and neck cancer receiving concomitant chemotherapy and
radiotherapy comprising administering an effective amount of a
humanized monoclonal antibody that selectively binds IL-6.
[0167] In another embodiment, the invention provides for the use of
an antibody according to the invention for preparing a composition
for the treating anemia, drug-induced immune hemolytic anemia
(DIIHA), anemia associated with chemotherapy, anemia associated
with radiotherapy, or anemia associated with cancer in a subject
with head and neck cancer receiving concomitant chemotherapy
comprising administering an effective amount of a humanized
monoclonal antibody that selectively binds IL-6, wherein said
antibody is Ab1.
[0168] In another embodiment, the invention provides for the use of
an antibody according to the invention for preparing a composition
for the treating anemia, drug-induced immune hemolytic anemia
(DIIHA), anemia associated with chemotherapy, anemia associated
with radiotherapy, or anemia associated with cancer in a subject
with head and neck cancer receiving concomitant chemotherapy
comprising administering an effective amount of a humanized
monoclonal antibody that selectively binds IL-6, wherein said
antibody is Ab1.
[0169] In one embodiment, the composition may be administered
subcutaneously. In another embodiment, the composition may be a
pharmaceutical composition. In a further embodiment, the
composition may be formulated for subcutaneous administration.
[0170] In one embodiment, the patient may have an elevated
C-reactive protein ("CRP"). In one embodiment, the patient may have
an elevated IL-6 serum level. In one embodiment, the patient may
have an elevated IL-6 level in the joints. In one embodiment, the
patient may have had an inadequate response to non-steroidal
anti-inflammatory drugs (NSAIDs). In one embodiment, the patient
may have had an inadequate response to non-biologic Disease
Modifying Anti-Rheumatic Drugs (DMARDs).
[0171] In one embodiment, the antibody or antibody fragment may be
directly or indirectly coupled to a detectable label, cytotoxic
agent, therapeutic agent, or an immunosuppressive agent. In one
embodiment, the detectable label may comprise a fluorescent dye,
bioluminescent material, radioactive material, chemiluminescent
moietie, streptavidin, avidin, biotin, radioactive material,
enzyme, substrate, horseradish peroxidase, acetylcholinesterase,
alkaline phosphatase, 3-galactosidase, luciferase, rhodamine,
fluorescein, fluorescein isothiocyanate, umbelliferone,
dichlorotriazinylamine, phycoerythrin, dansyl chloride, luminol,
luciferin, aequorin, Iodine 125 (.sup.125I), Carbon 14 (.sup.14C),
Sulfur 35 (.sup.35S), Tritium (.sup.3H), Phosphorus 32 (.sup.32P),
or any combination thereof. In another embodiment, the IL-6
antagonist may be coupled to a half-life increasing moiety.
[0172] In one embodiment, the antibody or antibody fragment may be
co-administered with another therapeutic agent selected from the
group consisting of analgesics, antibiotics, anti-cachexia agents,
anti-coagulants, anti-cytokine agents, antiemetic agents,
anti-fatigue agent, anti-fever agent, anti-inflammatory agents,
anti-nausea agents, antipyretics, antiviral agents, anti-weakness
agent, chemotherapy agents, cytokine antagonist, cytokines,
cytotoxic agents, gene therapy agents, growth factor, IL-6
antagonists, immunosuppressive agents, statins, or any combination
thereof. In one embodiment, the cytokine antagonist may be an
antagonist of a factor comprising tumor necrosis factor-alpha,
interferon gamma, interleukin 1 alpha, interleukin 1 beta,
interleukin 6, or any combination thereof. In one embodiment, the
cytokine antagonist may be an antagonist of TNF-.alpha.,
IL-1.alpha., IL-1.beta., IL-2, IL-4, IL-6, IL-10, IL-12, IL-13,
IL-18, IFN-.alpha., IFN-.gamma., BAFF, CXCL13, IP-10,
leukemia-inhibitory factor, or a combination thereof. In one
embodiment, the growth factor may be VEGF, EPO, EGF, HRG,
Hepatocyte Growth Factor (HGF), Hepcidin, or any combination
thereof. In one embodiment, the IL-6 antagonist may comprise an
anti-IL-6 antibodies or antibody fragments thereof, antisense
nucleic acids, polypeptides, small molecules, or any combination
thereof.
[0173] In another embodiment, the antisense nucleic acid may
comprise at least approximately 10 nucleotides of a sequence
encoding IL-6, IL-6 receptor alpha, gp130, p38 MAP kinase, JAK1,
JAK2, JAK3, STAT3, or SYK. In another embodiment, the antisense
nucleic acid may comprise DNA, RNA, peptide nucleic acid, locked
nucleic acid, morpholino (phosphorodiamidate morpholino oligo),
glycerol nucleic acid, threose nucleic acid, or any combination
thereof. In another embodiment, the IL-6 antagonist polypeptide may
comprise a fragment of a polypeptide having a sequence selected
from the group consisting IL-6, IL-6 receptor alpha, gp130, p38 MAP
kinase, JAK1, JAK2, JAK3, SYK, STAT3, or any combination thereof.
In a further embodiment, the IL-6 antagonist may be an anti-IL-6R,
anti-gp130, anti-p38 MAP kinase, anti-JAK1, anti-JAK2, anti-JAK3,
anti-STAT3, or anti-SYK antibody or antibody fragment
[0174] One embodiment encompasses specific humanized antibodies and
fragments and variants thereof for treatment or prevention of
anemia, drug-induced immune hemolytic anemia (DIIHA), anemia
associated with chemotherapy, anemia associated with radiotherapy,
or anemia associated with cancer capable of binding to IL-6 and/or
the IL-6/IL-6R complex. These antibodies may bind soluble IL-6 or
cell surface expressed IL-6. Also, these antibodies may inhibit the
formation or the biological effects of at least one of IL-6,
IL-6/IL-6R complexes, IL-6/IL-6R/gp130 complexes and/or multimers
of IL-6/IL-6R/gp130. The present invention relates to novel
therapies and therapeutic protocols using anti-IL-6 antibodies,
preferably those described herein.
[0175] The invention also contemplates the administration of
conjugates of anti-IL-6 antibodies and humanized, chimeric or
single chain versions thereof and other binding fragments and
variants thereof conjugated to at least one functional or
detectable moieties.
[0176] In an embodiment of the invention, the anti-IL-6 antibody or
antibody fragment or variant thereof may be directly or indirectly
attached to a detectable label or therapeutic agent.
[0177] In one embodiment, the IL-6 antagonist may be an antisense
nucleic acid. In another embodiment of the invention, the IL-6
antagonist may be an antisense nucleic acid, for example comprising
at least approximately 10 nucleotides of a sequence encoding IL-6,
IL-6 receptor alpha, gp130, p38 MAP kinase, JAK1, JAK2, JAK3,
STAT3, or SYK. In a further embodiment of the invention, the
antisense nucleic acid may comprise DNA, RNA, peptide nucleic acid,
locked nucleic acid, morpholino (phosphorodiamidate morpholino
oligo), glycerol nucleic acid, threose nucleic acid, or any
combination thereof.
[0178] In one embodiment, the IL-6 antagonist may comprise
Actemra.RTM. (Tocilizumab), Remicade.RTM., Zenapax.RTM.
(daclizumab), or any combination thereof.
[0179] In one embodiment, the IL-6 antagonist may comprise a
polypeptide having a sequence comprising a fragment of IL-6, IL-6
receptor alpha, gp130, p38 MAP kinase, JAK1, JAK2, JAK3, SYK, or
any combination thereof, such as a fragment or full-length
polypeptide that is at least 40 amino acids in length. In another
embodiment of the invention, the IL-6 antagonist may comprise a
soluble IL-6, IL-6 receptor alpha, gp130, p38 MAP kinase, JAK1,
JAK2, JAK3, SYK, STAT3, or any combination thereof.
[0180] In another aspect the invention provides pharmaceutical
compositions and their use in novel combination therapies and
comprising administration of an anti-IL-6 antibody, such as any one
of Ab1-Ab36 antibodies described in Table 4 or a fragment or
variant thereof, and at least one other therapeutic compound such
as an anti-cytokine agent.
[0181] In an embodiment of the invention, the IL-6 antagonist may
target IL-6, IL-6 receptor alpha, gp130, p38 MAP kinase, JAK1,
JAK2, JAK3, SYK, or any combination thereof. In one embodiment, the
IL-6 antagonist may comprise an antibody, an antibody fragment, a
peptide, a glycoalkoid, an antisense nucleic acid, a ribozyme, a
retinoid, an avemir, a small molecule, or any combination thereof.
In one embodiment, the IL-6 antagonist may comprise an anti-IL-6R,
anti-gp130, anti-p38 MAP kinase, anti-JAK1, anti-JAK2, anti-JAK3,
or anti-SYK antibody, anti-STAT3, or antibody fragment. In an
embodiment of the invention, the antagonist may comprise an
anti-IL-6 antibody (e.g., any one of Ab1-Ab36 antibodies described
in Table 4) or antibody fragment or variant thereof.
[0182] The present invention also pertains to methods of improving
survivability or quality of life of a patient having or at risk of
developing anemia, drug-induced immune hemolytic anemia (DIIHA),
anemia associated with chemotherapy, anemia associated with
radiotherapy, or anemia associated with cancer comprising
administering to the patient an anti-IL-6 antibody (e.g., ALD518
antibody) or antibody fragment or variant thereof, whereby the
patient's C-reactive protein ("CRP") level is lowered.
[0183] In one embodiment of the invention, the anti-IL-6 antibody
or antibody fragment or variant thereof may be administered to the
patient with a frequency at most once per period of approximately
4, 8, 12, 16, 20, or 24 weeks.
[0184] In an embodiment of the invention, the patient's quality of
life may be improved.
[0185] This invention relates to novel anti-IL-6 antibodies, novel
therapies and therapeutic protocols utilizing anti-IL-6 antibodies,
and pharmaceutical formulations containing anti-IL-6 antibodies. In
preferred embodiments, an anti-IL-6 antibody is any one of Ab1-Ab36
antibodies described in Table 4, which includes rabbit or humanized
forms thereof, as well as heavy chains, light chains, fragments,
variants, and CDRs thereof, or an antibody or antibody fragment
that specifically binds to the same linear or conformational
epitope(s) on an intact human IL-6 polypeptide fragment thereof as
Ab1. The subject application pertains in particular to preferred
formulations and therapeutic uses of an exemplary humanized
antibody referred to herein as any one of Ab1-Ab36 antibodies
described in Table 4 and variants thereof. In preferred
embodiments, the anti-IL-6 antibody has an in vivo half-life of at
least about 30 days, has an in vivo effect of lowering C-reactive
protein, possesses a binding affinity (Kd) for IL-6 of less than
about 50 picomolar, and/or has a rate of dissociation (K.sub.off)
from IL-6 of less than or equal to 10.sup.-4 S.sup.-1.
[0186] In one aspect, this invention pertains to methods of
improving survivability or quality of life of a patient in need
thereof, comprising administering to a patient with or at risk of
developing anemia, drug-induced immune hemolytic anemia (DIIHA),
anemia associated with chemotherapy, anemia associated with
radiotherapy, or anemia associated with cancer as a result of
disease or a therapeutic regimen comprising the administration of
an anti-IL-6 antibody, such as any one of Ab1-Ab36 antibodies
described in Table 4 antibody or a fragment or variant thereof
(e.g., Ab1).
[0187] Another embodiment relates to methods of improving
survivability or quality of life of a patient diagnosed with
anemia, drug-induced immune hemolytic anemia (DIIHA), anemia
associated with chemotherapy, anemia associated with radiotherapy,
or anemia associated with cancer, comprising administering to the
patient an anti-IL-6 antibody or antibody fragment or variant
thereof, whereby the patient's serum C-reactive protein ("CRP")
level is stabilized and preferably reduced, and monitoring the
patient to assess the reduction in the patient's serum CRP level.
In an embodiment, the patient may have an elevated C-reactive
protein (CRP) level prior to treatment. In an embodiment, the
patient may have an elevated serum CRP level prior to
treatment.
[0188] In an embodiment of the invention, the patient's serum CRP
level may remain decreased for an entire period intervening two
consecutive anti-IL-6 antibody administrations.
[0189] In one embodiment, the patient may have been diagnosed
anemia, drug-induced immune hemolytic anemia (DIIHA), anemia
associated with chemotherapy, anemia associated with radiotherapy,
or anemia associated with cancer.
[0190] In one embodiment, the antibody, or antibody fragment
thereof, may be expressed from a recombinant cell. In another
embodiment, the cell may be selected from a mammalian, yeast,
bacterial, and insect cell. In another embodiment, the cell may be
a yeast cell. In another embodiment, the cell may be a diploidal
yeast cell. In another embodiment, the yeast cell may be a Pichia
yeast. In another embodiment, the anti-IL-6 antibody may be
produced in a yeast based (Pichia pastoris) expression system using
conventional fermentation processes and downstream purification. In
one embodiment, the antibodies and antibody fragments described
herein may be expressed in yeast cells. In one embodiment, the
mating competent yeast may a member of the Saccharomycetaceae
family, which includes the genera Arxiozyma; Ascobotryozyma;
Citeromyces; Debaryomyces; Dekkera; Eremothecium; Issatchenkia;
Kazachstania; Kluyveromyces; Kodamaea; Lodderomyces; Pachysolen;
Pichia; Saccharomyces; Saturnispora; Tetrapisispora; Torulaspora;
Williopsis; and Zygosaccharomyces. Other types of yeast potentially
useful in the invention include Yarrowia, Rhodosporidium, Candida,
Hansenula, Filobasium, Filobasidellla, Sporidiobolus, Bullera,
Leucosporidium, and Filobasidella. In a preferred embodiment, the
mating competent yeast may a member of the genus Pichia. In a
further preferred embodiment, the mating competent yeast of the
genus Pichia is one of the following species: Pichia pastoris,
Pichia methanolica, and Hansenula polymorpha (Pichia angusta). In a
particularly preferred embodiment, the mating competent yeast of
the genus Pichia may the species Pichia pastoris.
[0191] In one embodiment, a composition for the reduction of
anemia, drug-induced immune hemolytic anemia (DIIHA), anemia
associated with chemotherapy, anemia associated with radiotherapy,
or anemia associated with cancer in subjects with head and neck
cancer receiving concomitant chemotherapy and radiotherapy may
comprise an effective amount of a humanized monoclonal antibody
that selectively binds IL-6.
[0192] In one embodiment, a composition for the treating anemia,
drug-induced immune hemolytic anemia (DIIHA), anemia associated
with chemotherapy, anemia associated with radiotherapy, or anemia
associated with cancer in a subject with head and neck cancer
receiving concomitant chemotherapy may comprise an effective amount
of a humanized monoclonal antibody that selectively binds IL-6,
wherein said antibody is Ab1.
[0193] In one embodiment, a composition comprising a humanized
monoclonal antibody or fragment thereof that selectively binds IL-6
for treating anemia, drug-induced immune hemolytic anemia (DIIHA),
anemia associated with chemotherapy, anemia associated with
radiotherapy, or anemia associated with cancer induced by
chemoradiation (CRT) regimens used for the treatment of cancers of
the head and neck.
[0194] In one embodiment, a composition for treatment or prevention
of anemia, drug-induced immune hemolytic anemia (DIIHA), anemia
associated with chemotherapy, anemia associated with radiotherapy,
or anemia associated with cancer may comprise a humanized
monoclonal antibody that selectively binds IL-6 and saline
solution.
[0195] In one embodiment, the anemia, drug-induced immune hemolytic
anemia (DIIHA), anemia associated with chemotherapy, anemia
associated with radiotherapy, or anemia associated with cancer may
be induced by chemoradiation (CRT) regimens or HSCT regimens used
for the treatment of cancers of the head and neck.
[0196] In one embodiment, a method of treating rheumatoid arthritis
by subcutaneously administering a therapeutically effective dosage
of an anti-IL-6 antibody or antibody fragment having the same
epitopic specificity as Ab1 or an antibody that competes with Ab1
for binding to IL-6 to a patient in need thereof.
[0197] In one embodiment, the invention provides for the use of
anti-IL-6 antibody or antibody fragment having the same epitopic
specificity as Ab1 or an antibody that competes with Ab for binding
to IL-6 for the preparation of a subcutaneously administrable
composition for treating rheumatoid arthritis in a patient in need
thereof.
[0198] In a further embodiment, a composition for treating
rheumatoid arthritis may comprise a therapeutically effective
dosage of an anti-IL-6 antibody or antibody fragment having the
same epitopic specificity as Ab1 or an antibody that competes with
Ab1 for binding to IL-6 to a patient in need thereof that is
formulated for subcutaneous administration.
[0199] In one embodiment, the composition may comprise an anti-IL-6
antibody or antibody fragment contained in a composition that
comprises, or alternatively consists of, said anti-IL-6 antibody or
antibody fragment, about 5 mM Histidine base, about 5 mM Histidine
HCl to make final pH 6, 250 mM sorbitol, and 0.015% (w/w)
Polysorbate 80.
[0200] In one embodiment, the composition may comprise an anti-IL-6
antibody or antibody fragment contained in a composition that
comprises, or alternatively consists of, said anti-IL-6 antibody or
antibody fragment, about 5 mM Histidine base, about 5 mM Histidine
HCl to make final pH 6, 250 to 280 mM sorbitol or sorbitol in
combination with sucrose, and 0.015% (w/w) Polysorbate 80, said
formulation having a nitrogen headspace in the shipping vials.
[0201] The invention also provides a composition for treating
rheumatoid arthritis comprising a therapeutically effective dosage
of an anti-IL-6 antibody or antibody fragment having the same
epitopic specificity as Ab1 or an antibody that competes with Ab1
for binding to IL-6 to a patient in need thereof that is formulated
for intravenous administration.
[0202] In one embodiment, the composition may comprise an anti-IL-6
antibody or antibody fragment contained in a composition
comprising, or alternatively consisting of, anti-IL-6 antibody or
antibody fragment, 25 mM Histidine base, Phosphoric acid q.s. to pH
6, and 250 mM sorbitol.
[0203] In one embodiment, the composition may comprise an anti-IL-6
antibody or antibody fragment contained in a composition
comprising, or alternatively consisting of, said anti-IL-6 antibody
or antibody fragment, 12.5 mM Histidine base, 12.5 mM Histidine HCl
(or 25 mM Histidine base and Hydrochloric acid q.s. to pH 6), 250
mM sorbitol, and 0.015% (w/w) Polysorbate 80.
[0204] In one embodiment, the composition may comprise an anti-IL-6
antibody or antibody fragment contained in a composition
comprising, or alternatively consisting of, said anti-IL-6 antibody
or antibody fragment, about 5 mM Histidine base, about 5 mM
Histidine HCl to make final pH 6, 250 mM sorbitol, and 0.015% (w/w)
Polysorbate 80.
[0205] In one embodiment, the composition may comprise a
concentration of an anti-IL-6 antibody or antibody fragment is at
least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 mg/mL or at
least about 10-100 mg/mL.
[0206] In one embodiment, the composition may comprise at least
about 50 or 100 mg of an anti-IL-6 antibody or antibody
fragment.
[0207] In one embodiment, the composition may comprise at least
about 80 mg, about 160 mg, or about 320 mg of an anti-IL-6 antibody
or antibody fragment.
[0208] In one embodiment, the effective amount is between about 0.1
and 20 mg/kg of body weight of recipient subject.
[0209] In one embodiment, the effective amount is between about 0.1
and 100 mg/kg of body weight of the subject.
[0210] In one embodiment, the composition may comprise at least
about 25, 80, 100, 160, 200, or 320 mg.
[0211] In one embodiment, the composition may be formulated for
intravenous administration.
[0212] In one embodiment, the composition may comprise an excipient
selected from the group consisting of histidine, sorbitol, and
polysorbate 80.
[0213] In one embodiment, the composition may be administered every
4 weeks. In one embodiment, the composition may be administered 80
mg every 4 weeks for a total of 2 doses. In one embodiment, the
composition may be administered 160 mg every 4 weeks for a total of
2 doses. In one embodiment, the composition may be administered 320
mg every 4 weeks for a total of 2 doses.
[0214] In one embodiment, the anti-IL-6 antibody may comprise a
light chain polypeptide comprising a polypeptide having at least
75% identity, at least 80% identity, at least 85% identity, at
least 90% identity, at least 95% identity, at least 96%, at least
97% identity, at least 98%, at least 99% identity, or 100% identity
to SEQ ID NO: 709.
[0215] In one embodiment, the anti-IL-6 antibody may comprise a
light chain polypeptide comprising a polypeptide encoded by a
polynucleotide that has at least 75% identity, at least 80%
identity, at least 85% identity, at least 90% identity, at least
95% identity, at least 96%, at least 97% identity, at least 98%, at
least 99% identity, or 100% identity to SEQ ID NO: 723.
[0216] In one embodiment, the anti-IL-6 antibody may comprise a
heavy chain polypeptide comprising a polypeptide having at least
75% identity, at least 80% identity, at least 85% identity, at
least 90% identity, at least 95% identity, at least 96%, at least
97% identity, at least 98%, at least 99% identity, or 100% identity
to SEQ ID NO: 657.
[0217] In one embodiment, the anti-IL-6 antibody may comprise a
heavy chain polypeptide comprising a polypeptide encoded by a
polynucleotide having at least 75% identity, at least 80% identity,
at least 85% identity, at least 90% identity, at least 95%
identity, at least 96%, at least 97% identity, at least 98%, at
least 99% identity, or 100% identity to SEQ ID NO: 700.
[0218] In one embodiment, the anti-IL-6 antibody may comprise a
light chain polypeptide comprising: a polypeptide having at least
75% identity to SEQ ID NO: 709, a polypeptide encoded by a
polynucleotide that has at least 75% identity to the polynucleotide
of SEQ ID NO: 723, a polypeptide encoded by a polynucleotide that
hybridizes under medium stringency conditions to a polynucleotide
having the sequence of the reverse complement of SEQ ID NO: 723, or
a polypeptide encoded by a polynucleotide that hybridizes under
high stringency conditions to a polynucleotide having the sequence
of the reverse complement of SEQ ID NO: 723; and a heavy chain
polypeptide comprising: a polypeptide having at least 75% identity
to SEQ ID NO: 657, a polypeptide encoded by a polynucleotide that
has at least 75% identity to the polynucleotide of SEQ ID NO: 700,
a polypeptide encoded by a polynucleotide that hybridizes under
medium stringency conditions to a polynucleotide having the
sequence of the reverse complement of SEQ ID NO: 700, or a
polypeptide encoded by a polynucleotide that hybridizes under high
stringency conditions to a polynucleotide having the sequence of
the reverse complement of SEQ ID NO: 700; wherein the Ab antibody
or antibody fragment specifically binds to IL-6 and antagonizes one
or more activity associated with IL-6.
[0219] In one embodiment, the anti-IL-6 antibody may comprise
anti-IL-6 antibody comprises variable heavy and light chain
sequences which are at least 90% identical to the variable heavy
and light sequences contained in SEQ ID NO: 19 and 20.
[0220] In one embodiment, the anti-IL-6 antibody may comprise
anti-IL-6 antibody comprises variable heavy and light chain
sequences which are at least 95% identical to the variable heavy
and light sequences contained in SEQ ID NO: 19 and 20.
[0221] In one embodiment, the anti-IL-6 antibody may comprise
anti-IL-6 antibody comprises variable heavy and light chain
sequences which are at least 98% identical to the variable heavy
and light sequences contained in SEQ ID NO:19 and 20.'
[0222] In one embodiment, the anti-IL-6 antibody may comprise
anti-IL-6 antibody comprises the variable heavy and light sequences
contained in SEQ ID NO: 19 and 20.
[0223] In one embodiment, the anti-IL-6 antibody may comprise
anti-IL-6 antibody further comprises the constant light chain
sequence contained in SEQ ID NO: 586.
[0224] In one embodiment, the anti-IL-6 antibody may comprise the
constant heavy chain sequence contained in SEQ ID NO: 588.
[0225] In one embodiment, the composition may further comprise
methotrexate.
[0226] In one embodiment, the composition may further comprise at
least one anti-inflammatory agent, analgesic agent, or
disease-modifying antirheumatic drug (DMARD).
[0227] In one embodiment, the anti-inflammatory agent is selected
from the group consisting of steroids, Cortisone, Glucocorticoids,
prednisone, prednisolone, Hydrocortisone (Cortisol), Cortisone
acetate, Methylprednisolone, Dexamethasone, Betamethasone,
Triamcinolone, Beclometasone, and Fludrocortisone acetate,
non-steroidal anti-inflammatory drug (NSAIDs), ibuprofen, naproxen,
meloxicam, etodolac, nabumetone, sulindac, tolementin, choline
magnesium salicylate, diclofenac, diflusinal, indomethicin,
Ketoprofen, Oxaprozin, piroxicam, and nimesulide, Salicylates,
Aspirin (acetylsalicylic acid), Diflunisal, Salsalate, p-amino
phenol derivatives, Paracetamol, phenacetin, Propionic acid
derivatives, Ibuprofen, Naproxen, Fenoprofen, Ketoprofen,
Flurbiprofen, Oxaprozin, Loxoprofen, Acetic acid derivatives,
Indomethacin, Sulindac, Etodolac, Ketorolac, Diclofenac,
Nabumetone, Enolic acid (Oxicam) derivatives, Piroxicam, Meloxicam,
Tenoxicam, Droxicam, Lornoxicam, Isoxicam, Fenamic acid derivatives
(Fenamates), Mefenamic acid, Meclofenamic acid, Flufenamic acid,
Tolfenamic acid, Selective COX-2 inhibitors (Coxibs), Celecoxib,
Rofecoxib, Valdecoxib, Parecoxib, Lumiracoxib, Etoricoxib,
Firocoxib, Sulphonanilides, Nimesulide, and Licofelone.
[0228] In one embodiment, the analgesic agent is selected from the
group consisting of NSAIDs, COX-2 inhibitors, Celecoxib, Rofecoxib,
Valdecoxib, Parecoxib, Lumiracoxib, Etoricoxib, Firocoxib,
acetaminophen, opiates, Dextropropoxyphene, Codeine, Tramadol,
Anileridine, Pethidine, Hydrocodone, Morphine, Oxycodone,
Methadone, Diacetylmorphine, Hydromorphone, Oxymorphone,
Levorphanol, Buprenorphine, Fentanyl, Sufentanyl, Etorphine,
Carfentanil, dihydromorphine, dihydrocodeine, Thebaine, Papaverine,
diproqualone, Flupirtine, Tricyclic antidepressants, and
lidocaine.
[0229] In one embodiment, the DMARD may be selected from the group
consisting of mycophenolate mofetil (CellCept), calcineurin
inhibitors, cyclosporine, sirolimus, everolimus, oral retinoids,
azathioprine, fumeric acid esters, D-penicillamine,
cyclophosphamide, immunoadsorption column, Prosorba(r) column, a
gold salt, auranofin, sodium aurothiomalate (Myocrisin),
hydroxychloroquine, chloroquine, leflunomide, methotrexate (MTX),
minocycline, sulfasalazine (SSZ), tumor necrosis factor alpha
(TNFa) blockers, etanercept (Enbrel), infliximab (Remicade),
adalimumab (Humira), certolizumab pegol (Cimzia), golimumab
(Simponi)), Interleukin 1 (IL-1) blockers, e.g., anakinra
(Kineret), monoclonal antibodies against B cells, rituximab
(Rituxan)), T cell costimulation blockers, abatacept (Orencia),
Interleukin 6 (IL-6) blockers, tocilizumab, RoActemra, and
Actemra.
[0230] In one embodiment, the DMARD is not an antibody.
[0231] In one embodiment, the administration of a composition
described herein to a patient in need thereof results in an
improvement in at least one of the following: (i) improved DAS-28
scores, (ii) improved EULAR scores, (iii) improved LDAS scores (iv)
improved ACR scores, (v) an increase in serum albumin, (vi) a
decrease in CRP, (vii) improvement in one or more SF-36 domain
scores, (viii) an improvement in SF-6D score, wherein said efficacy
is measured relative to said patient's baseline prior to
administration of said antibody or antibody fragment, relative
untreated patients, relative to patients receiving a placebo or
control formulation, or relative to age/gender norms.
[0232] In one embodiment, the administration of a composition
described herein to a patient in need thereof results in a
prolonged improvement in disease (observed at least 4, 6, 8, 10,
12, 14 or 16 weeks after antibody administration) as manifested by
at least one of the following: (i) improved DAS-28 scores, (ii)
improved EULAR scores, (iii) improved LDAS scores (iv) improved ACR
scores, (v) an increase in serum albumin, (vi) a decrease in CRP,
(vii) improvement in one or more SF-36 domain scores, (viii) an
improvement in SF-6D score, wherein said efficacy is measured
relative to said patient's baseline prior to administration of said
antibody or antibody fragment, relative untreated patients,
relative to patients receiving a placebo or control formulation, or
relative to age/gender norms.
[0233] In a further embodiment, the improvement in SF-6D score is
at least equal to the Minimum Important Difference (MID) relative
to the patient's SF-6D prior to said administration.
[0234] In a further embodiment, the improvement in SF-6D score is
at least twice the MID relative to the patient's SF-6D prior to
said administration. In a further embodiment, the improvement in
SF-6D score is at least three times the MID relative to the
patient's SF-6D prior to said administration. In another
embodiment, the improvement in SF-36 may comprise an improvement in
the physical functioning domain score, said improvement being at
least equal to the minimum clinically important difference (MCID),
at least 2 times the MCID, at least 3 times the MCID, at least 4
times the MCID, at least 5 times the MCID, or at least 6 times the
MCID for that domain score. In another embodiment, the improvement
in SF-36 may comprise an improvement in the role physical domain
score, said improvement being at least equal to the MCID, at least
2 times the MCID, at least 3 times the MCID, at least 4 times the
MCID, at least 5 times the MCID, or at least 6 times the MCID for
that domain score.
[0235] In another embodiment, the improvement in SF-36 may comprise
an improvement in the bodily pain domain score, said improvement
being at least equal to the MCID, at least 2 times the MCID, at
least 3 times the MCID, at least 4 times the MCID, at least 5 times
the MCID, or at least 6 times the MCID for that domain score. In
another embodiment, the improvement in SF-36 may comprise an
improvement in the general health domain score, said improvement
being at least equal to the MCID, at least 2 times the MCID, at
least 3 times the MCID, at least 4 times the MCID, at least 5 times
the MCID, or at least 6 times the MCID for that domain score. In
another embodiment, the improvement in SF-36 may comprise an
improvement in the role emotional domain score, said improvement
being at least equal to the MCID, at least 2 times the MCID, at
least 3 times the MCID, at least 4 times the MCID, at least 5 times
the MCID, or at least 6 times the MCID for that domain score.
[0236] In another embodiment, the improvement in SF-36 may comprise
an improvement in the vitality domain score, said improvement being
at least equal to the MCID, at least 2 times the MCID, at least 3
times the MCID, at least 4 times the MCID, at least 5 times the
MCID, or at least 6 times the MCID for that domain score.
[0237] In another embodiment, the improvement in SF-36 may comprise
an improvement in the social functioning domain score, said
improvement being at least equal to the MCID, at least 2 times the
MCID, at least 3 times the MCID, at least 4 times the MCID, at
least 5 times the MCID, or at least 6 times the MCID for that
domain score.
[0238] In another embodiment, the improvement in SF-36 may comprise
an improvement in the mental health domain score, said improvement
being at least equal to the MCID, at least 2 times the MCID, at
least 3 times the MCID, at least 4 times the MCID, at least 5 times
the MCID, or at least 6 times the MCID for that domain score.
[0239] In one embodiment, athod for treating rheumatoid arthritis
may comprise administering a composition comprising at least about
10 mg/mL of an anti-IL-6 antibody having the epitopic specificity
of Ab1 to a patient in need thereof.
[0240] The invention also provides for the use of an anti-IL-6
antibody having the epitopic specificity of Ab1 or any of the other
anti-11-6 antibodies disclosed herein for preparing a
pharmaceutical composition for treating rheumatoid arthritis
comprising at least about 10 mg/mL of an anti-IL-6 antibody having
the epitopic specificity of Ab1 to a patient in need thereof.
[0241] The invention also provides for a composition for treating
rheumatoid arthritis comprising at least about 10 mg/mL of an
anti-IL-6 antibody to a patient in need thereof. In one embodiment,
the composition may comporise at least about 20, 30, 40, 50, 60,
70, 80, or 100 mg/mL of an anti-IL-6 antibody. In one embodiment,
the composition may comporise at least about 10-100 mg/mL of an
anti-IL-6 antibody. In one embodiment, the composition may be
formulated for subcutaneous administration and comprises at least
about 100 mg/mL of an anti-IL-6 antibody. In one embodiment, the
composition may be formulated for intravenous administration and
comprises at least about 10, 20, 30, or 40 mg/mL, or 10-40 mg/mL of
an anti-IL-6 antibody.
[0242] In one embodiment, the anemia is severe anemia. In another
embodiment, the patient treated has at least one symptom of anemia,
optionally wherein the patient exhibits: hematocrit levels below
about 42-52% for men or about 36-48% for women; serum ferritin
levels below about 30-400 ng/mL for men or about 13-150 ng/mL for
women; serum iron levels below about 60-170 .mu.g/dL; reticulocyte
count below about 0.5%-1.5%; white blood cell (WBC) count of below
about 5,000-10,000/mL; red blood cell (RBC) count of below about
4.5-5.5.times.10.sup.6/mL for men and below about
4.0-5.0.times.10.sup.6/mL for women; platelet count below about
1.4-4.0.times.10.sup.5/mL; or total iron binding capacity (TIBC)
below about 250-370 .mu.g/dL. In another embodiment, the patient
treated has at least one symptom of anemia, optionally wherein the
patient exhibits fatigue, lack of energy, dizziness, headaches,
diminished sex drive, rapid heartbeat, inability to concentrate,
paleness, or shortness of breath. In another embodiment, the
patient has or is to receive autologous stem cell or bone marrow
transplant.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0243] FIG. 1 depicts alignments of variable light and variable
heavy sequences between a rabbit antibody variable light and
variable heavy sequences and homologous human sequences and the
humanized sequences. Framework regions are identified FR1-FR4.
Complementarity determining regions are identified as CDR1-CDR3.
Amino acid residues are numbered as shown. The initial rabbit
sequences are called RbtVL and RbtVH for the variable light and
variable heavy sequences respectively. Three of the most similar
human germline antibody sequences, spanning from Framework 1
through to the end of Framework 3, are aligned below the rabbit
sequences. The human sequence that is considered the most similar
to the rabbit sequence is shown first. In this example those most
similar sequences are L12A for the light chain and 3-64-04 for the
heavy chain. Human CDR3 sequences are not shown. The closest human
Framework 4 sequence is aligned below the rabbit Framework 4
sequence. The vertical dashes indicate a residue where the rabbit
residue is identical with at least one of the human residues at the
same position. The bold residues indicate that the human residue at
that position is identical to the rabbit residue at the same
position. The final humanized sequences are called VLh and VHh for
the variable light and variable heavy sequences respectively. The
underlined residues indicate that the residue is the same as the
rabbit residue at that position but different than the human
residues at that position in the three aligned human sequences.
[0244] FIG. 2 and FIG. 3 depicts alignments between a rabbit
antibody light and variable heavy sequences and homologous human
sequences and the humanized sequences. Framework regions are
identified as FR1-FR4. Complementarity determining regions are
identified as CDR1-CDR3.
[0245] FIGS. 4A-B and FIGS. 5A-B depicts alignments between light
and variable heavy sequences, respectively, of different forms of
Ab. Framework regions are identified as FR1-FR4. Complementarity
determining regions are identified as CDR1-CDR3. Sequence
differences within the CDR regions highlighted.
[0246] FIG. 6 provides the .alpha.-2-macroglobulin (A2M) dose
response curve for antibody Ab1 administered intravenously at
different doses one hour after a 100 .mu.g/kg s.c. dose of human
IL-6. See also WO 2011/066371.
[0247] FIG. 7 provides survival data for the antibody Ab1
progression groups versus control groups. See also WO
2011/066371.
[0248] FIG. 8 provides additional survival data for the antibody
Ab1 regression groups versus control groups. See also WO
2011/066371.
[0249] FIG. 9 provides survival data for polyclonal human IgG at 10
mg/kg i.v. every three days (270-320 mg tumor size) versus antibody
Ab1 at 10 mg/kg i.v. every three days (270-320 mg tumor size). See
also WO 2011/066371.
[0250] FIG. 10 provides survival data for polyclonal human IgG at
10 mg/kg i.v. every three days (400-527 mg tumor size) versus
antibody Ab1 at 10 mg/kg i.v. every three days (400-527 mg tumor
size). See also WO 2011/066371.
[0251] FIG. 11 shows increased hemoglobin concentration following
administration of Ab1 to patients with advanced cancer. See also WO
2011/066371.
[0252] FIG. 12 depicts mean plasma lipid concentrations following
administration of Ab1 to patients with advanced cancer. See also WO
2011/066371.
[0253] FIG. 13 depicts mean neutrophil counts following
administration of Ab1 to patients with advanced cancer. See also WO
2011/066371.
[0254] FIG. 14A demonstrates suppression of serum CRP levels in
healthy individuals.
[0255] FIG. 14B demonstrates suppression of serum CRP levels in
advanced cancer patients.
[0256] FIG. 15A depicts the mean CRP values for each dosage
concentrations (placebo, 80 mg, 160 mg, and 320 mg) of the Ab1
monoclonal antibody in NSCLC patients.
[0257] FIG. 15B depicts the change in median values of CRP from
each dosage concentration group corresponding to FIG. 15A in NSCLC
patients.
[0258] FIG. 16 depicts the mean plasma CRP concentration in
patients with advanced cancer after a single I.V. infusion of 80,
160, or 320 mg of Ab1 (ALD518) (n=8).
[0259] FIG. 17 depicts the mean serum CRP levels in patients with
rheumatoid arthritis patients with an inadequate response to
methotrexate after dosing at 80, 160, or 320 mg of Ab1
(ALD518).
[0260] FIG. 18A depicts that Ab1 increases mean hemoglobin
concentration (g/dL) at 80, 160 and 320 mg after 12 weeks of dosing
in NSCLC patients versus placebo. See also WO 2011/066371.
[0261] FIG. 18B depicts the mean change from baseline in hemoglobin
concentration (g/dL) for NSCLC patients versus placebo. See also WO
2011/066371.
[0262] FIG. 18C depicts the mean hemoglobin concentration (g/dL) in
NSCLC patients with a baseline hemoglobin below 11 g/L at baseline
versus time with Ab1 compared to placebo.
[0263] FIG. 19 depicts the mean change from baseline in hemoglobin
concentration (g/dL) for rheumatoid arthritis patients with an
inadequate response to methotrexate versus placebo. The normal
range of hemoglobin concentration is approximately 11.5-15.5 g/dL.
See also WO 2011/066371.
[0264] FIG. 20A depicts that Ab1 increases mean albumin
concentration at 80, 160 and 320 mg in NSCLC patients. See also WO
2011/066371.
[0265] FIG. 20B depicts the change from baseline for mean albumin
concentration from each dosage concentration group corresponding to
FIG. 20A in NSCLC patients. See also WO 2011/066371.
[0266] FIG. 20C depicts the mean albumin concentration in NSCLC
patients with a baseline albumin .ltoreq.35 g/l at baseline versus
time for Ab1 versus placebo. See also WO 2011/066371.
[0267] FIG. 21A depicts the mean plasma CRP levels concentration
after subcutaneous or intravenous dosing of humanized Ab1.
[0268] FIG. 21B depicts the mean plasma CRP levels concentration
after subcutaneous or intravenous dosing of humanized Ab1 at dosing
of 50 mg or 100 mg through 12 weeks.
[0269] FIG. 22 depicts percentage of mice ulcerated at any
timepoint after single dose radiation.
[0270] FIG. 23 depicts median tumor volume over time.
[0271] FIG. 24 depicts the percentage of mice with no ulcerations
versus ulcerations on Day 10.
[0272] FIG. 25 depicts median number of days ulcerated after single
dose of radiation.
[0273] FIG. 26 depicts of patient disposition in a Phase II
clinical trial for administration of ALD518 to patients with active
rheumatoid arthritis (RA). An asterisk indicates that one patient
did not receive treatment as randomized (the patient was randomized
to receive 160 mg ALD518, but received 320 mg on Day 1 and 160 mg
ALD518 at Week 8; AE=adverse event.
[0274] FIG. 27 graphically illustrates the mean changes in SF-36
composite scores at Week 12 in a Phase II clinical trial for
administration of ALD518 to patients with active RA. Data are mean
and error bars represent 95% confidence intervals (for each group,
the left bar shows the PCS score and the right bar shows the MCS
score). Mean changes in PCS and MCS scores at Week 12 exceeded the
MCID in all ALD-518 treatment groups. Greater improvements in MCS
score in favor of all ALD-518 treatment groups were demonstrated at
Week 12 (p<0.05). MCS scores changes also exceeded the PCS
scores in all ALD-518 treatment groups. SF-36=Short Form Health
Survey-36; PCS=physical component score; MCS=mental component
score; MCID=minimum clinically important difference.
[0275] FIGS. 28A-D presents spydergrams summarizing the changes
from baseline to week 12 in SF-36 domain scores compared with
age/gender matched norms for a Phase II clinical trial for
administration of ALD518 to patients with active RA. The
spydergrams summarize age/gender norms, average baseline scores
prior to treatment, and average scores after treatment in each of
eight tested domains for patients receiving 80 mg (panel A), 160 mg
(panel B), or 320 mg (panel C) ALD-518, or placebo (panel D).
PF=physical function; RP=role physical; BP=bodily pain; GH=general
health; VT=vitality; SF=social functioning; RE=role emotional;
MH=mental health; SF-36=Short Form-36.
[0276] FIGS. 29A-B presents spydergrams summarizing the changes
from baseline to weeks 12 (A) and 16 (B) in SF-36 domain scores
compared with age/gender matched norms for a Phase II clinical
trial for administration of ALD518 to patients with active RA. The
spydergrams summarize scores in eight tested domains for age/gender
norms, combined average baseline scores prior to treatment, and
average scores after treatment for each treatment group (ALD-518
dosages of 80 mg, 160 mg, or 320 mg), and the placebo group.
Abbreviations are as in FIG. 28.
[0277] FIG. 30 depicts WHO oral mucositis grade versus cumulative
IMRT (Gy): ALD518 160 mg intravenous at week 0 and week 4 for three
patients.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
Definitions
[0278] It is to be understood that this invention is not limited to
the particular methodology, protocols, cell lines, animal species
or genera, and reagents described, as such may vary. It is also to
be understood that the terminology used herein is for the purpose
of describing particular embodiments only, and is not intended to
limit the scope of the present invention which will be limited only
by the appended claims.
[0279] As used herein the singular forms "a", "and", and "the"
include plural referents unless the context clearly dictates
otherwise. Thus, for example, reference to "a cell" includes a
plurality of such cells and reference to "the protein" includes
reference to one or more proteins and equivalents thereof known to
those skilled in the art, and so forth. All technical and
scientific terms used herein have the same meaning as commonly
understood to one of ordinary skill in the art to which this
invention belongs unless clearly indicated otherwise.
[0280] Amplification as used herein, refers broadly to the
amplification of polynucleotide sequences is the in vitro
production of multiple copies of a particular nucleic acid
sequence. The amplified sequence is usually in the form of DNA. A
variety of techniques for carrying out such amplification are known
in the art. See, e.g., Van Brunt (1990) Bio/Technol. 8(4): 291-294.
Polymerase chain reaction or PCR is a prototype of nucleic acid
amplification, and use of PCR herein should be considered exemplary
of other suitable amplification techniques.
[0281] Antibody, as used herein, refers broadly to any polypeptide
chain-containing molecular structure with a specific shape that
fits to and recognizes an epitope, where at least one non-covalent
binding interactions stabilize the complex between the molecular
structure and the epitope. The archetypal antibody molecule is the
immunoglobulin, and all types of immunoglobulins, IgG, IgM, IgA,
IgE, IgD, from all sources, e.g., human, rodent, rabbit, cow,
sheep, pig, dog, chicken, are considered to be "antibodies."
Antibodies include but are not limited to chimeric antibodies,
human antibodies and other non-human mammalian antibodies,
humanized antibodies, single chain antibodies (scFvs), camelbodies,
nanobodies, IgNAR (single-chain antibodies derived from sharks),
small-modular immunopharmaceuticals (SMIPs), and antibody fragments
(e.g., Fabs, Fab', F(ab').sub.2.) Numerous antibody coding
sequences have been described; and others may be raised by methods
well-known in the art. See Streltsov, et al. (2005) Protein Sci.
14(11): 2901-9; Greenberg, et al. (1995) Nature 374(6518): 168-173;
Nuttall, et al. (2001) Mol Immunol. 38(4): 313-26;
Hamers-Casterman, et al. (1993) Nature 363(6428): 446-8; Gill, et
al. (2006) Curr Opin Biotechnol. 17(6): 653-8.
[0282] Antigen-binding fragment, as used herein, refers broadly to
a fragment of an antibody which recognizes an antigen (e.g.,
paratopes, antigen-binding fragment.) The antigen-binding fragment
may comprise a paratope that may be a small region (e.g., 15-22
amino acids) of the antibody's Fv region and may contain parts of
the antibody's heavy and light chains. See Goldsby, et al. Antigens
(Chapter 3) Immunology (5.sup.th Ed.) New York: W.H. Freeman and
Company, pages 57-75.
[0283] C-Reactive Protein (CRP), as used herein, refers broadly to
a 224 amino acid protein found in the blood that rise in response
to inflammation [(e.g., GenBank Protein Accession No. NP_000558
(SEQ ID NO: 726)]. CRP also encompasses any pre-pro, pro- and
mature forms of this CRP amino acid sequence, as well as mutants
and variants including allelic variants of this sequence. CRP
levels, e.g. in the serum, liver, or elsewhere in the body, can be
readily measured using routine methods and commercially available
reagents, e.g. ELISA, antibody test strip, immunoturbidimetry,
rapid immunodiffusion, visual agglutination, Western blot, Northern
blot As mentioned above CRP levels may in addition be measured in
patients having or at risk of developing thrombosis according to
the invention.
[0284] Coding sequence, as used herein refers broadly to an
in-frame sequence of codons that (in view of the genetic code)
correspond to or encode a protein or peptide sequence. Two coding
sequences correspond to each other if the sequences or their
complementary sequences encode the same amino acid sequences. A
coding sequence in association with appropriate regulatory
sequences may be transcribed and translated into a polypeptide. A
polyadenylation signal and transcription termination sequence will
usually be located 3' to the coding sequence. A "promoter sequence"
is a DNA regulatory region capable of binding RNA polymerase in a
cell and initiating transcription of a downstream (3' direction)
coding sequence. Promoter sequences typically contain additional
sites for binding of regulatory molecules (e.g., transcription
factors) which affect the transcription of the coding sequence. A
coding sequence is "under the control" of the promoter sequence or
"operatively linked" to the promoter when RNA polymerase binds the
promoter sequence in a cell and transcribes the coding sequence
into mRNA, which is then in turn translated into the protein
encoded by the coding sequence. A polynucleotide sequence
"corresponds" to a polypeptide sequence if translation of the
polynucleotide sequence in accordance with the genetic code yields
the polypeptide sequence (i.e., the polynucleotide sequence
"encodes" the polypeptide sequence), one polynucleotide sequence
"corresponds" to another polynucleotide sequence if the two
sequences encode the same polypeptide sequence.
[0285] Complementarity determining region, hypervariable region, or
CDR, as used herein refer broadly to at least one of the
hyper-variable or complementarity determining regions (CDRs) found
in the variable regions of light or heavy chains of an antibody
(See Kabat, E. A. et al. (1987) Sequences of Proteins of
Immunological Interest, National Institutes of Health, Bethesda,
Md.). These expressions include the hypervariable regions as
defined by Kabat et al. ("Sequences of Proteins of Immunological
Interest," Kabat E., et al. (1983) US Dept. of Health and Human
Services) or the hypervariable loops in 3-dimensional structures of
antibodies. Chothia and Lesk (1987) J Mol. Biol. 196: 901-917. The
CDRs in each chain are held in close proximity by framework regions
and, with the CDRs from the other chain, contribute to the
formation of the antigen binding site. Within the CDRs there are
select amino acids that have been described as the selectivity
determining regions (SDRs) which represent the critical contact
residues used by the CDR in the antibody-antigen interaction
(Kashmiri (2005) Methods 36:25-34). CDRs for exemplary anti-IL-6
antibodies are provided herein.
[0286] Disease or condition, as used herein, refers broadly to a
disease or condition that a patient has been diagnosed with or is
suspected of having, particularly a disease or condition associated
with elevated IL-6. A disease or condition encompasses, without
limitation thereto, anemia, as well as idiopathic conditions
characterized by symptoms that include elevated IL-6.
[0287] Effective amount, as used herein, refers broadly to an
amount of an active ingredient that is effective to relieve or
reduce to some extent at least one of the symptoms of the disease
in need of treatment, or to retard initiation of clinical markers
or symptoms of a disease in need of prevention, when the compound
is administered. Thus, an effective amount refers to an amount of
the active ingredient which exhibit effects such as (i) reversing
the rate of progress of a disease; (ii) inhibiting to some extent
further progress of the disease; and/or, (iii) relieving to some
extent (or, preferably, eliminating) at least one symptoms
associated with the disease. The effective amount may be
empirically determined by experimenting with the compounds
concerned in known in vivo and in vitro model systems for a disease
in need of treatment. The context in which the phrase "effective
amount" is used may indicate a particular desired effect. For
example, "an amount of an anti-IL-6 antibody effective to prevent
or treat a hypercoagulable state" and similar phrases refer to an
amount of anti-IL-6 antibody that, when administered to a subject,
will cause a measurable improvement in the subject's coagulation
profile, or prevent, slow, delay, or arrest, a worsening of the
coagulation profile for which the subject is at risk. Similarly,
"an amount of an anti-IL-6 antibody effective to reduce serum CRP
levels" and similar phrases refer to an amount of anti-IL-6
antibody that, when administered to a subject, will cause a
measurable decrease in serum CRP levels, or prevent, slow, delay,
or arrest, an increase in serum CRP levels for which the subject is
at risk. Similarly, "an amount of an anti-IL-6 antibody effective
to increase serum albumin levels" and similar phrases refer to an
amount of anti-IL-6 antibody that, when administered to a subject,
will cause a measurable increase in serum albumin levels, or
prevent, slow, delay, or arrest, a decrease in serum albumin levels
for which the subject is at risk. Similarly, "an amount of an
anti-IL-6 antibody effective to reduce weakness" and similar
phrases refer to an amount of anti-IL-6 antibody that, when
administered to a subject, will cause a measurable decrease in
weakness as determined by the hand grip strength test. Similarly,
"an amount of an anti-IL-6 antibody effective to increase weight"
and similar phrases refer to an amount of anti-IL-6 antibody that,
when administered to a subject, will cause a measurable increase in
a patient's weight. An effective amount will vary according to the
weight, sex, age and medical history of the individual, as well as
the severity of the patient's condition(s), the type of disease(s),
mode of administration, and the like. An effective amount may be
readily determined using routine experimentation, e.g., by
titration (administration of increasing dosages until an effective
dosage is found) and/or by reference to amounts that were effective
for prior patients. Generally, the anti-IL-6 antibodies of the
present invention will be administered in dosages ranging between
about 0.1 mg/kg and about 20 mg/kg of the patient's
body-weight.
[0288] Expression Vector, as used herein, refers broadly to a DNA
vectors contain elements that facilitate manipulation for the
expression of a foreign protein within the target host cell.
Conveniently, manipulation of sequences and production of DNA for
transformation is first performed in a bacterial host (e.g., E.
coli) and usually vectors will include sequences to facilitate such
manipulations, including a bacterial origin of replication and
appropriate bacterial selection marker. Selection markers encode
proteins necessary for the survival or growth of transformed host
cells grown in a selective culture medium. Host cells not
transformed with the vector containing the selection gene will not
survive in the culture medium. Typical selection genes encode
proteins that (a) confer resistance to antibiotics or other toxins,
(b) complement auxotrophic deficiencies, or (c) supply critical
nutrients not available from complex media. Exemplary vectors and
methods for transformation of yeast are described, for example, in
Burke, Dawson, & Stearns (2000) Methods in Yeast Genetics: a
Cold Spring Harbor Laboratory course manual. Cold Spring Harbor
Laboratory Press.
[0289] Folding, as used herein, refers broadly to the
three-dimensional structure of polypeptides and proteins, where
interactions between amino acid residues act to stabilize the
structure. While non-covalent interactions are important in
determining structure, usually the proteins of interest will have
intra- and/or intermolecular covalent disulfide bonds formed by two
cysteine residues. For naturally occurring proteins and
polypeptides or derivatives and variants thereof, the proper
folding is typically the arrangement that results in optimal
biological activity, and can conveniently be monitored by assays
for activity, e.g. ligand binding, enzymatic activity.
[0290] Framework region or FR, as used herein refers broadly to at
least one of the framework regions within the variable regions of
the light and heavy chains of an antibody. See Kabat, et al. (1987)
Sequences of Proteins of Immunological Interest, National
Institutes of Health, Bethesda, Md. These expressions include those
amino acid sequence regions interposed between the CDRs within the
variable regions of the light and heavy chains of an antibody. As
mentioned in the preferred embodiments, the FRs may comprise human
FRs highly homologous to the parent antibody (e.g., rabbit
antibody).
[0291] Glasgow Prognostic Score (GPS), as used herein, refers
broadly to an inflammation-based prognostic score that awards one
point for a serum albumin level less than <35 mg/L and one point
for a CRP level above 10 mg/L. Thus, a GPS of 0 indicates normal
albumin and CRP, a GPS of 1 indicates reduced albumin or elevated
CRP, and a GPS of 2 indicates both reduced albumin and elevated
CRP.
[0292] gp130 (also called Interleukin-6 receptor subunit beta), as
used herein, refers broadly to a transmembrane protein that forms
one subunit of type I cytokine receptors in the IL-6 receptor
family [(e.g., 918 precursor amino acid sequence available as
Swiss-Prot Protein Accession No. P40189 (SEQ ID NO: 728)]. gp130
also encompasses any pre-pro, pro- and mature forms of this amino
acid sequence, such as the mature form encoded by amino acids 23
through 918 of the sequence shown, as well as mutants and variants
including allelic variants of this sequence.
[0293] Heterologous region or domain of a DNA construct, as used
herein, refers broadly to an identifiable segment of DNA within a
larger DNA molecule that is not found in association with the
larger molecule in nature. Thus, when the heterologous region
encodes a mammalian gene, the gene will usually be flanked by DNA
that does not flank the mammalian genomic DNA in the genome of the
source organism. Another example of a heterologous region is a
construct where the coding sequence itself is not found in nature
(e.g., a cDNA where the genomic coding sequence contains introns,
or synthetic sequences having codons different than the native
gene). Allelic variations or naturally-occurring mutational events
do not give rise to a heterologous region of DNA as defined
herein.
[0294] Homology, as used herein, refers broadly to a degree of
similarity between a nucleic acid sequence and a reference nucleic
acid sequence or between a polypeptide sequence and a reference
polypeptide sequence. Homology may be partial or complete. Complete
homology indicates that the nucleic acid or amino acid sequences
are identical. A partially homologous nucleic acid or amino acid
sequence is one that is not identical to the reference nucleic acid
or amino acid sequence. The degree of homology can be determined by
sequence comparison. The term "sequence identity" may be used
interchangeably with "homology."
[0295] Host cell, as used herein, refers broadly to a cell that
contains an expression vector and supports the replication or
expression of the expression vector. Host cells may be prokaryotic
cells such as E. coli, or eukaryotic cells such as yeast, insect
(e.g., SF9), amphibian, or mammalian cells such as CHO, HeLa,
HEK-293 (e.g., cultured cells, explants, and cells in vivo.)
[0296] Isolated, as used herein, refers broadly to material removed
from its original environment in which it naturally occurs, and
thus is altered by the hand of man from its natural environment.
Isolated material may be, for example, exogenous nucleic acid
included in a vector system, exogenous nucleic acid contained
within a host cell, or any material which has been removed from its
original environment and thus altered by the hand of man (e.g.,
"isolated antibody").
[0297] Improved, as used herein, refers broadly to any beneficial
change resulting from a treatment. A beneficial change is any way
in which a patient's condition is better than it would have been in
the absence of the treatment. "Improved" includes prevention of an
undesired condition, slowing the rate at which a condition worsens,
delaying the development of an undesired condition, and restoration
to an essentially normal condition. For example, improvement in
anemia encompasses any increase in hemocrit, hemoglobin, or
reduction in fatigue.
[0298] IL-6 antagonist, as used herein, refers broadly to any
composition that prevents, inhibits, or lessens the effect(s) of
IL-6 signaling. Generally, such antagonists may reduce the levels
or activity of IL-6, IL-6 receptor alpha, gp130, or a molecule
involved in IL-6 signal transduction, or may reduce the levels or
activity complexes between the foregoing (e.g., reducing the
activity of an IL-6/IL-6 receptor complex). Antagonists include
antisense nucleic acids, including DNA, RNA, or a nucleic acid
analogue such as a peptide nucleic acid, locked nucleic acid,
morpholino (phosphorodiamidate morpholino oligo), glycerol nucleic
acid, or threose nucleic acid. See Heasman (2002) Dev Biol. 243(2):
209-14; Hannon and Rossi (2004) Nature 431(7006):371-8; Paul, et
al. (2002) Nat Biotechnol. 20(5):505-8; Zhang, et al. (2005) J Am
Chem Soc. 127(12):4174-5; Wahlestedt, et al. (2000) Proc Natl Acad
Sci USA. 97(10):5633-8; Hanvey, et al. (1992) Science 258
(5087):1481-5; Braasch, et al. (2002) Biochemistry 41(14): 4503-10;
Schoning, et al. (2000) Science 290(5495): 1347-51. In addition
IL-6 antagonists specifically include peptides that block IL-6
signaling such as those described in any of U.S. Pat. Nos.
5,210,075; 6,172,042; 6,599,875; 6,841,533; and 6,838,433. Also,
IL-6 antagonists according to the invention may include p38 MAP
kinase inhibitors such as those reported in U.S. Patent Application
No. 2007/0010529 given this kinase's role in cytokine production
and more particularly IL-6 production. Further, IL-6 antagonists
according to the invention include the glycoalkaloid compounds
reported in U.S. Patent Application Publication No. 2005/0090453 as
well as other IL-6 antagonist compounds isolatable using the IL-6
antagonist screening assays reported therein. Other L-6 antagonists
include antibodies, such as anti-IL-6 antibodies, anti-IL-6
receptor alpha antibodies, anti-gp130 antibodies, and anti-p38 MAP
kinase antibodies including (but not limited to) the anti-IL-6
antibodies disclosed herein, Actemra.RTM. (Tocilizumab),
Remicade.RTM., Zenapax.RTM. (daclizumab), or any combination
thereof. Other IL-6 antagonists include portions or fragments of
molecules involved in IL-6 signaling, such as IL-6, IL-6 receptor
alpha, and gp130, which may be native, mutant, or variant sequence,
and may optionally be coupled to other moieties (such as
half-life-increasing moieties, e.g. an Fc domain). For example, an
11-6 antagonist may be a soluble IL-6 receptor or fragment, a
soluble 11-6 receptor:Fc fusion protein, a small molecule inhibitor
of 11-6, an anti-IL-6 receptor antibody or antibody fragment or
variant thereof, antisense nucleic acid. Other IL-6 antagonists
include avemirs, such as C326 (Silverman, et al. (2005) Nat
Biotechnol. 23(12): 1556-61) and small molecules, such as synthetic
retinoid AM80 (tamibarotene) (Takeda, et al. (2006) Arterioscler
Thromb Vasc Biol. 26(5): 1177-83). Such IL-6 antagonists may be
administered by any means known in the art, including contacting a
subject with nucleic acids which encode or cause to be expressed
any of the foregoing polypeptides or antisense sequences.
[0299] Interleukin-6 (IL-6), as used herein, refers broadly to
interleukin-6 (IL-6) encompasses not only the following 212 amino
acid sequence available as GenBank Protein Accession No. NP_000591
(e.g., SEQ ID NO: 1), but also any pre-pro, pro- and mature forms
of this IL-6 amino acid sequence, as well as mutants and variants
including allelic variants of this sequence.
[0300] Interleukin-6 receptor (IL-6R) (IL-6 receptor alpha (IL-6RA)
[CD 126], as used herein, refers broadly to 468 amino acid protein
that binds IL-6, a potent pleiotropic cytokine that regulates cell
growth and differentiation and also plays an important role in
immune response (e.g., Swiss-Prot Protein Accession No. P08887 and
SEQ ID NO: 727). IL-6R also includes any pre-pro, pro- and mature
forms of this amino acid sequence, as well as mutants and variants
including allelic variants of this sequence.
[0301] Mammal, as used herein, refers broadly to any and all
warm-blooded vertebrate animals of the class Mammalia, including
humans, characterized by a covering of hair on the skin and, in the
female, milk-producing mammary glands for nourishing the young.
Examples of mammals include but are not limited to alpacas,
armadillos, capybaras, cats, camels, chimpanzees, chinchillas,
cattle, dogs, goats, gorillas, hamsters, horses, humans, lemurs,
llamas, mice, non-human primates, pigs, rats, sheep, shrews,
squirrels, and tapirs. Mammals include but are not limited to
bovine, canine, equine, feline, murine, ovine, porcine, primate,
and rodent species. Mammal also includes any and all those listed
on the Mammal Species of the World maintained by the National
Museum of Natural History, Smithsonian Institution in Washington
D.C.
[0302] Meiosis, as used herein, refers broadly to a process by
which a diploid yeast cell undergoes reductive division to form
four haploid spore products. Each spore may then germinate and form
a haploid vegetatively growing cell line.
[0303] Nucleic acid or nucleic acid sequence, as used herein,
refers broadly to a deoxy-ribonucleotide or ribonucleotide
oligonucleotide in either single- or double-stranded form. The term
encompasses nucleic acids, i.e., oligonucleotides, containing known
analogs of natural nucleotides. The term also encompasses
nucleic-acid-like structures with synthetic backbones. Unless
otherwise indicated, a particular nucleic acid sequence also
implicitly encompasses conservatively modified variants thereof
(e.g., degenerate codon substitutions) and complementary sequences,
as well as the sequence explicitly indicated. The term nucleic acid
is used interchangeably with gene, cDNA, mRNA, oligonucleotide, and
polynucleotide.
[0304] Operatively linked, as used herein, refers broadly to when
two DNA fragments are joined such that the amino acid sequences
encoded by the two DNA fragments remain in-frame.
[0305] Paratope, as used herein, refers broadly to the part of an
antibody which recognizes an antigen (e.g., the antigen-binding
site of an antibody.) Paratopes may be a small region (e.g., 15-22
amino acids) of the antibody's Fv region and may contain parts of
the antibody's heavy and light chains. See Goldsby, et al. Antigens
(Chapter 3) Immunology (5.sup.t Ed.) New York: W.H. Freeman and
Company, pages 57-75.
[0306] Patient, as used herein, refers broadly to any animal who is
in need of treatment either to alleviate a disease state or to
prevent the occurrence or reoccurrence of a disease state. Also,
"Patient" as used herein, refers broadly to any animal who has risk
factors, a history of disease, susceptibility, symptoms, signs, was
previously diagnosed, is at risk for, or is a member of a patient
population for a disease. The patient may be a clinical patient
such as a human or a veterinary patient such as a companion,
domesticated, livestock, exotic, or zoo animal. The term "subject"
may be used interchangeably with the term "patient".
[0307] Polyploid yeast that stably expresses or expresses a desired
secreted heterologous polypeptide for prolonged time, as used
herein, refers broadly to a yeast culture that secretes said
polypeptide for at least several days to a week, more preferably at
least a month, still more preferably at least about 1-6 months, and
even more preferably for more than a year at threshold expression
levels, typically at least about 10-25 mg/liter and preferably
substantially greater.
[0308] Polyploidal yeast culture that secretes desired amounts of
recombinant polypeptide, as used herein, refers broadly to cultures
that stably or for prolonged periods secrete at least about 10-25
mg/liter of heterologous polypeptide, more preferably at least
about 50-500 mg/liter, and most preferably at least about 500-1000
mg/liter or more.
[0309] Prolonged reduction in serum CRP, and similar phrases, as
used herein refer broadly to a measurable decrease in serum CRP
level relative to the initial serum CRP level (i.e. the serum CRP
level at a time before treatment begins) that is detectable within
about a week from when a treatment begins (e.g. administration of
an anti-IL-6 antibody) and remains below the initial serum CRP
level for an prolonged duration, e.g. at least about 14 days, at
least about 21 days, at least about 28 days, at least about 35
days, at least about 40 days, at least about 50 days, at least
about 60 days, at least about 70 days, at least about 11 weeks, or
at least about 12 weeks from when the treatment begins.
[0310] Promoter, as used herein, refers broadly to an array of
nucleic acid sequences that direct transcription of a nucleic acid.
As used herein, a promoter includes necessary nucleic acid
sequences near the start site of transcription, such as, in the
case of a polymerase II type promoter, a TATA element. A promoter
also optionally includes distal enhancer or repressor elements,
which can be located as much as several thousand base pairs from
the start site of transcription. A "constitutive" promoter is a
promoter that is active under most environmental and developmental
conditions. An "inducible" promoter is a promoter that is active
under environmental or developmental regulation.
[0311] Prophylactically effective amount, as used herein, refers
broadly to the amount of a compound that, when administered to a
patient for prophylaxis of a disease or prevention of the
reoccurrence of a disease, is sufficient to effect such prophylaxis
for the disease or reoccurrence. The prophylactically effective
amount may be an amount effective to prevent the incidence of signs
and/or symptoms. The "prophylactically effective amount" may vary
depending on the disease and its severity and the age, weight,
medical history, predisposition to conditions, preexisting
conditions, of the patient to be treated.
[0312] Prophylaxis, as used herein, refers broadly to a course of
therapy where signs and/or symptoms are not present in the patient,
are in remission, or were previously present in a patient.
Prophylaxis includes preventing disease occurring subsequent to
treatment of a disease in a patient. Further, prevention includes
treating patients who may potentially develop the disease,
especially patients who are susceptible to the disease (e.g.,
members of a patent population, those with risk factors, or at risk
for developing the disease).
[0313] Recombinant as used herein, refers broadly with reference to
a product, e.g., to a cell, or nucleic acid, protein, or vector,
indicates that the cell, nucleic acid, protein or vector, has been
modified by the introduction of a heterologous nucleic acid or
protein or the alteration of a native nucleic acid or protein, or
that the cell is derived from a cell so modified. Thus, for
example, recombinant cells express genes that are not found within
the native (non-recombinant) form of the cell or express native
genes that are otherwise abnormally expressed, under expressed or
not expressed at all.
[0314] Selectable Marker, as used herein, refers broadly to a
selectable marker is a gene or gene fragment that confers a growth
phenotype (physical growth characteristic) on a cell receiving that
gene as, for example through a transformation event. The selectable
marker allows that cell to survive and grow in a selective growth
medium under conditions in which cells that do not receive that
selectable marker gene cannot grow. Selectable marker genes
generally fall into several types, including positive selectable
marker genes such as a gene that confers on a cell resistance to an
antibiotic or other drug, temperature when two ts mutants are
crossed or a ts mutant is transformed; negative selectable marker
genes such as a biosynthetic gene that confers on a cell the
ability to grow in a medium without a specific nutrient needed by
all cells that do not have that biosynthetic gene, or a mutagenized
biosynthetic gene that confers on a cell inability to grow by cells
that do not have the wild type gene; and the like. Suitable markers
include but are not limited to ZEOMYCIN.RTM. (zeocin), neomycin,
G418, LYS3, MET1, MET3a, ADE1, ADE3, and URA3.
[0315] Specifically (or selectively) binds to an antibody or
"specifically (or selectively) immunoreactive with," or
"specifically interacts or binds," as used herein, refers broadly
to a protein or peptide (or other epitope), refers, in some
embodiments, to a binding reaction that is determinative of the
presence of the protein in a heterogeneous population of proteins
and other biologics. For example, under designated immunoassay
conditions, the specified antibodies bind to a particular protein
at least two times greater than the background (non-specific
signal) and do not substantially bind in a significant amount to
other proteins present in the sample. Typically a specific or
selective reaction will be at least twice background signal or
noise and more typically more than about 10 to 100 times
background.
[0316] Signs of disease, as used herein, refers broadly to any
abnormality indicative of disease, discoverable on examination of
the patient; an objective indication of disease, in contrast to a
symptom, which is a subjective indication of disease.
[0317] Solid support, support, and substrate, as used herein,
refers broadly to any material that provides a solid or semi-solid
structure with which another material can be attached including but
not limited to smooth supports (e.g., metal, glass, plastic,
silicon, and ceramic surfaces) as well as textured and porous
materials.
[0318] Subjects as used herein, refers broadly to anyone suitable
to be treated according to the present invention include, but are
not limited to, avian and mammalian subjects, and are preferably
mammalian. Mammals of the present invention include, but are not
limited to, canines, felines, bovines, caprines, equines, ovines,
porcines, rodents (e.g., rats and mice), lagomorphs, primates,
humans. Any mammalian subject in need of being treated according to
the present invention is suitable. Human subjects of both genders
and at any stage of development (i.e., neonate, infant, juvenile,
adolescent, adult) can be treated according to the present
invention. The present invention may also be carried out on animal
subjects, particularly mammalian subjects such as mice, rats, dogs,
cats, cattle, goats, sheep, and horses for veterinary purposes, and
for drug screening and drug development purposes. "Subjects" is
used interchangeably with "patients."
[0319] Mating competent yeast species, as used herein refers
broadly encompass any diploid or tetraploid yeast which can be
grown in culture. Such species of yeast may exist in a haploid,
diploid, or tetraploid form. The cells of a given ploidy may, under
appropriate conditions, proliferate for indefinite number of
generations in that form. Diploid cells can also sporulate to form
haploid cells. Sequential mating can result in tetraploid strains
through further mating or fusion of diploid strains. In the present
invention the diploid or polyploidal yeast cells are preferably
produced by mating or spheroplast fusion.
[0320] Haploid Yeast Cell, as used herein, refers broadly to a cell
having a single copy of each gene of its normal genomic
(chromosomal) complement.
[0321] Polyploid Yeast Cell, as used herein, refers broadly to a
cell having more than one copy of its normal genomic (chromosomal)
complement.
[0322] Diploid Yeast Cell, as used herein, refers broadly to a cell
having two copies (alleles) of essentially every gene of its normal
genomic complement, typically formed by the process of fusion
(mating) of two haploid cells.
[0323] Tetraploid Yeast Cell, as used herein, refers broadly to a
cell having four copies (alleles) of essentially every gene of its
normal genomic complement, typically formed by the process of
fusion (mating) of two haploid cells. Tetraploids may carry two,
three, four, or more different expression cassettes. Such
tetraploids might be obtained in S. cerevisiae by selective mating
homozygotic heterothallic a/a and alpha/alpha diploids and in
Pichia by sequential mating of haploids to obtain auxotrophic
diploids. For example, a [met his] haploid can be mated with [ade
his] haploid to obtain diploid [his]; and a [met arg] haploid can
be mated with [ade arg] haploid to obtain diploid [arg]; then the
diploid [his].times.diploid [arg] to obtain a tetraploid
prototroph. It will be understood by those of skill in the art that
reference to the benefits and uses of diploid cells may also apply
to tetraploid cells.
[0324] Yeast Mating, as used herein, refers broadly to a process by
which two haploid yeast cells naturally fuse to form one diploid
yeast cell.
[0325] Variable region or VR as used herein refers broadly to the
domains within each pair of light and heavy chains in an antibody
that are involved directly in binding the antibody to the antigen.
Each heavy chain has at one end a variable domain (V.sub.H)
followed by a number of constant domains. Each light chain has a
variable domain (V.sub.L) at one end and a constant domain at its
other end; the constant domain of the light chain is aligned with
the first constant domain of the heavy chain, and the light chain
variable domain is aligned with the variable domain of the heavy
chain.
[0326] Variants, as used herein refers broadly to single-chain
antibodies, dimers, multimers, sequence variants, and domain
substitution variants. Single-chain antibodies such as SMIPs, shark
antibodies, nanobodies (e.g., Camelidiae antibodies). Sequence
variants can be specified by percentage identity (similarity,
sequence homology) e.g., 99%, 95%, 90%, 85%, 80%, 70%, 60%, or by
numbers of permitted conservative or non-conservative
substitutions. Domain substitution variants include replacement of
a domain of one protein with a similar domain of a related protein.
A similar domain may be identified by similarity of sequence,
structure (actual or predicted), or function. For example, domain
substitution variants include the substitution of at least one CDRs
and/or framework regions.
[0327] The techniques and procedures are generally performed
according to conventional methods well known in the art and as
described in various general and more specific references that are
cited and discussed throughout the present specification. See,
e.g., Sambrook, et al. (2001) Molec. Cloning: Lab. Manual [3.sup.rd
Ed] Cold Spring Harbor Laboratory Press. Standard techniques may be
used for recombinant DNA, oligonucleotide synthesis, and tissue
culture, and transformation (e.g., electroporation, lipofection).
Enzymatic reactions and purification techniques may be performed
according to manufacturer's specifications or as commonly
accomplished in the art or as described herein. The nomenclatures
utilized in connection with, and the laboratory procedures and
techniques of, analytical chemistry, synthetic organic chemistry,
and medicinal and pharmaceutical chemistry described herein are
those well known and commonly used in the art. Standard techniques
may be used for chemical syntheses, chemical analyses,
pharmaceutical preparation, formulation, and delivery, and
treatment of patients.
Anemia
[0328] The IL-6 antagonists described herein, include but are not
limited to anti-IL-6 antibodies and antibody fragments, and may be
used in methods and compositions for the treatment of anemia (e.g.,
anemia associated with chemotherapy).
Anemia
[0329] Normal hemoglobin ranges for humans are about 14-18 g/dl for
men and 12-16 for women g/dl with the average hemoglobin value for
men at about 16 g/dL and for women at about 14 g/dL. Anemia may be
considered a drop of hemoglobin levels below about 11 g/dL and
severe anemia may be considered a drop in hemoglobin below about 8
g/dL. See Table 1; See also Groopman & Itri (1999) Journal of
National Cancer Institute 91(19): 1616-1634. Anemia may be caused
by cancer (e.g., cancer-related anemia), chemotherapy (e.g.,
chemotherapy-related anemia), radiotherapy (e.g.,
intensity-modulated radiotherapy (IMRT)), or drugs (e.g.,
drug-induced immune hemolytic anemia (DIIHA)). Garratty (2009)
Hematology 1: 73-79.
TABLE-US-00001 TABLE 1 WHO and NCI Grading Systems for Anemia World
Health National Cancer Severity Organization Institute Grade 0
.gtoreq.11.0 g/dL 12.0-16.0 g/dL for women 14.0-18.0 g/dL for men
Grade 1 (mild) 9.5-10.9 g/dL 10.0-12.0 g/dL for women 10.0-14.0
g/dL for men Grade 2 (moderate) 8.0-9.4 g/dL 8.0-10.0 g/dL Grade 3
(severe) 6.5-7.9 g/dL 6.5-7.9 g/dL Grade 4 (life threatening)
<6.5 g/dL <6.5 g/dL
[0330] Anemia may be assessed by assays well-known in the art such
as a Complete Blood Count (CBC) test that measures the red blood
cell (RBC) count, hematocrit, hemoglobin levels, white blood cell
count (CBC), differential blood count, and platelet count. The
first three parameters, the RBC, hematocrit, and hemoglobin levels
are the most commonly used in determining whether or not the
patient is suffering from anemia. Other anemia marker include the
measurement of the levels of serum ferritin and serum iron.
TABLE-US-00002 TABLE 2 Common Parameters Measured in Diagnosing
Anemia Parameter Normal Range (men) Normal Range (women) Hematocrit
42-52% 36-48% Ferritin (serum) 30-400 ng/mL 13-150 ng/mL Iron
(serum) 60-170 .mu.g/dL 60-170 .mu.g/dL Reticulocyte Count
0.5%-1.5% 0.5%-1.5% White Blood Cell 5,000-10,000/mL
5,000-10,000/mL (WBC) Red Blood Cell (RBC) 4.5-5.5 .times.
10.sup.6/mL 4.0-5.0 .times. 10.sup.6/mL Platelet 1.4-4.0 .times.
10.sup.5/mL 1.4-4.0 .times. 10.sup.5/mL TIBC 250-370 .mu.g/dL
250-370 .mu.g/dL
[0331] Lower values of hematocrit, serum ferritin, serum iron,
white blood cells, red blood cells, and platelets below those
levels presented in Table 2 are signs of anemia. The upper normal
limit of reticulocytes (immature red blood cells) is about 1.5%, a
low count suggests problems with the bone marrow and a high count
suggests hemolytic anemia (e.g., the patient's body is attempting
to make up for a loss of RBCs). MD Medical Center (2011)
"Anemia-Diagnosis". Additionally, total iron binding capacity
(TIBC) measures the level for transferring in the blood.
Transferrin is a protein that carries iron in the blood and a
higher than normal TIBC value is a sign of iron-deficiency anemia
and a lower than normal level indicates chronic anemia, pernicious
anemia, or hemolytic anemia. Additionally, tests for anemia include
direct or indirect Coombs' test, indirect bilirubin levels, serum
haptoglobin, vitamin B12 levels, folate levels, and urine
hemoglobin. MedlinePlus website "Drug-induced immune hemolytic
anemia." (2011).
[0332] Anemia is also common in cancer where about 30% of
newly-diagnosed untreated cancer patients exhibit anemia. Mori, et
al. (2009) Biomedical Research 30(1): 47-51. Over 70% of patients
who receive chemotherapy will develop some degree of anemia during
the course of their treatment. Further, patients receiving
radiation to the head, neck, or chest areas, and patients who
undergo bone marrow or stem cell transplant, often develop anemia.
Patient Advocate Foundation (2011) "Chemotherapy-Related Anemia
Guide." Certain chemotherapy agents known to cause anemia are
listed in Table 3.
TABLE-US-00003 TABLE 3 Common Chemotherapy Agents. Alemtuzumab
(Campath .RTM.) Bleomycin (Blenoxane .RTM.) Asparaginase (Elspar
.RTM.) Cyclophosphamide (Cytoxan .RTM.) Cytarabine (Cytosar-U
.RTM.) Busulfan (Myleran .RTM., Busulfex .RTM.) Docetaxel (Taxotere
.RTM.) Doxorubicin (Adriamycin .RTM.) Capecitabine (Xeloda .RTM.)
Fluorouracil (5-FU .RTM.) Gemcitabine (Gemzar .RTM.) Carboplatin
(Paraplatin .RTM.) Gemtuzumab ozogamicin (Mylotarg .RTM.)
Hydroxyurea (Hydrea .RTM.) Daunorubicin (Cerubidine .RTM.)
Idarubicin (Idamycin .RTM.) Interleukin 2 (Proleukin .RTM.)
Epirubicin (Ellence .RTM.) Lomustine (CeeNU .RTM.) Melphalan
(Alkeran .RTM.) Etoposide (VePesid .RTM.) Mitomycin (Mutamycin
.RTM.) Mitoxantrone (Novantrone .RTM.) Irinotecan (Camptosar .RTM.)
Oxaliplatin (Eloxatin .RTM.) Paclitaxel (Taxol .RTM.) Methotrexate
(Rheumatrex .RTM.) Pentostatin (Nipent .RTM.) Procarbazine
(Matulane .RTM.) Mechlorethamine (Mustargen .RTM.) Topotecan
(Hycamtin .RTM.) Trastuzumab (Herceptin .RTM.) Pemetrexed (Alimta
.RTM.) Vinblastine (Velban .RTM.) Vincristine (Oncovin .RTM.)
Thiotepa (Thioplex .RTM.) Tretinoin (Vesanoid .RTM.) Cisplatin
(PLATINOL .RTM.)
[0333] Anemia is also a common side-effect of radiation therapy
(radiotherapy). In one study, 41% of all patients were anemic
(hemoglobin <12 g/dL); by the end of radiation therapy, this
percentage increased to 54%. The most common tumor types were
prostate (16%), breast (14%), head and neck (12%), colorectal
(11%), lung/bronchus (11%), and uterine-cervix (9%). Anemia was
most prevalent in patients with uterine-cervical tumors (75%),
increasing to 79% by the end of radiation therapy. The prevalence
of lung/bronchus and colorectal cancer was 55% and 44%,
respectively, at baseline and increased to 77% and 63%,
respectively, after radiation therapy. For nearly all tumor types,
the majority of patients had or developed mild to moderate anemia
(hemoglobin 10.0 to 11.9 g/dL). Harrison, et al. (2001) Semin
Oncol. 28(2 Suppl 8): 54-9.
[0334] Drug-induced immune hemolytic anemia may be caused by
therapeutic regimes involving the administration of drugs, where
three classes of drug predominate in drug-induced immune hemolytic
anemia (DIIHA), namely anti-microbial, anti-inflammatory, and
anti-neoplastic drugs. Additionally, drugs that cause anemia
include but are not limited to carboplatin, cefamandole, cefazolin,
cefixime, cefotetan, cefoxitin, ceftazidime, ceftizoxime,
ceftriaxone, cefuroxime, cephalexin, cephalosporins (a class of
antibiotics), cephalothin, chlorpropamide, cimetidine, dapsone,
diclofenac, erythromycin, fludarabine, hydrochlorothiazide,
levodopa, levofloxacin, mefloquine, methyldopa, nafcillin,
nitrofurantoin, nonsteriodal anti-inflammatory drugs (NSAIDs),
oxaliplatin, penicillin (and its derivatives), phenacetin,
phenazopyridine (pyridium), piperacillin, probenecid, procainamide,
quinidine, rifampin, sulfamethoxazole, ticarcillin, tolectin,
trimethoprim, and 3-lactamase inhibitors. Garratty (2009)
Hematology 1: 73-79; MedlinePlus website "Drug-induced immune
hemolytic anemia." (2011).
[0335] The invention described herein provides a method of treating
or preventing anemia comprising administration of a composition
comprising an effective amount of an IL-6 antagonist. Also, the
IL-6 antagonists described herein may be used to treat anemia
comprising administration of a composition comprising an effective
amount of an IL-6 antagonist. The IL-6 antagonists described herein
may be used to prevent anemia comprising administration of a
composition comprising an effective amount of an IL-6 antagonist,
optionally prior to the onset of anemia.
[0336] In methods for treating or preventing anemia the IL-6
antagonists may target IL-6, IL-6 receptor alpha, gp130, p38 MAP
kinase, JAK1, JAK2, JAK3, SYK, or any combination thereof. Further,
the IL-6 antagonist may be an antibody, an antibody fragment, a
peptide, a glycoalkoid, an antisense nucleic acid, a ribozyme, a
retinoid, an avemir, a small molecule, or any combination thereof.
The IL-6 antagonist may be an anti-IL-6R, anti-gp130, anti-p38 MAP
kinase, anti-JAK1, anti-JAK2, anti-JAK3, or anti-SYK antibody or
antibody fragment. The IL-6 antagonist may be a small molecule
comprising thalidomide, lenalidomide, or any combination thereof.
The IL-6 antagonist may be IL-6 antagonists is an anti-IL-6
antibody or antibody fragment (e.g., antigen-binding fragment),
wherein the anti-IL-6 antibody or antibody fragment thereof (e.g.,
antigen-binding fragment) may be Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7,
Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18,
Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29,
Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antigen-binding fragment thereof, to a subject in need thereof,
wherein the antibody, or antigen-binding fragment thereof,
specifically binds to IL-6.
[0337] The invention described herein provides compositions of
treating or preventing anemia comprising an effective amount of an
IL-6 antagonist. Also, the IL-6 antagonists described herein may be
used in compositions for treating anemia comprising an effective
amount of an IL-6 antagonist. The IL-6 antagonists described herein
may be used in compositions for preventing anemia comprising an
effective amount of an IL-6 antagonist, optionally prior to the
onset of anemia.
[0338] In compositions for treating or preventing anemia the IL-6
antagonists may target IL-6, IL-6 receptor alpha, gp130, p38 MAP
kinase, JAK1, JAK2, JAK3, SYK, or any combination thereof. Further,
the IL-6 antagonist may be an antibody, an antibody fragment, a
peptide, a glycoalkoid, an antisense nucleic acid, a ribozyme, a
retinoid, an avemir, a small molecule, or any combination thereof.
The IL-6 antagonist may be an anti-IL-6R, anti-gp130, anti-p38 MAP
kinase, anti-JAK1, anti-JAK2, anti-JAK3, or anti-SYK antibody or
antibody fragment. The IL-6 antagonist may be a small molecule
comprising thalidomide, lenalidomide, or any combination thereof.
The IL-6 antagonist may be IL-6 antagonists is an anti-IL-6
antibody or antibody fragment (e.g., antigen-binding fragment),
wherein the anti-IL-6 antibody or antibody fragment thereof (e.g.,
antigen-binding fragment) may be Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7,
Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16, Ab17, Ab18,
Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29,
Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an
antigen-binding fragment thereof, to a subject in need thereof,
wherein the antibody, or antigen-binding fragment thereof,
specifically binds to IL-6.
[0339] The invention described herein provides a method of treating
or preventing anemia associated with chemotherapy comprising
administration of a composition comprising an effective amount of
an IL-6 antagonist. Also, the IL-6 antagonists described herein may
be used to treat anemia associated with chemotherapy comprising
administration of a composition comprising an effective amount of
an IL-6 antagonist. The IL-6 antagonists described herein may be
used to prevent anemia associated with chemotherapy comprising
administration of a composition comprising an effective amount of
an IL-6 antagonist, optionally prior to beginning chemotherapy.
[0340] In methods for treating or preventing anemia associated with
chemotherapy the IL-6 antagonists may target IL-6, IL-6 receptor
alpha, gp130, p38 MAP kinase, JAK1, JAK2, JAK3, SYK, or any
combination thereof. Further, the IL-6 antagonist may be an
antibody, an antibody fragment, a peptide, a glycoalkoid, an
antisense nucleic acid, a ribozyme, a retinoid, an avemir, a small
molecule, or any combination thereof. The IL-6 antagonist may be an
anti-IL-6R, anti-gp130, anti-p38 MAP kinase, anti-JAK1, anti-JAK2,
anti-JAK3, or anti-SYK antibody or antibody fragment. The IL-6
antagonist may be a small molecule comprising thalidomide,
lenalidomide, or any combination thereof. The IL-6 antagonist may
be IL-6 antagonists is an anti-IL-6 antibody or antibody fragment
(e.g., antigen-binding fragment), wherein the anti-IL-6 antibody or
antibody fragment thereof (e.g., antigen-binding fragment) may be
Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12,
Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23,
Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34,
Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to
a subject in need thereof, wherein the antibody, or antigen-binding
fragment thereof, specifically binds to IL-6.
[0341] The invention described herein provides compositions for
treating or preventing anemia associated with chemotherapy
comprising administration of a composition comprising an effective
amount of an IL-6 antagonist. Also, the IL-6 antagonists described
herein may be used in compositions for treating anemia associated
with chemotherapy comprising an effective amount of an IL-6
antagonist. The IL-6 antagonists described herein may be used in
compositions for preventing anemia associated with chemotherapy
comprising an effective amount of an IL-6 antagonist, optionally
prior to beginning chemotherapy.
[0342] In compositions for treating or preventing anemia associated
with chemotherapy the IL-6 antagonists may target IL-6, IL-6
receptor alpha, gp130, p38 MAP kinase, JAK1, JAK2, JAK3, SYK, or
any combination thereof. Further, the IL-6 antagonist may be an
antibody, an antibody fragment, a peptide, a glycoalkoid, an
antisense nucleic acid, a ribozyme, a retinoid, an avemir, a small
molecule, or any combination thereof. The IL-6 antagonist may be an
anti-IL-6R, anti-gp130, anti-p38 MAP kinase, anti-JAK1, anti-JAK2,
anti-JAK3, or anti-SYK antibody or antibody fragment. The IL-6
antagonist may be a small molecule comprising thalidomide,
lenalidomide, or any combination thereof. The IL-6 antagonist may
be IL-6 antagonists is an anti-IL-6 antibody or antibody fragment
(e.g., antigen-binding fragment), wherein the anti-IL-6 antibody or
antibody fragment thereof (e.g., antigen-binding fragment) may be
Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12,
Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23,
Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34,
Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to
a subject in need thereof, wherein the antibody, or antigen-binding
fragment thereof, specifically binds to IL-6.
[0343] The invention described herein provides a method of treating
or preventing anemia associated with radiotherapy comprising
administration of a composition comprising an effective amount of
an IL-6 antagonist. Also, the IL-6 antagonists described herein may
be used to treat anemia associated with radiotherapy comprising
administration of a composition comprising an effective amount of
an IL-6 antagonist. The IL-6 antagonists described herein may be
used to prevent anemia associated with radiotherapy comprising
administration of a composition comprising an effective amount of
an IL-6 antagonist, optionally prior to beginning radiotherapy.
[0344] In methods for treating or preventing anemia associated with
radiotherapy the IL-6 antagonists may target IL-6, IL-6 receptor
alpha, gp130, p38 MAP kinase, JAK1, JAK2, JAK3, SYK, or any
combination thereof. Further, the IL-6 antagonist may be an
antibody, an antibody fragment, a peptide, a glycoalkoid, an
antisense nucleic acid, a ribozyme, a retinoid, an avemir, a small
molecule, or any combination thereof. The IL-6 antagonist may be an
anti-IL-6R, anti-gp130, anti-p38 MAP kinase, anti-JAK1, anti-JAK2,
anti-JAK3, or anti-SYK antibody or antibody fragment. The IL-6
antagonist may be a small molecule comprising thalidomide,
lenalidomide, or any combination thereof. The IL-6 antagonist may
be IL-6 antagonists is an anti-IL-6 antibody or antibody fragment
(e.g., antigen-binding fragment), wherein the anti-IL-6 antibody or
antibody fragment thereof (e.g., antigen-binding fragment) may be
Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12,
Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23,
Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34,
Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to
a subject in need thereof, wherein the antibody, or antigen-binding
fragment thereof, specifically binds to IL-6.
[0345] The invention described herein provides compositions for
treating or preventing anemia associated with radiotherapy
comprising administration of a composition comprising an effective
amount of an IL-6 antagonist. Also, the IL-6 antagonists described
herein may be used in compositions for treating anemia associated
with radiotherapy comprising administration of a composition
comprising an effective amount of an IL-6 antagonist. The IL-6
antagonists described herein may be in compositions for preventing
anemia associated with radiotherapy comprising administration of a
composition comprising an effective amount of an IL-6 antagonist,
optionally prior to beginning radiotherapy.
[0346] In compositions for treating or preventing anemia associated
with radiotherapy the IL-6 antagonists may target IL-6, IL-6
receptor alpha, gp130, p.sup.38 MAP kinase, JAK1, JAK2, JAK3, SYK,
or any combination thereof. Further, the IL-6 antagonist may be an
antibody, an antibody fragment, a peptide, a glycoalkoid, an
antisense nucleic acid, a ribozyme, a retinoid, an avemir, a small
molecule, or any combination thereof. The IL-6 antagonist may be an
anti-IL-6R, anti-gp130, anti-p38 MAP kinase, anti-JAK1, anti-JAK2,
anti-JAK3, or anti-SYK antibody or antibody fragment. The IL-6
antagonist may be a small molecule comprising thalidomide,
lenalidomide, or any combination thereof. The IL-6 antagonist may
be IL-6 antagonists is an anti-IL-6 antibody or antibody fragment
(e.g., antigen-binding fragment), wherein the anti-IL-6 antibody or
antibody fragment thereof (e.g., antigen-binding fragment) may be
Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12,
Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23,
Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34,
Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to
a subject in need thereof, wherein the antibody, or antigen-binding
fragment thereof, specifically binds to IL-6.
[0347] The invention described herein provides a method of treating
or preventing cancer-related anemia comprising administration of a
composition comprising an effective amount of an IL-6 antagonist.
