U.S. patent application number 16/562891 was filed with the patent office on 2020-04-02 for delivery methods and compositions for nuclease-mediated genome engineering.
The applicant listed for this patent is Sangamo Therapeutics, Inc.. Invention is credited to GARY K. LEE, Brigit E. Riley, Susan J. St. Martin, Thomas Wechsler.
Application Number | 20200102577 16/562891 |
Document ID | / |
Family ID | 1000004509347 |
Filed Date | 2020-04-02 |
View All Diagrams
United States Patent
Application |
20200102577 |
Kind Code |
A1 |
LEE; GARY K. ; et
al. |
April 2, 2020 |
DELIVERY METHODS AND COMPOSITIONS FOR NUCLEASE-MEDIATED GENOME
ENGINEERING
Abstract
The present disclosure is in the field of genome engineering,
particularly targeted modification of the genome of a cell.
Inventors: |
LEE; GARY K.; (Richmond,
CA) ; Riley; Brigit E.; (Richmond, CA) ; St.
Martin; Susan J.; (Richmond, CA) ; Wechsler;
Thomas; (Richmond, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Sangamo Therapeutics, Inc. |
Richmond |
CA |
US |
|
|
Family ID: |
1000004509347 |
Appl. No.: |
16/562891 |
Filed: |
September 6, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15208997 |
Jul 13, 2016 |
10450585 |
|
|
16562891 |
|
|
|
|
62191918 |
Jul 13, 2015 |
|
|
|
62247469 |
Oct 28, 2015 |
|
|
|
62315438 |
Mar 30, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/86 20130101;
C12N 2510/00 20130101; C12Y 304/21022 20130101; A61K 38/4846
20130101; C12N 2501/515 20130101; C12N 2750/14143 20130101; C12N
5/0636 20130101; A61K 38/37 20130101 |
International
Class: |
C12N 15/86 20060101
C12N015/86; C12N 5/0783 20060101 C12N005/0783; A61K 38/48 20060101
A61K038/48; A61K 38/37 20060101 A61K038/37 |
Claims
1.-11. (canceled)
12. A method of introducing a nucleic acid into a cell of a
subject, the method comprising: administering to the subject at
least one adeno-associated vector (AAV) comprising a donor molecule
and at least one steroid and/or at least one B-cell inhibitor.
13. The method of claim 12, wherein the donor molecule comprising a
sequence encoding a transgene.
14. The method of claim 12, wherein the subject is a mammal and the
transgene encodes a therapeutic protein, and further wherein the
mammal becomes tolerized to the therapeutic protein.
15. The method of claim 12, wherein the subject has a hemophilia
and the donor molecule encodes a clotting factor.
16. The method of claim 15, wherein the clotting factor is Factor
VIII or Factor IX.
17.-18. (canceled)
19. The method of claim 12, wherein the administering comprises
administering at least one steroid.
20. The method of claim 19, wherein the steroid is
methylprednisolone or prednisolone.
21. The method of claim 12, wherein the administering comprises
administering at least one B-cell inhibitor.
22. The method of claim 21, wherein the B-cell inhibitor is
rituximab.
23. The method of claim 12, wherein the at least one steroid and/or
at least one B-cell inhibitor is administered after the donor
molecule.
24. The method of claim 12, wherein the at least one steroid and/or
at least one B-cell inhibitor is administered simultaneously with
the donor molecule.
25. The method of claim 12, wherein the at least one steroid and/or
at least one B-cell inhibitor is administered before the donor
molecule.
26. The method of claim 12, wherein the at least one steroid and
the at least one B-cell inhibitor is administered.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims the benefit of U.S.
Provisional Application No. 62/191,918, filed Jul. 13, 2015; U.S.
Provisional Patent Application No. 62/247,469, filed Oct. 28, 2015;
and U.S. Provisional Patent Application No. 62/315,438, filed Mar.
30, 2016, the disclosures of which are hereby incorporated by
reference in their entireties.
TECHNICAL FIELD
[0002] The present disclosure is in the field of genome
engineering, particularly targeted modification of the genome of a
cell.
BACKGROUND
[0003] Various methods and compositions for targeted cleavage of
genomic DNA have been described. Such targeted cleavage events can
be used, for example, to induce targeted mutagenesis, induce
targeted deletions of cellular DNA sequences, and facilitate
targeted recombination at a predetermined chromosomal locus. See,
e.g., U.S. Pat. Nos. ,255,250; 9,200,266; 9,045,763; 9,005,973;
9,150,847; 8,956,828; 8,945,868; 8,703,489; 8,586,526; 6,534,261;
6,599,692; 6,503,717; 6,689,558; 7,067,317; 7,262,054; 7,888,121;
7,972,854; 7,914,796; 7,951,925; 8,110,379; 8,409,861; U.S. Patent
Publications 20030232410; 20050208489; 20050026157; 20050064474;
20060063231; 20080159996; 201000218264; 20120017290; 20110265198;
20130137104; 20130122591; 20130177983; 20130196373; 20140120622;
20150056705; 20150335708; 20160030477 and 20160024474, the
disclosures of which are incorporated by reference in their
entireties for all purposes.
[0004] These methods often involve the use of engineered cleavage
systems to induce a double strand break (DSB) or a nick in a target
DNA sequence such that repair of the break by an error born process
such as non-homologous end joining (NHEJ) or repair using a repair
template (homology directed repair or HDR) can result in the knock
out of a gene or the insertion of a sequence of interest (targeted
integration). Cleavage can occur through the use of specific
nucleases such as engineered zinc finger nucleases (ZFN),
transcription-activator like effector nucleases (TALENs), using the
CRISPR/Cas system (including Cas and/or Cfp1) with an engineered
crRNA/tracr RNA (`single guide RNA`) to guide specific cleavage
and/or using nucleases based on the Argonaute system (e.g., from T.
thermophilus, known as `TtAgo`, (Swarts et al (2014) Nature
507(7491): 258-261).
[0005] Targeted cleavage using one of the above mentioned nuclease
systems can be exploited to insert a nucleic acid into a specific
target location using either HDR or NHEJ-mediated processes.
However, delivering both the nuclease system and the donor to the
cell can be problematic. For example, delivery of a donor or a
nuclease via transduction of a plasmid into the cell can be toxic
to the recipient cell, especially to a cell which is a primary cell
and so not as robust as a cell from a cell line.
[0006] One method often utilized for delivery of nucleic acids to
cells involves the use of viral nucleic acid delivery vectors. In
particular, the adeno associated virus (AAV) is widely used to
deliver nucleic acid because of its efficiency and relative
non-toxicity. The AAV genome can be nearly depleted of viral
nucleic acid and replaced with nucleic acids encoding donor
transgenes or engineered nucleases to facilitate integration of the
transgene into a recipient cell's DNA.
[0007] AAV transduction of mammalian cells depends on both primary
and secondary co-receptors on the target cells. While the primary
receptor is important for initial adhesion of the virus to the
target cell (and its tropism), the secondary receptor mediates
endocytosis of the AAV virus into the cell. For example, for
serotype AAV6 the primary receptor has been identified as alpha 2,3
N-linked sialic acid (Wu et al, (2006) J. Virol. 80(18):9093), and
the secondary receptor as EGFR. Furthermore, the use of additional
secondary co-receptors has also been proposed (Weller et al, (2010)
Nat Med 16(6): 662).
[0008] Delivery (transplantation) of cells and/or tissues in vivo
can often be hampered by antibody-mediated responses. For example,
some kidney transplant patients are prone to acute rejection
mediated by the development of host antibodies against the
transplant tissue. Accordingly, physicians routinely use steroid
therapy to suppress the antibody response following transplantation
(see for example Ku et al (1973) Br. Med J 4:702) and also can use
rituximab (anti-CD20 antibody) for B cell suppression (for example
Becker et al (2004) Am J Transpl 4:996). Antibody-mediated
responses are also challenges facing the use of AAV delivery due to
prevalence of background anti-AAV antibodies in the human
population and the de novo development of these antibodies
following dosing with a AAV mediated delivery system (see Kotterman
et al (2015) Gene Ther 22(2):116-126).
[0009] In the body, there are complex mechanisms that can regulate
either the activation or the suppression of the cellular members of
the immune system. For example, dendritic cells (DCs) have been
established as central players in the balance between immune
activation versus immune tolerance. They are the most potent
antigen presenting cells in the immune system and specifically
capture and present antigens to naive T cells. Immature DCs
interact with potential antigens through specific receptors such as
Toll-like receptors where the antigen is brought into the cell by
micropinocytosis. The antigen is then broken up into smaller
peptides that are presented to T cells by the major
histocompatibility complexes. In addition, mature DCs secrete
inflammatory mediators such as IL-10, IL-12, IL-6 and TNF which
further serve to activate the T cells. On the other side, DCs also
play a role in tolerizing the body to some antigens in order to
maintain central and peripheral tolerance. Tolerogenic DCs (tolDC)
have low amounts of co-stimulatory signals on the cell surfaces and
have a reduced expression of the inflammatory mediators described
above. However, these tolDCs express large amounts of
anti-inflammatory cytokines like IL-10 and when these cells
interact with naive T cells, the T cells are driven to become
anergic/regulatory T cells (CD8+ Tregs). In fact, it has been shown
that this process is enhanced upon repeated stimulation of T cells
with these immature/tolerogenic DCs. Several factors have also been
identified that work in concert with tolDCs to induce different
types of Tregs. For example, naive T cells co-exposed with tolDCs
and HGF, VIP peptide, TSLP or Vitamin D3 leads to the induction of
CD4+CD25+Foxp3+ Tregs, co-exposure with TGF-.beta. or IL-10 leads
to Tr1 T regs and co-exposure with corticosteroids, rapamycin,
retinoic acid can lead to CD4+/CD8+ Tregs (Raker et al (2015) Front
Immunol 6: art 569 and Osorio et al (2015) Front Immunol 6: art
535).
[0010] CD34+ stem or progenitor cells are a heterogeneous set of
cells characterized by their ability to self-renew and/or
differentiate into the cells of the lymphoid lineage (e.g. T cells,
B cells, NK cells) and myeloid lineage (e.g. monocytes,
erythrocytes, eosinophiles, basophiles, and neutrophils). Their
heterogeneous nature arises from the fact that within the CD34+
stem cell population, there are multiple subgroups which often
reflect the multipotency (whether lineage committed) of a specific
group. For example, CD34+ cells that are CD38- are more primitive,
immature CD34+ progenitor cell, (also referred to as long term
hematopoietic progenitors), while those that are CD34+CD38+ (short
term hematopoietic progenitors) are lineage committed (see Stella
et al (1995) Hematologica 80:367-387). When this population then
progresses further down the differentiation pathway, the CD34
marker is lost. CD34+ stem cells have enormous potential in
clinical cell therapy. However, in part due to their heterogeneous
nature, performing genetic manipulations such as gene knock out,
transgene insertion and the like upon the cells can be difficult.
Specifically, these cells are poorly transduced by conventional
delivery vectors, the most primitive stem cells are sensitive to
modification, there is limited HDR following induced DNA DSBs, and
there is insufficient HSC maintenance in prolonged standard culture
conditions. Additionally, other cells of interest (for non-limiting
example only, cardiomyocytes, medium spiny neurons, primary
hepatocytes, embryonic stem cells, induced pluripotent stem cells
and muscle cells) can be less successfully transduced for genome
editing than others.
[0011] Thus, there remains a need for additional compositions and
methods for genome engineering to deliver nucleic acids efficiently
to CD34+ cells and other cells of interest using viral vectors.
SUMMARY
[0012] The present invention describes compositions and methods for
use in gene therapy and genome engineering. Specifically, the
methods and compositions described relate to introducing nucleic
acids into cells such as primary cells including hematopoietic stem
cells/progenitor cells (HSC/PC) and T cells. In addition, the
methods and compositions of the invention are useful for delivery
of AAV particles (vectors) comprising donor DNAs of interest to
such cells.
[0013] In some aspects, the invention comprises delivery of at
least one nuclease to a cell (e.g., an HSC/PC or other
hematopoietic lineage cells such as T cell, B cell, or NK cell) for
the purpose of genome engineering. In some embodiments, the
nuclease is delivered as a peptide, while in others it is delivered
as a nucleic acid encoding the nuclease. In some embodiments, more
than one nuclease is used. In some preferred embodiments, the
nucleic acid encoding the nuclease is an mRNA, and in some
instances, the mRNA is protected. The nuclease may comprise a zinc
finger nuclease (ZFN), a TALE-nuclease (TALEN) or a CRISPR/Cas (Cas
and/or Cfp1) or TtAgo nuclease system or a combination thereof. In
a preferred embodiment, the nucleic acid encoding the nuclease(s)
is delivered via electroporation.
[0014] In another aspect, described herein is a method of
introducing a nucleic acid into an isolated cell (e.g., a
hematopoietic stem cell, a T-cell, a B-cell or an NK cell), the
method comprising: administering to the cell at least one
adeno-associated vector comprising a donor molecule (e.g., a
transgene that is expressed in the cell) in the presence of at
least one inhibitor of growth factor receptor binding. In certain
embodiments, the growth factor inhibitor inhibits binding to an
epidermal growth factor receptor (EGFR), a fibroblast growth factor
receptor (FGFR), a Met/hepatocyte growth factor receptor (HGFR), a
lipoarabinomannan receptor (LamR), a .alpha.V.beta.5 integrin
receptor, an Intercellular Adhesion Molecule 1 receptor (Icam-1)
and/or a Platelet-derived growth factor receptor. The transgene may
be episomal or may be integrated into the genome of the cell. In
any of the methods described herein, the transgene may encode a
chimeric antigen receptor (CAR). In addition, any of the methods as
described herein may further comprise introducing at least one
nuclease into the cell, wherein the transgene is integrated into
one or more genes of the cell following cleavage of the one or more
genes by the nuclease. Additional nucleases may be used for
inactivation (knockout) of additional genes, with or without
targeted integration. In certain embodiments, the nuclease cleaves
a programmed cell death 1 (PD1) gene, a Cytotoxic T-Lymphocyte
Antigen 4 (CTLA-4) gene, a beta 2-microglobulin (B2M) and/or a
T-cell receptor alpha (TRAC) gene. In certain embodiments, the cell
comprises at least one gene with an integrated transgene and which
gene is inactivated (KO) and at least one second (different) gene
in which is also inactivated (KO). The at least one second gene may
be inactivated with or without integration of a transgene.
[0015] Thus, the invention provides methods and compositions for
introducing a nucleic acid into a cell, including methods and
composition for increasing the efficiency of delivery of a nucleic
acid to a cell. In certain embodiments, at least 50% to 60% (or any
value therebetween), more preferably at least 60 to 70% (or any
value therebetween), even more preferably at least 70% to 80% (or
any value therebetween) or even more preferably greater than 80%
(any value between 80-100%) of the cells are modified by
introduction of the nucleic acid thereinto (e.g., into the genome
of cell). In some embodiments, the delivery encompasses use of a
viral vector. In preferred embodiments, the vector is an AAV
vector. In some aspects, increased efficiency of viral vector
delivery is accomplished through selectively inhibiting the ability
of one or more viral receptors on a cell to bind to the viral
vector (e.g., AAV), thereby increasing delivery of the nucleic acid
carried by the viral vector to the cell through one or more
alternate receptors. In some embodiments, binding of the viral
vector (e.g., AAV) to an epidermal growth factor receptor (EGFR) is
blocked or inhibited, while in other embodiments, binding to a
fibroblast growth factor receptor (FGFR) is blocked or inhibited.
In other embodiments, receptors that may be blocked or inhibited
from binding to the viral vector (e.g., AAV) include, but are not
limited to, a Met/hepatocyte growth factor receptor (HGFR), a
lipoarabinomannan receptor (LamR), a .alpha.V.beta.5 integrin
receptor, a Intercellular Adhesion Molecule 1 receptor (Icam-1)
and/or a Platelet-derived growth factor receptor (PDGFR, including
PDGFR beta and PDGFR alpha). In preferred embodiments, inhibition
of a receptor increases the efficiency of viral delivery by 2, 3,
4, 5, 6, 7, 8, 9, or 10 fold. The inhibitors may be given prior
(e.g. 4-5 days, 2-3 days, 1 day, 12-24 hours, 6-11 hours, 1-5 hours
or less than 1 hour (or any time therebetween)) to treatment of the
cell with the AAV. The inhibitors may also be given simultaneously
when the viral vector (e.g., AAV) is delivered to the cell and/or
after the viral vector (e.g., AAV) is delivered to cell (any time
up to one day or even longer). In some embodiments, the
inhibitor(s) used is/are gefitinib, BGJ398, SU11274, CP-673451,
and/or Crenolanib for inhibition of EGFR, FGFR, HGFR, and/or PDGFR.
The PDGFR inhibitors CP-673451 (also referred to as PDGFR1) and
Crenolanib (also referred to as PDGFR2), inhibit both PDGFR alpha
and beta, albeit with different affinities. In any of the methods
described herein, the viral vector may carry a nucleic acid
encoding one or more nucleases and/or one or more donors (e.g.,
sequences encoding therapeutic proteins).
[0016] In one aspect, a viral vector is used to deliver a transgene
such that the transgene does not integrate into the genome. In some
embodiments, the transgene comprises an inducible promoter. In
other embodiments, the transgene comprises a constitutive promoter.
In still further embodiments, the viral vector is an AAV or a
lentiviral vector. The viral vector may be delivered before, during
or after delivery of one or more molecules that inhibit binding of
the viral vector to one or more cell surface receptors.
[0017] In one aspect, provided herein is a method of integrating
one or more transgenes into a genome of an isolated cell, the
method comprising sequentially or concurrently introducing the
transgene and at least one nuclease into the cell such that the
nuclease mediates targeted integration of the transgene. The
methods comprise administering to the cell at least one
adeno-associated vector comprising a donor molecule in the presence
of at least one inhibitor of growth factor receptor binding or a
B-cell inhibitor and further comprise introducing at least one
nuclease into the cell, wherein the transgene (e.g., chimeric
antigen receptor) is integrated into the genome following cleavage
by the nuclease (e.g., cleavage of PD1, CTLA-4 and/or TRAC by a
targeted nuclease). Thus, in certain aspects, a method of
integrating one or more transgenes into a genome of an isolated
cell, the method comprising: introducing, into the cell, (a) a
donor vector comprising the one or more transgenes (e.g., encoding
chimeric antigen receptors (CARs) and/or engineered TCR) and (b) at
least one nuclease, wherein the at least one nuclease cleaves the
genome of the cell such that the one or more transgenes are
integrated into the genome of the cell, and further wherein (i) if
the donor vector is introduced into the cell before the at least
one nuclease, the at least one nuclease is introduced into the cell
within 48 hours after donor vector is introduced and; (ii) if the
at least one nuclease is introduced before the donor vector, the
donor vector is introduced into the cell within 4 hours after the
at least one nuclease is introduced. In certain embodiments, the
methods can comprise (a) introducing a donor vector comprising the
one or more transgenes into the cell; (b) culturing the cell for
less than 48 hours (e.g., seconds to 48 hours or any time
therebetween); and (c) introducing at least one nuclease into the
cell, wherein the at least one nuclease cleaves the genome of the
cell such that the one or more transgenes are integrated into the
genome of the cell. Alternatively, the methods can comprise: (a)
introducing at least one nuclease into the cell; (b) culturing the
cell for less than 24 hours (e.g., seconds to 24 hours or any time
therebetween); and (c) introducing a donor vector comprising the
one or more transgenes into the cell, wherein the at least one
nuclease cleaves the genome of the cell such that the one or more
transgenes are integrated into the genome of the cell. The method
steps may be repeated for integration of additional transgenes into
the same and/or different loci. In certain embodiments, the cell is
cultured (step (b)) for less than 24 hours (e.g., seconds to 24
hours or any time therebetween). In still further embodiments, the
cell is cultured for less than 4 hours, for example, when the
nuclease(s) is introduced before introduction of the donor vector.
Any of these methods may further comprise the step of administering
a molecule that inhibits binding of a viral vector (e.g., carrying
the nuclease(s) and/or the donor vector) to a cell receptor prior
to, simultaneously and/or after the step of introducing the
nucleases and/or donor vector to the cell.
