U.S. patent application number 16/700493 was filed with the patent office on 2020-03-19 for capture of nucleic acids using a nucleic acid-guided nuclease-based system.
The applicant listed for this patent is Arc Bio, LLC. Invention is credited to Meredith L. CARPENTER, Stephane B. GOURGUECHON, Eric HARNESS, David SINCLAIR.
Application Number | 20200087652 16/700493 |
Document ID | / |
Family ID | 58050956 |
Filed Date | 2020-03-19 |
![](/patent/app/20200087652/US20200087652A1-20200319-D00000.png)
![](/patent/app/20200087652/US20200087652A1-20200319-D00001.png)
![](/patent/app/20200087652/US20200087652A1-20200319-D00002.png)
![](/patent/app/20200087652/US20200087652A1-20200319-D00003.png)
![](/patent/app/20200087652/US20200087652A1-20200319-D00004.png)
![](/patent/app/20200087652/US20200087652A1-20200319-D00005.png)
![](/patent/app/20200087652/US20200087652A1-20200319-D00006.png)
![](/patent/app/20200087652/US20200087652A1-20200319-D00007.png)
![](/patent/app/20200087652/US20200087652A1-20200319-D00008.png)
![](/patent/app/20200087652/US20200087652A1-20200319-D00009.png)
![](/patent/app/20200087652/US20200087652A1-20200319-D00010.png)
View All Diagrams
United States Patent
Application |
20200087652 |
Kind Code |
A1 |
GOURGUECHON; Stephane B. ;
et al. |
March 19, 2020 |
CAPTURE OF NUCLEIC ACIDS USING A NUCLEIC ACID-GUIDED NUCLEASE-BASED
SYSTEM
Abstract
Provided herein are methods and compositions for the capture of
nucleic acids, for example by using a nucleic acid-guided
nuclease-based system.
Inventors: |
GOURGUECHON; Stephane B.;
(San Mateo, CA) ; HARNESS; Eric; (Sunnyvale,
CA) ; SINCLAIR; David; (Cambridge, MA) ;
CARPENTER; Meredith L.; (Cambridge, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Arc Bio, LLC |
Cambridge |
MA |
US |
|
|
Family ID: |
58050956 |
Appl. No.: |
16/700493 |
Filed: |
December 2, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15520052 |
Apr 18, 2017 |
10538758 |
|
|
PCT/US2016/047631 |
Aug 18, 2016 |
|
|
|
16700493 |
|
|
|
|
62207359 |
Aug 19, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 2525/191 20130101;
C12N 9/1276 20130101; C12N 9/22 20130101; C12N 15/10 20130101; C12Q
1/686 20130101; C12N 15/10 20130101; C12N 2310/20 20170501; C12Q
2521/301 20130101; C12Q 2525/191 20130101; C12Q 2521/301
20130101 |
International
Class: |
C12N 15/10 20060101
C12N015/10; C12N 9/12 20060101 C12N009/12; C12N 9/22 20060101
C12N009/22 |
Claims
1. A method of capturing target nucleic acid sequences comprising:
(a) providing a sample comprising a plurality of adapter-ligated
nucleic acids, wherein the nucleic acids are ligated to a first
adapter at one end and ligated to a second adapter at the other
end; (b) contacting the sample with a plurality of nucleic
acid-guided nuclease-gNA complexes, wherein the gNAs are
complementary to targeted sites of interest contained in a subset
of the nucleic acids, thereby generating a plurality of nucleic
acid fragments ligated to a first or second adapter at one end and
no adapter at the other end; and (c) contacting the plurality of
nucleic acid fragments with third adapters, thereby generating a
plurality of nucleic acid fragments ligated to either the first or
second adapter at one end and the third adapter at the other
end.
2. The method of claim 1, wherein the nucleic acid-guided nuclease
is a CRISPR/Cas system protein.
3. The method of claim 1, wherein the nucleic acid-guided nuclease
is a non-CRISPR/Cas system protein.
4. The method of claim 1, wherein the nucleic acid-guided nuclease
is selected from the group consisting of CAS Class I Type I, CAS
Class I Type III, CAS Class I Type IV, CAS Class II Type II, and
CAS Class II Type V.
5. The method of claim 1, wherein the nucleic acid-guided nuclease
is selected from the group consisting of Cas9, Cpf1, Cas3, Cas8a-c,
Cas10, Cse1, Csy1, Csn2, Cas4, Csm2, Cmr5, Csf1, C2c2, and
NgAgo.
6. The method of any one of claims 1 to 5, wherein the gNAs are
gRNAs.
7. The method of any one of claims 1 to 5, wherein the gNAs are
gDNAs.
8. The method of any one of claims 1 to 7, wherein the contacting
with the plurality of nucleic acid-guided nuclease-gNA complexes
cleaves the targeted sites of interest contained in a subset of the
nucleic acids, thereby generating a plurality of nucleic acid
fragments comprising a first or second adapter at one end and no
adapter at the other end.
9. The method of any one of claims 1 to 8, wherein the method
further comprises amplifying the product of step (c) using first or
second and third adapter-specific PCR.
10. The method of any one of claims 1 to 9, wherein the nucleic
acids are selected from the group consisting of single stranded
DNA, double stranded DNA, single stranded RNA, double stranded RNA,
and a DNA/RNA hybrid.
11. The method of claim 10, wherein the nucleic acids are double
stranded DNA.
12. The method of any one of claims 1 to 11, wherein nucleic acids
are from genomic DNA.
13. The method of claim 12, wherein the genomic DNA is human.
14. The method of any one of claims 1 to 13, wherein the nucleic
acids which are adapter-ligated are from 20 bp to 5000 bp in
length.
15. The method of any one of claims 1 to 14, wherein the targeted
sites of interest are single nucleotide polymorphisms (SNPs), short
tandem repeats (STRs), cancer genes, inserts, deletions, structural
variations, exons, genetic mutations, or regulatory regions.
16. The method of claim 9, wherein amplified products are used for
cloning, sequencing, or genotyping.
17. The method of any one of claims 1 to 16, wherein the adapters
are from 20 bp to 100 bp in length.
18. The method of any one of claims 1 to 17, wherein the adapters
comprise primer binding sites.
19. The method of any one of claims 1 to 18, wherein the adapters
comprise sequencing adapters or restriction sites.
20. The method of any one of claims 1 to 19, wherein the targeted
sites of interest represent less than 50% of the total nucleic acid
in the sample.
21. The method of any one of claims 1 to 20, wherein the sample is
obtained from a biological sample a clinical sample, a forensic
sample, or an environmental sample.
22. The method of any one of claims 1 to 21, wherein the first and
second adapters are identical.
23. The method of any one of claims 1 to 21, wherein the first and
second adapters are different.
24. The method of any one of claims 1 to 23, wherein the sample
comprises a sequencing library.
25. A method of introducing labeled nucleotides at targeted sites
of interest comprising: (a) providing a sample comprising a
plurality of nucleic acid fragments; (b) contacting the sample with
a plurality of nucleic acid-guided nuclease nickase-gNA complexes
wherein the gNAs are complementary to targeted sites of interest in
the nucleic acid fragments, thereby generating a plurality of
nicked nucleic acid fragments at the targeted sites of interest;
and (c) contacting the plurality of nicked nucleic acid fragments
with an enzyme capable of initiating nucleic acid synthesis at a
nicked site, and labeled nucleotides, thereby generating a
plurality of nucleic acid fragments comprising labeled nucleotides
in the targeted sites of interest.
26. The method of claim 25, wherein the nucleic acid-guided
nuclease nickase is selected from the group consisting of CAS Class
I Type I nickase, CAS Class I Type III nickase, CAS Class I Type IV
nickase, CAS Class II Type II nickase, and CAS Class II Type V
nickase.
27. The method of claim 25, wherein the nucleic acid-guided
nuclease nickase is selected from the group consisting of Cas9
nickase, Cpf1 nickase, Cas3 nickase, Cas8a-c nickase, Cas10
nickase, Cse1 nickase, Csy1 nickase, Csn2 nickase, Cas4 nickase,
Csm2 nickase, Cm5 nickase, Csf1 nickase, C2C2 nickase, CPF1
nickase, and NgAgo nickase.
28. The method of any one of claims 25 to 27, wherein the gNAs are
gRNAs.
29. The method of any one of claims 25 to 27, wherein the gNAs are
gDNAs.
30. The method of any one of claims 25 to 29, wherein the nucleic
acid fragments are selected from the group consisting of single
stranded DNA fragments, double stranded DNA fragments, single
stranded RNA fragments, double stranded RNA fragments, and a
DNA/RNA hybrid fragments.
31. The method of claim 30, wherein the nucleic acid fragments are
double stranded DNA fragments.
32. The method of claim 31, wherein double stranded DNA fragments
are from genomic DNA.
33. The method of claim 32, wherein the genomic DNA is human.
34. The method of any one of claims 25 to 33, wherein the nucleic
acid fragments are from 20 bp to 5000 bp in length.
35. The method of any one of claims 25 to 34, wherein the targeted
sites of interest are single nucleotide polymorphisms (SNPs), short
tandem repeats (STRs), cancer genes, inserts, deletions, structural
variations, exons, genetic mutations, or regulatory regions.
36. The method of any one of claims 25 to 35, wherein the targeted
sites of interest represent less than 50% of the total nucleic acid
in the sample.
37. The method of any one of claims 25 to 36, wherein the sample is
obtained from a biological sample a clinical sample, a forensic
sample, or an environmental sample.
38. The method of any one of claims 25 to 37, wherein the labeled
nucleotides are biotinylated nucleotides.
39. The method of any one of claims 25 to 37, wherein the labeled
nucleotides are part of an antibody conjugate pair.
40. The method of claim 38, further comprising contacting the
nucleic acid fragments comprising biotinylated nucleotides with
avidin or strepavidin, thereby capturing the targeted sites of
interest.
41. The method of any one of claims 25 to 40, wherein the enzyme
capable of initiating nucleic acid synthesis at a nicked site is
DNA Polymerase I, a Klenow fragment, a TAQ polymerase, or a Bst DNA
Polymerase.
42. The method of any one of claims 25 to 41, wherein the nucleic
acid-guided nuclease nickase nicks the 5' end of the nucleic acid
fragments.
43. The method of any one of claims 25 to 42, wherein the nucleic
acid fragments are from 20 bp to 5000 bp in length.
44. The method of any one of claims 25 to 43, wherein the sample is
obtained from a biological sample a clinical sample, a forensic
sample, or an environmental sample.
45. A method of capturing target nucleic acid sequences of interest
comprising: (a) providing a sample comprising a plurality of
adapter-ligated nucleic acids, wherein the nucleic acids are
ligated to a first adapter at one end and are ligated to a second
adapter at the other end; and (b) contacting the sample with a
plurality of catalytically dead nucleic acid-guided nuclease-gNA
complexes, wherein the catalytically dead nucleic acid-guided
nuclease is fused to a transposase, wherein the gRNAs are
complementary to targeted sites of interest contained in a subset
of the nucleic acids, and wherein the complexes are loaded with a
plurality of third adapters, to generate a plurality of nucleic
acids fragments comprising either a first or second adapter at one
end, and a third adapter at the other end.
46. The method of claim 45, wherein the method further comprises
amplifying the product of step (b) using first or second adapter
and third adapter-specific PCR.
47. The method of claim 45, wherein the catalytically dead nucleic
acid-guided nuclease is derived from a CRISPR/Cas system
protein.
48. The method of claim 45, wherein the catalytically dead nucleic
acid-guided nuclease is derived from a non-CRISPR/Cas system
protein.
49. The method of claim 45, wherein the catalytically dead nucleic
acid-guided nuclease is selected from the group consisting of dead
CAS Class I Type I, dead CAS Class I Type III, dead CAS Class I
Type IV, dead CAS Class II Type II, and dead CAS Class II Type
V.
50. The method of claim 45, wherein the catalytically dead nucleic
acid-guided nuclease is selected from the group consisting of
dCas9, dCpf1, dCas3, dCas8a-c, dCas10, dCse1, dCsy1, dCsn2, dCas4,
dCsm2, dCmr5, dCsf1, dC2C2, and dNgAgo.
51. The method of any one of claims 45 to 50, wherein the gNAs are
gRNAs.
52. The method of any one of claims 45 to 50, wherein the gNAs are
gDNAs.
53. The method of any one of claims 45 to 52, wherein nucleic acids
sequences are from genomic DNA.
54. The method of claim 53, wherein the genomic DNA is human.
55. The method of any one of claims 45 to 54, wherein the
catalytically dead nucleic acid-guided nuclease is fused to the
N-terminus of the transposase.
56. The method of any one of claims 45 to 54, wherein the
catalytically dead nucleic acid-guided nuclease is fused to the
C-terminus of the transposase.
57. The method of any one of claims 45 to 56, wherein the nucleic
acids, which are adapter ligated, are from 20 bp to 5000 bp in
length.
58. The method of any one of claims 45 to 57, wherein the
contacting of step (b) allows for the insertion of the second
adapter into the targeted nucleic acid sequences.
59. The method of any one of claims 45 to 58, wherein the targeted
sites of interest are single nucleotide polymorphisms (SNPs), short
tandem repeats (STRs), cancer genes, inserts, deletions, structural
variations, exons, genetic mutations, or regulatory regions.
60. The method of claim 46, wherein amplified products are used for
cloning, sequencing, or genotyping.
61. The method of any one of claims 45 to 59, wherein the adapters
are from 20 bp to 100 bp in length.
62. The method of any one of claims 45 to 61, wherein the adapters
comprise primer binding sites.
63. The method of any one of claims 45 to 62, wherein the adapters
comprise sequencing adapters or restriction sites.
64. The method of any one of claims 45 to 63, wherein the targeted
sites of interest represent less than 50% of the total nucleic acid
in the sample.
65. The method of any one of claims 45 to 64, wherein the sample is
obtained from a biological sample a clinical sample, a forensic
sample, or an environmental sample.
66. A method of capturing target nucleic acid sequences of interest
comprising: (a) providing a sample comprising a plurality of
adapter-ligated nucleic acids, wherein the nucleic acids are
ligated to the adapter at the 5' end and 3' ends; (b) contacting
the sample with a plurality of catalytically dead nucleic
acid-guided nuclease-gNA complexes, wherein the gNAs are
complementary to targeted sites of interest contained in a subset
of the nucleic acids, thereby generating a plurality of nucleic
acids adapter-ligated at the 5' and 3' ends, bound to a
catalytically dead nucleic acid-guided nuclease-gNA complex; and
(c) contacting the sample with a plurality of catalytically dead
nucleic acid-guided nuclease-gNA complexes, wherein the gNAs are
complementary to both targeted sites of interest and targeted sites
not of interest in the nucleic acids, thereby generating a
plurality of nucleic acid fragments comprising nucleic acid
sequences not of interest, adapter ligated at only one of the 5' or
3' ends.
67. The method of claim 66, wherein the catalytically dead nucleic
acid-guided nuclease is a CRISPR/Cas system protein.
68. The method of claim 66, wherein the catalytically dead nucleic
acid-guided nuclease is a non-CRISPR/Cas system protein.
69. The method of claim 66, wherein the catalytically-dead nucleic
acid-guided nuclease is selected from the group consisting of dead
CAS Class I Type I, dead CAS Class I Type III, dead CAS Class I
Type IV, dead CAS Class II Type II, and dead CAS Class II Type
V.
70. The method of claim 66, wherein the catalytically dead nucleic
acid-guided nuclease is selected from the group consisting of
dCas9, dCpf1, dCas3, dCas8a-c, dCas10, dCse1, dCsy1, dCsn2, dCas4,
dCsm2, dCm5, dCsf1, dC2C2, dCPF1, and dNgAgo.
71. The method of any one of claims 66 to 70, wherein the gNAs are
gRNAs.
72. The method of any one of claims 66 to 70, wherein the gNAs are
gDNAs.
73. The method of any one of claims 66 to 72, wherein the
contacting of step (c) does not displace the plurality of nucleic
acids adapter-ligated at the 5' and 3' ends, bound to a
catalytically dead nucleic acid-guided nuclease-gNA complex of step
(b).
74. The method of any one of claims 66 to 73, wherein the
contacting in step (d) cleaves the targeted sites not of interest
contained in a subset of the nucleic acids, thereby generating a
plurality of nucleic acid fragments comprising nucleic acid
sequences not of interest, adapter ligated at only one of the 5' or
3' ends.
75. The method of any one of claims 66 to 74, wherein the method
further comprises removing the bound catalytically dead nucleic
acid-guided nuclease-gNA complex and amplifying the product of step
(b) using adapter-specific PCR.
76. The method of any one of claims 66 to 75, wherein the nucleic
acids are selected from the group consisting of single stranded
DNA, double stranded DNA, single stranded RNA, double stranded RNA,
and a DNA/RNA hybrid.
77. The method of claim 76, wherein the nucleic acids are double
stranded DNA.
78. The method of any one of claims 66 to 77, wherein nucleic acids
are from genomic DNA.
79. The method of claim 78, wherein the genomic DNA is human.
80. The method of any one of claims 66 to 79, wherein the nucleic
acids adapter-ligated at the 5'ends and the 3'ends are from 20 bp
to 5000 bp.
81. The method of any one of claims 66 to 80, wherein the targeted
sites of interest are single nucleotide polymorphisms (SNPs), short
tandem repeats (STRs), cancer genes, inserts, deletions, structural
variations, exons, genetic mutations, or regulatory regions.
82. The method of claim 75, wherein amplified products are used for
cloning, sequencing, or genotyping.
83. The method of any one of claims 66 to 82, wherein the adapters
are from 20 bp to 100 bp in length.
84. The method of any one of claims 66 to 82, wherein the adapters
comprise primer binding sites.
85. The method of any one of claims 66 to 82, wherein the adapters
comprise sequencing adapters or restriction sites.
86. The method of any one of claims 66 to 82, wherein the targeted
sites of interest represent less than 50% of the total nucleic acid
in the sample.
87. The method of any one of claims 66 to 82, wherein the sample is
obtained from a biological sample a clinical sample, a forensic
sample, or an environmental sample.
88. A method of capturing target nucleic acid sequences of interest
comprising: (a) providing a sample comprising a plurality of
nucleic acid sequences, wherein the nucleic acid sequences comprise
methylated nucleotides, and wherein the nucleic acid sequences are
adapter ligated on the 5' and 3' ends; (b) contacting the sample
with a plurality of nucleic acid-guided nuclease nickase-gNA
complexes, wherein the gNAs are complementary to targeted sites of
interest in a subset of the nucleic acid sequences, thereby
generating a plurality of nicked sites of interest in the subset of
the nucleic acid sequences, and wherein the target nucleic acid
sequences are adapter ligated on the 5' and 3' ends; (c) contacting
the sample with an enzyme capable of initiating DNA synthesis at a
nicked site, and unmethylated nucleotides, thereby generating a
plurality of nucleic acid sequences comprising unmethylated
nucleotides in the targeted sites of interest and wherein the
nucleic acid sequences are adapter ligated on the 5' and 3' ends;
and (d) contacting the sample with an enzyme capable of cutting
methylated nucleic acids, thereby generating a plurality of nucleic
acid fragments comprising methylated nucleic acids, wherein the
plurality of nucleic acid fragments comprising methylated nucleic
acids that are adapter ligated on at most one of the 5' and 3'
ends.
89. The method of claim 88, wherein the nucleic acid-guided
nuclease nickase is selected from the group consisting of CAS Class
I Type I nickase, CAS Class I Type III nickase, CAS Class I Type IV
nickase, CAS Class II Type II nickase, and CAS Class II Type V
nickase.
90. The method of claim 88, wherein the nucleic acid-guided
nuclease nickase is selected from the group consisting of Cas9
nickase, Cpf1 nickase, Cas3 nickase, Cas8a-c nickase, Cas10
nickase, Cse1 nickase, Csy1 nickase, Csn2 nickase, Cas4 nickase,
Csm2 nickase, Cmr5 nickase, Csf1 nickase, C2C2 nickase, and NgAgo
nickase.
91. The method of claim 88, wherein the gNAs are gRNAs.
92. The method of claim 88, wherein the gNAs are gDNAs.
93. The method of any one of claims 88 to 92, wherein the DNA is
double stranded DNA.
94. The method of claim 93, wherein the double stranded DNA is from
genomic DNA.
95. The method of claim 94, wherein the genomic DNA is human.
96. The method of any one of claims 88 to 95, wherein the DNA
sequences are from 20 bp to 5000 bp in length.