Also, the IL-6 antagonists described herein may be used to treat
cancer-related anemia comprising administration of a composition
comprising an effective amount of an IL-6 antagonist. The IL-6
antagonists described herein may be used to prevent cancer-related
anemia comprising administration of a composition comprising an
effective amount of an IL-6 antagonist, optionally prior to
diagnosis of cancer or the diagnosis of anemia as an effect of
cancer. The patient may suffer from a benign tumor, a malignant
tumor, a non-malignant tumor, or a metastatic tumor.
[0348] In the methods of treating or preventing cancer-related
anemia the IL-6 antagonists may target IL-6, IL-6 receptor alpha,
gp130, p38 MAP kinase, JAK1, JAK2, JAK3, SYK, or any combination
thereof. Further, the IL-6 antagonist may be an antibody, an
antibody fragment, a peptide, a glycoalkoid, an antisense nucleic
acid, a ribozyme, a retinoid, an avemir, a small molecule, or any
combination thereof. The IL-6 antagonist may be an anti-IL-6R,
anti-gp130, anti-p38 MAP kinase, anti-JAK1, anti-JAK2, anti-JAK3,
or anti-SYK antibody or antibody fragment. The IL-6 antagonist may
be a small molecule comprising thalidomide, lenalidomide, or any
combination thereof. The IL-6 antagonist may be IL-6 antagonists is
an anti-IL-6 antibody or antibody fragment (e.g., antigen-binding
fragment), wherein the anti-IL-6 antibody or antibody fragment
thereof (e.g., antigen-binding fragment) may be Ab1, Ab2, Ab3, Ab4,
Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16,
Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27,
Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody,
or an antigen-binding fragment thereof, to a subject in need
thereof, wherein the antibody, or antigen-binding fragment thereof,
specifically binds to IL-6.
[0349] The invention described herein provides compositions of
treating or preventing cancer-related anemia comprising an
effective amount of an IL-6 antagonist. Also, the IL-6 antagonists
described herein may be used in compositions for treating
cancer-related anemia comprising an effective amount of an IL-6
antagonist. The IL-6 antagonists described herein may be used in
compositions for preventing cancer-related anemia comprising an
effective amount of an IL-6 antagonist, optionally the composition
may be administered prior to diagnosis of cancer or the diagnosis
of anemia as an effect of cancer. The patient may suffer from a
benign tumor, a malignant tumor, a non-malignant tumor, or a
metastatic tumor.
[0350] In compositions for treating or preventing cancer-related
anemia the IL-6 antagonists may target IL-6, IL-6 receptor alpha,
gp130, p38 MAP kinase, JAK1, JAK2, JAK3, SYK, or any combination
thereof. Further, the IL-6 antagonist may be an antibody, an
antibody fragment, a peptide, a glycoalkoid, an antisense nucleic
acid, a ribozyme, a retinoid, an avemir, a small molecule, or any
combination thereof. The IL-6 antagonist may be an anti-IL-6R,
anti-gp130, anti-p38 MAP kinase, anti-JAK1, anti-JAK2, anti-JAK3,
or anti-SYK antibody or antibody fragment. The IL-6 antagonist may
be a small molecule comprising thalidomide, lenalidomide, or any
combination thereof. The IL-6 antagonist may be IL-6 antagonists is
an anti-IL-6 antibody or antibody fragment (e.g., antigen-binding
fragment), wherein the anti-IL-6 antibody or antibody fragment
thereof (e.g., antigen-binding fragment) may be Ab1, Ab2, Ab3, Ab4,
Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12, Ab13, Ab14, Ab15, Ab16,
Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27,
Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody,
or an antigen-binding fragment thereof, to a subject in need
thereof, wherein the antibody, or antigen-binding fragment thereof,
specifically binds to IL-6.
[0351] The invention described herein provides a method of treating
or preventing drug-induced immune hemolytic anemia (DIIHA)
comprising administration of a composition comprising an effective
amount of an IL-6 antagonist. Also, the IL-6 antagonists described
herein may be used to treat drug-induced immune hemolytic anemia
(DIIHA) comprising administration of a composition comprising an
effective amount of an IL-6 antagonist. The IL-6 antagonists
described herein may be used to prevent drug-induced immune
hemolytic anemia (DIIHA) comprising administration of a composition
comprising an effective amount of an IL-6 antagonist, optionally
prior to beginning the drug therapy that may cause DIIHA.
[0352] In the methods of treating or preventing drug-induced immune
hemolytic anemia (DIIHA) the IL-6 antagonists may target IL-6, IL-6
receptor alpha, gp130, p.sup.38 MAP kinase, JAK1, JAK2, JAK3, SYK,
or any combination thereof. Further, the IL-6 antagonist may be an
antibody, an antibody fragment, a peptide, a glycoalkoid, an
antisense nucleic acid, a ribozyme, a retinoid, an avemir, a small
molecule, or any combination thereof. The IL-6 antagonist may be an
anti-IL-6R, anti-gp130, anti-p38 MAP kinase, anti-JAK1, anti-JAK2,
anti-JAK3, or anti-SYK antibody or antibody fragment. The IL-6
antagonist may be a small molecule comprising thalidomide,
lenalidomide, or any combination thereof. The IL-6 antagonist may
be IL-6 antagonists is an anti-IL-6 antibody or antibody fragment
(e.g., antigen-binding fragment), wherein the anti-IL-6 antibody or
antibody fragment thereof (e.g., antigen-binding fragment) may be
Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10O, Ab11, Ab12,
Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23,
Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34,
Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to
a subject in need thereof, wherein the antibody, or antigen-binding
fragment thereof, specifically binds to IL-6.
[0353] The invention described herein provides a compositions of
treating or preventing drug-induced immune hemolytic anemia (DIIHA)
comprising an effective amount of an IL-6 antagonist. Also, the
IL-6 antagonists described herein may be used to in compositions
for treating drug-induced immune hemolytic anemia (DIIHA)
comprising an effective amount of an IL-6 antagonist. The IL-6
antagonists described herein may be used in compositions for
prevention of drug-induced immune hemolytic anemia (DIIHA)
comprising an effective amount of an IL-6 antagonist, optionally
for administration prior to beginning the drug therapy that may
cause DIIHA.
[0354] In compositions for treating or preventing drug-induced
immune hemolytic anemia (DIIHA), the IL-6 antagonists may target
IL-6, IL-6 receptor alpha, gp130, p.sup.38 MAP kinase, JAK1, JAK2,
JAK3, SYK, or any combination thereof. Further, the IL-6 antagonist
may be an antibody, an antibody fragment, a peptide, a glycoalkoid,
an antisense nucleic acid, a ribozyme, a retinoid, an avemir, a
small molecule, or any combination thereof. The IL-6 antagonist may
be an anti-IL-6R, anti-gp130, anti-p38 MAP kinase, anti-JAK1,
anti-JAK2, anti-JAK3, or anti-SYK antibody or antibody fragment.
The IL-6 antagonist may be a small molecule comprising thalidomide,
lenalidomide, or any combination thereof. The IL-6 antagonist may
be IL-6 antagonists is an anti-IL-6 antibody or antibody fragment
(e.g., antigen-binding fragment), wherein the anti-IL-6 antibody or
antibody fragment thereof (e.g., antigen-binding fragment) may be
Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab10, Ab11, Ab12,
Ab13, Ab14, Ab15, Ab16, Ab17, Ab18, Ab19, Ab20, Ab21, Ab22, Ab23,
Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34,
Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to
a subject in need thereof, wherein the antibody, or antigen-binding
fragment thereof, specifically binds to IL-6.
Treatment of Rheumatoid Arthritis
[0355] This invention also relates to the use of IL-6 antagonists
including anti-IL-6 antibodies described herein, such as Ab1 or
humanized forms thereof for treating or preventing rheumatoid
arthritis. This application provides results of clinical studies
showing safety, pharmacokinetics, and pharmacodynamics for
subcutaneous and intravenous administration of an exemplary
anti-IL-6 antibody, Ab1 (also known as ALD-5 18, exemplary
sequences are provided in Table 4.) The clinical data demonstrates
that an anti-IL-6 antibody decreases disease severity in rheumatoid
arthritis patients which have been subcutaneously (SC) or
intravenously (IV) administered ALD-518, including improvement in
mental and physical components of disease.
[0356] The anti-IL-6 antibody (e.g., ALD518) was well tolerated
when administered in a single subcutaneous (SC) dose; injection
site reactions were generally mild. The bioavailability of SC
ALD518 was .about.60% of IV ALD518, and the half life was .about.30
days. Rapid and significant reductions in CRP (C-reactive protein)
were observed, which were sustained over 24 weeks of assessment.
The half-life of ALD518 when administered subcutaneously
(approximately 30 days) is similar to the half-life previously
observed with IV administration. Additionally, subcutaneous ALD518
led to rapid and large reductions in serum CRP and the reductions
in CRP observed during the first 12 weeks of the study were
sustained over 24 weeks of assessment. These results are also
similar to those observed with IV administration. Together, these
results suggest that anti-IL-6 antibodies, such as Ab1 (ALD518) may
be used for the treatment of RA, as well as prevention or treatment
of other IL-6 associated conditions. These therapeutic regimens may
be combined with other RA therapeutics, including methotrexate or
other RA drugs identified herein and generally known in the art,
including analgesics, disease-modifying antirheumatic drugs
(DMARDS), anti-inflammatories, and others.
[0357] The invention further provides specific dosage regimens and
dosage formulations for treating rheumatoid arthritis by
subcutaneous or intravenous administration of anti-IL-6 antibodies
or antibody fragments according to the invention such as humanized
Ab1 antibodies. For example, a subject may be administered 80, 160,
or 320 mg of an anti-IL-6 antibody (e.g., Ab1).
[0358] The anti-IL-6 antibodies may be used to subcutaneously
administer antibodies of the invention, including Ab1, for
rheumatoid arthritis indications, the administration formulation
comprises, or alternatively consists of, about 50 or 100 mg/mL of
antibody, about 5 mM Histidine base, about 5 mM Histidine HCl to
make final pH 6, 250 mM sorbitol, and 0.015% (w/w) Polysorbate 80.
In another embodiment of the invention that may be used to
subcutaneously administer antibodies of the invention, including
Ab1, for rheumatoid arthritis indications, the administration
formulation comprises, or alternatively consists of, about 20 or
100 mg/mL of antibody, about 5 mM Histidine base, about 5 mM
Histidine HCl to make final pH 6, 250 to 280 mM sorbitol (or
sorbitol in combination with sucrose), and 0.015% (w/w) Polysorbate
80, said formulation having a nitrogen headspace in the shipping
vials.
[0359] Therapeutic regimens for the prevention or treatment of RA
may be combined with other RA therapeutics, including analgesics,
analgesics, DMARDS, anti-inflammatories, and others. For example,
analgesics and anti-inflammatory drugs, including steroids, may
provide relief of disease symptoms, while disease-modifying
antirheumatic drugs (DMARDs), may inhibit or halt the underlying
immune process and prevent further long-term damage. In exemplary
embodiments, ALD518 (or another antibody of the present disclosure)
may be administered to a patient at approximately the same time as
another RA therapeutic (which may or may not be formulated
together) or may be administered to a patient who is also
undergoing another therapeutic regiment but not necessarily at the
same time. A regimen may be considered to provide a combination of
therapeutics as long as the patient concurrently experiences the
effects of the combined therapeutics. Due to possible differences
in dosing schedule, a combination may include administration of
different therapeutics at different times, e.g., a patient may
receive a drug such as methotrexate on a weekly schedule (e.g., at
least 10 mg per week) and may receive ALD518 (or another anti-IL-6
antibody of the present disclosure) less frequently (such as about
every eight weeks, every twelve weeks, every three months).
Exemplary DMARDs that may administered in combination with ALD518
(or another antibody of the present disclosure) include, but are
not limited to Mycophenolate mofetil (CellCept.RTM.), calcineurin
inhibitors (e.g., cyclosporine, sirolimus, everolimus), oral
retinoids, azathioprine, fumeric acid esters, D-penicillamine,
cyclophosphamide, immunoadsorption columns (e.g., Prosorba.RTM.
columns), gold salts (e.g., Auranofin, sodium aurothiomalate
(Myocrisin)), hydroxychloroquine, chloroquine, leflunomide,
methotrexate (MTX), minocycline, sulfasalazine (SSZ), tumor
necrosis factor alpha (TNF.alpha.) blockers (e.g., etanercept
(Enbrel), infliximab (Remicade), adalimumab (Humira), certolizumab
pegol (Cimzia), golimumab (Simponi)), Interleukin 1 (IL-1) blockers
(e.g., anakinra (Kineret)), monoclonal antibodies against B cells
(e.g., rituximab (Rituxan)), T cell costimulation blockers (e.g.,
abatacept (Orencia)), Interleukin 6 (IL-6) blockers (e.g.,
tocilizumab (an anti-IL-6 receptor antibody), RoActemra, Actemra).
Exemplary anti-inflammatory agents that may administered in
combination with ALD518 (or another antibody of the present
disclosure) include, but are not limited to, anti-inflammatory
steroids such as Cortisone, Glucocorticoids, prednisone,
prednisolone, Hydrocortisone (Cortisol), Cortisone acetate,
Methylprednisolone, Dexamethasone, Betamethasone, Triamcinolone,
Beclometasone, and Fludrocortisone acetate, and non-steroidal
anti-inflammatory drug (NSAIDs) (which may also act as analgesics),
such as ibuprofen, naproxen, meloxicam, etodolac, nabumetone,
sulindac, tolementin, choline magnesium salicylate, diclofenac,
diflusinal, indomethicin, Ketoprofen, Oxaprozin, piroxicam, and
nimesulide, Salicylates, Aspirin (acetylsalicylic acid),
Diflunisal, Salsalate, p-amino phenol derivatives, Paracetamol,
phenacetin, Propionic acid derivatives, Ibuprofen, Naproxen,
Fenoprofen, Ketoprofen, Flurbiprofen, Oxaprozin, Loxoprofen, Acetic
acid derivatives, Indomethacin, Sulindac, Etodolac, Ketorolac,
Diclofenac, Nabumetone, Enolic acid (Oxicam) derivatives,
Piroxicam, Meloxicam, Tenoxicam, Droxicam, Lornoxicam, Isoxicam,
Fenamic acid derivatives (Fenamates), Mefenamic acid, Meclofenamic
acid, Flufenamic acid, Tolfenamic acid, Selective COX-2 inhibitors
(Coxibs), Celecoxib, Rofecoxib, Valdecoxib, Parecoxib, Lumiracoxib,
Etoricoxib, Firocoxib, Sulphonanilides, Nimesulide, and Licofelone.
Exemplary analgesics include that may administered in combination
with ALD518 (or another antibody of the present disclosure)
include, but are not limited to, NSAIDs, COX-2 inhibitors
(including Celecoxib, Rofecoxib, Valdecoxib, Parecoxib,
Lumiracoxib, Etoricoxib, and Firocoxib), acetaminophen, opiates
(e.g., Dextropropoxyphene, Codeine, Tramadol, Anileridine,
Pethidine, Hydrocodone, Morphine [e.g., oral, intravenous (IV), or
intramuscular (IM)], Oxycodone, Methadone, Diacetylmorphine,
Hydromorphone, Oxymorphone, Levorphanol, Buprenorphine, Fentanyl,
Sufentanyl, Etorphine, Carfentanil, dihydromorphine,
dihydrocodeine, Thebaine, and Papaverine), diproqualone,
Flupirtine, Tricyclic antidepressants, and lidocaine (topical).
Anti-IL-6 Antagonists
[0360] The IL-6 antagonist may comprise an antibody, an antibody
fragment, a peptide, a glycoalkoid, an antisense nucleic acid, a
ribozyme, a retinoid, an avemir, a small molecule, or any
combination thereof. The IL-6 antagonist may be an agent that
blocks signal transmission by IL-6, blocks IL-6 binding to its
receptor, suppresses/interferes with IL-6 expression, and/or
inhibits the biological activity of IL-6. The IL-6 antagonists may
be attached directly or indirectly to immunoglobulin polypeptides
or effector moieties such as therapeutic or detectable
entities.
[0361] Examples of IL-6 antagonists include but are not limited to
anti-IL-6 antibody, anti-IL-6R antibody, anti-gp130 antibody, IL-6
mutant, IL-6R antisense oligonucleotide, and partial peptides of
IL-6 or IL-6R. An example of the IL-6 mutant used in the present
invention is disclosed in Brakenhoff, et al. (1994) J. Biol. Chem.
269: 86-93 or Savino, et al. (1994) EMBO J. 13: 1357-1367. The IL-6
mutant polypeptide or fragment thereof does not possess the signal
transmission effects of IL-6 but retains the binding activity with
IL-6R, and is produced by introducing a mutation in the form of a
substitution, deletion or insertion into the amino acid sequence of
IL6. While there are no limitations on the animal species used, it
is preferable to use an IL6 of human origin. Similarly, any IL-6
partial peptides or IL-6R partial peptides used in the present
invention provided they prevent IL6 or IL6R (gp80) or gp130 from
affecting signal transduction and thereby prevent IL-6 associated
biological activity. For details regarding IL-6 partial peptides
and IL-6R partial peptides, see, e.g., U.S. Pat. No. 5,210,075 and
EP Patent No. 617126. Additionally, a mutated soluble IL-6 receptor
may be used as an IL-6 antagonist. See Salvati, et al. (1995) The
Journal of Biological Chemistry 270: 12242-12249.
[0362] IL-6 signaling is mediated by the Jak-Tyk family of
cytoplasmic tyrosine kinases, including JAK1, JAK2, and JAK3
(reviewed in Murray (2007) J Immunol. 178(5): 2623-9). Inhibitors
of JAK1, JAK2, or JAK3 may be used as IL-6 antagonists of IL-6.
Sivash, et al. (2004) British Journal of Cancer 91: 1074-1080. An
inhibitor of Syk may be used as an IL-6 antagonist. Ulanova, et al.
(2005) Am J Physiol Lung Cell Mol Physiol. 288(3): L497-507.
Thalidomide, and derivatives thereof, such as lenalidomide, may be
useful antagonists of IL-6. Kedar, et al. (2004) Int J Cancer.
110(2): 260-5.
[0363] Further, oligonucleotides capable of IL6 or IL6R RNA
silencing or antisense mechanisms can be used in the method of the
present invention (JP5-300338 for details regarding IL-6R antisense
oligonucleotide).
[0364] Additionally, the IL-6 antagonist may target IL-6, IL-6
receptora, gp130, p38 MAP kinase, JAK1, JAK2, JAK3, SYK, or any
combination thereof. For example, SANT-7 is an IL-6 receptor
antagonist that interfers with the formation of IL-6/IL-6R/gp130
heteromers. See Honemann, et al. (2001) Int. J. Cancer 93:
674-680.
[0365] The IL-6 antagonist may comprise an anti-IL-6 receptor
(e.g., TOCILIZUMAB.RTM., ACTEMRA.RTM.), anti-IL6 (e.g.,
SILTUXIMAB.RTM.), anti-gp130, anti-p38 MAP kinase, anti-JAK1,
anti-JAK2, anti-JAK3, or anti-SYK antibody or antibody fragment.
See Nishimoto, et al. (2005) Blood 106(8): 2627-32; van Rhee, et
al. (2010) Journal of Clinical Oncology 28(23): 3701-3708; WO
2010/056948; U.S. Patent Application Publication No.
2010/0138945.
[0366] The IL-6 antagonist may comprise a small molecule including
but not limited to thalidomide, lenalidomide, aryl hodrocarbon
receptor agonists (e.g., 7,12-dimethylbenz [a]anthracene (DMBA) and
2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)) or any combination
thereof. See Jensen, et al. (2003) Environmental Health: A Global
Access Science Source 2:16.
[0367] IL-6 antagonist may be an IL-6 antagonist peptide. See,
e.g., U.S. Pat. No. 6,838,433. For example, a truncated IL-6
molecule may act as an IL-6 antagonist. See Alberti, et al. (2005)
J. Cancer Res 65: 2-5.
[0368] The IL-6 antagonist may be an anti-IL-6 antibody. See also
U.S. Patent Application Publication No. 2007/0292420. The IL-6
antagonist may comprise an anti-IL-6 antibody or antibody fragment
as described in further detail herein. The invention includes
antibodies having binding specificity to IL-6 and possessing a
variable light chain sequence comprising the sequence set forth in
the polypeptide sequence of SEQ ID NO: 2 or SEQ ID NO: 709 and
humanized versions and variants thereof including those set forth
in FIGS. 1-5, and those identified in Table 4.
Anti-IL-6 Antibodies and Antibody Fragments Thereof
[0369] Antibodies consist of two identical light polypeptide chains
of molecular weight approximately 23,000 daltons (the "light
chain"), and two identical heavy chains of molecular weight
53,000-70,000 (the "heavy chain"). The four chains are joined by
disulfide bonds in a "Y" configuration wherein the light chains
bracket the heavy chains starting at the mouth of the "Y"
configuration. The "branch" portion of the "Y" configuration is
designated the Fab region; the stem portion of the "Y"
configuration is designated the Fc region. The amino acid sequence
orientation runs from the N-terminal end at the top of the "Y"
configuration to the C-terminal end at the bottom of each chain.
The N-terminal end possesses the variable region having specificity
for the antigen that elicited it, and is approximately 100 amino
acids in length, there being slight variations between light and
heavy chain and from antibody to antibody.
[0370] The variable region is linked in each chain to a constant
region that extends the remaining length of the chain and that
within a particular class of antibody does not vary with the
specificity of the antibody (i.e., the antigen eliciting it). There
are five known major classes of constant regions that determine the
class of the immunoglobulin molecule (IgG, IgM, IgA, IgD, and IgE
corresponding to .gamma., .mu., .alpha., .delta., and .epsilon.
(gamma, mu, alpha, delta, or epsilon) heavy chain constant
regions). The constant region or class determines subsequent
effector function of the antibody, including activation of
complement (Kabat, E. A. (1976) Structural Concepts in Immunology
and Immunochemistry [2.sup.nd Ed.] pages 413-436, Holt, Rinehart,
Winston), and other cellular responses (Andrews, et al. (1980)
Clinical Immunobiology pages 1-18, W. B. Sanders; Kohl, et al.
(1983) Immunology 48: 187); while the variable region determines
the antigen with which it will react. Light chains are classified
as either .kappa. (kappa) or .lamda. (lambda). Each heavy chain
class can be paired with either kappa or lambda light chain. The
light and heavy chains are covalently bonded to each other, and the
"tail" portions of the two heavy chains are bonded to each other by
covalent disulfide linkages when the immunoglobulins are generated
either by hybridomas or by B cells.
[0371] For example, antibodies or antigen binding fragments or
variants thereof may be produced by genetic engineering. In this
technique, as with other methods, antibody-producing cells are
sensitized to the desired antigen or immunogen. The messenger RNA
isolated from antibody producing cells is used as a template to
make cDNA using PCR amplification. A library of vectors, each
containing one heavy chain gene and one light chain gene retaining
the initial antigen specificity, is produced by insertion of
appropriate sections of the amplified immunoglobulin cDNA into the
expression vectors. A combinatorial library is constructed by
combining the heavy chain gene library with the light chain gene
library. This results in a library of clones which co-express a
heavy and light chain (resembling the Fab fragment or antigen
binding fragment of an antibody molecule). The vectors that carry
these genes are co-transfected into a host cell. When antibody gene
synthesis is induced in the transfected host, the heavy and light
chain proteins self-assemble to produce active antibodies that can
be detected by screening with the antigen or immunogen.
[0372] Antibody coding sequences of interest include those encoded
by native sequences, as well as nucleic acids that, by virtue of
the degeneracy of the genetic code, are not identical in sequence
to the disclosed nucleic acids, and variants thereof. Variant
polypeptides can include amino acid (aa) substitutions, additions
or deletions. The amino acid substitutions can be conservative
amino acid substitutions or substitutions to eliminate
non-essential amino acids, such as to alter a glycosylation site,
or to minimize misfolding by substitution or deletion of at least
one cysteine residues that are not necessary for function. Variants
can be designed so as to retain or have enhanced biological
activity of a particular region of the protein (e.g., a functional
domain, catalytic amino acid residues). Variants also include
fragments of the polypeptides disclosed herein, particularly
biologically active fragments and/or fragments corresponding to
functional domains. Techniques for in vitro mutagenesis of cloned
genes are known. Also included in the subject invention are
polypeptides that have been modified using ordinary molecular
biological techniques so as to improve their resistance to
proteolytic degradation or to optimize solubility properties or to
render them more suitable as a therapeutic agent.
[0373] Chimeric antibodies may be made by recombinant means by
combining the variable light and heavy chain regions (V.sub.L and
V.sub.H), obtained from antibody producing cells of one species
with the constant light and heavy chain regions from another.
Typically chimeric antibodies utilize rodent or rabbit variable
regions and human constant regions, in order to produce an antibody
with predominantly human domains. The production of such chimeric
antibodies is well known in the art, and may be achieved by
standard means (as described, e.g., in U.S. Pat. No. 5,624,659,
incorporated herein by reference in its entirety). It is further
contemplated that the human constant regions of chimeric antibodies
of the invention may be selected from IgG1, IgG2, IgG3, IgG4, IgG5,
IgG6, IgG7, IgG8, IgG9, IgG10, IgG11, IgG12, IgG13, IgG14, IgG15,
IgG16, IgG17, IgG18 or IgG19 constant regions.
[0374] Humanized antibodies are engineered to contain even more
human-like immunoglobulin domains, and incorporate only the
complementarity-determining regions of the animal-derived antibody.
This is accomplished by carefully examining the sequence of the
hyper-variable loops of the variable regions of the monoclonal
antibody, and fitting them to the structure of the human antibody
chains. Although facially complex, the process is straightforward
in practice. See, e.g., U.S. Pat. No. 6,187,287. In a preferred
embodiment, humanization may be effected as disclosed in detail
infra. This scheme grafts CDRs onto human FRs highly homologous to
the parent antibody that is being humanized.
[0375] Immunoglobulins and fragments thereof may be modified
post-translationally, e.g. to add effector moieties such as
chemical linkers, detectable moieties, such as fluorescent dyes,
enzymes, toxins, substrates, bioluminescent materials, radioactive
materials, chemiluminescent moieties and the like, or specific
binding moieties, such as streptavidin, avidin, or biotin, and the
like may be utilized in the methods and compositions of the present
invention.
Exemplary Anti-IL-6 Antibodies
[0376] The invention also includes antibodies having binding
specificity to IL-6 and possessing a variable heavy chain sequence
comprising the sequence set forth in the polypeptide sequences of
SEQ ID NO: 3 and SEQ ID NO: 657 and humanized versions and variants
thereof including those set forth in FIGS. 1-5, and those
identified in Table 4.
[0377] The invention further includes antibodies having binding
specificity to IL-6 and possessing a variable heavy chain sequence
which is a modified version of SEQ ID NO: 3 wherein the tryptophan
residue in CDR2 is changed to a serine as set forth in the
polypeptide sequence of SEQ ID NO: 658 and humanized versions and
variants thereof including those set forth in FIGS. 1-5, and those
identified in Table 4.
[0378] The invention further contemplates antibodies comprising at
least one of the polypeptide sequences of SEQ ID NO: 4; SEQ ID NO:
5; and SEQ ID NO: 6 which correspond to the
complementarity-determining regions (CDRs, or hypervariable
regions) of the variable light chain sequence of SEQ ID NO: 2,
and/or at least one of the polypeptide sequences of SEQ ID NO: 7;
SEQ ID NO: 8 or 120; and SEQ ID NO: 9 which correspond to the
complementarity-determining regions (CDRs, or hypervariable
regions) of the variable heavy chain sequence of SEQ ID NO: 3 or
19, or combinations of these polypeptide sequences. In another
embodiment of the invention, the antibodies of the invention
include combinations of the CDRs and the variable heavy and light
chain sequences set forth herein.
[0379] In another embodiment, the invention contemplates other
antibodies, such as for example chimeric antibodies, comprising at
least one of the polypeptide sequences of SEQ ID NO: 4; SEQ ID NO:
5; and SEQ ID NO: 6 which correspond to the
complementarity-determining regions (CDRs, or hypervariable
regions) of the variable light chain sequence of SEQ ID NO: 2,
and/or at least one of the polypeptide sequences of SEQ ID NO: 7;
SEQ ID NO: 8 or 120; and SEQ ID NO: 9 which correspond to the
complementarity-determining regions (CDRs, or hypervariable
regions) of the variable heavy chain sequence of SEQ ID NO: 3 or
19, or combinations of these polypeptide sequences. In another
embodiment of the invention, the antibodies of the invention
include combinations of the CDRs and humanized versions of the
variable heavy and light chain sequences set forth above.
[0380] The invention also contemplates fragments of the antibody
having binding specificity to IL-6. In one embodiment of the
invention, antibody fragments of the invention comprise, or
alternatively consist of, humanized versions of the polypeptide
sequence of SEQ ID NO: 2, 20, 647, 651, 660, 666, 699, 702, 706, or
709. In another embodiment of the invention, antibody fragments of
the invention comprise, or alternatively consist of, humanized
versions of the polypeptide sequence of SEQ ID NO: 3, 18, 19, 652,
656, 657, 658, 661, 664, 665, 704, or 708.
[0381] In a further embodiment of the invention, fragments of the
antibody having binding specificity to 11-6 comprise, or
alternatively consist of, at least one of the polypeptide sequences
of SEQ ID NO: 4; SEQ ID NO: 5; and SEQ ID NO: 6 which correspond to
the complementarity-determining regions (CDRs, or hypervariable
regions) of the variable light chain sequence of SEQ ID NO: 2 or
SEQ ID NO: 709.
[0382] In a further embodiment of the invention, fragments of the
antibody having binding specificity to 11-6 comprise, or
alternatively consist of, at least one of the polypeptide sequences
of SEQ ID NO: 7; SEQ ID NO: 8 or SEQ ID NO: 120; and SEQ ID NO: 9
which correspond to the complementarity-determining regions (CDRs,
or hypervariable regions) of the variable heavy chain sequence of
SEQ ID NO: 3 and 657 or 19.
[0383] The invention also contemplates antibody fragments which
include at least one of the antibody fragments described herein. In
one embodiment of the invention, fragments of the antibodies having
binding specificity to IL-6 comprise, or alternatively consist of,
one, two, three or more, including all of the following antibody
fragments: the variable light chain region of SEQ ID NO: 2; the
variable heavy chain region of SEQ ID NO: 3; the
complementarity-determining regions (SEQ ID NO: 4; SEQ ID NO: 5;
and SEQ ID NO: 6) of the variable light chain region of SEQ ID NO:
2; and the complementarity-determining regions (SEQ ID NO: 7; SEQ
ID NO: 8 or SEQ ID NO: 120; and SEQ ID NO: 9) of the variable heavy
chain region of SEQ ID NO: 3 and 657 or 19.
[0384] The invention also contemplates variants wherein either of
the heavy chain polypeptide sequences of SEQ ID NO: 18 or SEQ ID
NO: 19 is substituted for the heavy chain polypeptide sequence of
SEQ ID NO: 3 or 657; the light chain polypeptide sequence of SEQ ID
NO: 20 is substituted for the light chain polypeptide sequence of
SEQ ID NO: 2 or SEQ ID NO: 709; and the heavy chain CDR sequence of
SEQ ID NO: 120 is substituted for the heavy chain CDR sequence of
SEQ ID NO: 8.
[0385] In a preferred embodiment of the invention, the anti-IL-6
antibody is Ab1, comprising SEQ ID NO: 2 and SEQ ID NO: 3, or more
particularly an antibody comprising SEQ ID NO: 657 and SEQ ID NO:
709 (which are respectively encoded by the nucleic acid sequences
in SEQ ID NO: 700 and SEQ ID NO: 723) or one comprised of the
alternative SEQ ID NOs set forth in the preceding paragraph, and
having at least one of the biological activities set forth herein.
In a preferred embodiment the anti-IL-6 antibody will comprise a
humanized sequence as shown in FIGS. 1-5.
[0386] Sequences of anti-IL-6 antibodies of the present invention
are shown in Table 4. Exemplary sequence variants other alternative
forms of the heavy and light chains of Ab1 through Ab36 are shown.
The antibodies of the present invention encompass additional
sequence variants, including conservative substitutions,
substitution of at least one CDR sequences and/or FR sequences.
[0387] Exemplary Ab1 embodiments include an antibody comprising a
variant of the light chain and/or heavy chain. Exemplary variants
of the light chain of Ab1 include the sequence of any of the Ab1
light chains shown (i.e., any of SEQ ID NO: 2, 20, 647, 651, 660,
666, 699, 702, 706, or 709) wherein the entire CDR1 sequence is
replaced or wherein at least one residues in the CDR1 sequence is
substituted by the residue in the corresponding position of any of
the other light chain CDR1 sequences set forth (i.e., any of SEQ ID
NO: 23, 39, 55, 71, 87, 103, 124, 140, 156, 172, 188, 204, 220,
236, 252, 268, 284, 300, 316, 332, 348, 364, 380, 396, 412, 428,
444, 460, 476, 492, 508, 524, 540, 556, or 572); and/or wherein the
entire CDR2 sequence is replaced or wherein at least one residues
in the CDR2 sequence is substituted by the residue in the
corresponding position of any of the other light chain CDR2
sequences set forth (i.e., any of SEQ ID NO: 24, 40, 56, 72, 88,
104, 125, 141, 157, 173, 189, 205, 221, 237, 253, 269, 285, 301,
317, 333, 349, 365, 381, 397, 413, 429, 445, 461, 477, 493, 509,
525, 541, 557, or 573); and/or wherein the entire CDR3 sequence is
replaced or wherein at least one residues in the CDR3 sequence is
substituted by the residue in the corresponding position of any of
the other light chain CDR3 sequences set forth (i.e., any of SEQ ID
NO: 25, 41, 57, 73, 89, 105, 126, 142, 158, 174, 190, 206, 222,
238, 254, 270, 286, 302, 318, 334, 350, 366, 382, 398, 414, 430,
446, 462, 478, 494, 510, 526, 542, 558, or 574).
[0388] Exemplary variants of the heavy chain of Ab1 include the
sequence of any of the Ab1 heavy chains shown (i.e., any of SEQ ID
NO: 3, 18, 19, 652, 656, 657, 658, 661, 664, 665, 704, or 708)
wherein the entire CDR1 sequence is replaced or wherein at least
one residues in the CDR1 sequence is substituted by the residue in
the corresponding position of any of the other heavy chain CDR1
sequences set forth (i.e., any of SEQ ID NO: 26, 42, 58, 74, 90,
106, 127, 143, 159, 175, 191, 207, 223, 239, 255, 271, 287, 303,
319, 335, 351, 367, 383, 399, 415, 431, 447, 463, 479, 495, 511,
527, 543, 559, or 575); and/or wherein the entire CDR2 sequence is
replaced or wherein at least one residues in the CDR2 sequence is
substituted by the residue in the corresponding position of an Ab1
heavy chain CDR2, such as those set forth in Table 4 (i.e., any of
SEQ ID NO: 8, or 120) or any of the other heavy chain CDR2
sequences set forth (i.e., any of SEQ ID NO: 27, 43, 59, 75, 91,
107, 121, 128, 144, 160, 176, 192, 208, 224, 240, 256, 272, 288,
304, 320, 336, 352, 368, 384, 400, 416, 432, 448, 464, 480, 496,
512, 528, 544, 560, or 576); and/or wherein the entire CDR3
sequence is replaced or wherein at least one residues in the CDR3
sequence is substituted by the residue in the corresponding
position of any of the other heavy chain CDR3 sequences set forth
(i.e., any of SEQ ID NO: 28, 44, 60, 76, 92, 108, 129, 145, 161,
177, 193, 209, 225, 241, 257, 273, 289, 305, 321, 337, 353, 369,
385, 401, 417, 433, 449, 465, 481, 497, 513, 529, 545, 561, or
577).
[0389] In another embodiment, the invention contemplates other
antibodies, such as for example chimeric or humanized antibodies,
comprising at least one of the polypeptide sequences of SEQ ID NO:
4; SEQ ID NO: 5; and SEQ ID NO: 6 which correspond to the
complementarity-determining regions (CDRs, or hypervariable
regions) of the variable light chain sequence of SEQ ID NO: 2,
and/or at least one of the polypeptide sequences of SEQ ID NO: 7
(CDR1); SEQ ID NO: 8 (CDR2); SEQ ID NO: 120 (CDR2); and SEQ ID NO:
9 (CDR3) which correspond to the complementarity-determining
regions (CDRs, or hypervariable regions) of the variable heavy
chain sequence of SEQ ID NO: 3 or SEQ ID NO: 19, or combinations of
these polypeptide sequences. In another embodiment of the
invention, the antibodies of the invention include combinations of
the CDRs and the variable heavy and light chain sequences set forth
above including those set forth in FIGS. 1-5, and those identified
in Table 4.
[0390] In another embodiment the anti-IL-6 antibody of the
invention is one comprising at least one of the following: a CDR1
light chain encoded by the sequence in SEQ ID NO: 12 or SEQ ID NO:
694; a light chain CDR2 encoded by the sequence in SEQ ID NO: 13; a
light chain CDR3 encoded by the sequence in SEQ ID NO: 14 or SEQ ID
NO: 695; a heavy chain CDR1 encoded by the sequence in SEQ ID NO:
15, a heavy chain CDR2 encoded by SEQ ID NO: 16 or SEQ ID NO: 696
and a heavy chain CDR3 encoded by SEQ ID NO: 17 or SEQ ID NO: 697.
In addition the invention embraces such nucleic acid sequences and
variants thereof.
[0391] In another embodiment the invention is directed to amino
acid sequences corresponding to the CDRs of said anti-IL-6 antibody
which are selected from SEQ ID NO: 4 (CDR1), SEQ ID NO: 5 (CDR2),
SEQ ID NO: 6 (CDR3), SEQ ID NO: 7, SEQ ID NO: 120 and SEQ ID NO:
9.
[0392] In another embodiment the anti-IL-6 antibody of the
invention comprises a light chain nucleic acid sequence of SEQ ID
NO: 10, 662, 698, 701, 705, 720, 721, 722, or 723; and/or a heavy
chain nucleic acid sequence of SEQ ID NO: 11, 663, 700, 703, 707,
724, or 725. In addition the invention is directed to the
corresponding polypeptides encoded by any of the foregoing nucleic
acid sequences and combinations thereof.
[0393] In a specific embodiment of the invention the anti-IL-6
antibodies or a portion thereof will be encoded by a nucleic acid
sequence selected from those comprised in SEQ ID NO: 10, 12, 13,
14, 662, 694, 695, 698, 701, 705, 720, 721, 722, 723, 11, 15, 16,
17, 663, 696, 697, 700, 703, 707, 724, and 725. For example the
CDR1 in the light chain may be encoded by SEQ ID NO: 12 or 694, the
CDR2 in the light chain may be encoded by SEQ ID NO: 13, the CDR3
in the light chain may be encoded by SEQ ID NO: 14 or 695; the CDR1
in the heavy chain may be encoded by SEQ ID NO: 15, the CDR2 in the
heavy chain may be encoded by SEQ ID NO: 16 or 696, the CDR3 in the
heavy chain may be encoded by SEQ ID NO: 17 or 697. As discussed
infra antibodies containing these CDRs may be constructed using
appropriate human frameworks based on the humanization methods
disclosed herein.
[0394] In another specific embodiment of the invention the variable
light chain will be encoded by SEQ ID NO: 10, 662, 698, 701, 705,
720, 721, 722, or 723 and the variable heavy chain of the anti-IL-6
antibodies will be encoded by SEQ ID NO: 11, 663, 700, 703, 707,
724, or 725.
[0395] In a more specific embodiment variable light and heavy
chains of the anti-IL-6 antibody respectively will be encoded by
SEQ ID NO: 10 and 11, or SEQ ID NO: 698 and SEQ ID NO: 700, or SEQ
ID NO: 701 and SEQ ID NO: 703 or SEQ ID NO: 705 and SEQ ID NO:
707.
[0396] In another specific embodiment the invention covers nucleic
acid constructs containing any of the foregoing nucleic acid
sequences and combinations thereof as well as recombinant cells
containing these nucleic acid sequences and constructs containing
wherein these nucleic acid sequences or constructs may be
extrachromosomal or integrated into the host cell genome
[0397] In another specific embodiment the invention covers
polypeptides containing any of the CDRs or combinations thereof
recited in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7,
SEQ ID NO: 8, SEQ ID NO: 120, SEQ ID NO: 9 or polypeptides
comprising any of the variable light polypeptides comprised in SEQ
ID NO: 2, 20, 647, 651, 660, 666, 699, 702, 706, or 709 and/or the
variable heavy polypeptides comprised in SEQ ID NO: 3, 18, 19, 652,
656, 657, 658, 661, 664, 665, 704, or 708.
[0398] In another embodiment the anti-IL-6 antibody is one
comprising at least one of the following: a variable light chain
encoded by the sequence in SEQ ID NO: 10 or SEQ ID NO: 698 or SEQ
ID NO: 701 or SEQ ID NO: 705 and a variable chain encoded by the
sequence in SEQ ID NO: 11 or SEQ ID NO: 700 or SEQ ID NO: 703 or
SEQ ID NO: 707.
[0399] In another embodiment the anti-IL-6 antibody is a variant of
the foregoing sequences that includes at least one substitution in
the framework and/or CDR sequences and which has at least one of
the properties of Ab1 in vitro and/or upon in vivo
administration.
[0400] These in vitro and in vivo properties are described in more
detail in the examples below and include: competing with Ab1 for
binding to IL-6 and/or peptides thereof; having a binding affinity
(Kd) for IL-6 of less than about 50 picomolar, and/or a rate of
dissociation (K.sub.off) from IL-6 of less than or equal to
10.sup.-4 S.sup.-1; having an in-vivo half-life of at least about
22 days in a healthy human subject; ability to prevent or treat
hypoalbunemia; ability to prevent or treat elevated CRP; ability to
prevent or treat abnormal coagulation; and/or ability to decrease
the risk of thrombosis in an individual having a disease or
condition associated with increased risk of thrombosis. Additional
non-limiting examples of anti-IL-6 activity are set forth herein,
for example, under the heading "Anti-IL-6 Activity."
[0401] In another embodiment the anti-IL-6 antibody includes at
least one of the Ab1 light-chain and/or heavy chain CDR sequences
(see Table 4) or variant(s) thereof which has at least one of the
properties of Ab1 in vitro and/or upon in vivo administration
(examples of such properties are discussed in the preceding
paragraph). One of skill in the art would understand how to combine
these CDR sequences to form an antigen-binding surface, e.g. by
linkage to at least one scaffold which may comprise human or other
mammalian framework sequences, or their functional orthologs
derived from a SMIP (Small Modular Immuno Pharmaceutical),
camelbody, nanobody, IgNAR, other immunoglobulin, or other
engineered antibody. See, e.g., Robak & Robak (2011) BioDrugs
25(1): 13-25 and Wesolowski, et al. (2009) Med Microbiol Immunol
198: 157-174. For example, embodiments may specifically bind to
human IL-6 and include one, two, three, four, five, six, or more of
the following CDR sequences or variants thereof: a polypeptide
having at least 72.7% sequence identity (i.e., 8 out of 11 amino
acids) to the light chain CDR1 of SEQ ID NO: 4; a polypeptide
having at least 81.8% (i.e., 9 out of 11 amino acids) identity to
the light chain CDR1 of SEQ ID NO: 4; a polypeptide having at least
90.9% (i.e., 10 out of 11 amino acids) identity to the light chain
CDR1 of SEQ ID NO: 4; a polypeptide having 100% (i.e., 11 out of 11
amino acids) identity to the light chain CDR1 of SEQ ID NO: 4; a
polypeptide having at least 85.7% sequence identity (i.e., 6 out of
7 amino acids) to the light chain CDR2 of SEQ ID NO: 5; a
polypeptide having 100% (i.e., 7 out of 7 amino acids) identity to
the light chain CDR2 of SEQ ID NO: 5; a polypeptide having at least
50% sequence identity (i.e., 6 out of 12 amino acids) to the light
chain CDR3 of SEQ ID NO: 6; a polypeptide having at least 58.3%
sequence identity (i.e., 7 out of 12 amino acids) to the light
chain CDR3 of SEQ ID NO: 6;
[0402] a polypeptide having at least 66.6% (i.e., 8 out of 12 amino
acids) identity to the light chain CDR3 of SEQ ID NO: 6; a
polypeptide having at least 75% (i.e., 9 out of 12 amino acids)
identity to the light chain CDR3 of SEQ ID NO: 6; a polypeptide
having at least 83.3% sequence identity (i.e., 10 out of 12 amino
acids) to the light chain CDR3 of SEQ ID NO: 6; a polypeptide
having at least 91.6% sequence identity (i.e., 11 out of 12 amino
acids) to the light chain CDR3 of SEQ ID NO: 6; a polypeptide
having 100% (i.e., 12 out of 12 amino acids) identity to the light
chain CDR3 of SEQ ID NO: 6; a polypeptide having at least 80%
sequence identity (i.e., 4 out of 5 amino acids) to the heavy chain
CDR1 of SEQ ID NO: 7; a polypeptide having 100% (i.e., 5 out of 5
amino acids) identity to the heavy chain CDR1 of SEQ ID NO: 7; a
polypeptide having at least 50% sequence identity (i.e., 8 out of
16 amino acids) to the heavy chain CDR2 of SEQ ID NO: 120; a
polypeptide having at least 56.2% sequence identity (i.e., 9 out of
16 amino acids) to the heavy chain CDR2 of SEQ ID NO: 120; a
polypeptide having at least 62.5% sequence identity (i.e., 10 out
of 16 amino acids) to the heavy chain CDR2 of SEQ ID NO: 120; a
polypeptide having at least 68.7% sequence identity (i.e., 11 out
of 16 amino acids) to the heavy chain CDR2 of SEQ ID NO: 120; a
polypeptide having at least 75% sequence identity (i.e., 12 out of
16 amino acids) to the heavy chain CDR2 of SEQ ID NO: 120;
[0403] a polypeptide having at least 81.2% sequence identity (i.e.,
13 out of 16 amino acids) to the heavy chain CDR2 of SEQ ID NO:
120; a polypeptide having at least 87.5% sequence identity (i.e.,
14 out of 16 amino acids) to the heavy chain CDR2 of SEQ ID NO:
120; a polypeptide having at least 93.7% sequence identity (i.e.,
15 out of 16 amino acids) to the heavy chain CDR2 of SEQ ID NO:
120; a polypeptide having 100% (i.e., 16 out of 16 amino acids)
identity to the heavy chain CDR2 of SEQ ID NO: 120; a polypeptide
having at least 33.3% sequence identity (i.e., 4 out of 12 amino
acids) to the heavy chain CDR3 of SEQ ID NO: 9; a polypeptide
having at least 41.6% (i.e., 5 out of 12 amino acids) identity to
the heavy chain CDR3 of SEQ ID NO: 9; a polypeptide having at least
50% sequence identity (i.e., 6 out of 12 amino acids) to the heavy
chain CDR3 of SEQ ID NO: 9; a polypeptide having at least 58.3%
sequence identity (i.e., 7 out of 12 amino acids) to the heavy
chain CDR3 of SEQ ID NO: 9; a polypeptide having at least 66.6%
sequence identity (i.e., 8 out of 12 amino acids) to the heavy
chain CDR3 of SEQ ID NO: 9; a polypeptide having at least 75%
sequence identity (i.e., 9 out of 12 amino acids) to the heavy
chain CDR3 of SEQ ID NO: 9; a polypeptide having at least 83.3%
sequence identity (i.e., 10 out of 12 amino acids) to the heavy
chain CDR3 of SEQ ID NO: 9; a polypeptide having at least 91.6%
sequence identity (i.e., 11 out of 12 amino acids) to the heavy
chain CDR3 of SEQ ID NO: 9; a polypeptide having 100% (i.e., 12 out
of 12 amino acids) identity to the heavy chain CDR3 of SEQ ID NO:
9; a polypeptide having at least 90.9% sequence identity (i.e., 10
out of 11 amino acids) to the light chain CDR1 of SEQ ID NO: 4; a
polypeptide having 100% (i.e., 11 out of 11 amino acids) similarity
to the light chain CDR1 of SEQ ID NO: 4; a polypeptide having at
least 85.7% sequence identity (i.e., 6 out of 7 amino acids) to the
light chain CDR2 of SEQ ID NO: 5; a polypeptide having 100% (i.e.,
7 out of 7 amino acids) similarity to the light chain CDR2 of SEQ
ID NO: 5; a polypeptide having at least 66.6% sequence identity
(i.e., 8 out of 12 amino acids) to the light chain CDR3 of SEQ ID
NO: 6; a polypeptide having at least 75% sequence identity (i.e., 9
out of 12 amino acids) to the light chain CDR3 of SEQ ID NO: 6; a
polypeptide having at least 83.3% sequence identity (i.e., 10 out
of 12 amino acids) to the light chain CDR3 of SEQ ID NO: 6; a
polypeptide having at least 91.6% sequence identity (i.e., 11 out
of 12 amino acids) to the light chain CDR3 of SEQ ID NO: 6; a
polypeptide having 100% (i.e., 12 out of 12 amino acids) similarity
to the light chain CDR3 of SEQ ID NO: 6; a polypeptide having at
least 80% sequence identity (i.e., 4 out of 5 amino acids) to the
heavy chain CDR1 of SEQ ID NO: 7; a polypeptide having 100% (i.e.,
5 out of 5 amino acids) similarity to the heavy chain CDR1 of SEQ
ID NO: 7; a polypeptide having at least 56.2% sequence identity
(i.e., 9 out of 16 amino acids) to the heavy chain CDR2 of SEQ ID
NO: 120; a polypeptide having at least 62.5% sequence identity
(i.e., 10 out of 16 amino acids) to the heavy chain CDR2 of SEQ ID
NO: 120; a polypeptide having at least 68.7% sequence identity
(i.e., 11 out of 16 amino acids) to the heavy chain CDR2 of SEQ ID
NO: 120; a polypeptide having at least 75% sequence identity (i.e.,
12 out of 16 amino acids) to the heavy chain CDR2 of SEQ ID NO:
120; a polypeptide having at least 81.2% sequence identity (i.e.,
13 out of 16 amino acids) to the heavy chain CDR2 of SEQ ID NO:
120; a polypeptide having at least 87.5% sequence identity (i.e.,
14 out of 16 amino acids) to the heavy chain CDR2 of SEQ ID NO:
120; a polypeptide having at least 93.7% sequence identity (i.e.,
15 out of 16 amino acids) to the heavy chain CDR2 of SEQ ID NO:
120; a polypeptide having 100% (i.e., 16 out of 16 amino acids)
similarity to the heavy chain CDR2 of SEQ ID NO: 120; a polypeptide
having at least 50% sequence similarity (i.e., 6 out of 12 amino
acids) to the heavy chain CDR3 of SEQ ID NO: 9; a polypeptide
having at least 58.3% sequence identity (i.e., 7 out of 12 amino
acids) to the heavy chain CDR3 of SEQ ID NO: 9; a polypeptide
having at least 66.6% sequence identity (i.e., 8 out of 12 amino
acids) to the heavy chain CDR3 of SEQ ID NO: 9; a polypeptide
having at least 75% sequence identity (i.e., 9 out of 12 amino
acids) to the heavy chain CDR3 of SEQ ID NO: 9; a polypeptide
having at least 83.3% sequence identity (i.e., 10 out of 12 amino
acids) to the heavy chain CDR3 of SEQ ID NO: 9; a polypeptide
having at least 91.6% sequence identity (i.e., 11 out of 12 amino
acids) to the heavy chain CDR3 of SEQ ID NO: 9; or a polypeptide
having 100% (i.e., 12 out of 12 amino acids) similarity to the
heavy chain CDR3 of SEQ ID NO: 9.
[0404] Other exemplary embodiments include at least one
polynucleotides encoding any of the foregoing, e.g., a
polynucleotide encoding a polypeptide that specifically binds to
human IL-6 and includes one, two, three, four, five, six, or more
of the following CDRs or variants thereof:
[0405] a polynucleotide encoding a polypeptide having at least
72.7% sequence identity (i.e., 8 out of 11 amino acids) to the
light chain CDR1 of SEQ ID NO: 4; a polynucleotide encoding a
polypeptide having at least 81.8% sequence identity (i.e., 9 out of
11 amino acids) to the light chain CDR1 of SEQ ID NO: 4; a
polynucleotide encoding a polypeptide having at least 90.9%
sequence identity (i.e., 10 out of 11 amino acids) to the light
chain CDR1 of SEQ ID NO: 4; a polynucleotide encoding a polypeptide
having 100% sequence identity to the light chain CDR1 of SEQ ID NO:
4; a polynucleotide encoding a polypeptide having at least 85.7%
sequence identity (i.e., 6 out of 7 amino acids) to the light chain
CDR2 of SEQ ID NO: 5; a polynucleotide encoding a polypeptide
having 100% sequence identity to the light chain CDR2 of SEQ ID NO:
5; a polynucleotide encoding a polypeptide having at least 50%
sequence identity (i.e., 6 out of 12 amino acids) to the light
chain CDR3 of SEQ ID NO: 6; a polynucleotide encoding a polypeptide
having at least 58.3% sequence identity (i.e., 7 out of 12 amino
acids) to the light chain CDR3 of SEQ ID NO: 6; a polynucleotide
encoding a polypeptide having at least 66.6% sequence identity
(i.e., 8 out of 12 amino acids) to the light chain CDR3 of SEQ ID
NO: 6; a polynucleotide encoding a polypeptide having at least 75%
sequence identity (i.e., 9 out of 12 amino acids) to the light
chain CDR3 of SEQ ID NO: 6; a polynucleotide encoding a polypeptide
having at least 83.3% sequence identity (i.e., 10 out of 12 amino
acids) to the light chain CDR3 of SEQ ID NO: 6; a polynucleotide
encoding a polypeptide having at least 91.6% sequence identity
(i.e., 11 out of 12 amino acids) to the light chain CDR3 of SEQ ID
NO: 6; a polynucleotide encoding a polypeptide having 100% identity
to the light chain CDR3 of SEQ ID NO: 6; a polynucleotide encoding
a polypeptide having at least 80% sequence identity (i.e., 4 out of
5 amino acids) to the heavy chain CDR1 of SEQ ID NO: 7; a
polynucleotide encoding a polypeptide having 100% identity to the
heavy chain CDR1 of SEQ ID NO: 7; a polynucleotide encoding a
polypeptide having at least 50% sequence identity (i.e., 8 out of
16 amino acids) to the heavy chain CDR2 of SEQ ID NO: 120; a
polynucleotide encoding a polypeptide having at least 56.2%
sequence identity (i.e., 9 out of 16 amino acids) to the heavy
chain CDR2 of SEQ ID NO: 120; a polynucleotide encoding a
polypeptide having at least 62.5% sequence identity (i.e., 10 out
of 16 amino acids) to the heavy chain CDR2 of SEQ ID NO: 120; a
polynucleotide encoding a polypeptide having at least 68.7%
sequence identity (i.e., 11 out of 16 amino acids) to the heavy
chain CDR2 of SEQ ID NO: 120; a polynucleotide encoding a
polypeptide having at least 75% sequence identity (i.e., 12 out of
16 amino acids) to the heavy chain CDR2 of SEQ ID NO: 120; a
polynucleotide encoding a polypeptide having at least 81.2%
sequence identity (i.e., 13 out of 16 amino acids) to the heavy
chain CDR2 of SEQ ID NO: 120; a polynucleotide encoding a
polypeptide having at least 87.5% sequence identity (i.e., 14 out
of 16 amino acids) to the heavy chain CDR2 of SEQ ID NO: 120; a
polynucleotide encoding a polypeptide having at least 93.7%
sequence identity (i.e., 15 out of 16 amino acids) to the heavy
chain CDR2 of SEQ ID NO: 120; a polynucleotide encoding a
polypeptide having 100% identity to the heavy chain CDR2 of SEQ ID
NO: 120; a polynucleotide encoding a polypeptide having at least
33.3% sequence identity (i.e., 4 out of 12 amino acids) to the
heavy chain CDR3 of SEQ ID NO: 9; a polynucleotide encoding a
polypeptide having at least 41.6% (i.e., 5 out of 12 amino acids)
identity to the heavy chain CDR3 of SEQ ID NO: 9; a polynucleotide
encoding a polypeptide having at least 50% sequence identity (i.e.,
6 out of 12 amino acids) to the heavy chain CDR3 of SEQ ID NO: 9; a
polynucleotide encoding a polypeptide having at least 58.3%
sequence identity (i.e., 7 out of 12 amino acids) to the heavy
chain CDR3 of SEQ ID NO: 9; a polynucleotide encoding a polypeptide
having at least 66.6% sequence identity (i.e., 8 out of 12 amino
acids) to the heavy chain CDR3 of SEQ ID NO: 9; a polynucleotide
encoding a polypeptide having at least 75% sequence identity (i.e.,
9 out of 12 amino acids) to the heavy chain CDR3 of SEQ ID NO: 9; a
polynucleotide encoding a polypeptide having at least 83.3%
sequence identity (i.e., 10 out of 12 amino acids) to the heavy
chain CDR3 of SEQ ID NO: 9; a polynucleotide encoding a polypeptide
having at least 91.6% sequence identity (i.e., 11 out of 12 amino
acids) to the heavy chain CDR3 of SEQ ID NO: 9; a polynucleotide
encoding a polypeptide having 100% (i.e., 12 out of 12 amino acids)
identity to the heavy chain CDR3 of SEQ ID NO: 9; a polynucleotide
encoding a polypeptide having at least 90.9% sequence identity
(i.e., 10 out of 11 amino acids) to the light chain CDR1 of SEQ ID
NO: 4; a polynucleotide encoding a polypeptide having 100% sequence
similarity to the light chain CDR1 of SEQ ID NO: 4; a
polynucleotide encoding a polypeptide having at least 85.7%
sequence identity (i.e., 6 out of 7 amino acids) to the light chain
CDR2 of SEQ ID NO: 5; a polynucleotide encoding a polypeptide
having 100% sequence similarity to the light chain CDR2 of SEQ ID
NO: 5; a polynucleotide encoding a polypeptide having at least
66.6% sequence identity (i.e., 8 out of 12 amino acids) to the
light chain CDR3 of SEQ ID NO: 6; a polynucleotide encoding a
polypeptide having at least 75% sequence identity (i.e., 9 out of
12 amino acids) to the light chain CDR3 of SEQ ID NO: 6; a
polynucleotide encoding a polypeptide having at least 83.3%
sequence identity (i.e., 10 out of 12 amino acids) to the light
chain CDR3 of SEQ ID NO: 6; a polynucleotide encoding a polypeptide
having at least 91.6% sequence identity (i.e., 11 out of 12 amino
acids) to the light chain CDR3 of SEQ ID NO: 6; a polynucleotide
encoding a polypeptide having 100% sequence similarity to the light
chain CDR3 of SEQ ID NO: 6; a polynucleotide encoding a polypeptide
having at least 80% sequence identity (i.e., 4 out of 5 amino
acids) to the heavy chain CDR1 of SEQ ID NO: 7; a polynucleotide
encoding a polypeptide having 100% sequence similarity to the heavy
chain CDR1 of SEQ ID NO: 7; a polynucleotide encoding a polypeptide
having at least 56.2% sequence identity (i.e., 9 out of 16 amino
acids) to the heavy chain CDR2 of SEQ ID NO: 120; a polynucleotide
encoding a polypeptide having at least 62.5% sequence identity
(i.e., 10 out of 16 amino acids) to the heavy chain CDR2 of SEQ ID
NO: 120; a polynucleotide encoding a polypeptide having at least
68.7% sequence identity (i.e., 11 out of 16 amino acids) to the
heavy chain CDR2 of SEQ ID NO: 120; a polynucleotide encoding a
polypeptide having at least 75% sequence identity (i.e., 12 out of
16 amino acids) to the heavy chain CDR2 of SEQ ID NO: 120; a
polynucleotide encoding a polypeptide having at least 81.2%
sequence identity (i.e., 13 out of 16 amino acids) to the heavy
chain CDR2 of SEQ ID NO: 120; a polynucleotide encoding a
polypeptide having at least 87.5% sequence identity (i.e., 14 out
of 16 amino acids) to the heavy chain CDR2 of SEQ ID NO: 120; a
polynucleotide encoding a polypeptide having at least 93.7%
sequence identity (i.e., 15 out of 16 amino acids) to the heavy
chain CDR2 of SEQ ID NO: 120;
[0406] a polynucleotide encoding a polypeptide having 100% sequence
similarity (i.e., 16 out of 16 amino acids) to the heavy chain CDR2
of SEQ ID NO: 120; a polynucleotide encoding a polypeptide having
at least 50% sequence similarity (i.e., 6 out of 12 amino acids) to
the heavy chain CDR3 of SEQ ID NO: 9; a polynucleotide encoding a
polypeptide having at least 58.3% sequence identity (i.e., 7 out of
12 amino acids) to the heavy chain CDR3 of SEQ ID NO: 9; a
polynucleotide encoding a polypeptide having at least 66.6%
sequence identity (i.e., 8 out of 12 amino acids) to the heavy
chain CDR3 of SEQ ID NO: 9; a polynucleotide encoding a polypeptide
having at least 75% sequence identity (i.e., 9 out of 12 amino
acids) to the heavy chain CDR3 of SEQ ID NO: 9; a polynucleotide
encoding a polypeptide having at least 83.3% sequence identity
(i.e., 10 out of 12 amino acids) to the heavy chain CDR3 of SEQ ID
NO: 9; a polynucleotide encoding a polypeptide having at least
91.6% sequence identity (i.e., 11 out of 12 amino acids) to the
heavy chain CDR3 of SEQ ID NO: 9; a polynucleotide encoding a
polypeptide having 100% sequence similarity (i.e., 12 out of 12
amino acids) to the heavy chain CDR3 of SEQ ID NO: 9.
TABLE-US-00004 TABLE 4 Sequences of exemplary anti-IL-6 antibodies.
Antibody chains CDR1 CDR2 CDR3 Antibody PRT. Nuc. PRT. Nuc. PRT.
Nuc. PRT. Nuc. Ab1 light chains * 2 10 4 12 5 13 6 14 20 720 4 12 5
13 6 14 647 721 4 12 5 13 6 14 651 4 12 5 13 6 14 660 662 4 12 5 13
6 14 666 722 4 12 5 13 6 14 699 698 4 694 5 13 6 695 702 701 4 694
5 13 6 695 706 705 4 694 5 13 6 695 709 723 4 12 5 13 6 14 Human
light chains 648 710 713 used in Ab1 649 711 714 humanization 650
712 715 Ab1 heavy chains 3 11 7 15 8 16 9 17 18 7 15 8 16 9 17 19
724 7 15 120 696 9 17 652 725 7 15 8 16 9 17 656 7 15 8 16 9 17 657
700 7 15 659 696 9 697 658 7 15 120 696 9 17 661 663 7 15 8 16 9 17
664 7 15 8 16 9 17 665 7 15 120 696 9 17 704 703 7 15 120 696 9 697
708 707 7 15 120 696 9 697 Human heavy chains 653 716 717 used in
Ab1 654 716 717 humanization 655 74 82 718 Ab2 light chains 21 29
23 31 24 32 25 33 667 669 23 31 24 32 25 33 Ab2 heavy chains 22 30
26 34 27 35 28 36 668 670 26 34 27 35 28 36 Ab3 light chains 37 45
39 47 40 48 41 49 671 673 39 47 40 48 41 49 Ab3 heavy chains 38 46
42 50 43 51 44 52 672 674 42 50 43 51 44 52 Ab4 light chains 53 61
55 63 56 64 57 65 675 677 55 63 56 64 57 65 Ab4 heavy chains 54 62
58 66 59 67 60 68 676 678 58 66 59 67 60 68 Ab5 light chains 69 77
71 79 72 80 73 81 679 681 71 79 72 80 73 81 Ab5 heavy chains 70 78
74 82 75 83 76 84 680 682 74 82 75 83 76 84 Ab6 light chains 85 93
87 95 88 96 89 97 683 685 87 95 88 96 89 97 Ab6 heavy chains 86 94
90 98 91 99 92 100 684 686 90 98 91 99 92 100 Ab7 light chains 101
109 103 111 104 112 105 113 119 103 111 104 112 105 113 687 689 103
111 104 112 105 113 693 103 111 104 112 105 113 Ab7 heavy chains
102 110 106 114 107 115 108 116 117 106 114 107 115 108 116 118 106
114 121 108 116 688 690 106 114 107 115 108 116 691 106 114 107 115
108 116 692 106 114 121 108 116 Ab8 light chain 122 130 124 132 125
133 126 134 Ab8 heavy chain 123 131 127 135 128 136 129 137 Ab9
light chain 138 146 140 148 141 149 142 150 Ab9 heavy chain 139 147
143 151 144 152 145 153 Ab10 light chain 154 162 156 164 157 165
158 166 Ab10 heavy chain 155 163 159 167 160 168 161 169 Ab11 light
chain 170 178 172 180 173 181 174 182 Ab11 heavy chain 171 179 175
183 176 184 177 185 Ab12 light chain 186 194 188 196 189 197 190
198 Ab12 heavy chain 187 195 191 199 192 200 193 201 Ab13 light
chain 202 210 204 212 205 213 206 214 Ab13 heavy chain 203 211 207
215 208 216 209 217 Ab14 light chain 218 226 220 228 221 229 222
230 Ab14 heavy chain 219 227 223 231 224 232 225 233 Ab15 light
chain 234 242 236 244 237 245 238 246 Ab15 heavy chain 235 243 239
247 240 248 241 249 Ab16 light chain 250 258 252 260 253 261 254
262 Ab16 heavy chain 251 259 255 263 256 264 257 265 Ab17 light
chain 266 274 268 276 269 277 270 278 Ab17 heavy chain 267 275 271
279 272 280 273 281 Ab18 light chain 282 290 284 292 285 293 286
294 Ab18 heavy chain 283 291 287 295 288 296 289 297 Ab19 light
chain 298 306 300 308 301 309 302 310 Ab19 heavy chain 299 307 303
311 304 312 305 313 Ab20 light chain 314 322 316 324 317 325 318
326 Ab20 heavy chain 315 323 319 327 320 328 321 329 Ab21 light
chain 330 338 332 340 333 341 334 342 Ab21 heavy chain 331 339 335
343 336 344 337 345 Ab22 light chain 346 354 348 356 349 357 350
358 Ab22 heavy chain 347 355 351 359 352 360 353 361 Ab23 light
chain 362 370 364 372 365 373 366 374 Ab23 heavy chain 363 371 367
375 368 376 369 377 Ab24 light chain 378 386 380 388 381 389 382
390 Ab24 heavy chain 379 387 383 391 384 392 385 393 Ab25 light
chain 394 402 396 404 397 405 398 406 Ab25 heavy chain 395 403 399
407 400 408 401 409 Ab26 light chain 410 418 412 420 413 421 414
422 Ab26 heavy chain 411 419 415 423 416 424 417 425 Ab27 light
chain 426 434 428 436 429 437 430 438 Ab27 heavy chain 427 435 431
439 432 440 433 441 Ab28 light chain 442 450 444 452 445 453 446
454 Ab28 heavy chain 443 451 447 455 448 456 449 457 Ab29 light
chain 458 466 460 468 461 469 462 470 Ab29 heavy chain 459 467 463
471 464 472 465 473 Ab30 light chain 474 482 476 484 477 485 478
486 Ab30 heavy chain 475 483 479 487 480 488 481 489 Ab31 light
chain 490 498 492 500 493 501 494 502 Ab31 heavy chain 491 499 495
503 496 504 497 505 Ab32 light chain 506 514 508 516 509 517 510
518 Ab32 heavy chain 507 515 511 519 512 520 513 521 Ab33 light
chain 522 530 524 532 525 533 526 534 Ab33 heavy chain 523 531 527
535 528 536 529 537 Ab34 light chain 538 546 540 548 541 549 542
550 Ab34 heavy chain 539 547 543 551 544 552 545 553 Ab35 light
chain 554 562 556 564 557 565 558 566 Ab35 heavy chain 555 563 559
567 560 568 561 569 Ab36 light chain 570 578 572 580 573 581 574
582 Ab36 heavy chain 571 579 575 583 576 584 577 585 * Exemplary
sequence variant forms of heavy and light chains are shown on
separate lines. (PRT.: Polypeptide sequence Nuc.: Exemplary coding
sequence)
[0407] For reference, sequence identifiers other than those
included in Table 4 are summarize in Table 5.
TABLE-US-00005 TABLE 5 Summary of sequence identifiers in this
application. SEQ ID Description 1 Human IL-6 586 kappa constant
light chain polypeptide sequence 587 kappa constant light chain
polynucleotide sequence 588 gamma-1 constant heavy chain
polypeptide sequence 589 gamma-1 constant heavy chain
polynucleotide sequence 590-646 Human IL-6 peptides (Example 14)
719 gamma-1 constant heavy chain polypeptide sequence (differs from
SEQ ID NO: 518 at two positions) 726 C-reactive protein polypeptide
sequence 727 IL-6 receptor alpha 728 IL-6 receptor beta/gp130
[0408] Such antibody fragments or variants thereof may be present
in at least one of the following non-limiting forms: Fab, Fab',
F(ab')2, Fv and single chain Fv antibody forms. In a preferred
embodiment, the anti-IL-6 antibodies described herein further
comprises the kappa constant light chain sequence comprising the
sequence set forth in the polypeptide sequence of SEQ ID NO:
586.
[0409] In another preferred embodiment, the anti-IL-6 antibodies
described herein further comprises the gamma-1 constant heavy chain
polypeptide sequence comprising one of the sequences set forth in
the polypeptide sequence of SEQ ID NO: 588 and SEQ ID NO: 719.
[0410] Embodiments of antibodies described herein may include a
leader sequence, such as a rabbit Ig leader, albumin pre-peptide, a
yeast mating factor pre pro secretion leader sequence (such as P.
pastoris or Saccharomyces cerevisiae a or alpha factor), or human
HAS leader. Exemplary leader sequences are shown offset from FR1 at
the N-terminus of polypeptides shown in FIGS. 4A-B and 5A-B as
follows: rabbit Ig leader sequences in SEQ ID NOs: 2 and 660 and
SEQ ID NOs: 3 and 661; and an albumin prepeptide in SEQ ID NOs: 706
and 708, which facilitates secretion. Other leader sequences known
in the art to confer desired properties, such as secretion,
improved stability or half-life, may also be used, either alone or
in combinations with one another, on the heavy and/or light chains,
which may optionally be cleaved prior to administration to a
subject. For example, a polypeptide may be expressed in a cell or
cell-free expression system that also expresses or includes (or is
modified to express or include) a protease, e.g., a membrane-bound
signal peptidase, that cleaves a leader sequence.
[0411] In another embodiment, the invention contemplates an
isolated anti-IL-6 antibody comprising a V.sub.H polypeptide
sequence comprising: SEQ ID NO: 3, 18, 19, 22, 38, 54, 70, 86, 102,
117, 118, 123, 139, 155, 171, 187, 203, 219, 235, 251, 267, 283,
299, 315, 331, 347, 363, 379, 395, 411, 427, 443, 459, 475, 491,
507, 523, 539, 555, 571, 652, 656, 657, 658, 661, 664, 665, 668,
672, 676, 680, 684, 688, 691, 692, 704, or 708; and further
comprising a V.sub.L polypeptide sequence comprising: SEQ ID NO: 2,
20, 21, 37, 53, 69, 85, 101, 119, 122, 138, 154, 170, 186, 202,
218, 234, 250, 266, 282, 298, 314, 330, 346, 362, 378, 394, 410,
426, 442, 458, 474, 490, 506, 522, 538, 554, 570, 647, 651, 660,
666, 667, 671, 675, 679, 683, 687, 693, 699, 702, 706, or 709 or a
variant thereof wherein at least one of the framework residues (FR
residues) or CDR residues in said V.sub.H or V.sub.L polypeptide
has been substituted with another amino acid residue resulting in
an anti-IL-6 antibody that specifically binds IL-6. The invention
contemplates humanized and chimeric forms of these antibodies
wherein preferably the FR will comprise human FRs highly homologous
to the parent antibody. The chimeric antibodies may include an Fc
derived from IgG, IgG2, IgG3, IgG4, IgG5, IgG6, IgG7, IgG8, IgG9,
IgG10, IgG1, IgG12, IgG13, IgG14, IgG15, IgG16, IgG17, IgG18 or
IgG19 constant regions and in particular a variable heavy and light
chain constant region as set forth in SEQ ID NO: 588 and SEQ ID NO:
586.
[0412] In one embodiment of the invention, the antibodies or
V.sub.H or V.sub.L polypeptides originate or are selected from at
least one rabbit B cell populations prior to initiation of the
humanization process referenced herein.
[0413] In another embodiment of the invention, the anti-IL-6
antibodies and fragments and variants thereof have binding
specificity for primate homologs of the human IL-6 protein.
Non-limiting examples of primate homologs of the human IL-6 protein
are IL-6 obtained from Macaca fascicularis (cynomolgus monkey) and
the Rhesus monkey. In another embodiment of the invention, the
anti-IL-6 antibodies and fragments and variants thereof inhibits
the association of IL-6 with IL-6R, and/or the production of
IL-6/IL-6R/gp130 complexes and/or the production of IL-6/L-6R/gp130
multimers and/or antagonizes the biological effects of at least one
of the foregoing.
Polyclonal Antibody
[0414] Polyclonal antibodies are heterogeneous populations of
antibody molecules derived from the sera of animals immunized with
an antigen. Polyclonal antibodies which selectively bind the IL-6
may be made by methods well-known in the art. See, e.g., Howard
& Kaser (2007) Making and Using Antibodies: A Practical
Handbook CRC Press.
Monoclonal Antibody
[0415] A monoclonal antibody contains a substantially homogeneous
population of antibodies specific to antigens, which population
contains substantially similar epitope binding sites. Monoclonal
antibodies may be obtained by methods known to those skilled in the
art. See, e.g. Kohler and Milstein (1975) Nature 256: 495-497; U.S.
Pat. No. 4,376,110; Ausubel, et al. [Eds.] (2011) CURRENT PROTOCOLS
IN MOLECULAR BIOLOGY, Greene Publishing Assoc. and Wiley
Interscience, NY.; and Harlow & Lane (1998) USING ANTIBODIES: A
LABORATORY MANUAL Cold Spring Harbor Laboratory; Colligan, et al.
(2005) [Eds.] Current Protocols in Immunology Greene Publishing
Assoc. and Wiley Interscience, NY. Such antibodies may be of any
immunoglobulin class including IgG, IgM, IgE, IgA, GILD, and any
subclass thereof. A hybridoma producing an antibody of the present
invention may be cultivated in vitro, in situ, or in vivo.
Chimeric Antibody
[0416] Chimeric antibodies are molecules different portions of
which are derived from different animal species, such as those
having variable region derived from a murine antibody and a human
immunoglobulin constant region, which are primarily used to reduce
immunogenicity in application and to increase yields in production,
for example, where murine monoclonal antibodies have higher yields
from hybridomas but higher immunogenicity in humans, such that
human murine chimeric monoclonal antibodies are used. Chimeric
antibodies and methods for their production are known in the art.
See Cabilly, et al. (1984) Proc. Natl. Acad. Sci. USA 81:
3273-3277; Morrison, et al. (1994) Proc. Natl. Acad. Sci. USA 81:
6851-6855, Boulianne, et al. (1984) Nature 312: 643-646; Neuberger,
et al. (1985) Nature 314: 268-270; European Patent Application
173494 (1986); WO 86/01533 (1986); European Patent 184187 (1992);
Sahagan, et al. (1986) J Immunol. 137: 1066-1074; Liu, et al.
(1987) Proc. Natl. Acad. Sci. USA 84: 3439-3443; Sun, et al. (1987)
Proc. Natl. Acad. Sci. USA 84: 214-218; Better, et al. (1988)
Science 240: 1041-1043; and Harlow & Lane (1998) USING
ANTIBODIES: A LABORATORY MANUAL Cold Spring Harbor Laboratory; and
U.S. Pat. No. 5,624,659.
Humanized Antibody
[0417] Humanized antibodies are engineered to contain even more
human-like immunoglobulin domains, and incorporate only the
complementarity-determining regions of the animal-derived antibody.
This may be accomplished by examining the sequence of the
hyper-variable loops of the variable regions of the monoclonal
antibody, and fitting them to the structure of the human antibody
chains. See, e.g., U.S. Pat. No. 6,187,287. Likewise, other methods
of producing humanized antibodies are now well known in the art.
See, e.g., U.S. Pat. Nos. 5,225,539; 5,530,101; 5,585,089;
5,693,762; 6,054,297; 6,180,370; 6,407,213; 6,548,640; 6,632,927;
and U.S. Pat. No. 6,639,055; Jones, et al. (1986) Nature 321:
522-525; Reichmann, et al. (1988) Nature 332: 323-327; Verhoeyen,
et al. (1988) Science 239: 1534-36; and Zhiqiang An (2009) [Ed.]
Therapeutic Monoclonal Antibodies: From Bench to Clinic John Wiley
& Sons, Inc.
Antibody Fragments (Antigen-Binding Fragments)
[0418] In addition to entire immunoglobulins (or their recombinant
counterparts), immunoglobulin fragments comprising the epitope
binding site (e.g., Fab', F(ab')2, or other fragments) may be
synthesized. "Fragment," or minimal immunoglobulins may be designed
utilizing recombinant immunoglobulin techniques. For instance "Fv"
immunoglobulins for use in the present invention may be produced by
synthesizing a fused variable light chain region and a variable
heavy chain region. Combinations of antibodies are also of
interest, e.g. diabodies, which comprise two distinct Fv
specificities. Antigen-binding fragments of immunoglobulins include
but are not limited to SMIPs (small molecule
immunopharmaceuticals), camelbodies, nanobodies, and IgNAR.
Further, antigen-binding fragments may comprise the epitope binding
site and have the same antigen binding selectivity as the
antibody.
[0419] An antigen-binding fragment (e.g., Fab fragment) may
comprise at least one constant and one variable domain of each of
the heavy and the light chain of the antibody from which it is
derived. These domains shape the paratope--the antigen-binding
site--at the amino terminal end of the monomer. The two variable
domains bind the epitope on their specific antigens. Fc and Fab
fragments may be generated using papain that cleaves the
immunoglobulin monomer into two Fab fragments and an Fc fragment.
Pepsin cleaves below hinge region, so a F(ab').sub.2 fragment and a
pFc' fragment may be formed. Another enzyme, IdeS (Immunoglobulin
degrading enzyme from Streptococcus pyogenes, trade name
FabRICATOR.RTM.) cleaves IgG in a sequence specific manner at
neutral pH. The F(ab').sub.2 fragment may be split into two Fab'
fragments by mild reduction. Additionally, the variable regions of
the heavy and light chains may be fused together to form a
single-chain variable fragment (scFv), which is only half the size
of the Fab fragment, but retains the original specificity of the
parent antibody.
Anti-Idiotypic Antibody
[0420] An anti-idiotypic (anti-Id) antibody is an antibody which
recognizes unique determinants generally associated with the
antigen-binding site of an antibody. An Id antibody may be prepared
by immunizing an animal of the same species and genetic type (e.g.,
mouse strain) as the source of the antibody with the antibody to
which an anti-Id is being prepared. The immunized animal will
recognize and respond to the idiotypic determinants of the
immunizing antibody by producing an antibody to these idiotypic
determinants (the anti-ld antibody). See e.g., U.S. Pat. No.
4,699,880. The anti-Id antibody may also be used as an "immunogen"
to induce an immune response in yet another animal, producing a
so-called anti-anti-Id antibody. The anti-anti-Id may be
epitopically identical to the original antibody which induced the
anti-Id. Thus, by using antibodies to the idiotypic determinants of
an antibody it is possible to identify other clones expressing
antibodies of identical specificity.
Engineered and Modified Antibodies
[0421] An antibody of the invention further may be prepared using
an antibody having at least one of the VH and/or VL sequences
derived from an antibody starting material to engineer a modified
antibody, which modified antibody may have altered properties from
the starting antibody. An antibody may be engineered by modifying
at least one residues within one or both variable regions (i.e., VH
and/or VL), for example within at least one CDR regions and/or
within at least one framework regions. Additionally or
alternatively, an antibody may be engineered by modifying residues
within the constant region(s), for example to alter the effector
function(s) of the antibody.
[0422] One type of variable region engineering that may be
performed is CDR grafting. Antibodies interact with target antigens
predominantly through amino acid residues that are located in the
six heavy and light chain complementarity determining regions
(CDRs). For this reason, the amino acid sequences within CDRs are
more diverse between individual antibodies than sequences outside
of CDRs. Because CDR sequences are responsible for most
antibody-antigen interactions, it is possible to express
recombinant antibodies that mimic the properties of specific
naturally occurring antibodies by constructing expression vectors
that include CDR sequences from the specific naturally occurring
antibody grafted onto framework sequences from a different antibody
with different properties. See, e.g., Riechmann, et al. (1998)
Nature 332: 323-327; Jones, et al. (1986) Nature 321: 522-525;
Queen, et al. (1989) Proc. Natl. Acad. U.S.A. 86: 10029-10033; U.S.
Pat. Nos. 5,225,539; 5,530,101; 5,585,089; 5,693,762; and
6,180,370.
[0423] Suitable framework sequences may be obtained from public DNA
databases or published references that include germline antibody
gene sequences. For example, germline DNA sequences for human heavy
and light chain variable region genes may be found in the "VBase"
human germline sequence database (available on the Internet), as
well as in Kabat, E. A., et al. (1991) Sequences of Proteins of
Immunological Interest, Fifth Edition, U.S. Department of Health
and Human Services, NIH Publication No. 91-3242; Tomlinson, et al.
(1992) "The Repertoire of Human Germline VH Sequences Reveals about
Fifty Groups of VH Segments with Different Hypervariable Loops" J.
Mol. Biol. 227: 776-798; and Cox, et al. (1994) Eur. J Immunol. 24:
827-836.
[0424] Another type of variable region modification is to mutate
amino acid residues within the VH and/or VL CDR 1, CDR2 and/or CDR3
regions to thereby improve at least one binding properties (e.g.,
affinity) of the antibody of interest. Site-directed mutagenesis or
PCR-mediated mutagenesis may be performed to introduce the
mutation(s) and the effect on antibody binding, or other functional
property of interest, may be evaluated in appropriate in vitro or
in vivo assays. Preferably conservative modifications (as discussed
herein) may be introduced. The mutations may be amino acid
substitutions, additions or deletions, but are preferably
substitutions. Moreover, typically no more than one, two, three,
four or five residues within a CDR region are altered.
[0425] Engineered antibodies of the invention include those in
which modifications have been made to framework residues within
V.sub.H and/or VL, e.g. to improve the properties of the antibody.
Typically such framework modifications are made to decrease the
immunogenicity of the antibody. For example, one approach is to
"backmutate" at least one framework residues to the corresponding
germline sequence. More specifically, an antibody that has
undergone somatic mutation may contain framework residues that
differ from the germline sequence from which the antibody is
derived. Such residues may be identified by comparing the antibody
framework sequences to the germline sequences from which the
antibody is derived.
[0426] In addition or alternative to modifications made within the
framework or CDR regions, antibodies of the invention may be
engineered to include modifications within the Fc region, typically
to alter at least one functional properties of the antibody, such
as serum half-life, complement fixation, Fc receptor binding,
and/or antigen-dependent cellular cytotoxicity. Furthermore, an
antibody of the invention may be chemically modified (e.g., at
least one chemical moieties may be attached to the antibody) or be
modified to alter its glycosylation, again to alter at least one
functional properties of the antibody. Such embodiments are
described further below. The numbering of residues in the Fc region
is that of the EU index of Kabat.
[0427] The hinge region of CH1 may be modified such that the number
of cysteine residues in the hinge region is altered, e.g.,
increased or decreased. See U.S. Pat. No. 5,677,425. The number of
cysteine residues in the hinge region of CH1 may be altered to, for
example, facilitate assembly of the light and heavy chains or to
increase or decrease the stability of the antibody. The Fc hinge
region of an antibody may be mutated to decrease the biological
half life of the antibody. More specifically, at least one amino
acid mutations may be introduced into the CH2-CH3 domain interface
region of the Fc-hinge fragment such that the antibody has impaired
Staphylococcyl protein A (SpA) binding relative to native Fc-hinge
domain SpA binding. See, e.g., U.S. Pat. No. 6,165,745.
[0428] The antibody may be modified to increase its biological half
life. Various approaches are possible. For example, at least one of
the following mutations may be introduced: T252L, T254S, T256F. See
U.S. Pat. No. 6,277,375. Alternatively, to increase the biological
half life, the antibody may be altered within the CH1 or CL region
to contain a salvage receptor binding epitope taken from two loops
of a CH2 domain of an Fc region of an IgG. See U.S. Pat. Nos.
5,869,046 and 6,121,022.
[0429] The Fc region may be altered by replacing at least one amino
acid residue with a different amino acid residue to alter the
effector function(s) of the antibody. For example, at least one
amino acids selected from amino acid residues 234, 235, 236, 237,
297, 318, 320 and 322 may be replaced with a different amino acid
residue such that the antibody has an altered affinity for an
effector ligand but retains the antigen-binding ability of the
parent antibody. The effector ligand to which affinity may be
altered may be, for example, an Fc receptor or the Cl component of
complement. See U.S. Pat. Nos. 5,624,821 and 5,648,260.
[0430] The Fc region may be modified to increase the affinity of
the antibody for an Fcy receptor by modifying at least one amino
acids at the following positions: 238, 239, 248, 249, 252, 254,
255, 256, 258, 265, 267, 268, 269, 270, 272, 276, 278, 280, 283,
285, 286, 289, 290, 292, 293, 294, 295, 296, 298, 301, 303, 305,
307, 309, 312, 315, 320, 322, 324, 326, 327, 329, 330, 331, 333,
334, 335, 337, 338, 340, 360, 373, 376, 378, 382, 388, 389, 398,
414, 416, 419, 430, 434, 435, 437, 438 or 439. See WO 00/42072.
Moreover, the binding sites on human IgG1 for Fc.gamma.RI,
Fc.gamma.RII, Fc.gamma.RIII and FcRn have been mapped and variants
with improved binding. See Shields, et al. (2001) J. Biol. Chem.
276: 6591-6604. Specific mutations at positions 256, 290, 298, 333,
334 and 339 are shown to improve binding to Fc.gamma.RIII.
Additionally, the following combination mutants are shown to
improve Fc.gamma.RIII binding: T256A/S298A, S298A/E333A,
S298A/K224A and S298A/E333A/K334A.
[0431] The glycosylation of an antibody may be modified. For
example, an aglycoslated antibody may be made (i.e., the antibody
lacks glycosylation). Glycosylation may be altered to, for example,
increase the affinity of the antibody for antigen. Such
carbohydrate modifications may be accomplished by, for example,
altering at least one sites of glycosylation within the antibody
sequence. For example, at least one amino acid substitutions may be
made that result in elimination of at least one variable region
framework glycosylation sites to thereby eliminate glycosylation at
that site. Such aglycosylation may increase the affinity of the
antibody for antigen. See, e.g., U.S. Pat. Nos. 5,714,350 and
6,350,861.
[0432] Additionally or alternatively, an antibody may be made that
has an altered type of glycosylation, such as a hypofucosylated
antibody having reduced amounts of fucosyl residues or an antibody
having increased bisecting GlcNac structures. Such carbohydrate
modifications may be accomplished by, for example, expressing the
antibody in a host cell with altered glycosylation machinery. Cells
with altered glycosylation machinery have been described in the art
and may be used as host cells in which to express recombinant
antibodies of the invention to thereby produce an antibody with
altered glycosylation. See U.S. Patent Application Publication No.
2004/0110704 and Yamane-Ohnuki, et al. (2004) Biotechnol Bioeng.
87: 614-22; EP 1,176,195; WO 2003/035835; Shields, et al. (2002) J.
Biol. Chem. 277: 26733-26740; WO 99/54342; Umana, et al. (1999)
Nat. Biotech. 17: 176-180; and Tarentino, et al. (1975) Biochem.
14: 5516-23.
[0433] An antibody may be pegylated to, for example, increase the
biological (e.g., serum) half life of the antibody. To pegylate an
antibody, the antibody, or fragment thereof, typically is reacted
with polyethylene glycol (PEG), such as a reactive ester or
aldehyde derivative of PEG, under conditions in which at least one
PEG groups become attached to the antibody or antibody fragment.
Preferably, the pegylation is carried out via an acylation reaction
or an alkylation reaction with a reactive PEG molecule (or an
analogous reactive water-soluble polymer).
[0434] The invention also provides variants and equivalents that
are substantially homologous to the antibodies, antibody fragments,
diabodies, SMIPs, camelbodies, nanobodies, IgNAR, polypeptides,
variable regions and CDRs set forth herein. These may contain,
e.g., conservative substitution mutations, (i.e., the substitution
of at least one amino acids by similar amino acids). For example,
conservative substitution refers to the substitution of an amino
acid with another within the same general class, e.g., one acidic
amino acid with another acidic amino acid, one basic amino acid
with another basic amino acid, or one neutral amino acid by another
neutral amino acid. In another embodiment, the invention further
contemplates the above-recited polypeptide homologs of the antibody
fragments, variable regions and CDRs set forth herein further
having anti-IL-6 activity. Non-limiting examples of anti-IL-6
activity are set forth herein, for example, under the heading
"Anti-IL-6 Activity," infra.
[0435] Anti-IL-6 antibodies have also been disclosed in the
following published and unpublished patent applications, which are
co-owned by the assignee of the present application: WO
2008/144763; U.S. Patent Application Publication Nos. 2009/0028784,
2009/0297513, and 2009/0297436. Other anti-IL-6 antibodies have
been disclosed in the following U.S. Pat. Nos. 7,482,436;
7,291,721; 6,121,423; U.S. Patent Application Publication Nos.
2008/0075726; 2007/0178098; 2007/0154481; 2006/0257407; and
2006/0188502.
Polypeptide Sequence Variants
[0436] For any anti-IL-6 antibodies sequence described herein,
further characterization or optimization may be achieved by
systematically either adding or removing amino acid residues to
generate longer or shorter peptides, and testing those and
sequences generated by walking a window of the longer or shorter
size up or down the antigen from that point. Coupling this approach
to generating new candidate targets with testing for effectiveness
of antigenic molecules based on those sequences in an
immunogenicity assay, as known in the art or as described herein,
may lead to further manipulation of the antigen. Further still,
such optimized sequences may be adjusted by, e.g., the addition,
deletions, or other mutations as known in the art and/or discussed
herein to further optimize the anti-IL-6 antibodies (e.g.,
increasing serum stability or circulating half-life, increasing
thermal stability, enhancing delivery, enhance immunogenicity,
increasing solubility, targeting to a particular in vivo location
or cell type).
[0437] In another embodiment, the invention contemplates
polypeptide sequences having at least about 90% sequence homology
to any at least one of the polypeptide sequences of antibody
fragments, variable regions and CDRs set forth herein. More
preferably, the invention contemplates polypeptide sequences having
at least about 95% sequence homology, even more preferably at least
about 98% sequence homology, and still more preferably at least
about 99% sequence homology to any at least one of the polypeptide
sequences of antibody fragments, variable regions and CDRs set
forth herein. Methods for determining homology between nucleic acid
and amino acid sequences are well known to those of ordinary skill
in the art.
[0438] The anti-IL-6 antibodies polypeptides described herein may
comprise conservative substitution mutations, (i.e., the
substitution of at least one amino acids by similar amino acids).
For example, conservative substitution refers to the substitution
of an amino acid with another within the same general class, e.g.,
one acidic amino acid with another acidic amino acid, one basic
amino acid with another basic amino acid, or one neutral amino acid
by another neutral amino acid.
[0439] Anti-IL-6 antibodies polypeptide sequences may have at least
about 60, 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,
91, 92, 93, 94, 95, 96, 97, 98, 98.5, 99, 99.5, 99.8, 99.9, or 100%
sequence homology to any at least one of the polypeptide sequences
set forth herein. More preferably, the invention contemplates
polypeptide sequences having at least about 95% sequence homology,
even more preferably at least about 98% sequence homology, and
still more preferably at least about 99% sequence homology to any
at least one of the polypeptide sequences of Anti-IL-6 antibodies
polypeptide sequences set forth herein. Methods for determining
homology between amino acid sequences, as well as nucleic acid
sequences, are well known to those of ordinary skill in the art.