[0018] Any cell can be used, for example, a hematopoietic stem cell
(e.g., CD34+ cell) or T-cell (e.g., CD4+ or CD8+ cell (including
Treg cells)), or B-cell or NK cell. In some embodiments, the T cell
is a tumor infiltrating T-lymphocyte (TIL). The donor vector may be
introduced as a viral or non-viral vector, for example an AAV
vector (e.g., AAV6 or AAV6 chimeric vector such as AAV2/6, etc.).
The nuclease (e.g., ZFN, TALEN, TtAgo and/or CRISPR/Cas) may also
be introduced using viral or non-viral vectors, for example in mRNA
form. In certain embodiments, the nuclease targets a safe-harbor
gene (e.g., a CCR5 gene, an AAVS1 gene, a Rosa gene, an albumin
gene, etc.). The transgene may encode a protein, for example a
therapeutic protein that is lacking or deficient in a subject with
a disorder (e.g., lysosomal storage disease, hemoglobinopathy,
hemophilia, etc.). In certain embodiments, a method of providing
one or more proteins to a subject in need thereof is described, the
method comprising: introducing one or more transgenes encoding the
one or more proteins into an isolated cell according to any of the
methods described herein and introducing the cell into the subject
such that the one or more proteins are provided to the subject.
[0019] In other aspects, the invention comprises delivery of a
donor nucleic acid to a target cell. The donor may be delivered
prior to, after, or along with the nucleic acid encoding the
nuclease(s) and/or optional viral receptor inhibitor. In certain
embodiments, the donor is delivered simultaneously with the
nuclease(s) and/or optional viral receptor inhibitor. In other
embodiments, the donor is delivered prior to the nuclease(s),
including any time before, for example, immediately before, 1 to 60
minutes before (or any time therebetween), 1 to 24 hours before (or
any time therebetween), 1 to 48 hours (or any time therebetween) or
more than 48 hours before. In certain embodiments, the donor is
delivered after the nuclease, preferably within 4 hours. In certain
embodiments, provided herein is a method of introducing a nucleic
acid into a cell, the method comprising: administering a donor
molecule comprising the nucleic acid into the cell; administering a
nuclease to the cell, wherein the nuclease is administered 1 to 48
hours after or within 4 hours before the donor molecule and further
wherein the donor molecule is integrated into the genome of the
cell following cleavage by the nuclease. In other embodiments, a
method of introducing one or more transgenes into a genome of a
cell, the method comprising: introducing at least one nuclease into
the cell, wherein the at least one nuclease cleaves the genome of
the cell such that the one or more transgenes are integrated into
the genome of the cell, and further wherein (i) if the donor vector
is introduced into the cell before the at least one nuclease, the
at least one nuclease is introduced into the cell within 48 hours
after donor vector is introduced and; (ii) if the at least one
nuclease is introduced before the donor vector, the donor vector is
introduced into the cell within 4 hours after the at least one
nuclease is introduced. The donor nucleic acid comprises an
exogenous sequence (transgene) to be integrated into the genome of
the cell, for example, an endogenous locus. The transgene is
preferably integrated at or near (e.g., within 1-50 base pairs) of
the site of cleavage by the nuclease(s). In some embodiments, the
donor comprises a full length gene or fragment thereof flanked by
regions of homology with the targeted cleavage site. In some
embodiments, the donor lacks homologous regions and is integrated
into a target locus through homology independent mechanism (i.e.
NHEJ). In other embodiments, the donor comprises an smaller piece
of nucleic acid flanked by homologous regions for use in the cell
(i.e. for gene correction). In some embodiments, the donor
comprises a gene encoding a functional or structural component such
as a shRNA, RNAi, miRNA or the like. In other embodiments the donor
comprises a gene encoding a regulatory element that binds to and/or
modulates expression of a gene of interest.
[0020] In other aspects, the donor is delivered by viral and/or
non-viral gene transfer methods. In preferred embodiments, the
donor is delivered to the cell via an adeno associated virus (AAV).
Any AAV vector can be used, including, but not limited to, AAV1,
AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 and combinations thereof.
In some instances, the AAV comprises LTRs that are of a
heterologous serotype in comparison with the capsid serotype (e.g.,
AAV2 ITRs with AAV5, AAV6, or AAV8 capsids). The donor may be
delivered using the same gene transfer system as used to deliver
the nuclease (including on the same vector) or may be delivered
using a different delivery system that is used for the nuclease. In
certain embodiments, the donor is delivered using a viral vector
(e.g., AAV) and the nuclease(s) is(are) delivered in mRNA form. The
cell may also be treated with one or more molecules that inhibit
binding of the viral vector to a cell surface receptor as described
herein prior to, simultaneously and/or after delivery of the viral
vector (e.g., carrying the nuclease(s) and/or donor).
[0021] The sequence of interest of the donor molecule may comprise
one or more sequences encoding a functional polypeptide (e.g., a
cDNA), with or without a promoter. In some instances, the donor
comprises a promoter for expression only in a specific cell type
(e.g., a T cell or B cell or NK cell specific promoter). In certain
embodiments, the nucleic acid sequence comprises a sequence
encoding an antibody, an antigen, an enzyme, a growth factor, a
receptor (cell surface or nuclear), a hormone, a lymphokine, a
cytokine, a reporter, functional fragments of any of the above and
combinations of the above. The nucleic acid sequences may also
encode one or more proteins that are lacking and/or aberrantly
expressed in a subject with a disease or a disorder, including by
way of example only a lysosomal storage disease or a hemophilia.
The nucleic acid sequences may also encode a one or more proteins
useful in cancer therapies, for example one or more chimeric
antigen receptors (CARs) and/or an engineered T cell receptor
(TCR). In embodiments in which the functional polypeptide encoding
sequences are promoterless, expression of the integrated sequence
is then ensured by transcription driven by an endogenous promoter
or other control element in the region of interest. In other
embodiments, a "tandem" cassette is integrated into the selected
site in this manner, the first component of the cassette comprising
a promoterless sequence as described above, followed by a
transcription termination sequence, and a second sequence, encoding
an autonomous expression cassette. Additional sequences (coding or
non-coding sequences) may be included in the donor molecule between
the homology arms, including but not limited to, sequences encoding
a 2A peptide, SA site, IRES, etc.
[0022] In another aspect, described herein are methods of
integrating a donor nucleic acid into the genome of a cell via
homology-independent mechanisms. The methods comprise creating a
double-stranded break (DSB) in the genome of a cell and cleaving
the donor molecule using a nuclease, such that the donor nucleic
acid is integrated at the site of the DSB. In certain embodiments,
the donor nucleic acid is integrated via non-homology dependent
methods (e.g., NHEJ). As noted above, upon in vivo cleavage the
donor sequences can be integrated in a targeted manner into the
genome of a cell at the location of a DSB. The donor sequence can
include one or more of the same target sites for one or more of the
nucleases used to create the DSB. Thus, the donor sequence may be
cleaved by one or more of the same nucleases used to cleave the
endogenous gene into which integration is desired. In certain
embodiments, the donor sequence includes different nuclease target
sites from the nucleases used to induce the DSB. DSBs in the genome
of the target cell may be created by any mechanism. In certain
embodiments, the DSB is created by one or more zinc-finger
nucleases (ZFNs), fusion proteins comprising a zinc finger binding
domain, which is engineered to bind a sequence within the region of
interest, and a cleavage domain or a cleavage half-domain. In other
embodiments, the DSB is created by one or more TALE DNA-binding
domains (naturally occurring or non-naturally occurring) fused to a
nuclease domain (TALEN). In yet further embodiments, the DSB is
created using a CRISPR/Cas (Cas and/or Cfp1) or TtAgo nuclease
system where an engineered single guide RNA or its functional
equivalent is used as needed to guide the nuclease to a targeted
site in a genome.
[0023] In other aspects, the nuclease(s) binds to and/or cleaves a
safe-harbor gene, for example a CCR5 gene, a PPP1R12C (also known
as AAVS1) gene, a Rosa gene or an albumin gene in mammalian cells.
In addition, to aid in selection in mammalian systems, the HPRT
locus may be used.
[0024] In some aspects, the nuclease(s) binds to and/or cleaves a
check point inhibitor gene, for example PD-1, CTLA4, receptors for
the B7 family of inhibitory ligands, or cleaves a receptor or
ligand gene involved in signaling through LAG3, 2B4, BTLA, TIM3,
A2aR, and killer inhibitor receptors (KIRs and C-type lectin
receptors), see Pardoll (2012) Nat Rev Cancer 12(4):252.
[0025] In other aspects, the nuclease(s) binds to and/or cleaves a
gene that encodes a factor involved in rejection, for example,
genes encoding subunits of the HLA complex (class I: HLA-A, HLA-B,
HLA-C, HLA-E, HLA-F, HLA-G, beta-2 microglobulin (B2M); class II:
HLA-DMA, HLA-DOA, HLA-DPA1, HLA-DQA, HLA-DRA, HLA-DMB, HLA-DOB,
HLA-DPB1, HLA-DQB, HLA-DRB) or TCR. In some embodiments, the
nuclease(s) target a gene encoding a product involved in the
peptide loading process and antigen processing for the HLA
complexes (e.g. TAP, tapasin, calreticulin, calnexin, LMP2, LMP7 or
Erp57).
[0026] In one aspect, the donor is a regulatory protein of interest
(e.g. ZFP TFs, TALE TFs or a CRISPR/Cas TF) that binds to and/or
modulates expression of a gene of interest. In one embodiment, the
regulatory proteins bind to a DNA sequence and prevent binding of
other regulatory factors. In another embodiment, the binding of a
the regulatory protein may modulate (i.e. induce or repress)
expression of a target DNA.
[0027] In other aspects, the donor encodes a protein capable of
redirecting a T cell. In some embodiments, the protein is an
engineered antigen receptor. In further embodiments, the engineered
receptor is a chimeric antigen receptor (CAR) or a T cell receptor
(TCR), where the TCR in some embodiments is an affinity enhanced
engineered TCR or a naturally occurring TCR. In other aspects, the
engineered protein is an antibody coupled T-cell receptor
(ACTR).
[0028] In other aspects, provided herein is a cell which has been
genetically modified (e.g., transgenic) as described herein, for
example using a nuclease to introduce the genetic modification. One
or more genes of the cell may be modified, for example via targeted
integration into one or more genes and/or partial or full
inactivation (KO) of one or more genes, including genetic
modifications involving targeted integration (with or without
inactivation of the target gene) of one or more genes and KO (with
or without targeted integration of one or more genes (e.g.,
targeted integration and inactivation (KO) of one gene and KO of a
second, different gene). In certain embodiments, the cell is made
by the methods described herein. In certain embodiments, the cell
comprises a transgene that is integrated into a safe-harbor locus,
such as CCR5, AAVS1, ALB, Rosa26 and/or HPRT. The genetic
modification to the cell (e.g., integration of nucleic acid) may be
for example within, at or near a site comprising 12 or more (e.g.,
12-35 or any value therebetween) contiguous nucleotides of the
target site in the gene to which the DNA-binding molecule of a
nuclease binds. The cells comprising the integrated transgene may
express the transgene from an endogenous promoter or,
alternatively, the transgene may include regulatory and control
elements such as exogenous promoters that drive expression of the
transgene (e.g., when integrated into a safe harbor locus). In
certain embodiments, the cells comprising the transgene do not
include any viral vector sequences integrated into the genome. The
cells may be any eukaryotic cell, for example CD34+ stem cells
(e.g., patient-derived stem cells mobilized in patients from the
bone marrow into the peripheral blood via granulocyte
colony-stimulating factor (GCSF) or other mobilizing agent
administration or harvested directly from the bone marrow or
umbilical cords). The cells can be harvested, purified, cultured,
and the nucleases and/or donor introduced into the cell by any
suitable method.
[0029] Compositions such as pharmaceutical compositions comprising
the genetically modified cells as described herein are also
provided. In some embodiments, the compositions comprise CD34+
HSC/PC or HSC/PC cell population. In other embodiments, the
compositions comprise T cells (e.g. CD4+ and/or CD8+ T cells or
TILs). In still further embodiments, the T cell compositions
comprise only CD4+ or only CD8+ cells.
[0030] In another aspect, provided are methods of using the
genetically modified cells as described herein. In certain
embodiments, genetically modified blood cell precursors ("HSC/PC")
are given in a bone marrow transplant and the HSC/PC differentiate
and mature in vivo. In some embodiments, the HSC/PC are isolated
following G-CSF-induced mobilization, and in others, the cells are
isolated from human bone marrow or umbilical cords. In some
aspects, the HSC/PC are edited by treatment with a nuclease
designed to knock out a specific gene or regulatory sequence. In
other aspects, the HSC/PC are modified with an engineered nuclease
and a donor nucleic acid such that a wild type gene or other gene
of interest is inserted and expressed and/or an endogenous aberrant
gene is corrected. In some embodiments, the modified HSCs/PC are
administered to the patient following mild myeloablative
pre-conditioning. In other aspects, the HSC/PC are administered
after full myeloablation such that following engraftment, 100% of
the hematopoietic cells are derived from the modified HSC/PC.
[0031] The methods and compositions of the invention may also
include additional treatment of the subject (e.g., animal) to
increase in vivo delivery efficiency of viral vectors (e.g., AAV)
to cells in target tissues. In some embodiments, treatments are
provided before, during and/or after delivery of AAV. In some
embodiments, treatments include the provision of steroids to the
subject to inhibit the humoral antibody response. Non-limiting
examples of suitable steroids include methylprednisolone (e.g.
Medrol.RTM., Solu Medrol.RTM.) and prednisolone. In other
embodiments, treatments include use of inhibitors of the humoral
response including B-cell inhibitors such as rituximab (e.g.
Rituxan.RTM.). In still further embodiments, treatment methods
combine regiments to increase delivery efficiency such as treating
the animal with at least steroids and B-cell inhibitors. These
treatment regiments can be used before, during or after treatment
of the animal with AAV.
[0032] In some embodiments, the method and compositions of the
invention as described herein can be used to induce tolerance in a
mammal to a therapeutic protein such that the levels of the
therapeutic protein encoded by the transgene remain at
therapeutically relevant levels following a transient rise in
anti-therapeutic protein antibodies. Thus, provided herein is a
method of inducing tolerance to a therapeutic protein in a subject,
the method comprising genetically modifying a cell in a subject
using the method as described herein (e.g., so that the cell
produces the therapeutic protein), optionally with treatment of the
subject with additional compositions (e.g., steroids and/or B-cell
inhibitors) such that the animal becomes tolerized to the
therapeutic protein. In some embodiments, insertion of the
therapeutic protein into the recipient cells is done at the same
time as treatment with an immune-inhibitory steroid or B-cell
inhibitor, whereas in other instances, no immunomodulatory is used.
In some instances, the immunomodulatory agent is administered only
if anti-therapeutic protein antibodies are generated. In further
instances, the immunomodulatory agent is discontinued after a
period of time. Thus, a method of introducing a nucleic acid into a
cell of a subject (e.g., a subject with a disorder such as a
hemophilia) is provided, the method comprising: administering to
the subject at least one adeno-associated vector (AAV) comprising a
donor molecule (e.g., transgene encoding a therapeutic protein such
as a clotting factor, optionally Factor VIII and/or Factor IX) and
at least one steroid and/or at least one B-cell inhibitor. In
certain embodiments, the subject is a mammal and the transgene
encodes a therapeutic protein, and the mammal becomes tolerized to
the therapeutic protein.
[0033] In any of the methods and compositions described herein, the
therapeutic transgene used encodes a clotting factor. In preferred
embodiments, the transgene encodes a FVIII protein or a F.IX
protein. In especially preferred embodiment, the transgene encoding
the FVIII protein encodes a FVIII that is lacking the B-domain
(B-Domain Delete or BDD).
[0034] In other embodiments, provided are methods of using
genetically modified T cells as described herein. In some
instances, autologous T cells (derived from the patient) are used
while in other embodiments, allogenic (derived from a donor) are
used. In some instances, the T cells are isolated from a donor or
patient by apheresis and then are treated ex vivo to achieve the
desired genetic modifications. The modified T cells are then
expanded to achieve greater numbers of cells for infusion into the
patient. In some embodiments, the isolated T cells are expanded
first, and then are modified to achieve the desired genetic
modifications. In some aspects, the T cells are edited by treatment
with a nuclease designed to knock out a specific gene or regulatory
sequence. In other aspects, the T cells are modified with an
engineered nuclease and a donor nucleic acid such that a wild type
gene or other gene of interest is inserted and expressed and/or an
endogenous aberrant gene is corrected. In some embodiments, TILs
are isolated from excised tumor tissues by known methods (for
example only, See, e.g., Ellebaek et al (2012) J. Transl Med
10:169), and in further embodiments, patients may be subjected to
lymphodepletive therapy following excision of the tumor tissue but
prior to infusion of the modified TILs. In still further
embodiments, the T cell is a regulatory T cell (Treg). Furthermore,
the cell may be arrested in the G2 phase of the cell cycle.
[0035] In some aspects, the present invention includes methods and
compositions for treating or preventing a specific disease in a
mammal. In some embodiments, the methods and compositions are used
to treat a cancer, for example follicular lymphoma, neuroblastoma,
non-Hodgkin lymphoma, lymphoma, glioblastoma, chronic lymphocytic
leukemia or CLL and acute lymphocytic leukemia or ALL, ovarian
cancer, prostate, colorectal, renal cell and carcinoma (see, e.g.,
Kershaw et al (2014) Clin Transl Immunol 3, e16,
doi:10.1038/cti.2014.7). In other embodiments, the methods and
compositions are used to treat an infectious disease, for example
HIV, HCV, HBV, (see Sautto et al (2015) Gut 0:1-12), Ebola, CMV,
EBV and adenovirus. In still further aspects, the methods and
compositions of the invention include treatment of autoimmune
disease, for example rheumatoid arthritis, multiple sclerosis,
inflammatory bowel disease, psoriasis, lupus and scleroderma.
[0036] In another aspect, a method of treating a cancer in subject
is provided, the method comprising introducing a nucleic acid into
an isolated cell by any of the methods described, wherein donor
molecule comprises a sequence encoding a CAR such that the cell
expresses the CAR and administering the cell expressing the CAR to
the subject. In certain embodiments, the CAR-encoding sequence is
integrated into a PD1, CTLA-4 and/or TRAC gene following cleavage
of the gene by a nuclease. In certain embodiments, the CAR-encoding
sequence is integrated into a first gene (e.g., a PD1, CTLA-4
and/or TRAC gene) following cleavage of the gene by a nuclease
following cleavage and a second (different) gene (e.g., a PD1,
CTLA-4 and/or TRAC gene) is inactivated by a second nuclease.
[0037] In some embodiments, the transgenic HSC/PC cell or T cell
and/or animal includes a transgene that encodes a human gene. In
some instances, the transgenic animal comprises a knock out at the
endogenous locus corresponding to exogenous transgene, thereby
allowing the development of an in vivo system where the human
protein may be studied in isolation. Such transgenic models may be
used for screening purposes to identify small molecules or large
biomolecules or other entities which may interact with or modify
the human protein of interest. In some aspects, the transgene is
integrated into the selected locus (e.g., safe-harbor) into a stem
cell (e.g., an embryonic stem cell, an induced pluripotent stem
cell, a hematopoietic stem or precursor cell, etc.), T cell (e.g.
CD4+, CD8+(including Treg) or TIL) or animal embryo obtained by any
of the methods described herein, and then the embryo is implanted
such that a live animal is born. The animal is then raised to
sexual maturity and allowed to produce offspring wherein at least
some of the offspring comprise edited endogenous gene sequence or
the integrated transgene.
[0038] A kit, comprising the AAVs and nucleic acids of the
invention, is also provided. The kit may comprise nucleic acids
encoding the nucleases, (e.g. RNA molecules or ZFN, TALEN, TtAgo or
CRISPR/Cas system encoding genes contained in a suitable expression
vector), or aliquots of the nuclease proteins, donor molecules,
suitable stemness modifiers, instructions for performing the
methods of the invention, and the like. The kit may also comprise
donor molecules of interest such as selection or screening
markers.
[0039] These and other aspects will be readily apparent to the
skilled artisan in light of disclosure as a whole.
BRIEF DESCRIPTION OF THE DRAWINGS
[0040] FIG. 1 depicts the design of a T-cell transgene donor
vector. The donor comprises right (R) and left (L) homology arms
which are homologous to the genomic sequence flanking the cleavage
site. The donor also comprises a promoter sequence linked to a
transgene of interest. The transgene encodes an engineered antigen
receptor such as a CAR, TCR or ACTR. A poly A signaling sequence is
also in the donor to achieve efficient expression of the transgene.