97. The method of any one of claims 88 to 96, wherein the targeted
sites of interest are single nucleotide polymorphisms (SNPs), short
tandem repeats (STRs), cancer genes, inserts, deletions, structural
variations, exons, genetic mutations, or regulatory regions.
98. The method of any one of claims 88 to 97, wherein the targeted
sites of interest represent less than 50% of the total DNA in the
sample.
99. The method of any one of claims 88 to 98, wherein the sample is
obtained from a biological sample a clinical sample, a forensic
sample, or an environmental sample.
100. The method of any one of claims 88 to 99, wherein the enzyme
capable of initiating nucleic acid synthesis at a nicked site is a
DNA Polymerase I, Klenow fragment a TAQ polymerase, or a Bst DNA
Polymerase.
101. The method of any one of claims 88 to 100, wherein the nucleic
acid-guided nuclease nickase nicks the 5' end of the DNA
sequences.
102. The method of any one of claims 88 to 101, wherein the enzyme
capable of cutting methylated DNA is DpnI.
103. A method of capturing target DNA sequences of interest
comprising: (a) contacting the sample with a plurality of nucleic
acid-guided nuclease nickase-gNA complexes, wherein the gNAs are
complementary to targeted sites of interest flanking a region of
interest in a subset of the DNA sequences, thereby generating a
plurality of nicked DNA at sites adjacent to the regions of
interest; (b) heating the sample to 65.degree. C. thereby causing
cause nicks in close proximity to generate a double stranded
breaks; (c) contacting the double stranded breaks with a
thermostable ligase thereby allowing ligation of adapter sequences
at these sites only; and (d) repeating steps a-c to place a second
adapter on the other side of the region of interest, thus allowing
enrichment of the region of interest.
104. The method of claim 103, wherein the gNAs are gRNAs.
105. The method of claim 103, wherein the gNAs are gDNAs.
106. The method of any one of claims 103 to 105, wherein the the
nucleic acid-guided nuclease nickase is selected from the group
consisting of CAS Class I Type I nickase, CAS Class I Type III
nickase, CAS Class I Type IV nickase, CAS Class II Type II nickase,
and CAS Class II Type V nickase.
107. The method of any one of claims 103 to 105, wherein the
nucleic acid-guided nuclease nickase is selected from the group
consisting of Cas9 nickase, Cpf1 nickase, Cas3 nickase, Cas8a-c
nickase, Cas10 nickase, Cse1 nickase, Csy1 nickase, Csn2 nickase,
Cas4 nickase, Csm2 nickase, Cmr5 nickase, Csf1 nickase, C2C2
nickase, and NgAgo nickase.
108. The method of claim 103, wherein the DNA is double stranded
DNA.
109. The method of claim 108, wherein the double stranded DNA is
from genomic DNA.
110. The method of claim 109, wherein the genomic DNA is human.
111. The method of any one of claims 103 to 110, wherein the DNA
sequences are from 20 bp to 5000 bp in length.
112. The method of any one of claims 103 to 111, wherein the
targeted sites of interest are single nucleotide polymorphisms
(SNPs), short tandem repeats (STRs), cancer genes, inserts,
deletions, structural variations, exons, genetic mutations, or
regulatory regions.
113. The method of any one of claims 103 to 112, wherein the
targeted sites of interest represent less than 50% of the total DNA
in the sample.
114. The method of any one of claims 103 to 113, wherein the sample
is obtained from a biological sample, a clinical sample, a forensic
sample, or an environmental sample.
115. The method of any one of claims 103 to 113, wherein the
thermostable ligase capable of contacting the double stranded break
is thermostable 5'App DNA/RNA ligase or T4 RNA ligase.
116. The method of any one of claims 103 to 115, wherein the
nucleic acid-guided nuclease nickase nicks the 5' end of the DNA
sequences.
117. A method of enriching a sample for sequences of interest,
comprising: (a) providing a sample comprising sequences of interest
and targeted sequences for depletion, wherein the sequences of
interest comprise less than 50% of the sample; and (b) contacting
the sample with a plurality of either nucleic acid-guided RNA
endonuclease-gRNA complexes or a plurality of nucleic acid-guided
DNA endonuclease-gDNA complexes, wherein the gRNAs and gDNAs are
complementary to the targeted sequences, and whereby the targeted
sequences are cleaved.
118. The method of claim 117, further comprising extracting the
sequences of interest and the targeted sequences for depletion from
the sample.
119. The method of claim 118, further comprising fragmenting the
extracted sequences.
120. The method of any one of claims 117 to 119, wherein the
cleaved targeted sequences are removed by size-exclusion.
121. The method of any one of claims 117 to 120, wherein the sample
is any one of a biological sample, a clinical sample, a forensic
sample or an environmental sample.
122. The method of any one of claims 117 to 121, wherein the sample
comprises host nucleic acid sequences targeted for depletion and
non-host nucleic acid sequences of interest.
123. The method of claim 122, wherein the non-host nucleic acid
sequences comprise microbial nucleic acid sequences.
124. The method of claim 123, wherein the microbial nucleic acid
sequences are bacterial, viral or eukaryotic parasitic nucleic acid
sequences.
125. The method of any one of claims 117 to 124, wherein the gRNAs
and gDNAs are complementary to ribosomal RNA sequences, spliced
transcripts, unspliced transcripts, introns, exons, or noncoding
RNAs.
126. The method of claim 118, wherein the extracted nucleic acids
include single-stranded or double-stranded RNA.
127. The method of claim 118, wherein the extracted nucleic acids
include single-stranded or double-stranded DNA.
128. The method of any one of claims 117 to 127, wherein the
sequences of interest comprise less than 10% of the extracted
nucleic acids.
129. The method of any one of claims 117 to 128, wherein the
nucleic acid-guided RNA endonuclease comprises C2c2.
130. The method of claim 129, wherein the C2c2 is catalytically
dead.
131. The method of any one of claims 117 to 128, wherein the
nucleic acid-guided DNA endonuclease comprises NgAgo.
132. The method of claim 131, wherein the NgAgo is catalytically
dead.
133. The method of any one of claims 117 to 132, wherein the sample
is selected from whole blood, plasma, serum, tears, saliva, mucous,
cerebrospinal fluid, teeth, bone, fingernails, feces, urine,
tissue, and a biopsy.
134. A method of enriching a sample comprising: (a) providing a
sample comprising host nucleic acids and non-host nucleic acids;
(b) contacting the sample with a plurality of nucleic acid-guided
RNA endonuclease-gRNA complexes or a plurality of nucleic
acid-guided DNA endonuclease-gDNA complexes, wherein the gRNAs and
gDNAs are complementary to targeted sites in the host nucleic
acids, and (c) enriching the sample for non-host nucleic acids.
135. The method of claim 134, wherein the nucleic acid-guided RNA
endonuclease comprises C2c2.
136. The method of claim 134, wherein the nucleic acid-guided RNA
endonuclease comprises catalytically dead C2c2.
137. The method of claim 134, wherein the nucleic acid-guided DNA
endonuclease comprises NgAgo.
138. The method of claim 134, wherein the nucleic acid-guided DNA
endonuclease comprises catalytically dead NgAgo.
139. The method of anyone of claims 134 to 138, wherein the host is
selected from the group consisting of a human, cow, horse, sheep,
pig, monkey, dog, cat, gerbil, bird, mouse, and rat.
140. The method of anyone of claims 134 to 138, wherein the
non-host is a prokaryotic organism.
141. The method of anyone of claims 134 to 138, wherein the
non-host is selected from the group consisting of a eukaryote, a
virus, a bacterium, a fungus, and a protozoan.
142. The method of anyone of claims 134 to 141, wherein the
adapter-ligated host nucleic acids and non-host nucleic acids range
from 50 bp to 1000 bp.
143. The method of anyone of claims 134 to 142, wherein the
non-host nucleic acids comprise less than 50% of the total nucleic
acids in the sample.
144. The method of anyone of claims 134 to 143, wherein the sample
is any one of a biological sample, a clinical sample, a forensic
sample or an environmental sample.
145. The method of anyone of claims 134 to 144, wherein step (c)
comprises reverse-transcribing the product of step (b) into
cDNA.
146. The method of anyone of claims 134 to 145, wherein step (c)
comprises removing the host nucleic acids by size-exclusion.
147. The method of anyone of claims 134 to 145, wherein step (c)
comprises removing the host nucleic acids with the use of
biotin.
148. The method of anyone of claims 134 to 147, wherein the sample
is selected from whole blood, plasma, serum, tears, saliva, mucous,
cerebrospinal fluid, teeth, bone, fingernails, feces, urine,
tissue, and a biopsy.
149. A composition comprising a nucleic acid fragment, a nucleic
acid-guided nuclease nickase-gNA complex, and labeled
nucleotides.
150. The composition of claim 149, wherein the nucleic acid-guided
nuclease nickase is selected from the group consisting of CAS Class
I Type I nickase, CAS Class I Type III nickase, CAS Class I Type IV
nickase, CAS Class II Type II nickase, and CAS Class II Type V
nickase.
151. The composition of claim 149, wherein the nucleic acid-guided
nuclease nickase is selected from the group consisting of Cas9
nickase, Cpf1 nickase, Cas3 nickase, Cas8a-c nickase, Cas10
nickase, Cse1 nickase, Csy1 nickase, Csn2 nickase, Cas4 nickase,
Csm2 nickase, Cmr5 nickase, Csf1 nickase, C2C2 nickase, and NgAgo
nickase.
152. The composition of any one of claims 149 to 151, wherein the
gNAs are gRNAs.
153. The composition of any one of claims 149 to 151, wherein the
gNAs are gDNAs.
154. The composition of any one of claims 149 to 153, wherein the
nucleic acid fragment comprises DNA.
155. The composition of any one of claims 149 to 153, wherein the
nucleic acid fragment comprises RNA.
156. The composition of any one of claims 149 to 155, wherein the
nucleotides are labeled with biotin.
157. The composition of any one of claims 149 to 156, wherein the
nucleotides are part of an antibody conjugate pair.
158. A composition comprising a nucleic acid fragment and a
catalytically dead nucleic acid-guided nuclease-gNA complex,
wherein the catalytically dead nucleic acid-guided nuclease is
fused to a transposase.
159. The composition of claim 158, wherein the catalytically-dead
nucleic acid-guided nuclease is selected from the group consisting
of dead CAS Class I Type I, dead CAS Class I Type III, dead CAS
Class I Type IV, dead CAS Class II Type II, and dead CAS Class II
Type V.
160. The composition of claim 158, wherein the catalytically dead
nucleic acid-guided nuclease is selected from the group consisting
of dCas9, dCpf1, dCas3, dCas8a-c, dCas10, dCse1, dCsy1, dCsn2,
dCas4, dCsm2, dCmr5, dCsf1, dC2C2, and dNgAgo.
161. The composition of any one of claims 158, 159, or 160, wherein
the gNAs are gRNAs.
162. The composition of any one of claims 158 to 161, wherein the
gNAs are gDNAs.
163. The composition of any one of claims 158 to 162, wherein the
nucleic acid fragment comprises DNA.
164. The composition of any one of claims 158 to 163, wherein the
nucleic acid fragment comprises RNA.
165. The composition of any one of claims 158 to 164, wherein the
catalytically dead nucleic acid-guided nuclease is fused to the
N-terminus of the transposase.
166. The composition of any one of claims 158 to 165, wherein the
catalytically dead nucleic acid-guided nuclease is fused to the
C-terminus of the transposase.
167. A composition comprising a nucleic acid fragment comprising
methylated nucleotides, a nucleic acid-guided nuclease nickase-gNA
complex, and unmethylated nucleotides.
168. The composition of claim 167, wherein the nucleic acid-guided
nuclease nickase is selected from the group consisting of CAS Class
I Type I nickase, CAS Class I Type III nickase, CAS Class I Type IV
nickase, CAS Class II Type II nickase, and CAS Class II Type V
nickase.
169. The composition of claim 167, wherein the nucleic acid-guided
nuclease nickase is selected from the group consisting of Cas9
nickase, Cpf1 nickase, Cas3 nickase, Cas8a-c nickase, Cas10
nickase, Cse1 nickase, Csy1 nickase, Csn2 nickase, Cas4 nickase,
Csm2 nickase, Cmr5 nickase, Csf1 nickase, C2C2 nickase, and NgAgo
nickase.
170. The composition of any one of claims 167, 168, or 169, wherein
the gNAs are gRNAs.
171. The composition of any one of claims 167 to 170, wherein the
gNAs are gDNAs.
172. The composition of any one of claims 167 to 171, wherein the
nucleic acid fragment comprises DNA.
173. The composition of any one of claims 167 to 171, wherein the
nucleic acid fragment comprises RNA.
174. The composition of any one of claims 167 to 173, wherein the
nucleotides are labeled with biotin.
175. The composition of any one of claims 167 to 174, wherein the
nucleotides are part of an antibody conjugate pair.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This is a division of U.S. application Ser. No. 15/520,052,
filed on Apr. 18, 2017 (now allowed), which is a U.S. National
Stage Application under 35 U.S.C. .sctn. 371 of International
Application No. PCT/US2016/047631, filed on Aug. 18, 2016, which
claims priority to U.S. Provisional Application Ser. No.
62/207,359, filed on Aug. 19, 2015, each of which is incorporated
herein by reference in its entirety.
INCORPORATION OF THE SEQUENCE LISTING
[0002] The contents of the text file named
"ARCB_00201US_SeqList.txt", which was created on Nov. 27, 2019 and
is 6 KB in size, are hereby incorporated by reference in their
entirety.
BACKGROUND OF THE INVENTION
[0003] Targeted sequencing of specific regions of the genome
continues to be of interest to researchers, particularly in a
clinical setting. Clinical diagnosis of genetic disease, cancer,
and many research projects rely on targeted sequencing to enable
high coverage sequencing of targeted sites while reducing
sequencing costs. Currently, the primary methods used for this
purpose are 1) hybridization-based enrichment, and 2) multiplex
PCR. In the former approach, biotin-labeled short oligonucleotide
probes are used to "pull out" sequences of interest from a library.
This process can be time-consuming, expensive, and require many
hands-on steps. Furthermore, often some "off-target" sequences can
remain in the resulting product. The multiplex PCR-based approach
can be faster, but the number of targets can be limited and the
cost can be high. Needed are methods for the efficient capture of
nucleic acid regions of interest that are easy, specific, rapid,
and inexpensive. Provided herein are methods and compositions that
address this need.
[0004] All patents, patent applications, publications, documents,
web links, and articles cited herein are incorporated herein by
reference in their entireties.
BRIEF SUMMARY OF THE INVENTION
[0005] Provided herein are methods and compositions that allow for
the selective capture of nucleic acid sequences of interest. The
nucleic acids may contain DNA or RNA. The methods and compositions
provided herein are particularly useful for working with complex
nucleic acid samples.
[0006] In one aspect, the invention provides a method of capturing
target nucleic acid sequences comprising: (a) providing a sample
comprising a plurality of adapter-ligated nucleic acids, wherein
the nucleic acids are ligated to a first adapter at one end and
ligated to a second adapter at the other end; (b) contacting the
sample with a plurality of nucleic acid-guided nuclease-gNA
complexes, wherein the gNAs are complementary to targeted sites of
interest contained in a subset of the nucleic acids, thereby
generating a plurality of nucleic acid fragments ligated to a first
or second adapter at one end and no adapter at the other end; and
(c) contacting the plurality of nucleic acid fragments with third
adapters, thereby generating a plurality of nucleic acid fragments
ligated to either the first or second adapter at one end and the
third adapter at the other end. In one embodiment, the nucleic
acid-guided nuclease is a CRISPR/Cas system protein. In one
embodiment, the nucleic acid-guided nuclease is a non-CRISPR/Cas
system protein. In one embodiment, the nucleic acid-guided nuclease
is selected from the group consisting of CAS Class I Type I, CAS
Class I Type III, CAS Class I Type IV, CAS Class II Type II, and
CAS Class II Type V. In one embodiment, the nucleic acid-guided
nuclease is selected from the group consisting of Cas9, Cpf1, Cas3,
Cas8a-c, Cas10, Cse1, Csy1, Csn2, Cas4, Csm2, Cm5, Csf1, C2c2, and
NgAgo. In one embodiment, the gNAs are gRNAs. In one embodiment,
the gNAs are gDNAs. In one embodiment, the contacting with a
plurality of nucleic acid-guided nuclease-gNA complexes cleaves the
targeted sites of interest contained in a subset of the nucleic
acids, thereby generating a plurality of nucleic acid fragments
comprising a first or second adapter at one end and no adapter at
the other end. In one embodiment the method further comprises
amplifying the product of step (c) using first or second and third
adapter-specific PCR. In one embodiment the nucleic acids are
selected from the group consisting of single stranded DNA, double
stranded DNA, single stranded RNA, double stranded RNA, and a
DNA/RNA hybrid. In one embodiment the nucleic acids are double
stranded DNA. In one embodiment the nucleic acids are from genomic
DNA. In one embodiment the genomic DNA is human. In one embodiment
the nucleic acids adapter-ligated ends are from 20 bp to 5000 bp in
length. In one embodiment the targeted sites of interest are single
nucleotide polymorphisms (SNPs), short tandem repeats (STRs),
cancer genes, inserts, deletions, structural variations, exons,
genetic mutations, or regulatory regions. In one embodiment
amplified products are used for cloning, sequencing, or genotyping.
In one embodiment the adapters are from 20 bp to 100 bp in length.
In one embodiment the adapters comprise primer binding sites. In
one embodiment the adapters comprise sequencing adapters or
restriction sites. In one embodiment the targeted sites of interest
represent less than 50% of the total nucleic acid in the sample. In
one embodiment the sample is obtained from a biological sample a
clinical sample, a forensic sample, or an environmental sample. In
one embodiment the first and second adapters are identical. In one
embodiment the first and second adapters are different. In one
embodiment the sample comprises a sequencing library.
[0007] In another aspect, the invention provides a method of
introducing labeled nucleotides at targeted sites of interest
comprising: (a) providing a sample comprising a plurality of
nucleic acid fragments; (b) contacting the sample with a plurality
of nucleic acid-guided nuclease nickase-gNA complexes wherein the
gNAs are complementary to targeted sites of interest in the nucleic
acid fragments, thereby generating a plurality of nicked nucleic
acid fragments at the targeted sites of interest; and (c)
contacting the plurality of nicked nucleic acid fragments with an
enzyme capable of initiating nucleic acid synthesis at a nicked
site, and labeled nucleotides, thereby generating a plurality of
nucleic acid fragments comprising labeled nucleotides in the
targeted sites of interest. In one embodiment, the nucleic
acid-guided nuclease nickase is selected from the group consisting
of CAS Class I Type I nickase, CAS Class I Type III nickase, CAS
Class I Type IV nickase, CAS Class II Type II nickase, and CAS
Class II Type V nickase. In one embodiment, the nucleic acid-guided
nuclease nickase is selected from the group consisting of Cas9
nickase, Cpf1 nickase, Cas3 nickase, Cas8a-c nickase, Cas10
nickase, Cse1 nickase, Csy1 nickase, Csn2 nickase, Cas4 nickase,
Csm2 nickase, Cm5 nickase, Csf1 nickase, C2C2 nickase, and NgAgo
nickase. In one embodiment, the the gNAs are gRNAs. In one
embodiment, the gNAs are gDNAs. In one embodiment the nucleic acid
fragments are selected from the group consisting of single stranded
DNA fragments, double stranded DNA fragments, single stranded RNA
fragments, double stranded RNA fragments, and a DNA/RNA hybrid
fragments. In one embodiment the nucleic fragments are double
stranded DNA fragments. In one embodiment double stranded DNA
fragments are from genomic DNA. In one embodiment the genomic DNA
is human. In one embodiment the nucleic acid fragments are from 20
bp to 5000 bp in length. In one embodiment the targeted sites of
interest are single nucleotide polymorphisms (SNPs), short tandem
repeats (STRs), cancer genes, inserts, deletions, structural
variations, exons, genetic mutations, or regulatory regions. In one
embodiment the targeted sites of interest represent less than 50%
of the total nucleic acid in the sample. In one embodiment the
sample is obtained from a biological sample, a clinical sample, a
forensic sample, or an environmental sample. In one embodiment the
labeled nucleotides are biotinylated nucleotides. In one
embodiment, the labeled nucleotides are part of an antibody
conjugate pair. In one embodiment the method further comprises
contacting the nucleic acid fragments comprising biotinylated
nucleotides with avidin or strepavidin, thereby capturing the
targeted nucleic acid sites of interest. In one embodiment the
enzyme capable of initiating nucleic acid synthesis at a nicked
site is DNA Polymerase I, a Klenow fragment, a TAQ polymerase, or a
Bst DNA Polymerase. In one embodiment the Cas9 nickase nicks the 5'
end of the nucleic acid fragments. In one embodiment the nucleic
acid fragments are from 20 bp to 5000 bp in length. In one
embodiment the sample is obtained from a biological sample a
clinical sample, a forensic sample, or an environmental sample.