See, e.g., Nedelkov & Nelson (2006) New and Emerging Proteomic
Techniques Humana Press. Thus, an anti-IL-6 antibodies polypeptide
may have at least about 60, 65, 70, 75, 80, 81, 82, 83, 84, 85, 86,
87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 98.5, 99, 99.5,
99.8, 99.9, or 100% sequence homology with a polypeptide
sequence.
[0440] The term homology, or identity, is understood as meaning the
number of agreeing amino acids (identity) with other proteins,
expressed in percent. The identity is preferably determined by
comparing a given sequence with other proteins with the aid of
computer programs. If sequences which are compared with each other
are different in length, the identity is to be determined in such a
way that the number of amino acids which the short sequence shares
with the longer sequence determines the percentage identity. The
identity can be determined routinely by means of known computer
programs which are publicly available such as, for example, Clustal
W. Thompson, et al. (1994) Nucleic Acids Research 22: 4673-4680.
ClustalW is publicly available from the European Molecular Biology
Laboratory and may be downloaded from various internet pages, inter
alia the IGBMC (Institut de Genetique et de Biologie Moleculaire et
Cellulaire) and the EBI and all mirrored EBI internet pages
(European Bioinformatics Institute). If the ClustalW computer
program Version 1.8 is used to determine the identity between, for
example, the reference protein of the present application and other
proteins, the following parameters are to be set: KTUPLE=1,
TOPDIAG=5, WINDOW=5, PAIRGAP=3, GAPOPEN=10, GAPEXTEND=0.05,
GAPDIST=8, MAXDIV=40, MATRIX=GONNET, ENDGAPS(OFF), NOPGAP, NOHGAP.
See also European Bioinformatics Institute (EBI) toolbox available
on-line and Smith (2002) Protein Sequencing Protocols [2nd Ed.]
Humana Press.
[0441] One possibility of finding similar sequences is to carry out
sequence database researches. Here, at least one sequences may be
entered as what is known as a query. This query sequence is then
compared with sequences present in the selected databases using
statistical computer programs. Such database queries (blast
searches) are known to the skilled worker and may be carried out at
different suppliers. If, for example, such a database query is
carried out at the NCBI (National Center for Biotechnology
Information), the standard settings for the respective comparison
query should be used. For protein sequence comparisons (blastp),
these settings are: Limit entrez=not activated; Filter=low
complexity activated; Expect value=10; word size=3;
Matrix=BLOSUM62; Gap costs: Existence=11, Extension=1. The result
of such a query is, among other parameters, the degree of identity
between the query sequence and the similar sequences found in the
databases. Methods and materials for making fragments of Anti-IL-6
antibodies polypeptides are well known in the art. See, e.g.,
Maniatis, et al. (2001) Molecular Cloning: A Laboratory Manual
[3.sup.rd Ed.] Cold Spring Harbor Laboratory Press.
[0442] Variant anti-IL-6 antibodies polypeptides may retain their
antigenic specificity to bind IL-6. Fully specific variants may
contain only conservative variations or variations in non-critical
residues or in non-critical regions. Variants may also contain
substitution of similar amino acids that result in no change or an
insignificant change in their specificity. Alternatively, such
substitutions may positively or negatively affect specificity to
some degree. Non-specific variants typically contain at least one
non-conservative amino acid substitutions, deletions, insertions,
inversions, or truncation or a substitution, insertion, inversion,
or deletion in a critical residue or critical region of an epitope.
Molecular biology and biochemistry techniques for modifying
anti-IL-6 antibodies polypeptides while preserving specificity are
well known in the art. See, e.g., Ho, et al. (1989) Gene 77(1):
51-59; Landt, et al. (1990) Gene 96(1): 125-128; Hopp & Woods
(1991) Proc. Natl. Acad. Sci. USA 78(6): 3824-3828; Kolaskar &
Tongaonkar (1990) FEBS Letters 276(1-2): 172-174; and Welling, et
al. (1985) FEBS Letters 188(2): 215-218.
[0443] Amino acids that are essential for function may be
identified by methods known in the art, such as site-directed
mutagenesis or alanine-scanning mutagenesis. Cunningham, et al.
(1989) Sci. 244: 1081-85. The latter procedure introduces single
alanine mutations at every residue in the molecule. The resulting
mutant molecules are then tested for biological activity such as
epitope binding. Sites that are critical for ligand-receptor
binding may also be determined by structural analysis such as
crystallography, nuclear magnetic resonance, or photoaffinity
labeling. Smith, et al. (1992) J. Mol. Biol. 224: 899-904; de Vos,
et al. (1992) Sci. 255: 306-12.
[0444] For example, one class of substitutions is conserved amino
acid substitutions. Such substitutions are those that substitute a
given amino acid in a Anti-IL-6 antibodies polypeptide with another
amino acid of like characteristics. Typically seen as conservative
substitutions are the replacements, one for another, among the
aliphatic amino acids Ala, Val, Leu, and Ile; interchange of the
hydroxyl residues Ser and Thr, exchange of the acidic residues Asp
and Glu, substitution between the amide residues Asn and Gln,
exchange of the basic residues Lys and Arg, replacements among the
aromatic residues Phe, Tyr. Guidance concerning which amino acid
changes are likely to be phenotypically silent is found in, for
example, Bowie, et al. (1990) Sci. 247: 1306-10. Hence, one of
ordinary skill in the art appreciates that the inventors possess
peptide variants without delineation of all the specific variants.
As to amino acid sequences, one of skill will recognize that
individual substitutions, deletions or additions to a nucleic acid,
peptide, polypeptide, or protein sequence which alters, adds or
deletes a single amino acid or a small percentage of amino acids in
the encoded sequence is a "conservatively modified variant" where
the alteration results in the substitution of an amino acid with a
chemically similar amino acid. Conservative substitution tables
providing functionally similar amino acids are well known in the
art. Such conservatively modified variants are in addition to and
do not exclude polymorphic variants, interspecies homologs, and
alleles of the invention. See, e.g., Creighton (1992) Proteins:
Structures and Molecular Properties [2nd Ed.] W.H. Freeman.
[0445] Moreover, polypeptides often contain amino acids other than
the twenty "naturally occurring" amino acids. Further, many amino
acids, including the terminal amino acids, may be modified by
natural processes, such as processing and other post-translational
modifications, or by chemical modification techniques well known in
the art. Known modifications include, but are not limited to,
acetylation, acylation, ADP-ribosylation, amidation, covalent
attachment of flavin, covalent attachment of a heme moiety,
covalent attachment of a nucleotide or nucleotide derivative,
covalent attachment of a lipid or lipid derivative, covalent
attachment of phosphotidylinositol, cross-linking, cyclization,
disulfide bond formation, demethylation, formation of covalent
crosslinks, formation of cystine, formation of pyroglutamate,
formylation, g-carboxylation, glycosylation, GPI anchor formation,
hydroxylation, iodination, methylation, myristoylation, oxidation,
proteolytic processing, phosphorylation, prenylation, racemization,
selenoylation, sulfation, transfer-RNA mediated addition of amino
acids to proteins such as arginylation, and ubiquitination. See
Creighton (1992) Proteins: Structure and Molecular Properties
[2.sup.nd Ed.] and Lundblad (1995) Techniques in Protein
Modification [1.sup.st Ed.] Many detailed reviews are available on
this subject. See, e.g., Wold (1983) Posttranslational Covalent
Modification of Proteins Acad. Press, NY; Seifter, et al. (1990)
Meth. Enzymol. 182: 626-46; and Rattan, et al. (1992) Ann. NY Acad.
Sci. 663: 48-62.
[0446] In another embodiment, the invention further contemplates
the generation and use of anti-idiotypic antibodies that bind any
of the foregoing sequences. In an exemplary embodiment, such an
anti-idiotypic antibody could be administered to a subject who has
received an anti-IL-6 antibody to modulate, reduce, or neutralize,
the effect of the anti-IL-6 antibody. A further exemplary use of
such anti-idiotypic antibodies is for detection of the anti-IL-6
antibodies of the present invention, for example to monitor the
levels of the anti-IL-6 antibodies present in a subject's blood or
other bodily fluids.
[0447] The present invention also contemplates anti-IL-6 antibodies
comprising any of the polypeptide or polynucleotide sequences
described herein substituted for any of the other polynucleotide
sequences described herein. For example, without limitation
thereto, the present invention contemplates antibodies comprising
the combination of any of the variable light chain and variable
heavy chain sequences described herein, and further contemplates
antibodies resulting from substitution of any of the CDR sequences
described herein for any of the other CDR sequences described
herein. As noted preferred anti-IL-6 antibodies or fragments or
variants thereof may contain a variable heavy and/or light sequence
as shown in FIG. 2-5, such as SEQ ID NO: 651, 657, 709 or variants
thereof wherein at least one CDR or FR residues are modified
without adversely affecting antibody binding to IL-6 or other
desired functional activity.
Polynucleotides Encoding Anti-IL-6 Antibody Polypeptides
[0448] The invention is further directed to polynucleotides
encoding polypeptides of the antibodies having binding specificity
to IL-6. In one embodiment of the invention, polynucleotides of the
invention comprise, or alternatively consist of, the following
polynucleotide sequence encoding the variable light chain
polypeptide sequence of SEQ ID NO: 2 which is encoded by the
polynucleotide sequence of SEQ ID NO: 10 or the polynucleotide
sequence of SEQ ID NO: 662, 698, 701, or 705.
[0449] In another embodiment of the invention, polynucleotides of
the invention comprise, or alternatively consist of, the following
polynucleotide sequence encoding the variable heavy chain
polypeptide sequence of SEQ ID NO: 3 which is encoded by the
polynucleotide sequence of SEQ ID NO: 11 or the polynucleotide
sequence of SEQ ID NO: 663, 700, 703, or 707.
[0450] In a further embodiment of the invention, polynucleotides
encoding fragments or variants of the antibody having binding
specificity to IL-6 comprise, or alternatively consist of, at least
one of the polynucleotide sequences of SEQ ID NO: 12 or 694; SEQ ID
NO: 13; and SEQ ID NO: 14 or 695 which correspond to
polynucleotides encoding the complementarity-determining regions
(CDRs, or hypervariable regions) of the light chain variable
sequence of SEQ ID NO: 2.
[0451] In a further embodiment of the invention, polynucleotides
encoding fragments or variants of the antibody having binding
specificity to IL-6 comprise, or alternatively consist of, at least
one of the polynucleotide sequences of SEQ ID NO: 15; SEQ ID NO: 16
or 696; and SEQ ID NO: 17 or 697 which correspond to
polynucleotides encoding the complementarity-determining regions
(CDRs, or hypervariable regions) of the heavy chain variable
sequence of SEQ ID NO: 3 or SEQ ID NO: 661 or SEQ ID NO: 657 or
others depicted in FIG. 4 or 5.
[0452] The invention also contemplates polynucleotide sequences
including at least one of the polynucleotide sequences encoding
antibody fragments or variants described herein. In one embodiment
of the invention, polynucleotides encoding fragments or variants of
the antibody having binding specificity to IL-6 comprise, or
alternatively consist of, one, two, three or more, including all of
the following polynucleotides encoding antibody fragments: the
polynucleotide SEQ ID NO: 10 encoding the light chain variable
region of SEQ ID NO: 2; the polynucleotide SEQ ID NO: 11 encoding
the heavy chain variable region of SEQ ID NO: 3; the polynucleotide
SEQ ID NO: 720 encoding the light chain polypeptide of SEQ ID NO:
20; the polynucleotide SEQ ID NO: 721 encoding the light chain
polypeptide of SEQ ID NO: 647; the polynucleotide SEQ ID NO: 662
encoding the light chain polypeptide of SEQ ID NO: 660; the
polynucleotide SEQ ID NO: 722 encoding the light chain polypeptide
of SEQ ID NO: 666; the polynucleotide SEQ ID NO: 698 encoding the
light chain polypeptide of SEQ ID NO: 699; the polynucleotide SEQ
ID NO: 701 encoding the light chain polypeptide of SEQ ID NO: 702;
the polynucleotide SEQ ID NO: 705 encoding the light chain
polypeptide of SEQ ID NO: 706; the polynucleotide SEQ ID NO: 723
encoding the light chain polypeptide of SEQ ID NO: 709; the
polynucleotide SEQ ID NO: 724 encoding the heavy chain polypeptide
of SEQ ID NO: 19; the polynucleotide SEQ ID NO: 725 encoding the
heavy chain polypeptide of SEQ ID NO: 652; the polynucleotide SEQ
ID NO: 700 encoding the heavy chain polypeptide of SEQ ID NO: 657;
the polynucleotide SEQ ID NO: 663 encoding the heavy chain
polypeptide of SEQ ID NO: 661; the polynucleotide SEQ ID NO: 703
encoding the heavy chain polypeptide of SEQ ID NO: 704; the
polynucleotide SEQ ID NO: 707 encoding the heavy chain polypeptide
of SEQ ID NO: 708; the polynucleotides of SEQ ID NO: 12, 13, 14,
694 and 695 encoding the complementarity-determining regions of the
aforementioned light chain polypeptides; and the polynucleotides of
SEQ ID NO: 15, 16, 17, 696 and 697 encoding the
complementarity-determining regions of the aforementioned heavy
chain polypeptides, and polynucleotides encoding the variable heavy
and light chain sequences in SEQ ID NO: 657 and SEQ ID NO: 709
respectively, e.g., the nucleic acid sequences in SEQ ID NO: 700
and SEQ ID NO: 723 and fragments or variants thereof, e.g., based
on codon degeneracy. These nucleic acid sequences encoding variable
heavy and light chain sequences may be expressed alone or in
combination and these sequences preferably are fused to suitable
variable constant sequences, e.g., those in SEQ ID NO: 589 and SEQ
ID NO: 587.
[0453] Exemplary nucleotide sequences encoding anti-IL-6 antibodies
of the present invention are identified in Table 4. The
polynucleotide sequences shown are to be understood to be
illustrative, rather than limiting. One of skill in the art can
readily determine the polynucleotide sequences that would encode a
given polypeptide and can readily generate coding sequences
suitable for expression in a given expression system, such as by
adapting the polynucleotide sequences provided and/or by generating
them de novo, and can readily produce codon-optimized expression
sequences, for example as described in published U.S. Patent
Application No. 2008/0120732 or using other methods known in the
art.
[0454] In another embodiment of the invention, polynucleotides of
the invention further comprise, the following polynucleotide
sequence encoding the kappa constant light chain sequence of SEQ ID
NO: 586 which is encoded by the polynucleotide sequence of SEQ ID
NO: 587.
[0455] In another embodiment of the invention, polynucleotides of
the invention further comprise, the following polynucleotide
sequence encoding the gamma-1 constant heavy chain polypeptide
sequence of SEQ ID NO: 588 which is encoded by the polynucleotide
sequence of SEQ ID NO: 589.
[0456] In one embodiment, the invention is directed to an isolated
polynucleotide comprising a polynucleotide encoding an anti-IL-6
V.sub.H antibody amino acid sequence selected from SEQ ID NO: 3,
18, 19, 652, 656, 657, 658, 661, 664, 665, 704, and 708 or encoding
a variant thereof wherein at least one framework residue (FR
residue) has been substituted with an amino acid present at the
corresponding position in a rabbit anti-IL-6 antibody V.sub.H
polypeptide or a conservative amino acid substitution. In addition,
the invention specifically encompasses humanized anti-IL-6
antibodies or humanized antibody binding fragments or variants
thereof and nucleic acid sequences encoding the foregoing
comprising the humanized variable heavy chain and/or light chain
polypeptides depicted in the sequences contained in FIG. 1-5, or
those identified in Table 4, or variants thereof wherein at least
one framework or CDR residues may be modified. Preferably, if any
modifications are introduced they will not affect adversely the
binding affinity of the resulting anti-IL-6 antibody or fragment or
variant thereof.
[0457] In another embodiment, the invention is directed to an
isolated polynucleotide comprising the polynucleotide sequence
encoding an anti-IL-6 V.sub.L antibody amino acid sequence selected
from SEQ ID NO: 2, 20, 647, 651, 660, 666, 699, 702, 706, and 709
or encoding a variant thereof wherein at least one framework
residue (FR residue) has been substituted with an amino acid
present at the corresponding position in a rabbit anti-IL-6
antibody V.sub.L polypeptide or a conservative amino acid
substitution.
[0458] In yet another embodiment, the invention is directed to at
least one heterologous polynucleotides comprising a sequence
encoding the polypeptides set forth in SEQ ID NO: 2 and SEQ ID NO:
3; SEQ ID NO: 2 and SEQ ID NO: 18; SEQ ID NO: 2 and SEQ ID NO: 19;
SEQ ID NO: 20 and SEQ ID NO: 3; SEQ ID NO: 20 and SEQ ID NO: 18; or
SEQ ID NO: 20 and SEQ ID NO: 19.
[0459] In another embodiment, the invention is directed to an
isolated polynucleotide that expresses a polypeptide containing at
least one CDR polypeptide derived from an anti-IL-6 antibody
wherein said expressed polypeptide alone specifically binds IL-6 or
specifically binds IL-6 when expressed in association with another
polynucleotide sequence that expresses a polypeptide containing at
least one CDR polypeptide derived from an anti-IL-6 antibody
wherein said at least one CDR is selected from those contained in
the V.sub.L or V.sub.H polypeptides set forth in SEQ ID NO: 3, 18,
19, 652, 656, 657, 658, 661, 664, 665, 704, 708, 2, 20, 647, 651,
660, 666, 699, 702, 706, or 709.
[0460] Host cells and vectors comprising said polynucleotides are
also contemplated.
[0461] In another specific embodiment the invention covers nucleic
acid constructs containing any of the foregoing nucleic acid
sequences and combinations thereof as well as recombinant cells
containing these nucleic acid sequences and constructs containing
wherein these nucleic acid sequences or constructs may be
extrachromosomal or integrated into the host cell genome.
[0462] The invention further contemplates vectors comprising the
polynucleotide sequences encoding the variable heavy and light
chain polypeptide sequences, as well as the individual
complementarity determining regions (CDRs, or hypervariable
regions) set forth herein, as well as host cells comprising said
sequences. In one embodiment of the invention, the host cell is a
yeast cell. In another embodiment of the invention, the yeast host
cell belongs to the genus Pichia.
[0463] In some instances, more than one exemplary polynucleotide
encoding a given polypeptide sequence is provided, as summarized in
Table 5.
TABLE-US-00006 TABLE 5 Multiple exemplary polynucleotides encoding
particular polypeptides. Polypeptide SEQ ID NO Exemplary coding SEQ
ID NOs 4 12, 111, 694 5 13, 112,389, 501 6 14, 113, 695 9 17, 116,
697 39 47, 260 40 48, 261 60 68, 265 72 80, 325, 565, 581 89 97,
134, 166 103 12, 111, 694 104 13, 112, 389, 501 105 14, 113, 695
108 17, 116, 697 126 97, 134, 166 158 97, 134, 166 190 198, 214 191
199, 215 205 213, 469, 485 206 198, 214 207 199, 215 252 47, 260
253 48, 261 257 68, 265 317 80, 325, 565, 581 333 341, 533 381 13,
112, 389, 501 415 423, 439 431 423, 439 461 213, 469, 485 475 483,
499 476 484, 500 477 213, 469, 485 478 486, 502 479 487, 503 480
488, 504 481 489, 505 491 483, 499 492 484, 500 493 13, 112, 389,
501 494 486, 502 495 487, 503 496 488, 504 497 489, 505 525 341,
533 545 553, 585 554 562, 578 556 564, 580 557 80, 325, 565, 581
558 566, 582 570 562, 578 572 564, 580 573 80, 325, 565, 581 574
566, 582 577 553, 585
[0464] In some instances, multiple sequence identifiers refer to
the same polypeptide or polynucleotide sequence, as summarized in
Table 6. References to these sequence identifiers are understood to
be interchangeable, except where context indicates otherwise.
TABLE-US-00007 TABLE 6 Repeated sequences. Each cell lists a group
of repeated sequences included in the sequence listing. SEQ ID NOs
of repeated sequences 4, 103 5, 104, 381, 493 6, 105 9, 108 12, 111
13, 112 14, 113 17, 116 39, 252 40, 253 48, 261 60, 257 68, 265 72,
317, 557, 573 80, 325, 565, 581 89, 126, 158 97, 134, 166 120, 659
190, 206 191, 207 198, 214 199, 215 205, 461, 477 213, 469 333, 525
415, 431 423, 439 475, 491 476, 492 478, 494 479, 495 480, 496 481,
497 483, 499 484, 500 486, 502 487, 503 488, 504 489, 505 545, 577
554, 570 556, 572 558, 574 562, 578 564, 580 566, 582
[0465] Certain exemplary embodiments include polynucleotides that
hybridize under moderately or highly stringent hybridization
conditions to a polynucleotide having one of the exemplary coding
sequences recited in Table 4, and also include polynucleotides that
hybridize under moderately or highly stringent hybridization
conditions to a polynucleotide encoding the same polypeptide as a
polynucleotide having one of the exemplary coding sequences recited
in Table 4, or polypeptide encoded by any of the foregoing
polynucleotides.
[0466] The phrase "high stringency hybridization conditions" refers
to conditions under which a probe will hybridize to its target
subsequence, typically in a complex mixture of nucleic acid, but to
no other sequences. High stringency conditions are sequence
dependent and will be different in different circumstances. Longer
sequences hybridize specifically at higher temperatures. An
extensive guide to the hybridization of nucleic acids is found in
Tijssen, Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Probes, "Overview of principles
of hybridization and the strategy of nucleic acid assays" (1993).
Generally, high stringency conditions are selected to be about
5-10.degree. C. lower than the thermal melting point (T.sub.m) for
the specific sequence at a defined ionic strength pH. The T.sub.m
is the temperature (under defined ionic strength, pH, and nucleic
concentration) at which 50% of the probes complementary to the
target hybridize to the target sequence at equilibrium (as the
target sequences are present in excess, at T.sub.m, 50% of the
probes are occupied at equilibrium). High stringency conditions
will be those in which the salt concentration is less than about
1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion
concentration (or other salts) at pH 7.0 to 8.3 and the temperature
is at least about 30.degree. C. for short probes (e.g., 10 to 50
nucleotides) and at least about 60.degree. C. for long probes
(e.g., greater than 50 nucleotides). High stringency conditions may
also be achieved with the addition of destabilizing agents such as
formamide. For selective or specific hybridization, a positive
signal is at least two times background, optionally 10 times
background hybridization. Exemplary high stringency hybridization
conditions can be as following: 50% formamide, 5.times.SSC, and 1%
SDS, incubating at 42.degree. C., or, 5.times.SSC, 1% SDS,
incubating at 65.degree. C., with wash in 0.2.times.SSC, and 0.1%
SDS at 65.degree. C. Such hybridizations and wash steps can be
carried out for, e.g., 1, 2, 5, 10, 15, 30, 60; or more
minutes.
[0467] Nucleic acids that do not hybridize to each other under high
stringency conditions are still substantially related if the
polypeptides that they encode are substantially related. This
occurs, for example, when a copy of a nucleic acid is created using
the maximum codon degeneracy permitted by the genetic code. In such
cases, the nucleic acids typically hybridize under moderate
stringency hybridization conditions. Exemplary "moderate stringency
hybridization conditions" include a hybridization in a buffer of
40% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
1.times.SSC at 45.degree. C. Such hybridizations and wash steps can
be carried out for, e.g., 1, 2, 5, 10, 15, 30, 60, or more minutes.
A positive hybridization is at least twice background. Those of
ordinary skill will readily recognize that alternative
hybridization and wash conditions can be utilized to provide
conditions of similar stringency.
[0468] Expression vectors for use in the methods of the invention
will further include yeast specific sequences, including a
selectable auxotrophic or drug marker for identifying transformed
yeast strains. A drug marker may further be used to amplify copy
number of the vector in a yeast host cell.
[0469] The polypeptide coding sequence of interest is operably
linked to transcriptional and translational regulatory sequences
that provide for expression of the polypeptide in yeast cells.
These vector components may include, but are not limited to, at
least one of the following: an enhancer element, a promoter, and a
transcription termination sequence. Sequences for the secretion of
the polypeptide may also be included, e.g. a signal sequence. A
yeast origin of replication is optional, as expression vectors are
often integrated into the yeast genome.
[0470] In one embodiment of the invention, the polypeptide of
interest is operably linked, or fused, to sequences providing for
optimized secretion of the polypeptide from yeast diploid
cells.
[0471] Nucleic acids are "operably linked" when placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a signal sequence is operably linked to DNA for a
polypeptide if it is expressed as a preprotein that participates in
the secretion of the polypeptide; a promoter or enhancer is
operably linked to a coding sequence if it affects the
transcription of the sequence. Generally, "operably linked" means
that the DNA sequences being linked are contiguous, and, in the
case of a secretory leader, contiguous and in reading frame.
However, enhancers do not have to be contiguous. Linking is
accomplished by ligation at convenient restriction sites or
alternatively via a PCR/recombination method familiar to those
skilled in the art (Gateway.RTM. Technology; Invitrogen, Carlsbad
Calif.). If such sites do not exist, the synthetic oligonucleotide
adapters or linkers are used in accordance with conventional
practice.
[0472] Promoters are untranslated sequences located upstream (5')
to the start codon of a structural gene (generally within about 100
to 1000 bp) that control the transcription and translation of
particular nucleic acid sequences to which they are operably
linked. Such promoters fall into several classes: inducible,
constitutive, and repressible promoters (that increase levels of
transcription in response to absence of a repressor). Inducible
promoters may initiate increased levels of transcription from DNA
under their control in response to some change in culture
conditions, e.g., the presence or absence of a nutrient or a change
in temperature.
[0473] The yeast promoter fragment may also serve as the site for
homologous recombination and integration of the expression vector
into the same site in the yeast genome; alternatively a selectable
marker is used as the site for homologous recombination. Pichia
transformation is described in Cregg, et al. (1985) Mol. Cell.
Biol. 5:3376-3385.
[0474] Examples of suitable promoters from Pichia include the AOX1
and promoter (Cregg, et al. (1989) Mol. Cell. Biol. 9:1316-1323);
ICL1 promoter (Menendez, et al. (2003) Yeast 20(13):1097-108);
glyceraldehyde-3-phosphate dehydrogenase promoter (GAP) (Waterham,
et al. (1997) Gene 186(1):37-44); and FLD1 promoter (Shen, et al.
(1998) Gene 216(1):93-102). The GAP promoter is a strong
constitutive promoter and the AOX and FLD1 promoters are
inducible.
[0475] Other yeast promoters include ADH1, alcohol dehydrogenase
II, GAL4, PHO3, PHO5, Pyk, and chimeric promoters derived
therefrom. Additionally, non-yeast promoters may be used in the
invention such as mammalian, insect, plant, reptile, amphibian,
viral, and avian promoters. Most typically the promoter will
comprise a mammalian promoter (potentially endogenous to the
expressed genes) or will comprise a yeast or viral promoter that
provides for efficient transcription in yeast systems.
[0476] The polypeptides of interest may be produced recombinantly
not only directly, but also as a fusion polypeptide with a
heterologous polypeptide, e.g. a signal sequence or other
polypeptide having a specific cleavage site at the N-terminus of
the mature protein or polypeptide. In general, the signal sequence
may be a component of the vector, or it may be a part of the
polypeptide coding sequence that is inserted into the vector. The
heterologous signal sequence selected preferably is one that is
recognized and processed through one of the standard pathways
available within the host cell. The S. cerevisiae alpha factor
pre-pro signal has proven effective in the secretion of a variety
of recombinant proteins from P. pastoris. Other yeast signal
sequences include the alpha mating factor signal sequence, the
invertase signal sequence, and signal sequences derived from other
secreted yeast polypeptides. Additionally, these signal peptide
sequences may be engineered to provide for enhanced secretion in
diploid yeast expression systems. Other secretion signals of
interest also include mammalian signal sequences, which may be
heterologous to the protein being secreted, or may be a native
sequence for the protein being secreted. Signal sequences include
pre-peptide sequences, and in some instances may include propeptide
sequences. Many such signal sequences are known in the art,
including the signal sequences found on immunoglobulin chains,
e.g., K28 preprotoxin sequence, PHA-E, FACE, human MCP-1, human
serum albumin signal sequences, human Ig heavy chain, human Ig
light chain, and the like. See Hashimoto, et al. (1998) Protein Eng
11(2): 75; and Kobayashi, et al. (1998) Therapeutic Apheresis 2(4):
257.
[0477] Transcription may be increased by inserting a
transcriptional activator sequence into the vector. These
activators are cis-acting elements of DNA, usually about from 10 to
300 bp, which act on a promoter to increase its transcription.
Transcriptional enhancers are relatively orientation and position
independent, having been found 5' and 3' to the transcription unit,
within an intron, as well as within the coding sequence itself. The
enhancer may be spliced into the expression vector at a position 5'
or 3' to the coding sequence, but is preferably located at a site
5' from the promoter.
[0478] Expression vectors used in eukaryotic host cells may also
contain sequences necessary for the termination of transcription
and for stabilizing the mRNA. Such sequences are commonly available
from 3' to the translation termination codon, in untranslated
regions of eukaryotic or viral DNAs or cDNAs. These regions contain
nucleotide segments transcribed as polyadenylated fragments in the
untranslated portion of the mRNA.
[0479] Construction of suitable vectors containing at least one of
the above-listed components employs standard ligation techniques or
PCR/recombination methods. Isolated plasmids or DNA fragments are
cleaved, tailored, and re-ligated in the form desired to generate
the plasmids required or via recombination methods. For analysis to
confirm correct sequences in plasmids constructed, the ligation
mixtures are used to transform host cells, and successful
transformants selected by antibiotic resistance (e.g. ampicillin or
Zeocin.RTM. (phleomycin)) where appropriate. Plasmids from the
transformants are prepared, analyzed by restriction endonuclease
digestion and/or sequenced.
[0480] As an alternative to restriction and ligation of fragments,
recombination methods based on att sites and recombination enzymes
may be used to insert DNA sequences into a vector. Such methods are
described, for example, by Landy (1989) Ann. Rev. Biochem. 58:
913-949; and are known to those of skill in the art. Such methods
utilize intermolecular DNA recombination that is mediated by a
mixture of lambda and E. coli-encoded recombination proteins.
Recombination occurs between specific attachment (att) sites on the
interacting DNA molecules. For a description of att sites See
Weisberg and Landy (1983) Site-Specific Recombination in Phage
Lambda Cold Spring Harbor, N.Y.:Cold Spring Harbor Press), pages
211-250. The DNA segments flanking the recombination sites are
switched, such that after recombination, the att sites are hybrid
sequences comprised of sequences donated by each parental vector.
The recombination can occur between DNAs of any topology.
[0481] Att sites may be introduced into a sequence of interest by
ligating the sequence of interest into an appropriate vector;
generating a PCR product containing att B sites through the use of
specific primers; generating a cDNA library cloned into an
appropriate vector containing att sites.
[0482] The expression host may be further modified by the
introduction of sequences encoding at least one enzymes that
enhance folding and disulfide bond formation, i.e. foldases,
chaperonins, Such sequences may be constitutively or inducibly
expressed in the yeast host cell, using vectors, markers, are known
in the art. Preferably the sequences, including transcriptional
regulatory elements sufficient for the desired pattern of
expression, are stably integrated in the yeast genome through a
targeted methodology.
[0483] For example, the eukaryotic PDI is not only an efficient
catalyst of protein cysteine oxidation and disulfide bond
isomerization, but also exhibits chaperone activity. Co-expression
of PDI can facilitate the production of active proteins having
multiple disulfide bonds. Also of interest is the expression of BIP
(immunoglobulin heavy chain binding protein); cyclophilin; and the
like. In one embodiment of the invention, each of the haploid
parental strains expresses a distinct folding enzyme, e.g. one
strain may express BIP, and the other strain may express PDI or
combinations thereof.
[0484] Vectors are used to introduce a foreign substance, such as
DNA, RNA or protein, into an organism or host cell. Typical vectors
include recombinant viruses (for polynucleotides) and liposomes or
other lipid aggregates (for polypeptides and/or polynucleotides). A
"DNA vector" is a replicon, such as plasmid, phage or cosmid, to
which another polynucleotide segment may be attached so as to bring
about the replication of the attached segment. An "expression
vector" is a DNA vector which contains regulatory sequences which
will direct polypeptide synthesis by an appropriate host cell. This
usually means a promoter to bind RNA polymerase and initiate
transcription of mRNA, as well as ribosome binding sites and
initiation signals to direct translation of the mRNA into a
polypeptide(s). Incorporation of a polynucleotide sequence into an
expression vector at the proper site and in correct reading frame,
followed by transformation of an appropriate host cell by the
vector, enables the production of a polypeptide encoded by said
polynucleotide sequence. Exemplary expression vectors and
techniques for their use are described in the following
publications: Old, et al. (1989) Principles of Gene Manipulation:
An Introduction to Genetic Engineering, Blackwell Scientific
Publications [4.sup.th Ed.]; Sambrook, et al. (1989) Molecular
Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor
Laboratory Press; Sambrook, et al. (2001) Molecular Cloning: A
Laboratory Manual [3.sup.rd Ed.] Cold Spring Harbor Laboratory
Press; Gorman, "High Efficiency Gene Transfer into Mammalian
Cells," in DNA Cloning, Volume II, Glover, D. M., Ed., IRL Press,
Washington, D.C., pages 143-190.
[0485] For example, a liposomes or other lipid aggregate may
comprise a lipid such as phosphatidylcholines (lecithins) (PC),
phosphatidylethanolamines (PE), lysolecithins,
lysophosphatidylethanolamines, phosphatidylserines (PS),
phosphatidylglycerols (PG), phosphatidylinositol (PI),
sphingomyelins, cardiolipin, phosphatidic acids (PA), fatty acids,
gangliosides, glucolipids, glycolipids, mono-, di or triglycerides,
ceramides, cerebrosides and combinations thereof; a cationic lipid
(or other cationic amphiphile) such as
1,2-dioleyloxy-3-(trimethylamino) propane (DOTAP);
N-cholesteryloxycarbaryl-3,7,12-triazapentadecane-1,15-diamine
(CTAP);
N-[1-(2,3,-ditetradecyloxy)propyl]-N,N-dimethyl-N-hydroxyethylamm-
onium bromide (DMRIE);
N-[1-(2,3,-dioleyloxy)propyl]-N,N-dimethyl-N-hydroxy ethylammonium
bromide (DORIE); N-[1-(2,3-dioleyloxy)
propyl]-N,N,N-trimethylammonium chloride (DOTMA); 3 beta
[N--(N',N'-dimethylaminoethane)carbamoly] cholesterol (DC-Choi);
and dimethyldioctadecylammonium (DDAB); dioleoylphosphatidyl
ethanolamine (DOPE), cholesterol-containing DOPC; and combinations
thereof; and/or a hydrophilic polymer such as polyvinylpyrrolidone,
polyvinylmethylether, polymethyloxazoline, polyethyloxazoline,
polyhydroxypropyloxazoline, polyhydroxypropylmethacrylamide,
polymethacrylamide, polydimethylacrylamide,
polyhydroxypropylmethacrylate, polyhydroxyethylacrylate,
hydroxymethylcellulose, hydroxyethylcellulose, polyethyleneglycol,
polyaspartamide and combinations thereof. Other suitable cationic
lipids are described in Miller (1998) Angewandte Chemie
International Edition 37(13-14): 1768-1785 and Cooper, et al.
(1998) Chem. Eur. J. 4(1): 137-151. Liposomes can be crosslinked,
partially crosslinked, or free from crosslinking. Crosslinked
liposomes can include crosslinked as well as non-crosslinked
components. Suitable cationic liposomes or cytofectins are
commercially available and can also be prepared as described in
Sipkins, et al. (1998) Nature Medicine 4(5): 623-626 or as
described in Miller, supra. Exemplary liposomes include a
polymerizable zwitterionic or neutral lipid, a polymerizable
integrin targeting lipid and a polymerizable cationic lipid
suitable for binding a nucleic acid. Liposomes can optionally
include peptides that provide increased efficiency, for example as
described in U.S. Pat. No. 7,297,759. Additional exemplary
liposomes and other lipid aggregates are described in U.S. Pat. No.
7,166,298.
Methods of Producing Antibodies and Fragments thereof
[0486] The invention is also directed to the production of the
antibodies described herein or fragments thereof. Recombinant
polypeptides corresponding to the antibodies described herein or
fragments thereof are secreted from polyploidal, preferably diploid
or tetraploid strains of mating competent yeast. In an exemplary
embodiment, the invention is directed to methods for producing
these recombinant polypeptides in secreted form for prolonged
periods using cultures comprising polyploid yeast, i.e., at least
several days to a week, more preferably at least a month or several
months, and even more preferably at least 6 months to a year or
longer. These polyploid yeast cultures will express at least 10-25
mg/liter of the polypeptide, more preferably at least 50-250
mg/liter, still more preferably at least 500-1000 mg/liter, and
most preferably a gram per liter or more of the recombinant
polypeptide(s).
[0487] In one embodiment of the invention a pair of genetically
marked yeast haploid cells are transformed with expression vectors
comprising subunits of a desired heteromultimeric protein. One
haploid cell comprises a first expression vector, and a second
haploid cell comprises a second expression vector. In another
embodiment diploid yeast cells will be transformed with at least
one expression vectors that provide for the expression and
secretion of at least one of the recombinant polypeptides. In still
another embodiment a single haploid cell may be transformed with at
least one vectors and used to produce a polyploidal yeast by fusion
or mating strategies. In yet another embodiment a diploid yeast
culture may be transformed with at least one vectors providing for
the expression and secretion of a desired polypeptide or
polypeptides. These vectors may comprise vectors e.g., linearized
plasmids or other linear DNA products that integrate into the yeast
cell's genome randomly, through homologous recombination, or using
a recombinase such as Cre/Lox or Flp/Frt. Optionally, additional
expression vectors may be introduced into the haploid or diploid
cells; or the first or second expression vectors may comprise
additional coding sequences; for the synthesis of heterotrimers;
heterotetramers. The expression levels of the non-identical
polypeptides may be individually calibrated, and adjusted through
appropriate selection, vector copy number, promoter strength and/or
induction and the like. The transformed haploid cells are
genetically crossed or fused. The resulting diploid or tetraploid
strains are utilized to produce and secrete fully assembled and
biologically functional proteins, humanized antibodies described
herein or fragments thereof.
[0488] The use of diploid or tetraploid cells for protein
production provides for unexpected benefits. The cells can be grown
for production purposes, i.e. scaled up, and for extended periods
of time, in conditions that can be deleterious to the growth of
haploid cells, which conditions may include high cell density;
growth in minimal media; growth at low temperatures; stable growth
in the absence of selective pressure; and which may provide for
maintenance of heterologous gene sequence integrity and maintenance
of high level expression over time. Without wishing to be bound
thereby, the inventors theorize that these benefits may arise, at
least in part, from the creation of diploid strains from two
distinct parental haploid strains. Such haploid strains can
comprise numerous minor autotrophic mutations, which mutations are
complemented in the diploid or tetraploid, enabling growth and
enhanced production under highly selective conditions.
[0489] Transformed mating competent haploid yeast cells provide a
genetic method that enables subunit pairing of a desired protein.
Haploid yeast strains are transformed with each of two expression
vectors, a first vector to direct the synthesis of one polypeptide
chain and a second vector to direct the synthesis of a second,
non-identical polypeptide chain. The two haploid strains are mated
to provide a diploid host where optimized target protein production
can be obtained.
[0490] Optionally, additional non-identical coding sequence(s) are
provided. Such sequences may be present on additional expression
vectors or in the first or the second expression vectors. As is
known in the art, multiple coding sequences may be independently
expressed from individual promoters; or may be coordinately
expressed through the inclusion of an "internal ribosome entry
site" or "IRES", which is an element that promotes direct internal
ribosome entry to the initiation codon, such as ATG, of a cistron
(a protein encoding region), thereby leading to the cap-independent
translation of the gene. IRES elements functional in yeast are
described by Thompson, et al. (2001) PNAS 98: 12866-12868.
[0491] In one embodiment of the invention, antibody sequences are
produced in combination with a secretory J chain, which provides
for enhanced stability of IgA. See U.S. Pat. Nos. 5,959,177 and
5,202,422.
[0492] In a preferred embodiment the two haploid yeast strains are
each auxotrophic, and require supplementation of media for growth
of the haploid cells. The pair of auxotrophs are complementary,
such that the diploid product will grow in the absence of the
supplements required for the haploid cells. Many such genetic
markers are known in yeast, including requirements for amino acids
(e.g. met, lys, his, arg), nucleosides (e.g. ura3, ade1); and the
like. Amino acid markers may be preferred for the methods of the
invention. Alternatively diploid cells which contain the desired
vectors can be selected by other means, e.g., by use of other
markers, such as green fluorescent protein, antibiotic resistance
genes, various dominant selectable markers, and the like.
[0493] Two transformed haploid cells may be genetically crossed and
diploid strains arising from this mating event selected by their
hybrid nutritional requirements and/or antibiotic resistance
spectra. Alternatively, populations of the two transformed haploid
strains are spheroplasted and fused, and diploid progeny
regenerated and selected. By either method, diploid strains can be
identified and selectively grown based on their ability to grow in
different media than their parents. For example, the diploid cells
may be grown in minimal medium that may include antibiotics. The
diploid synthesis strategy has certain advantages. Diploid strains
have the potential to produce enhanced levels of heterologous
protein through broader complementation to underlying mutations,
which may impact the production and/or secretion of recombinant
protein. Furthermore, once stable strains have been obtained, any
antibiotics used to select those strains do not necessarily need to
be continuously present in the growth media.
[0494] As noted above, in some embodiments a haploid yeast may be
transformed with a single or multiple vectors and mated or fused
with a non-transformed cell to produce a diploid cell containing
the vector or vectors. In other embodiments, a diploid yeast cell
may be transformed with at least one vectors that provide for the
expression and secretion of a desired heterologous polypeptide by
the diploid yeast cell.
[0495] In one embodiment of the invention, two haploid strains are
transformed with a library of polypeptides, e.g. a library of
antibody heavy or light chains. Transformed haploid cells that
synthesize the polypeptides are mated with the complementary
haploid cells. The resulting diploid cells are screened for
functional protein. The diploid cells provide a means of rapidly,
conveniently and inexpensively bringing together a large number of
combinations of polypeptides for functional testing. This
technology is especially applicable for the generation of
heterodimeric protein products, where optimized subunit synthesis
levels are critical for functional protein expression and
secretion.
[0496] In another embodiment of the invention, the expression level
ratio of the two subunits is regulated in order to maximize product
generation. Heterodimer subunit protein levels have been shown
previously to impact the final product generation. Simmons (2002) J
Immunol Methods. 263(1-2): 133-47. Regulation can be achieved prior
to the mating step by selection for a marker present on the
expression vector. By stably increasing the copy number of the
vector, the expression level can be increased. In some cases, it
may be desirable to increase the level of one chain relative to the
other, so as to reach a balanced proportion between the subunits of
the polypeptide. Antibiotic resistance markers are useful for this
purpose, e.g. Zeocin.RTM. (phleomycin) resistance marker, G418
resistance and provide a means of enrichment for strains that
contain multiple integrated copies of an expression vector in a
strain by selecting for transformants that are resistant to higher
levels of Zeocin.RTM. (phleomycin) or G418. The proper ratio (e.g.
1:1; 1:2) of the subunit genes may be important for efficient
protein production. Even when the same promoter is used to
transcribe both subunits, many other factors contribute to the
final level of protein expressed and therefore, it can be useful to
increase the number of copies of one encoded gene relative to the
other. Alternatively, diploid strains that produce higher levels of
a polypeptide, relative to single copy vector strains, are created
by mating two haploid strains, both of which have multiple copies
of the expression vectors.
[0497] Host cells are transformed with the above-described
expression vectors, mated to form diploid strains, and cultured in
conventional nutrient media modified as appropriate for inducing
promoters, selecting transformants or amplifying the genes encoding
the desired sequences. A number of minimal media suitable for the
growth of yeast are known in the art. Any of these media may be
supplemented as necessary with salts (such as sodium chloride,
calcium, magnesium, and phosphate), buffers (such as phosphate,
HEPES), nucleosides (such as adenosine and thymidine), antibiotics,
trace elements, and glucose or an equivalent energy source. Any
other necessary supplements may also be included at appropriate
concentrations that would be known to those skilled in the art. The
culture conditions, such as temperature, pH and the like, are those
previously used with the host cell selected for expression, and
will be apparent to the ordinarily skilled artisan.
[0498] Secreted proteins are recovered from the culture medium. A
protease inhibitor, such as phenyl methyl sulfonyl fluoride (PMSF)
may be useful to inhibit proteolytic degradation during
purification, and antibiotics may be included to prevent the growth
of adventitious contaminants. The composition may be concentrated,
filtered, dialyzed, using methods known in the art.
[0499] The diploid cells of the invention are grown for production
purposes. Such production purposes desirably include growth in
minimal media, which media lacks pre-formed amino acids and other
complex biomolecules, e.g., media comprising ammonia as a nitrogen
source, and glucose as an energy and carbon source, and salts as a
source of phosphate, calcium and the like. Preferably such
production media lacks selective agents such as antibiotics, amino
acids, purines, pyrimidines The diploid cells can be grown to high
cell density, for example at least about 50 g/L; more usually at
least about 100 g/L; and may be at least about 300, about 400,
about 500 g/L or more.
[0500] In one embodiment of the invention, the growth of the
subject cells for production purposes is performed at low
temperatures, which temperatures may be lowered during log phase,
during stationary phase, or both. The term "low temperature" refers
to temperatures of at least about 15.degree. C., more usually at
least about 17.degree. C., and may be about 20.degree. C., and is
usually not more than about 25.degree. C., more usually not more
than about 22.degree. C. In another embodiment of the invention,
the low temperature is usually not more than about 28.degree. C.
Growth temperature can impact the production of full-length
secreted proteins in production cultures, and decreasing the
culture growth temperature can strongly enhance the intact product
yield. The decreased temperature appears to assist intracellular
trafficking through the folding and post-translational processing
pathways used by the host to generate the target product, along
with reduction of cellular protease degradation.
[0501] The methods of the invention provide for expression of
secreted, active protein, preferably a mammalian protein. In one
embodiment, secreted, "active antibodies", as used herein, refers
to a correctly folded multimer of at least two properly paired
chains, which accurately binds to its cognate antigen. Expression
levels of active protein are usually at least about 10-50 mg/liter
culture, more usually at least about 100 mg/liter, preferably at
least about 500 mg/liter, and may be 1000 mg/liter or more.
[0502] The methods of the invention can provide for increased
stability of the host and heterologous coding sequences during
production. The stability is evidenced, for example, by maintenance
of high levels of expression of time, where the starting level of
expression is decreased by not more than about 20%, usually not
more than 10%, and may be decreased by not more than about 5% over
about 20 doublings, 50 doublings, 100 doublings, or more.
[0503] The strain stability also provides for maintenance of
heterologous gene sequence integrity over time, where the sequence
of the active coding sequence and requisite transcriptional
regulatory elements are maintained in at least about 99% of the
diploid cells, usually in at least about 99.9% of the diploid
cells, and preferably in at least about 99.99% of the diploid cells
over about 20 doublings, 50 doublings, 100 doublings, or more.
Preferably, substantially all of the diploid cells maintain the
sequence of the active coding sequence and requisite
transcriptional regulatory elements.
[0504] Other methods of producing antibodies are well known to
those of ordinary skill in the art. For example, methods of
producing chimeric antibodies are now well known in the art. See,
e.g., U.S. Pat. No. 4,816,567; Morrison, et al. (1984) PNAS USA 81:
8651-55; Neuberger, et al. (1985) Nature 314: 268-270; Boulianne,
et al. (1984) Nature 312: 643-46.
[0505] Likewise, other methods of producing humanized antibodies
are now well known in the art. See, e.g., U.S. Pat. Nos. 5,225,539;
5,530,101; 5,585,089; 5,693,762; 6,054,297; 6,180,370; 6,407,213;
6,548,640; 6,632,927; and U.S. Pat. No. 6,639,055; Jones, et al.
(1986) Nature 321: 522-525; Reichmann, et al. (1988) Nature 332:
323-327; Verhoeyen, et al. (1988) Science 239: 1534-36.
[0506] Antibody polypeptides of the invention having IL-6 binding
specificity may also be produced by constructing, using
conventional techniques well known to those of ordinary skill in
the art, an expression vector containing an operon and a DNA
sequence encoding an antibody heavy chain in which the DNA sequence
encoding the CDRs required for antibody specificity is derived from
a non-human cell source, preferably a rabbit B-cell source, while
the DNA sequence encoding the remaining parts of the antibody chain
is derived from a human cell source.
[0507] A second expression vector is produced using the same
conventional means well known to those of ordinary skill in the
art, said expression vector containing an operon and a DNA sequence
encoding an antibody light chain in which the DNA sequence encoding
the CDRs required for antibody specificity is derived from a
non-human cell source, preferably a rabbit B-cell source, while the
DNA sequence encoding the remaining parts of the antibody chain is
derived from a human cell source.
[0508] The expression vectors are transfected into a host cell by
convention techniques well known to those of ordinary skill in the
art to produce a transfected host cell, said transfected host cell
cultured by conventional techniques well known to those of ordinary
skill in the art to produce said antibody polypeptides.
[0509] The host cell may be co-transfected with the two expression
vectors described above, the first expression vector containing DNA
encoding an operon and a light chain-derived polypeptide and the
second vector containing DNA encoding an operon and a heavy
chain-derived polypeptide. The two vectors contain different
selectable markers, but preferably achieve substantially equal
expression of the heavy and light chain polypeptides.
Alternatively, a single vector may be used, the vector including
DNA encoding both the heavy and light chain polypeptides. The
coding sequences for the heavy and light chains may comprise
cDNA.
[0510] The host cells used to express the antibody polypeptides may
be either a bacterial cell such as E. coli, or a eukaryotic cell.
In a particularly preferred embodiment of the invention, a
mammalian cell of a well-defined type for this purpose, such as a
myeloma cell or a Chinese hamster ovary (CHO) cell line may be
used.
[0511] The general methods by which the vectors may be constructed,
transfection methods required to produce the host cell and
culturing methods required to produce the antibody polypeptides
from said host cells all include conventional techniques. Although
preferably the cell line used to produce the antibody is a
mammalian cell line, any other suitable cell line, such as a
bacterial cell line such as an E. coli-derived bacterial strain, or
a yeast cell line, may alternatively be used.
[0512] Similarly, once produced the antibody polypeptides may be
purified according to standard procedures in the art, such as for
example cross-flow filtration, ammonium sulphate precipitation,
affinity column chromatography and the like.
[0513] The antibody polypeptides described herein may also be used
for the design and synthesis of either peptide or non-peptide
mimetics that would be useful for the same therapeutic applications
as the antibody polypeptides of the invention. See, e.g., Saragobi
et al. (1991) Science 253: 792-795.
B-Cell Screening and Isolation
[0514] The present invention provides methods of isolating a clonal
population of antigen-specific B cells that may be used for
isolating at least one antigen-specific cell. As described and
exemplified infra, these methods contain a series of culture and
selection steps that can be used separately, in combination,
sequentially, repetitively, or periodically. Preferably, these
methods are used for isolating at least one antigen-specific cell,
which can be used to produce a monoclonal antibody, which is
specific to a desired antigen, or a nucleic acid sequence
corresponding to such an antibody.
[0515] The present invention provides a method comprising the steps
of: [0516] (a) preparing a cell population comprising at least one
antigen-specific B cell; [0517] (b) enriching the cell population,
e.g., by chromatography, to form an enriched cell population
comprising at least one antigen-specific B cell; [0518] (c)
isolating a single B cell from the enriched B cell population; and
[0519] (d) determining whether the single B cell produces an
antibody specific to the antigen.
[0520] The present invention provides an improvement to a method of
isolating a single, antibody-producing B cell, the improvement
comprising enriching a B cell population obtained from a host that
has been immunized or naturally exposed to an antigen, wherein the
enriching step precedes any selection steps, comprises at least one
culturing step, and results in a clonal population of B cells that
produces a single monoclonal antibody specific to said antigen.
[0521] Throughout this application, a "clonal population of B
cells" refers to a population of B cells that only secrete a single
antibody specific to a desired antigen. That is to say that these
cells produce only one type of monoclonal antibody specific to the
desired antigen.
[0522] In the present application, "enriching" a cell population
cells means increasing the frequency of desired cells, typically
antigen-specific cells, contained in a mixed cell population, e.g.,
a B cell-containing isolate derived from a host that is immunized
against a desired antigen. Thus, an enriched cell population
encompasses a cell population having a higher frequency of
antigen-specific cells as a result of an enrichment step, but this
population of cells may contain and produce different
antibodies.
[0523] The general term "cell population" encompasses pre- and a
post-enrichment cell populations, keeping in mind that when
multiple enrichment steps are performed, a cell population can be
both pre- and post-enrichment. For example, in one embodiment, the
present invention provides a method: [0524] (a) harvesting a cell
population from an immunized host to obtain a harvested cell
population; [0525] (b) creating at least one single cell suspension
from the harvested cell population; [0526] (c) enriching at least
one single cell suspension to form a first enriched cell
population; [0527] (d) enriching the first enriched cell population
to form a second enriched cell population; [0528] (e) enriching the
second enriched cell population to form a third enriched cell
population; and [0529] (f) selecting an antibody produced by an
antigen-specific cell of the third enriched cell population.
[0530] Each cell population may be used directly in the next step,
or it can be partially or wholly frozen for long- or short-term
storage or for later steps. Also, cells from a cell population can
be individually suspended to yield single cell suspensions. The
single cell suspension can be enriched, such that a single cell
suspension serves as the pre-enrichment cell population. Then, at
least one antigen-specific single cell suspensions together form
the enriched cell population; the antigen-specific single cell
suspensions can be grouped together, e.g., re-plated for further
analysis and/or antibody production.
[0531] In one embodiment, the present invention provides a method
of enriching a cell population to yield an enriched cell population
having an antigen-specific cell frequency that is about 50% to
about 100%, or increments therein. Preferably, the enriched cell
population has an antigen-specific cell frequency at least about
50%, 60%, 70%, 75%, 80%, 90%, 95%, 99%, or 100%.
[0532] In another embodiment, the present invention provides a
method of enriching a cell population whereby the frequency of
antigen-specific cells is increased by at least about 2-fold,
5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or increments
therein.
[0533] Throughout this application, the term "increment" is used to
define a numerical value in varying degrees of precision, e.g., to
the nearest 10, 1, 0.1, 0.01. The increment can be rounded to any
measurable degree of precision, and the increment need not be
rounded to the same degree of precision on both sides of a range.
For example, the range 1 to 100 or increments therein includes
ranges such as 20 to 80, 5 to 50, and 0.4 to 98. When a range is
open-ended, e.g., a range of less than 100, increments therein
means increments between 100 and the measurable limit. For example,
less than 100 or increments therein means 0 to 100 or increments
therein unless the feature, e.g., temperature, is not limited by
0.
[0534] Antigen-specificity can be measured with respect to any
antigen. The antigen can be any substance to which an antibody can
bind including, but not limited to, peptides, proteins or fragments
thereof; carbohydrates; organic and inorganic molecules; receptors
produced by animal cells, bacterial cells, and viruses; enzymes;
agonists and antagonists of biological pathways; hormones; and
cytokines. Exemplary antigens include, but are not limited to,
IL-2, IL-4, IL-6, IL-10, IL-12, IL-13, IL-18, IFN-.alpha.,
IFN-.gamma., BAFF, CXCL13, IP-10, VEGF, EPO, EGF, HRG, Hepatocyte
Growth Factor (HGF) and Hepcidin. Preferred antigens include IL-6,
IL-13, TNF-.alpha., VEGF-.alpha., Hepatocyte Growth Factor (HGF)
and Hepcidin. In a method utilizing more than one enrichment step,
the antigen used in each enrichment step can be the same as or
different from one another. Multiple enrichment steps with the same
antigen may yield a large and/or diverse population of
antigen-specific cells; multiple enrichment steps with different
antigens may yield an enriched cell population with
cross-specificity to the different antigens.
[0535] Enriching a cell population can be performed by any
cell-selection means known in the art for isolating
antigen-specific cells. For example, a cell population can be
enriched by chromatographic techniques, e.g., Miltenyi bead or
magnetic bead technology. The beads can be directly or indirectly
attached to the antigen of interest. In a preferred embodiment, the
method of enriching a cell population includes at least one
chromatographic enrichment step.
[0536] A cell population can also be enriched by performed by any
antigen-specificity assay technique known in the art, e.g., an
ELISA assay or a halo assay. ELISA assays include, but are not
limited to, selective antigen immobilization (e.g., biotinylated
antigen capture by streptavidin, avidin, or neutravidin coated
plate), non-specific antigen plate coating, and through an antigen
build-up strategy (e.g., selective antigen capture followed by
binding partner addition to generate a heteromeric protein-antigen
complex). The antigen can be directly or indirectly attached to a
solid matrix or support, e.g., a column. A halo assay comprises
contacting the cells with antigen-loaded beads and labeled
anti-host antibody specific to the host used to harvest the B
cells. The label can be, e.g., a fluorophore. In one embodiment, at
least one assay enrichment step is performed on at least one single
cell suspension. In another embodiment, the method of enriching a
cell population includes at least one chromatographic enrichment
step and at least one assay enrichment step.
[0537] Methods of "enriching" a cell population by size or density
are known in the art. See, e.g., U.S. Pat. No. 5,627,052. These
steps can be used in the present method in addition to enriching
the cell population by antigen-specificity.
[0538] The cell populations of the present invention contain at
least one cell capable of recognizing an antigen.
Antigen-recognizing cells include, but are not limited to, B cells,
plasma cells, and progeny thereof. In one embodiment, the present
invention provides a clonal cell population containing a single
type of antigen-specific B-cell, i.e., the cell population produces
a single monoclonal antibody specific to a desired antigen.
[0539] In such embodiment, it is believed that the clonal
antigen-specific population of B cells consists predominantly of
antigen-specific, antibody-secreting cells, which are obtained by
the novel culture and selection protocol provided herein.
Accordingly, the present invention also provides methods for
obtaining an enriched cell population containing at least one
antigen-specific, antibody-secreting cell. In one embodiment, the
present invention provides an enriched cell population containing
about 50% to about 100%, or increments therein, at least about 60%,
70%, 80%, 90%, or 100% of antigen-specific, antibody-secreting
cells.
[0540] In one embodiment, the present invention provides a method
of isolating a single B cell by enriching a cell population
obtained from a host before any selection steps, e.g., selecting a
particular B cell from a cell population and/or selecting an
antibody produced by a particular cell. The enrichment step can be
performed as one, two, three, or more steps. In one embodiment, a
single B cell is isolated from an enriched cell population before
confirming whether the single B cell secretes an antibody with
antigen-specificity and/or a desired property.
[0541] In one embodiment, a method of enriching a cell population
is used in a method for antibody production and/or selection. Thus,
the present invention provides a method comprising enriching a cell
population before selecting an antibody. The method can include the
steps of: preparing a cell population comprising at least one
antigen-specific cell, enriching the cell population by isolating
at least one antigen-specific cell to form an enriched cell
population, and inducing antibody production from at least one
antigen-specific cell. In a preferred embodiment, the enriched cell
population contains more than one antigen-specific cell. In one
embodiment, each antigen-specific cell of the enriched population
is cultured under conditions that yield a clonal antigen-specific B
cell population before isolating an antibody producing cell
therefrom and/or producing an antibody using said B cell, or a
nucleic acid sequence corresponding to such an antibody. In
contrast to prior techniques where antibodies are produced from a
cell population with a low frequency of antigen-specific cells, the
present invention allows antibody selection from among a high
frequency of antigen-specific cells. Because an enrichment step is
used prior to antibody selection, the majority of the cells,
preferably virtually all of the cells, used for antibody production
are antigen-specific. By producing antibodies from a population of
cells with an increased frequency of antigen specificity, the
quantity and variety of antibodies are increased.
[0542] In the antibody selection methods of the present invention,
an antibody is preferably selected after an enrichment step and a
culture step that results in a clonal population of
antigen-specific B cells. The methods can further comprise a step
of sequencing a selected antibody or portions thereof from at least
one isolated, antigen-specific cells. Any method known in the art
for sequencing can be employed and can include sequencing the heavy
chain, light chain, variable region(s), and/or complementarity
determining region(s) (CDR).
[0543] In addition to the enrichment step, the method for antibody
selection can also include at least one steps of screening a cell
population for antigen recognition and/or antibody functionality.
For example, the desired antibodies may have specific structural
features, such as binding to a particular epitope or mimicry of a
particular structure; antagonist or agonist activity; or
neutralizing activity, e.g., inhibiting binding between the antigen
and a ligand. In one embodiment, the antibody functionality screen
is ligand-dependent. Screening for antibody functionality includes,
but is not limited to, an in vitro protein-protein interaction
assay that recreates the natural interaction of the antigen ligand
with recombinant receptor protein; and a cell-based response that
is ligand dependent and easily monitored (e.g., proliferation
response). In one embodiment, the method for antibody selection
includes a step of screening the cell population for antibody
functionality by measuring the inhibitory concentration (IC50). In
one embodiment, at least one of the isolated, antigen-specific
cells produces an antibody having an IC50 of less than about 100,
50, 30, 25, 10 .mu.g/mL, or increments therein.
[0544] In addition to the enrichment step, the method for antibody
selection can also include at least one steps of screening a cell
population for antibody binding strength. Antibody binding strength
can be measured by any method known in the art (e.g.,
Biacore.RTM.). In one embodiment, at least one of the isolated,
antigen-specific cells produces an antibody having a high antigen
affinity, e.g., a dissociation constant (Kd) of less than about
5.times.10.sup.-10 M-1, preferably about 1.times.10.sup.-13 to
5.times.10.sup.-10, 1.times.10.sup.-12 to 1.times.10.sup.-10,
1.times.10.sup.-12 to 7.5.times.10.sup.11, 1.times.10.sup.11 to
2.times.10.sup.-11, about 1.5.times.10.sup.-11 or less, or
increments therein. In this embodiment, the antibodies are said to
be affinity mature. In a preferred embodiment, the affinity of the
antibodies is comparable to or higher than the affinity of any one
of Panorex.RTM. (edrecolomab), Rituxan.RTM. (rituximab),
Herceptin.RTM. (traztuzumab), Mylotarg.RTM. (gentuzumab),
Campath.RTM. (alemtuzumab), Zevalin.RTM. (ibritumomab),
Erbitux.RTM. (cetuximab), Avastin.RTM. (bevicizumab), Raptiva.RTM.
(efalizumab), Remicade.RTM. (infliximab), Humira.RTM. (adalimumab),
or Xolair.RTM. (omalizumab). Preferably, the affinity of the
antibodies is comparable to or higher than the affinity of
Humira.RTM.. The affinity of an antibody can also be increased by
known affinity maturation techniques. In one embodiment, at least
one cell population is screened for at least one of, preferably
both, antibody functionality and antibody binding strength.
[0545] In addition to the enrichment step, the method for antibody
selection can also include at least one steps of screening a cell
population for antibody sequence homology, especially human
homology. In one embodiment, at least one of the isolated,
antigen-specific cells produces an antibody that has a homology to
a human antibody of at least about 50% to about 100%, or increments
therein, or at least about 60%, 70%, 80%, 85%, 90%, or 95%
homologous. The antibodies can be humanized to increase the
homology to a human sequence by techniques known in the art such as
CDR grafting or selectivity determining residue grafting (SDR).
[0546] In another embodiment, the present invention also provides
the antibodies themselves according to any of the embodiments
described above in terms of IC50, Kd, and/or homology.
Methods of Humanizing Antibodies
[0547] The invention also provides a method for humanizing antibody
heavy and light chains. In this embodiment, the following method
may be followed for the humanization of the heavy and light
chains:
Light Chain
[0548] 1. Identify the amino acid that is the first one following
the signal peptide sequence. This is the start of Framework 1. The
signal peptide starts at the first initiation methionine and is
typically, but not necessarily 22 amino acids in length for rabbit
light chain protein sequences. The start of the mature polypeptide
can also be determined experimentally by N-terminal protein
sequencing, or can be predicted using a prediction algorithm. This
is also the start of Framework 1 as classically defined by those in
the field.
[0549] Example: RbtVL Amino acid residue 1 in FIG. 1, starting
`AYDM . . . ` (SEQ ID NO: 733)
[0550] 2. Identify the end of Framework
[0551] 3. This is typically 86-90 amino acids following the start
of Framework 1 and is typically a cysteine residue preceded by two
tyrosine residues. This is the end of the Framework 3 as
classically defined by those in the field.
[0552] Example: RbtVL amino acid residue 88 in FIG. 1, ending as
`TYYC` (SEQ ID NO: 733)
[0553] 3. Use the rabbit light chain sequence of the polypeptide
starting from the beginning of Framework 1 to the end of Framework
3 as defined above and perform a sequence homology search for the
most similar human antibody protein sequences. This will typically
be a search against human germline sequences prior to antibody
maturation in order to reduce the possibility of immunogenicity,
however any human sequences can be used. Typically a program like
BLAST can be used to search a database of sequences for the most
homologous. Databases of human antibody sequences can be found from
various sources such as NCBI (National Center for Biotechnology
Information).
[0554] Example: RbtVL amino acid sequence from residues numbered 1
through 88 in FIG. 1 is BLASTed against a human antibody germline
database. The top three unique returned sequences are shown in FIG.
1 as L12A (SEQ ID NO: 734), VI (SEQ ID NO: 735), and Vx02 (SEQ ID
NO: 736).
[0555] 4. Generally the most homologous human germline variable
light chain sequence is then used as the basis for humanization.
However those skilled in the art may decide to use another sequence
that wasn't the highest homology as determined by the homology
algorithm, based on other factors including sequence gaps and
framework similarities.
[0556] Example: In FIG. 1, L12A (SEQ ID NO: 734) was the most
homologous human germline variable light chain sequence and is used
as the basis for the humanization of RbtVL.
[0557] 5. Determine the framework and CDR arrangement (FR1, FR2,
FR3, CDR1 & CDR2) for the human homolog being used for the
light chain humanization. This is using the traditional layout as
described in the field. Align the rabbit variable light chain
sequence with the human homolog, while maintaining the layout of
the framework and CDR regions.
[0558] Example: In FIG. 1, the RbtVL sequence is aligned with the
human homologous sequence L12A, and the framework and CDR domains
are indicated.
[0559] 6. Replace the human homologous light chain sequence CDR1
and CDR2 regions with the CDR1 and CDR2 sequences from the rabbit
sequence. If there are differences in length between the rabbit and
human CDR sequences then use the entire rabbit CDR sequences and
their lengths. It is possible that the specificity, affinity and/or
immunogenicity of the resulting humanized antibody may be unaltered
if smaller or larger sequence exchanges are performed, or if
specific residue(s) are altered, however the exchanges as described
have been used successfully, but do not exclude the possibility
that other changes may be permitted.
[0560] Example: In FIG. 1, the CDR1 and CDR2 amino acid residues of
the human homologous variable light chain L12A are replaced with
the CDR1 and CDR2 amino acid sequences from the RbtVL rabbit
antibody light chain sequence. The human L12A frameworks 1, 2 and 3
are unaltered. The resulting humanized sequence is shown below as
VLh from residues numbered 1 through 88. Note that the only
residues that are different from the L12A human sequence are
underlined, and are thus rabbit-derived amino acid residues. In
this example only 8 of the 88 residues are different than the human
sequence.
[0561] 7. After framework 3 of the new hybrid sequence created in
Step 6, attach the entire CDR3 of the rabbit light chain antibody
sequence. The CDR3 sequence can be of various lengths, but is
typically 9 to 15 amino acid residues in length. The CDR3 region
and the beginning of the following framework 4 region are defined
classically and identifiable by those skilled in the art. Typically
the beginning of Framework 4, and thus after the end of CDR3
consists of the sequence `FGGG . . . ` (SEQ ID NO: 743), however
some variation may exist in these residues.
[0562] Example: In FIG. 1, the CDR3 of RbtVL (amino acid residues
numbered 89-100) is added after the end of framework 3 in the
humanized sequence indicated as VLh.
[0563] 8. The rabbit light chain framework 4, which is typically
the final 11 amino acid residues of the variable light chain and
begins as indicated in Step 7 above and typically ends with the
amino acid sequence ` . . . VVKR` (SEQ ID NO: 744) is replaced with
the nearest human light chain framework 4 homolog, usually from
germline sequence. Frequently this human light chain framework 4 is
of the sequence `FGGGTKVEIKR` (SEQ ID NO: 745). It is possible that
other human light chain framework 4 sequences that are not the most
homologous or otherwise different may be used without affecting the
specificity, affinity and/or immunogenicity of the resulting
humanized antibody. This human light chain framework 4 sequence is
added to the end of the variable light chain humanized sequence
immediately following the CDR3 sequence from Step 7 above. This is
now the end of the variable light chain humanized amino acid
sequence.
[0564] Example: In FIG. 1, Framework 4 (FR4) of the RbtVL rabbit
light chain sequence is shown above a homologous human FR4
sequence. The human FR4 sequence is added to the humanized variable
light chain sequence (VLh) right after the end of the CD3 region
added in Step 7 above.
[0565] In addition, FIGS. 4 and 5 depict preferred humanized
anti-IL-6 variable heavy and variable light chain sequences
humanized from the variable heavy and light regions in Ab1
according to the invention. These humanized light and heavy chain
regions are respectively contained in the polypeptides set forth in
SEQ ID NO: 647, or 651 and in SEQ ID NO: 652, 656, 657 or 658. The
CDR2 of the humanized variable heavy region in SEQ ID NO: 657
(containing a serine substitution in CDR2) is set forth in SEQ ID
NO: 658. Alignments illustrating variants of the light and heavy
chains are shown in FIGS. 2 and 3, respectively, with sequence
differences within the CDR regions highlighted. Sequence
identifiers of CDR sequences and of exemplary coding sequences are
summarized in Table 4, above.
Heavy Chain
[0566] 1. Identify the amino acid that is the first one following
the signal peptide sequence. This is the start of Framework 1. The
signal peptide starts at the first initiation methionine and is
typically 19 amino acids in length for rabbit heavy chain protein
sequences. Typically, but not necessarily always, the final 3 amino
acid residues of a rabbit heavy chain signal peptide are ` . . .
VQC`, followed by the start of Framework 1. The start of the mature
polypeptide can also be determined experimentally by N-terminal
protein sequencing, or can be predicted using a prediction
algorithm. This is also the start of Framework 1 as classically
defined by those in the field.
[0567] Example: RbtVH Amino acid residue 1 in FIG. 1, starting
`QEQL . . . ` (SEQ ID NO: 738)
[0568] 2. Identify the end of Framework 3. This is typically 95-100
amino acids following the start of Framework 1 and typically has
the final sequence of ` . . . CAR` (although the alanine can also
be a valine). This is the end of the Framework 3 as classically
defined by those in the field.
[0569] Example: RbtVH amino acid residue 98 in FIG. 1, ending as `
. . . FCVR` (SEQ ID NO: 738).
[0570] 3. Use the rabbit heavy chain sequence of the polypeptide
starting from the beginning of Framework 1 to the end of Framework
3 as defined above and perform a sequence homology search for the
most similar human antibody protein sequences. This will typically
be against a database of human germline sequences prior to antibody
maturation in order to reduce the possibility of immunogenicity,
however any human sequences can be used. Typically a program like
BLAST can be used to search a database of sequences for the most
homologous. Databases of human antibody sequences can be found from
various sources such as NCBI (National Center for Biotechnology
Information).
[0571] Example: RbtVH amino acid sequence from residues numbered 1
through 98 in FIG. 1 is BLASTed against a human antibody germline
database. The top three unique returned sequences are shown in FIG.
1 as 3-64-04 (SEQ ID NO: 739), 3-66-04 (SEQ ID NO: 740), and
3-53-02 (SEQ ID NO: 741).
[0572] 4. Generally the most homologous human germline variable
heavy chain sequence is then used as the basis for humanization.
However those skilled in the art may decide to use another sequence
that wasn't the most homologous as determined by the homology
algorithm, based on other factors including sequence gaps and
framework similarities.
[0573] Example: 3-64-04 in FIG. 1 was the most homologous human
germline variable heavy chain sequence and is used as the basis for
the humanization of RbtVH.
[0574] 5. Determine the framework and CDR arrangement (FR1, FR2,
FR3, CDR1 & CDR2) for the human homolog being used for the
heavy chain humanization. This is using the traditional layout as
described in the field. Align the rabbit variable heavy chain
sequence with the human homolog, while maintaining the layout of
the framework and CDR regions.
[0575] Example: In FIG. 1, the RbtVH sequence is aligned with the
human homologous sequence 3-64-04, and the framework and CDR
domains are indicated.
[0576] 6. Replace the human homologous heavy chain sequence CDR1
and CDR2 regions with the CDR1 and CDR2 sequences from the rabbit
sequence. If there are differences in length between the rabbit and
human CDR sequences then use the entire rabbit CDR sequences and
their lengths. In addition, it may be necessary to replace the
final three amino acids of the human heavy chain Framework 1 region
with the final three amino acids of the rabbit heavy chain
Framework 1. Typically but not always, in rabbit heavy chain
Framework 1 these three residues follow a Glycine residue preceded
by a Serine residue. In addition, it may be necessary replace the
final amino acid of the human heavy chain Framework 2 region with
the final amino acid of the rabbit heavy chain Framework 2.
Typically, but not necessarily always, this is a Glycine residue
preceded by an Isoleucine residue in the rabbit heavy chain
Framework 2. It is possible that the specificity, affinity and/or
immunogenicity of the resulting humanized antibody may be unaltered
if smaller or larger sequence exchanges are performed, or if
specific residue(s) are altered, however the exchanges as described
have been used successfully, but do not exclude the possibility
that other changes may be permitted. For example, a tryptophan
amino acid residue typically occurs four residues prior to the end
of the rabbit heavy chain CDR2 region, whereas in human heavy chain
CDR2 this residue is typically a Serine residue. Changing this
rabbit tryptophan residue to a the human Serine residue at this
position has been demonstrated to have minimal to no effect on the
humanized antibody's specificity or affinity, and thus further
minimizes the content of rabbit sequence-derived amino acid
residues in the humanized sequence.
[0577] Example: In FIG. 1, The CDR1 and CDR2 amino acid residues of
the human homologous variable heavy chain are replaced with the
CDR1 and CDR2 amino acid sequences from the RbtVH rabbit antibody
light chain sequence, except for the boxed residue, which is
tryptophan in the rabbit sequence (position number 63) and Serine
at the same position in the human sequence, and is kept as the
human Serine residue. In addition to the CDR1 and CDR2 changes, the
final three amino acids of Framework I (positions 28-30) as well as
the final residue of Framework 2 (position 49) are retained as
rabbit amino acid residues instead of human. The resulting
humanized sequence is shown below as VHh from residues numbered 1
through 98. Note that the only residues that are different from the
3-64-04 human sequence are underlined, and are thus rabbit-derived
amino acid residues. In this example only 15 of the 98 residues are
different than the human sequence.
[0578] 7. After framework 3 of the new hybrid sequence created in
Step 6, attach the entire CDR3 of the rabbit heavy chain antibody
sequence. The CDR3 sequence can be of various lengths, but is
typically 5 to 19 amino acid residues in length. The CDR3 region
and the beginning of the following framework 4 region are defined
classically and are identifiable by those skilled in the art.
Typically the beginning of framework 4, and thus after the end of
CDR3 consists of the sequence WGXG . . . (where X is usually Q or
P) (SEQ ID NO: 746), however some variation may exist in these
residues.
[0579] Example: The CDR3 of RbtVH (amino acid residues numbered
99-110) is added after the end of framework 3 in the humanized
sequence indicated as VHh.
[0580] 8. The rabbit heavy chain framework 4, which is typically
the final 11 amino acid residues of the variable heavy chain and
begins as indicated in Step 7 above and typically ends with the
amino acid sequence ` . . . TVSS` (SEQ ID NO: 747) is replaced with
the nearest human heavy chain framework 4 homolog, usually from
germline sequence. Frequently this human heavy chain framework 4 is
of the sequence `WGQGTLVTVSS` (SEQ ID NO: 748). It is possible that
other human heavy chain framework 4 sequences that are not the most
homologous or otherwise different may be used without affecting the
specificity, affinity and/or immunogenicity of the resulting
humanized antibody. This human heavy chain framework 4 sequence is
added to the end of the variable heavy chain humanized sequence
immediately following the CDR3 sequence from Step 7 above. This is
now the end of the variable heavy chain humanized amino acid
sequence.
[0581] Example: In FIG. 1, framework 4 (FR4) of the RbtVH rabbit
heavy chain sequence is shown above a homologous human heavy FR4
sequence. The human FR4 sequence is added to the humanized variable
heavy chain sequence (VHh) right after the end of the CD3 region
added in Step 7 above.
Additional Exemplary Embodiments of the Invention
[0582] In another embodiment, the invention contemplates at least
one anti-IL-6 antibodies or antibody fragments or variants thereof
which may specifically bind to the same linear or conformational
epitope(s) and/or compete for binding to the same linear or
conformational epitope(s) on an intact human IL-6 polypeptide or
fragment thereof as an anti-IL-6 antibody comprising Ab1 and
chimeric, humanized, single chain antibodies and fragments thereof
(containing at least one CDRs of the afore-identified antibodies)
that specifically bind IL-6, which preferably are aglycosylated. In
a preferred embodiment, the anti-IL-6 antibody or fragment or
variant thereof may specifically bind to the same linear or
conformational epitope(s) and/or compete for binding to the same
linear or conformational epitope(s) on an intact human IL-6
polypeptide or a fragment thereof as Ab1 and chimeric, humanized,
single chain antibodies and fragments thereof (containing at least
one CDRs of the afore-mentioned antibody) that specifically bind
IL-6, which preferably are aglycosylated.
[0583] In another embodiment of the invention, the anti-IL-6
antibody which may specifically bind to the same linear or
conformational epitopes on an intact IL-6 polypeptide or fragment
thereof that is (are) specifically bound by Ab1 may bind to an IL-6
epitope(s) ascertained by epitopic mapping using overlapping linear
peptide fragments which span the full length of the native human
IL-6 polypeptide. In one embodiment of the invention, the IL-6
epitope comprises, or alternatively consists of, at least one
residues comprised in IL-6 fragments selected from those
respectively encompassing amino acid residues 37-51, amino acid
residues 70-84, amino acid residues 169-183, amino acid residues
31-45 and/or amino acid residues 58-72.
[0584] The invention is also directed to an anti-IL-6 antibody that
binds with the same IL-6 epitope and/or competes with an anti-IL-6
antibody for binding to IL-6 as an antibody or antibody fragment
disclosed herein, including but not limited to an anti-IL-6
antibody selected from Ab1 and chimeric, humanized, single chain
antibodies and fragments thereof (containing at least one CDRs of
the afore-mentioned antibody) that specifically bind IL-6, which
preferably are aglycosylated.
[0585] In another embodiment, the invention is also directed to an
isolated anti-IL-6 antibody or antibody fragment or variant thereof
comprising at least one of the CDRs contained in the V.sub.H
polypeptide sequences comprising: SEQ ID NO: 3, 18, 19, 22, 38, 54,
70, 86, 102, 117, 118, 123, 139, 155, 171, 187, 203, 219, 235, 251,
267, 283, 299, 315, 331, 347, 363, 379, 395, 411, 427, 443, 459,
475, 491, 507, 523, 539, 555, 571, 652, 656, 657, 658, 661, 664,
665, 668, 672, 676, 680, 684, 688, 691, 692, 704, or 708 and/or at
least one of the CDRs contained in the V.sub.L polypeptide sequence
consisting of: 2, 20, 21, 37, 53, 69, 85, 101, 119, 122, 138, 154,
170, 186, 202, 218, 234, 250, 266, 282, 298, 314, 330, 346, 362,
378, 394, 410, 426, 442, 458, 474, 490, 506, 522, 538, 554, 570,
647, 651, 660, 666, 667, 671, 675, 679, 683, 687, 693, 699, 702,
706, or 709 and the VH and VL sequences depicted in the antibody
alignments comprised in FIGS. 1-5 of this application.
[0586] In one embodiment of the invention, the anti-IL-6 antibody
described herein may comprise at least 2 complementarity
determining regions (CDRs) in each the variable light and the
variable heavy regions which are identical to those contained in an
anti-IL-6 antibody comprising Ab1 and chimeric, humanized, single
chain antibodies and fragments thereof (containing at least one
CDRs of the afore-mentioned antibody) that specifically bind IL-6,
which preferably are aglycosylated.
[0587] In a preferred embodiment, the anti-IL-6 antibody described
herein may comprise at least 2 complementarity determining regions
(CDRs) in each the variable light and the variable heavy regions
which are identical to those contained in Ab1. In another
embodiment, all of the CDRs of the anti-IL-6 antibody discussed
above are identical to the CDRs contained in an anti-IL-6 antibody
comprising Ab1 and chimeric, humanized, single chain antibodies and
fragments thereof (containing at least one CDRs of the
afore-mentioned antibody) that specifically bind IL-6, which
preferably are aglycosylated. In a preferred embodiment of the
invention, all of the CDRs of the anti-IL-6 antibody discussed
above are identical to the CDRs contained in Ab1, e.g., an antibody
comprised of the V.sub.H and VL sequences comprised in SEQ ID NO:
657 and SEQ ID NO: 709 respectively.
[0588] The invention further contemplates that the one or more
anti-IL-6 antibodies discussed above are aglycosylated or
substantially non-glycosylated (e.g., may contain one or more,
e.g., 1-5 mannose residues); that contain an Fc region that has
been modified to alter effector function, half-life, proteolysis,
and/or glycosylation; are human, humanized, single chain or
chimeric; and are a humanized antibody derived from a rabbit
(parent) anti-IL-6 antibody. Exemplary constant regions that
provide for the production of aglycosylated antibodies in Pichia
are comprised in SEQ ID NO: 588 and SEQ ID NO: 586 which
respectively are encoded by the nucleic acid sequences in SEQ ID
NO: 589 and SEQ ID NO: 587.
[0589] The invention further contemplates at least one anti-IL-6
antibodies wherein the framework regions (FRs) in the variable
light region and the variable heavy regions of said antibody
respectively are human FRs which are unmodified or which have been
modified by the substitution of at most 2 or 3 human FR residues in
the variable light or heavy chain region with the corresponding FR
residues of the parent rabbit antibody, and wherein said human FRs
have been derived from human variable heavy and light chain
antibody sequences which have been selected from a library of human
germline antibody sequences based on their high level of homology
to the corresponding rabbit variable heavy or light chain regions
relative to other human germline antibody sequences contained in
the library.
[0590] In one embodiment of the invention, the anti-IL-6 antibody
or fragment or variant thereof may specifically bind to IL-6
expressing human cells and/or to circulating soluble IL-6 molecules
in vivo, including IL-6 expressed on or by human cells in a patient
with a disease associated with cells that express IL-6.
[0591] The invention further contemplates anti-IL-6 antibodies or
fragments or variants thereof directly or indirectly attached to a
detectable label or therapeutic agent.
[0592] The invention also contemplates at least one nucleic acid
sequences which result in the expression of an anti-IL-6 antibody
or antibody fragment or variant thereof as set forth above,
including those comprising, or alternatively consisting of, yeast
or human preferred codons. The invention also contemplates vectors
(including plasmids or recombinant viral vectors) comprising said
nucleic acid sequence(s). The invention also contemplates host
cells or recombinant host cells expressing at least one of the
antibodies set forth above, including a mammalian, yeast,
bacterial, and insect cells. In a preferred embodiment, the host
cell is a yeast cell. In a further preferred embodiment, the yeast
cell is a diploidal yeast cell. In a more preferred embodiment, the
yeast cell is a Pichia yeast.
[0593] The invention also contemplates a method of treatment
comprising administering to a patient with a disease or condition
associated with anemia a therapeutically effective amount of at
least one anti-IL-6 antibody or antigen-binding fragment or variant
thereof. The diseases that may be treated are presented in the
non-limiting list set forth above. In another embodiment the
treatment further includes the administration of another
therapeutic agent or regimen selected from chemotherapy,
radiotherapy, cytokine administration or gene therapy agent. For
example, TNF-.alpha. inhibitors including but not limited to
glyococordicoids, triamcinolone, dexamethasone, prednisone, may
also be administered sequentially or subsequently with at least one
anti-IL-6 antibody or antigen-binding fragment or variant thereof
described herein. Further examples of drugs that may be included
with the IL-6 antagonists include but are not limited to
ARISTOCORT.RTM. (triamcinolone), BAYCADROM.RTM. (dexamethasone),
DECADRON.RTM. (dexamethasone), DELTASONE.RTM. (prednisone),
DEXAMETHASONE INTENSOL.RTM. (dexamethasone), ENBREL.RTM.
(etancercept), HUMIRA.RTM. (adalimumab), REMICADE.RTM.
(infliximab), RIDUARA.RTM. (aruaofin), and SIMPONI.RTM.
(golimumab).
Exemplary Embodiments of Heavy and Light Chain Polypeptides and
Polynucleotides
[0594] This section recites exemplary embodiments of heavy and
light chain polypeptides, as well as exemplary polynucleotides
encoding such polypeptides. These exemplary polynucleotides are
suitable for expression in the disclosed Pichia expression
system.
[0595] In certain embodiments, the present invention encompasses
polynucleotides having at least about 70%, 75%, 80%, 85%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity
(sequence homology) to the polynucleotides recited in this
application or that encode polypeptides recited in this
application, or that hybridize to said polynucleotides under
conditions of low-stringency, moderate-stringency, or
high-stringency conditions, preferably those that encode
polypeptides (e.g. an immunoglobulin heavy and light chain, a
single-chain antibody, an antibody fragment) that have at least one
of the biological activities set forth herein, including without
limitation thereto specific binding to an IL-6 polypeptide. In
another aspect, the invention encompasses a composition comprising
such a polynucleotide and/or a polypeptide encoded by such a
polynucleotide. In yet another aspect, the invention encompasses a
method of treatment of a disease or condition associated with IL-6
or that may be prevented, treated, or ameliorated with an IL-6
antagonist such as Ab1 (e.g. anemia) comprising administration of a
composition comprising such a polynucleotide and/or
polypeptide.
[0596] In certain preferred embodiments, a heavy chain polypeptide
will comprise at least one of the CDR sequences of the heavy and/or
light chain polypeptides recited herein (including those contained
in the heavy and light chain polypeptides recited herein) and at
least one of the framework region polypeptides recited herein,
including those depicted in FIGS. 1-5 or Table 4, and contained in
the heavy and light chain polypeptide sequences recited herein. In
certain preferred embodiments, a heavy chain polypeptide will
comprise at least one Framework 4 region sequences as depicted in
FIGS. 1-5 or Table 4, or as contained in a heavy or light chain
polypeptide recited herein.
[0597] In certain preferred embodiments, a light chain polypeptide
will comprise at least one of the CDR sequences of the heavy and/or
light chain polypeptides recited herein (including those contained
in the heavy and light chain polypeptides recited herein) and at
least one of the Framework region polypeptides recited herein,
including those depicted in FIGS. 1-5 or Table 4, and contained in
the heavy and light chain polypeptide sequences recited herein. In
certain preferred embodiments, a light chain polypeptide will
comprise at least one Framework 4 region sequences as depicted in
FIGS. 1-5 or Table 4, or as contained in a heavy or light chain
polypeptide recited herein.
[0598] In any of the embodiments recited herein, certain of the
sequences recited may be substituted for each other, unless the
context indicates otherwise. The recitation that particular
sequences may be substituted for one another, where such
recitations are made, are understood to be illustrative rather than
limiting, and it is also understood that such substitutions are
encompassed even when no illustrative examples of substitutions are
recited, For example, wherever at least one of the Ab1 light chain
polypeptides is recited, e.g. any of SEQ ID NO: 2, 20, 647, 651,
660, 666, 699, 702, 706, or 709, another Ab1 light chain
polypeptide may be substituted unless the context indicates
otherwise. Similarly, wherever one of the Ab1 heavy chain
polypeptides is recited, e.g. any of SEQ ID NO: 3, 18, 19, 652,
656, 657, 658, 661, 664, 665, 704, or 708, another Ab1 heavy chain
polypeptide may be substituted unless the context indicates
otherwise. Likewise, wherever one of the Ab1 light chain
polynucleotides is recited, e.g. any of SEQ ID NO: 10, 662, 698,
701, or 705, another Ab1 light chain polynucleotide may be
substituted unless the context indicates otherwise. Similarly,
wherever one of the Ab1 heavy chain polynucleotides is recited,
e.g. any of SEQ ID NO: 11, 663, 700, 703, or 707, another Ab1 heavy
chain polynucleotide may be substituted unless the context
indicates otherwise.
[0599] Additionally, recitation of any member of any of the
following groups is understood to encompass substitution by any
other member of the group, as follows: Ab2 Light chain polypeptides
(SEQ ID NO: 21 and 667); Ab2 Light chain polynucleotides (SEQ ID
NO: 29 and 669); Ab2 Heavy chain polypeptides (SEQ ID NO: 22 and
668); Ab2 Heavy chain polynucleotides (SEQ ID NO: 30 and 670); Ab3
Light chain polypeptides (SEQ ID NO: 37 and 671); Ab3 Light chain
polynucleotides (SEQ ID NO: 45 and 673); Ab3 Heavy chain
polypeptides (SEQ ID NO: 38 and 672); Ab3 Heavy chain
polynucleotides (SEQ ID NO: 46 and 674); Ab4 Light chain
polypeptides (SEQ ID NO: 53 and 675); Ab4 Light chain
polynucleotides (SEQ ID NO: 61 and 677); Ab4 Heavy chain
polypeptides (SEQ ID NO: 54 and 676); Ab4 Heavy chain
polynucleotides (SEQ ID NO: 62 and 678); Ab5 Light chain
polypeptides (SEQ ID NO: 69 and 679); Ab5 Light chain
polynucleotides (SEQ ID NO: 77 and 681); Ab5 Heavy chain
polypeptides (SEQ ID NO: 70 and 680); Ab5 Heavy chain
polynucleotides (SEQ ID NO: 78 and 682); Ab6 Light chain
polypeptides (SEQ ID NO: 85 and 683); Ab6 Light chain
polynucleotides (SEQ ID NO: 93 and 685); Ab6 Heavy chain
polypeptides (SEQ ID NO: 86 and 684); Ab6 Heavy chain
polynucleotides (SEQ ID NO: 94 and 686); Ab7 Light chain
polypeptides (SEQ ID NO: 101, 119, 687, 693); Ab7 Light chain
polynucleotides (SEQ ID NO: 109 and 689); Ab7 Heavy chain
polypeptides (SEQ ID NO: 102, 117, 118, 688, 691, and 692); Ab7
Heavy chain polynucleotides (SEQ ID NO: 110 and 690); Ab1 Light
Chain CDR1 polynucleotides (SEQ ID NO: 12 and 694); Ab1 Light Chain
CDR3 polynucleotides (SEQ ID NO: 14 and 695); Ab1 Heavy Chain CDR2
polynucleotides (SEQ ID NO: 16 and 696) and Ab1 Heavy Chain CDR3
polynucleotides (SEQ ID NO: 17 and 697). Exemplary Ab1-encoding
polynucleotide sequences include but are not limited to SEQ ID NO:
662, 663, 698, 700, 701, 703, 705, 707, 720, 721, 722, 723, 724,
and 725.
Anti-IL-6 Activity
[0600] As stated previously, IL-6 is a member of a family of
cytokines that promote cellular responses through a receptor
complex consisting of at least one subunit of the
signal-transducing glycoprotein gp130 and the IL-6 receptor
(IL-6R). The IL-6R may also be present in a soluble form (sIL-6R).
IL-6 binds to IL-6R, which then dimerizes the signal-transducing
receptor gp130.