Depicted also is the method used to transduce the T cells.
[0041] FIG. 2 is a graph depicting the effect that serum present in
the culture media has on the targeted integration of a donor into a
CD3+ T cell. Integration of the donor is measured by the percent of
integrated RFLP detected at increasing doses of AAV2/6 comprising
the RFLP donor. CCR5-specific ZFNs were delivered via mRNA
electroporation.
[0042] FIG. 3 is a graph depicting nuclease activity in AAV 2/6
transduced cells. Hep3B cells were transduced with an MOI
(multiplicity of infection) of 3e4 vg/cell of AAV2/6 comprising a
pair of human albumin specific ZFNs in the presence of the
indicated inhibitors (that inhibit binding of AAV to a viral
receptor). Three days following transduction, genomic DNA was
isolated from the cells and analyzed for nuclease activity in the
form of small insertions and deletions around the ZFN cleavage site
(% indels). Inhibitors were used in the concentrations shown and
the data shows that inhibitors of PDGFR increase the amount of
activity observed.
[0043] FIG. 4 is a graph depicting nuclease activity of nucleases
delivered via mRNA transduction by Lipofectamine RNAiMAX. The data
demonstrates that unlike the results shown in FIG. 3, where AAV2/6
delivery was used increasing the concentration of PDGFR inhibitors
has no effect on the number of indels detected. Therefore, the
increase in indel frequency observed in the presence of the PDGFR
inhibitors is not due to the inhibitors acting directly on the DNA
break repair pathways.
[0044] FIG. 5 is a graph depicting nuclease activity following
treatment of Hep3B cells with AAV comprising albumin-specific ZFNs
and a combination of PDGFR and EGFR inhibitors where each condition
was done in duplicate. The results demonstrate that there is no
increase in indel formation in the presence of both inhibitor
types.
[0045] FIG. 6 is a graph depicting nuclease activity when the
inhibitors are used in HepG2 cells. The concentration of the
different inhibitors is shown below the data and demonstrates that
at this dose of ZFN-comprising AAV2/6 (MOI of 3e4 vg/cell), PDGFR
inhibitors lead to increased detectable nuclease activity.
[0046] FIG. 7 is a graph depicting nuclease activity in Hep3B cells
in the presence or absence of serum and the indicated viral
receptor inhibitors. Each data set shows the results either plus or
minus serum, where all the inhibitors were examined with the use of
the ZFN-comprising AAV2/6. The bars on the left of each set
correspond to the data measured in the absence of serum while the
bars on the right of each set are the results for those experiments
done with serum. The data demonstrate that in Hep3B the overall
AAV2/6 transduction was down in the presence of serum by about
40-fold. However, in the presence of the PDGFR inhibitors, AAV
transduction was robust with 20% indels detectable.
[0047] FIG. 8 is a graph showing the fold increase in indel
detection in the presence of the PDGFR inhibitors in the presence
or absence of serum. The data is plotted as the fold change in
indel formation detected as compared with ZFN alone for the two
conditions. This data demonstrates that indels detected increased
70 fold in the presence of the PDGFR inhibitors when the experiment
was done in serum as compared to ZFNs alone in serum.
[0048] FIG. 9 is a graph depicting the effect of the PDGFR
inhibitor 2 (Crenolanib) on AAV uptake in primary hepatocytes. The
data demonstrates that 9 .mu.M of the PDGFR inhibitor caused a
large increase in indels detected as compared to no inhibitor.
[0049] FIGS. 10A and 10B show a dosing schematic for non-human
primate studies. FIG. 10A reflects Rituxan.RTM. and
Solu-Medrol.RTM. dosing post-test article administration. FIG. 10B
reflects Rituxan.RTM. and Solu-Medrol.RTM. dosing pre-test article
administration.
[0050] FIGS. 11A through 11D are graphs depicting peak human F.IX
levels by total AAV-F.IX dose following treatment of NHP with AAV
donors carrying Factor IX (F.IX). FIGS. 11A and 11B reflect dose
curves for NHP study with Rituxan.RTM./Solu-Medrol.RTM. post-test
article administration. FIG. 11A depicts dose curves for Group 3
(see Examples; 1.5e15 vg/kg; 1:1:8; high dose ZFNs+hF9 donor);
Group 4 (9e13 vg/kg; 1:1:4; high dose ZFNs+hF9 donor); Group 5
(6e13 vg/kg; 1:1:2; high dose ZFNs+hF9 donor); Group 6 (5e13 vg/kg;
1:1:8; mid dose ZFNs+hF9 donor); Group 7 (mid dose ZFNs+hF9 donor;
1:1:2; 2e13 vg/kg) and Group 8 (low dose ZFNs+hF9 donor; 1:1:8;
1.5e13 vg/kg). FIG. 11B summarizes the peak circulating hF.IX
levels by ZFN+hF9 donor dose levels for the 1:1:8 ratio of
ZFN:ZFN:hF9 donor. FIG. 11C reflects dose curves for NHP study with
Rituxan.RTM./Solu-Medrol.RTM. pre-test article administration. FIG.
11D depicts compiled data for both post-(grey symbols) and
pre-(black symbols) Rituxan.RTM./Solu-Medrol.RTM. dosing.
[0051] FIGS. 12A through 12C are graphs depicting levels of gene
modification (% Indels) following treatment in NHP for the 1:1:8
dose ratio groups. FIG. 12A shows % Indels at day 28 for the NHP
study with Rituxan.RTM./Solu-Medrol.RTM. post-test article
administration. Group 3 (1.5e15 vg/kg; high dose ZFNs+hF9), Group 6
(5e13 vg/kg; 1:1:8; mid dose ZFNs+hF9 donor); and Group 8 (low dose
ZFNs+hF9 donor; 1:1:8; 1.5e13 vg/kg). FIG. 12B reflects % Indels at
day 61 for the NHP study with Rituxan.RTM./Solu-Medrol.RTM.
pre-test article administration. FIG. 12C shows compiled data for
both post-(grey symbols) and pre-(black symbols)
Rituxan.RTM./Solu-Medrol.RTM. dosing.
[0052] FIGS. 13A through 13D are graphs depict a summary of human
FVIII plasma levels for the NHP study using AAV donors carrying
Factor VIII (F8) B-Domain Deleted (FVIII-BDD) proteins. FIG. 13A
shows results for Group 2 animals (AAV2/6, 2E+12 vg/kg); FIG. 13B
shows results for Group 3 animals (AAV2/6, 6E+12 vg/kg); FIG. 13C
shows results for Group 4 animals (AAV2/8, 6E+12 vg/kg); and FIG.
13D shows results for Group 5 animals (AAV2/8, 6E+12 vg/kg). 1 U/mL
of human factor VIII is considered physiological normal, and thus
equals 100% of normal physiological circulating human factor
VIII.
[0053] FIG. 14 shows the dosing scheme with for the human FVIII-BDD
non-human primate (NHP) studies including removal of all
immunosuppression at Day 103. Overview of Rituxan and Solu-Medrol
dosing. Rituxan (10 mg/kg; IV) dosing was pre-test article
administration while methylprednisolone (Solu-Medrol) (10 mg/kg;
IM) dosing was daily up until Day 103.
[0054] FIG. 15 is a graph depicting the peak human FVIII antigen
levels over the study following treatment in non-human primates
(NHP). At dose levels of 2E+12 vg/kg (n=3), peak values of 111.0%,
493.9% and 840.0% (overall mean 481.6% as measured by hFVIII ELISA)
of normal hFVIII plasma levels in humans were achieved. At a higher
dose representing 6E+12 vg/kg (n=3), peak values of 450.0%, 625.6%
and 886.7% [overall mean 654.1%] of hFVIII plasma levels were
achieved.
[0055] FIGS. 16A through 16C are graphs depicting the results from
individual cynomolgus monkeys (n=3) dosed with the low dose (2E+12
vg/kg, Group 2) of AAV2/6-FVIII-BDD cDNA over a time period of 168
days post dosing. In all three graphs, concentrations of FVIII-BDD
in the plasma, as measured through ELISA, are shown in black.
Additionally, concentrations of neutralizing anti-FVIII antibody
(shown as Bethesda Units) in plasma are shown in grey. The dotted
horizontal line represents the Bethesda Unit cutoff point, below
which values would not be considered positive for anti-FVIII
neutralizing antibodies. The Solu-Medrol was stopped at day 103-
indicated by the vertical dashed line. Each graph shows the results
for a single monkey (animals 2101, 2102 and 2103).
[0056] FIGS. 17A through 17C are graphs depicting the results from
individual cynomolgus monkeys (n=3) dosed with the high dose (6E+12
vg/kg, Group 3) of AAV2/6-FVIII-BDD cDNA over a time period of 180
days post dosing. In all three graphs, concentrations of FVIII-BDD
in the plasma, as measured through ELISA, are shown in black.
Additionally, concentrations of neutralizing anti-FVIII antibody
(shown as Bethesda Units) in plasma are shown in grey. The dotted
horizontal line represents the Bethesda Unit cutoff point, below
which values would not be considered positive for anti-FVIII
neutralizing antibodies. The Solu-Medrol was stopped at day 103-
indicated by the vertical dashed line. Each graph shows the results
for a single monkey (animals 3101, 3102 and 3103).
[0057] FIGS. 18A through 18D are graphs depicting the results from
individual cynomolgus monkeys (n=3) dosed with the high dose (6E+12
vg/kg, Group 4) of AAV2/8-FVIII-BDD cDNA over a time period of 168
days post dosing. In graphs 18A-18C, concentrations of FVIII-BDD in
the plasma, as measured through ELISA, are shown in black.
Additionally, concentrations of neutralizing anti-FVIII antibody
(shown as Bethesda Units) in plasma are shown in grey. FIG. 18D is
a `blow up` of the lower values in the graph for animal 4103 (note
that they axis in 18A-C goes from 0-5 U/mL of FVIII antigen while
18D goes from 0-1 U/mL of FVIII antigen. The dotted horizontal line
represents the Bethesda Unit cutoff point, below which values would
not be considered positive for anti-FVIII neutralizing antibodies.
The Solu-Medrol was stopped at day 103- indicated by the vertical
dashed line. Each graph shows the results for a single monkey
(animals 4101, 4102 and 4103).
[0058] FIGS. 19A through 19E are graphs depicting the results from
individual cynomolgus monkeys (n=3) dosed with the high dose (6E+12
vg/kg, Group 5) of AAV2/8-FVIII-BDD cDNA over a time period of 168
days post dosing. In graphs 19A-19C, concentrations of FVIII-BDD in
the plasma, as measured through ELISA, are shown in black.
Additionally, concentrations of neutralizing anti-FVIII antibody
(shown as Bethesda Units) in plasma are shown in grey. FIGS. 19D
and 19E are `blow ups` of the lower values in the graph (note that
the y axis in 19A-C goes from 0-5 U/mL of FVIII antigen while the
axis for 19D and 19E goes from 0-1 U/mL of FVIII antigen. The
dotted horizontal line represents the Bethesda Unit cutoff point,
below which values would not be considered positive for anti-FVIII
neutralizing antibodies. The Solu-Medrol was stopped at day 103-
indicated by the vertical dashed line. Each graph shows the results
for a single monkey (animals 5101, 5102 and 5103).
[0059] FIGS. 20A through 20D show FACs analysis of TRAC and B2M
single and double knockouts (KOs) and targeted integration (TI).
FIG. 20A shows that 88% of TRAC-nuclease/AAV GFP donor-treated
cells had inactivated TRAC genes (left panel) and that 71% of cells
had the AAV-delivered GFP donor integrated into the TRAC gene
(right panel). FIG. 20B shows that 93% of B2M-nuclease/AAV GFP
donor-treated cells had inactivated B2M genes (left panel) and that
72% of cells had the AAV-delivered GFP donor integrated into the
B2M gene (right panel). FIGS. 20C and 20D show analysis of cells in
which both TRAC and B2M were targeted in the same cell (double
KO/modified cells).
DETAILED DESCRIPTION
[0060] Disclosed herein are compositions and methods for
transduction of a cell for use in gene therapy or genome
engineering. In particular, nuclease-mediated (i.e. ZFN, TALEN,
TtAgo or CRISPR/Cas (Cas and/or Cfp1) system) targeted integration
of an exogenous sequence or genome alteration by targeted cleavage
followed by non-homologous end joining, is efficiently achieved in
a cell. Particularly useful for transduction and engineering of
HSC/PC and primary T cells, however, the methods and compositions
can also be used for other cell types.
[0061] Delivery of ZFNs and donor template DNA was optimized as
detailed herein using viral vectors and/or molecules that inhibit
binding of the viral vector to cell surface receptors. The methods
and compositions described herein can be used in any cell type,
including any hematopoietic stem cell or precursor cell, such as
CD34+ cells. CD34+ cells can include primitive (CD133+CD90+, or
CD90-), early (CD34+, CD133+) and committed (CD34+CD133-) CD34+
subsets as well as T cells. T cells can comprise CD4+ or CD8+ cells
or TILs. The methods and compositions contained in the instant
application can also relate to use in vivo for delivery of nucleic
acids to primary cells via AAV. The methods described herein result
in long-term multilineage engraftment in animals treated with the
modified cells.
General
[0062] Practice of the methods, as well as preparation and use of
the compositions disclosed herein employ, unless otherwise
indicated, conventional techniques in molecular biology,
biochemistry, chromatin structure and analysis, computational
chemistry, cell culture, recombinant DNA and related fields as are
within the skill of the art. These techniques are fully explained
in the literature. See, for example, Sambrook et al. MOLECULAR
CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor
Laboratory Press, 1989 and Third edition, 2001; Ausubel et al.,
CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New
York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY,
Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND
FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS
IN ENZYMOLOGY, Vol. 304, "Chromatin" (P. M. Wassarman and A. P.
Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN
MOLECULAR BIOLOGY, Vol. 119, "Chromatin Protocols" (P. B. Becker,
ed.) Humana Press, Totowa, 1999.
Definitions
[0063] The terms "nucleic acid," "polynucleotide," and
"oligonucleotide" are used interchangeably and refer to a
deoxyribonucleotide or ribonucleotide polymer, in linear or
circular conformation, and in either single- or double-stranded
form. For the purposes of the present disclosure, these terms are
not to be construed as limiting with respect to the length of a
polymer. The terms can encompass known analogues of natural
nucleotides, as well as nucleotides that are modified in the base,
sugar and/or phosphate moieties (e.g., phosphorothioate backbones).
In general, an analogue of a particular nucleotide has the same
base-pairing specificity; i.e., an analogue of A will base-pair
with T.
[0064] The terms "polypeptide," "peptide" and "protein" are used
interchangeably to refer to a polymer of amino acid residues. The
term also applies to amino acid polymers in which one or more amino
acids are chemical analogues or modified derivatives of a
corresponding naturally-occurring amino acids.
[0065] "Binding" refers to a sequence-specific, non-covalent
interaction between macromolecules (e.g., between a protein and a
nucleic acid). Not all components of a binding interaction need be
sequence-specific (e.g., contacts with phosphate residues in a DNA
backbone), as long as the interaction as a whole is
sequence-specific. Such interactions are generally characterized by
a dissociation constant (K.sub.d) of 10.sup.-6 M.sup.-1 or lower.
"Affinity" refers to the strength of binding: increased binding
affinity being correlated with a lower K.sub.d.
[0066] A "binding protein" is a protein that is able to bind to
another molecule. A binding protein can bind to, for example, a DNA
molecule (a DNA-binding protein), an RNA molecule (an RNA-binding
protein) and/or a protein molecule (a protein-binding protein). In
the case of a protein-binding protein, it can bind to itself (to
form homodimers, homotrimers, etc.) and/or it can bind to one or
more molecules of a different protein or proteins. A binding
protein can have more than one type of binding activity. For
example, zinc finger proteins have DNA-binding, RNA-binding and
protein-binding activity.
[0067] A "zinc finger DNA binding protein" (or binding domain) is a
protein, or a domain within a larger protein, that binds DNA in a
sequence-specific manner through one or more zinc fingers, which
are regions of amino acid sequence within the binding domain whose
structure is stabilized through coordination of a zinc ion. The
term zinc finger DNA binding protein is often abbreviated as zinc
finger protein or ZFP.
[0068] A "TALE DNA binding domain" or "TALE" is a polypeptide
comprising one or more TALE repeat domains/units. The repeat
domains are involved in binding of the TALE to its cognate target
DNA sequence. A single "repeat unit" (also referred to as a
"repeat") is typically 33-35 amino acids in length and exhibits at
least some sequence homology with other TALE repeat sequences
within a naturally occurring TALE protein.
[0069] Zinc finger and TALE binding domains can be "engineered" to
bind to a predetermined nucleotide sequence, for example via
engineering (altering one or more amino acids) of the recognition
helix region of a naturally occurring zinc finger or TALE protein.
Therefore, engineered DNA binding proteins (zinc fingers or TALEs)
are proteins that are non-naturally occurring. Non-limiting
examples of methods for engineering DNA-binding proteins are design
and selection. A designed DNA binding protein is a protein not
occurring in nature whose design/composition results principally
from rational criteria. Rational criteria for design include
application of substitution rules and computerized algorithms for
processing information in a database storing information of
existing ZFP and/or TALE designs and binding data. See, for
example, U.S. Pat. Nos. 8,586,526; 6,140,081; 6,453,242; and
6,534,261; see also WO 98/53058; WO 98/53059; WO 98/53060; WO
02/016536 and WO 03/016496.
[0070] A "selected" zinc finger protein or TALE is a protein not
found in nature whose production results primarily from an
empirical process such as phage display, interaction trap or hybrid
selection. See e.g., U.S. Pat. Nos. 8,586,526; 5,789,538;
5,925,523; 6,007,988; 6,013,453; 6,200,759; WO 95/19431; WO
96/06166; WO 98/53057; WO 98/54311; WO 00/27878; WO 01/60970 WO
01/88197, WO 02/099084.
[0071] "TtAgo" is a prokaryotic Argonaute protein thought to be
involved in gene silencing. TtAgo is derived from the bacteria
Thermus thermophilus. (See, e.g., Swarts et al, ibid, G. Sheng et
al., (2013) Proc. Natl. Acad. Sci. U.S.A. 111, 652). A "TtAgo
system" is all the components required including, for example,
guide DNAs for cleavage by a TtAgo enzyme.
[0072] "Recombination" refers to a process of exchange of genetic
information between two polynucleotides, including but not limited
to, donor capture by non-homologous end joining (NHEJ) and
homologous recombination. For the purposes of this disclosure,
"homologous recombination (HR)" refers to the specialized form of
such exchange that takes place, for example, during repair of
double-strand breaks in cells via homology-directed repair
mechanisms. This process requires nucleotide sequence homology,
uses a "donor" molecule to template repair of a "target" molecule
(i.e., the one that experienced the double-strand break), and is
variously known as "non-crossover gene conversion" or "short tract
gene conversion," because it leads to the transfer of genetic
information from the donor to the target. Without wishing to be
bound by any particular theory, such transfer can involve mismatch
correction of heteroduplex DNA that forms between the broken target
and the donor, and/or "synthesis-dependent strand annealing," in
which the donor is used to resynthesize genetic information that
will become part of the target, and/or related processes. Such
specialized HR often results in an alteration of the sequence of
the target molecule such that part or all of the sequence of the
donor polynucleotide is incorporated into the target
polynucleotide.
[0073] In the methods of the disclosure, one or more targeted
nucleases as described herein create a double-stranded break in the
target sequence (e.g., cellular chromatin) at a predetermined site,
and a "donor" polynucleotide, having homology to the nucleotide
sequence in the region of the break, can be introduced into the
cell. The presence of the double-stranded break has been shown to
facilitate integration of the donor sequence. The donor sequence
may be physically integrated or, alternatively, the donor
polynucleotide is used as a template for repair of the break via
homologous recombination, resulting in the introduction of all or
part of the nucleotide sequence as in the donor into the cellular
chromatin. Thus, a first sequence in cellular chromatin can be
altered and, in certain embodiments, can be converted into a
sequence present in a donor polynucleotide. Thus, the use of the
terms "replace" or "replacement" can be understood to represent
replacement of one nucleotide sequence by another, (i.e.,
replacement of a sequence in the informational sense), and does not
necessarily require physical or chemical replacement of one
polynucleotide by another.
