U.S. patent application number 16/498465 was filed with the patent office on 2020-04-09 for method of regulating gene expression in a cell.
This patent application is currently assigned to President and Fellows of Harvard College. The applicant listed for this patent is President and Fellows of Harvard College. Invention is credited to George M. Church, Anik Debnath, Javier Fernandez Juarez, Henry Hung-yi Lee.
Application Number | 20200109407 16/498465 |
Document ID | / |
Family ID | 63678315 |
Filed Date | 2020-04-09 |
![](/patent/app/20200109407/US20200109407A1-20200409-D00000.png)
![](/patent/app/20200109407/US20200109407A1-20200409-D00001.png)
![](/patent/app/20200109407/US20200109407A1-20200409-D00002.png)
![](/patent/app/20200109407/US20200109407A1-20200409-D00003.png)
![](/patent/app/20200109407/US20200109407A1-20200409-D00004.png)
![](/patent/app/20200109407/US20200109407A1-20200409-D00005.png)
![](/patent/app/20200109407/US20200109407A1-20200409-D00006.png)
![](/patent/app/20200109407/US20200109407A1-20200409-D00007.png)
![](/patent/app/20200109407/US20200109407A1-20200409-D00008.png)
![](/patent/app/20200109407/US20200109407A1-20200409-D00009.png)
![](/patent/app/20200109407/US20200109407A1-20200409-D00010.png)
View All Diagrams
United States Patent
Application |
20200109407 |
Kind Code |
A1 |
Debnath; Anik ; et
al. |
April 9, 2020 |
Method of Regulating Gene Expression in a Cell
Abstract
The disclosure provides methods of making a tetracycline
inducible expression system in a cell. The methods include
providing the cell with a first nucleic acid sequence comprising a
first promoter operably linked to a tetracycline repressor gene
coding sequence, providing the cell with a second nucleic acid
sequence comprising a second promoter operably linked to a coding
sequence of a gene of interest wherein the second promoter is
modified to include one or more tetracycline repressor protein
binding sites, and determining the expression of the gene of
interest in the presence or absence of tetracycline. The disclosure
further provides nucleic acid sequences, vectors and cells
including the tetracycline inducible modified promoter.
Inventors: |
Debnath; Anik; (Boston,
MA) ; Juarez; Javier Fernandez; (Cambridge, MA)
; Lee; Henry Hung-yi; (Brookline, MA) ; Church;
George M.; (Brookline, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
President and Fellows of Harvard College |
Cambridge |
MA |
US |
|
|
Assignee: |
President and Fellows of Harvard
College
Cambridge
MA
|
Family ID: |
63678315 |
Appl. No.: |
16/498465 |
Filed: |
March 29, 2018 |
PCT Filed: |
March 29, 2018 |
PCT NO: |
PCT/US18/25154 |
371 Date: |
September 27, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62478219 |
Mar 29, 2017 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 1/20 20130101; C12N
15/635 20130101; C12R 1/25 20130101; A61P 29/00 20180101; C12R 1/24
20130101; C12N 15/746 20130101; C12R 1/245 20130101; C12R 1/23
20130101 |
International
Class: |
C12N 15/63 20060101
C12N015/63; C12N 1/20 20060101 C12N001/20; C12R 1/25 20060101
C12R001/25; C12N 15/74 20060101 C12N015/74; C12R 1/23 20060101
C12R001/23; C12R 1/24 20060101 C12R001/24; C12R 1/245 20060101
C12R001/245 |
Goverment Interests
STATEMENT OF GOVERNMENT INTERESTS
[0002] This invention was made with government support under
DE-FG02-02ER63445 awarded by Department of Energy. The government
has certain rights in the invention.
Claims
1. A lactic acid bacterial cell comprising a first exogenous
nucleic acid sequence comprising an agent-responsive element
operably linked to a target nucleic acid sequence, such that the
agent responsive element is inducible in the presence of the agent
to initiate transcription of the target nucleic acid sequence into
a corresponding mRNA and translation into a corresponding amino
acid sequence.
2. The method of claim 1 wherein the agent bonds to a
transcriptional repressor protein bound to a transcriptional
repressor protein binding site to cause an allosteric or
conformational change to the transcriptional repressor protein
thereby releasing the transcriptional repressor protein from the
transcriptional repressor protein binding site.
3. The lactic acid bacterial cell of claim 1 wherein the
agent-responsive element comprises a constitutive promoter sequence
modified to include one or more exogenous transcriptional repressor
protein binding sites corresponding to one or more transcriptional
repressor proteins, wherein the constitutive promoter sequence
within the agent-responsive element is operable to initiate
transcription of the target nucleic acid sequence in the absence of
one or more transcriptional repressor proteins.
4. The lactic acid bacterial cell of claim 1 wherein the
agent-responsive element comprises a constitutive promoter sequence
modified to include one or more exogenous transcriptional repressor
protein binding sites and wherein the lactic acid bacterial cell
further includes an exogenous nucleic acid sequence encoding one or
more transcriptional repressor proteins corresponding to the one or
more transcriptional repressor protein binding sites, wherein the
one or more transcriptional repressor proteins, when expressed,
bind to the one or more transcriptional repressor protein binding
sites to repress transcription of the target nucleic acid sequence,
and wherein, the agent activates the promoter and induces
transcription of the target nucleic acid sequence.
5. The method of claim 1 wherein the transcriptional repressor
protein binding site is TetO, the transcriptional repressor protein
is TetR and the agent is tetracycline.
6. The lactic acid bacterial cell of claim 1 wherein the lactic
acid bacterial cell is within the order Lactobacillales.
7. The lactic acid bacterial cell of claim 1 being a member of the
group consisting of Lactobacillus, Leuconostoc, Pediococcus,
Lactococcus, Streptococcus, Carnobacterium, Enterococcus,
Oenococcus, Tetragenococcus, Vagococcus, and Weisella.
8. The lactic acid bacterial cell of claim 1 wherein the lactic
acid bacterial cell is a member of the group consisting of
Lactobacillus acetotolerans, Lactobacillus acidifarinae,
Lactobacillus acidipiscis, Lactobacillus acidophilus, Lactobacillus
agilis, Lactobacillus algidus, Lactobacillus alimentarius,
Lactobacillus alvei, Lactobacillus alvi, Lactobacillus
amylolyticus, Lactobacillus amylophilus, Lactobacillus
amylotrophicus, Lactobacillus amylovorus, Lactobacillus animalis,
Lactobacillus animata, Lactobacillus antri, Lactobacillus apinorum,
Lactobacillus apis, Lactobacillus apodemi, Lactobacillus aquaticus,
Lactobacillus aviarius, Lactobacillus backii, Lactobacillus
bifermentans, Lactobacillus bombi, Lactobacillus bombicola,
Lactobacillus brantae, Lactobacillus brevis, Lactobacillus
brevisimilis, Lactobacillus buchneri, Lactobacillus cacaonum,
Lactobacillus camelliae, Lactobacillus capillatus, Lactobacillus
casei, Lactobacillus paracasei, Lactobacillus zeae, Lactobacillus
catenefornis, Lactobacillus ceti, Lactobacillus coleohominis,
Lactobacillus colini, Lactobacillus collinoides, Lactobacillus
composti, Lactobacillus concavus, Lactobacillus coryniformis,
Lactobacillus crispatus, Lactobacillus crustorum, Lactobacillus
curieae, Lactobacillus curvatus, Lactobacillus delbrueckii,
Lactobacillus dextrinicus, Lactobacillus diolivorans, Lactobacillus
equi, Lactobacillus equicursoris, Lactobacillus equigenerosi,
Lactobacillus fabifermentans, Lactobacillus faecis, Lactobacillus
faeni, Lactobacillus farciminis, Lactobacillus farraginis,
Lactobacillus fermentum, Lactobacillus floricola, Lactobacillus
florum, Lactobacillus formosensis, Lactobacillus fornicalis,
Lactobacillus fructivorans, Lactobacillus frumenti, Lactobacillus
fuchuensis, Lactobacillus furfuricola, Lactobacillus futsaii,
Lactobacillus gallinarum, Lactobacillus gasseri, Lactobacillus
gastricus, Lactobacillus ghanensis, Lactobacillus gigeriorum,
Lactobacillus ginsenosidimutans, Lactobacillus gorillae,
Lactobacillus graminis, Lactobacillus guizhouensis, Lactobacillus
halophilus, Lactobacillus hammesii, Lactobacillus hamsteri,
Lactobacillus harbinensis, Lactobacillus hayakitensis,
Lactobacillus heilongjiangensis, Lactobacillus helsingborgensis,
Lactobacillus helveticus, Lactobacillus herbarum, Lactobacillus
heterohiochii, Lactobacillus hilgardii, Lactobacillus
hokkaidonensis, Lactobacillus hominis, Lactobacillus homohiochii,
Lactobacillus hordei, Lactobacillus iatae, Lactobacillus iners,
Lactobacillus ingluviei, Lactobacillus insectis, Lactobacillus
insicii, Lactobacillus intermedius, Lactobacillus intestinalis,
Lactobacillus iwatensis, Lactobacillus ixorae, Lactobacillus
japonicus, Lactobacillus jensenii, Lactobacillus johnsonii,
Lactobacillus kalixensis, Lactobacillus kefiranofaciens,
Lactobacillus kefiri, Lactobacillus kimbladii, Lactobacillus
kimchicus, Lactobacillus kimchiensis, Lactobacillus kisonensis,
Lactobacillus kitasatonis, Lactobacillus koreensis, Lactobacillus
kullabergensis, Lactobacillus kunkeei, Lactobacillus larvae,
Lactobacillus leichmannii, Lactobacillus letivazi, Lactobacillus
lindneri, Lactobacillus malefermentans, Lactobacillus mali,
Lactobacillus manihotivorans, Lactobacillus mellifer, Lactobacillus
mellis, Lactobacillus melliventris, Lactobacillus micheneri,
Lactobacillus mindensis, Lactobacillus mixtipabuli, Lactobacillus
mobilis, Lactobacillus modestisalitolerans, Lactobacillus mucosae,
Lactobacillus mudanjiangensis, Lactobacillus murinus, Lactobacillus
nagelii, Lactobacillus namurensis, Lactobacillus nantensis,
Lactobacillus nasuensis, Lactobacillus nenjiangensis, Lactobacillus
nodensis, Lactobacillus odoratitofui, Lactobacillus oeni,
Lactobacillus oligofermentans, Lactobacillus ori, Lactobacillus
oryzae, Lactobacillus otakiensis, Lactobacillus ozensis,
Lactobacillus panis, Lactobacillus pantheris, Lactobacillus
parabrevis, Lactobacillus parabuchneri, Lactobacillus
paracollinoides, Lactobacillus parafarraginis, Lactobacillus
parakefiri, Lactobacillus paralimentarius, Lactobacillus
paraplantarum, Lactobacillus pasteurii, Lactobacillus paucivorans,
Lactobacillus pentosus, Lactobacillus perolens, Lactobacillus
plajomi, Lactobacillus plantarum, Lactobacillus pobuzihii,
Lactobacillus pontis, Lactobacillus porcinae, Lactobacillus
psittaci, Lactobacillus rapi, Lactobacillus rennanquilfy,
Lactobacillus rennini, Lactobacillus reuteri, Lactobacillus
rhamnosus, Lactobacillus rodentium, Lactobacillus rogosae,
Lactobacillus rossiae, Lactobacillus ruminis, Lactobacillus
saerimneri, Lactobacillus sakei, Lactobacillus salivarius,
Lactobacillus sanfranciscensis, Lactobacillus saniviri,
Lactobacillus satsumensis, Lactobacillus secaliphilus,
Lactobacillus selangorensis, Lactobacillus senioris, Lactobacillus
senmaizukei, Lactobacillus sharpeae, Lactobacillus shenzhenensis,
Lactobacillus sicerae, Lactobacillus silagei, Lactobacillus
siliginis, Lactobacillus similis, Lactobacillus songhuajiangensis,
Lactobacillus spicheri, Lactobacillus sucicola, Lactobacillus
suebicus, Lactobacillus sunkii, Lactobacillus taiwanensis,
Lactobacillus thailandensis, Lactobacillus tucceti, Lactobacillus
ultunensis, Lactobacillus uvarum, Lactobacillus vaccinostercus,
Lactobacillus vaginalis, Lactobacillus vermiforme, Lactobacillus
vespulae, Lactobacillus vini, Lactobacillus wasatchensis,
Lactobacillus xiangfangensis, Lactobacillus yonginensis, and
Lactobacillus zymae.
9. The lactic acid bacterial cell of claim 4 wherein the
constitutive promoter sequence is endogenous.
10. The lactic acid bacterial cell of claim 4 wherein the
constitutive promoter sequence comprises an endogenous slpA
promoter sequence.
11. The lactic acid bacterial cell of claim 4 wherein the
constitutive promoter sequence is an exogenous promoter
sequence.
12. The lactic acid bacterial cell of claim 4 wherein the one or
more repressor proteins comprise a tetracycline repressor protein
(TetR).
13. The lactic acid bacterial cell of claim 4 wherein the one or
more repressor proteins comprise a tetracycline repressor protein
(TetR) encoded by a nucleic acid sequence having at least 85%
homology to SEQ ID NO:1 or a recoded variant of TetR having a least
85% homology to SEQ ID NO:5.
14. The lactic acid bacterial cell of claim 4 wherein one or more
transcriptional repressor protein binding sites comprise one or
more tetracycline repressor protein binding sites (tetO).
15. The lactic acid bacterial cell of claim 4 wherein the
agent-responsive element comprises two tetracycline repressor
protein binding sites between a transcriptional start site and a
ribosome binding site.
16. The lactic acid bacterial cell of claim 4 wherein the
agent-responsive element has at least 85% homology to SEQ ID NO: 2
or SEQ ID NO:4.
17. The lactic acid bacterial cell of claim 1 wherein the target
nucleic acid sequence is an endogenous nucleic acid sequence or an
exogenous nucleic acid sequence.
18. The lactic acid bacterial cell of claim 1 wherein the target
nucleic acid sequence encodes a therapeutic protein, a diagnostic
protein, a reporter gene, or an enzyme.
19. The lactic acid bacterial cell of claim 1 wherein the target
nucleic acid sequence encodes an antibody.
20. The lactic acid bacterial cell of claim 1 wherein the target
nucleic acid sequence encodes a Cas9 protein, Cas9 nuclease, a Cas9
nickase, a nuclease null Cas9 protein, a spCas9 nuclease, a spCas9
nickase, a nuclease null spCas9 protein, a Cpf1 nuclease, a Cpf1
nickase, a nuclease null Cpf1 protein, a C2c2 nuclease, a C2c2
nickase, or a nuclease null C2c2 protein. Another nucleases with a
mechanism of action similar to Cas9 might be used, as Cpf1
nuclease, a Cpf1 nickase or a nuclease null Cpf1 protein.
21. The lactic acid bacterial cell of claim 1 wherein the target
nucleic acid sequence encodes a fluorescent protein or a
luminescent protein.
22. The lactic acid bacterial cell of claim 2 wherein the one or
more repressor proteins is operatively linked to a constitutive
promoter.
23. The lactic acid bacterial cell of claim 2 wherein the exogenous
nucleic acid sequence encoding one or more transcriptional
repressor proteins corresponding to the one or more transcriptional
repressor protein binding sites is included in an episomal vector
or integrated into cellular chromosomal DNA.
24. The lactic acid bacterial cell of claim 4 wherein the
agent-responsive element is a tetracycline-responsive element
comprising a plurality of tetracycline repressor protein binding
sites between a transcriptional start site and a ribosome binding
site.
25. The lactic acid bacterial cell of claim 1 wherein the
agent-responsive element comprises a constitutive promoter sequence
modified to include one or more exogenous transcriptional repressor
protein binding sites corresponding to one or more transcriptional
repressor proteins at one or more positions within the
transcriptional start site of the constitutive promoter sequence,
wherein the constitutive promoter sequence within the
agent-responsive element is operable to initiate transcription of
the target nucleic acid sequence in the absence of one or more
transcriptional repressor proteins.
26. A vector within a lactic acid bacterial cell, wherein the
vector comprises a nucleic acid sequence encoding one or more
exogenous transcriptional repressor proteins corresponding to one
or more exogenous transcriptional repressor protein binding sites
within an endogenous promoter sequence, wherein the promoter is
operably linked to a target nucleic acid sequence; wherein the one
or more transcriptional repressor proteins, when expressed, bind to
the one or more transcriptional repressor protein binding sites to
repress transcription of the target nucleic acid sequence, and
wherein, tetracycline activates the promoter and induces
transcription of the target nucleic acid sequence.
27. The vector of claim 26 wherein the one or more transcriptional
repressor proteins comprise a tetracycline repressor protein
(TetR).