[0601] It is believed that the anti-IL-6 antibodies of the
invention, or IL-6 binding fragments or variants thereof, are
useful by exhibiting anti-IL-6 activity. In one non-limiting
embodiment of the invention, the anti-IL-6 antibodies of the
invention, or IL-6 binding fragments or variants thereof, exhibit
anti-IL-6 activity by binding to IL-6 which may be soluble IL-6 or
cell surface expressed IL-6 and/or may prevent or inhibit the
binding of IL-6 to IL-6R and/or activation (dimerization) of the
gp130 signal-transducing glycoprotein and the formation of
IL-6/IL-6R/gp130 multimers and the biological effects of any of the
foregoing. The subject anti-IL-6 antibodies may possess different
antagonistic activities based on where (i.e., epitope) the
particular antibody binds IL-6 and/or how it affects the formation
of the foregoing IL-6 complexes and/or multimers and the biological
effects thereof. Consequently, different anti-IL-6 antibodies
according to the invention e.g., may be better suited for
preventing or treating conditions involving the formation and
accumulation of substantial soluble IL-6 such as rheumatoid
arthritis whereas other antibodies may be favored in treatments
wherein the prevention of IL-6/IL-6R/gp130 or IL-6/IL-6R/gp130
multimers is a desired therapeutic outcome. This can be determined
in binding and other assays.
[0602] The anti-IL-6 activity of the anti-IL-6 antibody of the
present invention, and fragments and variants thereof having
binding specificity to IL-6, may also be described by their
strength of binding or their affinity for IL-6. This also may
affect their therapeutic properties. In one embodiment of the
invention, the anti-IL-6 antibodies of the present invention, and
fragments thereof having binding specificity to IL-6, bind to IL-6
with a dissociation constant (K.sub.D) of less than or equal to
5.times.10.sup.-7, 10, 5.times.10.sup.-8, 10.sup.-8,
5.times.10.sup.-9, 10.sup.-9, 5.times.10.sup.-10, 10.sup.-10,
5.times.10.sup.-11, 10.sup.-11, 5.times.10.sup.-12, 10.sup.-12,
5.times.10.sup.-13, 10.sup.-13, 5.times.10.sup.-14, 10.sup.-14,
5.times.10.sup.-15 or 10.sup.-15. Preferably, the anti-IL-6
antibodies and fragments and variants thereof bind IL-6 with a
dissociation constant of less than or equal to
5.times.10.sup.10.
[0603] In another embodiment of the invention, the anti-IL-6
activity of the anti-IL-6 antibodies of the present invention, and
fragments and variants thereof having binding specificity to IL-6,
bind to IL-6 with an off-rate of less than or equal to 10.sup.-4
S.sup.-1, 5.times.10.sup.-5 S.sup.-1, 10.sup.-5 S.sup.-1,
5.times.10.sup.-6 S.sup.-1, 10.sup.-6 S.sub.-1, 5.times.10.sup.-7
S.sup.-1, or 10.sup.7 S.sup.-1. In one embodiment of the invention,
the anti-IL-6 antibodies of the invention, and fragments and
variants thereof having binding specificity to IL-6, bind to a
linear or conformational IL-6 epitope.
[0604] In a further embodiment of the invention, the anti-IL-6
activity of the anti-IL-6 antibodies of the present invention, and
fragments and variants thereof having binding specificity to IL-6,
exhibit anti-IL-6 activity by ameliorating or reducing the symptoms
of, or alternatively treating, or preventing, diseases and
disorders associated with IL-6. Non-limiting examples of diseases
and disorders associated with IL-6 are set forth infra. In another
embodiment of the invention, the anti-IL-6 antibodies described
herein, or IL-6 binding fragments and variants thereof, do not have
binding specificity for IL-6R or the gp-130 signal-transducing
glycoprotein.
Screening Assays
[0605] The invention also includes screening assays designed to
assist in the identification of diseases and disorders associated
with IL-6 in patients exhibiting symptoms of an IL-6 associated
disease or disorder, especially anemia.
[0606] In one embodiment of the invention, the anti-IL-6 antibodies
of the invention, or IL-6 binding fragments or variants thereof,
are used to detect the presence of IL-6 in a biological sample
obtained from a patient exhibiting symptoms of a disease or
disorder associated with IL-6. The presence of IL-6, or elevated
levels thereof when compared to pre-disease levels of IL-6 in a
comparable biological sample, may be beneficial in diagnosing a
disease or disorder associated with IL-6.
[0607] Another embodiment of the invention provides a diagnostic or
screening assay to assist in diagnosis of diseases or disorders
associated with IL-6 in patients exhibiting symptoms of an IL-6
associated disease or disorder identified herein, comprising
assaying the level of IL-6 expression in a biological sample from
said patient using a post-translationally modified anti-IL-6
antibody or binding fragment or variant thereof. The anti-IL-6
antibody or binding fragment or variant thereof may be
post-translationally modified to include a detectable moiety such
as set forth previously in the disclosure.
[0608] The IL-6 level in the biological sample is determined using
a modified anti-IL-6 antibody or binding fragment or variant
thereof as set forth herein, and comparing the level of IL-6 in the
biological sample against a standard level of IL-6 (e.g., the level
in normal biological samples). The skilled clinician would
understand that some variability may exist between normal
biological samples, and would take that into consideration when
evaluating results.
[0609] The above-recited assay may also be useful in monitoring a
disease or disorder, where the level of IL-6 obtained in a
biological sample from a patient believed to have an IL-6
associated disease or disorder is compared with the level of IL-6
in prior biological samples from the same patient, in order to
ascertain whether the IL-6 level in said patient has changed with,
for example, a treatment regimen. A skilled clinician would
understand that a biological sample includes, but is not limited
to, sera, plasma, urine, saliva, mucous, pleural fluid, synovial
fluid and spinal fluid.
Fusion Proteins
[0610] Fusion proteins comprising IL-6 antagonists are also
provided by the present invention. Fusions comprising the anti-IL-6
antibodies polypeptides are also within the scope of the present
invention. For example, the fusion protein may be linked to a GST
fusion protein in which the anti-IL-6 antibodies polypeptide
sequences are fused to the C-terminus of the GST sequences. Such
fusion proteins may facilitate the purification of the recombinant
Anti-IL-6 antibodies polypeptides. Alternatively, anti-IL-6
antibodies polypeptides may be fused with a protein that binds
B-cell follicles, thus initiating both a humoral immune response
and activation of T cells. Berney, et al. (1999) J. Exp. Med. 190:
851-60. Alternatively, for example, the Anti-IL-6 antibodies
polypeptides may be genetically coupled with and anti-dendritic
cell antibody to deliver the antigen to the immune system and
stimulate a cellular immune response. He, et al. (2004) Clin.
Cancer Res. 10: 1920-27. A chimeric or fusion protein of the
invention may be produced by standard recombinant DNA techniques.
For example, DNA fragments coding for the different polypeptide
sequences are ligated together in-frame in accordance with
conventional techniques, e.g., by employing blunt-ended or
stagger-ended termini for ligation, restriction enzyme digestion to
provide for appropriate termini, filling-in of cohesive ends as
appropriate, alkaline phosphatase treatment to avoid undesirable
joining, and enzymatic ligation. The fusion gene may be synthesized
by conventional techniques including automated DNA
synthesizers.
[0611] Fusion proteins may include C-terminal or N-terminal
translocation sequences. Further, fusion proteins can comprise
additional elements, e.g., for protein detection, purification, or
other applications. Detection and purification facilitating domains
including but not limited to metal chelating peptides such as
polyhistidine tracts, histidine-tryptophan modules, or other
domains that allow purification on immobilized metals; maltose
binding protein; protein A domains that allow purification on
immobilized immunoglobulin; or the domain utilized in the FLAG
extension/affinity purification system (Immunex Corp, Seattle
Wash.)
[0612] A fusion protein may be prepared from a protein of the
invention by fusion with a portion of an immunoglobulin comprising
a constant region of an immunoglobulin. More preferably, the
portion of the immunoglobulin comprises a heavy chain constant
region which is optionally and more preferably a human heavy chain
constant region. The heavy chain constant region is most preferably
an IgG heavy chain constant region, and optionally and most
preferably is an Fc chain, most preferably an IgG Fc fragment that
comprises CH2 and CH3 domains. Although any IgG subtype may
optionally be used, the IgG1 subtype is preferred. The Fc chain may
optionally be a known or "wild type" Fc chain, or alternatively may
be mutated. See, e.g., U.S. Patent Application Publication No.
2006/0034852. The term "Fc chain" also optionally comprises any
type of Fc fragment. Several of the specific amino acid residues
that are involved in antibody constant region-mediated activity in
the IgG subclass have been identified. Inclusion, substitution or
exclusion of these specific amino acids therefore allows for
inclusion or exclusion of specific immunoglobulin constant
region-mediated activity. Furthermore, specific changes may result
in aglycosylation for example and/or other desired changes to the
Fc chain. At least some changes may optionally be made to block a
function of Fc which is considered to be undesirable, such as an
undesirable immune system effect. See McCafferty, et al. (2002)
Antibody Engineering: A Practical Approach (Eds.) Oxford University
Press.
[0613] The inclusion of a cleavable linker sequences such as Factor
Xa (see, e.g., Ottavi, (1998) Biochimie 80: 289-93), subtilisin
protease recognition motif (see, e.g., Polyak (1997) Protein Eng.
10: 615-19); enterokinase (Invitrogen, San Diego, Calif.), between
the translocation domain (for efficient plasma membrane expression)
and the rest of the newly translated polypeptide may be useful to
facilitate purification. For example, one construct can include a
polypeptide encoding a nucleic acid sequence linked to six
histidine residues followed by a thioredoxin, an enterokinase
cleavage site (see, e.g., Williams (1995) Biochemistry 34:
1787-97), and an C-terminal translocation domain. The histidine
residues facilitate detection and purification while the
enterokinase cleavage site provides a means for purifying the
desired protein(s) from the remainder of the fusion protein.
Technology pertaining to vectors encoding fusion proteins and
application of fusion proteins are well described in the art. See,
e.g., Kroll (1993) DNA Cell. Biol. 12: 441-53.
Conjugates
[0614] IL-6 antagonists may be conjugated to other moieties (e.g.,
conjugates). Further, the anti-IL-6 antibodies, antibodies that
bind the Anti-IL-6 antibodies and fragments thereof, may be
conjugated to other moieties. Such conjugates are often used in the
preparation of vaccines. The anti-IL-6 antibodies polypeptide may
be conjugated to a carbohydrate (e.g., mannose, fucose, glucose,
GlcNAs, maltose), which is recognized by the mannose receptor
present on dendritic cells and macrophages. The ensuing binding,
aggregation, and receptor-mediated endocytosis and phagocytosis
functions provide enhanced innate and adaptive immunity. See
Mahnke, et al. (2000) J. Cell Biol. 151: 673-84; Dong, et al.
(1999) J. Immonol. 163: 5427-34. Other moieties suitable for
conjugation to elicit an immune response includes but not limited
to Keyhole Limpit Hemocyannin (KLH), diphtheria toxoid, cholera
toxoid, Pseudomonas exoprotein A, and microbial outer membrane
proteins (OMPS).
Labels
[0615] As stated above, antibodies and fragments and variants
thereof may be modified post-translationally to add effector
moieties such as chemical linkers, detectable moieties such as for
example fluorescent dyes, enzymes, substrates, bioluminescent
materials, radioactive materials, and chemiluminescent moieties, or
functional moieties such as for example streptavidin, avidin,
biotin, a cytotoxin, a cytotoxic agent, and radioactive
materials.
[0616] The anti-IL-6 antibodies and antigen-binding fragments
thereof described herein may be modified post-translationally to
add effector moieties such as chemical linkers, detectable moieties
such as for example fluorescent dyes, enzymes, substrates,
bioluminescent materials, radioactive materials, chemiluminescent
moieties, a cytotoxic agent, radioactive materials, or functional
moieties.
[0617] A wide variety of entities, e.g., ligands, may be coupled to
the oligonucleotides as known in the art. Ligands may include
naturally occurring molecules, or recombinant or synthetic
molecules. Exemplary ligands include, but are not limited to,
avadin, biotin, peptides, peptidomimetics, polylysine (PLL),
polyethylene glycol (PEG), mPEG, cationic groups, spermine,
spermidine, polyamine, thyrotropin, melanotropin, lectin,
glycoprotein, surfactant protein A, mucin, glycosylated
polyaminoacids, transferrin, aptamer, immunoglobulins (e.g.,
antibodies), insulin, transferrin, albumin, sugar, lipophilic
molecules (e.g., steroids, bile acids, cholesterol, cholic acid,
and fatty acids), vitamin A, vitamin E, vitamin K, vitamin B, folic
acid, B12, riboflavin, biotin, pyridoxal, vitamin cofactors,
lipopolysaccharide, hormones and hormone receptors, lectins,
carbohydrates, multivalent carbohydrates, radiolabeled markers,
fluorescent dyes, and derivatives thereof. See, e.g., U.S. Pat.
Nos. 6,153,737; 6,172,208; 6,300,319; 6,335,434; 6,335,437;
6,395,437; 6,444,806; 6,486,308; 6,525,031; 6,528,631; and 6,559,
279.
[0618] Additionally, moieties may be added to the antigen or
epitope to increase half-life in vivo (e.g., by lengthening the
time to clearance from the blood stream. Such techniques include,
for example, adding PEG moieties (also termed pegilation), and are
well-known in the art. See U.S. Patent Application Publication No.
2003/0031671.
[0619] An IL-6 antagonist, such as an anti-IL-6 antibody or antigen
binding fragment thereof, described herein may be "attached" to a
substrate when it is associated with the solid label through a
non-random chemical or physical interaction. The attachment may be
through a covalent bond. However, attachments need not be covalent
or permanent. Materials may be attached to a label through a
"spacer molecule" or "linker group." Such spacer molecules are
molecules that have a first portion that attaches to the biological
material and a second portion that attaches to the label. Thus,
when attached to the label, the spacer molecule separates the label
and the biological materials, but is attached to both. Methods of
attaching biological material (e.g., label) to a label are well
known in the art, and include but are not limited to chemical
coupling.
Detectable Labels
[0620] The anti-IL-6 antibody or antigen-binding fragments
described herein may be modified post-translationally to add
effector labels such as chemical linkers, detectable labels such as
for example fluorescent dyes, enzymes, substrates, bioluminescent
materials, radioactive materials, and chemiluminescent labels, or
functional labels such as for example streptavidin, avidin, biotin,
a cytotoxin, a cytotoxic agent, and radioactive materials. Further
exemplary enzymes include, but are not limited to, horseradish
peroxidase, acetylcholinesterase, alkaline phosphatase,
3-galactosidase and luciferase. Further exemplary fluorescent
materials include, but are not limited to, rhodamine, fluorescein,
fluorescein isothiocyanate, umbelliferone, dichlorotriazinylamine,
phycoerythrin and dansyl chloride. Further exemplary
chemiluminescent labels include, but are not limited to, luminol.
Further exemplary bioluminescent materials include, but are not
limited to, luciferin and aequorin. Further exemplary radioactive
materials include, but are not limited to, bismuth-213
(.sup.213Bs), carbon-14 (.sup.14C), carbon-11 (.sup.11C),
chlorine-18 (.sup.18Cl), chromium-51 (.sup.51Cr), cobalt-57
(.sup.57Co), cobalt-60 (.sup.60Co), copper-64 (.sup.64Cu),
copper-67 (.sup.67Cu), dysprosium-165 (.sup.165Dy), erbium-169
(.sup.169Er), fluorine-18 (.sup.18F), gallium-67 (.sup.67Ga),
gallium-68 (.sup.68Ga), germanium-68 (.sup.68Ge), holmium-166
(.sup.166Ho), indium-111 (.sup.111In), iodine-125 (.sup.125I),
iodine-123 (.sup.124I), iodine-124 (.sup.124I), iodine-131
(.sup.131I), iridium-192 (.sup.192Ir), iron-59 (.sup.59Fe),
krypton-81 (.sup.81Kr), lead-212 (.sup.212Pb), lutetium-177
(.sup.177Lu), molybdenum-99 (.sup.99Mo), nitrogen-13 (.sup.13N),
oxygen-15 (.sup.15O), palladium-103 (.sup.103Pd), phosphorus-32
(.sup.32p), potassium-42 (.sup.42K), rhenium-186 (.sup.186Re),
rhenium-188 (.sup.188Re), rubidium-81 (.sup.81Rb), rubidium-82
(.sup.82Rb), samarium-153 (.sup.153Sm), selenium-75 (.sup.75Se),
sodium-24 (.sup.24Na), strontium-82 (.sup.82Sr), strontium-89
(.sup.89Sr), sulfur 35 (.sup.35S), technetium-99m (.sup.99Tc),
thallium-201 (.sup.201Tl), tritium (.sup.3H), xenon-133
(.sup.133Xe), ytterbium-169 (.sup.169Yb), ytterbium-177
(.sup.177Yb), and yttrium-90 (.sup.90Y).
Cytotoxic Agents
[0621] The anti-IL-6 antibodies and antigen-binding fragments
described herein may be conjugated to cytotoxic agents including,
but are not limited to, methotrexate, aminopterin,
6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil
decarbazine; alkylating agents such as mechlorethamine, thioepa
chlorambucil, melphalan, carmustine (BSNU), mitomycin C, lomustine
(CCNU), 1-methylnitrosourea, cyclothosphamide, mechlorethamine,
busulfan, dibromomannitol, streptozotocin, mitomycin C,
cis-dichlorodiamine platinum (II) (DDP) cisplatin and carboplatin
(paraplatin); anthracyclines include daunorubicin (formerly
daunomycin), doxorubicin (adriamycin), detorubicin, carminomycin,
idarubicin, epirubicin, mitoxantrone and bisantrene; antibiotics
include dactinomycin (actinomycin D), bleomycin, calicheamicin,
mithramycin, and anthramycin (AMC); and antimytotic agents such as
the vinca alkaloids, vincristine and vinblastine. Other cytotoxic
agents include paclitaxel (TAXOL.RTM.), ricin, pseudomonas
exotoxin, gemcitabine, cytochalasin B, gramicidin D, ethidium
bromide, emetine, etoposide, tenoposide, colchicin, dihydroxy
anthracin dione, 1-dehydrotestosterone, glucocorticoids, procaine,
tetracaine, lidocaine, propranolol, puromycin, procarbazine,
hydroxyurea, asparaginase, corticosteroids, mytotane (O,P'-(DDD)),
interferons, and mixtures of these cytotoxic agents.
[0622] Further cytotoxic agents include, but are not limited to,
chemotherapeutic agents such as carboplatin, cisplatin, paclitaxel,
gemcitabine, calicheamicin, doxorubicin, 5-fluorouracil, mitomycin
C, actinomycin D, cyclophosphamide, vincristine, bleomycin, VEGF
antagonists, EGFR antagonists, platins, taxols, irinotecan,
5-fluorouracil, gemcytabine, leucovorine, steroids,
cyclophosphamide, melphalan, vinca alkaloids (e.g., vinblastine,
vincristine, vindesine and vinorelbine), mustines, tyrosine kinase
inhibitors, radiotherapy, sex hormone antagonists, selective
androgen receptor modulators, selective estrogen receptor
modulators, PDGF antagonists, TNF antagonists, IL-1 antagonists,
interleukins (e.g. IL-12 or IL-2), IL-12R antagonists,
Erbitux.RTM., Avastin.RTM., Pertuzumab, anti-CD20 antibodies,
Rituxan.RTM., ocrelizumab, ofatumumab, DXL625, Herceptin.RTM., or
any combination thereof. Toxic enzymes from plants and bacteria
such as ricin, diphtheria toxin and Pseudomonas toxin may be
conjugated to the humanized antibodies, or binding fragments
thereof, to generate cell-type-specific-killing reagents. Youle, et
al. (1980) Proc. Nat'l Acad. Sci. USA 77: 5483; Gilliland, et al.
(1980) Proc. Nat'l Acad. Sci. USA 77: 4539; Krolick, et al. (1980)
Proc. Nat'l Acad. Sci. USA 77: 5419. Other cytotoxic agents include
cytotoxic ribonucleases. See U.S. Pat. No. 6,653,104.
[0623] The anti-IL-6 antibodies and antigen-binding fragments
described herein may be conjugated to a radionuclide that emits
alpha or beta particles (e.g., radioimmunoconjuagtes). Such
radioactive isotopes include but are not limited to beta-emitters
such as phosphorus-32 (.sup.32P), scandium-47 (.sup.47Sc),
copper-67 (.sup.67Cu), gallium-67 (.sup.67Ga), yttrium-88
(.sup.88Y), yttrium-90 (.sup.90Y), iodine-125 (.sup.125I),
iodine-131 (.sup.131I), samarium-153 (.sup.153Sm), lutetium-177
(.sup.177Lu), rhenium-186 (.sup.186Re), rhenium-188 (.sup.188Re),
and alpha-emitters such as astatine-211 (.sup.211At), lead-212
(.sup.212Pb), bismuth-212 (.sup.212Bi), bismuth-213 (.sup.213Bi) or
actinium-225 (.sup.225Ac).
[0624] Methods are known in the art for conjugating an anti-IL-6
antibody described herein to a label, such as those methods
described by Hunter, et al. (1962) Nature 144: 945; David, et al.
(1974) Biochemistry 13: 1014; Pain, et al. (1981) J. Immunol. Meth.
40: 219; and Nygren (1982) Histochem and Cytochem 30: 407.
Substrates
[0625] The anti-IL-6 antibodies and antigen-binding fragments
thereof described herein may be attached to a substrate. A number
of substrates (e.g., solid supports) known in the art are suitable
for use with the anti-IL-6 antibody described herein. The substrate
may be modified to contain channels or other configurations. See
Fung (2004) [Ed.] Protein Arrays: Methods and Protocols Humana
Press and Kambhampati (2004) [Ed.] Protein Microarray Technology
John Wiley & Sons.
[0626] Substrate materials include, but are not limited to
acrylics, agarose, borosilicate glass, carbon (e.g., carbon
nanofiber sheets or pellets), cellulose acetate, cellulose,
ceramics, gels, glass (e.g., inorganic, controlled-pore, modified,
soda-lime, or functionalized glass), latex, magnetic beads,
membranes, metal, metalloids, nitrocellulose, NYLON.RTM., optical
fiber bundles, organic polymers, paper, plastics,
polyacryloylmorpholide, poly(4-methylbutene), poly(ethylene
terephthalate), poly(vinyl butyrate), polyacrylamide, polybutylene,
polycarbonate, polyethylene, polyethyleneglycol terephthalate,
polyformaldehyde, polymethacrylate, polymethylmethacrylate,
polypropylene, polysaccharides, polystyrene, polyurethanes,
polyvinylacetate, polyvinylchloride, polyvinylidene difluoride
(PVDF), polyvinylpyrrolidinone, rayon, resins, rubbers,
semiconductor materials, Sepharose.RTM., silica, silicon, styrene
copolymers, TEFLON.RTM., and variety of other polymers.
[0627] Substrates need not be flat and can include any type of
shape including spherical shapes (e.g., beads) or cylindrical
shapes (e.g., fibers). Materials attached to solid supports may be
attached to any portion of the solid support (e.g., may be attached
to an interior portion of a porous solid support material).
[0628] The substrate body may be in the form of a bead, box,
column, cylinder, disc, dish (e.g., glass dish, PETRI dish), fiber,
film, filter, microtiter plate (e.g., 96-well microtiter plate),
multi-bladed stick, net, pellet, plate, ring, rod, roll, sheet,
slide, stick, tray, tube, or vial. The substrate may be a singular
discrete body (e.g., a single tube, a single bead), any number of a
plurality of substrate bodies (e.g., a rack of 10 tubes, several
beads), or combinations thereof (e.g., a tray comprises a plurality
of microtiter plates, a column filled with beads, a microtiter
plate filed with beads).
[0629] An anti-IL-6 antibody or antigen-binding fragment thereof
may be "attached" to a substrate when it is associated with the
solid substrate through a non-random chemical or physical
interaction. The attachment may be through a covalent bond.
However, attachments need not be covalent or permanent. Materials
may be attached to a substrate through a "spacer molecule" or
"linker group." Such spacer molecules are molecules that have a
first portion that attaches to the biological material and a second
portion that attaches to the substrate. Thus, when attached to the
substrate, the spacer molecule separates the substrate and the
biological materials, but is attached to both. Methods of attaching
biological material (e.g., label) to a substrate are well known in
the art, and include but are not limited to chemical coupling.
[0630] Plates, such as microtiter plates, which support and contain
the solid-phase for solid-phase synthetic reactions may be used.
Microtiter plates may house beads that are used as the solid-phase.
By "particle" or "microparticle" or "nanoparticle" or "bead" or
"microbead" or "microsphere" herein is meant microparticulate
matter having any of a variety of shapes or sizes. The shape may be
generally spherical but need not be spherical, being, for example,
cylindrical or polyhedral. As will be appreciated by those in the
art, the particles may comprise a wide variety of materials
depending on their use, including, but not limited to, cross-linked
starch, dextrans, cellulose, proteins, organic polymers including
styrene polymers such as polystyrene and methylstyrene as well as
other styrene co-polymers, plastics, glass, ceramics, acrylic
polymers, magnetically responsive materials, colloids, thoriasol,
carbon graphite, titanium dioxide, nylon, latex, and TEFLON.RTM..
See e.g., "Microsphere Detection Guide" from Bangs Laboratories,
Fishers, Ind.
[0631] The anti-IL-6 antibody or antigen-binding fragment may be
attached to on any of the forms of substrates described herein
(e.g., bead, box, column, cylinder, disc, dish (e.g., glass dish,
PETRI dish), fiber, film, filter, microtiter plate (e.g., 96-well
microtiter plate), multi-bladed stick, net, pellet, plate, ring,
rod, roll, sheet, slide, stick, tray, tube, or vial). In
particular, particles or beads may be a component of a gelling
material or may be separate components such as latex beads made of
a variety of synthetic plastics (e.g., polystyrene). The label
(e.g., streptavidin) may be bound to a substrate (e.g., bead).
Assessment of Inflammatory Markers
[0632] Known inflammatory markers (e.g., IL-6) may be measured to
assess the risk for anemia or the severity of anemia. These markers
may be measured from serum, synovial fluid, or skin biopsies using
known methods in the art (e.g., immunassays).
IL-6 Serum Levels
[0633] Serum IL-6 levels may be measured as a pharmacodynamic
marker evaluate the effect of neutralization of IL-6 levels. Serum
IL-6 levels may be measured using an immunoassay (e.g., ELISA
assay). A decrease of serum IL-6 levels may be indicative of a
lessening of inflammation.
Serum Inflammatory Biomarkers
[0634] Serum biomarkers may be measured to determine the expression
of pro-inflammatory cytokines and other soluble biomarkers that may
correlate with anemia (e.g., anemia associated with chemotherapy or
radiotherapy) disease activity including but not limited to acute
phase reactants, serum pro-inflammatory cytokines (e.g., IL-1,
TNF-.alpha., IFN-.gamma., IL-12p40, IL-17), chemokines (e.g.,
RANTES, MIP-1.alpha., MCP-1), matrix metalloproteinases (e.g.,
MMP-2, MMP-3, MMP-9) and other biomarkers associated with
inflammation and autoimmune pathways that are known in the art.
Soluble biomarkers of bone and cartilage metabolism (e.g.,
osteocalcin and other collagen degradation products) may also be
assessed by an immunoassay (e.g., ELISA). A decrease in a serum
inflammatory biomark may be indicative of a lessening of
inflammation.
Immunohistochemistry of Skin Biopsies
[0635] Skin biopsies may be collected for biomarker analysis
including whole genome array analysis and immunohistochemistry
(IHC). Immunohistochemical analysis may include the measurement of
epidermal thickness, frequency of resident and inflammatory cell
populations (e.g., T cells, macrophages, keratinocytes) and other
inflammatory markers related to the IL-6 pathway known in the art.
Specifically, the following specific antigens may be assessed per
standard IHC procedure using the formalin-fixed samples: CD3, CD68,
keratin 16, FoxP3, IL-6R and MMP-3. A decrease in an inflammatory
biomarker in a skin biopsy may be indicative of a lessening of
inflammation.
Anemia Markers
[0636] Anemia may be assessed by assays well-known in the art such
as a Complete Blood Count (CBC) test that measures the red blood
cell (RBC) count, hematocrit, hemoglobin levels, white blood cell
count (CBC), differential blood count, and platelet count. The
first three parameters, the RBC, hematocrit, and hemoglobin levels
are the most commonly used in determining whether or not the
patient is suffering from anemia. Other anemia marker include the
measurement of the levels of serum ferritin and serum iron.
[0637] Hematocrit levels below about 42-52% for men or about 36-48%
for women are indicative of anemia. Serum ferritin levels below
about 30-400 ng/mL for men or about 13-150 ng/mL for women are
indicative of anemia. Serum iron levels below about 60-170 .mu.g/dL
is indicative of anemia. A reticulocyte count below about 0.5%-1.5%
is indicative of anemia. A white blood cell (WBC) count of below
about 5,000-10,000/mL is indicative of anemia and a red blood cell
(RBC) count of below about 4.5-5.5.times.10.sup.6/mL for men and
below about 4.0-5.0.times.10.sup.6/mL for women are indicative of
anemia. Further, a platelet count below about
1.4-4.0.times.10.sup.5/mL is indicative of anemia. Also,
Additionally, total iron binding capacity (TIBC) measures the level
for transferring in the blood and the normal levels are about
250-370 gtg/dL. Transferrin is a protein that carries iron in the
blood and a higher than normal TIBC value is a sign of
iron-deficiency anemia and a lower than normal level indicates
chronic anemia, pernicious anemia, or hemolytic anemia.
Additionally, tests for anemia include direct or indirect Coombs'
test, indirect bilirubin levels, serum haptoglobin, vitamin B12
levels, folate levels, and urine hemoglobin. MedlinePlus website
"Drug-induced immune hemolytic anemia." (2011) & D Medical
Center (2011) "Anemia-Diagnosis".
Administration
[0638] In one embodiment of the invention, the anti-IL-6 antibodies
described herein, or IL-6 binding fragments or variants thereof, as
well as combinations of said antibody fragments or variants, are
administered to a subject at a concentration of between about 0.1
and 20 mg/kg, such as about 0.4 mg/kg, about 0.8 mg/kg, about 1.6
mg/kg, or about 4 mg/kg, of body weight of recipient subject. For
example, compositions comprising the IL-6 antagonists described
herein may comprise at least about 0, 10, 20, 30, 40, 50, 60, 70,
80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210,
220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340,
350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470,
480, 490, or 500 mg. For example, compositions comprising the
anti-IL-6 antibodies described herein may comprise at least about
0, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140,
150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270,
280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400,
410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 mg.
[0639] For example, a composition for treating anemia may comprise
80, 160, or 320 mg of an anti-IL-6 antibody (e.g., Ab1). A
composition for treating drug-induced immune hemolytic anemia may
comprise 80, 160, or 320 mg of an anti-IL-6 antibody (e.g., Ab1). A
composition for treating anemia associated with chemotherapy may
comprise 80, 160, or 320 mg of an anti-IL-6 antibody (e.g., Ab1). A
composition for treating anemia associated with radiotherapy may
comprise 80, 160, or 320 mg of an anti-IL-6 antibody (e.g., Ab1). A
composition for treating anemia associated with cancer may comprise
80, 160, or 320 mg of an anti-IL-6 antibody (e.g., Ab1). For
example, compositions comprising the anti-IL-6 antibodies described
herein may comprise at least about 0.5-10 mg/kg of the anti-IL-6
antibody. In a preferred embodiment of the invention, the anti-IL-6
antibodies described herein, or IL-6 binding fragments or variants
thereof, as well as combinations of said antibody fragments or
variants, are administered to a subject at a concentration of about
0.4 mg/kg of body weight of recipient subject. In a preferred
embodiment of the invention, the anti-IL-6 antibodies described
herein, or IL-6 binding fragments or variants thereof, as well as
combinations of said antibody fragments or variants, are
administered to a recipient subject with a frequency of once every
twenty-six weeks or less, such as once every sixteen weeks or less,
once every eight weeks or less, or once every four weeks, or less.
In another preferred embodiment of the invention, the anti-IL-6
antibodies described herein, or IL-6 binding fragments or variants
thereof, as well as combinations thereof, are administered to a
recipient subject with a frequency at most once per period of
approximately one week, such as at most once per period of
approximately two weeks, such as at most once per period of
approximately four weeks, such as at most once per period of
approximately eight weeks, such as at most once per period of
approximately twelve weeks, such as at most once per period of
approximately sixteen weeks, such as at most once per period of
approximately twenty-four weeks.
[0640] The compositions described herein may be administered in any
of the following routes: buccal, epicutaneous, epidural, infusion,
inhalation, intraarterial, intracardial, intracerebroventricular,
intradermal, intramuscular, intranasal, intraocular,
intraperitoneal, intraspinal, intrathecal, intravenous, oral,
parenteral, pulmonary, rectally via an enema or suppository,
subcutaneous, subdermal, sublingual, transdermal, and transmucosal.
The preferred routes of administration are intravenous injection or
infusion. The administration can be local, where the composition is
administered directly, close to, in the locality, near, at, about,
or in the vicinity of, the site(s) of disease, e.g., local (joint)
or systemic, wherein the composition is given to the patient and
passes through the body widely, thereby reaching the site(s) of
disease. Local administration (e.g., subcutaneous injection) may be
accomplished by administration to the cell, tissue, organ, and/or
organ system, which encompasses and/or is affected by the disease,
and/or where the disease signs and/or symptoms are active or are
likely to occur (e.g., swollen joint). Administration can be
topical with a local effect, composition is applied directly where
its action is desired (e.g., joint). Further, administration of a
composition comprising an effective amount of an anti-IL-6 antibody
selected from the group consisting of Ab1-Ab36 or an
antigen-binding fragment thereof, may be subcutaneous.
[0641] For each of the recited embodiments, the compounds can be
administered by a variety of dosage forms as known in the art. Any
biologically-acceptable dosage form known to persons of ordinary
skill in the art, and combinations thereof, are contemplated.
Examples of such dosage forms include, without limitation, chewable
tablets, quick dissolve tablets, effervescent tablets,
reconstitutable powders, elixirs, liquids, solutions, suspensions,
emulsions, tablets, multi-layer tablets, bi-layer tablets,
capsules, soft gelatin capsules, hard gelatin capsules, caplets,
lozenges, chewable lozenges, beads, powders, gum, granules,
particles, microparticles, dispersible granules, cachets, douches,
suppositories, creams, topicals, inhalants, aerosol inhalants,
patches, particle inhalants, implants, depot implants, ingestibles,
injectables (including subcutaneous, intramuscular, intravenous,
and intradermal), infusions, and combinations thereof.
[0642] Other compounds which can be included by admixture are, for
example, medically inert ingredients (e.g., solid and liquid
diluent), such as lactose, dextrosesaccharose, cellulose, starch or
calcium phosphate for tablets or capsules, olive oil or ethyl
oleate for soft capsules and water or vegetable oil for suspensions
or emulsions; lubricating agents such as silica, talc, stearic
acid, magnesium or calcium stearate and/or polyethylene glycols;
gelling agents such as colloidal clays; thickening agents such as
gum tragacanth or sodium alginate, binding agents such as starches,
arabic gums, gelatin, methylcellulose, carboxymethylcellulose or
polyvinylpyrrolidone; disintegrating agents such as starch, alginic
acid, alginates or sodium starch glycolate; effervescing mixtures;
dyestuff; sweeteners; wetting agents such as lecithin, polysorbates
or laurylsulphates; and other therapeutically acceptable accessory
ingredients, such as humectants, preservatives, buffers and
antioxidants, which are known additives for such formulations.
[0643] Liquid dispersions for oral administration can be syrups,
emulsions, solutions, or suspensions. The syrups can contain as a
carrier, for example, saccharose or saccharose with glycerol and/or
mannitol and/or sorbitol. The suspensions and the emulsions can
contain a carrier, for example a natural gum, agar, sodium
alginate, pectin, methylcellulose, carboxymethylcellulose, or
polyvinyl alcohol.
[0644] In further embodiments, the present invention provides kits
including at least one containers comprising pharmaceutical dosage
units comprising an effective amount of at least one antibodies and
fragments thereof of the present invention. Kits may include
instructions, directions, labels, marketing information, warnings,
or information pamphlets.
Dosages
[0645] The amount of anti-IL-6 antibodies in a therapeutic
composition according to any embodiments of this invention may vary
according to factors such as the disease state, age, gender,
weight, patient history, risk factors, predisposition to disease,
administration route, pre-existing treatment regime (e.g., possible
interactions with other medications), and weight of the individual.
Dosage regimens may be adjusted to provide the optimum therapeutic
response. For example, a single bolus may be administered, several
divided doses may be administered over time, or the dose may be
proportionally reduced or increased as indicated by the exigencies
of therapeutic situation.
[0646] For example, for the treatment of anemia a composition
comprising at least about 80, 160, or 320 mg IL-6 antagonists may
be administered to a patient in need thereof. In another
embodiment, for the treatment of anemia associated with
chemotherapy a composition comprising at least about 80, 160, or
320 mg IL-6 antagonists may be administered to a patient in need
thereof. Further, for the treatment of anemia a composition
comprising at least about 80, 160, or 320 mg anti-IL-6 antibody
(e.g., Ab1) may be administered to a patient in need thereof. In
another embodiment, for the treatment of anemia associated with
chemotherapy a composition comprising at least about 80, 160, or
320 mg anti-IL-6 antibody (e.g., Ab1) may be administered to a
patient in need thereof. The dosage of IL-6 antagonist, may depend
upon the mode of administration. For example, for subcutaneous
administration of a composition comprising an IL-6 antagonist, the
composition may comprise at least about 1-500 mg/mL, 10-250 mg/mL,
10-100 mg/mL, or 40-100 mg/mL of an IL-antagonist. For example, a
composition for subcutaneous administration may comprise at least
about 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 mg/mL of an IL-6
antagonist. Thus, a composition for subcutaneous administration may
comprise at least about at least about 1-500 mg/mL, 10-250 mg/mL,
10-100 mg/mL, or 40-100 mg/mL of an anti-IL-6 antibody (e.g., Ab1).
or at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 mg/mL
of an anti-IL-6 antibody (e.g., Ab1). For intravenous
administration of a composition comprising an IL-6 antagonist, the
composition may comprise at least about 1-500 mg/mL, 10-250 mg/mL,
10-100 mg/mL, or 40-100 mg/mL of an IL-antagonist. For example, a
composition for intravenous administration may comprise at least
about 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 mg/mL of an IL-6
antagonist. Thus, a composition for intravenous administration may
comprise at least about at least about 1-500 mg/mL, 10-250 mg/mL,
10-100 mg/mL, or 40-100 mg/mL of an anti-IL-6 antibody (e.g., Ab1).
or at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 mg/mL
of an anti-IL-6 antibody (e.g., Ab1). Further, an intravenous
formulation of an Ab1 anti-IL-6 antibody may comprise at least
about 10 mg/mL or 40 mg/L for the treatment of rheumatoid arthritis
and a subcutaneous formulation of an Ab1 anti-IL-6 antibody may
comprise at least about 100 mg/mL for the treatment of rheumatoid
arthritis.
[0647] It is advantageous to formulate parenteral compositions in
dosage unit form for ease of administration and uniformity of
dosage. Dosage unit form as used herein refers to physically
discrete units suited as unitary dosages for the mammalian subjects
to be treated; each unit containing a predetermined quantity of
antibodies, or antigen-binding fragments thereof, calculated to
produce the desired therapeutic effect in association with the
required pharmaceutical carrier. The specification for the dosage
unit forms of the invention are dictated by and directly dependent
on the unique characteristics of the antibodies, and fragments
thereof, and the particular therapeutic effect to be achieved, and
the limitations inherent in the art of compounding such an
antibodies, and fragments thereof, for the treatment of sensitivity
in individuals. In therapeutic use for treatment of conditions in
mammals (e.g., humans) for which the antibodies and fragments
thereof of the present invention or an appropriate pharmaceutical
composition thereof are effective, the antibodies and fragments
thereof of the present invention may be administered in an
effective amount. The dosages as suitable for this invention may be
a composition, a pharmaceutical composition or any other
compositions described herein.
[0648] The dosage may be administered as a single dose, a double
dose, a triple dose, a quadruple dose, and/or a quintuple dose. The
dosages may be administered singularly, simultaneously, and
sequentially. For example, two doses may be administered on the
same day followed by subsequent two doses four weeks later.
[0649] The dosage form may be any form of release known to persons
of ordinary skill in the art. The compositions of the present
invention may be formulated to provide immediate release of the
active ingredient or sustained or controlled release of the active
ingredient. In a sustained release or controlled release
preparation, release of the active ingredient may occur at a rate
such that blood levels are maintained within a therapeutic range
but below toxic levels over an extended period of time (e.g., 4 to
24 hours). The preferred dosage forms include immediate release,
extended release, pulse release, variable release, controlled
release, timed release, sustained release, delayed release, long
acting, and combinations thereof, and are known in the art.
[0650] It will be appreciated that the pharmacological activity of
the compositions may be monitored using standard pharmacological
models that are known in the art. Furthermore, it will be
appreciated that the compositions comprising an anti-IL-6
antibodies or antigen-binding fragments thereof may be incorporated
or encapsulated in a suitable polymer matrix or membrane for
site-specific delivery, or may be functionalized with specific
targeting agents capable of effecting site specific delivery. These
techniques, as well as other drug delivery techniques are well
known in the art. Determination of optimal dosages for a particular
situation is within the capabilities of those skilled in the art.
See, e.g., Grennaro (2005) [Ed.] Remington: The Science and
Practice of Pharmacy [21.sup.st Ed.]
[0651] In another embodiment of the invention, the anti-IL-6
antibodies described herein, or IL-6 binding fragments or variants
thereof, as well as combinations of said antibody fragments or
variants, are administered to a subject in a pharmaceutical
formulation.
[0652] A "pharmaceutical composition" refers to a chemical or
biological composition suitable for administration to a mammal.
Such compositions may be specifically formulated for administration
via at least one of a number of routes, including but not limited
to buccal, epicutaneous, epidural, inhalation, intraarterial,
intracardial, intracerebroventricular, intradermal, intramuscular,
intranasal, intraocular, intraperitoneal, intraspinal, intrathecal,
intravenous, oral, parenteral, rectally via an enema or
suppository, subcutaneous, subdermal, sublingual, transdermal, and
transmucosal. In addition, administration can occur by means of
injection, powder, liquid, gel, drops, or other means of
administration. Further, a pharmaceutical composition comprising an
anti-IL-6 antibody described herein (e.g., ALD518) may be
administered subcutaneously.
[0653] In one embodiment of the invention, the anti-IL-6 antibodies
described herein, or IL-6 binding fragments or variants thereof, as
well as combinations of said antibody fragments or variants, may be
optionally administered in combination with at least one active
agents. Such active agents include analgesic, antipyretic,
anti-inflammatory, antibiotic, antiviral, and anti-cytokine agents.
Active agents include agonists, antagonists, and modulators of
TNF-alpha, IL-2, IL-4, IL-6, IL-10, IL-12, IL-13, IL-18, IFN-alpha,
IFN-gamma, BAFF, CXCL13, IP-10, VEGF, EPO, EGF, HRG, Hepatocyte
Growth Factor (HGF), Hepcidin, including antibodies reactive
against any of the foregoing, and antibodies reactive against any
of their receptors. Active agents also include 2-Arylpropionic
acids, Aceclofenac, Acemetacin, Acetylsalicylic acid (Aspirin),
Alclofenac, Alminoprofen, Amoxiprin, Ampyrone, Arylalkanoic acids,
Azapropazone, Benorylate/Benorilate, Benoxaprofen, Bromfenac,
Carprofen, Celecoxib, Choline magnesium salicylate, Clofezone,
COX-2 inhibitors, Dexibuprofen, Dexketoprofen, Diclofenac,
Diflunisal, Droxicam, Ethenzamide, Etodolac, Etoricoxib,
Faislamine, fenamic acids, Fenbufen, Fenoprofen, Flufenamic acid,
Flunoxaprofen, Flurbiprofen, Ibuprofen, Ibuproxam, Indometacin,
Indoprofen, Kebuzone, Ketoprofen, Ketorolac, Lornoxicam,
Loxoprofen, Lumiracoxib, Magnesium salicylate, Meclofenamic acid,
Mefenamic acid, Meloxicam, Metamizole, Methyl salicylate,
Mofebutazone, Nabumetone, Naproxen, N-Arylanthranilic acids,
Oxametacin, Oxaprozin, Oxicams, Oxyphenbutazone, Parecoxib,
Phenazone, Phenylbutazone, Phenylbutazone, Piroxicam, Pirprofen,
profens, Proglumetacin, Pyrazolidine derivatives, Rofecoxib,
Salicyl salicylate, Salicylamide, Salicylates, Sulfinpyrazone,
Sulindac, Suprofen, Tenoxicam, Tiaprofenic acid, Tolfenamic acid,
Tolmetin, and Valdecoxib. Antibiotics include Amikacin,
Aminoglycosides, Amoxicillin, Ampicillin, Ansamycins, Arsphenamine,
Azithromycin, Azlocillin, Aztreonam, Bacitracin, Carbacephem,
Carbapenems, Carbenicillin, Cefaclor, Cefadroxil, Cefalexin,
Cefalothin, Cefalotin, Cefamandole, Cefazolin, Cefdinir,
Cefditoren, Cefepime, Cefixime, Cefoperazone, Cefotaxime,
Cefoxitin, Cefpodoxime, Cefprozil, Ceftazidime, Ceftibuten,
Ceftizoxime, Ceftobiprole, Ceftriaxone, Cefuroxime, Cephalosporins,
Chloramphenicol, Cilastatin, Ciprofloxacin, Clarithromycin,
Clindamycin, Cloxacillin, Colistin, Co-trimoxazole, Dalfopristin,
Demeclocycline, Dicloxacillin, Dirithromycin, Doripenem,
Doxycycline, Enoxacin, Ertapenem, Erythromycin, Ethambutol,
Flucloxacillin, Fosfomycin, Furazolidone, Fusidic acid,
Gatifloxacin, Geldanamycin, Gentamicin, Glycopeptides, Herbimycin,
Imipenem, Isoniazid, Kanamycin, Levofloxacin, Lincomycin,
Linezolid, Lomefloxacin, Loracarbef, Macrolides, Mafenide,
Meropenem, Meticillin, Metronidazole, Mezlocillin, Minocycline,
Monobactams, Moxifloxacin, Mupirocin, Nafcillin, Neomycin,
Netilmicin, Nitrofurantoin, Norfloxacin, Ofloxacin, Oxacillin,
Oxytetracycline, Paromomycin, Penicillin, Penicillins,
Piperacillin, Platensimycin, Polymyxin B, Polypeptides, Prontosil,
Pyrazinamide, Quinolones, Quinupristin, Rifampicin, Rifampin,
Roxithromycin, Spectinomycin, Streptomycin, Sulfacetamide,
Sulfamethizole, Sulfanilimide, Sulfasalazine, Sulfisoxazole,
Sulfonamides, Teicoplanin, Telithromycin, Tetracycline,
Tetracyclines, Ticarcillin, Tinidazole, Tobramycin, Trimethoprim,
Trimethoprim-Sulfamethoxazole, Troleandomycin, Trovafloxacin, and
Vancomycin. Active agents also include Aldosterone, Beclometasone,
Betamethasone, Corticosteroids, Cortisol, Cortisone acetate,
Deoxycorticosterone acetate, Dexamethasone, Fludrocortisone
acetate, Glucocorticoids, Hydrocortisone, Methylprednisolone,
Prednisolone, Prednisone, Steroids, and Triamcinolone. Antiviral
agents include but are not limited to abacavir, aciclovir,
acyclovir, adefovir, amantadine, amprenavir, an antiretroviral
fixed dose combination, an antiretroviral synergistic enhancer,
arbidol, atazanavir, atripla, brivudine, cidofovir, combivir,
darunavir, delavirdine, didanosine, docosanol, edoxudine,
efavirenz, emtricitabine, enfuvirtide, entecavir, entry inhibitors,
famciclovir, fomivirsen, fosamprenavir, foscarnet, fosfonet, fusion
inhibitor, ganciclovir, gardasil, ibacitabine, idoxuridine,
imiquimod, imunovir, indinavir, inosine, integrase inhibitor,
interferon, interferon type I, interferon type II, interferon type
III, lamivudine, lopinavir, loviride, maraviroc, MK-0518,
moroxydine, nelfinavir, nevirapine, nexavir, nucleoside analogues,
oseltamivir, penciclovir, peramivir, pleconaril, podophyllotoxin,
protease inhibitor, reverse transcriptase inhibitor, ribavirin,
rimantadine, ritonavir, saquinavir, stavudine, tenofovir, tenofovir
disoproxil, tipranavir, trifluridine, trizivir, tromantadine,
truvada, valaciclovir, valganciclovir, vicriviroc, vidarabine,
viramidine, zalcitabine, zanamivir, and zidovudine. Any suitable
combination of these active agents is also contemplated.
[0654] A "pharmaceutical excipient" or a "pharmaceutically
acceptable excipient" is a carrier, usually a liquid, in which an
active therapeutic agent is formulated. In one embodiment of the
invention, the active therapeutic agent is a humanized antibody
described herein, or at least one fragments or variants thereof.
The excipient generally does not provide any pharmacological
activity to the formulation, though it may provide chemical and/or
biological stability, and release characteristics. Exemplary
formulations can be found, for example, in Grennaro (2005)
[Ed.]Remington: The Science and Practice of Pharmacy [21.sup.st
Ed.]
[0655] As used herein "pharmaceutically acceptable carrier" or
"excipient" includes any and all solvents, dispersion media,
coatings, antibacterial and antifungal agents, isotonic and
absorption delaying agents that are physiologically compatible. In
one embodiment, the carrier is suitable for parenteral
administration. Alternatively, the carrier can be suitable for
intravenous, intraperitoneal, intramuscular, or sublingual
administration. Pharmaceutically acceptable carriers include
sterile aqueous solutions or dispersions and sterile powders for
the extemporaneous preparation of sterile injectable solutions or
dispersions. The use of such media and agents for pharmaceutically
active substances is well known in the art. Except insofar as any
conventional media or agent is incompatible with the active
compound, use thereof in the pharmaceutical compositions of the
invention is contemplated. Supplementary active compounds can also
be incorporated into the compositions.
[0656] Pharmaceutical compositions typically must be sterile and
stable under the conditions of manufacture and storage. The
invention contemplates that the pharmaceutical composition is
present in lyophilized form. The composition may be formulated as a
solution, microemulsion, liposome, or other ordered structure
suitable to high drug concentration. The carrier may be a solvent
or dispersion medium containing, for example, water, ethanol,
polyol (for example, glycerol, propylene glycol, and liquid
polyethylene glycol), and suitable mixtures thereof. The invention
further contemplates the inclusion of a stabilizer in the
pharmaceutical composition.
[0657] The antibodies and fragments thereof, of the present
invention thereof may be formulated into pharmaceutical
compositions of various dosage forms. For example, the antibody may
be ALD518, a humanized anti-interleukin-6 (anti-IL-6) monoclonal
immunoglobulin 1 (IgG1) antibody manufactured in the yeast Pichia
pastoris. ALD518 may be supplied as a pH 6.0 frozen injection in
single-use vials (80 mg or 160 mg) for intravenous administration.
Exemplary non-active excipients include but are not limited to
histidine (e.g., 25 mM) and sorbitol (e.g., 250 mM). For example, a
160 mg formulation may comprise as non-active excipients, 25 mM
histidine, 250 mM sorbitol, and 0.015% polysorbate 80. To prepare
the pharmaceutical compositions of the invention, at least one
anti-IL-6 antibodies or binding fragments thereof, as the active
ingredient may be intimately mixed with appropriate carriers and
additives according to techniques well known to those skilled in
the art of pharmaceutical formulations. See Grennaro (2005) [Ed.]
Remington: The Science and Practice of Pharmacy [21.sup.stEd.] For
example, the antibodies described herein may be formulated in
phosphate buffered saline pH 7.2 and supplied as a 5.0 mg/mL clear
colorless liquid solution.
[0658] Similarly, compositions for liquid preparations include
solutions, emulsions, dispersions, suspensions, syrups, and
elixirs, with suitable carriers and additives including but not
limited to water, alcohols, oils, glycols, preservatives, flavoring
agents, coloring agents, and suspending agents. Typical
preparations for parenteral administration comprise the active
ingredient with a carrier such as sterile water or parenterally
acceptable oil including but not limited to polyethylene glycol,
polyvinyl pyrrolidone, lecithin, arachis oil or sesame oil, with
other additives for aiding solubility or preservation may also be
included. In the case of a solution, it may be lyophilized to a
powder and then reconstituted immediately prior to use. For
dispersions and suspensions, appropriate carriers and additives
include aqueous gums, celluloses, silicates, or oils.
[0659] For each of the recited embodiments, the anti-IL-6
antibodies or binding fragments thereof, may be administered by a
variety of dosage forms. Any biologically-acceptable dosage form
known to persons of ordinary skill in the art, and combinations
thereof, are contemplated. Examples of such dosage forms include,
without limitation, reconstitutable powders, elixirs, liquids,
solutions, suspensions, emulsions, powders, granules, particles,
microparticles, dispersible granules, cachets, inhalants, aerosol
inhalants, patches, particle inhalants, implants, depot implants,
injectables (including subcutaneous, intramuscular, intravenous,
and intradermal), infusions, and combinations thereof.
[0660] In many cases, it will be preferable to include isotonic
agents, e.g., sugars, polyalcohols such as mannitol, sorbitol, or
sodium chloride in the composition. Prolonged absorption of the
injectable compositions may be brought about by including in the
composition an agent which delays absorption, e.g., monostearate
salts and gelatin. Moreover, the compounds described herein may be
formulated in a time release formulation, e.g. in a composition
that includes a slow release polymer. The anti-IL-6 antibodies may
be prepared with carriers that will protect the compound against
rapid release, such as a controlled release formulation, including
implants and microencapsulated delivery systems. Biodegradable,
biocompatible polymers may be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters,
polylactic acid and polylactic, polyglycolic copolymers (PLG). Many
methods for the preparation of such formulations are known to those
skilled in the art.
[0661] In one embodiment of the invention that may be used to
intravenously administer antibodies of the invention, including
ALD518, for anemia, the administration formulation comprises, or
alternatively consists of, about 10.5 mg/mL of antibody, 25 mM
Histidine base, Phosphoric acid q.s. to pH 6, and 250 mM
sorbitol.
[0662] In another embodiment of the invention that may be used to
intravenously administer antibodies of the invention, including
ALD581, for anemia, the administration formulation comprises, or
alternatively consists of, about 10.5 mg/mL of antibody, 12.5 mM
Histidine base, 12.5 mM Histidine HCl (or 25 mM Histidine base and
Hydrochloric acid q.s. to pH 6), 250 mM sorbitol, and 0.015% (w/w)
Polysorbate 80.
[0663] In one embodiment of the invention that may be used to
subcutaneously administer antibodies of the invention, including
ALD518, for anemia, the administration formulation comprises, or
alternatively consists of, about 50 or 100 mg/mL of antibody, about
5 mM Histidine base, about 5 mM Histidine HCl to make final pH 6,
250 mM sorbitol, and 0.015% (w/w) Polysorbate 80. In another
embodiment of the invention that may be used to subcutaneously
administer antibodies of the invention, including Ab1, for anemia,
the administration formulation comprises, or alternatively consists
of, about 20 or 100 mg/mL of antibody, about 5 mM Histidine base,
about 5 mM Histidine HCl to make final pH 6, 250 to 280 mM sorbitol
(or sorbitol in combination with sucrose), and 0.015% (w/w)
Polysorbate 80, said formulation having a nitrogen headspace in the
shipping vials.
[0664] Pharmaceutical compositions typically must be sterile and
stable under the conditions of manufacture and storage. The
invention contemplates that the pharmaceutical composition is
present in lyophilized form. The composition can be formulated as a
solution, microemulsion, liposome, or other ordered structure
suitable to high drug concentration. The carrier can be a solvent
or dispersion medium containing, for example, water, ethanol,
polyol (for example, glycerol, propylene glycol, and liquid
polyethylene glycol), and suitable mixtures thereof. The invention
further contemplates the inclusion of a stabilizer in the
pharmaceutical composition.
[0665] In many cases, it will be preferable to include isotonic
agents, for example, sugars, polyalcohols such as mannitol,
sorbitol, or sodium chloride in the composition. Prolonged
absorption of the injectable compositions can be brought about by
including in the composition an agent which delays absorption, for
example, monostearate salts and gelatin. Moreover, the alkaline
polypeptide can be formulated in a time release formulation, for
example in a composition which includes a slow release polymer. The
active compounds can be prepared with carriers that will protect
the compound against rapid release, such as a controlled release
formulation, including implants and microencapsulated delivery
systems. Biodegradable, biocompatible polymers can be used, such as
ethylene vinyl acetate, polyanhydrides, polyglycolic acid,
collagen, polyorthoesters, polylactic acid and polylactic,
polyglycolic copolymers (PLG). Many methods for the preparation of
such formulations are known to those skilled in the art.
[0666] For each of the recited embodiments, the compounds can be
administered by a variety of dosage forms. Any
biologically-acceptable dosage form known to persons of ordinary
skill in the art, and combinations thereof, are contemplated.
Examples of such dosage forms include, without limitation,
reconstitutable powders, elixirs, liquids, solutions, suspensions,
emulsions, powders, granules, particles, microparticles,
dispersible granules, cachets, inhalants, aerosol inhalants,
patches, particle inhalants, implants, depot implants, injectables
(including subcutaneous, intramuscular, intravenous, and
intradermal), infusions, and combinations thereof.
[0667] A person of skill in the art would be able to determine an
effective dosage and frequency of administration through routine
experimentation, for example guided by the disclosure herein and
the teachings in Goodman, et al. (2011) Goodman & Gilman's The
Pharmacological Basis of Therapeutics [12.sup.th Ed.]; Howland, et
al. (2005) Lippincott's Illustrated Reviews: Pharmacology [2.sup.nd
Ed.]; and Golan, (2008) Principles of Pharmacology: The
Pathophysiologic Basis of Drug Therapy [2.sup.nd Ed.] See, also,
Grennaro (2005) [Ed.] Remington: The Science and Practice of
Pharmacy [21.sup.st Ed.]
[0668] The above description of various illustrated embodiments of
the invention is not intended to be exhaustive or to limit the
invention to the precise form disclosed. While specific embodiments
of, and examples for, the invention are described herein for
illustrative purposes, various equivalent modifications are
possible within the scope of the invention, as those skilled in the
relevant art will recognize. The teachings provided herein of the
invention can be applied to other purposes, other than the examples
described above.
[0669] These and other changes can be made to the invention in
light of the above detailed description. In general, in the
following claims, the terms used should not be construed to limit
the invention to the specific embodiments disclosed in the
specification and the claims. Accordingly, the invention is not
limited by the disclosure, but instead the scope of the invention
is to be determined entirely by the following claims.
[0670] The invention may be practiced in ways other than those
particularly described in the foregoing description and examples.
Numerous modifications and variations of the invention are possible
in light of the above teachings and, therefore, are within the
scope of the appended claims.
[0671] Certain teachings related to methods for obtaining a clonal
population of antigen-specific B cells were disclosed in U.S.
Patent Application Publication No. 2007/0269868.
[0672] Certain teachings related to humanization of rabbit-derived
monoclonal antibodies and preferred sequence modifications to
maintain antigen binding affinity were disclosed in U.S. Patent
Application Publication No. 2009/0104187.
[0673] Certain teachings related to producing antibodies or
fragments thereof using mating competent yeast and corresponding
methods were disclosed in U.S. Patent Application Publication No.
2006/0270045.
[0674] Certain teachings related to anti-IL-6 antibodies, methods
of producing antibodies or fragments thereof using mating competent
yeast and corresponding methods were disclosed in U.S. Patent
Application Publication No. 2009/0104187.
[0675] Certain teachings related to anti-IL-6 antibodies and
methods of using those antibodies or fragments thereof to address
certain diseases and/or disorders were disclosed in U.S. Patent
Application Publication No. 2010/0150829.
[0676] Certain anti-IL-6 antibody polynucleotides and polypeptides
are disclosed in the sequence listing accompanying this patent
application filing, and the disclosure of said sequence listing is
herein incorporated by reference in its entirety.
[0677] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the subject invention, and are
not intended to limit the scope of what is regarded as the
invention. Efforts have been made to ensure accuracy with respect
to the numbers used (e.g., amounts, temperature, concentrations)
but some experimental errors and deviations should be allowed for.
Unless otherwise indicated, parts are parts by weight, molecular
weight is average molecular weight, temperature is in degrees
centigrade; and pressure is at or near atmospheric.
EXAMPLES
[0678] In the following examples, the term "Ab1" refers to an
antibody comprising the light chain sequence of SEQ ID NO: 702 and
the heavy chain sequence of SEQ ID NO: 704, except where the
context indicates otherwise. The laboratory designation "Ab1" also
encompasses an anti-IL-6 antibody also known as "ALD518" and
"BMS-945429" comprising the light chain sequence of SEQ ID NO: 19
and the heavy chain sequence of SEQ ID NO: 20.
Example 1
Production of Enriched Antigen-Specific B Cell Antibody Culture
[0679] Panels of antibodies are derived by immunizing traditional
antibody host animals to exploit the native immune response to a
target antigen of interest. Typically, the host used for
immunization is a rabbit or other host that produces antibodies
using a similar maturation process and provides for a population of
antigen-specific B cells producing antibodies of comparable
diversity, e.g., epitopic diversity. The initial antigen
immunization can be conducted using complete Freund's adjuvant
(CFA), and the subsequent boosts effected with incomplete adjuvant.
At about 50-60 days after immunization, preferably at day 55,
antibody titers are tested, and the Antibody Selection (ABS)
process is initiated if appropriate titers are established. The two
key criteria for ABS initiation are potent antigen recognition and
function-modifying activity in the polyclonal sera.
[0680] At the time positive antibody titers are established,
animals are sacrificed and B cell sources isolated. These sources
include: the spleen, lymph nodes, bone marrow, and peripheral blood
mononuclear cells (PBMCs). Single cell suspensions are generated,
and the cell suspensions are washed to make them compatible for low
temperature long term storage. The cells are then typically
frozen.
[0681] To initiate the antibody identification process, a small
fraction of the frozen cell suspensions are thawed, washed, and
placed in tissue culture media. These suspensions are then mixed
with a biotinylated form of the antigen that was used to generate
the animal immune response, and antigen-specific cells are
recovered using the Miltenyi magnetic bead cell selection
methodology. Specific enrichment is conducted using streptavidin
beads. The enriched population is recovered and progressed in the
next phase of specific B cell isolation.
Example 2
Production of Clonal, Antigen-Specific B Cell-Containing
Culture
[0682] Enriched B cells produced according to Example 1 are then
plated at varying cell densities per well in a 96 well microtiter
plate. Generally, this is at 50, 100, 250, or 500 cells per well
with 10 plates per group. The media is supplemented with 4%
activated rabbit T cell conditioned media along with 50K frozen
irradiated EL4B feeder cells. These cultures are left undisturbed
for 5-7 days at which time supernatant-containing secreted antibody
is collected and evaluated for target properties in a separate
assay setting. The remaining supernatant is left intact, and the
plate is frozen at -70.degree. C. Under these conditions, the
culture process typically results in wells containing a mixed cell
population that comprises a clonal population of antigen-specific B
cells, i.e., a single well will only contain a single monoclonal
antibody specific to the desired antigen.
Example 3
Screening of Antibody Supernatants for Monoclonal Antibody of
Desired Specificity and/or Functional Properties
[0683] Antibody-containing supernatants derived from the well
containing a clonal antigen-specific B cell population produced
according to Example 2 are initially screened for antigen
recognition using ELISA methods. This includes selective antigen
immobilization (e.g., biotinylated antigen capture by streptavidin
coated plate), non-specific antigen plate coating, or
alternatively, through an antigen build-up strategy (e.g.,
selective antigen capture followed by binding partner addition to
generate a heteromeric protein-antigen complex). Antigen-positive
well supernatants are then optionally tested in a
function-modifying assay that is strictly dependant on the ligand.
One such example is an in vitro protein-protein interaction assay
that recreates the natural interaction of the antigen ligand with
recombinant receptor protein. Alternatively, a cell-based response
that is ligand dependent and easily monitored (e.g., proliferation
response) is utilized. Supernatant that displays significant
antigen recognition and potency is deemed a positive well. Cells
derived from the original positive well are then transitioned to
the antibody recovery phase.
Example 4
Recovery of Single, Antibody-Producing B Cell of Desired Antigen
Specificity
[0684] Cells are isolated from a well that contains a clonal
population of antigen-specific B cells (produced according to
Example 2 or 3), which secrete a single antibody sequence. The
isolated cells are then assayed to isolate a single,
antibody-secreting cell. Dynal.RTM. (magnetic beads) streptavidin
beads are coated with biotinylated target antigen under buffered
medium to prepare antigen-containing microbeads compatible with
cell viability. Next antigen-loaded beads, antibody-producing cells
from the positive well, and a fluorescein isothiocyanate
(FITC)-labeled anti-host H&L IgG antibody (as noted, the host
can be any mammalian host, e.g., rabbit, mouse, rat) are incubated
together at 37.degree. C. This mixture is then re-pipetted in
aliquots onto a glass slide such that each aliquot has on average a
single, antibody-producing B-cell. The antigen-specific,
antibody-secreting cells are then detected through fluorescence
microscopy. Secreted antibody is locally concentrated onto the
adjacent beads due to the bound antigen and provides localization
information based on the strong fluorescent signal.
Antibody-secreting cells are identified via FITC detection of
antibody-antigen complexes formed adjacent to the secreting cell.
The single cell found in the center of this complex is then
recovered using a micromanipulator. The cell is snap-frozen in an
eppendorf PCR tube for storage at -80.degree. C. until antibody
sequence recovery is initiated.
Example 5
Isolation of Antibody Sequences from Antigen-Specific B Cell
[0685] Antibody sequences are recovered using a combined RT-PCR
based method from a single isolated B-cell produced according to
Example 4 or an antigenic specific B cell isolated from the clonal
B cell population obtained according to Example 2. Primers are
designed to anneal in conserved and constant regions of the target
immunoglobulin genes (heavy and light), such as rabbit
immunoglobulin sequences, and a two-step nested PCR recovery step
is used to obtain the antibody sequence. Amplicons from each well
are analyzed for recovery and size integrity. The resulting
fragments are then digested with Alul to fingerprint the sequence
clonality. Identical sequences display a common fragmentation
pattern in their electrophoretic analysis. Significantly, this
common fragmentation pattern which proves cell clonality is
generally observed even in the wells originally plated up to 1000
cells/well. The original heavy and light chain amplicon fragments
are then restriction enzyme digested with HindIII and XhoI or
HindIII and BsiWI to prepare the respective pieces of DNA for
cloning. The resulting digestions are then ligated into an
expression vector and transformed into bacteria for plasmid
propagation and production. Colonies are selected for sequence
characterization.
Example 6
Recombinant Production of Monoclonal Antibody of Desired Antigen
Specificity and/or Functional Properties
[0686] Correct full-length antibody sequences for each well
containing a single monoclonal antibody is established and miniprep
DNA is prepared using Qiagen solid-phase methodology. This DNA is
then used to transfect mammalian cells to produce recombinant
full-length antibody. Crude antibody product is tested for antigen
recognition and functional properties to confirm the original
characteristics are found in the recombinant antibody protein.
Where appropriate, large-scale transient mammalian transfections
are completed, and antibody is purified through Protein A affinity
chromatography. Kd is assessed using standard methods (e.g.,
Biacore.RTM.) as well as IC50 in a potency assay.
Example 7
Preparation of Antibodies that Bind Human IL-6
[0687] By using the antibody selection protocol described herein,
one can generate an extensive panel of antibodies. The antibodies
have high affinity towards IL-6 (single to double digit pM Kd) and
demonstrate potent antagonism of IL-6 in multiple cell-based
screening systems (TI165 and HepG2). Furthermore, the collection of
antibodies displays distinct modes of antagonism toward IL-6-driven
processes.
Immunization Strategy
[0688] Rabbits were immunized with huIL-6 (R&R). Immunization
consisted of a first subcutaneous (sc) injection of 100 .mu.g in
complete Freund's adjuvant (CFA) (Sigma) followed by two boosts,
two weeks apart, of 50 .mu.g each in incomplete Freund's adjuvant
(IFA) (Sigma). Animals were bled on day 55, and serum titers were
determined by ELISA (antigen recognition) and by non-radioactive
proliferation assay (Promega) using the T1165 cell line.
Antibody Selection Titer Assessment
[0689] Antigen recognition was determined by coating Immulon 4
plates (Thermo) with 1 .mu.g/mL of huIL-6 (50 .mu.L/well) in
phosphate buffered saline (PBS, Hyclone) overnight at 4.degree. C.
On the day of the assay, plates were washed 3 times with PBS/Tween
20 (PBST tablets, Calbiochem). Plates were then blocked with 200
.mu.L/well of 0.5% fish skin gelatin (FSG, Sigma) in PBS for 30
minutes at 37.degree. C. Blocking solution was removed, and plates
were blotted. Serum samples were made (bleeds and pre-bleeds) at a
starting dilution of 1:100 (all dilutions were made in FSG 50
.mu.L/well) followed by 1:10 dilutions across the plate (column 12
was left blank for background control). Plates were incubated for
30 minutes at 37.degree. C. Plates were washed 3 times with
PBS/Tween 20. Goat anti-rabbit Fc-HRP (Pierce) diluted 1:5000 was
added to all wells (50 .mu.L/well), and plates were incubated for
30 minutes at 37.degree. C. Plates were washed as described above.
50 .mu.L/well of TMB-Stable stop (Fitzgerald Industries) was added
to plates, and color was allowed to develop, generally for 3 to 5
minutes. The development reaction was stopped with 50 .mu.L/well
0.5 M HCl. Plates were read at 450 nm. Optical density (OD) versus
dilution was plotted using Graph Pad Prizm software, and titers
were determined.
Functional Titer Assessment
[0690] The functional activity of the samples was determined by a
T1165 proliferation assay. T1165 cells were routinely maintained in
modified RPMI medium (Hyclone) supplemented with HEPES, sodium
pyruvate, sodium bicarbonate, L-glutamine, high glucose,
penicillin/streptomycin, 10% heat inactivated fetal bovine serum
(FBS) (all supplements from Hyclone), 2-mercaptoethanol (Sigma),
and 10 ng/mL of huIL-6 (R&D). On the day of the assay, cell
viability was determined by trypan blue (Invitrogen), and cells
were seeded at a fixed density of 20,000 cells/well. Prior to
seeding, cells were washed twice in the medium described above
without human-IL-6 (by centrifuging at 13000 rpm for 5 minutes and
discarding the supernatant). After the last wash, cells were
resuspended in the same medium used for washing in a volume
equivalent to 50 .mu.L/well. Cells were set aside at room
temperature.
[0691] In a round-bottom, 96-well plate (Costar), serum samples
were added starting at 1:100, followed by a 1:10 dilution across
the plate (columns 2 to 10) at 30 .mu.L/well in replicates of 5
(rows B to F: dilution made in the medium described above with no
huIL-6). Column 11 was medium only for IL-6 control. 30 .mu.L/well
of huIL-6 at 4.times. concentration of the final EC50
(concentration previously determined) were added to all wells
(huIL-6 was diluted in the medium described above). Wells were
incubated for 1 hour at 37.degree. C. to allow antibody binding to
occur. After 1 hour, 50 .mu.L/well of antibody-antigen (Ab-Ag)
complex were transferred to a flat-bottom, 96-well plate (Costar)
following the plate map format laid out in the round-bottom plate.
On Row G, 50 .mu.L/well of medium were added to all wells (columns
2 to 11) for background control. 50 .mu.L/well of the cell
suspension set aside were added to all wells (columns 2 to 11, rows
B to G). On Columns 1 and 12 and on rows A and H, 200 .mu.L/well of
medium was added to prevent evaporation of test wells and to
minimize edge effect. Plates were incubated for 72 hours at
37.degree. C. in 4% CO.sub.2. At 72 hours, 20 .mu.L/well of
CellTiter96 (Promega) reagents was added to all test wells per
manufacturer protocol, and plates were incubated for 2 hours at
37.degree. C. At 2 hours, plates were gently mixed on an orbital
shaker to disperse cells and to allow homogeneity in the test
wells. Plates were read at 490 nm wavelength. Optical density (OD)
versus dilution was plotted using Graph Pad Prizm software, and
functional titer was determined. A positive assay control plate was
conducted as described above using MAB2061 (R&D Systems) at a
starting concentration of 1 .mu.g/mL (final concentration) followed
by 1:3 dilutions across the plate.
Tissue Harvesting
[0692] Once acceptable titers were established, the rabbit(s) were
sacrificed. Spleen, lymph nodes, and whole blood were harvested and
processed as follows:
[0693] Spleen and lymph nodes were processed into a single cell
suspension by disassociating the tissue and pushing through sterile
wire mesh at 70 .mu.m (Fisher) with a plunger of a 20 cc syringe.
Cells were collected in the modified RPMI medium described above
without huIL-6, but with low glucose. Cells were washed twice by
centrifugation. After the last wash, cell density was determined by
trypan blue. Cells were centrifuged at 1500 rpm for 10 minutes; the
supernatant was discarded. Cells were resuspended in the
appropriate volume of 10% dimethyl sulfoxide (DMSO, Sigma) in FBS
(Hyclone) and dispensed at 1 mL/vial. Vials were then stored at
-70.degree. C. for 24 h prior to being placed in a liquid nitrogen
(LN2) tank for long-term storage.
[0694] Peripheral blood mononuclear cells (PBMCs) were isolated by
mixing whole blood with equal parts of the low glucose medium
described above without FBS. 35 mL of the whole blood mixture was
carefully layered onto 8 mL of Lympholyte Rabbit (Cedarlane) into a
45 mL conical tube (Corning) and centrifuged 30 minutes at 2500 rpm
at room temperature without brakes. After centrifugation, the PBMC
layers were carefully removed using a glass Pasteur pipette (VWR),
combined, and placed into a clean 50 mL vial. Cells were washed
twice with the modified medium described above by centrifugation at
1500 rpm for 10 minutes at room temperature, and cell density was
determined by trypan blue staining. After the last wash, cells were
resuspended in an appropriate volume of 10% DMSO/FBS medium and
frozen as described herein.
B cell culture
[0695] On the day of setting up B cell culture, PBMC, splenocyte,
or lymph node vials were thawed for use. Vials were removed from
LN2 tank and placed in a 37.degree. C. water bath until thawed.
Contents of vials were transferred into 15 mL conical centrifuge
tube (Corning) and 10 mL of modified RPMI described above was
slowly added to the tube. Cells were centrifuged for 5 minutes at
1.5K RPM, and the supernatant was discarded. Cells were resuspended
in 10 mL of fresh media. Cell density and viability was determined
by trypan blue. Cells were washed again and resuspended at 1E07
cells/80 .mu.L medium. Biotinylated huIL-6 (B huIL-6) was added to
the cell suspension at the final concentration of 3 g/mL and
incubated for 30 minutes at 4.degree. C. Unbound B huIL-6 was
removed with two 10 mL washes of phosphate-buffered (PBF):Ca/Mg
free PBS (Hyclone), 2 mM ethylenediamine tetraacetic acid (EDTA),
0.5% bovine serum albumin (BSA) (Sigma-biotin free). After the
second wash, cells were resuspended at 1E07 cells/80 .mu.L PBF. 20
.mu.L of MACS.RTM. streptavidin beads (Milteni)/10E7 cells were
added to the cell suspension. Cells were incubated at 4.degree. C.
for 15 minutes. Cells were washed once with 2 mL of PBF/10E7 cells.
After washing, the cells were resuspended at 1E08 cells/500 .mu.L
of PBF and set aside. A MACS.RTM. MS column (Milteni) was
pre-rinsed with 500 mL of PBF on a magnetic stand (Milteni). Cell
suspension was applied to the column through a pre-filter, and
unbound fraction was collected. The column was washed with 1.5 mL
of PBF buffer. The column was removed from the magnet stand and
placed onto a clean, sterile 5 mL Polypropylene Falcon tube. 1 mL
of PBF buffer was added to the top of the column, and positive
selected cells were collected. The yield and viability of positive
and negative cell fraction was determined by trypan blue staining.
Positive selection yielded an average of 1% of the starting cell
concentration.
[0696] A pilot cell screen was established to provide information
on seeding levels for the culture. Three 10-plate groups (a total
of 30 plates) were seeded at 50, 100, and 200 enriched B
cells/well. In addition, each well contained 50K cells/well of
irradiated EL-4.B5 cells (5,000 Rads) and an appropriate level of T
cell supernatant (ranging from 1-5% depending on preparation) in
high glucose modified RPMI medium at a final volume of 250
.mu.L/well. Cultures were incubated for 5 to 7 days at 37.degree.
C. in 4% CO.sub.2.
Identification of Selective Antibody Secreting B Cells
[0697] Cultures were tested for antigen recognition and functional
activity between days 5 and 7.
Antigen Recognition Screening
[0698] The ELISA format used is as described above except 50 .mu.L
of supernatant from the B cell cultures (BCC) wells (all 30 plates)
was used as the source of the antibody. The conditioned medium was
transferred to antigen-coated plates. After positive wells were
identified, the supernatant was removed and transferred to a
96-well master plate(s). The original culture plates were then
frozen by removing all the supernatant except 40 .mu.L/well and
adding 60 .mu.L/well of 16% DMSO in FBS. Plates were wrapped in
paper towels to slow freezing and placed at -70.degree. C.
Functional Activity Screening
[0699] Master plates were then screened for functional activity in
the T1165 proliferation assay as described before, except row B was
media only for background control, row C was media+IL-6 for
positive proliferation control, and rows D-G and columns 2-11 were
the wells from the BCC (50 .mu.L/well, single points). 40 .mu.L of
IL-6 was added to all wells except the media row at 2.5 times the
EC50 concentration determined for the assay. After 1 hour
incubation, the Ab/Ag complex was transferred to a tissue culture
(TC) treated, 96-well, flat-bottom plate. 20 .mu.L of cell
suspension in modified RPMI medium without huIL-6 (T1165 at 20,000
cells/well) was added to all wells (100 .mu.L final volume per
well). Background was subtracted, and observed OD values were
transformed into % of inhibition.
B Cell Recovery
[0700] Plates containing wells of interest were removed from
-70.degree. C., and the cells from each well were recovered with
5-200 .mu.L washes of medium/well. The washes were pooled in a 1.5
mL sterile centrifuge tube, and cells were pelleted for 2 minutes
at 1500 rpm.
[0701] The tube was inverted, the spin repeated, and the
supernatant carefully removed. Cells were resuspended in 100
.mu.L/tube of medium. 100 .mu.L biotinylated IL-6 coated
streptavidin M280 dynabeads (Invitrogen) and 16 .mu.L of goat
anti-rabbit H&L IgG-FITC diluted 1:100 in medium was added to
the cell suspension.
[0702] 20 .mu.L of cell/beads/FITC suspension was removed, and 5
.mu.L droplets were prepared on a glass slide (Corning) previously
treated with Sigmacote (Sigma), 35 to 40 droplets/slide. An
impermeable barrier of paraffin oil (JT Baker) was added to
submerge the droplets, and the slide was incubated for 90 minutes
at 37.degree. C., 4% CO.sub.2 in the dark.
[0703] Specific B cells that produce antibody can be identified by
the fluorescent ring around them due to antibody secretion,
recognition of the bead-associated biotinylated antigen, and
subsequent detection by the fluorescent-IgG detection reagent. Once
a cell of interest was identified, the cell in the center of the
fluorescent ring was recovered via a micromanipulator (Eppendorf).
The single cell synthesizing and exporting the antibody was
transferred into a 250 .mu.L microcentrifuge tube and placed in dry
ice. After recovering all cells of interest, these were transferred
to -70.degree. C. for long-term storage.
Example 8
Yeast Cell Expression
[0704] Antibody Genes:
[0705] Genes were cloned and constructed that directed the
synthesis of a chimeric humanized rabbit monoclonal antibody.
[0706] Expression Vector:
[0707] The vector contains the following functional components: 1)
a mutant ColE1 origin of replication, which facilitates the
replication of the plasmid vector in cells of the bacterium
Escherichia coli; 2) a bacterial Sh ble gene, which confers
resistance to the antibiotic Zeocin.RTM. (phleomycin) and serves as
the selectable marker for transformations of both E. coli and P.
pastoris; 3) an expression cassette composed of the glyceraldehyde
dehydrogenase gene (GAP gene) promoter, fused to sequences encoding
the Saccharomyces cerevisiae alpha mating factor pre pro secretion
leader sequence, followed by sequences encoding a P. pastoris
transcriptional termination signal from the P. pastoris alcohol
oxidase I gene (AOX1). The Zeocin.RTM. (phleomycin) resistance
marker gene provides a means of enrichment for strains that contain
multiple integrated copies of an expression vector in a strain by
selecting for transformants that are resistant to higher levels of
Zeocin.RTM. (phleomycin).
[0708] Pichia pastoris Strains:
[0709] Pichia pastoris strains met1, lys3, ura3 and ade1 may be
used. Although any two complementing sets of auxotrophic strains
could be used for the construction and maintenance of diploid
strains, these two strains are especially suited for this method
for two reasons. First, they grow more slowly than diploid strains
that are the result of their mating or fusion. Thus, if a small
number of haploid ade1 or ura3 cells remain present in a culture or
arise through meiosis or other mechanism, the diploid strain should
outgrow them in culture.
[0710] The second is that it is easy to monitor the sexual state of
these strains since diploid Ade+ colonies arising from their mating
are a normal white or cream color, whereas cells of any strains
that are haploid ade1 mutants will form a colony with a distinct
pink color. In addition, any strains that are haploid ura3 mutants
are resistant to the drug 5-fluoro-orotic acid (FOA) and can be
sensitively identified by plating samples of a culture on minimal
medium+uracil plates with FOA. On these plates, only
uracil-requiring ura3 mutant (presumably haploid) strains can grow
and form colonies. Thus, with haploid parent strains marked with
ade1 and ura3, one can readily monitor the sexual state of the
resulting antibody-producing diploid strains (haploid versus
diploid).
Methods
[0711] Construction of pGAPZ-alpha expression vectors for
transcription of light and heavy chain antibody genes. The
humanized light and heavy chain fragments were cloned into the
pGAPZ expression vectors through a PCR directed process. The
recovered humanized constructs were subjected to amplification
under standard KOD polymerase (Novagen) kit conditions ((1)
94.degree. C., 2 minutes; (2) 94.degree. C., 30 seconds (3)
55.degree. C., 30 seconds; (4) 72.degree. C., 30 seconds-cycling
through steps 2-4 for 35 times; (5) 72.degree. C. 2 minutes)
employing the following primers (1) light chain forward
AGCGCTTATTCCGCTATCCAGATGACCCAGTC-the AfeI site is single underlined
(SEQ ID NO: 729). The end of the HSA signal sequence is double
underlined, followed by the sequence for the mature variable light
chain (not underlined); the reverse CGTACGTTTGATTCCACCTTG (SEQ ID
NO: 730).
[0712] Variable light chain reverse primer. BsiWI site is
underlined, followed by the reverse complement for the 3' end of
the variable light chain. Upon restriction enzyme digest with AfeI
and BsiWI this enable insertion in-frame with the pGAPZ vector
using the human HAS leader sequence in frame with the human kapp
light chain constant region for export. (2) A similar strategy is
performed for the heavy chain. The forward primer employed is
TABLE-US-00008 (SEQ ID NO: 731)
AGCGCTTATTCCGAGGTGCAGCTGGTGGAGTC.
The AfeI site is single underlined. The end of the HSA signal
sequence is double underlined, followed by the sequence for the
mature variable heavy chain (not underlined). The reverse heavy
chain primer is CTCGAGACGGTGACGAGGGT (SEQ ID NO: 732). The XhoI
site is underlined, followed by the reverse complement for the 3'
end of the variable heavy chain. This enables cloning of the heavy
chain in-frame with IgG-.gamma.l CH1-CH2-CH3 region previous
inserted within pGAPZ using a comparable directional cloning
strategy.
[0713] Transformation of Expression Vectors into Haploid Ade1 Ura3,
Met1 and Lys3 Host Strains of P. pastoris.
[0714] All methods used for transformation of haploid P. pastoris
strains and genetic manipulation of the P. pastoris sexual cycle
are as described in Higgins, D. R., and Cregg, J. M., Eds. 1998.
Pichia Protocols. Methods in Molecular Biology. Humana Press,
Totowa, N.J.
[0715] Prior to transformation, each expression vector is
linearized within the GAP promoter sequences with AvrII to direct
the integration of the vectors into the GAP promoter locus of the
P. pastoris genome. Samples of each vector are then individually
transformed into electrocompetent cultures of the ade1, ura3, met1
and lys3 strains by electroporation and successful transformants
are selected on YPD Zeocin.RTM. (phleomycin) plates by their
resistance to this antibiotic. Resulting colonies are selected,
streaked for single colonies on YPD Zeocin.RTM. (phleomycin) plates
and then examined for the presence of the antibody gene insert by a
PCR assay on genomic DNA extracted from each strain for the proper
antibody gene insert and/or by the ability of each strain to
synthesize an antibody chain by a colony lift/immunoblot method.
Wung, et al. (1996) Biotechniques 21: 808-812. Haploid ade1, met1
and lys3 strains expressing one of the three heavy chain constructs
are collected for diploid constructions along with haploid ura3
strain expressing light chain gene. The haploid expressing heavy
chain genes are mated with the appropriate light chain haploid ura3
to generate diploid secreting protein.
[0716] Mating of haploid strains synthesizing a single antibody
chain and selection of diploid derivatives synthesizing tetrameric
functional antibodies. To mate P. pastoris haploid strains, each
ade1 (or met1 or lys3) heavy chain producing strain to be crossed
is streaked across a rich YPD plate and the ura3 light chain
producing strain is streaked across a second YPD plate (.about.10
streaks per plate). After one or two days incubation at 30.degree.
C., cells from one plate containing heavy chain strains and one
plate containing ura3 light chain strains are transferred to a
sterile velvet cloth on a replica-plating block in a cross hatched
pattern so that each heavy chain strain contain a patch of cells
mixed with each light chain strain. The cross-streaked replica
plated cells are then transferred to a mating plate and incubated
at 25.degree. C. to stimulate the initiation of mating between
strains. After two days, the cells on the mating plates are
transferred again to a sterile velvet on a replica-plating block
and then transferred to minimal medium plates. These plates are
incubated at 30.degree. C. for three days to allow for the
selective growth of colonies of prototrophic diploid strains.
Colonies that arose are picked and streaked onto a second minimal
medium plate to single colony isolate and purify each diploid
strain. The resulting diploid cell lines are then examined for
antibody production.
[0717] Putative diploid strains are tested to demonstrate that they
are diploid and contain both expression vectors for antibody
production. For diploidy, samples of a strain are spread on mating
plates to stimulate them to go through meiosis and form spores.
Haploid spore products are collected and tested for phenotype. If a
significant percentage of the resulting spore products are single
or double auxotrophs it may be concluded that the original strain
must have been diploid. Diploid strains are examined for the
presence of both antibody genes by extracting genomic DNA from each
and utilizing this DNA in PCR reactions specific for each gene.
[0718] Fusion of haploid strains synthesizing a single antibody
chain and selection of diploid derivatives synthesizing tetrameric
functional antibodies. As an alternative to the mating procedure
described above, individual cultures of single-chain antibody
producing haploid ade1 and ura3 strains are spheroplasted and their
resulting spheroplasts fused using polyethylene glycol/CaCl.sub.2.
The fused haploid strains are then embedded in agar containing 1 M
sorbitol and minimal medium to allow diploid strains to regenerate
their cell wall and grow into visible colonies. Resulting colonies
are picked from the agar, streaked onto a minimal medium plate, and
the plates are incubated for two days at 30.degree. C. to generate
colonies from single cells of diploid cell lines. The resulting
putative diploid cell lines are then examined for diploidy and
antibody production as described above.
[0719] Purification and analysis of antibodies. A diploid strain
for the production of full length antibody is derived through the
mating of met1 light chain and lys3 heavy chain using the methods
described above. Culture media from shake-flask or fermenter
cultures of diploid P. pastoris expression strains are collected
and examined for the presence of antibody protein via SDS-PAGE and
immunoblotting using antibodies directed against heavy and light
chains of human IgG, or specifically against the heavy chain of
IgG.
[0720] To purify the yeast secreted antibodies, clarified media
from antibody producing cultures are passed through a protein A
column and after washing with 20 mM sodium phosphate, pH 7.0,
binding buffer, protein A bound protein is eluted using 0.1 M
glycine HCl buffer, pH 3.0. Fractions containing the most total
protein are examined by Coomasie blue strained SDS-PAGE and
immunoblotting for antibody protein. Antibody is characterized
using the ELISA described above for IL-6 recognition.
[0721] Assay for antibody activity. The recombinant yeast-derived
humanized antibody is evaluated for functional activity through the
IL-6 driven T1165 cell proliferation assay and IL-6 stimulated
HepG2 haptoglobin assay described above.
Example 9
Acute Phase Response Neutralization by Intravenous Administration
of Anti-IL-6 Antibody Ab1
[0722] Human IL-6 can provoke an acute phase response in rats, and
one of the major acute phase proteins that is stimulated in the rat
is alpha-2 macroglobulin (A2M). A study was designed to assess the
dose of antibody Ab1 required to ablate the A2M response to a
single subcutaneous injection of 100 .mu.g of human IL-6 given one
hour after different doses (0.03, 0.1, 0.3, 1, and 3 mg/kg) of
antibody Ab1 administered intravenously (n=10 rats/dose level) or
polyclonal human IgG1 as the control (n=10 rats). Plasma was
recovered and the A2M was quantitated via a commercial sandwich
ELISA kit (ICL Inc., Newberg Oreg.; cat. no.-E-25A2M). The endpoint
was the difference in the plasma concentration of A2M at the 24
hour time point (post-Ab1).
[0723] The ID50 for antibody Ab1 was 0.1 mg/kg with complete
suppression of the A2M response at the 0.3 mg/kg. See FIG. 6. This
demonstrates that the IL-6 may be neutralized in vivo by anti-IL-6
antibodies described herein.
Example 10
RXF393 Cachexia Model Study 1
Introduction
[0724] The human renal cell cancer cell line, RXF393 produces
profound weight loss when transplanted into athymic nude mice.
Weight loss begins around day 15 after transplantation with 80% of
all animals losing at least 30% of their total body weight by day
18-20 after transplantation. RXF393 secretes human IL-6 and the
plasma concentration of human IL-6 in these animals is very high at
around 10 ng/ml. Human IL-6 can bind murine soluble IL-6 receptor
and activate IL-6 responses in the mouse. Human IL-6 is
approximately 10 times less potent than murine IL-6 at activating
IL-6 responses in the mouse. The objectives of this study were to
determine the effect of antibody Ab1, on survival, body weight,
serum amyloid A protein, hematology parameters, and tumor growth in
athymic nude mice transplanted with the human renal cell cancer
cell line, RXF393.
Methods
[0725] Eighty, 6 week old, male athymic nude mice were implanted
with RXF393 tumor fragments (30-40 mg) subcutaneously in the right
flank. Animals were then divided into eight groups of ten mice.
Three groups were given either antibody Ab1 at 3 mg/kg, 10 mg/kg,
or 30 mg/kg intravenously weekly on day 1, day 8, day 15 and day 22
after transplantation (progression groups). Another three groups
were given either antibody Ab1 at 3 mg/kg, or 10 mg/kg, or 30 mg/kg
intravenously weekly on day 8, day 15 and day 22 after
transplantation (regression groups). Finally, one control group was
given polyclonal human IgG 30 mg/kg and a second control group was
given phosphate buffered saline intravenously weekly on day 1, day
8, day 15 and day 22 after transplantation.
[0726] Animals were euthanized at either day 28, when the tumor
reached 4,000 mm.sup.3 or if they became debilitated (>30% loss
of body weight). Animals were weighed on days 1, 6 and then daily
from days 9 to 28 after transplantation. Mean Percent Body Weight
(MPBW) was used as the primary parameter to monitor weight loss
during the study. It was calculated as follows: (Body Weight-Tumor
Weight)/Baseline Body Weight.times.100. Tumor weight was measured
on days 1, 6, 9, 12, 15, 18, 22, 25 and 28 after transplantation.