[0008] In another aspect, the invention provides a method of
capturing target nucleic acid sequences of interest comprising: (a)
providing a sample comprising a plurality of adapter-ligated
nucleic acids, wherein the nucleic acids are ligated to a first
adapter at one end and are ligated to a second adapter at the other
end; and (b) contacting the sample with a plurality of
catalytically dead nucleic acid-guided nuclease-gNA complexes,
wherein the catalytically dead nucleic acid-guided nuclease is
fused to a transposase, wherein the gRNAs are complementary to
targeted sites of interest contained in a subset of the nucleic
acids, and wherein the complexes are loaded with a plurality of
third adapters, to generate a plurality of nucleic acids fragments
comprising either a first or second adapter at one end, and a third
adapter at the other end. In one embodiment the method further
comprises amplifying the product of step (b) using first or second
adapter and third adapter-specific PCR. In one embodiment, the
catalytically dead nucleic acid-guided nuclease is derived from a
CRISPR/Cas system protein. In one embodiment, the catalytically
dead nucleic acid-guided nuclease is derived from a non-CRISPR/Cas
system protein. In one embodiment, the catalytically-dead nucleic
acid-guided nuclease is selected from the group consisting of dead
CAS Class I Type I, dead CAS Class I Type III, dead CAS Class I
Type IV, dead CAS Class II Type II, and dead CAS Class II Type V.
In one embodiment, the catalytically dead nucleic acid-guided
nuclease is selected from the group consisting of dCas9, dCpf1,
dCas3, dCas8a-c, dCas10, dCse1, dCsy1, dCsn2, dCas4, dCsm2, dCm5,
dCsf1, dC2C2, and dNgAgo. In one embodiment, the gNAs are gRNAs. In
one embodiment, the gNAs are gDNAs. In one embodiment the nucleic
acids sequences are from genomic DNA. In one embodiment the genomic
DNA is human. In one embodiment the catalytically dead nucleic
acid-guided nuclease is fused to the N-terminus of the transposase.
In one embodiment the catalytically dead nucleic acid-guided
nuclease is fused to the C-terminus of the transposase. In one
embodiment the adapter-ligated nucleic acids are 20 bp-5000 bp. In
one embodiment the contacting of step (b) allows for the insertion
of the second adapter into the targeted nucleic acid sequences. In
one embodiment the targeted sites of interest are single nucleotide
polymorphisms (SNPs), short tandem repeats (STRs), cancer genes,
inserts, deletions, structural variations, exons, genetic
mutations, or regulatory regions. In one embodiment the amplified
products are used for cloning, sequencing, or genotyping. In one
embodiment the adapters are from 20 bp to 100 bp in length. In one
embodiment the adapters comprise primer binding sites. In one
embodiment the adapters comprise sequencing adapters or restriction
sites. In one embodiment the targeted sites of interest represent
less than 50% of the total nucleic acid in the sample. In one
embodiment the sample is obtained from a biological sample a
clinical sample, a forensic sample, or an environmental sample.
[0009] In another aspect, the invention provides a method of
capturing target nucleic acid sequences of interest comprising: (a)
providing a sample comprising a plurality of adapter-ligated
nucleic acids, wherein the nucleic acids are ligated to the adapter
at the 5' end and 3' ends; (b) contacting the sample with a
plurality of catalytically dead nucleic acid-guided nuclease-gNA
complexes, wherein the gNAs are complementary to targeted sites of
interest contained in a subset of the nucleic acids, thereby
generating a plurality of nucleic acids adapter-ligated at the 5'
and 3' ends, bound to a catalytically dead nucleic acid-guided
nuclease-gNA complex; and (c) contacting the sample with a
plurality of catalytically dead nucleic acid-guided nuclease-gNA
complexes, wherein the gNAs are complementary to both targeted
sites of interest and targeted sites not of interest in the nucleic
acids, thereby generating a plurality of nucleic acid fragments
comprising nucleic acid sequences not of interest, adapter ligated
at only one of the 5' or 3' ends. In one embodiment the contacting
of step (c) does not displace the plurality of nucleic acids
adapter-ligated at the 5' and 3' ends, bound to a dCAS9-gRNA
complex of step (b). In one embodiment the contacting in step (d)
cleaves the targeted sites not of interest contained in a subset of
the nucleic acids, thereby generating a plurality of nucleic acid
fragments comprising nucleic acid sequences not of interest,
adapter ligated at only one of the 5' or 3' ends. In one embodiment
the method further comprises removing the bound dCAS9-gRNA complex
and amplifying the product of step (b) using adapter-specific PCR.
In one embodiment the catalytically dead nucleic acid-guided
nuclease is a CRISPR/Cas system protein. In one embodiment the
catalytically dead nucleic acid-guided nuclease is a non-CRISPR/Cas
system protein. In one embodiment, the catalytically-dead nucleic
acid-guided nuclease is selected from the group consisting of dead
CAS Class I Type I, dead CAS Class I Type III, dead CAS Class I
Type IV, dead CAS Class II Type II, and dead CAS Class II Type V.
In one embodiment the catalytically dead nucleic acid-guided
nuclease is selected from the group consisting of dCas9, dCpf1,
dCas3, dCas8a-c, dCas10, dCse1, dCsy1, dCsn2, dCas4, dCsm2, dCm5,
dCsf1, dC2C2, and dNgAgo. In one embodiment the gNAs are gRNAs. In
one embodiment the gNAs are gDNAs. In one embodiment the nucleic
acids are selected from the group consisting of single stranded
DNA, double stranded DNA, single stranded RNA, double stranded RNA,
and a DNA/RNA hybrid. In one embodiment the nucleic acids are
double stranded DNA. In one embodiment the nucleic acids are from
genomic DNA. In one embodiment the genomic DNA is human. In one
embodiment the nucleic acids adapter-ligated at the 5'ends and the
3'ends are from 20 bp to 5000 bp in length. In one embodiment the
targeted sites of interest are single nucleotide polymorphisms
(SNPs), short tandem repeats (STRs), cancer genes, inserts,
deletions, structural variations, exons, genetic mutations, or
regulatory regions. In one embodiment the amplified products are
used for cloning, sequencing, or genotyping. In one embodiment the
adapters are from 20 bp to 100 bp in length. In one embodiment the
adapters comprise primer binding sites. In one embodiment the
adapters comprise sequencing adapters or restriction sites. In one
embodiment the targeted sites of interest represent less than 50%
of the total nucleic acid in the sample. In one embodiment the
sample is obtained from a biological sample, a clinical sample, a
forensic sample, or an environmental sample.
[0010] In another aspect, the invention provides a method of
capturing target DNA sequences of interest comprising: (a)
providing a sample comprising a plurality of nucleic acid
sequences, wherein the nucleic acid sequences comprise methylated
nucleotides, and wherein the nucleic acid sequences are adapter
ligated on the 5' and 3' ends; (b) contacting the sample with a
plurality of nucleic acid-guided nuclease nickase-gNA complexes,
wherein the gNAs are complementary to targeted sites of interest in
a subset of the nucleic acid sequences, thereby generating a
plurality of nicked sites of interest in the subset of the nucleic
acid sequences, and wherein the target nucleic acid sequences are
adapter ligated on the 5' and 3' ends; (c) contacting the sample
with an enzyme capable of initiating DNA synthesis at a nicked
site, and unmethylated nucleotides, thereby generating a plurality
of nucleic acid sequences comprising unmethylated nucleotides in
the targeted sites of interest and wherein the nucleic acid
sequences are adapter ligated on the 5' and 3' ends; and (d)
contacting the sample with an enzyme capable of cutting methylated
nucleic acids, thereby generating a plurality of nucleic acid
fragments comprising methylated nucleic acids, wherein the
plurality of nucleic acid fragments comprising methylated nucleic
acids that are adapter ligated on at most one of the 5' and 3'
ends. In one embodiment, the nucleic acid-guided nuclease nickase
is selected from the group consisting of CAS Class I Type I
nickase, CAS Class I Type III nickase, CAS Class I Type IV nickase,
CAS Class II Type II nickase, and CAS Class II Type V nickase. In
one embodiment the nucleic acid-guided nuclease nickase is selected
from the group consisting of Cas9 nickase, Cpf1 nickase, Cas3
nickase, Cas8a-c nickase, Cas10 nickase, Cse1 nickase, Csy1
nickase, Csn2 nickase, Cas4 nickase, Csm2 nickase, Cm5 nickase,
Csf1 nickase, C2c2 nickase, and NgAgo nickase. In one embodiment
the gNAs are gRNAs. In one embodiment the gNAs are gDNAs. In one
embodiment the DNA is double stranded DNA. In one embodiment the
double stranded DNA is from genomic DNA. In one embodiment the
genomic DNA is human. In one embodiment the DNA sequences are from
20 bp to 5000 bp in length. In one embodiment the targeted sites of
interest are single nucleotide polymorphisms (SNPs), short tandem
repeats (STRs), cancer genes, inserts, deletions, structural
variations, exons, genetic mutations, or regulatory regions. In one
embodiment the targeted sites of interest represent less than 50%
of the total DNA in the sample. In one embodiment the sample is
obtained from a biological sample, a clinical sample, a forensic
sample, or an environmental sample. In one embodiment the enzyme
capable of initiating nucleic acid synthesis at a nicked site is
DNA Polymerase I, Klenow fragment a TAQ polymerase, or a Bst DNA
Polymerase. In one embodiment the nucleic acid-guided nuclease
nickase nicks the 5' end of the DNA sequences. In one embodiment
the enzyme capable of cutting methylated DNA is DpnI.
[0011] In another aspect, the invention provides a method of
capturing target DNA sequences of interest comprising: (a)
contacting the sample with a plurality of nucleic acid-guided
nuclease nickase-gNA complexes, wherein the gNAs are complementary
to targeted sites flanking a region of interest in a subset of the
DNA sequences, thereby generating a plurality of nicked DNA at
sites adjacent to the regions of interest (b) heating to 65.degree.
C. to cause nicks in close proximity to generate a double stranded
break (c) contacting these double stranded breaks with a
thermostable ligase thereby allowing ligation of adapter sequences
at these sites only and (d), repeating these three steps to place a
second adapter on the other side of the region of interest, thus
allowing enrichment of the region of interest. In one embodiment,
the gNAs are gRNAs. In one embodiment, the gNAs are gDNAs. In one
embodiment, the nucleic acid-guided nuclease nickase is selected
from the group consisting of CAS Class I Type I nickase, CAS Class
I Type III nickase, CAS Class I Type IV nickase, CAS Class II Type
II nickase, and CAS Class II Type V nickase. In one embodiment the
nucleic acid-guided nuclease nickase is selected from the group
consisting of Cas9 nickase, Cpf1 nickase, Cas3 nickase, Cas8a-c
nickase, Cas10 nickase, Cse1 nickase, Csy1 nickase, Csn2 nickase,
Cas4 nickase, Csm2 nickase, Cm5 nickase, Csf1 nickase, C2C2
nickase, and NgAgo nickase. In one embodiment the DNA is double
stranded DNA. In one embodiment the double stranded DNA is from
genomic DNA. In one embodiment the genomic DNA is human. In one
embodiment the DNA sequences are from 20 bp to 5000 bp in length.
In one embodiment the targeted sites of interest are single
nucleotide polymorphisms (SNPs), short tandem repeats (STRs),
cancer genes, inserts, deletions, structural variations, exons,
genetic mutations, or regulatory regions. In one embodiment the
targeted sites of interest represent less than 50% of the total DNA
in the sample. In one embodiment the sample is obtained from a
biological sample, a clinical sample, a forensic sample, or an
environmental sample. In one embodiment the ligase capable of
contacting the double stranded break is Thermostable 5'App DNA/RNA
ligase, or T4 RNA ligase. In one embodiment the nucleic acid-guided
nuclease nickase nicks the 5' end of the DNA sequences. In one
embodiment the enzyme capable of cutting methylated DNA is
DpnI.
[0012] In another aspect, the invention provides a method of
enriching a sample for sequences of interest, comprising: (a)
providing a sample comprising sequences of interest and targeted
sequences for depletion, wherein the sequences of interest comprise
less than 50% of the sample; and (b) contacting the sample with a
plurality of either nucleic acid-guided RNA endonuclease-gRNA
complexes or a plurality of nucleic acid-guided DNA
endonuclease-gDNA complexes, wherein the gRNAs and gDNAs are
complementary to the targeted sequences, and whereby the targeted
sequences are cleaved. In one embodiment, the method further
comprises extracting the sequences of interest and the targeted
sequences for depletion from the sample. In one embodiment, the
method further comprises fragmenting the extracted sequences. In
one embodiment, the cleaved targeted sequences are removed by
size-exclusion. In one embodiment, the sample is any one of a
biological sample, a clinical sample, a forensic sample or an
environmental sample. In one embodiment, the sample comprises host
nucleic acid sequences targeted for depletion and non-host nucleic
acid sequences of interest. In one embodiment, the non-host nucleic
acid sequences comprise microbial nucleic acid sequences. In one
embodiment, the microbial nucleic acid sequences are bacterial,
viral or eukaryotic parasitic nucleic acid sequences. In one
embodiment, the gRNAs and gDNAs are complementary to ribosomal RNA
sequences, spliced transcripts, unspliced transcripts, introns,
exons, or noncoding RNAs. In one embodiment, the extracted nucleic
acids include single-stranded or double-stranded RNA. In one
embodiment, the extracted nucleic acids include single-stranded or
double-stranded DNA. In one embodiment, the sequences of interest
comprise less than 10% of the extracted nucleic acids. In one
embodiment, the nucleic acid-guided RNA endonuclease comprises
C2c2. In one embodiment, the C2c2 is catalytically dead. In one
embodiment, the nucleic acid-guided DNA endonuclease comprises
NgAgo. In one embodiment, the NgAgo is catalytically dead. In one
embodiment, the sample is selected from whole blood, plasma, serum,
tears, saliva, mucous, cerebrospinal fluid, teeth, bone,
fingernails, feces, urine, tissue, and a biopsy.
[0013] In another aspect, the invention provides a method of
enriching a sample comprising: (a) providing a sample comprising
host nucleic acids and non-host nucleic acids; (b) contacting the
sample with a plurality of nucleic acid-guided RNA
endonuclease-gRNA complexes or a plurality of nucleic acid-guided
DNA endonuclease-gDNA complexes, wherein the gRNAs and gDNAs are
complementary to targeted sites in the host nucleic acids, and (c)
enriching the sample for non-host nucleic acids. In one embodiment,
the nucleic acid-guided RNA endonuclease comprises C2c2. In one
embodiment, the nucleic acid-guided RNA endonuclease comprises
catalytically dead C2c2. In one embodiment, the nucleic acid-guided
DNA endonuclease comprises NgAgo. In one embodiment, the nucleic
acid-guided DNA endonuclease comprises catalytically dead NgAgo. In
one embodiment, the host is selected from the group consisting of a
human, cow, horse, sheep, pig, monkey, dog, cat, gerbil, bird,
mouse, and rat. In one embodiment, the non-host is a prokaryotic
organism. In one embodiment, the non-host is selected from the
group consisting of a eukaryote, a virus, a bacterium, a fungus,
and a protozoan. In one embodiment, the adapter-ligated host
nucleic acids and non-host nucleic acids range from 50 bp to 1000
bp in length. In one embodiment, the non-host nucleic acids
comprise less than 50% of the total nucleic acids in the sample. In
one embodiment, the sample is any one of a biological sample, a
clinical sample, a forensic sample or an environmental sample. In
one embodiment, step (c) comprises reverse-transcribing the product
of step (b) into cDNA. In one embodiment, step (c) comprises
removing the host nucleic acids by size-exclusion. In one
embodiment, step (c) comprises removing the host nucleic acids with
the use of biotin. In one embodiment, the sample is selected from
whole blood, plasma, serum, tears, saliva, mucous, cerebrospinal
fluid, teeth, bone, fingernails, feces, urine, tissue, and a
biopsy.
[0014] In another aspect, the invention provides a method of using
a nucleic acid-guided RNA endonuclease to enrich for a target in an
RNA sample using labeled, catalytically dead nucleic acid-guided
RNA endonuclease protein. In some embodiments, the nucleic
acid-guided RNA endonuclease protein is targeted to HIV RNA in a
blood RNA sample, and host RNA is washed away. In some embodiments,
nucleic acid-guided RNA endonuclease is C2c2.
[0015] In another aspect, the invention provides a composition
comprising a nucleic acid fragment, a nucleic acid-guided nuclease
nickase-gNA complex, and labeled nucleotides. In one embodiment,
the nucleic acid comprises DNA. In one embodiment, the nucleic
acid-guided nuclease nickase is selected from the group consisting
of CAS Class I Type I nickase, CAS Class I Type III nickase, CAS
Class I Type IV nickase, CAS Class II Type II nickase, and CAS
Class II Type V nickase. In one embodiment, the nucleic acid-guided
nuclease nickase is selected from the group consisting of Cas9
nickase, Cpf1 nickase, Cas3 nickase, Cas8a-c nickase, Cas10
nickase, Cse1 nickase, Csy1 nickase, Csn2 nickase, Cas4 nickase,
Csm2 nickase, Cm5 nickase, Csf1 nickase, C2C2 nickase, and NgAgo
nickase. In one embodiment, the gNAs are gRNAs. In one embodiment,
the gNAs are gDNAs. In one embodiment, the nucleic acid fragment
comprises DNA. In one embodiment, the nucleic acid fragment
comprises RNA. In one embodiment, the nucleotides are labeled with
biotin. In one embodiment, the nucleotides are part of an antibody
conjugate pair.
[0016] In another aspect, the invention provides a composition
comprising a nucleic acid fragment and a catalytically dead nucleic
acid-guided nuclease-gNA complex, wherein the catalytically dead
nucleic acid-guided nuclease is fused to a transposase. In one
embodiment, the catalytically-dead nucleic acid-guided nuclease is
selected from the group consisting of dead CAS Class I Type I, dead
CAS Class I Type III, dead CAS Class I Type IV, dead CAS Class II
Type II, and dead CAS Class II Type V. In one embodiment, the
catalytically dead nucleic acid-guided nuclease is selected from
the group consisting of dCas9, dCpf1, dCas3, dCas8a-c, dCas10,
dCse1, dCsy1, dCsn2, dCas4, dCsm2, dCm5, dCsf1, dC2C2, and dNgAgo.
In one embodiment, the gNAs are gRNAs. In one embodiment, the gNAs
are gDNAs. In one embodiment, the nucleic acid fragment comprises
DNA. In one embodiment, the nucleic acid fragment comprises RNA. In
one embodiment, the catalytically dead nucleic acid-guided nuclease
is fused to the N-terminus of the transposase. In one embodiment,
the catalytically dead nucleic acid-guided nuclease is fused to the
C-terminus of the transposase. In one embodiment, the composition
comprises a DNA fragment and a dCas9-gRNA complex, wherein the
dCas9 is fused to a transposase.
[0017] In another aspect, the invention provides a composition
comprising a nucleic acid fragment comprising methylated
nucleotides, a nucleic acid-guided nuclease nickase-gNA complex,
and unmethylated nucleotides. In one embodiment, the nucleic
acid-guided nuclease nickase is selected from the group consisting
of CAS Class I Type I nickase, CAS Class I Type III nickase, CAS
Class I Type IV nickase, CAS Class II Type II nickase, and CAS
Class II Type V nickase. In one embodiment, the nucleic acid-guided
nuclease nickase is selected from the group consisting of Cas9
nickase, Cpf1 nickase, Cas3 nickase, Cas8a-c nickase, Cas10
nickase, Cse1 nickase, Csy1 nickase, Csn2 nickase, Cas4 nickase,
Csm2 nickase, Cm5 nickase, Csf1 nickase, C2C2 nickase, and NgAgo
nickase. In one embodiment, the gNAs are gRNAs. In one embodiment,
the gNAs are gDNAs. In one embodiment, the nucleic acid fragment
comprises DNA. In one embodiment, the nucleic acid fragment
comprises RNA. In one embodiment, the nucleotides are labeled with
biotin. In one embodiment, the nucleotides are part of an antibody
conjugate pair. In one embodiment, the composition comprises a DNA
fragment comprising methylated nucleotides, a nickase Cas9-gRNA
complex, and unmethylated nucleotides.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1 illustrates a first protocol for the capture of
target nucleic acids from a library of human genomic DNA.