28. A method of making a tetracycline inducible expression system
for a target nucleic acid sequence in a lactic acid bacterial cell
comprising modifying an endogenous constitutive promoter sequence
to include one or more transcriptional repressor protein binding
sites, wherein the promoter sequence is operably linked to the
target nucleic acid sequence; providing to the lactic acid
bacterial cell an exogenous nucleic acid sequence encoding one or
more transcriptional repressor proteins corresponding to the one or
more transcriptional repressor protein binding sites, wherein the
one or more transcriptional repressor proteins, when expressed,
bind to the one or more transcriptional repressor protein binding
sites to repress transcription of the target nucleic acid sequence,
and wherein, tetracycline activates the promoter and induces
transcription of the target nucleic acid sequence.
29. A method for controlling the expression of one or more proteins
by a lactic acid bacterial cell within a subject comprising
introducing into the subject a lactic acid bacterial cell or
population of lactic acid bacterial cells including (1) an
endogenous constitutive promoter sequence modified to include one
or more transcriptional repressor protein binding sites, wherein
the promoter sequence is operably linked to one or more target
nucleic acid sequences encoding the one or more proteins; and (2)
exogenous nucleic acid sequence encoding one or more
transcriptional repressor proteins corresponding to the one or more
transcriptional repressor protein binding sites, wherein the one or
more transcriptional repressor proteins, when expressed, bind to
the one or more transcriptional repressor protein binding sites to
repress transcription of the target nucleic acid sequence, and,
providing the subject with a cognate binding agent which binds to
the one or more transcriptional repressor proteins to activate the
promoter and induce transcription of the one or more target nucleic
acid sequences.
Description
RELATED APPLICATION DATA
[0001] This application claims priority to U.S. Provisional
Application No. 62/478,219 filed on Mar. 29, 2017, which is hereby
incorporated herein by reference in its entirety for all
purposes.
SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Mar. 29, 2018, is named 010498_01066_WO_SL.txt and is 15,441
bytes in size.
FIELD
[0004] The present invention relates in general to methods of
regulating gene expression in a cell.
BACKGROUND
[0005] Lactobacilli are important industrial microbes in the dairy
industry and are heavily targeted for use in vivo due to their FDA
status as a generally regarded as safe (GRAS) probiotic organism.
However, few genetic tools exist to control gene expression in
Lactobacilli. Inducible expression systems are usually based on
"borrowing" native regulation responsive to their cognate sugar
activators. While several inducible promoters have been tried in
Lactobacilli, all suffer from high levels of basal leakage because
the rich media formulations required for the growth of most species
already contain non-trivial levels of the inducing sugar. See T.
Duong et al. Construction of vectors for inducible and constitutive
gene expression in Lactobacillus. Microb Biotech. 2010 Jul;
4(3):357-67 and S. Heiss et al. Evaluation of novel inducible
promoter/repressor systems for recombinant protein expression.
Microb Cell Fact. 2016 March; 15(50) each of which are hereby
incorporated by reference in its entirety.
[0006] Induction systems that have been used are the
nisin-controlled gene expression (NICE) system and to a lesser
extent the pSIP system, which use nisin and sakacin as inducing
agents, respectively (see I. Mierau & M. Kleerebezem. 10 years
of the nisin-controlled gene expression system (NICE) in
Lactococcus lactis. Appl Microbiol Biotcchnol. 2005 July;
68(6):705-17 and E. Sorvig et at High-level, inducible gene
expression in Lactobacilus sakes and Lactobacillus plantarum using
versatile expression vectors. Microbiology. 2005 151:2439-49 each
of which is hereby incorporated by reference in its entirety. While
these systems have been used successfully in a variety of lactic
acid bacteria in the past decade, they are unwieldy and
inefficient. The NICE system, for example, requires its regulatory
proteins to be encoded in the chromosome for proper function due to
strict requirements of copy control. Since genome integration is a
highly-inefficient process in well-studied Lactobacilli (see J. P.
van Piikeren & R. A. Britton. Precision genome engineering in
lactic acid bacteria. Microb Cell Fact. 2014 August; 13(1):S10
hereby incorporated by reference in its entirety), and unavailable
in most other strains, the NICE system cannot be easily used (see
S. Pavan et al. Adaptation of the nisin-controlled expression
system in Lactobacillus plantarum: a tool to study in vivo
biological effects. Appl Environ Microbiol. 2000 66:4427-32 and Wu
C M, Lin C F, Chang Y C, Chung R C. Construction and
characterization of nisin-controlled expression vectors for use in
Lactobacillus reuteri. Biosci Biotechnol Biochem. 2006 70:757-67
each of which are hereby incorporated by reference in its
entirety). Furthermore, both nisin and sakacin are bacteriocins,
and their antibiotic effects may be deleterious to the host
species. There is a continuing need for methods and expression
systems with improved control for gene expression.
SUMMARY
[0007] The present disclosure provides an inducible system for
control of nucleic acid expression, such as gene expression, in
lactic acid bacteria based on the use of an agent (i.e., binding
agent or cognate binding agent) to bind to a transcription
repressor protein in a manner to allow a constitutive promoter to
begin transcription of a target nucleic acid or to otherwise
control an otherwise constitutive promoter's activity insofar as
the binding of the transcription repressor protein prevents
transcription using the promoter and the binding of the agent to
the transcription repressor protein allows transcription by the
promoter. According to one aspect, a lactic acid bacterial cell
includes a constitutive promoter sequence that has been altered to
include one or more transcription repressor protein binding sites.
The altered constitutive promoter sequence is operable when the one
or more transcription repressor protein binding sites are unbound
by a corresponding transcription repressor protein. According to
one aspect, insertion of the one or more transcription repressor
protein binding sites does not alter or significantly alter the
ability of the constitutive promoter sequence to operate or
function. Accordingly, transcription by the cell of the target
nucleic acid sequence proceeds. When a transcription repressor
protein is provided to the cell, such as by expression of a foreign
nucleic acid sequence encoding for the corresponding transcription
repressor protein, the transcription repressor protein binds to the
transcription repressor protein binding site and transcription of
the target nucleic acid sequence is repressed. According to one
aspect, the transcription repressor protein may be allosteric. When
a cognate binding agent is introduced to the cell, the binding
agent binds to the transcription repressor protein causing an
allosteric change which removes the transcription repressor protein
from the transcription repressor protein binding site or otherwise
prevents or inhibits binding of the transcription repressor protein
to the transcription repressor protein binding site. As a result,
transcription of the target nucleic acid sequence is activated. The
nucleic acid sequence within the cell that includes the promoter
sequence and the one or more transcription repressor binding sites
may be referred to as an agent-responsive element to the extent
that the altered promoter sequence (when the transcription
repressor protein is bound to the transcription repressor protein
binding site) is responsive to the binding agent, i.e.,
transcription is activated.
[0008] According to one exemplary embodiment, lactic acid bacteria
are genetically modified to include a tetracycline-responsive
element operably linked to a target nucleic acid sequence, such
that the tetracycline-responsive element is inducible in the
presence of tetracycline to initiate transcription of the target
nucleic acid sequence into a corresponding mRNA and translation
into a corresponding amino acid sequence. Methods of making lactic
acid bacterial cells including an inducible system for control of
gene expression based on agent-responsive promoters or elements,
such as tetracycline-responsive promoters, genetic constructs and
the use of such cells are also disclosed.
[0009] According to one aspect, a method is provided for
controlling the expression of one or more proteins by a lactic acid
bacterial cell within a subject including introducing into the
subject a lactic acid bacterial cell or population of lactic acid
bacterial cells including (1) an endogenous constitutive promoter
sequence modified to include one or more transcriptional repressor
protein binding sites, wherein the promoter sequence is operably
linked to one or more target nucleic acid sequences encoding the
one or more proteins; and (2) exogenous nucleic acid sequence
encoding one or more transcriptional repressor proteins
corresponding to the one or more transcriptional repressor protein
binding sites, wherein the one or more transcriptional repressor
proteins, when expressed, bind to the one or more transcriptional
repressor protein binding sites to repress transcription of the
target nucleic acid sequence, and providing the subject with a
cognate binding agent which binds to the one or more
transcriptional repressor proteins to activate the promoter and
induce transcription of the one or more target nucleic acid
sequences.
[0010] Further features and advantages of certain embodiments of
the present invention will become more fully apparent in the
following description of embodiments and drawings thereof, and from
the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] The patent or application file contains at least one drawing
executed in color. Copies of this patent or patent application
publication with color drawing(s) will be provided by the Office
upon request and payment of the necessary fee. The foregoing and
other features and advantages of the present embodiments will be
more fully understood from the following detailed description of
illustrative embodiments taken in conjunction with the accompanying
drawings in which:
[0012] FIG. 1 depicts the results of repression and expression of a
fluorescent protein in the absence and presence of aTc in L.
rhamnosus GG.
[0013] FIG. 2 depicts data of gene expression of L. delbrueckii
2038.
[0014] FIG. 3 is a graph depicting a consensus sequence generated
from all sequenced Lactobacillus delbruckii.
[0015] FIG. 4 is a graph depicting a consensus sequence generated
from all sequenced Lactobacillus rhamnosus GG.
[0016] FIG. 5 is a graph depicting a consensus sequence generated
from all sequenced Lactobacillus gasseri.
[0017] FIG. 6 is a graph depicting a consensus sequence generated
from all sequenced Lactobacillus Phages.
[0018] FIG. 7 depicts the nucleic acid sequence design for Variant
1 (SEQ ID NO: 24).
[0019] FIG. 8 depicts the nucleic acid sequence design for Variant
2 (SEQ ID NO: 25).
[0020] FIG. 9 depicts the nucleic acid sequence design for Variant
3 (SEQ ID NO: 26).
[0021] FIG. 10 depicts the nucleic acid sequence design for Variant
4 (SEQ ID NO: 27).
[0022] FIG. 11 depicts in schematic minimum free energy mRNA
structural folding predictions for various mRNA structures.
[0023] FIG. 12 depicts fluorescence data of relative expression
strengths for the promoter for the ribosomal RNA 3-a from L.
plantarum and slpA.
[0024] FIG. 13 depicts data demonstrating that slpA with a deletion
successfully drives repressor function across a dynamic range of
10.sup.6 in E. coli, when paired with slpA-tetO variant 2.
[0025] FIG. 14 depicts the results of repression and expression of
a fluorescent protein in the absence and presence of aTc in L.
gasseri.
[0026] FIG. 15 depicts the results of repression and expression of
a fluorescent protein in the absence and presence of aTc in L.
gasseri, with a hybrid promoter variant.
[0027] FIG. 16 depicts data showing suppressed leakage of an
aTc-inducible slpA promoter variant modified to more closely
resemble the general tetO binding site sequence space of
PltetO.
[0028] FIG. 17 is a gel image of an experiment showing expression
of HisTagged, anti-HIV (gp120) camelid nanobody (J3-VHH) using an
aTc-inducible expression cassette encoding J3-VHH secretion.
DETAILED DESCRIPTION
[0029] The practice of certain embodiments or features of certain
embodiments may employ, unless otherwise indicated, conventional
techniques of molecular biology, microbiology, recombinant DNA, and
so forth which are within ordinary skill in the art. Such
techniques are explained fully in the literature. See e.g.,
Sambrook, Fritsch, and Maniatis, MOLECULAR CLONING: A LABORATORY
MANUAL, Second Edition (1989), OLIGONUCLEOTIDE SYNTHESIS (M. J.
Gait Ed., 1984), ANIMAL CELL CULTURE (R. I. Freshney, Ed., 1987),
the series METHODS IN ENZYMOLOGY (Academic Press, Inc.); GENE
TRANSFER VECTORS FOR MAMMALIAN CELLS (J. M. Miller and M. P. Calos
eds. 1987), HANDBOOK OF EXPERIMENTAL IMMUNOLOGY, (D. M. Weir and C.
C. Blackwell, Eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M.
Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Siedman, J.
A. Smith, and K. Struhl, eds., 1987), CURRENT PROTOCOLS IN
IMMUNOLOGY (J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M.
Shevach and W. Strober, eds., 1991); ANNUAL REVIEW OF IMMUNOLOGY;
as well as monographs in journals such as ADVANCES IN IMMUNOLOGY.
All patents, patent applications, and publications mentioned
herein, both supra and infra, are hereby incorporated herein by
reference.
[0030] Terms and symbols of nucleic acid chemistry, biochemistry,
genetics, and molecular biology used herein follow those of
standard treatises and texts in the field, e.g., Kornberg and
Baker, DNA Replication, Second Edition (W. H. Freeman, New York,
1992); Lehninger, Biochemistry, Second Edition (Worth Publishers,
New York, 1975); Strachan and Read, Human Molecular Genetics,
Second Edition (Wiley-Liss, New York, 1999); Eckstein, editor,
Oligonucleotides and Analogs: A Practical Approach (Oxford
University Press, New York, 1991); Gait, editor, Oligonucleotide
Synthesis: A Practical Approach (IRL Press, Oxford, 1984); and the
like.
[0031] Additional useful methods are described in manuals including
Advanced Bacterial Genetics (Davis, Roth and Botstein, Cold Spring
Harbor Laboratory, 1980), Experiments with Gene Fusions (Silhavy,
Berman and Enquist, Cold Spring Harbor Laboratory, 1984),
Experiments in Molecular Genetics (Miller, Cold Spring Harbor
Laboratory, 1972) Experimental Techniques in Bacterial Genetics
(Maloy, in Jones and Bartlett, 1990), and A Short Course in
Bacterial Genetics (Miller, Cold Spring Harbor Laboratory 1992)
each of which are hereby incorporated by reference in its
entirety.
[0032] It is to be understood that embodiments of the present
disclosure are intended to utilize the particular sequences
disclosed herein and sequences having at least 85% homology, at
least 90% homology, at least 95% homology, at least 97% homology,
at least 98% homology or at least 99% homology to the particular
sequence disclosed herein.
[0033] The present disclosure provides a lactic acid bacterial cell
including a first exogenous nucleic acid sequence comprising an
agent-responsive element operably linked to a target nucleic acid
sequence, such that the agent-responsive element is inducible in
the presence of the agent to initiate transcription of the target
nucleic acid sequence into a corresponding mRNA and translation
into a corresponding amino acid sequence. According to one aspect,
the agent bonds to a transcriptional repressor protein which may or
may not be bound to a transcriptional repressor protein binding
site to cause an allosteric or conformational change to the
transcriptional repressor protein thereby releasing the
transcriptional repressor protein from the transcriptional
repressor protein binding site or thereby preventing binding of the
transcriptional repressor protein to the transcriptional repressor
protein binding site, thereby allowing transcription of the target
nucleic acid sequence.
[0034] According to one aspect, the agent-responsive element
includes a constitutive promoter sequence modified to include one
or more exogenous transcriptional repressor protein binding sites
corresponding to one or more transcriptional repressor proteins,
wherein the constitutive promoter sequence within the
agent-responsive element is operable to initiate transcription of
the target nucleic acid sequence in the absence of one or more
transcriptional repressor proteins.
[0035] According to one aspect, the agent-responsive element
includes a constitutive promoter sequence modified to include one
or more exogenous transcriptional repressor protein binding sites
and wherein the lactic acid bacterial cell further includes an
exogenous nucleic acid sequence encoding one or more
transcriptional repressor proteins corresponding to the one or more
transcriptional repressor protein binding sites, wherein the one or
more transcriptional repressor proteins, when expressed, bind to
the one or more transcriptional repressor protein binding sites to
repress transcription of the target nucleic acid sequence, and
wherein, the agent activates the promoter, i.e. agent-responsive
promoter or element, and induces transcription of the target
nucleic acid sequence.
[0036] Aspects of the present disclosure include the genetic
modification of a cell to include foreign genetic material which
can then be expressed by the cell. The cell may be modified to
include any other genetic material or elements useful in the
expression of a nucleic acid sequence. Foreign genetic elements may
be introduced or provided to a cell using methods known to those of
skill in the art. A genetically modified cell encompasses lactic
acid bacterial cells that have been engineered to include an
episomal or expression vector or otherwise incorporate a nucleic
acid sequence, such as for example in the genome or the cell. Cells
and techniques for cellular transformation are well known in the
art (see e.g., Sambrook, et al., Molecular Cloning: A Laboratory
Manual, 2nd ed., Cold Spring Harbor (1989)).
[0037] Embodiments of the present disclosure provide a genetically
modified lactic acid bacterial cell including a first nucleic acid
sequence comprising a first promoter operably linked to a DNA
binding molecule such as a tetracycline repressor gene coding
sequence, and a second nucleic acid sequence comprising a second
promoter operably linked to a target nucleic acid sequence such as
a coding sequence of a gene of interest wherein the second promoter
is modified to include one or more DNA binding molecule binding
sites, such as tetracycline repressor protein binding sites.