Blood was taken under anesthesia from five mice in each group on
days 5 and 13 and all ten mice in each group when euthanized (day
28 in most cases). Blood was analyzed for hematology and serum
amyloid A protein (SAA) concentration. An additional group of 10
non-tumor bearing 6 week old, athymic nude male mice had blood
samples taken for hematology and SAA concentration estimation to
act as a baseline set of values.
Results--Survival
[0727] No animals were euthanized or died in any of the antibody
Ab1 groups prior to the study termination date of day 28. In the
two control groups, 15 animals (7/9 in the polyclonal human IgG
group and 8/10 in the phosphate buffered saline group) were found
dead or were euthanized because they were very debilitated (>30%
loss of body weight). Median survival time in both control groups
was 20 days.
[0728] The survival curves for the two control groups and the
antibody Ab1 progression (dosed from day 1 of the study) groups are
presented in FIG. 7.
[0729] The survival curves for the two control groups and the
antibody Ab1 regression (dosed from day 8 of the study) groups are
presented in FIG. 8.
[0730] There was a statistically significant difference between the
survival curves for the polyclonal human IgG (p=0.0038) and
phosphate buffered saline (p=0.0003) control groups and the
survival curve for the six antibody Ab1 groups. There was no
statistically significant difference between the two control groups
(p=0.97).
Results--Tumor Size
[0731] Tumor size in surviving mice was estimated by palpation. For
the first 15 days of the study, none of the mice in any group were
found dead or were euthanized, and so comparison of tumor sizes
between groups on these days was free from sampling bias. No
difference in tumor size was observed between the antibody Ab1
progression or regression groups and the control groups through day
15. Comparison of the tumor size between surviving mice in the
control and treatment groups subsequent to the onset of mortality
in the controls (on day 15) was not undertaken because tumor size
the surviving control mice was presumed to be biased and
accordingly the results of such comparison would not be
meaningful.
[0732] As administration of antibody Ab1 promoted survival without
any apparent reduction in tumor size, elevated serum IL-6 may
contribute to mortality through mechanisms independent of tumor
growth. These observations supports the hypothesis that antibody
Ab1 can promote cancer patient survivability without directly
affecting tumor growth, possibly by enhancing general patient
well-being.
Results--Weight Loss
[0733] Compared to controls, mice dosed with Ab1 were protected
from weight loss. On day 18, MPBW in control mice was 75%,
corresponding to an average weight loss of 25%. In contrast, on the
same day, MPBW in Ab-1 treatment groups was minimally changed
(between 97% and 103%). There was a statistically significant
difference between the MPBW curves for the controls (receiving
polyclonal human IgG or PBS) and the 10 mg/kg dosage group
(p<0.0001) or 3 mg/kg and 30 mg/kg dosage groups (p<0.0005).
There was no statistically significant difference between the two
control groups.
[0734] Control mice are emaciated compared to the normal appearance
of the Ab1-treated mouse. These results suggest that Ab1 may be
useful to prevent or treat cachexia caused by elevated IL-6 in
humans.
Results--Plasma Serum Amyloid A
[0735] The mean (.+-.SEM) plasma serum amyloid A concentration
versus time for the two control groups and the antibody Ab1
progression (dosed from day 1 of the study) and regression (dosed
from day 8 of the study) groups are presented in Table 7.
TABLE-US-00009 TABLE 7 Mean Plasma SAA- antibody Ab1, all groups
versus control groups Mean Plasma Mean Plasma Mean Plasma SAA .+-.
SAA .+-. SAA .+-. SEM Day 5 SEM Day 13 SEM Terminal (.mu.g/ml)
(.mu.g/ml) Bleed (.mu.g/ml) Polyclonal IgG 30 675 .+-. 240 3198
.+-. 628 13371 .+-. 2413 mg/kg iv weekly from (n = 5) (n = 4) (n =
4) day 1 PBS iv weekly from 355 .+-. 207 4844 .+-. 1126 15826 .+-.
802 day 1 (n = 5) (n = 5) (n = 3) Ab1 30 mg/kg iv 246 .+-. 100 2979
.+-. 170 841 .+-. 469 weekly from day 1 (n = 5) (n = 5) (n = 10)
Ab1 10 mg/kg iv 3629 .+-. 624 3096 .+-. 690 996 .+-. 348 weekly
from day 1 (n = 5) (n = 5) (n = 10) Ab1 3 mg/kg iv 106 .+-. 9 1623
.+-. 595 435 .+-. 70 weekly from day 1 (n = 5) (n = 4) (n = 9) Ab1
30 mg/kg iv 375 .+-. 177 1492 .+-. 418 498 .+-. 83 weekly from day
8 (n = 5) (n = 4) (n = 9) Ab1 10 mg/kg iv 487 .+-. 170 1403 .+-.
187 396 .+-. 58 weekly from day 8 (n = 5) (n = 5) (n = 10) Ab1 3
mg/kg iv 1255 .+-. 516 466 .+-. 157 685 .+-. 350 weekly from day 8
(n = 5) (n = 5) (n = 5)
[0736] SAA is up-regulated via the stimulation of hIL-6 and this
response is directly correlated with circulating levels of hIL-6
derived from the implanted tumor. The surrogate marker provides an
indirect readout for active hIL-6. Thus in the two treatment groups
described above there are significantly decreased levels of SAA due
to the neutralization of tumor-derived hIL-6. This further supports
the contention that antibody Ab1 displays in vivo efficacy.
Example 11
RXF393 Cachexia Model Study 2
Introduction
[0737] A second study was performed in the RXF-393 cachexia model
where treatment with antibody Ab1 was started at a later stage
(days 10 and 13 post-transplantation) and with a more prolonged
treatment phase (out to 49 days post transplantation). The dosing
interval with antibody Ab1 was shortened to 3 days from 7 and also
daily food consumption was measured. There was also an attempt to
standardize the tumor sizes at the time of initiating dosing with
antibody Ab1.
Methods
[0738] Eighty, 6 week old, male athymic nude mice were implanted
with RXF393 tumor fragments (30-40 mg) subcutaneously in the right
flank. 20 mice were selected whose tumors had reached between
270-320 mg in size and divided into two groups. One group received
antibody Ab1 at 10 mg/kg i.v. every three days and the other group
received polyclonal human IgG 10 mg/kg every 3 days from that
time-point (day 10 after transplantation). Another 20 mice were
selected when their tumor size had reached 400-527 mg in size and
divided into two groups. One group received antibody Ab1 at 10
mg/kg i.v. every three days and the other group received polyclonal
human IgG 10 mg/kg every 3 days from that time-point (day 13 after
transplantation). The remaining 40 mice took no further part in the
study and were euthanized at either day 49, when the tumor reached
4,000 mm.sup.3 or if they became very debilitated (>30% loss of
body weight).
[0739] Animals were weighed every 3-4 days from day 1 to day 49
after transplantation. Mean Percent Body Weight (MPBW) was used as
the primary parameter to monitor weight loss during the study. It
was calculated as follows: ((Body Weight-Tumor Weight)/Baseline
Body Weight).times.100. Tumor weight was measured every 3-4 days
from day 5 to day 49 after transplantation. Food consumption was
measured (amount consumed in 24 hours by weight (g) by each
treatment group) every day from day 10 for the 270-320 mg tumor
groups and day 13 for the 400-527 mg tumor groups.
Results--Survival
[0740] The survival curves for antibody Ab1 at 10 mg/kg i.v. every
three days (270-320 mg tumor size) and for the polyclonal human IgG
10 mg/kg i.v. every three days (270-320 mg tumor size) are
presented in FIG. 9.
[0741] Median survival for the antibody Ab1 at 10 mg/kg i.v. every
three days (270-320 mg tumor size) was 46 days and for the
polyclonal human IgG at 10 mg/kg i.v. every three days (270-320 mg
tumor size) was 32.5 days (p=0.0071).
[0742] The survival curves for the antibody Ab1 at 10 mg/kg i.v.
every three days (400-527 mg tumor size) and for the polyclonal
human IgG at 10 mg/kg i.v. every three days (400-527 mg tumor size)
are presented in FIG. 10. Median survival for the antibody Ab1 at
10 mg/kg i.v. every three days (400-527 mg tumor size) was 46.5
days and for the polyclonal human IgG at 10 mg/kg i.v. every three
days (400-527 mg tumor size) was 27 days (p=0.0481).
Example 12
Multi-Dose Pharmacokinetic Evaluation of Antibody Ab1 in Non-Human
Primates
[0743] Antibody Ab1 was dosed in a single bolus infusion to a
single male and single female cynomologus monkey in phosphate
buffered saline. Plasma samples were removed at fixed time
intervals and the level of antibody Ab1 was quantitated through of
the use of an antigen capture ELISA assay. Biotinylated IL-6 (50
.mu.l of 3 .mu.g/mL) was captured on Streptavidin coated 96 well
microtiter plates. The plates were washed and blocked with 0.5%
Fish skin gelatin. Appropriately diluted plasma samples were added
and incubated for 1 hour at room temperature. The supernatants
removed and an anti-hFc-HRP conjugated secondary antibody applied
and left at room temperature.
[0744] The plates were then aspirated and TMB added to visualize
the amount of antibody. The specific levels were then determined
through the use of a standard curve. A second dose of antibody Ab1
was administered at day 35 to the same two cynomologus monkeys and
the experiment replicated using an identical sampling plan.
[0745] This humanized full length aglycosylated antibody expressed
and purified Pichia pastoris displays comparable characteristics to
mammalian expressed protein. In addition, multiple doses of this
product display reproducible half-lives inferring that this
production platform does not generate products that display
enhanced immunogenicity.
Example 13
Octet Mechanistic Characterization of Antibody Proteins
[0746] IL-6 signaling is dependent upon interactions between IL-6
and two receptors, IL-6R1 (CD126) and gp130 (IL-6 signal
transducer). To determine the antibody mechanism of action,
mechanistic studies were performed using bio-layer interferometry
with an Octet QK instrument (ForteBio; Menlo Park, Calif.). Studies
were performed in two different configurations. In the first
orientation, biotinylated IL-6 (R&D systems part number
206-IL-001MG/CF, biotinylated using Pierce EZ-link
sulfo-NHS-LC-LC-biotin product number 21338 according to
manufacturer's protocols) was initially bound to a streptavidin
coated biosensor (ForteBio part number 18-5006). Binding is
monitored as an increase in signal.
[0747] The IL-6 bound to the sensor was then incubated either with
the antibody in question or diluent solution alone. The sensor was
then incubated with soluble IL-6R1 (R&D systems product number
227-SR-025/CF) molecule. If the IL-6R1 molecule failed to bind, the
antibody was deemed to block IL-6/IL-6R1 interactions. These
complexes were incubated with gp130 (R&D systems 228-GP-010/CF)
in the presence of IL-6R1 for stability purposes. If gp130 did not
bind, it was concluded that the antibody blocked gp130 interactions
with IL-6.
[0748] In the second orientation, the antibody was bound to a
biosensor coated with an anti-human IgG1 Fc-specific reagent
(ForteBio part number 18-5001). The IL-6 was bound to the
immobilized antibody and the sensor was incubated with IL-6R1. If
the IL-6R1 did not interact with the IL-6, then it was concluded
that the IL-6 binding antibody blocked IL-6/IL-6R1 interactions. In
those situations where antibody/IL-6/IL-6R1 was observed, the
complex was incubated with gp130 in the presence of IL-6R1. If
gp130 did not interact, then it was concluded that the antibody
blocked IL-6/gp130 interactions. All studies were performed in a
200 .mu.L final volume, at 30.degree. C. and 1000 rpm. For these
studies, all proteins were diluted using ForteBio's sample diluent
buffer (part number 18-5028). Results are presented in TABLE 8.
TABLE-US-00010 TABLE 8 Anti-IL6 Antibodies binding to R1 or GP130
Antibody Blocks IL6 binding to R1 Blocks IL6 Binding to GP130 Ab1
Yes Yes Ab2 No Partial Ab3 No Yes Ab4 No Yes Ab6 Yes Yes Ab7 Yes
Yes Ab8 No Yes
Example 14
Peptide Mapping
[0749] In order to determine the epitope recognized by Ab1 on human
IL-6, the antibody was employed in a western-blot based assay. The
form of human IL-6 utilized in this example had a sequence of 183
amino acids in length. A 57-member library of overlapping 15 amino
acid peptides encompassing this sequence was commercially
synthesized and covalently bound to a PepSpots nitrocellulose
membrane (JPT Peptide technologies, Berlin, Germany). The sequences
of the overlapping 15 amino acid peptides is in SEQ ID NOs:
590-646. Blots were prepared and probed according to the
manufacturer's recommendations.
[0750] Briefly, blots were pre-wet in methanol, rinsed in PBS, and
blocked for over 2 hours in 10% non-fat milk in PBS/0.05% Tween
(Blocking Solution). The Ab1 antibody was used at 1 mg/mL final
dilution, and the HRP-conjugated Mouse Anti-Human-Kappa secondary
antibody (Southern BioTech #9220-05) was used at a 1:5000 dilution.
Antibody dilutions/incubations were performed in blocking solution.
Blots were developed using Amersham ECL advance reagents (GE #
RPN2135) and chemiluminescent signal documented using a CCD camera
(AlphaInnotec). The sequence of the form of human IL-6 utilized to
generate peptide library is set forth in SEQ ID NO: 1.
Example 15
Ab1 has High Affinity for IL-6
[0751] Surface plasmon resonance was used to measure association
rate (Ka), dissociation rate (Kd) and dissociation constant (KD)
for Ab1 to IL-6 from rat, mouse, dog, human, and cynomolgus monkey
at 25.degree. C. (TABLE 5). The dissociation constant for human
IL-6 was 4 pM, indicating very high affinity. As expected, affinity
generally decreased with phylogenetic distance from human. The
dissociation constants of Ab1 for IL-6 of cynomolgus monkey, rat,
and mouse were 31 pM, 1.4 nM, and 0.4 nM, respectively. Ab1
affinity for dog IL-6 below the limit of quantitation of the
experiment.
[0752] The high affinity of Ab1 for mouse, rat, and cynomolgus
monkey IL-6 suggest that Ab1 may be used to inhibit IL-6 of these
species. This hypothesis was tested using a cell proliferation
assay. In brief, each species's IL-6 was used to stimulate
proliferation of T1165 cells, and the concentration at which Ab1
could inhibit 50% of proliferation (IC50) was measured. Inhibition
was consistent with the measured dissociation constants (TABLE 6).
These results demonstrate that Ab1 can inhibit the native IL-6 of
these species, and suggest the use of these organisms for in vitro
or in vivo modeling of IL-6 inhibition by Ab1. Further, other IL-6
antibodies described herein may have similar properties.
TABLE-US-00011 TABLE 9 Surface Plasmon Resonance: Averaged binding
constants determined at 25.degree. C. for Ab1 to IL-6. Species
(IL-6) K.sub.a (M.sup.-1s.sup.-1) K.sub.d (s.sup.-1) K.sub.p Rat
1.6e.sup.6 2.2e.sup.-3 1.4 nM Mouse 1.1e.sup.6 4.0e.sup.-4 0.4 nM
Dog Below LOQ.sup.a Below LOQ.sup.a Below LOQ.sup.a Human
1.6e.sup.5 5e.sup.-7 4 pM Cynomolgus monkey 9.6e.sup.4 3e.sup.-6 31
pM .sup.aBelow Limit of Quantitation
TABLE-US-00012 TABLE 10 IC50 values for Ab1 against human,
cynomolgus monkey, mouse, rat and dog IL-6 in the T1165 assay. IL-6
Species IC50 (pM) Human 13 Cynomolgus monkey 12 Mouse 1840 Rat 2060
Dog No inhibition of cell proliferation
Example 16
Multi-Dose Pharmacokinetic Evaluation of Antibody Ab1 in Healthy
Human Volunteers
[0753] Antibody Ab1 was dosed in a single bolus infusion in
histidine and sorbitol to healthy human volunteers. Dosages of 1
mg, 3 mg, 10 mg, 30 mg or 100 mg were administered to each
individual in dosage groups containing five to six individuals.
Plasma samples were removed at fixed time intervals for up to
twelve weeks. Human plasma was collected via venipuncture into a
vacuum collection tube containing EDTA. Plasma was separated and
used to assess the circulating levels of Ab1 using a monoclonal
antibody specific for Ab1, as follows. A 96 well microtiter plate
was coated overnight with the monoclonal antibody specific for Ab1
in 1.times.PBS overnight at 4.degree. C. The remaining steps were
conducted at room temperature. The wells were aspirated and
subsequently blocked using 0.5% Fish Skin Gelatin (FSG) (Sigma) in
1.times.PBS for 60 minutes. Human plasma samples were then added
and incubated for 60 minutes, then aspirated, then 50 .mu.L of 1
.mu.g/mL biotinylated IL-6 was then added to each well and
incubated for 60 minutes. The wells were aspirated, and 50 .mu.L
streptavidin-HRP (Pharmingen), diluted 1:5,000 in 0.5% FSG/PBS, was
added and incubated for 45 minutes. Development was conducted using
standard methods employing TMB for detection. Levels were then
determined via comparison to a standard curve prepared in a
comparable format.
[0754] Average plasma concentration of Ab1 for each dosage group
was examined. Mean AUC and Cmax increased linearly with dosage. For
dosages of 30 mg and above, the average Ab1 half-life in each
dosage group was between approximately 25 and 30 days. The
pharmacokinetics is shown in Table 11.
TABLE-US-00013 TABLE 11 Summary of Ab1 Pharmacokinetics in Health
Human Volunteers T.sub.1/2 AUC C.sub.max Dose of Ab1 (days) (.mu.g
h/mL) (.mu.g/mL) T.sub.max 1 mg 10.3 35 0.1 8 3 mg 11.6 229 0.7 4
10 mg 22.4 1473 4.0 4 30 mg 25.1 9076 19.7 4 100 mg 30.3 26128 48.0
12 300 mg 26.2 92891 188.0 12 640 mg 30.2 175684 306.0 12
Example 17
Pharmacokinetics of Ab1 in Patients with Advanced Cancer
[0755] Antibody Ab1 was dosed in a single bolus infusion in
phosphate buffered saline to five individuals with advanced cancer.
Each individual received a dosage of 80 mg (n=2) or 160 mg (n=3) of
Ab1. Plasma samples were drawn weekly, and the level of antibody
Ab1 was quantitated as in Example 16. Average plasma concentration
of Ab1 in these individuals as a function of time was examined. The
average Ab1 half-life was approximately 31 days. The anti-IL-6
antibodies described herein may have similarly long half-lives.
Example 18
Ab1 has an Unexpectedly Long Half-Life
[0756] Overall, the average half-life of Ab1 was approximately 31
days in humans (for dosages of 10 mg and above), and approximately
15-21 days in cynomolgus monkey. The Ab1 half-life in humans and
cynomolgus monkeys are unprecedented when compared with the
half-lives of other anti-IL-6 antibodies (TABLE 11). As described
above, Ab1 was derived from humanization of a rabbit antibody, and
is produced from Pichia pastoris in an aglycosylated form. These
characteristics results in an antibody with very low immunogenicity
in humans. Moreover, the lack of glycosylation prevents Ab1 from
interacting with the Fc receptor or complement. Without intent to
be limited by theory, it is believed that the unexpectedly long
half-life of Ab1 is at least partially attributable to the
humanization and/or the lack of glycosylation. The particular
sequence and/or structure of the antigen binding surfaces may also
contribute to Ab1's half-life. See also WO 2011/066369.
TABLE-US-00014 TABLE 12 Elimination Half-life of Ab1 Cynomolgus
Monkey Human Dose of AB1 (days) (days) Ab1 15-21 ~31 Acemra
(Tocilizumab) 7 6 Remicade 5 8-9.5 Synagis 8.6 20 Erbitux 3-7 5
Zenapax 7 20 Avastin 10 20 Pertuzumab 10 18-22
Example 19
Ab1 Effect on Hemoglobin Concentration, Plasma Lipid Concentration,
and Neutrophil Counts in Patients with Advanced Cancer
[0757] Antibody Ab1 was dosed in a single bolus infusion in
phosphate buffered saline to eight individuals with advanced cancer
(NSCLC, colorectal cancer, cholangiocarcinoma, or mesothelioma).
Each individual received a dosage of 80 mg, 160 mg, or 320 mg of
Ab1. Blood samples were removed just prior to infusion and at fixed
time intervals for six weeks, and the hemoglobin concentration,
plasma lipid concentration, and neutrophil counts were determined.
Average hemoglobin concentration rose slightly (FIG. 11), as did
total cholesterol and triglycerides (FIG. 12), while mean
neutrophil counts fell slightly (FIG. 13).
[0758] These results further demonstrate some of the beneficial
effects of administration of Ab1 to chronically ill individuals.
Because IL-6 is the main cytokine responsible for the anemia of
chronic disease (including cancer-related anemia), neutralization
of IL-6 by Ab1 increases hemoglobin concentration in these
individuals. Similarly, as IL-6 is centrally important in
increasing neutrophil counts in inflammation, the observed slight
reduction in neutrophil counts further confirms that Ab1 inhibits
IL-6. Finally, IL-6 causes anorexia as well as cachexia in these
patients; neutralization of IL-6 by Ab1 results in the return of
appetite and reversal of cachexia. The increase in plasma lipid
concentrations reflects the improved nutritional status of the
patients. Taken together, these results further demonstrate that
Ab1 effectively reverses these adverse consequences of IL-6 in
these patients.
Example 20
Ab1 Suppresses Serum CRP in Healthy Volunteers and in Patients with
Advanced Cancer
Introduction
[0759] Serum CRP concentrations have been identified as a strong
prognostic indicator in patients with certain forms of cancer. For
example, Hashimoto et al. performed univariate and multivariate
analysis of preoperative serum CRP concentrations in patients with
hepatocellular carcinoma in order to identify factors affecting
survival and disease recurrence. Hashimoto, et al. (2005) Cancer
103(9): 1856-1864. Patients were classified into two groups, those
with serum CRP levels >1.0 mg/dL ("the CRP positive group") and
those with serum CRP levels <1.0 mg/dL ("the CRP negative
group"). The authors identified "a significant correlation between
preoperative serum CRP level and tumor size." Id. Furthermore, the
authors found that "[t]he overall survival and recurrence-free
survival rates in the CRP-positive group were significantly lower
compared with the rates in the CRP-negative group." Id. The authors
concluded that the preoperative CRP level of patients is an
independent and significant predictive indicator or poor prognosis
and early recurrence in patients with hepatocellular carcinoma.
[0760] Similar correlations have been identified by other
investigators. For example, Karakiewicz et al. determined that
serum CRP was an independent and informative predictor of renal
cell carcinoma-specific mortality. Karakiewicz, et al. (2007)
Cancer. 110(6):1241-1247. Accordingly, there remains a need in the
art for methods and/or treatments that reduce serum C-Reactive
Protein (CRP) concentrations in cancer patients, and particularly
those with advanced cancers.
Methods
[0761] Healthy volunteers received a single 1-hour intravenous (IV)
infusion of either 100 mg (5 patients), 30 mg (5 patients), 10 mg
(6 patients), 3 mg (6 patients) or 1 mg (6 patients) of the Ab1
monoclonal antibody, while another 14 healthy volunteers received
intravenous placebo. Comparatively, 2 patients with advanced forms
of colorectal cancer received a single 1-hour intravenous (IV)
infusion of 80 mg of the Ab1 monoclonal antibody. No further
dosages of the Ab1 monoclonal antibody were administered to the
test population.
[0762] Patients were evaluated prior to administration of the
dosage, and thereafter on a weekly basis for at least 5 weeks post
dose. At the time of each evaluation, patients were screened for
serum CRP concentration.
Results--Healthy Volunteers
[0763] As noted above, serum CRP levels are a marker of
inflammation; accordingly, baseline CRP levels are typically low in
healthy individuals. The low baseline CRP levels can make a further
reduction in CRP levels difficult to detect. Nonetheless, a
substantial reduction in serum CRP concentrations was detectable in
healthy volunteers receiving all concentrations of the Ab1
monoclonal antibody, compared to controls (FIG. 14A). The reduction
in serum CRP levels was rapid, occurring within one week of
antibody administration, and prolonged, continuing at least through
the final measurement was taken (8 or 12 weeks from antibody
administration).
Results--Cancer Patients
[0764] Five advanced cancer patients (colorectal cancer,
cholangiocarcinoma, or NSCLC) having elevated serum CRP levels were
dosed with 80 mg or 160 mg of Ab1. Serum CRP levels were greatly
reduced in these patients (FIG. 14B). The reduction in serum CRP
levels was rapid, with 90% of the decrease occurring within one
week of Ab1 administration, and prolonged, continuing at least
until the final measurement was taken (up to twelve weeks). In two
representative individuals, the CRP levels were lowered to below
the normal reference range (less than 5-6 mg/1) within one week.
Thus, administration of Ab1 to patients can cause a rapid and
sustained suppression of serum CRP levels.
Example 21
Ab1 Improved Muscular Strength, Improved Weight, and Reduced
Fatigue in Patients with Advanced Cancer
Introduction
[0765] Weight loss and fatigue (and accompanying muscular weakness)
are very common symptoms of patients with advanced forms of cancer,
and these symptoms can worsen as the cancer continues to progress.
Fatigue, weight loss and muscular weakness can have significant
negative effects on the recovery of patients with advanced forms of
cancer, for example by disrupting lifestyles and relationships and
affecting the willingness or ability of patients to continue cancer
treatments. Known methods of addressing fatigue, weight loss and
muscular weakness include regular routines of fitness and exercise,
methods of conserving the patient's energy, and treatments that
address anemia-induced fatigue and muscular weakness. Nevertheless,
there remains a need in the art for methods and/or treatments that
improve fatigue, weight loss and muscular weakness in cancer
patients.
Methods
[0766] Four patients with advanced forms of cancer [(colorectal
cancer (2), NSCLC (1), cholangiocarcinoma (1)] received a single
1-hour intravenous (IV) infusion of either 80 mg or 160 mg of the
Ab1 monoclonal antibody. No further dosages of the Ab1 monoclonal
antibody were administered to the test population.
[0767] Patients were evaluated prior to administration of the
dosage, and thereafter for at least 6 weeks post dose. At the time
of each evaluation, patients were screened for the following: a.)
any change in weight; b.) fatigue as measured using the Facit-F
Fatigue Subscale questionnaire a medically recognized test for
evaluating fatigue. See, e.g., Cella, et al. (2002) Cancer 94(2):
528-538; Cella, et al. (2002) Journal of Pain & Symptom
Management 24(6): 547-561); and hand-grip strength (a medically
recognized test for evaluating muscle strength, typically employing
a handgrip dynamometer).
Results--Weight Change
[0768] The averaged data for both dosage concentrations (80 mg and
160 mg) of the Ab1 monoclonal antibody demonstrated an increase of
about 2 kilograms of weight per patient over the period of 6
weeks.
Fatigue
[0769] The averaged data for both dosage concentrations (80 mg and
160 mg) of the Ab1 monoclonal antibody demonstrated an increase in
the mean Facit-F FS subscale score of at least about 10 points in
the patient population over the period of 6 weeks.
Hand-Grip Strength
[0770] The averaged data for both dosage concentrations (80 mg and
160 mg) of the Ab1 monoclonal antibody demonstrated an increase in
the mean hand-grip strength of at least about 10 percent in the
patient population over the period of 6 weeks. See, e.g., WO
2011/066371.
Example 22
Ab1 for Prevention of Thrombosis
[0771] Prior studies have shown that administration of an anti-IL-6
antibody can cause decreased platelet counts. Emilie, et al. (1994)
Blood 84(8): 2472-9; Blay, et al. (1997) Int J Cancer 72(3):
424-30. These results have apparently been viewed as an indicator
of potential danger, because further decreases in platelet counts
could cause complications such as bleeding. However, Applicants
have now discerned that inhibiting IL-6 restores a normal
coagulation profile, which Applicants predict will prevent
thrombosis. Decreased platelet counts resulting from inhibition of
IL-6 is not a sign of potential danger but rather reflects the
beneficial restoration of normal coagulation.
[0772] The mechanism by which normal coagulation is restored is
believed to result from the interplay between IL-6 and the acute
phase reaction. In response to elevated IL-6 levels, as for example
in a cancer patient, the liver produces acute phase proteins. These
acute phase proteins include coagulation factors, such as Factor
II, Factor V, Factor VIII, Factor IX, Factor XI, Factor XII,
F/fibrin degradation products, thrombin-antithrombin III complex,
fibrinogen, plasminogen, prothrombin, and von Willebrand factor.
This increase in coagulation factors may be measured directly, or
may be inferred from functional measurements of clotting ability.
Antagonists of IL-6, such as Ab1, suppresses acute phase proteins,
e.g., Serum Amyloid (Example 23). Applicants now predict that this
suppression of acute phase proteins will restore the normal
coagulation profile, and thereby prevent thrombosis. The
restoration of normal coagulation may cause a slight drop in
platelet counts, but the patient will nonetheless retain normal
coagulation ability and thus will not have an increased risk of
bleeding. Such a treatment will represent a vast improvement over
the available anticoagulation therapies whose usefulness is limited
by the risk of adverse side-effects, such as major bleeding. See,
e.g., WO 2011/066371.
[0773] Applicants contemplate that the same beneficial effects of
inhibiting IL-6 will be obtained regardless of the method of
inhibition. Suitable methods of inhibiting IL-6 include
administration of anti-IL-6 antibodies, antisense therapy, soluble
IL-6 receptor, either individually or in combinations.
Example 23
Ab1 Increases Plasma Albumin Concentration in Patients with
Advanced Cancer
Introduction
[0774] Serum albumin concentrations are recognized as predictive
indicators of survival and/or recovery success of cancer patients.
Hypoalbumenia correlates strongly with poor patient performance in
numerous forms of cancer. For example, in one study no patients
undergoing systemic chemotherapy for metastatic pancreatic
adenocarcinoma and having serum albumin levels less than 3.5 g/dL
successfully responded to systemic chemotherapy. Fujishiro, et al.
(2000) Hepatogastroenterology 47(36): 1744-46 and Senior and Maroni
(1999) Am. Soc. Nutr. Sci. 129: 313S-314S. In at least one study,
attempts to rectify hypoalbuminemia in 27 patients with metastatic
cancer by daily intravenous albumin infusion of 20 g until normal
serum albumin levels (>3.5 g/dL) were achieved had little
success. Demirkazik, et al. (2002) Proc. Am. Soc. Clin. Oncol.
21:Abstr 2892. Accordingly, there remains a need in the art for
methods and/or treatments that improve serum albumin concentrations
in cancer patients and address hypoalbuminemic states in cancer
patients, particularly those with advanced cancers.
Methods
[0775] Four patients with advanced forms of cancer [(colorectal
cancer (2), NSCLC (1), cholangiocarcinoma (1)] received a single
1-hour intravenous (IV) infusion of either 80 mg or 160 mg of the
Ab1 monoclonal antibody. No further dosages of the Ab1 monoclonal
antibody were administered to the test population.
[0776] Patients were evaluated prior to administration of the
dosage, and thereafter for at least 6 weeks post dose. At the time
of each evaluation, patients were screened for plasma albumin
concentration.
Results
[0777] The averaged data for both dosage concentrations (80 mg and
160 mg) of the Ab1 monoclonal antibody demonstrated an increase of
about 5 g/L of plasma albumin concentration per patient over the
period of 6 weeks. See, e.g., WO 2011/066371.
Example 24
Ab1 Suppresses Serum CRP in Patients with Advanced Cancer
Introduction
[0778] Serum CRP concentrations have been identified as a strong
prognostic indicator in patients with certain forms of cancer. For
example, Hashimoto et al. performed univariate and multivariate
analysis of preoperative serum CRP concentrations in patients with
hepatocellular carcinoma in order to identify factors affecting
survival and disease recurrence. Hashimoto, et al. (2005) Cancer
103(9): 1856-1864. Patients were classified into two groups, those
with serum CRP levels >1.0 mg/dL ("the CRP positive group") and
those with serum CRP levels <1.0 mg/dL ("the CRP negative
group"). The authors identified "a significant correlation between
preoperative serum CRP level and tumor size." Id. Furthermore, the
authors found that "[t]he overall survival and recurrence-free
survival rates in the CRP-positive group were significantly lower
compared with the rates in the CRP-negative group." Id. The authors
concluded that the preoperative CRP level of patients is an
independent and significant predictive indicator of poor prognosis
and early recurrence in patients with hepatocellular carcinoma.
[0779] Similar correlations have been identified by other
investigators. For example, Karakiewicz et al. determined that
serum CRP was an independent and informative predictor of renal
cell carcinoma-specific mortality. Karakiewicz, et al. (2007)
Cancer 110(6):1241-1247. Accordingly, there remains a need in the
art for methods and/or treatments that reduce serum C-Reactive
Protein (CRP) concentrations in cancer patients, and particularly
those with advanced cancers.
Methods
[0780] One-hundred twenty-four patients with non-small cell lung
cancer (NSCLC) were divided into 4 treatment groups. Patients in
one group received one 1-hour intravenous (IV) infusion of either
placebo (n=31), 80 mg (n=29), 160 mg (n=32), or 320 mg (n=32) of
the Ab1 monoclonal antibody every 8 weeks over a 24 week duration
for a total of 3 doses. CRP concentration was quantitated by a
C-reactive protein particle-enhanced immunoturbidimetric assay
using latex-attached anti-CRP antibodies (i.e. Roche CRP
Tinaquant.RTM.). Briefly, about 1.0 mL of patient sample serum was
collected and stored in a plastic collection tube. Sample was
placed into appropriate buffer, and anti-CRP antibody coupled to
latex microparticles was added to the sample to start the reaction.
These anti-CRP antibodies with conjugated latex microparticles
react with antigen in the sample to form an antigen/antibody
complex. Following agglutination, this was measured
turbidimetrically using a Roche/Hitachi Modular P analizer.
[0781] Patients were evaluated prior to administration of the
dosage, and thereafter at weeks 2, 4, 8, and 12. At the time of
each evaluation, patients were screened for serum CRP
concentration. Results
[0782] The averaged data for each dosage concentrations (placebo,
80 mg, 160 mg, and 320 mg) of the Ab1 monoclonal antibody are
plotted in FIG. 15A. All dosage levels of Ab1 antibody demonstrated
an immediate drop in CRP concentrations relative to placebo over
the period of 12 weeks. CRP levels displayed breakthrough at 8
weeks post-dosing. The CRP levels fell below 5 mg/L by week 12.
Median values of CRP demonstrated rapid and sustained decreases for
all dosage concentrations relative to placebo (FIG. 15B). Thus,
administration of Ab1 to advanced cancer patients can cause a rapid
and sustained suppression of serum CRP levels.
Example 25
Ab1 Suppresses Serum CRP in Patients with Advanced Cancers
Introduction
[0783] Serum CRP concentrations have been identified as a strong
prognostic indicator in patients with certain forms of cancer. For
example, Hashimoto et al. performed univariate and multivariate
analysis of preoperative serum CRP concentrations in patients with
hepatocellular carcinoma in order to identify factors affecting
survival and disease recurrence. Hashimoto, et al. (2005) Cancer
103(9): 1856-1864. Patients were classified into two groups, those
with serum CRP levels >1.0 mg/dL ("the CRP positive group") and
those with serum CRP levels <1.0 mg/dL ("the CRP negative
group"). The authors identified "a significant correlation between
preoperative serum CRP level and tumor size." Id. Furthermore, the
authors found that "[t]he overall survival and recurrence-free
survival rates in the CRP-positive group were significantly lower
compared with the rates in the CRP-negative group." Id. The authors
concluded that the preoperative CRP level of patients is an
independent and significant predictive indicator of poor prognosis
and early recurrence in patients with hepatocellular carcinoma.
[0784] Similar correlations have been identified by other
investigators. For example, Karakiewicz et al. determined that
serum CRP was an independent and informative predictor of renal
cell carcinoma-specific mortality. Karakiewicz, et al. (2007)
Cancer 110(6): 1241-1247. Accordingly, there remains a need in the
art for methods and/or treatments that reduce serum C-Reactive
Protein (CRP) concentrations in cancer patients, and particularly
those with advanced cancers.
Methods
[0785] Eight patients with various forms of advanced cancer
[(colorectal (3), NSCLC (1), cholangio (1), and mesothelioma (2)]
received a single 1-hour intravenous infusion of either 80 mg (2
patients), 160 mg (3 patients) or 320 mg (3 patients) of the Ab1
monoclonal antibody. No further dosages of the Ab1 monoclonal
antibody were administered to the test population.
[0786] Patients were evaluated prior to administration of the
dosage and thereafter on a weekly basis for at least 8 weeks post
dose. At the time of each evaluation, patients were screened for
serum CRP concentration. CRP concentration was quantitated by a
C-reactive protein particle-enhanced immunoturbidimetric assay
using latex-attached anti-CRP antibodies (i.e. Roche CRP
Tinaquant.RTM.). Briefly, about 1.0 mL of patient sample serum was
collected and stored in a plastic collection tube. Sample was
placed into appropriate buffer, and anti-CRP antibody coupled to
latex microparticles was added to the sample to start the reaction.
These anti-CRP antibodies with conjugated latex microparticles
react with antigen in the sample to form an antigen/antibody
complex. Following agglutination, this was measured
turbidimetrically using a Roche/Hitachi Modular P analizer.
Results
[0787] Serum CRP levels were greatly reduced in all patients
studied (FIG. 16). The reduction in serum CRP levels was rapid,
with approximately 90% of the decrease occurring within one week of
Ab1 administration, and prolonged diminished levels continued at
least until the final measurement was taken (up to twelve weeks).
In all cases except one patient with colorectal cancer, CRP levels
fell to at or below the normal reference range (less than 5-6 mg/L)
within one week. The colorectal cancer patient achieved similar
normal levels by week 4 of the study. Thus, administration of Ab1
to advanced cancer patients can cause a rapid and sustained
suppression of serum CRP levels.
Example 26
Ab1 Suppresses Serum CRP in Patients with Rheumatoid Arthritis
Introduction
[0788] Serum CRP concentrations have been identified as a strong
prognostic indicator in patients with rheumatoid arthritis.
Patients suffering from rheumatoid arthritis with high levels of
CRP demonstrated almost universal deterioration. Amos, et al.
(1977) Br. Med. J. 1: 195-97. Conversely, patients with low CRP
levels showed no disease progression, suggesting that sustaining
low levels of CRP is necessary for effectively treating rheumatoid
arthritis. Id. Tracking of CRP during rheumatoid arthritis
treatment regimes of gold, D-penicillamine, chloroquine, or dapsone
indicated that radiological deterioration was impeded after the
first 6 months of treatment when CRP levels were consistently
controlled. Dawes et al., (1986) Rheumatology 25: 44-49. A highly
significant correlation between CRP production and radiological
progression was identified. van Leeuwen, et al. (1997) Rheumatology
32 (Supp. 3): 9-13. Another study revealed that for patients with
active rheumatoid arthritis, suppression of abnormally elevated CRP
led to improvement in functional testing metrics, whereas sustained
CRP elevation associated with deterioration in the same metrics.
Devlin, et al. (1997) J. Rheumatol. 24: 9-13. No further
deterioration was observed without CRP re-elevation, indicating CRP
suppression as a viable candidate for rheumatoid arthritis
treatment. Id. Accordingly, there remains a need in the art for
methods and/or treatments that reduce serum C-Reactive Protein
(CRP) concentrations in rheumatoid arthritis patients.
Methods
[0789] One-hundred twenty-seven patients with active rheumatoid
arthritis and CRP >10 mg/L were divided into 4 treatment groups.
Patients in one group received one 1-hour intravenous (IV) infusion
of either placebo (n=33), 80 mg (n=32), 160 mg (n=34), or 320 mg
(n=28) of the Ab1 monoclonal antibody, once at the start of the 16
week trial and again at week 8. CRP concentration was quantitated
by a C-reactive protein particle-enhanced immunoturbidimetric assay
using latex-attached anti-CRP antibodies (i.e., Roche CRP
Tinaquant.RTM.). Briefly, about 1.0 mL of patient sample serum was
collected and stored in a plastic collection tube. Sample was
placed into appropriate buffer, and anti-CRP antibody coupled to
latex microparticles was added to the sample to start the reaction.
These anti-CRP antibodies with conjugated latex microparticles
react with antigen in the sample to form an antigen/antibody
complex. Following agglutination, this was measured
turbidimetrically using a Roche/Hitachi Modular P analizer. Data on
CRP concentration was collected every week for the first 4 weeks,
every two weeks between weeks 4 and 12, and at the conclusion of
the test at week 16.
Results
[0790] Serum CRP levels were greatly reduced in all patients
studied (FIG. 17). The reduction in serum CRP levels was rapid,
with immediate reduction in CRP levels relative to placebo within
one week of Ab1 administration, and prolonged diminished levels
continued at least until the final measurement was taken (up to
sixteen weeks). In all cases, CRP levels fell to at or below the
normal reference range (less than 5-6 mg/L) within one week. Thus,
administration of Ab1 to rheumatoid arthritis patients can cause a
rapid and sustained suppression of serum CRP levels and presents an
effective treatment regime.
Example 27
Ab1 Increases Hemoglobin in Patients with Advanced Cancer
[0791] Antibody Ab1 was dosed at 80 mg, 160 mg, or 320 mg of Ab1 in
phosphate buffered saline to 93 individuals with non-small cell
lung carcinoma. The placebo group of 31 individuals with non-small
cell lung carcinoma was dosed with phosphate buffered saline only.
Blood samples were removed just prior to dosing (zero week), and at
two, four, eight and twelve weeks, and the hemoglobin concentration
was determined. Mean hemoglobin concentration rose for those
receiving antibody Ab1, while mean hemoglobin concentration of
those receiving placebo did not rise after twelve weeks when
compared to the concentration just prior to dosing (zero week)
(FIGS. 18A and 18B).
[0792] A subset of the study population began the study with low
levels of hemoglobin, defined as a baseline hemoglobin
concentration below 11 g/l. Mean hemoglobin concentration rose
above 11 g/l after eight weeks for those receiving antibody Ab1 at
dosages of 160 mg and 320 mg, while mean hemoglobin concentration
of those receiving antibody Ab1 at dosages of 80 mg or placebo did
not rise above 11 g/l after eight weeks (FIG. 18C).
[0793] These results further demonstrate some of the beneficial
effects of administration of Ab1 to chronically ill individuals.
Because IL-6 is the main cytokine responsible for the anemia of
chronic disease (including cancer-related anemia), neutralization
of IL-6 by Ab1 increases hemoglobin concentration in these
individuals.
Example 28
Ab1 Increases Hemoglobin in Patients with Rheumatoid Arthritis
[0794] Hemoglobin levels were analyzed in patients with rheumatoid
arthritis during treatment with Ab1 antibody. Ab1 antibody was
dosed at 80 mg, 160 mg, or 320 mg in phosphate buffered saline to
94 individuals with rheumatoid arthritis. The placebo group of 33
individuals with rheumatoid arthritis was dosed with phosphate
buffered saline only. Blood samples were removed just prior to
dosing (zero week), and at one, two, three, four, six, eight, ten,
twelve, and sixteen weeks, and the hemoglobin concentration was
determined. Mean hemoglobin concentration rose for those receiving
antibody Ab1, while mean hemoglobin concentration of those
receiving placebo did not appreciably rise after sixteen weeks when
compared to the concentration just prior to dosing (zero week)
(FIG. 19).
[0795] These results further demonstrate some of the beneficial
effects of administration of Ab1 to chronically ill individuals.
Because IL-6 is the main cytokine responsible for the anemia of
chronic disease (including cancer-related anemia), neutralization
of IL-6 by Ab1 increases hemoglobin concentration.
Example 29
Ab1 Increases Albumin in Patients with Advanced Cancer
Introduction
[0796] Serum albumin concentrations are recognized as predictive
indicators of survival and/or recovery success of cancer patients.
Hypoalbumenia correlates strongly with poor patient performance in
numerous forms of cancer. For example, in one study no patients
undergoing systemic chemotherapy for metastatic pancreatic
adenocarcinoma and having serum albumin levels less than 3.5 g/dL
successfully responded to systemic chemotherapy. Fujishiro, et al.
(2000) Hepatogastroenterology 47(36): 1744-46. The authors conclude
that "[p]atients with . . . hypoalbuminemia . . . might be
inappropriate candidates for systemic chemotherapy and might be
treated with other experimental approaches or supportive care."
Id.
[0797] Similarly, Senior and Maroni state that "[t]he recent
appreciation that hypoalbuminemia is the most powerful predictor of
mortality in end-stage renal disease highlights the critical
importance of ensuring adequate protein intake in this patient
population." Senior & Maroni (1999) Am. Soc. Nutr. Sci. 129:
313S-314S.
[0798] In at least one study, attempts to rectify hypoalbuminemia
in 27 patients with metastatic cancer by daily intravenous albumin
infusion of 20 g until normal serum albumin levels (>3.5 g/dL)
were achieved had little success. The authors note that "[a]lbumin
infusion for the advanced stage cancer patients has limited value
in clinical practice. Patients with PS 4 and hypoalbuminemia have
poorer prognosis." Demirkazik, et al. (2002) Proc. Am. Soc. Clin.
Oncol. 21: Abstr 2892.
[0799] Accordingly, there remains a need in the art for methods
and/or treatments that improve serum albumin concentrations in
cancer patients and address hypoalbuminemic states in cancer
patients, particularly those with advanced cancers.
Methods
[0800] Antibody Ab1 was dosed at 80 mg, 160 mg, or 320 mg of Ab1 in
phosphate buffered saline to 93 individuals with non-small cell
lung carcinoma. Each individual received a dosage of. The placebo
group of 31 individuals with non-small cell lung carcinoma was
dosed with phosphate buffered saline only. Blood samples were
removed just prior to dosing (zero week), and at two, four, eight
and twelve weeks, and the albumin concentration was determined.
Results
[0801] Mean albumin concentration rose for those receiving antibody
Ab1, while mean albumin concentration of those receiving placebo
did not rise after twelve weeks when compared to the concentration
just prior to dosing (zero week) (FIG. 20A). The change from
baseline albumin values for all dosage concentration groups is
plotted in FIG. 20B.
[0802] A subset of the study population began the study with low
levels of albumin, defined as a baseline albumin concentration less
than or equal to 35 g/L. Mean albumin concentration initially rose
with all dosages of antibody Ab1 over placebo, but only patients
receiving 160 mg or 320 mg demonstrated sustained albumin levels
above 35 g/L over 8 weeks of the study (FIG. 20C). The 80 mg dosage
group demonstrated an initial increase, but gradually declined
after week 2 and never rose above 35 g/L during the 8 weeks where
data was available. Id.
Example 30
Ab1 Improved Weight and Reduced Fatigue in Patients with Advanced
Cancer
Introduction
[0803] Weight loss and fatigue are very common symptoms of patients
with advanced forms of cancer, and these symptoms can worsen as the
cancer continues to progress. Fatigue and weight loss can have
significant negative effects on the recovery of patients with
advanced forms of cancer, for example by disrupting lifestyles and
relationships and affecting the willingness or ability of patients
to continue cancer treatments. Known methods of addressing fatigue
and weight loss include regular routines of fitness and exercise,
methods of conserving the patient's energy, and treatments that
address anemia-induced fatigue. Nevertheless, there remains a need
in the art for methods and/or treatments that improve fatigue and
weight loss in cancer patients.
Methods
[0804] One-hundred twenty-four patients with non-small cell lung
cancer (NSCLC) were divided into 4 treatment groups. Patients in
one group received one 1-hour intravenous (IV) infusion of either
placebo (n=31), 80 mg (n=29), 160 mg (n=32), or 320 mg (n=32) of
the Ab monoclonal antibody every 8 weeks over a 24 week duration
for a total of 3 doses.
[0805] Patients were evaluated prior to administration of the
dosage, and thereafter for at least 12 weeks post dose. At the time
of each evaluation, patients were screened for the following: any
change in weight; and fatigue as measured using the Facit-F Fatigue
Subscale questionnaire a medically recognized test for evaluating
fatigue. See, e.g., Cella, et al. (2002) Cancer 94(2): 528-538;
Cella, et al. (2002) Journal of Pain & Symptom Management
24(6): 547-561.
Results
Weight Change
[0806] The averaged weight change data from each dosage
concentration group (placebo, 80 mg, 160 mg, and 320 mg) of the Ab1
monoclonal antibody over 12 weeks. The average percent change in
body weight from each dosage concentration. The averaged lean body
mass data for the dosage concentration groups.
Fatigue
[0807] The averaged fatigue from each dosage concentration group
(placebo, 80 mg, 160 mg, and 320 mg) of the Ab1 monoclonal antibody
demonstrated increases in the mean Facit-F FS subscale score for
some of the dosage concentration groups in the patient population
over the period of 8 weeks.
Example 31
Ab1 Decreases D-Dimer Levels in Patients with Advanced Cancer
Introduction
[0808] D-dimer concentrations are recognized as useful diagnostic
tools in predicting risks of thrombotic events in patients. Adam,
et al. (2009) Blood 113: 2878-87. Patients that are negative for
D-dimer have a low probability for thrombosis. For example, D-dimer
analysis can rule out suspected lower-extremity deep-vein
thrombosis in patients. Wells, et al. (2003) N. Engl. J. Med. 349:
1227-35. Clinical evaluation in combination with negative D-dimer
test can effectively lower the instance of pulmonary embolism to
0.5%. Van Belle, et al. (2006) JAMA 295: 172-79; Kruip, et al.
(2002) Arch. Intern. Med. 162: 1631-35; Wells, et al. (2001) Ann.
Intern. Med. 135: 98-107.
[0809] D-dimer analysis may have utility in tracking the progress
of treating coagulation disorders. One study indicated that
anticoagulation treatment for acute venous thromboembolism resulted
in a gradual decline in D-dimer concentrations. Adam, et al. (2009)
Blood 113: 2878-87; Schutgens, et al. (2004) J. Lab. Clin. Med.
144: 100-107. This discovery led to the conclusion that D-dimer
levels monitoring could be used to assess treatment responsiveness.
Adam, at 2883.
[0810] For patients with cancer, D-dimer analysis may have
additional significance, as cancer increases the prevalence of
thrombosis. Adam, et al. (2009) Blood 113: 2878-87. One study with
oncology patients indicated that D-dimer concentrations have a high
negative predictive value and high sensitivity in diagnosing
pulmonary embolism. King, et al. (2008) Radiology 247: 854-61.
Deep-vein thrombosis can similarly be excluded for cancer patients
with low probability of developing deep-vein thrombosis and a
negative test for D-dimer, although such a combination is less
likely for oncology patients. Lee, et al. (2008) Thromb. Res. 123:
177-83. A higher threshold for a negative D-dimer result may be
necessary in cancer patients. Righini, et al. (2006) Haemost. 95:
715-19.
[0811] Accordingly, there remains a need in the art for methods
and/or treatments of thrombosis that improve D-dimer concentrations
in cancer patients and address elevated D-dimer states in cancer
patients, particularly those with advanced cancers.
Methods
[0812] One-hundred twenty-four patients with non-small cell lung
cancer (NSCLC) were divided into 4 treatment groups. Patients in
one group received one 1-hour intravenous (IV) infusion of either
placebo (n=31), 80 mg (n=29), 160 mg (n=32), or 320 mg (n=32) of
the Ab1 monoclonal antibody every 8 weeks over a 24 week duration
for a total of 3 doses. Data on D-dimer concentration was collected
for the first 8 weeks of treatment. D-dimer data concentration was
quantitated by a D-dimer immunoturbidimetric assay. Briefly, the
assay is based on the change in turbidity of a microparticle
suspension that is measured by photometry. About 1.5 mL of patient
sample sodium citrate plasma was collected and stored in a plastic
collection tube. A suspension of latex microparticles, coated by
covalent bonding with monoclonal antibodies specific for D-dimer,
was mixed with the test plasma whose D-dimer level was to be
assayed. Antigen-antibody reactions leading to an agglutination of
the latex microparticles induced an increase in turbidity of the
reaction medium. This increase in turbidity was reflected by an
increase in absorbance, the latter being measured photometrically
using a STAGO STA analyzer. The increase in absorbance was a
function of the D-dimer level present in the test sample.
Results
[0813] The averaged data for each dosage concentrations (placebo,
80 mg, 160 mg, and 320 mg) of the Ab1 monoclonal antibody. All
dosage levels of Ab1 antibody demonstrated a drop in D-dimer levels
over placebo over the period of 8 weeks. See WO 2011/066371.
Example 32
Ab1 Efficacy and Safety in Patients with Advanced NSCLC
[0814] The primary objective of this study was to determine the
efficacy and safety of ALD518 or humanized Ab1 in patients with
advanced NSCLC.
Methods
[0815] 124 patients (pts) with NSCLC, ECOG 0-3, weight loss in the
preceding 3 months of >5% body weight, hemoglobin (Hb) >7
g/dL, and C-reactive protein (CRP) >10 mg/L were dosed. Pts were
randomized to 1 of 4 groups (n-30/group). Placebo or ALD518 80 mg,
160 mg, or 320 mg was administered intravenously every 8 weeks. Pts
were followed up for 24 weeks. Data included hematology, clinical
chemistry, CRP and adverse events (AEs).
Results
[0816] 29 pts completed the study treatments and evaluations, 38
failed to complete every visit, 52 died of progressive disease, and
5 withdrew because of adverse events. There were no dose limiting
toxicities (DLTs) or infusion reactions. 84 pts had serious AEs of
which 1 was deemed to be possibly related to administration of
ALD518 (rectal hemorrhage). The mean (+SD) values for Hb,
hematocrit (Hct), mean corpuscular Hb (MCH), and albumin are
below:
TABLE-US-00015 TABLE 13 Clinical Parameters measured for ALD518
(Ab1) versus Placebo n Hb (g/dL) Hct (%) MCH (pg) Albumin (g/L)
ALD518 Pre-dose 93 11.5 (.+-.2.1) 37.9 (.+-.6.2) 28.4 (.+-.2.8)
37.3 (.+-.5.3) (pooled) Week 4 69 13.1 (.+-.1.6).sup.a 42.5
(.+-.5.0).sup.a 29.2 (.+-.2.5).sup.a 43.6 (.+-.4.7).sup.a Week 12
39 13.4 (.+-.1.6).sup.a .sup. 42.5 (.+-.4.7).sup.b 29.8
(.+-.2.8).sup.a 45.2 (.+-.4.5).sup.a Placebo Pre-dose 31 12.2
(.+-.1.8) 39.0 (.+-.5.9) 29.0 (.+-.2.8) 37.5 (.+-.5.7) Week 4 29
11.8 (.+-.2.0) 39.5 (.+-.6.4) 28.0 (.+-.2.8).sup.c 37.3 (.+-.6.8)
Week 12 21 12.0 (.+-.2.5) 39.6 (.+-.7.4) 27.8 (.+-.3.0).sup.c 37.0
(.+-.7.5) .sup.ap < 0.0001 .sup.bp = 0.0002 .sup.cp .ltoreq.
0.001 (paired t-test compared to pre-dose)
[0817] 38/93 pts treated ALD518 and 10/31 given placebo has a
pre-dose Hb.ltoreq.1 lg/dL. 24 of these pts on ALD518 and 7 of
these pts on placebo remained in the study at week 4. 14/24 pts on
ALD518 and 0/7 on placebo had raised their Hb from .ltoreq.1 lg/dL
to .gtoreq.12 g/dL.
Conclusion
[0818] ALD518 increased Hb, Hct, MCH and albumin in NSCLC pts and
raised Hb to .gtoreq.12 g/dL in 58% of pts with a Hb.ltoreq.1 lg/dL
at baseline. This further indicates that ALD518 can be administered
as a non-erythropoietic stimulating agent for treating
cancer-related anemia.
Example 33
Ab1 Achieved ACR 20/50/70 in Patients with Rheumatoid Arthritis
Introduction
[0819] Rheumatoid arthritis is a chronic, systemic inflammatory
disorder that principally attack synovium of joints. The disease
causes painful and potentially disabling inflammation, with onset
typically occurring between 40 and 50 years of age. Interpretation
of drug treatment efficacy in rheumatoid arthritis is made
difficult by the myriad of subjective and objective assessment
tools made available over the years. The American College of
Rheumatology ("ACR") released a standardized set of rheumatoid
arthritis measures to facilitate evaluation of improvement of the
disease in clinical trials. Felson, et al. (1993) Arthritis &
Rheumatism 36: 729-40.
Methods
[0820] One-hundred twenty-seven patients with active rheumatoid
arthritis and CRP.gtoreq.10 mg/L were divided into 4 treatment
groups. Patients in one group received one 1-hour intravenous (IV)
infusion of either placebo (n=33), 80 mg (n=32), 160 mg (n=34), or
320 mg (n=28) of the Ab1 monoclonal antibody, once at the start of
the 16 week trial and again at week 8. Data on CRP concentration
was collected every week for the first 4 weeks, every two weeks
between weeks 4 and 12, and at the conclusion of the test at week
16.
[0821] Assessment under the standardized protocols from the
American College of Rheumatology were employed in determining the
percentage of improvement of patients during the clinical trial and
conducted by a person trained in the ordinary art of evaluating
rheumatoid arthritis. The evaluation was based upon activity
measures, including tender joint count, swollen joint count, the
patient's assessment of pain, the patient's and physician's global
assessments of disease activity, and laboratory evaluation of
either erythrocyte sedimentation rate or CRP level. Id. The
patient's assessment of pain was based upon the Stanford Health
Assessment Questionnaire Disability Index (HAQ DI). Patients that
achieve a 20% increase in activity measures for rheumatoid
arthritis during a clinical trial are categorized as achieving ACR
20. Similarly, patients achieving 50% and 70% improvements are
categorized as ACR 50 and ACR 70, respectively.
Results
[0822] A significant portion of patients suffering from rheumatoid
arthritis achieved ACR 20 or greater during the course of the
study. See Table 14. Patients observed rapid improvement in systems
within the first 4 weeks of the study, as well as continued, steady
improvement throughout the course of the 16 week evaluation. The
greatest results where exhibited by patients receiving the 320 mg
dosage level, with 43% achieving ACR 70 status during the
study.
TABLE-US-00016 TABLE 14 Percentage patients achieving ACR 20/50/70
at week 16 - MITT non responder imputation Pla- Ab1 Ab1 Ab1 Ab1
cebo 80 mg 160 mg 320 mg Pooled (n = 33) (n = 32) (n = 34) (n = 28)
(n = 94) ACR 36% 75% 65% 82% 73% 20 (p = 0.0026) (p = 0.0283) (p =
0.0005) (p = 0.0002) ACR 15% 41% 41% 50% 44% 50 (p = 0.0281) (p =
0.0291) (p = 0.0052) (p = 0.0032) ACR 6% 22% 18% 43% 27% 70 (p =
0.0824) (p = 0.2585) (p = 0.0015) (p = 0.0130)
[0823] Analysis of the individual components of the ACR evaluation
demonstrated gains in every component. HAQ DI scores demonstrated
clinically meaningful change over placebo during the course of the
evaluation. Serum CRP levels were greatly reduced in all patients
studied. The reduction in serum CRP levels was rapid, with
immediate reduction in CRP levels relative to placebo within one
week of Ab1 administration, and prolonged diminished levels
continued at least until the final measurement was taken (up to
sixteen weeks). In all cases, CRP levels fell to at or below the
normal reference range (less than 5-6 mg/L) within one week. Thus,
administration of Ab1 can cause a rapid and sustained improvement
rheumatoid arthritis patients, as evidenced by the significant
improvement in ACR scores during clinical evaluation, and presents
an effective treatment regime. See also WO 2011/066371.
Example 34
Ab1 Achieved Improved DAS28 and EULAR Scores in Patients with
Rheumatoid Arthritis
Introduction
[0824] Rheumatoid arthritis is a chronic, systemic inflammatory
disorder that principally attack synovium of joints. The disease
causes painful and potentially disabling inflammation, with onset
typically occurring between 40 and 50 years of age. Interpretation
of drug treatment efficacy in rheumatoid arthritis is made
difficult by the myriad of subjective and objective assessment
tools made available over the years. The American College of
Rheumatology ("ACR") released a standardized set of rheumatoid
arthritis measures to facilitate evaluation of improvement of the
disease in clinical trials. Felson, et al. (1993) Arthritis &
Rheumatism 36: 729-40.
[0825] Inflammatory activity associated with rheumatoid arthritis
is measured using numerous variables through validated response
criteria such as Disease Activity Score (DAS), DAS28 and EULAR. The
DAS is a clinical index of rheumatoid arthritis disease activity
that combines information from swollen joints, tender joints, the
acute phase response, and general health. Fransen, et al. (2005)
Clin. Exp. Rheumatol. 23(Suppl. 39): S93-S99. The DAS 28 is an
index similar to the original DAS, but utilizes a 28 tender joint
count (range 0-28), a 28 swollen joint count (range 0-28), ESR
(erythrocyte sedimentation rate), and an optional general health
assessment on a visual analogue scale (range 0-100). Id. The
European League against Rheumatism (EULAR) response criteria
classify patients using the individual amount of change in the DAS
and the DAS value (low, moderate, high) reached into one of the
following classifications: Good; Moderate; or Non-Responders.
Id.
Methods
[0826] One-hundred twenty-seven patients with active rheumatoid
arthritis were divided into 4 treatment groups. Patients in one
group received one 1-hour intravenous (IV) infusion of either
placebo (n=33), 80 mg (n=32), 160 mg (n=34), or 320 mg (n=28) of
the Ab1 monoclonal antibody, once at the start of the 16 week trial
and again at week 8. Data on the DAS28 and EULAR scores was
collected every week for the first 4 weeks, every two weeks between
weeks 4 and 12, and at the conclusion of the test at week 16.
Assessment under the standardized DAS28 and EULAR protocols were
employed in determining the respective scores of patients during
the clinical trial and conducted by a person trained in the
ordinary art of evaluating rheumatoid arthritis.
Results
[0827] Patients receiving 80 mg, 160 mg or 320 mg of Ab1
demonstrated improved DAS28 scores relative to those patients
receiving placebo over the course of 16 weeks, as presented in FIG.
62 as a mean change from the baseline DAS28 score. Furthermore, a
significant percentage of patients receiving 80 mg, 160 mg or 320
mg of Ab1 achieved "Good" or "Moderate" classifications relative to
those patients receiving placebo over the course of 16 weeks. Thus,
administration of Ab1 can result in improved DAS28 and EULAR scores
in rheumatoid arthritis when compared to those patients receiving
placebo. See WO 2011/066371.
Example 35
Safety, Pharmacokinetics (PK), and Pharmacodynamics (PD) of Ab1 in
Human Subjects Background
[0828] A humanized antibody derived from Ab1 (humanized Ab1 or
ALD518) containing the variable heavy and light sequences in SEQ ID
NO: 19 and 20 was administered to rheumatoid arthritis patients.
This antibody is a humanized, asialated, IgG1 monoclonal antibody
against IL-6 which has been shown to have a half-life (t1/2) of
approximately 30 days in humans. In studies in patients with RA,
intravenous (IV) with this antibody (humanized Ab1) has
demonstrated: efficacy over 16 weeks with rapid American College of
Rheumatology (ACR) responses; Complete and durable suppression of
C-reactive protein (CRP); Good tolerability, and a safety profile
consistent with the biology of IL-6 blockade. This humanized
antibody binds to IL-6 with high affinity, preventing interaction
and signaling mediated via IL-6R. Rapid and significant treatment
responses have been demonstrated with intravenous (IV)
administration of humanized Ab1 in patients with RA. In this
example we study the safety, pharmacokinetics and pharmacodynamics
of subcutaneous (SC) administration of humanized Ab1 in healthy
subjects.
[0829] The objective of this study was to assess the safety,
pharmacokinetics (PK) and pharmacodynamics (PD) of a single SC
injection of this humanized antibody in healthy male subjects.
Methods
[0830] In this Phase I, double-blind, placebo-controlled study, 27
subjects were randomized 2:1 to receive a single dose of humanized
Ab1 or placebo in the following groups: humanized Ab1 50 mg SC,
humanized Ab1 100 mg SC or humanized Ab1 100 mg IV (n=6 active and
n=3 placebo per group). The primary objective was to assess safety
of SC humanized Ab1 versus placebo over 12 weeks. Plasma
concentrations of humanized Ab1 and serum concentrations of
C-reactive protein (CRP) were assessed as secondary objectives.
Assessments were performed daily in Week 1 and then on Day 10,
Weeks 2, 4, 6 and 8, and then monthly to Week 12. The study was
unblinded at Week 12, and humanized Ab1 subjects were monitored to
Week 24.
Study Design and Population
[0831] The study included 27 healthy male subjects (aged 18-65
years). Subjects were dosed in three treatment groups of nine
subjects each, randomized 2:1 to receive a single dose of humanized
Ab1 or placebo on Day 1. Humanized Ab1 treatments per group were:
humanized Ab1 IV 100 mg infusion over 60 minutes; humanized Ab1 SC
50 mg injection (1 mL); or humanized Ab1 100 mg injection (1 mL).
The study was unblinded at Week 12, after which placebo subjects
discontinued the trial and ALD518 subjects were monitored to Week
24.
Safety and Immunogenicity Assessments
[0832] The primary objective of the study was to assess the safety
of SC humanized Ab1 compared with placebo over 12 weeks. Safety was
monitored over 12 weeks for all subjects. The study was unblinded
at Week 12, and Humanized AB1 subjects were monitored to Week 24.
Laboratory safety tests were performed pre-dose at screening and
Day -1, and post dose on Days 2 and 7, Weeks 2, 4, 6, 8 and 12 for
all subjects, and Weeks 16, 20 and 24 post-dose for those
randomized to Humanized Ab1. Anti-Humanized AB1 antibodies were
measured by enzyme-linked immunosorbent assay (ELISA). Blood
samples were collected at Day 1 (pre-dose) and Week 12 post-dose
for all subjects, and Week 24 post-dose for those randomized to
Humanized Ab1.
Pharmacokinetic and Pharmacodynamic Assessments
[0833] Plasma Humanized AB1 and serum CRP concentrations were
assessed by ELISA. For all subjects, samples were collected at
screening, pre-dose on Day 1, and post-dose on Days 2 and 7 and
Weeks 2, 4, 6, 8 and 12. For subjects randomized to Humanized AB1,
further samples were collected at Weeks 16, 20 and 24
post-dose.
Statistical Analysis
[0834] All subjects who received a dose of Humanized AB1 or placebo
were included in the safety analysis. All subjects who received a
dose of Humanized AB1 or placebo were included in PD and
immunogenicity analyses. All subjects who received a dose of
Humanized AB1 were included in PK analyses (n=18). All PK samples
for placebo subjects were confirmed as below quantification.
Descriptive statistics were generated for baseline demographics,
safety data, plasma Humanized AB1 parameters and serum CRP
concentrations. Wilcoxon Rank Sum test was used to compare CRP
concentrations for Humanized AB1 treatments versus placebo.
Results--Summary
[0835] Over 24 weeks, there were no deaths or serious AEs, and no
withdrawals due to AEs. Nearly all subjects (89%) experienced AEs,
which were mild or moderate except one event of severe
gastroenteritis in the Humanized ab1 SC 50 mg group. Injection site
reactions occurred in 5/12 Humanized Ab1 SC subjects, 1/6 placebo
SC subjects and 1/3 placebo IV subjects (none were reported in
Humanized Ab1 IV subjects). These were mild except one case of
moderate erythema and pruritis in the Humanized Ab1 100 mg SC
group. Increases in direct bilirubin and neutrophil counts below
the limit of normal were more common in subjects receiving
Humanized Ab1 than placebo; all were CTC Grade 1 or 2. The half
life of Humanized Ab1 was similar across all groups (mean range:
30.7-33.6 days). The median Tmax of Humanized Ab1 was longer after
SC (.about.1 week) than after IV administration (.about.end of
infusion). The PK of SC Humanized Ab1 was dose-proportional in
terms of AUC and Cmax at doses of 50 mg and 100 mg. Based on
AUC0-.infin. (day*gg/mL) of 237, 452 and 764 for the Humanized Ab1
50 mg SC, 100 mg SC and 100 mg IV groups, respectively, the
bioavailability of Humanized Ab1 was .about.60% for the SC versus
IV groups. Subjects receiving Humanized Ab1 experienced rapid and
sustained reductions in serum CRP (FIG. 21A), similar results were
seen when the antibody was administered either intravenous or
subcutaneously (FIG. 21B).
Subject Disposition and Baseline Demographics
[0836] A total of 27 subjects were enrolled and completed the study
(n=18 Humanized Ab1 and n=9 placebo). No subjects were withdrawn
for any reason. All subjects were male; 23/27 subjects were
Caucasian and 4/27 were Asian. Mean age was 29 (range 20-59) and
was similar across the groups. Mean height and weight were also
generally comparable across groups, although the IV placebo group
were slightly lighter.
Safety and Immunogenicity to Week 12 for Humanized AB1 and
Placebo
[0837] A summary of safety is presented in TABLE 15. For the SC
Humanized AB1 groups, a total of 11/12 (91%) patients experienced
an adverse event (AE) compared with: 6/6 (100%) for the IV
Humanized AB1 group; 4/6 (66.6%) for the SC placebo group; and 3/3
(100%) for the IV placebo group.
TABLE-US-00017 TABLE 15 Adverse Events Up to Week 12 Week 12-Week
24* MedRA SC 50 mg SC 100 mg IV 100 mg Placebo SC Placebo IV SC 100
mg SC 100 mg IV 100 mg Preferred Term n = 6 n = 6 n = 6 n = 6 n = 6
n = 6 n = 6 n = 6 Subjects with 6 5 6 4 3 3 5 5 an AE AE severity
Mild 2 2 5 1 2 3 5 7 Moderate 3 3 1 3 1 1 1 0 Severe 1 0 0 0 0 0 0
0 Discontinuations 0 0 0 0 0 0 0 0 Due to AEs Deaths 0 0 0 0 0 0 0
0 AEs reported in .gtoreq. 2 subjects in any group Injection site 1
2 0 0 0 0 0 0 erythema Injection site 1 2 0 0 1 0 0 0 pruritis
Gastroenteritis 1 0 2 0 0 0 0 0 URTI 4 4 4 2 2 0 1 2 Skin
laceration 2 1 2 0 0 0 0 0 Myalgia 0 0 0 2 0 0 0 0 Headache 5 2 1 1
0 0 1 1 Nasal 0 0 2 0 0 0 0 0 congestion *Patients randomized to
placebo (IV or SC) discontinued at Week 12 and are not included in
Week 24 analyses; AE = adverse event; SC = subcutaneous; IV =
intravenous; URTI = upper respiratory tact infection.
[0838] Across groups: No deaths or serious AEs were reported and
there were no withdrawals due to AEs. Most AEs were mild or
moderate in intensity. One case of gastroenteritis in a SC
Humanized AB1 50 mg subject was considered severe, but not serious,
and not related to study medication. No anti-Humanized AB1
antibodies were detected in any subject during this period.
Injection Site Reactions
[0839] Injection site reactions were reported in 26% (7/27) of
subjects, and all occurred prior to Week 12 (TABLE 40). Injection
site reactions occurred in 5/12 SC Humanized AB1 subjects and 1/6
SC placebo subjects. In the IV groups, 0/6 Humanized AB1 subjects
and 1/3 placebo subjects experienced injection site reactions. All
injection site reactions were mild except in one SC Humanized AB1
100 mg subject with moderate injection site erythema and pruritis.
No injection site reactions occurred after Week 12 in any of the
Humanized AB1 groups. Infusion site reactions were reported in 0/6
subjects receiving IV Humanized AB1 and 1/3 IV placebo subjects
(infusion site pruritis)
TABLE-US-00018 TABLE 16 Ab1 Injection Site Reactions to Week 12*
Placebo Placebo 50 mg 100 mg 100 mg SC IV n = 6 n = 6 n = 6 n = 6 n
= 3 Total subjects with 2 3 0 1 1 injection site reaction Injection
site erythema 1 2 0 0 0 Injection site pain 1 1 0 1 0 Injection
site pruritis 1 2 0 0 1 Injection site rash 1 0 0 0 0 *All
injection site reactions were reported in the first 12 weeks of the
study. SC = subcutaneous; IV = intravenous
Clinical Laboratory Evaluations
[0840] TABLE 43 shows incidences of increased alanine
aminotransferase (ALT) and aspartate aminotransferase (AST) and
bilirubin levels across the Humanized AB1 and placebo groups. All
ALT and AST levels were Grade 1 by the Common Terminology Criteria
for Adverse Events (CTCAE), and no levels were .gtoreq.3 times the
upper limit of normal (ULN). All increases in total and direct
bilirubin were CTCAE Grade 1 or 2 and no subject met criteria for
drug-induced liver damage. Only one subject (SC Humanized AB1 100
mg group) had total bilirubin out of range (26 .mu.mol/L, range
0-24 .mu.mol/L), at Week 24.
TABLE 16 Clinical Laboratory Evaluations Over 24 Weeks (Ab1)
TABLE-US-00019 [0841] TABLE 16 Clinical Laboratory Evaluations Over
24 Weeks (Ab1) SC SC IV 50 mg 100 mg 100 mg Placebo* n = 6 n = 6 n
= 6 n = 9 Elevated ALT 0 1 3 2 Elevated AST 0 1 1 1 Elevated total
bilirubin 0 1 1 0 Elevated direct bililrubin 2 4 5 2 Low neutrophil
count.sup..dagger. 4 1 2 3 Low platelet count.sup..dagger. 2 0 0 1
*SC and IV groups combined up to Week 12 only, after which
placebo-treated patients discontinued; .sup..dagger.Below the lower
limit of normal; SC = subcutaneous; IV = intravenous; ALT = alanine
aminotransferase; AST = aspartate aminotransferase
[0842] Sporadic decreases in neutrophil and platelet counts were
also observed in the Humanized AB1 and placebo groups. Neutrophil
counts below the lower limit of normal were more common in subjects
receiving Humanized AB1 than placebo but all decreases were CTCAE
Grade 1 or 2. Only one subject (SC Humanized AB1 50 mg group) had
consistent mild neutropenia to Week 24 (1.6.times.109/L at Week
24). Reductions in platelet counts were all CTCAE Grade 1 (lowest
level 134.times.109/L) and no subject had a low platelet count past
Week 8.
Pharmacokinetics
[0843] Bioavailability of Humanized AB1 was 60% for SC Humanized
AB1 50 and 100 mg versus IV Humanized AB1 100 mg groups based on
the mean AUC.sub.0-.infin. (TABLE 44). The half-life of Humanized
AB1 was similar across all groups (mean range: 30.7-33.6 days)
(Table 17). Peak plasma concentration (C.sub.max) of SC Humanized
AB1 was reduced as compared to IV (FIG. 15). Median time to maximum
plasma concentration (T.sub.max) of Humanized Ab1 was longer after
SC Humanized AB1 (at approximately one week) than after IV
Humanized Ab1 administration (at approximately the end of
infusion).
TABLE-US-00020 TABLE 17 Ab1 Plasma Pharmacokinetic Parameters to
Week 24 SC 50 mg SC 100 mg IV 100 mg n = 6 n = 6 n = 6 C.sub.max
(.mu.g/mL) (CV)* 5.57 (24%) 9.19 (34%) 33.6 (30%) T.sub.max (days)
(min, max).sup..dagger. 6 (6, 14) 5.5 (2, 28) 0.17 (0, 17, 0.34)
AUC.sub.5-24 (day .mu.g/mL) (CV)* 218 (34%) 435 (19%) 732 (22%)
AUC.sub.8-.chi. (day .mu.g/mL) (CV)* 224 (39%) 444 (20%) 746 (22%)
t.sub.1/2 (days .+-. SD).sup..dagger-dbl. 33.6 .+-. 21.7 31.1 .+-.
9.0 30.7 .+-. 5.9 CL (mL/day) (CV)* 223 (32%) 225 (21%) 134 (27%)
*Data are geometric mean (coefficient of variation %, CV %).
.sup..dagger.Data are median (minimum, maximum).
.sup..dagger-dbl.Data are mean (.+-.SD). CV = coefficient of
variation; C.sub.max = maximum plasma concentration; AUC = area
under curve; SD = standard deviation; CL = apparent total body
clearance for IV and apparent total body clearance divided by
bioavailability for SC; IV = intravenous; SC = subcutaneous;
T.sub.max = time to maximum plasma concentration; t.sub.1/2 =
terminal plasma half-life
Pharmacodynamics
[0844] CRP levels were reduced in all subjects who received
Humanized AB1 irrespective of dose or administration route. From
Weeks 4 to 12, CRP levels were significantly lower in subjects who
received Humanized Ab1 compared with placebo (unadjusted p-value
<0.05). A high correlation between the IgG produced and antigen
specificity for an exemplary L-6 protocol was observed with 9 of 11
wells showed specific IgG correlation with antigen recognition. In
Humanized AB1 subjects, CRP levels were lowered to <20% of
pre-dose levels in: 72% (13/18) of subjects at Week 1; 73% (11/15)
of subjects at Week 12; and 56% (10/18) of subjects at Week 24.
Conclusions
[0845] In this Phase I study, the anti-IL-6 antibody Humanized Ab1
was generally well tolerated when administered in a single SC dose
in healthy male subjects. Injection site reactions were generally
mild. No anti-Humanized Ab1 antibodies were detected. Changes in
liver enzymes, neutrophil and platelet counts were reversible. The
bioavailability of SC Humanized AB1 was approximately 60% of that
observed with IV Humanized Ab1. The half-life of Humanized AB1 was
approximately 30 days, irrespective of route of administration.
These data concur with previous data using IV Humanized Ab12.
Subcutaneous Humanized AB1 led to rapid and large reductions in
serum CRP. Reductions in CRP observed during the first 12 weeks of
the study were sustained over 24 weeks of assessment. These
preliminary data support the continued development and evaluation
of subcutaneous Humanized Ab1 for the treatment of patients with
mucositis.
[0846] In summary, in this Phase I study, the anti-IL-6 antibody
Humanized Ab1 was well tolerated when administered in a single SC
dose; injection site reactions were generally mild. The
bioavailability of SC Humanized Ab1 was .about.60% of IV Humanized
Ab1, and the half life was -30 days. Rapid and significant
reductions in CRP were observed, which were sustained over 24 weeks
of assessment.
Example 36
Effect of Ab1 on DAS28-Assessed Disease Activity
[0847] ALD518* is an asialated, humanized anti-IL-6 monoclonal
antibody with a half-life of .about.30 days containing the
humanized variable heavy and light sequences contained in SEQ ID
NO: 19 and 20. These humanized heavy and light sequences are
derived from a parent rabbit antibody that specifically binds human
IL-6 which antibody is referred to in said incorporated application
as Ab1. ALD518 binds to IL-6 with high affinity, preventing
interaction and signalling mediated via soluble and membrane-bound
IL-6R. Rapid and significant ACR responses have been demonstrated
with ALD518* in patients with RA. In this example we report the
impact of ALD518 on DAS28-assessed disease activity over 16
weeks.
Methods
[0848] Patients with active RA and an inadequate response to
methotrexate (MTX) were randomized 1:1:1:1 to intravenous
ALD518*80, 160 or 320 mg or placebo during this 16-week,
double-blind, placebo-controlled Phase II study. Patients received
two IV infusions of ALD518 (Day 1 and Week 8), while continuing on
stable doses of methotrexate (MTX). The primary efficacy endpoint
was the proportion of patients achieving ACR20 at Week 12; disease
activity was assessed via Disease Activity Score (DAS28) based on
C-reactive protein (CRP) as a secondary endpoint. The proportion of
patients achieving DAS28-defined remission (score <2.6), low
disease activity state (LDAS; score .ltoreq.3.2) and good EULAR
responses (current DAS28<3.2 and improvement from baseline
.gtoreq.1.2) were assessed for the modified intent-to-treat
population, and are presented for patients with available data (as
observed). P-values are based on Chi-square tests.
Results
[0849] Of 127 randomized and treated patients, 116 completed the
trial. At baseline, mean age was 52.3 years and RA duration was 6.8
years. At Weeks 4, 12 and 16, the proportion of patients achieving
LDAS and remission was greater than placebo for all ALD518* doses;
differences were significant versus placebo (p<0.05) for all
assessments except ALD518*80 mg at Week 4 (p=0.056). Similarly,
EULAR responses were significantly better for all ALD518* doses
versus placebo (p<0.01) at Weeks 4, 12 and 16. There was a trend
toward greater responses with higher ALD518* doses.
TABLE-US-00021 TABLE 18 Proportion of patients achieving
DAS28-defined remission, LDAS and good EULAR responses ALD518*
ALD518* ALD518* Placebo 80 mg 160 mg 320 mg -- (N = 32) (N = 34) (N
= 28) (N = 33) DAS28-defined remission Week 4 10.0 8.8 17.9 0 Week
12 17.2 21.2 34.6 3.3 Week 16 13.8 28.1 44.0 0 LDAS Week 4 10.0
23.5 28.6 0 Week 12 20.6 33.3 46.1 6.6 Week 16 20.7 50.0 52.0 3.4
Good EULAR response Week 4 10.0 23.5 28.6 0 Week 12 20.7 33.3 46.2
6.7 Week 16 20.7 50.0 52.0 3.4 DAS28 = Disease Activity Score 28;
LDAS = low disease activity state
[0850] SAEs were reported in two ALD518 patients (both had
significant increases in liver enzymes, and discontinued
treatment). Overall, elevations in liver enzymes >2.times.ULN
occurred in 17% of ALD518*-versus 0% placebo-treated patients; the
frequency was highest in the 320 mg dose group. Modest increases in
total cholesterol were observed (mean increase by Week 16=1.1
mmol/L for ALD518* versus 0.2 mmol/L for placebo). Nine ALD518
patients had transient Grade II and two had transient Grade III
neutropenias. There were no serious infections or infusion
reactions in any treatment group, and no evident
immunogenicity.
Conclusions
[0851] In this Phase II study, the novel IL-6 inhibitor ALD518
resulted in rapid and significant improvements in disease activity
sustained over 16 weeks of assessment in patients with RA and an
inadequate response to methotrexate (MTX). ALD518 was well
tolerated, with a safety profile consistent with the biology of
IL-6 blockade.
Example 37
Ab1 Administration
Methods
[0852] Patients with active RA were randomized into a 16 week,
double-blind, placebo-controlled trial comparing multiple iv
infusions of ALD518 (80, 160 or 320 mg). Patients received an
infusion every 8 weeks and were maintained on a stable dose of MTX
throughout the trial. Assessments included ACR 20/50/70 responses
and DAS28. All patients were evaluated for safety. For early
withdrawals, LOCF analysis was used for continuous variables and
non-responder imputation for categorical variables.
Results
[0853] 132 patients were randomized; 127 were dosed. Mean disease
duration was 6.6 years; mean DAS28 score was 6.2 and mean HAQ-DI
was 1.72. 11 patients did not complete the 16-week trial: 320 mg-3,
160 mg-1, 80 mg-3, placebo-4: 4 discontinued due to adverse events
(80 mg-2, 320 mg-2), with 2 SAEs (80 mg-1, 320 mg-1). Elevations in
liver enzymes (LFTs) >2.times.ULN were observed in 17% ALD518
versus 0% placebo. There were modest increases in total cholesterol
(mean increase by week 16=1.1 mmol/L ALD518 versus 0.2 mmol/L
placebo). 9 patients on ALD518 had transient grade 2 neutropenias;
2 pts transient grade 3 neutropenias. There were no serious
infections reported in any treatment group. Infusions of ALD518
were well tolerated without infusion reactions or evident
immunogenicity. At weeks 4 and 16, ACR responses (non responder
imputation analysis) and improvements in DAS28 scores were:
TABLE-US-00022 TABLE 19 Week 4 DAS28 Scores for Ab1 80, 160, and
320 dosages 80 mg 160 mg 320 mg PBO + MTX Week 4 (n = 32) (n = 34)
(n = 28) (n = 33) ACR20 50% (16)* 56% (19)* 71% (20)* 23% (8) ACR50
9% (3) 15% (5) 29% (8).dagger. 3% (1) ACR70 6% (2) 0% (0) 11% (3)
0% (0) Mean .DELTA. -1.8 -2.1 -2 -0.6 DAS28 *p.English Pound.0.04;
.dagger.p = 0.009
TABLE-US-00023 TABLE 20 Week 16 DAS28 Scores for Ab1 80, 160, and
320 dosages 80 mg 160 mg 320 mg PBO + MTX Week 16 (n = 32) (n = 34)
(n = 28) (n = 33) ACR20 75% (24)* 65% (22)* 82% (23)* 36% (12)
ACR50 41% (13)* 41% (14)* 50% (140* 15% (5) ACR70 22% (7).dagger.
18% (6).dagger-dbl. 43% (12)* 6% (2) Mean .DELTA. -2.7 -2.7 -3.2
-1.1 DAS28 *p.English Pound.0.03 .dagger.p = 0.08 .dagger-dbl.p =
0.26
Conclusion
[0854] ALD518 is the first mAb to IL-6, as opposed to an anti-IL-6
receptor mAb, to show a significant, rapid and sustained
improvement in disease activity in RA. ALD518 in doses ranging from
80 to 320 mg given as 2 IV infusions to pts with active RA was well
tolerated with increases in LFTs and total cholesterol and
transient neutropenia observed in some patients. There were no
infusion reactions associated with administration of ALD518 and no
detectible immunogenicity.
Example 38
Treatment of Oral Mucositis with Head and Neck Cancer Receiving
Concurrent Chemotherapy and Radiotherapy
[0855] Subjects suffering from oral mucositis with head and neck
cancer receiving concurrent chemotherapy and radiotherapy may
receive a regimen of a 160 mg or 320 mg doses of a composition
comprising a humanized monoclonal antibody that selectively binds
IL-6.
[0856] Subjects will be assessed using tumor staging (standard TNM
system) during the screening period, which may occur within 30 days
prior to radiotherapy (RT) start. The RT treatment period will be
approximately 7 weeks, depending on the subject's prescribed
radiation plan. Post-RT treatment period visits will be at Weeks 1,
2, 3, and 4 following the treatment period. Long term follow-up
visits will occur at 3, 6, 9, and 12 months following the end of RT
to determine if there is an effect of ALD518 on the tumor response
to CRT.
[0857] Subjects may have recently diagnosed, pathologically
confirmed, non-metastatic SCC of the oral cavity, oropharynx,
hypopharynx or larynx. Subjects may be scheduled to receive a
continuous course of intensity-modulated radiotherapy (IMRT), with
a minimum cumulative dose of 55 Gy and maximum dose of 72 Gy.
Planned radiation treatment fields may include at least 2 oral
sites (e.g., buccal mucosa, floor of oral cavity, tongue or soft
palate) with each site receiving a total dose of >55 Gy. The
treatment plan may include monotherapy with cisplatin administered
in standard weekly (30 to 40 mg/m.sup.2) or tri-weekly (80 to 100
mg/m.sup.2, given on Days 0, 21 and 42) regimens or monotherapy
with carboplatin administered weekly (100 mg/m.sup.2).
[0858] A composition comprising a humanized monoclonal antibody
that selectively binds IL-6 may be given within 2 hours prior to
the subjects' radiation every 4 weeks for a total of 2 doses. A
baseline visit will occur on the first day of ALD5 18 and RT.
Safety, PK, PD, and markers of IL-6 biology (e.g., total IL-6,
slL-6r, soluble gp130, sIL-6 Complex) will be monitored during the
RT treatment and Post-RT treatment period. The long term follow-up
period of the treatment may include long term follow-up visits,
primarily for the assessment of tumor response and survival. These
assessments will take place at Months 3, 6, 9 and 12 following the
last dose of RT. At Months 3, 6, 9, and 12 tumors will be assessed
clinically. At the Month 6 and Month 12 follow-up visits, tumor
status will be assessed using RECIST criteria and the same imaging
modality (CAT, PET or MRI) that was used to evaluate tumor status
prior to RT start (at the time of staging) may be used.
[0859] Following a treatment regimen comprising the administration
of a humanized monoclonal antibody that selectively binds IL-6,
patients may show improvement in their oral mucositis (e.g., a
reduction in symptoms).
Example 39
Oral Mucositis Study 1: Single Acute Radiation Dose (40 Gy)
Study
[0860] Introduction: The efficacy of treatment with a rodent
anti-IL-6 antibody (monoclonal rat IgG1 clone MP5-20F3, R&D
Systems) was studied in an established mouse model of
radiation-induced oral mucositis. Dorr & Kummermehr (1991)
Virchows Arch B Cell Pathol Incl Mol Pathol 60(5): 287-94. Study
endpoints included oral mucositis duration and severity, body
weight, and survival in normal C3H mice.
[0861] Methods:
[0862] 36 male C3H mice were exposed to a single dose of 40 Gy
radiation directed to the underside of the tongue on Day 0. Animals
were dosed with a rodent anti-IL-6 antibody (monoclonal rat IgG1
clone MP5-20F3, R&D Systems), control antibody (monoclonal rat
IgG1 clone 43414, R&D Systems), or vehicle on Days -1, 2, 6, 9,
and 13, via intravenous injection at 10 mg/kg into the tail vein.
Animals were weighed daily, and food and water consumption were
monitored in each treatment group.
[0863] Images of the tongue were captured daily from Days 4 to 16.
An oral mucositis score was assigned to each animal based on a
defined scoring scale per protocol design. The scoring scale is
presented in Table 21. Following completion of the study, the
tongue images were scored by blinded observers to establish the
values used to determine the degree and duration of oral mucositis
and any treatment effects. A score of 1-2 is considered to
represent a mild stage of disease, whereas a score of 3-5 is
considered to indicate moderate to severe mucositis.
TABLE-US-00024 TABLE 21 Rodent Model Oral Mucositis Scoring Scale
Score Description 0 Tongue completely healthy. No erythema or
vasodilation. 1 Light to severe erythema and vasodilation. No
erosion of mucosa. 2 Severe erythema and vasodilation. Erosion of
superficial aspects of mucosa leaving denuded areas. Decreased
stippling of mucosa. 3 Formation of off-white ulcers in at least
one places. Ulcers may have a yellow/gray appearance due to
pseudomembrane. Cumulative size of ulcers should equal about 1/4 of
the tongue. Severe erythema and vasodilation. 4 Cumulative size of
ulcers should equal 1/4 to 1/2 of the tongue. Loss of pliability.
Severe erythema and vasodilation. 5 Virtually all of tongue is
ulcerated.
[0864] Results:
[0865] The onset of mucositis was the same for all 3 groups with
peak mucositis scores occurring on Day 10. An analysis of the
number of days mice presented with scores of 3+ during the study
demonstrated no statistical difference among the 3 groups (mean
days of 3.3, 4 and 3.6 for vehicle, isotype control and anti-IL-6,
respectively).
[0866] On Day 10, 100% of the mice in the vehicle and control
antibody groups developed ulcers while 67% of the anti-IL-6 group
developed ulcers (FIG. 22). There was no statistical difference in
ulceration scores at Day 10 between the anti-IL-6 antibody and
control antibody or vehicle groups. On Days 12 and 13, a
numerically larger (not statistically different) number of mice in
the anti-IL-6 group had ulceration compared to the mice in the
vehicle or control groups.
[0867] Weight loss was seen in all 3 groups with peak weight loss
occurring between Days 11 and 12. There were no statistically
significant differences in weight change between the three groups.
No general toxicities were noted in this study that could be
attributed to treatment with the control or anti-IL-6 antibodies or
the vehicle. No treatment-related deaths occurred during the
study.
Example 40
Ascending Radiation Dose Levels Study in Mouse Model of
Radiation-Induced Oral Mucositis
Introduction
[0868] The efficacy of treatment with a rodent anti-IL-6 antibody
(monoclonal rat IgG1 clone MP5-20F3, R&D Systems) was studied
in an established mouse model of radiation-induced oral mucositis.
Dorr & Kummermehr J. Proliferation kinetics of mouse tongue
epithelium under normal conditions and following single dose
irradiation. Virchows (1991) Arch B Cell Pathol Incl Mol Pathol.
60(5): 287-294. Study endpoints included oral mucositis duration
and severity, body weight, and survival in normal C3H mice.