[0074] In any of the methods described herein, additional pairs of
zinc-finger proteins or TALEN can be used for additional
double-stranded cleavage of additional target sites within the
cell.
[0075] Any of the methods described herein can be used for
insertion of a donor of any size and/or partial or complete
inactivation of one or more target sequences in a cell by targeted
integration of donor sequence that disrupts expression of the
gene(s) of interest. Cell lines with partially or completely
inactivated genes are also provided.
[0076] Furthermore, the methods of targeted integration as
described herein can also be used to integrate one or more
exogenous sequences. The exogenous nucleic acid sequence can
comprise, for example, one or more genes or cDNA molecules, or any
type of coding or noncoding sequence, as well as one or more
control elements (e.g., promoters). In addition, the exogenous
nucleic acid sequence may produce one or more RNA molecules (e.g.,
small hairpin RNAs (shRNAs), inhibitory RNAs (RNAis), microRNAs
(miRNAs), etc.).
[0077] In certain embodiments of methods for targeted recombination
and/or replacement and/or alteration of a sequence in a region of
interest in cellular chromatin, a chromosomal sequence is altered
by homologous recombination with an exogenous "donor" nucleotide
sequence. Such homologous recombination is stimulated by the
presence of a double-stranded break in cellular chromatin, if
sequences homologous to the region of the break are present.
[0078] In any of the methods described herein, the exogenous
nucleotide sequence (the "donor sequence" or "transgene") can
contain sequences that are homologous, but not identical, to
genomic sequences in the region of interest, thereby stimulating
homologous recombination to insert a non-identical sequence in the
region of interest. Thus, in certain embodiments, portions of the
donor sequence that are homologous to sequences in the region of
interest exhibit between about 80 to 99% (or any integer
therebetween) sequence identity to the genomic sequence that is
replaced. In other embodiments, the homology between the donor and
genomic sequence is higher than 99%, for example if only 1
nucleotide differs as between donor and genomic sequences of over
100 contiguous base pairs. In certain cases, a non-homologous
portion of the donor sequence can contain sequences not present in
the region of interest, such that new sequences are introduced into
the region of interest. In these instances, the non-homologous
sequence is generally flanked by sequences of 50-1,000 base pairs
(or any integral value therebetween) or any number of base pairs
greater than 1,000, that are homologous or identical to sequences
in the region of interest. In other embodiments, the donor sequence
is non-homologous to the first sequence, and is inserted into the
genome by non-homologous recombination mechanisms.
[0079] "Cleavage" refers to the breakage of the covalent backbone
of a DNA molecule. Cleavage can be initiated by a variety of
methods including, but not limited to, enzymatic or chemical
hydrolysis of a phosphodiester bond. Both single-stranded cleavage
and double-stranded cleavage are possible, and double-stranded
cleavage can occur as a result of two distinct single-stranded
cleavage events. DNA cleavage can result in the production of
either blunt ends or staggered ends. In certain embodiments, fusion
polypeptides are used for targeted double-stranded DNA
cleavage.
[0080] A "cleavage half-domain" is a polypeptide sequence which, in
conjunction with a second polypeptide (either identical or
different) forms a complex having cleavage activity (preferably
double-strand cleavage activity). The terms "first and second
cleavage half-domains;" "+ and - cleavage half-domains" and "right
and left cleavage half-domains" are used interchangeably to refer
to pairs of cleavage half-domains that dimerize.
[0081] An "engineered cleavage half-domain" is a cleavage
half-domain that has been modified so as to form obligate
heterodimers with another cleavage half-domain (e.g., another
engineered cleavage half-domain). See, also, U.S. Patent
Publication Nos. 2005/0064474, 20070218528, 2008/0131962 and
2011/0201055, incorporated herein by reference in their
entireties.
[0082] The term "sequence" refers to a nucleotide sequence of any
length, which can be DNA or RNA; can be linear, circular or
branched and can be either single-stranded or double stranded. The
term "donor sequence" refers to a nucleotide sequence that is
inserted into a genome. A donor sequence can be of any length, for
example between 2 and 100,000,000 nucleotides in length (or any
integer value therebetween or thereabove), preferably between about
100 and 100,000 nucleotides in length (or any integer
therebetween), more preferably between about 100 and 5,000
nucleotides in length (or any value therebetween) and even more
preferable, between about 100 and 2,000 base pairs (or any value
therebetween).
[0083] A "homologous, non-identical sequence" refers to a first
sequence which shares a degree of sequence identity with a second
sequence, but whose sequence is not identical to that of the second
sequence. For example, a polynucleotide comprising the wild-type
sequence of a mutant gene is homologous and non-identical to the
sequence of the mutant gene. In certain embodiments, the degree of
homology between the two sequences is sufficient to allow
homologous recombination therebetween, utilizing normal cellular
mechanisms. Two homologous non-identical sequences can be any
length and their degree of non-homology can be as small as a single
nucleotide (e.g., for correction of a genomic point mutation by
targeted homologous recombination) or as large as 10 or more
kilobases (e.g., for insertion of a gene at a predetermined ectopic
site in a chromosome). Two polynucleotides comprising the
homologous non-identical sequences need not be the same length. For
example, an exogenous polynucleotide (i.e., donor polynucleotide)
of between 20 and 10,000 nucleotides or nucleotide pairs can be
used.
[0084] Techniques for determining nucleic acid and amino acid
sequence identity are known in the art. Typically, such techniques
include determining the nucleotide sequence of the mRNA for a gene
and/or determining the amino acid sequence encoded thereby, and
comparing these sequences to a second nucleotide or amino acid
sequence. Genomic sequences can also be determined and compared in
this fashion. In general, identity refers to an exact
nucleotide-to-nucleotide or amino acid-to-amino acid correspondence
of two polynucleotides or polypeptide sequences, respectively. Two
or more sequences (polynucleotide or amino acid) can be compared by
determining their percent identity using standard techniques.
Typically the percent identities between sequences are at least
70-75%, preferably 80-82%, more preferably 85-90%, even more
preferably 92%, still more preferably 95%, and most preferably 98%
sequence identity.
[0085] Alternatively, the degree of sequence similarity between
polynucleotides can be determined by hybridization of
polynucleotides under conditions that allow formation of stable
duplexes between homologous regions, followed by digestion with
single-stranded-specific nuclease(s), and size determination of the
digested fragments. Two nucleic acid, or two polypeptide sequences
are substantially homologous to each other when the sequences
exhibit at least about 70%-75%, preferably 80%-82%, more preferably
85%-90%, even more preferably 92%, still more preferably 95%, and
most preferably 98% sequence identity over a defined length of the
molecules, as determined using the methods known in the art.
Conditions for hybridization are well-known to those of skill in
the art. Hybridization stringency refers to the degree to which
hybridization conditions disfavor the formation of hybrids
containing mismatched nucleotides, with higher stringency
correlated with a lower tolerance for mismatched hybrids. Factors
that affect the stringency of hybridization are well-known to those
of skill in the art and include, but are not limited to,
temperature, pH, ionic strength, and concentration of organic
solvents such as, for example, formamide and dimethylsulfoxide. As
is known to those of skill in the art, hybridization stringency is
increased by higher temperatures, lower ionic strength and lower
solvent concentrations.
[0086] "Chromatin" is the nucleoprotein structure comprising the
cellular genome. Cellular chromatin comprises nucleic acid,
primarily DNA, and protein, including histones and non-histone
chromosomal proteins. The majority of eukaryotic cellular chromatin
exists in the form of nucleosomes, wherein a nucleosome core
comprises approximately 150 base pairs of DNA associated with an
octamer comprising two each of histones H2A, H2B, H3 and H4; and
linker DNA (of variable length depending on the organism) extends
between nucleosome cores. A molecule of histone H1 is generally
associated with the linker DNA. For the purposes of the present
disclosure, the term "chromatin" is meant to encompass all types of
cellular nucleoprotein, both prokaryotic and eukaryotic. Cellular
chromatin includes both chromosomal and episomal chromatin.
[0087] A "chromosome," is a chromatin complex comprising all or a
portion of the genome of a cell. The genome of a cell is often
characterized by its karyotype, which is the collection of all the
chromosomes that comprise the genome of the cell. The genome of a
cell can comprise one or more chromosomes.
[0088] An "episome" is a replicating nucleic acid, nucleoprotein
complex or other structure comprising a nucleic acid that is not
part of the chromosomal karyotype of a cell. Examples of episomes
include plasmids and certain viral genomes.
[0089] An "accessible region" is a site in cellular chromatin in
which a target site present in the nucleic acid can be bound by an
exogenous molecule which recognizes the target site. Without
wishing to be bound by any particular theory, it is believed that
an accessible region is one that is not packaged into a nucleosomal
structure. The distinct structure of an accessible region can often
be detected by its sensitivity to chemical and enzymatic probes,
for example, nucleases.
[0090] A "target site" or "target sequence" is a nucleic acid
sequence that defines a portion of a nucleic acid to which a
binding molecule will bind, provided sufficient conditions for
binding exist.
[0091] An "exogenous" molecule is a molecule that is not normally
present in a cell, but can be introduced into a cell by one or more
genetic, biochemical or other methods. "Normal presence in the
cell" is determined with respect to the particular developmental
stage and environmental conditions of the cell. Thus, for example,
a molecule that is present only during embryonic development of
muscle is an exogenous molecule with respect to an adult muscle
cell. Similarly, a molecule induced by heat shock is an exogenous
molecule with respect to a non-heat-shocked cell. An exogenous
molecule can comprise, for example, a functioning version of a
malfunctioning endogenous molecule or a malfunctioning version of a
normally-functioning endogenous molecule.
[0092] An exogenous molecule can be, among other things, a small
molecule, such as is generated by a combinatorial chemistry
process, or a macromolecule such as a protein, nucleic acid,
carbohydrate, lipid, glycoprotein, lipoprotein, polysaccharide, any
modified derivative of the above molecules, or any complex
comprising one or more of the above molecules. Nucleic acids
include DNA and RNA, can be single- or double-stranded; can be
linear, branched or circular; and can be of any length. Nucleic
acids include those capable of forming duplexes, as well as
triplex-forming nucleic acids. See, for example, U.S. Pat. Nos.
5,176,996 and 5,422,251. Proteins include, but are not limited to,
DNA-binding proteins, transcription factors, chromatin remodeling
factors, methylated DNA binding proteins, polymerases, methylases,
demethylases, acetylases, deacetylases, kinases, phosphatases,
integrases, recombinases, ligases, topoisomerases, gyrases and
helicases.
[0093] An exogenous molecule can be the same type of molecule as an
endogenous molecule, e.g., an exogenous protein or nucleic acid.
For example, an exogenous nucleic acid can comprise an infecting
viral genome, a plasmid or episome introduced into a cell, or a
chromosome that is not normally present in the cell. Methods for
the introduction of exogenous molecules into cells are known to
those of skill in the art and include, but are not limited to,
lipid-mediated transfer (i.e., liposomes, including neutral and
cationic lipids), electroporation, direct injection, cell fusion,
particle bombardment, biopolymer nanoparticle delivery (see Nitta
and Numata (2013) Int J Mol Sci 14:1629), calcium phosphate
co-precipitation, DEAE-dextran-mediated transfer and viral
vector-mediated transfer. An exogeneous molecule can also be the
same type of molecule as an endogenous molecule but derived from a
different species than the cell is derived from. For example, a
human nucleic acid sequence may be introduced into a cell line
originally derived from a mouse or hamster.
[0094] By contrast, an "endogenous" molecule is one that is
normally present in a particular cell at a particular developmental
stage under particular environmental conditions. For example, an
endogenous nucleic acid can comprise a chromosome, the genome of a
mitochondrion, or other organelle, or a naturally-occurring
episomal nucleic acid. Additional endogenous molecules can include
proteins, for example, transcription factors and enzymes.
[0095] As used herein, the term "product of an exogenous nucleic
acid" includes both polynucleotide and polypeptide products, for
example, transcription products (polynucleotides such as RNA) and
translation products (polypeptides).
[0096] A "fusion" molecule is a molecule in which two or more
subunit molecules are linked, preferably covalently. The subunit
molecules can be the same chemical type of molecule, or can be
different chemical types of molecules. Examples of the first type
of fusion molecule include, but are not limited to, fusion proteins
(for example, a fusion between a ZFP or TALE DNA-binding domain and
one or more activation domains) and fusion nucleic acids (for
example, a nucleic acid encoding the fusion protein described
supra). Examples of the second type of fusion molecule include, but
are not limited to, a fusion between a triplex-forming nucleic acid
and a polypeptide, and a fusion between a minor groove binder and a
nucleic acid.
[0097] Expression of a fusion protein in a cell can result from
delivery of the fusion protein to the cell or by delivery of a
polynucleotide encoding the fusion protein to a cell, wherein the
polynucleotide is transcribed, and the transcript is translated, to
generate the fusion protein. Trans-splicing, polypeptide cleavage
and polypeptide ligation can also be involved in expression of a
protein in a cell. Methods for polynucleotide and polypeptide
delivery to cells are presented elsewhere in this disclosure.
[0098] A "gene," for the purposes of the present disclosure,
includes a DNA region encoding a gene product (see infra), as well
as all DNA regions which regulate the production of the gene
product, whether or not such regulatory sequences are adjacent to
coding and/or transcribed sequences. Accordingly, a gene includes,
but is not necessarily limited to, promoter sequences, terminators,
translational regulatory sequences such as ribosome binding sites
and internal ribosome entry sites, enhancers, silencers,
insulators, boundary elements, replication origins, matrix
attachment sites and locus control regions.
[0099] "Gene expression" refers to the conversion of the
information, contained in a gene, into a gene product. A gene
product can be the direct transcriptional product of a gene (e.g.,
mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA or any
other type of RNA) or a protein produced by translation of an mRNA.
Gene products also include RNAs which are modified, by processes
such as capping, polyadenylation, methylation, and editing, and
proteins modified by, for example, methylation, acetylation,
phosphorylation, ubiquitination, ADP-ribosylation, myristilation,
and glycosylation.
[0100] "Modulation" of gene expression refers to a change in the
activity of a gene. Modulation of expression can include, but is
not limited to, gene activation and gene repression. Genome editing
(e.g., cleavage, alteration, inactivation, random mutation) can be
used to modulate expression. Gene inactivation refers to any
reduction in gene expression as compared to a cell that does not
include a ZFP, TALE or CRISPR/Cas system as described herein. Thus,
gene inactivation may be partial or complete.
[0101] A "region of interest" is any region of cellular chromatin,
such as, for example, a gene or a non-coding sequence within or
adjacent to a gene, in which it is desirable to bind an exogenous
molecule. Binding can be for the purposes of targeted DNA cleavage
and/or targeted recombination. A region of interest can be present
in a chromosome, an episome, an organellar genome (e.g.,
mitochondrial, chloroplast), or an infecting viral genome, for
example. A region of interest can be within the coding region of a
gene, within transcribed non-coding regions such as, for example,
leader sequences, trailer sequences or introns, or within
non-transcribed regions, either upstream or downstream of the
coding region. A region of interest can be as small as a single
nucleotide pair or up to 2,000 nucleotide pairs in length, or any
integral value of nucleotide pairs.
[0102] "Eukaryotic" cells include, but are not limited to, fungal
cells (such as yeast), plant cells, animal cells, mammalian cells
and human cells (e.g., T-cells).
[0103] "Secretory tissues" are those tissues in an animal that
secrete products out of the individual cell into a lumen of some
type which are typically derived from epithelium. Examples of
secretory tissues that are localized to the gastrointestinal tract
include the cells that line the gut, the pancreas, and the
gallbladder. Other secretory tissues include the liver, tissues
associated with the eye and mucous membranes such as salivary
glands, mammary glands, the prostate gland, the pituitary gland and
other members of the endocrine system. Additionally, secretory
tissues include individual cells of a tissue type which are capable
of secretion.
[0104] The terms "operative linkage" and "operatively linked" (or
"operably linked") are used interchangeably with reference to a
juxtaposition of two or more components (such as sequence
elements), in which the components are arranged such that both
components function normally and allow the possibility that at
least one of the components can mediate a function that is exerted
upon at least one of the other components. By way of illustration,
a transcriptional regulatory sequence, such as a promoter, is
operatively linked to a coding sequence if the transcriptional
regulatory sequence controls the level of transcription of the
coding sequence in response to the presence or absence of one or
more transcriptional regulatory factors. A transcriptional
regulatory sequence is generally operatively linked in cis with a
coding sequence, but need not be directly adjacent to it. For
example, an enhancer is a transcriptional regulatory sequence that
is operatively linked to a coding sequence, even though they are
not contiguous.
[0105] With respect to fusion polypeptides, the term "operatively
linked" can refer to the fact that each of the components performs
the same function in linkage to the other component as it would if
it were not so linked. For example, with respect to a fusion
polypeptide in which a ZFP, TALE or Cas DNA-binding domain is fused
to an activation domain, the ZFP, TALE or Cas DNA-binding domain
and the activation domain are in operative linkage if, in the
fusion polypeptide, the ZFP, TALE of Cas DNA-binding domain portion
is able to bind its target site and/or its binding site, while the
activation domain is able to upregulate gene expression. When a
fusion polypeptide in which a ZFP, TALE or Cas DNA-binding domain
is fused to a cleavage domain, the ZFP, TALE or Cas DNA-binding
domain and the cleavage domain are in operative linkage if, in the
fusion polypeptide, the ZFP, TALE or Cas DNA-binding domain portion
is able to bind its target site and/or its binding site, while the
cleavage domain is able to cleave DNA in the vicinity of the target
site (e.g., 1 to 500 base pairs or any value therebetween on either
side of the target site).
[0106] A "functional fragment" of a protein, polypeptide or nucleic
acid is a protein, polypeptide or nucleic acid whose sequence is
not identical to the full-length protein, polypeptide or nucleic
acid, yet retains the same function as the full-length protein,
polypeptide or nucleic acid. A functional fragment can possess
more, fewer, or the same number of residues as the corresponding
native molecule, and/or can contain one or more amino acid or
nucleotide substitutions. Methods for determining the function of a
nucleic acid (e.g., coding function, ability to hybridize to
another nucleic acid) are well-known in the art. Similarly, methods
for determining protein function are well-known. For example, the
DNA-binding function of a polypeptide can be determined, for
example, by filter-binding, electrophoretic mobility-shift, or
immunoprecipitation assays. DNA cleavage can be assayed by gel
electrophoresis. See Ausubel et al., supra. The ability of a
protein to interact with another protein can be determined, for
example, by co-immunoprecipitation, two-hybrid assays or
complementation, both genetic and biochemical. See, for example,
Fields et al. (1989) Nature 340:245-246; U.S. Pat. No. 5,585,245
and PCT WO 98/44350.
[0107] A "vector" is capable of transferring gene sequences to
target cells. Typically, "vector construct," "expression vector,"
and "gene transfer vector," mean any nucleic acid construct capable
of directing the expression of a gene of interest and which can
transfer gene sequences to target cells. Thus, the term includes
cloning, and expression vehicles, as well as integrating
vectors.
[0108] A "reporter gene" or "reporter sequence" refers to any
sequence that produces a protein product that is easily measured,
preferably although not necessarily in a routine assay. Suitable
reporter genes include, but are not limited to, sequences encoding
proteins that mediate antibiotic resistance (e.g., ampicillin
resistance, neomycin resistance, G418 resistance, puromycin
resistance), sequences encoding colored or fluorescent or
luminescent proteins (e.g., green fluorescent protein, enhanced
green fluorescent protein, red fluorescent protein, luciferase),
and proteins which mediate enhanced cell growth and/or gene
amplification (e.g., dihydrofolate reductase). Epitope tags
include, for example, one or more copies of FLAG, His, myc, Tap, HA
or any detectable amino acid sequence. "Expression tags" include
sequences that encode reporters that may be operably linked to a
desired gene sequence in order to monitor expression of the gene of
interest.
[0109] A "safe harbor" locus is a locus within the genome wherein a
gene may be inserted without any deleterious effects on the host
cell. Most beneficial is a safe harbor locus in which expression of
the inserted gene sequence is not perturbed by any read-through
expression from neighboring genes. Non-limiting examples of safe
harbor loci in mammalian cells are the AAVS1 gene (U.S. Pat. No.