[0038] Embodiments of the present disclosure are directed to
methods of making a tetracycline inducible expression system in a
lactic acid bacterial cell. The cell is genetically modified to
include a first nucleic acid sequence comprising a first promoter
operably linked to a tetracycline repressor gene coding sequence,
and a second nucleic acid sequence comprising a second promoter
operably linked to a coding sequence of a gene of interest wherein
the second promoter is modified to include one or more tetracycline
repressor protein binding sites. The first promoter drives
constitutive expression of a tetracycline repressor. The second
promoter regulates the expression of a gene of interest in response
to tetracycline induction.
[0039] Embodiments of the present disclosure provide for a first
nucleic acid sequence including a first promoter operably linked to
a tetracycline repressor gene coding sequence. The first promoter
can be any promoter that is operable in a lactic acid bacterial
cell. Preferably, the first promoter can drive constitutive
expression of the tet repressor. In an exemplary embodiment, the
first nucleic acid sequence is represented by a sequence having at
least 85% homology, at least 90% homology, at least 95% homology,
at least 97% homology, at least 98% homology or at least 99%
homology to SEQ ID NO: 1 and the first promoter is an L. plantarum
ribosomal RNA promoter.
[0040] Embodiments of the present disclosure provide for a second
nucleic acid sequence including a second promoter operably linked
to a coding sequence of a gene of interest wherein the promoter is
modified to include one or more tetracycline repressor protein
binding sites. The second promoter is inducible by an inducing
agent. In an exemplary embodiment, the promoter is inducible by
tetracycline or its analogs or functional equivalents. The second
promoter is operable in lactic acid bacterial cells. In an
exemplary embodiment, the second promoter is an slpA promoter. The
second promoter is modified to include one or more tetracycline
repressor protein binding sites so that tight control of gene
expression in the respective prokaryotic or eukaryotic cell can be
achieved. In one embodiment, the modified promoter sequence has at
least 85% homology, at least 90% homology, at least 95% homology,
at least 97% homology, at least 98% homology or at least 99%
homology to SEQ ID NO: 2 or SEQ ID NO: 4.
[0041] Embodiments of the present disclosure provide an expression
vector including a nucleic acid sequence including a promoter
operably linked to a coding sequence of a gene of interest wherein
the promoter is modified to include one or more tetracycline
repressor protein binding sites. Further, a polynucleotide sequence
can be operably linked to the promoter. The polynucleotide sequence
may be a polynucleotide sequence encoding a gene, an antisense
polynucleotide, a ribozyme, a fusion protein, a polynucleotide
encoding an antibody, or therapeutic protein etc.
Lactic Acid Bacterial Cells
[0042] Cells according to the present disclosure include lactic
acid bacterial cells. Exemplary lactic acid bacterial cells include
bacterial cells within the order Lactobacillales. According to one
aspect, bacterial cells include bacterial cells from the genus
Lactobacillus, Leuconostoc, Pediococcus, Lactococcus,
Streptococcus, Carnobacterium, Enterococcus, Oenococcus,
Tetragenococcus, Vagococcus, or Weisella. According to one aspect,
bacterial cells include bacterial cells from the species
Lactobacillus acetotolerans, Lactobacillus acidifarinae,
Lactobacillus acidipiscis, Lactobacillus acidophilus, Lactobacillus
agilis, Lactobacillus algidus, Lactobacillus alimentarius,
Lactobacillus alvei, Lactobacillus alvi, Lactobacillus
amylolyticus, Lactobacillus amylophilus, Lactobacillus
amylotrophicus, Lactobacillus amylovorus, Lactobacillus animalis,
Lactobacillus animata, Lactobacillus antri, Lactobacillus apinorum,
Lactobacillus apis, Lactobacillus apodemi, Lactobacillus aquaticus,
Lactobacillus aviarius, Lactobacillus backii, Lactobacillus
bifermentans, Lactobacillus bombi, Lactobacillus bombicola,
Lactobacillus brantae, Lactobacillus brevis, Lactobacillus
brevisimilis, Lactobacillus buchneri, Lactobacillus cacaonum,
Lactobacillus camelliae, Lactobacillus capillatus, Lactobacillus
casei, Lactobacillus paracasei, Lactobacillus zeae, Lactobacillus
catenefornis, Lactobacillus ceti, Lactobacillus coleohominis,
Lactobacillus colini, Lactobacillus collinoides, Lactobacillus
composti, Lactobacillus concavus, Lactobacillus coryniformis,
Lactobacillus crispatus, Lactobacillus crustorum, Lactobacillus
curieae, Lactobacillus curvatus, Lactobacillus delbrueckii,
Lactobacillus dextrinicus, Lactobacillus diolivorans, Lactobacillus
equi, Lactobacillus equicursoris, Lactobacillus equigenerosi,
Lactobacillus fabifermentans, Lactobacillus faecis, Lactobacillus
faeni, Lactobacillus farciminis, Lactobacillus farraginis,
Lactobacillus fermentum, Lactobacillus floricola, Lactobacillus
florum, Lactobacillus formosensis, Lactobacillus fornicalis,
Lactobacillus fructivorans, Lactobacillus frumenti, Lactobacillus
fuchuensis, Lactobacillus furfuricola, Lactobacillus futsaii,
Lactobacillus gallinarum, Lactobacillus gasseri, Lactobacillus
gastricus, Lactobacillus ghanensis, Lactobacillus gigeriorum,
Lactobacillus ginsenosidimutans, Lactobacillus gorillae,
Lactobacillus graminis, Lactobacillus guizhouensis, Lactobacillus
halophilus, Lactobacillus hammesii, Lactobacillus hamsteri,
Lactobacillus harbinensis, Lactobacillus hayakitensis,
Lactobacillus heilongjiangensis, Lactobacillus helsingborgensis,
Lactobacillus helveticus, Lactobacillus herbarum, Lactobacillus
heterohiochii, Lactobacillus hilgardii, Lactobacillus
hokkaidonensis, Lactobacillus hominis, Lactobacillus homohiochii,
Lactobacillus hordei, Lactobacillus iatae, Lactobacillus iners,
Lactobacillus ingluviei, Lactobacillus insectis, Lactobacillus
insicii, Lactobacillus intermedius, Lactobacillus intestinalis,
Lactobacillus iwatensis, Lactobacillus ixorae, Lactobacillus
japonicus, Lactobacillus jensenii, Lactobacillus johnsonii,
Lactobacillus kalixensis, Lactobacillus kefiranofaciens,
Lactobacillus kefiri, Lactobacillus kimbladii, Lactobacillus
kimchicus, Lactobacillus kimchiensis, Lactobacillus kisonensis,
Lactobacillus kitasatonis, Lactobacillus koreensis, Lactobacillus
kullabergensis, Lactobacillus kunkeei, Lactobacillus larvae,
Lactobacillus leichmannii, Lactobacillus letivazi, Lactobacillus
lindneri, Lactobacillus malefermentans, Lactobacillus mali,
Lactobacillus manihotivorans, Lactobacillus mellifer, Lactobacillus
mellis, Lactobacillus melliventris, Lactobacillus micheneri,
Lactobacillus mindensis, Lactobacillus mixtipabuli, Lactobacillus
mobilis, Lactobacillus modestisalitolerans, Lactobacillus mucosae,
Lactobacillus mudanjiangensis, Lactobacillus murinus, Lactobacillus
nagelii, Lactobacillus namurensis, Lactobacillus nantensis,
Lactobacillus nasuensis, Lactobacillus nenjiangensis, Lactobacillus
nodensis, Lactobacillus odoratitofui, Lactobacillus oeni,
Lactobacillus oligofermentans, Lactobacillus ori, Lactobacillus
oryzae, Lactobacillus otakiensis, Lactobacillus ozensis,
Lactobacillus panis, Lactobacillus pantheris, Lactobacillus
parabrevis, Lactobacillus parabuchneri, Lactobacillus
paracollinoides, Lactobacillus parafarraginis, Lactobacillus
parakefiri, Lactobacillus paralimentarius, Lactobacillus
paraplantarum, Lactobacillus pasteurii, Lactobacillus paucivorans,
Lactobacillus pentosus, Lactobacillus perolens, Lactobacillus
plajomi, Lactobacillus plantarum, Lactobacillus pobuzihii,
Lactobacillus pontis, Lactobacillus porcinae, Lactobacillus
psittaci, Lactobacillus rapi, Lactobacillus rennanquilfy,
Lactobacillus rennini, Lactobacillus reuteri, Lactobacillus
rhamnosus, Lactobacillus rodentium, Lactobacillus rogosae,
Lactobacillus rossiae, Lactobacillus ruminis, Lactobacillus
saerimneri, Lactobacillus sakei, Lactobacillus salivarius,
Lactobacillus sanfranciscensis, Lactobacillus saniviri,
Lactobacillus satsumensis, Lactobacillus secaliphilus,
Lactobacillus selangorensis, Lactobacillus senioris, Lactobacillus
senmaizukei, Lactobacillus sharpeae, Lactobacillus shenzhenensis,
Lactobacillus sicerae, Lactobacillus silagei, Lactobacillus
siliginis, Lactobacillus similis, Lactobacillus songhuajiangensis,
Lactobacillus spicheri, Lactobacillus sucicola, Lactobacillus
suebicus, Lactobacillus sunkii, Lactobacillus taiwanensis,
Lactobacillus thailandensis, Lactobacillus tucceti, Lactobacillus
ultunensis, Lactobacillus uvarum, Lactobacillus vaccinostercus,
Lactobacillus vaginalis, Lactobacillus vermiforme, Lactobacillus
vespulae, Lactobacillus vini, Lactobacillus wasatchensis,
Lactobacillus xiangfangensis, Lactobacillus yonginensis, or
Lactobacillus zymae.
[0043] Cells according to the present disclosure include any lactic
acid bacterial cell such as those listed at world wide website
ncbi.nlm nih.gov/Taxonomy/Browser/wwwtax.cgi?id=1578 into which
nucleic acids having modified or altered promoter sequences
operably linked to a target nucleic acid sequence of interest, such
as a gene, can be introduced and expression of the gene of interest
can be regulated by an inducing agent as described herein. It is to
be understood that the basic concepts of the present disclosure
described herein are not limited by cell type.
[0044] Another aspect of the invention pertains to host cells into
which a recombinant expression vector of the invention has been
introduced. The recombinant expression vector may include the
agent-responsive promoter or element as described herein. The
recombinant expression vector may include the nucleic acid encoding
the transcriptional repression protein. The recombinant expression
vector may include the altered or modified promoter sequence that
includes one or more transcriptional repression protein binding
sites. The terms "host cell" and "recombinant host cell" are used
interchangeably herein. It is understood that such terms refer not
only to the particular subject cell but to the progeny or potential
progeny of such a cell. Because certain modifications may occur in
succeeding generations due to either mutation or environmental
influences, such progeny may not, in fact, be identical to the
parent cell, but are still included within the scope of the term as
used herein.
Agent-Responsive Element
[0045] According to one aspect, the disclosure provides an
agent-responsive element. The agent responsive element includes one
or more of a constitutive promoter sequence, which may be
endogenous or exogenous, and one or more exogenous transcriptional
repressor protein binding sites corresponding to one or more
transcriptional repressor proteins. The constitutive promoter
sequences may be modified or altered to include the one or more
exogenous transcriptional repressor protein binding sites
corresponding to one or more transcriptional repressor proteins.
The constitutive promoter sequence combined with one or more
exogenous transcriptional repressor protein binding sites is
operable to initiate transcription of the target nucleic acid
sequence in the absence of one or more transcriptional repressor
proteins. According to one aspect, the presence of the one or more
exogenous transcriptional repressor protein binding sites may not
inhibit the transcription of a target nucleic acid sequence as
activated by the constitutive promoter sequence. The one or more
exogenous transcriptional repressor protein binding sites may be
placed upstream of the constitutive promoter sequence or within the
constitutive promoter sequence. The agent, as described herein, is
an entity that binds to the transcriptional repressor protein in a
manner to inhibit binding of the transcriptional repressor protein
to the transcriptional repressor protein binding site. When binding
of the transcriptional repressor protein to the transcriptional
repressor protein binding site is inhibited, transcription of the
target nucleic acid sequence is promoted or activated through the
constitutive promoter.
[0046] According to one aspect, a constitutive promoter sequence is
modified to include one or more transcriptional repressor protein
binding sites. The promoter sequence may be referred to as an
altered promoter sequence or a modified promoter sequence. The
transcriptional repressor protein binding site has a corresponding
transcriptional repressor protein that binds to the transcriptional
repressor protein binding site. The transcriptional repressor
protein has a cognate binding partner that when bound to the
transcriptional repressor protein inhibits binding of the
transcriptional repressor protein to the transcriptional repressor
protein binding site by way of allosteric change of the
transcriptional repressor protein or steric hindrance or other
mechanism of inhibition. An exemplary agent-induction system is the
tetracycline induction system which has been used extensively in
bacterial, fungal, plant, and mammalian systems. See J. L. Ramos et
al. The TetR family of transcriptional repressors. Microbiol Mol
Biol Rev, 2005 June; 69(2):326-56; E. Gari et al. A set of vectors
with a tetracycline-regulatable promoter system for modulated gene
expression in Saccharomyces cerevisiae. Yeast. 1997 July;
13(9):837-48; P. Weinmann et al. A chimeric transactivator allowes
tetracycline-responsive gene expression in whole plants. Plant J.
1994 April; 5(4):559-69 and M. Gossen & H. Bujard. Tight
control of gene expression in mammalian cells by
tetracycline-responsive promoters. PNAS, 1992 Jun. 15;
89(12):5547-51 each of which are hereby incorporated by reference
in its entirety. According to certain aspects, a
tetracycline-regulatable promoter system, with tetracycline being
the agent that induces transcription, is exemplary because of its
ability to facilitate tight regulation and exhibit superior dynamic
range of up to 5000-fold (see R. Lutz & H. Bujard. Independent
and tight regulation of transcriptional units in Escheria coli via
the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements hereby
incorporated by reference in its entirety), as well as its
orthogonality to host factors. According to one aspect, the
agent-responsive element and the agent are exemplary in their
ability to exhibit, in most hosts of interest, little to no
crosstalk between the system and host genetics or metabolism.
Heterologous gene expression may thus be more reliably controlled
by the experimenter. A tetracycline-regulatable promoter system is
particularly exemplary. This feature of a tetracycline-regulatable
promoter system also enables tetracycline or anhydrous tetracycline
(aTc) induction's use in vivo. See X. Xia et al. In vitro- and in
vivo-induced transgene expression in human embryonic stern cells
and derivatives. Stem Cells. 2008 December; 26(2):525-33 and L. E.
Dow et al. inducible in vivo genome editing with CR1SPR-Cas9. Nat
Biotech. February 18; 33:390-4 each of which are hereby
incorporated by reference in its entirety. Cas proteins are found
in Streptococcus pyogenes, S. thermophiles, S. aureus or any other
strain known to those of skill in the art.
[0047] According to one aspect, the promoter is endogenous and is a
strong constitutive promoter with a longer promoter sequence into
which operator boxes may be placed to control and regulate the
promoter, Longer promoter sequences allow operator boxes to be
inserted and not abrogate promoter ability but also to stop
promoter ability when the transcriptional repressor protein
binds.
[0048] As used herein, the term "repressor" or "transcriptional
repressor protein" refers to a molecule capable of inhibiting the
expression of a particular nucleic acid sequence, such as a gene,
from a promoter. In effect, the molecule "represses" the expression
of the gene from its promoter. In general, repressor systems will
readily be recognized by those of skill in the art based on the
present disclosure and which include a DNA binding site also
referred to as a transcriptional repressor protein binding site or
operator sequence and its corresponding binding partner also
referred to as a transcriptional repressor protein. When the DNA
binding site is included into a DNA sequence in a cell and the
corresponding binding partner is provided to the cell, the
corresponding binding partner binds to the DNA binding site. Such a
system can be used to inhibit transcription when operably linked to
a promoter sequence. Such a system can be included into a
constitutive promoter sequence to transform the constitutive
promoter sequence into an inducible promoter sequence. According to
this aspect, the binding of the corresponding binding partner to
the DNA binding site within a promoter sequence inhibits
transcription of a target nucleic acid sequence operatively
connected or linked to the promoter sequence. When the
corresponding binding partner is removed from the DNA binding site,
the constitutive promoter sequence begins transcription of the
target nucleic acid sequence.
[0049] According to one aspect, an agent is provided that binds to
the transcriptional repressor protein causing a conformational
change in the transcriptional repressor protein thereby rendering
it unable to bind to the transcriptional repressor protein binding
site. In this manner, the transcriptional repressor protein is
allosteric insofar as it can change structure or form when bound by
an agent. In this manner, repressor dimerization and function may
be disrupted. An agent may also inhibit binding of the
transcriptional repressor protein through steric hindrance or other
methods.
[0050] Transcriptional repressor proteins and their cognate binding
sites are known to those of skill in the art and such as the
TetR/tetO system, LacR/lacO or TreR/treO (lactose and trehalose
controlled repression). For example, the tet repressor (TetR) is a
protein that represses gene transcription of the tet operon upon
binding to its cognate tet operator sequences tetO (tet binding
sites) within the operon promoter. One of skill will readily
identify useful TetR sequences based on the present disclosure
including those identified in Ramos et al., The TetR Family of
Transcriptional Repressors, Microbiology and Molecular Biology
Reviews, June 2005, P. 326-356 hereby incorporated by reference in
its entirety.