Methods
[0869] 120 male C3H mice (12 per treatment group per radiation
dose) were exposed to a single dose of radiation, totaling 25, 30,
35, 40, or 45 Gy directed to the underside of the tongue on Day 0.
Animals were dosed with a rodent anti-IL-6 antibody (monoclonal rat
IgG1 clone MP5-20F3, R&D Systems) or control antibody
(monoclonal rat IgG1 clone 42414, R&D Systems) on Days -1, 2,
6, 9, and 13, via intravenous injection at 10 mg/kg into the tail
vein. Animals were weighed daily; and food and water consumption
was monitored in each treatment group.
[0870] Images of the tongue were captured daily from Days 4 to 16.
An oral mucositis score was assigned to each animal based on a
defined scoring scale per protocol design. The scoring scale is
presented in Table 21. Following completion of the study, the
tongue images were scored by blinded observers to establish the
values used to determine the degree and duration of oral mucositis
and any treatment effects. A score of 1-2 is considered to
represent a mild stage of disease, whereas a score of 3-5 is
considered to indicate moderate to severe mucositis.
Conclusions
[0871] Mice treated with the anti-IL-6 antibody at 25 Gy showed a
statistically significant decrease in the median number of days
with ulceration compared to mice treated with the control antibody
(p=0.0134). There was no difference between the treatment groups at
30 and 35 Gy. Mice treated with the anti-IL-6 antibody at 40 and 45
Gy showed a statistically significant increase in the median number
of days with ulceration compared to mice treated with the control
antibody (p=0.0237 and 0.0037, respectively). These data are shown
in FIG. 23.
[0872] The anti-IL-6 treated group had a numerically lower
percentage of mice that were ulcerated at any timepoint over the
course of the study compared to control antibody treated group at
the 25 and 30 Gy radiation levels (45% vs. 82%; 67% vs. 92%). See
FIG. 24. At higher radiation dose levels the percentage of mice
that were ulcerated over the course of the study in the two
treatment groups were similar.
[0873] Over the course of the study, the anti-IL-6 treatment group
receiving 25 Gy had statistically significant positive median
percentage changes from baseline body weight compared to the
control antibody group at all timepoints. Additionally, at Day 4,
the anti-IL-6 group at 30 and 35 Gy radiation dose levels had
statistically significant positive median percentage changes from
baseline body weight compared to the control antibody group. At the
40 and 45 Gy radiation dose levels, there were no differences in
median percent change from baseline between the anti-IL-6 and
control antibody groups.
[0874] No general toxicities were noted in this study that could be
attributed to treatment with the anti-IL-6 antibody or control
antibody. No treatment-related deaths were observed during the
study.
Conclusions
[0875] In conclusion, at the lowest dose (25 Gy) of radiation there
was a lower incidence and duration of ulcerated oral mucositis
(scores 3-5) in the anti-IL-6 treated group compared to controls.
Additionally, the mice treated with the anti-IL-6 antibody did not
lose body weight compared to controls. At the 30 Gy radiation dose
level, there was lower incidence of ulcerated oral mucositis in the
anti-IL-6 treated group compared to controls. Mice receiving higher
single doses of radiation (40 Gy and 45 Gy) had a longer duration
of ulcerated oral mucositis in the anti-IL-6 antibody treated group
compared to controls. The radiation dose levels administered as
single doses in this study are much higher than the daily doses
(approximately 2 Gy) given in IMRT for the treatment of head and
neck cancer. These data support with the use of a humanized
monoclonal antibody (e.g., ALD518) in the prevention of CRT-induced
oral mucositis in head and neck cancer patients.
Example 41
Effect of Anti-IL-6 Treatment on Tumor Growth in a Xenograft
Model
Introduction
[0876] The human pharynx squamous cell carcinoma cell line (FaDu)
has been utilized as a model for head and neck cancers in mouse
xenograft studies. Alderson, et al (2002) Cancer Chemother.
Pharmacol. 50: 202-212. FaDu expresses both IL-6 and the IL-6
receptor and IL-6 levels are induced in response to radiation
treatment. Chen, et al. (2010) Int. J. Radiation Oncology Biol.
Phys. 76:1214-1224 The effect of anti-IL-6 treatment on the growth
of FaDu tumors in the presence or absence of radiation treatment
was studied in an established mouse xenograft model. Study
endpoints included tumor volume and body weights.
Methods
[0877] 120, six week old, female athymic nude mice were implanted
with ten million FaDu tumor cells subcutaneously. When tumors
reached the weight range of 125-250 mg (Day 10), animals were
divided into 3 groups of 40 mice. One group was given vehicle twice
weekly via intravenous injection into the tail vein. The second
group was given 10 mg/kg each of ALD518 and an anti-mouse IL-6
antibody (monoclonal rat IgG1, R&D Systems). The third
treatment group was given 10 mg/kg each of isotype control
antibodies (monoclonal human IgG1, R&D Systems). In each of the
treatment groups, half of the animals (N=20) were irradiated with
2Gy/day for 5 days and the other 20 animals were not irradiated.
Animals were euthanized when tumor volume reached 4,000 mm.sup.3 or
ulceration of the tumor occurred. All animals were weighed and
tumor volumes measured three times a week for the duration of the
study.
Results
[0878] The tumor volumes for each animal were measured three times
a week starting on the first day of treatment (Day 10). The study
was completed on Day 29. FaDu tumors have a high rate of
ulceration; in this study, between 9 and 13 animals were sacrificed
in each group by Day 29 due to tumor ulceration. No animals were
euthanized due to tumor burden. The median tumor volume for each
group is presented in FIG. 25. All groups had median tumor volumes
between 162-167 mm.sup.3 at the start of treatment (Day 10). Groups
treated with vehicle, isotype control antibodies or anti-IL-6
antibodies but not irradiated displayed very similar median tumor
volumes throughout the study. These groups were not statistically
different. Groups treated with vehicle, isotype control antibodies
or anti-IL-6 antibodies plus radiation had reduced median tumor
volumes of roughly 50% compared to the non-irradiated groups post
Day 22. Median tumor volumes of the irradiated groups were similar
and not statistically different. Thus, treatment with anti-IL-6
antibodies had no effect on tumor growth in either the
non-irradiated or irradiated groups.
[0879] Additional conclusions from the study include: no
differences in weight were observed between the six groups; no
general toxicities were noted that could be attributed to treatment
with the vehicle, control antibodies or anti-IL-6 antibodies; and
there were no treatment-related deaths.
Example 43
Clinical Trial Design
[0880] A phase 2, double-blind, placebo-controlled trial evaluating
the safety, efficacy, pharmacokinetics and pharmacodynamics of
ALD518, and the health and economic outcomes in subjects receiving
CRT for the treatment of squamous cell carcinomas (SCCs) of the
oral cavity, oropharynx, hypopharynx or larynx may be conducted. Up
to 96 subjects may be enrolled into this trial. Initially 3
open-label subjects will be enrolled into a safety run-in of the
160 mg dose. Approximately 90 subjects will be randomized (1:1:1)
into 1 of 2 dose levels of ALD518 (160 mg and 320 mg) or placebo
during the double-blind portion of the trial. Safety, PK, PD, and
markers of IL-6 biology (e.g., total IL-6, sIL-6r, soluble gp130,
sIL-6 Complex) will be monitored during the RT treatment and
Post-RT treatment period. Additionally, exploratory analyses of
IL-6 biology including cytokine biomarkers may be performed in a
subset of subjects and will require separate consent.
[0881] Subject eligibility, including tumor staging (standard TNM
system), will be assessed during the screening period, which may
occur within 30 days prior to radiotherapy (RT) start. The RT
treatment period will be approximately 7 weeks, depending on the
subject's prescribed radiation plan. Post-RT follow-up visits will
be at Weeks 1, 2, 3, and 4. Long term follow-up visits will occur
at 3, 6, 9, and 12 months following the end of RT to determine if
there is an effect of ALD518 on the tumor response to CRT.
[0882] Eligible subjects will have recently diagnosed,
pathologically confirmed, non-metastatic SCC of the oral cavity,
oropharynx, hypopharynx or larynx. Subjects must be scheduled to
receive a continuous course of intensity-modulated radiotherapy
(IMRT), with a minimum cumulative dose of 55 Gy and maximum dose of
72 Gy. Planned radiation treatment fields must include at least 2
oral sites (e.g., buccal mucosa, floor of oral cavity, tongue or
soft palate) with each site receiving a total dose of >55 Gy.
The treatment plan must include monotherapy with cisplatin
administered in standard weekly (30 to 40 mg/m.sup.2) or tri-weekly
(80 to 100 mg/m.sup.2, given on Days 0, 21 and 42) regimens or
monotherapy with carboplatin administered weekly (100
mg/m.sup.2).
[0883] ALD518 or placebo will be given every 4 weeks within 2 hours
prior to the subjects' radiation for a total of 2 doses. A baseline
visit will occur on the first day of RT. During the RT treatment
period, subjects will be assessed twice weekly for the presence and
severity of OM by treatment-blinded, trained evaluators using the
World Health Organization (WHO) grading scale for OM. Subjects will
also complete a daily diary, containing the Oral Mucositis Daily
Questionnaire (OMDQ) and a listing of analgesic use, and on a
weekly basis the FACT-HN and FACIT-F subscale PRO instruments.
[0884] All subjects will return to the clinic for 4 weekly visits
after RT completion for assessment of OM. During this time,
subjects will also continue to complete the OMDQ and the FACT-HN
and FACIT-F subscale PRO instruments. The long term follow-up
period of the clinical trial will include quarterly visits,
primarily for the assessment of tumor response. These assessments
will take place at Months 3, 6, 9 and 12 following the last dose of
RT. At Months 3, 6, 9, and 12 tumors will be assessed clinically.
At the Month 6 and Month 12 follow-up visits, tumor status will be
assessed using RECIST criteria and the same imaging modality (CAT,
PET, or MRI) that was used to evaluate tumor status prior to RT
start (at the time of staging).
Example 44
Additional Evaluation of ALD518 in RA Clinical Trials
[0885] This example describes further Phase II clinical trial
results for administration of ALD518 to patients with active RA.
For purposes of inclusion in this study, a patient was considered
to have active RA if the patient exhibited at least 6 swollen/6
tender joints, CRP>10 mg/dL, and had been treated with a stable
dose of methotrexate (MTX) (>10 mg/week) for at least 3 months
and stable use of NSAIDs or steroids (if any).
[0886] ALD518 was administered in a double-blind,
placebo-controlled study in which patients with active RA were
randomized 1:1:1:1 to receive either 80 mg (n=32), 160 mg (n=34),
or 320 mg (n=28) ALD518, or placebo (n=33). ALD518 or placebo were
given as an intravenous infusion over 60 minutes on Day 1 and then
again 8 weeks later. Patients were maintained on stable doses of
methotrexate (MTX) (at least 10 mg/week). Disease-modifying
antirheumatic drugs (DMARDs) other than MTX were discontinued at
least 4 months prior to study entry. Efficacy endpoints were
assessed at weeks 12 (primary endpoint) and week 16. HRQoL was
evaluated by the Medical Outcomes Survey Short Form-36 (SF-36).
Analyses were performed on the modified intent-to-treat population
for patients with data available at the visit of interest (as
observed).
[0887] 127 active RA patients were randomized and treated, and 116
completed the trial (80 mg, 29/32; 160 mg, 33/34; 320 mg, 25/28;
placebo, 29/33). Patient disposition is summarized in FIG. 26.
[0888] At baseline, mean age was 52.3 years; mean RA duration was
6.8 years; mean tender and swollen joint counts were 26.1 and 16.7,
and mean Physical (PCS) and Mental component summary (MCS) scores
were 31.0 and 35.0, respectively. Mean changes from baseline to
week 12 in MCS were significantly greater in each ALD518 dose group
vs placebo, and mean changes in both PCS and MCS scores exceeded
MCID in each ALD518 group. At week 12, mean changes from baseline
in one or more SF-36 domains were significantly greater in ALD518
dose groups vs placebo. Changes >MCID were observed in all
domains and in SF-6D in patients receiving ALD518. Improvements at
week 12 were sustained at week 16.
Results
[0889] Short Form-36 Component Summary Scores:
[0890] HRQoL was assessed by the patient-reported Short Form-36
(SF-36) questionnaire. The SF-36 includes 36 questions divided into
eight domains and summarized into the physical and mental component
summary scores (PCS and MCS, respectively). Scores range from 0 to
100, with higher scores indicating better health. The observed
Minimum Clinically Important Differences (MCID) are 2.5-5.0 for the
PCS and MCS, and 5.0-10.0 for domain scores.
[0891] Short Form-6D:
[0892] The SF-6D is a validated preference-based measure of health
utilities. The SF-6D was calculated using mean changes within
treatment groups across all eight SF-36 domains to yield a single
utility measure. The Minimum Important Difference (MID) is
0.041.
Analysis
[0893] Analysis was performed on the modified intent-to-treat
population for patients with available data at the visit of
interest (as observed). Changes from baseline in SF-36 PCS, MCS and
domain scores were summarized as descriptive statistics by
treatment group and visit. ALD518 treatment groups were also
compared with placebo at Week 12 using a two-sample t-test.
[0894] For Weeks 12 and 16, spydergrams were used to present
results across all domains of the SF-36 in a single figure, and to
compare with age- and gender-matched normative data from a US
population. Demarcations along the domain axes of the spydergrams
represent changes of 10 in domain score, and patient disposition
and baseline demographics and characteristics.
[0895] As shown in FIG. 26, a total of 127 patients were randomized
and received >1 dose of ALD518; 91.3% of patients completed the
study and eleven (8.7%) patients discontinued the study.
[0896] The individual SF-36 domain scores at Baseline and Week 12
are shown in Table 22 and illustrated graphically in FIG. 27.
Baseline domain scores were generally well balanced across the
treatment groups At baseline, patients had impaired HRQoL. Combined
mean baseline PCS and MCS scores were 31.0 and 35.0, respectively,
and 1.5-2.0 standard deviations less than normative values of 50.
Scores for each of the individual subscales of the SF-36 were also
considerably lower than age- and gender-matched US norms.
[0897] For all ALD518 treatment groups, mean improvements from
baseline to Week 12 were large across the eight domains of the
SF-36 and exceeded those observed with placebo (See the Table 22
and FIG. 27). Mean improvements were significantly greater than
those observed with placebo (p<0.05; Table 22) at Week 12 in the
following domains: Role physical (ALD518 320 mg group); bodily
pain, general health, social functioning and mental health (ALD518
80 and 320 mg treatment groups); vitality (all ALD518 groups); role
emotional (ALD518 80 mg group).
[0898] At all doses of ALD518, mean improvements in all eight SF-36
domains exceeded the MCID at Week 12. See Table 22. After
adjustment for the change from baseline in the placebo group,
improvements from baseline observed with ALD518 were greater than,
and in some cases at least twice, that observed in the placebo
group. There was observed dose-dependent changes (improvements) in
the domains of role physical, bodily pain and mental health.
Treatment with ALD518 resulted in improvements in SF-36 scores
toward those observed in the `normal` comparative population. See
FIG. 29.
TABLE-US-00025 TABLE 22 SF-36 PCS and MCS Domains at Baseline and
at Week 12 ALD518 ALD518 ALD518 Domain* 80 mg 160 mg 320 mg Placebo
(+age/gender norm) Time point (n = 32) (n = 34) (n = 28) (n = 33)
PCS Domains Physical functioning Baseline 48.3 42.1 49.3 42.8
(79.6) Mean at Week 12 61.0 61.6 70.4 55.0 Role physical Baseline
27.9 26.0 36.7 33.5 (80.1) Mean at Week 12 50.0 53.5 59.7.dagger.
47.1 Bodily pain Baseline 26.4 22.1 33.6 30.7 (68.3) Mean at Week
12 47.8.dagger. 50.5 56.9.dagger. 39.5 General health Baseline 36.5
33.4 38.7 38.9 (69.5) Mean at Week 12 45.1.dagger. 45.6
49.5.dagger. 39.4 Vitality Baseline 32.5 26.2 38.8 41.5 (58.2) Mean
at Week 12 50.9.dagger. 50.8.dagger. 60.9.dagger. 46.3 Social
functioning Baseline 47.7 31.6 42.1 48.8 (83.6) Mean at Week 12
66.8.dagger. 59.4 73.1.dagger. 57.5 Role emotional Baseline 44.5
40.8 37.3 43.1 (86.8) Mean at Week 12 60.3.dagger. 63.0 61.7 51.9
Mental health Baseline 48.4 34.7 51.1 52.7 (74.9) Mean at Week 12
61.0.dagger. 61.6 70.4.dagger. 55.0 *0-100 scores are presented for
each domain to enable interpretation within the context of the
MCIDs; shading highlights changes .gtoreq.MCID in domain scores;
Baseline scores are mean, based on patients with available data at
visit of interest; PCS = Physical Component Score; MCS = Mental
Component Score; MCID = Minimum Clinically Important Differences;
.dagger.represents p < 0.05 associated with comparison of
changes from baseline between a ALD518 arm versus placebo based on
an ANCOVA model, adjusted for age at baseline and sex
[0899] Result Summary: 127 active RA patients were randomized and
treated, and 116 completed the trial (80 mg, 29/32; 160 mg, 33/34;
320 mg, 25/28; placebo, 29/33). At baseline, mean age was 52.3
years; mean RA duration was 6.8 years; mean tender and swollen
joint counts were 26.1 and 16.7, and mean Physical (PCS) and Mental
component summary (MCS) scores were 31.0 and 35.0, respectively.
Mean changes from baseline to week 12 in MCS were significantly
greater in each ALD518 dose group vs placebo, and mean changes in
both PCS and MCS scores exceeded MCID in each ALD518 group. At week
12, mean changes from baseline in one or more SF-36 domains were
significantly greater in ALD518 dose groups than the placebo group
(Table 23). Improvements in SF-6D were 3-4 times the MID in the
ALD-518 groups compared with less than 2 times the MID in the
placebo group (as noted above, the MID is 0.041). Changes exceeding
the MCID were observed in all domains and in SF-6D in patients
receiving ALD518. Improvements at week 12 were sustained at week
16.
TABLE-US-00026 TABLE 23 SF-6D Scores at Baseline and Weeks 12 and
16. Shading highlights changes that exceeded the MID (minimum
important difference). ALD51 ALD518 ALD518 SF-6D 8 80 mg 160 mg 320
mg Placebo (+age/gender norm) (n = 32) (n = 34) (n = 28) (n = 33)
SF-6D Week 12 n = 32 33 29 32 (0.831) Baseline 0.582 0.522 0.612
0.603 Mean at Week 12 0.714 0.715 0.785 0.664 Mean change to Week
12 0.132 0.193 0.172 0.062 Week 16 n = 32 33 29 32 Baseline 0.556
0.584 0.579 0.592 Mean at Week 16 0.692 0.736 0.751 0.662 Mean
change to Week 16 0.140 0.150 0.170 0.070
[0900] Conclusions:
[0901] Treatment with the IL-6 inhibitor ALD518 resulted in
statistically significant and clinically meaningful improvements in
physical and mental aspects of HRQoL. These data further support
the clinical efficacy of ALD518 for treatment of patients with
active RA and inadequate responses to methotrexate (MTX).
Example 45
Oral Mucositis Clinical Trial in Progress
[0902] Subjects suffering from oral mucositis with head and neck
cancer receiving concurrent chemotherapy and radiotherapy are being
treated with regimen of a 160 mg doses of a composition comprising
a humanized monoclonal antibody that selectively binds IL-6
(ALD518, also known as Ab1 which contains the variable sequences in
SEQ ID NO: 19 and SEQ ID NO:20).
[0903] Subjects are being assessed using tumor staging (standard
TNM system) during the screening period, which occurs within 30
days prior to radiotherapy (RT) start. The RT treatment period is
approximately 7 weeks, depending on the subject's prescribed
radiation plan. Post-RT treatment period visits are scheduled at
weeks 1, 2, 3, and 4 following the treatment period. Long term
follow-up visits are scheduled at 3, 6, 9, and 12 months following
the end of RT to determine if there is an effect of ALD518 on the
tumor response to CRT.
[0904] Subjects were recently diagnosed and pathologically
confirmed with non-metastatic SCC of the oral cavity, oropharynx,
hypopharynx or larynx. Subjects are scheduled to receive a
continuous course of intensity-modulated radiotherapy (IMRT) with a
minimum cumulative dose of 55 Gy and maximum dose of 72 Gy. Planned
radiation treatment fields include at least 2 oral sites (e.g.,
buccal mucosa, floor of oral cavity, tongue or soft palate) with
each site receiving a total dose of .gtoreq.55 Gy. The treatment
plan include monotherapy with cisplatin administered in standard
weekly (30 to 40 mg/m.sup.2) or tri-weekly (80 to 100 mg/m.sup.2,
given on Days 0, 21 and 42) regimens or monotherapy with
carboplatin administered weekly (100 mg/m.sup.2).
[0905] A composition comprising a humanized monoclonal antibody
that selectively binds IL-6 (ALD518 also known as Ab1) is being
given within 2 hours prior to the subjects' radiation every 4 weeks
for a total of 2 doses. A baseline visit occurred on the first day
of ALD518 and RT. Safety, PK, PD, and markers of IL-6 biology
(e.g., total IL-6, sIL-6r, soluble gp130, sIL-6 Complex) are being
monitored during the RT treatment and Post-RT treatment period. The
long term follow-up period of the treatment includes scheduled long
term follow-up visits, primarily for the assessment of tumor
response and survival. These assessments are scheduled at months 3,
6, 9 and 12 following the last dose of RT. At months 3, 6, 9, and
12 tumors will be assessed clinically. At the Month 6 and Month 12
follow-up visits, tumor status will be assessed using RECIST
criteria and the same imaging modality (CAT, PET or MRI) that was
used to evaluate tumor status prior to RT start (at the time of
staging) may be used.
[0906] Following a treatment regimen comprising the administration
of a humanized monoclonal antibody that selectively binds IL-6
ALD-518 (Ab1) the patients show improvement in their oral mucositis
(e.g., a reduction in symptoms) after only 4 weeks of
treatment.
[0907] As assessed using the WHO (World Health Organization) oral
mucositis scale (Table 2) 3 patients receiving 160 mg intravenous
administration of ALD518 (Ab1) were assessed. The first subject
(circles) has not shown any signs of developing oral mucositis,
maintaining a Grade 0 for the entire 4 weeks. This is indicative of
ALD518 acting to prevent the development of oral mucositis. The
second patient (squares) developed Grade 2 oral mucositis, but this
appears to have lessened in severity. This is indicative of ALD518
acting to prevent the development of severe oral mucositis (e.g.,
Grade 4) and even lessen the severity of oral mucositis. The third
patient (triangles) developed Grade 2/3 oral mucosits. This is
indicative of ALD518 acting to prevent the development of severe
oral mucositis (e.g., Grade 4). In this patient population, it is
expected that about 60% of patients to develop at least Grade 3 or
Grade 4 oral mucositis with this type of IMRT+chemotherapy and over
80% of the patients to develop at least Grade 2 and above oral
mucositis. Thus, this data suggests that a humanized monoclonal
antibody that selectively binds IL-6 (e.g., ALD518 also known as
Ab1) is effective in treating and preventing oral mucositis
resulting from the combination of chemotherapy and
radiotherapy.
[0908] We further conclude based on these results that other IL-6
antagonists, including those identified in this application, e.g.,
the exemplified anti-IL-6 antibodies and antibody fragments, as
well as the identified non-antibody IL-6 antagonists, will have
clinical application in treating and preventing mucositis, e.g.,
oral and gastrointestinal or alimentary mucositis.
Example 46
Ongoing Anemia Clinical Trial
[0909] Three cancer patients which were to be treated with
cisplatin were treated with ALD-518 prior to cisplatin chemotherapy
in order to prevent or lessen anemia, and in particular to prevent
the onset of severe anemia which is a very common side effect of
cisplatin therapy, i.e., when administered alone or in conjunction
with radiotherapy.
[0910] All three patients received cisplatin every 3 weeks at a
dosage of 100 mg/m.sup.2. Particularly, said dosage of chemo was
administered at week 0, at week 3 and in one patient another dose
was administered at week 6. In these same patients, 160 mg of
ALD518 (Ab1), a humanized anti-IL-6 monoclonal antibody containing
the variable sequences in SEQ ID NO: 19 and SEQ ID NO:20, was
administered intravenously at week 0 and week 4. Radiotherapy (RT)
was also administered to these patients at a dosage of 2-2.2 Gray
per day from week 0 and will continue until the end of the planned
RT for each patient every day 5 days a week.
[0911] All 3 patients are now post-therapy (between week 8 and week
12 of the treatment regimen). The last blood count was at the end
of RT about week 8. None of these patients as of week 8 after
treatment shows signs of severe anemia. All three patients will be
monitored at least until week 12 and are expected to show no or
less severe anemia resulting from the combination of cisplatin and
radiotherapy as compared to the severe anemia typically seen in
patients receiving cisplatin alone or when administered in a
clinical regimen also including radiation. This will be confirmed
by assaying hemoglobin and/or RBC counts and other clinical
indicators of anemia in these patients.
[0912] Although the invention has been described in some detail by
way of illustration and example for purposes of clarity of
understanding, it will be obvious that certain changes and
modifications will practiced within the scope of the appended
claims. Modifications of the above-described modes for carrying out
the invention that are obvious to persons of skill in medicine,
pharmacology, microbiology, and/or related fields are intended to
be within the scope of the following claims.
[0913] All publications (e.g., Non-Patent Literature), patent
application publications, and patent applications mentioned in this
specification are indicative of the level of skill of those skilled
in the art to which this invention pertains. All such publications
(e.g., Non-Patent Literature), patent application publications, and
patent applications are herein incorporated by reference to the
same extent as if each individual publication, patent, patent
application publication, or patent application is specifically and
individually indicated to be incorporated by reference.
Sequence CWU 1
1
7481183PRTHomo sapiens 1Val Pro Pro Gly Glu Asp Ser Lys Asp Val Ala
Ala Pro His Arg Gln1 5 10 15Pro Leu Thr Ser Ser Glu Arg Ile Asp Lys
Gln Ile Arg Tyr Ile Leu 20 25 30Asp Gly Ile Ser Ala Leu Arg Lys Glu
Thr Cys Asn Lys Ser Asn Met 35 40 45Cys Glu Ser Ser Lys Glu Ala Leu
Ala Glu Asn Asn Leu Asn Leu Pro 50 55 60Lys Met Ala Glu Lys Asp Gly
Cys Phe Gln Ser Gly Phe Asn Glu Glu65 70 75 80Thr Cys Leu Val Lys
Ile Ile Thr Gly Leu Leu Glu Phe Glu Val Tyr 85 90 95Leu Glu Tyr Leu
Gln Asn Arg Phe Glu Ser Ser Glu Glu Gln Ala Arg 100 105 110Ala Val
Gln Met Ser Thr Lys Val Leu Ile Gln Phe Leu Gln Lys Lys 115 120
125Ala Lys Asn Leu Asp Ala Ile Thr Thr Pro Asp Pro Thr Thr Asn Ala
130 135 140Ser Leu Leu Thr Lys Leu Gln Ala Gln Asn Gln Trp Leu Gln
Asp Met145 150 155 160Thr Thr His Leu Ile Leu Arg Ser Phe Lys Glu
Phe Leu Gln Ser Ser 165 170 175Leu Arg Ala Leu Arg Gln Met
1802163PRTOryctolagus cuniculus 2Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys Ala
Tyr Asp Met Thr Gln Thr Pro Ala Ser 20 25 30Val Ser Ala Ala Val Gly
Gly Thr Val Thr Ile Lys Cys Gln Ala Ser 35 40 45Gln Ser Ile Asn Asn
Glu Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln 50 55 60Arg Pro Lys Leu
Leu Ile Tyr Arg Ala Ser Thr Leu Ala Ser Gly Val65 70 75 80Ser Ser
Arg Phe Lys Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr 85 90 95Ile
Ser Asp Leu Glu Cys Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Gln 100 105
110Gly Tyr Ser Leu Arg Asn Ile Asp Asn Ala Phe Gly Gly Gly Thr Glu
115 120 125Val Val Val Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile
Phe Pro 130 135 140Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser
Val Val Cys Leu145 150 155 160Leu Asn Asn3166PRTOryctolagus
cuniculus 3Met Glu Thr Gly Leu Arg Trp Leu Leu Leu Val Ala Val Leu
Lys Gly1 5 10 15Val Gln Cys Gln Ser Leu Glu Glu Ser Gly Gly Arg Leu
Val Thr Pro 20 25 30Gly Thr Pro Leu Thr Leu Thr Cys Thr Ala Ser Gly
Phe Ser Leu Ser 35 40 45Asn Tyr Tyr Val Thr Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu 50 55 60Trp Ile Gly Ile Ile Tyr Gly Ser Asp Glu
Thr Ala Tyr Ala Thr Trp65 70 75 80Ala Ile Gly Arg Phe Thr Ile Ser
Lys Thr Ser Thr Thr Val Asp Leu 85 90 95Lys Met Thr Ser Leu Thr Ala
Ala Asp Thr Ala Thr Tyr Phe Cys Ala 100 105 110Arg Asp Asp Ser Ser
Asp Trp Asp Ala Lys Phe Asn Leu Trp Gly Gln 115 120 125Gly Thr Leu
Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val 130 135 140Phe
Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala145 150
155 160Leu Gly Cys Leu Val Lys 165411PRTOryctolagus cuniculus 4Gln
Ala Ser Gln Ser Ile Asn Asn Glu Leu Ser1 5 1057PRTOryctolagus
cuniculus 5Arg Ala Ser Thr Leu Ala Ser1 5612PRTOryctolagus
cuniculus 6Gln Gln Gly Tyr Ser Leu Arg Asn Ile Asp Asn Ala1 5
1075PRTOryctolagus cuniculus 7Asn Tyr Tyr Val Thr1
5816PRTOryctolagus cuniculus 8Ile Ile Tyr Gly Ser Asp Glu Thr Ala
Tyr Ala Thr Trp Ala Ile Gly1 5 10 15912PRTOryctolagus cuniculus
9Asp Asp Ser Ser Asp Trp Asp Ala Lys Phe Asn Leu1 5
1010491DNAOryctolagus cuniculus 10atggacacga gggcccccac tcagctgctg
gggctcctgc tgctctggct cccaggtgcc 60agatgtgcct atgatatgac ccagactcca
gcctcggtgt ctgcagctgt gggaggcaca 120gtcaccatca agtgccaggc
cagtcagagc attaacaatg aattatcctg gtatcagcag 180aaaccagggc
agcgtcccaa gctcctgatc tatagggcat ccactctggc atctggggtc
240tcatcgcggt tcaaaggcag tggatctggg acagagttca ctctcaccat
cagcgacctg 300gagtgtgccg atgctgccac ttactactgt caacagggtt
atagtctgag gaatattgat 360aatgctttcg gcggagggac cgaggtggtg
gtcaaacgta cggtagcggc cccatctgtc 420ttcatcttcc cgccatctga
tgagcagttg aaatctggaa ctgcctctgt tgtgtgcctg 480ctgaataact t
49111499DNAOryctolagus cuniculus 11atggagactg ggctgcgctg gcttctcctg
gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcgctggagg agtccggggg tcgcctggtc
acgcctggga cacccctgac actcacctgc 120acagcctctg gattctccct
cagtaactac tacgtgacct gggtccgcca ggctccaggg 180aaggggctgg
aatggatcgg aatcatttat ggtagtgatg aaacggccta cgcgacctgg
240gcgataggcc gattcaccat ctccaaaacc tcgaccacgg tggatctgaa
aatgaccagt 300ctgacagccg cggacacggc cacctatttc tgtgccagag
atgatagtag tgactgggat 360gcaaaattta acttgtgggg ccaaggcacc
ctggtcaccg tctcgagcgc ctccaccaag 420ggcccatcgg tcttccccct
ggcaccctcc tccaagagca cctctggggg cacagcggcc 480ctgggctgcc tggtcaagg
4991233DNAOryctolagus cuniculus 12caggccagtc agagcattaa caatgaatta
tcc 331321DNAOryctolagus cuniculus 13agggcatcca ctctggcatc t
211436DNAOryctolagus cuniculus 14caacagggtt atagtctgag gaatattgat
aatgct 361515DNAOryctolagus cuniculus 15aactactacg tgacc
151648DNAOryctolagus cuniculus 16atcatttatg gtagtgatga aacggcctac
gcgacctggg cgataggc 481736DNAOryctolagus cuniculus 17gatgatagta
gtgactggga tgcaaaattt aacttg 3618109PRTOryctolagus cuniculus 18Glu
Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Leu Ser Asn Tyr
20 25 30Tyr Val Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Gly Ile Ile Tyr Gly Ser Asp Glu Thr Ala Tyr Ala Thr Trp
Ala Ile 50 55 60Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr
Leu Tyr Leu65 70 75 80Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala
Val Tyr Tyr Cys Ala 85 90 95Arg Asp Asp Ser Ser Asp Trp Asp Ala Lys
Phe Asn Leu 100 10519109PRTOryctolagus cuniculus 19Glu Val Gln Leu
Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Ser Leu Ser Asn Tyr 20 25 30Tyr Val
Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly
Ile Ile Tyr Gly Ser Asp Glu Thr Ala Tyr Ala Thr Ser Ala Ile 50 55
60Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu65
70 75 80Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
Ala 85 90 95Arg Asp Asp Ser Ser Asp Trp Asp Ala Lys Phe Asn Leu 100
1052099PRTOryctolagus cuniculus 20Ile Gln Met Thr Gln Ser Pro Ser
Ser Leu Ser Ala Ser Val Gly Asp1 5 10 15Arg Val Thr Ile Thr Cys Gln
Ala Ser Gln Ser Ile Asn Asn Glu Leu 20 25 30Ser Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr 35 40 45Arg Ala Ser Thr Leu
Ala Ser Gly Val Pro Ser Arg Phe Ser Gly Ser 50 55 60Gly Ser Gly Thr
Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Asp65 70 75 80Asp Phe
Ala Thr Tyr Tyr Cys Gln Gln Gly Tyr Ser Leu Arg Asn Ile 85 90 95Asp
Asn Ala21170PRTOryctolagus cuniculus 21Met Asp Thr Arg Ala Pro Thr
Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys
Ala Tyr Asp Met Thr Gln Thr Pro Ala Ser 20 25 30Val Glu Val Ala Val
Gly Gly Thr Val Thr Ile Asn Cys Gln Ala Ser 35 40 45Glu Thr Ile Tyr
Ser Trp Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln 50 55 60Pro Pro Lys
Leu Leu Ile Tyr Gln Ala Ser Asp Leu Ala Ser Gly Val65 70 75 80Pro
Ser Arg Phe Ser Gly Ser Gly Ala Gly Thr Glu Tyr Thr Leu Thr 85 90
95Ile Ser Gly Val Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Gln
100 105 110Gly Tyr Ser Gly Ser Asn Val Asp Asn Val Phe Gly Gly Gly
Thr Glu 115 120 125Val Val Val Lys Arg Thr Val Ala Ala Pro Ser Val
Phe Ile Phe Pro 130 135 140Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr
Ala Ser Val Val Cys Leu145 150 155 160Leu Asn Asn Phe Tyr Pro Arg
Glu Ala Lys 165 17022167PRTOryctolagus cuniculus 22Met Glu Thr Gly
Leu Arg Trp Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys
Gln Glu Gln Leu Lys Glu Ser Gly Gly Arg Leu Val Thr 20 25 30Pro Gly
Thr Pro Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Leu 35 40 45Asn
Asp His Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 50 55
60Glu Tyr Ile Gly Phe Ile Asn Ser Gly Gly Ser Ala Arg Tyr Ala Ser65
70 75 80Trp Ala Glu Gly Arg Phe Thr Ile Ser Arg Thr Ser Thr Thr Val
Asp 85 90 95Leu Lys Met Thr Ser Leu Thr Thr Glu Asp Thr Ala Thr Tyr
Phe Cys 100 105 110Val Arg Gly Gly Ala Val Trp Ser Ile His Ser Phe
Asp Pro Trp Gly 115 120 125Pro Gly Thr Leu Val Thr Val Ser Ser Ala
Ser Thr Lys Gly Pro Ser 130 135 140Val Phe Pro Leu Ala Pro Ser Ser
Lys Ser Thr Ser Gly Gly Thr Ala145 150 155 160Ala Leu Gly Cys Leu
Val Lys 1652311PRTOryctolagus cuniculus 23Gln Ala Ser Glu Thr Ile
Tyr Ser Trp Leu Ser1 5 10247PRTOryctolagus cuniculus 24Gln Ala Ser
Asp Leu Ala Ser1 52512PRTOryctolagus cuniculus 25Gln Gln Gly Tyr
Ser Gly Ser Asn Val Asp Asn Val1 5 10265PRTOryctolagus cuniculus
26Asp His Ala Met Gly1 52716PRTOryctolagus cuniculus 27Phe Ile Asn
Ser Gly Gly Ser Ala Arg Tyr Ala Ser Trp Ala Glu Gly1 5 10
152812PRTOryctolagus cuniculus 28Gly Gly Ala Val Trp Ser Ile His
Ser Phe Asp Pro1 5 1029511DNAOryctolagus cuniculus 29atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60agatgtgcct
atgatatgac ccagactcca gcctctgtgg aggtagctgt gggaggcaca
120gtcaccatca attgccaggc cagtgagacc atttacagtt ggttatcctg
gtatcagcag 180aagccagggc agcctcccaa gctcctgatc taccaggcat
ccgatctggc atctggggtc 240ccatcgcgat tcagcggcag tggggctggg
acagagtaca ctctcaccat cagcggcgtg 300cagtgtgacg atgctgccac
ttactactgt caacagggtt atagtggtag taatgttgat 360aatgttttcg
gcggagggac cgaggtggtg gtcaaacgta cggtagcggc cccatctgtc
420ttcatcttcc cgccatctga tgagcagttg aaatctggaa ctgcctctgt
tgtgtgcctg 480ctgaataact tctatcccag agaggccaaa g
51130501DNAOryctolagus cuniculus 30atggagactg ggctgcgctg gcttctcctg
gtcgctgtgc tcaaaggtgt ccagtgtcag 60gagcagctga aggagtccgg gggtcgcctg
gtcacgcctg ggacacccct gacacttacc 120tgcacagcct ctggattctc
cctcaatgac catgcaatgg gctgggtccg ccaggctcca 180gggaaggggc
tggaatacat cggattcatt aatagtggtg gtagcgcacg ctacgcgagc
240tgggcagaag gccgattcac catctccaga acctcgacca cggtggatct
gaaaatgacc 300agtctgacaa ccgaggacac ggccacctat ttctgtgtca
gagggggtgc tgtttggagt 360attcatagtt ttgatccctg gggcccaggg
accctggtca ccgtctcgag cgcctccacc 420aagggcccat cggtcttccc
cctggcaccc tcctccaaga gcacctctgg gggcacagcg 480gccctgggct
gcctggtcaa g 5013133DNAOryctolagus cuniculus 31caggccagtg
agaccattta cagttggtta tcc 333221DNAOryctolagus cuniculus
32caggcatccg atctggcatc t 213336DNAOryctolagus cuniculus
33caacagggtt atagtggtag taatgttgat aatgtt 363415DNAOryctolagus
cuniculus 34gaccatgcaa tgggc 153548DNAOryctolagus cuniculus
35ttcattaata gtggtggtag cgcacgctac gcgagctggg cagaaggc
483636DNAOryctolagus cuniculus 36gggggtgctg tttggagtat tcatagtttt
gatccc 3637165PRTOryctolagus cuniculus 37Met Asp Thr Arg Ala Pro
Thr Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Thr
Phe Ala Ala Val Leu Thr Gln Thr Pro Ser Pro 20 25 30Val Ser Ala Ala
Val Gly Gly Thr Val Ser Ile Ser Cys Gln Ala Ser 35 40 45Gln Ser Val
Tyr Asp Asn Asn Tyr Leu Ser Trp Phe Gln Gln Lys Pro 50 55 60Gly Gln
Pro Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Leu Ala Ser65 70 75
80Gly Val Pro Ser Arg Phe Val Gly Ser Gly Ser Gly Thr Gln Phe Thr
85 90 95Leu Thr Ile Thr Asp Val Gln Cys Asp Asp Ala Ala Thr Tyr Tyr
Cys 100 105 110Ala Gly Val Tyr Asp Asp Asp Ser Asp Asn Ala Phe Gly
Gly Gly Thr 115 120 125Glu Val Val Val Lys Arg Thr Val Ala Ala Pro
Ser Val Phe Ile Phe 130 135 140Pro Pro Ser Asp Glu Gln Leu Lys Ser
Gly Thr Ala Ser Val Val Cys145 150 155 160Leu Leu Asn Asn Phe
16538166PRTOryctolagus cuniculus 38Met Glu Thr Gly Leu Arg Trp Leu
Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Leu Glu
Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr Leu
Thr Cys Thr Ala Ser Gly Phe Ser Leu Ser 35 40 45Val Tyr Tyr Met Asn
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile Gly Phe
Ile Thr Met Ser Asp Asn Ile Asn Tyr Ala Ser Trp65 70 75 80Ala Lys
Gly Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu 85 90 95Lys
Met Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Ala 100 105
110Arg Ser Arg Gly Trp Gly Thr Met Gly Arg Leu Asp Leu Trp Gly Pro
115 120 125Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro
Ser Val 130 135 140Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly
Gly Thr Ala Ala145 150 155 160Leu Gly Cys Leu Val Lys
1653913PRTOryctolagus cuniculus 39Gln Ala Ser Gln Ser Val Tyr Asp
Asn Asn Tyr Leu Ser1 5 10407PRTOryctolagus cuniculus 40Gly Ala Ser
Thr Leu Ala Ser1 54111PRTOryctolagus cuniculus 41Ala Gly Val Tyr
Asp Asp Asp Ser Asp Asn Ala1 5 10425PRTOryctolagus cuniculus 42Val
Tyr Tyr Met Asn1 54316PRTOryctolagus cuniculus 43Phe Ile Thr Met
Ser Asp Asn Ile Asn Tyr Ala Ser Trp Ala Lys Gly1 5 10
154412PRTOryctolagus cuniculus 44Ser Arg Gly Trp Gly Thr Met Gly
Arg Leu Asp Leu1 5 1045496DNAOryctolagus cuniculus 45atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60acatttgccg
ccgtgctgac ccagactcca tctcccgtgt ctgcagctgt gggaggcaca
120gtcagcatca gttgccaggc cagtcagagt gtttatgaca acaactactt
atcctggttt 180cagcagaaac cagggcagcc tcccaagctc ctgatctatg
gtgcatccac tctggcatct 240ggggtcccat cgcggttcgt gggcagtgga
tctgggacac agttcactct caccatcaca 300gacgtgcagt gtgacgatgc
tgccacttac tattgtgcag gcgtttatga tgatgatagt 360gataatgcct
tcggcggagg gaccgaggtg gtggtcaaac gtacggtagc ggccccatct
420gtcttcatct tcccgccatc tgatgagcag ttgaaatctg gaactgcctc
tgttgtgtgc 480ctgctgaata acttct 49646499DNAOryctolagus cuniculus
46atggagactg ggctgcgctg gcttctcctg gtggctgtgc tcaaaggtgt ccagtgtcag
60tcgctggagg agtccggggg tcgcctggtc acccctggga cacccctgac actcacctgc
120acagcctctg gattctccct cagtgtctac tacatgaact gggtccgcca
ggctccaggg 180aaggggctgg aatggatcgg attcattaca atgagtgata
atataaatta
cgcgagctgg 240gcgaaaggcc gattcaccat ctccaaaacc tcgaccacgg
tggatctgaa aatgaccagt 300ccgacaaccg aggacacggc cacctatttc
tgtgccagga gtcgtggctg gggtacaatg 360ggtcggttgg atctctgggg
cccaggcacc ctcgtcaccg tctcgagcgc ctccaccaag 420ggcccatcgg
tcttccccct ggcaccctcc tccaagagca cctctggggg cacagcggcc
480ctgggctgcc tggtcaagg 4994739DNAOryctolagus cuniculus
47caggccagtc agagtgttta tgacaacaac tacttatcc 394821DNAOryctolagus
cuniculus 48ggtgcatcca ctctggcatc t 214933DNAOryctolagus cuniculus
49gcaggcgttt atgatgatga tagtgataat gcc 335015DNAOryctolagus
cuniculus 50gtctactaca tgaac 155148DNAOryctolagus cuniculus
51ttcattacaa tgagtgataa tataaattac gcgagctggg cgaaaggc
485236DNAOryctolagus cuniculus 52agtcgtggct ggggtacaat gggtcggttg
gatctc 3653164PRTOryctolagus cuniculus 53Met Asp Thr Arg Ala Pro
Thr Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Ile
Cys Asp Pro Val Leu Thr Gln Thr Pro Ser Pro 20 25 30Val Ser Ala Pro
Val Gly Gly Thr Val Ser Ile Ser Cys Gln Ala Ser 35 40 45Gln Ser Val
Tyr Glu Asn Asn Tyr Leu Ser Trp Phe Gln Gln Lys Pro 50 55 60Gly Gln
Pro Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Leu Asp Ser65 70 75
80Gly Val Pro Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Gln Phe Thr
85 90 95Leu Thr Ile Thr Asp Val Gln Cys Asp Asp Ala Ala Thr Tyr Tyr
Cys 100 105 110Ala Gly Val Tyr Asp Asp Asp Ser Asp Asp Ala Phe Gly
Gly Gly Thr 115 120 125Glu Val Val Val Lys Arg Thr Val Ala Ala Pro
Ser Val Phe Ile Phe 130 135 140Pro Pro Ser Asp Glu Gln Leu Lys Ser
Gly Thr Ala Ser Val Val Cys145 150 155 160Leu Leu Asn
Asn54167PRTOryctolagus cuniculus 54Met Glu Thr Gly Leu Arg Trp Leu
Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Glu Gln Leu
Lys Glu Ser Gly Gly Gly Leu Val Thr 20 25 30Pro Gly Gly Thr Leu Thr
Leu Thr Cys Thr Ala Ser Gly Phe Ser Leu 35 40 45Asn Ala Tyr Tyr Met
Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 50 55 60Glu Trp Ile Gly
Phe Ile Thr Leu Asn Asn Asn Val Ala Tyr Ala Asn65 70 75 80Trp Ala
Lys Gly Arg Phe Thr Phe Ser Lys Thr Ser Thr Thr Val Asp 85 90 95Leu
Lys Met Thr Ser Pro Thr Pro Glu Asp Thr Ala Thr Tyr Phe Cys 100 105
110Ala Arg Ser Arg Gly Trp Gly Ala Met Gly Arg Leu Asp Leu Trp Gly
115 120 125His Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly
Pro Ser 130 135 140Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser
Gly Gly Thr Ala145 150 155 160Ala Leu Gly Cys Leu Val Lys
1655513PRTOryctolagus cuniculus 55Gln Ala Ser Gln Ser Val Tyr Glu
Asn Asn Tyr Leu Ser1 5 10567PRTOryctolagus cuniculus 56Gly Ala Ser
Thr Leu Asp Ser1 55711PRTOryctolagus cuniculus 57Ala Gly Val Tyr
Asp Asp Asp Ser Asp Asp Ala1 5 10585PRTOryctolagus cuniculus 58Ala
Tyr Tyr Met Asn1 55916PRTOryctolagus cuniculus 59Phe Ile Thr Leu
Asn Asn Asn Val Ala Tyr Ala Asn Trp Ala Lys Gly1 5 10
156012PRTOryctolagus cuniculus 60Ser Arg Gly Trp Gly Ala Met Gly
Arg Leu Asp Leu1 5 1061494DNAOryctolagus cuniculus 61atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60atatgtgacc
ctgtgctgac ccagactcca tctcccgtat ctgcacctgt gggaggcaca
120gtcagcatca gttgccaggc cagtcagagt gtttatgaga acaactattt
atcctggttt 180cagcagaaac cagggcagcc tcccaagctc ctgatctatg
gtgcatccac tctggattct 240ggggtcccat cgcggttcaa aggcagtgga
tctgggacac agttcactct caccattaca 300gacgtgcagt gtgacgatgc
tgccacttac tattgtgcag gcgtttatga tgatgatagt 360gatgatgcct
tcggcggagg gaccgaggtg gtggtcaaac gtacggtagc ggccccatct
420gtcttcatct tcccgccatc tgatgagcag ttgaaatctg gaactgcctc
tgttgtgtgc 480ctgctgaata actt 49462502DNAOryctolagus cuniculus
62atggagactg ggctgcgctg gcttctcctg gtggctgtgc tcaaaggtgt ccagtgtcag
60gagcagctga aggagtccgg aggaggcctg gtaacgcctg gaggaaccct gacactcacc
120tgcacagcct ctggattctc cctcaatgcc tactacatga actgggtccg
ccaggctcca 180gggaaggggc tggaatggat cggattcatt actctgaata
ataatgtagc ttacgcgaac 240tgggcgaaag gccgattcac cttctccaaa
acctcgacca cggtggatct gaaaatgacc 300agtccgacac ccgaggacac
ggccacctat ttctgtgcca ggagtcgtgg ctggggtgca 360atgggtcggt
tggatctctg gggccatggc accctggtca ccgtctcgag cgcctccacc
420aagggcccat cggtcttccc cctggcaccc tcctccaaga gcacctctgg
gggcacagcg 480gccctgggct gcctggtcaa gg 5026339DNAOryctolagus
cuniculus 63caggccagtc agagtgttta tgagaacaac tatttatcc
396421DNAOryctolagus cuniculus 64ggtgcatcca ctctggattc t
216533DNAOryctolagus cuniculus 65gcaggcgttt atgatgatga tagtgatgat
gcc 336615DNAOryctolagus cuniculus 66gcctactaca tgaac
156748DNAOryctolagus cuniculus 67ttcattactc tgaataataa tgtagcttac
gcgaactggg cgaaaggc 486836DNAOryctolagus cuniculus 68agtcgtggct
ggggtgcaat gggtcggttg gatctc 3669164PRTOryctolagus cuniculus 69Met
Asp Thr Arg Ala Pro Thr Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10
15Leu Pro Gly Ala Thr Phe Ala Gln Val Leu Thr Gln Thr Pro Ser Pro
20 25 30Val Ser Ala Ala Val Gly Gly Thr Val Thr Ile Asn Cys Gln Ala
Ser 35 40 45Gln Ser Val Asp Asp Asn Asn Trp Leu Gly Trp Tyr Gln Gln
Lys Arg 50 55 60Gly Gln Pro Pro Lys Tyr Leu Ile Tyr Ser Ala Ser Thr
Leu Ala Ser65 70 75 80Gly Val Pro Ser Arg Phe Lys Gly Ser Gly Ser
Gly Thr Gln Phe Thr 85 90 95Leu Thr Ile Ser Asp Leu Glu Cys Asp Asp
Ala Ala Thr Tyr Tyr Cys 100 105 110Ala Gly Gly Phe Ser Gly Asn Ile
Phe Ala Phe Gly Gly Gly Thr Glu 115 120 125Val Val Val Lys Arg Thr
Val Ala Ala Pro Ser Val Phe Ile Phe Pro 130 135 140Pro Ser Asp Glu
Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu145 150 155 160Leu
Asn Asn Phe70164PRTOryctolagus cuniculus 70Met Glu Thr Gly Leu Arg
Trp Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser
Val Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu
Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser 35 40 45Ser Tyr Ala
Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile
Gly Ile Ile Gly Gly Phe Gly Thr Thr Tyr Tyr Ala Thr Trp65 70 75
80Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu
85 90 95Arg Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys
Ala 100 105 110Arg Gly Gly Pro Gly Asn Gly Gly Asp Ile Trp Gly Gln
Gly Thr Leu 115 120 125Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro
Ser Val Phe Pro Leu 130 135 140Ala Pro Ser Ser Lys Ser Thr Ser Gly
Gly Thr Ala Ala Leu Gly Cys145 150 155 160Leu Val Lys
Asp7113PRTOryctolagus cuniculus 71Gln Ala Ser Gln Ser Val Asp Asp
Asn Asn Trp Leu Gly1 5 10727PRTOryctolagus cuniculus 72Ser Ala Ser
Thr Leu Ala Ser1 57310PRTOryctolagus cuniculus 73Ala Gly Gly Phe
Ser Gly Asn Ile Phe Ala1 5 10745PRTOryctolagus cuniculus 74Ser Tyr
Ala Met Ser1 57516PRTOryctolagus cuniculus 75Ile Ile Gly Gly Phe
Gly Thr Thr Tyr Tyr Ala Thr Trp Ala Lys Gly1 5 10
15769PRTOryctolagus cuniculus 76Gly Gly Pro Gly Asn Gly Gly Asp
Ile1 577493DNAOryctolagus cuniculus 77atggacacga gggcccccac
tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60acatttgccc aagtgctgac
ccagactcca tcgcctgtgt ctgcagctgt gggaggcaca 120gtcaccatca
actgccaggc cagtcagagt gttgatgata acaactggtt aggctggtat
180cagcagaaac gagggcagcc tcccaagtac ctgatctatt ctgcatccac
tctggcatct 240ggggtcccat cgcggttcaa aggcagtgga tctgggacac
agttcactct caccatcagc 300gacctggagt gtgacgatgc tgccacttac
tactgtgcag gcggttttag tggtaatatc 360tttgctttcg gcggagggac
cgaggtggtg gtcaaacgta cggtagcggc cccatctgtc 420ttcatcttcc
cgccatctga tgagcagttg aaatctggaa ctgcctctgt tgtgtgcctg
480ctgaataact tct 49378493DNAOryctolagus cuniculus 78atggagactg
ggctgcgctg gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcggtggagg
agtccggggg tcgcctggtc acgcctggga cacccctgac actcacctgc
120acagtctctg gcttctccct cagtagctat gcaatgagct gggtccgcca
ggctccagga 180aaggggctgg agtggatcgg aatcattggt ggttttggta
ccacatacta cgcgacctgg 240gcgaaaggcc gattcaccat ctccaaaacc
tcgaccacgg tggatctgag aatcaccagt 300ccgacaaccg aggacacggc
cacctatttc tgtgccagag gtggtcctgg taatggtggt 360gacatctggg
gccaagggac cctggtcacc gtctcgagcg cctccaccaa gggcccatcg
420gtcttccccc tggcaccctc ctccaagagc acctctgggg gcacagcggc
cctgggctgc 480ctggtcaagg act 4937939DNAOryctolagus cuniculus
79caggccagtc agagtgttga tgataacaac tggttaggc 398021DNAOryctolagus
cuniculus 80tctgcatcca ctctggcatc t 218130DNAOryctolagus cuniculus
81gcaggcggtt ttagtggtaa tatctttgct 308215DNAOryctolagus cuniculus
82agctatgcaa tgagc 158348DNAOryctolagus cuniculus 83atcattggtg
gttttggtac cacatactac gcgacctggg cgaaaggc 488427DNAOryctolagus
cuniculus 84ggtggtcctg gtaatggtgg tgacatc 2785164PRTOryctolagus
cuniculus 85Met Asp Thr Arg Ala Pro Thr Gln Leu Leu Gly Leu Leu Leu
Leu Trp1 5 10 15Leu Pro Gly Ala Thr Phe Ala Ala Val Leu Thr Gln Thr
Pro Ser Pro 20 25 30Val Ser Val Pro Val Gly Gly Thr Val Thr Ile Lys
Cys Gln Ser Ser 35 40 45Gln Ser Val Tyr Asn Asn Phe Leu Ser Trp Tyr
Gln Gln Lys Pro Gly 50 55 60Gln Pro Pro Lys Leu Leu Ile Tyr Gln Ala
Ser Lys Leu Ala Ser Gly65 70 75 80Val Pro Asp Arg Phe Ser Gly Ser
Gly Ser Gly Thr Gln Phe Thr Leu 85 90 95Thr Ile Ser Gly Val Gln Cys
Asp Asp Ala Ala Thr Tyr Tyr Cys Leu 100 105 110Gly Gly Tyr Asp Asp
Asp Ala Asp Asn Ala Phe Gly Gly Gly Thr Glu 115 120 125Val Val Val
Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro 130 135 140Pro
Ser Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu145 150
155 160Leu Asn Asn Phe86170PRTOryctolagus cuniculus 86Met Glu Thr
Gly Leu Arg Trp Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln
Cys Gln Ser Val Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly
Thr Pro Leu Thr Leu Thr Cys Thr Val Ser Gly Ile Asp Leu Ser 35 40
45Asp Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
50 55 60Trp Ile Gly Ile Ile Tyr Ala Gly Ser Gly Ser Thr Trp Tyr Ala
Ser65 70 75 80Trp Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Thr
Thr Val Asp 85 90 95Leu Lys Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala
Thr Tyr Phe Cys 100 105 110Ala Arg Asp Gly Tyr Asp Asp Tyr Gly Asp
Phe Asp Arg Leu Asp Leu 115 120 125Trp Gly Pro Gly Thr Leu Val Thr
Val Ser Ser Ala Ser Thr Lys Gly 130 135 140Pro Ser Val Phe Pro Leu
Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly145 150 155 160Thr Ala Ala
Leu Gly Cys Leu Val Lys Asp 165 1708712PRTOryctolagus cuniculus
87Gln Ser Ser Gln Ser Val Tyr Asn Asn Phe Leu Ser1 5
10887PRTOryctolagus cuniculus 88Gln Ala Ser Lys Leu Ala Ser1
58911PRTOryctolagus cuniculus 89Leu Gly Gly Tyr Asp Asp Asp Ala Asp
Asn Ala1 5 10905PRTOryctolagus cuniculus 90Asp Tyr Ala Met Ser1
59117PRTOryctolagus cuniculus 91Ile Ile Tyr Ala Gly Ser Gly Ser Thr
Trp Tyr Ala Ser Trp Ala Lys1 5 10 15Gly9214PRTOryctolagus cuniculus
92Asp Gly Tyr Asp Asp Tyr Gly Asp Phe Asp Arg Leu Asp Leu1 5
1093492DNAOryctolagus cuniculus 93atggacacga gggcccccac tcagctgctg
gggctcctgc tgctctggct cccaggtgcc 60acatttgcag ccgtgctgac ccagacacca
tcgcccgtgt ctgtacctgt gggaggcaca 120gtcaccatca agtgccagtc
cagtcagagt gtttataata atttcttatc gtggtatcag 180cagaaaccag
ggcagcctcc caagctcctg atctaccagg catccaaact ggcatctggg
240gtcccagata ggttcagcgg cagtggatct gggacacagt tcactctcac
catcagcggc 300gtgcagtgtg acgatgctgc cacttactac tgtctaggcg
gttatgatga tgatgctgat 360aatgctttcg gcggagggac cgaggtggtg
gtcaaacgta cggtagcggc cccatctgtc 420ttcatcttcc cgccatctga
tgagcagttg aaatctggaa ctgcctctgt tgtgtgcctg 480ctgaataact tc
49294511DNAOryctolagus cuniculus 94atggagactg ggctgcgctg gcttctcctg
gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcggtggagg agtccggggg tcgcctggtc
acgcctggga cacccctgac gctcacctgc 120acagtctctg gaatcgacct
cagtgactat gcaatgagct gggtccgcca ggctccaggg 180aaggggctgg
aatggatcgg aatcatttat gctggtagtg gtagcacatg gtacgcgagc
240tgggcgaaag gccgattcac catctccaaa acctcgacca cggtggatct
gaaaatcacc 300agtccgacaa ccgaggacac ggccacctat ttctgtgcca
gagatggata cgatgactat 360ggtgatttcg atcgattgga tctctggggc
ccaggcaccc tcgtcaccgt ctcgagcgcc 420tccaccaagg gcccatcggt
cttccccctg gcaccctcct ccaagagcac ctctgggggc 480acagcggccc
tgggctgcct ggtcaaggac t 5119536DNAOryctolagus cuniculus
95cagtccagtc agagtgttta taataatttc ttatcg 369621DNAOryctolagus
cuniculus 96caggcatcca aactggcatc t 219733DNAOryctolagus cuniculus
97ctaggcggtt atgatgatga tgctgataat gct 339815DNAOryctolagus
cuniculus 98gactatgcaa tgagc 159951DNAOryctolagus cuniculus
99atcatttatg ctggtagtgg tagcacatgg tacgcgagct gggcgaaagg c
5110042DNAOryctolagus cuniculus 100gatggatacg atgactatgg tgatttcgat
cgattggatc tc 42101164PRTOryctolagus cuniculus 101Met Asp Thr Arg
Ala Pro Thr Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly
Ala Arg Cys Ala Tyr Asp Met Thr Gln Thr Pro Ala Ser 20 25 30Val Ser
Ala Ala Val Gly Gly Thr Val Thr Ile Lys Cys Gln Ala Ser 35 40 45Gln
Ser Ile Asn Asn Glu Leu Ser Trp Tyr Gln Gln Lys Ser Gly Gln 50 55
60Arg Pro Lys Leu Leu Ile Tyr Arg Ala Ser Thr Leu Ala Ser Gly Val65
70 75 80Ser Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu
Thr 85 90 95Ile Ser Asp Leu Glu Cys Ala Asp Ala Ala Thr Tyr Tyr Cys
Gln Gln 100 105 110Gly Tyr Ser Leu Arg Asn Ile Asp Asn Ala Phe Gly
Gly Gly Thr Glu 115 120 125Val Val Val Lys Arg Thr Val Ala Ala Pro
Ser Val Phe Ile Phe Pro 130 135 140Pro Ser Asp Glu Gln Leu Lys Ser
Gly Thr Ala Ser Val Val Cys Leu145 150 155 160Leu Asn Asn
Phe102166PRTOryctolagus cuniculus 102Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Ser Gly1 5 10 15Val Gln Cys Gln Ser Leu
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Ala Ser Gly Phe Ser Leu Ser 35 40 45Asn Tyr Tyr Met
Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile
Gly
Met Ile Tyr Gly Ser Asp Glu Thr Ala Tyr Ala Asn Trp65 70 75 80Ala
Ile Gly Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu 85 90
95Lys Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys Ala
100 105 110Arg Asp Asp Ser Ser Asp Trp Asp Ala Lys Phe Asn Leu Trp
Gly Gln 115 120 125Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys
Gly Pro Ser Val 130 135 140Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr
Ser Gly Gly Thr Ala Ala145 150 155 160Leu Gly Cys Leu Val Lys
16510311PRTOryctolagus cuniculus 103Gln Ala Ser Gln Ser Ile Asn Asn
Glu Leu Ser1 5 101047PRTOryctolagus cuniculus 104Arg Ala Ser Thr
Leu Ala Ser1 510512PRTOryctolagus cuniculus 105Gln Gln Gly Tyr Ser
Leu Arg Asn Ile Asp Asn Ala1 5 101065PRTOryctolagus cuniculus
106Asn Tyr Tyr Met Thr1 510716PRTOryctolagus cuniculus 107Met Ile
Tyr Gly Ser Asp Glu Thr Ala Tyr Ala Asn Trp Ala Ile Gly1 5 10
1510812PRTOryctolagus cuniculus 108Asp Asp Ser Ser Asp Trp Asp Ala
Lys Phe Asn Leu1 5 10109492DNAOryctolagus cuniculus 109atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60agatgtgcct
atgatatgac ccagactcca gcctcggtgt ctgcagctgt gggaggcaca
120gtcaccatca aatgccaggc cagtcagagc attaacaatg aattatcctg
gtatcagcag 180aaatcagggc agcgtcccaa gctcctgatc tatagggcat
ccactctggc atctggggtc 240tcatcgcggt tcaaaggcag tggatctggg
acagagttca ctctcaccat cagcgacctg 300gagtgtgccg atgctgccac
ttactactgt caacagggtt atagtctgag gaatattgat 360aatgctttcg
gcggagggac cgaggtggtg gtcaaacgta cggtagcggc cccatctgtc
420ttcatcttcc cgccatctga tgagcagttg aaatctggaa ctgcctctgt
tgtgtgcctg 480ctgaataact tc 492110499DNAOryctolagus cuniculus
110atggagactg ggctgcgctg gcttctcctg gtcgctgtgc tctcaggtgt
ccagtgtcag 60tcgctggagg agtccggggg tcgcctggtc acgcctggga cacccctgac
actcacctgc 120acagcctctg gattctccct cagtaactac tacatgacct
gggtccgcca ggctccaggg 180aaggggctgg aatggatcgg aatgatttat
ggtagtgatg aaacagccta cgcgaactgg 240gcgataggcc gattcaccat
ctccaaaacc tcgaccacgg tggatctgaa aatgaccagt 300ctgacagccg
cggacacggc cacctatttc tgtgccagag atgatagtag tgactgggat
360gcaaaattta acttgtgggg ccaagggacc ctcgtcaccg tctcgagcgc
ctccaccaag 420ggcccatcgg tcttccccct ggcaccctcc tccaagagca
cctctggggg cacagcggcc 480ctgggctgcc tggtcaagg
49911133DNAOryctolagus cuniculus 111caggccagtc agagcattaa
caatgaatta tcc 3311221DNAOryctolagus cuniculus 112agggcatcca
ctctggcatc t 2111336DNAOryctolagus cuniculus 113caacagggtt
atagtctgag gaatattgat aatgct 3611415DNAOryctolagus cuniculus
114aactactaca tgacc 1511548DNAOryctolagus cuniculus 115atgatttatg
gtagtgatga aacagcctac gcgaactggg cgataggc 4811636DNAOryctolagus
cuniculus 116gatgatagta gtgactggga tgcaaaattt aacttg
36117109PRTOryctolagus cuniculus 117Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Phe Ser Leu Ser Asn Tyr 20 25 30Tyr Met Thr Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Met Ile Tyr Gly
Ser Asp Glu Thr Ala Tyr Ala Asn Trp Ala Ile 50 55 60Gly Arg Phe Thr
Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu65 70 75 80Gln Met
Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Arg
Asp Asp Ser Ser Asp Trp Asp Ala Lys Phe Asn Leu 100
105118109PRTOryctolagus cuniculus 118Glu Val Gln Leu Val Glu Ser
Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Phe Ser Leu Ser Asn Tyr 20 25 30Tyr Met Thr Trp Val
Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Met Ile Tyr
Gly Ser Asp Glu Thr Ala Tyr Ala Asn Ser Ala Ile 50 55 60Gly Arg Phe
Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu65 70 75 80Gln
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90
95Arg Asp Asp Ser Ser Asp Trp Asp Ala Lys Phe Asn Leu 100
105119100PRTOryctolagus cuniculus 119Asp Ile Gln Met Thr Gln Ser
Pro Ser Thr Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr
Cys Gln Ala Ser Gln Ser Ile Asn Asn Glu 20 25 30Leu Ser Trp Tyr Gln
Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Arg Ala Ser
Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser
Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Asp
Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Tyr Ser Leu Arg Asn 85 90
95Ile Asp Asn Ala 10012016PRTOryctolagus cuniculus 120Ile Ile Tyr
Gly Ser Asp Glu Thr Ala Tyr Ala Thr Ser Ala Ile Gly1 5 10
1512116PRTOryctolagus cuniculus 121Met Ile Tyr Gly Ser Asp Glu Thr
Ala Tyr Ala Asn Ser Ala Ile Gly1 5 10 15122123PRTOryctolagus
cuniculus 122Met Asp Thr Arg Ala Pro Thr Gln Leu Leu Gly Leu Leu
Leu Leu Trp1 5 10 15Leu Pro Gly Ala Thr Phe Ala Ala Val Leu Thr Gln
Thr Pro Ser Pro 20 25 30Val Ser Ala Ala Val Gly Gly Thr Val Thr Ile
Ser Cys Gln Ser Ser 35 40 45Gln Ser Val Gly Asn Asn Gln Asp Leu Ser
Trp Phe Gln Gln Arg Pro 50 55 60Gly Gln Pro Pro Lys Leu Leu Ile Tyr
Glu Ile Ser Lys Leu Glu Ser65 70 75 80Gly Val Pro Ser Arg Phe Ser
Gly Ser Gly Ser Gly Thr His Phe Thr 85 90 95Leu Thr Ile Ser Gly Val
Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys 100 105 110Leu Gly Gly Tyr
Asp Asp Asp Ala Asp Asn Ala 115 120123128PRTOryctolagus cuniculus
123Met Glu Thr Gly Leu Arg Trp Leu Leu Leu Val Ala Val Leu Lys Gly1
5 10 15Val Gln Cys His Ser Val Glu Glu Ser Gly Gly Arg Leu Val Thr
Pro 20 25 30Gly Thr Pro Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser
Leu Ser 35 40 45Ser Arg Thr Met Ser Trp Val Arg Gln Ala Pro Gly Lys
Gly Leu Glu 50 55 60Trp Ile Gly Tyr Ile Trp Ser Gly Gly Ser Thr Tyr
Tyr Ala Thr Trp65 70 75 80Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr
Ser Thr Thr Val Asp Leu 85 90 95Lys Ile Thr Ser Pro Thr Thr Glu Asp
Thr Ala Thr Tyr Phe Cys Ala 100 105 110Arg Leu Gly Asp Thr Gly Gly
His Ala Tyr Ala Thr Arg Leu Asn Leu 115 120 12512413PRTOryctolagus
cuniculus 124Gln Ser Ser Gln Ser Val Gly Asn Asn Gln Asp Leu Ser1 5
101257PRTOryctolagus cuniculus 125Glu Ile Ser Lys Leu Glu Ser1
512611PRTOryctolagus cuniculus 126Leu Gly Gly Tyr Asp Asp Asp Ala
Asp Asn Ala1 5 101275PRTOryctolagus cuniculus 127Ser Arg Thr Met
Ser1 512816PRTOryctolagus cuniculus 128Tyr Ile Trp Ser Gly Gly Ser
Thr Tyr Tyr Ala Thr Trp Ala Lys Gly1 5 10 1512915PRTOryctolagus
cuniculus 129Leu Gly Asp Thr Gly Gly His Ala Tyr Ala Thr Arg Leu
Asn Leu1 5 10 15130369DNAOryctolagus cuniculus 130atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60acatttgcag
ccgtgctgac ccagacacca tcacccgtgt ctgcagctgt gggaggcaca
120gtcaccatca gttgccagtc cagtcagagt gttggtaata accaggactt
atcctggttt 180cagcagagac cagggcagcc tcccaagctc ctgatctacg
aaatatccaa actggaatct 240ggggtcccat cgcggttcag cggcagtgga
tctgggacac acttcactct caccatcagc 300ggcgtacagt gtgacgatgc
tgccacttac tactgtctag gcggttatga tgatgatgct 360gataatgct
369131384DNAOryctolagus cuniculus 131atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcac 60tcggtggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acagtctctg
gattctccct cagtagtcgt acaatgtcct gggtccgcca ggctccaggg
180aaggggctgg agtggatcgg atacatttgg agtggtggta gcacatacta
cgcgacctgg 240gcgaaaggcc gattcaccat ctccaaaacc tcgaccacgg
tggatctgaa aatcaccagt 300ccgacaaccg aggacacggc cacctatttc
tgtgccagat tgggcgatac tggtggtcac 360gcttatgcta ctcgcttaaa tctc
38413239DNAOryctolagus cuniculus 132cagtccagtc agagtgttgg
taataaccag gacttatcc 3913321DNAOryctolagus cuniculus 133gaaatatcca
aactggaatc t 2113433DNAOryctolagus cuniculus 134ctaggcggtt
atgatgatga tgctgataat gct 3313515DNAOryctolagus cuniculus
135agtcgtacaa tgtcc 1513648DNAOryctolagus cuniculus 136tacatttgga
gtggtggtag cacatactac gcgacctggg cgaaaggc 4813745DNAOryctolagus
cuniculus 137ttgggcgata ctggtggtca cgcttatgct actcgcttaa atctc
45138123PRTOryctolagus cuniculus 138Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Thr Phe Ala
Ala Val Leu Thr Gln Thr Pro Ser Ser 20 25 30Val Ser Ala Ala Val Gly
Gly Thr Val Ser Ile Ser Cys Gln Ser Ser 35 40 45Gln Ser Val Tyr Ser
Asn Lys Tyr Leu Ala Trp Tyr Gln Gln Lys Pro 50 55 60Gly Gln Pro Pro
Lys Leu Leu Ile Tyr Trp Thr Ser Lys Leu Ala Ser65 70 75 80Gly Ala
Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Gln Phe Thr 85 90 95Leu
Thr Ile Ser Gly Val Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys 100 105
110Leu Gly Ala Tyr Asp Asp Asp Ala Asp Asn Ala 115
120139126PRTOryctolagus cuniculus 139Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Val
Glu Glu Ser Gly Gly Arg Leu Val Lys Pro 20 25 30Asp Glu Thr Leu Thr
Leu Thr Cys Thr Ala Ser Gly Phe Ser Leu Glu 35 40 45Gly Gly Tyr Met
Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile Gly
Ile Ser Tyr Asp Ser Gly Ser Thr Tyr Tyr Ala Ser Trp65 70 75 80Ala
Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Asp 85 90
95Leu Lys Met Thr Ser Leu Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys
100 105 110Val Arg Ser Leu Lys Tyr Pro Thr Val Thr Ser Asp Asp Leu
115 120 12514013PRTOryctolagus cuniculus 140Gln Ser Ser Gln Ser Val
Tyr Ser Asn Lys Tyr Leu Ala1 5 101417PRTOryctolagus cuniculus
141Trp Thr Ser Lys Leu Ala Ser1 514211PRTOryctolagus cuniculus
142Leu Gly Ala Tyr Asp Asp Asp Ala Asp Asn Ala1 5
101435PRTOryctolagus cuniculus 143Gly Gly Tyr Met Thr1
514416PRTOryctolagus cuniculus 144Ile Ser Tyr Asp Ser Gly Ser Thr
Tyr Tyr Ala Ser Trp Ala Lys Gly1 5 10 1514512PRTOryctolagus
cuniculus 145Ser Leu Lys Tyr Pro Thr Val Thr Ser Asp Asp Leu1 5
10146369DNAOryctolagus cuniculus 146atggacacga gggcccccac
tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60acatttgcag ccgtgctgac
ccagacacca tcgtccgtgt ctgcagctgt gggaggcaca 120gtcagcatca
gttgccagtc cagtcagagt gtttatagta ataagtacct agcctggtat
180cagcagaaac cagggcagcc tcccaagctc ctgatctact ggacatccaa
actggcatct 240ggggccccat cacggttcag cggcagtgga tctgggacac
aattcactct caccatcagc 300ggcgtgcagt gtgacgatgc tgccacttac
tactgtctag gcgcttatga tgatgatgct 360gataatgct
369147378DNAOryctolagus cuniculus 147atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcggtggaag agtccggggg
tcgcctggtc aagcctgacg aaaccctgac actcacctgc 120acagcctctg
gattctccct ggagggcggc tacatgacct gggtccgcca ggctccaggg
180aaggggctgg aatggatcgg aatcagttat gatagtggta gcacatacta
cgcgagctgg 240gcgaaaggcc gattcaccat ctccaagacc tcgtcgacca
cggtggatct gaaaatgacc 300agtctgacaa ccgaggacac ggccacctat
ttctgcgtca gatcactaaa atatcctact 360gttacttctg atgacttg
37814839DNAOryctolagus cuniculus 148cagtccagtc agagtgttta
tagtaataag tacctagcc 3914921DNAOryctolagus cuniculus 149tggacatcca
aactggcatc t 2115033DNAOryctolagus cuniculus 150ctaggcgctt
atgatgatga tgctgataat gct 3315115DNAOryctolagus cuniculus
151ggcggctaca tgacc 1515248DNAOryctolagus cuniculus 152atcagttatg
atagtggtag cacatactac gcgagctggg cgaaaggc 4815336DNAOryctolagus
cuniculus 153tcactaaaat atcctactgt tacttctgat gacttg
36154123PRTOryctolagus cuniculus 154Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Thr Phe Ala
Ala Val Leu Thr Gln Thr Pro Ser Pro 20 25 30Val Ser Ala Ala Val Gly
Gly Thr Val Thr Ile Ser Cys Gln Ser Ser 35 40 45Gln Ser Val Tyr Asn
Asn Asn Asp Leu Ala Trp Tyr Gln Gln Lys Pro 50 55 60Gly Gln Pro Pro
Lys Leu Leu Ile Tyr Tyr Ala Ser Thr Leu Ala Ser65 70 75 80Gly Val
Pro Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Gln Phe Thr 85 90 95Leu
Thr Ile Ser Gly Val Gln Cys Asp Asp Ala Ala Ala Tyr Tyr Cys 100 105
110Leu Gly Gly Tyr Asp Asp Asp Ala Asp Asn Ala 115
120155129PRTOryctolagus cuniculus 155Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Val
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Val Ser Gly Leu Ser Leu Ser 35 40 45Ser Asn Thr Ile
Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile Gly
Tyr Ile Trp Ser Gly Gly Ser Thr Tyr Tyr Ala Ser Trp65 70 75 80Val
Asn Gly Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu 85 90
95Lys Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Ala
100 105 110Arg Gly Gly Tyr Ala Ser Gly Gly Tyr Pro Tyr Ala Thr Arg
Leu Asp 115 120 125Leu15613PRTOryctolagus cuniculus 156Gln Ser Ser
Gln Ser Val Tyr Asn Asn Asn Asp Leu Ala1 5 101577PRTOryctolagus
cuniculus 157Tyr Ala Ser Thr Leu Ala Ser1 515811PRTOryctolagus
cuniculus 158Leu Gly Gly Tyr Asp Asp Asp Ala Asp Asn Ala1 5
101595PRTOryctolagus cuniculus 159Ser Asn Thr Ile Asn1
516016PRTOryctolagus cuniculus 160Tyr Ile Trp Ser Gly Gly Ser Thr
Tyr Tyr Ala Ser Trp Val Asn Gly1 5 10 1516116PRTOryctolagus
cuniculus 161Gly Gly Tyr Ala Ser Gly Gly Tyr Pro Tyr Ala Thr Arg
Leu Asp Leu1 5 10 15162369DNAOryctolagus cuniculus 162atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60acatttgcag
ccgtgctgac ccagacacca tcacccgtgt ctgcagctgt gggaggcaca
120gtcaccatca gttgccagtc cagtcagagt gtttataata ataacgactt
agcctggtat 180cagcagaaac cagggcagcc tcctaaactc ctgatctatt
atgcatccac tctggcatct 240ggggtcccat cgcggttcaa aggcagtgga
tctgggacac agttcactct caccatcagc 300ggcgtgcagt gtgacgatgc
tgccgcttac tactgtctag gcggttatga tgatgatgct 360gataatgct
369163387DNAOryctolagus cuniculus 163atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcggtggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acagtatctg
gattatccct cagtagcaat acaataaact gggtccgcca
ggctccaggg 180aaggggctgg agtggatcgg atacatttgg agtggtggta
gtacatacta cgcgagctgg 240gtgaatggtc gattcaccat ctccaaaacc
tcgaccacgg tggatctgaa aatcaccagt 300ccgacaaccg aggacacggc
cacctatttc tgtgccagag ggggttacgc tagtggtggt 360tatccttatg
ccactcggtt ggatctc 38716439DNAOryctolagus cuniculus 164cagtccagtc
agagtgttta taataataac gacttagcc 3916521DNAOryctolagus cuniculus
165tatgcatcca ctctggcatc t 2116633DNAOryctolagus cuniculus
166ctaggcggtt atgatgatga tgctgataat gct 3316715DNAOryctolagus
cuniculus 167agcaatacaa taaac 1516848DNAOryctolagus cuniculus
168tacatttgga gtggtggtag tacatactac gcgagctggg tgaatggt
4816948DNAOryctolagus cuniculus 169gggggttacg ctagtggtgg ttatccttat
gccactcggt tggatctc 48170123PRTOryctolagus cuniculus 170Met Asp Thr
Arg Ala Pro Thr Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro
Gly Ala Thr Phe Ala Ala Val Leu Thr Gln Thr Pro Ser Ser 20 25 30Val
Ser Ala Ala Val Gly Gly Thr Val Thr Ile Asn Cys Gln Ser Ser 35 40
45Gln Ser Val Tyr Asn Asn Asp Tyr Leu Ser Trp Tyr Gln Gln Arg Pro
50 55 60Gly Gln Arg Pro Lys Leu Leu Ile Tyr Gly Ala Ser Lys Leu Ala
Ser65 70 75 80Gly Val Pro Ser Arg Phe Lys Gly Ser Gly Ser Gly Lys
Gln Phe Thr 85 90 95Leu Thr Ile Ser Gly Val Gln Cys Asp Asp Ala Ala
Thr Tyr Tyr Cys 100 105 110Leu Gly Asp Tyr Asp Asp Asp Ala Asp Asn
Thr 115 120171123PRTOryctolagus cuniculus 171Met Glu Thr Gly Leu
Arg Trp Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln
Ser Leu Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro
Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Thr Leu Ser 35 40 45Thr Asn
Tyr Tyr Leu Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 50 55 60Glu
Trp Ile Gly Ile Ile Tyr Pro Ser Gly Asn Thr Tyr Cys Ala Lys65 70 75
80Trp Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val
85 90 95Asp Leu Lys Met Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr
Phe 100 105 110Cys Ala Arg Asn Tyr Gly Gly Asp Glu Ser Leu 115
12017213PRTOryctolagus cuniculus 172Gln Ser Ser Gln Ser Val Tyr Asn
Asn Asp Tyr Leu Ser1 5 101737PRTOryctolagus cuniculus 173Gly Ala
Ser Lys Leu Ala Ser1 517411PRTOryctolagus cuniculus 174Leu Gly Asp
Tyr Asp Asp Asp Ala Asp Asn Thr1 5 101756PRTOryctolagus cuniculus
175Thr Asn Tyr Tyr Leu Ser1 517616PRTOryctolagus cuniculus 176Ile
Ile Tyr Pro Ser Gly Asn Thr Tyr Cys Ala Lys Trp Ala Lys Gly1 5 10
151778PRTOryctolagus cuniculus 177Asn Tyr Gly Gly Asp Glu Ser Leu1
5178369DNAOryctolagus cuniculus 178atggacacga gggcccccac tcagctgctg
gggctcctgc tgctctggct cccaggtgcc 60acatttgcag ccgtgctgac ccagacacca
tcctccgtgt ctgcagctgt gggaggcaca 120gtcaccatca attgccagtc
cagtcagagt gtttataata acgactactt atcctggtat 180caacagaggc
cagggcaacg tcccaagctc ctaatctatg gtgcttccaa actggcatct
240ggggtcccgt cacggttcaa aggcagtgga tctgggaaac agtttactct
caccatcagc 300ggcgtgcagt gtgacgatgc tgccacttac tactgtctgg
gcgattatga tgatgatgct 360gataatact 369179369DNAOryctolagus
cuniculus 179atggagactg ggctgcgctg gcttctcctg gtcgctgtgc tcaaaggtgt
ccagtgtcag 60tcgctggagg agtccggggg tcgcctggtc acgcctggga cacccctgac
actcacttgc 120acagtctctg gattcaccct cagtaccaac tactacctga
gctgggtccg ccaggctcca 180gggaaggggc tagaatggat cggaatcatt
tatcctagtg gtaacacata ttgcgcgaag 240tgggcgaaag gccgattcac
catctccaaa acctcgtcga ccacggtgga tctgaaaatg 300accagtccga
caaccgagga cacagccacg tatttctgtg ccagaaatta tggtggtgat 360gaaagtttg
36918039DNAOryctolagus cuniculus 180cagtccagtc agagtgttta
taataacgac tacttatcc 3918121DNAOryctolagus cuniculus 181ggtgcttcca
aactggcatc t 2118233DNAOryctolagus cuniculus 182ctgggcgatt
atgatgatga tgctgataat act 3318318DNAOryctolagus cuniculus
183accaactact acctgagc 1818448DNAOryctolagus cuniculus
184atcatttatc ctagtggtaa cacatattgc gcgaagtggg cgaaaggc
4818524DNAOryctolagus cuniculus 185aattatggtg gtgatgaaag tttg
24186119PRTOryctolagus cuniculus 186Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys Asp
Val Val Met Thr Gln Thr Pro Ala Ser 20 25 30Val Glu Ala Ala Val Gly
Gly Thr Val Thr Ile Lys Cys Gln Ala Ser 35 40 45Glu Thr Ile Gly Asn
Ala Leu Ala Trp Tyr Gln Gln Lys Ser Gly Gln 50 55 60Pro Pro Lys Leu
Leu Ile Tyr Lys Ala Ser Lys Leu Ala Ser Gly Val65 70 75 80Pro Ser
Arg Phe Lys Gly Ser Gly Ser Gly Thr Glu Tyr Thr Leu Thr 85 90 95Ile
Ser Asp Leu Glu Cys Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Trp 100 105
110Cys Tyr Phe Gly Asp Ser Val 115187128PRTOryctolagus cuniculus
187Met Glu Thr Gly Leu Arg Trp Leu Leu Leu Val Thr Val Leu Lys Gly1
5 10 15Val Gln Cys Gln Glu Gln Leu Val Glu Ser Gly Gly Gly Leu Val
Gln 20 25 30Pro Glu Gly Ser Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe
Asp Phe 35 40 45Ser Ser Gly Tyr Tyr Met Cys Trp Val Arg Gln Ala Pro
Gly Lys Gly 50 55 60Leu Glu Trp Ile Ala Cys Ile Phe Thr Ile Thr Thr
Asn Thr Tyr Tyr65 70 75 80Ala Ser Trp Ala Lys Gly Arg Phe Thr Ile
Ser Lys Thr Ser Ser Thr 85 90 95Thr Val Thr Leu Gln Met Thr Ser Leu
Thr Ala Ala Asp Thr Ala Thr 100 105 110Tyr Leu Cys Ala Arg Gly Ile
Tyr Ser Asp Asn Asn Tyr Tyr Ala Leu 115 120 12518811PRTOryctolagus
cuniculus 188Gln Ala Ser Glu Thr Ile Gly Asn Ala Leu Ala1 5
101897PRTOryctolagus cuniculus 189Lys Ala Ser Lys Leu Ala Ser1
51909PRTOryctolagus cuniculus 190Gln Trp Cys Tyr Phe Gly Asp Ser
Val1 51916PRTOryctolagus cuniculus 191Ser Gly Tyr Tyr Met Cys1
519217PRTOryctolagus cuniculus 192Cys Ile Phe Thr Ile Thr Thr Asn
Thr Tyr Tyr Ala Ser Trp Ala Lys1 5 10 15Gly19311PRTOryctolagus
cuniculus 193Gly Ile Tyr Ser Asp Asn Asn Tyr Tyr Ala Leu1 5
10194357DNAOryctolagus cuniculus 194atggacacga gggcccccac
tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60agatgtgatg ttgtgatgac
ccagactcca gcctccgtgg aggcagctgt gggaggcaca 120gtcaccatca
agtgccaggc cagtgagacc attggcaatg cattagcctg gtatcagcag
180aaatcagggc agcctcccaa gctcctgatc tacaaggcat ccaaactggc
atctggggtc 240ccatcgcggt tcaaaggcag tggatctggg acagagtaca
ctctcaccat cagcgacctg 300gagtgtgccg atgctgccac ttactactgt
caatggtgtt attttggtga tagtgtt 357195384DNAOryctolagus cuniculus
195atggagactg ggctgcgctg gcttctcctg gtcactgtgc tcaaaggtgt
ccagtgtcag 60gagcagctgg tggagtccgg gggaggcctg gtccagcctg agggatccct
gacactcacc 120tgcacagcct ctggattcga cttcagtagc ggctactaca
tgtgctgggt ccgccaggct 180ccagggaagg ggctggagtg gatcgcgtgt
attttcacta ttactactaa cacttactac 240gcgagctggg cgaaaggccg
attcaccatc tccaagacct cgtcgaccac ggtgactctg 300caaatgacca
gtctgacagc cgcggacacg gccacctatc tctgtgcgag agggatttat
360tctgataata attattatgc cttg 38419633DNAOryctolagus cuniculus
196caggccagtg agaccattgg caatgcatta gcc 3319721DNAOryctolagus
cuniculus 197aaggcatcca aactggcatc t 2119827DNAOryctolagus
cuniculus 198caatggtgtt attttggtga tagtgtt 2719918DNAOryctolagus
cuniculus 199agcggctact acatgtgc 1820051DNAOryctolagus cuniculus
200tgtattttca ctattactac taacacttac tacgcgagct gggcgaaagg c
5120133DNAOryctolagus cuniculus 201gggatttatt ctgataataa ttattatgcc
ttg 33202119PRTOryctolagus cuniculus 202Met Asp Thr Arg Ala Pro Thr
Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys
Asp Val Val Met Thr Gln Thr Pro Ala Ser 20 25 30Val Glu Ala Ala Val
