U.S. patent application number 16/199970 was filed with the patent office on 2020-04-23 for therapeutic nanoparticles and related compositions, methods and systems.
The applicant listed for this patent is Genesegues, Inc.. Invention is credited to Gretchen M. Unger.
Application Number | 20200121602 16/199970 |
Document ID | / |
Family ID | 54200055 |
Filed Date | 2020-04-23 |
![](/patent/app/20200121602/US20200121602A1-20200423-C00001.png)
![](/patent/app/20200121602/US20200121602A1-20200423-C00002.png)
![](/patent/app/20200121602/US20200121602A1-20200423-C00003.png)
United States Patent
Application |
20200121602 |
Kind Code |
A1 |
Unger; Gretchen M. |
April 23, 2020 |
THERAPEUTIC NANOPARTICLES AND RELATED COMPOSITIONS, METHODS AND
SYSTEMS
Abstract
Disclosed are targeted sub-50 nanometer nanoparticles suitable
for delivering bioactive agents of interest, and related
compositions, methods, and systems, which improve the
manufacturing, stability, efficacy and other aspects of therapeutic
nanoparticles.
Inventors: |
Unger; Gretchen M.; (Chaska,
MN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Genesegues, Inc. |
Chaska |
MN |
US |
|
|
Family ID: |
54200055 |
Appl. No.: |
16/199970 |
Filed: |
November 26, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15963626 |
Apr 26, 2018 |
|
|
|
16199970 |
|
|
|
|
14844828 |
Sep 3, 2015 |
|
|
|
15963626 |
|
|
|
|
62045519 |
Sep 3, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 9/5169 20130101;
A61K 9/141 20130101; A61P 35/00 20180101; A61K 9/5161 20130101;
A61K 31/7088 20130101; A61K 9/1075 20130101; C12N 15/88
20130101 |
International
Class: |
A61K 9/14 20060101
A61K009/14; C12N 15/88 20060101 C12N015/88; A61K 9/51 20060101
A61K009/51; A61K 9/107 20060101 A61K009/107; A61K 31/7088 20060101
A61K031/7088 |
Goverment Interests
STATEMENT REGARDING GOVERNMENT RIGHTS
[0003] This invention was made with government support under
Contract No. HHSN261201300030C awarded by the National Institutes
of Health. Thus, the government has certain rights in the
invention.
Claims
1. A composition comprising nanoparticles, wherein the
nanoparticles comprise: at least one bioactive agent, a surfactant
having an HLB value of less than 6.0 units, a ligand, and Li+ and
Cs+, wherein: i) the at least one bioactive agent and the
surfactant form a surfactant micelle core; ii) the ligand forms a
shell; and iii) the nanoparticles have an average diameter of less
than about 50 nanometers.
2. The composition of claim 1, wherein the nanoparticles are
prepared using sterile water.
3. The composition of claim 1, wherein the at least one bioactive
agent is a polynucleotide or a plasmid DNA.
4. The composition of claim 1, wherein: i) the at least one
bioactive agent comprises a plurality of polynucleotides, each
comprising a 3' RNA portion and a 5' primarily DNA portion, wherein
the number 2 position from the 5' end of each polynucleotide is a
2'-OMe modified RNA, wherein the sequence of more than about 40%
and less than about 60% of the plurality of polynucleotides on
average comprises SEQ ID NO: 8, and the sequence of the remainder
of the plurality of polynucleotides on average comprises SEQ ID NO:
9, and ii) the ligand is a protein targeting a tenascin
receptor.
5. The composition of claim 4, wherein the protein is
tenfibgen.
6. A method of administering at least one bioactive agent to a
subject, the method comprising administering to the subject the
composition of claim 1.
7. A method for treating a patient with a solid tumor cancer,
comprising administering to the patient a therapeutically effective
amount of the composition of claim 1, wherein i) the at least one
bioactive agent comprises a plurality of polynucleotides, each
comprising a 3' RNA portion and a 5' primarily DNA portion, wherein
the number 2 position from the 5' end of each polynucleotide is a
2'-OMe modified RNA, wherein the sequence of more than about 40%
and less than about 60% of the plurality of polynucleotides on
average comprises SEQ ID NO: 8, and the sequence of the remainder
of the plurality of polynucleotides on average comprises SEQ ID NO:
9, and ii) the ligand is a protein targeting a tenascin
receptor.
8. A method for preparing the composition of claim 1, the method
comprising: i) complexing at least one bioactive agent with a
condensing agent to form a condensed bioactive agent; ii)
dispersing the condensed bioactive agent into a water-miscible
solvent comprising a surfactant with an HLB of less than 6.0 to
form a surfactant micelle; iii) adsorbing a ligand to the exterior
surface of the surfactant micelle to form a ligand particle; and
iv) mixing and incubating the ligand particle with (a) Li+
pre-treated with Cs+ and (b) sterile water to form the
composition.
9. The composition of claim 1, wherein the Li+ is pretreated with
Cs+.
10. The composition of claim 1, wherein the ligand comprises a
protein, a peptide, a polypeptide, a carbohydrate,
polyvinylpyrrolidone (PVP), an antibody, or a biocompatible
polymer, or fragments thereof, or a small molecule.
11. The method of claim 8, wherein the at least one bioactive agent
is a polynucleotide or plasmid DNA.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of application Ser. No.
15/963,626 filed Apr. 26, 2018, which claims the benefit of
application Ser. No. 14/844,828 filed Sep. 3, 2015, which claims
the benefit of U.S. Provisional Application No. 62/045,519 filed
Sep. 3, 2014.
RELATED APPLICATIONS AND INCORPORATIONS BY REFERENCE
[0002] Each of the applications and patents cited in this text, as
well as each document or reference cited in each of the
applications and patents (including during the prosecution of each
issued patent; "application cited documents"), and each of the PCT
and foreign applications or patents corresponding to and/or
claiming priority from any of these applications and patents, and
each of the documents cited or referenced in each of the
application cited documents, are hereby expressly incorporated
herein by reference and may be employed in the practice of the
invention. More generally, documents or references are cited in
this text, either in a Reference List before the claims, or in the
text itself; and, each of these documents or references ("herein
cited references"), as well as each document or reference cited in
each of the herein cited references (including any manufacturer's
specifications, instructions, etc.), is hereby expressly
incorporated herein by reference.
SEQUENCE LISTING
[0004] The instant application contains a Sequence Listing, which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Sep. 1, 2015, is named 0269.13US_SL.txt and is 9,515 bytes in
size.
BACKGROUND
[0005] Effective delivery of agents of interest to cells, tissues,
organs, and organisms has been a challenge in biomedicine, imaging,
and other fields where delivery of molecules of various sizes and
dimensions to a predetermined target is desirable. Whether for
pathological examination, therapeutic treatment, or fundamental
biology studies, several methods are known and used for delivering
various classes of biomaterials and biomolecules, which are
typically associated with a biological and/or chemical activity of
interest. As the number of molecules suitable to be used as
chemical or biological agents (e.g., drugs, biologics, therapeutic
or imaging agents) increases, development of a delivery system
suitable for use with compounds of varied complexity, dimensions,
and chemical nature has proven to be particularly challenging.
[0006] Nanoparticles are structures useful as carriers for
delivering agents with various methods of delivery. Several
nanoparticle delivery systems exist, which utilize an array of
different strategies to package, transport, and deliver an agent to
specific targets. However, a need exists for nanoparticle
therapeutics (and methods of making such nanoparticles) that are
capable of delivering therapeutic levels of drug to cellular and
molecular targets to improve treatment of diseases.
[0007] Polynucleotides have important therapeutic applications in
medicine. Polynucleotides can be used to modulate (increase or
decrease) the expression of genes that are responsible for a
particular disease. Gene silencing technology employs
polynucleotides that hybridize to a target nucleic acid and
modulate gene expression activities or function, such as
transcription or translation. Importantly, gene-silencing agents
are a promising alternative to traditional small organic compounds
that inhibit the function of a protein linked to a disease. RNAseH,
small interfering RNAs (siRNAs), microRNAs (miRNAs), and small
hairpin RNAs (shRNAs) are examples of gene silencing compounds and
mechanisms that prevent the formation of proteins by gene
silencing.
[0008] A need persists for delivery systems and therapeutic agents
that are capable of specifically modulating gene expression to
improve treatment of diseases.
BRIEF SUMMARY OF THE INVENTION
[0009] Provided herein are non-viral nanoparticles and related
compositions, methods, and systems that can be used for carrying
and delivering a wide range of molecules of various sizes,
dimensions, and chemical natures, including to predetermined
targets. One having skill in the art, once armed with this
disclosure, will be able, without undue experimentation, to
identify, prepare, and exploit non-viral nanoparticles for these
and other uses.
[0010] In one aspect, the invention provides a system for the
delivery of therapeutics, vaccines, and/or diagnostic agents to a
desired target. When nanoparticles are formulated with sterile
water, such as in the course of developing or manufacturing a
pharmaceutically acceptable therapeutic nanoparticle, and a lithium
dopant that has been pre-treated with cesium, significant benefits
and unexpected advantages are achieved. Such significant benefits
and unexpected advantages include, but are not limited to, greater
stability of the nanoparticles, including increased capabilities
for reliable transport of the nanoparticles, more flexibility and
efficiency in employing the disclosed nanoparticles in drug
development, such as manufacturing at multiple sites, and other
advantages evident to the person of ordinary skill in the art.
[0011] The compositions and methods disclosed herein demonstrate
the flexibility of the inventive nanoparticles to successfully
accommodate ligands and cargoes of choice. In one embodiment, the
nanoparticle comprises a core comprised of a bioactive agent
including, for example, a drug, vaccine, and/or diagnostic agent,
with an optional condensing agent; a surfactant substantially
surrounding the core to form a surfactant-coated complex, wherein
the surfactant has an hydrophile-lipophile balance (HLB) value of
less than about 6.0 units; and a shell that non-covalently adheres
to and substantially surrounds the surfactant-coated complex,
wherein the shell comprises a targeting moiety (ligand), wherein
the shell has been formed with a cationic agent comprising lithium
pre-treated with cesium. The mean diameter of the nanoparticle is
less than about 50 nanometers (i.e., a sub-50 nm particle).
[0012] Also disclosed herein are DNA/RNA chimeric single-stranded
polynucleotides of up to about 50 nucleotides in length and capable
of specifically hybridizing to the corresponding RNA nucleic acid
sequence of Casein Kinase 2 (CK2) alpha and DNA/RNA chimeric
single-stranded polynucleotides of up to about 50 nucleotides in
length and capable of specifically hybridizing to the corresponding
RNA sequence of CK2 alpha prime, as well as methods of preparing
and using a combination ("mix") of said polynucleotides comprising
different sequences to decrease or inhibit expression of CK2 alpha
and CK2 alpha prime and inhibit the growth of solid tumors.
Non-limiting examples of such polynucleotides include SEQ ID NO:8
against CK2 alpha and SEQ ID NO:9 against CK2 alpha prime.
[0013] Additionally disclosed herein are CK2-targeted
polynucleotides with backbones modified to substitute the number 2
position from the 5'end to a 2' O-Methylated (2' O-Me) RNA
nucleotide. Non-limiting examples of such backbone-modified
polynucleotides are provided in Table 2, below.
[0014] In another aspect of the invention, combining and
incorporating a mix of thus modified, CK2-targeted polynucleotides
in a tumor-targeted sub-50 nanometer capsule results in a
therapeutic composition of nanoparticles that, upon administration
to a subject, significantly reduces or inhibits tumor growth, tumor
cell proliferation, and/or inflammation.
[0015] Thus, in one aspect, the invention provides a composition
comprising nanoparticles, wherein the nanoparticles comprise: at
least one bioactive agent, a surfactant having an HLB value of less
than 6.0 units, a ligand, and Li.sup.+ and Cs.sup.+, wherein: i)
the at least one bioactive agent and the surfactant form a
surfactant micelle core, ii) the ligand forms a shell, and iii) the
nanoparticles have an average diameter of less than 50 nanometers.
In one embodiment, the ligand forms an exterior shell. In another
embodiment, the nanoparticles are prepared using sterile water.
[0016] In still another embodiment, the at least one bioactive
agent is a polynucleotide. In still another embodiment, the at
least one bioactive agent is a plasmid DNA. In yet another
embodiment, the Li.sup.+ is pre-treated with Cs.sup.+.
[0017] In another aspect, the invention provides a system for
delivering at least one bioactive agent to a target, the system
comprising at least one bioactive agent, a surfactant having an HLB
value of less than 6.0 units, a ligand, and Li.sup.+ pre-treated
with Cs.sup.+, to be assembled in a nanoparticle to be used to
deliver the at least one bioactive agent to the target. In one
embodiment, the bioactive agent is a polynucleotide. In another
embodiment, the target is a cell within the body of a mammal.
[0018] In a further aspect, the invention provides a method of
administering at least one bioactive agent to a subject, the method
comprising administering to the subject a composition comprising
nanoparticles according to the invention.
[0019] In still a further aspect, the invention provides a system
for administering at least one bioactive agent to a subject, the
system comprising at least one bioactive agent, a surfactant having
an HLB value of less than 6.0 units, a ligand, and Li.sup.+
pre-treated with Cs.sup.+, to be assembled in a nanoparticle to be
administered to the subject.
[0020] In one embodiment of a composition according to the
invention, i): the nanoparticles comprise a plurality of
polynucleotides, each comprising a 3' RNA portion and a 5'
primarily DNA portion, wherein the number 2 position from the 5'
end of each polynucleotide is a 2'-OMe-modified RNA, wherein the
sequence of more than about 45% and less than about 55%, of more
than about 40% and less than about 60%, or of more than about 30%
and less than about 70% of the plurality of polynucleotides on
average for the composition of nanoparticles comprises SEQ ID NO:
8, and the sequence of the remainder of the plurality of
polynucleotides comprises SEQ ID NO: 9, and ii) the ligand is a
protein targeting a tenascin receptor. In another embodiment, the
ligand targeting a tenascin receptor is tenfibgen.
[0021] The phrase "composition comprising nanoparticles" or a
similar phrase as used herein refers, without limitation, to a
dose, a sample, a formulation, a manufacturing lot, and other
compositions of matter comprising the inventive nanoparticles.
[0022] In one aspect, the invention provides a polynucleotide
comprising a 3' RNA portion and a 5' primarily DNA portion, wherein
the number 2 position from the 5' end is a 2'-OMe modified RNA,
wherein the polynucleotide comprises up to about 50 consecutive
nucleotides of SEQ ID NO:11 and comprises a portion of at least 8
consecutive nucleotides of SEQ ID NO: 8. In another embodiment, the
polynucleotide is about 20 nucleotides in length and comprises SEQ
ID NO:8.
[0023] In another aspect, the invention provides a polynucleotide
comprising a 3' RNA portion and a 5' primarily DNA portion, wherein
the number 2 position from the 5' end is a 2'-OMe modified RNA,
wherein the polynucleotide comprises up to about 50 consecutive
nucleotides of SEQ ID NO:12 and comprises a portion of at least 8
consecutive nucleotides of SEQ ID NO: 9. In another embodiment, the
polynucleotide is about 20 nucleotides in length and comprises SEQ
ID NO:9.
[0024] In one aspect, the invention provides a method for treating
a patient, comprising administering to the subject a
therapeutically effective amount of a composition according to the
invention, wherein the patient has been diagnosed with a solid
tumor cancer.
[0025] In another aspect, the invention provides a method for
treating a patient diagnosed with a solid tumor cancer, comprising
administering to the patient a therapeutically effective amount of
the composition according to the invention, wherein the
nanoparticles comprise a plurality of polynucleotides, wherein each
of the plurality of polynucleotides comprises a 3'
[0026] RNA portion and a 5' primarily DNA portion, wherein the
number 2 position from the 5' end of the each of the plurality of
polynucleotides is a 2'-OMe modified RNA, wherein the sequence of
the plurality of polynucleotides comprises either SEQ ID NO: 8 or
SEQ ID NO: 9, wherein the percentage of nanoparticles comprising
polynucleotides comprising SEQ ID NO: 8 is at least about 10%,
about 20%, about 30%, about 40%, about 50%, about 60%, about 70%,
about 80%, or about 90%, and the remainder of the nanoparticles
comprise polynucleotides comprising SEQ ID NO: 9, wherein the
ligand is a protein targeting a tenascin receptor.