[0051] The TetR/tetO system is said to be a tetracycline responsive
system insofar as tetracycline, anhydrous tetracycline or suitable
derivatives of tetracycline may prevent binding of the tetracycline
repressor to the tet operator sequences. Additional
agent-responsive promoter systems include metabolite responsive
systems such as metabolite-controlled operator boxes paired with
their corresponding repressor such as LacR/lacO & TreR/treO
(lactose and trehalose controlled repression). Additional repressor
systems exist which are based on binding agents such as glucose,
mannose, fructose, galactose, sucrose, raffinose, maltose,
arabinose, ribose, sorbose, rhamnose, xylose which inhibit binding
of a cognate transcriptional repressor protein thereby activating
traqnscription. Such repressor systems may be included within any
promoter sequence, such as slpA.
[0052] According to certain aspects, a cell is genetically modified
to include one or more exogenous nucleic acids encoding for a
transcriptional repressor protein and wherein the cell includes the
cognate transcriptional repressor protein binding site. A binding
agent cognate to the transcriptional repressor protein is also
provided. The cell may also be genetically modified to include one
or more exogenous nucleic acid sequences including one or more
transcriptional repressor protein binding sites. Transcriptional
repressor proteins and their corresponding or cognate binding
agents are known to those of skill in the art and include those
listed in Table 1 below.
TABLE-US-00001 TABLE 1 Transcriptional Type of Transcriptional
Repressor Protein Binding Agent Repressor Protein ttgR naringennin
(flavanoids) Transcriptional repressor mphR macrolides
Transcriptional repressor tetR tetracycline, anhydrous
Transcriptional repressor tetracycline, tetracycline derivatives,
tetracycline analogs gntR Gluconate Transcriptional repressor galS
Galactose Transcriptional repressor trpR tryptophan Transcriptional
repressor qacR Berberine Transcriptional repressor rmrR Phytoalexin
Transcriptional repressor cymR Cumate Transcriptional repressor
varR Virginiamycin Transcriptional repressor rhaR Rhamnose
Transcriptional repressor
[0053] It is to be understood that the examples of transcriptional
repressors and their corresponding binding agents are exemplary
only and that one of skill in the art can readily identify
additional transcriptional repressors and their corresponding
binding agents for use in the present disclosure. Aside from the
TetR family of transcriptional repressors, any member of the main
bacterial transcriptional repressor families could be similarly
implemented. This list includes members of the ArgR, AsnC/LrP,
DeoR, GalR/LacI, GntR, IclR, LysR, MerR, MetJ, ModE, PadR and XRE
families, not excluding other groups or subgroups of
transcriptional regulators from bacterial, phagic or mammalian
origin directly used or repurposed for their application in
Lactobacilli.
[0054] Transcriptional repressors and/or binding agents may be
natural or synthetic. One of skill can also design synthetic
transcriptional repressors to bind to natural or non-natural
cognate nucleic acid sequences and which may further bind natural
or non-natural binding agents using methods known to those of skill
in the art. The transformed cell is intended to express the
transcriptional repressor under suitable conditions. Methods
described herein can be used to insert the nucleic acids into the
genome of the cells that are responsible for production of
transcriptional repressors.
[0055] According to one aspect, the transformed, recombinant cell
expresses the transcriptional repressor protein which regulates
production of a target nucleic acid, for example, by binding to
transcriptional repressor protein binding site within a promoter
thereby inhibiting transcription of the target nucleic acid.
According to one aspect, when expressed, the transcriptional
repressor protein prevents the cell from expressing the target
nucleic acid, either by blocking the expression (i.e. a repressor)
of the target nucleic acid unless the transcriptional repressor
protein is bound by the binding agent, which leads to target
nucleic acid expression. According to one aspect for an allosteric
transcription factor that is a repressor, the repressor protein
blocks transcription of the reporter gene by binding as an oligomer
to a region of DNA 5' to the reporter gene unless the desired
binding agent binds the repressor thereby disrupting the oligomeric
behavior and thus frequently preventing the effective binding of
the complex to its cognate operator sequences. According to a
further aspect, the transformed, recombinant cell is provided with
a binding agent which binds to the transcription repressor protein
in a manner to promote production of the peptide, polypeptide or
amino acid sequence corresponding to the target nucleic acid
sequence. According to one aspect, in the absence of the binding
agent, the transcription repressor protein prevents transcription
of the target nucleic acid.
Target Nucleic Acid Sequence
[0056] Target nucleic acid sequences maybe of any sequences desired
to be transcribed. Target nucleic acid sequences include those that
encode for therapeutic proteins, diagnostic proteins, reporter
proteins, genes or enzymes.
[0057] As used herein, "gene" refers to the nucleic acid sequence
that undergoes transcription as the result of promoter activity. A
gene may code for a particular protein or, alternatively, code for
an RNA sequence that is of interest in itself, e.g. because it acts
as an antisense inhibitor.
[0058] Therapeutic proteins envisioned herein include proteins,
such as endogenous proteins, associated with probiotic function
(e.g. LGG p40, spaC), antibodies (including IgG, IgE, IgA, scFv and
camlid antibodies--that target infectious agents, or host
cell-surface proteins and antibody Fc), antimicrobial peptides of
mammalian, viral, and bacterial origin (e.g. collistin, caerin,
dermaseptin, LL-37, HBD-2) antiviral peptides (e.g. HCV-C5A,
Fuzeon), cytokines (e.g. IL-10), allergens (e.g. pollen, nut
proteins), worm protein (e.g. hookworm protein), trefoil factor,
dietary enzymes, mucin binding proteins (e.g. intJ, GroEL),
invasins, antitoxins or any antigen derived from an infectious
agent delivered as a vaccination target.
[0059] Diagnostic proteins envisioned herein include antibodies
that also can be used as diagnostic sensors, reactive oxygen
species sensors or temperature sensors.
[0060] According to one aspect, the target nucleic acid sequence or
downstream gene is a detectable moiety or reporter, such as a
fluorescent moiety, such as GFP, that can be detected by
fluorimetry, for example. An exemplary detectable moiety is a
reporter protein. Reporter proteins envisioned herein include
fluorescent proteins, luminescent proteins, enzymatic reporters
such as GusA or PepN. Aspects of the methods described herein may
make use of epitope tags and reporter gene sequences as detectable
moieties. Non-limiting examples of epitope tags include histidine
(His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags,
Myc tags, VSV-G tags, and thioredoxin (Trx) tags. Examples of
reporter genes include, but are not limited to,
glutathione-S-transferase (GST), horseradish peroxidase (HRP),
chloramphenicol acetyltransferase (CAT) beta-galactosidase,
betaglucuronidase, maltose binding protein, luciferase, green
fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein
(CFP), yellow fluorescent protein (YFP), and autofluorescent
proteins including blue fluorescent protein (BFP). Exemplary
fluorescent protein reporters are provided at world wide website
tsienlab.ucsd.edu/Samples/Constructs.htm. Any aforementioned
instance of reporter proteins may be conjoined, with or without a
peptide linker (such as [GGGS].sub.n (SEQ ID NO: 16), G.sub.n,
[EAAAK].sub.n (SEQ ID NO: 17), or PAPAP (SEQ ID NO: 18) where n is
the number of motif repeats), to any of the aforementioned target
nucleic acid sequences, thereby yielding a fusion protein with
double function or function attributable to each portion or segment
fused together.
Definitions
[0061] As used herein, the term "recombinant" refers to nucleic
acid that is formed by experimentally recombining nucleic acid
sequences and sequence elements. A recombinant host would be any
host receiving a recombinant nucleic acid and the term "recombinant
protein" refers to protein produced by such a host.
[0062] As used herein, the term "expression" refers to the process
by which a polypeptide is produced from DNA. The process involves
the transcription of the gene into mRNA and the translation of this
mRNA into a polypeptide. Depending on the context in which it is
used, the term "expression" may refer to the production of RNA,
protein or both.
[0063] As used herein, the term "operably linked" refers to genetic
elements that are joined in such a manner that enables them to
carry out their normal functions. For example, a gene is operably
linked to a promotor when its transcription is under the control of
the promotor and such transcription produces the protein normally
encoded by the gene.
Vectors
[0064] As used herein, the term "vector" refers to a nucleic acid
sequence capable of transporting another nucleic acid to which it
has been linked. In certain aspects of the invention, vectors and
plasmids useful for transformation of a variety of host cells are
provided. Vectors and plasmids are common and commercially
available from companies such as Invitrogen Corp. (Carlsbad,
Calif.), Stratagene (La Jolla, Calif.), New England Biolabs, Inc.
(Beverly, Mass.) and Addgene (Cambridge, Mass.). Vectors used to
deliver the nucleic acids to cells as described herein include
vectors known to those of skill in the art and used for such
purposes.
[0065] As used herein, the term "episomal or expression vector" or
comparable terms refer to a vector which is capable of inducing the
expression of a nucleic acid sequence encoding a gene that has been
cloned into it after transformation into a cell. The cloned nucleic
acid sequence is usually placed under the control of (i.e.,
operably linked to) certain regulatory sequences such as a
promoter.
[0066] In certain exemplary embodiments, recombinant expression
vectors can comprise a nucleic acid of the invention in a form
suitable for expression of the nucleic acid in a host cell, which
means that the recombinant expression vectors include one or more
regulatory elements, which may be selected on the basis of the host
cells to be used for expression, that is operatively-linked to the
nucleic acid sequence to be expressed. Within a recombinant
expression vector, "operably linked" is intended to mean that the
nucleotide sequence of interest is linked to the regulatory
element(s) in a manner that allows for expression of the nucleotide
sequence (e.g. in an in vitro transcription/translation system or
in a host cell when the vector is introduced into the host cell).
The term "regulatory sequence" is intended to include promoters,
enhancers and other expression control elements (e.g.,
polyadenylation signals). Such regulatory sequences are described,
for example, in Goeddel; Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, Calif. (1990) hereby
incorporated by reference in its entirety. It will be appreciated
by those skilled in the art that the design of the expression
vector can depend on such factors as the choice of the host cell to
be transformed, the level of expression of protein desired, and the
like.
[0067] One type of vector is a "plasmid," which refers to a
circular double stranded DNA loop into which additional DNA
segments can be ligated. Vectors include, but are not limited to,
nucleic acid molecules that are single-stranded, doublestranded, or
partially double-stranded; nucleic acid molecules that comprise one
or more free ends, no free ends (e.g. circular); nucleic acid
molecules that comprise DNA, RNA, or both; and other varieties of
polynucleotides known in the art. By way of example, but not of
limitation, a vector of the invention can be a single-copy or
multi-copy vector, including, but not limited to, a BAC (bacterial
artificial chromosome), a fosmid, a cosmid, a plasmid, a suicide
plasmid, a shuttle vector, a P1 vector, an episome, or YAC (yeast
artificial chromosome) or any other suitable vector.
[0068] Another type of vector is a viral vector, wherein
virally-derived DNA or RNA sequences are present in the vector for
packaging into a virus (e.g. retroviruses, lentiviruses,
replication defective retroviruses, adenoviruses, replication
defective adenoviruses, and adeno-associated viruses). Viral
vectors also include polynucleotides carried by a virus for
transfection into a host cell. Viral vectors include those where
additional DNA segments can be ligated into the viral genome, a
bacteriophage or viral genome, or any other suitable vector. The
host cells can be any cells in which the vector is able to
replicate.
[0069] Certain vectors are capable of autonomous replication in a
host cell into which they are introduced (e.g. bacterial vectors
having a bacterial origin of replication and episomal mammalian
vectors). Other vectors (e.g., non-episomal mammalian vectors) are
integrated into the genome of a host cell upon introduction into
the host cell, and thereby are replicated along with the host
genome. Moreover, certain vectors are capable of directing the
expression of genes to which they are operatively linked. Such
vectors are referred to herein as "expression vectors." Common
expression vectors of utility in recombinant DNA techniques are
often in the form of plasmids. In the present specification,
"plasmid" and "vector" can be used interchangeably. However, the
invention is intended to include such other forms of expression
vectors, such as viral vectors (e.g., replication defective
retroviruses, adenoviruses and adeno-associated viruses), which
serve equivalent functions.
[0070] Typically, the vector or plasmid contains sequences
directing transcription and translation of a relevant gene or genes
and sequences allowing autonomous replication or chromosomal
integration. Suitable vectors comprise a region 5' of the gene
which harbors transcriptional initiation controls and a region 3'
of the DNA fragment which controls transcription termination. Both
control regions may be derived from genes homologous to the
transformed host cell, although it is to be understood that such
control regions may also be derived from genes that are not native
to the species chosen as a production host.
[0071] According to certain aspect of the invention, phages and
their genetic material are provided. As used herein, the terms
"phage" and "bacteriophage" are used interchangeably. Phage can be
distinguished from each another based on their genetic composition
and/or their virion morphology. Some phage have double stranded DNA
genomes, including phage of the Corticoviridae, Lipothrixviridae,
Plasmaviridae, Myrovridae, Siphoviridae, Sulfolobus, Podoviridae,
Tectiviridae and Fuselloviridae families. Other phage have single
stranded DNA genomes, including phage of the Microviridae and
Inoviridae families. Other phage have RNA genomes, including phage
of the Leviviridae and Cystoviridae families. Exemplary
bacteriophage include, but are not limited to, Wphi, Mu, T2, T2,
T3, T4, T5, T6, T7, P1, P2, P4, P22, fd, phi6, phi29, phiC31,
phi80, phiX174, SP01, M13, MS2, PM2, SSV-1, L5, PRD1, Qbeta,
lambda, UC-1, HK97, HK022 and the like. Exemplary phages include
lactobacillus phages such as those described in world wide website
ncbi.nlm nih.gov/taxonomy/?term=lactobacillus+phage, including
Bacteriophage phiADH, which has been used to transform L. gasseri
as described in Appl Environ Microbiol. 2010 June; 76(12):
3878-3885 hereby incorporated by reference in its entirety.
[0072] Embodiments of the present disclosure include the use of an
inducible system as described herein in a plasmid as well as an
entity integrated into the host cell genome, via plasmids with
enzymatic elements that direct chromosomal integration of
expression cassettes encoded on the plasmid or any kind of suicidal
plasmids that leverage the recombination machinery of the cell for
integration into its genome. Such vectors are described in
Ortiz-Martin et al., J Microbiol Methods. 2006 December;
67(3):395-407. Epub 2006 Jun. 5 hereby incorporated by reference in
its entirety and can be designed by those of skill in the art based
on the present disclosure.
Promoter Sequences
[0073] According to methods and constructs described herein,
promoter sequences may be constitutive, inducible or repressible.
As used herein, the term "promotor" refers to a DNA sequence that
initiates the transcription of a gene. Promoters are typically
found 5' to the gene and located proximal to the start codon. If a
promotor is of the inducible type (i.e., exemplary tetracycline
inducible promoters of the present disclosure), then the rate of
transcription increases in response to an inducing agent or binding
agent, i.e. tetracycline. The promoter can be modified to include
one or more transcription repressor protein binding sites, also
referred to herein as operator sequences, to improve the regulatory
functionality of the promoter in response to an inducing agent,
such as tetracycline. It is to be understood that the driving
promoter sequence for any endogenous protein can be used in the
methods described herein. The driving promoter for any
Lactobacillus phage protein can be used in the methods described
herein. One of skill will have ready access to the identification
of such promoter sequences of any host organism of interest.
Exemplary host strains include L. delbruckii, L. gasseri, and L.
rhamnosus GG) and other host strains as described herein. Exemplary
promoter sequences include the slpA promoter sequence from L.
acidophilus, the clpC promoter L. fermentum BR11, the lacA promoter
from L. lactis, the ldh promoter from L. plantarum, L. casei, or L.
reuteri, the pgm promoter from L. agilis, and the ermB promoter
from E. faecalis. One of skill in the art will readily be able to
identify cognates of these exemplary promoters in sister organisms,
and other promoter sequences in addition to the slpA promoter
sequence through analysis of sequence databases. Such databases
include whole genome DNA sequences that can be mined for promoter
elements, and transcriptome RNA sequences, that can be sorted by
apparent expression strength through computation of the relative
abundance via the quantification of transcripts (e.g., `RPKM`).
Highly expressive promoters can thus be predicted from RNA
transcripts exhibiting high transcriptional counts. For example,
previously published transcriptome data from L. delbrueckii (H
Zheng et al. Strans-specific RNA-seq analysis of Lactibacillus
delbrueckii subsp. Bulgaricus transcriptome. Mol. Biosyst., 2016,
12, 508 hereby incorporated by reference in its entirety) can be
analyzed by plotting the RPKM profile of this strain. See FIG. 2.