[0019] FIG. 2 further illustrates the protocol for the capture of
target nucleic acids (e.g. DNA) from a nucleic acid mixture. Target
nucleic acid is cut with a nucleic acid-guided nuclease, following
which adapters are ligated into the newly available blunt ends.
[0020] FIG. 3 illustrates that Cas9 cutting, followed by ligation
of adapters, allows for specific amplification of target DNA.
[0021] FIG. 4 illustrates that upon sequencing the amplified DNA,
ligation of adapters occurred only at the location specified by the
guide RNA. AUK sequence, after Cas9 cleavage and adapter ligation
(upper left panel): SEQ ID NO: 1. Adapter sequence, after Cas9
cleavage and adapter ligation (upper right panel): SEQ ID NO: 2.
AUK sequence, original sequence (lower panel: SEQ ID NO: 3.
Cas9/gRNA1 binding site (at bottom): SEQ ID NO: 4.
[0022] FIG. 5 illustrates that the method of FIG. 1 efficiently
amplifies DNA that is under-represented in any given library.
[0023] FIG. 6 illustrates a second protocol for capture: the use of
a nucleic acid-guided nuclease nickase to label target nucleic
acids (e.g. DNA), allowing for further capture and
purification.
[0024] FIG. 7 illustrates a proof of principle experiment using a
restriction nickase as a substitute for the nucleic acid-guided
nuclease nickase.
[0025] FIG. 8 illustrates that enrichment of test DNA by
approximately 50-fold for the experiment illustrated in FIG. 7
(using a Cas9-nickase).
[0026] FIG. 9 illustrates a third protocol for capture: the use of
a catalytically dead nucleic acid-guided nuclease-transposase
fusion to insert adaptors in human genomic library, to allowing for
enrichment of specific SNPs.
[0027] FIG. 10 illustrates a fourth protocol for capture: the use
of dead nucleic acid-guided nuclease to protect targeted sites from
subsequent fragmentation by a nucleic acid-guided nuclease,
allowing for enrichment of regions of interest.
[0028] FIG. 11 illustrates a fifth protocol for capture: the use of
a nucleic acid-guided nuclease nickase to protect and then enrich
any targeted region, for example SNPs or STRs, from, for example,
human genomic DNA, by replacing methylated DNA with unmethylated
DNA.
[0029] FIG. 12 illustrates that the methylation of test DNA in the
fifth protocol renders it susceptible to DpnI-mediated
cleavage.
[0030] FIG. 13 illustrates a sixth protocol for capture: the use of
a nucleic acid-guided nuclease nickase to introduce two double
stranded breaks delineating a region of interest, allowing for 3'
single stranded ligation of adapters and subsequent enrichment.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0031] Unless defined otherwise herein, all technical and
scientific terms used herein have the same meaning as commonly
understood by one of ordinary skill in the art to which this
invention belongs. Although any methods and materials similar or
equivalent to those described herein can be used in the practice or
testing of the present invention, the preferred methods and
materials are described.
[0032] The headings provided herein are not limitations of the
various aspects or embodiments of the invention. Accordingly, the
terms defined immediately below are more fully defined by reference
to the specification as a whole.
[0033] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR
BIOLOGY, 2D ED., John Wiley and Sons, New York (1994), and Hale
& Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper
Perennial, N.Y. (1991) provide one of skill with the general
meaning of many of the terms used herein. Still, certain terms are
defined below for the sake of clarity and ease of reference.
[0034] Numeric ranges are inclusive of the numbers defining the
range.
[0035] The term "sample" as used herein relates to a material or
mixture of materials, typically, although not necessarily, in
liquid form, containing one or more analytes of interest.
[0036] The term "nucleic acid sample," as used herein denotes a
sample containing nucleic acids. Nucleic acid samples used herein
may be complex in that they contain multiple different molecules
that contain sequences. Genomic DNA from a mammal is a type of a
complex sample. Complex samples may have more then 10.sup.4,
10.sup.5, 10.sup.6 or 10.sup.7 different nucleic acid molecules. A
DNA target may originate from any source such as genomic DNA, cDNA,
or an artificial DNA construct. Any sample containing nucleic acid,
e.g., genomic DNA made from tissue culture cells or a sample of
tissue, may be employed herein.
[0037] The term "nucleotide" is intended to include those moieties
that contain not only the known purine and pyrimidine bases, but
also other heterocyclic bases that have been modified. Such
modifications include methylated purines or pyrimidines, acylated
purines or pyrimidines, alkylated riboses or other heterocycles. In
addition, the term "nucleotide" includes those moieties that
contain hapten or fluorescent labels and may contain not only
conventional ribose and deoxyribose sugars, but other sugars as
well. Modified nucleosides or nucleotides also include
modifications on the sugar moiety, e.g., wherein one or more of the
hydroxyl groups are replaced with halogen atoms or aliphatic
groups, or are functionalized as ethers, amines, or the like.
[0038] The term "nucleic acids" and "polynucleotides" are used
interchangeably herein. Polynucleotide is used to describe a
nucleic acid polymer of any length, e.g., greater than about 2
bases, greater than about 10 bases, greater than about 100 bases,
greater than about 500 bases, greater than 1000 bases, up to about
10,000 or more bases composed of nucleotides, e.g.,
deoxyribonucleotides or ribonucleotides, and may be produced
enzymatically or synthetically (e.g., PNA as described in U.S. Pat.
No. 5,948,902 and the references cited therein) which can hybridize
with naturally occurring nucleic acids in a sequence specific
manner analogous to that of two naturally occurring nucleic acids,
e.g., can participate in Watson-Crick base pairing interactions.
Naturally-occurring nucleotides include guanine, cytosine, adenine
and thymine (G, C, A and T, respectively). DNA and RNA have a
deoxyribose and ribose sugar backbones, respectively, whereas PNA's
backbone is composed of repeating N-(2-aminoethyl)-glycine units
linked by peptide bonds. In PNA various purine and pyrimidine bases
are linked to the backbone by methylene carbonyl bonds. A locked
nucleic acid (LNA), often referred to as inaccessible RNA, is a
modified RNA nucleotide. The ribose moiety of an LNA nucleotide is
modified with an extra bridge connecting the 2' oxygen and 4'
carbon. The bridge "locks" the ribose in the 3'-endo (North)
conformation, which is often found in the A-form duplexes. LNA
nucleotides can be mixed with DNA or RNA residues in the
oligonucleotide whenever desired. The term "unstructured nucleic
acid," or "UNA," is a nucleic acid containing non-natural
nucleotides that bind to each other with reduced stability. For
example, an unstructured nucleic acid may contain a G' residue and
a C' residue, where these residues correspond to non-naturally
occurring forms, i.e., analogs, of G and C that base pair with each
other with reduced stability, but retain an ability to base pair
with naturally occurring C and G residues, respectively.
Unstructured nucleic acid is described in US20050233340, which is
incorporated by reference herein for disclosure of UNA.
[0039] The term "oligonucleotide" as used herein denotes a
single-stranded multimer of nucleotides.
[0040] Unless otherwise indicated, nucleic acids are written left
to right in 5' to 3' orientation; amino acid sequences are written
left to right in amino to carboxy orientation, respectively.
[0041] The term "cleaving," as used herein, refers to a reaction
that breaks the phosphodiester bonds between two adjacent
nucleotides in both strands of a double-stranded DNA molecule,
thereby resulting in a double-stranded break in the DNA
molecule.
[0042] The term "cleavage site, as used herein, refers to the site
at which a double-stranded DNA molecule has been cleaved.
[0043] The "nucleic acid-guided nuclease-gNA complex" refers to a
complex comprising a nucleic acid-guided nuclease protein and a
guide nucleic acid (gNA, for example a gRNA or a gDNA). For example
the "Cas9-gRNA complex" refers to a complex comprising a Cas9
protein and a guide RNA (gRNA). The nucleic acid-guided nuclease
may be any type of nucleic acid-guided nuclease, including but not
limited to wild type nucleic acid-guided nuclease, a catalytically
dead nucleic acid-guided nuclease, or a nucleic acid-guided
nuclease-nickase.
[0044] The term "nucleic acid-guided nuclease-associated guide NA"
refers to a guide nucleic acid (guide NA). The nucleic acid-guided
nuclease-associated guide NA may exist as an isolated nucleic acid,
or as part of a nucleic acid-guided nuclease-gNA complex, for
example a Cas9-gRNA complex.
[0045] The terms "capture" and "enrichment" are used
interchangeably herein, and refer to the process of selectively
isolating a nucleic acid region containing: sequences of interest,
targeted sites of interest, sequences not of interest, or targeted
sites not of interest.
[0046] The term "hybridization" refers to the process by which a
strand of nucleic acid joins with a complementary strand through
base pairing as known in the art. A nucleic acid is considered to
be "selectively hybridizable" to a reference nucleic acid sequence
if the two sequences specifically hybridize to one another under
moderate to high stringency hybridization and wash conditions.
Moderate and high stringency hybridization conditions are known
(see, e.g., Ausubel, et al., Short Protocols in Molecular Biology,
3rd ed., Wiley & Sons 1995 and Sambrook et al., Molecular
Cloning: A Laboratory Manual, Third Edition, 2001 Cold Spring
Harbor, N.Y.). One example of high stringency conditions includes
hybridization at about 42.degree. C. in 50% formamide, 5.times.SSC,
5.times.Denhardt's solution, 0.5% SDS and 100 .mu.g/ml denatured
carrier DNA followed by washing two times in 2.times.SSC and 0.5%
SDS at room temperature and two additional times in 0.1.times.SSC
and 0.5% SDS at 42.degree. C.
[0047] The term "duplex," or "duplexed," as used herein, describes
two complementary polynucleotides that are base-paired, i.e.,
hybridized together.
[0048] The term "amplifying" as used herein refers to generating
one or more copies of a target nucleic acid, using the target
nucleic acid as a template.
[0049] The term "genomic region," as used herein, refers to a
region of a genome, e.g., an animal or plant genome such as the
genome of a human, monkey, rat, fish or insect or plant. In certain
cases, an oligonucleotide used in the method described herein may
be designed using a reference genomic region, i.e., a genomic
region of known nucleotide sequence, e.g., a chromosomal region
whose sequence is deposited at NCBI's Genbank database or other
databases, for example.
[0050] The term "genomic sequence," as used herein, refers to a
sequence that occurs in a genome. Because RNAs are transcribed from
a genome, this term encompasses sequence that exist in the nuclear
genome of an organism, as well as sequences that are present in a
cDNA copy of an RNA (e.g., an mRNA) transcribed from such a
genome.
[0051] The term "genomic fragment," as used herein, refers to a
region of a genome, e.g., an animal or plant genome such as the
genome of a human, monkey, rat, fish or insect or plant. A genomic
fragment may be an entire chromosome, or a fragment of a
chromosome. A genomic fragment may be adapter ligated (in which
case it has an adapter ligated to one or both ends of the fragment,
or to at least the 5' end of a molecule), or may not be adapter
ligated.
[0052] In certain cases, an oligonucleotide used in the method
described herein may be designed using a reference genomic region,
i.e., a genomic region of known nucleotide sequence, e.g., a
chromosomal region whose sequence is deposited at NCBI's Genbank
database or other databases, for example. Such an oligonucleotide
may be employed in an assay that uses a sample containing a test
genome, where the test genome contains a binding site for the
oligonucleotide.
[0053] The term "ligating," as used herein, refers to the
enzymatically catalyzed joining of the terminal nucleotide at the
5' end of a first DNA molecule to the terminal nucleotide at the 3'
end of a second DNA molecule.
[0054] If two nucleic acids are "complementary," each base of one
of the nucleic acids base pairs with corresponding nucleotides in
the other nucleic acid. The term "complementary" and "perfectly
complementary" are used synonymously herein.
[0055] The term "separating," as used herein, refers to physical
separation of two elements (e.g., by size or affinity, etc.) as
well as degradation of one element, leaving the other intact. For
example, size exclusion can be employed to separate nucleic acids,
including cleaved targeted sequences.
[0056] In a cell, DNA usually exists in a double-stranded form, and
as such, has two complementary strands of nucleic acid referred to
herein as the "top" and "bottom" strands. In certain cases,
complementary strands of a chromosomal region may be referred to as
"plus" and "minus" strands, the "first" and "second" strands, the
"coding" and "noncoding" strands, the "Watson" and "Crick" strands
or the "sense" and "antisense" strands. The assignment of a strand
as being a top or bottom strand is arbitrary and does not imply any
particular orientation, function or structure. Until they become
covalently linked, the first and second strands are distinct
molecules. For ease of description, the "top" and "bottom" strands
of a double-stranded nucleic acid in which the top and bottom
strands have been covalently linked will still be described as the
"top" and "bottom" strands. In other words, for the purposes of
this disclosure, the top and bottom strands of a double-stranded
DNA do not need to be separated molecules. The nucleotide sequences
of the first strand of several exemplary mammalian chromosomal
regions (e.g., BACs, assemblies, chromosomes, etc.) is known, and
may be found in NCBI's Genbank database, for example.
[0057] The term "top strand," as used herein, refers to either
strand of a nucleic acid but not both strands of a nucleic acid.
When an oligonucleotide or a primer binds or anneals "only to a top
strand," it binds to only one strand but not the other. The term
"bottom strand," as used herein, refers to the strand that is
complementary to the "top strand." When an oligonucleotide binds or
anneals "only to one strand," it binds to only one strand, e.g.,
the first or second strand, but not the other strand. If an
oligonucleotide binds or anneals to both strands of a
double-stranded DNA, the oligonucleotide may have two regions, a
first region that hybridizes with the top strand of the
double-stranded DNA, and a second region that hybridizes with the
bottom strand of the double-stranded DNA.
[0058] The term "double-stranded DNA molecule" refers to both
double-stranded DNA molecules in which the top and bottom strands
are not covalently linked, as well as double-stranded DNA molecules
in which the top and bottom stands are covalently linked. The top
and bottom strands of a double-stranded DNA are base paired with
one other by Watson-Crick interactions.
[0059] The term "denaturing," as used herein, refers to the
separation of at least a portion of the base pairs of a nucleic
acid duplex by placing the duplex in suitable denaturing
conditions. Denaturing conditions are well known in the art. In one
embodiment, in order to denature a nucleic acid duplex, the duplex
may be exposed to a temperature that is above the T, of the duplex,
thereby releasing one strand of the duplex from the other. In
certain embodiments, a nucleic acid may be denatured by exposing it
to a temperature of at least 90.degree. C. for a suitable amount of
time (e.g., at least 30 seconds, up to 30 mins). In certain
embodiments, fully denaturing conditions may be used to completely
separate the base pairs of the duplex. In other embodiments,
partially denaturing conditions (e.g., with a lower temperature
than fully denaturing conditions) may be used to separate the base
pairs of certain parts of the duplex (e.g., regions enriched for
A-T base pairs may separate while regions enriched for G-C base
pairs may remain paired). Nucleic acid may also be denatured
chemically (e.g., using urea or NaOH).
[0060] The term "genotyping," as used herein, refers to any type of
analysis of a nucleic acid sequence, and includes sequencing,
polymorphism (SNP) analysis, and analysis to identify
rearrangements.
[0061] The term "sequencing," as used herein, refers to a method by
which the identity of consecutive nucleotides of a polynucleotide
are obtained.
[0062] The term "next-generation sequencing" refers to the
so-called parallelized sequencing-by-synthesis or
sequencing-by-ligation platforms, for example, those currently
employed by Illumina, Life Technologies, and Roche, etc.
Next-generation sequencing methods may also include nanopore
sequencing methods or electronic-detection based methods such as
Ion Torrent technology commercialized by Life Technologies.
[0063] The term "complementary DNA" or cDNA refers to a
double-stranded DNA sample that was produced from an RNA sample by
reverse transcription of RNA (using primers such as random hexamers
or oligo-dT primers) followed by second-strand synthesis by
digestion of the RNA with RNaseH and synthesis by DNA
polymerase.
[0064] The term "RNA promoter adapter" is an adapter that contains
a promoter for a bacteriophage RNA polymerase, e.g., the RNA
polymerase from bacteriophage T3, T7, SP6 or the like.
[0065] Other definitions of terms may appear throughout the
specification.
Exemplary Methods of the Invention
[0066] As described herein, the invention provides exemplary
protocols for the capture of nucleic acids and compositions for use
in these protocols. Exemplary protocols are illustrated in FIGS. 1,
6, 9, 10, 11, and 13, respectively, and in the Examples section.
Various uses are contemplated throughout. Specific terms referred
to in this section are described in greater detail in subsequent
sections.
[0067] In one embodiment, the invention provides a capture method
(depicted as Protocol 1) as provided in FIGS. 1-5. In this
embodiment, the method is used to capture target nucleic acid
sequences. Referring to FIG. 1, the method comprises providing a
sample or a library 100, subject to extraction protocols 101 (e.g.
DNA extraction protocols), resulting in a sample 102 comprising
>99% non-target sequence and <1% target sequence. The sample
is subjected to library construction protocols 103, resulting in a
nucleic acid library comprising sequencing indexed adapters 104,
resulting in a plurality of adapter-ligated nucleic acids, wherein
the nucleic acids are ligated to a first adapter at one end, and a
second adapter at the other end. To produce a library of
target-specific guide NAs (e.g. gRNAs), a library of target
specific gNA precursors 110, each comprising a RNA polymerase
promoter 111, a specific-base pair region 112 (e.g. a 20 base pair
region), and a stem-loop binding site for a nucleic acid-guided
nuclease 113, was subjected to in vitro transcription 114, yielding
a library of target-specific guide RNAs 115. The library of
target-specific guide NAs was then combined with nucleic
acid-guided nuclease proteins 116 to yield a library of nucleic
acid-guided nuclease-gNA complexes. The nucleic acid-guided
nuclease-gNA complexes were then combined with the nucleic acid
library such that the nucleic acid-guided nuclease cleaved matching
target nucleic acid sequences and left other nucleic acids
uncleaved 117. Second adapters 118 were added and allowed to ligate
specifically to the 5' phosphorylated blunt ends of cleaved nucleic
acids 119. This allows for downstream applications, for example
amplifying the nucleic acid fragments comprising a first or second
adapter at one end and a third adapter at the other end, using
adapter-specific PCR 120.
[0068] In an exemplary depiction of Protocol 1, referring to FIG.
1, the method is used to capture target nucleic acid sequences. The
method comprises providing a sample or a library comprising a
plurality of adapter-ligated nucleic acids, wherein the nucleic
acids are ligated to a first adapter at one end, and a second
adapter at the other end. This is followed by contacting the sample
with a plurality of Cas9-gRNA complexes, wherein the gRNAs are
complementary to targeted sites of interest contained in a subset
of the nucleic acids. The contacting cleaves the targeted sites of
interest, thereby generating a plurality of nucleic acid fragments
ligated to a first or second adapter at one end and no adapter at
the other end. This step is followed by ligating the plurality of
resulting nucleic acid fragments with third adapters, thereby
generating a plurality of nucleic acid fragments ligated to a first
or second adapter at one end and a third adapter at the other end.
This allows for downstream applications, for example amplifying the
nucleic acid fragments comprising a first or second adapter at one
end and a third adapter at the other end, using adapter-specific
PCR.
[0069] In one embodiment, the invention provides a capture method
(depicted as Protocol 2) as provided in FIGS. 6-8. In this
embodiment, the method is used to introduce labeled nucleotides at
targeted sites of interest. The method comprises providing a sample
comprising a plurality of double stranded nucleic acid fragments
601 (e.g. double stranded DNA); contacting the sample with a
plurality of nucleic acid-guided nuclease nickase-gNA complexes.
The nickase nucleic acid-guided nuclease 603 is guided by
target-specific guide NAs 604, wherein the gNAs are complementary
to targeted sites of interest in the nucleic acid fragments,
thereby generating a plurality of nicked nucleic acid fragments at
the targeted sites of interest. Nickase is used to nick target
sequences 605. The nickase-nucleic acid-guided nuclease cleaves at
target sequence. Single strand cuts (nicks) are a substrate for DNA
polymerase I which can be used to replace DNA downstream of the
nick with biotin labeled DNA 606.