[0027] In one embodiment, the percentages are determined based upon
the relative levels of CK2 alpha enzymes and CK2 alpha prime
enyzmes measured in tumor tissue from one or more subjects,
optionally compared to relative levels of CK2 alpha and CK2 alpha
prime enzymes in a reference tissue and/or cell culture. In another
embodiment, the percentages are about 50% nanoparticles comprising
SEQ ID NO: 8 and about 50% comprising SEQ ID NO: 9.
[0028] In one aspect, the invention provides a method for preparing
a composition according to the invention, the method comprising: i)
complexing a bioactive agent with a condensing agent to form a
condensed bioactive agent; ii) dispersing the condensed bioactive
agent into a water-miscible solvent comprising a surfactant with an
HLB of less than 6.0 to form a surfactant micelle; iii) adsorbing a
ligand to the exterior surface of the surfactant micelle to form a
ligand-stabilized particle (a.k.a., ligand particle); and iv)
mixing and incubating the ligand particle with Li.sup.+ pretreated
with Cs.sup.+, and sterile water, to form the composition.
[0029] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. While
suitable methods and materials to practice or test the present
invention are provided below, the artisan will recognize that other
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention. In addition, the materials, methods, and examples
iterated herein are illustrative only and not intended to be
limiting.
DETAILED DESCRIPTION OF THE INVENTION
Nanoparticles
[0030] In one aspect, the invention provides stable nanoparticles
for the targeted delivery of bioactive agents to specific tissues
and cells. The inventive nanoparticles have a ligand coating or
shell and an average diameter of less than 50 nanometers, enabling
the delivery of bioactive agent cargo through the biologic barriers
of the body and/or to and into a cell or tissue of interest.
[0031] As used herein, "sub-50 nm nanoparticles" are generally
referred to in the context of a composition of nanoparticles,
wherein said nanoparticles comprise (i) a surfactant micelle
comprising a bioactive agent and a hydrophobic surfactant and (ii)
a shell comprising a ligand, and having an average diameter of less
than about 50 nanometers. In certain embodiments, the nanoparticles
of a composition according to the present invention have an average
diameter of between about 5 and about 50 nanometers, between about
5 and about 40 nanometers, between about 5 and about 30 nanometers,
between about 5 and about 20 nanometers, between about 10 and 40
nanometers, between about 10 and 30 nanometers, or between about 10
and 20 nanometers.
[0032] As used herein, the term "shell" generally refers to the
exterior or outer shell of the nanoparticle and comprises a layer
or coating or corona, which surrounds at least a portion of the
outer surface of the core surfactant micelle. In one embodiment,
the shell comprises one or more ligands. For a given formulation or
composition (used interchangeably herein) of nanoparticles,
incorporation of insufficient weight of ligand will typically
result in non-uniform particles manifested, for example, by
irregular drug-aggregates or fused micelles, while excessive weight
of ligand will typically result in large masses or loss of
spherical or cubical shape manifested, for example, by elongated
structures, as determined by analysis, for example, of TEM or AFM
micrographs. One having skill in the art, once armed with the
instant disclosure, will be able, without undue experimentation, to
identify, prepare, and exploit the use of ligands for incorporation
in the inventive nanoparticles.
[0033] In one aspect, the invention provides a composition
comprising nanoparticles comprising a bioactive agent. The artisan
will understand that the phrase "a composition comprising
nanoparticles comprising (a certain feature, property, etc.)"
indicates that a plurality of the nanoparticles of the composition
comprise the certain feature, property, etc.
[0034] In one embodiment, the nanoparticles are prepared using
sterile water. The terms "prepared," "synthesized," "made",
"manufactured", and the like are used interchangeably herein. The
phrase "nanoparticles (are) prepared using sterile water", as used
herein, means that the salt receiving solution used in the
synthesis of the inventive nanoparticles is prepared with sterile
water. The artisan will understand that the volume of sterile water
added at any step or steps in the preparation of the final salt
receiving solution comprises, in total, at least 80%, 90%, 95%,
96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% of the
total water volume of the final salt receiving solution. In this
context, "final salt receiving solution" refers to the solution
prior to the addition of ligand-stabilized nanoparticles. Within
this framework, other grades of water may be used, for example, as
stock solutions for excipients added to the salt receiving
solution. It is understood that the phrases "nanoparticles prepared
using sterile water" and "salt receiving solution comprising
sterile water" contemplate that sterile water accounts for between
about 80% and 100% of the total water volume of the final salt
receiving solution. "Sterile water", as used in the context of
"nanoparticles prepared using sterile water" and "salt receiving
solution comprising sterile water" refers to water in which the
level of the following metals is no more than about 0.2 parts per
million in sum total: aluminum, arsenic, barium, cadmium, chromium,
copper, iron, lead, magnanese, nickel, rubinium, sulfur, vanadium,
and zinc. In one embodiment, the "sterile water" refers to water in
which the level of the following metals is no more than about 0.1
parts per million in sum total: aluminum, arsenic, barium, cadmium,
chromium, copper, iron, lead, magnanese, nickel, rubinium, sulfur,
vanadium, and zinc. In this framework, levels of each metal and the
sum of the metals are based on results reported down to the Method
Detection Limit (MDL). Metal testing can be performed according to
available methods, such as, for example, U.S. Environmental
Protection Agency methods 6010 and 6020.
[0035] In some embodiments, the use of water of high purity, such
as sterile water, is required to meet regulatory standards for
pharmaceutical products. In some embodiments, the use of sterile
water is desirable to improve control of manufacturing of
nanoparticles by reducing levels of contaminants that can alter
characteristics of the nanoparticle such as size, shape, stability,
and functionality, as determined by, for example, transmission
electron microscopy (TEM) or atomic force microscopy (AFM). In some
embodiments, the use of sterile water is desirable to improve
control of manufacturing nanoparticles by providing a consistent
base to which ingredients such as excipients can be added to
improve nanoparticle characteristics such as size, shape,
stability, and functionality. The ordinarily skilled artisan will
also understand that methods and guidelines are available with
respect to tests, grades, and uses of water in pharmaceutical
research, development, and manufacturing, such as those produced by
United States Pharmacopeia and similar organizations.
[0036] In one embodiment, the sterile water used is pharmaceutical
grade water. In another embodiment, the sterile water is used to
prepare pharmaceutically acceptable therapeutic nanoparticles. The
phrase "pharmaceutically acceptable" is employed herein to refer to
those compounds, materials, compositions, and/or dosage forms that
are, within the scope of sound medical judgment, suitable for use
in contact with the tissues of subjects without excessive toxicity,
irritation, allergic response, or other problem or complication,
commensurate with a reasonable benefit/risk ratio. In one
embodiment, the sterile water is also used in other steps in the
nanoparticle preparation process, such as the solution preparation
of any reagent used in assembling the salt receiving solution or in
preparing one or more components of the nanoparticles prior to
their addition to the salt receiving solution.
[0037] In one embodiment, the nanoparticles comprise the ions
lithium (Li.sup.+) and cesium (Cs.sup.+). In another embodiment,
the nanoparticles comprise Li.sup.+ that has been pre-treated with
Cs.sup.+. The phrase "Li.sup.+ pretreated with Cs.sup.+" and
similar phrases, as used herein, refer to the pre-mixing or
contacting of the Li.sup.+ and Cs.sup.+ ions prior to associating
said pre-mixed or contacted ions with the sterile water volume that
has been or will be used to prepare the salt receiving solution.
The concentration of Li.sup.+ in the pretreatment step should
typically be at least 1M. In one embodiment, the concentration is
2M. In one embodiment, the concentration is 3M. In one embodiment,
the concentration is between 3M and 5M. In one embodiment, the
concentration is 4M. In one embodiment, the concentration is 5M. In
one embodiment, the pretreatment of Li.sup.+ with ions prior to
addition of the Li.sup.+ to the salt receiving bath used to form
the nanoparticles is limited to the ion Cs.sup.+. In said
embodiment, it is understood that the limitation of pretreatment
ions to Cs.sup.+ is contemplated to specifically exclude other ions
being added to the premix but is not contemplated to exclude other
ions that may be present in the water source used to pretreat
Li.sup.+ with Cs.sup.+. The pre-mixing or contacting of Li.sup.+
and Cs.sup.+ ions, for the purposes disclosed and contemplated
herein, can be readily performed according to methods for combining
ions and similar molecules known to the artisan, including simply
mixing the ions in desired concentrations in water, for example,
sterile water. In one embodiment, Cs.sup.+ at about 0.1 .mu.g/1 ml
is added to about 4M Li.sup.+, at about 2.5 ppb Cs.sup.+ to
Li.sup.+ by weight, in sterile water in a 50 ml tube, and rotated
for about 2 minutes. The artisan will understand that the ratio of
Cs.sup.+ to Li.sup.+ used and/or the concentration of the combined
ions in, for example, the sterile water in a 50 ml tube, can be
routinely varied to manipulate the morphology or stability or some
other characteristic of the nanoparticles subsequently
produced.
[0038] In another embodiment, Cs.sup.+ is pre-mixed with Li.sup.+
at a ratio of between about 0.1 and about 100 parts per billion
(ppb). In yet another embodiment, the pre-mix ratio is between
about 0.1 and about 5 ppb. In still another embodiment, the pre-mix
ratio is between about 1 and about 4 ppb. Each of these ranges
include sub-ranges within that range. For example, between about 1
and about 4 ppb includes such ranges as: between about 1.2 and
about 2.5 ppb, and between about 2 and about 4 ppb, and the like.
Surprisingly, for nanoparticles prepared using sterile water, those
particles formulated with Cs.sup.+ pre-mixed with Li.sup.+ formed
desirable spherical, cuboid, or elliptical sub-50 nanometer
nanoparticles, while those particles formulated with Cs.sup.+ and
Li.sup.+ that were simply commingled in the salt receiving solution
and not pre-mixed, generally formed unwound, long rod-like
compositions unsuitable for use. One having skill in the art, once
armed with this disclosure, will be able, through routine
experimentation, to identify, prepare, and exploit the use of
Cs.sup.+ and Li.sup.+ pre-mixtures for the targeted
nanoparticles.
[0039] The disclosed nanoparticles provide a modular targeting
component that can be readily synthesized for a given target, for
example, a given tissue or cellular target, without the steps of
chelating, conjugating, or covalently attaching the targeting
moiety to the nanoparticle. One having skill in the art will
understand that, with judicious selection of a targeting moiety
based upon the intended target and methods and compositions known
in the art, the inventive nanoparticles are capable of delivering
bioactive agents to predetermined target tissue and cells.
[0040] In one embodiment, the shell comprises a ligand. The term
"ligand", as used herein, refers to a substance that binds to a
target receptor. In some embodiments, the ligand comprises a
protein, a peptide, a polypeptide, a carbohydrate,
polyvinylpyrrolidone (PVP), an antibody, or a biocompatible
polymer, or fragments thereof, or a small molecule. In one
embodiment, the sub-50 nm nanoparticles are coated with at least
one tissue- or cell-specific ligand. A "coated nanoparticle" refers
to a nanoparticle wherein the ligand is bound to the core
surfactant micelle via a non-covalent association. The flexibility
of ligand options for the inventive nanoparticles is enabled, in
part, by the absence of such complex steps as attaching the ligand
to the nanoparticle via chelation, conjugation, or covalent
attachment, employing, instead, a straight-forward step of
adsorbing the ligand to the hydrophobic micelle surface, and,
subsequently, stabilizing the targeted particle in a salt
crystallization solution. Thus for example, adsorption of the
ligand to the core surfactant micelle allows for more efficient
incorporation of larger ligands than nanoparticles where ligands
are conjugated or chelated to the core particle. Diverse ligands
including, for example, tenfibgen, hyaluronan, and synthetic
polymers such as PVP, may be utilized as ligands in formulating the
inventive Cs.sup.+-treated nanoparticles. For example, a particle
comprising PVP would be formulated similarly to Formula J
(Examples, below) for a 5.5 kb plasmid except using 4 .mu.l of 25
kD PEI as a condenser, 3.3 .mu.g of 10 kD PVP as a ligand adsorbed
to the core micelle, and modifying the receiving bath to 1.5 nM
Mg.sup.2+ and 1.88 nM Sr.sup.2+, all other ions the same.
[0041] In one embodiment, the ligand targets cells with tenascin
receptors. In another embodiment, the ligand is tenfibgen.
[0042] In still another embodiment, the ligand is hyaluronan.
[0043] In one aspect, the invention provides a system to deliver a
bioactive agent to a target or to administer a bioactive agent to a
subject. In one embodiment, the system comprises at least one
bioactive agent, for example, a polynucleotide, a surfactant having
an HLB value of less than 6.0 units, a ligand, and Li.sup.+ and
Cs.sup.+, to be assembled in a sub-50 nanometer nanoparticle to be
used to deliver the at least one bioactive agent to the target or
administer the at least one bioactive agent to a subject. The term
"system", as used herein, refers to a formulation or composition
that enables the introduction of a bioactive agent in the body of a
subject and improves its efficacy or performance.
[0044] In one embodiment, the instant nanoparticles incorporate a
bioactive agent or agents useful for modulating gene expression, to
increase or decrease the production of specific gene products
(e.g., proteins or RNA). In another embodiment, the bioactive agent
or agents engage(s) mechanisms of action such as RNaseH, RNAi, and
dsRNA enzymes, as well as other modulating mechanisms based on
target degradation or target occupancy.
Bioactive Agents
[0045] Cs-treated nanoparticles of the present invention can be
used to carry and deliver bioactive agents to targeted tissues and
cells. The phrase "bioactive agent" or "bioactive agents", as used
herein, refers to one or more agents that, when administered or
delivered to a cell, tissue, or organism, mimics, alters, or
modulates one or more physiological, biochemical, or pathological
processes of the cell, tissue. or organism. Preferably, the
alteration or modulation is a medically desirable alteration or
modulation. More specifically, a bioactive agent can be any one or
more of a number of different compounds or molecules for purposes
comprising imaging or monitoring or therapeutic or prophylactic
uses including, but not limited to, a bioactive agent such as an
oligonucleotide, a polynucleotide, a plasmid DNA, any nucleic
acid-based molecule including but not limited to DNA, RNA, siRNA,
mRNA, miRNA, shRNA, aptamers, antisense molecules, or ribozymes, as
well as a protein, a polypeptide, a peptide, a carbohydrate, an
antibody or a small molecule.
[0046] Without wishing to be bound by theory, the flexiblity of
bioactive agent options is enabled, in part, by the partitioning
and condensing features of the hydrophobic-surfactant-coated
micelle that forms the core of the nanoparticle. The artisan would
recognize these features as being suitable and functional for the
purposes of formulating the inventive nanoparticles with
oligonucleotides, polynucleotides, plasmid DNA, any nucleic
acid-based molecule including DNA, RNA, siRNA, miRNA, shRNA,
aptamers, antisense molecules, or ribozymes, proteins,
polypeptides, peptides, carbohydrates, antibodies, or other cargos,
more preferably, but not exclusively, hydrophilic and/or negatively
or approximately neutrally charged cargos. This flexibilty of the
inventive nanoparticles for incorporating a range of bioactive
agents in different formulations is demonstrated, for example, by
the formulation of a 10.5 kb plasmid DNA and hyaluronan
nanoparticle shell with a resulting average diameter of 22.7
nanometers and charge of -6.4 mev, and the formulation of a 6800
dalton single strand oligonucleotide and tenfibgen nanoparticle
shell with a resulting diameter of 19.5 nanometers and charge of
-5.8 mev (see Examples).