This procedure highlights the highly expressed genes, LBU_1429,
LBU_0225, LBU_1379, and LBU_1747, whose promoter sequences are
exemplary based on the present disclosure.
[0074] According to one aspect, computational techniques known to
those of skill in the art can be used to identify all predicted
promoter sequences from all sequenced Lactobacillus phages.
Particularly exemplary are Lactobacillus phages as most phage genes
tend to be strongly expressed. Synthetically derived promoter
sequences can also be used, i.e., computationally optimized
sequences generated by identifying consensus sequences from known
databases where every permutation of displayed bases can be strung
together into a potential promoter and where blank positions can be
filled with any of A, T, G, or C. Sequences with at least 80%
sequence identity, at least 85% sequence identity, at least 90%
sequence identity, at least 95% sequence identity, at least 97%
sequence identity, at least 98% sequence identity, or at least 99%
sequence identity with any of these resulting, synthetic promoter
sequences have similar efficacy. FIG. 3 is a graph depicting a
consensus sequence generated from all sequenced Lactobacillus
delbruckii. FIG. 4 is a graph depicting a consensus sequence
generated from all sequenced Lactobacillus rhamnosus GG. FIG. 5 is
a graph depicting a consensus sequence generated from all sequenced
Lactobacillus gasseri. FIG. 6 is a graph depicting a consensus
sequence generated from all sequenced Lactobacillus Phages. These
consensus sequences provide the relative frequencies of an A, T, G,
or C occurring at each position of the consensus promoter sequence,
which can be used to generate libraries of synthetic promoters that
are theoretically optimized for robust expression in that host (in
the case a strain-specific consensus as in FIGS. 4 and 5) or for
Lactobacilli in general (in the case of a phage-derived consensus
as in FIG. 6).
[0075] Initiation control regions or promoters, which are useful to
drive expression of the relevant pathway coding regions in the
desired host cell are numerous and familiar to those skilled in the
art. Virtually any promoter capable of driving these genetic
elements is suitable for the present invention including, but not
limited to, lac, ara, tet, trp, IP.sub.L, IP.sub.R, T7, tac, and
trc (useful for expression in Escherichia coli and Pseudomonas);
the amy, apr, npr promoters and various phage promoters useful for
expression in Bacillus subtilis, and Bacillus licheniformis; nisA,
orfX, and xylT promoters (useful for expression in Gram-positive
bacteria, Eichenbaum et al. Appl. Environ. Microbiol.
64(8):2763-2769 (1998)); Sorvig et al. FEMS Microbiol. Lett.
229:119-126 (2003), Miyoshi et al., FEMS Microbiol. Lett.
239(2):205-212 (2004)); the lac, tre, FOS promoters (useful for
expression in Lactobacilli, Duong et al. Microb. Biotech,
4(3):357-367 (2010)); ribosomal RNA subunit promoters and synthetic
derivatives thereof such as the synthetic P11 promoter (useful for
expression in Lactobacillus plantarum, Rud et al., Microbiology
152:1011-1019 (2006)). Termination control regions may also be
derived from various genes native to the preferred hosts.
[0076] Regulatory elements are contemplated for use with the
methods and constructs described herein. The term "regulatory
element" is intended to include promoters, enhancers, internal
ribosomal entry sites (IRES), and other expression control elements
(e.g. catabolite repressive elements, transcription termination
signals, such as polyadenylation signals and poly-U sequences).
Such regulatory elements are described, for example, in Goeddel,
GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic
Press, San Diego, Calif. (1990). Regulatory elements include those
that direct constitutive expression of a nucleotide sequence in
many types of host cell and those that direct expression of the
nucleotide sequence only in certain host cells (e.g.,
tissue-specific regulatory sequences). A tissue-specific promoter
may direct expression primarily in a desired tissue of interest,
such as muscle, neuron, bone, skin, blood, specific organs (e.g.
liver, pancreas), or particular cell types (e.g. lymphocytes).
Regulatory elements may also direct expression in a
temporal-dependent manner, such as in a cell-cycle dependent or
developmental stage-dependent manner, which may or may not also be
tissue or cell-type specific. In some embodiments, a vector may
comprise one or more pol III promoter (e.g. 1, 2, 3, 4, 5, or more
pol III promoters), one or more pol II promoters (e.g. 1, 2, 3, 4,
5, or more pol II promoters), one or more pol I promoters (e.g. 1,
2, 3, 4, 5, or more pol I promoters), or combinations thereof.
Examples of pol III promoters include, but are not limited to, U6
and H1 promoters. Examples of pol II promoters include, but are not
limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter
(optionally with the RSV enhancer), the cytomegalovirus (CMV)
promoter (optionally with the CMV enhancer) [see, e.g., Boshart et
al, Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate
reductase promoter, the .beta.-actin promoter, the phosphoglycerol
kinase (PGK) promoter, and the EF1.alpha. promoter and Pol II
promoters described herein. Also encompassed by the term
"regulatory element" are enhancer elements, such as WPRE; CMV
enhancers; the R-U5' segment in LTR of HTLV-1 (Mol. Cell. Biol.,
Vol. 8(1), p. 466-472, 1988); SV40 enhancer; and the intron
sequence between exons 2 and 3 of rabbit .beta.-globin (Proc. Natl.
Acad. Sci. USA., Vol. 78(3), p. 1527-31, 1981). It will be
appreciated by those skilled in the art that the design of the
expression vector can depend on such factors as the choice of the
host cell to be transformed, the level of expression desired, etc.
A vector can be introduced into host cells to thereby produce
transcripts, proteins, or peptides, including fusion proteins or
peptides, encoded by nucleic acids as described herein.
Terminators
[0077] Aspects of the methods described herein may make use of
terminator sequences. A terminator sequence includes a section of
nucleic acid sequence that marks the end of a gene or operon in
genomic DNA during transcription. This sequence mediates
transcriptional termination by providing signals in the newly
synthesized mRNA that trigger processes which release the mRNA from
the transcriptional complex. These processes include the direct
interaction of the mRNA secondary structure with the complex and/or
the indirect activities of recruited termination factors. Release
of the transcriptional complex frees RNA polymerase and related
transcriptional machinery to begin transcription of new mRNAs.
Terminator sequences include those known in the art and identified
and described herein. Rho-independent, hairpin-forming terminator
sequences are of particular use in lactic acid bacteria, and
effective terminators include, but are not limited to, the rrnB T1
terminator sequence:
TABLE-US-00002 (SEQ ID NO: 19)
ATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTAT.
Genetic Modification
[0078] Foreign nucleic acids (i.e., those which are not part of a
cell's natural nucleic acid composition) may be introduced into a
cell using any method known to those skilled in the art for such
introduction. Such methods include transfection, transformation,
transduction, infection (e.g., viral transduction), injection,
microinjection, gene gun, nucleofection, nanoparticle bombardment,
transformation, conjugation, by application of the nucleic acid in
a gel, oil, or cream, by electroporation, using lipid-based
transfection reagents, or by any other suitable transfection
method. One of skill in the art will readily understand and adapt
such methods using readily identifiable literature sources.
[0079] As used herein, the terms "transformation" and
"transfection" are intended to refer to a variety of art-recognized
techniques for introducing foreign nucleic acid into a host cell,
including calcium phosphate or calcium chloride co-precipitation,
DEAE-dextran-mediated transfection, lipofection (e.g., using
commercially available reagents such as, for example,
LIPOFECTIN.RTM. (Invitrogen Corp., San Diego, Calif.),
LIPOFECTAMINE.RTM. (Invitrogen), FUGENE.RTM. (Roche Applied
Science, Basel, Switzerland), JETPEI.TM. (Polyplus-transfection
Inc., New York, N.Y.), EFFECTENE.RTM. (Qiagen, Valencia, Calif.),
DREAMFECT.TM. (OZ Biosciences, France) and the like), or
electroporation (e.g., in vivo electroporation). Suitable methods
for transforming or transfecting host cells can be found in
Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed.,
Cold Spring harbor Laboratory, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y., 1989), and other laboratory manuals.
[0080] Methods and materials of non-viral delivery of nucleic acids
to cells further include biolistics, virosomes, liposomes,
immunoliposomes, polycation or lipid:nucleic acid conjugates, naked
DNA, artificial virions, and agent-enhanced uptake of DNA.
Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386,
4,946,787; and 4,897,355) and lipofection reagents are sold
commercially (e.g., Transfectam.TM. and Lipofectin.TM.). Cationic
and neutral lipids that are suitable for efficient
receptor-recognition lipofection of polynucleotides include those
of Felgner, WO 91/17424; WO 91/16024.
[0081] The above disclosure generally describes the present
invention. All references disclosed herein are expressly
incorporated by reference. A more complete understanding can be
obtained by reference to the following specific examples which are
provided herein for purposes of illustration only, and are not
intended to limit the scope of the invention.
EXAMPLE I
Methods of Making a Tetracycline Inducible Expression System in
Lactobacilli
[0082] The present disclosure provides a TetR-PltetO system using
different promoters than are featured in the original TetR-PltetO
system, so as to function in lactic acid bacteria. In general, the
TetR-PltetO system drives the expression of the gene encoding the
efflux pump TetA (which provides antibiotic resistance against
tetracycline in bacteria). TetR is a transcriptional repressor that
prevents the transcription of the tetA gene from the PltetO
promoter in absence of tetracycline, by means of attaching to the
so-called tetO operator boxes (the TetR binding sites). In the
presence of the antibiotic, TetR disengages from PltetO, allowing
access by RNA polymerase and thus permitting the transcription of
the resistance gene tetA. This way, the transmembrane efflux pump
is produced only when needed.
[0083] An expression system that is inducible by tetracycline in
Lactobacilli is described as follows. It was first verified that
Lactobacilli possess no resistance genes that would adulterate any
induction system based on the addition of tetracycline or any of
its analogs. A BLAST analysis of the TetR protein sequence as well
as the TetA tetracycline efflux pump that drives resistance was
performed, across all available Lactobacillus proteomes and
potential homologs in L. lactis, and L. plantarum were identified,
because they carry a transferrable plasmid harboring tetM and tetS
genes. These plasmids can be eliminated from these strains with
novobiocin so that this system can still be implemented in them,
but regardless, no other strain of Lactobacillus possessed any
sequences pertinent to tetracycline. This was imperically validated
by testing several strains (L. rhamnosus GG, L gasseri, L.
jensenii, and L. crispatus) for their susceptibility to
tetracycline, and found their growth to be inhibited with as little
as 2 mg/mL of tetracycline, indicating a lack of any resistance
mechanism in these strains.
[0084] Existing formats of tetracycline responsive promoters, such
as those frequently utilized in the PltetO system in E. coli, do
not function in Lactobacilli. This is because the architecture of
promoters in Lactobacilli differ from that in E. coli, i.e. the
average separation between the -35 and -10 boxes recognized by the
.sigma..sup.70 subunit of the RNA polymerase is 17 bp as opposed to
16 bp, and the sequence space in this region requires more AT-rich
content in Lactobacilli. The length of this spacing sequence is
related to the recognizing of the -35 and -10 boxes by
.sigma..sup.70 as consensus boxes can render very poor gene
expression if they are too far apart or too close. Additionally,
Lactobacillus promoters frequently contain AT-rich upstream
promoter elements that can interact with .alpha. or .sigma. factors
and are thus important for robust expression. Therefore, to design
a functional tetracycline response promoter for use in
Lactobacilli, the promoter sequence that drives the expression of
the s-layer protein A (slpA) in L. acidophilus is manipulated in a
manner to operably link it to tetracycline. This promoter exhibits
strong, robust expression of heterologous protein in diverse
species of Lactobacilli, making it an exemplary design template (A.
McCracken et al. Analysis of promoter sequences from Lactobacillus
and Lactococcus and their activity in several Lactobacillus
species. Arch Microbiol. 2000 173:383-389).
[0085] To edit the slpA promoter sequence in order to bring it
under the control of tetracycline, the tetO operator box sequence
from the PltetO system was inserted into various regions within the
promoter sequence. lacO and treO--the operator box sequences for
trehalose and lactose based repression identified in the native
Plac and Ptre promoters in L. acidophilus (see Duong et al. Microb.
Biotech, 4(3):357-367 (2010) hereby incorporated by reference in
its entirety) were inserted into the region upstream to slpA,
replacing a segment of the original sequence (preserving the
original length of the operator box) at the same relative locations
as they are in the wild-type, trehalose and lactose inducible
promoters where the operator boxes were first characterized. Doing
so resulted in Lactose and Trehalose driven induction of slpA,
exceeding the performances of the original promoters. The strategy
was replicated for tetracycline and various variants were tested as
follows.
[0086] Variant 1: The relative locations of the tetR operators were
preserved as they exist in the E. coli PltetO expression system.
However, a single base pair substitution was made within the tetO
box downstream of the -10 sequence, in order to preserve the base
encoding for the transcriptional start site (TSS) for slpA, as the
tetO placement overlaps with that position (i.e., the C in the
7.sup.th base of the tetO sequences was mutated to a G) as shown in
FIG. 7.
[0087] Variant 2: In this variant, the tetO boxes were inserted in
locations that minimally perturb the -35/-10, and upstream promoter
sequence region. They are placed subsequent to the transcriptional
start site, so that TetR protein binding physically restricts
processing by RNA polymerase, rather than preventing RNA polymerase
binding in the first place (as is encoded by the tetO placement in
Variant 1). See FIG. 8.
[0088] Variant 3: This design mimics the relative placement of
operator boxes common to carbohydrate linked induction such as
lactose and trehalose. The tetO boxes are placed 5' to the
"upstream promoter element" and 5' to the RBS. See FIG. 9.
[0089] Variant 4: This design combines the principles of Variants 2
and 3 together to account for a potential secondary issue. Prior
literature has demonstrated that slpA owes its expression strength
to the high degree of mRNA stability afforded by the 5'
untranslated region of the promoter (from the TSS to the RBS),
which forms a high-free-energy RNA hairpin to protect mRNA species
from 5' mediated degradation. See Narita et al. Appl Microbiol
Biotechnol 73:366-373 (2006). However, the hairpin is such that the
RBS is in a low energy binding region of the hairpin and is thus
still accessible to the ribosome. Variants 2 and 3 alter the
binding free energy of the mRNA. So, to account for this property,
in variant 4 there are 4 tetO boxes in this design: two that are
proximal to the Transcriptional start site just as in Variant 2,
and two that are proximal to the RBS as in Variant 4. However, the
two near the RBS are encoded in reverse complement, evenly spaced
from the first two tetO sequences next to the TSS, thus not only
preserving, but increasing the mRNA hairpin folding energy (while
still leaving the RBS accessible). See FIG. 10.
[0090] FIG. 11 depicts minimum free energy mRNA structural folding
predictions. Each of these variants was then tested in a plasmid
with no TetR (meaning the inserted promoters are not repressed, and
should be constitutively active), driving a fluorescent reporter.
E. coli harboring these plasmids were grown to stationary phase
(where wild-type slpA promoter expression is strongest), and all
variants exhibited equivalent expression strength to the original
promoter. Subsequently, this test was replicated in L. rhamnosus
GG. In this setting, only variant 2 exhibited measurable expression
(3 fold-less than the wild-type promoter). Therefore, only variant
2 was selected for testing in the presence of TetR. The other
variants may exhibit function in other strains of Lactobacilli, and
would as such be rescreened when switching strains. In this vein,
the promoter sequence may be further edited to replace the A in the
-13 position upstream of the -10 box with a G. 25% of Lactobacilli
exhibit a TG dinucleotide motif in the -13/-14 positions of their
promoter sequences, so when implementing the slpA promoter, or
engineered variants thereof, in these strains, this nucleotide
substitution may yield more robust expression. See McCracken et al.
J Bacteriol 181(20):6569-6572 (1999).
[0091] The TetR coding region from PltetO was then transferred to a
plasmid, fused upstream of, but in reverse complement to the
promoter, so as to eliminate the potential for transcriptional read
through by DNA polymerase between the two. However, no repression
of the promoter was observed in Lactobacillus, due to the same
reason the original PltetO promoter exhibited no function--the
promoter driving expression of TetR was not sufficiently active. As
such, the promoter sequence was replaced with constitutive
promoters native to Lactobacilli. Selection of the promoter is
important to the repressor function. Weak promoters driving low
expression of TetR will result in a "leaky", basal expression in
the absence of induction agent. However, TetR has high affinity to
the tetO sequence, so overexpression of TetR will reduce the
dynamic range of induced expression. Accordingly, the promoter for
the ribosomal RNA 3-a from L. plantarum was selected, because its
expression strength is 5-fold weaker than that of slpA. See FIG.