[0070] In an exemplary depiction of Protocol 2, referring to FIG.
6, the method is used to introduce labeled nucleotides at targeted
sites of interest. The method comprises providing a sample
comprising a plurality of nucleic acid fragments; contacting the
sample with a plurality of Cas9 nickase-gRNA complexes, wherein the
gRNAs are complementary to targeted sites of interest in the
nucleic acid fragments, thereby generating a plurality of nicked
nucleic acid fragments at the targeted sites of interest; and then
is followed by contacting the plurality of nicked nucleic acid
fragments with an enzyme capable of initiating nucleic acid
synthesis at a nicked site, and labeled nucleotides, thereby
generating a plurality of nucleic acid fragments comprising labeled
nucleotides in the targeted sites of interest.
[0071] In one embodiment, the invention provides a capture method
(depicted as Protocol 3) as provided in FIG. 9. In this embodiment,
the method is used to capture target nucleic acid sequences of
interest 901. The method first involves providing a sample
comprising a plurality of adapter-ligated nucleic acids 902,
wherein the nucleic acids are ligated to a first adapter at one end
and are ligated to a second adapter at the other end. This is then
followed by contacting the sample with a plurality of catalytically
dead nucleic acid-guided nuclease-gNA complexes, wherein the
catalytically dead nucleic acid-guided nuclease is fused to a
transposase 903, wherein the gNAs 904 are complementary to targeted
sites of interest contained in a subset of the nucleic acids, and
wherein the catalytically dead nucleic acid-guided nuclease-gNA
transposase complexes are loaded with a plurality of third adapters
905, to generate a plurality of nucleic acids fragments 906
comprising either a first or second adapter at one end and a third
adapter at the other end. These fragments can then be amplified 907
using the adapter sequences and then sequenced 908.
[0072] In an exemplary depiction of Protocol 3, referring to FIG.
9, the method is used to capture target nucleic acid sequences of
interest. The method first involves providing a sample comprising a
plurality of adapter-ligated nucleic acids, wherein the nucleic
acids are ligated to a first adapter at one end and are ligated to
a second adapter at the other end. This is then followed by
contacting the sample with a plurality of dCas9-gRNA complexes,
wherein the dCas9 is fused to a transposase, wherein the gRNAs are
complementary to targeted sites of interest contained in a subset
of the nucleic acids, and wherein the dCas9-gRNA transposase
complexes are loaded with a plurality of third adapters, to
generate a plurality of nucleic acids fragments comprising either a
first or second adapter at one end and a third adapter at the other
end.
[0073] In one embodiment, the invention provides a capture method
(depicted as Protocol 4) as provided for example in FIG. 10. In
this embodiment, the method is used to capture target nucleic acid
sequences of interest 1001. The method comprises first providing a
sample comprising a plurality of adapter-ligated nucleic acids
1002, wherein the nucleic acids are ligated to the adapter at the
5' end and 3' ends. The method then involves contacting the sample
with a plurality of catalytically dead nucleic acid-guided
nuclease-gNA complexes 1003, wherein the gNAs 1004 are
complementary to targeted sites of interest contained in a subset
of the nucleic acids, thereby generating a plurality of nucleic
acids adapter-ligated at the 5' and 3' ends, bound to a
catalytically dead nucleic acid-guided nuclease-gNA complex 1005.
This is followed by contacting the sample with a plurality of
nucleic acid-guided nuclease-gNA complexes 1006, wherein the gNAs
1007 are complementary to targeted sites of interest and targeted
sites not of interest in the nucleic acids, thereby generating a
plurality of nucleic acid fragments 1008 comprising nucleic acid
sequences not of interest, adapter ligated at only one of the 5' or
3' ends. In this method wherein the second contacting step,
contacting with a plurality of nucleic acid-guided nuclease-gNA
complexes, does not displace the plurality of nucleic acids
adapter-ligated at the 5' and 3' ends, bound to a catalytically
dead nucleic acid-guided nuclease-gNA complex of step (b).
[0074] In an exemplary depiction of Protocol 4, referring to FIG.
10, the method is used to capture target nucleic acid sequences of
interest. The method comprises first providing a sample comprising
a plurality of adapter-ligated nucleic acids, wherein the nucleic
acids are ligated to the adapter at the 5' end and 3' ends. The
method then involves contacting the sample with a plurality of dead
nucleic acid-guided nuclease-gNA complexes (e.g., dCas9-gRNA)
complexes, wherein the gNAs are complementary to targeted sites of
interest contained in a subset of the nucleic acids, thereby
generating a plurality of nucleic acids adapter-ligated at the 5'
and 3' ends, bound to a dead nucleic acid-guided nuclease-gNA
complex (e.g., dCAS9-gRNA complex). This is followed by contacting
the sample with a plurality of nucleic acid-guided nuclease-gNA
complexes (e.g., Cas9-gRNA complexes), wherein the gNAs are
complementary to targeted sites of interest and targeted sites not
of interest in the nucleic acids, thereby generating a plurality of
nucleic acid fragments comprising nucleic acid sequences not of
interest, adapter ligated at only one of the 5' or 3' ends. In this
method wherein the second contacting step, contacting with a
plurality of nucleic acid-guided nuclease-gNA complexes (e.g.,
Cas9-gRNA complexes), does not displace the plurality of nucleic
acids adapter-ligated at the 5' and 3' ends, bound to a dead
nucleic acid-guided nuclease-gNA complex (e.g., dCAS9-gRNA complex)
of step (b).
[0075] In one embodiment, the invention provides a capture method
(depicted as Protocol 5) as provided, for example, in FIG. 11 and
FIG. 12. In this embodiment, the method is used to capture target
nucleic sequences of interest 1101. The method involves first
providing a sample comprising a plurality of sequences 1102,
wherein the sequences comprise methylated nucleotides (e.g.,
treated with Dam methyltransferase), and wherein the sequences are
adapter ligated on the 5' and 3' ends. The method then involves
first contacting the sample with a plurality of nucleic acid-guided
nuclease nickase-gNA complexes 1103, wherein the gNAs 1104 are
complementary to targeted sites of interest in a subset of the
sequences, thereby generating a plurality of nicked nucleic acid
sequences 1105 at the targeted sites of interest, and wherein the
nucleic acid sequences are adapter ligated on the 5' and 3' ends.
Where the nucleic acid is DNA, single strand cuts (nicks) can be,
for example, a substrate for DNA polymerase I, which replaces the
DNA downstream of the nick with unmethylated DNA. This can then be
followed by then contacting the sample with an enzyme capable of
initiating DNA synthesis at a nicked site, and unmethylated
nucleotides, thereby generating a plurality of DNA comprising
unmethylated nucleotides 1106 in the targeted sites of interest and
wherein the DNA sequences are adapter ligated on the 5' and 3'
ends. This is then followed by contacting the sample with an enzyme
capable of cutting methylated DNA (e.g., DpnI) 1107, thereby
generating a plurality of DNA fragments comprising methylated DNA,
wherein the plurality of DNA fragments comprising methylated DNA
are adapter ligated only one of the 5' and 3' ends. Remaining
intact nucleic acid can be amplified and sequenced 1108. FIG. 12
shows, for example, results from an experiment conducted according
to this protocol. The first column on the gel shows a 1 kb ladder,
the second column shows test DNA treated with Dam
methyltransferase, then digested with DpnI, and the third column
shows test DNA digested with DpnI. The second column shows a band
corresponding to DpnI digested DNA, while the third column shows a
band corresponding to uncut test DNA.
[0076] In an exemplary depiction of Protocol 5, referring to FIGS.
11-12, the method is used to capture target DNA sequences of
interest. The method involves first providing a sample comprising a
plurality of DNA sequences, wherein the DNA sequences comprise
methylated nucleotides, and wherein the DNA sequences are adapter
ligated on the 5' and 3' ends. The method then involves first
contacting the sample with a plurality of Cas9 nickase-gRNA
complexes, wherein the gRNAs are complementary to targeted sites of
interest in a subset of the DNA sequences, thereby generating a
plurality of nicked DNA at the targeted sites of interest, and
wherein the DNA are adapter ligated on the 5' and 3' ends. This is
then followed by then contacting the sample with an enzyme capable
of initiating DNA synthesis at a nicked site, and unmethylated
nucleotides, thereby generating a plurality of DNA comprising
unmethylated nucleotides in the targeted sites of interest and
wherein the DNA sequences are adapter ligated on the 5' and 3'
ends. This is then followed by contacting the sample with an enzyme
capable of cutting methylated DNA, thereby generating a plurality
of DNA fragments comprising methylated DNA, wherein the plurality
of DNA fragments comprising methylated DNA are adapter ligated only
one of the 5' and 3' ends.
[0077] In one embodiment, the invention provides a capture method
(depicted as Protocol 6) as provided in FIG. 13. The objective of
this method is to enrich a region of a nucleic acid 1301, from any
source (e.g., library 1302, genomic, or PCR), as depicted for
example in FIG. 13. The nucleic acid-guided nuclease-nickase 1303
can be targeted to proximal sites using two guide NAs 1304 and
1305, resulting in nicking of nucleic acid at each location 1306.
Alternatively, an adapter can be ligated on only one side, then
filled in, then an adapter can be ligated on the other side. The
two nicks can be close to each other (e.g., within 10 to 15 bp).
Single nicks may be generated in non-target molecules. Because of
the proximity of the two nicking sites, a double stranded break can
be created when the reaction is heated 1307, e.g. to 65.degree. C.,
resulting in long (e.g., 10-15 bp) 3' overhangs. These overhangs
can be recognized by a thermostable single stranded DNA/RNA ligase,
to allow for site-specific ligation 1308 of single stranded
adapters. The ligase can, for example, only recognize long 3'
overhangs, thus ensuring that adapters will not be ligated at other
sites. This process can be repeated using nucleic acid-guided
nuclease nickase and guide NAs targeting on the other side of the
region of interest, followed by ligation as above using a second
single stranded adapter. Once two adapters have been ligated on
either side of the region of interest, the region can be amplified
or sequenced directly 1309.
[0078] In an exemplary depiction of Protocol 6, referring to FIG.
13, the method is to enrich a region of DNA, from any DNA source
(e.g., library, genomic, or PCR). A Cas9 Nickase can be targeted to
proximal sites using two guide RNAs and, resulting in nicking of
DNA at each location. Alternatively, an adapter can be ligated on
only one side, then filled in, then an adapter can be ligated on
the other side. The two nicks can be close to each other (e.g.,
within 10 to 15 bp). Single nicks may be generated in non-target
molecules. Because of the proximity of the two nicking sites, a
double stranded break can be created when the reaction is heated,
e.g. to 65.degree. C., resulting in long (e.g., 10-15 bp) 3'
overhangs. These overhangs can be recognized by a thermostable
single stranded DNA/RNA ligase, such as a Thermostable 5'App
DNA/RNA ligase to allow for site-specific ligation of single
stranded adapters. The ligase can, for example, only recognize long
3' overhangs, thus ensuring that adapters will not be ligated at
other sites. This process can be repeated using Cas9 Nickase and
guide RNA targeting on the other side of the region of interest,
followed by ligation as above using a second single stranded
adapter. Once two adapters have been ligated on either side of the
region of interest, the region can be amplified or sequenced
directly.
[0079] In one embodiment, provided herein is a method of enriching
a sample for sequences of interest, comprising: (a) providing a
sample comprising sequences of interest and targeted sequences for
depletion, wherein the sequences of interest comprise less than 50%
of the sample; and (b) contacting the sample with a plurality of
nucleic acid-guided RNA endonuclease-gRNA complexes or a plurality
of nucleic acid-guided DNA endonuclease-gDNA complexes, wherein the
gRNAs and gDNAs are complementary to the targeted sequences. In
some embodiments, the targeted sequences are thereby cleaved. In
one embodiment, the nucleic acid-guided RNA endonuclease is C2c2.
In one embodiment the C2c2 is catalytically dead. In one
embodiment, the nucleic acid-guided DNA endonuclease is NgAgo
(Argonaute from Natronobacterium gregoryi). In one embodiment the
NgAgo is catalytically dead.
[0080] In one embodiment, provided herein is a method of enriching
a sample comprising: (a) providing a sample comprising host nucleic
acids and non-host nucleic acids; (b) contacting the sample with a
plurality of nucleic acid-guided RNA endonuclease-gRNA complexes or
plurality of nucleic acid-guided DNA endonuclease-gDNA complexes,
wherein the gNAs are complementary to targeted sites in the host
nucleic acids, and (c) enriching the sample for non-host nucleic
acids. In one embodiment, the nucleic acid-guided RNA endonuclease
is C2c2. In one embodiment the C2c2 is catalytically dead. In one
embodiment, the nucleic acid-guided DNA endonuclease is NgAgo. In
one embodiment the NgAgo is catalytically dead.
Nucleic Acids, Samples
[0081] Nucleic acids of the invention (targeted for capture) can be
any DNA, any RNA, single stranded DNA, single stranded RNA, double
stranded DNA, double stranded RNA, artificial DNA, artificial RNA,
synthetic DNA, synthetic RNA, and RNA/DNA hybrids.
[0082] The nucleic acids of the invention can be a genomic
fragment, comprising a region of the genome, or the whole genome
itself. In one embodiment, the genome is a DNA genome. In another
embodiment, the genome is a RNA genome.
[0083] Nucleic acids of the invention can be obtained from a
eukaryotic or prokaryotic organism; from a mammalian organism or a
non-mammalian organism; from an animal or a plant; from a bacteria
or virus; from an animal parasite; or from a pathogen.
[0084] Nucleic acids of the invention can be obtained from any
mammalian organism. In one embodiment the mammal is a human. In
another embodiment the mammal is a livestock animal, for example a
horse, a sheep, a cow, a pig, or a donkey. In another embodiment, a
mammalian organism is a domestic pet, for example a cat, a dog, a
gerbil, a mouse, a rat. In another embodiment the mammal is a type
of a monkey.
[0085] Nucleic acids of the invention can be obtained from any bird
or avian organism. An avian organism includes but is not limited to
chicken, turkey, duck and goose.
[0086] Nucleic acids of the invention can be obtained from a plant.
In one embodiment, the plant is rice, maize, wheat, rose, grape,
coffee, fruit, tomato, potato, or cotton.
[0087] In some embodiments, nucleic acids of the invention are
obtained from a species of bacteria. In one embodiment, the
bacteria are tuberculosis-causing bacteria.
[0088] In some embodiments, nucleic acids of the invention are
obtained from a virus.
[0089] In some embodiments, nucleic acids of the invention are
obtained from a species of fungi.
[0090] In some embodiments, nucleic acids of the invention are
obtained from a species of algae.
[0091] In some embodiments, nucleic acids of the invention are
obtained from any mammalian parasite.
[0092] In some embodiments, nucleic acids of the invention are
obtained from any mammalian parasite. In one embodiment, the
parasite is a worm. In another embodiment, the parasite is a
malaria-causing parasite. In another embodiment, the parasite is a
Leishmaniasis-causing parasite. In another embodiment, the parasite
is an amoeba.
[0093] In some embodiments the pathogen is a non-mammalian pathogen
(is pathogenic in non-mammalian organisms).
[0094] In one embodiment, the nucleic acids of the invention
include nucleic acids that are targets of gNAs and nucleic acids
that are not the targets of gNAs, in the same sample.
[0095] In one embodiment, the nucleic acids of the invention
include nucleic acids that are targets of gRNAs and nucleic acids
that are not the targets of gRNAs, in the same sample.
[0096] In one embodiment, the nucleic acids of the invention
include nucleic acids that are targets of gDNAs and nucleic acids
that are not the targets of gDNAs, in the same sample.
[0097] In one embodiment, the nucleic acids of the invention
include target nucleic acids (targets of gNAs) and nucleic acids of
interest (not targeted by gNAs) from a sample.
[0098] In one embodiment, the nucleic acids of the invention
include target nucleic acids (targets of gRNAs) and nucleic acids
of interest (not targeted by gRNAs) from a sample.
[0099] In one embodiment, the nucleic acids of the invention
include target nucleic acids (targets of gDNAs) and nucleic acids
of interest (not targeted by gDNAs) from a sample.
[0100] In one embodiment, the target DNA (target of the gNAs,
gRNAs, gDNAs) may be human non-mitochondrial DNA (e.g. genomic
DNA), and the DNA of interest (for capture) may be the human
mitochondrial DNA, and the human mitochondrial DNA is enriched by
targeting the non-mitochondrial human DNA.
[0101] In one embodiment, the nucleic acids to be captured may be a
non-mapable region of a genome; and the nucleic acids to be
retained for further analysis/sequencing/cloning may be mapable
regions of a genome. In one embodiment, the nucleic acids to be
captured out may be a mapable region of a genome; and the nucleic
acids to be retained for further analysis/sequencing/cloning may be
non-mapable regions of a genome. Examples of non mapable regions
include telomeres, centromeres, or other genomic regions that
contain features harder to map.
[0102] In one embodiment, the nucleic acids of the invention are
obtained from a biological sample. The biological sample from which
the nucleic acids are obtained include but are not limited to whole
blood, plasma, serum, tears, saliva, mucous, cerebrospinal fluid,
teeth, bone, fingernails, feces, urine, tissue, and biopsy. The
biological sample may include forensic samples such as teeth, bone,
fingernails or the like. The biological sample may include tissue,
a tissue biopsy, for example a resected lung tissue. The biological
sample may include a clinical sample, which refers to a sample
obtained in a clinical setting, such as in a hospital, or
clinic.
[0103] In one embodiment, the nucleic acids of the invention are
obtained from an environmental sample, for example from water,
soil, air, or rock.
[0104] In one embodiment, the nucleic acids of the invention are
obtained from a forensic sample, for example, a sample obtained
from an individual at a crime scene, from a piece of evidence,
post-mortem, as a part of an ongoing investigation or the like.
[0105] In on embodiment, the nucleic acids of the invention are
provided in a library.
[0106] The nucleic acids of the invention can be either provided or
extracted from a sample. Extraction can extract substantially all
the nucleic acid sequences from a specimen.
[0107] The methods of the invention may produce nucleic acids to be
captured: nucleic acids to not be captured at a ratio of anywhere
between 99.999:0.001 to 0.001:99.999. The methods of the invention
may produce targeted nucleic acids and nucleic acids of interest at
a ratio of anywhere between 99.999:0.001 to 0.001:99.999. The
methods of the invention may produce nucleic acids to be captured
to nucleic acids to be retained/analyzed/sequenced at a ratio of
anywhere between 99.999:0.001 to 0.001:99.999. In these
embodiments, the ratios can be equal to or fall anywhere in between
99.999:0.001 to 0.001:99.999, for example the ratio can be 99:1,
95:5, 90:10, 85:15, 80:20, 75:25, 70:30, 65:35, 60:40, 55:45,
50:50, 45:55, 40:60, 35:65, 30:70, 25:75, 20:80, 15:85, 10:90,
5:95, and 1:99.
[0108] After the capture, the captured or retained nucleic
sequences can be fragmented to reduce the lengths of each extracted
nucleic acids to a more manageable length for amplifying,
sequencing or the like.
[0109] As provided herein, at least 10%, 15%, 20%, 25%, 30%, 40%,
50%, 60%, 70%, 80%, 90% of the starting nucleic acid material can
be captured. This capture can be achieved in no greater than 10
minutes, 15 minutes, 20 minutes, 30 minutes, 45 minutes, 60
minutes, 75 minutes, 90 minutes, 105 minutes, 120 minutes, 150
minutes, 180 minutes, or 240 minutes.
[0110] In some cases, the targeted sites of interest represent less
than 90%, less than 80%, less than 70%, less than 60%, less than
50%, less than 40%, less than 30%, less than 20%, or less than 10%
of the total DNA in the sample.
Adapters
[0111] As provided herein, the nucleic acids of the invention
(referred to interchangeably as nucleic acids or nucleic acid
fragments) are adapter-ligated, to aid in carrying out the methods
provided herein.
[0112] Nucleic acids of the invention to be adapter-ligated can
range from 20 bp in size to 5000 bp in size. For example, the
nucleic acid to be adapter-ligated may be at least 20, 25, 50, 75,
100, 125, 150, 175, 200, 25, 300, 350, 400, 450, 500, 550, 600,
650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000,
3500, 4000, 4500, or 5000 bp. In one specific embodiment, the
nucleic acid to be adapter ligated is 100 bp. In one specific
embodiment, the nucleic acid to be adapter ligated is 200 bp. In
one specific embodiment, the nucleic acid to be adapter ligated is
300 bp. In one specific embodiment, the nucleic acid to be adapter
ligated is 400 bp. In one specific embodiment, the nucleic acid to
be adapter ligated is 500 bp.