[0047] Thus, other diverse bioactive agents can be incorporated in
the cesium-pretreated nanoparticles through routine
experimentation. For example, the small molecule erythritol (MW,
122) would be formulated similar to Formula A (Examples), except
that 500 .mu.g of erythritol without any condenser would be
micellized with 8.75 .mu.g of surfactant, coated with 5.5 mcg of
TBG, and atomized into a receiving bath modified with 6.25 nM of
Mg.sup.2+ and 9.38 nM of Sr2+, all other ions the same. Resulting
nanoparticle size would be approximately 25 nm in diameter, and
surface charge would be approximatly -12 mev.
[0048] The phrase "hydrophobic surfactant-coated", as used herein,
refers to the coating or layer of hydrophobic surfactant used to
form the surfactant micelle, and which surrounds at least a portion
of the bioactive agent and optional condensing agent. For a given
formulation, incorporation of insufficient surfactant will
typically result in irregular drug aggregates, while excessive
surfactant will typically result in surfactant globules, as
determined by analysis for example of TEM or AFM micrographs. In
certain embodiments, the bioactive agent is a single-stranded
chimeric oligonucleotide. Bioactive agents including
oligonucleotides can generally be prepared using techniques well
known in the art but can also be obtained from commercial
manufacturers.
[0049] In one embodiment, the bioactive agent is a plurality of
bioactive agents against a molecular target. In another embodiment,
the bioactive agent comprises a mix of two or more bioactive agents
with different molecular targets and/or mechanisms of action.
[0050] In some embodiments, the bioactive agent is condensed with a
cationic condensing agent comprising polyethyleneimine,
polyornithine, polyarginine, spermine, or other cationic condensing
agent or agents well known in the art.
[0051] "Specifically hybridizable" and "complementary" are terms
that are used to indicate a sufficient degree of complementarity
such that stable and specific binding occurs between a
polynucleotide of the present invention and a target RNA molecule.
It is understood in the art that the sequence of a polynucleotide
need not be 100% complementary to that of its target RNA molecule
to be specifically hybridizable. One of ordinary skill in the art
would recognize that the compounds provided herein are at least
80%, at least 85%, at least 90%, at least 95%, at least 96%, at
least 97%, at least 98%, at least 99% or 100% complementary to a
target nucleic acid. A polynucleotide is specifically hybridizable
when (a) binding of the polynucleotide to the target RNA molecule
interferes with the normal function of the target RNA molecule, and
(b) there is sufficient complementarity so that binding of the
polynucleotide to the target RNA molecule is highly selective and
largely avoids non-specific binding of the polynucleotide to
non-target sequences under conditions in which specific binding is
desired, i.e., under conditions in which in vitro assays are
performed or under physiological conditions for in vivo assays or
therapeutic uses. Examples of methods for designing
oligonucleotides that are sufficiently complementary to be useful
in the present invention and such design skills are within the
purview of one of skill in the art.
[0052] The term "RNA" or "RNA molecule" or "ribonucleic acid
molecule" refers to a polymer of ribonucleotides. "Target RNA"
refers to any RNA that can hybridize with a sufficiently
complementary polynucleotide of the present invention. Target RNA
can include, without limitation, pre-mRNA, pre-miRNA, pri-miRNA,
mRNA, miRNA, small nuclear or cytosolic non-coding regulatory RNAs,
ribosomal RNA, transfer RNAs, hnRNA at any stage in the mRNA
processing pathway, or mitochondrial RNAs. "mRNA" or "messenger
RNA" is single-stranded RNA that specifies the amino acid sequence
of one or more polypeptide chains. In one embodiment, the target
mRNA of the invention specifies the amino acid sequence of a
cellular protein (e.g., a nuclear, cytoplasmic, mitochondrial,
transmembrane, or membrane-associated protein). In another
embodiment, the target mRNA of the invention specifies the amino
acid sequence of an extracellular protein (e.g., an extracellular
matrix protein or secreted protein). The term "DNA" or "DNA
molecule" or "deoxyribonucleic acid molecule" refers to a polymer
of deoxyribonucleotides.
[0053] The term "nucleic acid molecule" or "polynucleotide" refers
to any nucleic acid-containing molecule, including, but not limited
to, DNA and/or RNA of more than 1 nucleotide in either single
chain, duplex, or multiple chain form. The terms encompass
sequences that include any of the known base analogs of DNA and
RNA. The term "polynucleotide" is also meant to encompass
polydeoxyribonucleotides containing 2'-deoxy-D-ribose or modified
forms thereof, RNA and any other type of polynucleotide that is an
N-glycoside or C-glycoside of a purine or pyrimidine base, or
modified purine or pyrimidine base or basic nucleotide. The
polynucleotide, in some embodiments, may encode promoter regions,
operator regions, structural regions, termination regions,
combinations thereof, or any other genetically relevant material
that regulates or modifies chromatin or other polynucleotides.
Similarly, the term "genetic" as used herein, refers to any
material capable of modifying gene expression.
[0054] The term "oligonucleotide" refers to a short length of
single-stranded polynucleotide chain. Oligonucleotides are
typically less than 200 residues long (e.g., between about 8 and
100). The terms "polynucleotide" and "oligonucleotide" are used
interchangeably herein.
[0055] As used herein, "gene silencing," "gene silencing molecule,"
"gene silencing compound", and the like refer to a polynucleotide,
at least a portion of which is at least partially complementary to
a target nucleic acid to which it hybridizes. In certain
embodiments, a gene silencing compound modulates (for example,
decreases) expression or amount of a target nucleic acid. In
certain embodiments, a gene silencing compound alters splicing of a
target pre-mRNA, resulting in a different splice variant. In
certain embodiments, an antisense compound modulates expression of
one or more different target proteins. Gene silencing mechanisms
contemplated herein include, but are not limited to, RNase H
mechanisms, RNAi mechanisms, splicing modulation, translational
arrest, altering RNA processing, inhibiting microRNA function, and
mimicking microRNA function, as well as additional mechanisms
identifiable by the artisan upon reading of the present
disclosure.
[0056] The term "small interfering RNA" ("siRNA") (also referred to
in the art as "short interfering RNAs") refers to an RNA (or RNA
analog) comprising between about 10-50 nucleotides (or nucleotide
analogs) capable of directing or mediating RNA interference. As
used herein, the term "RNA interference" ("RNAi") refers to a
selective intracellular degradation of RNA. In some embodiments,
the bioactive agent is a double-stranded siRNA polynucleotide.
[0057] As used herein, "expression" refers to the process by which
a gene ultimately results in a protein. Expression includes, but is
not limited to, transcription, splicing, post-transcriptional
modification, and translation.
[0058] The term "gene" refers to a nucleic acid (e.g., DNA)
sequence that comprises coding sequences necessary for the
production of a polypeptide, precursor, or RNA (e.g., rRNA, tRNA,
and other ncRNAs). The polypeptide can be encoded by a full length
coding sequence or by any portion of the coding sequence, so long
as the desired activity or functional properties (e.g., enzymatic
activity, ligand binding, signal transduction, immunogenicity,
etc.) of the full-length or fragment is retained.
[0059] The term "gene expression" refers to the process of
converting genetic information encoded in a gene into RNA (e.g.,
mRNA, rRNA, tRNA, or snRNA) through "transcription" of the gene
(i.e., via the enzymatic action of an RNA polymerase), and for
protein encoding genes, into protein through "translation" of mRNA.
Gene expression can be regulated at many stages in the process.
"Up-regulation" or "activation" refers to regulation that increases
the production of gene expression products (i.e., RNA or protein),
while "down-regulation" or "repression" refers to regulation that
decrease production. Molecules (e.g., transcription factors) that
are involved in up-regulation or down-regulation are often called
"activators" and "repressors," respectively.
[0060] The term "inhibition of gene expression" refers to
conditions where a polynucleotide of the present invention
hybridizes to a target RNA and provides partial or complete loss of
function of said gene. It is understood that a polynucleotide need
not be 100% complementary to its target RNA sequence to be
specifically hybridizable. In certain embodiments, a reduction of
target gene expression by at least about 10%, 25%, 50%, 60%, 70%,
80%, 90%, 95%, or 99% is desired relative to the level of
expression in the absence of the bifunctional chimeric single
stranded polynucleotides of the present invention. The present
invention is not limited to the inhibition of expression of a
particular gene.
[0061] The term "nucleoside" refers to a molecule having a purine
or pyrimidine base covalently linked to a ribose or deoxyribose
sugar. Exemplary nucleosides include adenosine, guanosine,
cytidine, uridine and thymidine. The term "nucleotide" refers to a
nucleoside having one or more phosphate groups joined in ester
linkages to the sugar moiety. Exemplary nucleotides include
nucleoside monophosphates, diphosphates and triphosphates. The
terms "polynucleotide" and "nucleic acid molecule" are used
interchangeably herein and refer to a polymer of nucleotides, and
in one embodiment of the present invention, are joined together by
a phosphodiester linkage between 5' and 3' carbon atoms of the
sugar moiety.
[0062] The term "nucleotide analog" or "altered nucleotide" or
"modified nucleotide" refers to a less commonly occurring
nucleotide, including natural and non-naturally occurring
ribonucleotides or deoxyribonucleotides. Nucleotide analogs may be
modified at any position so as to alter certain chemical properties
of the nucleotide yet retain the ability of the nucleotide analog
to perform its intended function. Nucleotide analogs may also
comprise modifications to the sugar portion of the nucleotides. The
phosphate group of the nucleotide may also be modified, e.g., by
substituting one or more of the oxygens of the phosphate group with
sulfur (e.g., phosphorothioates), or by making other substitutions
which allow the nucleotide to perform its intended function.
[0063] For use in preparing the nucleoside structural subunits of
the compounds of the invention, suitable nucleobases for
incorporation in these nucleoside subunits include purines and
pyrimidines such as adenine, guanine, cytosine, uridine, and
thymine, as well as other synthetic and natural nucleobases such as
xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl
derivatives of adenine and guanine, 2-propyl and other alkyl
derivatives of adenine and guanine, 5-halouracil and cytosine,
5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine,
5-uracil (pseudouracil), 4-thiouracil, 8-halo, amino, thiol,
thioalkyl, hydroxyl and other 8-substituted adenines and guanines,
5-trifluoromethyl and other 5-substituted uracils and cytosines,
7-methylguanine. Further purines and pyrimidines include those
disclosed in U.S. Pat. No. 3,687,808, those disclosed in the
Concise Encyclopedia Of Polymer Science And Engineering, pages
858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, and
those disclosed by Englisch, et al. 1991 Angewandte Chemie,
International Edition 30:613, all incorporated herein by
reference.
[0064] "Phosphodiester" refers to a polynucleotide with an oxygen
atom linking consecutive nucleotides. "Phosphorothiate" refers to a
polynucleotide in which the oxygen atom normally linking two
consecutive nucleotides has been replaced with sulfur and which
resists degradation by cellular enzymes. Polynucleotides of the
present invention have their nucleoside subunits connected by
phosphorus linkages from a list including phosphodiester,
phosphorothioate, 3'-(or -5')deoxy-3'-(or
-5')thio-phosphorothioate, phosphorodithioate, phosphoroselenates,
3'-(or -5')deoxy phosphinates, borano phosphates, 3'-(or
-5')deoxy-3'-(or 5'-) amino phosphoramidates, hydrogen
phosphonates, borano phosphate esters, phosphoramidates, alkyl or
aryl phosphonates and phosphotriester phosphorus linkages.
Phosphorothioate modification of nucleoside linkages for increased
stability has been reported to minimally effect silencing activity
(2007 Nat Rev Mol Cell Biol 8:23-6). In one embodiment, a backbone
comprising PS/2-O-Me may be of value in situations where PO/2-O-Me
seems limited.
[0065] The term "phosphorylated" means that at least one phosphate
group is attached to a chemical (e.g., organic) compound. Phosphate
groups can be attached, for example, to proteins or to sugar
moieties via the following reaction: free hydroxyl
group+phosphate.fwdarw.donor phosphate ester linkage. Also intended
to be included within the scope of the instant invention are
phosphate group analogs, which function in the same or similar
manner as the mono-, di-, or triphosphate groups found in nature.
In one embodiment, the chimeric polynucleotides disclosed herein
comprise extrinsic 5' phosphorylation. In another embodiment, the
chimeric polynucleotides disclosed herein do not comprise extrinsic
5' phosphorylation. The term "extrinsic 5' phosphorylation"
generally refers to phosphorylation carried out through synthetic
methods and not natural biological processes.
[0066] "Chimeric" refers, but is not limited, to a molecule that is
composed of both RNA and DNA moieties that are naturally occurring
or nucleotide analogs, linked by phosphodiester, phosphorothioate,
and/or any other naturally occurring or synthetic linkage that
permits the nucleotides or analogs to retain their intended
function. The oligonucleotide or polynucleotide can be referred to
as having at least two segments. One segment is defined as the
portion beginning at the 3' end of the polynucleotide and is the
ribonucleic acid segment and should include at least about three
consecutive ribonucleotides, and the second segment is defined as
the portion ending at the 5' end of the polynucleotide and is the
primarily deoxyribonucleic acid portion, and comprises at least
about 6, 7, 8, 9, or 10 deoxyribonucleotides, wherein a total of
zero, one, two, or three riboncucleotides may be placed between the
at least about 6, 7, 8, 9, or 10 deoxyribonucleotides. In one
embodiment, the second section comprises at least 5 consecutive
deoxyribonucleotides. In one embodiment, the number 2 position from
the 5' end is a 2'-OMe modified RNA.
[0067] Preferred single stranded chimeric polynucleotides in
accordance with this invention preferably comprise from about 8 to
about 50 nucleoside subunits. In the context of this invention, it
is understood that this encompasses non-naturally occurring
oligomers as hereinbefore described, having 8 to 50 nucleoside
subunits. It is more preferred that the single stranded chimeric
polynucleotides of the present invention comprise from about 15 to
about 25 nucleoside subunits. Accordingly, single stranded chimeric
polynucleotides can be 8 nucleotides in length, 9 nucleotides in
length, 10 nucleotides in length, 11 nucleotides in length, 12
nucleotides in length, 13 nucleotides in length, 14 nucleotides in
length, 15 nucleotides in length, 16 nucleotides in length, 17
nucleotides in length, 18 nucleotides in length, 19 nucleotides in
length, 20 nucleotides in length, 21 nucleotides in length, 22
nucleotides in length, 23 nucleotides in length, 24 nucleotides in
length, 25 nucleotides in length, 26 nucleotides in length, 27
nucleotides in length, 28 nucleotides in length, 29 nucleotides in
length, 30 nucleotides in length, 31 nucleotides in length, 32
nucleotides in length, 33 nucleotides in length, 34 nucleotides in
length, 35 nucleotides in length, 36 nucleotides in length, 37
nucleotides in length, 38 nucleotides in length, 39 nucleotides in
length, 40 nucleotides in length, 41 nucleotides in length, 42
nucleotides in length, 43 nucleotides in length, 44 nucleotides in
length, 45 nucleotides in length, 46 nucleotides in length, 47
nucleotides in length, 48 nucleotides in length, 49 nucleotides in
length, or 50 nucleotides in length. As will be appreciated, a
"nucleoside subunit" is a nucleobase and sugar or sugar surrogate
combination suitably bound to adjacent subunits through phosphorus
linkages in oligoribonucleotides and through non-phosphorus
linkages in oligoribonucleosides. In this context, the term
"nucleoside subunit" is used interchangeably with the term
"nucleoside unit" or "nucleoside." More preferably, the chimeric
oligonucleotides of the invention will have nucleosides linked by
naturally occurring phosphodiester linkages.
[0068] In certain embodiments, the bioactive agent is a
single-stranded polynucleotide, and the polynucleotide is a guide
strand, garnered from standard optimization siRNA techniques. A
discussion of conventional siRNA sequence selection is included
herein.