8,110,379), the CCR5 gene (U.S. Publication No. 20080159996), the
Rosa locus (WO 2010/065123) and/or the albumin locus (U.S.
Publication Nos. 20130177960 and 20130177983). A safe harbor in a
plant cell is the ZP15 locus (U.S. patent publication
20100199389).
[0110] The terms "subject" and "patient" are used interchangeably
and refer to mammals such as human patients and non-human primates,
as well as experimental animals such as rabbits, dogs, cats, rats,
mice, and other animals. Accordingly, the term "subject" or
"patient" as used herein means any mammalian patient or subject to
which the or stem cells of the invention can be administered.
Subjects of the present invention include those that have been
exposed to one or more chemical toxins, including, for example, a
nerve toxin.
[0111] "Sternness" refers to the relative ability of any cell to
act in a stem cell-like manner, i.e., the degree of toti-, pluri-,
or oligopotentcy and expanded or indefinite self-renewal that any
particular stem cell may have.
Nucleases
[0112] Described herein are compositions, particularly nucleases,
such as ZFNs, TALEs, homing endonucleases, Ttago and/or CRISPR/Cas
systems, that are useful for in vivo cleavage of a donor molecule
carrying a transgene and nucleases for cleavage of the genome of a
cell such that the transgene is integrated into the genome in a
targeted manner. In certain embodiments, one or more of the
nucleases are naturally occurring. In other embodiments, one or
more of the nucleases are non-naturally occurring, i.e., engineered
in the DNA-binding domain and/or cleavage domain. For example, the
DNA-binding domain of a naturally-occurring nuclease may be altered
to bind to a selected target site (e.g., a meganuclease that has
been engineered to bind to site different than the cognate binding
site). In other embodiments, the nuclease comprises heterologous
DNA-binding and cleavage domains (e.g., zinc finger nucleases;
TAL-effector domain DNA binding proteins; meganuclease DNA-binding
domains with heterologous cleavage domains). In other embodiments,
the nuclease comprises a system such as the CRISPR/Cas or Ttago
system.
A. DNA-Binding Domains
[0113] In certain embodiments, the composition and methods
described herein employ a meganuclease (homing endonuclease)
DNA-binding domain for binding to the donor molecule and/or binding
to the region of interest in the genome of the cell.
Naturally-occurring meganucleases recognize 15-40 base-pair
cleavage sites and are commonly grouped into four families: the
LAGLIDADG family, the GIY-YIG family, the His-Cyst box family and
the HNH family. Exemplary homing endonucleases include I-SceI,
I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI,
I-SceIII, I-CreI, I-TevI, I-TevII and I-TevIII. Their recognition
sequences are known. See also U.S. Pat. Nos. 5,420,032; 6,833,252;
Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388; Dujon et al.
(1989) Gene 82:115-118; Perler et al. (1994) Nucleic Acids Res. 22,
1125-1127; Jasin (1996) Trends Genet. 12:224-228; Gimble et al.
(1996)J. Mol. Biol. 263:163-180; Argast et al. (1998)J. Mol. Biol.
280:345-353 and the New England Biolabs catalogue.
[0114] In certain embodiments, the methods and compositions
described herein make use of a nuclease that comprises an
engineered (non-naturally occurring) homing endonuclease
(meganuclease). The recognition sequences of homing endonucleases
and meganucleases such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV,
I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII
and I-TevIII are known. See also U.S. Pat. Nos. 5,420,032;
6,833,252; Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388;
Dujon et al. (1989) Gene 82:115-118; Perler et al. (1994) Nucleic
Acids Res. 22, 1125-1127; Jasin (1996) Trends Genet. 12:224-228;
Gimble et al. (1996)J Mol. Biol. 263:163-180; Argast et al. (1998)
J. Mol. Biol. 280:345-353 and the New England Biolabs catalogue. In
addition, the DNA-binding specificity of homing endonucleases and
meganucleases can be engineered to bind non-natural target sites.
See, for example, Chevalier et al. (2002) Molec. Cell 10:895-905;
Epinat et al. (2003) Nucleic Acids Res. 31:2952-2962; Ashworth et
al. (2006) Nature 441:656-659; Paques et al. (2007) Current Gene
Therapy 7:49-66; U.S. Patent Publication No. 20070117128. The
DNA-binding domains of the homing endonucleases and meganucleases
may be altered in the context of the nuclease as a whole (i.e.,
such that the nuclease includes the cognate cleavage domain) or may
be fused to a heterologous cleavage domain.
[0115] In other embodiments, the DNA-binding domain of one or more
of the nucleases used in the methods and compositions described
herein comprises a naturally occurring or engineered (non-naturally
occurring) TAL effector DNA binding domain. See, e.g., U.S. Pat.
No. 8,586,526, incorporated by reference in its entirety herein.
The plant pathogenic bacteria of the genus Xanthomonas are known to
cause many diseases in important crop plants. Pathogenicity of
Xanthomonas depends on a conserved type III secretion (T3S) system
which injects more than 25 different effector proteins into the
plant cell. Among these injected proteins are transcription
activator-like (TAL) effectors which mimic plant transcriptional
activators and manipulate the plant transcriptome (see Kay et al
(2007) Science 318:648-651). These proteins contain a DNA binding
domain and a transcriptional activation domain. One of the most
well characterized TAL-effectors is AvrBs3 from Xanthomonas
campestgris pv. Vesicatoria (see Bonas et al (1989)Mol Gen Genet
218: 127-136 and WO2010079430). TAL-effectors contain a centralized
domain of tandem repeats, each repeat containing approximately 34
amino acids, which are key to the DNA binding specificity of these
proteins. In addition, they contain a nuclear localization sequence
and an acidic transcriptional activation domain (for a review see
Schornack S, et al (2006) J Plant Physiol 163(3): 256-272). In
addition, in the phytopathogenic bacteria Ralstonia solanacearum
two genes, designated brg11 and hpx17 have been found that are
homologous to the AvrBs3 family of Xanthomonas in the R.
solanacearum biovar 1 strain GMI1000 and in the biovar 4 strain
RS1000 (See Heuer et al (2007) Appl and Envir Micro 73(13):
4379-4384). These genes are 98.9% identical in nucleotide sequence
to each other but differ by a deletion of 1,575 bp in the repeat
domain of hpx17. However, both gene products have less than 40%
sequence identity with AvrBs3 family proteins of Xanthomonas. See,
e.g., U.S. Pat. No. 8,586,526, incorporated by reference in its
entirety herein.
[0116] Specificity of these TAL effectors depends on the sequences
found in the tandem repeats. The repeated sequence comprises
approximately 102 bp and the repeats are typically 91-100%
homologous with each other (Bonas et al, ibid). Polymorphism of the
repeats is usually located at positions 12 and 13 and there appears
to be a one-to-one correspondence between the identity of the
hypervariable diresidues at positions 12 and 13 with the identity
of the contiguous nucleotides in the TAL-effector's target sequence
(see Moscou and Bogdanove, (2009) Science 326:1501 and Boch et al
(2009) Science 326:1509-1512). Experimentally, the natural code for
DNA recognition of these TAL-effectors has been determined such
that an HD sequence at positions 12 and 13 leads to a binding to
cytosine (C), NG binds to T, NI to A, C, G or T, NN binds to A or
G, and ING binds to T. These DNA binding repeats have been
assembled into proteins with new combinations and numbers of
repeats, to make artificial transcription factors that are able to
interact with new sequences and activate the expression of a
non-endogenous reporter gene in plant cells (Boch et al, ibid).
Engineered TAL proteins have been linked to a FokI cleavage half
domain to yield a TAL effector domain nuclease fusion (TALEN)
exhibiting activity in a yeast reporter assay (plasmid based
target). See, e.g., U.S. Pat. No. 8,586,526; Christian et al
((2010)<Genetics epub 10.1534/genetics.110.120717).
[0117] In certain embodiments, the DNA binding domain of one or
more of the nucleases used for in vivo cleavage and/or targeted
cleavage of the genome of a cell comprises a zinc finger protein.
Preferably, the zinc finger protein is non-naturally occurring in
that it is engineered to bind to a target site of choice. See, for
example, See, for example, Beerli et al. (2002) Nature Biotechnol.
20:135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340;
Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al.
(2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr.
Opin. Struct. Biol. 10:411-416; U.S. Pat. Nos. 6,453,242;
6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,030,215; 6,794,136;
7,067,317; 7,262,054; 7,070,934; 7,361,635; 7,253,273; and U.S.
Patent Publication Nos. 2005/0064474; 2007/0218528; 2005/0267061,
all incorporated herein by reference in their entireties.
[0118] An engineered zinc finger binding domain can have a novel
binding specificity, compared to a naturally-occurring zinc finger
protein. Engineering methods include, but are not limited to,
rational design and various types of selection. Rational design
includes, for example, using databases comprising triplet (or
quadruplet) nucleotide sequences and individual zinc finger amino
acid sequences, in which each triplet or quadruplet nucleotide
sequence is associated with one or more amino acid sequences of
zinc fingers which bind the particular triplet or quadruplet
sequence. See, for example, co-owned U.S. Pat. Nos. 6,453,242 and
6,534,261, incorporated by reference herein in their
entireties.
[0119] Exemplary selection methods, including phage display and
two-hybrid systems, are disclosed in U.S. Pat. Nos. 5,789,538;
5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759;
and 6,242,568; as well as WO 98/37186; WO 98/53057; WO 00/27878;
and WO 01/88197. In addition, enhancement of binding specificity
for zinc finger binding domains has been described, for example, in
co-owned WO 02/077227.
[0120] In addition, as disclosed in these and other references,
zinc finger domains and/or multi-fingered zinc finger proteins may
be linked together using any suitable linker sequences, including
for example, linkers of 5 or more amino acids in length. See, also,
U.S. Pat. Nos. 8,772,453; 6,479,626; 6,903,185; and 7,153,949 for
exemplary linker sequences. The proteins described herein may
include any combination of suitable linkers between the individual
zinc fingers of the protein.
[0121] Selection of target sites; ZFPs and methods for design and
construction of fusion proteins (and polynucleotides encoding same)
are known to those of skill in the art and described in detail in
U.S. Pat. Nos. 6,140,815; 5,789,538; 6,453,242; 6,534,261;
5,925,523; 6,007,988; 6,013,453; 6,200,759; WO 95/19431; WO
96/06166; WO 98/53057; WO 98/54311; WO 00/27878; WO 01/60970 WO
01/88197; WO 02/099084; WO 98/53058; WO 98/53059; WO 98/53060; WO
02/016536 and WO 03/016496.
[0122] In addition, as disclosed in these and other references,
zinc finger domains and/or multi-fingered zinc finger proteins may
be linked together using any suitable linker sequences, including
for example, linkers of 5 or more amino acids in length. See, also,
U.S. Pat. Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary
linker sequences 6 or more amino acids in length. The proteins
described herein may include any combination of suitable linkers
between the individual zinc fingers of the protein.
[0123] In certain embodiments, the DNA-binding domain is part of a
CRISPR/Cas nuclease system. See, e.g., U.S. Pat. No. 8,697,359 and
U.S. patent application Ser. No. 14/278,903. The CRISPR (clustered
regularly interspaced short palindromic repeats) locus, which
encodes RNA components of the system, and the cas
(CRISPR-associated) locus, which encodes proteins (Jansen et al.,
2002. Mol. Microbiol. 43: 1565-1575; Makarova et al., 2002. Nucleic
Acids Res. 30: 482-496; Makarova et al., 2006. Biol. Direct 1: 7;
Haft et al., 2005. PLoS Comput. Biol. 1: e60) make up the gene
sequences of the CRISPR/Cas nuclease system. CRISPR loci in
microbial hosts contain a combination of CRISPR-associated (Cas)
genes as well as non-coding RNA elements capable of programming the
specificity of the CRISPR-mediated nucleic acid cleavage.
[0124] The Type II CRISPR is one of the most well characterized
systems and carries out targeted DNA double-strand break in four
sequential steps. First, two non-coding RNA, the pre-crRNA array
and tracrRNA, are transcribed from the CRISPR locus. Second,
tracrRNA hybridizes to the repeat regions of the pre-crRNA and
mediates the processing of pre-crRNA into mature crRNAs containing
individual spacer sequences. Third, the mature crRNA:tracrRNA
complex directs Cas9 to the target DNA via Watson-Crick
base-pairing between the spacer on the crRNA and the protospacer on
the target DNA next to the protospacer adjacent motif (PAM), an
additional requirement for target recognition. Finally, Cas9
mediates cleavage of target DNA to create a double-stranded break
within the protospacer. Activity of the CRISPR/Cas system comprises
of three steps: (i) insertion of alien DNA sequences into the
CRISPR array to prevent future attacks, in a process called
`adaptation`, (ii) expression of the relevant proteins, as well as
expression and processing of the array, followed by (iii)
RNA-mediated interference with the alien nucleic acid. Thus, in the
bacterial cell, several of the so-called `Cas` proteins are
involved with the natural function of the CRISPR/Cas system and
serve roles in functions such as insertion of the alien DNA
etc.
[0125] In some embodiments, the CRISPR-Cpf1 system is used. The
CRISPR-Cpf1 system, identified in Francisella spp, is a class 2
CRISPR-Cas system that mediates robust DNA interference in human
cells. Although functionally conserved, Cpf1 and Cas9 differ in
many aspects including in their guide RNAs and substrate
specificity (see Fagerlund et al, (2015) Genom Bio 16:251). A major
difference between Cas9 and Cpf1 proteins is that Cpf1 does not
utilize tracrRNA, and thus requires only a crRNA. The FnCpf1 crRNAs
are 42-44 nucleotides long (19-nucleotide repeat and
23-25-nucleotide spacer) and contain a single stem-loop, which
tolerates sequence changes that retain secondary structure. In
addition, the Cpf1 crRNAs are significantly shorter than the
.about.100-nucleotide engineered sgRNAs required by Cas9, and the
PAM requirements for FnCpf1 are 5'-TTN-3' and 5'-CTA-3' on the
displaced strand. Although both Cas9 and Cpf1 make double strand
breaks in the target DNA, Cas9 uses its RuvC- and HNH-like domains
to make blunt-ended cuts within the seed sequence of the guide RNA,
whereas Cpf1 uses a RuvC-like domain to produce staggered cuts
outside of the seed. Because Cpf1 makes staggered cuts away from
the critical seed region, NHEJ will not disrupt the target site,
therefore ensuring that Cpf1 can continue to cut the same site
until the desired HDR recombination event has taken place. Thus, in
the methods and compositions described herein, it is understood
that the term "Cas" includes both Cas9 and Cfp1 proteins. Thus, as
used herein, a "CRISPR/Cas system" refers both CRISPR/Cas and/or
CRISPR/Cfp1 systems, including both nuclease and/or transcription
factor systems.
[0126] In certain embodiments, Cas protein may be a "functional
derivative" of a naturally occurring Cas protein. A "functional
derivative" of a native sequence polypeptide is a compound having a
qualitative biological property in common with a native sequence
polypeptide. "Functional derivatives" include, but are not limited
to, fragments of a native sequence and derivatives of a native
sequence polypeptide and its fragments, provided that they have a
biological activity in common with a corresponding native sequence
polypeptide. A biological activity contemplated herein is the
ability of the functional derivative to hydrolyze a DNA substrate
into fragments. The term "derivative" encompasses both amino acid
sequence variants of polypeptide, covalent modifications, and
fusions thereof. Suitable derivatives of a Cas polypeptide or a
fragment thereof include but are not limited to mutants, fusions,
covalent modifications of Cas protein or a fragment thereof. Cas
protein, which includes Cas protein or a fragment thereof, as well
as derivatives of Cas protein or a fragment thereof, may be
obtainable from a cell or synthesized chemically or by a
combination of these two procedures. The cell may be a cell that
naturally produces Cas protein, or a cell that naturally produces
Cas protein and is genetically engineered to produce the endogenous
Cas protein at a higher expression level or to produce a Cas
protein from an exogenously introduced nucleic acid, which nucleic
acid encodes a Cas that is same or different from the endogenous
Cas. In some case, the cell does not naturally produce Cas protein
and is genetically engineered to produce a Cas protein.
[0127] In some embodiments, the DNA binding domain is part of a
TtAgo system (see Swarts et al, ibid; Sheng et al, ibid). In
eukaryotes, gene silencing is mediated by the Argonaute (Ago)
family of proteins. In this paradigm, Ago is bound to small (19-31
nt) RNAs. This protein-RNA silencing complex recognizes target RNAs
via Watson-Crick base pairing between the small RNA and the target
and endonucleolytically cleaves the target RNA (Vogel (2014)
Science 344:972-973). In contrast, prokaryotic Ago proteins bind to
small single-stranded DNA fragments and likely function to detect
and remove foreign (often viral) DNA (Yuan et al., (2005) Mol. Cell
19, 405; Olovnikov, et al. (2013)Mol. Cell 51, 594; Swarts et al.,
ibid). Exemplary prokaryotic Ago proteins include those from
Aquifex aeolicus, Rhodobacter sphaeroides, and Thermus
thermophilus.
[0128] One of the most well-characterized prokaryotic Ago protein
is the one from T. thermophilus (TtAgo; Swarts et al. ibid). TtAgo
associates with either 15 nt or 13-25 nt single-stranded DNA
fragments with 5' phosphate groups. This "guide DNA" bound by TtAgo
serves to direct the protein-DNA complex to bind a Watson-Crick
complementary DNA sequence in a third-party molecule of DNA. Once
the sequence information in these guide DNAs has allowed
identification of the target DNA, the TtAgo-guide DNA complex
cleaves the target DNA. Such a mechanism is also supported by the
structure of the TtAgo-guide DNA complex while bound to its target
DNA (G. Sheng et al., ibid). Ago from Rhodobacter sphaeroides
(RsAgo) has similar properties (Olivnikov et al. ibid).
[0129] Exogenous guide DNAs of arbitrary DNA sequence can be loaded
onto the TtAgo protein (Swarts et al. ibid.). Since the specificity
of TtAgo cleavage is directed by the guide DNA, a TtAgo-DNA complex
formed with an exogenous, investigator-specified guide DNA will
therefore direct TtAgo target DNA cleavage to a complementary
investigator-specified target DNA. In this way, one may create a
targeted double-strand break in DNA. Use of the TtAgo-guide DNA
system (or orthologous Ago-guide DNA systems from other organisms)
allows for targeted cleavage of genomic DNA within cells. Such
cleavage can be either single- or double-stranded. For cleavage of
mammalian genomic DNA, it would be preferable to use of a version
of TtAgo codon optimized for expression in mammalian cells.
Further, it might be preferable to treat cells with a TtAgo-DNA
complex formed in vitro where the TtAgo protein is fused to a
cell-penetrating peptide. Further, it might be preferable to use a
version of the TtAgo protein that has been altered via mutagenesis
to have improved activity at 37 degrees Celcius. Ago-RNA-mediated
DNA cleavage could be used to effect a panopoly of outcomes
including gene knock-out, targeted gene addition, gene correction,
targeted gene deletion using techniques standard in the art for
exploitation of DNA breaks.
[0130] Thus, the nuclease comprises a DNA-binding domain in that
specifically binds to a target site in any gene into which it is
desired to insert a donor (transgene). The DNA-binding domains
described herein typically bind to a target site comprising 12 to
35 nucleotides (or any value therebetween). The nucleotides within
the target sites that are bound by the DNA-binding domain may be
contiguous or non-contiguous (e.g., the DNA-binding domain may bind
to less than all base pairs making up the target site).
B. Cleavage Domains
[0131] Any suitable cleavage domain can be operatively linked to a
DNA-binding domain to form a nuclease. For example, ZFP DNA-binding
domains have been fused to nuclease domains to create ZFNs--a
functional entity that is able to recognize its intended nucleic
acid target through its engineered (ZFP) DNA binding domain and
cause the DNA to be cut near the ZFP binding site via the nuclease
activity. See, e.g., Kim et al. (1996) Proc Natl Acad Sci USA
93(3):1156-1160. More recently, ZFNs have been used for genome
modification in a variety of organisms. See, for example, United
States Patent Publications 20030232410; 20050208489; 20050026157;
20050064474; 20060188987; 20060063231; and International
Publication WO 07/014275. Likewise, TALE DNA-binding domains have
been fused to nuclease domains to create TALENs. See, e.g., U.S.