[0113] An adapter can be ligated to each end of each of the nucleic
acids, or nucleic acid fragments, at the 5' and 3' ends. In other
embodiments an adapter may be ligated to only one end of each of
the fragments or in other instances adapters may be ligated in a
later step. In one example the adapter is a nucleic acid that is
ligatable to both strands of a double-stranded DNA molecule. In
various embodiments the adapter may be a hairpin adapter e.g., one
molecule that base pairs with itself to form a structure that has a
double-stranded stem and a loop, where the 3' and 5' ends of the
molecule ligate to the 5' and 3' ends of the double-stranded DNA
molecule of the fragment, respectively. Alternately, the adapter
may be a Y-adapter ligated to one end or to both ends of a
fragment, also called a universal adapter. Alternately, the adapter
may itself be composed of two distinct oligonucleotide molecules
that are base paired with one another. Additionally, a ligatable
end of the adapter may be designed to be compatible with overhangs
made by cleavage by a restriction enzyme, or it may have blunt ends
or a 5' T overhang. Generally, the adapter may include
double-stranded as well as single-stranded molecules. Thus the
adapter can be DNA or RNA, or a mixture of the two. Adapters
containing RNA may be cleavable by RNase treatment or by alkaline
hydrolysis.
[0114] Adapters can be 10 to 100 bp in length although adapters
outside of this range are usable without deviating from the present
invention. In specific embodiments, the adapter is at least 10 bp,
at least 15 bp, at least 20 bp, at least 25 bp, at least 30 bp, at
least 35 bp, at least 40 bp, at least 45 bp, at least 50 bp, at
least 55 bp, at least 60 bp, at least 65 bp, at least 70 bp, at
least 75 bp, at least 80 bp, at least 85 bp, at least 90 bp, or at
least 95 bp in length.
[0115] In further examples the captured nucleic acid sequences may
be derived from one or more DNA sequencing libraries. An adapter
may be configured for a next generation sequencing platform, for
example for use on an Illumina sequencing platform or for use on an
IonTorrent platform.
[0116] An adapter may contain a restriction site of interest or a
primer binding site.
[0117] Exemplary adapters include P5 and P7 adapters.
Guide Nucleic Acids (gNAs)
[0118] Provided herein are guide nucleic acids (gNAs), wherein the
gNAs are complementary to (selective for, can hybridize with)
targeted sites or sequences of interest, or sequences not of
interest in the nucleic acids, for example in genomic DNA from a
host. The gNAs guide nucleic acid-guided nucleases to specific
sites on a nucleic acid.
[0119] In some embodiments, the gNAs are guide RNAs (gRNAs); in
other embodiments, the gNAs are guide DNAs (gDNAs). In some
embodiments the gNAs comprise a mixture of gRNAs and gDNAs.
[0120] The host to which the gNAs are directed to can be an animal,
for example a human, cow, horse, sheep, pig, monkey, dog, cat,
gerbil, bird, mouse, or rat. The host can be a plant. The non-host
can be a prokaryotic organism, a eukaryote, a virus, a bacterium, a
fungus, and a protozoan.
[0121] In one embodiment, the present invention provides a guide
nucleic acid (gNA) library which comprises a collection of gNAs,
configured to hybridize with a nucleic acid sequence targeted for
capture. In another embodiment, the present invention provides a
guide NA library which comprises a collection of gNAs, configured
to hybridize with a nucleic acid sequence that is not targeted for
capture.
[0122] In one embodiment, the present invention provides a guide
RNA library which comprises a collection of gRNAs, configured to
hybridize with a nucleic acid sequence targeted for capture. In
another embodiment, the present invention provides a guide RNA
library which comprises a collection of gRNAs, configured to
hybridize with a nucleic acid sequence that is not targeted for
capture.
[0123] In one embodiment, the present invention provides a guide
DNA library which comprises a collection of gDNAs, configured to
hybridize with a nucleic acid sequence targeted for capture. In
another embodiment, the present invention provides a guide DNA
library which comprises a collection of gDNAs, configured to
hybridize with a nucleic acid sequence that is not targeted for
capture.
[0124] In one embodiment, the gNAs are selective for target nucleic
acids in a sample, but are not selective for sequences of interest
from the sample.
[0125] In one embodiment, the gNAs are used to serially capture
nucleic acid sequences.
[0126] In some embodiments, the gNAs are selective for a target
nucleic acid sequences which are followed by Protospacer Adjacent
Motif (PAM) sequences that can be bound by a nucleic acid-guided
nuclease. In some embodiments, the sequence of the gNAs is
determined by the nucleic acid-guided nuclease type. In various
embodiments the gNAs may be tailored to different nucleic
acid-guided nuclease types as the PAM sequence can vary by the
species of the organism from which the nucleic acid-guided nuclease
is derived.
[0127] The gNAs (gRNAs or gDNAs) of the invention can range in size
from 50-200 base pairs. For example, a gNA of the invention can be
at least 50 bp, 55 bp, 60 bp, 65 bp, 70 bp, 75 bp, 80 bp, 85 bp, 90
bp, 95 bp, 100 bp, 110 bp, 120 bp, 125 bp, 130 bp, 140 bp, 150 bp,
160 bp, 170 bp, 175 bp, 180 bp, 190 bp, or 195 bp. In specific
embodiments, the gNA is 80 bp, 90 bp, 100 bp, or 110 bp. In some
embodiments, a target-specific gNA comprises a base pair sequence
can be complementary to a pre-defined site in a target nucleic acid
that is followed by a Protospacer Adjacent Motif or (PAM) sequence
that can be bound by a nucleic acid-guided nuclease protein (e.g.
Cas9) derived from a bacterial species. In specific embodiments,
the base pair sequence of the gNA that is complementary to a
pre-defined site in a target nucleic acid is 15, 16, 17, 18, 19,
20, 25, 30, 35, 40, 45, or 50 base pairs.
[0128] The present invention also provides for gNA libraries (e.g.
gRNA libraries or gDNA libraries). A gNA library can comprise a
number of different species-specific guide NA (e.g. gRNA or gDNA)
elements each, configured to hybridize with (be selective for) a
nucleic acid sequence being targeted capture, a nucleic acid
sequence of interest, or a nucleic acid sequence not of interest.
Each gNA includes a target-specific guide sequence and a stem loop
binding site that is formed to bind with a nucleic acid-guided
nuclease protein. In some embodiments, the library can comprise a
plurality of different guide NAs, each having a different 15-30
base pair sequence that is complementary to a different pre-defined
site in the nucleic acid being targeted, that is followed by an
appropriate PAM sequence that can be bound by a nucleic acid-guided
nuclease protein. For each guide NA the PAM sequence is present in
the pre-defined DNA or RNA target sequence of the nucleic acid of
interest but is not present in the corresponding target specific
guide sequence.
[0129] Generally according to the present invention, any nucleic
acid sequence in a genome of interest, with a pre-defined target
sequence followed by the appropriate PAM sequence can be hybridized
by a corresponding guide RNA provided in the guide NA library and
bound by a nucleic acid-guided nuclease. In various embodiments the
gNA library may be tailored to different nucleic acid-guided
nuclease types since the PAM sequence can vary by the species of
the bacteria from which nucleic acid-guided nuclease is derived.
But in some variations, the pre-defined target sequence is not
followed by a PAM sequence.
[0130] Different target-specific sequences in the gNAs can be
generated. This can be done by using a promoter for a bacteriophage
RNA polymerase, e.g., the RNA polymerase from bacteriophage T3, T7,
SP6 or the like. Accordingly, each different T7 RNA polymerase
promoter provides a different target specific sequence suitable for
hybridizing to a different target nucleic acid sequence. A
non-limiting exemplary set of forward primers usable for both
annealing and subsequent PCR reactions is listed in Table 1
provided below.
[0131] A gNA library (e.g. a gRNA or gDNA library) can be amplified
to include a large number of copies of each different guide NA
element as well as a large number of different guide NA elements as
may be suitable to for the desired capture results. The number of
unique guide NA elements in a given guide NA library may range from
1 unique guide NA element to as many as 300,000,000 unique guide NA
elements, or approximately 1 unique guide NA sequence for every 10
base pairs in the human genome. The number of unique gNAs (e.g.,
gRNAs or gDNAs) can be at least about 101, 102, 103, 104, 105, 106,
107, or 108 unique gNAs. The number of unique gNAs can result in
that number of unique nucleic acid-guided nuclease-gNA complexes
(e.g. CRISPR/Cas system protein-gRNA complexes).
[0132] Without being limited to theory, the distance between gNAs
to arrive at >95% cleavage of the target nucleic acid can be
computed, if the gNAs display .about.100% efficacy: this can be
computed by measuring the distribution of library size and
determining the mean, N and the standard deviation SD;
N-2SD=minimum size for >95% of the library, ensuring that there
is one guide NA per fragment of this size to ensure >95%
capture. This can also be described as the Maximum distance between
guide NAs=Mean of library size-2.times.(standard deviation of
library size).
[0133] In various embodiments of the invention, the gNAs can be
specific for various targeted sites of interest, including, but not
limited to, single nucleotide polymorphisms (SNPs), short tandem
repeats (STRs), cancer genes, inserts, deletions, structural
variations, exons, genetic mutations, and regulatory regions.
Nucleic Acid-Guided Nucleases
[0134] Provided herein compositions and methods for the capture of
nucleic acids from a sample. These compositions and methods utilize
nucleic acid-guided nucleases. As used herein, a "nucleic
acid-guided nuclease" is any endonuclease that cleaves DNA, RNA or
DNA/RNA hybrids, and which uses one or more nucleic acid guide
nucleic acids (gNAs) to confer specificity. Nucleic acid-guided
nucleases include CRISPR/Cas system proteins as well as
non-CRISPR/Cas system proteins.
[0135] The nucleic acid-guided nucleases provided herein can be DNA
guided DNA endonucleases; DNA guided RNA endonucleases; RNA guided
DNA endonucleases; or RNA guided RNA endonucleases.
[0136] In one embodiment, the nucleic acid-guided nuclease is a
nucleic acid-guided-DNA endonuclease.
[0137] In one embodiment, the nucleic acid-guided nuclease is a
nucleic acid-guided-RNA endonuclease.
CRISPR/Cas System Nucleic Acid-Guided Nucleases
[0138] In some embodiments, CRISPR/Cas system proteins are used in
the embodiments provided herein. In some embodiments, CRISPR/Cas
system proteins include proteins from CRISPR Type I systems, CRISPR
Type II systems, and CRISPR Type III systems.
[0139] In some embodiments, CRISPR/Cas system proteins can be from
any bacterial or archaeal species.
[0140] In some embodiments, the CRISPR/Cas system protein is
isolated, recombinantly produced, or synthetic.
[0141] In some embodiments, the CRIPR/Cas system proteins are from,
or are derived from CRISPR/Cas system proteins from Streptococcus
pyogenes, Staphylococcus aureus, Neisseria meningitidis,
Streptococcus thermophiles, Treponema denticola, Francisella
tularensis, Pasteurella multocida, Campylobacter jejuni,
Campylobacter lari, Mycoplasma gallisepticum, Nitratifractor
salsuginis, Parvibaculum lavamentivorans, Roseburia intestinalis,
Neisseria cinerea, Gluconacetobacter diazotrophicus, Azospirillum,
Sphaerochaeta globus, Flavobacterium columnare, Fluviicola
taffensis, Bacteroides coprophilus, Mycoplasma mobile,
Lactobacillus farciminis, Streptococcus pasteurianus, Lactobacillus
johnsonii, Staphylococcus pseudintermedius, Filifactor alocis,
Legionella pneumophila, Suterella wadsworthensis, or Corynebacter
diphtheria.
[0142] In some embodiments, examples of CRISPR/Cas system proteins
can be naturally occurring or engineered versions.
[0143] In some embodiments, naturally occurring CRISPR/Cas system
proteins can belong to CAS Class I Type I, III, or IV, or CAS Class
II Type II or V, and can include Cas9, Cas3, Cas8a-c, Cas10, Cse1,
Csy1, Csn2, Cas4, Csm2, Cmr5, Csf1, C2c2, and Cpf1.
[0144] In an exemplary embodiment, the CRISPR/Cas system protein
comprises Cas9.
[0145] A "CRISPR/Cas system protein-gNA complex" refers to a
complex comprising a CRISPR/Cas system protein and a guide NA (e.g.
a gRNA or a gDNA). Where the gNA is a gRNA, the gRNA may be
composed of two molecules, i.e., one RNA ("crRNA") which hybridizes
to a target and provides sequence specificity, and one RNA, the
"tracrRNA", which is capable of hybridizing to the crRNA.
Alternatively, the guide RNA may be a single molecule (i.e., a
gRNA) that contains crRNA and tracrRNA sequences.
[0146] A CRISPR/Cas system protein may be at least 60% identical
(e.g., at least 70%, at least 80%, or 90% identical, at least 95%
identical or at least 98% identical or at least 99% identical) to a
wild type CRISPR/Cas system protein. The CRISPR/Cas system protein
may have all the functions of a wild type CRISPR/Cas system
protein, or only one or some of the functions, including binding
activity, nuclease activity, and nuclease activity.
[0147] The term "CRISPR/Cas system protein-associated guide NA"
refers to a guide NA. The CRISPR/Cas system protein-associated
guide NA may exist as isolated NA, or as part of a CRISPR/Cas
system protein-gNA complex.
Cas9
[0148] In some embodiments the CRISPR/Cas System protein nucleic
acid-guided nuclease is or comprises Cas9. The Cas9 of the present
invention can be isolated, recombinantly produced, or
synthetic.
[0149] Examples of Cas9 proteins that can be used in the
embodiments herein can be found in F. A. Ran, L. Cong, W. X. Yan,
D. A. Scott, J. S. Gootenberg, A. J. Kriz, B. Zetsche, O. Shalem,
X. Wu, K. S. Makarova, E. V. Koonin, P. A. Sharp, and F. Zhang; "In
vivo genome editing using Staphylococcus aureus Cas9," Nature 520,
186-191 (9 Apr. 2015) doi:10.1038/nature14299, which is
incorporated herein by reference.
[0150] In some embodiments, the Cas9 is a Type II CRISPR system
derived from Streptococcus pyogenes, Staphylococcus aureus,
Neisseria meningitidis, Streptococcus thermophiles, Treponema
denticola, Francisella tularensis, Pasteurella multocida,
Campylobacter jejuni, Campylobacter lari, Mycoplasma gallisepticum,
Nitratifractor salsuginis, Parvibaculum lavamentivorans, Roseburia
intestinalis, Neisseria cinerea, Gluconacetobacter diazotrophicus,
Azospirillum, Sphaerochaeta globus, Flavobacterium columnare,
Fluviicola taffensis, Bacteroides coprophilus, Mycoplasma mobile,
Lactobacillus farciminis, Streptococcus pasteurianus, Lactobacillus
johnsonii, Staphylococcus pseudintermedius, Filifactor alocis,
Legionella pneumophila, Suterella wadsworthensis, or Corynebacter
diphtheria.
[0151] In some embodiments, the Cas9 is a Type II CRISPR system
derived from S. pyogenes and the PAM sequence is NGG located on the
immediate 3' end of the target specific guide sequence. The PAM
sequences of Type II CRISPR systems from exemplary bacterial
species can also include: Streptococcus pyogenes (NGG), Staph
aureus (NNGRRT), Neisseria meningitidis (NNNNGA TT), Streptococcus
thermophilus (NNAGAA) and Treponema denticola (NAAAAC) which are
all usable without deviating from the present invention.
[0152] In one exemplary embodiment, Cas9 sequence can be obtained,
for example, from the pX330 plasmid (available from Addgene),
re-amplified by PCR then cloned into pET30 (from EMD biosciences)
to express in bacteria and purify the recombinant 6His tagged
protein.
[0153] A "Cas9-gNA complex" refers to a complex comprising a Cas9
protein and a guide NA. A Cas9 protein may be at least 60%
identical (e.g., at least 70%, at least 80%, or 90% identical, at
least 95% identical or at least 98% identical or at least 99%
identical) to a wild type Cas9 protein, e.g., to the Streptococcus
pyogenes Cas9 protein. The Cas9 protein may have all the functions
of a wild type Cas9 protein, or only one or some of the functions,
including binding activity, nuclease activity, and nuclease
activity.
[0154] The term "Cas9-associated guide NA" refers to a guide NA as
described above. The Cas9-associated guide NA may exist isolated,
or as part of a Cas9-gNA complex.
Non-CRISPR/Cas System Nucleic Acid-Guided Nucleases
[0155] In some embodiments, non-CRISPR/Cas system proteins are used
in the embodiments provided herein.
[0156] In some embodiments, the non-CRISPR/Cas system proteins can
be from any bacterial or archaeal species.
[0157] In some embodiments, the non-CRISPR/Cas system protein is
isolated, recombinantly produced, or synthetic.
[0158] In some embodiments, the non-CRISPR/Cas system proteins are
from, or are derived from Aquifex aeolicus, Thermus thermophilus,
Streptococcus pyogenes, Staphylococcus aureus, Neisseria
meningitidis, Streptococcus thermophiles, Treponema denticola,
Francisella tularensis, Pasteurella multocida, Campylobacter
jejuni, Campylobacter lari, Mycoplasma gallisepticum,
Nitratifractor salsuginis, Parvibaculum lavamentivorans, Roseburia
intestinalis, Neisseria cinerea, Gluconacetobacter diazotrophicus,
Azospirillum, Sphaerochaeta globus, Flavobacterium columnare,
Fluviicola taffensis, Bacteroides coprophilus, Mycoplasma mobile,
Lactobacillus farciminis, Streptococcus pasteurianus, Lactobacillus
johnsonii, Staphylococcus pseudintermedius, Filifactor alocis,
Legionella pneumophila, Suterella wadsworthensis, Natronobacterium
gregoryi, or Corynebacter diphtheria.
[0159] In some embodiments, the non-CRISPR/Cas system proteins can
be naturally occurring or engineered versions.
[0160] In some embodiments, a naturally occurring non-CRISPR/Cas
system protein is NgAgo (Argonaute from Natronobacterium
gregoryi).
[0161] A "non-CRISPR/Cas system protein-gNA complex" refers to a
complex comprising a non-CRISPR/Cas system protein and a guide NA
(e.g. a gRNA or a gDNA). Where the gNA is a gRNA, the gRNA may be
composed of two molecules, i.e., one RNA ("crRNA") which hybridizes
to a target and provides sequence specificity, and one RNA, the
"tracrRNA", which is capable of hybridizing to the crRNA.
Alternatively, the guide RNA may be a single molecule (i.e., a
gRNA) that contains crRNA and tracrRNA sequences.
[0162] A non-CRISPR/Cas system protein may be at least 60%
identical (e.g., at least 70%, at least 80%, or 90% identical, at
least 95% identical or at least 98% identical or at least 99%
identical) to a wild type non-CRISPR/Cas system protein. The
non-CRISPR/Cas system protein may have all the functions of a wild
type non-CRISPR/Cas system protein, or only one or some of the
functions, including binding activity, nuclease activity, and
nuclease activity.
[0163] The term "non-CRISPR/Cas system protein-associated guide NA"
refers to a guide NA. The non-CRISPR/Cas system protein-associated
guide NA may exist as isolated NA, or as part of a non-CRISPR/Cas
system protein-gNA complex.
Catalytically Dead Nucleic Acid-Guided Nucleases
[0164] In some embodiments, engineered examples of nucleic
acid-guided nucleases include catalytically dead nucleic
acid-guided nucleases (CRISPR/Cas system nucleic acid-guided
nucleases or non-CRISPR/Cas system nucleic acid-guided nucleases).
The term "catalytically dead" generally refers to a nucleic
acid-guided nuclease that has inactivated nucleases, for example
inactivated HNH and RuvC nucleases. Such a protein can bind to a
target site in any nucleic acid (where the target site is
determined by the guide NA), but the protein is unable to cleave or
nick the nucleic acid.
[0165] Accordingly, the catalytically dead nucleic acid-guided
nuclease allows separation of the mixture into unbound nucleic
acids and catalytically dead nucleic acid-guided nuclease-bound
fragments. Use of a dead nucleic acid-guided nuclease is depicted,
for example, in FIG. 9 and FIG. 10, in Protocols 3 and 4,
respectively. In one exemplary embodiment, a dCas9/gRNA complex
binds to the targets determined by the gRNA sequence. The dCas9
bound can prevent cutting by Cas9 while other manipulations
proceed, as pictured in FIG. 10.