12. An effective choice for the promoter of TetR is not limited to
that of rRNA3-a. Published data indicate that the clpC promoter L.
fermentum BR11, the lacA promoter from L. lactis, the ldh promoter
from L. plantarum, L. casei, or L. reuteri, the pgm promoter from
L. agilis, and the ermB promoter from E. faecalis, all are
similarly weaker than slpA, and can thus be substituted (see
McCracken et al. Arch Microbiol. 2000 173:383-389, Miyoshi et al.,
FEMS Microbiol. Lett. 239(2):205-212 (2004), Lizier et al., FEMS
Microbiol. Lett. 308:8-15 (2010) each of which are hereby
incorporated by reference in its entirety). By extension, cognate
promoters from sister species of the aforementioned organisms may
similarly be used. The wild-type slpA promoter itself can also be
utilized as the promoter for TetR--with the potential benefit of
maximally reducing any leakage from the induction system (basal
expression in the absence of an inducer), since it is as strong or
stronger than any of the engineered slpA variants. However this may
require tuning in order to preserve an optimal dynamic range during
induction. Slight weakening of the promoter sequence associated
with TetR (referred to as TetR-slpA) via RBS site mutation,
deletion or mutation of the upstream promoter element
(AAATATTACAAATAGTATTTTTCGGTCA (SEQ ID NO: 20), or any subsequence
thereof), or mutations introduced into the -35 box, the -10 box, or
the sequence space between them, may achieve the desired strength
relative to the engineered slpA promoter intended for the target
protein (referred to as slpA-target). TetR expression by slpA may
also be tuned by the introduction of catabolic repressive elements
such as those sensitive to glucose, to thus scale TetR expression
by slpA with cellular growth rate. Alternatively, variant 2's
design may be applied to TetR-slpA using mutated tetO sequences
that bind with lower affinity than the original tetO (e.g. via the
introduction of point mutations that break the tetO's sequence
palindromes), thus scaling tetR expression with the induction by
aTc itself (two candidates with weakly binding tetO mutants include
TCTCTAACACTGTTAGGG (SEQ ID NO: 21) and TCTGTATCACTGATACGG (SEQ ID
NO: 22), as per Bolinteneau et al. ACS JCED 59:3167-3176 (2014)
hereby incorporated by reference in its entirety). All designs take
into consideration the cloning of apposed slpA promoters that is
inherent to the slpA promoter sequence. In L. acidophilus, the slpA
promoter sequence is naturally apposed, in the same orientation as
proposed for TetR-slpA, to promoter sequence for slpB. In nature,
the slpA and slpB promoters invert with one another in order to
control the expression of their respective proteins. The same
occurs if TetR-slpA is in apposition to slpA-target. However,
deletion of an invertase recognition site associated with the Din
family of invertases (ATCTTGCTTTGAAGGGTTTTGTACAT (SEQ ID NO: 23) as
per Boot et al. Mol. Microbiol. 21(4):799-809 (1996) hereby
incorporated by reference in its entirety) located between the
transcriptional start site and the RBS, together with the
introduction of a randomized DNA spacer sequence between the two
promoter units (comprised of 30% A, 50% G, and 20% T), resolves
this issue (see SEQ ID NO: 3). It is sufficient to delete only one
of either invertase sites within TetR-slpA, or slpA-target, though
it is preferable to delete the site within TetR-slpA as this lesion
disrupts the 5' untranslated region mRNA folding structure
described earlier. slpA with this deletion successfully drives
repressor function across a dynamic range of 10.sup.6 in E. coli,
when paired with slpA-tetO variant 2. See FIG. 13.
[0092] Embodiments of the present disclosure are directed to an
engineered slpA promoter for repression by tetO having the
following characteristics. First, for each variant, the tetO boxes
can be shifted up to 22 base pairs (i.e. two Kuhn lengths) upstream
or downstream from their present locations in the variants. That
is, the tetO boxes can be placed within plus or minus 22 base pairs
from the location identified in each variant. Second, the function
of variant 2 can be readily replicated with any other
promoter--since the tetO boxes are located past slpA's
transcriptional start site (and regulate promoter function at the
stage just after RNA polymerase binding by preventing it from
proceeding into the protein reading frame), the sequence region of
variant 2 from the transcriptional start site to the RBS can be
fused at its 5' end to any promoter within the region of its
respective transcriptional start site (see SEQ ID NO: 4, 7).
Accordingly, one aspect of the present disclosure is the insertion
of one or more tetO boxes within a target promoter's
transcriptional start site. Such fusions are shown to either
preserve or boost the expression strength of several promoters
unrelated to slpA, indicating that the embodiments of the present
disclosure are not limited to the promoter slpA and can be
replicated for other promoters (see Miyoshi et al., FEMS Microbiol.
Lett. 239(2):205-212 (2004) hereby incorporated by reference in its
entirety). Third, the effect of fusing slpA's 5' untranslated
region to any given promoter can similarly be applied to the
expression of TetR, if it is desirable to increase its expression
strength, or tune its dynamic range via the introduction of tetO
sequences (or mutants thereof) as described above for TetR-slpA
(exemplified with the L. fermentum BR11 ClpC promoter in SEQ ID 7).
Fusing the slpA 5' untranslated region which includes one or more
operator boxes to any given promoter sequence allows for methods of
target nucleic acid expression or repressor expression. Fourth, the
expression of TetR may be further modulated by codon engineering.
Bacteria have varying tRNA abundances that lead to biased
translational efficiencies within sets of degenerate codons. Thus,
like codons may be substituted to tune the translational efficiency
of TetR. For example, the TetR sequence may be recoded with the
most frequently used tRNAs in Lactobacilli to optimize
translational efficiency in this species (see SEQ ID NO: 5).
Lastly, the principles of potential tetO (or any other repressor
operator box sequence) variant design can be applied to any other
promoter sequence and will be apparent to those of skill in the art
based on the present disclosure.
[0093] In this expression system, gene expression was orthogonally
induced with improved control. This was accomplished by engineering
a high-copy plasmid that carries the tetracycline repressor (tetR)
paired with the oft used PltetO system, and editing the promoter
for s-layer protein A (slpA), which is one of the strongest
constitutive promoters known in Lactobacilli and has been used to
direct heterologous gene expression in a wide range of species (see
A. McCracken et at. Analysis of promoter sequences from
Lactobacillus and Lactococcus and their activity in several
Lactobacillus species. Arch Microbiol. 2000 173:383-389 hereby
incorporated by reference in its entirety). The slpA promoter was
edited by inserting tetracycline repressor protein binding sites
(tetO) at a variety of locations that were then screened for
function. Several guidelines were designed for promoter design in
regards to the placement of tetO. Variant design was dictated by
the locations of endogenous repressor binding site locations in
Lactobacilli, and their endogenous catabolic repressor motifs.
Custom bioinformatics were also utilized to generate consensus
sequences for Lactobacillus promoters in order to identify
functionally important sequence spaces to mitigate disruption of
promoter function. Lastly, promoter designs were further guided by
secondary structure predictions of predicted mRNA.
EXAMPLE II
Orthogonally Induced Gene Expression in Lactobacilli
[0094] To evaluate the functionality of the aTc induction system
described herein in lactic acid bacteria, the TetR regulon
described herein is driven by a L. plantarum promoter paired with
slpA-tetO variant 2 (current SEQ IDs 1 and 2), into L. rhamnosus GG
via electroporation with a high copy plasmid. Sequence verified
colonies, as well as colonies harboring a negative control plasmid
with no fluorescence reporter, were then picked in triplicate, and
used to inoculate liquid cultures that were grown overnight. These
overnight cultures were then sub-cultured 1/100 into fresh media,
in duplicate--one culture containing 10 ng/mL aTc, the other
containing no inducing agent. The culture with inducing agent, was
then serially diluted by 50%, 5 times (yielding cultures with 5,
2.5, 1.25, 0.625, and 0.3125 ng/mL of aTc, in addition to the
original 10 ng/mL culture). These cultures were then grown to an
optical density of 0.2 (to capture lag phase behavior), 0.6 (log
phase), and 1.0 (stationary phase), as measured by an optical cell
density meter. At each optical density, the fluorescence of all
cultures and replicates were measured in absolute units in a
fluorimeter. Relative fluorescence units were then computed as a
fold change value over the measured fluorescence of the negative
control cell cultures that were known to not express fluorescence
protein.
[0095] The slpA variant featuring two tetO sites between the
transcriptional start site and the ribosome binding site
demonstrated reliable repression and expression of a fluorescent
protein in the absence and presence of aTc, in L. rhamnosus GG--a
prevalent probiotic (see FIG. 1). Importantly, control of gene
expression in all growth phases: early exponential,
mid-exponential, and stationary phase were demonstrated.
[0096] The functionality of tetracycline induction was similarly
demonstrated in the vaginal probiotic strain, L. gasseri,
indicating the ease of transfer for this system into different
strains. In this instance, the TetR regulon of the induction system
was expressed by the E. faecalis ermB promoter and, as above,
paired with the slpA-tetO variant 2 (current SEQ IDs 2 and 6). The
experimental procedure used was exactly as described above for L.
rhamnosus GG, with the exception that the dilution series began at
500 ng/mL aTc (see FIG. 14). Strong expression was driven by
tetracycline with this induction system in L. gasseri, indicating
the versatility of our methodology.
[0097] Under similar experimental conditions, a hybrid promoter in
junction with TetR (TetR-ClpC-slpA) in L. gasseri was functional,
validating the potential use of the strategy for modulating
promoter function with the slpA untranslated region, as expounded
in previous sections (see FIG. 15).
[0098] The functionality of the tetracycline inducible promoters as
an orthogonal gene expression system can be further modified and
verified in a wider array of strains and cells, and the dynamic
range of the promoter can be improved by modulation of basal
repression strength. According to certain aspects, methods and
expression systems as herein described are provided to control
production of proteins by probiotic species such as L. rhamnosus GG
or L. gasseri while in vivo, which aTc has previously enabled in
the gut pathogen, H. pylori, in mouse models (see A. Debowski et
al. Development of a tetracycline-inducible gene expression system
for the study of Helicobacter pylori pathogenesis. Appl Environ.
Microbiol. 2013 December; 79(23):7351-59 hereby incorporated by
reference in its entirety.
EXAMPLE III
aTc-Inducible Promoter Variant
[0099] According to one aspect, an aTc-inducible promoter variant
is provided. According to an additional aspect, the aTc-inducible
promoter variant exhibits low or undetectable levels of leakage.
Lowering or preventing leakage is desirable such as in the case of
controlling expression of gene editing proteins such as Cas9, where
the repressed state ideally has no measurable gene editing
activity. In some aspects, replacement of a regulon promoter to
address leakage may not be desirable insofar as such a replacement
may present incompatibility issues with the host.
[0100] According to one aspect, the present disclosure provides
methods for creating lower leakage variants of an aTc-inducible
promoter. According to one aspect, a promoter variant is provided
wherein the sequence space around the tetO binding sites is
altered. According to one aspect, a promoter variant is provided
wherein the sequence space around the tetO binding sites is altered
to more closely mimic the general tetO binding site sequence space
as found in PltetO (which exhibits low leakage in E. coli).
[0101] According to one aspect, an altered promoter sequence is
provided where the tetR binding site (or binding landing pad)
includes a base pair from PltetO that is one nucleotide upstream to
the first tetO binding site (SEQ ID NO:8), the second tetO binding
site (SEQ ID NO:9), or both tetO binding sites (SEQ ID NO:10). In
this manner, the promoter sequence of SEQ ID NO:2 is altered to
extend the tetR binding landing pad by including one additional
base pair from PltetO that is one nucleotide upstream to the first,
second, or both tetO binding sites as represented in SEQ ID NO:8,
SEQ ID NO:9 and SEQ ID NO:10. Crystallographic analysis of the
TetR-tetO complex has shown that this particular nucleotide is not
a critical participant in TetR binding (see J. L. Ramos et al.).
For this reason, carry over of this nucleotide between PltetO and
P.sub.slpA was omitted in the case of SEQ ID NO:2, in order to
better preserve the mRNA secondary structure of the 5'UTR sequence
due to its influence on promoter function as described previously.
However, it has been shown that substitution at this position from
A/T base-pairing to G/C base-pairing (as is the case in SEQ ID
NO:2) renders a marginal, but measurable reduction in TetR binding
affinity (A. Wissmann et al., Saturation mutagenesis of the
Tn10-encoded tet operator O.sub.1: Identification of base-pairs
involved in Tet repressor recognition. J. Mol. Bio. (1988)
202:397-406). According to the present disclosure, retaining an A/T
base-pair results in the first tetO binding site sequence with a
higher affinity to TetR, and thus a more tightly repressed system.
In one embodiment, a promoter sequence has at least 85% homology,
at least 90% homology, at least 95% homology, at least 97%
homology, at least 98% homology or at least 99% homology to SEQ ID
NO:8. In one embodiment, a promoter sequence has at least 85%
homology, at least 90% homology, at least 95% homology, at least
97% homology, at least 98% homology or at least 99% homology to SEQ
ID NO:9. In one embodiment, a promoter sequence has at least 85%
homology, at least 90% homology, at least 95% homology, at least
97% homology, at least 98% homology or at least 99% homology to SEQ
ID NO:10.
[0102] According to one aspect, an altered promoter sequence is
provided where the tetR binding site (or binding landing pad)
includes a base pair from PltetO that is one nucleotide downstream
to the first tetO binding site (SEQ ID NO:11), the second tetO
binding site (SEQ ID NO:12), or both tetO binding sites (SEQ ID
NO:13), on its 3' end. In this manner, the promoter sequence of SEQ
ID NO:2 is altered to extend the tetR binding landing pad by
including one additional base pair from PltetO that is one
nucleotide downstream to the first, second, or both tetO binding
sites as represented in SEQ ID NO:11, SEQ ID NO:12 and SEQ ID
NO:13.
[0103] According to one aspect, the inclusion of the original
nucleotide that is 1 base-pair downstream of the tetO binding site
in PltetO, on its 3' end has the same effect on TetR binding (as
including the 1 base-pair upstream of the tetO binding site), as
the tetO sequence is palindromic, and each of the opposite ends of
the sequence exhibit the same mechanism of interaction with TetR,
albeit with distinct (but identical) helix-turn-helix motifs within
the TetR dimer. Carrying over this nucleotide to the first, second,
or both tetO binding site sequence, and substituting the
affinity-reducing G/C base-pair in that region of P.sub.slpA
results in the more repressive promoter design described by SEQ ID
NO:11, 12, and 13. In one embodiment, a promoter sequence has at
least 85% homology, at least 90% homology, at least 95% homology,
at least 97% homology, at least 98% homology or at least 99%
homology to SEQ ID NO:11. In one embodiment, a promoter sequence
has at least 85% homology, at least 90% homology, at least 95%
homology, at least 97% homology, at least 98% homology or at least
99% homology to SEQ ID NO:12. In one embodiment, a promoter
sequence has at least 85% homology, at least 90% homology, at least
95% homology, at least 97% homology, at least 98% homology or at
least 99% homology to SEQ ID NO:13.
[0104] According to one aspect, an altered promoter sequence is
provided that includes the 6 bp sequence found in the PltetO
promoter from which the tetO binding site sequences were derived.
In this manner, the promoter sequence of SEQ ID NO:2 is altered to
include the 6 bp sequence found in the PltetO promoter from which
the tetO binding site sequences were derived. The intervening 7 bp
sequence--currently 7 bp of the original slpA 5' UTR sequence at
that location--is replaced with the 6 bp sequence found in the
PltetO promoter from which the tetO binding site sequences were
derived (which happens in this case to be the -35 binding site
sequence of PltetO). This alteration more closely replicates the
DNA helicity and melting temperature of PltetO at this location, as
these factors influence the binding energy of the TetR-tetO
complex. Reduction of this spacer sequence from 7 to 6 bp also
serves to more closely replicate the relative rotational
displacement between the tetO contact sites, which may have
additional influence on TetR binding kinetics. This results in
another, more repressive promoter design variant, represented by
SEQ ID NO:14. In one embodiment, a promoter sequence has at least
85% homology, at least 90% homology, at least 95% homology, at
least 97% homology, at least 98% homology or at least 99% homology
to SEQ ID NO:14.
[0105] According to one aspect, a promoter sequence is provided
that includes one or more or all of the following: (1) a base pair
from PltetO that is one nucleotide upstream to the first tetO
binding site, the second tetO binding site, or both tetO binding
sites; (2) a base pair from PltetO that is one nucleotide
downstream to the first tetO binding site, the second tetO binding
site, or both tetO binding sites, on its 3' end; and/or (3) the 6
bp sequence found in the PltetO promoter from which the tetO
binding site sequences were derived. According to one aspect, a
promoter sequence is provided that includes all of the following:
(1) a base pair from PltetO that is one nucleotide upstream to the
first tetO binding site, the second tetO binding site, or both tetO
binding sites; (2) a base pair from PltetO that is one nucleotide
downstream to the first tetO binding site, the second tetO binding
site, or both tetO binding sites, on its 3' end; and (3) the 6 bp
sequence found in the PltetO promoter from which the tetO binding
site sequences were derived.