Pat. No. 8,586,526.
[0132] As noted above, the cleavage domain may be heterologous to
the DNA-binding domain, for example a zinc finger DNA-binding
domain and a cleavage domain from a nuclease or a TALEN DNA-binding
domain and a cleavage domain, or meganuclease DNA-binding domain
and cleavage domain from a different nuclease. Heterologous
cleavage domains can be obtained from any endonuclease or
exonuclease. Exemplary endonucleases from which a cleavage domain
can be derived include, but are not limited to, restriction
endonucleases and homing endonucleases. See, for example, 2002-2003
Catalogue, New England Biolabs, Beverly, Mass.; and Belfort et al.
(1997) Nucleic Acids Res. 25:3379-3388. Additional enzymes which
cleave DNA are known (e.g., 51 Nuclease; mung bean nuclease;
pancreatic DNase I; micrococcal nuclease; yeast HO endonuclease;
see also Linn et al. (eds.) Nucleases, Cold Spring Harbor
Laboratory Press, 1993). One or more of these enzymes (or
functional fragments thereof) can be used as a source of cleavage
domains and cleavage half-domains.
[0133] Similarly, a cleavage half-domain can be derived from any
nuclease or portion thereof, as set forth above, that requires
dimerization for cleavage activity. In general, two fusion proteins
are required for cleavage if the fusion proteins comprise cleavage
half-domains. Alternatively, a single protein comprising two
cleavage half-domains can be used. The two cleavage half-domains
can be derived from the same endonuclease (or functional fragments
thereof), or each cleavage half-domain can be derived from a
different endonuclease (or functional fragments thereof). In
addition, the target sites for the two fusion proteins are
preferably disposed, with respect to each other, such that binding
of the two fusion proteins to their respective target sites places
the cleavage half-domains in a spatial orientation to each other
that allows the cleavage half-domains to form a functional cleavage
domain, e.g., by dimerizing. Thus, in certain embodiments, the near
edges of the target sites are separated by 5-8 nucleotides or by
15-18 nucleotides. However any integral number of nucleotides or
nucleotide pairs can intervene between two target sites (e.g., from
2 to 50 nucleotide pairs or more). In general, the site of cleavage
lies between the target sites.
[0134] Restriction endonucleases (restriction enzymes) are present
in many species and are capable of sequence-specific binding to DNA
(at a recognition site), and cleaving DNA at or near the site of
binding. Certain restriction enzymes (e.g., Type IIS) cleave DNA at
sites removed from the recognition site and have separable binding
and cleavage domains. For example, the Type IIS enzyme Fok I
catalyzes double-stranded cleavage of DNA, at 9 nucleotides from
its recognition site on one strand and 13 nucleotides from its
recognition site on the other. See, for example, U.S. Pat. Nos.
5,356,802; 5,436,150 and 5,487,994; as well as Li et al. (1992)
Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al. (1993) Proc.
Natl. Acad. Sci. USA 90:2764-2768; Kim et al. (1994a) Proc. Natl.
Acad. Sci. USA 91:883-887; Kim et al. (1994b) J. Biol. Chem.
269:31,978-31,982. Thus, in one embodiment, fusion proteins
comprise the cleavage domain (or cleavage half-domain) from at
least one Type IIS restriction enzyme and one or more zinc finger
binding domains, which may or may not be engineered.
[0135] An exemplary Type IIS restriction enzyme, whose cleavage
domain is separable from the binding domain, is Fok I. This
particular enzyme is active as a dimer. Bitinaite et al. (1998)
Proc. Natl. Acad. Sci. USA 95: 10,570-10,575. Accordingly, for the
purposes of the present disclosure, the portion of the Fok I enzyme
used in the disclosed fusion proteins is considered a cleavage
half-domain. Thus, for targeted double-stranded cleavage and/or
targeted replacement of cellular sequences using zinc finger-Fok I
fusions, two fusion proteins, each comprising a FokI cleavage
half-domain, can be used to reconstitute a catalytically active
cleavage domain. Alternatively, a single polypeptide molecule
containing a zinc finger binding domain and two Fok I cleavage
half-domains can also be used. Parameters for targeted cleavage and
targeted sequence alteration using zinc finger-Fok I fusions are
provided elsewhere in this disclosure.
[0136] A cleavage domain or cleavage half-domain can be any portion
of a protein that retains cleavage activity, or that retains the
ability to multimerize (e.g., dimerize) to form a functional
cleavage domain.
[0137] Exemplary Type IIS restriction enzymes are described in U.S.
Pat. No. 7,888,121, incorporated herein in its entirety. Additional
restriction enzymes also contain separable binding and cleavage
domains, and these are contemplated by the present disclosure. See,
for example, Roberts et al. (2003) Nucleic Acids Res.
31:418-420.
[0138] In certain embodiments, the cleavage domain comprises one or
more engineered cleavage half-domain (also referred to as
dimerization domain mutants) that minimize or prevent
homodimerization, as described, for example, in U.S. Pat. Nos.
8,772,453; 8,623,618; 8,409,861; 8,034,598; 7,914,796; and
7,888,121, the disclosures of all of which are incorporated by
reference in their entireties herein. Amino acid residues at
positions 446, 447, 479, 483, 484, 486, 487, 490, 491, 496, 498,
499, 500, 531, 534, 537, and 538 of Fok I are all targets for
influencing dimerization of the Fok I cleavage half-domains.
[0139] Exemplary engineered cleavage half-domains of Fok I that
form obligate heterodimers include a pair in which a first cleavage
half-domain includes mutations at amino acid residues at positions
490 and 538 of Fok I and a second cleavage half-domain includes
mutations at amino acid residues 486 and 499.
[0140] Thus, in one embodiment, a mutation at 490 replaces Glu (E)
with Lys (K); the mutation at 538 replaces Iso (I) with Lys (K);
the mutation at 486 replaced Gln (Q) with Glu (E); and the mutation
at position 499 replaces Iso (I) with Lys (K). Specifically, the
engineered cleavage half-domains described herein were prepared by
mutating positions 490 (E.fwdarw.K) and 538 (I.fwdarw.K) in one
cleavage half-domain to produce an engineered cleavage half-domain
designated "E490K:I538K" and by mutating positions 486 (Q.fwdarw.E)
and 499 (I.fwdarw.L) in another cleavage half-domain to produce an
engineered cleavage half-domain designated "Q486E:I499L". The
engineered cleavage half-domains described herein are obligate
heterodimer mutants in which aberrant cleavage is minimized or
abolished. See, e.g., U.S. Pat. Nos. 7,914,796 and 8,034,598, the
disclosures of which are incorporated by reference in their
entireties for all purposes. In certain embodiments, the engineered
cleavage half-domain comprises mutations at positions 486, 499 and
496 (numbered relative to wild-type FokI), for instance mutations
that replace the wild type Gln (Q) residue at position 486 with a
Glu (E) residue, the wild type Iso (I) residue at position 499 with
a Leu (L) residue and the wild-type Asn (N) residue at position 496
with an Asp (D) or Glu (E) residue (also referred to as a "ELD" and
"ELE" domains, respectively). In other embodiments, the engineered
cleavage half-domain comprises mutations at positions 490, 538 and
537 (numbered relative to wild-type FokI), for instance mutations
that replace the wild type Glu (E) residue at position 490 with a
Lys (K) residue, the wild type Iso (I) residue at position 538 with
a Lys (K) residue, and the wild-type His (H) residue at position
537 with a Lys (K) residue or a Arg (R) residue (also referred to
as "KKK" and "KKR" domains, respectively). In other embodiments,
the engineered cleavage half-domain comprises mutations at
positions 490 and 537 (numbered relative to wild-type FokI), for
instance mutations that replace the wild type Glu (E) residue at
position 490 with a Lys (K) residue and the wild-type His (H)
residue at position 537 with a Lys (K) residue or a Arg (R) residue
(also referred to as "KIK" and "KIR" domains, respectively). See,
e.g., U.S. Pat. No. 8,772,453. In other embodiments, the engineered
cleavage half domain comprises the "Sharkey" and/or "Sharkey'"
mutations (see Guo et al, (2010) J. Mol. Biol. 400(1):96-107).
[0141] Engineered cleavage half-domains described herein can be
prepared using any suitable method, for example, by site-directed
mutagenesis of wild-type cleavage half-domains (Fok I) as described
in U.S. Pat. Nos. 8,772,453; 8,623,618; 8,409,861; 8,034,598;
7,914,796; and 7,888,121.
[0142] Alternatively, nucleases may be assembled in vivo at the
nucleic acid target site using so-called "split-enzyme" technology
(see e.g. U.S. Patent Publication No. 20090068164). Components of
such split enzymes may be expressed either on separate expression
constructs, or can be linked in one open reading frame where the
individual components are separated, for example, by a
self-cleaving 2A peptide or IRES sequence. Components may be
individual zinc finger binding domains or domains of a meganuclease
nucleic acid binding domain.
[0143] Nucleases can be screened for activity prior to use, for
example in a yeast-based chromosomal system as described in U.S.
Pat. No. 8,563,314.
[0144] Expression of the nuclease may be under the control of a
constitutive promoter or an inducible promoter, for example the
galactokinase promoter which is activated (de-repressed) in the
presence of raffinose and/or galactose and repressed in presence of
glucose.
[0145] The Cas9 related CRISPR/Cas system comprises two RNA
non-coding components: tracrRNA and a pre-crRNA array containing
nuclease guide sequences (spacers) interspaced by identical direct
repeats (DRs). To use a CRISPR/Cas system to accomplish genome
engineering, both functions of these RNAs must be present (see Cong
et al, (2013) Sciencexpress 1/10.1126/science 1231143). In some
embodiments, the tracrRNA and pre-crRNAs are supplied via separate
expression constructs or as separate RNAs. In other embodiments, a
chimeric RNA is constructed where an engineered mature crRNA
(conferring target specificity) is fused to a tracrRNA (supplying
interaction with the Cas9) to create a chimeric cr-RNA-tracrRNA
hybrid (also termed a single guide RNA). (see Jinek ibid and Cong,
ibid).
Target Sites
[0146] As described in detail above, DNA domains can be engineered
to bind to any sequence of choice. An engineered DNA-binding domain
can have a novel binding specificity, compared to a
naturally-occurring DNA-binding domain. Engineering methods
include, but are not limited to, rational design and various types
of selection. Rational design includes, for example, using
databases comprising triplet (or quadruplet) nucleotide sequences
and individual zinc finger amino acid sequences, in which each
triplet or quadruplet nucleotide sequence is associated with one or
more amino acid sequences of zinc fingers which bind the particular
triplet or quadruplet sequence. See, for example, co-owned U.S.
Pat. Nos. 6,453,242 and 6,534,261, incorporated by reference herein
in their entireties. Rational design of TAL-effector domains can
also be performed. See, e.g., U.S. Pat. No. 8,586,526.
[0147] Exemplary selection methods applicable to DNA-binding
domains, including phage display and two-hybrid systems, are
disclosed in U.S. Pat. Nos. 5,789,538; 5,925,523; 6,007,988;
6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; as well
as WO 98/37186; WO 98/53057; WO 00/27878; WO 01/88197 and GB
2,338,237. In addition, enhancement of binding specificity for zinc
finger binding domains has been described, for example, in co-owned
WO 02/077227.
[0148] Selection of target sites; nucleases and methods for design
and construction of fusion proteins (and polynucleotides encoding
same) are known to those of skill in the art and described in
detail in U.S. Patent Application Publication Nos. 20050064474 and
20060188987, incorporated by reference in their entireties
herein.
[0149] In addition, as disclosed in these and other references,
DNA-binding domains (e.g., multi-fingered zinc finger proteins) may
be linked together using any suitable linker sequences, including
for example, linkers of 5 or more amino acids. See, e.g., U.S. Pat.
Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary linker
sequences 6 or more amino acids in length. The proteins described
herein may include any combination of suitable linkers between the
individual DNA-binding domains of the protein. See, also, U.S. Pat.
No. 8,586,526.
[0150] Non-limiting examples of suitable target genes include a
beta (.beta.) globin gene (HBB), a gamma (.delta.) globin gene
(HBG1), a B-cell lymphoma/leukemia 11A (BCL11A) gene, a
Kruppel-like factor 1 (KLF1) gene, a CCR5 gene, a CXCR4 gene, a
PPP1R12C (AAVS1) gene, an hypoxanthine phosphoribosyltransferase
(HPRT) gene, an albumin gene, a Factor VIII gene, a Factor IX gene,
a Leucine-rich repeat kinase 2 (LRRK2) gene, a Hungtingin (Htt)
gene, a rhodopsin (RHO) gene, a Cystic Fibrosis Transmembrane
Conductance Regulator (CFTR) gene, a surfactant protein B gene
(SFTPB), a T-cell receptor alpha (TRAC) gene, a T-cell receptor
beta (TRBC) gene, a programmed cell death 1 (PD1) gene, a Cytotoxic
T-Lymphocyte Antigen 4 (CTLA-4) gene, an human leukocyte antigen
(HLA) A gene, an HLA B gene, an HLA C gene, an HLA-DPA gene, an
HLA-DQ gene, an HLA-DRA gene, a LMP7 gene, a Transporter associated
with Antigen Processing (TAP) 1 gene, a TAP2 gene, a tapasin gene
(TAPBP), a class II major histocompatibility complex transactivator
(CIITA) gene, a dystrophin gene (DMD), a glucocorticoid receptor
gene (GR), an IL2RG gene, a Rag-1 gene, an RFXS gene, a FAD2 gene,
a FAD3 gene, a ZP15 gene, a KASII gene, a MDH gene, and/or an EPSPS
gene. In some aspects, the nuclease(s) binds to and/or cleaves a
check point inhibitor gene, for example PD-1, CTLA4, receptors for
the B7 family of inhibitory ligands, or cleaves a receptor or
ligand gene involved in signaling through LAG3, 2B4, BTLA, TIM3,
A2aR, and killer inhibitor receptors (KIRs and C-type lectin
receptors), see Pardoll (2012) Nat Rev Cancer 12(4):252. See, also,
U.S. Pat. Nos. 8,956,828 and 8,945,868 and U.S. Patent Publication
No. 20140120622 and 20150056705.
[0151] In other aspects, the nuclease(s) binds to and/or cleaves a
gene that encodes a factor involved in rejection, for example,
genes encoding subunits of the HLA complex (class I: HLA-A, HLA-B,
HLA-C, HLA-E, HLA-F, HLA-G, B2M; class II: HLA-DMA, HLA-DOA,
HLA-DPA1, HLA-DQA, HLA-DRA, HLA-DMB, HLA-DOB, HLA-DPB1, HLA-DQB,
HLA-DRB) or TCR. In some embodiments, the nuclease(s) target a gene
encoding a product involved in the peptide loading process and
antigen processing for the HLA complexes (e.g. TAP, tapasin,
calreticulin, calnexin, LMP2, LMP7 or Erp57). See, e.g., U.S. Pat.
Nos. 8,956,828 and 8,945,868.
[0152] In certain embodiments, the nuclease targets a "safe harbor"
loci such as the AAVS1, HPRT, albumin and CCR5 genes in human
cells, and Rosa26 in murine cells (see, e.g., U.S. Pat. Nos.
7,888,121; 7,972,854; 7,914,796; 7,951,925; 8,110,379; 8,409,861;
8,586,526; U.S. Patent Publications 20030232410; 20050208489;
20050026157; 20060063231; 20080159996; 201000218264; 20120017290;
20110265198; 20130137104; 20130122591; 20130177983 and 20130177960)
and the Zp15 locus in plants (see U.S. Pat. No. 8,329,986).
Donors
[0153] The present disclosure relates to nuclease-mediated targeted
integration of an exogenous sequence into the genome of an HSC/PC.
As noted above, insertion of an exogenous sequence (also called a
"donor sequence" or "donor" or "transgene"), for example for
correction of a mutant gene or for increased expression of a
wild-type gene or for expression of a transgene. It will be readily
apparent that the donor sequence is typically not identical to the
genomic sequence where it is placed. A donor sequence can contain a
non-homologous sequence flanked by two regions of homology to allow
for efficient HDR at the location of interest. Additionally, donor
sequences can comprise a vector molecule containing sequences that
are not homologous to the region of interest in cellular chromatin.
A donor molecule can contain several, discontinuous regions of
homology to cellular chromatin. For example, for targeted insertion
of sequences not normally present in a region of interest, said
sequences can be present in a donor nucleic acid molecule and
flanked by regions of homology to sequence in the region of
interest.
[0154] Described herein are methods of targeted insertion of any
polynucleotides for insertion into a chosen location.
Polynucleotides for insertion can also be referred to as
"exogenous" polynucleotides, "donor" polynucleotides or molecules
or "transgenes." The donor polynucleotide can be DNA,
single-stranded and/or double-stranded and can be introduced into a
cell in linear or circular form. See, e.g., U.S. Patent Publication
Nos. 20100047805 and 20110207221. The donor sequence(s) can also be
introduced in DNA MC form, which may be introduced into the cell in
circular or linear form. If introduced in linear form, the ends of
the donor sequence can be protected (e.g., from exonucleolytic
degradation) by methods known to those of skill in the art. For
example, one or more dideoxynucleotide residues are added to the 3'
terminus of a linear molecule and/or self-complementary
oligonucleotides are ligated to one or both ends. See, for example,
Chang et al. (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls
et al. (1996) Science 272:886-889. Additional methods for
protecting exogenous polynucleotides from degradation include, but
are not limited to, addition of terminal amino group(s) and the use
of modified internucleotide linkages such as, for example,
phosphorothioates, phosphoramidates, and O-methyl ribose or
deoxyribose residues. If introduced in double-stranded form, the
donor may include one or more nuclease target sites, for example,
nuclease target sites flanking the transgene to be integrated into
the cell's genome. See, e.g., U.S. Patent Publication No.
20130326645.
[0155] A polynucleotide can be introduced into a cell as part of a
vector molecule having additional sequences such as, for example,
replication origins, promoters and genes encoding antibiotic
resistance. Moreover, donor polynucleotides can be introduced as
naked nucleic acid, as nucleic acid complexed with an agent such as
a liposome, nanoparticle or poloxamer, or can be delivered by
viruses (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus
and integrase defective lentivirus (IDLV)).
[0156] In certain embodiments, the double-stranded donor includes
sequences (e.g., coding sequences, also referred to as transgenes)
greater than 1 kb in length, for example between 2 and 200 kb,
between 2 and 10 kb (or any value therebetween). The
double-stranded donor also includes at least one nuclease target
site, for example. In certain embodiments, the donor includes at
least 2 target sites, for example for a pair of ZFNs or TALENs.
Typically, the nuclease target sites are outside the transgene
sequences, for example, 5' and/or 3' to the transgene sequences,
for cleavage of the transgene. The nuclease cleavage site(s) may be
for any nuclease(s). In certain embodiments, the nuclease target
site(s) contained in the double-stranded donor are for the same
nuclease(s) used to cleave the endogenous target into which the
cleaved donor is integrated via homology-independent methods.
[0157] The donor is generally inserted so that its expression is
driven by the endogenous promoter at the integration site, namely
the promoter that drives expression of the endogenous gene into
which the donor is inserted (e.g., globin, AAVS1, etc.). However,
it will be apparent that the donor may comprise a promoter and/or
enhancer, for example a constitutive promoter or an inducible or
tissue specific promoter.
[0158] The donor molecule may be inserted into an endogenous gene
such that all, some or none of the endogenous gene is expressed. In
other embodiments, the transgene (e.g., with or without
peptide-encoding sequences) is integrated into any endogenous
locus, for example a safe-harbor locus. See, e.g., US patent
publications 20080299580; 20080159996 and 201000218264.
[0159] Furthermore, although not required for expression, exogenous
sequences may also include transcriptional or translational
regulatory sequences, for example, promoters, enhancers,
insulators, internal ribosome entry sites, sequences encoding 2A
peptides and/or polyadenylation signals. Additionally, splice
acceptor sequences may be included. Exemplary splice acceptor site
sequences are known to those of skill in the art and include, by
way of example only, CTGACCTCTTCTCTTCCTCCCACAG, (SEQ ID NO:1) (from
the human HBB gene) and TTTCTCTCCACAG (SEQ ID NO:2) (from the human
Immunoglobulin-gamma gene).