[0166] In another embodiment, the catalytically dead nucleic
acid-guided nuclease can be fused to another enzyme, such as a
transposase, to target that enzyme's activity to a specific
site.
[0167] In some embodiments, the catalytically dead nucleic
acid-guided nuclease is dCas9, dCpf1, dCas3, dCas8a-c, dCas10,
dCse1, dCsy1, dCsn2, dCas4, dCsm2, dCm5, dCsf1, dC2C2, or
dNgAgo.
[0168] In one exemplary embodiment the catalytically dead nucleic
acid-guided nuclease protein is a dCas9.
Nucleic Acid-Guided Nuclease Nickases
[0169] In some embodiments, engineered examples of nucleic
acid-guided nucleases include nucleic acid-guided nuclease nickases
(referred to interchangeably as nickase nucleic acid-guided
nucleases).
[0170] In some embodiments, engineered examples of nucleic
acid-guided nucleases include CRISPR/Cas system nickases or
non-CRISPR/Cas system nickases, containing a single inactive
catalytic domain.
[0171] In some embodiments, the nucleic acid-guided nuclease
nickase is a Cas9 nickase, Cpf1 nickase, Cas3 nickase, Cas8a-c
nickase, Cas10 nickase, Cse1 nickase, Csy1 nickase, Csn2 nickase,
Cas4 nickase, Csm2 nickase, Cm5 nickase, Csf1 nickase, C2C2
nickase, or a NgAgo nickase.
[0172] In one embodiment, the nucleic acid-guided nuclease nickase
is a Cas9 nickase.
[0173] In some embodiments, a nucleic acid-guided nuclease nickase
can be used to bind to target sequence. With only one active
nuclease domain, the nucleic acid-guided nuclease nickase cuts only
one strand of a target DNA, creating a single-strand break or
"nick". Depending on which mutant is used, the guide NA-hybridized
strand or the non-hybridized strand may be cleaved. nucleic
acid-guided nuclease nickases bound to 2 gNAs that target opposite
strands can create a double-strand break in the nucleic acid. This
"dual nickase" strategy increases the specificity of cutting
because it requires that both nucleic acid-guided nuclease/gNA
complexes be specifically bound at a site before a double-strand
break is formed.
[0174] In exemplary embodiments, a Cas9 nickase can be used to bind
to target sequence. The term "Cas9 nickase" refers to a modified
version of the Cas9 protein, containing a single inactive catalytic
domain, i.e., either the RuvC- or the HNH-domain. With only one
active nuclease domain, the Cas9 nickase cuts only one strand of
the target DNA, creating a single-strand break or "nick". Depending
on which mutant is used, the guide RNA-hybridized strand or the
non-hybridized strand may be cleaved. Cas9 nickases bound to 2
gRNAs that target opposite strands will create a double-strand
break in the DNA. This "dual nickase" strategy can increase the
specificity of cutting because it requires that both Cas9/gRNA
complexes be specifically bound at a site before a double-strand
break is formed.
[0175] Capture of DNA can be carried out using a nucleic
acid-guided nuclease nickase. This is illustrated in FIG. 6 and
FIG. 11, Protocols 2 and 5, respectively. In one exemplary
embodiment, as pictured in FIGS. 6 and 11, a nucleic acid-guided
nuclease nickase cuts a single strand of double stranded nucleic
acid, wherein the double stranded region comprises methylated
nucleotides.
Dissociable and Thermostable Nucleic Acid-Guided Nucleases
[0176] In some embodiments thermostable nucleic acid-guided
nucleases are used in the methods provided herein (thermostable
CRISPR/Cas system nucleic acid-guided nucleases or thermostable
non-CRISPR/Cas system nucleic acid-guided nucleases). In such
embodiments, the reaction temperature is elevated, inducing
dissociation of the protein; the reaction temperature is lowered,
allowing for the generation of additional cleaved target sequences.
In some embodiments, thermostable nucleic acid-guided nucleases
maintain at least 50% activity, at least 55% activity, at least 60%
activity, at least 65% activity, at least 70% activity, at least
75% activity, at least 80% activity, at least 85% activity, at
least 90% activity, at least 95% activity, at least 96% activity,
at least 97% activity, at least 98% activity, at least 99%
activity, or 100% activity, when maintained for at least 75.degree.
C. for at least 1 minute. In some embodiments, thermostable nucleic
acid-guided nucleases maintain at least 50% activity, when
maintained for at least 1 minute at least at 75.degree. C., at
least at 80.degree. C., at least at 85.degree. C., at least at
90.degree. C., at least at 91.degree. C., at least at 92.degree.
C., at least at 93.degree. C., at least at 94.degree. C., at least
at 95.degree. C., 96.degree. C., at least at 97.degree. C., at
least at 98.degree. C., at least at 99.degree. C., or at least at
100.degree. C. In some embodiments, thermostable nucleic
acid-guided nucleases maintain at least 50% activity, when
maintained at least at 75.degree. C. for at least 1 minute, 2
minutes, 3 minutes, 4 minutes, or 5 minutes. In some embodiments, a
thermostable nucleic acid-guided nucleases maintains at least 50%
activity when the temperature is elevated, lowered to 25.degree.
C.-50.degree. C. In some embodiments, the temperature is lowered to
25.degree. C., to 30.degree. C., to 35.degree. C., to 40.degree.
C., to 45.degree. C., or to 50.degree. C. In one exemplary
embodiment, a thermostable enzyme retains at least 90% activity
after 1 min at 95.degree. C.
[0177] In some embodiments, the thermostable nucleic acid-guided
nuclease is thermostable Cas9, thermostable Cpf1, thermostable
Cas3, thermostable Cas8a-c, thermostable Cas10, thermostable Cse1,
thermostable Csy1, thermostable Csn2, thermostable Cas4,
thermostable Csm2, thermostable Cm5, thermostable Csf1,
thermostable C2C2, or thermostable NgAgo.
[0178] In some embodiments the thermostable CRISPR/Cas system
protein is thermostable Cas9.
[0179] Thermostable nucleic acid-guided nucleases can be isolated,
for example, identified by sequence homology in the genome of
thermophilic bacteria Streptococcus thermophilus and Pyrococcus
furiosus. Nucleic acid-guided nuclease genes can then be cloned
into an expression vector. In one exemplary embodiment, a
thermostable Cas9 protein is isolated.
[0180] In another embodiment, a thermostable nucleic acid-guided
nuclease can be obtained by in vitro evolution of a
non-thermostable nucleic acid-guided nuclease. The sequence of a
nucleic acid-guided nuclease can be mutagenized to improve its
thermostability.
Exemplary Compositions of the Invention
[0181] In one embodiment, provided herein is a composition
comprising a nucleic acid fragment, a nickase nucleic acid-guided
nuclease-gNA complex, and labeled nucleotides. In one exemplary
embodiment, provided herein is a composition comprising a nucleic
acid fragment, a nickase Cas9-gRNA complex, and labeled
nucleotides. In such embodiments, the nucleic acid may comprise
DNA. The nucleotides can be labeled, for example with biotin. The
nucleotides can be part of an antibody-conjugate pair.
[0182] In one embodiment, provided herein is a composition
comprising a nucleic acid fragment and a catalytically dead nucleic
acid-guided nuclease-gNA complex, wherein the catalytically dead
nucleic acid-guided nuclease is fused to a transposase. In one
exemplary embodiment, provided herein is a composition comprising a
DNA fragment and a dCas9-gRNA complex, wherein the dCas9 is fused
to a transposase.
[0183] In one embodiment, provided herein is a composition
comprising a nucleic acid fragment comprising methylated
nucleotides, a nickase nucleic acid-guided nuclease-gNA complex,
and unmethylated nucleotides. In an exemplary embodiment, provided
herein is a composition comprising a DNA fragment comprising
methylated nucleotides, a nickase Cas9-gRNA complex, and
unmethylated nucleotides.
[0184] In one embodiment, provided herein is a gDNA complexed with
a nucleic acid-guided-DNA endonuclease. In an exemplary embodiment,
the nucleic acid-guided-DNA endonuclease is NgAgo.
[0185] In one embodiment, provided herein is a gDNA complexed with
a nucleic acid-guided-RNA endonuclease.
[0186] In one embodiment, provided herein is a gRNA complexed with
a nucleic acid-guided-DNA endonuclease.
[0187] In one embodiment, provided herein is a gRNA complexed with
a nucleic acid-guided-RNA endonuclease. In one embodiment the
nucleic acid-guided-RNA endonuclease comprises C2c2.
Kits and Articles of Manufacture
[0188] The present application provides kits comprising any one or
more of the compositions described herein, including, but not
limited to, adapters, gNAs, gDNAs, gRNAs, gNA libraries, gRNA
libraries, gDNA libraries, a nucleic acid-guided nuclease, a
catalytically dead nucleic acid-guided nuclease, a nickase nucleic
acid-guided nuclease, a CRISPR/Cas system protein, a nickase
CRISPR/Cas system protein, a catalytically dead CRISPR/Cas system
protein, Cas9, dCas9, Cas9 nickase, methylated nucleotides, labeled
nucleotides, biotinylated nucleotides, avidin, streptavidin, an
enzyme capable of initiating nucleic acid synthesis at a nicked
site, DNA Polymerase I, TAQ polymerase, bst DNA Polymerase, an
enzyme capable of cleaving methylated nucleotides, a Dpn1 enzyme,
and an enzyme capable of methylating DNA, for example a Dam/Dcm1
methyltransferase).
[0189] In one embodiment, the kit comprises a collection or library
of gNAs wherein the gNAs are targeted to human genomic DNA
sequences, for example particular genes of interest (e.g. cancer
genes) SNPs, STRs. In another exemplary embodiment, the kit
comprises a collection or library of gNAs wherein the gNAs are
targeted to non-human mammalian DNA sequences. In another exemplary
embodiment, the kit comprises a collection or library of gNAs
wherein the gNAs are targeted to human ribosomal RNA sequences. In
another exemplary embodiment, the kit comprises a collection or
library of gNAs wherein the gNAs are targeted to human
mitochondrial DNA sequences.
[0190] In one exemplary embodiment, the kit comprises a collection
or library of gRNAs wherein the gRNAs are targeted to human genomic
DNA sequences, for example particular genes of interest (e.g.
cancer genes) SNPs, STRs. In another exemplary embodiment, the kit
comprises a collection or library of gRNAs wherein the gRNAs are
targeted to non-human mammalian DNA sequences. In another exemplary
embodiment, the kit comprises a collection or library of gRNAs
wherein the gRNAs are targeted to human ribosomal RNA sequences. In
another exemplary embodiment, the kit comprises a collection or
library of gRNAs wherein the gRNAs are targeted to human
mitochondrial DNA sequences.
[0191] The present application also provides articles of
manufacture comprising any one of the kits described herein.
Examples of an article of manufacture include vials (including
sealed vials).
[0192] The following examples are included for illustrative
purposes and are not intend to limit the scope of the
invention.
EXAMPLES
Example 1: Capture of Mitochondrial DNA from Total Human Genomic
DNA (Protocol 1 for Capture of DNA)
Overview
[0193] The objective of this method was to capture mitochondrial
DNA from a library of human genomic DNA, as depicted in FIG. 1. A
human tissue specimen was subjected to DNA extraction protocols,
resulting in a DNA sample comprising >99% human DNA and <1%
target sequence. The DNA sample was subjected to sequencing library
construction protocols, resulting in a nucleic acid library
comprising sequencing indexed adapters. To produce a library of
target-specific guide RNAs (gRNAs), a library of target specific
gRNA precursors, each comprising a T7 RNA polymerase promoter, a
human-specific 20-base pair region, and a stem-loop binding site
for Cas9, was subjected to in vitro transcription, yielding a
library of target-specific guide RNAs. The library of
target-specific guide RNAs was then combined with Cas9 proteins to
yield a library of Cas9-gRNA complexes. The Cas9-gRNA complexes
were then combined with the nucleic acid library such that the Cas9
cleaved matching target DNA sequences and left other DNA uncleaved.
Second adapters were added and allowed to ligate specifically to
the 5' phosphorylated blunt ends of cleaved DNA. PCR was then used
to amplify specifically using the first and second adapters.
[0194] Mitochondrial DNA makes up approximately 0.1-0.2% of total
human genomic DNA. To test the precise site-specific cutting of DNA
with Cas9, followed by ligation of adapters, referring to FIG. 2, a
test DNA (e.g., a plasmid) 201 was cut with Cas9 at a first
location 202 or a second location 203, yielding either first
products 204 or second products 205 (see, e.g., FIG. 2). Adapters
were ligated 206 into the newly available blunt DNA ends. PCR
amplification was performed for AUK-F/P7 or MB1OriR/P7, yielding
two separate products per reaction. If the first location was cut,
the products were 212 and 1.9 k in size; if the second location was
cut, the products were 359 and 1.75 k in size. Verification was
performed by sequencing.
[0195] Results showed that Cas9 cutting followed by ligation of
adapters allowed for specific amplification of target DNA (see,
e.g., FIG. 3); sequencing of the amplified DNA showed that ligation
of adapters occurred only at the location specified by the guide
RNA (see, e.g., FIG. 4).
[0196] Mitochondrial DNA was then enriched from a mixture
containing predominantly human nuclear DNA. 25 guide RNAs specific
for mitochondrial DNA were used, then cut with Cas9 and ligated
with adapters, followed by amplification. As seen from FIG. 5, two
separate reactions allowed for amplification of mitochondrial DNA
whereas a reaction without guide RNAs did not amplify any DNA, thus
showing that the method efficiently amplifies DNA that is
under-represented in any given library.
Preparation of DNA Libraries
[0197] Human genomic DNA libraries were generated by end repairing
500 ng of fragmented human genomic DNA (ds DNA fragmentase, NEB,
treated for 1 hour at 37.degree. C.) using the blunt end repair kit
(NEB) for 20 minutes at 25.degree. C. Reactions were then heat
inactivated at 75.degree. C. for 20 minutes, cooled to 25.degree.
C. then ligated to 15 pmoles of P5/Myc adapters for two hours at
25.degree. C. using T4 DNA ligase (NEB). Adapter dimmers were
removed using the NGS cleanup kit (Life Technologies).
Expression of Cas9
[0198] Cas9 (from S. pyogenes) was cloned into the pET30 expression
vector (EMD biosciences) to insert the hexahistidine tag
immediately upstream of the Cas9 start codon. The resulting plasmid
was transformed into the Rosetta (DE3) BL21 bacterial strain (EMD
biosciences) and grown in 1 L of LB media with vigorous aeration
until optical density of the culture (OD at 600 nm) reached 0.4.
The temperature was lowered to 25.degree. C., 0.2 mM IPTG was added
and the culture grown for another four hours. Cells were then
harvested by centrifugation (1,000.times.g for 20 min at 4.degree.
C.), resuspended in 10 ml binding buffer (20 mM Tris pH8, 0.5 M
NaCl, 5 mM Imidazole, 0.05% NP40) and lysed by sonication
(7.times.10 second bursts at 30% power, Sonifier 250, Branson).
Insoluble cell debris were removed by centrifugation at
10,000.times.g for 20 min; supernatant containing soluble protein
was then mixed with 0.4 ml of NTA beads (Qiagen) and loaded onto a
column. Beads were washed three times with 4 ml binding buffer,
then eluted with 3.times.0.5 ml of binding buffer supplemented with
250 mM Imidazole. Eluted fractions were then concentrated and
buffer exchanged with storage buffer (10 mM Tris pH8, 0.3 M NaCl,
0.1 mM EDTA, 1 mM DTT, 50% glycerol) using a 30,000 MWCO protein
concentrator (Life Technologies), verified by SDS PAGE followed by
Colloidal Blue staining (Life Technologies), quantified, then
stored at -20.degree. C. for later use.
[0199] A mutant Cas9 nickase, a D10A mutant of S. pyogenes Cas9,
can be produced and purified using the same procedures used to
produce Cas9 as above.
Preparation of gRNA1 and gRNA2
[0200] Three oligonucleotides T7-guideRNA1 and 2 (sequences, in 5'
to 3' direction GCCTCGAGCTAATACGACTCACTATAGGGATTTATACAGCACTTTAA
(SEQ ID NO: 5), and GCCTCGAGCTAATACGACTCACTATAGGGTCTTTTTGGTCCTCGAAG
(SEQ ID NO: 6)) and stlgR (sequence, GT TTT AGA GCT AGA AAT AGC AAG
TTA AAA TAA GGC TAG TCC GTT ATC AAC TTG AAA AAG TGG CAC CGA GTC GGT
GCT TTT TTT GGA TCC GAT GC (SEQ ID NO: 7)) were ordered and
synthesized (IDT). The stlgR oligonucleotide (300 pmol) was
sequentially 5' phosphorylated using T4 PNK (New England Biolabs)
and then 5' adenylated sing the 5'adenylation kit (New England
Biolabs), according to the manufacturer's instructions. T7-guide
RNAs oligonucleotides (5 pmol) and the 5'adenylated stlgR (10 pmol)
were then ligated using thermostable 5'App DNA/RNA ligase (New
England Biolabs) at 65 C for one hour. Ligation reactions were heat
inactivated at 90.degree. C. for 5 min, then amplified by PCR
(using OneTaq, New England Biolabs, 30 cycles of 95.degree. C. 30
secs, 57.degree. C. 20 secs, 72.degree. C., 20 secs) with primers
ForT7 (sequence GCC TCG AGC TAA TAC GAC TCA C (SEQ ID NO: 8)) and
gRU (sequence AAAAAAAGCACCGACTCGGTG (SEQ ID NO: 9)). PCR products
were purified using PCR cleanup kit (Life Technologies) and
verified by agarose gel electrophoresis and sequencing. Verified
products were then used as templates for in vitro
transcription.
Preparation of Guide RNA Libraries
[0201] T7-guideRNA oligonucleotides (Table 1) and a separate
oligonucleotide, stlgR (sequence, GT TTT AGA GCT AGA AAT AGC AAG
TTA AAA TAA GGC TAG TCC GTT ATC AAC TTG AAA AAG TGG CAC CGA GTC GGT
GCT TTT TTT GGA TCC GAT GC (SEQ ID NO: 7)) were ordered and
synthesized (IDT).
[0202] The stlgR oligonucleotide (300 pmol) was sequentially 5'
phosphorylated using T4 PNK (New England Biolabs) and then 5'
adenylated sing the 5'adenylation kit (New England Biolabs),
according to the manufacturer's instructions. T7-guide RNAs
oligonucleotides (5 pmol) and the 5'adenylated stlgR (10 pmol) were
then ligated using thermostable 5'App DNA/RNA ligase (New England
Biolabs) at 65 C for one hour. Ligation reactions were heat
inactivated at 90.degree. C. for 5 min, then amplified by PCR
(using OneTaq, New England Biolabs, 30 cycles of 95.degree. C. 30
secs, 57.degree. C. 20 secs, 72.degree. C., 20 secs) with primers
ForT7 (sequence GCC TCG AGC TAA TAC GAC TCA C (SEQ ID NO: 8)) and
gRU (sequence AAAAAAAGCACCGACTCGGTG (SEQ ID NO: 9)). PCR products
were purified using PCR cleanup kit (Life Technologies) and
verified by agarose gel electrophoresis and sequencing. Verified
products were then used as templates for in vitro
transcription.