[0106] Relative to SEQ ID NO:2, an aspect of the present disclosure
provides one or more base or base pair alterations (i.e., additions
or deletions) include the following: (1) one additional base pair
upstream of the first tetO binding site, (2) one additional base
pair downstream of the second tetO binding site, and/or (3)
replacement of the intervening, 7 bp sequence--currently 7 bp of
the original slpA 5'UTR sequence at that location--with the 6 bp
sequence found in the PltetO promoter from which the tetO binding
site sequences were derived (which in an exemplary embodiment is
the -35 binding site sequence of PltetO). According to one aspect,
the alterations are selected to more closely mimic the general tetO
binding site sequence space as found in PltetO (which exhibits low
leakage in E. coli). In particular, replacement of the intervening,
7 bp sequence between the tetO binding sites to its original
identity serves to more closely replicate the DNA helicity and
melting temperature of PltetO at this location, as these factors
influence the binding energy of the TetR-tetO complex.
[0107] An exemplary aTc-inducible slpA promoter variant is provided
in SEQ ID NO:15 which includes the alterations above resulting in a
combined, maximally repressive variant. In one embodiment, a
promoter sequence has at least 85% homology, at least 90% homology,
at least 95% homology, at least 97% homology, at least 98% homology
or at least 99% homology to SEQ ID NO:15. All of the described
alterations work in concert to achieve an inducible system that has
essentially undetectable levels of leakage in all phases of growth.
Using this aTc-inducible slpA promoter variant of SEQ ID NO:15, no
basal expression was detected in the absence of aTc, whether at
stationary phase for 0 hours, 2.5 hours, 7.5 hours, and 17.5 hours,
as exemplified in L. rhamnosus GG (see FIG. 16). FIG. 16 also shows
an order of magnitude (10.times.) reduction in maximum inducible
expression.
EXAMPLE 4
Induction of Antibody Fragment Protein Secretion in Lactobacillus
Via aTc
[0108] The engineered aTc-inducible slpA promoter has been valuable
for enabling heterologous protein secretion in Lactobacillus. When
secreting heterologous proteins via the Type I secretion system in
Lactobacilli (or any bacterial or fungal strain), toxicity can be
an issue that prevents successful secretion, especially when
driving expression of a secreted protein with a strong
promoter--this is because it may overload host cell secretion
machinery at the expense of proteins that are naturally secreted by
the same pathway that are necessary for survival. As a result,
genetic engineering of expression cassettes for secreted proteins
is problematic due to frame-shift mutations that prevent protein
expression or secretion. This is because cells that secrete toxic
levels of heterologous proteins are outcompeted by cells that
generate mutations that prevent it in culture, making it difficult
to isolate cells that harbor intact genetic elements encoding the
desired secretory activity.
[0109] According to one aspect, an inducible expression system is
used prevent expression during bacterial culture and clone
isolation. According to one aspect, expression is controlled and
kept off during bacterial culture and clone isolation to avoid or
lower or reduce or inhibit secretion-induced toxicity. According to
one aspect, the level of a HisTagged, anti-HIV (gp120) camelid
nanobody (J3-VHH) purified from culture supernatant, when secretion
of protein was driven by an inducible system (SEQ ID NO: 2) was
compared to a system using an uncontrolled, constitutive slpA.
Cells (in this case, L. gasseri) without an expression cassette
(negative control with no protein expected), an aTc-inducible
expression cassette encoding J3-VHH secretion, and an equivalent,
but constitutive expression cassette, were grown in culture to an
optical density of 0.4 (the start of the exponential growth phase,
during which time cellular protein production capacity is maximal),
and split into two equal volumes--500 ng/mL of aTc was added to
one, while the other received no aTc (as an internal negative
control to verify functional induction). Only cells with the
inducible cassette that received aTc secreted any protein into the
supernatant--as shown by protein gel electrophoresis of HisTag
purified L. gasseri culture supernatant of FIG. 17. Subsequent
sequencing analysis showed that the majority of L. gasseri cells
that carried the constitutive expression cassette acquired
mutations that stopped expression and secretion of J3-VHH, while
cells with the inducible cassette remained genetically intact.
TABLE-US-00003 Sequences TetR-3a regulon: (SEQ ID NO: 1) 5'-
TTATAAAAAGATGTTGACAGCTTGTTCTGATGATGATAAACTTTAATAGTTG
CGAGAGAAAGAGGAGAAATACTAG.sup.1ATGATGTCTAGATTAGATAAAAGTAAAG
TGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAA
CCCGTAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCCTACATTGTATTGGCATGT
AAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCA
CCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAAT
AACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTAC
ATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAG
CCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGC
TGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCT
AAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAA
GCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTG
AATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCTTAA.sup.2-3' 1.
L. plantarum ribosomal RNA promoter 3-a 2. TetR coding region TetR
coding region, codon optimized for Lactobacillus (SEQ ID NO: 5):
5'- ATGATGTCACGCTTGGATAAATCAAAAGTTATTAATTCAGCATTGGAATTGTTGA
ATGAAGTTGGCATTGAAGGCTTGACCACCCGCAAATTGGCACAAAAATTGGGCG
TTGAACAACCAACCTTGTATTGGCATGTTAAAAATAAACGCGCATTGTTGGATGC
ATTGGCAATTGAAATGTTGGATCGCCATCATACCCATTTTTGCCCATTGGAAGGC
GAATCATGGCAAGATTTTTTGCGCAATAATGCAAAATCATTTCGCTGCGCATTGT
TGTCACATCGCGATGGCGCAAAAGTTCATTTGGGCACCCGCCCAACCGAAAAAC
AATATGAAACCTTGGAAAATCAATTGGCATTTTTGTGCCAACAAGGCTTTTCATT
GGAAAATGCATTGTATGCATTGTCAGCAGTTGGCCATTTTACCTTGGGCTGCGTT
TTGGAAGATCAAGAACATCAAGTTGCAAAAGAAGAACGCGAAACCCCAACCACC
GATTCAATGCCACCATTGTTGCGCCAAGCAATTGAATTGTTTGATCATCAAGGCG
CAGAACCAGCATTTTTGTTTGGCTTGGAATTGATTATTTGCGGCTTGGAAAAACA
ATTGAAATGCGAATCAGGCTCATAA-3' TetR-slpA regulon with Din invertase
site removed (SEQ ID NO: 3): 5'- .sup.1TGCTTG
TGGGGGTAAGCGGTAGGTGAAATATTACAAATAGTATTTTTCGGTCATTTTA
ACTTGCTATTTCTTGAAGAGGTTAGTACAATATGAATC .sup.2TGGTAAGTAATAG
GACGTGCTTCAGGCGTGTTGCCTGTACGCATGCTGATTCTTCAGCAAGACTA
CTACCTCATGAGAGTTATAGACTCATGGTATAGGCTCCTATCACATGCTGAA
CCTATGGCCTATTACATTTTTTTATATTTC .sup.3AAAAGACCACATGATG
TCTAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTTAATGAGGTCGG
AATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCCTACAT
TGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAG
ATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTA
ATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATT
TAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTAT
GCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTA
CTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACA
CCTACTACTGATAGTATGCGGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAA
GGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAA
CTTAAATGTGAAAGTGGGTCTTAA.sup.4-3' 1. Spacer sequence 2.
Transcriptional Start Site 3. Ribosomal Binding Site 4. TetR codon
region Edited slpA promoter sequence: (SEQ ID NO: 2) 5'-
TGCTTGTGGGGGTAAGCGGTAGGTGAAATATTACAAATAGTATTTTTCGGTCATT
TTAACTTGCTATTTCTTGAAGAGGTTAGTACAATATGAATCG.sup.1TGGCCCTATCAG
TGATAGAGA.sup.2TCAGGCGCCCTATCAGTGATAGAGA.sup.3TGATTCTTCAGCAAGACT
ACTACCTCATGAGAGTTATAGACTCATGGATCTTGCTTTGAAGGGTTTTGTACATT
ATAGGCTCCTATCACATGCTGAACCTATGGCCTATTACATTTTTTTATATTTCAAG
GAGG.sup.4AAAAGACCAC-3' 1. Transcriptional start site 2. TetR
binding site 3. TetR binding site 4. Ribosomal binding site slpA 5'
untranslated region for hybrid promoter fusions: (SEQ ID NO: 4) 5'-
G.sup.1TGGTAAGTAATAGGACGTGCT.sup.2TCAGGCGTGTTGCCTGTACGCATGC.sup.3TGAT
TCTTCAGCAAGACTACTACCTCATGAGAGTTATAGACTCATGGATCTTGCTTTGA
AGGGTTTTGTACATTATAGGCTCCTATCACATGCTGAACCTATGGCCTATTACATT
TTTTTATATTTCAAGGAGG.sup.4AAAAGACCAC-3'-1, Transcriptional start
site 2. Sequence space that can be substituted with repressor
binding site 3. Sequence space that can be substituted with
repressor binding site 4. Ribosomal binding site TetR-ermB regulon:
(SEQ ID NO: 6) 5'-
CTTAAAATATAGTCATAGAATTAGGGCGTCGGTTTTAAAAGTGTGGTAAAAT
AATGGTCAAGATTA.sup.1ATGATGTCTAGATTAGATAAAAGTAAAGTGATTAACAGC
GCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTC
GCCCAGAAGCTAGGTGTAGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAG
CGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACT
TTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAG
TTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACTA
CGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCC
AACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTT
TACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAG
GGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTA
TTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATAT
GCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCTTAA.sup.2-3' 1. E. faecalis
ermB promoter 2. TetR coding region TetR-clpC-slpA hybrid regulon:
(SEQ ID NO: 7) 5'-
CTTAAAATATAGTCATAGAATTAGGGCGTCGGTTTTAAAAGTGTGGTAAAAT
AATGGTCAAGATTA.sup.1GTGGTAAGTAATAGGACGTGCTTCAGGCGTGTTGCCT
GTACGCATGCTGATTCTTCAGCAAGACTACTACCTCATGAGAGTTATAGACT
CATGGTATAGGCTCCTATCACATGCTGAACCTATGGCCTATTACATTTTTTT
ATATTTCAAGGAGGAAAAGACCAC.sup.2ATGATGTCACGCTTGGATAAATCAAAAGT
TATTAATTCAGCATTGGAATTGTTGAATGAAGTTGGCATTGAAGGCTTGACCACC
CGCAAATTGGCACAAAAATTGGGCGTTGAACAACCAACCTTGTATTGGCATGTTA
AAAATAAACGCGCATTGTTGGATGCATTGGCAATTGAAATGTTGGATCGCCATCA
TACCCATTTTTGCCCATTGGAAGGCGAATCATGGCAAGATTTTTTGCGCAATAAT
GCAAAATCATTTCGCTGCGCATTGTTGTCACATCGCGATGGCGCAAAAGTTCATT
TGGGCACCCGCCCAACCGAAAAACAATATGAAACCTTGGAAAATCAATTGGCAT
TTTTGTGCCAACAAGGCTTTTCATTGGAAAATGCATTGTATGCATTGTCAGCAGTT
GGCCATTTTACCTTGGGCTGCGTTTTGGAAGATCAAGAACATCAAGTTGCAAAAG
AAGAACGCGAAACCCCAACCACCGATTCAATGCCACCATTGTTGCGCCAAGCAA
TTGAATTGTTTGATCATCAAGGCGCAGAACCAGCATTTTTGTTTGGCTTGGAATT
GATTATTTGCGGCTTGGAAAAACAATTGAAATGCGAATCAGGCTCATAA.sup.3-3' 1. L.
fermentem BR11 ClpC promoter 2. slpA 5' untranslated region
fragment (see Seq ID 4) 3. TetR codon region SEQ ID NO: 8
Suppressed leakage slpA promoter 1 5'-
TGCTTGTGGGGGTAAGCGGTAGGTGAAATATTACAAATAGTATTTTTCGGTCATT
TTAACTTGCTATTTCTTGAAGAGGTTAGTACAATATGAATCG.sup.1TGGT.sup.2CCCTATCA
GTGATAGAGA.sup.3TCAGGCGCCCTATCAGTGATAGAGA.sup.4TGATTCTTCAGCAAGAC
TACTACCTCATGAGAGTTATAGACTCATGGATCTTGCTTTGAAGGGTTTTGTACAT
TATAGGCTCCTATCACATGCTGAACCTATGGCCTATTACATTTTTTTATATTTCAA
GGAGG.sup.5AAAAGACCAC-3' 1. Transcriptional start site 2. Original
base pair 5' to TetR binding site in PltetO 3. TetR binding site 4.
TetR binding site 5. Ribosome binding site SEQ ID NO: 9 Suppressed
leakage slpA promoter 2 5'-
TGCTTGTGGGGGTAAGCGGTAGGTGAAATATTACAAATAGTATTTTTCGGTCATT
TTAACTTGCTATTTCTTGAAGAGGTTAGTACAATATGAATCG.sup.1TGGCCCTATCAG
TGATAGAGA.sup.2TCAGGCT.sup.3CCCTATCAGTGATAGAGA.sup.4TGATTCTTCAGCAAGACT
ACTACCTCATGAGAGTTATAGACTCATGGATCTTGCTTTGAAGGGTTTTGTACATT
ATAGGCTCCTATCACATGCTGAACCTATGGCCTATTACATTTTTTTATATTTCAAG
GAGG.sup.5AAAAGACCAC-3' 1. Transcriptional start site 2. TetR
binding site 3. Original base pair 5' to TetR binding site in
PltetO 4. TetR binding site 5. Ribosome binding site SEQ ID NO: 10
Suppressed leakage slpA promoter 3 5'-
TGCTTGTGGGGGTAAGCGGTAGGTGAAATATTACAAATAGTATTTTTCGGTCATT
TTAACTTGCTATTTCTTGAAGAGGTTAGTACAATATGAATCG.sup.1TGGT.sup.2CCCTATCA
GTGATAGAGA.sup.3TCAGGCT.sup.4CCCTATCAGTGATAGAGA.sup.5TGATTCTTCAGCAAGA
CTACTACCTCATGAGAGTTATAGACTCATGGATCTTGCTTTGAAGGGTTTTGTAC
ATTATAGGCTCCTATCACATGCTGAACCTATGGCCTATTACATTTTTTTATATTTC
AAGGAGG.sup.6AAAAGACCAC-3' 1. Transcriptional start site 2.
Original base pair 5' to TetR binding site in PltetO 3. TetR
binding site 4. Original base pair 5' to TetR binding site in
PltetO 5. TetR binding site 6. Ribosome binding site SEQ ID NO: 11
Suppressed leakage slpA promoter 4 5'-
TGCTTGTGGGGGTAAGCGGTAGGTGAAATATTACAAATAGTATTTTTCGGTCATT
TTAACTTGCTATTTCTTGAAGAGGTTAGTACAATATGAATCG.sup.1TGGCCCTATCAG
TGATAGAGA.sup.2T.sup.3AGGCGCCCTATCAGTGATAGAGA.sup.4TGATTCTTCAGCAAGACT
ACTACCTCATGAGAGTTATAGACTCATGGATCTTGCTTTGAAGGGTTTTGTACATT
ATAGGCTCCTATCACATGCTGAACCTATGGCCTATTACATTTTTTTATATTTCAAG
GAGG.sup.5AAAAGACCAC-3' 1. Transcriptional start site 2. TetR
binding site 3. Original base pair 3' to TetR binding site in
PltetO 4. TetR binding site 5. Ribosome binding site SEQ ID NO: 12
Suppressed leakage slpA promoter 5 5'-
TGCTTGTGGGGGTAAGCGGTAGGTGAAATATTACAAATAGTATTTTTCGGTCATT
TTAACTTGCTATTTCTTGAAGAGGTTAGTACAATATGAATCG.sup.1TGGCCCTATCAG
TGATAGAGA.sup.2TCAGGCGCCCTATCAGTGATAGAGA.sup.3T.sup.4ATTCTTCAGCAAGACTA
CTACCTCATGAGAGTTATAGACTCATGGATCTTGCTTTGAAGGGTTTTGTACATTA
TAGGCTCCTATCACATGCTGAACCTATGGCCTATTACATTTTTTTATATTTCAAGG
AGG.sup.5AAAAGACCAC-3' 1. Transcriptional start site 2. TetR
binding site 3. TetR binding site 4. Original base pair 3' to TetR
binding site in PltetO 5. Ribosome binding site SEQ ID NO: 13
Supressed leakage slpA promoter 6 5'-
TGCTTGTGGGGGTAAGCGGTAGGTGAAATATTACAAATAGTATTTTTCGGTCATT
TTAACTTGCTATTTCTTGAAGAGGTTAGTACAATATGAATCG.sup.1TGGCCCTATCAG
TGATAGAGA.sup.2T.sup.3AGGCGCCCTATCAGTGATAGAGA.sup.4T.sup.5ATTCTTCAGCAAGACT-
A CTACCTCATGAGAGTTATAGACTCATGGATCTTGCTTTGAAGGGTTTTGTACATTA
TAGGCTCCTATCACATGCTGAACCTATGGCCTATTACATTTTTTTATATTTCAAGG
AGG.sup.6AAAAGACCAC-3' 1. Transcriptional start site 2. TetR
binding site 3. Original base pair 3' to TetR binding site in
PltetO 4. TetR binding site 5. Original base pair 3' to TetR
binding site in PltetO 6. Ribosome binding site SEQ ID NO: 14
Suppressed leakage slpA promoter 7 5'-
TGCTTGTGGGGGTAAGCGGTAGGTGAAATATTACAAATAGTATTTTTCGGTCATT
TTAACTTGCTATTTCTTGAAGAGGTTAGTACAATATGAATCG.sup.1TGGCCCTATCAG
TGATAGAGA.sup.2 .sup.3TCCCTATCAGTGATAGAGA.sup.4TGATTCTTCAGCAAGACT
ACTACCTCATGAGAGTTATAGACTCATGGATCTTGCTTTGAAGGGTTTTGTACATT
ATAGGCTCCTATCACATGCTGAACCTATGGCCTATTACATTTTTTTATATTTCAAG
GAGG.sup.5AAAAGACCAC-3' 1. Transcriptional start site 2. TetR
binding site 3. Original intervening sequence (-35 binding site)
between TetR binding sites in PltetO 4. TetR binding site 5.