[0160] The transgenes carried on the donor sequences described
herein may be isolated from plasmids, cells or other sources using
standard techniques known in the art such as PCR. Donors for use
can include varying types of topology, including circular
supercoiled, circular relaxed, linear and the like. Alternatively,
they may be chemically synthesized using standard oligonucleotide
synthesis techniques. In addition, donors may be methylated or lack
methylation. Donors may be in the form of bacterial or yeast
artificial chromosomes (BACs or YACs).
[0161] The double-stranded donor polynucleotides described herein
may include one or more non-natural bases and/or backbones. In
particular, insertion of a donor molecule with methylated cytosines
may be carried out using the methods described herein to achieve a
state of transcriptional quiescence in a region of interest.
[0162] The exogenous (donor) polynucleotide may comprise any
sequence of interest (exogenous sequence). Exemplary exogenous
sequences include, but are not limited to any polypeptide coding
sequence (e.g., cDNAs or fragments thereof), promoter sequences,
enhancer sequences, epitope tags, marker genes, cleavage enzyme
recognition sites and various types of expression constructs.
Marker genes include, but are not limited to, sequences encoding
proteins that mediate antibiotic resistance (e.g., ampicillin
resistance, neomycin resistance, G418 resistance, puromycin
resistance), sequences encoding colored or fluorescent or
luminescent proteins (e.g., green fluorescent protein, enhanced
green fluorescent protein, red fluorescent protein, luciferase),
and proteins which mediate enhanced cell growth and/or gene
amplification (e.g., dihydrofolate reductase). Epitope tags
include, for example, one or more copies of FLAG, His, myc, Tap, HA
or any detectable amino acid sequence.
[0163] In a preferred embodiment, the exogenous sequence
(transgene) comprises a polynucleotide encoding any polypeptide of
which expression in the cell is desired, including, but not limited
to antibodies, antigens, enzymes, receptors (cell surface or
nuclear), hormones, lymphokines, cytokines, reporter polypeptides,
growth factors, and functional fragments of any of the above. The
coding sequences may be, for example, cDNAs. The exogenous
sequences may also be a fragment of a transgene for linking with an
endogenous gene sequence of interest. For example, a fragment of a
transgene comprising sequence at the 3' end of a gene of interest
may be utilized to correct, via insertion or replacement, of a
sequence encoding a mutation in the 3' end of an endogenous gene
sequence. Similarly, the fragment may comprise sequences similar to
the 5' end of the endogenous gene for insertion/replacement of the
endogenous sequences to correct or modify such endogenous sequence.
Additionally the fragment may encode a functional domain of
interest (catalytic, secretory or the like) for linking in situ to
an endogenous gene sequence to produce a fusion protein.
[0164] For example, the exogenous sequence may comprise a sequence
encoding a polypeptide that is lacking or non-functional in the
subject having a genetic disease, including but not limited to any
of the following genetic diseases: achondroplasia, achromatopsia,
acid maltase deficiency, adenosine deaminase deficiency (OMIM No.
102700), adrenoleukodystrophy, aicardi syndrome, alpha-1
antitrypsin deficiency, alpha-thalassemia, androgen insensitivity
syndrome, apert syndrome, arrhythmogenic right ventricular,
dysplasia, ataxia telangictasia, barth syndrome, beta-thalassemia,
blue rubber bleb nevus syndrome, canavan disease, chronic
granulomatous diseases (CGD), cri du chat syndrome, cystic
fibrosis, dercum's disease, ectodermal dysplasia, fanconi anemia,
fibrodysplasia ossificans progressive, fragile X syndrome,
galactosemis, Gaucher's disease, generalized gangliosidoses (e.g.,
GM1), hemochromatosis, the hemoglobin C mutation in the 6.sup.th
codon of beta-globin (HbC), hemophilia, Huntington's disease,
Hurler Syndrome, hypophosphatasia, Klinefleter syndrome, Krabbes
Disease, Langer-Giedion Syndrome, leukocyte adhesion deficiency
(LAD, OMIM No. 116920), leukodystrophy, long QT syndrome, Marfan
syndrome, Moebius syndrome, mucopolysaccharidosis (MPS), nail
patella syndrome, nephrogenic diabetes insipdius,
neurofibromatosis, Neimann-Pick disease, osteogenesis imperfecta,
porphyria, Prader-Willi syndrome, progeria, Proteus syndrome,
retinoblastoma, Rett syndrome, Rubinstein-Taybi syndrome,
Sanfilippo syndrome, severe combined immunodeficiency (SCID),
Shwachman syndrome, sickle cell disease (sickle cell anemia),
Smith-Magenis syndrome, Stickler syndrome, Tay-Sachs disease,
Thrombocytopenia Absent Radius (TAR) syndrome, Treacher Collins
syndrome, trisomy, tuberous sclerosis, Turner's syndrome, urea
cycle disorder, von Hippel-Landau disease, Waardenburg syndrome,
Williams syndrome, Wilson's disease, Wiskott-Aldrich syndrome,
X-linked lymphoproliferative syndrome (XLP, OMIM No. 308240).
[0165] Additional exemplary diseases that can be treated by
targeted integration include acquired immunodeficiencies, lysosomal
storage diseases (e.g., Gaucher's disease, GM1, Fabry disease and
Tay-Sachs disease), mucopolysaccahidosis (e.g. Hunter's disease,
Hurler's disease), hemoglobinopathies (e.g., sickle cell diseases,
HbC, .alpha.-thalassemia, .beta.-thalassemia) and hemophilias.
[0166] In certain embodiments, the exogenous sequences can comprise
a marker gene (described above), allowing selection of cells that
have undergone targeted integration, and a linked sequence encoding
an additional functionality. Non-limiting examples of marker genes
include GFP, drug selection marker(s) and the like.
[0167] Additional gene sequences that can be inserted may include,
for example, wild-type genes to replace mutated sequences. For
example, a wild-type Factor IX gene sequence may be inserted into
the genome of a stem cell in which the endogenous copy of the gene
is mutated. The wild-type copy may be inserted at the endogenous
locus, or may alternatively be targeted to a safe harbor locus.
[0168] In some embodiments, the donor sequence encodes a receptor
that serves to direct the function of a T cell. Chimeric Antigen
Receptors (CARs) are molecules designed to target immune cells to
specific molecular targets expressed on cell surfaces. In their
most basic form, they are receptors introduced to a cell that
couple a specificity domain expressed on the outside of the cell to
signaling pathways on the inside of the cell such that when the
specificity domain interacts with its target, the cell becomes
activated. Often CARs are made from variants of T-cell receptors
(TCRs) where a specificity domain such as a scFv or some type of
receptor is fused to the signaling domain of a TCR. These
constructs are then introduced into a T cell allowing the T cell to
become activated in the presence of a cell expressing the target
antigen, resulting in the attack on the targeted cell by the
activated T cell in a non-MHC dependent manner (see Chicaybam et al
(2011) Int Rev Immunol 30:294-311). Alternatively, CAR expression
cassettes can be introduced into an HSC/PC for later engraftment
such that the CAR cassette is under the control of a T cell
specific promoter (e.g., the FOXP3 promoter, see Mantel et al
(2006) J. Immunol 176: 3593-3602).
[0169] Currently, tumor specific CARs targeting a variety of tumor
antigens are being tested in the clinic for treatment of a variety
of different cancers. Examples of these cancers and their antigens
that are being targeted includes follicular lymphoma (CD20 or GD2),
neuroblastoma (CD171), non-Hodgkin lymphoma (CD20), lymphoma
(CD19), glioblastoma (IL13R.alpha.2), chronic lymphocytic leukemia
or CLL and acute lymphocytic leukemia or ALL (both CD19).
[0170] Virus specific CARs have also been developed to attack cells
harboring virus such as HIV. For example, a clinical trial was
initiated using a CAR specific for Gp100 for treatment of HIV
(Chicaybam, ibid). Other virus specific CARs could be developed to
target Ebola to knock out cells harboring the Ebola virus, or CAR
containing T cells can be used post-transplant to target CMV,
adenovirus and/or EBV using engineered T cells comprising CARs
specific for these viruses.
[0171] CARs are also being developed for the treatment of
autoimmune disease. Regulatory T cells (Tregs) are a subset of CD4+
T cells that constiutively express the IL-2 receptor alpha chain
and the transcription factor FoxP3. Tregs are believed to suppress
colitis, for example, by inhibiting effector T cell proliferation
and the production of proinflammatory cytokines, as well as
hindering components of the innate immune system. Due to the
scarcity of T regs to a specific antigen, researchers are exploring
the potential of adoptive transfer of engineered antigen specific
Tregs where the T cells have been modified to express a CAR against
an antigen associated with autoimmunity (e.g, CEA for colitis, see
Blat et al (2014) Mol Ther 22(5): 1018).
[0172] The T cell receptor (TCR) is an essential part of the
selective activation of T cells and is typically made from two
chains, a and (3, which co-assemble to form a heterodimer. The
genomic loci that encode the TCR chains resemble antibody encoding
loci in that the TCR a gene comprises V and J segments, while the
.beta. chain locus comprises D segments in addition to V and J
segments. Additionally, the TCR complex makes up part of the CD3
antigen complex on T cells. During T cell activation, the TCR
interacts with antigens displayed on the major histocompatability
complex (MHC) of an antigen presenting cell. Recognition of the
antigen-MHC complex by the TCR leads to T cell stimulation, which
in turn leads to differentiation of both T helper cells (CD4+) and
cytotoxic T lymphocytes (CD8+) in memory and effector lymphocytes.
Thus, use of an engineered TCR can also lead to alter the direction
of T cell activity (see U.S. Pat. No. 8,956,828), and the donor
sequence can comprise engineered sequences encoding a TCR. In some
embodiments, the endogenous TCR is also disrupted through use an
engineered nuclease designed to cleave a gene encoding an
endogenous TCR subunit (i.e. TRAC or TRBC). See, e.g., U.S. Pat.
Nos. 8,956,828 and 8,945,868.
[0173] Antibody coupled-T cell receptor (ACTR) technology is the
use of a single species of T cell comprising the ACTR molecule that
is combined with a variety of different antibodies to direct the T
cells. An ACTR is a membrane spanning protein composed of a CD3t
signaling domain, a 4-1BB co-stimulatory domain, a CD8 membrane
spanning and hinge domain, and a CD16 Fc receptor domain. This
protein is expressed in T cells and then is combined in vivo with
an antibody such that the antibody associates with the T cell
expressing the ACTR, and the antibody-ACTR complex serves to target
the TCR to a specific cell or tissue that expresses the specific
antigen that the antibody binds to. In some embodiments, the T cell
to be modified with the ACTR is derived from the patient. In other
embodiments, the T cell is a `universal` T cell where specific
endogenous T cell receptors (e.g. TCR, MHC) have been inactivated.
In some cases, the receptors are inactivated with an engineered
nuclease, creating a bank of T cells that will not react with host
antigens in the absence of the ACTR-antibody complex.
[0174] Construction of such expression cassettes, following the
teachings of the present specification, utilizes methodologies well
known in the art of molecular biology (see, for example, Ausubel or
Maniatis). Before use of the expression cassette to generate a
transgenic animal, the responsiveness of the expression cassette to
the stress-inducer associated with selected control elements can be
tested by introducing the expression cassette into a suitable cell
line (e.g., primary cells, transformed cells, or immortalized cell
lines).
[0175] Furthermore, although not required for expression, exogenous
sequences may also transcriptional or translational regulatory
sequences, for example, promoters, enhancers, insulators, internal
ribosome entry sites, sequences encoding 2A peptides and/or
polyadenylation signals. Further, the control elements of the genes
of interest can be operably linked to reporter genes to create
chimeric genes (e.g., reporter expression cassettes).
[0176] Targeted insertion of non-coding nucleic acid sequence may
also be achieved. Sequences encoding antisense RNAs, RNAi, shRNAs
and micro RNAs (miRNAs) may also be used for targeted
insertions.
[0177] In additional embodiments, the donor nucleic acid may
comprise non-coding sequences that are specific target sites for
additional nuclease designs. Subsequently, additional nucleases may
be expressed in cells such that the original donor molecule is
cleaved and modified by insertion of another donor molecule of
interest. In this way, reiterative integrations of donor molecules
may be generated allowing for trait stacking at a particular locus
of interest or at a safe harbor locus.
[0178] The donor(s) may be delivered prior to, simultaneously or
after the nuclease(s) is(are) introduced into a cell. In certain
embodiments, the donor(s) are delivered simultaneously with the
nuclease(s). In other embodiments, the donors are delivered prior
to the nuclease(s), for example, seconds to hours to days before
the donors, including, but not limited to, 1 to 60 minutes (or any
time therebetween) before the nuclease(s), 1 to 24 hours (or any
time therebetween) before the nuclease(s) or more than 24 hours
before the nuclease(s). In certain embodiments, the donor is
delivered after the nuclease, preferably within 4 hours.
[0179] The donors may be delivered using the same delivery systems
as the nuclease(s). When delivered simultaneously, the donors and
nucleases may be on the same vector, for example an AAV vector
(e.g., AAV6). In certain embodiments, the donors are delivered
using an AAV vector and the nuclease(s) are delivered in mRNA
form.
Cells
[0180] Thus, provided herein are genetically modified cells, for
example primary HSC/PC or T cells comprising a transgene, including
a transgene that expresses a functional protein in the cell. Cells
produced by the methods described herein are also provided. The
transgene is integrated in a targeted manner into the cell's genome
using one or more nucleases. In certain embodiments, the transgene
is integrated into a safe harbor gene.
[0181] Unlike random integration, targeted integration ensures that
the transgene is integrated into a specified gene or locus. The
transgene may be integrated anywhere in the target gene. In certain
embodiments, the transgene is integrated at or near the nuclease
cleavage site, for example, within 1-300 (or any value
therebetween) base pairs upstream or downstream of the site of
cleavage, more preferably within 1-100 base pairs (or any value
therebetween) of either side of the cleavage site, even more
preferably within 1 to 50 base pairs (or any value therebetween) of
either side of the cleavage site. In certain embodiments, the
integrated sequence comprising the transgene does not include any
vector sequences (e.g., viral vector sequences).
[0182] Any cell type can be genetically modified as described
herein, including but not limited to cells and cell lines. Other
non-limiting examples of cells as described herein include T-cells
(e.g., CD4+, CD3+, CD8+ (including Tregs), etc.); dendritic cells;
B-cells; autologous (e.g., patient-derived) or heterologous
pluripotent, totipotent or multipotent stem cells (e.g., CD34+
cells, induced pluripotent stem cells (iPSCs), embryonic stem cells
or the like). In certain embodiments, the cells as described herein
are CD34+ cells derived from a patient with a disorder it is
desired to treat.
[0183] The cells as described herein are useful in treating and/or
preventing a disorder, for example, by ex vivo therapies. The
nuclease-modified cells can be expanded and then reintroduced into
the patient using standard techniques. See, e.g., Tebas et al
(2014) New Eng J Med 370(10):901. In the case of stem cells, after
infusion into the subject, in vivo differentiation of these
precursors into cells expressing the functional transgene also
occurs. Pharmaceutical compositions comprising the cells as
described herein are also provided. In addition, the cells may be
cryopreserved prior to administration to a patient.
Delivery
[0184] The nucleases, polynucleotides encoding these nucleases,
donor polynucleotides and compositions comprising the proteins
and/or polynucleotides described herein may be delivered in vivo or
ex vivo by any suitable means into any cell type.
[0185] Suitable cells include eukaryotic (e.g., animal) and
prokaryotic cells and/or cell lines. Non-limiting examples of such
cells or cell lines generated from such cells include COS, CHO
(e.g., CHO-S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV),
VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NS0, SP2/0-Ag14, HeLa,
HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T), and perC6 cells as
well as insect cells such as Spodoptera fugiperda (Sf), or fungal
cells such as Saccharomyces, Pichia and Schizosaccharomyces. In
certain embodiments, the cell line is a CHO, MDCK or HEK293 cell
line. Suitable cells also include stem cells such as, by way of
example, embryonic stem cells, induced pluripotent stem cells,
hematopoietic stem cells, neuronal stem cells and mesenchymal stem
cells.
[0186] Methods of delivering nucleases as described herein are
described, for example, in U.S. Pat. Nos. 6,453,242; 6,503,717;
6,534,261; 6,599,692; 6,607,882; 6,689,558; 6,824,978; 6,933,113;
6,979,539; 7,013,219; and 7,163,824, the disclosures of all of
which are incorporated by reference herein in their entireties.
[0187] Nucleases and/or donor constructs as described herein may
also be delivered using vectors containing sequences encoding one
or more of the ZFN(s), TALEN(s) or CRIPSR/Cas systems. Any vector
systems may be used including, but not limited to, plasmid vectors,
retroviral vectors, lentiviral vectors, adenovirus vectors,
poxvirus vectors; herpesvirus vectors and adeno-associated virus
vectors, etc. See, also, U.S. Pat. Nos. 6,534,261; 6,607,882;
6,824,978; 6,933,113; 6,979,539; 7,013,219; and 7,163,824,
incorporated by reference herein in their entireties. Furthermore,
it will be apparent that any of these vectors may comprise one or
more of the sequences needed for treatment. Thus, when one or more
nucleases and a donor construct are introduced into the cell, the
nucleases and/or donor polynucleotide may be carried on the same
vector or on different vectors (DNA MC(s)). When multiple vectors
are used, each vector may comprise a sequence encoding one or
multiple nucleases and/or donor constructs.
[0188] Conventional viral and non-viral based gene transfer methods
can be used to introduce nucleic acids encoding nucleases and donor
constructs in cells (e.g., mammalian cells) and target tissues.
Non-viral vector delivery systems include DNA or RNA plasmids, DNA
MCs, naked nucleic acid, and nucleic acid complexed with a delivery
vehicle such as a liposome, nanoparticle or poloxamer. Viral vector
delivery systems include DNA and RNA viruses, which have either
episomal or integrated genomes after delivery to the cell. For a
review of in vivo delivery of engineered DNA-binding proteins and
fusion proteins comprising these binding proteins, see, e.g., Rebar
(2004) Expert Opinion Invest. Drugs 13(7):829-839; Rossi et al.
(2007) Nature Biotech. 25(12):1444-1454 as well as general gene
delivery references such as Anderson, Science 256:808-813 (1992);
Nabel & Felgner, TIBTECH 11:211-217 (1993); Mitani &
Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175
(1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology
6(10):1149-1154 (1988); Vigne, Restorative Neurology and
Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British
Medical Bulletin 51(1):31-44 (1995); Haddada et al., in Current
Topics in Microbiology and Immunology Doerfler and Bohm (eds.)
(1995); and Yu et al., Gene Therapy 1:13-26 (1994).
[0189] Methods of non-viral delivery of nucleic acids include
electroporation, lipofection, microinjection, biolistics,
virosomes, liposomes, immunoliposomes, other nanoparticle,
polycation or lipid:nucleic acid conjugates, naked DNA, artificial
virions, and agent-enhanced uptake of DNA. Sonoporation using,
e.g., the Sonitron 2000 system (Rich-Mar) can also be used for
delivery of nucleic acids.
[0190] Additional exemplary nucleic acid delivery systems include
those provided by Amaxa Biosystems (Cologne, Germany), Maxcyte,
Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston,
Mass.) and Copernicus Therapeutics Inc, (see for example U.S. Pat.
No. 6,008,336). Lipofection is described in e.g., U.S. Pat. Nos.
5,049,386; 4,946,787; and 4,897,355) and lipofection reagents are
sold commercially (e.g., Transfectam.TM. and Lipofectin.TM.).
Cationic and neutral lipids that are suitable for efficient
receptor-recognition lipofection of polynucleotides include those
of Felgner, WO 91/17424, WO 91/16024.
[0191] The preparation of lipid:nucleic acid complexes, including
targeted liposomes such as immunolipid complexes, is well known to
one of skill in the art (see, e.g., Crystal, Science 270:404-410
(1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et
al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate
Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995);
Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos.
4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728,
4,774,085, 4,837,028, and 4,946,787).
[0192] Additional methods of delivery include the use of packaging
the nucleic acids to be delivered into EnGeneIC delivery vehicles
(EDVs). These EDVs are specifically delivered to target tissues
using bispecific antibodies where one arm of the antibody has
specificity for the target tissue and the other has specificity for
the EDV. The antibody brings the EDVs to the target cell surface
and then the EDV is brought into the cell by endocytosis. Once in
the cell, the contents are released (see MacDiarmid et al (2009)
Nature Biotechnology 27(7):643).