[0069] The target RNA cleavage reaction guided by siRNAs is highly
sequence-specific. In general, siRNA containing a nucleotide
sequence identical to a nucleotide sequence or a portion of a
nucleotide sequence of the target gene is preferred for inhibition.
However, 100% sequence identity between the siRNA and the target
gene is not required to practice the present invention. Thus, the
invention has the advantage of being able to tolerate sequence
variations that might be expected due to genetic mutation, strain
polymorphism, or evolutionary divergence. For example, siRNA
sequences with insertions, deletions, and single point mutations
relative to the target sequence have also been found to be
effective for inhibition. Alternatively, siRNA sequences with
nucleotide analog substitutions or insertions can be effective for
inhibition.
[0070] Moreover, not all positions of the siRNA contribute equally
to target recognition. Mismatches in the center of the siRNA are
most critical and essentially abolish target RNA cleavage. In
contrast, the 3' nucleotides of the siRNA do not contribute
significantly to specificity of target recognition. In particular,
residues 3' of the siRNA sequence, which is complementary to the
target RNA (e.g., the guide sequence), are not critical for target
RNA cleavage.
[0071] Sequence identity may be determined by sequence comparison
and alignment algorithms known in the art. To determine the percent
identity of two nucleic acid sequences (or of two amino acid
sequences), the sequences are aligned for optimal comparison
purposes (e.g., gaps can be introduced in the first sequence or
second sequence for optimal alignment). The nucleotides (or amino
acid residues) at corresponding nucleotide (or amino acid)
positions are then compared. When a position in the first sequence
is occupied by the same residue as the corresponding position in
the second sequence, then the molecules are identical at that
position. The percent identity between the two sequences is a
function of the number of identical positions shared by the
sequences (i.e., % homology=# of identical positions/total # of
positions.times.100), optionally penalizing the score for the
number of gaps introduced and/or length of gaps introduced.
[0072] The comparison of sequences and determination of percent
identity between two sequences can be accomplished using a
mathematical algorithm. In one embodiment, the alignment is
generated over a certain portion of the sequence aligned having
sufficient identity, but not over portions having low degree of
identity (i.e., a local alignment). A preferred, non-limiting
example of a local alignment algorithm utilized for the comparison
of sequences is the algorithm of Karlin and Altschul ((1990) Proc.
Natl. Acad. Sci. USA 87:2264-68, modified as in Karlin and Altschul
(1993) Proc. Natl. Acad. Sci. USA 90:5873-77, incorporated herein
by reference. Such an algorithm is incorporated into the BLAST
programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol.
215:403-10), incorporated herein by reference.
[0073] In another embodiment, the alignment is optimized by
introducing appropriate gaps, and percent identity is determined
over the length of the aligned sequences (i.e., a gapped
alignment). To obtain gapped alignments for comparison purposes,
Gapped BLAST can be utilized as described in Altschul, et al.,
((1997) Nucleic Acids Res. 25(17):3389-3402). In still another
embodiment, the alignment is optimized by introducing appropriate
gaps, and percent identity is determined over the entire length of
the sequences aligned (i.e., a global alignment). A preferred,
non-limiting example of a mathematical algorithm utilized for the
global comparison of sequences is the algorithm of Myers and
Miller, CABIOS (1989). Such an algorithm is incorporated into the
ALIGN program (version 2.0), which is part of the GCG sequence
alignment software package. When utilizing the ALIGN program for
comparing amino acid sequences, a PAM120 weight residue table, a
gap length penalty of 12, and a gap penalty of 4 can be used.
[0074] Sequence identity of at least about 80%, at least about 85%,
at least about 90%, at least about 95%, at least about 96%, at
least about 97%, at least about 98%, at least about 99% or about
100% between the siRNA and a portion of the target gene is
preferred. Alternatively, the siRNA may be defined functionally as
a nucleotide sequence (or oligonucleotide sequence) that is capable
of hybridizing with a portion of the target gene transcript (e.g.,
400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50.degree. C. or
70.degree. C. hybridization for 12-16 hours; followed by washing).
Additional exemplary hybridization conditions include hybridization
at 70.degree. C. in 1.times.SSC or 50 .degree. C. in 1.times.SSC,
50% formamide followed by washing at 70.degree. C. in 0.3.times.SSC
or hybridization at 70.degree. C. in 4.times.SSC or 50.degree. C.
in 4.times.SSC, 50% formamide followed by washing at 67.degree. C.
in 1.times.SSC. The hybridization temperature for hybrids
anticipated to be less than 50 base pairs in length should be
5-10.degree. C. less than the melting temperature (Tm) of the
hybrid, where Tm is determined according to the following
equations. For hybrids less than 18 base pairs in length,
Tm(.degree. C.)=2(# of A+T bases)+4(# of G+C bases). For hybrids
between 18 and 49 base pairs in length, Tm((.degree.
C.)=81.5+16.6(log10[Na+])+0.41(% G+C)-(600/N), where N is the
number of bases in the hybrid, and [Na+] is the concentration of
sodium ions in the hybridization buffer ([Na+] for
1.times.SSC=0.165 M). Additional examples of stringency conditions
for polynucleotide hybridization are provided in Sambrook, J., E.
F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y., chapters 9 and 11, and Current Protocols in Molecular
Biology, 1995, F. M. Ausubel et al., eds., John Wiley & Sons,
Inc., sections 2.10 and 6.3-6.4, incorporated herein by reference.
The length of the identical nucleotide sequences may be at least
about 10, 12, 15, 17, 20, 22, 25, 27, 30, 32, 35, 37, 40, 42, 45,
47 or 50 bases.
Treatment Methods
[0075] In one aspect, the invention provides a method of inhibiting
the expression of casein kinase 2 in a solid tumor. This inventive
method comprises administering targeted nanoparticles delivering
polynucleotides to the tumor, wherein the polynucleotides hybridize
to casein kinase 2 nucleic acid sequences and reduce or inhibit the
expression thereof.
[0076] In one aspect, the invention provides a method of modulating
activity of downstream targets of casein kinase 2 in a solid tumor.
In some embodiments, downstream targets of casein kinase 2 include,
without limitation, NF-.sub.KB p65, Cdc37, and AKT. This inventive
method comprises administering targeted nanoparticles delivering
polynucleotides to the tumor, wherein the polynucleotides hybridize
to casein kinase 2 nucleic acid sequences and reduce or inhibit the
activity of downstream targets, and/or downstream markers of casein
kinase 2 activity, including, for example, Ki-67.
[0077] In another aspect, the invention provides a method of
reducing the size of a solid tumor or inhibiting or stabilizing the
growth of a solid tumor in a subject. This inventive method
comprises administering targeted nanoparticles delivering
polynucleotides to the tumor, wherein the polynucleotides hybridize
to casein kinase 2 nucleic acid sequences and reduce or inhibit the
expression thereof. In certain embodiments, targeted nanoparticles
delivering polynucleotides to the tumor result in reduction in size
or stabilization or inhibition of growth of the solid tumor.
[0078] As used herein, the term "subject" refers to any animal
(e.g., a mammal), including, but not limited to, humans, non-human
primates, vertebrate animals, rodents, and the like, which is to be
the recipient of a particular treatment. The terms "subject",
"patient", and "individual" are used interchangeably herein.
[0079] In some embodiments, the target is an in vitro biological
system such as in vitro tissues or cells, and the method comprises
contacting the target with the nanoparticles herein described.
[0080] In one embodiment, oligonucleotides for binding to casein
kinase 2 have the sequence shown in SEQ ID NO:8 (for the target
casein kinase 2 alpha), or SEQ ID NO:9 (for the target casein
kinase 2 alpha prime). In one embodiment of a composition of
nanoparticles according to the invention, the nanoparticles
comprise a plurality of polynucleotides, wherein the percentage of
the plurality of polynucleotides that comprises SEQ ID NO: 8 is, on
average, more than about 1% and less than about 100%, more than
about 30% and less than 70%, more than about 40% and less than
about 60%, more than about 45% and less than about 55%, more than
about 48% and less than about 52%, more than about 49% and less
than about 51%, or is about 50%, and the remainder of the plurality
of polynucleotides comprises SEQ ID NO:9. Factors influencing the
percentages of each polynucleotide sequence include, for example,
the relative volume of each polynucleotide incorporated upon
formulating the nanoparticles or the relative encapsulation
percentage of each polynucleotide. The polynucleotide makeup of the
composition can be determined using sampling methods known in the
art, such as hybridization assays and functional cell assays.
[0081] In one embodiment of a composition of nanoparticles
according to the invention, a mix of nanoparticles comprises
polynucleotides comprising either SEQ ID NO: 8 or SEQ ID NO: 9. In
another embodiment of a nanoparticle composition according to the
invention, the percentage of nanoparticles that comprise
polynucleotides comprising SEQ ID NO: 8 is about 10%, about 20%,
about 30%, about 40%, about 50%, about 60%, about 70%, about 80%,
or about 90%, with the remainder of nanoparticles of the
composition comprising polynucleotides comprising SEQ ID NO: 9.
[0082] Representative tumors contemplated for treatment by methods
of the invention include those associated with certain cancers, and
include, without limitation, breast cancer, lung cancer (including
non-small cell lung carcinoma), prostate cancer, colorectal cancer,
brain cancer, esophageal cancer, kidney cancer, bladder cancer,
pancreatic cancer, cervical cancer, head and neck cancer, skin
cancers, nasopharyngeal carcinoma, liposarcoma, epithelial
carcinoma, renal cell carcinoma, gallbladder adenocarcinoma,
parotid adenocarcinoma, ovarian cancer, melanoma, lymphoma, glioma,
and endometrial sarcoma.
[0083] In one embodiment, treatment by methods of the invention
includes administration to patients diagnosed with a solid tumor
cancer. "Solid tumor", as used herein, refers to an abnormal mass
of tissue that results from the proliferation of cells. Solid
tumors can arise in any part of the body and may be benign (not
cancerous) or malignant (cancerous). Most types of cancer other
than leukemias can form solid tumors. Solid tumors include, without
limitation, adenocarcinomas, carcinomas, hemangiomas, liposarcomas,
lymphomas, melanomas, and sarcomas. The phrase "solid tumor" can
also be used to refer to conditions such as endometriosis, i.e.,
conditions caused by uncontrolled proliferation of cells.
[0084] Tenascin is a large glycoprotein shown to be overexpressed
in the microenvironment of solid tumors (Brellier, et al. 2011 J
Cell Molec Med 16: 32-40). Receptors for tenascin are found on
tumor cells, representing an attractive target for treating solid
tumor cancers by employing therapeutic nanoparticles with
tenascin-directed ligands. Non-limiting examples of receptors for
tenascin found on tumor cells include integrin alpha V, alpha 2,
beta 1, and beta 3. One having skill in the art, once armed with
this disclosure, will be able, without undue experimentation, to
identify, prepare, and exploit tenascin-directed ligand
nanoparticles to solid tumors for the purposes of targeting and
delivering bioactive agents to solid tumors. Non-limiting examples
of such tenascin-directed ligands include tenascin-C, tenascin-W,
and fragments thereof, including, but not limited to,
tenfibgen.
[0085] In one embodiment, the inventive nanoparticle compositions
are useful for treating any condition in which inhibiting
expression of a target gene is potentially of use. In another
embodiment, the compositions may be used for treating a subject
suffering from a proliferative disease. By "proliferative disease"
is meant any human or animal disease or disorder affecting any one
or any combination of organs, cavities, or body parts, which is
characterized by single or multiple local abnormal proliferations
of cells, groups of cells, or tissues, whether benign or
malignant.
[0086] The terms "treatment", "treating", and the like are intended
to mean administering a therapeutic, vaccine, or diagnostic on one
or more occasions for the purpose of obtaining or assessing a
desired pharmacologic and/or physiologic effect in a subject. The
effect may be prophylactic in terms of completely or partially
preventing a disease or symptom thereof and/or may be therapeutic
in terms of a partial or complete cure for a disease and/or adverse
effect (symptom) attributable to the disease. "Treatment", as used
herein, covers any treatment of a disease in a subject and
includes, without limitation: (a) preventing a disease or condition
from occurring in an individual who may be predisposed to the
disease but has not yet been diagnosed as having it; (b)
eliminating or inhibiting the disease, (e.g., arresting its
development); or (c) relieving the disease (e.g., reducing or
eliminating symptoms associated with the disease).
[0087] In another aspect, the invention provides a single-stranded
(ss) oligonucleotide of up to about 50 nucleotides in length that
includes a portion of at least 8 consecutive nucleotides of SEQ ID
NO: 8, wherein the ss oligonucleotide inhibits the expression of
human casein kinase 2 alpha. In another aspect, the invention
provides a ss oligonucleotide of up to about 50 nucleotides in
length that includes a portion of at least 8 consecutive
nucleotides of SEQ ID NO: 9, wherein the ss oligonucleotide
inhibits the expression of human casein kinase 2 alpha prime.
Administration
[0088] The formulation of therapeutic compositions of the present
invention and their subsequent administration are described herein
and can be practiced by those of ordinary skill in the art. In
general, for therapeutics, a patient in need of therapy is provided
a composition in accordance with the invention, in dosages and
novel regimen strategies as described elsewhere herein. In some
embodiments of the present invention, administration is determined
based upon one or more of the patient's body weight or surface
area, age, and severity of the disease or disorder being
treated.
[0089] In one embodiment, the subject is treated with the
nanoparticle composition, for example, comprising polynucleotides,
at a dose/in an amount sufficient to reduce, stabilize, or inhibit
expression of a target gene against a suitable control. In another
embodiment, the subject is treated with the single-stranded
polynucleotide at a dose/in an amount sufficient to reduce,
stabilize, or inhibit the target lesion against a suitable control.
In another embodiment, the bioactive agent (for example,
polynucleotide) dose is of equal to or less than about 20 mg/kg
body weight, less than about 10 mg/kg body weight, or less than
about 5 mg/kg body weight. In other embodiments, the bioactive
agent, for example, a single-stranded chimeric polynucleotide, is
delivered at a dose of less than about 4 mg/kg body weight, less
than about 3 mg/kg body weight, less than about 2 mg/kg body
weight, less than about 1 mg/kg body weight, less than about 100
mg/kg body weight, less than about 100 nanogram(ng)/kg body weight,
less than about 10 ng/kg body weight, less than about 1 ng/kg body
weight, less than about 100 picogram(pg)/kg body weight, less than
about 10 pg/kg body weight, less than about 1 pg/kg body weight,
less than about 100 femtogram(fg)/kg body weight, less than about
10 fg/kg body weight, less than about 1 fg/kg body weight, less
than about 100 attogram(ag)/kg body weight, less than about 10
ag/kg body weight, or less than about 1 ag/kg body weight. Similar
dosage ranges can be developed and used based upon for example the
body surface area of the subject.
[0090] The treatment regimen may last for a period of time that
will vary depending upon the nature of the particular disease, its
severity, and the overall condition of the patient, and may extend
from once daily to once every 30 years. Following treatment, the
patient may be monitored for changes in his/her condition and for
alleviation of the symptoms of the disease or disorder state. The
dosage of the bioactive agent may either be increased in the event
that the patient does not respond significantly to current dosage
levels, or the dosage may be decreased if an alleviation of the
symptoms of the disease or disorder is observed, or if the disease
or disorder has been ablated.
[0091] Dosing is dependent on severity and responsiveness of the
disease condition to be treated, with the course of treatment
lasting from several days to several months, or until a cure is
effected or a diminution of disease or disorder is achieved.
Optimal dosing schedules can be calculated, for example, from
measurements of bioactive agent accumulation in the body of the
patient. Persons of ordinary skill can readily determine optimum
dosages, dosing methodologies, and repetition rates. Optimum
dosages may vary depending on the relative potency of individual
compounds, and can generally be estimated, for example, based on
EC50 found to be effective in in vitro and in vivo animal models.
Dosages may be given, for example, once or more daily, weekly,
monthly or yearly, or even once every 2 to 30 years.