Ribosome binding site SEQ ID NO: 15 Supressed leakage slpA promoter
8 5'- TGCTTGTGGGGGTAAGCGGTAGGTGAAATATTACAAATAGTATTTTTCGGTCATT
TTAACTTGCTATTTCTTGAAGAGGTTAGTACAATATGAATCG.sup.1TGGT.sup.2CCCTATCA
GTGATAGAGA.sup.3 .sup.4TCCCTATCAGTGATAGAGA.sup.5
.sup.6ATTCTTCAGCAAGAC
TACTACCTCATGAGAGTTATAGACTCATGGATCTTGCTTTGAAGGGTTTTGTACAT
TATAGGCTCCTATCACATGCTGAACCTATGGCCTATTACATTTTTTTATATTTCAA
GGAGG.sup.7AAAAGACCAC-3' 1. Transcriptional start site 2. Original
base pair 5' to TetR binding site in PltetO 3. TetR binding site 4.
Original intervening sequence (-35 binding site) between TetR
binding sites in PltetO 5. TetR binding site 6. Original base pair
5' to TetR binding site in PltetO 7. Ribosome binding site
Sequence CWU 1
1
271703DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 1ttataaaaag atgttgacag cttgttctga
tgatgataaa ctttaatagt tgcgagagaa 60agaggagaaa tactagatga tgtctagatt
agataaaagt aaagtgatta acagcgcatt 120agagctgctt aatgaggtcg
gaatcgaagg tttaacaacc cgtaaactcg cccagaagct 180aggtgtagag
cagcctacat tgtattggca tgtaaaaaat aagcgggctt tgctcgacgc
240cttagccatt gagatgttag ataggcacca tactcacttt tgccctttag
aaggggaaag 300ctggcaagat tttttacgta ataacgctaa aagttttaga
tgtgctttac taagtcatcg 360cgatggagca aaagtacatt taggtacacg
gcctacagaa aaacagtatg aaactctcga 420aaatcaatta gcctttttat
gccaacaagg tttttcacta gagaatgcat tatatgcact 480cagcgctgtg
gggcatttta ctttaggttg cgtattggaa gatcaagagc atcaagtcgc
540taaagaagaa agggaaacac ctactactga tagtatgccg ccattattac
gacaagctat 600cgaattattt gatcaccaag gtgcagagcc agccttctta
ttcggccttg aattgatcat 660atgcggatta gaaaaacaac ttaaatgtga
aagtgggtct taa 7032287DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 2tgcttgtggg ggtaagcggt
aggtgaaata ttacaaatag tatttttcgg tcattttaac 60ttgctatttc ttgaagaggt
tagtacaata tgaatcgtgg ccctatcagt gatagagatc 120aggcgcccta
tcagtgatag agatgattct tcagcaagac tactacctca tgagagttat
180agactcatgg atcttgcttt gaagggtttt gtacattata ggctcctatc
acatgctgaa 240cctatggcct attacatttt tttatatttc aaggaggaaa agaccac
2873938DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 3ccccttctac cataccccct ttacacctac
tccacctcta tattccatcc tgcttgtggg 60ggtaagcggt aggtgaaata ttacaaatag
tatttttcgg tcattttaac ttgctatttc 120ttgaagaggt tagtacaata
tgaatcgtgg taagtaatag gacgtgcttc aggcgtgttg 180cctgtacgca
tgctgattct tcagcaagac tactacctca tgagagttat agactcatgg
240tataggctcc tatcacatgc tgaacctatg gcctattaca tttttttata
tttcaaggag 300gaaaagacca catgatgtct agattagata aaagtaaagt
gattaacagc gcattagagc 360tgcttaatga ggtcggaatc gaaggtttaa
caacccgtaa actcgcccag aagctaggtg 420tagagcagcc tacattgtat
tggcatgtaa aaaataagcg ggctttgctc gacgccttag 480ccattgagat
gttagatagg caccatactc acttttgccc tttagaaggg gaaagctggc
540aagatttttt acgtaataac gctaaaagtt ttagatgtgc tttactaagt
catcgcgatg 600gagcaaaagt acatttaggt acacggccta cagaaaaaca
gtatgaaact ctcgaaaatc 660aattagcctt tttatgccaa caaggttttt
cactagagaa tgcattatat gcactcagcg 720ctgtggggca ttttacttta
ggttgcgtat tggaagatca agagcatcaa gtcgctaaag 780aagaaaggga
aacacctact actgatagta tgccgccatt attacgacaa gctatcgaat
840tatttgatca ccaaggtgca gagccagcct tcttattcgg ccttgaattg
atcatatgcg 900gattagaaaa acaacttaaa tgtgaaagtg ggtcttaa
9384191DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 4gtggtaagta ataggacgtg cttcaggcgt
gttgcctgta cgcatgctga ttcttcagca 60agactactac ctcatgagag ttatagactc
atggatcttg ctttgaaggg ttttgtacat 120tataggctcc tatcacatgc
tgaacctatg gcctattaca tttttttata tttcaaggag 180gaaaagacca c
1915627DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 5atgatgtcac gcttggataa atcaaaagtt
attaattcag cattggaatt gttgaatgaa 60gttggcattg aaggcttgac cacccgcaaa
ttggcacaaa aattgggcgt tgaacaacca 120accttgtatt ggcatgttaa
aaataaacgc gcattgttgg atgcattggc aattgaaatg 180ttggatcgcc
atcataccca tttttgccca ttggaaggcg aatcatggca agattttttg
240cgcaataatg caaaatcatt tcgctgcgca ttgttgtcac atcgcgatgg
cgcaaaagtt 300catttgggca cccgcccaac cgaaaaacaa tatgaaacct
tggaaaatca attggcattt 360ttgtgccaac aaggcttttc attggaaaat
gcattgtatg cattgtcagc agttggccat 420tttaccttgg gctgcgtttt
ggaagatcaa gaacatcaag ttgcaaaaga agaacgcgaa 480accccaacca
ccgattcaat gccaccattg ttgcgccaag caattgaatt gtttgatcat
540caaggcgcag aaccagcatt tttgtttggc ttggaattga ttatttgcgg
cttggaaaaa 600caattgaaat gcgaatcagg ctcataa 6276693DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
6cttaaaatat agtcatagaa ttagggcgtc ggttttaaaa gtgtggtaaa ataatggtca
60agattaatga tgtctagatt agataaaagt aaagtgatta acagcgcatt agagctgctt
120aatgaggtcg gaatcgaagg tttaacaacc cgtaaactcg cccagaagct
aggtgtagag 180cagcctacat tgtattggca tgtaaaaaat aagcgggctt
tgctcgacgc cttagccatt 240gagatgttag ataggcacca tactcacttt
tgccctttag aaggggaaag ctggcaagat 300tttttacgta ataacgctaa
aagttttaga tgtgctttac taagtcatcg cgatggagca 360aaagtacatt
taggtacacg gcctacagaa aaacagtatg aaactctcga aaatcaatta
420gcctttttat gccaacaagg tttttcacta gagaatgcat tatatgcact
cagcgctgtg 480gggcatttta ctttaggttg cgtattggaa gatcaagagc
atcaagtcgc taaagaagaa 540agggaaacac ctactactga tagtatgccg
ccattattac gacaagctat cgaattattt 600gatcaccaag gtgcagagcc
agccttctta ttcggccttg aattgatcat atgcggatta 660gaaaaacaac
ttaaatgtga aagtgggtct taa 6937858DNAArtificial SequenceDescription
of Artificial Sequence Synthetic polynucleotide 7cttaaaatat
agtcatagaa ttagggcgtc ggttttaaaa gtgtggtaaa ataatggtca 60agattagtgg
taagtaatag gacgtgcttc aggcgtgttg cctgtacgca tgctgattct
120tcagcaagac tactacctca tgagagttat agactcatgg tataggctcc
tatcacatgc 180tgaacctatg gcctattaca tttttttata tttcaaggag
gaaaagacca catgatgtca 240cgcttggata aatcaaaagt tattaattca
gcattggaat tgttgaatga agttggcatt 300gaaggcttga ccacccgcaa
attggcacaa aaattgggcg ttgaacaacc aaccttgtat 360tggcatgtta
aaaataaacg cgcattgttg gatgcattgg caattgaaat gttggatcgc
420catcataccc atttttgccc attggaaggc gaatcatggc aagatttttt
gcgcaataat 480gcaaaatcat ttcgctgcgc attgttgtca catcgcgatg
gcgcaaaagt tcatttgggc 540acccgcccaa ccgaaaaaca atatgaaacc
ttggaaaatc aattggcatt tttgtgccaa 600caaggctttt cattggaaaa
tgcattgtat gcattgtcag cagttggcca ttttaccttg 660ggctgcgttt
tggaagatca agaacatcaa gttgcaaaag aagaacgcga aaccccaacc
720accgattcaa tgccaccatt gttgcgccaa gcaattgaat tgtttgatca
tcaaggcgca 780gaaccagcat ttttgtttgg cttggaattg attatttgcg
gcttggaaaa acaattgaaa 840tgcgaatcag gctcataa 8588288DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
8tgcttgtggg ggtaagcggt aggtgaaata ttacaaatag tatttttcgg tcattttaac
60ttgctatttc ttgaagaggt tagtacaata tgaatcgtgg tccctatcag tgatagagat
120caggcgccct atcagtgata gagatgattc ttcagcaaga ctactacctc
atgagagtta 180tagactcatg gatcttgctt tgaagggttt tgtacattat
aggctcctat cacatgctga 240acctatggcc tattacattt ttttatattt
caaggaggaa aagaccac 2889287DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 9tgcttgtggg ggtaagcggt
aggtgaaata ttacaaatag tatttttcgg tcattttaac 60ttgctatttc ttgaagaggt
tagtacaata tgaatcgtgg ccctatcagt gatagagatc 120aggctcccta
tcagtgatag agatgattct tcagcaagac tactacctca tgagagttat
180agactcatgg atcttgcttt gaagggtttt gtacattata ggctcctatc
acatgctgaa 240cctatggcct attacatttt tttatatttc aaggaggaaa agaccac
28710288DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 10tgcttgtggg ggtaagcggt aggtgaaata
ttacaaatag tatttttcgg tcattttaac 60ttgctatttc ttgaagaggt tagtacaata
tgaatcgtgg tccctatcag tgatagagat 120caggctccct atcagtgata
gagatgattc ttcagcaaga ctactacctc atgagagtta 180tagactcatg
gatcttgctt tgaagggttt tgtacattat aggctcctat cacatgctga
240acctatggcc tattacattt ttttatattt caaggaggaa aagaccac
28811286DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 11tgcttgtggg ggtaagcggt aggtgaaata
ttacaaatag tatttttcgg tcattttaac 60ttgctatttc ttgaagaggt tagtacaata
tgaatcgtgg ccctatcagt gatagagata 120ggcgccctat cagtgataga
gatgattctt cagcaagact actacctcat gagagttata 180gactcatgga
tcttgctttg aagggttttg tacattatag gctcctatca catgctgaac
240ctatggccta ttacattttt ttatatttca aggaggaaaa gaccac
28612286DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 12tgcttgtggg ggtaagcggt aggtgaaata
ttacaaatag tatttttcgg tcattttaac 60ttgctatttc ttgaagaggt tagtacaata
tgaatcgtgg ccctatcagt gatagagatc 120aggcgcccta tcagtgatag
agatattctt cagcaagact actacctcat gagagttata 180gactcatgga
tcttgctttg aagggttttg tacattatag gctcctatca catgctgaac
240ctatggccta ttacattttt ttatatttca aggaggaaaa gaccac
28613285DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 13tgcttgtggg ggtaagcggt aggtgaaata
ttacaaatag tatttttcgg tcattttaac 60ttgctatttc ttgaagaggt tagtacaata
tgaatcgtgg ccctatcagt gatagagata 120ggcgccctat cagtgataga
gatattcttc agcaagacta ctacctcatg agagttatag 180actcatggat
cttgctttga agggttttgt acattatagg ctcctatcac atgctgaacc
240tatggcctat tacatttttt tatatttcaa ggaggaaaag accac
28514287DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 14tgcttgtggg ggtaagcggt aggtgaaata
ttacaaatag tatttttcgg tcattttaac 60ttgctatttc ttgaagaggt tagtacaata
tgaatcgtgg ccctatcagt gatagagatt 120gacatcccta tcagtgatag
agatgattct tcagcaagac tactacctca tgagagttat 180agactcatgg
atcttgcttt gaagggtttt gtacattata ggctcctatc acatgctgaa
240cctatggcct attacatttt tttatatttc aaggaggaaa agaccac
28715287DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 15tgcttgtggg ggtaagcggt aggtgaaata
ttacaaatag tatttttcgg tcattttaac 60ttgctatttc ttgaagaggt tagtacaata
tgaatcgtgg tccctatcag tgatagagat 120tgacatccct atcagtgata
gagatattct tcagcaagac tactacctca tgagagttat 180agactcatgg
atcttgcttt gaagggtttt gtacattata ggctcctatc acatgctgaa
240cctatggcct attacatttt tttatatttc aaggaggaaa agaccac
287164PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 16Gly Gly Gly Ser1175PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 17Glu
Ala Ala Ala Lys1 5185PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 18Pro Ala Pro Ala Pro1
51944DNAEscherichia coli 19ataaaacgaa aggctcagtc gaaagactgg
gcctttcgtt ttat 442028DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 20aaatattaca
aatagtattt ttcggtca 282118DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 21tctctaacac tgttaggg
182218DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 22tctgtatcac tgatacgg 182326DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 23atcttgcttt gaagggtttt gtacat 2624287DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
24tgcttgtggg ggtaagcggt aggtgaaata ttacaaatag tatttttcgg tcattttaac
60ttgctaccct atcagtgata gagtacaata ccctatgagt gatagagaag gacgtgcttc
120aggcgtgttg cctgtacgca tgctgattct tcagcaagac tactacctca
tgagagttat 180agactcatgg atcttgcttt gaagggtttt gtacattata
ggctcctatc acatgctgaa 240cctatggcct attacatttt tttatatttc
aaggaggaaa agaccac 28725287DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 25tgcttgtggg
ggtaagcggt aggtgaaata ttacaaatag tatttttcgg tcattttaac 60ttgctatttc
ttgaagaggt tagtacaata tgaatcgtgg ccctatcagt gatagagatc
120aggcgcccta tcagtgatag agatgattct tcagcaagac tactacctca
tgagagttat 180agactcatgg atcttgcttt gaagggtttt gtacattata
ggctcctatc acatgctgaa 240cctatggcct attacatttt tttatatttc
aaggaggaaa agaccac 28726265DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 26ccctatcagt
gatagagata tttttcggtc attttaactt gctatttctt gaagaggtta 60gtacaatatg
aatcgtggta agtaatagga cgtgcttcag gcgtgttgcc tgtacgcatg
120ctgattcttc agcaagacta ctacctcatg agagttatag actcatggat
cttgctttga 180agggttttgt acattatagg ctcctatcac atgctgaacc
tatggcctac cctatcagtg 240atagagacaa ggaggaaaag accac
26527262DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 27tgcttgtggg ggtaagcggt aggtgaaata
ttacaaatag tatttttcgg tcattttaac 60ttgctatttc ttgaagaggt tagtacaata
tgaatcgtgg taaccctatc agtgatagag 120attcttcacc ctatcagtga
tagagagaga gttatagact catggatctt gctttgaagg 180gttttgttct
ctatcactga tagggacatg cttctctatc actgataggg atttttttat
240atttcaagga ggaaaagacc ac 262
* * * * *