[0193] The use of RNA or DNA viral based systems for the delivery
of nucleic acids encoding engineered ZFPs, TALEs and/or CRISPR/Cas
systems take advantage of highly evolved processes for targeting a
virus to specific cells in the body and trafficking the viral
payload to the nucleus. Viral vectors can be administered directly
to patients (in vivo) or they can be used to treat cells in vitro
and the modified cells are administered to patients (ex vivo).
Conventional viral based systems for the delivery of ZFPs include,
but are not limited to, retroviral, lentivirus, adenoviral,
adeno-associated, vaccinia and herpes simplex virus vectors for
gene transfer. Integration in the host genome is possible with the
retrovirus, lentivirus, and adeno-associated virus gene transfer
methods, often resulting in long term expression of the inserted
transgene. Additionally, high transduction efficiencies have been
observed in many different cell types and target tissues.
[0194] The tropism of a retrovirus can be altered by incorporating
foreign envelope proteins, expanding the potential target
population of target cells. Lentiviral vectors are retroviral
vectors that are able to transduce or infect non-dividing cells and
typically produce high viral titers. Selection of a retroviral gene
transfer system depends on the target tissue. Retroviral vectors
are comprised of cis-acting long terminal repeats with packaging
capacity for up to 6-10 kb of foreign sequence. The minimum
cis-acting LTRs are sufficient for replication and packaging of the
vectors, which are then used to integrate the therapeutic gene into
the target cell to provide permanent transgene expression. Widely
used retroviral vectors include those based upon murine leukemia
virus (MuLV), gibbon ape leukemia virus (GaLV), Simian
Immunodeficiency virus (SIV), human immunodeficiency virus (HIV),
and combinations thereof (see, e.g., Buchscher et al., J. Virol.
66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992);
Sommerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J.
Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224
(1991); PCT/US94/05700).
[0195] In applications in which transient expression is preferred,
adenoviral based systems can be used. Adenoviral based vectors are
capable of very high transduction efficiency in many cell types and
do not require cell division. With such vectors, high titer and
high levels of expression have been obtained. This vector can be
produced in large quantities in a relatively simple system.
Adeno-associated virus ("AAV") vectors are also used to transduce
cells with target nucleic acids, e.g., in the in vitro production
of nucleic acids and peptides, and for in vivo and ex vivo gene
therapy procedures (see, e.g., West et al., Virology 160:38-47
(1987); U.S. Pat. No. 4,797,368; WO 93/24641; Kotin, Human Gene
Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351
(1994). Construction of recombinant AAV vectors are described in a
number of publications, including U.S. Pat. No. 5,173,414;
Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin,
et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat &
Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol.
63:03822-3828 (1989).
[0196] At least six viral vector approaches are currently available
for gene transfer in clinical trials, which utilize approaches that
involve complementation of defective vectors by genes inserted into
helper cell lines to generate the transducing agent.
[0197] pLASN and MFG-S are examples of retroviral vectors that have
been used in clinical trials (Dunbar et al., Blood 85:3048-305
(1995); Kohn et al., Nat. Med. 1:1017-102 (1995); Malech et al.,
PNAS 94:22 12133-12138 (1997)). PA317/pLASN was the first
therapeutic vector used in a gene therapy trial. (Blaese et al.,
Science 270:475-480 (1995)). Transduction efficiencies of 50% or
greater have been observed for MFG-S packaged vectors. (Ellem et
al., Immunol Immunother. 44(1):10-20 (1997); Dranoff et al., Hum.
Gene Ther. 1:111-2 (1997).
[0198] Recombinant adeno-associated virus vectors (rAAV) are a
promising alternative gene delivery systems based on the defective
and nonpathogenic parvovirus adeno-associated type 2 virus. All
vectors are derived from a plasmid that retains only the AAV 145 bp
inverted terminal repeats flanking the transgene expression
cassette. Efficient gene transfer and stable transgene delivery due
to integration into the genomes of the transduced cell are key
features for this vector system. (Wagner et al., Lancet 351:9117
1702-3 (1998), Kearns et al., Gene Ther. 9:748-55 (1996)). Other
AAV serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7,
AAV8, AAV9 and AAVrh.10 and any novel AAV serotype can also be used
in accordance with the present invention. In some embodiments,
chimeric AAV is used where the viral origins of the LTR sequences
of the viral nucleic acid are heterologous to the viral origin of
the capsid sequences. Examples include chimeric virus with LTRs
derived from AAV2 and capsids derived from AAV5, AAV6, AAV8 or AAV9
(i.e. AAV2/5, AAV2/6, AAV2/8 and AAV2/9, respectively).
[0199] Replication-deficient recombinant adenoviral vectors (Ad)
can be produced at high titer and readily infect a number of
different cell types. Most adenovirus vectors are engineered such
that a transgene replaces the Ad E1a, E1b, and/or E3 genes;
subsequently the replication defective vector is propagated in
human 293 cells that supply deleted gene function in trans. Ad
vectors can transduce multiple types of tissues in vivo, including
nondividing, differentiated cells such as those found in liver,
kidney and muscle. Conventional Ad vectors have a large carrying
capacity. An example of the use of an Ad vector in a clinical trial
involved polynucleotide therapy for antitumor immunization with
intramuscular injection (Sterman et al., Hum. Gene Ther. 7:1083-9
(1998)). Additional examples of the use of adenovirus vectors for
gene transfer in clinical trials include Rosenecker et al.,
Infection 24:1 5-10 (1996); Sterman et al., Hum. Gene Ther. 9:7
1083-1089 (1998); Welsh et al., Hum. Gene Ther. 2:205-18 (1995);
Alvarez et al., Hum. Gene Ther. 5:597-613 (1997); Topf et al., Gene
Ther. 5:507-513 (1998); Sterman et al., Hum. Gene Ther. 7:1083-1089
(1998).
[0200] Packaging cells are used to form virus particles that are
capable of infecting a host cell. Such cells include 293 cells,
which package AAV and adenovirus, and .psi.2 cells or PA317 cells,
which package retrovirus. Viral vectors used in gene therapy are
usually generated by a producer cell line that packages a nucleic
acid vector into a viral particle. The vectors typically contain
the minimal viral sequences required for packaging and subsequent
integration into a host (if applicable), other viral sequences
being replaced by an expression cassette encoding the protein to be
expressed. The missing viral functions are supplied in trans by the
packaging cell line. For example, AAV vectors used in gene therapy
typically only possess inverted terminal repeat (ITR) sequences
from the AAV genome which are required for packaging and
integration into the host genome. Viral DNA is packaged in a cell
line, which contains a helper plasmid encoding the other AAV genes,
namely rep and cap, but lacking ITR sequences. The cell line is
also infected with adenovirus as a helper. The helper virus
promotes replication of the AAV vector and expression of AAV genes
from the helper plasmid. The helper plasmid is not packaged in
significant amounts due to a lack of ITR sequences. Contamination
with adenovirus can be reduced by, e.g., heat treatment to which
adenovirus is more sensitive than AAV. In some embodiments, AAV is
produced using a baculovirus expression system.
[0201] In many gene therapy applications, it is desirable that the
gene therapy vector be delivered with a high degree of specificity
to a particular tissue type. Accordingly, a viral vector can be
modified to have specificity for a given cell type by expressing a
ligand as a fusion protein with a viral coat protein on the outer
surface of the virus. The ligand is chosen to have affinity for a
receptor known to be present on the cell type of interest. For
example, Han et al., Proc. Natl. Acad. Sci. USA 92:9747-9751
(1995), reported that Moloney murine leukemia virus can be modified
to express human heregulin fused to gp70, and the recombinant virus
infects certain human breast cancer cells expressing human
epidermal growth factor receptor. This principle can be extended to
other virus-target cell pairs, in which the target cell expresses a
receptor and the virus expresses a fusion protein comprising a
ligand for the cell-surface receptor. For example, filamentous
phage can be engineered to display antibody fragments (e.g., FAB or
Fv) having specific binding affinity for virtually any chosen
cellular receptor. Although the above description applies primarily
to viral vectors, the same principles can be applied to nonviral
vectors. Such vectors can be engineered to contain specific uptake
sequences which favor uptake by specific target cells.
[0202] Gene therapy vectors can be delivered in vivo by
administration to an individual patient, typically by systemic
administration (e.g., intravenous, intraperitoneal, intramuscular,
subdermal, or intracranial infusion) or topical application, as
described below. Alternatively, vectors can be delivered to cells
ex vivo, such as cells explanted from an individual patient (e.g.,
lymphocytes, bone marrow aspirates, tissue biopsy) or universal
donor hematopoietic stem cells, followed by reimplantation of the
cells into a patient, usually after selection for cells which have
incorporated the vector.
[0203] Vectors (e.g., retroviruses, adenoviruses, liposomes, etc.)
containing nucleases and/or donor constructs can also be
administered directly to an organism for transduction of cells in
vivo. Alternatively, naked DNA can be administered. Administration
is by any of the routes normally used for introducing a molecule
into ultimate contact with blood or tissue cells including, but not
limited to, injection, infusion, topical application and
electroporation. Suitable methods of administering such nucleic
acids are available and well known to those of skill in the art,
and, although more than one route can be used to administer a
particular composition, a particular route can often provide a more
immediate and more effective reaction than another route.
[0204] Vectors suitable for introduction of polynucleotides (e.g.
nuclease-encoding and/or double-stranded donors) described herein
include non-integrating lentivirus vectors (IDLV). See, for
example, Ory et al. (1996) Proc. Natl. Acad. Sci. USA
93:11382-11388; Dull et al. (1998) J. Virol. 72:8463-8471; Zuffery
et al. (1998) J. Virol. 72:9873-9880; Follenzi et al. (2000) Nature
Genetics 25:217-222; U.S. Patent Publication No 2009/054985.
[0205] Pharmaceutically acceptable carriers are determined in part
by the particular composition being administered, as well as by the
particular method used to administer the composition. Accordingly,
there is a wide variety of suitable formulations of pharmaceutical
compositions available, as described below (see, e.g., Remington's
Pharmaceutical Sciences, 17th ed., 1989).
[0206] It will be apparent that the nuclease-encoding sequences and
donor constructs can be delivered using the same or different
systems. For example, the nucleases and donors can be carried by
the same DNA MC. Alternatively, a donor polynucleotide can be
carried by a MC, while the one or more nucleases can be carried by
a standard plasmid or AAV vector. Furthermore, the different
vectors can be administered by the same or different routes
(intramuscular injection, tail vein injection, other intravenous
injection, intraperitoneal administration and/or intramuscular
injection. The vectors can be delivered simultaneously or in any
sequential order.
[0207] Thus, the instant disclosure includes in vivo or ex vivo
treatment of diseases and conditions that are amenable to insertion
of a transgenes encoding a therapeutic protein, for example
treatment of hemophilias via nuclease-mediated integration of
clotting factors such as Factor VIII (F8). The compositions are
administered to a human patient in an amount effective to obtain
the desired concentration of the therapeutic polypeptide in the
serum or the target organ or cells. Administration can be by any
means in which the polynucleotides are delivered to the desired
target cells. For example, both in vivo and ex vivo methods are
contemplated. Intravenous injection to the portal vein is a
preferred method of administration. Other in vivo administration
modes include, for example, direct injection into the lobes of the
liver or the biliary duct and intravenous injection distal to the
liver, including through the hepatic artery, direct injection in to
the liver parenchyma, injection via the hepatic artery, and/or
retrograde injection through the biliary tree. Ex vivo modes of
administration include transduction in vitro of resected
hepatocytes or other cells of the liver, followed by infusion of
the transduced, resected hepatocytes back into the portal
vasculature, liver parenchyma or biliary tree of the human patient,
see e.g., Grossman et al., (1994) Nature Genetics, 6:335-341.
[0208] The effective amount of nuclease(s) and donor to be
administered will vary from patient to patient and according to the
therapeutic polypeptide of interest. Accordingly, effective amounts
are best determined by the physician administering the compositions
and appropriate dosages can be determined readily by one of
ordinary skill in the art. After allowing sufficient time for
integration and expression (typically 4-15 days, for example),
analysis of the serum or other tissue levels of the therapeutic
polypeptide and comparison to the initial level prior to
administration will determine whether the amount being administered
is too low, within the right range or too high. Suitable regimes
for initial and subsequent administrations are also variable, but
are typified by an initial administration followed by subsequent
administrations if necessary. Subsequent administrations may be
administered at variable intervals, ranging from daily to annually
to every several years. One of skill in the art will appreciate
that appropriate immunosuppressive techniques may be recommended to
avoid inhibition or blockage of transduction by immunosuppression
of the delivery vectors, see e.g., Vilquin et al., (1995) Human
Gene Ther., 6:1391-1401.
[0209] Formulations for both ex vivo and in vivo administrations
include suspensions in liquid or emulsified liquids. The active
ingredients often are mixed with excipients which are
pharmaceutically acceptable and compatible with the active
ingredient. Suitable excipients include, for example, water,
saline, dextrose, glycerol, ethanol or the like, and combinations
thereof. In addition, the composition may contain minor amounts of
auxiliary substances, such as, wetting or emulsifying agents, pH
buffering agents, stabilizing agents or other reagents that enhance
the effectiveness of the pharmaceutical composition.
[0210] The following Examples relate to exemplary embodiments of
the present disclosure in which the nuclease comprises a zinc
finger nuclease (ZFN), a TALEN or a CRISPR/Cas nuclease system. It
will be appreciated that this is for purposes of exemplification
only and that other nucleases can be used, for instance Ttago
systems, homing endonucleases (meganucleases) with engineered
DNA-binding domains and/or fusions of naturally occurring of
engineered homing endonucleases (meganucleases) DNA-binding domains
and heterologous cleavage domains and/or fusions of meganucleases
and TALE proteins.
EXAMPLES
Example 1: Assembly of Zinc Finger Nucleases
[0211] ZFNs were assembled against the human PD1 genes and were
tested for activity by ELISA and CEL1 assays as described in Miller
et al. (2007) Nat. Biotechnol. 25:778-785. For TCR (e.g., TRAC)-,
B2M-, CTLA-4- and PD1-specific nucleases, see U.S. Pat. Nos.
8,956,828; 8,945,868; 8,563,314 and U.S. Patent Publication Nos.
20140120622 and 20150056705, incorporated by reference herein.
Example 2: AAV Transduction and Gene Modification TI
[0212] A. CD4+ or CD8+ T-Cells
[0213] Primary CD4+ or CD8+ T cells are transduced with AAV6
vectors containing a promoter (e.g. EF1a or PGK) driving and
engineered antigen receptor transgene (e.g. an CAR, TCR or ACTR as
depicted in FIG. 1) and mRNAs encoding PD1-specific ZFN or
TRAC-specific ZFN in the presence of IL2 (20 ng/ml) and
Dynabeads.RTM. Human T-Activator CD3/CD28 (Life Technology). Cells
are then collected at 5 days post-infection (dpi) and analyzed for
expression of the engineered antigen receptor. The results
demonstrate that use of an AAV6 vector comprising an engineered
antigen receptor transgene in combination with ZFNs specific for
the PD1 checkpoint inhibitor or TCR alpha chain TRAC results in
integration of the transgene into the PD1 or TRAC locus.
[0214] B. CD3+ T-Cells
[0215] To transduce CD3+ T cells with AAV2/6 vectors carrying the
CCR5-RFLP donor, CD3+ T-cells were exposed to AAV2/6-RFLP donor
vectors for four hours under standard conditions (see PCT
application PCT/US2015/041807). Standard conditions include the use
of serum in the media. mRNA encoding CCR5-specific ZFN as described
previously (DeKelver et al (2010) Gen. Res. 20:1133-1142) were
introduced into the cells via electroporation at 60 .mu.g/mL. To
investigate the effect of serum has on the transduction efficiency,
a comparison experiment was performed with no serum in the media
during the four hour transduction. Following transduction and
electroporation, the cells were expanded for five days under serum
containing conditions, and then collected. Genomic DNA was isolated
by Illumina deep sequencing by standard procedures to measure the
efficiency of targeted integration of the RFLP containing donor ("%
RFLP").
[0216] The results are depicted in FIG. 2, and demonstrate that at
low concentrations of AAV2/6 donor, targeted integration of the
donor is inhibited in the presence of serum, which is not observed
while serum is not present.
Example 3: AAV Transduction and Gene Modification
[0217] AAV donor expression was also studied in cells in which one
or more endogenous genes were modified (e.g., inactivated with or
without TI) using the compositions and methods and described
herein. In particular, TRAC and/or B2M genes were modified
essentially as described above in primary T-cells (CD3+). Briefly,
nucleases targeted TRAC and/or B2M were administered to the cells
along with AAV donors comprising a transgene encoding a GFP (250
ug/mL and AAV MOI of 1e5vg/cell for TRAC1 nucleases alone; 120
ug/mL and AAV MOI of 1e5vg/cell for B2M nucleases alone; 120 ug/mL
for B2M and 60 ug/mL and AAV MOI of 1e5vg/cell for TRAC1 and B2M
nucleases). T-cells were activated using anti-CD3/CD28 beads, and
cultured in media with serum replacement and IL-2. Two days post
activation, activated cells were transduced with AAV6 GFP donor
vectors (comprising homology arms specific to either the TRAC or
B2M ZFN cut site) at 1E5 vg/cell. The next day, cells were
transfected with mRNA encoding for ZFNs targeting either TRAC or
B2M by electroporation with mRNA concentration ranged from 60-250
ug/mL. T-cells were then diluted with standard T-cell culture media
and incubated at 30.degree. C. overnight. Cultures were
subsequently expanded under standard T-cell expansion condition for
7-11 more days.
[0218] As shown in FIG. 20, a large percentage of the cells
(greater than 70% in all cases) exhibited targeted integration (TI)
of the AAV donor into the TRAC or B2M locus. In addition, a similar
percentage of cells receiving both TRAC and B2M targeted nucleases
showed inactivation (KO) of both TRAC and of B2M as well as
targeted integration of the AAV GFP donor (into TRAC when using
donor with TRAC homology arms).
Example 4: Ex Vivo Methods
[0219] The genetically modified cells, including CD34+ HSPCs (e.g.,
patient-derived CD34+ cells and/or modified CD4+, CD3+ and/or CD8+
T cells) as previously described (Aiuti et al. (2013) Science 341,
1233151), expressing one or more CARs as described herein are
administered to subjects as previously described (Aiuti et al.
ibid), resulting in long-term multilineage engraftment in subjects
treated with the modified cells.
Example 5: AAV Transduction Using PDGFr Inhibitors
[0220] In order to test the relative contribution of co-receptors
to AAV transduction, inhibitors against epidermal growth factor
receptor (EGFR), hepatocyte growth factor receptor (HGFR),
fibroblast growth factor receptor (FGFR) and platelet-derived
growth factor receptor (PDGFR) were used prior to in vitro AAV2/6
transduction experiments in Hep3B (human hepatoma cell line) cells
using zinc-finger nucleases (ZFNs) targeting the human albumin
locus. Hep3B cells were plated at a density of 1.times.105 cells
per well in a 48-well tissue culture plate in 300 .mu.L complete
growth media the day before transduction with AAV2/6. On the
morning of transduction, the cells were washed three times with
serum-free media and incubated in the serum-free media for three
hours. Growth factor receptor inhibitors were added to the wells
and incubated for one hour. AAV2/6 particles to deliver ZFNs
targeted to the albumin locus were then added to the wells. After
three hours, serum was added to the wells to a final concentration
of 10%. The cells were harvested on day 4 post-transduction.
Genomic DNA was extracted and analyzed by deep sequencing (MiSeq)
at the albumin locus. The growth factor receptor inhibitors used
are shown below in Table 1, and they were used in the experiment in
the concentrations indicated in FIG. 3, where each inhibitor is
labeled by its target. For example, Gefitinib, an inhibitor of
EGFR, is labeled as "EGFRi".
[0221] As shown in FIG. 3, compared to control, only EGFRi showed
mild inhibition (as expected due to its role as AAV6 co-receptor)
while HGFRi and FGFRi showed mild stimulation of AAV transduction.
In contrast, both PDGFR inhibitors used, CP-673451 and Crenolanib,
sho