[0092] In some embodiments, methods of the invention include a step
that involves comparing a value, level, feature, characteristic,
property, etc. to a "suitable control", referred to interchangeably
herein as an "appropriate control". A "suitable control" or
"appropriate control" is any control or standard familiar to one of
ordinary skill in the art useful for comparison purposes. In one
embodiment, a "suitable control" or "appropriate control" is a
value, level, feature, characteristic, property, etc. determined
prior to administering a composition of nanoparticles as described
herein. For example, a transcription rate, mRNA level, translation
rate, protein level, biological activity, lesion size, cellular
characteristic or property, genotype, phenotype, etc. can be
determined prior to introducing a composition of nanoparticles of
the invention into a cell or organism. In another embodiment, a
"suitable control" or "appropriate control" is a value, level,
feature, characteristic, property, etc. determined in a cell or
organism, e.g., a control or normal cell or organism, exhibiting,
for example, normal traits. In yet another embodiment, a "suitable
control" or "appropriate control" is a predefined value, level,
feature, characteristic, property, etc.
[0093] In another aspect, the invention provides methods of
treatment comprising administering to a subject in need thereof a
therapeutically effective amount of a bioactive agent in a
formulated composition of nanoparticles according to the invention.
By the term "therapeutically effective amount", for example, of a
bioactive agent, is meant such amount as is capable of obtaining
the desired phenotype or performing the desired therapeutic
function such as stabilizing, slowing, reducing, eliminating, or
preventing a disease or disorder (or a symptom of such disease or
disorder). The exact amount required will vary, depending on known
variables, such as the bioactive agent employed, the condition of
the subject, and the parameters of the therapeutic regimen. Thus,
it is neither necessarily possible nor required to specify an exact
"therapeutically effective amount." Rather, the appropriate
effective amount may be determined by one of ordinary skill in the
art using routine experimentation.
[0094] The compositions of the present invention may be
administered via a number of routes, depending upon whether local
or systemic treatment is desired and upon the area to be treated.
Administration may be topical (including ophthalmic, vaginal,
rectal, intranasal, transdermal), oral, or parenteral. Parenteral
administration includes, but is not limited to, intravenous,
subcutaneous, intraperitoneal or intramuscular injection,
intratumoral, or intrathecal or intraventricular administration.
Without wishing to be bound by theory, the flexibility of particle
(composition) administration options is enabled, in part, by the
small size and low surface charge of the highly stable
nanoparticles of the inventive composition, allowing the particle
and its drug cargo to traverse biologic barriers and size-limited
structures such as the bloodstream wall, lymphatic channels, and
the skin to reach cellular and molecular targets.
[0095] "Low surface charge" of the nanoparticles of the inventive
compositions generally means an average surface charge of between
about -20 and about +4 milli-electron volts (mev), although one
skilled in the art will understand that the inventive nanoparticles
having an average surface charge outside of this range can still be
exploited for therapeutic purposes, if the nanoparticles retain
their spherical or elliptical shape, sub-50 nanometer size, and
crystallized form.
[0096] In one embodiment, the invention provides a method of
treating a disease or disorder in a subject, for the purpose of
obtaining a desired phenotype or performing a desired function such
as stabilizing, slowing, reducing, or eliminating such disease or
disorder (or a symptom of such disease or disorder), such as,
without limitation, proliferative disease, such as, without
limitation, cancer, comprising administering to a subject under
conditions suitable for the treatment of the disease or disorder, a
therapeutically effective amount of a nanoparticle composition,
wherein the nanoparticles comprise a micelle core comprising
bioactive agents comprising a mix of SEQ ID NO: 8 and SEQ ID NO: 9,
a surfactant with an HLB value of less than or equal to about 6.0,
a shell adsorbed to the micelle core and comprising tenfibgen,
Li.sup.+and Cs.sup.+, and having a mean diameter of less than about
50 nanometers, wherein the nanoparticles are administered via one
or more of the routes described above. In another embodiment, the
inventive method comprises pre-treatment of the Li.sup.+ with
Cs.sup.+. In one embodiment, the polynucleotide of the present
invention may be introduced in an amount which allows delivery of
at least about 1, 5, 10, 50, 100, 500, or 5000 polynucleotides per
target cell.
[0097] The following illustrates some of the benefits and
advantages of the instant invention based on work described in the
examples, below. Stable tenfibgen-shell sub-50 nanometer
nanoparticles made with sterile water and Cs+ pre-mixed with Li+,
and encapsulating a mix of oligonucleotides comprising 2R-modified
anti-CK2 SEQ ID NO: 8 and SEQ ID NO: 9, significantly inhibited
tumor growth in mice over a 30-day period (Table 3, below). An
analysis of the tumors treated with the mix also showed significant
inhibition of Ki-67, a marker of cell proliferation, and NF-kB, a
marker of inflammation. Under similar experimental conditions, mice
treated with only nanoencapsulated 2R-modified SEQ ID NO: 8 showed
reductions in tumor weight and NF-kB vs. controls, but the changes
were not significant, and the Ki-67 index for the treated group
increased vs. controls. Similarly, mice treated with only a
nanoencapsulated, unmodified oligonucleotide mix (SEQ ID NO: 5 and
SEQ ID NO: 6) showed an increase in tumor weight, with small
changes in Ki-67 and NF-kB.
Preparation of Nanoparticles
[0098] The following description of methods that can be used to
make targeted sub-50 nanoparticles is meant to be representative
only and is not meant to be limiting. U.S. Pat. No. 6,632,671, U.S.
Pat. No. 7,741,304, and U.S. Patent Publication No. 2013/0267577,
incorporated herein by reference, disclose the preparation of
unmodified nanoparticles. Briefly, a negatively-charged bioactive
agent such as a nucleic acid that is to be targeted and delivered
to, for example, a tumor cell, can be complexed with a polycationic
polymer to condense or reduce its size to about 50 nm or less. A
number of different polycationic polymers (also known as
"condensing" agents or proteins) can be used and are well-known in
the art (Rolland 1998, Crit. Rev. Therapeutic Drug Carr. Syst.,
15:143-198). For example, enough polycationic condensing protein
can be complexed with the negatively-charged cargo moiety to
neutralize at least about 75% (e.g., about 80%, 85%, 90%, 95%, 99%
or 100%) of the negatively-charged cargo moiety, which, for nucleic
acids, can be measured by ethidium dye exclusion (see, for example,
(1998, J. Controlled Release, 53:289-99)). Simply by way of
example, 125 .mu.g of 10 kD polyornithine can be used to condense
500 .mu.g of a 20-mer oligonucleotide, or 87.5 .mu.g of spermine
may be used to condense 250 .mu.g of a 14 kD siRNA oligo. For cargo
moieties lacking a negative charge or bearing a positive charge, a
condensing polycationic polymer may not be necessary.
[0099] An aqueous solution of the complexed or uncomplexed cargo
moiety can be encapsulated by first dispersing the cargo moiety
into a biocompatible, water-miscible solvent using a biocompatible,
water-insoluble surfactant system suitable for preparation of an
inverted or reverse micelle. Suitable surfactant systems are
well-known in the formulation arts as amphiphilic materials that
are essentially hydrophobic and characterized by a
hydrophile-lipophile balance (HLB) of less than about 6, a critical
micelle concentration (CMC) of less than about 200 .mu.M, or a
critical packing diameter greater than 1. In some embodiments, the
HLB is less than about 5. Hydrophobic surfactants and hydrophobic,
water-miscible solvents suitable for preparing reverse micelles are
described in Pashley & Karaman (2004, In Applied Colloid and
Surface Chemistry, John Wiley, pp. 60-85), Rosen (2004, in
Surfactants and Interfacial Phenomena, John Wiley), The Handbook of
Industrial Surfactants (1993, Ash, ed., Gower Pub), and Perry's
Chemical Engineer's Handbook (1997, Perry & Green, 7th Ed.,
McGraw-Hill Professional), incorporated herein by reference.
[0100] In some embodiments, the surfactant component may be
2,4,7,9-tetramethyl-5-decyn-4,7-diol(TM-diol), blends of
2,4,7,9-tetramethyl-5-decyn-4,7-diol(TM-diol), molecules having one
or more acetylenic diol groups, cetyl alcohol, or any combination
of any of these. In some embodiments, water-miscible solvents
comprising food or USP grade oils, such as DMSO, DMF, castor oil,
or any combination thereof, may be used. In one embodiment, a
hydrophobic surfactant can be 2,4,7,9-tetramethyl-5-decyn-4,7-diol
(TM-diol) or preparations thereof, such as SE-30 (Air Products),
used in a concentration of up to about 0.5% by weight of surfactant
micelle volume, and a water-miscible solvent can be DMSO. The
concentration of surfactant selected should be sufficient to
prepare an optically clear nanoemulsion, but not so much as to
induce aggregation, since aggregation can lead to overly large
nanoparticles.
[0101] The micelles carrying the cargo moieties (i.e., the
surfactant micelles) can be coated with tumor-targeting moieties
(e.g., tenfibgen) by mixing one or more targeting moieties with an
aqueous dilution of the nanoparticles. In some embodiments,
targeting moieties can be mixed with nanoparticles in a ratio (by
weight) of about 1:500 to about 1:0.1 of targeting moiety to
bioactive agent, depending upon factors including the targeting
moiety and the rate at which the nanoparticle is desired to
dissolve or disassemble. In one embodiment, the weight ratio is
about 1:90 (that is, 1/90.sup.th) of targeting moiety to bioactive
agent. In one embodiment, the weight ratio is about 1:40 of
targeting moiety to bioactive agent.
[0102] Nanoparticle ligands may be modified by processes designed
to enhance final nanoparticle function. As a non-limiting example,
coating ligands may be readily modified with pharmaceutically
acceptable heavy metals by re-precipitating protein in saturated
ammonium sulfate solutions prepared with known levels of heavy
metals. Incubation of about a 0.1-1 mg/ml solution of protein
ligand at a ratio of 1:1 with a saturated ammonium sulfate solution
is most expeditiously executed for about 4-36 hours before
recovering metal-modified coating ligand by centrifugation. Metal
concentrations in the ultrapure ammonium sulfate may range from,
for example, 1 part per thousand to 1 part per trillion. As a
further non-limiting example, tenascin polypeptides may be
precipitated from cell culture supernatants using metal-containing
ammonium sulfate, such that metals known to promote oxidative
stress are adsorbed onto coating ligands preceding nanoparticles
preparation.
[0103] To stabilize the ligand-adsorbed nanoparticle, the aqueous
suspension of nanoparticles coated with one or more ligands can be
mixed into an aqueous solution of metal ions (i.e., a
"stabilization solution") capable of precipitating, crystallizing,
or iontophoretic exchange with the coated nanoparticles.
Representative, non-limiting examples of solutes that can be used
to form coated nanoparticles include ionic species derived from
elements listed in the periodic table. Ions may be included in the
aqueous stabilization composition in a range from about, for
example, 0.1 part per trillion to about 1 Molar (M). An adequate
amount of ion should be included, such that the coated
nanoparticles are sufficiently contacted with ions, but not so much
that aggregation occurs, which can lead to overly large
nanoparticles.
[0104] In one embodiment, a stabilization (or crystallization or
receiving) solution can comprise about 10 millimolar (mM) Ca.sup.2+
and about 126 mM Li.sup.+. If ultrapure reagents are used in the
stabilization solution, very small amounts (e.g., less than about 1
mM) of ions such as Ba, Fe, Mg, Sr, Pb and Zn may be added to
optimize stabilization of the coated nanoparticles. In one
embodiment, when the nanoparticles are prepared with sterile water,
126 mM of Li.sup.+ is pre-treated with 2.5 ppb of CS.sup.+ for
increased stability. In one embodiment, a stabilization solution
includes 10 mM Ca.sup.2+, 126 mM Li+ (pre-mixed with 2.5 ppb
Cs.sup.+), 0.042 mM Ba.sup.2+with 14 nM Sr.sup.2+, 6.25 nM
Mg.sup.2+ (all ultrapure, all prepared as stock solutions with
sterile water, except Sr.sup.2+ and Mg.sup.2+, which are prepared
with laboratory grade water, all metals are used as chloride salts,
total bath volume approximately 30 ml). Flexibility of the system
is demonstrated by nanoparticles showing high levels of cellular
uptake that have been synthesized at lithium levels about 10-fold
lower than those described here (data not shown). The artisan will
understand that a variety of counter-ions can be used with these
metals in the stabilization solution, such as chloride, sulfate,
and nitrate.
[0105] The term "ultrapure", as used in reference to salts and
metals, refers to salts and metals that are about or greater than
99% pure or of the highest purity available. The artisan will
understand that ultrapure salts and metals are generally
commercially available, and that, if required, altering effects of
variations in content of such ultrapure materials on nanoparticle
formulation can be addressed without undue experimentation by, for
example, adjusting the baseline levels of other salts and metals
that were used in previous formulations. Reducing the level of
barium in a formulation can, for example, offset increases in the
levels of impurities in calcium chloride dihydrate, to maintain
size, shape, and/or function of formulated nanoparticles.
[0106] As used herein, "laboratory grade" salts and metals refers
to salts and metals that are not ultrapure. In order to maintain
consistency of nanoparticle size, shape, and/or function for a
given line of formulation, it is recommended that use of laboratory
grade salts and metals be minimized, such as less than 25%, 20%,
15%, 10%, or 5% of the total weight of salts and metals added to
the final salt receiving solution.
[0107] In one embodiment, the Cesium (Cs)-pretreated lithium
nanoparticles comprise a polymorphic form that is differentiated
from nanoparticles not pre-treated with Cs. This differentiation is
evidenced by, for example, the substantive differences in melting
point and FTIR spectra between Cs and non-CS nanoparticles
presented in Table 1, below. As used herein, the terms "polymorph"
and "polymorphic form" refer to solid crystalline-ordered forms of
a compound or complex.
[0108] One or more solid state forms of a compound of interest such
as a nanoparticle may be generated by crystallization. One or more
solid state forms may also be generated by cocrystallization of a
chemical substance with different guest molecules (i.e., components
that are not the principal component of the crystal lattice). One
or more solid forms may also be generated by inclusion of an
element or element-combination into a supramolecular assembly or
addition of a new element or element-combination to generate a new
supramolecular assembly.
[0109] Among the phenomena in crystallization are the processes of
nucleation and growth. Crystal nucleation is the formation of an
ordered solid phase from liquids, supersaturated solutions,
saturated vapors, or amorphous phases. Growth is the enlargement of
crystals caused by deposition of molecules upon an existing
surface. Nucleation may be induced by the presence of "seed"
crystals. Some solid particle is present to provide a catalytic
effect and reduce the energy barrier to formation of a new phase.
Crystals may originate, for example, on a minute trace of a foreign
substance (e.g., either impurities or scratches on container walls)
acting as a nucleation site. Nucleation may also be promoted by
external or nonchemical means, such as stirring the crystallization
environment, or by applying both an initiating surface, together
with physical energy, such as could be observed by the process of
atomizing ultra-small nanoscale micelles into a salt solution.
[0110] Practically, polymorphic and novel forms of a compound such
as a nanoparticle are known in the pharmaceutical arts to affect,
for example, the solubility, stability, flowability, fractability,
and compressibility of the compound, (Knapman, K. 2000 Modern Drug
Discovery 3: 53-58). Therefore, the discovery of either new
polymorphs of a nanoparticle drug or highly-related structural
forms can provide a variety of advantages.
[0111] Polymorphs can be detected, identified, classified, and
characterized using well-known techniques, such as, but not limited
to, differential scanning calorimetry (DSC), thermogravimetry
(TGA), X-ray powder diffractometry (XRPD), single crystal X-ray
diffractometry, vibrational spectroscopy, solution calorimetry,
solid state nuclear magnetic resonance (NMR), infrared (IR)
spectroscopy, Fourier-transform infared spectroscopy (FTIR), Raman
spectroscopy, hot stage optical microscopy, scanning electron
microscopy (SEM), transmission electron microscopy (TEM), electron
crystallography and quantitative analysis, particle size analysis
(PSA), surface area analysis, solubility, and rate of
dissolution.