TABLE-US-00001 TABLE 1 Mito/T7 primers for ligation reactions
Series 1 GCC TCG AGC TAA TAC GAC TCA CTA TAG GCT TGG ATT AGC GTT
TAG T7-1-F (SEQ ID AA NO: 10) T7-13-F (SEQ ID GCC TCG AGC TAA TAC
GAC TCA CTA TAG GCT CTT AAA ACT AGG CGG NO: 11) CTA T7-39-F (SEQ ID
GCC TCG AGC TAA TAC GAC TCA CTA TAG ATT TAC ACT CAC AAC ACC NO: 12)
CT T7-41-F (SEQ ID GCC TCG AGC TAA TAC GAC TCA CTA TAG AAC AGC TAT
CCA TTG GTC NO: 13) TT T7-43-F (SEQ ID GCC TCG AGC TAA TAC GAC TCA
CTA TAG GCA GCC GGA AGC CTA TTC NO: 14) GC T7-61-F (SEQ ID GCC TCG
AGC TAA TAC GAC TCA CTA TAG GTA ATG AGG ATG TAA GCC NO: 15) CG
T7-63-F (SEQ ID GCC TCG AGC TAA TAC GAC TCA CTA TAG ATA TTT ACA AGA
GGA AAA NO: 16) CC T7-65-F (SEQ ID GCC TCG AGC TAA TAC GAC TCA CTA
TAG GTT TGA AGC TTA GGG AGA NO: 17) GCT T7-67-F (SEQ ID GCC TCG AGC
TAA TAC GAC TCA CTA TAG GTA TGG CTT TGA AGA AGG NO: 18) CG Series 2
GCC TCG AGC TAA TAC GAC TCA CTA TAG TAG ATG ACG GGT TGG GCC
T7mtgRNA3 AG (SEQ ID NO: 19) T7mtgRNA7 GCC TCG AGC TAA TAC GAC TCA
CTA TAG AGC TTT ACA GTG GGC TCT (SEQ ID NO: 20) AG T7mtgRNA11 GCC
TCG AGC TAA TAC GAC TCA CTA TAG ATG GCA GCT TCT GTG GAA (SEQ ID NO:
21) CG T7mtgRNA15 GCC TCG AGC TAA TAC GAC TCA CTA TAG GTG GTA AGG
GCG ATG AGT (SEQ ID NO: 22) GT T7mtgRNA31 GCC TCG AGC TAA TAC GAC
TCA CTA TAG TCC ATA ACG CTC CTC ATA (SEQ ID NO: 23) CT T7mtgRNA33
GCC TCG AGC TAA TAC GAC TCA CTA TAG TCT CCC TTC ACC ATT TCC (SEQ ID
NO: 24) GA
In Vitro Transcription
[0203] Verified products were then used as templates for in vitro
transcription reactions using the HiScribe T7 transcription kit
(New England Biolabs). 500-1000 ng of template was incubated
overnight at 37.degree. C. according to the manufacturer's
instruction. To transcribe the guide libraries into guide RNA, we
assembled the following in vitro transcription reaction mixture: 10
.mu.l purified library (.about.500 ng), 6.5 .mu.l of H2O, of 2.25
.mu.l of ATP, 2.25 .mu.l of CTP, 2.25 .mu.l of GTP, 2.25 .mu.l of
UTP, 2.25 .mu.l 10.times. reaction buffer (NEB) and 2.25 .mu.l of
T7 RNA polymerase mix. The reaction was incubated at 37.degree. C.
for 24 hours, then purified using the RNA cleanup kit (Life
Technologies), eluted into 100 .mu.l of RNase-free water,
quantified and stored at -20.degree. C. until use.
DNA-Specific Cas9-Mediated Fragmentation
[0204] For cutting the test DNA test guide RNA 1 and 2 were used
separately. For cutting and enriching the mitochondrial DNA from a
human genomic DNA library, guide RNA series 1 and 2 were used.
Diluted guide RNA (1 ul, equivalent to 2 pmol) was combined with 3
ul 10.times. Cas9 reaction buffer (NEB), 20 ul H2O and 1 ul of
recombinant Cas9 enzyme (NEB, 1 pmol/ul). A control reaction using
a control guide RNA targeting the following sequence
(5'-GGATTTATACAGCACTTTAA-3'(SEQ ID NO: 25)) was performed
separately, using the same parameters. This sequence is absent from
either the human chromosomal or mitochondrial DNA. Reactions were
incubated for 15 min at 37.degree. C., then supplemented with 5
.mu.l diluted DNA library (50 pg/.mu.l) and incubation at
37.degree. C. continued for 90 min. The reactions were terminated
by adding RNase A (Thermo Fisher Scientific) at a 1:100 dilution,
then purifying the DNA using a PCR cleanup kit (LifeTechnologies)
and eluting in 30 ul 10 mM Tris-Cl pH 8. Reactions were then stored
at -20.degree. C. until use.
Ligation of Adapters and PCR Analysis
[0205] For the test DNA, reactions after Cas9 digestion were
incubated with 15 pmoles of P5/P7 adapters and T4 DNA ligase (NEB)
for one hour at 25.degree. C. Ligations were then used as templates
for PCR using the TestDNA-F primer (sequence ATGCCGCAGCACTTGG (SEQ
ID NO: 26)) and P5 primer (sequence AATGATACGGCGACCACCGA (SEQ ID
NO: 27)). Succesful PCR products were confirmed by agarose gel
electrophoresis sequenced using the TestDNA-F primer (ElimBio), to
show cutting and ligation occurred at the target DNA sequence.
Elimination of Adapters Ligated at Old Ends
[0206] For the enrichment of mitochondrial DNA, after Cas9
digestion, reactions were incubated with 15 pmoles of Flag5/P7
adapters and T4 DNA ligase (NEB) for one hour at 25.degree. C.
Multiple molecular biology methods can be employed to eliminate
ligation of adapters at the ends of the old P5 and P7 adapters from
the original library, for example with enzyme treatment. Reactions
were then used as templates for PCR using the P7 (sequence
CAAGCAGAAGACGGCATACGA (SEQ ID NO: 28)) and P5 primers (sequence
AATGATACGGCGACCACCGA (SEQ ID NO: 27)). Successful PCR products were
confirmed by agarose gel electrophoresis.
Example 2: Using Cas9 Nickase to Label, then Purify Test DNA from a
DNA Mixture (Protocol 2 for Capture of DNA)
Overview
[0207] The purpose of this method was to capture a region of
interest (e.g., SNP, STR, etc.) from a library of human genomic
DNA, as depicted for example in FIG. 6. To apply this protocol, a
test DNA containing a site for a nicking enzyme guided by
target-specific guide RNAs (NtAlwI (NEB)) was mixed at 1% or 5%
into another pool of DNA that does not contain this site. Nickase
Cas9 cleaves only at target sequence and only cuts one strand of
DNA. Nickase was used to nick target sequences. Single strand cuts
(nicks) are a substrate for DNA polymerase I which can be used to
replace the DNA downstream of the nick with biotin labeled DNA.
Biotinylated DNA of interest was then purified, amplified, and
sequenced.
[0208] The mixture of DNA with 701 and without 702 target sites for
nicking (e.g., GGATC) 703 was nicked 704 using NtAlwI (see, e.g.,
FIG. 7). DNA that does not have nickase sites was present in
100.times. excess compared to DNA of interest with the nickase
sites. Single strand cuts (nicks) are a substrate for DNA
polymerase I which are used to replace 705 the DNA downstream of
the nick with biotin labeled DNA. Biotin-labeled DNA of interest
was isolated by streptavidin binding and washing 706. PCR
amplification was performed with specific primers 707, yielding
amplified regions of interest 708 and amplified unlabeled sequences
709 present, for example, due to non-specific labeling or
capture.
[0209] Two specific PCR reactions (one for the test DNA with
regions of interest, the other for other DNA without regions of
interest) showed that the test DNA had been enriched approximately
50-fold (see, e.g., FIG. 8).
Expression and Purification of Cas9 Nickase
[0210] A mutant Cas9 nickase, a D10A mutant of S. pyogenes Cas9,
can be produced and purified using the same procedures used to
produce Cas9 as above.
Sequence Specific Cas9 Nickase-Mediated Nicking
[0211] Diluted guide RNA, targeting the following sequence
5'-GGATTTATACAGCACTTTAA-3' (SEQ ID NO: 29) (1 ul, equivalent to 2
pmol) was combined with 3 ul 10.times. Cas9 reaction buffer (NEB),
20 ul H2O and 1 ul of recombinant Cas9 Nickase enzyme (10 pmol/ul).
This target sequence is only present on the target DNA (that makes
either 5% or 1% of the total DNA). Reactions were incubated for 15
min at 37.degree. C., then supplemented with 5 .mu.l diluted DNA
(100 ng total) and incubation at 37.degree. C. continued for 90
min. The reactions were terminated by adding RNase A (Thermo Fisher
Scientific) at a 1:100 dilution, then purifying the DNA using a PCR
cleanup kit (LifeTechnologies) and eluting in 30 ul 10 mM Tris-Cl
pH 8. Reactions were then stored at -20.degree. C. until use.
Biotin Nick Translation
[0212] Nicked DNA was incubated with E. coli DNA polymerase I which
has 5'>3' exonuclease activity, and is capable of initiating DNA
synthesis at nicks, thus allowing it to replace nucleotides
downstream of a nick with labeled nucleotides (in the case of this
procedure, biotin-labeled nucleotides). Nick labeling reactions
were performed in 20 ul of DNA polymerase buffer (NEB) with 1 unit
of E. coli DNA polymerase I (NEB) and 0.02 mM each of dCTP, dGTP
and dTTP, 0.01 mM of dATP and 0.01 mM biotin-C14 labeled dATP
(LifeTechnologies) for 30 min at 25.degree. C. Reactions were
terminated by adding 1 mM EDTA.
Enrichment of Biotin Labeled DNA
[0213] Streptavidin C1 beads (5 ul per reaction, LifeTechnologies)
were resuspended in 1 ml binding buffer (50 mM Tris-Cl pH 8, 1 mM
EDTA, 0.1% Tween20), bound to a magnetic rack, and washed twice
with binding buffer. Beads were then resuspended in 30 ul of
binding buffer and mixed with the nick translation reaction, then
incubated at 25.degree. C. for 30 minutes. Beads were captured
using the magnetic rack and washed four times with 0.5 ml binding
buffer, then three times with 0.5 ml of 10 mM Tris-Cl pH 8. Beads
were then resuspended in 20 ul 10 mM Tris-Cl pH 8, then used as
templates for PCR to determine the proportion of test DNA and other
DNA.
Example 3: Use of a Catalytically Dead Nucleic Acid-Guided
Nuclease-Transposase Fusion to Insert Adaptors in Human Genomic
Library Followed by Enriching for Specific SNPs (Protocol 3 for
Capture of DNA)
[0214] In this example, catalytically dead nucleic acid-guided
nuclease-transposase fusion protein (e.g. a dCas9-transposase
fusion protein) is expressed and purified from E. coli as described
for the Cas9 purification. The fusion protein is complexed with
adapters (Nextera) then with guide NAs (e.g. gRNAs) targeting the
regions of interest (e.g. human SNPs). Then the complex is added to
human genomic DNA; regions of interest are targeted by the
catalytically dead nucleic acid-guided nuclease, bringing the
trasnposase-adapter complex in close proximity to the regions of
interest, allowing insertion of the adapters. Human SNPs can then
be amplified by PCR and then sequenced using MiSeq; thus human SNPs
can be enriched from human genomic DNA.
Example 4: Using Catalytically Dead Nucleic Acid-Guided Nuclease
and Nucleic Acid-Guided Nuclease to Protect Mitochondrial DNA and
Digest Remaining Human Nuclear DNA from a Human Genomic DNA Library
(Protocol 4 for Capture of DNA)
[0215] A human genomic DNA library with P5/P7 adapters from a
clinical, forensic or environmental sample is obtained. To enrich
for certain regions (e.g. SNPs) guide RNAs targeting these regions
are made and incubated with catalytically dead nucleic acid-guided
nuclease (e.g. dCas9) then added to the human genomic DNA library
for 20 minutes at 37 C. Then, a library of guide NAs covering the
human genome complexed with active nucleic acid-guided nuclease
(e.g. Cas9) is added. The catalytically dead nucleic acid-guided
nuclease will remain bound at the target locations and protect the
regions of interests (e.g. SNPs) from being cleaved and becoming
non PCR-amplifiable and sequence-able. Thus, the DNA of interest
remains intact while all other DNA will be cleaved and eliminated.
DNA of interest is recovered from the reactions using the PCR
cleanup kit, PCR amplified and sequenced using MiSeq.
[0216] For proof of concept testing, mitochondrial DNA is enriched
from a total human genomic DNA library. Mitochondrial specific
guide RNAs are added to dCas9, then added to the library. Then,
random guide RNAs complexed with Cas9 degrade any sequence, except
for those inaccessible because already protected by bound dCas9.
This allows enrichment of the mitochondrial DNA to levels far
higher than the original 0.1-0.2%.
Example 5: Using a Nucleic Acid-Guided Nuclease Nickase (e.g. Cas9
Nickase) to Protect and then Enrich SNPs from Human Genomic DNA by
Replacing Methylated DNA with Unmethylated DNA (Protocol 5 for
Capture of DNA)
Overview
[0217] The objective of this method is to capture a region of
interest from a library of human genomic DNA, as depicted in FIG.
11. As proof of principle, a test DNA containing a site for a
nicking enzyme, NtBbvCI (NEB) was mixed at 1% or 5% into another
pool of DNA that does not contain this site. The entire mixture was
then treated with Dam methyltransferase to add methyl groups to all
GATC sequences. Both test DNA and other DNA contain GATC motifs in
their sequence. The mixture was then nicked using NtBbvCI, then
incubated with DNA polymerase I and unlabeled nucleotides (dATP,
dCTP, dGTP, dTTP), then heat inactivated at 75.degree. C. for 20
minutes. The mixture is then digested with DpnI, which only digests
methylated DNA; unmethylated or hemimethylated DNA will not be
digested. FIG. 12 shows that methylation of test DNA renders it
susceptible to DpnI mediated cleavage.
Expression and Purification of Cas9 Nickase
[0218] A mutant Cas9 nickase, a D10A mutant of S. pyogenes Cas9,
can be produced and purified using the same procedures used to
produce Cas9 as above.
Sequence Specific Cas9 Nickase-Mediated Nicking
[0219] Diluted guide RNA, targeting the following sequence
5'-GGATTTATACAGCACTTTAA-3' (SEQ ID NO: 29) (1 ul, equivalent to 2
pmol) is combined with 3 ul 10.times. Cas9 reaction buffer (NEB),
20 ul H2O and 1 ul of recombinant Cas9 Nickase enzyme (10 pmol/ul).
This target sequence is only present on the target DNA (that makes
either 5% or 1% of the total DNA). Reactions are incubated for 15
min at 37.degree. C., then supplemented with 5 .mu.l diluted DNA
(100 ng total) and incubation at 37.degree. C. continued for 90
min. The reactions are terminated by adding RNase A (Thermo Fisher
Scientific) at a 1:100 dilution, then purifying the DNA using a PCR
cleanup kit (LifeTechnologies) and eluting in 30 ul 10 mM Tris-Cl
pH 8. Reactions are then stored at -20.degree. C. until use.
Unlabeled DNA Nick Translation
[0220] Nicked DNA is incubated with E. coli DNA polymerase I which
has 5'>3' exonuclease activity, and is capable of initiating DNA
synthesis at nicks, thus allowing it to replace nucleotides
downstream of a nick with labeled nucleotides (in the case of this
procedure, biotin-labeled nucleotides). Nick labeling reactions are
performed in 20 ul of DNA polymerase buffer (NEB) with 1 unit of E.
coli DNA polymerase I (NEB) and 0.02 mM each of dATP, dCTP, dGTP
and dTTP for 30 min at 25.degree. C. Reactions are terminated by
heat inactivation at 75.degree. C. for 20 minutes.
Digestion with DpnI
[0221] Reactions are then incubated with DpnI (NEB) for one hour at
37.degree. C. DNA is recovered using the PCR cleanup kit
(LifeTechnologies) and then used as template for PCR using test DNA
specific primers.
Example 6: Using a Nucleic Acid-Guided Nuclease Nickase (e.g. Cas9
Nickase) to Generate Long 3' Overhangs Flanking Regions of
Interests, then Ligating Adapters to these Overhangs to Enrich
Target DNA (Protocol 6 for Capture of DNA)
[0222] The objective of this method can be used to enrich a region
of DNA, from any DNA source (e.g., library, genomic, or PCR), as
depicted for example in FIG. 13. The nucleic acid-guided nuclease
nickase (e.g. Cas9 Nickase)` can be targeted to proximal sites
using two guide NAs (e.g. gRNAs) and, resulting in nicking of DNA
at each location. Alternatively, an adapter can be ligated on only
one side, then filled in, then an adapter can be ligated on the
other side. The two nicks can be close to each other (e.g., within
10 to 15 bp). Single nicks may be generated in non-target
molecules. Because of the proximity of the two nicking sites, a
double stranded break can be created when the reaction is heated,
e.g. to 65.degree. C., resulting in long (e.g., 10-15 bp) 3'
overhangs. These overhangs can be recognized by a thermostable
single stranded DNA/RNA ligase, such as a Thermostable 5'App
DNA/RNA ligase to allow for site-specific ligation of single
stranded adapters. The ligase can, for example, only recognize long
3' overhangs, thus ensuring that adapters will not be ligated at
other sites. This process can be repeated using the nucleic
acid-guided nuclease nickase and guide NA targeting on the other
side of the region of interest, followed by ligation as above using
a second single stranded adapter. Once two adapters have been
ligated on either side of the region of interest, the region can be
amplified or sequenced directly.
Sequence CWU 1
1
29129DNAArtificial SequenceAUK sequencing read 1cagtcctcca
agttggtggt tgcccttaa 29227DNAArtificial SequenceAdapter sequence
2gatcggaaga gcacacgtct gaactcc 27356DNAArtificial SequenceAUK
sequencing read 3cagtcctcca agttggtggt tgcccttaaa gtgctgtata
aatcctacat caaatc 56421DNAArtificial SequenceCas9/gRNA1 binding
site 4ttaaagtgct gtataaatcc t 21547DNAArtificial SequenceT7-gRNA
oligonucleotide 5gcctcgagct aatacgactc actataggga tttatacagc
actttaa 47647DNAArtificial SequenceT7-gRNA oligonucleotide
6gcctcgagct aatacgactc actatagggt ctttttggtc ctcgaag
47794DNAArtificial SequencestglR oligonucleotide 7gttttagagc
tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60ggcaccgagt
cggtgctttt tttggatccg atgc 94822DNAArtificial SequenceForT7 primer
8gcctcgagct aatacgactc ac 22921DNAArtificial SequencegRU primer
9aaaaaaagca ccgactcggt g 211047DNAArtificial SequenceT7-1-F primer
10gcctcgagct aatacgactc actataggct tggattagcg tttagaa
471148DNAArtificial SequenceT7-13-F primer 11gcctcgagct aatacgactc
actataggct cttaaaacta ggcggcta 481247DNAArtificial SequenceT7-39-F
primer 12gcctcgagct aatacgactc actatagatt tacactcaca acaccct
471347DNAArtificial SequenceT7-41-F primer 13gcctcgagct aatacgactc
actatagaac agctatccat tggtctt 471447DNAArtificial SequenceT7-43-F
primer 14gcctcgagct aatacgactc actataggca gccggaagcc tattcgc
471547DNAArtificial SequenceT7-61-F primer 15gcctcgagct aatacgactc
actataggta atgaggatgt aagcccg 471647DNAArtificial SequenceT7-63-F
primer 16gcctcgagct aatacgactc actatagata tttacaagag gaaaacc
471748DNAArtificial SequenceT7-65-F primer 17gcctcgagct aatacgactc
actataggtt tgaagcttag ggagagct 481847DNAArtificial SequenceT7-67-F
primer 18gcctcgagct aatacgactc actataggta tggctttgaa gaaggcg
471947DNAArtificial SequenceT7mtgRNA3 primer 19gcctcgagct
aatacgactc actatagtag atgacgggtt gggccag 472047DNAArtificial
SequenceT7mtgRNA7 primer 20gcctcgagct aatacgactc actatagagc
tttacagtgg gctctag 472147DNAArtificial SequenceT7mtgRNA11 primer
21gcctcgagct aatacgactc actatagatg gcagcttctg tggaacg
472247DNAArtificial SequenceT7mtgRNA15 primer 22gcctcgagct
aatacgactc actataggtg gtaagggcga tgagtgt 472347DNAArtificial
SequenceT7mtgRNA31 primer 23gcctcgagct aatacgactc actatagtcc
ataacgctcc tcatact 472447DNAArtificial SequenceT7mtgRNA33 primer
24gcctcgagct aatacgactc actatagtct cccttcacca tttccga
472520DNAArtificial Sequencecontrol guide RNA target sequence
25ggatttatac agcactttaa 202616DNAArtificial SequenceTestDNA-F
primer 26atgccgcagc acttgg 162720DNAArtificial SequenceP5 primer
27aatgatacgg cgaccaccga 202821DNAArtificial SequenceP7 primer
28caagcagaag acggcatacg a 212920DNAArtificial SequencegRNA
targeting sequence 29ggatttatac agcactttaa 20
* * * * *