Gly Gly Thr Val Thr Ile Lys Cys Gln Ala Ser 35 40 45Glu Ser Ile Gly
Asn Ala Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 50 55 60Pro Pro Lys
Leu Leu Ile Tyr Lys Ala Ser Thr Leu Ala Ser Gly Val65 70 75 80Pro
Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr 85 90
95Ile Ser Gly Val Gln Cys Ala Asp Ala Ala Ala Tyr Tyr Cys Gln Trp
100 105 110Cys Tyr Phe Gly Asp Ser Val 115203128PRTOryctolagus
cuniculus 203Met Glu Thr Gly Leu Arg Trp Leu Leu Leu Val Ala Val
Leu Lys Gly1 5 10 15Val Gln Cys Gln Gln Gln Leu Val Glu Ser Gly Gly
Gly Leu Val Lys 20 25 30Pro Gly Ala Ser Leu Thr Leu Thr Cys Lys Ala
Ser Gly Phe Ser Phe 35 40 45Ser Ser Gly Tyr Tyr Met Cys Trp Val Arg
Gln Ala Pro Gly Lys Gly 50 55 60Leu Glu Ser Ile Ala Cys Ile Phe Thr
Ile Thr Asp Asn Thr Tyr Tyr65 70 75 80Ala Asn Trp Ala Lys Gly Arg
Phe Thr Ile Ser Lys Pro Ser Ser Pro 85 90 95Thr Val Thr Leu Gln Met
Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr 100 105 110Tyr Phe Cys Ala
Arg Gly Ile Tyr Ser Thr Asp Asn Tyr Tyr Ala Leu 115 120
12520411PRTOryctolagus cuniculus 204Gln Ala Ser Glu Ser Ile Gly Asn
Ala Leu Ala1 5 102057PRTOryctolagus cuniculus 205Lys Ala Ser Thr
Leu Ala Ser1 52069PRTOryctolagus cuniculus 206Gln Trp Cys Tyr Phe
Gly Asp Ser Val1 52076PRTOryctolagus cuniculus 207Ser Gly Tyr Tyr
Met Cys1 520817PRTOryctolagus cuniculus 208Cys Ile Phe Thr Ile Thr
Asp Asn Thr Tyr Tyr Ala Asn Trp Ala Lys1 5 10
15Gly20911PRTOryctolagus cuniculus 209Gly Ile Tyr Ser Thr Asp Asn
Tyr Tyr Ala Leu1 5 10210357DNAOryctolagus cuniculus 210atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60agatgtgatg
ttgtgatgac ccagactcca gcctccgtgg aggcagctgt gggaggcaca
120gtcaccatca agtgccaggc cagtgagagc attggcaatg cattagcctg
gtatcagcag 180aaaccagggc agcctcccaa gctcctgatc tacaaggcat
ccactctggc atctggggtc 240ccatcgcggt tcagcggcag tggatctggg
acagagttca ctctcaccat cagcggcgtg 300cagtgtgccg atgctgccgc
ttactactgt caatggtgtt attttggtga tagtgtt 357211384DNAOryctolagus
cuniculus 211atggagactg ggctgcgctg gcttctcctg gtcgctgtgc tcaaaggtgt
ccagtgtcag 60cagcagctgg tggagtccgg gggaggcctg gtcaagccgg gggcatccct
gacactcacc 120tgcaaagcct ctggattctc cttcagtagc ggctactaca
tgtgctgggt ccgccaggct 180ccagggaagg ggctggagtc gatcgcatgc
atttttacta ttactgataa cacttactac 240gcgaactggg cgaaaggccg
attcaccatc tccaagccct cgtcgcccac ggtgactctg 300caaatgacca
gtctgacagc cgcggacacg gccacctatt tctgtgcgag ggggatttat
360tctactgata attattatgc cttg 38421233DNAOryctolagus cuniculus
212caggccagtg agagcattgg caatgcatta gcc 3321321DNAOryctolagus
cuniculus 213aaggcatcca ctctggcatc t 2121427DNAOryctolagus
cuniculus 214caatggtgtt attttggtga tagtgtt 2721518DNAOryctolagus
cuniculus 215agcggctact acatgtgc 1821651DNAOryctolagus cuniculus
216tgcattttta ctattactga taacacttac tacgcgaact gggcgaaagg c
5121733DNAOryctolagus cuniculus 217gggatttatt ctactgataa ttattatgcc
ttg 33218123PRTOryctolagus cuniculus 218Met Asp Thr Arg Ala Pro Thr
Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys
Asp Val Val Met Thr Gln Thr Pro Ala Ser 20 25 30Val Glu Ala Ala Val
Gly Gly Thr Val Thr Ile Lys Cys Gln Ala Ser 35 40 45Gln Ser Val Ser
Ser Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Gln 50 55 60Pro Pro Lys
Leu Leu Ile Tyr Arg Ala Ser Thr Leu Glu Ser Gly Val65 70 75 80Pro
Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr 85 90
95Ile Ser Asp Leu Glu Cys Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Cys
100 105 110Thr Tyr Gly Thr Ser Ser Ser Tyr Gly Ala Ala 115
120219133PRTOryctolagus cuniculus 219Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Val
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Val Ser Gly Ile Ser Leu Ser 35 40 45Ser Asn Ala Ile
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile Gly
Ile Ile Ser Tyr Ser Gly Thr Thr Tyr Tyr Ala Ser Trp65 70 75 80Ala
Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr Val Asp 85 90
95Leu Lys Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys
100 105 110Ala Arg Asp Asp Pro Thr Thr Val Met Val Met Leu Ile Pro
Phe Gly 115 120 125Ala Gly Met Asp Leu 13022011PRTOryctolagus
cuniculus 220Gln Ala Ser Gln Ser Val Ser Ser Tyr Leu Asn1 5
102217PRTOryctolagus cuniculus 221Arg Ala Ser Thr Leu Glu Ser1
522213PRTOryctolagus cuniculus 222Gln Cys Thr Tyr Gly Thr Ser Ser
Ser Tyr Gly Ala Ala1 5 102235PRTOryctolagus cuniculus 223Ser Asn
Ala Ile Ser1 522416PRTOryctolagus cuniculus 224Ile Ile Ser Tyr Ser
Gly Thr Thr Tyr Tyr Ala Ser Trp Ala Lys Gly1 5 10
1522519PRTOryctolagus cuniculus 225Asp Asp Pro Thr Thr Val Met Val
Met Leu Ile Pro Phe Gly Ala Gly1 5 10 15Met Asp
Leu226369DNAOryctolagus cuniculus 226atggacacga gggcccccac
tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60agatgtgatg ttgtgatgac
ccagactcca gcctccgtgg aggcagctgt gggaggcaca 120gtcaccatca
agtgccaggc cagtcagagc gttagtagct acttaaactg gtatcagcag
180aaaccagggc agcctcccaa gctcctgatc tacagggcat ccactctgga
atctggggtc 240ccatcgcggt tcaaaggcag tggatctggg acagagttca
ctctcaccat cagcgacctg 300gagtgtgccg atgctgccac ttactactgt
caatgtactt atggtactag tagtagttat 360ggtgctgct
369227399DNAOryctolagus cuniculus 227atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcggtggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120accgtctctg
gtatctccct cagtagcaat gcaataagct gggtccgcca ggctccaggg
180aaggggctgg aatggatcgg aatcattagt tatagtggta ccacatacta
cgcgagctgg 240gcgaaaggcc gattcaccat ctccaaaacc tcgtcgacca
cggtggatct gaaaatcact 300agtccgacaa ccgaggacac ggccacctac
ttctgtgcca gagatgaccc tacgacagtt 360atggttatgt tgataccttt
tggagccggc atggacctc 39922833DNAOryctolagus cuniculus 228caggccagtc
agagcgttag tagctactta aac 3322921DNAOryctolagus cuniculus
229agggcatcca ctctggaatc t 2123039DNAOryctolagus cuniculus
230caatgtactt atggtactag tagtagttat ggtgctgct 3923115DNAOryctolagus
cuniculus 231agcaatgcaa taagc 1523248DNAOryctolagus cuniculus
232atcattagtt atagtggtac cacatactac gcgagctggg cgaaaggc
4823357DNAOryctolagus cuniculus 233gatgacccta cgacagttat ggttatgttg
ataccttttg gagccggcat ggacctc 57234125PRTOryctolagus cuniculus
234Met Asp Thr Arg Ala Pro Thr Gln Leu Leu Gly Leu Leu Leu Leu Trp1
5 10 15Leu Pro Gly Ala Thr Phe Ala Gln Val Leu Thr Gln Thr Ala Ser
Pro 20 25 30Val Ser Ala Ala Val Gly Gly Thr Val Thr Ile Asn Cys
Gln Ala Ser 35 40 45Gln Ser Val Tyr Lys Asn Asn Tyr Leu Ser Trp Tyr
Gln Gln Lys Pro 50 55 60Gly Gln Pro Pro Lys Gly Leu Ile Tyr Ser Ala
Ser Thr Leu Asp Ser65 70 75 80Gly Val Pro Leu Arg Phe Ser Gly Ser
Gly Ser Gly Thr Gln Phe Thr 85 90 95Leu Thr Ile Ser Asp Val Gln Cys
Asp Asp Ala Ala Thr Tyr Tyr Cys 100 105 110Leu Gly Ser Tyr Asp Cys
Ser Ser Gly Asp Cys Tyr Ala 115 120 125235119PRTOryctolagus
cuniculus 235Met Glu Thr Gly Leu Arg Trp Leu Leu Leu Val Ala Val
Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Leu Glu Glu Ser Gly Gly Asp
Leu Val Lys Pro 20 25 30Glu Gly Ser Leu Thr Leu Thr Cys Thr Ala Ser
Gly Phe Ser Phe Ser 35 40 45Ser Tyr Trp Met Cys Trp Val Arg Gln Ala
Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile Ala Cys Ile Val Thr Gly Asn
Gly Asn Thr Tyr Tyr Ala Asn65 70 75 80Trp Ala Lys Gly Arg Phe Thr
Ile Ser Lys Thr Ser Ser Thr Thr Val 85 90 95Thr Leu Gln Met Thr Ser
Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe 100 105 110Cys Ala Lys Ala
Tyr Asp Leu 11523613PRTOryctolagus cuniculus 236Gln Ala Ser Gln Ser
Val Tyr Lys Asn Asn Tyr Leu Ser1 5 102377PRTOryctolagus cuniculus
237Ser Ala Ser Thr Leu Asp Ser1 523813PRTOryctolagus cuniculus
238Leu Gly Ser Tyr Asp Cys Ser Ser Gly Asp Cys Tyr Ala1 5
102395PRTOryctolagus cuniculus 239Ser Tyr Trp Met Cys1
524017PRTOryctolagus cuniculus 240Cys Ile Val Thr Gly Asn Gly Asn
Thr Tyr Tyr Ala Asn Trp Ala Lys1 5 10 15Gly2414PRTOryctolagus
cuniculus 241Ala Tyr Asp Leu1242375DNAOryctolagus cuniculus
242atggacacga gggcccccac tcagctgctg gggctcctgc tgctctggct
cccaggtgcc 60acatttgccc aagtgctgac ccagactgca tcgcccgtgt ctgcagctgt
gggaggcaca 120gtcaccatca actgccaggc cagtcagagt gtttataaga
acaactactt atcctggtat 180cagcagaaac cagggcagcc tcccaaaggc
ctgatctatt ctgcatcgac tctagattct 240ggggtcccat tgcggttcag
cggcagtgga tctgggacac agttcactct caccatcagc 300gacgtgcagt
gtgacgatgc tgccacttac tactgtctag gcagttatga ttgtagtagt
360ggtgattgtt atgct 375243357DNAOryctolagus cuniculus 243atggagactg
ggctgcgctg gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcgttggagg
agtccggggg agacctggtc aagcctgagg gatccctgac actcacctgc
120acagcctctg gattctcctt cagtagctac tggatgtgct gggtccgcca
ggctccaggg 180aaggggctgg agtggatcgc atgcattgtt actggtaatg
gtaacactta ctacgcgaac 240tgggcgaaag gccgattcac catctccaaa
acctcgtcga ccacggtgac tctgcaaatg 300accagtctga cagccgcgga
cacggccacc tatttttgtg cgaaagccta tgacttg 35724439DNAOryctolagus
cuniculus 244caggccagtc agagtgttta taagaacaac tacttatcc
3924521DNAOryctolagus cuniculus 245tctgcatcga ctctagattc t
2124639DNAOryctolagus cuniculus 246ctaggcagtt atgattgtag tagtggtgat
tgttatgct 3924715DNAOryctolagus cuniculus 247agctactgga tgtgc
1524851DNAOryctolagus cuniculus 248tgcattgtta ctggtaatgg taacacttac
tacgcgaact gggcgaaagg c 5124912DNAOryctolagus cuniculus
249gcctatgact tg 12250123PRTOryctolagus cuniculus 250Met Asp Thr
Arg Ala Pro Thr Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro
Gly Ser Thr Phe Ala Ala Val Leu Thr Gln Thr Pro Ser Pro 20 25 30Val
Ser Ala Ala Val Gly Gly Thr Val Ser Ile Ser Cys Gln Ala Ser 35 40
45Gln Ser Val Tyr Asp Asn Asn Tyr Leu Ser Trp Tyr Gln Gln Lys Pro
50 55 60Gly Gln Pro Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Leu Ala
Ser65 70 75 80Gly Val Pro Ser Arg Phe Lys Gly Thr Gly Ser Gly Thr
Gln Phe Thr 85 90 95Leu Thr Ile Thr Asp Val Gln Cys Asp Asp Ala Ala
Thr Tyr Tyr Cys 100 105 110Ala Gly Val Phe Asn Asp Asp Ser Asp Asp
Ala 115 120251125PRTOryctolagus cuniculus 251Met Glu Thr Gly Leu
Arg Trp Leu Leu Leu Val Ala Val Pro Lys Gly1 5 10 15Val Gln Cys Gln
Ser Leu Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro
Leu Thr Leu Thr Cys Thr Leu Ser Gly Phe Ser Leu Ser 35 40 45Ala Tyr
Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp
Ile Gly Phe Ile Thr Leu Ser Asp His Ile Ser Tyr Ala Arg Trp65 70 75
80Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu
85 90 95Lys Met Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys
Ala 100 105 110Arg Ser Arg Gly Trp Gly Ala Met Gly Arg Leu Asp Leu
115 120 12525213PRTOryctolagus cuniculus 252Gln Ala Ser Gln Ser Val
Tyr Asp Asn Asn Tyr Leu Ser1 5 102537PRTOryctolagus cuniculus
253Gly Ala Ser Thr Leu Ala Ser1 525411PRTOryctolagus cuniculus
254Ala Gly Val Phe Asn Asp Asp Ser Asp Asp Ala1 5
102555PRTOryctolagus cuniculus 255Ala Tyr Tyr Met Ser1
525616PRTOryctolagus cuniculus 256Phe Ile Thr Leu Ser Asp His Ile
Ser Tyr Ala Arg Trp Ala Lys Gly1 5 10 1525712PRTOryctolagus
cuniculus 257Ser Arg Gly Trp Gly Ala Met Gly Arg Leu Asp Leu1 5
10258369DNAOryctolagus cuniculus 258atggacacga gggcccccac
tcagctgctg gggctcctgc tgctctggct cccaggttcc 60acatttgccg ccgtgctgac
ccagactcca tctcccgtgt ctgcagctgt gggaggcaca 120gtcagcatca
gttgccaggc cagtcagagt gtttatgaca acaactattt atcctggtat
180cagcagaaac caggacagcc tcccaagctc ctgatctatg gtgcatccac
tctggcatct 240ggggtcccat cgcggttcaa aggcacggga tctgggacac
agttcactct caccatcaca 300gacgtgcagt gtgacgatgc tgccacttac
tattgtgcag gcgtttttaa tgatgatagt 360gatgatgcc
369259375DNAOryctolagus cuniculus 259atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc ccaaaggtgt ccagtgtcag 60tcgctggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acactctctg
gattctccct cagtgcatac tatatgagct gggtccgcca ggctccaggg
180aaggggctgg aatggatcgg attcattact ctgagtgatc atatatctta
cgcgaggtgg 240gcgaaaggcc gattcaccat ctccaaaacc tcgaccacgg
tggatctgaa aatgaccagt 300ccgacaaccg aggacacggc cacctatttc
tgtgccagga gtcgtggctg gggtgcaatg 360ggtcggttgg atctc
37526039DNAOryctolagus cuniculus 260caggccagtc agagtgttta
tgacaacaac tatttatcc 3926121DNAOryctolagus cuniculus 261ggtgcatcca
ctctggcatc t 2126233DNAOryctolagus cuniculus 262gcaggcgttt
ttaatgatga tagtgatgat gcc 3326315DNAOryctolagus cuniculus
263gcatactata tgagc 1526448DNAOryctolagus cuniculus 264ttcattactc
tgagtgatca tatatcttac gcgaggtggg cgaaaggc 4826536DNAOryctolagus
cuniculus 265agtcgtggct ggggtgcaat gggtcggttg gatctc
36266123PRTOryctolagus cuniculus 266Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Thr Phe Ala
Ala Val Leu Thr Gln Thr Pro Ser Pro 20 25 30Val Ser Ala Ala Val Gly
Gly Thr Val Thr Ile Ser Cys Gln Ala Ser 35 40 45Gln Ser Val Tyr Asn
Asn Lys Asn Leu Ala Trp Tyr Gln Gln Lys Ser 50 55 60Gly Gln Pro Pro
Lys Leu Leu Ile Tyr Trp Ala Ser Thr Leu Ala Ser65 70 75 80Gly Val
Ser Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Gln Phe Thr 85 90 95Leu
Thr Val Ser Gly Val Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys 100 105
110Leu Gly Val Phe Asp Asp Asp Ala Asp Asn Ala 115
120267121PRTOryctolagus cuniculus 267Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Val
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Ala Ser Gly Phe Ser Leu Ser 35 40 45Ser Tyr Ser Met
Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Tyr Ile Gly
Val Ile Gly Thr Ser Gly Ser Thr Tyr Tyr Ala Thr Trp65 70 75 80Ala
Lys Gly Arg Phe Thr Ile Ser Arg Thr Ser Thr Thr Val Ala Leu 85 90
95Lys Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Val
100 105 110Arg Ser Leu Ser Ser Ile Thr Phe Leu 115
12026813PRTOryctolagus cuniculus 268Gln Ala Ser Gln Ser Val Tyr Asn
Asn Lys Asn Leu Ala1 5 102697PRTOryctolagus cuniculus 269Trp Ala
Ser Thr Leu Ala Ser1 527011PRTOryctolagus cuniculus 270Leu Gly Val
Phe Asp Asp Asp Ala Asp Asn Ala1 5 102715PRTOryctolagus cuniculus
271Ser Tyr Ser Met Thr1 527216PRTOryctolagus cuniculus 272Val Ile
Gly Thr Ser Gly Ser Thr Tyr Tyr Ala Thr Trp Ala Lys Gly1 5 10
152738PRTOryctolagus cuniculus 273Ser Leu Ser Ser Ile Thr Phe Leu1
5274369DNAOryctolagus cuniculus 274atggacacga gggcccccac tcagctgctg
gggctcctgc tgctctggct cccaggtgcc 60acattcgcag ccgtgctgac ccagacacca
tcgcccgtgt ctgcggctgt gggaggcaca 120gtcaccatca gttgccaggc
cagtcagagt gtttataaca acaaaaattt agcctggtat 180cagcagaaat
cagggcagcc tcccaagctc ctgatctact gggcatccac tctggcatct
240ggggtctcat cgcggttcag cggcagtgga tctgggacac agttcactct
caccgtcagc 300ggcgtgcagt gtgacgatgc tgccacttac tactgtctag
gcgtttttga tgatgatgct 360gataatgct 369275363DNAOryctolagus
cuniculus 275atggagactg ggctgcgctg gcttctcctg gtcgctgtgc tcaaaggtgt
ccaatgtcag 60tcggtggagg agtccggggg tcgcctggtc acgcctggga cacccctgac
actcacctgc 120acagcctctg gattctccct cagtagctac tccatgacct
gggtccgcca ggctccaggg 180aaggggctgg aatatatcgg agtcattggt
actagtggta gcacatacta cgcgacctgg 240gcgaaaggcc gattcaccat
ctccagaacc tcgaccacgg tggctctgaa aatcaccagt 300ccgacaaccg
aggacacggc cacctatttc tgtgtcagga gtctttcttc tattactttc 360ttg
36327639DNAOryctolagus cuniculus 276caggccagtc agagtgttta
taacaacaaa aatttagcc 3927721DNAOryctolagus cuniculus 277tgggcatcca
ctctggcatc t 2127833DNAOryctolagus cuniculus 278ctaggcgttt
ttgatgatga tgctgataat gct 3327915DNAOryctolagus cuniculus
279agctactcca tgacc 1528048DNAOryctolagus cuniculus 280gtcattggta
ctagtggtag cacatactac gcgacctggg cgaaaggc 4828124DNAOryctolagus
cuniculus 281agtctttctt ctattacttt cttg 24282120PRTOryctolagus
cuniculus 282Met Asp Thr Arg Ala Pro Thr Gln Leu Leu Gly Leu Leu
Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys Ala Phe Glu Leu Thr Gln
Thr Pro Ala Ser 20 25 30Val Glu Ala Ala Val Gly Gly Thr Val Thr Ile
Asn Cys Gln Ala Ser 35 40 45Gln Asn Ile Tyr Arg Tyr Leu Ala Trp Tyr
Gln Gln Lys Pro Gly Gln 50 55 60Pro Pro Lys Phe Leu Ile Tyr Leu Ala
Ser Thr Leu Ala Ser Gly Val65 70 75 80Pro Ser Arg Phe Lys Gly Ser
Gly Ser Gly Thr Glu Phe Thr Leu Thr 85 90 95Ile Ser Asp Leu Glu Cys
Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser 100 105 110Tyr Tyr Ser Ser
Asn Ser Val Ala 115 120283128PRTOryctolagus cuniculus 283Met Glu
Thr Gly Leu Arg Trp Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val
Gln Cys Gln Glu Gln Leu Val Glu Ser Gly Gly Asp Leu Val Gln 20 25
30Pro Glu Gly Ser Leu Thr Leu Thr Cys Thr Ala Ser Glu Leu Asp Phe
35 40 45Ser Ser Gly Tyr Trp Ile Cys Trp Val Arg Gln Val Pro Gly Lys
Gly 50 55 60Leu Glu Trp Ile Gly Cys Ile Tyr Thr Gly Ser Ser Gly Ser
Thr Phe65 70 75 80Tyr Ala Ser Trp Ala Lys Gly Arg Phe Thr Ile Ser
Lys Thr Ser Ser 85 90 95Thr Thr Val Thr Leu Gln Met Thr Ser Leu Thr
Ala Ala Asp Thr Ala 100 105 110Thr Tyr Phe Cys Ala Arg Gly Tyr Ser
Gly Phe Gly Tyr Phe Lys Leu 115 120 12528411PRTOryctolagus
cuniculus 284Gln Ala Ser Gln Asn Ile Tyr Arg Tyr Leu Ala1 5
102857PRTOryctolagus cuniculus 285Leu Ala Ser Thr Leu Ala Ser1
528610PRTOryctolagus cuniculus 286Gln Ser Tyr Tyr Ser Ser Asn Ser
Val Ala1 5 102876PRTOryctolagus cuniculus 287Ser Gly Tyr Trp Ile
Cys1 528818PRTOryctolagus cuniculus 288Cys Ile Tyr Thr Gly Ser Ser
Gly Ser Thr Phe Tyr Ala Ser Trp Ala1 5 10 15Lys
Gly28910PRTOryctolagus cuniculus 289Gly Tyr Ser Gly Phe Gly Tyr Phe
Lys Leu1 5 10290360DNAOryctolagus cuniculus 290atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60agatgtgcat
tcgaattgac ccagactcca gcctccgtgg aggcagctgt gggaggcaca
120gtcaccatca attgccaggc cagtcagaac atttatagat acttagcctg
gtatcagcag 180aaaccagggc agcctcccaa gttcctgatc tatctggcat
ctactctggc atctggggtc 240ccatcgcggt ttaaaggcag tggatctggg
acagagttca ctctcaccat cagcgacctg 300gagtgtgccg atgctgccac
ttactactgt caaagttatt atagtagtaa tagtgtcgct 360291384DNAOryctolagus
cuniculus 291atggagactg ggctgcgctg gcttctcctg gtcgctgtgc tcaaaggtgt
ccagtgtcag 60gagcagctgg tggagtccgg gggagacctg gtccagcctg agggatccct
gacactcacc 120tgcacagctt ctgagttaga cttcagtagc ggctactgga
tatgctgggt ccgccaggtt 180ccagggaagg ggctggagtg gatcggatgc
atttatactg gtagtagtgg tagcactttt 240tacgcgagtt gggcgaaagg
ccgattcacc atctccaaaa cctcgtcgac cacggtgact 300ctgcaaatga
ccagtctgac agccgcggac acggccacct atttctgtgc gagaggttat
360agtggctttg gttactttaa gttg 38429233DNAOryctolagus cuniculus
292caggccagtc agaacattta tagatactta gcc 3329321DNAOryctolagus
cuniculus 293ctggcatcta ctctggcatc t 2129430DNAOryctolagus
cuniculus 294caaagttatt atagtagtaa tagtgtcgct 3029518DNAOryctolagus
cuniculus 295agcggctact ggatatgc 1829654DNAOryctolagus cuniculus
296tgcatttata ctggtagtag tggtagcact ttttacgcga gttgggcgaa aggc
5429730DNAOryctolagus cuniculus 297ggttatagtg gctttggtta ctttaagttg
30298122PRTOryctolagus cuniculus 298Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys Ala
Tyr Asp Met Thr Gln Thr Pro Ala Ser 20 25 30Val Glu Val Ala Val Gly
Gly Thr Val Thr Ile Lys Cys Gln Ala Ser 35 40 45Glu Asp Ile Tyr Arg
Leu Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 50 55 60Pro Pro Lys Leu
Leu Ile Tyr Asp Ser Ser Asp Leu Ala Ser Gly Val65 70 75 80Pro Ser
Arg Phe Lys Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Ala 85 90 95Ile
Ser Gly Val Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Gln 100 105
110Ala Trp Ser Tyr Ser Asp Ile Asp Asn Ala 115
120299123PRTOryctolagus cuniculus 299Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Val
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Ala Ser Gly Phe Ser Leu Ser 35 40 45Ser Tyr Tyr Met
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile Gly
Ile Ile Thr Thr Ser Gly Asn Thr Phe Tyr Ala Ser Trp65 70 75 80Ala
Lys Gly Arg Leu Thr Ile Ser Arg Thr Ser Thr Thr Val Asp Leu 85
90
95Lys Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Ala
100 105 110Arg Thr Ser Asp Ile Phe Tyr Tyr Arg Asn Leu 115
12030011PRTOryctolagus cuniculus 300Gln Ala Ser Glu Asp Ile Tyr Arg
Leu Leu Ala1 5 103017PRTOryctolagus cuniculus 301Asp Ser Ser Asp
Leu Ala Ser1 530212PRTOryctolagus cuniculus 302Gln Gln Ala Trp Ser
Tyr Ser Asp Ile Asp Asn Ala1 5 103035PRTOryctolagus cuniculus
303Ser Tyr Tyr Met Ser1 530416PRTOryctolagus cuniculus 304Ile Ile
Thr Thr Ser Gly Asn Thr Phe Tyr Ala Ser Trp Ala Lys Gly1 5 10
1530510PRTOryctolagus cuniculus 305Thr Ser Asp Ile Phe Tyr Tyr Arg
Asn Leu1 5 10306366DNAOryctolagus cuniculus 306atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60agatgtgcct
atgatatgac ccagactcca gcctctgtgg aggtagctgt gggaggcaca
120gtcaccatca agtgccaggc cagtgaggac atttataggt tattggcctg
gtatcaacag 180aaaccagggc agcctcccaa gctcctgatc tatgattcat
ccgatctggc atctggggtc 240ccatcgcggt tcaaaggcag tggatctggg
acagagttca ctctcgccat cagcggtgtg 300cagtgtgacg atgctgccac
ttactactgt caacaggctt ggagttatag tgatattgat 360aatgct
366307369DNAOryctolagus cuniculus 307atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcggtggagg agtccggggg
tcgcctggtc acgccgggga cacccctgac actcacctgc 120acagcctctg
gattctccct cagtagctac tacatgagct gggtccgcca ggctccaggg
180aaggggctgg aatggatcgg aatcattact actagtggta atacatttta
cgcgagctgg 240gcgaaaggcc ggctcaccat ctccagaacc tcgaccacgg
tggatctgaa aatcaccagt 300ccgacaaccg aggacacggc cacctatttc
tgtgccagaa cttctgatat tttttattat 360cgtaacttg
36930833DNAOryctolagus cuniculus 308caggccagtg aggacattta
taggttattg gcc 3330921DNAOryctolagus cuniculus 309gattcatccg
atctggcatc t 2131036DNAOryctolagus cuniculus 310caacaggctt
ggagttatag tgatattgat aatgct 3631115DNAOryctolagus cuniculus
311agctactaca tgagc 1531248DNAOryctolagus cuniculus 312atcattacta
ctagtggtaa tacattttac gcgagctggg cgaaaggc 4831330DNAOryctolagus
cuniculus 313acttctgata ttttttatta tcgtaacttg
30314123PRTOryctolagus cuniculus 314Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Thr Phe Ala
Ala Val Leu Thr Gln Thr Ala Ser Pro 20 25 30Val Ser Ala Ala Val Gly
Ala Thr Val Thr Ile Asn Cys Gln Ser Ser 35 40 45Gln Ser Val Tyr Asn
Asp Met Asp Leu Ala Trp Phe Gln Gln Lys Pro 50 55 60Gly Gln Pro Pro
Lys Leu Leu Ile Tyr Ser Ala Ser Thr Leu Ala Ser65 70 75 80Gly Val
Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr 85 90 95Leu
Thr Ile Ser Gly Val Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys 100 105
110Leu Gly Ala Phe Asp Asp Asp Ala Asp Asn Thr 115
120315129PRTOryctolagus cuniculus 315Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Val
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Thr 35 40 45Arg His Ala Ile
Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile Gly
Cys Ile Trp Ser Gly Gly Ser Thr Tyr Tyr Ala Thr Trp65 70 75 80Ala
Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu 85 90
95Arg Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Ala
100 105 110Arg Val Ile Gly Asp Thr Ala Gly Tyr Ala Tyr Phe Thr Gly
Leu Asp 115 120 125Leu31613PRTOryctolagus cuniculus 316Gln Ser Ser
Gln Ser Val Tyr Asn Asp Met Asp Leu Ala1 5 103177PRTOryctolagus
cuniculus 317Ser Ala Ser Thr Leu Ala Ser1 531811PRTOryctolagus
cuniculus 318Leu Gly Ala Phe Asp Asp Asp Ala Asp Asn Thr1 5
103195PRTOryctolagus cuniculus 319Arg His Ala Ile Thr1
532016PRTOryctolagus cuniculus 320Cys Ile Trp Ser Gly Gly Ser Thr
Tyr Tyr Ala Thr Trp Ala Lys Gly1 5 10 1532116PRTOryctolagus
cuniculus 321Val Ile Gly Asp Thr Ala Gly Tyr Ala Tyr Phe Thr Gly
Leu Asp Leu1 5 10 15322369DNAOryctolagus cuniculus 322atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60acgtttgcag
ccgtgctgac ccagactgca tcacccgtgt ctgccgctgt gggagccaca
120gtcaccatca actgccagtc cagtcagagt gtttataatg acatggactt
agcctggttt 180cagcagaaac cagggcagcc tcccaagctc ctgatctatt
ctgcatccac tctggcatct 240ggggtcccat cgcggttcag cggcagtgga
tctgggacag agttcactct caccatcagc 300ggcgtgcagt gtgacgatgc
tgccacttac tactgtctag gcgcttttga tgatgatgct 360gataatact
369323387DNAOryctolagus cuniculus 323atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcggtggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acagtctctg
gattctccct cactaggcat gcaataacct gggtccgcca ggctccaggg
180aaggggctgg aatggatcgg atgcatttgg agtggtggta gcacatacta
cgcgacctgg 240gcgaaaggcc gattcaccat ctccaaaacc tcgaccacgg
tggatctcag aatcaccagt 300ccgacaaccg aggacacggc cacctacttc
tgtgccagag tcattggcga tactgctggt 360tatgcttatt ttacggggct tgacttg
38732439DNAOryctolagus cuniculus 324cagtccagtc agagtgttta
taatgacatg gacttagcc 3932521DNAOryctolagus cuniculus 325tctgcatcca
ctctggcatc t 2132633DNAOryctolagus cuniculus 326ctaggcgctt
ttgatgatga tgctgataat act 3332715DNAOryctolagus cuniculus
327aggcatgcaa taacc 1532848DNAOryctolagus cuniculus 328tgcatttgga
gtggtggtag cacatactac gcgacctggg cgaaaggc 4832948DNAOryctolagus
cuniculus 329gtcattggcg atactgctgg ttatgcttat tttacggggc ttgacttg
48330121PRTOryctolagus cuniculus 330Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys Ala
Tyr Asp Met Thr Gln Thr Pro Ala Ser 20 25 30Val Glu Val Ala Val Gly
Gly Thr Val Thr Ile Lys Cys Gln Ala Ser 35 40 45Gln Ser Val Tyr Asn
Trp Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln 50 55 60Pro Pro Lys Leu
Leu Ile Tyr Thr Ala Ser Ser Leu Ala Ser Gly Val65 70 75 80Pro Ser
Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr 85 90 95Ile
Ser Gly Val Glu Cys Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Gln 100 105
110Gly Tyr Thr Ser Asp Val Asp Asn Val 115 120331130PRTOryctolagus
cuniculus 331Met Glu Thr Gly Leu Arg Trp Leu Leu Leu Val Ala Val
Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Leu Glu Glu Ala Gly Gly Arg
Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr Leu Thr Cys Thr Val Ser
Gly Ile Asp Leu Ser 35 40 45Ser Tyr Ala Met Gly Trp Val Arg Gln Ala
Pro Gly Lys Gly Leu Glu 50 55 60Tyr Ile Gly Ile Ile Ser Ser Ser Gly
Ser Thr Tyr Tyr Ala Thr Trp65 70 75 80Ala Lys Gly Arg Phe Thr Ile
Ser Gln Ala Ser Ser Thr Thr Val Asp 85 90 95Leu Lys Ile Thr Ser Pro
Thr Thr Glu Asp Ser Ala Thr Tyr Phe Cys 100 105 110Ala Arg Gly Gly
Ala Gly Ser Gly Gly Val Trp Leu Leu Asp Gly Phe 115 120 125Asp Pro
13033211PRTOryctolagus cuniculus 332Gln Ala Ser Gln Ser Val Tyr Asn
Trp Leu Ser1 5 103337PRTOryctolagus cuniculus 333Thr Ala Ser Ser
Leu Ala Ser1 533411PRTOryctolagus cuniculus 334Gln Gln Gly Tyr Thr
Ser Asp Val Asp Asn Val1 5 103355PRTOryctolagus cuniculus 335Ser
Tyr Ala Met Gly1 533616PRTOryctolagus cuniculus 336Ile Ile Ser Ser
Ser Gly Ser Thr Tyr Tyr Ala Thr Trp Ala Lys Gly1 5 10
1533716PRTOryctolagus cuniculus 337Gly Gly Ala Gly Ser Gly Gly Val
Trp Leu Leu Asp Gly Phe Asp Pro1 5 10 15338363DNAOryctolagus
cuniculus 338atggacacga gggcccccac tcagctgctg gggctcctgc tgctctggct
cccaggtgcc 60agatgtgcct atgatatgac ccagactcca gcctctgtgg aggtagctgt
gggaggcaca 120gtcaccatca agtgccaggc cagtcagagt gtttataatt
ggttatcctg gtatcagcag 180aaaccagggc agcctcccaa gctcctgatc
tatactgcat ccagtctggc atctggggtc 240ccatcgcggt tcagtggcag
tggatctggg acagagttca ctctcaccat cagcggcgtg 300gagtgtgccg
atgctgccac ttactactgt caacagggtt atactagtga tgttgataat 360gtt
363339390DNAOryctolagus cuniculus 339atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcgctggagg aggccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acagtctctg
gaatcgacct cagtagctat gcaatgggct gggtccgcca ggctccaggg
180aaggggctgg aatacatcgg aatcattagt agtagtggta gcacatacta
cgcgacctgg 240gcgaaaggcc gattcaccat ctcacaagcc tcgtcgacca
cggtggatct gaaaattacc 300agtccgacaa ccgaggactc ggccacatat
ttctgtgcca gagggggtgc tggtagtggt 360ggtgtttggc tgcttgatgg
ttttgatccc 39034033DNAOryctolagus cuniculus 340caggccagtc
agagtgttta taattggtta tcc 3334121DNAOryctolagus cuniculus
341actgcatcca gtctggcatc t 2134233DNAOryctolagus cuniculus
342caacagggtt atactagtga tgttgataat gtt 3334315DNAOryctolagus
cuniculus 343agctatgcaa tgggc 1534448DNAOryctolagus cuniculus
344atcattagta gtagtggtag cacatactac gcgacctggg cgaaaggc
4834548DNAOryctolagus cuniculus 345gggggtgctg gtagtggtgg tgtttggctg
cttgatggtt ttgatccc 48346123PRTOryctolagus cuniculus 346Met Asp Thr
Arg Ala Pro Thr Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro
Gly Ala Lys Cys Ala Asp Val Val Met Thr Gln Thr Pro Ala 20 25 30Ser
Val Ser Ala Ala Val Gly Gly Thr Val Thr Ile Asn Cys Gln Ala 35 40
45Ser Glu Asn Ile Tyr Asn Trp Leu Ala Trp Tyr Gln Gln Lys Pro Gly
50 55 60Gln Pro Pro Lys Leu Leu Ile Tyr Thr Val Gly Asp Leu Ala Ser
Gly65 70 75 80Val Ser Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Glu
Phe Thr Leu 85 90 95Thr Ile Ser Asp Leu Glu Cys Ala Asp Ala Ala Thr
Tyr Tyr Cys Gln 100 105 110Gln Gly Tyr Ser Ser Ser Tyr Val Asp Asn
Val 115 120347130PRTOryctolagus cuniculus 347Met Glu Thr Gly Leu
Arg Trp Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln
Glu Gln Leu Lys Glu Ser Gly Gly Arg Leu Val Thr 20 25 30Pro Gly Thr
Pro Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45Asn Asp
Tyr Ala Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Gly Leu 50 55 60Glu
Trp Ile Gly Tyr Ile Arg Ser Ser Gly Thr Thr Ala Tyr Ala Thr65 70 75
80Trp Ala Lys Gly Arg Phe Thr Ile Ser Ala Thr Ser Thr Thr Val Asp
85 90 95Leu Lys Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe
Cys 100 105 110Ala Arg Gly Gly Ala Gly Ser Ser Gly Val Trp Ile Leu
Asp Gly Phe 115 120 125Ala Pro 13034811PRTOryctolagus cuniculus
348Gln Ala Ser Glu Asn Ile Tyr Asn Trp Leu Ala1 5
103497PRTOryctolagus cuniculus 349Thr Val Gly Asp Leu Ala Ser1
535012PRTOryctolagus cuniculus 350Gln Gln Gly Tyr Ser Ser Ser Tyr
Val Asp Asn Val1 5 103515PRTOryctolagus cuniculus 351Asp Tyr Ala
Val Gly1 535216PRTOryctolagus cuniculus 352Tyr Ile Arg Ser Ser Gly
Thr Thr Ala Tyr Ala Thr Trp Ala Lys Gly1 5 10 1535316PRTOryctolagus
cuniculus 353Gly Gly Ala Gly Ser Ser Gly Val Trp Ile Leu Asp Gly
Phe Ala Pro1 5 10 15354369DNAOryctolagus cuniculus 354atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60aaatgtgccg
atgttgtgat gacccagact ccagcctccg tgtctgcagc tgtgggaggc
120acagtcacca tcaattgcca ggccagtgag aacatttata attggttagc
ctggtatcag 180cagaaaccag ggcagcctcc caagctcctg atctatactg
taggcgatct ggcatctggg 240gtctcatcgc ggttcaaagg cagtggatct
gggacagagt tcactctcac catcagcgac 300ctggagtgtg ccgatgctgc
cacttactat tgtcaacagg gttatagtag tagttatgtt 360gataatgtt
369355390DNAOryctolagus cuniculus 355atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60gagcagctga aggagtccgg
gggtcgcctg gtcacgcctg ggacacccct gacactcacc 120tgcacagtct
ctggattctc cctcaatgac tatgcagtgg gctggttccg ccaggctcca
180gggaaggggc tggaatggat cggatacatt cgtagtagtg gtaccacagc
ctacgcgacc 240tgggcgaaag gccgattcac catctccgct acctcgacca
cggtggatct gaaaatcacc 300agtccgacaa ccgaggacac ggccacctat
ttctgtgcca gagggggtgc tggtagtagt 360ggtgtgtgga tccttgatgg
ttttgctccc 39035633DNAOryctolagus cuniculus 356caggccagtg
agaacattta taattggtta gcc 3335721DNAOryctolagus cuniculus
357actgtaggcg atctggcatc t 2135836DNAOryctolagus cuniculus
358caacagggtt atagtagtag ttatgttgat aatgtt 3635915DNAOryctolagus
cuniculus 359gactatgcag tgggc 1536048DNAOryctolagus cuniculus
360tacattcgta gtagtggtac cacagcctac gcgacctggg cgaaaggc
4836148DNAOryctolagus cuniculus 361gggggtgctg gtagtagtgg tgtgtggatc
cttgatggtt ttgctccc 48362121PRTOryctolagus cuniculus 362Met Asp Thr
Arg Ala Pro Thr Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro
Gly Ala Thr Phe Ala Gln Val Leu Thr Gln Thr Pro Ser Ser 20 25 30Val
Ser Ala Ala Val Gly Gly Thr Val Thr Ile Asn Cys Gln Ala Ser 35 40
45Gln Ser Val Tyr Gln Asn Asn Tyr Leu Ser Trp Phe Gln Gln Lys Pro
50 55 60Gly Gln Pro Pro Lys Leu Leu Ile Tyr Gly Ala Ala Thr Leu Ala
Ser65 70 75 80Gly Val Pro Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr
Gln Phe Thr 85 90 95Leu Thr Ile Ser Asp Leu Glu Cys Asp Asp Ala Ala
Thr Tyr Tyr Cys 100 105 110Ala Gly Ala Tyr Arg Asp Val Asp Ser 115
120363130PRTOryctolagus cuniculus 363Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Leu
Glu Glu Ser Gly Gly Asp Leu Val Lys Pro 20 25 30Gly Ala Ser Leu Thr
Leu Thr Cys Thr Ala Ser Gly Phe Ser Phe Thr 35 40 45Ser Thr Tyr Tyr
Ile Tyr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 50 55 60Glu Trp Ile
Ala Cys Ile Asp Ala Gly Ser Ser Gly Ser Thr Tyr Tyr65 70 75 80Ala
Thr Trp Val Asn Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr 85 90
95Thr Val Thr Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr
100 105 110Tyr Phe Cys Ala Lys Trp Asp Tyr Gly Gly Asn Val Gly Trp
Gly Tyr 115 120 125Asp Leu 13036413PRTOryctolagus cuniculus 364Gln
Ala Ser Gln Ser Val Tyr Gln Asn Asn Tyr Leu Ser1 5
103657PRTOryctolagus cuniculus 365Gly Ala Ala Thr Leu Ala Ser1
53669PRTOryctolagus cuniculus 366Ala Gly Ala Tyr Arg Asp Val Asp
Ser1 53676PRTOryctolagus cuniculus 367Ser Thr Tyr Tyr Ile Tyr1
536818PRTOryctolagus cuniculus 368Cys Ile Asp Ala Gly Ser Ser Gly
Ser Thr Tyr Tyr Ala Thr Trp Val1 5 10 15Asn Gly36913PRTOryctolagus
cuniculus 369Trp Asp Tyr Gly Gly Asn Val Gly Trp Gly Tyr Asp
Leu1
5 10370363DNAOryctolagus cuniculus 370atggacacga gggcccccac
tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60acatttgctc aagtgctgac
ccagactcca tcctccgtgt ctgcagctgt gggaggcaca 120gtcaccatca
attgccaggc cagtcagagt gtttatcaga acaactactt atcctggttt
180cagcagaaac cagggcagcc tcccaagctc ctgatctatg gtgcggccac
tctggcatct 240ggggtcccat cgcggttcaa aggcagtgga tctgggacac
agttcactct caccatcagc 300gacctggagt gtgacgatgc tgccacttac
tactgtgcag gcgcttatag ggatgtggat 360tct 363371390DNAOryctolagus
cuniculus 371atggagactg ggctgcgctg gcttctcctg gtcgctgtgc tcaaaggtgt
ccagtgtcag 60tcgttggagg agtccggggg agacctggtc aagcctgggg catccctgac
actcacctgc 120acagcctctg gattctcctt tactagtacc tactacatct
actgggtccg ccaggctcca 180gggaaggggc tggagtggat cgcatgtatt
gatgctggta gtagtggtag cacttactac 240gcgacctggg tgaatggccg
attcaccatc tccaaaacct cgtcgaccac ggtgactctg 300caaatgacca
gtctgacagc cgcggacacg gccacctatt tctgtgcgaa atgggattat
360ggtggtaatg ttggttgggg ttatgacttg 39037239DNAOryctolagus
cuniculus 372caggccagtc agagtgttta tcagaacaac tacttatcc
3937321DNAOryctolagus cuniculus 373ggtgcggcca ctctggcatc t
2137427DNAOryctolagus cuniculus 374gcaggcgctt atagggatgt ggattct
2737518DNAOryctolagus cuniculus 375agtacctact acatctac
1837654DNAOryctolagus cuniculus 376tgtattgatg ctggtagtag tggtagcact
tactacgcga cctgggtgaa tggc 5437739DNAOryctolagus cuniculus
377tgggattatg gtggtaatgt tggttggggt tatgacttg
39378120PRTOryctolagus cuniculus 378Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys Ala
Phe Glu Leu Thr Gln Thr Pro Ser Ser 20 25 30Val Glu Ala Ala Val Gly
Gly Thr Val Thr Ile Lys Cys Gln Ala Ser 35 40 45Gln Ser Ile Ser Ser
Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 50 55 60Pro Pro Lys Phe
Leu Ile Tyr Arg Ala Ser Thr Leu Ala Ser Gly Val65 70 75 80Pro Ser
Arg Phe Lys Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr 85 90 95Ile
Ser Asp Leu Glu Cys Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Ser 100 105
110Tyr Tyr Asp Ser Val Ser Asn Pro 115 120379127PRTOryctolagus
cuniculus 379Met Glu Thr Gly Leu Arg Trp Leu Leu Leu Val Ala Val
Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Leu Glu Glu Ser Gly Gly Asp
Leu Val Lys Pro 20 25 30Glu Gly Ser Leu Thr Leu Thr Cys Lys Ala Ser
Gly Leu Asp Leu Gly 35 40 45Thr Tyr Trp Phe Met Cys Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu 50 55 60Glu Trp Ile Ala Cys Ile Tyr Thr Gly
Ser Ser Gly Ser Thr Phe Tyr65 70 75 80Ala Ser Trp Val Asn Gly Arg
Phe Thr Ile Ser Lys Thr Ser Ser Thr 85 90 95Thr Val Thr Leu Gln Met
Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr 100 105 110Tyr Phe Cys Ala
Arg Gly Tyr Ser Gly Tyr Gly Tyr Phe Lys Leu 115 120
12538011PRTOryctolagus cuniculus 380Gln Ala Ser Gln Ser Ile Ser Ser
Tyr Leu Ala1 5 103817PRTOryctolagus cuniculus 381Arg Ala Ser Thr
Leu Ala Ser1 538210PRTOryctolagus cuniculus 382Gln Ser Tyr Tyr Asp
Ser Val Ser Asn Pro1 5 103836PRTOryctolagus cuniculus 383Thr Tyr
Trp Phe Met Cys1 538418PRTOryctolagus cuniculus 384Cys Ile Tyr Thr
Gly Ser Ser Gly Ser Thr Phe Tyr Ala Ser Trp Val1 5 10 15Asn
Gly38510PRTOryctolagus cuniculus 385Gly Tyr Ser Gly Tyr Gly Tyr Phe
Lys Leu1 5 10386360DNAOryctolagus cuniculus 386atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60agatgtgcat
tcgaattgac ccagactcca tcctccgtgg aggcagctgt gggaggcaca
120gtcaccatca agtgccaggc cagtcagagc attagtagtt acttagcctg
gtatcagcag 180aaaccagggc agcctcccaa gttcctgatc tacagggcgt
ccactctggc atctggggtc 240ccatcgcgat tcaaaggcag tggatctggg
acagagttca ctctcaccat cagcgacctg 300gagtgtgccg atgctgccac
ttactactgt caaagctatt atgatagtgt ttcaaatcct 360387381DNAOryctolagus
cuniculus 387atggagactg ggctgcgctg gcttctcctg gtcgctgtgc tcaaaggtgt
ccagtgtcag 60tcgttggagg agtccggggg agacctggtc aagcctgagg gatccctgac
actcacctgc 120aaagcctctg gactcgacct cggtacctac tggttcatgt
gctgggtccg ccaggctcca 180gggaaggggc tggagtggat cgcttgtatt
tatactggta gtagtggttc cactttctac 240gcgagctggg tgaatggccg
attcaccatc tccaaaacct cgtcgaccac ggtgactctg 300caaatgacca
gtctgacagc cgcggacacg gccacttatt tttgtgcgag aggttatagt
360ggttatggtt attttaagtt g 38138833DNAOryctolagus cuniculus
388caggccagtc agagcattag tagttactta gcc 3338921DNAOryctolagus
cuniculus 389agggcgtcca ctctggcatc t 2139030DNAOryctolagus
cuniculus 390caaagctatt atgatagtgt ttcaaatcct 3039118DNAOryctolagus
cuniculus 391acctactggt tcatgtgc 1839254DNAOryctolagus cuniculus
392tgtatttata ctggtagtag tggttccact ttctacgcga gctgggtgaa tggc
5439330DNAOryctolagus cuniculus 393ggttatagtg gttatggtta ttttaagttg
30394124PRTOryctolagus cuniculus 394Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Val Thr Phe Ala
Ile Glu Met Thr Gln Ser Pro Phe Ser 20 25 30Val Ser Ala Ala Val Gly
Gly Thr Val Ser Ile Ser Cys Gln Ala Ser 35 40 45Gln Ser Val Tyr Lys
Asn Asn Gln Leu Ser Trp Tyr Gln Gln Lys Ser 50 55 60Gly Gln Pro Pro
Lys Leu Leu Ile Tyr Gly Ala Ser Ala Leu Ala Ser65 70 75 80Gly Val
Pro Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Glu Phe Thr 85 90 95Leu
Thr Ile Ser Asp Val Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys 100 105
110Ala Gly Ala Ile Thr Gly Ser Ile Asp Thr Asp Gly 115
120395130PRTOryctolagus cuniculus 395Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Leu
Glu Glu Ser Gly Gly Asp Leu Val Lys Pro 20 25 30Gly Ala Ser Leu Thr
Leu Thr Cys Thr Thr Ser Gly Phe Ser Phe Ser 35 40 45Ser Ser Tyr Phe
Ile Cys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 50 55 60Glu Trp Ile
Ala Cys Ile Tyr Gly Gly Asp Gly Ser Thr Tyr Tyr Ala65 70 75 80Ser
Trp Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Ser Thr Thr 85 90
95Val Thr Leu Gln Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr
100 105 110Phe Cys Ala Arg Glu Trp Ala Tyr Ser Gln Gly Tyr Phe Gly
Ala Phe 115 120 125Asp Leu 13039613PRTOryctolagus cuniculus 396Gln
Ala Ser Gln Ser Val Tyr Lys Asn Asn Gln Leu Ser1 5
103977PRTOryctolagus cuniculus 397Gly Ala Ser Ala Leu Ala Ser1
539812PRTOryctolagus cuniculus 398Ala Gly Ala Ile Thr Gly Ser Ile
Asp Thr Asp Gly1 5 103996PRTOryctolagus cuniculus 399Ser Ser Tyr
Phe Ile Cys1 540017PRTOryctolagus cuniculus 400Cys Ile Tyr Gly Gly
Asp Gly Ser Thr Tyr Tyr Ala Ser Trp Ala Lys1 5 10
15Gly40114PRTOryctolagus cuniculus 401Glu Trp Ala Tyr Ser Gln Gly
Tyr Phe Gly Ala Phe Asp Leu1 5 10402372DNAOryctolagus cuniculus
402atggacacga gggcccccac tcagctgctg gggctcctgc tgctctggct
cccaggtgtc 60acatttgcca tcgaaatgac ccagagtcca ttctccgtgt ctgcagctgt
gggaggcaca 120gtcagcatca gttgccaggc cagtcagagt gtttataaga
acaaccaatt atcctggtat 180cagcagaaat cagggcagcc tcccaagctc
ctgatctatg gtgcatcggc tctggcatct 240ggggtcccat cgcggttcaa
aggcagtgga tctgggacag agttcactct caccatcagc 300gacgtgcagt
gtgacgatgc tgccacttac tactgtgcag gcgctattac tggtagtatt
360gatacggatg gt 372403390DNAOryctolagus cuniculus 403atggagactg
ggctgcgctg gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcgttggagg
agtccggggg agacctggtc aagcctgggg catccctgac actcacctgc
120acaacttctg gattctcctt cagtagcagc tacttcattt gctgggtccg
ccaggctcca 180gggaaggggc tggagtggat cgcatgcatt tatggtggtg
atggcagcac atactacgcg 240agctgggcga aaggccgatt caccatctcc
aaaacctcgt cgaccacggt gacgctgcaa 300atgaccagtc tgacagccgc
ggacacggcc acctatttct gtgcgagaga atgggcatat 360agtcaaggtt
attttggtgc ttttgatctc 39040439DNAOryctolagus cuniculus
404caggccagtc agagtgttta taagaacaac caattatcc 3940521DNAOryctolagus
cuniculus 405ggtgcatcgg ctctggcatc t 2140636DNAOryctolagus
cuniculus 406gcaggcgcta ttactggtag tattgatacg gatggt
3640718DNAOryctolagus cuniculus 407agcagctact tcatttgc
1840851DNAOryctolagus cuniculus 408tgcatttatg gtggtgatgg cagcacatac
tacgcgagct gggcgaaagg c 5140942DNAOryctolagus cuniculus
409gaatgggcat atagtcaagg ttattttggt gcttttgatc tc
42410124PRTOryctolagus cuniculus 410Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys Asp
Val Val Met Thr Gln Thr Pro Ala Ser 20 25 30Val Glu Ala Ala Val Gly
Gly Thr Val Thr Ile Lys Cys Gln Ala Ser 35 40 45Glu Asp Ile Ser Ser
Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 50 55 60Pro Pro Lys Leu
Leu Ile Tyr Ala Ala Ser Asn Leu Glu Ser Gly Val65 70 75 80Ser Ser
Arg Phe Lys Gly Ser Gly Ser Gly Thr Glu Tyr Thr Leu Thr 85 90 95Ile
Ser Asp Leu Glu Cys Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Cys 100 105
110Thr Tyr Gly Thr Ile Ser Ile Ser Asp Gly Asn Ala 115
120411124PRTOryctolagus cuniculus 411Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Val
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser 35 40 45Ser Tyr Phe Met
Thr Trp Val Arg Gln Ala Pro Gly Glu Gly Leu Glu 50 55 60Tyr Ile Gly
Phe Ile Asn Pro Gly Gly Ser Ala Tyr Tyr Ala Ser Trp65 70 75 80Val
Lys Gly Arg Phe Thr Ile Ser Lys Ser Ser Thr Thr Val Asp Leu 85 90
95Lys Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Ala
100 105 110Arg Val Leu Ile Val Ser Tyr Gly Ala Phe Thr Ile 115
12041211PRTOryctolagus cuniculus 412Gln Ala Ser Glu Asp Ile Ser Ser
Tyr Leu Ala1 5 104137PRTOryctolagus cuniculus 413Ala Ala Ser Asn
Leu Glu Ser1 541414PRTOryctolagus cuniculus 414Gln Cys Thr Tyr Gly
Thr Ile Ser Ile Ser Asp Gly Asn Ala1 5 104155PRTOryctolagus
cuniculus 415Ser Tyr Phe Met Thr1 541616PRTOryctolagus cuniculus
416Phe Ile Asn Pro Gly Gly Ser Ala Tyr Tyr Ala Ser Trp Val Lys Gly1
5 10 1541711PRTOryctolagus cuniculus 417Val Leu Ile Val Ser Tyr Gly
Ala Phe Thr Ile1 5 10418372DNAOryctolagus cuniculus 418atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60agatgtgatg
ttgtgatgac ccagactcca gcctccgtgg aggcagctgt gggaggcaca
120gtcaccatca agtgccaggc cagtgaggat attagtagct acttagcctg
gtatcagcag 180aaaccagggc agcctcccaa gctcctgatc tatgctgcat
ccaatctgga atctggggtc 240tcatcgcgat tcaaaggcag tggatctggg
acagagtaca ctctcaccat cagcgacctg 300gagtgtgccg atgctgccac
ctattactgt caatgtactt atggtactat ttctattagt 360gatggtaatg ct
372419372DNAOryctolagus cuniculus 419atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccaatgtcag 60tcggtggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acagtctctg
gattctccct cagtagctac ttcatgacct gggtccgcca ggctccaggg
180gaggggctgg aatacatcgg attcattaat cctggtggta gcgcttacta
cgcgagctgg 240gtgaaaggcc gattcaccat ctccaagtcc tcgaccacgg
tagatctgaa aatcaccagt 300ccgacaaccg aggacacggc cacctatttc
tgtgccaggg ttctgattgt ttcttatgga 360gcctttacca tc
37242033DNAOryctolagus cuniculus 420caggccagtg aggatattag
tagctactta gcc 3342121DNAOryctolagus cuniculus 421gctgcatcca
atctggaatc t 2142242DNAOryctolagus cuniculus 422caatgtactt
atggtactat ttctattagt gatggtaatg ct 4242315DNAOryctolagus cuniculus
423agctacttca tgacc 1542448DNAOryctolagus cuniculus 424ttcattaatc
ctggtggtag cgcttactac gcgagctggg tgaaaggc 4842533DNAOryctolagus
cuniculus 425gttctgattg tttcttatgg agcctttacc atc
33426124PRTOryctolagus cuniculus 426Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys Asp
Val Val Met Thr Gln Thr Pro Ala Ser 20 25 30Val Ser Ala Ala Val Gly
Gly Thr Val Thr Ile Lys Cys Gln Ala Ser 35 40 45Glu Asp Ile Glu Ser
Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 50 55 60Pro Pro Lys Leu
Leu Ile Tyr Gly Ala Ser Asn Leu Glu Ser Gly Val65 70 75 80Ser Ser
Arg Phe Lys Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr 85 90 95Ile
Ser Asp Leu Glu Cys Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Cys 100 105
110Thr Tyr Gly Ile Ile Ser Ile Ser Asp Gly Asn Ala 115
120427124PRTOryctolagus cuniculus 427Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Val
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser 35 40 45Ser Tyr Phe Met
Thr Trp Val Arg Gln Ala Pro Gly Glu Gly Leu Glu 50 55 60Tyr Ile Gly
Phe Met Asn Thr Gly Asp Asn Ala Tyr Tyr Ala Ser Trp65 70 75 80Ala
Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu 85 90
95Lys Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Ala
100 105 110Arg Val Leu Val Val Ala Tyr Gly Ala Phe Asn Ile 115
12042811PRTOryctolagus cuniculus 428Gln Ala Ser Glu Asp Ile Glu Ser
Tyr Leu Ala1 5 104297PRTOryctolagus cuniculus 429Gly Ala Ser Asn
Leu Glu Ser1 543014PRTOryctolagus cuniculus 430Gln Cys Thr Tyr Gly
Ile Ile Ser Ile Ser Asp Gly Asn Ala1 5 104315PRTOryctolagus
cuniculus 431Ser Tyr Phe Met Thr1 543216PRTOryctolagus cuniculus
432Phe Met Asn Thr Gly Asp Asn Ala Tyr Tyr Ala Ser Trp Ala Lys Gly1
5 10 1543311PRTOryctolagus cuniculus 433Val Leu Val Val Ala Tyr Gly
Ala Phe Asn Ile1 5 10434372DNAOryctolagus cuniculus 434atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60agatgtgatg
ttgtgatgac ccagactcca gcctccgtgt ctgcagctgt gggaggcaca
120gtcaccatca agtgccaggc cagtgaggac attgaaagct atctagcctg
gtatcagcag 180aaaccagggc agcctcccaa gctcctgatc tatggtgcat
ccaatctgga atctggggtc 240tcatcgcggt tcaaaggcag tggatctggg
acagagttca ctctcaccat cagcgacctg 300gagtgtgccg atgctgccac
ttactattgt caatgcactt atggtattat tagtattagt 360gatggtaatg ct
372435372DNAOryctolagus cuniculus 435atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcggtggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acagtgtctg
gattctccct cagtagctac ttcatgacct gggtccgcca ggctccaggg
180gaggggctgg aatacatcgg attcatgaat actggtgata acgcatacta
cgcgagctgg 240gcgaaaggcc gattcaccat ctccaaaacc tcgaccacgg
tggatctgaa aatcaccagt 300ccgacaaccg aggacacggc cacctatttc
tgtgccaggg ttcttgttgt tgcttatgga 360gcctttaaca tc
37243633DNAOryctolagus cuniculus 436caggccagtg aggacattga
aagctatcta gcc 3343721DNAOryctolagus cuniculus 437ggtgcatcca
atctggaatc t 2143842DNAOryctolagus cuniculus 438caatgcactt
atggtattat tagtattagt gatggtaatg ct 4243915DNAOryctolagus cuniculus
439agctacttca tgacc 1544048DNAOryctolagus cuniculus 440ttcatgaata
ctggtgataa cgcatactac gcgagctggg cgaaaggc 4844133DNAOryctolagus
cuniculus 441gttcttgttg ttgcttatgg agcctttaac atc
33442124PRTOryctolagus cuniculus 442Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Thr Phe Ala
Ala Val Leu Thr Gln Thr Pro Ser Pro 20 25 30Val Ser Glu Pro Val Gly
Gly Thr Val Ser Ile Ser Cys Gln Ser Ser 35 40 45Lys Ser Val Met Asn
Asn Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro 50 55 60Gly Gln Pro Pro
Lys Leu Leu Ile Tyr Gly Ala Ser Asn Leu Ala Ser65 70 75 80Gly Val
Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Gln Phe Thr 85 90 95Leu
Thr Ile Ser Asp Val Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys 100 105
110Gln Gly Gly Tyr Thr Gly Tyr Ser Asp His Gly Thr 115
120443127PRTOryctolagus cuniculus 443Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Val
Glu Glu Ser Gly Gly Arg Leu Val Lys Pro 20 25 30Asp Glu Thr Leu Thr
Leu Thr Cys Thr Val Ser Gly Ile Asp Leu Ser 35 40 45Ser Tyr Pro Met
Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile Gly
Phe Ile Asn Thr Gly Gly Thr Ile Val Tyr Ala Ser Trp65 70 75 80Ala
Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu 85 90
95Lys Met Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Ala
100 105 110Arg Gly Ser Tyr Val Ser Ser Gly Tyr Ala Tyr Tyr Phe Asn
Val 115 120 12544413PRTOryctolagus cuniculus 444Gln Ser Ser Lys Ser
Val Met Asn Asn Asn Tyr Leu Ala1 5 104457PRTOryctolagus cuniculus
445Gly Ala Ser Asn Leu Ala Ser1 544612PRTOryctolagus cuniculus
446Gln Gly Gly Tyr Thr Gly Tyr Ser Asp His Gly Thr1 5
104475PRTOryctolagus cuniculus 447Ser Tyr Pro Met Asn1
544816PRTOryctolagus cuniculus 448Phe Ile Asn Thr Gly Gly Thr Ile
Val Tyr Ala Ser Trp Ala Lys Gly1 5 10 1544914PRTOryctolagus
cuniculus 449Gly Ser Tyr Val Ser Ser Gly Tyr Ala Tyr Tyr Phe Asn
Val1 5 10450372DNAOryctolagus cuniculus 450atggacacga gggcccccac
tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60acatttgccg ccgtgctgac
ccagactcca tctcccgtgt ctgaacctgt gggaggcaca 120gtcagcatca
gttgccagtc cagtaagagt gttatgaata acaactactt agcctggtat
180cagcagaaac cagggcagcc tcccaagctc ctgatctatg gtgcatccaa
tctggcatct 240ggggtcccat cacggttcag cggcagtgga tctgggacac
agttcactct caccatcagc 300gacgtgcagt gtgacgatgc tgccacttac
tactgtcaag gcggttatac tggttatagt 360gatcatggga ct
372451381DNAOryctolagus cuniculus 451atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcggtggagg agtccggggg
tcgcctggtc aagcctgacg aaaccctgac actcacctgc 120acagtctctg
gaatcgacct cagtagctat ccaatgaact gggtccgcca ggctccaggg
180aaggggctgg aatggatcgg attcattaat actggtggta ccatagtcta
cgcgagctgg 240gcaaaaggcc gattcaccat ctccaaaacc tcgaccacgg
tggatctgaa aatgaccagt 300ccgacaaccg aggacacggc cacctatttc
tgtgccagag gcagttatgt ttcatctggt 360tatgcctact attttaatgt c
38145239DNAOryctolagus cuniculus 452cagtccagta agagtgttat
gaataacaac tacttagcc 3945321DNAOryctolagus cuniculus 453ggtgcatcca
atctggcatc t 2145436DNAOryctolagus cuniculus 454caaggcggtt
atactggtta tagtgatcat gggact 3645515DNAOryctolagus cuniculus
455agctatccaa tgaac 1545648DNAOryctolagus cuniculus 456ttcattaata
ctggtggtac catagtctac gcgagctggg caaaaggc 4845742DNAOryctolagus
cuniculus 457ggcagttatg tttcatctgg ttatgcctac tattttaatg tc
42458121PRTOryctolagus cuniculus 458Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Thr Phe Ala
Ala Val Leu Thr Gln Thr Pro Ser Pro 20 25 30Val Ser Ala Ala Val Gly
Gly Thr Val Ser Ile Ser Cys Gln Ser Ser 35 40 45Gln Ser Val Tyr Asn
Asn Asn Trp Leu Ser Trp Phe Gln Gln Lys Pro 50 55 60Gly Gln Pro Pro
Lys Leu Leu Ile Tyr Lys Ala Ser Thr Leu Ala Ser65 70 75 80Gly Val
Pro Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Gln Phe Thr 85 90 95Leu
Thr Ile Ser Asp Val Gln Cys Asp Asp Val Ala Thr Tyr Tyr Cys 100 105
110Ala Gly Gly Tyr Leu Asp Ser Val Ile 115 120459126PRTOryctolagus
cuniculus 459Met Glu Thr Gly Leu Arg Trp Leu Leu Leu Val Ala Val
Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Val Glu Glu Ser Gly Gly Arg
Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr Leu Thr Cys Thr Val Ser
Gly Phe Ser Leu Ser 35 40 45Thr Tyr Ser Ile Asn Trp Val Arg Gln Ala
Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile Gly Ile Ile Ala Asn Ser Gly
Thr Thr Phe Tyr Ala Asn Trp65 70 75 80Ala Lys Gly Arg Phe Thr Val
Ser Lys Thr Ser Thr Thr Val Asp Leu 85 90 95Lys Ile Thr Ser Pro Thr
Thr Glu Asp Thr Ala Thr Tyr Phe Cys Ala 100 105 110Arg Glu Ser Gly
Met Tyr Asn Glu Tyr Gly Lys Phe Asn Ile 115 120
12546013PRTOryctolagus cuniculus 460Gln Ser Ser Gln Ser Val Tyr Asn
Asn Asn Trp Leu Ser1 5 104617PRTOryctolagus cuniculus 461Lys Ala
Ser Thr Leu Ala Ser1 54629PRTOryctolagus cuniculus 462Ala Gly Gly
Tyr Leu Asp Ser Val Ile1 54635PRTOryctolagus cuniculus 463Thr Tyr
Ser Ile Asn1 546416PRTOryctolagus cuniculus 464Ile Ile Ala Asn Ser
Gly Thr Thr Phe Tyr Ala Asn Trp Ala Lys Gly1 5 10
1546513PRTOryctolagus cuniculus 465Glu Ser Gly Met Tyr Asn Glu Tyr
Gly Lys Phe Asn Ile1 5 10466363DNAOryctolagus cuniculus
466atggacacga gggcccccac tcagctgctg gggctcctgc tgctctggct
cccaggtgcc 60acatttgccg ccgtgctgac ccagactcca tctcccgtgt ctgcagctgt
gggaggcaca 120gtcagcatca gttgccagtc cagtcagagt gtttataata
acaactggtt atcctggttt 180cagcagaaac cagggcagcc tcccaagctc
ctgatctaca aggcatccac tctggcatct 240ggggtcccat cgcggttcaa
aggcagtgga tctgggacac agttcactct caccatcagc 300gacgtgcagt
gtgacgatgt tgccacttac tactgtgcgg gcggttatct tgatagtgtt 360att
363467378DNAOryctolagus cuniculus 467atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcggtggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acagtctctg
gattctccct cagtacctat tcaataaact gggtccgcca ggctccaggg
180aagggcctgg aatggatcgg aatcattgct aatagtggta ccacattcta
cgcgaactgg 240gcgaaaggcc gattcaccgt ctccaaaacc tcgaccacgg
tggatctgaa aatcaccagt 300ccgacaaccg aggacacggc cacctatttc
tgtgccagag agagtggaat gtacaatgaa 360tatggtaaat ttaacatc
37846839DNAOryctolagus cuniculus 468cagtccagtc agagtgttta
taataacaac tggttatcc 3946921DNAOryctolagus cuniculus 469aaggcatcca
ctctggcatc t 2147027DNAOryctolagus cuniculus 470gcgggcggtt
atcttgatag tgttatt 2747115DNAOryctolagus cuniculus 471acctattcaa
taaac 1547248DNAOryctolagus cuniculus 472atcattgcta atagtggtac
cacattctac gcgaactggg cgaaaggc 4847339DNAOryctolagus cuniculus
473gagagtggaa tgtacaatga atatggtaaa tttaacatc
39474122PRTOryctolagus cuniculus 474Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys Ala
Ser Asp Met Thr Gln Thr Pro Ser Ser 20 25 30Val Ser Ala Ala Val Gly
Gly Thr Val Thr Ile Asn Cys Gln Ala Ser 35 40 45Glu Asn Ile Tyr Ser
Phe Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 50 55 60Pro Pro Lys Leu
Leu Ile Phe Lys Ala Ser Thr Leu Ala Ser Gly Val65 70 75 80Ser Ser
Arg Phe Lys Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr 85 90 95Ile
Ser Asp Leu Glu Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Gln 100 105
110Gly Ala Thr Val Tyr Asp Ile Asp Asn Asn 115
120475128PRTOryctolagus cuniculus 475Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Leu
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Val Ser Gly Ile Asp Leu Ser 35 40 45Ala Tyr Ala Met
Ile Trp Val Arg Gln Ala Pro Gly Glu Gly Leu Glu 50 55 60Trp Ile Thr
Ile Ile Tyr Pro Asn Gly Ile Thr Tyr Tyr Ala Asn Trp65 70 75 80Ala
Lys Gly Arg Phe Thr Val Ser Lys Thr Ser Thr Ala Met Asp Leu 85 90
95Lys Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Ala
100 105 110Arg Asp Ala Glu Ser Ser Lys Asn Ala Tyr Trp Gly Tyr Phe
Asn Val 115 120 12547611PRTOryctolagus cuniculus 476Gln Ala Ser Glu
Asn Ile Tyr Ser Phe Leu Ala1 5 104777PRTOryctolagus cuniculus
477Lys Ala Ser Thr Leu Ala Ser1 547812PRTOryctolagus cuniculus
478Gln Gln Gly Ala Thr Val Tyr Asp Ile Asp Asn Asn1 5
104795PRTOryctolagus cuniculus 479Ala Tyr Ala Met Ile1
548016PRTOryctolagus cuniculus 480Ile Ile Tyr Pro Asn Gly Ile Thr
Tyr Tyr Ala Asn Trp Ala Lys Gly1 5 10 1548115PRTOryctolagus
cuniculus 481Asp Ala Glu Ser Ser Lys Asn Ala Tyr Trp Gly Tyr Phe
Asn Val1 5 10 15482366DNAOryctolagus cuniculus 482atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60agatgtgcct
ctgatatgac ccagactcca tcctccgtgt ctgcagctgt gggaggcaca
120gtcaccatca attgccaggc cagtgagaac atttatagct ttttggcctg
gtatcagcag 180aaaccagggc agcctcccaa gctcctgatc ttcaaggctt
ccactctggc atctggggtc 240tcatcgcggt tcaaaggcag tggatctggg
acacagttca ctctcaccat cagcgacctg 300gagtgtgacg atgctgccac
ttactactgt caacagggtg ctactgtgta tgatattgat 360aataat
366483384DNAOryctolagus cuniculus 483atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcgctggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acagtttctg
gaatcgacct cagtgcctat gcaatgatct gggtccgcca ggctccaggg
180gaggggctgg aatggatcac aatcatttat cctaatggta tcacatacta
cgcgaactgg 240gcgaaaggcc gattcaccgt ctccaaaacc tcgaccgcga
tggatctgaa aatcaccagt 300ccgacaaccg aggacacggc cacctatttc
tgtgccagag atgcagaaag tagtaagaat 360gcttattggg gctactttaa cgtc
38448433DNAOryctolagus cuniculus 484caggccagtg agaacattta
tagctttttg gcc 3348521DNAOryctolagus cuniculus 485aaggcttcca
ctctggcatc t 2148636DNAOryctolagus cuniculus 486caacagggtg
ctactgtgta tgatattgat aataat 3648715DNAOryctolagus cuniculus
487gcctatgcaa tgatc 1548848DNAOryctolagus cuniculus 488atcatttatc
ctaatggtat cacatactac gcgaactggg cgaaaggc 4848945DNAOryctolagus
cuniculus 489gatgcagaaa gtagtaagaa tgcttattgg ggctacttta acgtc
45490122PRTOryctolagus cuniculus 490Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys Ala
Ser Asp Met Thr Gln Thr Pro Ser Ser 20 25 30Val Ser Ala Ala Val Gly
Gly Thr Val Thr Ile Asn Cys Gln Ala Ser 35 40 45Glu Asn Ile Tyr Ser
Phe Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 50 55 60Pro Pro Lys Leu
Leu Ile Phe Arg Ala Ser Thr Leu Ala Ser Gly Val65 70 75 80Ser Ser
Arg Phe Lys Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr 85 90 95Ile
Ser Asp Leu Glu Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Gln 100 105
110Gly Ala Thr Val Tyr Asp Ile Asp Asn Asn 115
120491128PRTOryctolagus cuniculus 491Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Leu
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Val Ser Gly Ile Asp Leu Ser 35 40 45Ala Tyr Ala Met
Ile Trp Val Arg Gln Ala Pro Gly Glu Gly Leu Glu 50 55 60Trp Ile Thr
Ile Ile Tyr Pro Asn Gly Ile Thr Tyr Tyr Ala Asn Trp65 70 75 80Ala
Lys Gly Arg Phe Thr Val Ser Lys Thr Ser Thr Ala Met Asp Leu 85 90
95Lys Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Ala
100 105 110Arg Asp Ala Glu Ser Ser Lys Asn Ala Tyr Trp Gly Tyr Phe
Asn Val 115 120 12549211PRTOryctolagus cuniculus 492Gln Ala Ser Glu
Asn Ile Tyr Ser Phe Leu Ala1 5 104937PRTOryctolagus cuniculus
493Arg Ala Ser Thr Leu Ala Ser1 549412PRTOryctolagus cuniculus
494Gln Gln Gly Ala Thr Val Tyr Asp Ile Asp Asn Asn1 5
104955PRTOryctolagus cuniculus 495Ala Tyr Ala Met Ile1
549616PRTOryctolagus cuniculus 496Ile Ile Tyr Pro Asn Gly Ile Thr
Tyr Tyr Ala Asn Trp Ala Lys Gly1 5 10 1549715PRTOryctolagus
cuniculus 497Asp Ala Glu Ser Ser Lys Asn Ala Tyr Trp Gly Tyr Phe
Asn Val1 5 10 15498366DNAOryctolagus cuniculus 498atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60agatgtgcct
ctgatatgac ccagactcca tcctccgtgt ctgcagctgt gggaggcaca
120gtcaccatca attgccaggc cagtgagaac atttatagct ttttggcctg
gtatcagcag 180aaaccagggc agcctcccaa gctcctgatc ttcagggctt
ccactctggc atctggggtc 240tcatcgcggt tcaaaggcag tggatctggg
acacagttca ctctcaccat cagcgacctg 300gagtgtgacg atgctgccac
ttactactgt caacagggtg ctactgtgta tgatattgat 360aataat
366499384DNAOryctolagus cuniculus 499atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcgctggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acagtttctg
gaatcgacct cagtgcctat gcaatgatct gggtccgcca ggctccaggg
180gaggggctgg aatggatcac aatcatttat cctaatggta tcacatacta
cgcgaactgg 240gcgaaaggcc gattcaccgt ctccaaaacc tcgaccgcga
tggatctgaa aatcaccagt 300ccgacaaccg aggacacggc cacctatttc
tgtgccagag atgcagaaag tagtaagaat 360gcttattggg gctactttaa cgtc
38450033DNAOryctolagus cuniculus 500caggccagtg agaacattta
tagctttttg gcc 3350121DNAOryctolagus cuniculus 501agggcttcca
ctctggcatc t 2150236DNAOryctolagus cuniculus 502caacagggtg
ctactgtgta tgatattgat aataat 3650315DNAOryctolagus cuniculus
503gcctatgcaa tgatc 1550448DNAOryctolagus cuniculus 504atcatttatc
ctaatggtat cacatactac gcgaactggg cgaaaggc 4850545DNAOryctolagus
cuniculus 505gatgcagaaa gtagtaagaa tgcttattgg ggctacttta acgtc
45506124PRTOryctolagus cuniculus 506Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Thr Phe Ala
Ile Glu Met Thr Gln Thr Pro Ser
Pro 20 25 30Val Ser Ala Ala Val Gly Gly Thr Val Thr Ile Asn Cys Gln
Ala Ser 35 40 45Glu Ser Val Phe Asn Asn Met Leu Ser Trp Tyr Gln Gln
Lys Pro Gly 50 55 60His Ser Pro Lys Leu Leu Ile Tyr Asp Ala Ser Asp
Leu Ala Ser Gly65 70 75 80Val Pro Ser Arg Phe Lys Gly Ser Gly Ser
Gly Thr Gln Phe Thr Leu 85 90 95Thr Ile Ser Gly Val Glu Cys Asp Asp
Ala Ala Thr Tyr Tyr Cys Ala 100 105 110Gly Tyr Lys Ser Asp Ser Asn
Asp Gly Asp Asn Val 115 120507123PRTOryctolagus cuniculus 507Met
Glu Thr Gly Leu Arg Trp Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10
15Val Gln Cys Gln Ser Leu Glu Glu Ser Gly Gly Arg Leu Val Thr Pro
20 25 30Gly Thr Pro Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu
Asn 35 40 45Arg Asn Ser Ile Thr Trp Val Arg Gln Ala Pro Gly Glu Gly
Leu Glu 50 55 60Trp Ile Gly Ile Ile Thr Gly Ser Gly Arg Thr Tyr Tyr
Ala Asn Trp65 70 75 80Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser
Thr Thr Val Asp Leu 85 90 95Lys Met Thr Ser Pro Thr Thr Glu Asp Thr
Ala Thr Tyr Phe Cys Ala 100 105 110Arg Gly His Pro Gly Leu Gly Ser
Gly Asn Ile 115 12050812PRTOryctolagus cuniculus 508Gln Ala Ser Glu
Ser Val Phe Asn Asn Met Leu Ser1 5 105097PRTOryctolagus cuniculus
509Asp Ala Ser Asp Leu Ala Ser1 551013PRTOryctolagus cuniculus
510Ala Gly Tyr Lys Ser Asp Ser Asn Asp Gly Asp Asn Val1 5
105115PRTOryctolagus cuniculus 511Arg Asn Ser Ile Thr1
551216PRTOryctolagus cuniculus 512Ile Ile Thr Gly Ser Gly Arg Thr
Tyr Tyr Ala Asn Trp Ala Lys Gly1 5 10 1551310PRTOryctolagus
cuniculus 513Gly His Pro Gly Leu Gly Ser Gly Asn Ile1 5
10514372DNAOryctolagus cuniculus 514atggacacga gggcccccac
tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60acatttgcca ttgaaatgac
ccagactcca tcccccgtgt ctgccgctgt gggaggcaca 120gtcaccatca
attgccaggc cagtgagagt gtttttaata atatgttatc ctggtatcag
180cagaaaccag ggcactctcc taagctcctg atctatgatg catccgatct
ggcatctggg 240gtcccatcgc ggttcaaagg cagtggatct gggacacagt
tcactctcac catcagtggc 300gtggagtgtg acgatgctgc cacttactat
tgtgcagggt ataaaagtga tagtaatgat 360ggcgataatg tt
372515369DNAOryctolagus cuniculus 515atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcgctggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acagtctctg
gattctccct caacaggaat tcaataacct gggtccgcca ggctccaggg
180gaggggctgg aatggatcgg aatcattact ggtagtggta gaacgtacta
cgcgaactgg 240gcaaaaggcc gattcaccat ctccaaaacc tcgaccacgg
tggatctgaa aatgaccagt 300ccgacaaccg aggacacggc cacctatttc
tgtgccagag gccatcctgg tcttggtagt 360ggtaacatc
36951636DNAOryctolagus cuniculus 516caggccagtg agagtgtttt
taataatatg ttatcc 3651721DNAOryctolagus cuniculus 517gatgcatccg
atctggcatc t 2151839DNAOryctolagus cuniculus 518gcagggtata
aaagtgatag taatgatggc gataatgtt 3951915DNAOryctolagus cuniculus
519aggaattcaa taacc 1552048DNAOryctolagus cuniculus 520atcattactg
gtagtggtag aacgtactac gcgaactggg caaaaggc 4852130DNAOryctolagus
cuniculus 521ggccatcctg gtcttggtag tggtaacatc
30522121PRTOryctolagus cuniculus 522Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Thr Phe Ala
Gln Val Leu Thr Gln Thr Ala Ser Ser 20 25 30Val Ser Ala Ala Val Gly
Gly Thr Val Thr Ile Asn Cys Gln Ser Ser 35 40 45Gln Ser Val Tyr Asn
Asn Tyr Leu Ser Trp Tyr Gln Gln Lys Pro Gly 50 55 60Gln Pro Pro Lys
Leu Leu Ile Tyr Thr Ala Ser Ser Leu Ala Ser Gly65 70 75 80Val Pro
Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu 85 90 95Thr
Ile Ser Glu Val Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Gln 100 105
110Gly Tyr Tyr Ser Gly Pro Ile Ile Thr 115 120523122PRTOryctolagus
cuniculus 523Met Glu Thr Gly Leu Arg Trp Leu Leu Leu Val Ala Val
Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Leu Glu Glu Ser Gly Gly Arg
Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr Leu Thr Cys Thr Ala Ser
Gly Phe Ser Leu Asn 35 40 45Asn Tyr Tyr Ile Gln Trp Val Arg Gln Ala
Pro Gly Glu Gly Leu Glu 50 55 60Trp Ile Gly Ile Ile Tyr Ala Gly Gly
Ser Ala Tyr Tyr Ala Thr Trp65 70 75 80Ala Asn Gly Arg Phe Thr Ile
Ala Lys Thr Ser Ser Thr Thr Val Asp 85 90 95Leu Lys Met Thr Ser Leu
Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys 100 105 110Ala Arg Gly Thr
Phe Asp Gly Tyr Glu Leu 115 12052412PRTOryctolagus cuniculus 524Gln
Ser Ser Gln Ser Val Tyr Asn Asn Tyr Leu Ser1 5 105257PRTOryctolagus
cuniculus 525Thr Ala Ser Ser Leu Ala Ser1 552610PRTOryctolagus
cuniculus 526Gln Gly Tyr Tyr Ser Gly Pro Ile Ile Thr1 5
105275PRTOryctolagus cuniculus 527Asn Tyr Tyr Ile Gln1
552816PRTOryctolagus cuniculus 528Ile Ile Tyr Ala Gly Gly Ser Ala
Tyr Tyr Ala Thr Trp Ala Asn Gly1 5 10 155298PRTOryctolagus
cuniculus 529Gly Thr Phe Asp Gly Tyr Glu Leu1 5530363DNAOryctolagus
cuniculus 530atggacacga gggcccccac tcagctgctg gggctcctgc tgctctggct
cccaggtgcc 60acatttgcgc aagtgctgac ccagactgca tcgtccgtgt ctgcagctgt
gggaggcaca 120gtcaccatca attgccagtc cagtcagagt gtttataata
actacttatc ctggtatcag 180cagaaaccag ggcagcctcc caagctcctg
atctatactg catccagcct ggcatctggg 240gtcccatcgc ggttcaaagg
cagtggatct gggacacagt tcactctcac catcagcgaa 300gtgcagtgtg
acgatgctgc cacttactac tgtcaaggct attatagtgg tcctataatt 360act
363531366DNAOryctolagus cuniculus 531atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcgctggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acagcctctg
gattctccct caataactac tacatacaat gggtccgcca ggctccaggg
180gaggggctgg aatggatcgg gatcatttat gctggtggta gcgcatacta
cgcgacctgg 240gcaaacggcc gattcaccat cgccaaaacc tcgtcgacca
cggtggatct gaagatgacc 300agtctgacaa ccgaggacac ggccacctat
ttctgtgcca gagggacatt tgatggttat 360gagttg 36653236DNAOryctolagus
cuniculus 532cagtccagtc agagtgttta taataactac ttatcc
3653321DNAOryctolagus cuniculus 533actgcatcca gcctggcatc t
2153430DNAOryctolagus cuniculus 534caaggctatt atagtggtcc tataattact
3053515DNAOryctolagus cuniculus 535aactactaca tacaa
1553648DNAOryctolagus cuniculus 536atcatttatg ctggtggtag cgcatactac
gcgacctggg caaacggc 4853724DNAOryctolagus cuniculus 537gggacatttg
atggttatga gttg 24538122PRTOryctolagus cuniculus 538Met Asp Thr Arg
Ala Pro Thr Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly
Ala Thr Phe Ala Gln Val Leu Thr Gln Thr Pro Ser Pro 20 25 30Val Ser
Val Pro Val Gly Asp Thr Val Thr Ile Ser Cys Gln Ser Ser 35 40 45Glu
Ser Val Tyr Ser Asn Asn Leu Leu Ser Trp Tyr Gln Gln Lys Pro 50 55
60Gly Gln Pro Pro Lys Leu Leu Ile Tyr Arg Ala Ser Asn Leu Ala Ser65
70 75 80Gly Val Pro Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Gln Phe
Thr 85 90 95Leu Thr Ile Ser Gly Ala Gln Cys Asp Asp Ala Ala Thr Tyr
Tyr Cys 100 105 110Gln Gly Tyr Tyr Ser Gly Val Ile Asn Ser 115
120539124PRTOryctolagus cuniculus 539Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Val
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser 35 40 45Ser Tyr Phe Met
Ser Trp Val Arg Gln Ala Pro Gly Glu Gly Leu Glu 50 55 60Tyr Ile Gly
Phe Ile Asn Pro Gly Gly Ser Ala Tyr Tyr Ala Ser Trp65 70 75 80Ala
Ser Gly Arg Leu Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu 85 90
95Lys Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Ala
100 105 110Arg Ile Leu Ile Val Ser Tyr Gly Ala Phe Thr Ile 115
12054013PRTOryctolagus cuniculus 540Gln Ser Ser Glu Ser Val Tyr Ser
Asn Asn Leu Leu Ser1 5 105417PRTOryctolagus cuniculus 541Arg Ala
Ser Asn Leu Ala Ser1 554210PRTOryctolagus cuniculus 542Gln Gly Tyr
Tyr Ser Gly Val Ile Asn Ser1 5 105435PRTOryctolagus cuniculus
543Ser Tyr Phe Met Ser1 554416PRTOryctolagus cuniculus 544Phe Ile
Asn Pro Gly Gly Ser Ala Tyr Tyr Ala Ser Trp Ala Ser Gly1 5 10
1554511PRTOryctolagus cuniculus 545Ile Leu Ile Val Ser Tyr Gly Ala
Phe Thr Ile1 5 10546366DNAOryctolagus cuniculus 546atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60acatttgccc
aagtgctgac ccagactcca tcccctgtgt ctgtccctgt gggagacaca
120gtcaccatca gttgccagtc cagtgagagc gtttatagta ataacctctt
atcctggtat 180cagcagaaac cagggcagcc tcccaagctc ctgatctaca
gggcatccaa tctggcatct 240ggtgtcccat cgcggttcaa aggcagtgga
tctgggacac agttcactct caccatcagc 300ggcgcacagt gtgacgatgc
tgccacttac tactgtcaag gctattatag tggtgtcatt 360aatagt
366547372DNAOryctolagus cuniculus 547atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcggtggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acagtgtctg
gattctccct cagtagctac ttcatgagct gggtccgcca ggctccaggg
180gaggggctgg aatacatcgg attcattaat cctggtggta gcgcatacta
cgcgagctgg 240gcgagtggcc gactcaccat ctccaaaacc tcgaccacgg
tagatctgaa aatcaccagt 300ccgacaaccg aggacacggc cacctatttc
tgtgccagga ttcttattgt ttcttatgga 360gcctttacca tc
37254839DNAOryctolagus cuniculus 548cagtccagtg agagcgttta
tagtaataac ctcttatcc 3954921DNAOryctolagus cuniculus 549agggcatcca
atctggcatc t 2155030DNAOryctolagus cuniculus 550caaggctatt
atagtggtgt cattaatagt 3055115DNAOryctolagus cuniculus 551agctacttca
tgagc 1555248DNAOryctolagus cuniculus 552ttcattaatc ctggtggtag
cgcatactac gcgagctggg cgagtggc 4855333DNAOryctolagus cuniculus
553attcttattg tttcttatgg agcctttacc atc 33554122PRTOryctolagus
cuniculus 554Met Asp Thr Arg Ala Pro Thr Gln Leu Leu Gly Leu Leu
Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys Ala Tyr Asp Met Thr Gln
Thr Pro Ala Ser 20 25 30Val Glu Val Ala Val Gly Gly Thr Val Thr Ile
Lys Cys Gln Ala Thr 35 40 45Glu Ser Ile Gly Asn Glu Leu Ser Trp Tyr
Gln Gln Lys Pro Gly Gln 50 55 60Ala Pro Lys Leu Leu Ile Tyr Ser Ala
Ser Thr Leu Ala Ser Gly Val65 70 75 80Pro Ser Arg Phe Lys Gly Ser
Gly Ser Gly Thr Gln Phe Thr Leu Thr 85 90 95Ile Thr Gly Val Glu Cys
Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Gln 100 105 110Gly Tyr Ser Ser
Ala Asn Ile Asp Asn Ala 115 120555128PRTOryctolagus cuniculus
555Met Glu Thr Gly Leu Arg Trp Leu Leu Leu Val Ala Val Leu Lys Gly1
5 10 15Val Gln Cys Gln Ser Leu Glu Glu Ser Gly Gly Arg Leu Val Thr
Pro 20 25 30Gly Thr Pro Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser
Leu Ser 35 40 45Lys Tyr Tyr Met Ser Trp Val Arg Gln Ala Pro Glu Lys
Gly Leu Lys 50 55 60Tyr Ile Gly Tyr Ile Asp Ser Thr Thr Val Asn Thr
Tyr Tyr Ala Thr65 70 75 80Trp Ala Arg Gly Arg Phe Thr Ile Ser Lys
Thr Ser Thr Thr Val Asp 85 90 95Leu Lys Ile Thr Ser Pro Thr Ser Glu
Asp Thr Ala Thr Tyr Phe Cys 100 105 110Ala Arg Gly Ser Thr Tyr Phe
Thr Asp Gly Gly His Arg Leu Asp Leu 115 120 12555611PRTOryctolagus
cuniculus 556Gln Ala Thr Glu Ser Ile Gly Asn Glu Leu Ser1 5
105577PRTOryctolagus cuniculus 557Ser Ala Ser Thr Leu Ala Ser1
555812PRTOryctolagus cuniculus 558Gln Gln Gly Tyr Ser Ser Ala Asn
Ile Asp Asn Ala1 5 105595PRTOryctolagus cuniculus 559Lys Tyr Tyr
Met Ser1 556017PRTOryctolagus cuniculus 560Tyr Ile Asp Ser Thr Thr
Val Asn Thr Tyr Tyr Ala Thr Trp Ala Arg1 5 10
15Gly56114PRTOryctolagus cuniculus 561Gly Ser Thr Tyr Phe Thr Asp
Gly Gly His Arg Leu Asp Leu1 5 10562366DNAOryctolagus cuniculus
562atggacacga gggcccccac tcagctgctg gggctcctgc tgctctggct
cccaggtgcc 60agatgtgcct atgatatgac ccagactcca gcctctgtgg aggtagctgt
gggaggcaca 120gtcaccatca agtgccaggc cactgagagc attggcaatg
agttatcctg gtatcagcag 180aaaccagggc aggctcccaa gctcctgatc
tattctgcat ccactctggc atctggggtc 240ccatcgcggt tcaaaggcag
tggatctggg acacagttca ctctcaccat caccggcgtg 300gagtgtgatg
atgctgccac ttactactgt caacagggtt atagtagtgc taatattgat 360aatgct
366563384DNAOryctolagus cuniculus 563atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcgctggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120accgtctctg
gattctccct cagtaagtac tacatgagct gggtccgcca ggctccagag
180aaggggctga aatacatcgg atacattgat agtactactg ttaatacata
ctacgcgacc 240tgggcgagag gccgattcac catctccaaa acctcgacca
cggtggatct gaagatcacc 300agtccgacaa gtgaggacac ggccacctat
ttctgtgcca gaggaagtac ttattttact 360gatggaggcc atcggttgga tctc
38456433DNAOryctolagus cuniculus 564caggccactg agagcattgg
caatgagtta tcc 3356521DNAOryctolagus cuniculus 565tctgcatcca
ctctggcatc t 2156636DNAOryctolagus cuniculus 566caacagggtt
atagtagtgc taatattgat aatgct 3656715DNAOryctolagus cuniculus
567aagtactaca tgagc 1556851DNAOryctolagus cuniculus 568tacattgata
gtactactgt taatacatac tacgcgacct gggcgagagg c 5156942DNAOryctolagus
cuniculus 569ggaagtactt attttactga tggaggccat cggttggatc tc
42570122PRTOryctolagus cuniculus 570Met Asp Thr Arg Ala Pro Thr Gln
Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys Ala
Tyr Asp Met Thr Gln Thr Pro Ala Ser 20 25 30Val Glu Val Ala Val Gly
Gly Thr Val Thr Ile Lys Cys Gln Ala Thr 35 40 45Glu Ser Ile Gly Asn
Glu Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln 50 55 60Ala Pro Lys Leu
Leu Ile Tyr Ser Ala Ser Thr Leu Ala Ser Gly Val65 70 75 80Pro Ser
Arg Phe Lys Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr 85 90 95Ile
Thr Gly Val Glu Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Gln 100 105
110Gly Tyr Ser Ser Ala Asn Ile Asp Asn Ala 115
120571124PRTOryctolagus cuniculus 571Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Leu
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu
Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser 35 40 45Thr Tyr Asn
Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile
Gly Ser Ile Thr Ile Asp Gly Arg Thr Tyr Tyr Ala Ser Trp65 70 75
80Ala Lys Gly Arg Phe Thr Val Ser Lys Ser Ser Thr Thr Val Asp Leu
85 90 95Lys Met Thr Ser Leu Thr Thr Gly Asp Thr Ala Thr Tyr Phe Cys
Ala 100 105 110Arg Ile Leu Ile Val Ser Tyr Gly Ala Phe Thr Ile 115
12057211PRTOryctolagus cuniculus 572Gln Ala Thr Glu Ser Ile Gly Asn
Glu Leu Ser1 5 105737PRTOryctolagus cuniculus 573Ser Ala Ser Thr
Leu Ala Ser1 557412PRTOryctolagus cuniculus 574Gln Gln Gly Tyr Ser
Ser Ala Asn Ile Asp Asn Ala1 5 105755PRTOryctolagus cuniculus
575Thr Tyr Asn Met Gly1 557616PRTOryctolagus cuniculus 576Ser Ile
Thr Ile Asp Gly Arg Thr Tyr Tyr Ala Ser Trp Ala Lys Gly1 5 10
1557711PRTOryctolagus cuniculus 577Ile Leu Ile Val Ser Tyr Gly Ala
Phe Thr Ile1 5 10578366DNAOryctolagus cuniculus 578atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60agatgtgcct
atgatatgac ccagactcca gcctctgtgg aggtagctgt gggaggcaca
120gtcaccatca agtgccaggc cactgagagc attggcaatg agttatcctg
gtatcagcag 180aaaccagggc aggctcccaa gctcctgatc tattctgcat
ccactctggc atctggggtc 240ccatcgcggt tcaaaggcag tggatctggg
acacagttca ctctcaccat caccggcgtg 300gagtgtgatg atgctgccac
ttactactgt caacagggtt atagtagtgc taatattgat 360aatgct
366579372DNAOryctolagus cuniculus 579atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcgctggagg agtccggggg
tcgcctggta acgcctggga cacccctgac actcacctgc 120acagtctctg
gattctccct cagtacctac aacatgggct gggtccgcca ggctccaggg
180aaggggctgg aatggatcgg aagtattact attgatggtc gcacatacta
cgcgagctgg 240gcgaaaggcc gattcaccgt ctccaaaagc tcgaccacgg
tggatctgaa aatgaccagt 300ctgacaaccg gggacacggc cacctatttc
tgtgccagga ttcttattgt ttcttatggg 360gcctttacca tc
37258033DNAOryctolagus cuniculus 580caggccactg agagcattgg
caatgagtta tcc 3358121DNAOryctolagus cuniculus 581tctgcatcca
ctctggcatc t 2158236DNAOryctolagus cuniculus 582caacagggtt
atagtagtgc taatattgat aatgct 3658315DNAOryctolagus cuniculus
583acctacaaca tgggc 1558448DNAOryctolagus cuniculus 584agtattacta
ttgatggtcg cacatactac gcgagctggg cgaaaggc 4858533DNAOryctolagus
cuniculus 585attcttattg tttcttatgg ggcctttacc atc
33586105PRTArtificial SequenceKappa constant domain 586Val Ala Ala
Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu1 5 10 15Lys Ser
Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro 20 25 30Arg
Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly 35 40
45Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr
50 55 60Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys
His65 70 75 80Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser
Ser Pro Val 85 90 95Thr Lys Ser Phe Asn Arg Gly Glu Cys 100
105587315DNAArtificial SequenceKappa constant domain 587gtggctgcac
catctgtctt catcttcccg ccatctgatg agcagttgaa atctggaact 60gcctctgttg
tgtgcctgct gaataacttc tatcccagag aggccaaagt acagtggaag
120gtggataacg ccctccaatc gggtaactcc caggagagtg tcacagagca
ggacagcaag 180gacagcacct acagcctcag cagcaccctg acgctgagca
aagcagacta cgagaaacac 240aaagtctacg cctgcgaagt cacccatcag
ggcctgagct cgcccgtcac aaagagcttc 300aacaggggag agtgt
315588330PRTArtificial SequenceGamma-1 constant domain 588Ala Ser
Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys1 5 10 15Ser
Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr 20 25
30Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser
35 40 45Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr
Ser 50 55 60Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr
Gln Thr65 70 75 80Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr
Lys Val Asp Lys 85 90 95Arg Val Glu Pro Lys Ser Cys Asp Lys Thr His
Thr Cys Pro Pro Cys 100 105 110Pro Ala Pro Glu Leu Leu Gly Gly Pro
Ser Val Phe Leu Phe Pro Pro 115 120 125Lys Pro Lys Asp Thr Leu Met
Ile Ser Arg Thr Pro Glu Val Thr Cys 130 135 140Val Val Val Asp Val
Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp145 150 155 160Tyr Val
Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu 165 170
175Glu Gln Tyr Ala Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu
180 185 190His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val
Ser Asn 195 200 205Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser
Lys Ala Lys Gly 210 215 220Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu
Pro Pro Ser Arg Glu Glu225 230 235 240Met Thr Lys Asn Gln Val Ser
Leu Thr Cys Leu Val Lys Gly Phe Tyr 245 250 255Pro Ser Asp Ile Ala
Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn 260 265 270Asn Tyr Lys
Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe 275 280 285Leu
Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn 290 295
300Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr
Thr305 310 315 320Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 325
330589990DNAArtificial SequenceGamma-1 constant domain
589gcctccacca agggcccatc ggtcttcccc ctggcaccct cctccaagag
cacctctggg 60ggcacagcgg ccctgggctg cctggtcaag gactacttcc ccgaaccggt
gacggtgtcg 120tggaactcag gcgccctgac cagcggcgtg cacaccttcc
cggctgtcct acagtcctca 180ggactctact ccctcagcag cgtggtgacc
gtgccctcca gcagcttggg cacccagacc 240tacatctgca acgtgaatca
caagcccagc aacaccaagg tggacaagag agttgagccc 300aaatcttgtg
acaaaactca cacatgccca ccgtgcccag cacctgaact cctgggggga
360ccgtcagtct tcctcttccc cccaaaaccc aaggacaccc tcatgatctc
ccggacccct 420gaggtcacat gcgtggtggt ggacgtgagc cacgaagacc
ctgaggtcaa gttcaactgg 480tacgtggacg gcgtggaggt gcataatgcc
aagacaaagc cgcgggagga gcagtacgcc 540agcacgtacc gtgtggtcag
cgtcctcacc gtcctgcacc aggactggct gaatggcaag 600gagtacaagt
gcaaggtctc caacaaagcc ctcccagccc ccatcgagaa aaccatctcc
660aaagccaaag ggcagccccg agaaccacag gtgtacaccc tgcccccatc
ccgggaggag 720atgaccaaga accaggtcag cctgacctgc ctggtcaaag
gcttctatcc cagcgacatc 780gccgtggagt gggagagcaa tgggcagccg
gagaacaact acaagaccac gcctcccgtg 840ctggactccg acggctcctt
cttcctctac agcaagctca ccgtggacaa gagcaggtgg 900cagcagggga
acgtcttctc atgctccgtg atgcatgagg ctctgcacaa ccactacacg
960cagaagagcc tctccctgtc tccgggtaaa 99059015PRTHomo sapiens 590Val
Pro Pro Gly Glu Asp Ser Lys Asp Val Ala Ala Pro His Arg1 5 10
1559115PRTHomo sapiens 591Gly Glu Asp Ser Lys Asp Val Ala Ala Pro
His Arg Gln Pro Leu1 5 10 1559215PRTHomo sapiens 592Ser Lys Asp Val
Ala Ala Pro His Arg Gln Pro Leu Thr Ser Ser1 5 10 1559315PRTHomo
sapiens 593Val Ala Ala Pro His Arg Gln Pro Leu Thr Ser Ser Glu Arg
Ile1 5 10 1559415PRTHomo sapiens 594Pro His Arg Gln Pro Leu Thr Ser
Ser Glu Arg Ile Asp Lys Gln1 5 10 1559515PRTHomo sapiens 595Gln Pro
Leu Thr Ser Ser Glu Arg Ile Asp Lys Gln Ile Arg Tyr1 5 10
1559615PRTHomo sapiens 596Thr Ser Ser Glu Arg Ile Asp Lys Gln Ile
Arg Tyr Ile Leu Asp1 5 10 1559715PRTHomo sapiens 597Glu Arg Ile Asp
Lys Gln Ile Arg Tyr Ile Leu Asp Gly Ile Ser1 5 10 1559815PRTHomo
sapiens 598Asp Lys Gln Ile Arg Tyr Ile Leu Asp Gly Ile Ser Ala Leu
Arg1 5 10 1559915PRTHomo sapiens 599Ile Arg Tyr Ile Leu Asp Gly Ile
Ser Ala Leu Arg Lys Glu Thr1 5 10 1560015PRTHomo sapiens 600Ile Leu
Asp Gly Ile Ser Ala Leu Arg Lys Glu Thr Cys Asn Lys1 5 10
1560115PRTHomo sapiens 601Gly Ile Ser Ala Leu Arg Lys Glu Thr Cys
Asn Lys Ser Asn Met1 5 10 1560215PRTHomo sapiens 602Ala Leu Arg Lys
Glu Thr Cys Asn Lys Ser Asn Met Cys Glu Ser1 5 10 1560315PRTHomo
sapiens 603Lys Glu Thr Cys Asn Lys Ser Asn Met Cys Glu Ser Ser Lys
Glu1 5 10 1560415PRTHomo sapiens 604Cys Asn Lys Ser Asn Met Cys Glu
Ser Ser Lys Glu Ala Leu Ala1 5 10 1560515PRTHomo sapiens 605Ser Asn
Met Cys Glu Ser Ser Lys Glu Ala Leu Ala Glu Asn Asn1 5 10
1560615PRTHomo sapiens 606Cys Glu Ser Ser Lys Glu Ala Leu Ala Glu
Asn Asn Leu Asn Leu1 5 10 1560715PRTHomo sapiens 607Ser Lys Glu Ala
Leu Ala Glu Asn Asn Leu Asn Leu Pro Lys Met1 5 10 1560815PRTHomo
sapiens 608Ala Leu Ala Glu Asn Asn Leu Asn Leu Pro Lys Met Ala Glu
Lys1 5 10 1560915PRTHomo sapiens 609Glu Asn Asn Leu Asn Leu Pro Lys
Met Ala Glu Lys Asp Gly Cys1 5 10 1561015PRTHomo sapiens 610Leu Asn
Leu Pro Lys Met Ala Glu Lys Asp Gly Cys Phe Gln Ser1 5 10
1561115PRTHomo sapiens 611Pro Lys Met Ala Glu Lys Asp Gly Cys Phe
Gln Ser Gly Phe Asn1 5 10 1561215PRTHomo sapiens 612Ala Glu Lys Asp
Gly Cys Phe Gln Ser Gly Phe Asn Glu Glu Thr1 5 10 1561315PRTHomo
sapiens 613Asp Gly Cys Phe Gln Ser Gly Phe Asn Glu Glu Thr Cys Leu
Val1 5 10 1561415PRTHomo sapiens 614Phe Gln Ser Gly Phe Asn Glu Glu
Thr Cys Leu Val Lys Ile Ile1 5 10 1561515PRTHomo sapiens 615Gly Phe
Asn Glu Glu Thr Cys Leu Val Lys Ile Ile Thr Gly Leu1 5 10
1561615PRTHomo sapiens 616Glu Glu Thr Cys Leu Val Lys Ile Ile Thr
Gly Leu Leu Glu Phe1 5 10 1561715PRTHomo sapiens 617Cys Leu Val Lys
Ile Ile Thr Gly Leu Leu Glu Phe Glu Val Tyr1 5 10 1561815PRTHomo
sapiens 618Lys Ile Ile Thr Gly Leu Leu Glu Phe Glu Val Tyr Leu Glu
Tyr1 5 10 1561915PRTHomo sapiens 619Thr Gly Leu Leu Glu Phe Glu Val
Tyr Leu Glu Tyr Leu Gln Asn1 5 10 1562015PRTHomo sapiens 620Leu Glu
Phe Glu Val Tyr Leu Glu Tyr Leu Gln Asn Arg Phe Glu1 5 10
1562115PRTHomo sapiens 621Glu Val Tyr Leu Glu Tyr Leu Gln Asn Arg
Phe Glu Ser Ser Glu1 5 10 1562215PRTHomo sapiens 622Leu Glu Tyr Leu
Gln Asn Arg Phe Glu Ser Ser Glu Glu Gln Ala1 5 10 1562315PRTHomo
sapiens 623Leu Gln Asn Arg Phe Glu Ser Ser Glu Glu Gln Ala Arg Ala
Val1 5 10 1562415PRTHomo sapiens 624Arg Phe Glu Ser Ser Glu Glu Gln
Ala Arg Ala Val Gln Met Ser1 5 10 1562515PRTHomo sapiens 625Ser Ser
Glu Glu Gln Ala Arg Ala Val Gln Met Ser Thr Lys Val1 5 10
1562615PRTHomo sapiens 626Glu Gln Ala Arg Ala Val Gln Met Ser Thr
Lys Val Leu Ile Gln1 5 10 1562715PRTHomo sapiens 627Arg Ala Val Gln
Met Ser Thr Lys Val Leu Ile Gln Phe Leu Gln1 5 10 1562815PRTHomo
sapiens 628Gln Met Ser Thr Lys Val Leu Ile Gln Phe Leu Gln Lys Lys
Ala1 5 10 1562915PRTHomo sapiens 629Thr Lys Val Leu Ile Gln Phe Leu
Gln Lys Lys Ala Lys Asn Leu1 5 10 1563015PRTHomo sapiens 630Leu Ile
Gln Phe Leu Gln Lys Lys Ala Lys Asn Leu Asp Ala Ile1 5 10
1563115PRTHomo sapiens 631Phe Leu Gln Lys Lys Ala Lys Asn Leu Asp
Ala Ile Thr Thr Pro1 5 10 1563215PRTHomo sapiens 632Lys Lys Ala Lys
Asn Leu Asp Ala Ile Thr Thr Pro Asp Pro Thr1 5 10 1563315PRTHomo
sapiens 633Lys Asn Leu Asp Ala Ile Thr Thr Pro Asp Pro Thr Thr Asn
Ala1 5 10 1563415PRTHomo sapiens 634Asp Ala Ile Thr Thr Pro Asp Pro
Thr Thr Asn Ala Ser Leu Leu1 5 10 1563515PRTHomo sapiens 635Thr Thr
Pro Asp Pro Thr Thr Asn Ala Ser Leu Leu Thr Lys Leu1 5 10
1563615PRTHomo sapiens 636Asp Pro Thr Thr Asn Ala Ser Leu Leu Thr
Lys Leu Gln Ala Gln1 5 10 1563715PRTHomo sapiens 637Thr Asn Ala Ser
Leu Leu Thr Lys Leu Gln Ala Gln Asn Gln Trp1 5 10 1563815PRTHomo
sapiens 638Ser Leu Leu Thr Lys Leu Gln Ala Gln Asn Gln Trp Leu Gln
Asp1 5 10 1563915PRTHomo sapiens 639Thr Lys Leu Gln Ala Gln Asn Gln
Trp Leu Gln Asp Met Thr Thr1 5 10 1564015PRTHomo sapiens 640Gln Ala
Gln Asn Gln Trp Leu Gln Asp Met Thr Thr His Leu Ile1 5 10
1564115PRTHomo sapiens 641Asn Gln Trp Leu Gln Asp Met Thr Thr His
Leu Ile Leu Arg Ser1 5 10 1564215PRTHomo sapiens 642Leu Gln Asp Met
Thr Thr His Leu Ile Leu Arg Ser Phe Lys Glu1 5 10 1564315PRTHomo
sapiens 643Met Thr Thr His Leu Ile Leu Arg Ser Phe Lys Glu Phe Leu
Gln1 5 10 1564415PRTHomo sapiens 644His Leu Ile Leu Arg Ser Phe Lys
Glu Phe Leu Gln Ser Ser Leu1 5 10 1564515PRTHomo sapiens 645Leu Arg
Ser Phe Lys Glu Phe Leu Gln Ser Ser Leu Arg Ala Leu1 5 10
1564615PRTHomo sapiens 646Phe Lys Glu Phe Leu Gln Ser Ser Leu Arg
Ala Leu Arg Gln Met1 5 10 15647111PRTOryctolagus cuniculus 647Ala
Tyr Asp Met Thr Gln Thr Pro Ala Ser Val Ser Ala Ala Val Gly1 5 10
15Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Asn Asn Glu
20 25 30Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln Arg Pro Lys Leu Leu
Ile 35 40 45Tyr Arg Ala Ser Thr Leu Ala Ser Gly Val Ser Ser Arg Phe
Lys Gly 50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp
Leu Glu Cys65 70 75 80Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Gly
Tyr Ser Leu Arg Asn 85 90 95Ile Asp Asn Ala Phe Gly Gly Gly Thr Glu
Val Val Val Lys Arg 100 105 11064888PRTHomo sapiens 648Ala Ile Gln
Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg
Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Asp 20 25 30Leu
Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40
45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln
Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys 8564988PRTHomo
sapiens 649Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser
Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile
Ser Asn Tyr 20 25 30Leu Ala Trp Tyr Gln Gln Lys
Pro Gly Lys Val Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Thr Leu
Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr
Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Val
Ala Thr Tyr Tyr Cys 8565088PRTHomo sapiens 650Asp Ile Gln Met Thr
Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr
Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Trp 20 25 30Leu Ala Trp
Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Lys
Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser
Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75
80Asp Asp Phe Ala Thr Tyr Tyr Cys 85651111PRTArtificial
SequenceHumanized antibody 651Ala Ile Gln Met Thr Gln Ser Pro Ser
Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Gln
Ala Ser Gln Ser Ile Asn Asn Glu 20 25 30Leu Ser Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Arg Ala Ser Thr Leu
Ala Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr
Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe
Ala Thr Tyr Tyr Cys Gln Gln Gly Tyr Ser Leu Arg Asn 85 90 95Ile Asp
Asn Ala Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg 100 105
110652117PRTOryctolagus cuniculus 652Gln Ser Leu Glu Glu Ser Gly
Gly Arg Leu Val Thr Pro Gly Thr Pro1 5 10 15Leu Thr Leu Thr Cys Thr
Ala Ser Gly Phe Ser Leu Ser Asn Tyr Tyr 20 25 30Val Thr Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly 35 40 45Ile Ile Tyr Gly
Ser Asp Glu Thr Ala Tyr Ala Thr Trp Ala Ile Gly 50 55 60Arg Phe Thr
Ile Ser Lys Thr Ser Thr Thr Val Asp Leu Lys Met Thr65 70 75 80Ser
Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys Ala Arg Asp Asp 85 90
95Ser Ser Asp Trp Asp Ala Lys Phe Asn Leu Trp Gly Gln Gly Thr Leu
100 105 110Val Thr Val Ser Ser 11565397PRTHomo sapiens 653Glu Val
Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Val Ser Ser Asn 20 25
30Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45Ser Val Ile Tyr Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
Lys 50 55 60Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu
Tyr Leu65 70 75 80Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys Ala 85 90 95Arg65497PRTHomo sapiens 654Glu Val Gln Leu
Val Glu Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Thr Val Ser Ser Asn 20 25 30Tyr Met
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser
Val Ile Tyr Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 50 55
60Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu65
70 75 80Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
Ala 85 90 95Arg65598PRTHomo sapiens 655Glu Val Gln Leu Leu Glu Ser
Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ala Met Ser Trp Val
Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Val Ile Tyr
Ser Gly Gly Ser Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90
95Ala Lys656120PRTArtificial sequenceHumanized antibody 656Glu Val
Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Leu Ser Asn Tyr 20 25
30Tyr Val Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45Gly Ile Ile Tyr Gly Ser Asp Glu Thr Ala Tyr Ala Thr Trp Ala
Ile 50 55 60Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu
Tyr Leu65 70 75 80Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys Ala 85 90 95Arg Asp Asp Ser Ser Asp Trp Asp Ala Lys Phe
Asn Leu Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser 115
120657120PRTArtificial sequenceHumanized antibody 657Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Leu Ser Asn Tyr 20 25 30Tyr
Val Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Ile Ile Tyr Gly Ser Asp Glu Thr Ala Tyr Ala Thr Ser Ala Ile
50 55 60Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
Leu65 70 75 80Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
Tyr Cys Ala 85 90 95Arg Asp Asp Ser Ser Asp Trp Asp Ala Lys Phe Asn
Leu Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser 115
120658166PRTOryctolagus cuniculus 658Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Leu
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Ala Ser Gly Phe Ser Leu Ser 35 40 45Asn Tyr Tyr Val
Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile Gly
Ile Ile Tyr Gly Ser Asp Glu Thr Ala Tyr Ala Thr Ser65 70 75 80Ala
Ile Gly Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu 85 90
95Lys Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys Ala
100 105 110Arg Asp Asp Ser Ser Asp Trp Asp Ala Lys Phe Asn Leu Trp
Gly Gln 115 120 125Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys
Gly Pro Ser Val 130 135 140Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr
Ser Gly Gly Thr Ala Ala145 150 155 160Leu Gly Cys Leu Val Lys
16565916PRTOryctolagus cuniculus 659Ile Ile Tyr Gly Ser Asp Glu Thr
Ala Tyr Ala Thr Ser Ala Ile Gly1 5 10 15660122PRTOryctolagus
cuniculus 660Met Asp Thr Arg Ala Pro Thr Gln Leu Leu Gly Leu Leu
Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys Ala Tyr Asp Met Thr Gln
Thr Pro Ala Ser 20 25 30Val Ser Ala Ala Val Gly Gly Thr Val Thr Ile
Lys Cys Gln Ala Ser 35 40 45Gln Ser Ile Asn Asn Glu Leu Ser Trp Tyr
Gln Gln Lys Pro Gly Gln 50 55 60Arg Pro Lys Leu Leu Ile Tyr Arg Ala
Ser Thr Leu Ala Ser Gly Val65 70 75 80Ser Ser Arg Phe Lys Gly Ser
Gly Ser Gly Thr Glu Phe Thr Leu Thr 85 90 95Ile Ser Asp Leu Glu Cys
Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Gln 100 105 110Gly Tyr Ser Leu
Arg Asn Ile Asp Asn Ala 115 120661125PRTOryctolagus cuniculus
661Met Glu Thr Gly Leu Arg Trp Leu Leu Leu Val Ala Val Leu Lys Gly1
5 10 15Val Gln Cys Gln Ser Leu Glu Glu Ser Gly Gly Arg Leu Val Thr
Pro 20 25 30Gly Thr Pro Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser
Leu Ser 35 40 45Asn Tyr Tyr Val Thr Trp Val Arg Gln Ala Pro Gly Lys
Gly Leu Glu 50 55 60Trp Ile Gly Ile Ile Tyr Gly Ser Asp Glu Thr Ala
Tyr Ala Thr Trp65 70 75 80Ala Ile Gly Arg Phe Thr Ile Ser Lys Thr
Ser Thr Thr Val Asp Leu 85 90 95Lys Met Thr Ser Leu Thr Ala Ala Asp
Thr Ala Thr Tyr Phe Cys Ala 100 105 110Arg Asp Asp Ser Ser Asp Trp
Asp Ala Lys Phe Asn Leu 115 120 125662366DNAOryctolagus cuniculus
662atggacacga gggcccccac tcagctgctg gggctcctgc tgctctggct
cccaggtgcc 60agatgtgcct atgatatgac ccagactcca gcctcggtgt ctgcagctgt
gggaggcaca 120gtcaccatca agtgccaggc cagtcagagc attaacaatg
aattatcctg gtatcagcag 180aaaccagggc agcgtcccaa gctcctgatc
tatagggcat ccactctggc atctggggtc 240tcatcgcggt tcaaaggcag
tggatctggg acagagttca ctctcaccat cagcgacctg 300gagtgtgccg
atgctgccac ttactactgt caacagggtt atagtctgag gaatattgat 360aatgct
366663375DNAOryctolagus cuniculus 663atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcgctggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acagcctctg
gattctccct cagtaactac tacgtgacct gggtccgcca ggctccaggg
180aaggggctgg aatggatcgg aatcatttat ggtagtgatg aaacggccta
cgcgacctgg 240gcgataggcc gattcaccat ctccaaaacc tcgaccacgg
tggatctgaa aatgaccagt 300ctgacagccg cggacacggc cacctatttc
tgtgccagag atgatagtag tgactgggat 360gcaaaattta acttg
375664450PRTOryctolagus cuniculus 664Glu Val Gln Leu Val Glu Ser
Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Phe Ser Leu Ser Asn Tyr 20 25 30Tyr Val Thr Trp Val
Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Ile Ile Tyr
Gly Ser Asp Glu Thr Ala Tyr Ala Thr Trp Ala Ile 50 55 60Gly Arg Phe
Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu65 70 75 80Gln
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90
95Arg Asp Asp Ser Ser Asp Trp Asp Ala Lys Phe Asn Leu Trp Gly Gln
100 105 110Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro
Ser Val 115 120 125Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly
Gly Thr Ala Ala 130 135 140Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro
Glu Pro Val Thr Val Ser145 150 155 160Trp Asn Ser Gly Ala Leu Thr
Ser Gly Val His Thr Phe Pro Ala Val 165 170 175Leu Gln Ser Ser Gly
Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190Ser Ser Ser
Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195 200 205Pro
Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp 210 215
220Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly
Gly225 230 235 240Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr Leu Met Ile 245 250 255Ser Arg Thr Pro Glu Val Thr Cys Val Val
Val Asp Val Ser His Glu 260 265 270Asp Pro Glu Val Lys Phe Asn Trp
Tyr Val Asp Gly Val Glu Val His 275 280 285Asn Ala Lys Thr Lys Pro
Arg Glu Glu Gln Tyr Ala Ser Thr Tyr Arg 290 295 300Val Val Ser Val
Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys305 310 315 320Glu
Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 325 330
335Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr
340 345 350Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val
Ser Leu 355 360 365Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile
Ala Val Glu Trp 370 375 380Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr
Lys Thr Thr Pro Pro Val385 390 395 400Leu Asp Ser Asp Gly Ser Phe
Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415Lys Ser Arg Trp Gln
Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430Glu Ala Leu
His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440 445Gly
Lys 450665450PRTOryctolagus cuniculus 665Glu Val Gln Leu Val Glu
Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser
Cys Ala Ala Ser Gly Phe Ser Leu Ser Asn Tyr 20 25 30Tyr Val Thr Trp
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Ile Ile
Tyr Gly Ser Asp Glu Thr Ala Tyr Ala Thr Ser Ala Ile 50 55 60Gly Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu65 70 75
80Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95Arg Asp Asp Ser Ser Asp Trp Asp Ala Lys Phe Asn Leu Trp Gly
Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly
Pro Ser Val 115 120 125Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser
Gly Gly Thr Ala Ala 130 135 140Leu Gly Cys Leu Val Lys Asp Tyr Phe
Pro Glu Pro Val Thr Val Ser145 150 155 160Trp Asn Ser Gly Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175Leu Gln Ser Ser
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190Ser Ser
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195 200
205Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp
210 215 220Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu
Gly Gly225 230 235 240Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys
Asp Thr Leu Met Ile 245 250 255Ser Arg Thr Pro Glu Val Thr Cys Val
Val Val Asp Val Ser His Glu 260 265 270Asp Pro Glu Val Lys Phe Asn
Trp Tyr Val Asp Gly Val Glu Val His 275 280 285Asn Ala Lys Thr Lys
Pro Arg Glu Glu Gln Tyr Ala Ser Thr Tyr Arg 290 295 300Val Val Ser
Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys305 310 315
320Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu
325 330 335Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln
Val Tyr 340 345 350Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn
Gln Val Ser Leu 355 360 365Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser
Asp Ile Ala Val Glu Trp 370 375 380Glu Ser Asn Gly Gln Pro Glu Asn
Asn Tyr Lys Thr Thr Pro Pro Val385 390 395 400Leu Asp Ser Asp Gly
Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415Lys Ser Arg
Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430Glu
Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440
445Gly Lys 450666216PRTOryctolagus cuniculus 666Ile Gln Met Thr Gln
Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp1 5 10 15Arg Val Thr Ile
Thr Cys Gln Ala Ser Gln Ser Ile Asn Asn Glu Leu 20 25 30Ser Trp Tyr
Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
Leu Ile Tyr 35 40 45Arg Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg
Phe Ser Gly Ser 50 55 60Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser
Ser Leu Gln Pro Asp65 70 75 80Asp Phe Ala Thr Tyr Tyr Cys Gln Gln
Gly Tyr Ser Leu Arg Asn Ile 85 90 95Asp Asn Ala Phe Gly Gly Gly Thr
Lys Val Glu Ile Lys Arg Thr Val 100 105 110Ala Ala Pro Ser Val Phe
Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys 115 120 125Ser Gly Thr Ala
Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg 130 135 140Glu Ala
Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn145 150 155
160Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser
165 170 175Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys
His Lys 180 185 190Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser
Ser Pro Val Thr 195 200 205Lys Ser Phe Asn Arg Gly Glu Cys 210
215667122PRTOryctolagus cuniculus 667Met Asp Thr Arg Ala Pro Thr
Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys
Ala Tyr Asp Met Thr Gln Thr Pro Ala Ser 20 25 30Val Glu Val Ala Val
Gly Gly Thr Val Thr Ile Asn Cys Gln Ala Ser 35 40 45Glu Thr Ile Tyr
Ser Trp Leu Ser Trp Tyr Gln Gln Lys Pro Gly Gln 50 55 60Pro Pro Lys
Leu Leu Ile Tyr Gln Ala Ser Asp Leu Ala Ser Gly Val65 70 75 80Pro
Ser Arg Phe Ser Gly Ser Gly Ala Gly Thr Glu Tyr Thr Leu Thr 85 90
95Ile Ser Gly Val Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Gln
100 105 110Gly Tyr Ser Gly Ser Asn Val Asp Asn Val 115
120668126PRTOryctolagus cuniculus 668Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Glu Gln
Leu Lys Glu Ser Gly Gly Arg Leu Val Thr 20 25 30Pro Gly Thr Pro Leu
Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Leu 35 40 45Asn Asp His Ala
Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 50 55 60Glu Tyr Ile
Gly Phe Ile Asn Ser Gly Gly Ser Ala Arg Tyr Ala Ser65 70 75 80Trp
Ala Glu Gly Arg Phe Thr Ile Ser Arg Thr Ser Thr Thr Val Asp 85 90
95Leu Lys Met Thr Ser Leu Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys
100 105 110Val Arg Gly Gly Ala Val Trp Ser Ile His Ser Phe Asp Pro
115 120 125669366DNAOryctolagus cuniculus 669atggacacga gggcccccac
tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60agatgtgcct atgatatgac
ccagactcca gcctctgtgg aggtagctgt gggaggcaca 120gtcaccatca
attgccaggc cagtgagacc atttacagtt ggttatcctg gtatcagcag
180aagccagggc agcctcccaa gctcctgatc taccaggcat ccgatctggc
atctggggtc 240ccatcgcgat tcagcggcag tggggctggg acagagtaca
ctctcaccat cagcggcgtg 300cagtgtgacg atgctgccac ttactactgt
caacagggtt atagtggtag taatgttgat 360aatgtt 366670378DNAOryctolagus
cuniculus 670atggagactg ggctgcgctg gcttctcctg gtcgctgtgc tcaaaggtgt
ccagtgtcag 60gagcagctga aggagtccgg gggtcgcctg gtcacgcctg ggacacccct
gacacttacc 120tgcacagcct ctggattctc cctcaatgac catgcaatgg
gctgggtccg ccaggctcca 180gggaaggggc tggaatacat cggattcatt
aatagtggtg gtagcgcacg ctacgcgagc 240tgggcagaag gccgattcac
catctccaga acctcgacca cggtggatct gaaaatgacc 300agtctgacaa
ccgaggacac ggccacctat ttctgtgtca gagggggtgc tgtttggagt
360attcatagtt ttgatccc 378671123PRTOryctolagus cuniculus 671Met Asp
Thr Arg Ala Pro Thr Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu
Pro Gly Ala Thr Phe Ala Ala Val Leu Thr Gln Thr Pro Ser Pro 20 25
30Val Ser Ala Ala Val Gly Gly Thr Val Ser Ile Ser Cys Gln Ala Ser
35 40 45Gln Ser Val Tyr Asp Asn Asn Tyr Leu Ser Trp Phe Gln Gln Lys
Pro 50 55 60Gly Gln Pro Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Leu
Ala Ser65 70 75 80Gly Val Pro Ser Arg Phe Val Gly Ser Gly Ser Gly
Thr Gln Phe Thr 85 90 95Leu Thr Ile Thr Asp Val Gln Cys Asp Asp Ala
Ala Thr Tyr Tyr Cys 100 105 110Ala Gly Val Tyr Asp Asp Asp Ser Asp
Asn Ala 115 120672125PRTOryctolagus cuniculus 672Met Glu Thr Gly
Leu Arg Trp Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys
Gln Ser Leu Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr
Pro Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Leu Ser 35 40 45Val
Tyr Tyr Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55
60Trp Ile Gly Phe Ile Thr Met Ser Asp Asn Ile Asn Tyr Ala Ser Trp65
70 75 80Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp
Leu 85 90 95Lys Met Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe
Cys Ala 100 105 110Arg Ser Arg Gly Trp Gly Thr Met Gly Arg Leu Asp
Leu 115 120 125673369DNAOryctolagus cuniculus 673atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60acatttgccg
ccgtgctgac ccagactcca tctcccgtgt ctgcagctgt gggaggcaca
120gtcagcatca gttgccaggc cagtcagagt gtttatgaca acaactactt
atcctggttt 180cagcagaaac cagggcagcc tcccaagctc ctgatctatg
gtgcatccac tctggcatct 240ggggtcccat cgcggttcgt gggcagtgga
tctgggacac agttcactct caccatcaca 300gacgtgcagt gtgacgatgc
tgccacttac tattgtgcag gcgtttatga tgatgatagt 360gataatgcc
369674375DNAOryctolagus cuniculus 674atggagactg ggctgcgctg
gcttctcctg gtggctgtgc tcaaaggtgt ccagtgtcag 60tcgctggagg agtccggggg
tcgcctggtc acccctggga cacccctgac actcacctgc 120acagcctctg
gattctccct cagtgtctac tacatgaact gggtccgcca ggctccaggg
180aaggggctgg aatggatcgg attcattaca atgagtgata atataaatta
cgcgagctgg 240gcgaaaggcc gattcaccat ctccaaaacc tcgaccacgg
tggatctgaa aatgaccagt 300ccgacaaccg aggacacggc cacctatttc
tgtgccagga gtcgtggctg gggtacaatg 360ggtcggttgg atctc
375675123PRTOryctolagus cuniculus 675Met Asp Thr Arg Ala Pro Thr
Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Ile Cys
Asp Pro Val Leu Thr Gln Thr Pro Ser Pro 20 25 30Val Ser Ala Pro Val
Gly Gly Thr Val Ser Ile Ser Cys Gln Ala Ser 35 40 45Gln Ser Val Tyr
Glu Asn Asn Tyr Leu Ser Trp Phe Gln Gln Lys Pro 50 55 60Gly Gln Pro
Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Leu Asp Ser65 70 75 80Gly
Val Pro Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Gln Phe Thr 85 90
95Leu Thr Ile Thr Asp Val Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys
100 105 110Ala Gly Val Tyr Asp Asp Asp Ser Asp Asp Ala 115
120676126PRTOryctolagus cuniculus 676Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Glu Gln
Leu Lys Glu Ser Gly Gly Gly Leu Val Thr 20 25 30Pro Gly Gly Thr Leu
Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Leu 35 40 45Asn Ala Tyr Tyr
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 50 55 60Glu Trp Ile
Gly Phe Ile Thr Leu Asn Asn Asn Val Ala Tyr Ala Asn65 70 75 80Trp
Ala Lys Gly Arg Phe Thr Phe Ser Lys Thr Ser Thr Thr Val Asp 85 90
95Leu Lys Met Thr Ser Pro Thr Pro Glu Asp Thr Ala Thr Tyr Phe Cys
100 105 110Ala Arg Ser Arg Gly Trp Gly Ala Met Gly Arg Leu Asp Leu
115 120 125677369DNAOryctolagus cuniculus 677atggacacga gggcccccac
tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60atatgtgacc ctgtgctgac
ccagactcca tctcccgtat ctgcacctgt gggaggcaca 120gtcagcatca
gttgccaggc cagtcagagt gtttatgaga acaactattt atcctggttt
180cagcagaaac cagggcagcc tcccaagctc ctgatctatg gtgcatccac
tctggattct 240ggggtcccat cgcggttcaa aggcagtgga tctgggacac
agttcactct caccattaca 300gacgtgcagt gtgacgatgc tgccacttac
tattgtgcag gcgtttatga tgatgatagt 360gatgatgcc
369678378DNAOryctolagus cuniculus 678atggagactg ggctgcgctg
gcttctcctg gtggctgtgc tcaaaggtgt ccagtgtcag 60gagcagctga aggagtccgg
aggaggcctg gtaacgcctg gaggaaccct gacactcacc 120tgcacagcct
ctggattctc cctcaatgcc tactacatga actgggtccg ccaggctcca
180gggaaggggc tggaatggat cggattcatt actctgaata ataatgtagc
ttacgcgaac 240tgggcgaaag gccgattcac cttctccaaa acctcgacca
cggtggatct gaaaatgacc 300agtccgacac ccgaggacac ggccacctat
ttctgtgcca ggagtcgtgg ctggggtgca 360atgggtcggt tggatctc
378679122PRTOryctolagus cuniculus 679Met Asp Thr Arg Ala Pro Thr
Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Thr Phe
Ala Gln Val Leu Thr Gln Thr Pro Ser Pro 20 25 30Val Ser Ala Ala Val
Gly Gly Thr Val Thr Ile Asn Cys Gln Ala Ser 35 40 45Gln Ser Val Asp
Asp Asn Asn Trp Leu Gly Trp Tyr Gln Gln Lys Arg 50 55 60Gly Gln Pro
Pro Lys Tyr Leu Ile Tyr Ser Ala Ser Thr Leu Ala Ser65 70 75 80Gly
Val Pro Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Gln Phe Thr 85 90
95Leu Thr Ile Ser Asp Leu Glu Cys Asp Asp Ala Ala Thr Tyr Tyr Cys
100 105 110Ala Gly Gly Phe Ser Gly Asn Ile Phe Ala 115
120680122PRTOryctolagus cuniculus 680Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Val
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser 35 40 45Ser Tyr Ala Met
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile Gly
Ile Ile Gly Gly Phe Gly Thr Thr Tyr Tyr Ala Thr Trp65 70 75 80Ala
Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu 85 90
95Arg Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Ala
100 105 110Arg Gly Gly Pro Gly Asn Gly Gly Asp Ile 115
120681366DNAOryctolagus cuniculus 681atggacacga gggcccccac
tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60acatttgccc aagtgctgac
ccagactcca tcgcctgtgt ctgcagctgt gggaggcaca 120gtcaccatca
actgccaggc cagtcagagt gttgatgata acaactggtt aggctggtat
180cagcagaaac gagggcagcc tcccaagtac ctgatctatt ctgcatccac
tctggcatct 240ggggtcccat cgcggttcaa aggcagtgga tctgggacac
agttcactct caccatcagc 300gacctggagt gtgacgatgc tgccacttac
tactgtgcag gcggttttag tggtaatatc 360tttgct 366682366DNAOryctolagus
cuniculus 682atggagactg ggctgcgctg gcttctcctg gtcgctgtgc tcaaaggtgt
ccagtgtcag 60tcggtggagg agtccggggg tcgcctggtc acgcctggga cacccctgac
actcacctgc 120acagtctctg gcttctccct cagtagctat gcaatgagct
gggtccgcca ggctccagga 180aaggggctgg agtggatcgg aatcattggt
ggttttggta ccacatacta cgcgacctgg 240gcgaaaggcc gattcaccat
ctccaaaacc tcgaccacgg tggatctgag aatcaccagt 300ccgacaaccg
aggacacggc cacctatttc tgtgccagag gtggtcctgg taatggtggt 360gacatc
366683122PRTOryctolagus cuniculus 683Met Asp Thr Arg Ala Pro Thr
Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Thr Phe
Ala Ala Val Leu Thr Gln Thr Pro Ser Pro 20 25 30Val Ser Val Pro Val
Gly Gly Thr Val Thr Ile Lys Cys Gln Ser Ser 35 40 45Gln Ser Val Tyr
Asn Asn Phe Leu Ser Trp Tyr Gln Gln Lys Pro Gly 50 55 60Gln Pro Pro
Lys Leu Leu Ile Tyr Gln Ala Ser Lys Leu Ala Ser Gly65 70 75 80Val
Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu 85 90
95Thr Ile Ser Gly Val Gln Cys Asp Asp Ala Ala Thr Tyr Tyr Cys Leu
100 105 110Gly Gly Tyr Asp Asp Asp Ala Asp Asn Ala 115
120684128PRTOryctolagus cuniculus 684Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Lys Gly1 5 10 15Val Gln Cys Gln Ser Val
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Val Ser Gly Ile Asp Leu Ser 35 40 45Asp Tyr Ala Met
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile Gly
Ile Ile Tyr Ala Gly Ser Gly Ser Thr Trp Tyr Ala Ser65 70 75 80Trp
Ala Lys Gly Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp 85 90
95Leu Lys Ile Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys
100 105 110Ala Arg Asp Gly Tyr Asp Asp Tyr Gly Asp Phe Asp Arg Leu
Asp Leu 115 120 125685366DNAOryctolagus cuniculus 685atggacacga
gggcccccac tcagctgctg gggctcctgc tgctctggct cccaggtgcc 60acatttgcag
ccgtgctgac ccagacacca tcgcccgtgt ctgtacctgt gggaggcaca
120gtcaccatca agtgccagtc cagtcagagt gtttataata atttcttatc
gtggtatcag 180cagaaaccag ggcagcctcc caagctcctg atctaccagg
catccaaact ggcatctggg 240gtcccagata ggttcagcgg cagtggatct
gggacacagt tcactctcac catcagcggc 300gtgcagtgtg acgatgctgc
cacttactac tgtctaggcg gttatgatga tgatgctgat 360aatgct
366686384DNAOryctolagus cuniculus 686atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tcaaaggtgt ccagtgtcag 60tcggtggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac gctcacctgc 120acagtctctg
gaatcgacct cagtgactat gcaatgagct gggtccgcca ggctccaggg
180aaggggctgg aatggatcgg aatcatttat gctggtagtg gtagcacatg
gtacgcgagc 240tgggcgaaag gccgattcac catctccaaa acctcgacca
cggtggatct gaaaatcacc 300agtccgacaa ccgaggacac ggccacctat
ttctgtgcca gagatggata cgatgactat 360ggtgatttcg atcgattgga tctc
384687122PRTOryctolagus cuniculus 687Met Asp Thr Arg Ala Pro Thr
Gln Leu Leu Gly Leu Leu Leu Leu Trp1 5 10 15Leu Pro Gly Ala Arg Cys
Ala Tyr Asp Met Thr Gln Thr Pro Ala Ser 20 25 30Val Ser Ala Ala Val
Gly Gly Thr Val Thr Ile Lys Cys Gln Ala Ser 35 40 45Gln Ser Ile Asn
Asn Glu Leu Ser Trp Tyr Gln Gln Lys Ser Gly Gln 50 55 60Arg Pro Lys
Leu Leu Ile Tyr Arg Ala Ser Thr Leu Ala Ser Gly Val65 70 75 80Ser
Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr 85 90
95Ile Ser Asp Leu Glu Cys Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Gln
100 105 110Gly Tyr Ser Leu Arg Asn Ile Asp Asn Ala 115
120688125PRTOryctolagus cuniculus 688Met Glu Thr Gly Leu Arg Trp
Leu Leu Leu Val Ala Val Leu Ser Gly1 5 10 15Val Gln Cys Gln Ser Leu
Glu Glu Ser Gly Gly Arg Leu Val Thr Pro 20 25 30Gly Thr Pro Leu Thr
Leu Thr Cys Thr Ala Ser Gly Phe Ser Leu Ser 35 40 45Asn Tyr Tyr Met
Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 50 55 60Trp Ile Gly
Met Ile Tyr Gly Ser Asp Glu Thr Ala Tyr Ala Asn Trp65 70 75 80Ala
Ile Gly Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu 85 90
95Lys Met Thr Ser Leu Thr Ala Ala Asp Thr Ala Thr Tyr Phe Cys Ala
100 105 110Arg Asp Asp Ser Ser Asp Trp Asp Ala Lys Phe Asn Leu 115
120 125689366DNAOryctolagus cuniculus 689atggacacga gggcccccac
tcagctgctg gggctcctgc tgctctggct cccaggtgcc
60agatgtgcct atgatatgac ccagactcca gcctcggtgt ctgcagctgt gggaggcaca
120gtcaccatca aatgccaggc cagtcagagc attaacaatg aattatcctg
gtatcagcag 180aaatcagggc agcgtcccaa gctcctgatc tatagggcat
ccactctggc atctggggtc 240tcatcgcggt tcaaaggcag tggatctggg
acagagttca ctctcaccat cagcgacctg 300gagtgtgccg atgctgccac
ttactactgt caacagggtt atagtctgag gaatattgat 360aatgct
366690375DNAOryctolagus cuniculus 690atggagactg ggctgcgctg
gcttctcctg gtcgctgtgc tctcaggtgt ccagtgtcag 60tcgctggagg agtccggggg
tcgcctggtc acgcctggga cacccctgac actcacctgc 120acagcctctg
gattctccct cagtaactac tacatgacct gggtccgcca ggctccaggg
180aaggggctgg aatggatcgg aatgatttat ggtagtgatg aaacagccta
cgcgaactgg 240gcgataggcc gattcaccat ctccaaaacc tcgaccacgg
tggatctgaa aatgaccagt 300ctgacagccg cggacacggc cacctatttc
tgtgccagag atgatagtag tgactgggat 360gcaaaattta acttg
375691450PRTOryctolagus cuniculus 691Glu Val Gln Leu Val Glu Ser
Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Phe Ser Leu Ser Asn Tyr 20 25 30Tyr Met Thr Trp Val
Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Met Ile Tyr
Gly Ser Asp Glu Thr Ala Tyr Ala Asn Trp Ala Ile 50 55 60Gly Arg Phe
Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu65 70 75 80Gln
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90
95Arg Asp Asp Ser Ser Asp Trp Asp Ala Lys Phe Asn Leu Trp Gly Gln
100 105 110Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro
Ser Val 115 120 125Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly
Gly Thr Ala Ala 130 135 140Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro
Glu Pro Val Thr Val Ser145 150 155 160Trp Asn Ser Gly Ala Leu Thr
Ser Gly Val His Thr Phe Pro Ala Val 165 170 175Leu Gln Ser Ser Gly
Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190Ser Ser Ser
Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195 200 205Pro
Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp 210 215
220Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly
Gly225 230 235 240Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr Leu Met Ile 245 250 255Ser Arg Thr Pro Glu Val Thr Cys Val Val
Val Asp Val Ser His Glu 260 265 270Asp Pro Glu Val Lys Phe Asn Trp
Tyr Val Asp Gly Val Glu Val His 275 280 285Asn Ala Lys Thr Lys Pro
Arg Glu Glu Gln Tyr Ala Ser Thr Tyr Arg 290 295 300Val Val Ser Val
Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys305 310 315 320Glu
Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 325 330
335Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr
340 345 350Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val
Ser Leu 355 360 365Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile
Ala Val Glu Trp 370 375 380Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr
Lys Thr Thr Pro Pro Val385 390 395 400Leu Asp Ser Asp Gly Ser Phe
Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415Lys Ser Arg Trp Gln
Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430Glu Ala Leu
His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440 445Gly
Lys 450692450PRTOryctolagus cuniculus 692Glu Val Gln Leu Val Glu
Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser
Cys Ala Ala Ser Gly Phe Ser Leu Ser Asn Tyr 20 25 30Tyr Met Thr Trp
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Met Ile
Tyr Gly Ser Asp Glu Thr Ala Tyr Ala Asn Ser Ala Ile 50 55 60Gly Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu65 70 75
80Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95Arg Asp Asp Ser Ser Asp Trp Asp Ala Lys Phe Asn Leu Trp Gly
Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly
Pro Ser Val 115 120 125Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser
Gly Gly Thr Ala Ala 130 135 140Leu Gly Cys Leu Val Lys Asp Tyr Phe
Pro Glu Pro Val Thr Val Ser145 150 155 160Trp Asn Ser Gly Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170 175Leu Gln Ser Ser
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 180 185 190Ser Ser
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 195 200
205Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp
210 215 220Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu
Gly Gly225 230 235 240Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys
Asp Thr Leu Met Ile 245 250 255Ser Arg Thr Pro Glu Val Thr Cys Val
Val Val Asp Val Ser His Glu 260 265 270Asp Pro Glu Val Lys Phe Asn
Trp Tyr Val Asp Gly Val Glu Val His 275 280 285Asn Ala Lys Thr Lys
Pro Arg Glu Glu Gln Tyr Ala Ser Thr Tyr Arg 290 295 300Val Val Ser
Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys305 310 315
320Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu
325 330 335Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln
Val Tyr 340 345 350Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn
Gln Val Ser Leu 355 360 365Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser
Asp Ile Ala Val Glu Trp 370 375 380Glu Ser Asn Gly Gln Pro Glu Asn
Asn Tyr Lys Thr Thr Pro Pro Val385 390 395 400Leu Asp Ser Asp Gly
Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415Lys Ser Arg
Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430Glu
Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440
445Gly Lys 450693217PRTOryctolagus cuniculus 693Asp Ile Gln Met Thr
Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr
Ile Thr Cys Gln Ala Ser Gln Ser Ile Asn Asn Glu 20 25 30Leu Ser Trp
Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Arg
Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser
Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75
80Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Tyr Ser Leu Arg Asn
85 90 95Ile Asp Asn Ala Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
Thr 100 105 110Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp
Glu Gln Leu 115 120 125Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu
Asn Asn Phe Tyr Pro 130 135 140Arg Glu Ala Lys Val Gln Trp Lys Val
Asp Asn Ala Leu Gln Ser Gly145 150 155 160Asn Ser Gln Glu Ser Val
Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr 165 170 175Ser Leu Ser Ser
Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His 180 185 190Lys Val
Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val 195 200
205Thr Lys Ser Phe Asn Arg Gly Glu Cys 210 21569433DNAOryctolagus
cuniculus 694caggccagtc agagcattaa caatgagtta tcc
3369536DNAOryctolagus cuniculus 695caacagggtt atagtctgag gaacattgat
aatgct 3669648DNAOryctolagus cuniculus 696atcatctatg gtagtgatga
aaccgcctac gctacctccg ctataggc 4869736DNAOryctolagus cuniculus
697gatgatagta gtgactggga tgcaaagttc aacttg 36698336DNAOryctolagus
cuniculus 698gctatccaga tgacccagtc tccttcctcc ctgtctgcat ctgtaggaga
cagagtcacc 60atcacttgcc aggccagtca gagcattaac aatgagttat cctggtatca
gcagaaacca 120gggaaagccc ctaagctcct gatctatagg gcatccactc
tggcatctgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagac
ttcactctca ccatcagcag cctgcagcct 240gatgattttg caacttatta
ctgccaacag ggttatagtc tgaggaacat tgataatgct 300ttcggcggag
ggaccaaggt ggaaatcaaa cgtacg 336699112PRTOryctolagus cuniculus
699Ala Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1
5 10 15Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Ser Ile Asn Asn
Glu 20 25 30Leu Ser Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
Leu Ile 35 40 45Tyr Arg Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg
Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser
Ser Leu Gln Pro65 70 75 80Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln
Gly Tyr Ser Leu Arg Asn 85 90 95Ile Asp Asn Ala Phe Gly Gly Gly Thr
Lys Val Glu Ile Lys Arg Thr 100 105 110700360DNAOryctolagus
cuniculus 700gaggtgcagc tggtggagtc tgggggaggc ttggtccagc ctggggggtc
cctgagactc 60tcctgtgcag cctctggatt ctccctcagt aactactacg tgacctgggt
ccgtcaggct 120ccagggaagg ggctggagtg ggtcggcatc atctatggta
gtgatgaaac cgcctacgct 180acctccgcta taggccgatt caccatctcc
agagacaatt ccaagaacac cctgtatctt 240caaatgaaca gcctgagagc
tgaggacact gctgtgtatt actgtgctag agatgatagt 300agtgactggg
atgcaaagtt caacttgtgg ggccaaggga ccctcgtcac cgtctcgagc
360701651DNAOryctolagus cuniculus 701gctatccaga tgacccagtc
tccttcctcc ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc aggccagtca
gagcattaac aatgagttat cctggtatca gcagaaacca 120gggaaagccc
ctaagctcct gatctatagg gcatccactc tggcatctgg ggtcccatca
180aggttcagcg gcagtggatc tgggacagac ttcactctca ccatcagcag
cctgcagcct 240gatgattttg caacttatta ctgccaacag ggttatagtc
tgaggaacat tgataatgct 300ttcggcggag ggaccaaggt ggaaatcaaa
cgtacggtgg ctgcaccatc tgtcttcatc 360ttcccgccat ctgatgagca
gttgaaatct ggaactgcct ctgttgtgtg cctgctgaat 420aacttctatc
ccagagaggc caaagtacag tggaaggtgg ataacgccct ccaatcgggt
480aactcccagg agagtgtcac agagcaggac agcaaggaca gcacctacag
cctcagcagc 540accctgacgc tgagcaaagc agactacgag aaacacaaag
tctacgcctg cgaagtcacc 600catcagggcc tgagctcgcc cgtcacaaag
agcttcaaca ggggagagtg t 651702217PRTOryctolagus cuniculus 702Ala
Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Ser Ile Asn Asn Glu
20 25 30Leu Ser Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu
Ile 35 40 45Tyr Arg Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe
Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser
Leu Gln Pro65 70 75 80Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly
Tyr Ser Leu Arg Asn 85 90 95Ile Asp Asn Ala Phe Gly Gly Gly Thr Lys
Val Glu Ile Lys Arg Thr 100 105 110Val Ala Ala Pro Ser Val Phe Ile
Phe Pro Pro Ser Asp Glu Gln Leu 115 120 125Lys Ser Gly Thr Ala Ser
Val Val Cys Leu Leu Asn Asn Phe Tyr Pro 130 135 140Arg Glu Ala Lys
Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly145 150 155 160Asn
Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr 165 170
175Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His
180 185 190Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser
Pro Val 195 200 205Thr Lys Ser Phe Asn Arg Gly Glu Cys 210
2157031350DNAOryctolagus cuniculus 703gaggtgcagc tggtggagtc
tgggggaggc ttggtccagc ctggggggtc cctgagactc 60tcctgtgcag cctctggatt
ctccctcagt aactactacg tgacctgggt ccgtcaggct 120ccagggaagg
ggctggagtg ggtcggcatc atctatggta gtgatgaaac cgcctacgct
180acctccgcta taggccgatt caccatctcc agagacaatt ccaagaacac
cctgtatctt 240caaatgaaca gcctgagagc tgaggacact gctgtgtatt
actgtgctag agatgatagt 300agtgactggg atgcaaagtt caacttgtgg
ggccaaggga ccctcgtcac cgtctcgagc 360gcctccacca agggcccatc
ggtcttcccc ctggcaccct cctccaagag cacctctggg 420ggcacagcgg
ccctgggctg cctggtcaag gactacttcc ccgaaccggt gacggtgtcg
480tggaactcag gcgccctgac cagcggcgtg cacaccttcc cggctgtcct
acagtcctca 540ggactctact ccctcagcag cgtggtgacc gtgccctcca
gcagcttggg cacccagacc 600tacatctgca acgtgaatca caagcccagc
aacaccaagg tggacaagag agttgagccc 660aaatcttgtg acaaaactca
cacatgccca ccgtgcccag cacctgaact cctgggggga 720ccgtcagtct
tcctcttccc cccaaaaccc aaggacaccc tcatgatctc ccggacccct
780gaggtcacat gcgtggtggt ggacgtgagc cacgaagacc ctgaggtcaa
gttcaactgg 840tacgtggacg gcgtggaggt gcataatgcc aagacaaagc
cgcgggagga gcagtacgcc 900agcacgtacc gtgtggtcag cgtcctcacc
gtcctgcacc aggactggct gaatggcaag 960gagtacaagt gcaaggtctc
caacaaagcc ctcccagccc ccatcgagaa aaccatctcc 1020aaagccaaag
ggcagccccg agaaccacag gtgtacaccc tgcccccatc ccgggaggag
1080atgaccaaga accaggtcag cctgacctgc ctggtcaaag gcttctatcc
cagcgacatc 1140gccgtggagt gggagagcaa tgggcagccg gagaacaact
acaagaccac gcctcccgtg 1200ctggactccg acggctcctt cttcctctac
agcaagctca ccgtggacaa gagcaggtgg 1260cagcagggga acgtcttctc
atgctccgtg atgcatgagg ctctgcacaa ccactacacg 1320cagaagagcc
tctccctgtc tccgggtaaa 1350704450PRTOryctolagus cuniculus 704Glu Val
Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Leu Ser Asn Tyr 20 25
30Tyr Val Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45Gly Ile Ile Tyr Gly Ser Asp Glu Thr Ala Tyr Ala Thr Ser Ala
Ile 50 55 60Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu
Tyr Leu65 70 75 80Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys Ala 85 90 95Arg Asp Asp Ser Ser Asp Trp Asp Ala Lys Phe
Asn Leu Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser Ala
Ser Thr Lys Gly Pro Ser Val 115 120 125Phe Pro Leu Ala Pro Ser Ser
Lys Ser Thr Ser Gly Gly Thr Ala Ala 130 135 140Leu Gly Cys Leu Val
Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser145 150 155 160Trp Asn
Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 165 170
175Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro
180 185 190Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn
His Lys 195 200 205Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro
Lys Ser Cys Asp 210 215 220Lys Thr His Thr Cys Pro Pro Cys Pro Ala
Pro Glu Leu Leu Gly Gly225 230 235 240Pro Ser Val Phe Leu Phe Pro
Pro Lys Pro Lys Asp Thr Leu Met Ile 245 250 255Ser Arg Thr Pro Glu
Val Thr Cys Val Val Val Asp Val Ser His Glu 260 265 270Asp Pro Glu
Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 275 280 285Asn
Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Ala Ser Thr Tyr Arg 290 295
300Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly
Lys305 310 315 320Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro
Ala Pro Ile Glu 325 330
335Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr
340 345 350Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val
Ser Leu 355 360 365Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile
Ala Val Glu Trp 370 375 380Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr
Lys Thr Thr Pro Pro Val385 390 395 400Leu Asp Ser Asp Gly Ser Phe
Phe Leu Tyr Ser Lys Leu Thr Val Asp 405 410 415Lys Ser Arg Trp Gln
Gln Gly Asn Val Phe Ser Cys Ser Val Met His 420 425 430Glu Ala Leu
His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 435 440 445Gly
Lys 450705705DNAOryctolagus cuniculus 705atgaagtggg taacctttat
ttcccttctg tttctcttta gcagcgctta ttccgctatc 60cagatgaccc agtctccttc
ctccctgtct gcatctgtag gagacagagt caccatcact 120tgccaggcca
gtcagagcat taacaatgag ttatcctggt atcagcagaa accagggaaa
180gcccctaagc tcctgatcta tagggcatcc actctggcat ctggggtccc
atcaaggttc 240agcggcagtg gatctgggac agacttcact ctcaccatca
gcagcctgca gcctgatgat 300tttgcaactt attactgcca acagggttat
agtctgagga acattgataa tgctttcggc 360ggagggacca aggtggaaat
caaacgtacg gtggctgcac catctgtctt catcttcccg 420ccatctgatg
agcagttgaa atctggaact gcctctgttg tgtgcctgct gaataacttc
480tatcccagag aggccaaagt acagtggaag gtggataacg ccctccaatc
gggtaactcc 540caggagagtg tcacagagca ggacagcaag gacagcacct
acagcctcag cagcaccctg 600acgctgagca aagcagacta cgagaaacac
aaagtctacg cctgcgaagt cacccatcag 660ggcctgagct cgcccgtcac
aaagagcttc aacaggggag agtgt 705706235PRTOryctolagus cuniculus
706Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala1
5 10 15Tyr Ser Ala Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala
Ser 20 25 30Val Gly Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Ser
Ile Asn 35 40 45Asn Glu Leu Ser Trp Tyr Gln Gln Lys Pro Gly Lys Ala
Pro Lys Leu 50 55 60Leu Ile Tyr Arg Ala Ser Thr Leu Ala Ser Gly Val
Pro Ser Arg Phe65 70 75 80Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr
Leu Thr Ile Ser Ser Leu 85 90 95Gln Pro Asp Asp Phe Ala Thr Tyr Tyr
Cys Gln Gln Gly Tyr Ser Leu 100 105 110Arg Asn Ile Asp Asn Ala Phe
Gly Gly Gly Thr Lys Val Glu Ile Lys 115 120 125Arg Thr Val Ala Ala
Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 130 135 140Gln Leu Lys
Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe145 150 155
160Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln
165 170 175Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys
Asp Ser 180 185 190Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys
Ala Asp Tyr Glu 195 200 205Lys His Lys Val Tyr Ala Cys Glu Val Thr
His Gln Gly Leu Ser Ser 210 215 220Pro Val Thr Lys Ser Phe Asn Arg
Gly Glu Cys225 230 2357071404DNAOryctolagus cuniculus 707atgaagtggg
taacctttat ttcccttctg tttctcttta gcagcgctta ttccgaggtg 60cagctggtgg
agtctggggg aggcttggtc cagcctgggg ggtccctgag actctcctgt
120gcagcctctg gattctccct cagtaactac tacgtgacct gggtccgtca
ggctccaggg 180aaggggctgg agtgggtcgg catcatctat ggtagtgatg
aaaccgccta cgctacctcc 240gctataggcc gattcaccat ctccagagac
aattccaaga acaccctgta tcttcaaatg 300aacagcctga gagctgagga
cactgctgtg tattactgtg ctagagatga tagtagtgac 360tgggatgcaa
agttcaactt gtggggccaa gggaccctcg tcaccgtctc gagcgcctcc
420accaagggcc catcggtctt ccccctggca ccctcctcca agagcacctc
tgggggcaca 480gcggccctgg gctgcctggt caaggactac ttccccgaac
cggtgacggt gtcgtggaac 540tcaggcgccc tgaccagcgg cgtgcacacc
ttcccggctg tcctacagtc ctcaggactc 600tactccctca gcagcgtggt
gaccgtgccc tccagcagct tgggcaccca gacctacatc 660tgcaacgtga
atcacaagcc cagcaacacc aaggtggaca agagagttga gcccaaatct
720tgtgacaaaa ctcacacatg cccaccgtgc ccagcacctg aactcctggg
gggaccgtca 780gtcttcctct tccccccaaa acccaaggac accctcatga
tctcccggac ccctgaggtc 840acatgcgtgg tggtggacgt gagccacgaa
gaccctgagg tcaagttcaa ctggtacgtg 900gacggcgtgg aggtgcataa
tgccaagaca aagccgcggg aggagcagta cgccagcacg 960taccgtgtgg
tcagcgtcct caccgtcctg caccaggact ggctgaatgg caaggagtac
1020aagtgcaagg tctccaacaa agccctccca gcccccatcg agaaaaccat
ctccaaagcc 1080aaagggcagc cccgagaacc acaggtgtac accctgcccc
catcccggga ggagatgacc 1140aagaaccagg tcagcctgac ctgcctggtc
aaaggcttct atcccagcga catcgccgtg 1200gagtgggaga gcaatgggca
gccggagaac aactacaaga ccacgcctcc cgtgctggac 1260tccgacggct
ccttcttcct ctacagcaag ctcaccgtgg acaagagcag gtggcagcag
1320gggaacgtct tctcatgctc cgtgatgcat gaggctctgc acaaccacta
cacgcagaag 1380agcctctccc tgtctccggg taaa 1404708468PRTOryctolagus
cuniculus 708Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Leu Phe
Ser Ser Ala1 5 10 15Tyr Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Gln Pro 20 25 30Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser
Gly Phe Ser Leu Ser 35 40 45Asn Tyr Tyr Val Thr Trp Val Arg Gln Ala
Pro Gly Lys Gly Leu Glu 50 55 60Trp Val Gly Ile Ile Tyr Gly Ser Asp
Glu Thr Ala Tyr Ala Thr Ser65 70 75 80Ala Ile Gly Arg Phe Thr Ile
Ser Arg Asp Asn Ser Lys Asn Thr Leu 85 90 95Tyr Leu Gln Met Asn Ser
Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr 100 105 110Cys Ala Arg Asp
Asp Ser Ser Asp Trp Asp Ala Lys Phe Asn Leu Trp 115 120 125Gly Gln
Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 130 135
140Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly
Thr145 150 155 160Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro
Glu Pro Val Thr 165 170 175Val Ser Trp Asn Ser Gly Ala Leu Thr Ser
Gly Val His Thr Phe Pro 180 185 190Ala Val Leu Gln Ser Ser Gly Leu
Tyr Ser Leu Ser Ser Val Val Thr 195 200 205Val Pro Ser Ser Ser Leu
Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn 210 215 220His Lys Pro Ser
Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser225 230 235 240Cys
Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 245 250
255Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu
260 265 270Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp
Val Ser 275 280 285His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val
Asp Gly Val Glu 290 295 300Val His Asn Ala Lys Thr Lys Pro Arg Glu
Glu Gln Tyr Ala Ser Thr305 310 315 320Tyr Arg Val Val Ser Val Leu
Thr Val Leu His Gln Asp Trp Leu Asn 325 330 335Gly Lys Glu Tyr Lys
Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 340 345 350Ile Glu Lys
Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln 355 360 365Val
Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val 370 375
380Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala
Val385 390 395 400Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr
Lys Thr Thr Pro 405 410 415Pro Val Leu Asp Ser Asp Gly Ser Phe Phe
Leu Tyr Ser Lys Leu Thr 420 425 430Val Asp Lys Ser Arg Trp Gln Gln
Gly Asn Val Phe Ser Cys Ser Val 435 440 445Met His Glu Ala Leu His
Asn His Tyr Thr Gln Lys Ser Leu Ser Leu 450 455 460Ser Pro Gly
Lys465709111PRTOryctolagus cuniculus 709Ala Ile Gln Met Thr Gln Ser
Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr
Cys Gln Ala Ser Gln Ser Ile Asn Asn Glu 20 25 30Leu Ser Trp Tyr Gln
Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Arg Ala Ser
Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser
Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Asp
Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Tyr Ser Leu Arg Asn 85 90
95Ile Asp Asn Ala Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg 100
105 11071011PRTHomo sapiens 710Arg Ala Ser Gln Gly Ile Arg Asn Asp
Leu Gly1 5 1071111PRTHomo sapiens 711Arg Ala Ser Gln Gly Ile Ser
Asn Tyr Leu Ala1 5 1071211PRTHomo sapiens 712Arg Ala Ser Gln Ser
Ile Ser Ser Trp Leu Ala1 5 107137PRTHomo sapiens 713Ala Ala Ser Ser
Leu Gln Ser1 57147PRTHomo sapiens 714Ala Ala Ser Thr Leu Gln Ser1
57157PRTHomo sapiens 715Lys Ala Ser Ser Leu Glu Ser1 57165PRTHomo
sapiens 716Ser Asn Tyr Met Ser1 571716PRTHomo sapiens 717Val Ile
Tyr Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly1 5 10
1571817PRTHomo sapiens 718Val Ile Tyr Ser Gly Gly Ser Ser Thr Tyr
Tyr Ala Asp Ser Val Lys1 5 10 15Gly719330PRTArtificial
SequenceGamma-1 constant domain 719Ala Ser Thr Lys Gly Pro Ser Val
Phe Pro Leu Ala Pro Ser Ser Lys1 5 10 15Ser Thr Ser Gly Gly Thr Ala
Ala Leu Gly Cys Leu Val Lys Asp Tyr 20 25 30Phe Pro Glu Pro Val Thr
Val Ser Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45Gly Val His Thr Phe
Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60Leu Ser Ser Val
Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr65 70 75 80Tyr Ile
Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys 85 90 95Arg
Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys 100 105
110Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro
115 120 125Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val
Thr Cys 130 135 140Val Val Val Asp Val Ser His Glu Asp Pro Glu Val
Lys Phe Asn Trp145 150 155 160Tyr Val Asp Gly Val Glu Val His Asn
Ala Lys Thr Lys Pro Arg Glu 165 170 175Glu Gln Tyr Ala Ser Thr Tyr
Arg Val Val Ser Val Leu Thr Val Leu 180 185 190His Gln Asp Trp Leu
Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn 195 200 205Lys Ala Leu
Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly 210 215 220Gln
Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu225 230
235 240Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe
Tyr 245 250 255Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln
Pro Glu Asn 260 265 270Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser
Asp Gly Ser Phe Phe 275 280 285Leu Tyr Ser Lys Leu Thr Val Asp Lys
Ser Arg Trp Gln Gln Gly Asn 290 295 300Val Phe Ser Cys Ser Val Met
His Glu Ala Leu His Asn His Tyr Thr305 310 315 320Gln Lys Ser Leu
Ser Leu Ser Pro Gly Lys 325 330720297DNAOryctolagus cuniculus
720atccagatga cccagtctcc ttcctccctg tctgcatctg taggagacag
agtcaccatc 60acttgccagg ccagtcagag cattaacaat gagttatcct ggtatcagca
gaaaccaggg 120aaagccccta agctcctgat ctatagggca tccactctgg
catctggggt cccatcaagg 180ttcagcggca gtggatctgg gacagacttc
actctcacca tcagcagcct gcagcctgat 240gattttgcaa cttattactg
ccaacagggt tatagtctga ggaacattga taatgct 297721333DNAOryctolagus
cuniculus 721gcctatgata tgacccagac tccagcctcg gtgtctgcag ctgtgggagg
cacagtcacc 60atcaagtgcc aggccagtca gagcattaac aatgaattat cctggtatca
gcagaaacca 120gggcagcgtc ccaagctcct gatctatagg gcatccactc
tggcatctgg ggtctcatcg 180cggttcaaag gcagtggatc tgggacagag
ttcactctca ccatcagcga cctggagtgt 240gccgatgctg ccacttacta
ctgtcaacag ggttatagtc tgaggaatat tgataatgct 300ttcggcggag
ggaccgaggt ggtggtcaaa cgt 333722648DNAOryctolagus cuniculus
722atccagatga cccagtctcc ttcctccctg tctgcatctg taggagacag
agtcaccatc 60acttgccagg ccagtcagag cattaacaat gagttatcct ggtatcagca
gaaaccaggg 120aaagccccta agctcctgat ctatagggca tccactctgg
catctggggt cccatcaagg 180ttcagcggca gtggatctgg gacagacttc
actctcacca tcagcagcct gcagcctgat 240gattttgcaa cttattactg
ccaacagggt tatagtctga ggaacattga taatgctttc 300ggcggaggga
ccaaggtgga aatcaaacgt acggtggctg caccatctgt cttcatcttc
360ccgccatctg atgagcagtt gaaatctgga actgcctctg ttgtgtgcct
gctgaataac 420ttctatccca gagaggccaa agtacagtgg aaggtggata
acgccctcca atcgggtaac 480tcccaggaga gtgtcacaga gcaggacagc
aaggacagca cctacagcct cagcagcacc 540ctgacgctga gcaaagcaga
ctacgagaaa cacaaagtct acgcctgcga agtcacccat 600cagggcctga
gctcgcccgt cacaaagagc ttcaacaggg gagagtgt 648723333DNAOryctolagus
cuniculus 723gctatccaga tgacccagtc tccttcctcc ctgtctgcat ctgtaggaga
cagagtcacc 60atcacttgcc aggccagtca gagcattaac aatgagttat cctggtatca
gcagaaacca 120gggaaagccc ctaagctcct gatctatagg gcatccactc
tggcatctgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagac
ttcactctca ccatcagcag cctgcagcct 240gatgattttg caacttatta
ctgccaacag ggttatagtc tgaggaacat tgataatgct 300ttcggcggag
ggaccaaggt ggaaatcaaa cgt 333724327DNAOryctolagus cuniculus
724gaggtgcagc tggtggagtc tgggggaggc ttggtccagc ctggggggtc
cctgagactc 60tcctgtgcag cctctggatt ctccctcagt aactactacg tgacctgggt
ccgtcaggct 120ccagggaagg ggctggagtg ggtcggcatc atctatggta
gtgatgaaac cgcctacgct 180acctccgcta taggccgatt caccatctcc
agagacaatt ccaagaacac cctgtatctt 240caaatgaaca gcctgagagc
tgaggacact gctgtgtatt actgtgctag agatgatagt 300agtgactggg
atgcaaagtt caacttg 327725351DNAOryctolagus cuniculus 725cagtcgctgg
aggagtccgg gggtcgcctg gtcacgcctg ggacacccct gacactcacc 60tgcacagcct
ctggattctc cctcagtaac tactacgtga cctgggtccg ccaggctcca
120gggaaggggc tggaatggat cggaatcatt tatggtagtg atgaaacggc
ctacgcgacc 180tgggcgatag gccgattcac catctccaaa acctcgacca
cggtggatct gaaaatgacc 240agtctgacag ccgcggacac ggccacctat
ttctgtgcca gagatgatag tagtgactgg 300gatgcaaaat ttaacttgtg
gggccaaggc accctggtca ccgtctcgag c 351726224PRTHomo sapiens 726Met
Glu Lys Leu Leu Cys Phe Leu Val Leu Thr Ser Leu Ser His Ala1 5 10
15Phe Gly Gln Thr Asp Met Ser Arg Lys Ala Phe Val Phe Pro Lys Glu
20 25 30Ser Asp Thr Ser Tyr Val Ser Leu Lys Ala Pro Leu Thr Lys Pro
Leu 35 40 45Lys Ala Phe Thr Val Cys Leu His Phe Tyr Thr Glu Leu Ser
Ser Thr 50 55 60Arg Gly Tyr Ser Ile Phe Ser Tyr Ala Thr Lys Arg Gln
Asp Asn Glu65 70 75 80Ile Leu Ile Phe Trp Ser Lys Asp Ile Gly Tyr
Ser Phe Thr Val Gly 85 90 95Gly Ser Glu Ile Leu Phe Glu Val Pro Glu
Val Thr Val Ala Pro Val 100 105 110His Ile Cys Thr Ser Trp Glu Ser
Ala Ser Gly Ile Val Glu Phe Trp 115 120 125Val Asp Gly Lys Pro Arg
Val Arg Lys Ser Leu Lys Lys Gly Tyr Thr 130 135 140Val Gly Ala Glu
Ala Ser Ile Ile Leu Gly Gln Glu Gln Asp Ser Phe145 150 155 160Gly
Gly Asn Phe Glu Gly Ser Gln Ser Leu Val Gly Asp Ile Gly Asn 165 170
175Val Asn Met Trp Asp Phe Val Leu Ser Pro Asp Glu Ile Asn Thr Ile
180 185 190Tyr Leu Gly Gly Pro Phe Ser Pro Asn Val Leu Asn Trp Arg
Ala Leu 195 200 205Lys Tyr Glu Val Gln Gly Glu Val Phe Thr Lys Pro
Gln Leu Trp Pro 210 215 220727468PRTHomo sapiens 727Met Leu Ala Val
Gly Cys Ala Leu Leu Ala Ala Leu Leu Ala Ala Pro1 5 10 15Gly Ala Ala
Leu Ala Pro Arg Arg Cys Pro Ala Gln Glu Val Ala Arg 20 25 30Gly Val
Leu Thr Ser Leu Pro Gly Asp Ser Val Thr Leu Thr Cys Pro 35 40 45Gly
Val Glu Pro Glu Asp Asn Ala Thr Val His Trp Val Leu Arg Lys 50 55
60Pro Ala Ala Gly Ser His
Pro Ser Arg Trp Ala Gly Met Gly Arg Arg65 70 75 80Leu Leu Leu Arg
Ser Val Gln Leu His Asp Ser Gly Asn Tyr Ser Cys 85 90 95Tyr Arg Ala
Gly Arg Pro Ala Gly Thr Val His Leu Leu Val Asp Val 100 105 110Pro
Pro Glu Glu Pro Gln Leu Ser Cys Phe Arg Lys Ser Pro Leu Ser 115 120
125Asn Val Val Cys Glu Trp Gly Pro Arg Ser Thr Pro Ser Leu Thr Thr
130 135 140Lys Ala Val Leu Leu Val Arg Lys Phe Gln Asn Ser Pro Ala
Glu Asp145 150 155 160Phe Gln Glu Pro Cys Gln Tyr Ser Gln Glu Ser
Gln Lys Phe Ser Cys 165 170 175Gln Leu Ala Val Pro Glu Gly Asp Ser
Ser Phe Tyr Ile Val Ser Met 180 185 190Cys Val Ala Ser Ser Val Gly
Ser Lys Phe Ser Lys Thr Gln Thr Phe 195 200 205Gln Gly Cys Gly Ile
Leu Gln Pro Asp Pro Pro Ala Asn Ile Thr Val 210 215 220Thr Ala Val
Ala Arg Asn Pro Arg Trp Leu Ser Val Thr Trp Gln Asp225 230 235
240Pro His Ser Trp Asn Ser Ser Phe Tyr Arg Leu Arg Phe Glu Leu Arg
245 250 255Tyr Arg Ala Glu Arg Ser Lys Thr Phe Thr Thr Trp Met Val
Lys Asp 260 265 270Leu Gln His His Cys Val Ile His Asp Ala Trp Ser
Gly Leu Arg His 275 280 285Val Val Gln Leu Arg Ala Gln Glu Glu Phe
Gly Gln Gly Glu Trp Ser 290 295 300Glu Trp Ser Pro Glu Ala Met Gly
Thr Pro Trp Thr Glu Ser Arg Ser305 310 315 320Pro Pro Ala Glu Asn
Glu Val Ser Thr Pro Met Gln Ala Leu Thr Thr 325 330 335Asn Lys Asp
Asp Asp Asn Ile Leu Phe Arg Asp Ser Ala Asn Ala Thr 340 345 350Ser
Leu Pro Val Gln Asp Ser Ser Ser Val Pro Leu Pro Thr Phe Leu 355 360
365Val Ala Gly Gly Ser Leu Ala Phe Gly Thr Leu Leu Cys Ile Ala Ile
370 375 380Val Leu Arg Phe Lys Lys Thr Trp Lys Leu Arg Ala Leu Lys
Glu Gly385 390 395 400Lys Thr Ser Met His Pro Pro Tyr Ser Leu Gly
Gln Leu Val Pro Glu 405 410 415Arg Pro Arg Pro Thr Pro Val Leu Val
Pro Leu Ile Ser Pro Pro Val 420 425 430Ser Pro Ser Ser Leu Gly Ser
Asp Asn Thr Ser Ser His Asn Arg Pro 435 440 445Asp Ala Arg Asp Pro
Arg Ser Pro Tyr Asp Ile Ser Asn Thr Asp Tyr 450 455 460Phe Phe Pro
Arg465728918PRTHomo sapiens 728Met Leu Thr Leu Gln Thr Trp Val Val
Gln Ala Leu Phe Ile Phe Leu1 5 10 15Thr Thr Glu Ser Thr Gly Glu Leu
Leu Asp Pro Cys Gly Tyr Ile Ser 20 25 30Pro Glu Ser Pro Val Val Gln
Leu His Ser Asn Phe Thr Ala Val Cys 35 40 45Val Leu Lys Glu Lys Cys
Met Asp Tyr Phe His Val Asn Ala Asn Tyr 50 55 60Ile Val Trp Lys Thr
Asn His Phe Thr Ile Pro Lys Glu Gln Tyr Thr65 70 75 80Ile Ile Asn
Arg Thr Ala Ser Ser Val Thr Phe Thr Asp Ile Ala Ser 85 90 95Leu Asn
Ile Gln Leu Thr Cys Asn Ile Leu Thr Phe Gly Gln Leu Glu 100 105
110Gln Asn Val Tyr Gly Ile Thr Ile Ile Ser Gly Leu Pro Pro Glu Lys
115 120 125Pro Lys Asn Leu Ser Cys Ile Val Asn Glu Gly Lys Lys Met
Arg Cys 130 135 140Glu Trp Asp Gly Gly Arg Glu Thr His Leu Glu Thr
Asn Phe Thr Leu145 150 155 160Lys Ser Glu Trp Ala Thr His Lys Phe
Ala Asp Cys Lys Ala Lys Arg 165 170 175Asp Thr Pro Thr Ser Cys Thr
Val Asp Tyr Ser Thr Val Tyr Phe Val 180 185 190Asn Ile Glu Val Trp
Val Glu Ala Glu Asn Ala Leu Gly Lys Val Thr 195 200 205Ser Asp His
Ile Asn Phe Asp Pro Val Tyr Lys Val Lys Pro Asn Pro 210 215 220Pro
His Asn Leu Ser Val Ile Asn Ser Glu Glu Leu Ser Ser Ile Leu225 230
235 240Lys Leu Thr Trp Thr Asn Pro Ser Ile Lys Ser Val Ile Ile Leu
Lys 245 250 255Tyr Asn Ile Gln Tyr Arg Thr Lys Asp Ala Ser Thr Trp
Ser Gln Ile 260 265 270Pro Pro Glu Asp Thr Ala Ser Thr Arg Ser Ser
Phe Thr Val Gln Asp 275 280 285Leu Lys Pro Phe Thr Glu Tyr Val Phe
Arg Ile Arg Cys Met Lys Glu 290 295 300Asp Gly Lys Gly Tyr Trp Ser
Asp Trp Ser Glu Glu Ala Ser Gly Ile305 310 315 320Thr Tyr Glu Asp
Arg Pro Ser Lys Ala Pro Ser Phe Trp Tyr Lys Ile 325 330 335Asp Pro
Ser His Thr Gln Gly Tyr Arg Thr Val Gln Leu Val Trp Lys 340 345
350Thr Leu Pro Pro Phe Glu Ala Asn Gly Lys Ile Leu Asp Tyr Glu Val
355 360 365Thr Leu Thr Arg Trp Lys Ser His Leu Gln Asn Tyr Thr Val
Asn Ala 370 375 380Thr Lys Leu Thr Val Asn Leu Thr Asn Asp Arg Tyr
Leu Ala Thr Leu385 390 395 400Thr Val Arg Asn Leu Val Gly Lys Ser
Asp Ala Ala Val Leu Thr Ile 405 410 415Pro Ala Cys Asp Phe Gln Ala
Thr His Pro Val Met Asp Leu Lys Ala 420 425 430Phe Pro Lys Asp Asn
Met Leu Trp Val Glu Trp Thr Thr Pro Arg Glu 435 440 445Ser Val Lys
Lys Tyr Ile Leu Glu Trp Cys Val Leu Ser Asp Lys Ala 450 455 460Pro
Cys Ile Thr Asp Trp Gln Gln Glu Asp Gly Thr Val His Arg Thr465 470
475 480Tyr Leu Arg Gly Asn Leu Ala Glu Ser Lys Cys Tyr Leu Ile Thr
Val 485 490 495Thr Pro Val Tyr Ala Asp Gly Pro Gly Ser Pro Glu Ser
Ile Lys Ala 500 505 510Tyr Leu Lys Gln Ala Pro Pro Ser Lys Gly Pro
Thr Val Arg Thr Lys 515 520 525Lys Val Gly Lys Asn Glu Ala Val Leu
Glu Trp Asp Gln Leu Pro Val 530 535 540Asp Val Gln Asn Gly Phe Ile
Arg Asn Tyr Thr Ile Phe Tyr Arg Thr545 550 555 560Ile Ile Gly Asn
Glu Thr Ala Val Asn Val Asp Ser Ser His Thr Glu 565 570 575Tyr Thr
Leu Ser Ser Leu Thr Ser Asp Thr Leu Tyr Met Val Arg Met 580 585
590Ala Ala Tyr Thr Asp Glu Gly Gly Lys Asp Gly Pro Glu Phe Thr Phe
595 600 605Thr Thr Pro Lys Phe Ala Gln Gly Glu Ile Glu Ala Ile Val
Val Pro 610 615 620Val Cys Leu Ala Phe Leu Leu Thr Thr Leu Leu Gly
Val Leu Phe Cys625 630 635 640Phe Asn Lys Arg Asp Leu Ile Lys Lys
His Ile Trp Pro Asn Val Pro 645 650 655Asp Pro Ser Lys Ser His Ile
Ala Gln Trp Ser Pro His Thr Pro Pro 660 665 670Arg His Asn Phe Asn
Ser Lys Asp Gln Met Tyr Ser Asp Gly Asn Phe 675 680 685Thr Asp Val
Ser Val Val Glu Ile Glu Ala Asn Asp Lys Lys Pro Phe 690 695 700Pro
Glu Asp Leu Lys Ser Leu Asp Leu Phe Lys Lys Glu Lys Ile Asn705 710
715 720Thr Glu Gly His Ser Ser Gly Ile Gly Gly Ser Ser Cys Met Ser
Ser 725 730 735Ser Arg Pro Ser Ile Ser Ser Ser Asp Glu Asn Glu Ser
Ser Gln Asn 740 745 750Thr Ser Ser Thr Val Gln Tyr Ser Thr Val Val
His Ser Gly Tyr Arg 755 760 765His Gln Val Pro Ser Val Gln Val Phe
Ser Arg Ser Glu Ser Thr Gln 770 775 780Pro Leu Leu Asp Ser Glu Glu
Arg Pro Glu Asp Leu Gln Leu Val Asp785 790 795 800His Val Asp Gly
Gly Asp Gly Ile Leu Pro Arg Gln Gln Tyr Phe Lys 805 810 815Gln Asn
Cys Ser Gln His Glu Ser Ser Pro Asp Ile Ser His Phe Glu 820 825
830Arg Ser Lys Gln Val Ser Ser Val Asn Glu Glu Asp Phe Val Arg Leu
835 840 845Lys Gln Gln Ile Ser Asp His Ile Ser Gln Ser Cys Gly Ser
Gly Gln 850 855 860Met Lys Met Phe Gln Glu Val Ser Ala Ala Asp Ala
Phe Gly Pro Gly865 870 875 880Thr Glu Gly Gln Val Glu Arg Phe Glu
Thr Val Gly Met Glu Ala Ala 885 890 895Thr Asp Glu Gly Met Pro Lys
Ser Tyr Leu Pro Gln Thr Val Arg Gln 900 905 910Gly Gly Tyr Met Pro
Gln 91572932DNAArtificial SequenceChemically Synthesized
729agcgcttatt ccgctatcca gatgacccag tc 3273022DNAArtificial
SequenceChemically Synthesized 730cgtacgtttg atttccacct tg
2273132DNAArtificial SequenceChemically Synthesized 731agcgcttatt
ccgaggtgca gctggtggag tc 3273220DNAArtificial SequenceChemically
Synthesized 732ctcgagacgg tgacgagggt 20733111PRTArtificial
SequenceChemically Synthesized 733Ala Tyr Asp Met Thr Gln Thr Pro
Ala Ser Val Glu Val Ala Val Gly1 5 10 15Gly Thr Val Thr Ile Asn Cys
Gln Ala Ser Glu Thr Ile Tyr Ser Trp 20 25 30Leu Ser Trp Tyr Gln Gln
Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 35 40 45Tyr Gln Ala Ser Asp
Leu Ala Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ala Gly
Thr Glu Tyr Thr Leu Thr Ile Ser Gly Val Gln Cys65 70 75 80Asp Asp
Ala Ala Thr Tyr Tyr Cys Gln Gln Gly Tyr Ser Gly Ser Asn 85 90 95Val
Asp Asn Val Phe Gly Gly Gly Thr Glu Val Val Val Lys Arg 100 105
11073499PRTArtificial SequenceChemically Synthesized 734Asp Ile Gln
Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg
Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Trp 20 25 30Leu
Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40
45Tyr Lys Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln
Pro65 70 75 80Asp Asp Phe Ala Thr Tyr Tyr Cys Phe Gly Gly Gly Thr
Lys Val Glu 85 90 95Ile Lys Arg73588PRTArtificial
SequenceChemically Synthesized 735Asp Ile Gln Met Thr Gln Ser Pro
Ser Thr Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys
Arg Ala Ser Gln Ser Ile Ser Ser Trp 20 25 30Leu Ala Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Asp Ala Ser Ser
Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly
Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Asp Asp
Phe Ala Thr Tyr Tyr Cys 8573688PRTArtificial SequenceChemically
Synthesized 736Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala
Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser
Ile Ser Ser Tyr 20 25 30Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala
Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val
Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr
Cys 85737111PRTArtificial SequenceChemically Synthesized 737Asp Ile
Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly1 5 10 15Asp
Arg Val Thr Ile Thr Cys Gln Ala Ser Glu Thr Ile Tyr Ser Trp 20 25
30Leu Ser Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45Tyr Gln Ala Ser Asp Leu Ala Ser Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu
Gln Pro65 70 75 80Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Tyr
Ser Gly Ser Asn 85 90 95Val Asp Asn Val Phe Gly Gly Gly Thr Lys Val
Glu Ile Lys Arg 100 105 110738118PRTArtificial SequenceChemically
Synthesized 738Gln Glu Gln Leu Lys Glu Ser Gly Gly Arg Leu Val Thr
Pro Gly Thr1 5 10 15Pro Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser
Leu Asn Asp His 20 25 30Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys
Gly Leu Glu Tyr Ile 35 40 45Gly Phe Ile Asn Ser Gly Gly Ser Ala Arg
Tyr Ala Ser Trp Ala Glu 50 55 60Gly Arg Phe Thr Ile Ser Arg Thr Ser
Thr Thr Val Asp Leu Lys Met65 70 75 80Thr Ser Leu Thr Thr Glu Asp
Thr Ala Thr Tyr Phe Cys Val Arg Gly 85 90 95Gly Ala Val Trp Ser Ile
His Ser Phe Asp Pro Trp Gly Pro Gly Thr 100 105 110Leu Val Thr Val
Ser Ser 115739109PRTArtificial SequenceChemically Synthesized
739Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1
5 10 15Ser Leu Arg Leu Ser Cys Ser Ala Ser Gly Phe Thr Phe Ser Ser
Tyr 20 25 30Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Tyr Val 35 40 45Ser Ala Ile Ser Ser Asn Gly Gly Ser Thr Tyr Tyr Ala
Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys
Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Trp Gly Gln Gly Thr Leu Val
Thr Val Ser Ser 100 10574097PRTArtificial SequenceChemically
Synthesized 740Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln
Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr
Val Ser Ser Asn 20 25 30Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys
Gly Leu Glu Trp Val 35 40 45Ser Val Ile Tyr Ser Gly Gly Ser Thr Tyr
Tyr Ala Asp Ser Val Lys 50 55 60Gly Arg Phe Thr Ile Ser Arg Asp Asn
Ser Lys Asn Thr Leu Tyr Leu65 70 75 80Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Arg74197PRTArtificial
SequenceChemically Synthesized 741Glu Val Gln Leu Val Glu Thr Gly
Gly Gly Leu Ile Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Phe Thr Val Ser Ser Asn 20 25 30Tyr Met Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Val Ile Tyr Ser
Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60Gly Arg Phe Thr
Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu65 70 75 80Gln Met
Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90
95Arg742120PRTArtificial SequenceChemically Synthesized 742Gln Val
Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser
Leu Arg Leu Ser Cys Ser Ala Ser Gly Phe Ser Leu Asn Asp His 20 25
30Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val
35 40 45Gly Phe Ile Asn Ser Gly Gly Ser Ala Arg Tyr Ala Ser Ser Ala
Glu 50 55 60Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu
Tyr Leu65 70 75 80Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys Ala 85 90
95Arg Gly Gly Ala Val Trp Ser Ile His Ser Phe Asp Pro Trp Gly Gln
100 105 110Gly Thr Leu Val Thr Val Ser Ser 115 1207434PRTArtificial
SynthesizedChemically Synthesized 743Phe Gly Gly
Gly17444PRTArtificial SequenceChemically Synthesized 744Val Val Lys
Arg174511PRTArtificial SequenceChemically Synthesized 745Phe Gly
Gly Gly Thr Lys Val Glu Ile Lys Arg1 5 107464PRTArtificial
SequenceChemically SynthesizedVARIANT(3)..(3)Xaa may be Q or P
746Trp Gly Xaa Gly17474PRTArtificial SequenceChemically Synthesized
747Thr Val Ser Ser174811PRTArtificial SequenceChemically
Synthesized 748Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser1 5
10
* * * * *