[0112] As used herein, in reference to the spectra or data
originally generated in graphical form (e.g., XRPD, IR, FTIR, Raman
and NMR spectra), and unless otherwise indicated, the term "peak"
refers to a peak or other special feature that one skilled in the
art would recognize as not attributable to background noise. Some
limited variance in interpreting or reading peak positioning can
occur due to machine and/or algorithm variability in peak
detection.
[0113] While not wishing to be bound by theory, the material
science data presented in Table 1, below, indicate the addition of
trace amounts of cesium (in the form of the element combination,
i.e., cesium-treated lithium) surprisingly induced significant
changes in the melting point and FTIR spectra of the inventive
nanoparticles as compared to non-cesium nanoparticles. Changes in
melting point indicates a new polymorphic form that corresponds
with changes in physical state. The data presented in Table 1 link
the measured changes in melting point with increases in
nanoparticle stability, as manifested by improved shipping
performance and extended Burton-derived in vitro release times.
[0114] As discussed elsewhere herein, nanoparticles formulated with
cesium-treated lithium formed suitable nanoparticles with respect
to size and shape (sub-50 nm spheroid, cuboid, or elliptical),
while nanoparticles formulated with cesium simply commingled with
lithium in the salt receiving bath did not. This supports the
observation that it is the introduction of the element combination,
i.e., cesium-treated lithium, and not simply the addition of
cesium, which induced the significant changes in melting point and
concomitant improved stability described above.
[0115] In one embodiment, the Cs-pretreated lithium sub-50
nanometer nanoparticles with a hydrophobic micelle core, ligand
shell and an encapsulated bioactive agent comprise a novel
polymorphic form of a supramolecular assembly (referred to herein
as a Cs polymorph nanoparticle) of apparent molecular weight
greater than 10,000 daltons, greater than 20,000 daltons, or
greater than 30,000 daltons. The artisan can determine apparent
molecular weight by standard methods such as for example, ultra
high resolution aqueous size exclusion chromatography, using, for
example, a Yarra 3u SEC-2000, 30 cm.times.7.8 mm column and UV
detection together with a mobile phase of 0.3M NaCl in 0.1M
phosphate buffer, pH 7.
[0116] In one embodiment, the element combination of cesium and
lithium yields Cs polymorph nanoparticles that are/can be formed,
used, and/or stored in an aqueous environment.
[0117] In another embodiment, the ligand shell of the Cs polymorph
nanoparticle comprises tenfibgen. In still another embodiment, the
ligand shell of the Cs polymorph nanoparticle comprises
hyaluronan.
[0118] Nanoparticles that have a low surface charge, preferably as
close to neutral as possible or even slightly negative, and/or that
have the morphology of a compact or roughly spheroidal, cuboid, or
elliptical shape, exemplify optimized stability. Additionally, any
other components that are capable of increasing the stability of
the nanoparticles can be included as part of the stabilization
solution, such that the final mean diameter of the nanoparticles is
between a range of about, for example, 5-50 nm. In certain
embodiments, nanoparticles of a composition according to the
invention have an average diameter of between about 5 and about 50
nanometers, between about 5 and about 40 nanometers, between about
5 and about 30 nanometers, or between about 5 and about 20
nanometers.
[0119] Particle size can be manipulated through routine variation
of parameters, including, for example, the length of incubation
time after crystallization in the salt receiving solution. In one
embodiment, the nanoparticles are measured by atomic force
microscopy (AFM). In another embodiment, the nanoparticles are
measured by transmission electron microscopy (TEM). In another
embodiment, the nanoparticles are measured by dynamic light
scattering (DLS). In another embodiment, the nanoparticles are
measured by size exclusion chromatography (SEC). In another
embodiment, the nanoparticles are measured in dry state by methods
known in the art. Unless otherwise stated, average diameter is
expressed herein as the average of the major and minor axes of the
nanoparticles as measured in dry state. Generally, formulations or
compositions of nanoparticles with average major-to-minor
-dimension ratios of greater than about about 10:1, about 5:1, or
about 3:1 are not suitable for uses intended herein.
[0120] For a more consistent size of nanoparticles, the
nanoparticles can optionally be atomized into a receiving solution
through a nozzle. Atomization should be sufficient to apply a shear
force capable of breaking up flocculated aggregates without so much
force as to induce hard aggregates. Those skilled in the art will
understand that a particular nozzle diameter will lead to range of
feed pressures suitable for atomizing the nanoparticles to a
suitable and consistent size. In one embodiment, a nozzle diameter
of about 250 microns or smaller with feed pressure of less than
about 10 psi produces suitable nanoparticles.
[0121] The stabilized nanoparticles can be incubated at varying
times and temperatures depending upon the amount of time required
or desired for particle dissolution or disassembly in end use.
Incubation times can vary from about 8 hours to about 7 days. In
some embodiments, nanoparticles are incubated in round bottom tubes
with nominal rotation at 4.degree. C. for between 36 and 48 hours.
Without wishing to be bound by theory, longer incubation times
result in higher crystallization that increases both size and
stability of the particle. After atomizing and/or incubating the
nanoparticles in a stabilization solution, the nanoparticles can be
filtered, centrifuged and/or dried to obtain a composition
comprising separate and discrete sub-50 nm nanoparticles. In one
embodiment, nanoparticles are centrifuged at 20,000.times.g at
4.degree. C. for 2 hours and sterile-filtered through a 0.2 .mu.m
filter. The resultant nanoparticles can be frozen at about
-20.degree. C. or dried and reconstituted for later use. Sequences
manufactured as chimeric polynucleotides are optionally propyl 3'
end-blocked.
[0122] In one embodiment, the nanoparticles are prepared without
polyethylene glycol (PEG) and similar species typically used to
stabilize nanoparticles. In another embodiment, nanoparticles can
be lyophilized and resuspended at lower, same, or higher
concentrations, using standard methods known in the art.
[0123] Although the invention has been particularly shown and
described with reference to a number of embodiments, it is
understood by those skilled in the art that changes in the form and
details may be made to the various embodiments disclosed herein
without departing from the spirit and scope of the invention, and
that the various embodiments disclosed herein are not intended to
limit the scope of the claims.
[0124] The invention will be further described in the following
examples, which likewise are not intended to limit the scope of the
invention described in the claims.
EXAMPLES
Example 1
Formulation of Targeted Therapeutic Nanoparticles
[0125] Illustrative nanoparticles comprising diverse cargos and
targeting moieties were generated as follows.
[0126] Formula A: In a 2 mL conical tube, 500 .mu.g of chimeric
oligo (SEQ ID NO: 5) polynucleotide against CK2 (phosphodiester 3'
and propylendblocked--2'-OMe RNA chimeric, "LCK-6", (U.S. Pat. No.
7,741304, incorporated herein in its entirety by reference)) in
sterile water (HPLC grade, Fisher) at a concentraton of 1 mg/ml was
briefly vortexed, then complexed with 200 .mu.g of 10 kD
polyornithine (Sigma), and dispersed into 150 .mu.l of sterile
water using a water-insoluble surfactant system (TM-diol blend
(SE-30, Air Product), 10 .mu.g in 10 .mu.g DMSO. Following
emulsification with a water-miscible solvent (DMSO), by adding 150
.mu.l of DMSO, vortexing, and subsequently placing in bath
sonicator for 5 minutes, the complexes were then inverted and
diluted by the addition of 700 .mu.l of PBS.
[0127] The resultant hydrophobic micelles were coated
(non-covalently) by the addition of 5.5 .mu.g of recombinant
fibrinogen fragment of tenascin (TBG), prepared by the method of
Aukhill, et al. (J. Biol Chem., 268:2542-53 (1993)), with
modifications as described herein, placed in a bath sonicator for
15 minutes, transferred to a 5 ml polypropylene tube, and diluted
up to 3 ml with PBS, then atomized with a manual actuator using an
approximately 250 .mu.m diameter orifice with feed pressure of less
than about 10 psi into a salt receiving solution of sterile water
containing primarily Li.sup.+ (126 mM Li.sup.+ (premixed with 2.5
ppb Cs.sup.+ on Li.sup.+), 10 mM Ca.sup.2+, 0.042 mM Ba.sup.2+ with
14 nM Sr.sup.2+, 6.25 nM Mg.sup.2+ (all ultrapure, all prepared as
stock solutions with sterile water except Sr.sup.2+ and Mg.sup.2+
prepared with laboratory grade water, all metals were used as
chloride salts, total bath volume approximately 30 ml). The total
reaction volume was 36 ml. The level of the following metals tested
for in the sterile water used to prepare the stabilization solution
was determined to be less than 0.1 parts per million in sum total:
aluminum, arsenic, barium, cadmium, chromium, copper, iron, lead,
magnanese, nickel, rubinium, sulfur, vanadium, and zinc.
[0128] The premixing step comprised adding Cs.sup.+ at about 0.1
.mu.gl ml to about 4M Li.sup.+, at about 2.5 ppm Cs.sup.+ to
Li.sup.+ by weight, in sterile water in a 50 ml tube, and rotating
for about 2 minutes. Following cold-room incubation (4.degree. C.)
with nominal rotation in 40 ml round-bottomed tubes for 48 hours,
which further stabilized the coated micelles in the salt solution,
the sub-50 nm nanoparticles were recovered by centrifugation at
20,000.times.g at 4.degree. C. for 2 hrs and resuspended in PBS+10%
lactitol (at a concentration of 1 .mu.g/.mu.l), transferred to a 2
ml conical, and spun down at maximum speed for 5 minutes at
4.degree. C., washed by resuspending pellet in PBS/10% lactitol,
sterilized through a 0.2 .mu.m filter, and frozen at -20.degree.
C.
[0129] In all formulations described in the instant example, a
small amount (1% of coating weight) of Syrian Hamster IgG was
"spiked" into the ligand coat to enable immunodetection of
nanoparticle uptake by anti-Syrian Hamster antibodies. Average
particle size was less than 50 nm, as measured by tapping mode
atomic force microscopy using elliptical diameters of a 1
e.sup.(-27) g/ml sample dried down on a mica sheet. Average
particle size is stated as the average of the major and minor axes
of the measured nanoparticles. AFM measurements were further
supported by TEM negative staining, where 1 ng/ml suspensions were
spotted onto carbon grids. NIH Image J is used to calculate mean
particle diameters. Most typically, the average particle size
ranged from about 8 nanometers to about 30 nanometers. Formula A
had an average particle diameter of 16.+-.2.3 nm by TEM with a
surface charge of -2.4.+-.2.3 mev, as measured by a Zetasizer 4
dynamic light scattering device at a potential of 20 volts with a
2-minute pause between measurements in 1 mM KCl at 2 .mu.g/ml.
[0130] Tenascin-based ligands: Tenascin has been implicated in
cancer activities and also as being specific for smooth muscle
cells; furthermore, peptidic domains of tenascin have been
identified, e.g., as in U.S. Pat. No. 6,124,260, and are known in
the art. In one embodiment, tenascin suitable for the present
invention is H. sapiens tenascin C, Genbank Accession No.
NM_002160. Moreover, tenascin peptides and domains for adhesion
with particular cell types, as well as functional and structural
aspects of tenascin, have been disclosed and are known in the art,
e.g., Aukhill, et al. 1993 J Biol Chem 268:2542-2553. Tenascin
and/or any of its domains are suitable as ligands for the present
invention. In one embodiment, the fibrinogen fragment of tenascin
(also referred to herein as Fbg-L domain of tenascin-C or tenfibgen
or TBG; nucleotide sequence of tenfibgen used in one embodiment of
this invention as follows
TABLE-US-00001 (SEQ ID NO: 10)
(atgattggactcctgtaccccttccccaaggactgctcccaagcaatgc
tgaatggagacacgacctctggcctctacaccatttatctgaatggtgat
aaggctcaggcgctggaagtcttctgtgacatgacctctgatgggggtgg
atggattgtgttcctgagacgcaaaaacggacgcgagaacttctaccaaa
actggaaggcatatgctgctggatttggggaccgcagagaagaattctgg
cttgggctggacaacctgaacaaaatcacagcccaggggcagtacgagct
ccgggtggacctgcgggaccatggggagacagcctttgctgtctatgaca
agttcagcgtgggagatgccaagactcgctacaagctgaaggtggagggg
tacagtgggacagcaggtgactccatggcctaccacaatggcagatcctt
ctccacctttgacaaggacacagattcagccatcaccaactgtgctctgt
cctacaaaggggctttctggtacaggaactgtcaccgtgtcaacctgatg
gggagatatggggacaataaccacagtcagggcgttaactggttccactg
gaagggccacgaacactcaatccagtttgctgagatgaagctgagaccaa
gcaacttcagaaatcttgaaggcaggcgtaagcgggcataa)
is used as the ligand. Tenascin, its subdomains, or any other
biocompatible polymer ligand may be expressed or produced by
methods known in the art or methods which the artisan can readily
adapt. For illustration purposes, a method for producing TBG is
provided below.
[0131] Tenfibgen (TBG) preparation: For all TBG formulas, unless
otherwise noted, TBG was prepared by the method of Aukhil (J Biol
Chem (268): 2542-2553 (1993)) with modifications, i.e. TBG was
isolated and refolded from bacterial lysate by washing the
insoluble pellet once with lysis buffer (50 mM Tris-HCl, 1.0 mM
EDTA, 0.1 M NaCl, 0.2 mg/ml lysozyme, 0.1% Triton X-100, 0.1 mM
PMSF, pH 8.0) containing 2 M urea and resuspending in 4M GuCL, 5 mM
DTT in 0.02 M Tris-HCl, pH 8.0. After additional centrifugation,
the clarified TBG solution was diluted with 2 M Guanidine-HC1, 20
mM Tris-HC1, pH 8.0 to make a final OD280 of about 1 and diluted
dropwise about 10-fold into N.sub.2-sparged, 20 mM Tris-HC1, 0.2 M
NaCl, 0.5 M Arginine-HCl for overnight stirred incubation
(4.degree. C.). After diafiltration against 20 mM Tris-HCl, pH 8.0
with an approximate 4-5 fold reduction in concentration and 0.45
.mu.M filtration, a final purification was performed on heparan
sepharose in 20 mM Tris-HCl, pH 8.0, with elution by bringing the
NaCl concentration to 0.6 M. Endotoxin was removed in an anion
exchange chromatography step by applying pH 10.5 Tenfibgen to Q
Fast Flow resin, equillibrated with 20 mM NaH.sub.2CO.sub.3, 0.2M
NaCl, pH=10.5, then readjusting pH to 7 with H.sub.3PO.sub.4 before
final 0.2 um filtration. In therapeutic tumor-targeting
formulations, TBG was reprecipitated in ultra-pure 40% ammonium
sulfate containing 250 ppb As.sup.+3, 25 ppm Se.sup.+4, 2.5 ppm
Hg.sup.+2 and 25 ppm Mo.sup.+5 for about 16 hours.
[0132] Formula B: sub-50 nm nanoparticles coated with TBG were
generated as described in Formula A, except that 6.3 mcg of TBG was
added to 500 mcg of 2R-modified chimeric oligo (SEQ ID NO: 8),
condensed with 125 mcg of 10 kD polyornithine (Sigma). When
generating these nanoparticles, the TBG-coated micelles were
atomized into the salt receiving solution of Formula A except for
the following modified concentrations: 4.5 nM Sr.sup.2+, 2.25 nM
Mg.sup.2.+-.. Average particle diameter was less than 50 nm
(17.8.+-.3.1 nm), as measured by negative staining TEM using
elliptical diameters of a 1 ng/ml sample spotted onto a carbon
grid, with a surface charge of -7.7.+-.4.2 mev, as measured by a
Zetasizer 4 dynamic light scattering device at a potential of 20
volts with a 2-minute pause between measurements in 1 mM KCl at 2
.mu.g/ml.
[0133] Formula C: sub-50 nm nanoparticles coated with TBG were
generated as described in Formula A, except that 2.6 mcg of TBG was
added to 250 mcg of chimeric oligos (SEQ ID NOs:5 and 6, 1:1 by
weight) condensed with 100 mcg of 10 kD polyornithine (Sigma) and
micellized using 7.5 ug surfactant. When generating these
nanoparticles, the TBG-coated micelles were atomized into the salt
receiving solution of Formula A modified for the following
concentrations: 3.75 nM Sr.sup.2+, 4.68 nM Mg.sup.2+. Average
particle diameter was less than 50 nm (17.8.+-.1.5 nm), as measured
by negative staining TEM using elliptical diameters of a 1 ng/ml
sample spotted onto a carbon grid, with a surface charge of
-12.3.+-.3.5 mev, as measured by a Zetasizer 4 dynamic light
scattering device at a potential of 20 volts with a 2-minute pause
between measurements in 1 mM KCl at 2 .mu.g/ml.
[0134] Formula D: sub-50 nm nanoparticles coated with TBG were
generated as described in Formula C, except the oligonucleotide mix
consisted of SEQ ID NOs: 5 and 7 (1:1 by weight). Average particle
diameter was less than 50 nm (17.+-.1.6 nm), as measured by
negative staining TEM using elliptical diameters of a 1 ng/ml
sample spotted onto a carbon grid, with a surface charge of -7.1
.+-.5.4 mev, as measured by a Zetasizer 4 dynamic light scattering
device at a potential of 20 volts with a 2-minute pause between
measurements in 1 mM KCl at 2 .mu.g/ml.
[0135] Formula E: sub-50 nm nanoparticles coated with TBG were
generated as described in Formula A, except that 3.1 mcg of TBG was
added to 250 mcg of 2R-modified chimeric oligos (SEQ ID NOs: 8 and
9, 1:1 by weight) condensed with 62.5 mcg of 10 kD polyornithine
(Sigma) and micellized using 7.5 ug TM-diol. When generating these
nanoparticles, the TBG-coated micelles were atomized into the salt
receiving solution of Formula A modified for the following
concentrations: 2.5 nM Sr.sup.2+, 0.25 nM Mg.sup.2+. Average
particle diameter was less than 50 nm (19.5.+-.1.5 nm), as measured
by negative staining TEM using elliptical diameters of a 1 ng/ml
sample spotted onto a carbon grid, with a surface charge of
-5.8.+-.3.9 mev, as measured by a Zetasizer 4 dynamic light
scattering device at a potential of 20 volts with a 2-minute pause
between measurements in 1 mM KCl at 2 .mu.g/ml. Lithium content was
assessed as 5.39 ng of Li.sup.+ per .mu.g of oligo by ICP-AES. (It
is noted that for an analogous formulation, lithium content of 292
pg/ug of oligo was measured by the more senstive ICP-MS
method.)
[0136] Formula F: sub-50 nm control nanoparticles coated with TBG
were generated as described in Formula A, except that 6.3 mcg of
TBG was added to 500 mcg of a 2R-modified chimeric oligo
(anti-coagulation Factor VII, as reported in Akinc, et al. 2008 Nat
Biotechnol 26:5(561-9)) condensed with 125 mcg of 10 kD
polyornthine (Sigma) and micellized using 5 ug TM-diol. When
generating these nanoparticles, the TBG-coated micelles were
atomized into the salt receiving solution of Formula A modified for
the following concentrations: 1.17 nM Sr2+, 4.68 nM Mg2+. Average
particle diameter was less than 50 nm (24.7.+-.3 nm), as measured
by negative staining TEM using elliptical diameters of a 1 ng/ml
sample spotted onto a carbon grid, with a surface charge of
-7.6.+-.2.4 mev, as measured by a Zetasizer 4 dynamic light
scattering device at a potential of 20 volts with a 2-minute pause
between measurements in 1 mM KC1 at 2 .mu.g/ml.
[0137] Formula G: sub-50 nm nanoparticles coated with TBG were
generated as described in Formula A, except that the stabilization
solution was comprised of non-sterile, laboratory-grade water, and
the Lithium Chloride stock was not pretreated with cesium or any
other ion. The level of the following metals tested for in the
water used to prepare the stabilization solution was determined to
be about 0.9 parts per million in sum total: aluminum, arsenic,
barium, cadmium, chromium, copper, iron, lead, magnanese, nickel,
rubinium, sulfur, vanadium, and zinc. Nanoparticles were
resuspended following centrifugation in PBS+10% Lactitol. Average
particle diameter was less than 50 nm (21.8.+-.4 nm), as measured
by negative staining TEM using elliptical diameters of a 1 ng/ml
sample spotted onto a carbon grid, with a surface charge of
-9.6.+-.3.8 mev, as measured by a Zetasizer 4 dynamic light
scattering device at a potential of 20 volts with a 2-minute pause
between measurements in 1 mM KCl at 2 .mu.g/ml.
[0138] Formula H: sub-50 nm nanoparticles coated with TBG were
generated as described in Formula A using the same LCK oligo. When
generating these nanoparticles, the TBG-coated micelles were
atomized into the salt receiving solution of Formula A based on
Lithium Nitrate, rather than Lithium Chloride and modified for the
following concentrations: 7.5 nM Sr.sup.2+, 5.0 nM Mg.sup.2+.
Average particle diameter was less than 50 nm (21.5.+-.2 nm), as
measured by negative staining TEM using elliptical diameters of a 1
ng/ml sample spotted onto a carbon grid with a surface charge of
-12.4.+-.4 mev, as measured by a Zetasizer 4 dynamic light
scattering device at a potential of 20 volts with a 2-minute pause
between measurements in 1 mM KCl at 2 .mu.g/ml.
[0139] Formula I: sub-50 nm nanoparticles coated with 20 kD MW
hyaluronan (Sodium Hyaluronate powder resuspended in HPLC water,
Lifecore Biomedical, Lha, low molecular-weight hyaluronan) were
generated as described in Formula G, except that 3.1 mcg of HA
(substituted for TBG) was added to 125 mcg of plasmid DNA
(pVivol.beta.gal, Invivogen Corp., 10.5 kb) (substituted for
oligonucleotides), first complexed with 19.4 .mu.g of 25 kDa
polyethyleneimine (PEI; Sigma Chemical Co., St. Louis, Mo.), a
branched cationic polymer, then micellized with 6.25 ug of TM-diol.
When generating these nanoparticles, the Lha-coated micelles were
atomized into the salt receiving solution of Formula G modified for
the following concentrations and additions: 2 nM Sr.sup.2+, 0.5 nM
Mg.sup.2+, 0.54 Bi.sup.2+ .mu.M, and addition of 0.40 mM Ni.sup.2+
(ultrapure, basis of 40 ml total volume) . Average particle
diameter was less than 50 nm (20.4.+-.2), as measured by negative
staining TEM using elliptical diameters of a 1 ng/ml sample spotted
onto a carbon grid with an average surface charge of -8.1.+-.4.7
mev, as measured by a Zetasizer 4 dynamic light scattering device
at a potential of 20 volts with a 2-minute pause between
measurements in 1 mM KCl at 2 .mu.g/ml.
[0140] Formula J: sub-50 nm nanoparticles coated with 20 kD MW
hyaluronan (Sodium Hyaluronate powder resuspended in HPLC water,
Lifecore Biomedical, Lha, low molecular-weight hyaluronan) were
generated as described in Formula A, except that 3.1 mcg of HA
(substituted for TBG) was added to 125 mcg of plasmid DNA
(pVivol.beta.gal, Invivogen Corp., 10.5 kb) (substituted for
oligonucleotides), first complexed with 19.4 .mu.g of 25 kDa
polyethyleneimine (PEI; Sigma Chemical Co., St. Louis, Mo.), a
branched cationic polymer, then micellized with 6.25 .mu.g of
TM-diol. When generating these nanoparticles, the Lha-coated
micelles were atomized into the salt receiving solution of Formula
A modified for the following concentrations and additions: 2 nM
Sr.sup.2+, 0.5 nM Mg.sup.2+, 0.54 Bi.sup.2+ uM and addition of 0.40
mM Ni.sup.2+ (ultrapure, basis of 40 ml total volume). Average
particle diameter was less than 50 nm (22.7.+-.5 nm), as measured
by negative staining TEM using elliptical diameters of a 1 ng/ml
sample spotted onto a carbon grid with an average surface charge of
-6.4.+-.4.2 mev, as measured by a Zetasizer 4 dynamic light
scattering device at a potential of 20 volts with a 2-minute pause
between measurements in 1 mM KCl at 2 .mu.g/ml. Li+ content of
between 8.1-13.1 ng/.mu.g of plasmid have been measured in similar
formulations by ICP (data not shown). By routine characterization
and TEM, plasmid s50 particles of Formula I and J were found to be
similar to TBG-coated oligo particles of Formulas A-H in terms of
physical properties and comparable TEM. For example, regardless of
nucleic acid cargo, nanoparticle encapsulation yields for the
formulas described herein were greater than 95%, as determined by
the modified method of Burton (Kren, et al. 2009 JCI 119 :2086-99)
(data not shown). This similarity of properties between the
nanoparticles comprising an oligonucleotide bioactive agent and
protein shell and the nanoparticles comprising a plasmid DNA
bioactive agent and carbohydrate shell demonstrates the flexibility
of the nanoparticle formulation process and resulting nanoparticle
composition to accommodate different bioactive agents, polymers,
and ligand moieties.
Example 2
Cesium Modification of the Lithium Ion in Nanoparticle Synthesis
Improves Stability.
[0141] Besides being efficacious, nanoparticle dosage forms must
comply with the requirements of pharmaceutical manufacturing and
product requirements from regulatory and other entities. For
example, a nanoparticle's physical stability is a a key component
of its regulatory approval, impacting formulation, manufacturing,
and storage protocols. Trace addition of cesium to the nanoparticle
synthesis when executed in sterile water, has been found,
surprisingly, to result in improved physical stability, as
manifested by enhanced shipping performance and Burton-derived
stability measures.
[0142] It has been discovered, quite unexpectedly, that 2.5 ppb
cesium pre-treatment of the lithium before assembling the receiving
solution into which the ligand-stabilized micelles are added
quadruples the concentration at which nanoparticles bearing either
oliogonucleotides or plasmid DNA may be shipped as liquid
formulations by air freight at -4.degree. C. These observations are
summarized in Table 1. In these air shipping tests, nanoparticle
suspensions were concentrated by lyophilization, shipped, and
subsequently examined upon return for changes in particle diameter
by TEM microscopy following an air shipping challenge. In TEM, the
inventive nanoparticles appear as cubic or fractal supramolecular
assemblies surrounded in a visible, but poorly refractive corona,
comprised of targeting ligand (data not shown). For example,
suspension concentrations of 20 mg/ml are required to aquire light
scattering data for (i.e., to detect) the nanoparticles (sized
approximately 25 nanometers in diameter) in low power (1 mW)
dynamic light scattering (DLS). In contrast, ligand-coated micelles
preceding incubation in the cesium-treated lithium salt receiving
solution, while similarly small in size (28 nm diameter, Table 1),
are readily detected at concentrations of about 1 mg/ml under
similar DLS conditions, suggesting significant change in
nanoparticle supramolecular assembly occurs during the
incubation/stabilization step (data not shown).
[0143] In shipping and control samples, particle diameters were
quantified by image analysis in NIH Image J as the average of
ellipitical axes fitted to particles from TEM micrographs. Results
are summarized in Table 1 to show that for a non-modified cesium
formulation bearing oligo (Formula G), average particle diameter
increased 161% from a control formulation to the same formulation
air-shipped at 3 mg/ml. A concommitant loss in protein corona
surrounding the faceted, birefringent particle was also observed
after shipping (data not shown). In contrast, the analogous
cesium-modified formulation (Formula A) maintained shape and corona
at 4 mg/ml (Table 1, data not shown).
[0144] The same analysis was executed for a pair of formulations
bearing a commercial reporter gene plasmid and coated with
hyaluronan with a similar result. For Formula J, prepared with
cesium pre-treatment of the lithium in the receiving bath,
particles could be shipped at 8-fold increase in concentration (2
vs. 0.25 mg/ml) with less than 15% increase in particle diameter
relative to Formula I, prepared without cesium pretreament. A loss
in ligand corona was also observed in the non-cesium pretreated
particles with increased shipping concentration also (data not
shown). The improvement in shipping concentration demonstrated with
Formula H, prepared with Lithium Nitrate rather than Lithium
Chloride, indicates that multiple salts of lithium may be used in
nanoparticle synthesis. While premixing of cesium and lithium prior
to their addition to the salt receiving solution resulted in
nanoparticles of suitable spherical or cuboid ultra-small (LTE 50
nm dry diameter) morphology, the unmixed addition of cesium and
lithium to the salt receiving solutiondid not (data not shown).
TABLE-US-00002 TABLE 1 Particle and shipping stability with +
without cesium modification Particle DSC Diameter .sup.1
Transactions.sup.3, % .DELTA. In vitro .degree. C., gt FTIR
spectrum.sup.7 from release .sup.2 midpoints, et (wavenumber,
Particle/Cargo Formula (nm) control Hrs % .DELTA. nadirs cm -1) PBS
+ 10% Lactitol gt 160; sharp et, 186 TM-Diol surfactant.sup.4 quad,
2956, 2928, 2873, 2832; singlet, 1733; triplet, 1449, 1370, 1260;
group of 5; singlet, 805 Ligand-coated micelle.sup.4 28.2 .+-. 1.6
broad et, 98, 105 (45-126) TBG LCK oligo (-Cs) G 21.8 .+-. 0.9 --
62 -- gt 158; v brd, 3329; quad, 2952, 1 mg/ml shipped 27.4 .+-.
1.4 +26* strong, broad 2921, 2873, 2839; s brd et, 180(172-
singlet, 1647; md triplet, 200) 1456, 1377, 1260; v st 2 mg/ml
shipped 35.9 .+-. 1.2 +65* doublet, 1079, 1031; md 3 mg/ml shipped
57 .+-. 3.4 +161* singlet, 798 TBG LCK oligo(+Cs) A 24.8 .+-. 2.5
104 +68 et, v brd, 3377; triplet, 2 mg/ml shipped 24.7 .+-. 1.8 0
130, 137, 275 2952, 2925, 2853; 3 mg/ml shipped 25.7 .+-. 1 +4
doublet, 1740, 1644; md 4 mg/ml shipped 21.4 .+-. 1.1 -14 triplet,
1462, 1377, 1260; v st doublet, 1093, 1021; md singlet, 795 TBG LCK
oligo(+Cs) H 21.5 .+-. 0.5 82 +33 3 mg/ml shipped 22.8 .+-. 0.9 +6
LhaNi pVivo.beta.gal I 20.4 .+-. 0.5 -- 117 -- gt 158; (-Cs)
strong, broad 0.25 mg/ml, shipped 23.4 .+-. 0.9 +15 et, 178(172-
227).sup.5 0.5 mg/ml, shipped 32.3 .+-. 1.3 +58* 1 mg/ml, shipped
34.4 .+-. 2.2 +69* 2 mg/ml, shipped 36 .+-. 1.6 +76* LhaNi
pVivo.beta.gal J 22.7 .+-. 1.1 .sup. >120.sup.6 +++ vs gt 150;
(+Cs) sharp et, 193, 0.25 mg/ml, shipped 21.6 .+-. 0.7 -5 206,
227.degree. C..sup.5 0.5 mg/ml, shipped 21 .+-. 0.9 -7 1 mg/ml,
shipped 23.8 .+-. 1.3 +5 2 mg/ml, shipped 25.5 .+-. 1.6 +12 Notes:
*= p < 0.5, .sup.1 Particle diameter was measured as average
elliptical diameter after drying at 0.1 ng/ml by negative staining
TEM at x271,000. Expressed as mean .+-. SE with 15-20 measurements
per analysis. Lots were confirmed to have substantial in vitro
cellular uptake into tumor cells grown in 3-D culture before use in
shipping studies. .sup.2 In vitro release was measured in
conjunction with DNA incorporation by a colorimetric, modified
Burton assay employing a standard curve. Release is reported as a
timepoint interpolated from later timepoints with average Burton
yields surrounding 100%. .sup.3Thermal transitions were identified
from thermograms generated by differential scanning calorimetry
(DSC). Suspensions were dried to produce powder for analysis, and
1-2 mg were scanned at 20.degree. C./min from room temperature to
about 400.degree. C. in crimped aluminum pans. abbreviations, gt,
glass transition; et, endotherm; vs, very small. .sup.4TM-Diol is
unformulated hydrophobic surfactant and is presented for analysis
reference. Ligand-coated micelles are micelles formulated according
to Formula E but were scanned prior to incubation in salt receiving
solution. .sup.5Hyaluronan-coated ligand particles were similar
formulations to shipping samples but comprised 8.5 kb reporter gene
plasmids rather than 10.5 kb reporter plasmids. .sup.6After about
120 hours in this form of assay, color started to degrade in the
standard curve, necessitating, here, the premature termination of
the assay. .sup.7The FTIR spectra were recorded using a Perkin
Elmer Spectrum 65, equipped with a ATR attachment, a mid-infrared
source as the excitation source, and a DTGS detector. The spectra
were acquired in 32 scans at a resolution of 4 cm.sup.-1.
Suspension samples were extracted with 3:1 (v/v) of isobutyl to
isoamyl alcohol at 4.degree. C. to remove residual surfactant and
evaporated, dried powder was submitted for analysis. Abbreviations,
v, very; s, small; md, moderate; str, strong; brd, broad.
[0145] The impact of cesium pre-treatment of lithium preceding
assembly of the receiving solution on particle stability was
further investigated by examining formulations for in vitro
release. In vitro release was assessed in conjunction with particle
degradation based on a modified colorimetric Burton assay (Kren, et
al. 2009 JCI 119:2086-99). In this assay, particles are incubated
at 56.degree. C. in 1M NaOH overnight rather than 6M NaOH. The
nanoparticles were then neutralized and the Burton reagents added
to create a blue signal upon reaction with released DNA. Percent
yield is expressed relative to a theoretical value from a standard
curve, so that 100% yield is approached as the nanoparticles are
fully degraded to release their contents. In vitro release is then
expressed as an endpoint interpolated from timepoints surrounding
100% yield. Thus, in vitro release time is a measure of the
nanoparticle's resistance to degradation, and its increase
following Cs-pre-treatment corresponds with the increase in
shipping stability observed for Cs-treated vs. non-CS-treated
nanoparticles for both oligo and plasmid series (Table 1 in vitro
release times; Cs vs. non-Cs oligo, 104 hrs. vs. 62 hrs.; Cs vs.
non-Cs plasmid DNA, >120 hrs. vs. 117 hrs.).
[0146] To investigate how differences in nanoparticle composition
might impact the inventive nanoparticles at a physical (release)
and functional (shipping) level, thermal profiles of the dried and
crushed powder of the oligo and plasmid-bearing nanoparticles were
examined for potential changes in characteristic transitions by
differential scanning calorimetry at 10.degree. C. per minute over
a range from about 25.degree. C. to about 400.degree. C.
(summarized in Table 1, above). In multiple runs, a small
transition at 158.degree. C., followed by a strong, broad endotherm
(172-200.degree. C.) with nadir at 180.degree. C., was observed in
the non-Cs-modifed Formula G, while only one strong endotherm at
275.degree. C. was observed for Cs-modified Formula A, indicating a
change in morphological state. Similarly, for hyaluronan
nanoparticles bearing 8.5 kb reporter gene plasmids, in the
non-Cs-modified compound (representing Formula I), a small
transition at 158.degree. C. followed by a stong and broad
endotherm with nadir at 178.degree. C. (172-227) was observed,
compared to the Cs-modified compound, where a very small transition
at 150.degree. C., with strong, very sharp endotherms at 193, 206,
and 227.degree. C., was observed (representing Formula J), again
indicating a change in morphological state. In contrast, a scan of
the diluent, PBS+10% lactitol, a non-reducing sugar, showed a very
small transition at about 160.degree. C. and a strong, sharp
endotherm at 186.degree. C. with a degradation endotherm centered
around at about 310.degree. C. All nanoparticle compounds showed
such an endotherm centered around 307-313.degree. C. A thermal scan
of a TBG-coated micelle before atomization and subsequent
incubation in the primarily lithium salt solution ("Ligand-coated
micelle") showed a broad endotherm with peaks (98, 105.degree. C.)
centered around 100.degree. C. The observation that this thermogram
was markedly different from the nanoparticles scanned post
incubation in the cesium-treated lithium solution supports the
statement that the cesium-treated lithium solution imparts order
and rearrangement to the stabilized micelle and nanoparticle over
time to create a unique supramolecular assembly.
[0147] Compound differences upon introducing cesium-pretreatment of
lithium into the stabilization bath were further investigated by
FTIR spectroscopy. The FTIR spectrum of non-Cs Formula G and
Cs-containing Formula A were read from 600-4000 cm-.sup.1. Based on
peak assignment derived from component and library scans, the
capsule scans were generally characterized by a broad, intensive
band around 3300, representing the O--H stretching vibration of
water at 3390 cm-.sup.1, groups of bands attributable to the
surfactant (4: at about 2956-2832 cm.sup.-1, 3:at about 1449-1260
cm.sup.-1) and a strong, intensive band attributable to Li--O and
Li--OH vibrations at about 1100-1110 cm.sup.-1. Major peak
differences observed upon cesium-pretreatment of the stabilizing
bath (Formula G vs. Formula A) were: 1) the narrowing of a broad
peak at about 1647 cm.sup.-1 into peaks at about 1740, 1640; 2) the
modification of a likely surfactant-derived quadruplet at about
2952-2839 into a triplet at about 2952-2853; and 3) a shift in the
water vibration band from about 3329 to 3377 cm.sup.-1.
[0148] In terms of absorbance shifts, cesium pretreatment resulted
in a greater than 50% decrease in the magnitude of the water
absorbance, consistent with a possible decrease in the amount of
water trapped within a reorganized capsule assembly. Of note, the
hydrophobic surfactant was devoid of absorbances in this region.
There were also greater than 50% absorbance increases in the
surfactant-attributable bands at about 1260 and 795 cm.sup.-1
nearest to the lithium region, suggesting possible changes in the
interactions between these critical components of the assembly.
Following atomization of the ligand-coated micelle into the
receiving bath comprised of cesium-treated lithium, these
components are in intimate contact for a number of hours before the
reaction is stopped.
[0149] Significant changes in thermal transitions and IR spectra
are important indicators of polymorphic change in crystalline
compounds, pharmaceutical compounds, and nanoscale supramolecular
assemblies, which are known to undergo, in different morphology
states, important phyical and functional change. Without wishing to
be be bound by theory, the indicated differences (Table 1) in
morphological state for Cs-modified nanoparticles compared with
unmodified nanoparticles potentially provides an important
mechansim underlying the improved shipping stability and extended
Burton-derived in vitro stability observed for the Cs-modified
nanoparticles.
[0150] This example shows that the inventive nanoparticles
substantially increase shipping concentrations and Burton-derived
stability for diverse cargos and nanoparticle polymorphs.
Example 3
Modified Chimeric Polynucleotide Mix Demonstrates Surprising
Efficacy in a Mouse Tumor Model.
[0151] The cesium-modified nanoparticles comprising TBG ligands and
anti-CK2 chimeric polynucleotide bioactive agents are directed
toward manipulating levels of Casein Kinase 2alpha (Csnk2a1) and
Casein Kinase 2alphaprime (Csnk2a2) protein in tumor and tumor
stromal cells, as the TBG ligand in the nanoparticle delivery
system directs particle and oligo cargo to both tissue types.
Casein Kinase 2 (CK2) is a ubiquitous enzyme overdriven by tumor
cells to promote survival by multiple pathways, and it accumulates
in cell nuclei under conditions of stress and in tumors. Shuttling
of CK2 from the nuclear compartment precedes apoptosis, and the
inability of the tumor cell to maintain nuclear CK2 precedes tumor
death. Oncology therapeutics are often evaluated in human tumors
grown in immunocompromised mice (xenograft models). As outlined in
Table 2, below, in the regions of the genes targeted with the
bifunctional oligos engaging Ago2 and RNAseH (U.S. Patent
Publication No. 2013/0267577, incorporated herein in its entirety
by reference), up to 3 mismatches can exist between human and mouse
(3 between hu Csnk2a1 and mu Csnk2a2). Mismatches to hu Csnk2a1 are
highlighted by shading and either bolded underline, outlined, or
oversize letters.
[0152] Upon incorporating a single-nucleotide modification into the
single-strand oligo design described herein (SEQ ID NO: 8), as well
as into a novel single-strand oligo design directed to Csnk2a2 (SEQ
ID NO: 9), and combining these single-strand oligos in TBG-coated
s50 particles to form a CK2 anticancer therapeutic mix, significant
results in terms of inhibition of tumor growth, cell proliferation,
and inflammation were achieved in tumor-bearing mice. The 2R
backbone modification consisted of changing a single
nucleotide--the DNA nucleotide at position 2 from the 5'-end to a
2'-O-methyl-modified RNA nucleotide. All backbone linkages in these
oligos were phosphodiester. In this experiment, efforts were also
made to assess the impact of mismatching analogous murine target
regions. Table 2, below, describes the sequences used or referred
to the instant example:
TABLE-US-00003 TABLE 2 Sequences Target- SEQ DNA perfect match ID
NO: Sequence Hu Csnk2a1 1 ATGTGGAGTTTGGGTTGTAT Hu Csnk2a2 2
ATGTGGAGTTTGGGCTGTAT Mu Csnk2a1 3 ##STR00001## Mu Csnk2a2 4
##STR00002## Oligos LCK Hu Csnk2a1 5 5'ATACAACCCAAACT
ccacau-propyl-3' huCK2prime Hu Csnk2a2 6 5'ATACAGCCCAAACT
ccacau-propyl-3' muCK2prime Mu Csnk2a2 7 ##STR00003## Modified
Oligos 2RLCK Hu Csnk2a1 8 5'AuACAACCCAAACT ccacau-propyl-3'
2RhuCK2prime Hu Csnk2a2 9 5'AuACAGCCCAAACT ccacau-propyl-3' Notes:
1) All nucleotide linkages are phosphodiester. 2) Italics in DNA
target sequences = 2' O--Methyl RNA region in the 3' end of the
corresponding chimeric drug oligo. 3) Mismatches to Hu Csnk2a1 are
shaded and contain either shaded underline, boxed, or oversize
underline letters. 4) For Oligos and Modified Oligos, caps denote
DNA, lower case denotes RNA, and all RNA nucleotides are 2' O--Me
modified.
[0153] Using two strains of nude mouse (FoxN, Balb/CaNCR (BN)) and
one tumor line (FaDu, hypopharyngeal), mice were inoculated
intradermally with either 2e.sup.6 (FoxN) or 2e.sup.5 (BN) tumor
cells in 50% Matrigel, and subcutaneous treatment was initiated 7
days later. Average tumor size at start of treatment was
approximately 69-86 cu mm. Cohorts of 5 mice were treated at 10
.mu.g/kg twice weekly. In some cases, after approximately 10 days
of treatment, 2 mice from a treatment group were sacrificed. After
30 days of treatment (D30), the remaining 3-5 animals per group
were sacrificed, and residual viable tumors were weighed.
[0154] To assess molecular changes, cryosections from viable tumor
regions from each mouse were assayed for Ki-67 and p65 NF-kB levels
by microscopy and quantified as signal area fraction thresholded
against background controls using NIH Image J. Duplicate
representative fields were collected from viable tumor sections
representing all D30 mice. Ki-67 is a common clinical indicator of
tumor proliferation rate and is expressed as a fraction or
percentage of viable cell nuclei area, and p65 NF-kB is a major
signaling and regulatory protein in inflammation and is an
important downstream target of CK2. NF-kB is aberrantly activated,
and inhibition of NF-kB induces cell death and inhibits
tumorigenesis in head and neck squamous cell carcinomas (HNSCC)
(Yu, et al. 2006 Cancer Research 66:6722-6731). The artisan, thus,
appreciates the potency and many of the results of anti-CK2
strategies in tumor models can be understood in terms of anti-NF-kB
activity. In terms of cell biology, p65 NF-kB (similar to CK2)
localizes to cell nuclei under inflammatory conditions and
conditions of stress, and is cytoplasmic or less detectable with
increasing reduction in inflammation. Table 3 summarizes treatments
and results for the three analyses.
TABLE-US-00004 TABLE 3 Results 30 days after start of treatment in
mouse Fadu tumor model SEQ Ki-67 Index NF-kB Index ID Formula Tumor
(signal area/ (signal/tissue Treatment NO: No..sup.5 Weight (g) %
.DELTA. nuclear area) % .DELTA. area) % .DELTA. Experiment
E1-Effect of 2R modification on starting single-stranded oligo in
FoxN mouse model. Control 1.03 .+-. 0.04 0.8 .+-. 00.13 0.87 .+-.
0.06 2RLCK 8 B 0.58 .+-. 0.19 -43.7 0.87 .+-. 0.09 +9 0.69 .+-.
0.06 -20.4 LCK 5 A 1.043 .+-. 0.22 0 1.1 .+-. 0.32 +44 0.8 .+-. 0.1
-7.5 Experiment E2-Effect of oligo mix perfect match approach
without 2R modification in BN mouse model Control 0.634 .+-. 0.17
0.96 .+-. 0.05 0.78 .+-. 0.01 muMix 5 + 7 D 0.8 .+-. 0.07 +26.2
0.85 .+-. 0.33 -11 0.31 .+-. 0.05 -59.7* huMix 5 + 6 C 0.85 .+-.
0.06 +34.1* 0.89 .+-. 0.42 -6.5 0.82 .+-. 0.12 +5.1 LCK 5 A 1.0
.+-. 0.39 +57.7 1 .+-. 0.16 +5.5 0.74 .+-. 0.01 -5.3 Experiment
E3-Effect of combined 2R modification and oligo mix approach in BN
mouse model Control 0.68 .+-. 0.24 0.89 .+-. 0.11 0.89 .+-. 0.09 2R
huMix 8 + 9 E 0.29 .+-. 0.04 -56.1*# 0.24 .+-. 0.1 -73* 0.0029 .+-.
0.002 -99.7* Notes: 1) N = 3 mice per group, except for huMix which
had 5. 2) Values are reported as mean .+-. SE. 3) *= p < 0.05,
Student's t-test. 4) #= p < 0.05, Student's t-test, significant
against entire BN control pool, 0.66 .+-. 0.11 g. .sup.5Formula
number for TBG nanoencapsulated sequence as listed under and
described in Example 1.
[0155] Of note, despite limited differences between the
oligonucleotide components of the experiment groups, the
TBG-encapsulated 2R huMix oligo was the only approach that produced
significant reductions in all three categories of tumor weight,
cell proliferation (Ki-67), and inflammation index (NF-kB) vs.
controls 30 days after the start of treatment (Table 2, E3
experiment, Formula E). Neither the encapsulated single-nucleotide
2R modification (E1 experiment, Formula B) nor the encapsulated
huMix approach (E2 experiment, Formula C) showed a significant
decrease in tumor weight at 30 days post-treatment. Indeed, the
huMix-treated group (Formula C) showed a significant increase of
34% in tumor weight relative to control. Conversely, the tumors
from mice treated with nanoencapsulated 2RhuMix (Formula E) showed
a significant 56% reduction in tumor weight against pooled BN
control tumors that corresponded with large and dramatic reductions
in cell proliferation and inflammatory index (-73% Ki-67 index,
-99.7% p65 NF-kB signal fraction, p<0.05). No other treatment
group showed significant reduction in both cell proliferation index
and p65 NF-kB signal vs. controls, much less those two measures and
tumor weight. The muMix treatment in the E2